#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
A2M	2	genome.wustl.edu	37	12	9254052	9254052	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr12:9254052G>C	ENST00000318602.7	-	12	1792	c.1485C>G	c.(1483-1485)ttC>ttG	p.F495L		NM_000014.4	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin	495					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|stem cell differentiation (GO:0048863)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	calcium-dependent protein binding (GO:0048306)|enzyme binding (GO:0019899)|growth factor binding (GO:0019838)|interleukin-1 binding (GO:0019966)|interleukin-8 binding (GO:0019959)|protease binding (GO:0002020)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|tumor necrosis factor binding (GO:0043120)			breast(1)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(17)|lung(30)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	77					Bacitracin(DB00626)|Becaplermin(DB00102)|Ocriplasmin(DB08888)	CCAGATAATAGAAGGAGAGCT	0.468																																																	0													49.0	46.0	47.0					12																	9254052		1882	4110	5992	SO:0001583	missense	0			BX647329, X68728, M11313	CCDS44827.1	12p13.31	2010-02-24			ENSG00000175899	ENSG00000175899			7	protein-coding gene	gene with protein product		103950					Standard	XM_006719056		Approved	FWP007, S863-7, CPAMD5	uc001qvk.1	P01023	OTTHUMG00000150267	ENST00000318602.7:c.1485C>G	12.37:g.9254052G>C	ENSP00000323929:p.Phe495Leu		Q13677|Q59F47|Q5QTS0|Q68DN2|Q6PIY3|Q6PN97	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd,superfamily_Beta-lactam/transpept-like,superfamily_Cupredoxin	p.F495L	ENST00000318602.7	37	c.1485	CCDS44827.1	12	.	.	.	.	.	.	.	.	.	.	G	16.30	3.085763	0.55861	.	.	ENSG00000175899	ENST00000318602;ENST00000540099	T	0.63913	-0.07	5.85	4.02	0.46733	Alpha-2-macroglobulin, N-terminal 2 (1);	0.066264	0.64402	D	0.000006	T	0.74527	0.3728	M	0.74258	2.255	0.34431	D	0.698545	D	0.71674	0.998	D	0.68353	0.957	T	0.80476	-0.1366	10	0.51188	T	0.08	.	9.0245	0.36220	0.2279:0.0:0.7721:0.0	.	495	P01023	A2MG_HUMAN	L	495;510	ENSP00000323929:F495L	ENSP00000323929:F495L	F	-	3	2	A2M	9145319	1.000000	0.71417	0.992000	0.48379	0.265000	0.26407	0.517000	0.22832	0.809000	0.34255	0.655000	0.94253	TTC	A2M	-	pfam_A2M_N_2	ENSG00000175899		0.468	A2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	A2M	HGNC	protein_coding	OTTHUMT00000317233.2	-	0.00	22	0	G	NM_000014		9254052	-1	tier1	-	no_errors	ENST00000318602	ensembl	human	known	74_37	missense	42.31	15	11	SNP	1.000	C
ABCA13	154664	genome.wustl.edu	37	7	48391999	48391999	+	Missense_Mutation	SNP	A	A	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr7:48391999A>C	ENST00000435803.1	+	31	10627	c.10603A>C	c.(10603-10605)Atc>Ctc	p.I3535L		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	3535					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						CGAAAGAGCCATCATTTTGGT	0.532																																																	0													32.0	34.0	33.0					7																	48391999		1940	4148	6088	SO:0001583	missense	0			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.10603A>C	7.37:g.48391999A>C	ENSP00000411096:p.Ile3535Leu		K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.I3535L	ENST00000435803.1	37	c.10603	CCDS47584.1	7	.	.	.	.	.	.	.	.	.	.	A	15.19	2.760773	0.49468	.	.	ENSG00000179869	ENST00000435803	D	0.85861	-2.04	4.93	3.78	0.43462	.	0.147126	0.31102	N	0.008256	D	0.89986	0.6874	M	0.69523	2.12	0.80722	D	1	P;D	0.63046	0.951;0.992	P;D	0.79108	0.802;0.992	D	0.88623	0.3164	10	0.59425	D	0.04	.	8.4532	0.32884	0.911:0.0:0.089:0.0	.	1237;3535	Q86UQ4-3;Q86UQ4	.;ABCAD_HUMAN	L	3535	ENSP00000411096:I3535L	ENSP00000411096:I3535L	I	+	1	0	ABCA13	48362545	1.000000	0.71417	0.949000	0.38748	0.173000	0.22820	4.869000	0.63028	0.732000	0.32470	-0.464000	0.05259	ATC	ABCA13	-	NULL	ENSG00000179869		0.532	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2	-	0.00	32	0	A	NM_152701		48391999	+1	tier1	-	no_errors	ENST00000435803	ensembl	human	known	74_37	missense	68.75	10	22	SNP	1.000	C
ABCA7	10347	genome.wustl.edu	37	19	1044587	1044587	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr19:1044587G>C	ENST00000263094.6	+	11	1290	c.1059G>C	c.(1057-1059)caG>caC	p.Q353H	ABCA7_ENST00000435683.2_Missense_Mutation_p.Q215H|ABCA7_ENST00000433129.1_Missense_Mutation_p.Q353H	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	353					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCTCCTGCAGATGCAGGATG	0.647																																																	0													45.0	57.0	53.0					19																	1044587		2203	4300	6503	SO:0001583	missense	0			AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.1059G>C	19.37:g.1044587G>C	ENSP00000263094:p.Gln353His		Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_GroES-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.Q353H	ENST00000263094.6	37	c.1059	CCDS12055.1	19	.	.	.	.	.	.	.	.	.	.	G	10.70	1.424395	0.25639	.	.	ENSG00000064687	ENST00000263094;ENST00000433129	D;D	0.86627	-2.15;-2.15	3.02	-3.15	0.05233	.	.	.	.	.	T	0.79155	0.4398	N	0.25647	0.755	0.09310	N	1	B;B	0.30104	0.268;0.001	B;B	0.39738	0.308;0.007	T	0.69822	-0.5041	9	0.66056	D	0.02	.	4.1228	0.10112	0.3295:0.0:0.4747:0.1958	.	215;353	Q8IZY2-2;Q8IZY2	.;ABCA7_HUMAN	H	353	ENSP00000263094:Q353H;ENSP00000414062:Q353H	ENSP00000263094:Q353H	Q	+	3	2	ABCA7	995587	0.000000	0.05858	0.004000	0.12327	0.013000	0.08279	-0.138000	0.10374	-0.817000	0.04335	-0.870000	0.02990	CAG	ABCA7	-	NULL	ENSG00000064687		0.647	ABCA7-001	KNOWN	basic|CCDS	protein_coding	ABCA7	HGNC	protein_coding	OTTHUMT00000394993.1	-	0.00	90	0	G	NM_019112		1044587	+1	tier1	-	no_errors	ENST00000263094	ensembl	human	known	74_37	missense	32.93	55	27	SNP	0.006	C
ACAN	176	genome.wustl.edu	37	15	89400157	89400157	+	Missense_Mutation	SNP	G	G	C	rs201505307		TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr15:89400157G>C	ENST00000561243.1	+	11	4341	c.4341G>C	c.(4339-4341)gaG>gaC	p.E1447D	ACAN_ENST00000352105.7_Missense_Mutation_p.E1447D|ACAN_ENST00000439576.2_Missense_Mutation_p.E1447D|ACAN_ENST00000559004.1_Missense_Mutation_p.E1447D			P16112	PGCA_HUMAN	aggrecan	1450	29 X 19 AA approximate tandem repeats of E-[IVDG]-[LV]-[EV]-[GTI]-[STA]-[ATV]- [SP]-[GA]-[VIFAD]-[GEDL]-[DE]-[LVI]-[SG]- [GERK]-[LV]-P-S-G.|CS-1.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			GAGTAGAGGAGATCAGCGGGC	0.512																																																	0													110.0	111.0	111.0					15																	89400157		1841	4092	5933	SO:0001583	missense	0			M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.4341G>C	15.37:g.89400157G>C	ENSP00000453342:p.Glu1447Asp		Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_Sushi_SCR_CCP,pfam_EG-like_dom,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Link,smart_EG-like_dom,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like_dom,prints_Link	p.E1447D	ENST00000561243.1	37	c.4341	CCDS53970.1	15	.	.	.	.	.	.	.	.	.	.	-	1.549	-0.539725	0.04053	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	D;D	0.92647	-3.08;-3.08	2.63	-5.26	0.02772	.	.	.	.	.	T	0.61375	0.2342	N	0.00313	-1.665	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.06405	0.002;0.002	T	0.64305	-0.6439	9	0.02654	T	1	.	1.407	0.02283	0.2552:0.163:0.3826:0.1992	.	1447;1447	E7ENV9;E7EX88	.;.	D	1447;1447;1333	ENSP00000387356:E1447D;ENSP00000341615:E1447D	ENSP00000268134:E1333D	E	+	3	2	ACAN	87201161	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-7.837000	0.00029	-1.573000	0.01659	-0.661000	0.03856	GAG	ACAN	-	NULL	ENSG00000157766		0.512	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	ACAN	HGNC	protein_coding	OTTHUMT00000416267.2	-	0.00	79	0	G	NM_001135		89400157	+1	tier1	rs201505307	no_errors	ENST00000439576	ensembl	human	known	74_37	missense	23.88	51	16	SNP	0.000	C
ACTRT3	84517	genome.wustl.edu	37	3	169486006	169486006	+	Silent	SNP	T	T	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr3:169486006T>C	ENST00000330368.2	-	2	707	c.333A>G	c.(331-333)ccA>ccG	p.P111P	RP11-816J6.3_ENST00000602879.1_RNA	NM_032487.4	NP_115876.3	Q9BYD9	ACTT3_HUMAN	actin-related protein T3	111						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|male germ cell nucleus (GO:0001673)											GGTTGGCCAGTGGGTTCAGCG	0.507																																																	0													79.0	81.0	80.0					3																	169486006		2203	4300	6503	SO:0001819	synonymous_variant	0			AK055346	CCDS3206.1	3q26.2	2012-04-10			ENSG00000184378	ENSG00000184378			24022	protein-coding gene	gene with protein product	"""actin related protein M1"""	608534				11750065, 18692047	Standard	NM_032487		Approved	ARPM1	uc003ffs.2	Q9BYD9		ENST00000330368.2:c.333A>G	3.37:g.169486006T>C			Q96IS0|Q96NJ0	Silent	SNP	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.P111	ENST00000330368.2	37	c.333	CCDS3206.1	3																																																																																			ACTRT3	-	pfam_Actin-related,smart_Actin-related	ENSG00000184378		0.507	ACTRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTRT3	HGNC	protein_coding	OTTHUMT00000467797.1	-	0.00	23	0	T	NM_032487		169486006	-1	tier1	-	no_errors	ENST00000330368	ensembl	human	known	74_37	silent	31.03	40	18	SNP	0.875	C
ADAD2	161931	genome.wustl.edu	37	16	84228699	84228699	+	Missense_Mutation	SNP	G	G	A	rs568492054		TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr16:84228699G>A	ENST00000315906.5	+	4	684	c.632G>A	c.(631-633)cGc>cAc	p.R211H	ADAD2_ENST00000268624.3_Missense_Mutation_p.R283H|RP11-486L19.2_ENST00000569834.1_RNA|RP11-486L19.2_ENST00000561900.1_RNA|RP11-486L19.2_ENST00000536986.1_RNA|RP11-486L19.2_ENST00000565643.1_RNA	NM_001145400.1	NP_001138872.1	Q8NCV1	ADAD2_HUMAN	adenosine deaminase domain containing 2	211					RNA processing (GO:0006396)		adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|skin(1)	13						CATGAGCAGCGCTGCGCAGCG	0.647													G|||	1	0.000199681	0.0	0.0	5008	,	,		17151	0.001		0.0	False		,,,				2504	0.0																0													46.0	48.0	47.0					16																	84228699		2200	4300	6500	SO:0001583	missense	0			AF447586	CCDS10944.1, CCDS45536.1	16q24.1	2007-05-31			ENSG00000140955	ENSG00000140955			30714	protein-coding gene	gene with protein product							Standard	NM_139174		Approved	TENRL, FLJ00337	uc002fhr.2	Q8NCV1	OTTHUMG00000137637	ENST00000315906.5:c.632G>A	16.37:g.84228699G>A	ENSP00000325153:p.Arg211His		B2RCL6|Q8NA94	Missense_Mutation	SNP	pfam_A_deamin,pfam_dsRNA-bd_dom,smart_A_deamin,pfscan_dsRNA-bd_dom,pfscan_A_deamin	p.R283H	ENST00000315906.5	37	c.848	CCDS45536.1	16	.	.	.	.	.	.	.	.	.	.	G	14.47	2.544673	0.45280	.	.	ENSG00000140955	ENST00000315906;ENST00000268624	T;T	0.19532	2.14;2.18	4.57	4.57	0.56435	.	0.222920	0.31061	N	0.008323	T	0.33352	0.0860	L	0.49126	1.545	0.36440	D	0.865425	D;D	0.69078	0.992;0.997	P;P	0.56343	0.551;0.796	T	0.38112	-0.9676	10	0.66056	D	0.02	-30.0194	13.2049	0.59790	0.0:0.0:1.0:0.0	.	211;283	Q8NCV1;Q8NCV1-2	ADAD2_HUMAN;.	H	211;283	ENSP00000325153:R211H;ENSP00000268624:R283H	ENSP00000268624:R283H	R	+	2	0	ADAD2	82786200	1.000000	0.71417	1.000000	0.80357	0.045000	0.14185	2.808000	0.47963	2.250000	0.74265	0.650000	0.86243	CGC	ADAD2	-	smart_A_deamin	ENSG00000140955		0.647	ADAD2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAD2	HGNC	protein_coding	OTTHUMT00000433385.1	-	0.00	99	0	G	NM_139174		84228699	+1	tier1	-	no_errors	ENST00000268624	ensembl	human	known	74_37	missense	13.79	100	16	SNP	1.000	A
ADAM20	8748	genome.wustl.edu	37	14	70990362	70990362	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr14:70990362C>A	ENST00000256389.3	-	2	1507	c.1263G>T	c.(1261-1263)aaG>aaT	p.K421N	RP11-486O13.4_ENST00000556646.1_lincRNA	NM_003814.4	NP_003805.3	O43506	ADA20_HUMAN	ADAM metallopeptidase domain 20	371	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|prostate(1)|skin(2)	27			KIRC - Kidney renal clear cell carcinoma(12;0.133)|Kidney(31;0.188)	all cancers(60;0.00294)|BRCA - Breast invasive adenocarcinoma(234;0.00668)|OV - Ovarian serous cystadenocarcinoma(108;0.0344)		TAGTTGTCACCTTTCTATAGG	0.433																																																	0													283.0	152.0	196.0					14																	70990362		2203	4300	6503	SO:0001583	missense	0			AF029899	CCDS32111.1	14q24.2	2012-04-30	2005-08-18		ENSG00000134007	ENSG00000134007		"""ADAM metallopeptidase domain containing"""	199	protein-coding gene	gene with protein product		603712	"""a disintegrin and metalloproteinase domain 20"""			9469942	Standard	NM_003814		Approved		uc001xme.3	O43506	OTTHUMG00000167548	ENST00000256389.3:c.1263G>T	14.37:g.70990362C>A	ENSP00000256389:p.Lys421Asn		Q6GTZ1|Q9UKJ9	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.K421N	ENST00000256389.3	37	c.1263	CCDS32111.1	14	.	.	.	.	.	.	.	.	.	.	C	4.304	0.055619	0.08291	.	.	ENSG00000134007	ENST00000256389	T	0.64260	-0.09	4.54	-7.4	0.01397	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	2.357600	0.02515	U	0.091917	T	0.32010	0.0815	N	0.11201	0.11	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.13899	-1.0492	10	0.17369	T	0.5	.	0.6288	0.00791	0.3319:0.1351:0.1563:0.3767	.	371	O43506	ADA20_HUMAN	N	421	ENSP00000256389:K421N	ENSP00000256389:K421N	K	-	3	2	ADAM20	70060115	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.934000	0.00331	-1.236000	0.02542	-0.259000	0.10710	AAG	ADAM20	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000134007		0.433	ADAM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM20	HGNC	protein_coding	OTTHUMT00000395004.2	-	0.00	51	0	C			70990362	-1	tier1	-	no_errors	ENST00000256389	ensembl	human	known	74_37	missense	73.08	21	57	SNP	0.000	A
AGK	55750	genome.wustl.edu	37	7	141301071	141301071	+	Silent	SNP	T	T	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr7:141301071T>A	ENST00000355413.4	+	5	548	c.288T>A	c.(286-288)acT>acA	p.T96T	AGK_ENST00000473247.1_Silent_p.T68T|AGK_ENST00000535825.1_Silent_p.T93T	NM_018238.3	NP_060708.1	Q53H12	AGK_HUMAN	acylglycerol kinase	96	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				ceramide biosynthetic process (GO:0046513)|glycerolipid metabolic process (GO:0046486)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)	acylglycerol kinase activity (GO:0047620)|ATP binding (GO:0005524)|ceramide kinase activity (GO:0001729)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			breast(1)|endometrium(1)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(3)	17	Melanoma(164;0.0171)					TGGATGTGACTATTGTTAAGG	0.358																																																	0													83.0	84.0	83.0					7																	141301071		2203	4299	6502	SO:0001819	synonymous_variant	0			BC022777	CCDS5865.1	7q34	2010-05-04	2007-01-11	2007-01-11	ENSG00000006530	ENSG00000006530	2.7.1.94		21869	protein-coding gene	gene with protein product		610345	"""multiple substrate lipid kinase"""	MULK		15252046, 15939762, 17135245	Standard	NM_018238		Approved	FLJ10842	uc003vwi.2	Q53H12	OTTHUMG00000157499	ENST00000355413.4:c.288T>A	7.37:g.141301071T>A			Q75KN1|Q96GC3|Q9NP48	Silent	SNP	pfam_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kinase_cat_dom	p.T96	ENST00000355413.4	37	c.288	CCDS5865.1	7																																																																																			AGK	-	pfam_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kinase_cat_dom	ENSG00000006530		0.358	AGK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGK	HGNC	protein_coding	OTTHUMT00000348969.1	-	0.00	29	0	T	NM_018238		141301071	+1	tier1	-	no_errors	ENST00000355413	ensembl	human	known	74_37	silent	26.42	39	14	SNP	0.293	A
USP34	9736	genome.wustl.edu	37	2	61412994	61412994	+	IGR	SNP	A	A	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr2:61412994A>G	ENST00000398571.2	-	0	11357				AHSA2_ENST00000394457.3_Intron|AHSA2_ENST00000357022.2_Intron|AHSA2_ENST00000410073.1_Silent_p.L71L|AHSA2_ENST00000489653.1_Intron	NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34						positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			TTTGTGTTTTATTTTCTGTAA	0.318																																																	0																																										SO:0001628	intergenic_variant	0			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265		2.37:g.61412994A>G			A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Silent	SNP	NULL	p.L71	ENST00000398571.2	37	c.213	CCDS42686.1	2																																																																																			AHSA2	-	NULL	ENSG00000173209		0.318	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AHSA2	HGNC	protein_coding	OTTHUMT00000325650.4	-	0.00	63	0	A			61412994	+1	tier1	-	no_errors	ENST00000410073	ensembl	human	novel	74_37	silent	69.77	12	30	SNP	0.000	G
AIM1	202	genome.wustl.edu	37	6	106999729	106999729	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr6:106999729G>C	ENST00000369066.3	+	12	4578	c.4091G>C	c.(4090-4092)tGg>tCg	p.W1364S	AIM1_ENST00000535438.1_Missense_Mutation_p.W183S|AIM1_ENST00000487681.1_3'UTR	NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		TTTCTTAGATGGGTAGCCTAT	0.333																																																	0													82.0	91.0	88.0					6																	106999729		2203	4298	6501	SO:0001583	missense	0			U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.4091G>C	6.37:g.106999729G>C	ENSP00000358062:p.Trp1364Ser		Q6P2P0|Q9BTM3	Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,pfam_Ricin_B_lectin,superfamily_G_crystallin-rel,superfamily_Ricin_B_lectin,smart_Beta/gamma_crystallin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.W1364S	ENST00000369066.3	37	c.4091	CCDS34506.1	6	.	.	.	.	.	.	.	.	.	.	G	23.4	4.409609	0.83340	.	.	ENSG00000112297	ENST00000369066;ENST00000457437;ENST00000535438	D;D;D	0.85629	-2.01;-2.01;-2.01	5.9	5.9	0.94986	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.000000	0.85682	D	0.000000	D	0.95379	0.8500	H	0.96604	3.85	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.96120	0.9084	10	0.87932	D	0	.	20.2723	0.98479	0.0:0.0:1.0:0.0	.	183;1364	B4DU04;Q9Y4K1	.;AIM1_HUMAN	S	1364;183;183	ENSP00000358062:W1364S;ENSP00000391419:W183S;ENSP00000439183:W183S	ENSP00000358062:W1364S	W	+	2	0	AIM1	107106422	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.463000	0.97652	2.793000	0.96121	0.563000	0.77884	TGG	AIM1	-	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin	ENSG00000112297		0.333	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AIM1	HGNC	protein_coding	OTTHUMT00000041669.1	-	0.00	43	0	G			106999729	+1	tier1	-	no_errors	ENST00000369066	ensembl	human	known	74_37	missense	35.71	18	10	SNP	1.000	C
AKAP13	11214	genome.wustl.edu	37	15	86269664	86269664	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr15:86269664G>A	ENST00000394518.2	+	27	6864	c.6769G>A	c.(6769-6771)Gac>Aac	p.D2257N	AKAP13_ENST00000394510.2_Missense_Mutation_p.D502N|AKAP13_ENST00000560579.1_3'UTR|AKAP13_ENST00000361243.2_Missense_Mutation_p.D2261N|RP11-158M2.2_ENST00000561417.1_RNA	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	2257	Interaction with ESR1.|PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						TCTTCTCACTGACATTTTAGT	0.338																																					Melanoma(94;603 1453 3280 32295 32951)												0													187.0	188.0	187.0					15																	86269664		2202	4298	6500	SO:0001583	missense	0			M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.6769G>A	15.37:g.86269664G>A	ENSP00000378026:p.Asp2257Asn		Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain	p.D2261N	ENST00000394518.2	37	c.6781	CCDS32319.1	15	.	.	.	.	.	.	.	.	.	.	G	33	5.245089	0.95272	.	.	ENSG00000170776	ENST00000426424;ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540;ENST00000394510	T;T;T	0.73152	-0.72;-0.72;-0.72	5.31	5.31	0.75309	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	.	.	.	.	D	0.83608	0.5291	M	0.76838	2.35	0.80722	D	1	P;P;P	0.51147	0.929;0.942;0.929	P;P;P	0.62491	0.843;0.903;0.843	D	0.85374	0.1115	9	0.66056	D	0.02	.	17.9585	0.89076	0.0:0.0:1.0:0.0	.	2237;2257;2261	Q12802-4;Q12802;Q12802-2	.;AKP13_HUMAN;.	N	337;2261;2257;2260;2236;502	ENSP00000354718:D2261N;ENSP00000378026:D2257N;ENSP00000378018:D502N	ENSP00000354718:D2261N	D	+	1	0	AKAP13	84070668	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.118000	0.94355	2.484000	0.83849	0.484000	0.47621	GAC	AKAP13	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000170776		0.338	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	AKAP13	HGNC	protein_coding	OTTHUMT00000417318.1	-	0.00	49	0	G	NM_007200		86269664	+1	tier1	-	no_errors	ENST00000361243	ensembl	human	known	74_37	missense	41.82	32	23	SNP	1.000	A
ANKEF1	63926	genome.wustl.edu	37	20	10030832	10030832	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr20:10030832G>C	ENST00000378380.3	+	6	1944	c.1615G>C	c.(1615-1617)Gat>Cat	p.D539H	ANKEF1_ENST00000378392.1_Missense_Mutation_p.D539H|SNAP25-AS1_ENST00000603542.1_RNA|SNAP25-AS1_ENST00000421143.2_RNA|ANKEF1_ENST00000488991.1_3'UTR	NM_198798.1	NP_942093.1	Q9NU02	ANKE1_HUMAN	ankyrin repeat and EF-hand domain containing 1	539							calcium ion binding (GO:0005509)										TGGAAACATAGATGTGGTCAA	0.433																																																	0													50.0	51.0	50.0					20																	10030832		2203	4298	6501	SO:0001583	missense	0			AK025322	CCDS13108.1	20p12.2	2013-01-11	2013-01-11	2013-01-11	ENSG00000132623	ENSG00000132623		"""EF-hand domain containing"", ""Ankyrin repeat domain containing"""	15803	protein-coding gene	gene with protein product			"""ankyrin repeat domain 5"""	ANKRD5		17142250	Standard	NM_022096		Approved	FLJ21669, dJ839B4.6	uc002wnp.3	Q9NU02	OTTHUMG00000031860	ENST00000378380.3:c.1615G>C	20.37:g.10030832G>C	ENSP00000367631:p.Asp539His		B3KUQ0|Q9H6Y9	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EF_hand_dom,prints_Ankyrin_rpt	p.D539H	ENST00000378380.3	37	c.1615	CCDS13108.1	20	.	.	.	.	.	.	.	.	.	.	G	19.37	3.814309	0.70912	.	.	ENSG00000132623	ENST00000378392;ENST00000378380	T;T	0.66638	-0.22;-0.22	5.65	5.65	0.86999	Ankyrin repeat-containing domain (4);	0.373751	0.35936	N	0.002893	T	0.68412	0.2998	L	0.60957	1.885	0.48975	D	0.999731	P	0.35107	0.484	B	0.42030	0.373	T	0.70930	-0.4738	10	0.87932	D	0	0.2511	13.313	0.60390	0.0725:0.0:0.9275:0.0	.	539	Q9NU02	ANKR5_HUMAN	H	539	ENSP00000367644:D539H;ENSP00000367631:D539H	ENSP00000367631:D539H	D	+	1	0	ANKRD5	9978832	1.000000	0.71417	0.693000	0.30195	0.766000	0.43426	6.984000	0.76186	2.817000	0.96982	0.563000	0.77884	GAT	ANKEF1	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000132623		0.433	ANKEF1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ANKEF1	HGNC	protein_coding	OTTHUMT00000077968.2	-	0.00	50	0	G	NM_022096		10030832	+1	tier1	-	no_errors	ENST00000378380	ensembl	human	known	74_37	missense	15.91	37	7	SNP	0.953	C
AOX1	316	genome.wustl.edu	37	2	201457904	201457904	+	Silent	SNP	G	G	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr2:201457904G>C	ENST00000374700.2	+	2	322	c.81G>C	c.(79-81)ctG>ctC	p.L27L		NM_001159.3	NP_001150.3	Q06278	AOXA_HUMAN	aldehyde oxidase 1	27	2Fe-2S ferredoxin-type. {ECO:0000255|PROSITE-ProRule:PRU00465}.				inflammatory response (GO:0006954)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|vitamin B6 metabolic process (GO:0042816)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	2 iron, 2 sulfur cluster binding (GO:0051537)|aldehyde oxidase activity (GO:0004031)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|NAD binding (GO:0051287)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)			breast(5)|endometrium(3)|kidney(4)|large_intestine(13)|lung(38)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	81					Allopurinol(DB00437)|Aminocaproic Acid(DB00513)|Brimonidine(DB00484)|Famciclovir(DB00426)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Pyrazinamide(DB00339)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	AAACAATGCTGTTGCCTTATT	0.333																																																	0													290.0	248.0	262.0					2																	201457904		2203	4300	6503	SO:0001819	synonymous_variant	0			AF017060	CCDS33360.1	2q33	2008-05-20			ENSG00000138356	ENSG00000138356			553	protein-coding gene	gene with protein product		602841				7570184	Standard	NM_001159		Approved	AO, AOH1	uc002uvx.3	Q06278	OTTHUMG00000154536	ENST00000374700.2:c.81G>C	2.37:g.201457904G>C			O14765|Q53RR8|Q53TV3|Q9BYF0|Q9UPG6	Silent	SNP	pfam_AldOxase/xan_DH_Mopterin-bd,pfam_Mopterin_DH_FAD-bd,pfam_Ald_Oxase/Xan_DH_a/b,pfam_2Fe-2S-bd,pfam_CO_DH_flav_C,pfam_2Fe-2S_ferredoxin-type,superfamily_AldOxase/xan_DH_Mopterin-bd,superfamily_FAD-bd_2,superfamily_Ald_Oxase/Xan_DH_a/b,superfamily_2Fe-2S-bd,superfamily_CO_DH_flav_C,superfamily_2Fe-2S_ferredoxin-type,pirsf_Ald_Oxase/xanthine_DH,pfscan_2Fe-2S_ferredoxin-type,tigrfam_Aldehyde_oxidase	p.L27	ENST00000374700.2	37	c.81	CCDS33360.1	2																																																																																			AOX1	-	pfam_2Fe-2S_ferredoxin-type,superfamily_2Fe-2S_ferredoxin-type,pirsf_Ald_Oxase/xanthine_DH,pfscan_2Fe-2S_ferredoxin-type,tigrfam_Aldehyde_oxidase	ENSG00000138356		0.333	AOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AOX1	HGNC	protein_coding	OTTHUMT00000335844.1	-	0.00	101	0	G	NM_001159		201457904	+1	tier1	-	no_errors	ENST00000374700	ensembl	human	known	74_37	silent	38.79	71	45	SNP	0.771	C
APP	351	genome.wustl.edu	37	21	27462296	27462296	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr21:27462296C>A	ENST00000346798.3	-	3	351	c.318G>T	c.(316-318)aaG>aaT	p.K106N	APP_ENST00000354192.3_Missense_Mutation_p.K50N|APP_ENST00000359726.3_Missense_Mutation_p.K106N|APP_ENST00000357903.3_Missense_Mutation_p.K106N|APP_ENST00000474136.1_5'UTR|APP_ENST00000440126.3_Missense_Mutation_p.K101N|APP_ENST00000439274.2_Missense_Mutation_p.K50N|APP_ENST00000348990.5_Missense_Mutation_p.K106N|APP_ENST00000358918.3_Missense_Mutation_p.K106N|APP_ENST00000448388.2_Missense_Mutation_p.K71N	NM_000484.3	NP_000475.1	P05067	A4_HUMAN	amyloid beta (A4) precursor protein	106	Heparin-binding.				adult locomotory behavior (GO:0008344)|axon cargo transport (GO:0008088)|axon midline choice point recognition (GO:0016199)|axonogenesis (GO:0007409)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|collateral sprouting in absence of injury (GO:0048669)|dendrite development (GO:0016358)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|ionotropic glutamate receptor signaling pathway (GO:0035235)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|mRNA polyadenylation (GO:0006378)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron differentiation (GO:0045665)|neuromuscular process controlling balance (GO:0050885)|neuron apoptotic process (GO:0051402)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of multicellular organism growth (GO:0040014)|regulation of protein binding (GO:0043393)|regulation of synapse structure and activity (GO:0050803)|regulation of translation (GO:0006417)|response to oxidative stress (GO:0006979)|smooth endoplasmic reticulum calcium ion homeostasis (GO:0051563)|suckling behavior (GO:0001967)|synaptic growth at neuromuscular junction (GO:0051124)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|ciliary rootlet (GO:0035253)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endosome (GO:0005768)|ER to Golgi transport vesicle (GO:0030134)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane raft (GO:0045121)|neuromuscular junction (GO:0031594)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|receptor complex (GO:0043235)|spindle midzone (GO:0051233)|synapse (GO:0045202)	acetylcholine receptor binding (GO:0033130)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|peptidase activator activity (GO:0016504)|PTB domain binding (GO:0051425)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)			endometrium(5)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(209;0.00295)				GGGGATGGGTCTTGCACTGCT	0.582																																																	0													149.0	123.0	132.0					21																	27462296		2203	4300	6503	SO:0001583	missense	0			M15533	CCDS13576.1, CCDS13577.1, CCDS33523.1, CCDS46638.1, CCDS46639.1, CCDS56211.1, CCDS56212.1, CCDS56213.1	21q21.2	2014-01-30	2008-07-31		ENSG00000142192	ENSG00000142192		"""Endogenous ligands"""	620	protein-coding gene	gene with protein product	"""peptidase nexin-II"""	104760	"""Alzheimer disease"""	AD1		1679289	Standard	NM_001136130		Approved		uc002ylz.3	P05067	OTTHUMG00000078438	ENST00000346798.3:c.318G>T	21.37:g.27462296C>A	ENSP00000284981:p.Lys106Asn		B2R5V1|B4DII8|D3DSD1|D3DSD2|D3DSD3|P09000|P78438|Q13764|Q13778|Q13793|Q16011|Q16014|Q16019|Q16020|Q6GSC0|Q8WZ99|Q9BT38|Q9UC33|Q9UCA9|Q9UCB6|Q9UCC8|Q9UCD1|Q9UQ58	Missense_Mutation	SNP	pfam_Amyloid_glyco_heparin-bd,pfam_APP_amyloid_C,pfam_Amyloid_glyco_Abeta,pfam_Prot_inh_Kunz-m,superfamily_Amyloid_glyco_E2_domain,superfamily_Amyloid_glyco_heparin-bd,superfamily_Amyloid_glyco_Cu-bd,superfamily_Prot_inh_Kunz-m,smart_Amyloid_glyco_extra,smart_Prot_inh_Kunz-m,prints_Amyloid_glyco,prints_Amyloid_glyco_Abeta,prints_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m	p.K106N	ENST00000346798.3	37	c.318	CCDS13576.1	21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.16|17.16	3.319932|3.319932	0.60634|0.60634	.|.	.|.	ENSG00000142192|ENSG00000142192	ENST00000448850|ENST00000346798;ENST00000354192;ENST00000348990;ENST00000357903;ENST00000358918;ENST00000359726;ENST00000448388;ENST00000440126;ENST00000439274	.|D;D;D;D;D;D;D;D;D	.|0.96940	.|-2.22;-4.18;-4.17;-2.21;-2.05;-4.17;-4.14;-2.22;-2.23	5.75|5.75	4.87|4.87	0.63330|0.63330	.|Amyloidogenic glycoprotein, extracellular (1);Amyloidogenic glycoprotein, heparin-binding (3);	.|0.114379	.|0.64402	.|D	.|0.000018	D|D	0.96185|0.96185	0.8756|0.8756	M|M	0.77486|0.77486	2.375|2.375	0.58432|0.58432	D|D	0.999998|0.999998	.|B;B;P;P;B;B;B;P	.|0.38395	.|0.012;0.443;0.629;0.626;0.389;0.22;0.111;0.629	.|B;B;B;B;B;B;B;B	.|0.42555	.|0.013;0.131;0.242;0.391;0.055;0.129;0.089;0.242	D|D	0.95915|0.95915	0.8926|0.8926	5|10	.|0.66056	.|D	.|0.02	-31.3014|-31.3014	13.6738|13.6738	0.62440|0.62440	0.0:0.9245:0.0:0.0755|0.0:0.9245:0.0:0.0755	.|.	.|106;71;50;101;50;106;106;106	.|P05067-2;E9PEV0;E9PG40;B4DII8;P05067-10;P05067-4;P05067-8;P05067	.|.;.;.;.;.;.;.;A4_HUMAN	Y|N	28|106;50;106;106;106;106;71;101;50	.|ENSP00000284981:K106N;ENSP00000346129:K50N;ENSP00000345463:K106N;ENSP00000350578:K106N;ENSP00000351796:K106N;ENSP00000352760:K106N;ENSP00000388538:K71N;ENSP00000387483:K101N;ENSP00000398879:K50N	.|ENSP00000284981:K106N	D|K	-|-	1|3	0|2	APP|APP	26384167|26384167	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.979000|0.979000	0.70002|0.70002	2.975000|2.975000	0.49281|0.49281	1.441000|1.441000	0.47550|0.47550	0.650000|0.650000	0.86243|0.86243	GAC|AAG	APP	-	pfam_Amyloid_glyco_heparin-bd,superfamily_Amyloid_glyco_heparin-bd,smart_Amyloid_glyco_extra	ENSG00000142192		0.582	APP-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	APP	HGNC	protein_coding	OTTHUMT00000171340.1	-	0.00	96	0	C	NM_000484		27462296	-1	tier1	-	no_errors	ENST00000346798	ensembl	human	known	74_37	missense	71.13	28	69	SNP	1.000	A
ARAP2	116984	genome.wustl.edu	37	4	36130237	36130237	+	Silent	SNP	C	C	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr4:36130237C>G	ENST00000303965.4	-	21	4047	c.3558G>C	c.(3556-3558)acG>acC	p.T1186T		NM_015230.3	NP_056045.2	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2	1186	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of ARF GTPase activity (GO:0032312)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(32)|ovary(2)|pancreas(1)|prostate(3)|skin(7)|urinary_tract(1)	82						TCAACACAGCCGTCACATCTT	0.388																																																	0													118.0	115.0	116.0					4																	36130237		2203	4300	6503	SO:0001819	synonymous_variant	0			AF411982	CCDS3441.1	4p15.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000047365	ENSG00000047365		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16924	protein-coding gene	gene with protein product		606645	"""centaurin, delta 1"""	CENTD1			Standard	NM_015230		Approved	PARX	uc003gsq.2	Q8WZ64	OTTHUMG00000097811	ENST00000303965.4:c.3558G>C	4.37:g.36130237C>G			Q4W5D2|Q7Z2L5|Q96L70|Q96P49|Q9Y4E4	Silent	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_ArfGAP,pfam_SAM_type1,pfam_SAM_2,pfam_Ras-assoc,superfamily_Rho_GTPase_activation_prot,superfamily_SAM/pointed,smart_SAM,smart_Pleckstrin_homology,smart_ArfGAP,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SAM,pfscan_ArfGAP,pfscan_RhoGAP_dom,prints_ArfGAP	p.T1186	ENST00000303965.4	37	c.3558	CCDS3441.1	4																																																																																			ARAP2	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000047365		0.388	ARAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARAP2	HGNC	protein_coding	OTTHUMT00000215074.2	-	0.00	52	0	C	NM_015230		36130237	-1	tier1	-	no_errors	ENST00000303965	ensembl	human	known	74_37	silent	54.90	23	28	SNP	0.001	G
ARHGAP23	57636	genome.wustl.edu	37	17	36633860	36633860	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr17:36633860C>T	ENST00000431231.2	+	12	2227	c.2159C>T	c.(2158-2160)gCc>gTc	p.A720V	ARHGAP23_ENST00000437668.3_Missense_Mutation_p.A720V|ARHGAP23_ENST00000443378.1_Missense_Mutation_p.A626V	NM_001199417.1	NP_001186346.1	Q9P227	RHG23_HUMAN	Rho GTPase activating protein 23	720	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(8)|kidney(6)|lung(1)|skin(1)|stomach(2)	20						CGGGTGTACGCCGCGCTGCGG	0.746																																																	0													2.0	2.0	2.0					17																	36633860		594	1373	1967	SO:0001583	missense	0			AB040934	CCDS56027.1	17q12	2014-05-06			ENSG00000225485	ENSG00000275832		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	29293	protein-coding gene	gene with protein product		610590				10819331, 15254754	Standard	NM_001199417		Approved	KIAA1501	uc021twd.1	Q9P227	OTTHUMG00000188547	ENST00000431231.2:c.2159C>T	17.37:g.36633860C>T	ENSP00000393539:p.Ala720Val			Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_PDZ,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_PDZ,smart_PDZ,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.A720V	ENST00000431231.2	37	c.2159	CCDS56027.1	17	.	.	.	.	.	.	.	.	.	.	c	1.107	-0.659270	0.03454	.	.	ENSG00000225485	ENST00000437668;ENST00000431231;ENST00000443378	T;T;T	0.77750	-1.12;-1.12;-1.12	3.18	1.12	0.20585	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.340343	0.26719	U	0.022849	T	0.63260	0.2496	L	0.35341	1.055	0.24783	N	0.992806	B;P	0.37370	0.349;0.592	B;B	0.42959	0.369;0.403	T	0.55541	-0.8125	10	0.06236	T	0.91	.	6.7526	0.23495	0.0:0.7122:0.1803:0.1075	.	720;720	Q9P227;Q9P227-2	RHG23_HUMAN;.	V	720;720;626	ENSP00000394153:A720V;ENSP00000393539:A720V;ENSP00000407333:A626V	ENSP00000393539:A720V	A	+	2	0	ARHGAP23	33887386	0.993000	0.37304	0.915000	0.36163	0.004000	0.04260	2.648000	0.46647	0.105000	0.17753	-1.316000	0.01300	GCC	ARHGAP23	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000225485		0.746	ARHGAP23-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP23	HGNC	protein_coding	OTTHUMT00000441789.1	-	0.00	54	0	C	XM_290799		36633860	+1	tier1	-	no_errors	ENST00000431231	ensembl	human	known	74_37	missense	42.31	30	22	SNP	0.877	T
ASXL2	55252	genome.wustl.edu	37	2	25972870	25972870	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr2:25972870C>G	ENST00000435504.4	-	12	1848	c.1555G>C	c.(1555-1557)Gaa>Caa	p.E519Q	ASXL2_ENST00000404843.1_Missense_Mutation_p.E259Q|ASXL2_ENST00000336112.4_Missense_Mutation_p.E491Q|ASXL2_ENST00000272341.4_Missense_Mutation_p.E259Q			Q76L83	ASXL2_HUMAN	additional sex combs like transcriptional regulator 2	519					adult heart development (GO:0007512)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone H3-K27 trimethylation (GO:1902466)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(3)	33	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACTAAAGATTCTTGGCTTTCA	0.458																																																	0													99.0	92.0	94.0					2																	25972870		1866	4117	5983	SO:0001583	missense	0					2p24.1	2014-06-17	2014-06-17		ENSG00000143970	ENSG00000143970			23805	protein-coding gene	gene with protein product		612991	"""additional sex combs like 2 (Drosophila)"""			12888926	Standard	NM_018263		Approved	ASXH2, FLJ10898, KIAA1685	uc002rgs.2	Q76L83	OTTHUMG00000152176	ENST00000435504.4:c.1555G>C	2.37:g.25972870C>G	ENSP00000391447:p.Glu519Gln		Q53TC9|Q5H9U4|Q76L81|Q86XM1|Q9C0H8|Q9NV67	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD	p.E519Q	ENST00000435504.4	37	c.1555		2	.	.	.	.	.	.	.	.	.	.	C	14.28	2.487563	0.44249	.	.	ENSG00000143970	ENST00000435504;ENST00000336112;ENST00000404843;ENST00000272341	T;T;T;T	0.19105	2.17;2.17;2.2;2.2	6.01	6.01	0.97437	.	0.628699	0.16576	N	0.208393	T	0.25344	0.0616	M	0.63428	1.95	0.30055	N	0.811431	B;B	0.30973	0.302;0.011	B;B	0.32289	0.143;0.003	T	0.12066	-1.0562	10	0.19590	T	0.45	-2.5007	15.4837	0.75548	0.0:0.8612:0.1388:0.0	.	259;519	Q76L83-2;Q76L83	.;ASXL2_HUMAN	Q	519;491;259;259	ENSP00000391447:E519Q;ENSP00000337250:E491Q;ENSP00000383920:E259Q;ENSP00000272341:E259Q	ENSP00000272341:E259Q	E	-	1	0	ASXL2	25826374	0.798000	0.28890	0.904000	0.35570	0.914000	0.54420	1.582000	0.36568	2.861000	0.98227	0.650000	0.86243	GAA	ASXL2	-	NULL	ENSG00000143970		0.458	ASXL2-001	KNOWN	basic|appris_principal	protein_coding	ASXL2	HGNC	protein_coding	OTTHUMT00000325593.3	-	0.00	77	0	C	NM_018263		25972870	-1	tier1	-	no_errors	ENST00000435504	ensembl	human	known	74_37	missense	32.05	53	25	SNP	0.848	G
ATP13A3	79572	genome.wustl.edu	37	3	194147849	194147850	+	Frame_Shift_Ins	INS	-	-	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr3:194147849_194147850insA	ENST00000439040.1	-	29	3870_3871	c.3079_3080insT	c.(3079-3081)tggfs	p.W1027fs	ATP13A3_ENST00000256031.4_Frame_Shift_Ins_p.W1027fs			Q9H7F0	AT133_HUMAN	ATPase type 13A3	1027						integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	24	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)		CTGTTTGACCCAAAAAAAACCC	0.381																																																	0																																										SO:0001589	frameshift_variant	0			AJ306929	CCDS43187.1	3q29	2010-04-20			ENSG00000133657	ENSG00000133657		"""ATPases / P-type"""	24113	protein-coding gene	gene with protein product	"""ATPase family homolog up regulated in senescence cells"""	610232				11867234	Standard	NM_024524		Approved	AFURS1	uc003fty.4	Q9H7F0	OTTHUMG00000156034	ENST00000439040.1:c.3080dupT	3.37:g.194147857_194147857dupA	ENSP00000416508:p.Trp1027fs		Q8NC11|Q96KS1	Frame_Shift_Ins	INS	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_Cation_typ_V,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Cation_typ_V,tigrfam_Cation_transp_P_typ_ATPase	p.W1027fs	ENST00000439040.1	37	c.3080_3079	CCDS43187.1	3																																																																																			ATP13A3	-	tigrfam_ATPase_P-typ_Cation_typ_V	ENSG00000133657		0.381	ATP13A3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ATP13A3	HGNC	protein_coding	OTTHUMT00000342799.2		0.00	37	0	0	NM_024524		194147850	-1			no_errors	ENST00000256031	ensembl	human	known	74_37	frame_shift_ins	11.29	55	7	INS	1.000:1.000	A
ATP1A2	477	genome.wustl.edu	37	1	160093831	160093831	+	Silent	SNP	G	G	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr1:160093831G>A	ENST00000361216.3	+	5	569	c.480G>A	c.(478-480)aaG>aaA	p.K160K	ATP1A2_ENST00000392233.3_Silent_p.K160K	NM_000702.3	NP_000693.1	P50993	AT1A2_HUMAN	ATPase, Na+/K+ transporting, alpha 2 polypeptide	160					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|locomotion (GO:0040011)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of heart contraction (GO:0045822)|negative regulation of striated muscle contraction (GO:0045988)|neurotransmitter uptake (GO:0001504)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of smooth muscle contraction (GO:0006940)|regulation of striated muscle contraction (GO:0006942)|regulation of the force of heart contraction (GO:0002026)|regulation of vasoconstriction (GO:0019229)|relaxation of cardiac muscle (GO:0055119)|response to nicotine (GO:0035094)|sodium ion export from cell (GO:0036376)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	caveola (GO:0005901)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|endosome (GO:0005768)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(30)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	69	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			ATTCCTTCAAGAACATGGTAC	0.527																																																	0													96.0	86.0	89.0					1																	160093831		2203	4300	6503	SO:0001819	synonymous_variant	0			AB018321	CCDS1196.1	1q23.2	2014-09-17	2010-04-20		ENSG00000018625	ENSG00000018625	3.6.3.9	"""ATPases / P-type"""	800	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-2"", ""sodium pump subunit alpha-2"", ""sodium-potassium ATPase catalytic subunit alpha-2"""	182340	"""migraine, hemiplegic 2"", ""ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide"""	MHP2		9403481	Standard	NM_000702		Approved	FHM2	uc001fvc.3	P50993	OTTHUMG00000024080	ENST00000361216.3:c.480G>A	1.37:g.160093831G>A			D3DVE4|Q07059|Q5JW74|Q86UZ5|Q9UQ25	Silent	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Na/K_IIC,tigrfam_Cation_transp_P_typ_ATPase	p.K160	ENST00000361216.3	37	c.480	CCDS1196.1	1																																																																																			ATP1A2	-	pfam_ATPase_P-typ_transduc_dom_A,tigrfam_ATPase_P-typ_Na/K_IIC,tigrfam_Cation_transp_P_typ_ATPase	ENSG00000018625		0.527	ATP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP1A2	HGNC	protein_coding	OTTHUMT00000060642.2	-	0.00	100	0	G	NM_000702		160093831	+1	tier1	-	no_errors	ENST00000361216	ensembl	human	known	74_37	silent	45.54	61	51	SNP	1.000	A
ATP2B4	493	genome.wustl.edu	37	1	203696810	203696810	+	3'UTR	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr1:203696810C>T	ENST00000466407.1	+	0	316				ATP2B4_ENST00000391954.2_Intron|ATP2B4_ENST00000357681.5_Intron|SNORA77_ENST00000408716.1_RNA|ATP2B4_ENST00000341360.2_Intron|ATP2B4_ENST00000367218.3_Intron|ATP2B4_ENST00000367219.3_Intron			P23634	AT2B4_HUMAN	ATPase, Ca++ transporting, plasma membrane 4						blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion import across plasma membrane (GO:0098703)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|cellular response to epinephrine stimulus (GO:0071872)|ion transmembrane transport (GO:0034220)|negative regulation of adrenergic receptor signaling pathway involved in heart process (GO:1901205)|negative regulation of arginine catabolic process (GO:1900082)|negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of cardiac muscle hypertrophy in response to stress (GO:1903243)|negative regulation of citrulline biosynthetic process (GO:1903249)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of the force of heart contraction (GO:0098736)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to hydrostatic pressure (GO:0051599)|transmembrane transport (GO:0055085)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|nitric-oxide synthase binding (GO:0050998)|protein phosphatase 2B binding (GO:0030346)|scaffold protein binding (GO:0097110)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(20)|ovary(2)|prostate(6)|skin(1)|stomach(1)|urinary_tract(3)	56	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			TCCAAAGGCTCACTACTGATG	0.542																																																	0																																										SO:0001624	3_prime_UTR_variant	0			M25874	CCDS1440.1, CCDS30977.1	1q32.1	2010-04-20	2005-05-26		ENSG00000058668	ENSG00000058668	3.6.3.8	"""ATPases / P-type"""	817	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 4"""	108732	"""matrix-remodelling associated 1"""	ATP2B2, MXRA1		1674727	Standard	NM_001001396		Approved	PMCA4	uc001gzw.3	P23634	OTTHUMG00000035906	ENST00000466407.1:c.*313C>T	1.37:g.203696810C>T			B1APW5|B1APW6|Q13450|Q13452|Q13455|Q16817|Q7Z3S1	RNA	SNP	-	NULL	ENST00000466407.1	37	NULL		1																																																																																			ATP2B4	-	-	ENSG00000058668		0.542	ATP2B4-005	KNOWN	basic	processed_transcript	ATP2B4	HGNC	protein_coding	OTTHUMT00000098774.1	-	0.00	40	0	C	NM_001001396		203696810	+1	tier1	-	no_errors	ENST00000466407	ensembl	human	known	74_37	rna	48.98	25	24	SNP	0.000	T
ATXN7L1	222255	genome.wustl.edu	37	7	105254708	105254708	+	Silent	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr7:105254708C>T	ENST00000419735.3	-	10	2118	c.2073G>A	c.(2071-2073)gcG>gcA	p.A691A	ATXN7L1_ENST00000388807.4_Silent_p.A351A|ATXN7L1_ENST00000477775.1_Silent_p.A567A	NM_020725.1	NP_065776.1	Q9ULK2	AT7L1_HUMAN	ataxin 7-like 1	691	Ser-rich.									endometrium(1)|large_intestine(4)|lung(5)	10						AGGGAGGGGCCGCCTGATAGG	0.562																																																	0													48.0	41.0	43.0					7																	105254708		692	1591	2283	SO:0001819	synonymous_variant	0			AB033044	CCDS34727.1, CCDS47682.1, CCDS47683.1	7q22.1	2007-11-13			ENSG00000146776	ENSG00000146776			22210	protein-coding gene	gene with protein product			"""ataxin 7-like 4"""	ATXN7L4		15115762	Standard	NM_152749		Approved	KIAA1218, MGC33190	uc003vde.2	Q9ULK2	OTTHUMG00000157521	ENST00000419735.3:c.2073G>A	7.37:g.105254708C>T			A4D0Q2|B4DTS1|Q8N2T0	Silent	SNP	pfam_SCA7_dom	p.A691	ENST00000419735.3	37	c.2073	CCDS47682.1	7																																																																																			ATXN7L1	-	NULL	ENSG00000146776		0.562	ATXN7L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN7L1	HGNC	protein_coding	OTTHUMT00000349037.2	-	0.00	40	0	C			105254708	-1	tier1	-	no_errors	ENST00000419735	ensembl	human	known	74_37	silent	26.32	42	15	SNP	0.137	T
BAI3	577	genome.wustl.edu	37	6	69640512	69640512	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr6:69640512A>T	ENST00000370598.1	+	4	1640	c.819A>T	c.(817-819)aaA>aaT	p.K273N		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	273					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				TTCATGAAAAAAGGGTCCCTC	0.343																																																	0													96.0	94.0	95.0					6																	69640512		2203	4300	6503	SO:0001583	missense	0			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.819A>T	6.37:g.69640512A>T	ENSP00000359630:p.Lys273Asn		B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_CUB_dom,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.K273N	ENST00000370598.1	37	c.819	CCDS4968.1	6	.	.	.	.	.	.	.	.	.	.	A	15.73	2.918362	0.52546	.	.	ENSG00000135298	ENST00000370598	T	0.20738	2.05	4.93	4.93	0.64822	.	0.140991	0.47093	D	0.000242	T	0.06735	0.0172	N	0.14661	0.345	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.09292	-1.0681	10	0.49607	T	0.09	.	14.8747	0.70485	1.0:0.0:0.0:0.0	.	273	O60242	BAI3_HUMAN	N	273	ENSP00000359630:K273N	ENSP00000359630:K273N	K	+	3	2	BAI3	69697233	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.854000	0.92228	1.976000	0.57569	0.477000	0.44152	AAA	BAI3	-	NULL	ENSG00000135298		0.343	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAI3	HGNC	protein_coding	OTTHUMT00000041120.1	-	0.00	29	0	A			69640512	+1	tier1	-	no_errors	ENST00000370598	ensembl	human	known	74_37	missense	48.57	18	17	SNP	1.000	T
BEND5	79656	genome.wustl.edu	37	1	49227056	49227056	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr1:49227056C>A	ENST00000371833.3	-	2	399	c.313G>T	c.(313-315)Gag>Tag	p.E105*	AGBL4_ENST00000371838.1_Intron|AGBL4_ENST00000371839.1_Intron|BEND5_ENST00000476096.1_5'Flank	NM_024603.2	NP_078879.2	Q7L4P6	BEND5_HUMAN	BEN domain containing 5	105						Golgi apparatus (GO:0005794)				large_intestine(5)|lung(2)|skin(1)	8						TCTTTAACCTCTCCATCTTCT	0.353																																																	0													244.0	200.0	213.0					1																	49227056		692	1591	2283	SO:0001587	stop_gained	0			BC007932	CCDS552.2	1p33	2012-11-22	2008-10-03	2008-10-03	ENSG00000162373	ENSG00000162373		"""BEN domain containing"""	25668	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 165"""	C1orf165		12477932	Standard	NM_024603		Approved	FLJ11588	uc001crx.4	Q7L4P6	OTTHUMG00000008153	ENST00000371833.3:c.313G>T	1.37:g.49227056C>A	ENSP00000360899:p.Glu105*		D3DQ27|Q96A62|Q9HAI3	Nonsense_Mutation	SNP	pfam_BEN_domain	p.E105*	ENST00000371833.3	37	c.313	CCDS552.2	1	.	.	.	.	.	.	.	.	.	.	C	32	5.172019	0.94807	.	.	ENSG00000162373	ENST00000371833	.	.	.	5.61	5.61	0.85477	.	0.108794	0.64402	D	0.000013	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-6.2836	19.0051	0.92848	0.0:1.0:0.0:0.0	.	.	.	.	X	105	.	.	E	-	1	0	BEND5	48999643	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.205000	0.65186	2.814000	0.96858	0.591000	0.81541	GAG	BEND5	-	NULL	ENSG00000162373		0.353	BEND5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BEND5	HGNC	protein_coding	OTTHUMT00000022323.1	-	0.00	87	0	C	NM_024603		49227056	-1	tier1	-	no_errors	ENST00000371833	ensembl	human	known	74_37	nonsense	22.55	79	23	SNP	1.000	A
BMP15	9210	genome.wustl.edu	37	X	50654013	50654013	+	Nonsense_Mutation	SNP	C	C	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chrX:50654013C>G	ENST00000252677.3	+	1	230	c.230C>G	c.(229-231)tCa>tGa	p.S77*		NM_005448.2	NP_005439.2	O95972	BMP15_HUMAN	bone morphogenetic protein 15	77					female gamete generation (GO:0007292)|granulosa cell development (GO:0060016)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)				NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|skin(1)	26	Ovarian(276;0.236)					TACCGGCGTTCAGCTGACTCG	0.592																																																	0													29.0	20.0	23.0					X																	50654013		2200	4294	6494	SO:0001587	stop_gained	0			AF082349	CCDS14334.1	Xp11.2	2013-02-06			ENSG00000130385	ENSG00000130385		"""Bone morphogenetic proteins"""	1068	protein-coding gene	gene with protein product		300247				9849956	Standard	NM_005448		Approved	GDF9B	uc011mnw.2	O95972	OTTHUMG00000021525	ENST00000252677.3:c.230C>G	X.37:g.50654013C>G	ENSP00000252677:p.Ser77*		Q17RM6|Q5JST1|Q9UMS1	Nonsense_Mutation	SNP	pfam_TGF-b_C,smart_TGF-b_C,prints_Inhibin_asu	p.S77*	ENST00000252677.3	37	c.230	CCDS14334.1	X	.	.	.	.	.	.	.	.	.	.	c	14.76	2.631213	0.46944	.	.	ENSG00000130385	ENST00000252677	.	.	.	5.9	1.93	0.25924	.	0.260930	0.38326	N	0.001725	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	.	8.2418	0.31665	0.271:0.4667:0.2623:0.0	.	.	.	.	X	77	.	ENSP00000252677:S77X	S	+	2	0	BMP15	50670753	0.950000	0.32346	0.435000	0.26784	0.113000	0.19764	1.713000	0.37951	0.612000	0.30071	-0.229000	0.12294	TCA	BMP15	-	NULL	ENSG00000130385		0.592	BMP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP15	HGNC	protein_coding	OTTHUMT00000056572.1	-	0.00	18	0	C	NM_005448		50654013	+1	tier1	-	no_errors	ENST00000252677	ensembl	human	known	74_37	nonsense	28.57	20	8	SNP	0.006	G
BRD8	10902	genome.wustl.edu	37	5	137498825	137498825	+	Nonsense_Mutation	SNP	G	G	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr5:137498825G>C	ENST00000254900.5	-	15	2452	c.2081C>G	c.(2080-2082)tCa>tGa	p.S694*	BRD8_ENST00000402931.1_Nonsense_Mutation_p.S694*|BRD8_ENST00000455658.2_Nonsense_Mutation_p.S653*|BRD8_ENST00000411594.2_Nonsense_Mutation_p.S697*|BRD8_ENST00000515014.1_Intron|BRD8_ENST00000230901.5_Nonsense_Mutation_p.S767*	NM_139199.1	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8	694					cell surface receptor signaling pathway (GO:0007166)|chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|intracellular receptor signaling pathway (GO:0030522)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(3)|urinary_tract(1)	35			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TCACAACTGTGAAGAAGCAGG	0.493																																																	0													147.0	127.0	134.0					5																	137498825		2203	4300	6503	SO:0001587	stop_gained	0			AF016270	CCDS4198.1, CCDS34241.1, CCDS54907.1	5q31	2008-02-05			ENSG00000112983	ENSG00000112983			19874	protein-coding gene	gene with protein product		602848				8611617, 9368056	Standard	NM_001164326		Approved	SMAP, p120	uc003lcf.1	Q9H0E9	OTTHUMG00000129204	ENST00000254900.5:c.2081C>G	5.37:g.137498825G>C	ENSP00000254900:p.Ser694*		O43178|Q15355|Q58AB0|Q59GN0|Q969M9	Nonsense_Mutation	SNP	pfam_Bromodomain,superfamily_Bromodomain,superfamily_Peptidase_M20_dimer,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.S694*	ENST00000254900.5	37	c.2081	CCDS4198.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	42|42	9.734196|9.734196	0.99251|0.99251	.|.	.|.	ENSG00000112983|ENSG00000112983	ENST00000441656|ENST00000254900;ENST00000454473;ENST00000418329;ENST00000230901;ENST00000402931;ENST00000411594;ENST00000239899;ENST00000455658;ENST00000511898	.|.	.|.	.|.	5.39|5.39	5.39|5.39	0.77823|0.77823	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.77644|.	0.4161|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.79087|.	-0.1947|.	3|.	.|0.66056	.|D	.|0.02	-3.0372|-3.0372	18.3245|18.3245	0.90248|0.90248	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	D|X	688|694;723;692;767;694;697;588;653;162	.|.	.|ENSP00000230901:S767X	H|S	-|-	1|2	0|0	BRD8|BRD8	137526724|137526724	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	9.156000|9.156000	0.94705|0.94705	2.808000|2.808000	0.96608|0.96608	0.561000|0.561000	0.74099|0.74099	CAC|TCA	BRD8	-	superfamily_Bromodomain	ENSG00000112983		0.493	BRD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRD8	HGNC	protein_coding	OTTHUMT00000251282.3	-	0.00	66	0	G	NM_006696		137498825	-1	tier1	-	no_errors	ENST00000254900	ensembl	human	known	74_37	nonsense	36.36	56	32	SNP	1.000	C
C16orf96	342346	genome.wustl.edu	37	16	4625340	4625340	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr16:4625340G>C	ENST00000444310.4	+	5	859	c.859G>C	c.(859-861)Gag>Cag	p.E287Q		NM_001145011.1	NP_001138483.1			chromosome 16 open reading frame 96											NS(1)|breast(1)|endometrium(6)|kidney(1)|skin(3)	12						TGAGGTCCCAGAGCTCCTCCC	0.622																																																	0													41.0	42.0	42.0					16																	4625340		692	1591	2283	SO:0001583	missense	0				CCDS53986.1	16p13.3	2012-10-10			ENSG00000205832	ENSG00000205832			40031	protein-coding gene	gene with protein product							Standard	NM_001145011		Approved		uc010uxn.2	A6NNT2	OTTHUMG00000176519	ENST00000444310.4:c.859G>C	16.37:g.4625340G>C	ENSP00000415027:p.Glu287Gln			Missense_Mutation	SNP	NULL	p.E287Q	ENST00000444310.4	37	c.859	CCDS53986.1	16	.	.	.	.	.	.	.	.	.	.	G	11.08	1.533017	0.27387	.	.	ENSG00000205832	ENST00000444310	.	.	.	3.48	0.326	0.15908	.	.	.	.	.	T	0.17450	0.0419	N	0.19112	0.55	0.09310	N	1	B	0.25441	0.126	B	0.22880	0.042	T	0.27872	-1.0061	8	0.13853	T	0.58	.	3.7841	0.08692	0.2351:0.2035:0.5614:0.0	.	287	A6NNT2	CP096_HUMAN	Q	287	.	ENSP00000415027:E287Q	E	+	1	0	C16orf96	4565341	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.147000	0.16202	0.115000	0.18071	-0.502000	0.04539	GAG	C16orf96	-	NULL	ENSG00000205832		0.622	C16orf96-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C16orf96	HGNC	protein_coding	OTTHUMT00000432384.1	-	0.00	46	0	G	NM_001145011		4625340	+1	tier1	-	no_errors	ENST00000444310	ensembl	human	known	74_37	missense	22.03	46	13	SNP	0.000	C
C19orf54	284325	genome.wustl.edu	37	19	41247442	41247442	+	3'UTR	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr19:41247442C>T	ENST00000378313.2	-	0	2071				C19orf54_ENST00000598485.2_Intron|C19orf54_ENST00000594163.1_5'UTR|C19orf54_ENST00000470681.1_3'UTR	NM_198476.3	NP_940878.3	Q5BKX5	CS054_HUMAN	chromosome 19 open reading frame 54											breast(1)|lung(1)|urinary_tract(2)	4			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			GTTCCTCCTTCAGAGTGGAGG	0.428																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK123126	CCDS12564.2	19q13.2	2012-10-26			ENSG00000188493	ENSG00000188493			24758	protein-coding gene	gene with protein product							Standard	NM_198476		Approved	FLJ41131	uc002oou.1	Q5BKX5	OTTHUMG00000150174	ENST00000378313.2:c.*896G>A	19.37:g.41247442C>T			A8MSZ5|B4DNU7	RNA	SNP	-	NULL	ENST00000378313.2	37	NULL	CCDS12564.2	19																																																																																			C19orf54	-	-	ENSG00000188493		0.428	C19orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C19orf54	HGNC	protein_coding	OTTHUMT00000316701.1	-	0.00	11	0	C	NM_198476		41247442	-1	tier1	-	no_errors	ENST00000594163	ensembl	human	known	74_37	rna	41.67	7	5	SNP	0.016	T
C1orf195	727684	genome.wustl.edu	37	1	15495205	15495205	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr1:15495205T>A	ENST00000376005.3	-	2	205	c.167A>T	c.(166-168)cAc>cTc	p.H56L	TMEM51_ENST00000428417.1_Intron|C1orf195_ENST00000424792.1_Intron|TMEM51_ENST00000400796.3_Intron|TMEM51_ENST00000376014.3_Intron|TMEM51_ENST00000434578.2_Intron|TMEM51_ENST00000376008.2_Intron	NM_001278501.1	NP_001265430.1	Q5TG92	CA195_HUMAN	chromosome 1 open reading frame 195	56																	TCTCCCAGGGTGAGCCAGTGA	0.483																																																	0																																										SO:0001583	missense	0				CCDS59992.1, CCDS59993.1	1p36.21	2012-07-30			ENSG00000204464	ENSG00000204464			32332	protein-coding gene	gene with protein product							Standard	NM_001278501		Approved			Q5TG92	OTTHUMG00000037852	ENST00000376005.3:c.167A>T	1.37:g.15495205T>A	ENSP00000365173:p.His56Leu			Missense_Mutation	SNP	NULL	p.H56L	ENST00000376005.3	37	c.167		1	.	.	.	.	.	.	.	.	.	.	T	4.749	0.139275	0.09083	.	.	ENSG00000204464	ENST00000376005	.	.	.	3.28	-6.56	0.01848	.	.	.	.	.	T	0.35278	0.0926	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	T	0.48007	-0.9072	5	0.87932	D	0	.	6.0864	0.19970	0.0:0.3516:0.2284:0.4199	.	.	.	.	L	56	.	ENSP00000365173:H56L	H	-	2	0	C1orf195	15367792	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.652000	0.05366	-2.002000	0.00963	-1.471000	0.01009	CAC	C1orf195	-	NULL	ENSG00000204464		0.483	C1orf195-001	KNOWN	basic|appris_candidate_longest	protein_coding	C1orf195	HGNC	protein_coding	OTTHUMT00000092383.1	-	0.00	31	0	T			15495205	-1	tier1	-	no_errors	ENST00000376005	ensembl	human	known	74_37	missense	27.78	26	10	SNP	0.000	A
B3GALT5	10317	genome.wustl.edu	37	21	40978250	40978250	+	Intron	SNP	C	C	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr21:40978250C>G	ENST00000380620.4	+	2	201				C21orf88_ENST00000380604.3_Intron|C21orf88_ENST00000380612.4_Intron|C21orf88_ENST00000329618.6_Missense_Mutation_p.K59N			Q9Y2C3	B3GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5						protein glycosylation (GO:0006486)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	16		Prostate(19;2.55e-06)				ATTCTGAAGGCTTCCAAACAC	0.403																																																	0																																										SO:0001627	intron_variant	0			AB020337	CCDS13667.1, CCDS74795.1	21q22.3	2013-02-19			ENSG00000183778	ENSG00000183778		"""Beta 3-glycosyltransferases"""	920	protein-coding gene	gene with protein product	"""homolog of C. elegans Bt toxin resistance gene bre-5"", ""GlcNAc-beta-1,3-galactosyltransferase 5"""	604066				10212226	Standard	NM_006057		Approved	beta3Gal-T5, B3GalT-V, GLCT5, B3T5	uc002yyj.1	Q9Y2C3	OTTHUMG00000086725	ENST00000380620.4:c.-392+1098C>G	21.37:g.40978250C>G			A8KA86|D3DSI3|Q2M3L5|Q53Z19|Q9NY96|Q9P1X6|Q9P1X7	Missense_Mutation	SNP	NULL	p.K59N	ENST00000380620.4	37	c.177	CCDS13667.1	21	.	.	.	.	.	.	.	.	.	.	C	2.269	-0.367417	0.05069	.	.	ENSG00000184809	ENST00000329618	.	.	.	2.74	-0.389	0.12455	.	.	.	.	.	T	0.23846	0.0577	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.27536	-1.0071	4	.	.	.	.	4.6362	0.12525	0.4164:0.3585:0.2251:0.0	.	.	.	.	N	59	.	.	K	-	3	2	C21orf88	39900120	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.001000	0.12947	-0.095000	0.12351	0.563000	0.77884	AAG	C21orf88	-	NULL	ENSG00000184809		0.403	B3GALT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C21orf88	HGNC	protein_coding	OTTHUMT00000195008.2	-	0.00	25	0	C	NM_033170		40978250	-1	tier1	-	no_errors	ENST00000329618	ensembl	human	putative	74_37	missense	23.08	30	9	SNP	0.000	G
C3orf20	84077	genome.wustl.edu	37	3	14746055	14746055	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr3:14746055C>G	ENST00000253697.3	+	7	1542	c.1090C>G	c.(1090-1092)Caa>Gaa	p.Q364E	C3orf20_ENST00000412910.1_Missense_Mutation_p.Q242E|C3orf20_ENST00000435614.1_Missense_Mutation_p.Q242E|C3orf20_ENST00000495387.1_3'UTR	NM_032137.4	NP_115513.4	Q8ND61	CC020_HUMAN	chromosome 3 open reading frame 20	364						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(13)|lung(11)|ovary(4)|skin(2)	40						TCAGCATTGTCAAGAGGGGAA	0.498																																																	0													259.0	246.0	250.0					3																	14746055		2203	4300	6503	SO:0001583	missense	0			AL136781	CCDS33706.1, CCDS54555.1	3p25.1	2011-01-25			ENSG00000131379	ENSG00000131379			25320	protein-coding gene	gene with protein product						11230166	Standard	NM_032137		Approved	DKFZP434N1817	uc003byy.3	Q8ND61	OTTHUMG00000155545	ENST00000253697.3:c.1090C>G	3.37:g.14746055C>G	ENSP00000253697:p.Gln364Glu		Q7L0U6|Q8NCP2|Q9H0I7	Missense_Mutation	SNP	NULL	p.Q364E	ENST00000253697.3	37	c.1090	CCDS33706.1	3	.	.	.	.	.	.	.	.	.	.	C	9.717	1.158554	0.21454	.	.	ENSG00000131379	ENST00000253697;ENST00000435614;ENST00000412910	T;T;T	0.11063	2.81;2.81;2.81	4.64	3.73	0.42828	.	0.347184	0.21555	N	0.072680	T	0.09730	0.0239	L	0.32530	0.975	0.09310	N	1	P	0.39847	0.691	B	0.42771	0.397	T	0.21415	-1.0246	10	0.17832	T	0.49	-10.5974	9.6523	0.39906	0.2079:0.7921:0.0:0.0	.	364	Q8ND61	CC020_HUMAN	E	364;242;242	ENSP00000253697:Q364E;ENSP00000402933:Q242E;ENSP00000396081:Q242E	ENSP00000253697:Q364E	Q	+	1	0	C3orf20	14721059	0.740000	0.28207	0.026000	0.17262	0.039000	0.13416	3.036000	0.49767	1.111000	0.41721	0.591000	0.81541	CAA	C3orf20	-	NULL	ENSG00000131379		0.498	C3orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf20	HGNC	protein_coding	OTTHUMT00000340586.1	-	0.00	107	0	C	NM_032137		14746055	+1	tier1	-	no_errors	ENST00000253697	ensembl	human	known	74_37	missense	32.58	60	29	SNP	0.049	G
C5orf60	285679	genome.wustl.edu	37	5	179070016	179070016	+	Silent	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr5:179070016C>T	ENST00000448248.2	-	4	562	c.537G>A	c.(535-537)ccG>ccA	p.P179P	C5orf60_ENST00000506142.1_5'UTR	NM_001142306.1	NP_001135778.1	A6NFR6	CE060_HUMAN	chromosome 5 open reading frame 60	179	Ser-rich.					integral component of membrane (GO:0016021)				NS(1)|breast(1)|kidney(5)	7						CGGAGGTCTTCGGGACTGATG	0.642																																																	0													40.0	44.0	43.0					5																	179070016		692	1591	2283	SO:0001819	synonymous_variant	0			BC043435	CCDS47353.1	5q35.3	2010-08-19			ENSG00000204661	ENSG00000204661			27753	protein-coding gene	gene with protein product						12477932	Standard	NM_001142306		Approved		uc003mki.3	A6NFR6	OTTHUMG00000163221	ENST00000448248.2:c.537G>A	5.37:g.179070016C>T			A1L488|B7ZM52|B7ZM53	Silent	SNP	NULL	p.P179	ENST00000448248.2	37	c.537	CCDS47353.1	5																																																																																			C5orf60	-	NULL	ENSG00000204661		0.642	C5orf60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5orf60	HGNC	protein_coding	OTTHUMT00000372148.2	-	0.00	108	0	C	NM_001142306		179070016	-1	tier1	-	no_errors	ENST00000448248	ensembl	human	known	74_37	silent	34.65	66	35	SNP	0.000	T
C8A	731	genome.wustl.edu	37	1	57378148	57378148	+	Missense_Mutation	SNP	C	C	A	rs370599466|rs386631447		TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr1:57378148C>A	ENST00000361249.3	+	10	1549	c.1453C>A	c.(1453-1455)Cgc>Agc	p.R485S		NM_000562.2	NP_000553.1	P07357	CO8A_HUMAN	complement component 8, alpha polypeptide	485	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.		R -> L (in dbSNP:rs1620075).		complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	43						GAACCTGCGCCGCGCCTTGGA	0.622																																																	0													67.0	70.0	69.0					1																	57378148		2203	4300	6503	SO:0001583	missense	0			M16974	CCDS606.1	1p32.2	2014-09-17			ENSG00000157131	ENSG00000157131		"""Complement system"""	1352	protein-coding gene	gene with protein product		120950					Standard	NM_000562		Approved		uc001cyo.2	P07357	OTTHUMG00000008306	ENST00000361249.3:c.1453C>A	1.37:g.57378148C>A	ENSP00000354458:p.Arg485Ser		A2RUI4|A2RUI5|Q13668|Q9H130	Missense_Mutation	SNP	pfam_MACPF,pfam_LDrepeatLR_classA_rpt,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,pfscan_LDrepeatLR_classA_rpt,pfscan_Thrombospondin_1_rpt,prints_MAC_perforin	p.R485S	ENST00000361249.3	37	c.1453	CCDS606.1	1	.	.	.	.	.	.	.	.	.	.	C	12.29	1.893234	0.33442	.	.	ENSG00000157131	ENST00000361249	D	0.84944	-1.92	5.73	-1.62	0.08372	Membrane attack complex component/perforin (MACPF) domain (3);	0.258044	0.41001	D	0.000972	D	0.86239	0.5885	M	0.83483	2.645	0.09310	N	1	B	0.33748	0.423	B	0.40228	0.323	T	0.80968	-0.1145	10	0.54805	T	0.06	-1.8617	14.1942	0.65659	0.6495:0.2585:0.092:0.0	.	485	P07357	CO8A_HUMAN	S	485	ENSP00000354458:R485S	ENSP00000354458:R485S	R	+	1	0	C8A	57150736	0.000000	0.05858	0.006000	0.13384	0.589000	0.36550	-0.057000	0.11768	-0.212000	0.10109	0.655000	0.94253	CGC	C8A	-	pfam_MACPF,smart_MACPF,prints_MAC_perforin	ENSG00000157131		0.622	C8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C8A	HGNC	protein_coding	OTTHUMT00000022890.1	-	0.00	40	0	C	NM_000562		57378148	+1	tier1	-	no_errors	ENST00000361249	ensembl	human	known	74_37	missense	24.24	50	16	SNP	0.000	A
CARS	833	genome.wustl.edu	37	11	3050660	3050660	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr11:3050660T>A	ENST00000397111.5	-	7	811	c.566A>T	c.(565-567)gAa>gTa	p.E189V	CARS_ENST00000401769.3_Missense_Mutation_p.E202V|CARS_ENST00000278224.9_Missense_Mutation_p.E189V|CARS-AS1_ENST00000499962.1_RNA|CARS_ENST00000397114.3_Missense_Mutation_p.E179V|CARS_ENST00000380525.4_Missense_Mutation_p.E272V			P49589	SYCC_HUMAN	cysteinyl-tRNA synthetase	189					cysteinyl-tRNA aminoacylation (GO:0006423)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|cysteine-tRNA ligase activity (GO:0004817)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)		CARS/ALK(5)	central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)	31		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00317)|LUSC - Lung squamous cell carcinoma(625;0.218)	L-Cysteine(DB00151)	ATCCTTGGCTTCTTCCAGCAA	0.517			T	ALK	ALCL																																Ovarian(61;932 1157 5961 20446 52152)			Dom	yes		11	11p15.5	833	cysteinyl-tRNA synthetase		L	0													64.0	66.0	65.0					11																	3050660		2202	4298	6500	SO:0001583	missense	0			AF288207	CCDS7742.1, CCDS41600.1, CCDS41602.1	11p15.5	2011-07-01			ENSG00000110619	ENSG00000110619	6.1.1.16	"""Aminoacyl tRNA synthetases / Class I"""	1493	protein-coding gene	gene with protein product	"""cysteine tRNA ligase 1, cytoplasmic"""	123859				8468064	Standard	NM_139273		Approved	CARS1	uc001lxf.3	P49589	OTTHUMG00000010927	ENST00000397111.5:c.566A>T	11.37:g.3050660T>A	ENSP00000380300:p.Glu189Val		Q53XI8|Q5HYE4|Q9HD24|Q9HD25	Missense_Mutation	SNP	pfam_Cys-tRNA/MSH_ligase,pfam_Methionyl/Leucyl_tRNA_Synth,superfamily_tRNAsynth_1a_anticodon-bd,superfamily_Glutathione-S-Trfase_C-like,prints_Cys-tRNA/MSH_ligase,tigrfam_Cys-tRNA-ligase	p.E272V	ENST00000397111.5	37	c.815	CCDS7742.1	11	.	.	.	.	.	.	.	.	.	.	T	11.99	1.802386	0.31869	.	.	ENSG00000110619	ENST00000380525;ENST00000397111;ENST00000278224;ENST00000397114;ENST00000401769	T;T;T;T;T	0.46451	0.87;0.88;0.88;0.88;0.87	3.9	2.74	0.32292	.	0.314311	0.34652	N	0.003795	T	0.46367	0.1389	M	0.64997	1.995	0.53005	D	0.999965	B;B;P;P;B;P	0.45474	0.038;0.122;0.774;0.83;0.152;0.859	B;B;P;P;B;P	0.49597	0.063;0.068;0.616;0.481;0.152;0.616	T	0.30268	-0.9984	10	0.35671	T	0.21	-21.6558	9.4426	0.38677	0.0:0.0:0.3454:0.6546	.	202;272;189;189;272;179	B4DKY1;B4DPV7;P49589;P49589-2;Q5HYE4;A8MVQ3	.;.;SYCC_HUMAN;.;.;.	V	272;189;189;179;202	ENSP00000369897:E272V;ENSP00000380300:E189V;ENSP00000278224:E189V;ENSP00000380303:E179V;ENSP00000384069:E202V	ENSP00000278224:E189V	E	-	2	0	CARS	3007236	1.000000	0.71417	0.819000	0.32651	0.181000	0.23173	3.374000	0.52402	0.530000	0.28619	0.454000	0.30748	GAA	CARS	-	pfam_Cys-tRNA/MSH_ligase,tigrfam_Cys-tRNA-ligase	ENSG00000110619		0.517	CARS-001	KNOWN	basic|CCDS	protein_coding	CARS	HGNC	protein_coding	OTTHUMT00000030117.4	-	0.00	28	0	T	NM_001751		3050660	-1	tier1	-	no_errors	ENST00000380525	ensembl	human	known	74_37	missense	72.50	11	29	SNP	0.984	A
CAPRIN1	4076	genome.wustl.edu	37	11	34118131	34118131	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr11:34118131A>G	ENST00000341394.4	+	16	2000	c.1811A>G	c.(1810-1812)tAt>tGt	p.Y604C	CAPRIN1_ENST00000389645.3_Missense_Mutation_p.Y604C|CAPRIN1_ENST00000533657.1_3'UTR|CAPRIN1_ENST00000529307.1_Missense_Mutation_p.Y523C|CAPRIN1_ENST00000532820.1_Missense_Mutation_p.Y604C|CAPRIN1_ENST00000530820.1_Missense_Mutation_p.Y604C	NM_005898.4	NP_005889.3	Q14444	CAPR1_HUMAN	cell cycle associated protein 1	604					negative regulation of translation (GO:0017148)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)	18		Acute lymphoblastic leukemia(5;0.00045)|all_hematologic(20;0.0016)				AATCAGCCCTATTACAATAGT	0.522																																																	0													106.0	104.0	105.0					11																	34118131		2202	4298	6500	SO:0001583	missense	0			BC001731	CCDS31453.1, CCDS31454.1	11p13	2010-08-03	2007-03-27	2007-03-27	ENSG00000135387	ENSG00000135387			6743	protein-coding gene	gene with protein product	"""cytoplasmic activation/proliferation-associated protein-1"""	601178	"""membrane component, chromosome 11, surface marker 1"", ""GPI-anchored membrane protein 1"""	M11S1, GPIAP1		7657653, 16177067, 17210633, 14764709, 15471883	Standard	NM_005898		Approved	caprin-1, RNG105	uc001mvh.1	Q14444	OTTHUMG00000166248	ENST00000341394.4:c.1811A>G	11.37:g.34118131A>G	ENSP00000340329:p.Tyr604Cys		A6NMY7|D3DR06|Q15074|Q6IMN4|Q6IMN7|Q9BV09	Missense_Mutation	SNP	pfam_Caprin-1_C	p.Y604C	ENST00000341394.4	37	c.1811	CCDS31453.1	11	.	.	.	.	.	.	.	.	.	.	A	19.68	3.871970	0.72180	.	.	ENSG00000135387	ENST00000341394;ENST00000389645;ENST00000532820;ENST00000530820;ENST00000529307	T;T;T;T;T	0.26518	1.73;1.73;1.73;1.73;1.73	6.06	6.06	0.98353	.	0.050149	0.85682	D	0.000000	T	0.38401	0.1039	L	0.43152	1.355	0.45979	D	0.99879	D;D	0.71674	0.998;0.997	P;P	0.62491	0.903;0.843	T	0.08493	-1.0719	10	0.42905	T	0.14	-5.1886	11.6593	0.51337	0.8677:0.0:0.0:0.1323	.	604;604	Q14444;Q14444-2	CAPR1_HUMAN;.	C	604;604;604;604;523	ENSP00000340329:Y604C;ENSP00000374296:Y604C;ENSP00000434150:Y604C;ENSP00000434204:Y604C;ENSP00000431581:Y523C	ENSP00000340329:Y604C	Y	+	2	0	CAPRIN1	34074707	1.000000	0.71417	1.000000	0.80357	0.796000	0.44982	6.523000	0.73787	2.324000	0.78689	0.533000	0.62120	TAT	CAPRIN1	-	pfam_Caprin-1_C	ENSG00000135387		0.522	CAPRIN1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	CAPRIN1	HGNC	protein_coding	OTTHUMT00000388680.2	-	0.00	41	0	A	NM_005898		34118131	+1	tier1	-	no_errors	ENST00000341394	ensembl	human	known	74_37	missense	48.00	26	24	SNP	1.000	G
CASP5	838	genome.wustl.edu	37	11	104878040	104878041	+	Frame_Shift_Ins	INS	-	-	T	rs112680102|rs144697764		TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr11:104878040_104878041insT	ENST00000260315.3	-	3	201_202	c.202_203insA	c.(202-204)acafs	p.T68fs	CASP5_ENST00000444749.2_Frame_Shift_Ins_p.T10fs|CASP5_ENST00000393139.2_Frame_Shift_Ins_p.T35fs|CASP5_ENST00000531367.1_Intron|CASP5_ENST00000418434.1_Intron|CASP5_ENST00000393141.2_Frame_Shift_Ins_p.T81fs|CASP5_ENST00000526056.1_Frame_Shift_Ins_p.T81fs			P51878	CASP5_HUMAN	caspase 5, apoptosis-related cysteine peptidase	68	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|execution phase of apoptosis (GO:0097194)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of inflammatory response (GO:0050727)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|NLRP1 inflammasome complex (GO:0072558)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)	p.T52fs*26(1)		NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|ovary(3)|skin(1)|urinary_tract(1)	35		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)		CATCTTAACTGTTTTTTTTTTG	0.356																																																	1	Deletion - Frameshift(1)	ovary(1)																																								SO:0001589	frameshift_variant	0				CCDS8328.2, CCDS44718.1, CCDS44719.1, CCDS44720.1	11q22.2-q22.3	2006-02-17	2005-08-17		ENSG00000137757	ENSG00000137757		"""Caspases"""	1506	protein-coding gene	gene with protein product		602665	"""caspase 5, apoptosis-related cysteine protease"""			7797592, 9250871	Standard	NM_004347		Approved	ICE(rel)III	uc010ruz.1	P51878	OTTHUMG00000048073	ENST00000260315.3:c.203dupA	11.37:g.104878050_104878050dupT	ENSP00000260315:p.Thr68fs		B4DKP5|Q0QVY7|Q0QVY8|Q0QVZ0|Q0QVZ1|Q0QVZ2|Q14DD6|Q1HBJ3|Q6DJV7	Frame_Shift_Ins	INS	pfam_Pept_C14_caspase,pfam_CARD,superfamily_DEATH-like_dom,smart_CARD,smart_Pept_C14A_p45_core,pirsf_Caspase_IL-1_beta,pfscan_CARD,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	p.T81fs	ENST00000260315.3	37	c.242_241	CCDS8328.2	11																																																																																			CASP5	-	pfam_CARD,superfamily_DEATH-like_dom,smart_CARD,pirsf_Caspase_IL-1_beta,pfscan_CARD	ENSG00000137757		0.356	CASP5-001	KNOWN	basic|CCDS	protein_coding	CASP5	HGNC	protein_coding	OTTHUMT00000109397.2		0.00	28	0	-	NM_004347		104878041	-1	tier1		no_errors	ENST00000393141	ensembl	human	known	74_37	frame_shift_ins	16.67	20	4	INS	0.000:0.000	T
CCDC168	643677	genome.wustl.edu	37	13	103384753	103384753	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr13:103384753C>G	ENST00000322527.2	-	1	4406	c.4407G>C	c.(4405-4407)atG>atC	p.M1469I		NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168	1469																	TCTGGATTTTCATAGTTAAAT	0.343																																																	0													196.0	156.0	168.0					13																	103384753		692	1590	2282	SO:0001583	missense	0				CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287	ENST00000322527.2:c.4407G>C	13.37:g.103384753C>G	ENSP00000320232:p.Met1469Ile		Q8N800	Missense_Mutation	SNP	NULL	p.M1469I	ENST00000322527.2	37	c.4407		13	.	.	.	.	.	.	.	.	.	.	C	9.346	1.064214	0.20067	.	.	ENSG00000175820	ENST00000322527	T	0.05649	3.41	3.67	2.83	0.33086	.	.	.	.	.	T	0.04318	0.0119	N	0.19112	0.55	0.09310	N	1	B	0.24823	0.112	B	0.20184	0.028	T	0.41179	-0.9523	9	0.30854	T	0.27	.	7.1445	0.25575	0.0:0.878:0.0:0.122	.	1469	Q8NDH2	CC168_HUMAN	I	1469	ENSP00000320232:M1469I	ENSP00000320232:M1469I	M	-	3	0	CCDC168	102182754	0.032000	0.19561	0.094000	0.20943	0.004000	0.04260	0.411000	0.21115	1.120000	0.41904	-0.259000	0.10710	ATG	CCDC168	-	NULL	ENSG00000175820		0.343	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	CCDC168	HGNC	protein_coding		-	0.00	77	0	C	NM_001146197		103384753	-1	tier1	-	no_errors	ENST00000322527	ensembl	human	known	74_37	missense	39.08	53	34	SNP	0.174	G
CDAN1	146059	genome.wustl.edu	37	15	43029216	43029216	+	Missense_Mutation	SNP	A	A	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr15:43029216A>C	ENST00000356231.3	-	1	108	c.85T>G	c.(85-87)Tcg>Gcg	p.S29A		NM_138477.2	NP_612486.2	Q8IWY9	CDAN1_HUMAN	codanin 1	29					chromatin assembly (GO:0031497)|chromatin organization (GO:0006325)|negative regulation of DNA replication (GO:0008156)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	24		all_cancers(109;5.4e-16)|all_epithelial(112;2.97e-14)|Lung NSC(122;1.75e-08)|all_lung(180;5.99e-08)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;2.49e-07)		GTTACCTCCGAACCCTGGGTG	0.692																																																	0													27.0	25.0	26.0					15																	43029216		2179	4255	6434	SO:0001583	missense	0			AF525398	CCDS32209.1	15q15.2	2012-04-25	2012-04-25			ENSG00000140326			1713	protein-coding gene	gene with protein product		607465	"""congenital dyserythropoietic anemia, type I"""			8634422, 12434312	Standard	XM_005254177		Approved	CDA-I, CDAI	uc001zql.3	Q8IWY9		ENST00000356231.3:c.85T>G	15.37:g.43029216A>C	ENSP00000348564:p.Ser29Ala		Q6NYD0|Q7Z7L5|Q969N3	Missense_Mutation	SNP	NULL	p.S29A	ENST00000356231.3	37	c.85	CCDS32209.1	15	.	.	.	.	.	.	.	.	.	.	A	14.72	2.619726	0.46736	.	.	ENSG00000140326	ENST00000356231;ENST00000267892	D	0.86297	-2.1	4.42	3.27	0.37495	.	0.957554	0.08624	N	0.918097	T	0.77336	0.4115	N	0.19112	0.55	0.22827	N	0.998684	B	0.02656	0.0	B	0.04013	0.001	T	0.63152	-0.6701	10	0.30854	T	0.27	-0.7984	7.9919	0.30246	0.6992:0.3008:0.0:0.0	.	29	Q8IWY9	CDAN1_HUMAN	A	29	ENSP00000348564:S29A	ENSP00000267892:S29A	S	-	1	0	CDAN1	40816508	0.798000	0.28890	0.999000	0.59377	0.003000	0.03518	1.314000	0.33597	1.843000	0.53566	0.533000	0.62120	TCG	CDAN1	-	NULL	ENSG00000140326		0.692	CDAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDAN1	HGNC	protein_coding	OTTHUMT00000431103.1	-	0.00	68	0	A	XM_085300		43029216	-1	tier1	-	no_errors	ENST00000356231	ensembl	human	known	74_37	missense	64.52	22	40	SNP	0.982	C
CEACAM21	90273	genome.wustl.edu	37	19	42082640	42082640	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr19:42082640C>T	ENST00000401445.2	+	1	40	c.14C>T	c.(13-15)tCa>tTa	p.S5L	CEACAM21_ENST00000187608.9_Missense_Mutation_p.S5L|CEACAM21_ENST00000482870.2_Intron|CEACAM21_ENST00000407170.2_Intron			Q3KPI0	CEA21_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 21	5						integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(3)|lung(6)|ovary(1)|urinary_tract(1)	13						GGGCCCCCCTCAGCTTGTCCC	0.617																																																	0													44.0	46.0	45.0					19																	42082640		2203	4300	6503	SO:0001583	missense	0			AK023602	CCDS46086.1, CCDS46087.1, CCDS74373.1	19q13.2	2013-01-29			ENSG00000007129	ENSG00000007129		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28834	protein-coding gene	gene with protein product						12477932	Standard	XM_005278397		Approved	R29124_1, FLJ13540	uc002ore.4	Q3KPI0	OTTHUMG00000151062	ENST00000401445.2:c.14C>T	19.37:g.42082640C>T	ENSP00000385739:p.Ser5Leu		B7WNQ6|O75296|Q6UY47|Q96ER7	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.S5L	ENST00000401445.2	37	c.14	CCDS46086.1	19	.	.	.	.	.	.	.	.	.	.	C	16.33	3.093697	0.56075	.	.	ENSG00000007129	ENST00000187608;ENST00000401445	T;T	0.39592	1.07;1.09	2.26	2.26	0.28386	.	.	.	.	.	T	0.57636	0.2067	M	0.76433	2.335	0.21020	N	0.999806	P;P	0.49783	0.922;0.928	P;P	0.60068	0.868;0.677	T	0.43410	-0.9393	9	0.72032	D	0.01	.	8.6491	0.34025	0.0:1.0:0.0:0.0	.	5;5	Q3KPI0-2;Q3KPI0	.;CEA21_HUMAN	L	5	ENSP00000187608:S5L;ENSP00000385739:S5L	ENSP00000187608:S5L	S	+	2	0	CEACAM21	46774480	0.002000	0.14202	0.119000	0.21687	0.326000	0.28443	0.044000	0.13992	1.236000	0.43740	0.123000	0.15791	TCA	CEACAM21	-	NULL	ENSG00000007129		0.617	CEACAM21-005	KNOWN	non_canonical_polymorphism|basic|appris_candidate_longest|CCDS	protein_coding	CEACAM21	HGNC	protein_coding	OTTHUMT00000321140.1	-	0.00	74	0	C	NM_033543		42082640	+1	tier1	-	no_errors	ENST00000401445	ensembl	human	known	74_37	missense	32.47	52	25	SNP	0.557	T
CGREF1	10669	genome.wustl.edu	37	2	27324150	27324150	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr2:27324150C>A	ENST00000260595.5	-	7	1190	c.898G>T	c.(898-900)Gag>Tag	p.E300*	CGREF1_ENST00000404694.3_Nonsense_Mutation_p.E439*|CGREF1_ENST00000452318.2_Intron|CGREF1_ENST00000402550.1_Intron|CGREF1_ENST00000405600.1_Nonsense_Mutation_p.E317*|CGREF1_ENST00000312734.4_Nonsense_Mutation_p.E317*|CGREF1_ENST00000402394.1_Nonsense_Mutation_p.E317*			Q99674	CGRE1_HUMAN	cell growth regulator with EF-hand domain 1	300					cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			kidney(1)|lung(4)|ovary(1)|prostate(2)|skin(1)|soft_tissue(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATCTAGATCTCATCATTCTCC	0.493																																																	0													142.0	137.0	139.0					2																	27324150		2203	4300	6503	SO:0001587	stop_gained	0			BC034764	CCDS33162.1, CCDS33162.2, CCDS54339.1	2p23.3	2013-01-10			ENSG00000138028	ENSG00000138028		"""EF-hand domain containing"""	16962	protein-coding gene	gene with protein product		606137				8968090	Standard	NM_006569		Approved	CGR11	uc002riq.3	Q99674	OTTHUMG00000152009	ENST00000260595.5:c.898G>T	2.37:g.27324150C>A	ENSP00000260595:p.Glu300*		A6NHV7|B4DXY8|B5MCB7|B5MCC9|B5MCP5|E7EU99|Q8N4B7	Nonsense_Mutation	SNP	pfscan_EF_hand_dom	p.E317*	ENST00000260595.5	37	c.949		2	.	.	.	.	.	.	.	.	.	.	C	14.43	2.532999	0.45073	.	.	ENSG00000138028	ENST00000402394;ENST00000405600;ENST00000389521;ENST00000312734;ENST00000404694;ENST00000260595	.	.	.	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.28624	N	0.908022	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-21.1409	15.5838	0.76465	0.0:1.0:0.0:0.0	.	.	.	.	X	317;317;300;317;439;300	.	ENSP00000260595:E300X	E	-	1	0	CGREF1	27177654	0.995000	0.38212	0.999000	0.59377	0.201000	0.24016	3.526000	0.53509	2.551000	0.86045	0.561000	0.74099	GAG	CGREF1	-	NULL	ENSG00000138028		0.493	CGREF1-201	KNOWN	basic	protein_coding	CGREF1	HGNC	protein_coding		-	0.00	58	0	C	NM_006569		27324150	-1	tier1	-	no_errors	ENST00000312734	ensembl	human	known	74_37	nonsense	24.19	47	15	SNP	1.000	A
CHL1	10752	genome.wustl.edu	37	3	401982	401982	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr3:401982G>A	ENST00000256509.2	+	12	1823	c.1181G>A	c.(1180-1182)gGt>gAt	p.G394D	CHL1_ENST00000397491.2_Missense_Mutation_p.G378D	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		CCATTTGCTGGTGATGTTGTC	0.368																																																	0													144.0	139.0	140.0					3																	401982		2203	4300	6503	SO:0001583	missense	0			AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.1181G>A	3.37:g.401982G>A	ENSP00000256509:p.Gly394Asp		Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.G394D	ENST00000256509.2	37	c.1181	CCDS2556.1	3	.	.	.	.	.	.	.	.	.	.	G	12.19	1.863826	0.32884	.	.	ENSG00000134121	ENST00000256509;ENST00000397491	T;T	0.66995	-0.24;-0.24	5.16	3.34	0.38264	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.235594	0.44285	D	0.000466	T	0.56077	0.1961	L	0.41906	1.305	0.21256	N	0.999741	B;B;B	0.25486	0.056;0.0;0.127	B;B;B	0.33295	0.161;0.002;0.139	T	0.42498	-0.9448	10	0.18276	T	0.48	.	9.9623	0.41704	0.0:0.1492:0.6959:0.1549	.	378;378;394	B3KX75;O00533;O00533-2	.;CHL1_HUMAN;.	D	394;378	ENSP00000256509:G394D;ENSP00000380628:G378D	ENSP00000256509:G394D	G	+	2	0	CHL1	376982	0.938000	0.31826	0.155000	0.22561	0.915000	0.54546	2.783000	0.47766	0.651000	0.30788	0.655000	0.94253	GGT	CHL1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000134121		0.368	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHL1	HGNC	protein_coding	OTTHUMT00000207155.2	-	0.00	58	0	G	NM_006614		401982	+1	tier1	-	no_errors	ENST00000256509	ensembl	human	known	74_37	missense	6.56	57	4	SNP	0.186	A
CHST11	50515	genome.wustl.edu	37	12	104995745	104995745	+	Silent	SNP	G	G	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr12:104995745G>T	ENST00000303694.5	+	2	619	c.180G>T	c.(178-180)ctG>ctT	p.L60L	CHST11_ENST00000546689.1_Silent_p.L55L|CHST11_ENST00000547956.1_Silent_p.L60L|CHST11_ENST00000549260.1_Silent_p.L55L	NM_018413.5	NP_060883.1	Q9NPF2	CHSTB_HUMAN	carbohydrate (chondroitin 4) sulfotransferase 11	60					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondrocyte development (GO:0002063)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|developmental growth (GO:0048589)|embryonic digit morphogenesis (GO:0042733)|embryonic viscerocranium morphogenesis (GO:0048703)|glycosaminoglycan metabolic process (GO:0030203)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|polysaccharide localization (GO:0033037)|post-anal tail morphogenesis (GO:0036342)|post-embryonic development (GO:0009791)|regulation of cell proliferation (GO:0042127)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	chondroitin 4-sulfotransferase activity (GO:0047756)|N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)|N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase activity (GO:0050659)			breast(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(1)	18						GAAGCCCCCTGCAGGAACTCT	0.458																																																	0													79.0	77.0	77.0					12																	104995745		2203	4300	6503	SO:0001819	synonymous_variant	0			AB042326	CCDS9099.1, CCDS55878.1	12q23.3	2008-02-05				ENSG00000171310	2.8.2.5	"""Sulfotransferases, membrane-bound"""	17422	protein-coding gene	gene with protein product		610128				10781601	Standard	NM_018413		Approved	C4ST1, C4St-1, C4ST, HSA269537	uc001tkz.3	Q9NPF2	OTTHUMG00000169803	ENST00000303694.5:c.180G>T	12.37:g.104995745G>T			A8K4F8|Q9NXY6|Q9NY36	Silent	SNP	pfam_Sulfotransferase	p.L60	ENST00000303694.5	37	c.180	CCDS9099.1	12																																																																																			CHST11	-	NULL	ENSG00000171310		0.458	CHST11-001	KNOWN	basic|CCDS	protein_coding	CHST11	HGNC	protein_coding	OTTHUMT00000405960.2	-	0.00	44	0	G	NM_018413		104995745	+1	tier1	-	no_errors	ENST00000303694	ensembl	human	known	74_37	silent	34.04	31	16	SNP	1.000	T
CIC	23152	genome.wustl.edu	37	19	42796614	42796614	+	Silent	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr19:42796614C>T	ENST00000575354.2	+	13	3211	c.3171C>T	c.(3169-3171)ctC>ctT	p.L1057L	CIC_ENST00000572681.2_Silent_p.L1966L|CIC_ENST00000160740.3_Silent_p.L1057L	NM_015125.3	NP_055940.3	Q96RK0	CIC_HUMAN	capicua transcriptional repressor	1057	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(5)|central_nervous_system(32)|endometrium(10)|kidney(2)|large_intestine(7)|lung(9)|ovary(7)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	82		Prostate(69;0.00682)				AGCCCCTGCTCTCAGGTGAGG	0.667			"""Mis, F, S"""		oligodendroglioma																																			Rec	yes		19	19q13.2	23152	capicua homolog		O	0													19.0	22.0	21.0					19																	42796614		2195	4280	6475	SO:0001819	synonymous_variant	0			AB002304	CCDS12601.1	19q13.2	2013-03-15	2013-03-15		ENSG00000079432	ENSG00000079432			14214	protein-coding gene	gene with protein product		612082	"""capicua (Drosophila) homolog"", ""capicua homolog (Drosophila)"""			12393275, 15981098	Standard	NM_015125		Approved	KIAA0306	uc002otf.1	Q96RK0		ENST00000575354.2:c.3171C>T	19.37:g.42796614C>T			Q7LGI1|Q9UEG5|Q9Y6T1	Silent	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.L1057	ENST00000575354.2	37	c.3171	CCDS12601.1	19																																																																																			CIC	-	NULL	ENSG00000079432		0.667	CIC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CIC	HGNC	protein_coding	OTTHUMT00000438532.2	-	0.00	18	0	C			42796614	+1	tier1	-	no_errors	ENST00000575354	ensembl	human	known	74_37	silent	26.09	17	6	SNP	1.000	T
COG2	22796	genome.wustl.edu	37	1	230798959	230798959	+	Frame_Shift_Del	DEL	A	A	-	rs141422644	byFrequency	TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr1:230798959delA	ENST00000366669.4	+	4	488	c.373delA	c.(373-375)aaafs	p.K127fs	COG2_ENST00000534989.1_Frame_Shift_Del_p.K68fs|COG2_ENST00000535166.1_Frame_Shift_Del_p.K11fs|COG2_ENST00000366668.3_Frame_Shift_Del_p.K127fs	NM_001145036.1|NM_007357.2	NP_001138508.1|NP_031383.1	Q14746	COG2_HUMAN	component of oligomeric golgi complex 2	127					Golgi organization (GO:0007030)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)	cytosol (GO:0005829)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|Golgi transport complex (GO:0017119)	protein transporter activity (GO:0008565)			NS(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(11)|prostate(2)|skin(2)|urinary_tract(3)	27	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)				GGACATTAGGAAAAAAAAGGT	0.348																																																	0																																										SO:0001589	frameshift_variant	0			Z34975	CCDS1584.1, CCDS44329.1	1q42.2	2008-02-05	2002-05-28	2002-05-31	ENSG00000135775	ENSG00000135775		"""Components of oligomeric golgi complex"""	6546	protein-coding gene	gene with protein product		606974	"""low density lipoprotein receptor defect C complementing"""	LDLC		7962052	Standard	NM_007357		Approved		uc001htw.3	Q14746	OTTHUMG00000037753	ENST00000366669.4:c.373delA	1.37:g.230798959delA	ENSP00000355629:p.Lys127fs		Q86U99	Frame_Shift_Del	DEL	pfam_COG_complex_COG2_C,pfam_COG_su2_N	p.K127fs	ENST00000366669.4	37	c.373	CCDS1584.1	1																																																																																			COG2	-	pfam_COG_su2_N	ENSG00000135775		0.348	COG2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COG2	HGNC	protein_coding	OTTHUMT00000092087.1		0.00	40	0	A	NM_007357		230798959	+1	tier1		no_errors	ENST00000366669	ensembl	human	known	74_37	frame_shift_del	5.88	32	2	DEL	0.935	-
COL11A2	1302	genome.wustl.edu	37	6	33147584	33147584	+	Splice_Site	SNP	T	T	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr6:33147584T>C	ENST00000374708.4	-	11	1360		c.e11-2		COL11A2_ENST00000374713.1_Splice_Site|COL11A2_ENST00000374714.1_Splice_Site|COL11A2_ENST00000341947.2_Splice_Site|COL11A2_ENST00000361917.1_Splice_Site|COL11A2_ENST00000395197.1_Splice_Site|COL11A2_ENST00000374712.1_Splice_Site|COL11A2_ENST00000357486.1_Splice_Site|COL11A2_ENST00000477772.1_5'Flank	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2						cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						AAACCGGAACTGAGGTCAAGG	0.637																																					Melanoma(1;90 116 3946 5341 17093)												0													46.0	54.0	51.0					6																	33147584		2203	4300	6503	SO:0001630	splice_region_variant	0			U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.1102-2A>G	6.37:g.33147584T>C			A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Splice_Site	SNP	-	e13-2	ENST00000374708.4	37	c.1360-2	CCDS43452.1	6	.	.	.	.	.	.	.	.	.	.	t	16.10	3.028643	0.54790	.	.	ENSG00000204248	ENST00000374708;ENST00000341947;ENST00000357486;ENST00000374714;ENST00000374713;ENST00000395197;ENST00000374712;ENST00000361917;ENST00000457788	.	.	.	4.37	4.37	0.52481	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.8872	0.41268	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	COL11A2	33255562	1.000000	0.71417	0.975000	0.42487	0.810000	0.45777	3.870000	0.56070	1.842000	0.53543	0.444000	0.29173	.	COL11A2	-	-	ENSG00000204248		0.637	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	COL11A2	HGNC	protein_coding	OTTHUMT00000076032.2	-	0.00	50	0	T		Intron	33147584	-1	tier1	-	no_errors	ENST00000341947	ensembl	human	known	74_37	splice_site	27.66	34	13	SNP	0.998	C
COL6A5	256076	genome.wustl.edu	37	3	130098549	130098549	+	Missense_Mutation	SNP	A	A	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr3:130098549A>C	ENST00000432398.2	+	4	1450	c.956A>C	c.(955-957)gAt>gCt	p.D319A	COL6A5_ENST00000265379.6_Missense_Mutation_p.D319A	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	319	Nonhelical region.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						GCTGCCATTGATCAGATGAGA	0.438																																																	0													72.0	62.0	65.0					3																	130098549		692	1591	2283	SO:0001583	missense	0			AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.956A>C	3.37:g.130098549A>C	ENSP00000390895:p.Asp319Ala		A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.D319A	ENST00000432398.2	37	c.956		3	.	.	.	.	.	.	.	.	.	.	A	5.930	0.355703	0.11239	.	.	ENSG00000172752	ENST00000432398;ENST00000265379	D;D	0.82984	-1.67;-1.67	4.92	4.92	0.64577	.	.	.	.	.	T	0.82199	0.4985	M	0.70595	2.14	0.24000	N	0.996217	B	0.15930	0.015	B	0.22152	0.038	T	0.70215	-0.4933	9	0.27785	T	0.31	.	13.5533	0.61745	1.0:0.0:0.0:0.0	.	319	A8TX70-2	.	A	319	ENSP00000390895:D319A;ENSP00000265379:D319A	ENSP00000265379:D319A	D	+	2	0	COL6A5	131581239	0.339000	0.24784	0.889000	0.34880	0.167000	0.22549	4.828000	0.62730	1.852000	0.53769	0.374000	0.22700	GAT	COL6A5	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000172752		0.438	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	COL6A5	HGNC	protein_coding		-	0.00	35	0	A	NM_153264		130098549	+1	tier1	-	no_errors	ENST00000265379	ensembl	human	known	74_37	missense	18.18	36	8	SNP	0.819	C
CPZ	8532	genome.wustl.edu	37	4	8602970	8602970	+	Missense_Mutation	SNP	T	T	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr4:8602970T>G	ENST00000360986.4	+	3	416	c.242T>G	c.(241-243)cTg>cGg	p.L81R	CPZ_ENST00000429646.2_5'Flank|CPZ_ENST00000506287.1_3'UTR|CPZ_ENST00000382480.2_5'UTR|CPZ_ENST00000315782.6_Missense_Mutation_p.L70R	NM_001014447.2	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z	81	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				proteolysis (GO:0006508)|Wnt signaling pathway (GO:0016055)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(23)|ovary(3)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						GAGTACATCCTGCTGAGCGTT	0.657																																																	0													68.0	59.0	62.0					4																	8602970		2203	4300	6503	SO:0001583	missense	0			U83411	CCDS3404.1, CCDS33953.1, CCDS43212.1	4p16.1	2012-02-10			ENSG00000109625	ENSG00000109625			2333	protein-coding gene	gene with protein product	"""metallocarboxypeptidase Z"""	603105				9099699	Standard	NM_001014447		Approved		uc003glm.3	Q66K79	OTTHUMG00000090513	ENST00000360986.4:c.242T>G	4.37:g.8602970T>G	ENSP00000354255:p.Leu81Arg		O00520|Q96MX2	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_Frizzled_dom,superfamily_Frizzled_dom,superfamily_CarboxyPept-like_regulatory,smart_Frizzled_dom,smart_Peptidase_M14,prints_Peptidase_M14,pfscan_Frizzled_dom	p.L81R	ENST00000360986.4	37	c.242	CCDS33953.1	4	.	.	.	.	.	.	.	.	.	.	T	20.9	4.068932	0.76301	.	.	ENSG00000109625	ENST00000360986;ENST00000315782	T;T	0.80033	-1.33;-1.33	3.59	3.59	0.41128	Frizzled domain (5);	0.000000	0.64402	D	0.000003	D	0.87752	0.6256	M	0.72576	2.205	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.88870	0.3332	10	0.87932	D	0	-20.4707	12.344	0.55109	0.0:0.0:0.0:1.0	.	70;81	Q66K79-2;Q66K79	.;CBPZ_HUMAN	R	81;70	ENSP00000354255:L81R;ENSP00000315074:L70R	ENSP00000315074:L70R	L	+	2	0	CPZ	8653870	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	7.001000	0.76297	1.477000	0.48234	0.459000	0.35465	CTG	CPZ	-	pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom	ENSG00000109625		0.657	CPZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CPZ	HGNC	protein_coding	OTTHUMT00000207001.4	-	0.00	125	0	T	NM_003652		8602970	+1	tier1	-	no_errors	ENST00000360986	ensembl	human	known	74_37	missense	39.05	64	41	SNP	1.000	G
CROCCP2	84809	genome.wustl.edu	37	1	16945182	16945184	+	lincRNA	DEL	AAT	AAT	-	rs374889577|rs71803374	byFrequency	TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	AAT	AAT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr1:16945182_16945184delAAT	ENST00000412962.1	-	0	2335_2337				RP5-1182A14.5_ENST00000607700.1_lincRNA			Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											TACTGATGAAAATAATAACAGAT	0.325														915	0.182708	0.1906	0.2853	5008	,	,		89095	0.0278		0.2157	False		,,,				2504	0.2249																0																																												0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16945185_16945187delAAT			Q8NF65|Q96FR5|Q9BRE8	RNA	DEL	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-	ENSG00000215908		0.325	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1		0.00	9	0	AAT	NR_026752.1		16945184	-1	tier1		no_errors	ENST00000412962	ensembl	human	known	74_37	rna	37.50	5	3	DEL	0.016:0.018:0.018	-
CUX2	23316	genome.wustl.edu	37	12	111748077	111748077	+	Silent	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr12:111748077C>T	ENST00000261726.6	+	15	1645	c.1491C>T	c.(1489-1491)ttC>ttT	p.F497F		NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	497	Pro-rich.				cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						CAGCCGCCTTCAAGGGAGAGG	0.706																																																	0													9.0	10.0	10.0					12																	111748077		1856	4056	5912	SO:0001819	synonymous_variant	0			AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.1491C>T	12.37:g.111748077C>T			A7E2Y4	Silent	SNP	pfam_Hmoeo_CUT,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,superfamily_Prefoldin,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Hmoeo_CUT	p.F497	ENST00000261726.6	37	c.1491	CCDS41837.1	12																																																																																			CUX2	-	NULL	ENSG00000111249		0.706	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUX2	HGNC	protein_coding	OTTHUMT00000404765.1	-	0.00	13	0	C	NM_015267		111748077	+1	tier1	-	no_errors	ENST00000261726	ensembl	human	known	74_37	silent	70.59	5	12	SNP	1.000	T
CYTH2	9266	genome.wustl.edu	37	19	48976633	48976633	+	Silent	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr19:48976633C>T	ENST00000452733.2	+	5	908	c.432C>T	c.(430-432)ctC>ctT	p.L144L	CYTH2_ENST00000427476.1_Silent_p.L144L			Q99418	CYH2_HUMAN	cytohesin 2	144	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				actin cytoskeleton organization (GO:0030036)|endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|regulation of cell adhesion (GO:0030155)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|inositol 1,4,5 trisphosphate binding (GO:0070679)|lipid binding (GO:0008289)			endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15						TGCAGGCCCTCAGGTGAGTGA	0.502																																																	0													84.0	72.0	76.0					19																	48976633		2203	4300	6503	SO:0001819	synonymous_variant	0			X99753	CCDS12722.1	19q13.32	2014-05-02	2008-08-14	2008-08-14	ENSG00000105443	ENSG00000105443		"""Pleckstrin homology (PH) domain containing"""	9502	protein-coding gene	gene with protein product		602488	"""pleckstrin homology, Sec7 and coiled/coil domains 2 (cytohesin-2)"", ""pleckstrin homology, Sec7 and coiled-coil domains 2"""	PSCD2L, PSCD2		8706128, 8945478, 20525696	Standard	NM_004228		Approved	CTS18.1, Sec7p-L, ARNO, Sec7p-like, cytohesin-2	uc002pjj.4	Q99418	OTTHUMG00000150245	ENST00000452733.2:c.432C>T	19.37:g.48976633C>T			A8K8P0|Q8IXY9|Q92958	Silent	SNP	pfam_Sec7_dom,pfam_Pleckstrin_homology,superfamily_Sec7_dom,smart_Sec7_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7_dom	p.L144	ENST00000452733.2	37	c.432	CCDS12722.1	19																																																																																			CYTH2	-	pfam_Sec7_dom,superfamily_Sec7_dom,smart_Sec7_dom,pfscan_Sec7_dom	ENSG00000105443		0.502	CYTH2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CYTH2	HGNC	protein_coding	OTTHUMT00000317060.1	-	0.00	57	0	C	NM_004228		48976633	+1	tier1	-	no_errors	ENST00000427476	ensembl	human	known	74_37	silent	27.91	31	12	SNP	1.000	T
DEFB107B	503614	genome.wustl.edu	37	8	7366735	7366735	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr8:7366735A>G	ENST00000355602.2	+	2	291	c.203A>G	c.(202-204)aAg>aGg	p.K68R		NM_001040705.1	NP_001035795.1	Q8IZN7	D107A_HUMAN	defensin, beta 107B	68					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)									COAD - Colon adenocarcinoma(149;0.0162)|READ - Rectum adenocarcinoma(644;0.236)		AAAAACAGAAAGAAACATTAA	0.418																																																	0													1.0	1.0	1.0					8																	7366735		102	502	604	SO:0001583	missense	0				CCDS43696.1	8p23.1	2011-03-29			ENSG00000198129	ENSG00000198129		"""Defensins, beta"""	31918	protein-coding gene	gene with protein product							Standard	NM_001040705		Approved	HsT21816	uc003wrs.1	Q8IZN7	OTTHUMG00000149987	ENST00000355602.2:c.203A>G	8.37:g.7366735A>G	ENSP00000347810:p.Lys68Arg		B2RPM1|Q30E75|Q8NET2	Missense_Mutation	SNP	NULL	p.K68R	ENST00000355602.2	37	c.203	CCDS43696.1	8	.	.	.	.	.	.	.	.	.	.	.	6.332	0.429311	0.11987	.	.	ENSG00000198129	ENST00000355602	.	.	.	1.19	-2.39	0.06602	.	.	.	.	.	T	0.22820	0.0551	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.18209	-1.0344	7	0.44086	T	0.13	1.4825	1.5428	0.02559	0.469:0.0:0.2284:0.3026	.	68	Q8IZN7	D107A_HUMAN	R	68	.	ENSP00000347810:K68R	K	+	2	0	DEFB107B	7354145	0.000000	0.05858	0.000000	0.03702	0.118000	0.20060	-1.416000	0.02467	-0.656000	0.05380	0.234000	0.17832	AAG	DEFB107B	-	NULL	ENSG00000198129		0.418	DEFB107B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB107B	HGNC	protein_coding	OTTHUMT00000315231.1	-	0.00	19	0	A			7366735	+1	tier1	-	no_errors	ENST00000355602	ensembl	human	known	74_37	missense	37.50	5	3	SNP	0.000	G
DEFB108B	245911	genome.wustl.edu	37	11	71544281	71544281	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr11:71544281C>G	ENST00000328698.1	+	1	36	c.36C>G	c.(34-36)ttC>ttG	p.F12L		NM_001002035.1	NP_001002035.1	Q8NET1	D108B_HUMAN	defensin, beta 108B	12					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				endometrium(1)|kidney(1)|lung(2)|skin(1)	5						CCATTTTCTTCTTTATGAGCC	0.413																																																	0													17.0	16.0	16.0					11																	71544281		2155	4232	6387	SO:0001583	missense	0			AF529416	CCDS31631.1	11q13.4	2011-03-29			ENSG00000184276	ENSG00000184276		"""Defensins, beta"""	29966	protein-coding gene	gene with protein product							Standard	NM_001002035		Approved		uc010rqr.2	Q8NET1	OTTHUMG00000167533	ENST00000328698.1:c.36C>G	11.37:g.71544281C>G	ENSP00000333234:p.Phe12Leu			Missense_Mutation	SNP	NULL	p.F12L	ENST00000328698.1	37	c.36	CCDS31631.1	11	.	.	.	.	.	.	.	.	.	.	.	11.47	1.649574	0.29336	.	.	ENSG00000184276	ENST00000328698	T	0.11821	2.74	1.33	0.346	0.16017	.	.	.	.	.	T	0.17831	0.0428	.	.	.	0.09310	N	0.999998	P	0.46578	0.88	P	0.50270	0.636	T	0.13495	-1.0507	8	0.87932	D	0	.	5.3799	0.16186	0.0:0.6384:0.3616:0.0	.	12	Q8NET1	D108B_HUMAN	L	12	ENSP00000333234:F12L	ENSP00000333234:F12L	F	+	3	2	DEFB108B	71221929	0.255000	0.24002	0.384000	0.26145	0.627000	0.37826	0.696000	0.25541	0.133000	0.18654	0.486000	0.48141	TTC	DEFB108B	-	NULL	ENSG00000184276		0.413	DEFB108B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB108B	HGNC	protein_coding	OTTHUMT00000394945.1	-	0.00	61	0	C	NM_001002035		71544281	+1	tier1	-	no_errors	ENST00000328698	ensembl	human	known	74_37	missense	33.33	30	15	SNP	0.484	G
DEFB113	245927	genome.wustl.edu	37	6	49937287	49937287	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr6:49937287G>T	ENST00000398718.1	-	1	51	c.52C>A	c.(52-54)Cca>Aca	p.P18T		NM_001037729.1	NP_001032818.1	Q30KQ7	DB113_HUMAN	defensin, beta 113	18					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)	7	Lung NSC(77;0.042)					TTACCTGATGGACCACAAGAC	0.303																																																	0													94.0	92.0	93.0					6																	49937287		1829	4081	5910	SO:0001583	missense	0			DQ012017	CCDS43472.1	6p12.3	2010-03-30			ENSG00000214642	ENSG00000214642		"""Defensins, beta"""	18094	protein-coding gene	gene with protein product						11854508, 16033865	Standard	NM_001037729		Approved	DEFB-13	uc011dwq.2	Q30KQ7	OTTHUMG00000160210	ENST00000398718.1:c.52C>A	6.37:g.49937287G>T	ENSP00000381703:p.Pro18Thr			Missense_Mutation	SNP	NULL	p.P18T	ENST00000398718.1	37	c.52	CCDS43472.1	6	.	.	.	.	.	.	.	.	.	.	G	17.30	3.354364	0.61293	.	.	ENSG00000214642	ENST00000398718	.	.	.	3.96	3.96	0.45880	.	.	.	.	.	T	0.68393	0.2996	.	.	.	0.80722	D	1	D	0.76494	0.999	D	0.67103	0.949	T	0.69650	-0.5088	6	.	.	.	-12.9235	11.7095	0.51616	0.0:0.0:1.0:0.0	.	18	Q30KQ7	DB113_HUMAN	T	18	.	.	P	-	1	0	DEFB113	50045246	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.653000	0.54446	2.214000	0.71695	0.591000	0.81541	CCA	DEFB113	-	NULL	ENSG00000214642		0.303	DEFB113-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB113	HGNC	protein_coding	OTTHUMT00000359666.1		0.00	49	0	G			49937287	-1			no_errors	ENST00000398718	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	T
DEFB123	245936	genome.wustl.edu	37	20	30037842	30037842	+	Silent	SNP	A	A	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr20:30037842A>G	ENST00000376309.3	+	2	249	c.69A>G	c.(67-69)caA>caG	p.Q23Q		NM_153324.2	NP_697019.1	Q8N688	DB123_HUMAN	defensin, beta 123	23					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				kidney(1)|lung(2)	3	Lung NSC(7;0.000139)|all_lung(7;0.000197)|all_hematologic(12;0.158)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			GTGGCACCCAAAGATGCTGGA	0.423																																																	0													151.0	150.0	150.0					20																	30037842		2203	4300	6503	SO:0001819	synonymous_variant	0			AA933749	CCDS13180.1	20q11.1	2008-07-17			ENSG00000180424	ENSG00000180424		"""Defensins, beta"""	18103	protein-coding gene	gene with protein product	"""beta defensin 23"""					11854508	Standard	NM_153324		Approved	DEFB-23	uc002wvy.3	Q8N688	OTTHUMG00000032170	ENST00000376309.3:c.69A>G	20.37:g.30037842A>G				Silent	SNP	NULL	p.Q23	ENST00000376309.3	37	c.69	CCDS13180.1	20																																																																																			DEFB123	-	NULL	ENSG00000180424		0.423	DEFB123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB123	HGNC	protein_coding	OTTHUMT00000078510.2	-	0.00	51	0	A	NM_153324		30037842	+1	tier1	-	no_errors	ENST00000376309	ensembl	human	known	74_37	silent	27.27	48	18	SNP	0.278	G
DNAH3	55567	genome.wustl.edu	37	16	21152626	21152626	+	Silent	SNP	G	G	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr16:21152626G>T	ENST00000261383.3	-	4	515	c.516C>A	c.(514-516)tcC>tcA	p.S172S	DNAH3_ENST00000415178.1_Silent_p.S172S|DNAH3_ENST00000575491.1_5'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	172	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		CTTACCTAGTGGAATCCTCTT	0.463																																																	0													131.0	96.0	108.0					16																	21152626		2199	4300	6499	SO:0001819	synonymous_variant	0			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.516C>A	16.37:g.21152626G>T			O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_AAA+_ATPase	p.S172	ENST00000261383.3	37	c.516	CCDS10594.1	16																																																																																			DNAH3	-	NULL	ENSG00000158486		0.463	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	HGNC	protein_coding	OTTHUMT00000207361.1	-	0.00	74	0	G	NM_017539		21152626	-1	tier1	-	no_errors	ENST00000261383	ensembl	human	known	74_37	silent	7.14	52	4	SNP	0.000	T
DNAH9	1770	genome.wustl.edu	37	17	11659960	11659960	+	Missense_Mutation	SNP	C	C	G	rs139421775		TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr17:11659960C>G	ENST00000262442.4	+	34	6882	c.6814C>G	c.(6814-6816)Cgc>Ggc	p.R2272G	DNAH9_ENST00000454412.2_Missense_Mutation_p.R2272G	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	2272	AAA 2. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CAGCCACCTGCGCACAGCCAC	0.552																																																	0													110.0	106.0	108.0					17																	11659960		2203	4300	6503	SO:0001583	missense	0			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.6814C>G	17.37:g.11659960C>G	ENSP00000262442:p.Arg2272Gly		A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.R2272G	ENST00000262442.4	37	c.6814	CCDS11160.1	17	.	.	.	.	.	.	.	.	.	.	C	17.68	3.448563	0.63178	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.26373	1.74;1.74	5.89	4.92	0.64577	ATPase, AAA+ type, core (1);	0.321785	0.34338	N	0.004059	T	0.50274	0.1606	M	0.81942	2.565	0.80722	D	1	P	0.46220	0.874	P	0.58721	0.844	T	0.55805	-0.8083	10	0.66056	D	0.02	.	14.9471	0.71042	0.0:0.9318:0.0:0.0682	.	2272	Q9NYC9	DYH9_HUMAN	G	2272;2272;854	ENSP00000262442:R2272G;ENSP00000414874:R2272G	ENSP00000262442:R2272G	R	+	1	0	DNAH9	11600685	0.437000	0.25593	1.000000	0.80357	0.991000	0.79684	0.675000	0.25232	1.503000	0.48686	-0.225000	0.12378	CGC	DNAH9	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase	ENSG00000007174		0.552	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH9	HGNC	protein_coding	OTTHUMT00000252756.2	-	0.00	48	0	C	NM_001372		11659960	+1	tier1	-	no_errors	ENST00000262442	ensembl	human	known	74_37	missense	64.15	19	34	SNP	1.000	G
DST	667	genome.wustl.edu	37	6	56472397	56472397	+	Silent	SNP	G	G	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr6:56472397G>C	ENST00000361203.3	-	36	6403	c.6396C>G	c.(6394-6396)ctC>ctG	p.L2132L	DST_ENST00000244364.6_Intron|DST_ENST00000446842.2_Silent_p.L1806L|DST_ENST00000370769.4_Silent_p.L2132L|DST_ENST00000312431.6_Silent_p.L2132L|DST_ENST00000370754.5_Silent_p.L2310L|DST_ENST00000421834.2_Intron|DST_ENST00000370788.2_Intron			Q03001	DYST_HUMAN	dystonin	2132					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AATATGATATGAGACTGGGAA	0.363																																																	0													75.0	67.0	70.0					6																	56472397		1880	4123	6003	SO:0001819	synonymous_variant	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.6396C>G	6.37:g.56472397G>C			B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Silent	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.L2310	ENST00000361203.3	37	c.6930		6																																																																																			DST	-	superfamily_ABC1_TM_dom	ENSG00000151914		0.363	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	-	0.00	57	0	G	NM_001723		56472397	-1	tier1	-	no_errors	ENST00000370754	ensembl	human	known	74_37	silent	38.89	33	21	SNP	0.000	C
DZIP1L	199221	genome.wustl.edu	37	3	137822805	137822805	+	Silent	SNP	G	G	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr3:137822805G>C	ENST00000327532.2	-	2	371	c.9C>G	c.(7-9)tcC>tcG	p.S3S	DZIP1L_ENST00000469243.1_Silent_p.S3S	NM_173543.2	NP_775814.2	Q8IYY4	DZI1L_HUMAN	DAZ interacting zinc finger protein 1-like	3					cilium assembly (GO:0042384)	ciliary basal body (GO:0036064)	metal ion binding (GO:0046872)			breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|pancreas(2)|prostate(1)|skin(1)	35						TGGCAGCTGGGGACTGCATGG	0.612																																																	0													38.0	44.0	42.0					3																	137822805		2194	4291	6485	SO:0001819	synonymous_variant	0			AK057406	CCDS3096.1, CCDS54645.1	3q22.3	2013-05-22	2013-05-22		ENSG00000158163	ENSG00000158163			26551	protein-coding gene	gene with protein product			"""DAZ interacting protein 1-like"""			12477932	Standard	NM_173543		Approved	FLJ32844, DZIP2	uc003erq.3	Q8IYY4	OTTHUMG00000159819	ENST00000327532.2:c.9C>G	3.37:g.137822805G>C			C9JUG5|Q96M38	Silent	SNP	pfscan_Znf_C2H2	p.S3	ENST00000327532.2	37	c.9	CCDS3096.1	3																																																																																			DZIP1L	-	NULL	ENSG00000158163		0.612	DZIP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DZIP1L	HGNC	protein_coding	OTTHUMT00000357548.1	-	0.00	44	0	G	NM_173543		137822805	-1	tier1	-	no_errors	ENST00000327532	ensembl	human	known	74_37	silent	18.84	55	13	SNP	0.000	C
EEA1	8411	genome.wustl.edu	37	12	93169819	93169819	+	Missense_Mutation	SNP	A	A	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr12:93169819A>C	ENST00000322349.8	-	29	4468	c.4204T>G	c.(4204-4206)Tgt>Ggt	p.C1402G		NM_003566.3	NP_003557	Q15075	EEA1_HUMAN	early endosome antigen 1	1402					early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|synaptic vesicle to endosome fusion (GO:0016189)|vesicle fusion (GO:0006906)	axonal spine (GO:0044308)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|recycling endosome (GO:0055037)|serine-pyruvate aminotransferase complex (GO:0005969)	1-phosphatidylinositol binding (GO:0005545)|calmodulin binding (GO:0005516)|GTP-dependent protein binding (GO:0030742)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(11)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	36						CATGCATCACAGACACGAACA	0.373																																																	0													102.0	95.0	98.0					12																	93169819		2203	4299	6502	SO:0001583	missense	0			L40157	CCDS31874.1	12q22	2007-02-23	2007-02-23			ENSG00000102189		"""Zinc fingers, FYVE domain containing"""	3185	protein-coding gene	gene with protein product		605070	"""early endosome antigen 1, 162kD"""			7768953, 9697774	Standard	NM_003566		Approved	ZFYVE2	uc001tck.3	Q15075	OTTHUMG00000170110	ENST00000322349.8:c.4204T>G	12.37:g.93169819A>C	ENSP00000317955:p.Cys1402Gly		Q14221	Missense_Mutation	SNP	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel,pfscan_Znf_C2H2	p.C1402G	ENST00000322349.8	37	c.4204	CCDS31874.1	12	.	.	.	.	.	.	.	.	.	.	A	20.0	3.930598	0.73327	.	.	ENSG00000102189	ENST00000322349	D	0.99836	-7.05	5.51	5.51	0.81932	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, FYVE-type (2);Zinc finger, FYVE-related (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.64402	D	0.000016	D	0.99910	0.9957	H	0.99211	4.47	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95970	0.8969	10	0.87932	D	0	.	15.6104	0.76713	1.0:0.0:0.0:0.0	.	1402	Q15075	EEA1_HUMAN	G	1402	ENSP00000317955:C1402G	ENSP00000317955:C1402G	C	-	1	0	EEA1	91693950	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	9.300000	0.96151	2.082000	0.62665	0.460000	0.39030	TGT	EEA1	-	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	ENSG00000102189		0.373	EEA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEA1	HGNC	protein_coding	OTTHUMT00000407304.1	-	0.00	31	0	A	NM_003566		93169819	-1	tier1	-	no_errors	ENST00000322349	ensembl	human	known	74_37	missense	25.93	40	14	SNP	1.000	C
EHD1	10938	genome.wustl.edu	37	11	64622896	64622896	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr11:64622896G>C	ENST00000320631.3	-	4	1232	c.978C>G	c.(976-978)agC>agG	p.S326R	EHD1_ENST00000488711.1_5'Flank|EHD1_ENST00000359393.2_Missense_Mutation_p.S326R	NM_001282445.1|NM_006795.2	NP_001269374.1|NP_006786.2	Q9H4M9	EHD1_HUMAN	EH-domain containing 1	326					blood coagulation (GO:0007596)|cellular response to nerve growth factor stimulus (GO:1990090)|cholesterol homeostasis (GO:0042632)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|low-density lipoprotein particle clearance (GO:0034383)|neuron projection development (GO:0031175)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of myoblast fusion (GO:1901741)|protein homooligomerization (GO:0051260)	early endosome membrane (GO:0031901)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lipid particle (GO:0005811)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	12						CTTTCTTTTTGCTCTCTTTAC	0.547											OREG0004024	type=REGULATORY REGION|Gene=EHD1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0													156.0	143.0	147.0					11																	64622896		2201	4297	6498	SO:0001583	missense	0			AF099011	CCDS8084.1, CCDS73315.1	11q13	2013-01-10			ENSG00000110047	ENSG00000110047		"""EF-hand domain containing"""	3242	protein-coding gene	gene with protein product	"""testilin"""	605888		PAST1		10395801, 10673336	Standard	NM_001282444		Approved	H-PAST, HPAST1, FLJ42622, FLJ44618	uc001obu.1	Q9H4M9	OTTHUMG00000066832	ENST00000320631.3:c.978C>G	11.37:g.64622896G>C	ENSP00000320516:p.Ser326Arg	1078	O14611|Q2M3Q4|Q9UNR3	Missense_Mutation	SNP	pfam_Dynamin_GTPase,superfamily_P-loop_NTPase,smart_EPS15_homology,pfscan_EF_hand_dom,pfscan_EPS15_homology	p.S326R	ENST00000320631.3	37	c.978	CCDS8084.1	11	.	.	.	.	.	.	.	.	.	.	G	14.08	2.428552	0.43122	.	.	ENSG00000110047	ENST00000320631;ENST00000359393;ENST00000541001;ENST00000421303;ENST00000421510;ENST00000433803	T;T;T;T	0.43688	2.25;2.25;0.94;1.54	4.63	3.69	0.42338	.	0.295322	0.40302	N	0.001140	T	0.32704	0.0838	L	0.46885	1.475	0.50813	D	0.999891	B;B	0.12630	0.006;0.006	B;B	0.06405	0.002;0.002	T	0.25606	-1.0127	10	0.52906	T	0.07	.	7.3636	0.26760	0.1924:0.0:0.8076:0.0	.	326;326	B2R5U3;Q9H4M9	.;EHD1_HUMAN	R	326;326;302;340;190;340	ENSP00000320516:S326R;ENSP00000352354:S326R;ENSP00000391429:S190R;ENSP00000404944:S340R	ENSP00000320516:S326R	S	-	3	2	EHD1	64379472	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	2.610000	0.46325	2.420000	0.82092	0.561000	0.74099	AGC	EHD1	-	superfamily_P-loop_NTPase	ENSG00000110047		0.547	EHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHD1	HGNC	protein_coding	OTTHUMT00000143229.2	-	0.00	38	0	G	NM_006795		64622896	-1	tier1	-	no_errors	ENST00000320631	ensembl	human	known	74_37	missense	24.24	25	8	SNP	1.000	C
EIF4H	7458	genome.wustl.edu	37	7	73588738	73588738	+	Missense_Mutation	SNP	G	G	C	rs146609826	byFrequency	TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr7:73588738G>C	ENST00000265753.8	+	1	164	c.25G>C	c.(25-27)Gat>Cat	p.D9H	EIF4H_ENST00000353999.6_Missense_Mutation_p.D9H	NM_022170.1	NP_071496.1	Q15056	IF4H_HUMAN	eukaryotic translation initiation factor 4H	9					cellular protein metabolic process (GO:0044267)|developmental growth (GO:0048589)|gene expression (GO:0010467)|regulation of translational initiation (GO:0006446)|sexual reproduction (GO:0019953)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(1)|lung(2)|prostate(1)	4						CACCTACGACGATCGGGCCTA	0.726																																																	0													22.0	21.0	21.0					7																	73588738		2202	4299	6501	SO:0001583	missense	0				CCDS5564.1, CCDS5565.1	7q11.23	2013-02-12	2006-11-27	2006-11-27	ENSG00000106682	ENSG00000106682		"""RNA binding motif (RRM) containing"""	12741	protein-coding gene	gene with protein product		603431	"""Williams-Beuren syndrome chromosome region 1"""	WBSCR1		9516461, 15078951	Standard	NM_022170		Approved	WSCR1, KIAA0038	uc003uad.1	Q15056	OTTHUMG00000023025	ENST00000265753.8:c.25G>C	7.37:g.73588738G>C	ENSP00000265753:p.Asp9His		A8K3R1|D3DXF6|D3DXF8	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.D9H	ENST00000265753.8	37	c.25	CCDS5564.1	7	.	.	.	.	.	.	.	.	.	.	G	24.5	4.535075	0.85812	.	.	ENSG00000106682	ENST00000265753;ENST00000353999	T;T	0.36520	1.25;1.31	4.2	3.23	0.37069	.	0.126690	0.51477	U	0.000085	T	0.44498	0.1296	L	0.34521	1.04	0.58432	D	0.999995	P;D;D;D	0.89917	0.742;1.0;0.997;0.988	B;D;D;P	0.68353	0.211;0.94;0.957;0.839	T	0.30504	-0.9976	10	0.39692	T	0.17	0.006	12.3662	0.55230	0.0:0.1712:0.8287:0.0	.	9;9;9;9	B4DMV6;Q75MU2;Q15056-2;Q15056	.;.;.;IF4H_HUMAN	H	9	ENSP00000265753:D9H;ENSP00000265754:D9H	ENSP00000265753:D9H	D	+	1	0	EIF4H	73226674	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.397000	0.73239	2.045000	0.60652	0.462000	0.41574	GAT	EIF4H	-	NULL	ENSG00000106682		0.726	EIF4H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF4H	HGNC	protein_coding	OTTHUMT00000252375.2	-	0.00	53	0	G	NM_022170		73588738	+1	tier1	-	no_errors	ENST00000265753	ensembl	human	known	74_37	missense	24.14	44	14	SNP	1.000	C
TCEANC2	127428	genome.wustl.edu	37	1	54570299	54570299	+	Silent	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr1:54570299C>T	ENST00000391366.1	+	1	332	c.159C>T	c.(157-159)ctC>ctT	p.L53L	TCEANC2_ENST00000498272.1_Intron																							actgcaacctctgcctcctgg	0.488																																																	0																																										SO:0001819	synonymous_variant	0																														ENST00000391366.1:c.159C>T	1.37:g.54570299C>T				Silent	SNP	NULL	p.L53	ENST00000391366.1	37	c.159		1																																																																																			AL161915.1	-	NULL	ENSG00000212670		0.488	AL161915.1-201	NOVEL	basic|appris_principal	protein_coding	ENSG00000212670	Clone_based_ensembl_gene	protein_coding		-	0.00	29	0	C			54570299	+1	tier1	-	no_errors	ENST00000391366	ensembl	human	novel	74_37	silent	25.00	33	11	SNP	0.021	T
AL031653.1	0	genome.wustl.edu	37	20	7677574	7677574	+	RNA	SNP	C	C	G	rs191818315	byFrequency	TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr20:7677574C>G	ENST00000408799.2	-	0	50																											gaatgtcctgcgtcccgagaa	0.463																																																	0																																												0																															20.37:g.7677574C>G				RNA	SNP	-	NULL	ENST00000408799.2	37	NULL		20																																																																																			AL031653.1	-	-	ENSG00000221726		0.463	AL031653.1-201	NOVEL	basic	miRNA	ENSG00000221726	Clone_based_ensembl_gene	miRNA		-	0.00	45	0	C			7677574	-1	tier1	-	no_errors	ENST00000408799	ensembl	human	novel	74_37	rna	63.64	12	21	SNP	0.000	G
AC011718.2	0	genome.wustl.edu	37	22	20640127	20640127	+	lincRNA	SNP	C	C	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr22:20640127C>G	ENST00000577456.1	-	0	1433																											ATAAAGCGCCCTCATTGGTGA	0.483																																																	0																																												0																															22.37:g.20640127C>G				RNA	SNP	-	NULL	ENST00000577456.1	37	NULL		22																																																																																			AC011718.2	-	-	ENSG00000223579		0.483	AC011718.2-004	KNOWN	basic	lincRNA	ENSG00000223579	Clone_based_vega_gene	lincRNA	OTTHUMT00000444810.1	-	0.00	55	0	C			20640127	-1	tier1	-	no_errors	ENST00000577456	ensembl	human	known	74_37	rna	69.57	14	32	SNP	0.053	G
POT1-AS1	401398	genome.wustl.edu	37	7	124782801	124782801	+	RNA	SNP	T	T	G	rs548614026		TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr7:124782801T>G	ENST00000453342.1	+	0	1433				RP11-3B12.1_ENST00000435452.2_RNA|RP11-3B12.1_ENST00000449642.1_RNA																							atgaaaaaagttggaaaagag	0.318													T|||	1	0.000199681	0.0	0.0	5008	,	,		17004	0.0		0.0	False		,,,				2504	0.001																0																																												0																															7.37:g.124782801T>G				RNA	SNP	-	NULL	ENST00000453342.1	37	NULL		7																																																																																			RP11-3B12.1	-	-	ENSG00000224897		0.318	RP11-3B12.1-002	KNOWN	basic	antisense	ENSG00000224897	Clone_based_vega_gene	antisense	OTTHUMT00000347736.1	-	0.00	8	0	T			124782801	+1	tier1	-	no_errors	ENST00000449642	ensembl	human	known	74_37	rna	45.45	6	5	SNP	0.096	G
SRGAP2-AS1	100873165	genome.wustl.edu	37	1	121138853	121138853	+	lincRNA	SNP	G	G	A	rs184767318		TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr1:121138853G>A	ENST00000417218.1	+	0	240				RP11-343N15.1_ENST00000437515.1_lincRNA																							GCCGAGGGGTGCTCCTGGTCC	0.692																																																	0																																												0																															1.37:g.121138853G>A				RNA	SNP	-	NULL	ENST00000417218.1	37	NULL		1																																																																																			AL592494.5	-	-	ENSG00000227082		0.692	AL592494.5-001	KNOWN	basic	lincRNA	ENSG00000227082	Clone_based_vega_gene	lincRNA	OTTHUMT00000036739.1	-	0.00	10	0	G			121138853	+1	tier1	rs184767318	no_errors	ENST00000417218	ensembl	human	known	74_37	rna	30.77	9	4	SNP	0.951	A
ZNF687	57592	genome.wustl.edu	37	1	151254324	151254324	+	5'UTR	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr1:151254324C>T	ENST00000447795.2	-	0	81				ZNF687_ENST00000368879.2_5'Flank|RP11-126K1.2_ENST00000494138.1_5'UTR																							GTTCTGCTCTCAGTGCCCACC	0.552																																																	0																																										SO:0001623	5_prime_UTR_variant	0																														ENST00000447795.2:c.-189G>A	1.37:g.151254324C>T				RNA	SNP	-	NULL	ENST00000447795.2	37	NULL		1																																																																																			RP11-126K1.2	-	-	ENSG00000232671		0.552	RP11-126K1.2-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	ENSG00000232671	Clone_based_vega_gene	protein_coding	OTTHUMT00000034395.4	-	0.00	30	0	C			151254324	-1	tier1	-	no_errors	ENST00000494138	ensembl	human	putative	74_37	rna	27.59	21	8	SNP	0.000	T
IZUMO3	100129669	genome.wustl.edu	37	9	24545981	24545981	+	5'Flank	SNP	T	T	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr9:24545981T>A	ENST00000543880.2	-	0	0				RP11-20A20.2_ENST00000602851.1_lincRNA|IZUMO3_ENST00000604921.1_5'Flank			Q5VZ72	IZUM3_HUMAN	IZUMO family member 3							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)										AAAGTGTTTCTTTAGCCCTCT	0.458																																																	0																																										SO:0001631	upstream_gene_variant	0				CCDS65020.1	9p21.3	2014-02-17	2010-07-29	2010-07-29	ENSG00000205442	ENSG00000205442		"""-"""	31421	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 134"""	C9orf134		19658160, 22957301	Standard	NM_001271706		Approved	bA20A20.1	uc031tdg.1	Q5VZ72	OTTHUMG00000019704		9.37:g.24545981T>A	Exception_encountered			RNA	SNP	-	NULL	ENST00000543880.2	37	NULL		9																																																																																			RP11-20A20.2	-	-	ENSG00000269957		0.458	IZUMO3-001	NOVEL	not_organism_supported|basic	protein_coding	ENSG00000269957	Clone_based_vega_gene	protein_coding	OTTHUMT00000467652.1	-	0.00	23	0	T	NM_001271706		24545981	+1	tier1	-	no_errors	ENST00000602851	ensembl	human	known	74_37	rna	65.22	8	15	SNP	0.000	A
EPB41L5	57669	genome.wustl.edu	37	2	120925515	120925515	+	Silent	SNP	A	A	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr2:120925515A>G	ENST00000263713.5	+	24	2281	c.2067A>G	c.(2065-2067)ggA>ggG	p.G689G	EPB41L5_ENST00000452780.1_Silent_p.G688G|EPB41L5_ENST00000443902.2_Intron|EPB41L5_ENST00000488691.1_3'UTR	NM_020909.3	NP_065960.2	Q9HCM4	E41L5_HUMAN	erythrocyte membrane protein band 4.1 like 5	689					actomyosin structure organization (GO:0031032)|apical constriction (GO:0003383)|axial mesoderm morphogenesis (GO:0048319)|cellular response to transforming growth factor beta stimulus (GO:0071560)|ectoderm development (GO:0007398)|embryonic foregut morphogenesis (GO:0048617)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|in utero embryonic development (GO:0001701)|left/right axis specification (GO:0070986)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of protein binding (GO:0032091)|neural plate morphogenesis (GO:0001839)|paraxial mesoderm development (GO:0048339)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein binding (GO:0032092)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of establishment of protein localization (GO:0070201)|somite rostral/caudal axis specification (GO:0032525)|substrate-dependent cell migration, cell attachment to substrate (GO:0006931)|unidimensional cell growth (GO:0009826)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(5)|lung(12)|ovary(1)	26						GGAAGGAGGGACATGGTAATA	0.448																																																	0													159.0	139.0	146.0					2																	120925515		2203	4300	6503	SO:0001819	synonymous_variant	0			AK023019	CCDS2130.1, CCDS54392.1, CCDS54393.1	2q14.2	2009-07-28			ENSG00000115109	ENSG00000115109			19819	protein-coding gene	gene with protein product		611730					Standard	NM_001184937		Approved	KIAA1548, FLJ12957, BE37, YMO1	uc002tmg.3	Q9HCM4	OTTHUMG00000131433	ENST00000263713.5:c.2067A>G	2.37:g.120925515A>G			Q7Z5S1|Q8IZ12|Q9H975	Silent	SNP	pfam_FERM_central,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.G689	ENST00000263713.5	37	c.2067	CCDS2130.1	2																																																																																			EPB41L5	-	NULL	ENSG00000115109		0.448	EPB41L5-001	KNOWN	basic|CCDS	protein_coding	EPB41L5	HGNC	protein_coding	OTTHUMT00000254230.2	-	0.00	92	0	A	NM_020909		120925515	+1	tier1	-	no_errors	ENST00000263713	ensembl	human	known	74_37	silent	35.35	64	35	SNP	0.002	G
EPRS	2058	genome.wustl.edu	37	1	220154793	220154793	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr1:220154793T>C	ENST00000366923.3	-	24	3649	c.3380A>G	c.(3379-3381)tAt>tGt	p.Y1127C		NM_004446.2	NP_004437.2	P07814	SYEP_HUMAN	glutamyl-prolyl-tRNA synthetase	1127	Proline--tRNA ligase.				cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|negative regulation of translation (GO:0017148)|prolyl-tRNA aminoacylation (GO:0006433)|protein complex assembly (GO:0006461)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|GAIT complex (GO:0097452)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|proline-tRNA ligase activity (GO:0004827)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(11)|kidney(2)|large_intestine(13)|lung(24)|ovary(1)|prostate(3)|skin(2)|stomach(2)|urinary_tract(3)	63				GBM - Glioblastoma multiforme(131;0.0735)	L-Proline(DB00172)	ATATGCAGGATACATTACTGA	0.408																																																	0													136.0	120.0	125.0					1																	220154793		2203	4300	6503	SO:0001583	missense	0			X54326	CCDS31027.1	1q41	2011-07-01			ENSG00000136628	ENSG00000136628	6.1.1.15, 6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"", ""Aminoacyl tRNA synthetases / Class II"""	3418	protein-coding gene	gene with protein product	"""glutamate tRNA ligase"", ""proline tRNA ligase"""	138295		QPRS, QARS		1988429	Standard	NM_004446		Approved	EARS, PARS, GLUPRORS	uc001hly.1	P07814	OTTHUMG00000037433	ENST00000366923.3:c.3380A>G	1.37:g.220154793T>C	ENSP00000355890:p.Tyr1127Cys		A0AVA9|B9EGH3|Q05BP6|Q05DF8|Q5DSM1|Q5H9S5|Q6PD57|Q86X73	Missense_Mutation	SNP	pfam_Glu/Gln-tRNA-synth_Ib_cat-dom,pfam_WHEP-TRS,pfam_Glu/Gln-tRNA-synth_Ib_codon-bd,pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Pro-tRNA_ligase_II_C,pfam_Anticodon-bd,superfamily_Ribosomal_L25/Gln-tRNA_synth,superfamily_Anticodon-bd,superfamily_Pro-tRNA_synth_II,superfamily_S15_NS1_RNA-bd,superfamily_Glutathione-S-Trfase_C-like,smart_Pro-tRNA_ligase_II_C,prints_Glu/Gln-tRNA-synth,prints_Pro-tRNA-ligase_IIa,pfscan_aa-tRNA-synth_II,pfscan_WHEP-TRS,tigrfam_Pro-tRNA-ligase_IIa_arc-type,tigrfam_Glu-tRNA-synth_arc/euk	p.Y1127C	ENST00000366923.3	37	c.3380	CCDS31027.1	1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.377701	0.82682	.	.	ENSG00000136628	ENST00000366923	T	0.66638	-0.22	5.98	5.98	0.97165	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (G/ H/ P/ S), conserved domain (1);	0.000000	0.85682	D	0.000000	D	0.82958	0.5150	M	0.79693	2.465	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85257	0.1048	10	0.87932	D	0	-22.5634	16.4696	0.84102	0.0:0.0:0.0:1.0	.	1127	P07814	SYEP_HUMAN	C	1127	ENSP00000355890:Y1127C	ENSP00000355890:Y1127C	Y	-	2	0	EPRS	218221416	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	7.807000	0.86032	2.289000	0.77006	0.482000	0.46254	TAT	EPRS	-	pfam_aa-tRNA-synt_IIb_cons-dom,prints_Pro-tRNA-ligase_IIa,pfscan_aa-tRNA-synth_II,tigrfam_Pro-tRNA-ligase_IIa_arc-type	ENSG00000136628		0.408	EPRS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPRS	HGNC	protein_coding	OTTHUMT00000091133.2	-	0.00	70	0	T	NM_004446		220154793	-1	tier1	-	no_errors	ENST00000366923	ensembl	human	known	74_37	missense	27.42	45	17	SNP	1.000	C
ERAP1	51752	genome.wustl.edu	37	5	96132929	96132929	+	Missense_Mutation	SNP	G	G	T	rs138975720		TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr5:96132929G>T	ENST00000443439.2	-	4	813	c.747C>A	c.(745-747)ttC>ttA	p.F249L	ERAP1_ENST00000296754.3_Missense_Mutation_p.F249L	NM_001040458.1|NM_001198541.1	NP_001035548.1|NP_001185470.1	Q9NZ08	ERAP1_HUMAN	endoplasmic reticulum aminopeptidase 1	249					angiogenesis (GO:0001525)|antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|fat cell differentiation (GO:0045444)|membrane protein ectodomain proteolysis (GO:0006509)|positive regulation of angiogenesis (GO:0045766)|regulation of blood pressure (GO:0008217)|regulation of innate immune response (GO:0045088)|response to bacterium (GO:0009617)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	aminopeptidase activity (GO:0004177)|interleukin-1, Type II receptor binding (GO:0005151)|interleukin-6 receptor binding (GO:0005138)|metalloexopeptidase activity (GO:0008235)|zinc ion binding (GO:0008270)			endometrium(7)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|stomach(2)	19		all_cancers(142;1.75e-06)|all_epithelial(76;3.08e-09)|all_lung(232;0.000435)|Lung NSC(167;0.000601)|Ovarian(225;0.024)|Colorectal(57;0.0432)|Breast(839;0.244)		all cancers(79;7.26e-15)|COAD - Colon adenocarcinoma(37;0.071)		CTGAAATGATGAAGGCCACCA	0.418																																																	0													119.0	102.0	108.0					5																	96132929		2203	4300	6503	SO:0001583	missense	0			AB011097	CCDS4085.1, CCDS47250.1	5q15	2014-04-07			ENSG00000164307	ENSG00000164307			18173	protein-coding gene	gene with protein product	"""aminopeptidase regulator of TNFR1 shedding"", ""adipocyte-derived leucine aminopeptidase"", ""puromycin-insensitive leucyl-specific aminopeptidase"""	606832				10220586, 12189246, 16286653	Standard	NM_001198541		Approved	ARTS-1, A-LAP, PILS-AP, KIAA0525, ERAAP1	uc003kml.3	Q9NZ08	OTTHUMG00000128721	ENST00000443439.2:c.747C>A	5.37:g.96132929G>T	ENSP00000406304:p.Phe249Leu		O60278|Q6UWY6|Q8NEL4|Q8TAD0|Q9UHF8|Q9UKY2	Missense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.F249L	ENST00000443439.2	37	c.747	CCDS47250.1	5	.	.	.	.	.	.	.	.	.	.	G	17.68	3.449028	0.63178	.	.	ENSG00000164307	ENST00000296754;ENST00000443439;ENST00000414384	T;T	0.03553	3.89;3.89	5.32	4.25	0.50352	Peptidase M1, membrane alanine aminopeptidase, N-terminal (2);	0.168555	0.53938	N	0.000050	T	0.06962	0.0177	M	0.62723	1.935	0.43267	D	0.99521	B;B;B	0.24043	0.004;0.046;0.096	B;B;B	0.33750	0.047;0.169;0.159	T	0.07028	-1.0794	10	0.72032	D	0.01	.	9.9864	0.41843	0.1596:0.0:0.8404:0.0	.	249;249;249	A8K6H1;Q9NZ08;Q9NZ08-2	.;ERAP1_HUMAN;.	L	249	ENSP00000296754:F249L;ENSP00000406304:F249L	ENSP00000296754:F249L	F	-	3	2	ERAP1	96158685	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.308000	0.59129	2.515000	0.84797	0.549000	0.68633	TTC	ERAP1	-	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	ENSG00000164307		0.418	ERAP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ERAP1	HGNC	protein_coding	OTTHUMT00000370699.1	-	0.00	15	0	G	NM_016442		96132929	-1	tier1	-	no_errors	ENST00000296754	ensembl	human	known	74_37	missense	48.00	13	12	SNP	1.000	T
EXOC6	54536	genome.wustl.edu	37	10	94694131	94694131	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr10:94694131G>A	ENST00000260762.6	+	11	1098	c.1084G>A	c.(1084-1086)Gat>Aat	p.D362N	EXOC6_ENST00000371552.4_Missense_Mutation_p.D357N|EXOC6_ENST00000443748.2_Intron|EXOC6_ENST00000371547.4_Missense_Mutation_p.D378N	NM_019053.4	NP_061926.3	Q8TAG9	EXOC6_HUMAN	exocyst complex component 6	362					cellular protein metabolic process (GO:0044267)|erythrocyte differentiation (GO:0030218)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	exocyst (GO:0000145)|plasma membrane (GO:0005886)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	26		Colorectal(252;0.123)				GGCATACACTGATGAACTTTG	0.343																																																	0													102.0	99.0	100.0					10																	94694131		2203	4300	6503	SO:0001583	missense	0			BC028395	CCDS7424.2, CCDS31247.1	10q23.33	2013-01-22	2006-11-07	2006-11-07	ENSG00000138190	ENSG00000138190			23196	protein-coding gene	gene with protein product		609672	"""SEC15-like 1 (S. cerevisiae)"""	SEC15L1		8889548	Standard	NM_001013848		Approved	SEC15L, FLJ1125, DKFZp761I2124, MGC33397, Sec15p, EXOC6A	uc001kig.3	Q8TAG9	OTTHUMG00000018767	ENST00000260762.6:c.1084G>A	10.37:g.94694131G>A	ENSP00000260762:p.Asp362Asn		E9PHI3|Q5VXH8|Q9NZ24	Missense_Mutation	SNP	pfam_Sec15,pirsf_Sec15	p.D378N	ENST00000260762.6	37	c.1132	CCDS7424.2	10	.	.	.	.	.	.	.	.	.	.	G	19.07	3.755804	0.69648	.	.	ENSG00000138190	ENST00000371547;ENST00000371552;ENST00000260762	T;T;T	0.31247	1.5;1.5;1.5	5.38	5.38	0.77491	.	0.149441	0.64402	D	0.000015	T	0.45736	0.1357	L	0.53671	1.685	0.80722	D	1	P;P;B;B	0.48503	0.911;0.507;0.032;0.108	P;B;B;B	0.58780	0.845;0.211;0.064;0.102	T	0.35001	-0.9806	10	0.59425	D	0.04	-9.9098	12.4773	0.55821	0.0766:0.0:0.9234:0.0	.	378;354;362;357	F2Z2Q3;B4DEZ1;Q8TAG9;E9PHI3	.;.;EXOC6_HUMAN;.	N	378;357;362	ENSP00000360602:D378N;ENSP00000360607:D357N;ENSP00000260762:D362N	ENSP00000260762:D362N	D	+	1	0	EXOC6	94684111	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.914000	0.87478	2.516000	0.84829	0.460000	0.39030	GAT	EXOC6	-	pirsf_Sec15	ENSG00000138190		0.343	EXOC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC6	HGNC	protein_coding	OTTHUMT00000049410.2	-	0.00	31	0	G	NM_019053		94694131	+1	tier1	-	no_errors	ENST00000371547	ensembl	human	known	74_37	missense	26.67	22	8	SNP	1.000	A
ZACN	353174	genome.wustl.edu	37	17	74077223	74077223	+	Intron	SNP	C	C	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr17:74077223C>A	ENST00000334586.5	+	6	627				EXOC7_ENST00000332065.5_3'UTR|EXOC7_ENST00000607838.1_3'UTR|EXOC7_ENST00000589210.1_3'UTR|EXOC7_ENST00000591724.1_5'UTR	NM_180990.3	NP_851321.2	Q401N2	ZACN_HUMAN	zinc activated ligand-gated ion channel						ion transmembrane transport (GO:0034220)|response to zinc ion (GO:0010043)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)|ligand-gated ion channel activity (GO:0015276)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	11						TTCTATGGATCGGTTTTGTGT	0.483																																																	0													218.0	193.0	201.0					17																	74077223		692	1591	2283	SO:0001627	intron_variant	0			AK122638	CCDS11740.2	17q25.3	2012-01-18	2008-04-17	2008-04-17	ENSG00000186919	ENSG00000186919		"""Ligand-gated ion channels / Zinc activated channels"""	29504	protein-coding gene	gene with protein product		610935	"""ligand-gated ion channel, zinc activated 1"""	LGICZ1		12381728, 16083862	Standard	NM_180990		Approved	LGICZ, L2, ZAC, ZAC1	uc002jqn.2	Q401N2	OTTHUMG00000157186	ENST00000334586.5:c.545-136C>A	17.37:g.74077223C>A			Q2TB29|Q6ZWK3|Q86YW4	RNA	SNP	-	NULL	ENST00000334586.5	37	NULL	CCDS11740.2	17																																																																																			EXOC7	-	-	ENSG00000182473		0.483	ZACN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC7	HGNC	protein_coding	OTTHUMT00000347827.2	-	0.00	24	0	C	NM_180990		74077223	-1	tier1	-	no_errors	ENST00000591724	ensembl	human	known	74_37	rna	75.00	7	21	SNP	0.000	A
FAM155A	728215	genome.wustl.edu	37	13	108518718	108518718	+	Missense_Mutation	SNP	T	T	C	rs3832903|rs372708176	byFrequency	TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr13:108518718T>C	ENST00000375915.2	-	1	365	c.227A>G	c.(226-228)cAg>cGg	p.Q76R		NM_001080396.2	NP_001073865.1	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A	76	Poly-Gln.					integral component of membrane (GO:0016021)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						ctgctgccgctgctgctgctg	0.672																																																	0								T	ARG/GLN	0,4394		0,0,2197	24.0	30.0	28.0		227	5.1	1.0	13		28	1,8583		0,1,4291	no	missense	FAM155A	NM_001080396.2	43	0,1,6488	CC,CT,TT		0.0116,0.0,0.0077	possibly-damaging	76/459	108518718	1,12977	2197	4292	6489	SO:0001583	missense	0			L10374	CCDS32006.1	13q33.3	2008-04-15			ENSG00000204442	ENSG00000204442			33877	protein-coding gene	gene with protein product							Standard	NM_001080396		Approved		uc001vql.3	B1AL88	OTTHUMG00000017326	ENST00000375915.2:c.227A>G	13.37:g.108518718T>C	ENSP00000365080:p.Gln76Arg		B2RUV1|B7Z334	Missense_Mutation	SNP	NULL	p.Q76R	ENST00000375915.2	37	c.227	CCDS32006.1	13	.	.	.	.	.	.	.	.	.	.	T	0.006	-2.066115	0.00382	0.0	1.16E-4	ENSG00000204442	ENST00000375915	T	0.71934	-0.61	5.13	5.13	0.70059	Armadillo-like helical (1);	0.788765	0.10459	N	0.672200	T	0.63616	0.2526	L	0.43923	1.385	0.22787	N	0.998731	B	0.18968	0.032	B	0.21917	0.037	T	0.52895	-0.8514	10	0.36615	T	0.2	.	9.2369	0.37473	0.1614:0.0:0.0:0.8386	.	76	B1AL88	F155A_HUMAN	R	76	ENSP00000365080:Q76R	ENSP00000365080:Q76R	Q	-	2	0	FAM155A	107316719	1.000000	0.71417	1.000000	0.80357	0.385000	0.30292	4.557000	0.60782	1.936000	0.56123	0.528000	0.53228	CAG	FAM155A	-	NULL	ENSG00000204442		0.672	FAM155A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM155A	HGNC	protein_coding	OTTHUMT00000045736.2	-	0.00	32	0	T	NM_001080396		108518718	-1	tier1	-	no_errors	ENST00000375915	ensembl	human	known	74_37	missense	13.16	33	5	SNP	1.000	C
FAM86DP	692099	genome.wustl.edu	37	3	75475771	75475771	+	RNA	SNP	T	T	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr3:75475771T>A	ENST00000459803.1	-	0	779					NR_024241.1				family with sequence similarity 86, member D, pseudogene																		AGCTTCAGGTTACTGAAAGGG	0.552																																																	0																																												0			BC016686		3p12.3	2010-06-04	2010-06-04	2010-06-04	ENSG00000244026	ENSG00000244026			32659	pseudogene	pseudogene			"""family with sequence similarity 86, member D"""	FAM86D			Standard	NR_024241		Approved		uc003dpp.4		OTTHUMG00000158855		3.37:g.75475771T>A				RNA	SNP	-	NULL	ENST00000459803.1	37	NULL		3																																																																																			FAM86DP	-	-	ENSG00000244026		0.552	FAM86DP-003	KNOWN	basic	processed_transcript	FAM86DP	HGNC	pseudogene	OTTHUMT00000352425.1	-	0.00	205	0	T	NR_024241		75475771	-1	tier1	-	no_errors	ENST00000491583	ensembl	human	known	74_37	rna	75.81	45	141	SNP	0.187	A
FANCC	2176	genome.wustl.edu	37	9	97869387	97869387	+	Silent	SNP	A	A	T	rs76895298	byFrequency	TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr9:97869387A>T	ENST00000289081.3	-	14	1748	c.1494T>A	c.(1492-1494)gcT>gcA	p.A498A	FANCC_ENST00000375305.1_Silent_p.A498A	NM_000136.2	NP_000127.2	Q00597	FANCC_HUMAN	Fanconi anemia, complementation group C	498					DNA repair (GO:0006281)|germ cell development (GO:0007281)|myeloid cell homeostasis (GO:0002262)|nucleotide-excision repair (GO:0006289)|protein complex assembly (GO:0006461)|removal of superoxide radicals (GO:0019430)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				kidney(1)|skin(1)|upper_aerodigestive_tract(1)	3		Acute lymphoblastic leukemia(62;0.138)				GGCCTCCAGGAGCCCAGAGCA	0.582			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																														yes	Rec		Fanconi anaemia C	9	9q22.3	2176	"""Fanconi anemia, complementation group C"""		L	0													218.0	180.0	193.0					9																	97869387		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	BC006303	CCDS35071.1, CCDS75861.1	9q22.3	2014-09-17			ENSG00000158169	ENSG00000158169		"""Fanconi anemia, complementation groups"""	3584	protein-coding gene	gene with protein product		613899		FACC		1303234	Standard	NM_001243743		Approved	FAC, FA3	uc004avh.3	Q00597	OTTHUMG00000020279	ENST00000289081.3:c.1494T>A	9.37:g.97869387A>T			B1ALR8	Silent	SNP	pfam_Fanconi,pirsf_Fanconi,prints_Fanconi	p.A498	ENST00000289081.3	37	c.1494	CCDS35071.1	9																																																																																			FANCC	-	pfam_Fanconi,pirsf_Fanconi,prints_Fanconi	ENSG00000158169		0.582	FANCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCC	HGNC	protein_coding	OTTHUMT00000053219.1	-	0.00	94	0	A	NM_000136		97869387	-1	tier1	-	no_errors	ENST00000289081	ensembl	human	known	74_37	silent	30.30	92	40	SNP	0.912	T
FAT1	2195	genome.wustl.edu	37	4	187524844	187524844	+	Silent	SNP	G	G	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr4:187524844G>C	ENST00000441802.2	-	19	11045	c.10836C>G	c.(10834-10836)ctC>ctG	p.L3612L		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	3612	Cadherin 33. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						CGCTGACATTGAGAAGGTATT	0.507										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)												0													120.0	121.0	121.0					4																	187524844		2184	4279	6463	SO:0001819	synonymous_variant	0			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.10836C>G	4.37:g.187524844G>C				Silent	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.L3612	ENST00000441802.2	37	c.10836	CCDS47177.1	4																																																																																			FAT1	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000083857		0.507	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT1	HGNC	protein_coding	OTTHUMT00000360209.3	-	0.00	34	0	G	NM_005245		187524844	-1	tier1	-	no_errors	ENST00000441802	ensembl	human	known	74_37	silent	32.76	38	19	SNP	0.981	C
FBXL13	222235	genome.wustl.edu	37	7	102453968	102453968	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr7:102453968G>C	ENST00000313221.4	-	20	2455	c.2029C>G	c.(2029-2031)Caa>Gaa	p.Q677E	FBXL13_ENST00000379305.3_Missense_Mutation_p.Q649E|FBXL13_ENST00000455112.2_Missense_Mutation_p.Q632E|FBXL13_ENST00000379306.3_Missense_Mutation_p.Q395E|FBXL13_ENST00000456695.1_Missense_Mutation_p.Q395E|FBXL13_ENST00000436908.1_Missense_Mutation_p.Q677E|FBXL13_ENST00000379308.3_Missense_Mutation_p.Q632E|FBXL13_ENST00000393772.2_Missense_Mutation_p.Q649E	NM_145032.3	NP_659469.3	Q8NEE6	FXL13_HUMAN	F-box and leucine-rich repeat protein 13	677										NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|skin(3)|stomach(1)	27						GACATTCTTTGAGCTGCCTTC	0.413																																																	0													239.0	210.0	220.0					7																	102453968		2203	4300	6503	SO:0001583	missense	0			BC031285	CCDS5726.1, CCDS47678.1, CCDS75649.1	7q22.1	2014-07-18			ENSG00000161040	ENSG00000161040		"""F-boxes / Leucine-rich repeats"""	21658	protein-coding gene	gene with protein product		609080					Standard	NM_145032		Approved	MGC21636, Fbl13	uc003vaq.2	Q8NEE6	OTTHUMG00000157224	ENST00000313221.4:c.2029C>G	7.37:g.102453968G>C	ENSP00000321927:p.Gln677Glu		C9J565|C9J566|Q6UVW7|Q6UVW8|Q75MN5|Q86UJ5|Q8N7Y4|Q8TCL2|Q8WUF9|Q8WUG0	Missense_Mutation	SNP	smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_F-box_dom	p.Q677E	ENST00000313221.4	37	c.2029	CCDS5726.1	7	.	.	.	.	.	.	.	.	.	.	G	12.85	2.062818	0.36373	.	.	ENSG00000161040	ENST00000393772;ENST00000379308;ENST00000379306;ENST00000349747;ENST00000379305;ENST00000436908;ENST00000313221;ENST00000456695;ENST00000455112	T;T;T;T;T;T;T;T	0.33654	1.4;2.02;1.4;1.4;1.4;1.4;1.4;2.02	5.79	-6.34	0.01982	.	5.733430	0.00166	N	0.000003	T	0.14485	0.0350	N	0.12182	0.205	0.09310	N	1	B;B;B;B	0.06786	0.0;0.0;0.0;0.001	B;B;B;B	0.04013	0.001;0.001;0.0;0.001	T	0.29336	-1.0015	10	0.02654	T	1	.	3.8922	0.09123	0.0914:0.4077:0.1913:0.3097	.	632;395;649;677	Q8NEE6-3;Q8NEE6-4;Q8NEE6-2;Q8NEE6	.;.;.;FXL13_HUMAN	E	649;632;395;398;649;677;677;395;632	ENSP00000377367:Q649E;ENSP00000368610:Q632E;ENSP00000368608:Q395E;ENSP00000368607:Q649E;ENSP00000388608:Q677E;ENSP00000321927:Q677E;ENSP00000409716:Q395E;ENSP00000391550:Q632E	ENSP00000321927:Q677E	Q	-	1	0	FBXL13	102241204	0.000000	0.05858	0.001000	0.08648	0.345000	0.29048	-1.008000	0.03663	-0.922000	0.03789	-0.226000	0.12346	CAA	FBXL13	-	smart_Leu-rich_rpt_Cys-con_subtyp	ENSG00000161040		0.413	FBXL13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FBXL13	HGNC	protein_coding	OTTHUMT00000348001.1	-	0.00	165	0	G	NM_145032		102453968	-1	tier1	-	no_errors	ENST00000313221	ensembl	human	known	74_37	missense	27.51	137	52	SNP	0.000	C
FBXO41	150726	genome.wustl.edu	37	2	73491122	73491122	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr2:73491122C>G	ENST00000521871.1	-	7	2281	c.1866G>C	c.(1864-1866)ttG>ttC	p.L622F	FBXO41_ENST00000295133.5_Missense_Mutation_p.L683F|FBXO41_ENST00000520530.2_Missense_Mutation_p.L622F			Q8TF61	FBX41_HUMAN	F-box protein 41	622										breast(2)|central_nervous_system(1)|endometrium(1)|lung(6)|pancreas(1)|prostate(1)|skin(1)	13						GCCGGGGCTTCAAGTTCTGCA	0.632																																																	0													21.0	25.0	24.0					2																	73491122		1953	4151	6104	SO:0001583	missense	0			AB075820	CCDS46337.1, CCDS46337.2	2p13.2	2004-08-24				ENSG00000163013		"""F-boxes /  ""other"""""	29409	protein-coding gene	gene with protein product		609108				11853319	Standard	NM_001080410		Approved	KIAA1940, Fbx41	uc021vjh.1	Q8TF61		ENST00000521871.1:c.1866G>C	2.37:g.73491122C>G	ENSP00000428646:p.Leu622Phe		G3V0Z7|Q2M1V8	Missense_Mutation	SNP	superfamily_F-box_dom	p.L683F	ENST00000521871.1	37	c.2049	CCDS46337.2	2	.	.	.	.	.	.	.	.	.	.	C	19.81	3.896342	0.72639	.	.	ENSG00000163013	ENST00000295133;ENST00000521871	T;T	0.24538	1.85;1.85	5.06	4.17	0.49024	F-box domain, Skp2-like (1);	0.069080	0.64402	D	0.000014	T	0.39091	0.1065	L	0.44542	1.39	0.58432	D	0.999999	D	0.76494	0.999	D	0.85130	0.997	T	0.16689	-1.0394	10	0.62326	D	0.03	-21.6981	8.5179	0.33257	0.1566:0.5677:0.2756:0.0	.	622	Q8TF61	FBX41_HUMAN	F	683;622	ENSP00000295133:L683F;ENSP00000428646:L622F	ENSP00000295133:L683F	L	-	3	2	FBXO41	73344630	0.999000	0.42202	1.000000	0.80357	0.995000	0.86356	0.461000	0.21940	1.318000	0.45170	0.561000	0.74099	TTG	FBXO41	-	superfamily_F-box_dom	ENSG00000163013		0.632	FBXO41-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FBXO41	HGNC	protein_coding	OTTHUMT00000377381.1	-	0.00	65	0	C			73491122	-1	tier1	-	no_errors	ENST00000295133	ensembl	human	known	74_37	missense	42.86	44	33	SNP	1.000	G
FBXW4	6468	genome.wustl.edu	37	10	103386126	103386126	+	Intron	SNP	A	A	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr10:103386126A>C	ENST00000331272.7	-	6	1389				FBXW4_ENST00000470093.1_5'UTR	NM_022039.3	NP_071322.1	P57775	FBXW4_HUMAN	F-box and WD repeat domain containing 4						cartilage development (GO:0051216)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|positive regulation of mesenchymal cell proliferation (GO:0002053)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)	ubiquitin ligase complex (GO:0000151)				breast(3)|endometrium(2)|large_intestine(4)|lung(4)|skin(1)|stomach(1)	15		Colorectal(252;0.123)		Epithelial(162;4.35e-08)|all cancers(201;1.92e-06)		TCCATTAATAACTGGTAAAGC	0.458																																																	0																																										SO:0001627	intron_variant	0			AF281859	CCDS31271.1	10q24	2013-01-09	2007-02-08	2005-03-12	ENSG00000107829	ENSG00000107829		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	10847	protein-coding gene	gene with protein product		608071	"""split hand/foot malformation (ectrodactyly) type 3"", ""F-box and WD-40 domain protein 4"""	SHFM3		8723077, 7912888	Standard	XM_005270053		Approved	Fbw4, dactylin	uc001kto.3	P57775	OTTHUMG00000018938	ENST00000331272.7:c.771-1559T>G	10.37:g.103386126A>C			Q5SVS1|Q96IM6	RNA	SNP	-	NULL	ENST00000331272.7	37	NULL	CCDS31271.1	10																																																																																			FBXW4	-	-	ENSG00000107829		0.458	FBXW4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW4	HGNC	protein_coding	OTTHUMT00000049979.2	-	0.00	61	0	A	NM_022039		103386126	-1	tier1	-	no_errors	ENST00000470093	ensembl	human	known	74_37	rna	75.81	15	47	SNP	1.000	C
FBXW5	54461	genome.wustl.edu	37	9	139837916	139837916	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr9:139837916G>A	ENST00000325285.3	-	3	315	c.236C>T	c.(235-237)aCg>aTg	p.T79M	C8G_ENST00000224181.3_5'Flank|FBXW5_ENST00000483559.1_5'UTR	NM_018998.3	NP_061871.1	Q969U6	FBXW5_HUMAN	F-box and WD repeat domain containing 5	79					centrosome duplication (GO:0051298)|mitotic nuclear division (GO:0007067)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	12	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;7.8e-06)|Epithelial(140;0.000106)		GCAGGGCACCGTGTCATACAG	0.647																																																	0													65.0	46.0	53.0					9																	139837916		2200	4299	6499	SO:0001583	missense	0			BC014130	CCDS7014.1	9q34.3	2013-01-09	2007-02-08		ENSG00000159069	ENSG00000159069		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13613	protein-coding gene	gene with protein product		609072	"""F-box and WD-40 domain protein 5"""				Standard	NM_018998		Approved	DKFZP434B205, MGC20962, Fbw5	uc004cjx.3	Q969U6	OTTHUMG00000020967	ENST00000325285.3:c.236C>T	9.37:g.139837916G>A	ENSP00000313034:p.Thr79Met		B2RDZ6|Q59ET5|Q5SPZ8|Q5SPZ9|Q5SQ00|Q5SQ02|Q5SQ03|Q5SQ04|Q8WY79|Q96GJ6|Q9BSU8|Q9H6A8|Q9HBQ6|Q9NSZ3	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_F-box_dom,superfamily_Quinoprot_gluc/sorb_DH,superfamily_F-box_dom,smart_F-box_dom,smart_WD40_repeat,pfscan_F-box_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T79M	ENST00000325285.3	37	c.236	CCDS7014.1	9	.	.	.	.	.	.	.	.	.	.	g	13.17	2.157444	0.38119	.	.	ENSG00000159069	ENST00000325285;ENST00000428398;ENST00000443788	T;T;D	0.83673	-0.21;1.54;-1.75	4.85	-4.33	0.03677	Soluble quinoprotein glucose/sorbosone dehydrogenase (1);F-box domain, Skp2-like (1);	0.697292	0.15088	N	0.281260	T	0.69788	0.3150	L	0.36672	1.1	0.09310	N	1	B	0.12630	0.006	B	0.06405	0.002	T	0.52358	-0.8586	10	0.45353	T	0.12	-13.5982	8.5827	0.33640	0.1708:0.3217:0.5075:0.0	.	79	Q969U6	FBXW5_HUMAN	M	79	ENSP00000313034:T79M;ENSP00000404829:T79M;ENSP00000394011:T79M	ENSP00000313034:T79M	T	-	2	0	FBXW5	138957737	0.340000	0.24792	0.000000	0.03702	0.972000	0.66771	0.904000	0.28491	-1.251000	0.02494	-0.471000	0.05019	ACG	FBXW5	-	superfamily_Quinoprot_gluc/sorb_DH,superfamily_F-box_dom	ENSG00000159069		0.647	FBXW5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW5	HGNC	protein_coding	OTTHUMT00000055227.1	-	0.00	65	0	G	NM_018998		139837916	-1	tier1	-	no_errors	ENST00000325285	ensembl	human	known	74_37	missense	29.33	53	22	SNP	0.000	A
FCRL1	115350	genome.wustl.edu	37	1	157772422	157772422	+	Missense_Mutation	SNP	G	G	C	rs144206423	byFrequency	TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr1:157772422G>C	ENST00000368176.3	-	4	419	c.352C>G	c.(352-354)Cag>Gag	p.Q118E	FCRL1_ENST00000358292.3_Missense_Mutation_p.Q118E|FCRL1_ENST00000489998.1_5'UTR|FCRL1_ENST00000491942.1_Missense_Mutation_p.Q118E	NM_001159398.1|NM_052938.4	NP_001152870.1|NP_443170.1	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1	118	Ig-like C2-type 2.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(24)|ovary(4)|prostate(1)|skin(6)	42	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			CCTGGGGGCTGAGTCTCCAAG	0.537																																					GBM(54;482 1003 11223 30131 35730)												0													44.0	42.0	43.0					1																	157772422		2203	4300	6503	SO:0001583	missense	0			BC033690	CCDS1170.1, CCDS53382.1, CCDS53383.1	1q21-q22	2013-01-14			ENSG00000163534	ENSG00000163534		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18509	protein-coding gene	gene with protein product		606508				11493702, 11929751	Standard	NM_052938		Approved	FCRH1, IRTA5, IFGP1, CD307a	uc001frg.3	Q96LA6	OTTHUMG00000019398	ENST00000368176.3:c.352C>G	1.37:g.157772422G>C	ENSP00000357158:p.Gln118Glu		B2RE05|Q8N759|Q8NDI0|Q96PJ6	Missense_Mutation	SNP	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.Q118E	ENST00000368176.3	37	c.352	CCDS1170.1	1	.	.	.	.	.	.	.	.	.	.	G	12.48	1.951166	0.34471	.	.	ENSG00000163534	ENST00000358292;ENST00000368176;ENST00000491942	T;T;T	0.11712	2.75;2.75;2.75	5.41	2.39	0.29439	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.219200	0.05679	N	0.590018	T	0.03608	0.0103	L	0.39147	1.195	0.09310	N	1	P;P;P	0.46952	0.868;0.887;0.826	P;P;B	0.48982	0.467;0.597;0.371	T	0.22800	-1.0206	10	0.02654	T	1	.	6.8227	0.23866	0.0831:0.0:0.6088:0.3081	.	118;118;118	Q96LA6-3;Q96LA6-2;Q96LA6	.;.;FCRL1_HUMAN	E	118	ENSP00000351039:Q118E;ENSP00000357158:Q118E;ENSP00000418130:Q118E	ENSP00000351039:Q118E	Q	-	1	0	FCRL1	156039046	0.003000	0.15002	0.002000	0.10522	0.433000	0.31745	0.804000	0.27098	0.298000	0.22638	0.655000	0.94253	CAG	FCRL1	-	pfam_Ig_I-set,pfscan_Ig-like_dom	ENSG00000163534		0.537	FCRL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCRL1	HGNC	protein_coding	OTTHUMT00000051401.1	-	0.00	33	0	G	NM_052938		157772422	-1	tier1	-	no_errors	ENST00000368176	ensembl	human	known	74_37	missense	44.19	24	19	SNP	0.016	C
FCRL6	343413	genome.wustl.edu	37	1	159772228	159772228	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr1:159772228C>T	ENST00000368106.3	+	1	15	c.14C>T	c.(13-15)aCg>aTg	p.T5M	FCRL6_ENST00000321935.6_Missense_Mutation_p.T12M|FCRL6_ENST00000392235.3_Missense_Mutation_p.T5M|FCRL6_ENST00000339348.5_Missense_Mutation_p.T5M	NM_001004310.2	NP_001004310.2	Q6DN72	FCRL6_HUMAN	Fc receptor-like 6	5						external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	24	all_hematologic(112;0.0597)					CTGCTCTGGACGGCTGTGCTG	0.582																																																	0													79.0	57.0	64.0					1																	159772228		2203	4300	6503	SO:0001583	missense	0			AK131201	CCDS30912.1, CCDS60312.1	1q23.2	2013-01-11			ENSG00000181036	ENSG00000181036		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	31910	protein-coding gene	gene with protein product		613562					Standard	NM_001004310		Approved	IFGP6, FLJ16056, FcRH6	uc001fud.4	Q6DN72	OTTHUMG00000035351	ENST00000368106.3:c.14C>T	1.37:g.159772228C>T	ENSP00000357086:p.Thr5Met		A1KXW6|A2A4D6|Q6DN73|Q6XRC3|Q6ZNI1	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.T5M	ENST00000368106.3	37	c.14	CCDS30912.1	1	.	.	.	.	.	.	.	.	.	.	C	0.015	-1.559002	0.00910	.	.	ENSG00000181036	ENST00000321935;ENST00000339348;ENST00000392235;ENST00000368106	T;T;T;T	0.01272	5.2;5.07;5.63;5.16	4.08	-5.87	0.02297	.	.	.	.	.	T	0.00328	0.0010	N	0.14661	0.345	0.09310	N	1	B;B;B;B	0.15473	0.013;0.011;0.006;0.003	B;B;B;B	0.11329	0.006;0.002;0.001;0.001	T	0.42241	-0.9463	9	0.36615	T	0.2	.	8.6955	0.34293	0.0:0.1414:0.1363:0.7223	.	5;5;5;12	Q6DN72-3;Q6DN72-4;Q6DN72;Q6DN72-2	.;.;FCRL6_HUMAN;.	M	12;5;5;5	ENSP00000320625:T12M;ENSP00000340949:T5M;ENSP00000376068:T5M;ENSP00000357086:T5M	ENSP00000320625:T12M	T	+	2	0	FCRL6	158038852	0.000000	0.05858	0.005000	0.12908	0.062000	0.15995	-4.314000	0.00254	-1.134000	0.02899	-0.736000	0.03550	ACG	FCRL6	-	NULL	ENSG00000181036		0.582	FCRL6-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCRL6	HGNC	protein_coding	OTTHUMT00000276853.1	-	0.00	90	0	C	NM_001004310		159772228	+1	tier1	-	no_errors	ENST00000368106	ensembl	human	known	74_37	missense	36.67	57	33	SNP	0.002	T
FIGN	55137	genome.wustl.edu	37	2	164466828	164466828	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr2:164466828G>T	ENST00000333129.3	-	3	1828	c.1514C>A	c.(1513-1515)cCa>cAa	p.P505Q	FIGN_ENST00000409634.1_Intron|FIGN_ENST00000482917.1_5'Flank	NM_018086.2	NP_060556.2	Q5HY92	FIGN_HUMAN	fidgetin	505					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)			breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(1)|prostate(2)|skin(1)	47						CCTCAACACTGGCCATAAAAC	0.507																																																	0													117.0	109.0	112.0					2																	164466828		2011	4189	6200	SO:0001583	missense	0			AK001267	CCDS2221.2	2q24	2010-04-21			ENSG00000182263	ENSG00000182263		"""ATPases / AAA-type"""	13285	protein-coding gene	gene with protein product		605295				11017077	Standard	XM_005246661		Approved		uc002uck.1	Q5HY92	OTTHUMG00000074059	ENST00000333129.3:c.1514C>A	2.37:g.164466828G>T	ENSP00000333836:p.Pro505Gln		B3KWM0|Q9H6M5|Q9NVZ9	Missense_Mutation	SNP	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.P505Q	ENST00000333129.3	37	c.1514	CCDS2221.2	2	.	.	.	.	.	.	.	.	.	.	G	17.09	3.301577	0.60195	.	.	ENSG00000182263	ENST00000333129	D	0.95238	-3.65	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	D	0.98356	0.9454	H	0.96208	3.785	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99146	1.0857	10	0.87932	D	0	-25.6294	19.7468	0.96255	0.0:0.0:1.0:0.0	.	505	Q5HY92	FIGN_HUMAN	Q	505	ENSP00000333836:P505Q	ENSP00000333836:P505Q	P	-	2	0	FIGN	164175074	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.869000	0.99810	2.678000	0.91216	0.563000	0.77884	CCA	FIGN	-	superfamily_P-loop_NTPase	ENSG00000182263		0.507	FIGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FIGN	HGNC	protein_coding	OTTHUMT00000157220.2	-	0.00	64	0	G	NM_018086		164466828	-1	tier1	-	no_errors	ENST00000333129	ensembl	human	known	74_37	missense	38.60	35	22	SNP	1.000	T
DMBT1P1	375940	genome.wustl.edu	37	10	124554869	124554869	+	RNA	SNP	T	T	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr10:124554869T>G	ENST00000439464.2	+	0	3229					NR_003570.1																						TGGGCAGGTTTTGTGCTGGGA	0.478																																																	0																																												0																															10.37:g.124554869T>G				RNA	SNP	-	NULL	ENST00000439464.2	37	NULL		10																																																																																			RP11-318C4.2	-	-	ENSG00000176584		0.478	RP11-318C4.2-001	KNOWN	basic	processed_transcript	FLJ46361	Clone_based_vega_gene	pseudogene	OTTHUMT00000471298.1	-	0.00	25	0	T			124554869	+1	tier1	-	no_errors	ENST00000439464	ensembl	human	known	74_37	rna	72.97	10	27	SNP	0.215	G
FOXD2	2306	genome.wustl.edu	37	1	47904390	47904390	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr1:47904390C>T	ENST00000334793.5	+	1	2702	c.583C>T	c.(583-585)Ccg>Tcg	p.P195S		NM_004474.3	NP_004465.3	O60548	FOXD2_HUMAN	forkhead box D2	195					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(4)	4				READ - Rectum adenocarcinoma(2;0.0908)		GCCGGGCAACCCGGGCAAGGG	0.652																																																	0													62.0	75.0	71.0					1																	47904390		2203	4300	6503	SO:0001583	missense	0			AF042832	CCDS30708.1	1p34-p32	2008-02-05			ENSG00000186564	ENSG00000186564		"""Forkhead boxes"""	3803	protein-coding gene	gene with protein product		602211		FKHL17		9403061, 12621056	Standard	NM_004474		Approved	FREAC9	uc001crm.3	O60548	OTTHUMG00000007950	ENST00000334793.5:c.583C>T	1.37:g.47904390C>T	ENSP00000335493:p.Pro195Ser		Q5SVZ3	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.P195S	ENST00000334793.5	37	c.583	CCDS30708.1	1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.526340	0.85600	.	.	ENSG00000186564	ENST00000334793	D	0.95482	-3.72	4.2	4.2	0.49525	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.000000	0.85682	U	0.000000	D	0.97380	0.9143	M	0.77820	2.39	0.80722	D	1	D	0.69078	0.997	D	0.79784	0.993	D	0.98139	1.0435	10	0.72032	D	0.01	.	15.3129	0.74048	0.0:1.0:0.0:0.0	.	195	O60548	FOXD2_HUMAN	S	195	ENSP00000335493:P195S	ENSP00000335493:P195S	P	+	1	0	FOXD2	47676977	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.230000	0.78097	1.866000	0.54105	0.436000	0.28706	CCG	FOXD2	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head	ENSG00000186564		0.652	FOXD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXD2	HGNC	protein_coding	OTTHUMT00000021831.1	-	0.00	138	0	C	NM_004474		47904390	+1	tier1	-	no_errors	ENST00000334793	ensembl	human	known	74_37	missense	22.67	116	34	SNP	1.000	T
GGH	8836	genome.wustl.edu	37	8	63948274	63948274	+	Silent	SNP	A	A	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr8:63948274A>G	ENST00000260118.6	-	2	567	c.165T>C	c.(163-165)taT>taC	p.Y55Y		NM_003878.2	NP_003869.1	Q92820	GGH_HUMAN	gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase)	55	Gamma-glutamyl hydrolase. {ECO:0000255|PROSITE-ProRule:PRU00607}.				glutamine metabolic process (GO:0006541)|proteolysis (GO:0006508)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to insulin (GO:0032868)|response to zinc ion (GO:0010043)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	exopeptidase activity (GO:0008238)|gamma-glutamyl-peptidase activity (GO:0034722)|omega peptidase activity (GO:0008242)			breast(1)|kidney(1)|large_intestine(1)|liver(1)|lung(6)|stomach(1)	11	Breast(64;0.0716)	all_cancers(86;0.189)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.131)			Folic Acid(DB00158)|Methotrexate(DB00563)	ACGCAGCAATATAGTATCTTC	0.308																																																	0													108.0	105.0	106.0					8																	63948274		2203	4300	6503	SO:0001819	synonymous_variant	0			U55206	CCDS6177.1	8q12.3	2008-02-05			ENSG00000137563	ENSG00000137563	3.4.19.9		4248	protein-coding gene	gene with protein product		601509				8816764, 10570974	Standard	NM_003878		Approved		uc003xuw.3	Q92820	OTTHUMG00000164365	ENST00000260118.6:c.165T>C	8.37:g.63948274A>G				Silent	SNP	pfam_Peptidase_C26,pfam_GATASE	p.Y55	ENST00000260118.6	37	c.165	CCDS6177.1	8																																																																																			GGH	-	pfam_Peptidase_C26	ENSG00000137563		0.308	GGH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GGH	HGNC	protein_coding	OTTHUMT00000378453.1	-	0.00	25	0	A			63948274	-1	tier1	-	no_errors	ENST00000260118	ensembl	human	known	74_37	silent	56.36	24	31	SNP	1.000	G
GGNBP2	79893	genome.wustl.edu	37	17	34916662	34916662	+	Nonsense_Mutation	SNP	A	A	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr17:34916662A>T	ENST00000304718.4	+	5	794	c.478A>T	c.(478-480)Aag>Tag	p.K160*		NM_024835.3	NP_079111.1	Q9H3C7	GGNB2_HUMAN	gametogenetin binding protein 2	160					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)	38		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		TAAGAAGAATAAGAGATGTCA	0.299																																																	0													81.0	83.0	83.0					17																	34916662		2203	4299	6502	SO:0001587	stop_gained	0			AF126964	CCDS11314.1	17q21.1	2014-05-06	2007-08-20	2007-08-20	ENSG00000005955	ENSG00000278311			19357	protein-coding gene	gene with protein product		612275	"""zinc finger protein 403"""	ZNF403		11728448	Standard	NM_024835		Approved	ZFP403, LZK1, FLJ22561, FLJ21230, DIF-3, DIF3	uc002hnb.3	Q9H3C7	OTTHUMG00000188440	ENST00000304718.4:c.478A>T	17.37:g.34916662A>T	ENSP00000307617:p.Lys160*		B2RPK7|Q96T90|Q9GZR8|Q9H767	Nonsense_Mutation	SNP	NULL	p.K160*	ENST00000304718.4	37	c.478	CCDS11314.1	17	.	.	.	.	.	.	.	.	.	.	A	39	7.401784	0.98262	.	.	ENSG00000005955	ENST00000304718	.	.	.	5.33	5.33	0.75918	.	0.045710	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.5235	15.3431	0.74314	1.0:0.0:0.0:0.0	.	.	.	.	X	160	.	ENSP00000307617:K160X	K	+	1	0	GGNBP2	31990775	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.601000	0.90864	2.024000	0.59613	0.454000	0.30748	AAG	GGNBP2	-	NULL	ENSG00000005955		0.299	GGNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GGNBP2	HGNC	protein_coding	OTTHUMT00000256684.2	-	0.00	65	0	A	NM_024835		34916662	+1	tier1	-	no_errors	ENST00000304718	ensembl	human	known	74_37	nonsense	74.51	13	38	SNP	1.000	T
GGNBP2	79893	genome.wustl.edu	37	17	34916664	34916664	+	Missense_Mutation	SNP	G	G	T	rs527456793		TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr17:34916664G>T	ENST00000304718.4	+	5	796	c.480G>T	c.(478-480)aaG>aaT	p.K160N		NM_024835.3	NP_079111.1	Q9H3C7	GGNB2_HUMAN	gametogenetin binding protein 2	160					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)	38		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		AGAAGAATAAGAGATGTCAGT	0.303																																																	0													82.0	84.0	83.0					17																	34916664		2203	4299	6502	SO:0001583	missense	0			AF126964	CCDS11314.1	17q21.1	2014-05-06	2007-08-20	2007-08-20	ENSG00000005955	ENSG00000278311			19357	protein-coding gene	gene with protein product		612275	"""zinc finger protein 403"""	ZNF403		11728448	Standard	NM_024835		Approved	ZFP403, LZK1, FLJ22561, FLJ21230, DIF-3, DIF3	uc002hnb.3	Q9H3C7	OTTHUMG00000188440	ENST00000304718.4:c.480G>T	17.37:g.34916664G>T	ENSP00000307617:p.Lys160Asn		B2RPK7|Q96T90|Q9GZR8|Q9H767	Missense_Mutation	SNP	NULL	p.K160N	ENST00000304718.4	37	c.480	CCDS11314.1	17	.	.	.	.	.	.	.	.	.	.	G	13.44	2.236623	0.39498	.	.	ENSG00000005955	ENST00000304718	.	.	.	5.33	3.26	0.37387	.	0.045710	0.85682	D	0.000000	T	0.25791	0.0628	N	0.04508	-0.205	0.41952	D	0.990667	B;B	0.24721	0.11;0.004	B;B	0.20184	0.028;0.006	T	0.04607	-1.0939	9	0.41790	T	0.15	-14.5235	5.8005	0.18412	0.1681:0.0:0.6794:0.1525	.	160;160	Q9H3C7;Q9H3C7-3	GGNB2_HUMAN;.	N	160	.	ENSP00000307617:K160N	K	+	3	2	GGNBP2	31990777	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.267000	0.33050	0.563000	0.29222	0.555000	0.69702	AAG	GGNBP2	-	NULL	ENSG00000005955		0.303	GGNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GGNBP2	HGNC	protein_coding	OTTHUMT00000256684.2	-	0.00	63	0	G	NM_024835		34916664	+1	tier1	-	no_errors	ENST00000304718	ensembl	human	known	74_37	missense	74.51	13	38	SNP	1.000	T
GH1	2688	genome.wustl.edu	37	17	61994789	61994789	+	Silent	SNP	G	G	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr17:61994789G>A	ENST00000323322.5	-	5	576	c.534C>T	c.(532-534)aaC>aaT	p.N178N	CSHL1_ENST00000392824.4_Intron|GH1_ENST00000458650.2_Silent_p.N163N|GH1_ENST00000342364.4_Silent_p.N83N|GH1_ENST00000351388.4_Silent_p.N138N	NM_000515.3	NP_000506.2	P01241	SOMA_HUMAN	growth hormone 1	178					bone maturation (GO:0070977)|glucose transport (GO:0015758)|growth hormone receptor signaling pathway (GO:0060396)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|response to estradiol (GO:0032355)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)|growth hormone receptor binding (GO:0005131)|metal ion binding (GO:0046872)|prolactin receptor binding (GO:0005148)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)	19						GTGCGTCATCGTTGTGTGAGT	0.547																																																	0													277.0	213.0	234.0					17																	61994789		2203	4300	6503	SO:0001819	synonymous_variant	0			M13438	CCDS11653.1, CCDS11654.1, CCDS45760.1	17q22-q24	2014-01-30				ENSG00000259384		"""Endogenous ligands"""	4261	protein-coding gene	gene with protein product	"""pituitary growth hormone"", ""somatotropin"""	139250				6306568	Standard	XM_005257218		Approved	GH-N, GHN, GH, hGH-N	uc002jdj.3	P01241		ENST00000323322.5:c.534C>T	17.37:g.61994789G>A			A6NEF6|Q14405|Q16631|Q5EB53|Q9HBZ1|Q9UMJ7|Q9UNL5	Silent	SNP	pfam_Somatotropin,superfamily_4_helix_cytokine-like_core,prints_Somatotropin	p.N178	ENST00000323322.5	37	c.534	CCDS11653.1	17																																																																																			GH1	-	pfam_Somatotropin,superfamily_4_helix_cytokine-like_core	ENSG00000259384		0.547	GH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GH1	HGNC	protein_coding	OTTHUMT00000417708.1	-	0.00	330	0	G	NM_000515		61994789	-1	tier1	-	no_errors	ENST00000323322	ensembl	human	known	74_37	silent	79.50	74	287	SNP	0.562	A
GHSR	2693	genome.wustl.edu	37	3	172163075	172163076	+	Frame_Shift_Ins	INS	-	-	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr3:172163075_172163076insT	ENST00000241256.2	-	2	1018_1019	c.976_977insA	c.(976-978)atgfs	p.M326fs		NM_198407.2	NP_940799.1	Q92847	GHSR_HUMAN	growth hormone secretagogue receptor	326					actin polymerization or depolymerization (GO:0008154)|adult feeding behavior (GO:0008343)|cellular response to insulin stimulus (GO:0032869)|decidualization (GO:0046697)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone secretion (GO:0030252)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin secretion (GO:0046676)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of appetite (GO:0032100)|positive regulation of fatty acid metabolic process (GO:0045923)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of multicellular organism growth (GO:0040018)|regulation of hindgut contraction (GO:0043134)|regulation of synapse assembly (GO:0051963)|response to food (GO:0032094)|response to hormone (GO:0009725)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|growth hormone secretagogue receptor activity (GO:0001616)|growth hormone-releasing hormone receptor activity (GO:0016520)|peptide hormone binding (GO:0017046)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	33	Ovarian(172;0.00143)|Breast(254;0.197)		Lung(28;3.93e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			CTTCTTGGACATGATGTTGTAC	0.515																																					Esophageal Squamous(93;641 1401 20883 29581 34638)												0																																										SO:0001589	frameshift_variant	0			AY429112	CCDS3218.1, CCDS46959.1	3q26.31	2012-08-08			ENSG00000121853	ENSG00000121853		"""GPCR / Class A : Ghrelin receptors"""	4267	protein-coding gene	gene with protein product		601898				8688086	Standard	NM_198407		Approved		uc003fib.2	Q92847	OTTHUMG00000156946	ENST00000241256.2:c.977dupA	3.37:g.172163076_172163076dupT	ENSP00000241256:p.Met326fs		Q14D12|Q6ISR8|Q92848|Q96RJ7	Frame_Shift_Ins	INS	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_GHS-R,prints_GPCR_Rhodpsn	p.M326fs	ENST00000241256.2	37	c.977_976	CCDS3218.1	3																																																																																			GHSR	-	pfam_7TM_GPCR_serpentine_rcpt_Srw,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,prints_GPCR_Rhodpsn	ENSG00000121853		0.515	GHSR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GHSR	HGNC	protein_coding	OTTHUMT00000346728.1		0.00	53	0	-	NM_004122		172163076	-1	tier1		no_errors	ENST00000241256	ensembl	human	known	74_37	frame_shift_ins	35.00	52	28	INS	1.000:1.000	T
GJD2	57369	genome.wustl.edu	37	15	35044811	35044811	+	Silent	SNP	G	G	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr15:35044811G>T	ENST00000290374.4	-	2	1310	c.834C>A	c.(832-834)cgC>cgA	p.R278R	RP11-814P5.1_ENST00000558707.1_RNA|RP11-814P5.1_ENST00000503496.1_RNA	NM_020660.2	NP_065711.1	Q9UKL4	CXD2_HUMAN	gap junction protein, delta 2, 36kDa	278					action potential (GO:0001508)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|pancreas(1)|urinary_tract(1)	19		all_lung(180;9.67e-07)		all cancers(64;2.75e-18)|GBM - Glioblastoma multiforme(113;1.9e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0156)		GCTTGATCTTGCGCCATCCCA	0.512																																																	0													128.0	106.0	113.0					15																	35044811		2201	4298	6499	SO:0001819	synonymous_variant	0			AB037509	CCDS10040.1	15q13.1	2008-02-04	2007-11-06	2007-11-06	ENSG00000159248	ENSG00000159248		"""Ion channels / Gap junction proteins (connexins)"""	19154	protein-coding gene	gene with protein product	"""connexin 36"""	607058	"""gap junction protein, alpha 9, 36kDa"""	GJA9		10462698	Standard	NM_020660		Approved	CX36	uc001zis.2	Q9UKL4	OTTHUMG00000129674	ENST00000290374.4:c.834C>A	15.37:g.35044811G>T			Q2M241|Q9P2R0	Silent	SNP	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin,prints_Connexin36	p.R278	ENST00000290374.4	37	c.834	CCDS10040.1	15																																																																																			GJD2	-	NULL	ENSG00000159248		0.512	GJD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GJD2	HGNC	protein_coding	OTTHUMT00000251875.2		0.00	60	0	G			35044811	-1			no_errors	ENST00000290374	ensembl	human	known	74_37	silent	5.08	56	3	SNP	1.000	T
GLI3	2737	genome.wustl.edu	37	7	42017206	42017206	+	Nonsense_Mutation	SNP	G	G	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr7:42017206G>C	ENST00000395925.3	-	12	1847	c.1763C>G	c.(1762-1764)tCa>tGa	p.S588*	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	588					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						AGAGGCATTTGAGAAAGCCTT	0.458									Pallister-Hall syndrome;Greig Cephalopolysyndactyly		OREG0018015	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													241.0	197.0	212.0					7																	42017206		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	;		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.1763C>G	7.37:g.42017206G>C	ENSP00000379258:p.Ser588*	905	A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Nonsense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S588*	ENST00000395925.3	37	c.1763	CCDS5465.1	7	.	.	.	.	.	.	.	.	.	.	G	41	8.781045	0.98952	.	.	ENSG00000106571	ENST00000395925	.	.	.	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.1092	0.97906	0.0:0.0:1.0:0.0	.	.	.	.	X	588	.	ENSP00000379258:S588X	S	-	2	0	GLI3	41983731	1.000000	0.71417	0.964000	0.40570	0.812000	0.45895	9.807000	0.99171	2.745000	0.94114	0.655000	0.94253	TCA	GLI3	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000106571		0.458	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLI3	HGNC	protein_coding	OTTHUMT00000250806.3	-	0.00	168	0	G	NM_000168		42017206	-1	tier1	-	no_errors	ENST00000395925	ensembl	human	known	74_37	nonsense	26.42	142	51	SNP	1.000	C
GPR83	10888	genome.wustl.edu	37	11	94134350	94134350	+	Missense_Mutation	SNP	C	C	A	rs543076194		TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr11:94134350C>A	ENST00000243673.2	-	1	235	c.64G>T	c.(64-66)Ggc>Tgc	p.G22C	GPR83_ENST00000539203.2_Missense_Mutation_p.G22C	NM_016540.3	NP_057624.3	Q9NYM4	GPR83_HUMAN	G protein-coupled receptor 83	22					response to glucocorticoid (GO:0051384)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide Y receptor activity (GO:0004983)			NS(1)|breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)	19		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				TCGGCCCGGCCCTCGTGGGGC	0.662																																																	0													28.0	31.0	30.0					11																	94134350		2196	4295	6491	SO:0001583	missense	0			AF236081	CCDS8297.1	11q21	2012-08-21	2003-07-30	2003-08-01	ENSG00000123901	ENSG00000123901		"""GPCR / Class A : Orphans"""	4523	protein-coding gene	gene with protein product		605569	"""G protein-coupled receptor 72"""	GPR72		10760605, 11060465	Standard	NM_016540		Approved		uc001pet.2	Q9NYM4	OTTHUMG00000167779	ENST00000243673.2:c.64G>T	11.37:g.94134350C>A	ENSP00000243673:p.Gly22Cys		B0M0K5|Q6NWR4|Q9P1Y8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_NPY_rcpt	p.G22C	ENST00000243673.2	37	c.64	CCDS8297.1	11	.	.	.	.	.	.	.	.	.	.	C	10.71	1.427681	0.25726	.	.	ENSG00000123901	ENST00000243673;ENST00000539203	T;T	0.61274	0.12;0.22	4.04	1.46	0.22682	.	0.559883	0.16727	N	0.202027	T	0.31104	0.0786	N	0.08118	0	0.09310	N	1	B	0.30709	0.291	B	0.27262	0.078	T	0.16689	-1.0394	10	0.56958	D	0.05	.	5.4474	0.16544	0.0:0.3237:0.0:0.6763	.	22	Q9NYM4	GPR83_HUMAN	C	22	ENSP00000243673:G22C;ENSP00000441550:G22C	ENSP00000243673:G22C	G	-	1	0	GPR83	93773998	0.000000	0.05858	0.058000	0.19502	0.053000	0.15095	0.070000	0.14573	0.218000	0.20820	0.462000	0.41574	GGC	GPR83	-	NULL	ENSG00000123901		0.662	GPR83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR83	HGNC	protein_coding	OTTHUMT00000396232.1	-	0.00	17	0	C	NM_016540		94134350	-1	tier1	-	no_errors	ENST00000243673	ensembl	human	known	74_37	missense	78.57	3	11	SNP	0.001	A
GPRC6A	222545	genome.wustl.edu	37	6	117113916	117113916	+	Missense_Mutation	SNP	T	T	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr6:117113916T>G	ENST00000310357.3	-	6	2191	c.2170A>C	c.(2170-2172)Atc>Ctc	p.I724L	GPRC6A_ENST00000368549.3_Missense_Mutation_p.I653L|GPRC6A_ENST00000530250.1_Missense_Mutation_p.I549L	NM_148963.2	NP_683766.2	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, class C, group 6, member A	724					calcium-mediated signaling (GO:0019722)|response to amino acid (GO:0043200)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|liver(1)|lung(24)|ovary(5)|pancreas(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)	65		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		GCTGCAAAGATTAGCCAGAGT	0.473																																																	0													77.0	72.0	74.0					6																	117113916		2203	4300	6503	SO:0001583	missense	0			AF502962	CCDS5112.1, CCDS69184.1, CCDS69185.1	6q22.31	2014-01-30	2014-01-30		ENSG00000173612	ENSG00000173612		"""GPCR / Class C : Calcium-sensing receptors"""	18510	protein-coding gene	gene with protein product			"""G protein-coupled receptor, family C, group 6, member A"""				Standard	NM_001286354		Approved	bA86F4.3	uc003pxj.1	Q5T6X5	OTTHUMG00000015447	ENST00000310357.3:c.2170A>C	6.37:g.117113916T>G	ENSP00000309493:p.Ile724Leu		Q6JK43|Q6JK44|Q8NGU8|Q8NHZ9|Q8TDT6	Missense_Mutation	SNP	pfam_GPCR_3_C,pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_vmron_rcpt_2	p.I724L	ENST00000310357.3	37	c.2170	CCDS5112.1	6	.	.	.	.	.	.	.	.	.	.	T	1.346	-0.592659	0.03771	.	.	ENSG00000173612	ENST00000310357;ENST00000368549;ENST00000530250	D;D;D	0.88046	-2.33;-2.33;-2.33	4.37	-3.12	0.05282	GPCR, family 3, C-terminal (2);	0.692519	0.12698	N	0.446581	T	0.45094	0.1325	N	0.08118	0	0.09310	N	1	B;B;B	0.13145	0.002;0.007;0.003	B;B;B	0.16289	0.008;0.015;0.015	T	0.50372	-0.8836	10	0.10902	T	0.67	.	6.8402	0.23959	0.0:0.4594:0.1442:0.3964	.	653;549;724	Q5T6X5-3;Q5T6X5-2;Q5T6X5	.;.;GPC6A_HUMAN	L	724;653;549	ENSP00000309493:I724L;ENSP00000357537:I653L;ENSP00000433465:I549L	ENSP00000309493:I724L	I	-	1	0	GPRC6A	117220609	0.000000	0.05858	0.000000	0.03702	0.233000	0.25261	-0.724000	0.04947	-0.346000	0.08312	-0.353000	0.07706	ATC	GPRC6A	-	pfam_GPCR_3_C,pfscan_GPCR_3_C,prints_GPCR_3	ENSG00000173612		0.473	GPRC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRC6A	HGNC	protein_coding	OTTHUMT00000041966.2	-	0.00	38	0	T			117113916	-1	tier1	-	no_errors	ENST00000310357	ensembl	human	known	74_37	missense	38.24	21	13	SNP	0.000	G
GRAMD4	23151	genome.wustl.edu	37	22	47022732	47022732	+	Silent	SNP	T	T	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr22:47022732T>C	ENST00000406902.1	+	2	249	c.36T>C	c.(34-36)ggT>ggC	p.G12G	GRAMD4_ENST00000361034.3_Silent_p.G12G			Q6IC98	GRAM4_HUMAN	GRAM domain containing 4	12					apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	12		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.166)		GGTTCAGAGGTCACAAGAGAG	0.567																																																	0													167.0	136.0	147.0					22																	47022732		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS33672.1	22q13.31	2008-03-03			ENSG00000075240	ENSG00000075240			29113	protein-coding gene	gene with protein product	"""death-inducing-protein"""	613691				15565177	Standard	NM_015124		Approved	KIAA0767, DIP	uc003bhx.3	Q6IC98	OTTHUMG00000150402	ENST00000406902.1:c.36T>C	22.37:g.47022732T>C			A9IN51|A9IN57|Q68EN0|Q9UGE6|Q9Y4B9	Silent	SNP	pfam_GRAM,smart_GRAM	p.G12	ENST00000406902.1	37	c.36	CCDS33672.1	22																																																																																			GRAMD4	-	NULL	ENSG00000075240		0.567	GRAMD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRAMD4	HGNC	protein_coding	OTTHUMT00000317969.1	-	0.00	48	0	T	NM_015124		47022732	+1	tier1	-	no_errors	ENST00000361034	ensembl	human	known	74_37	silent	34.21	25	13	SNP	1.000	C
GRAMD4	23151	genome.wustl.edu	37	22	47072525	47072525	+	Nonsense_Mutation	SNP	C	C	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr22:47072525C>G	ENST00000406902.1	+	18	1805	c.1592C>G	c.(1591-1593)tCa>tGa	p.S531*	GRAMD4_ENST00000408031.1_Nonsense_Mutation_p.S54*|GRAMD4_ENST00000361034.3_Nonsense_Mutation_p.S531*			Q6IC98	GRAM4_HUMAN	GRAM domain containing 4	531					apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	12		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.166)		CTCCCAGGCTCAGGCATGGGG	0.662																																																	0													50.0	30.0	37.0					22																	47072525		1897	3604	5501	SO:0001587	stop_gained	0				CCDS33672.1	22q13.31	2008-03-03			ENSG00000075240	ENSG00000075240			29113	protein-coding gene	gene with protein product	"""death-inducing-protein"""	613691				15565177	Standard	NM_015124		Approved	KIAA0767, DIP	uc003bhx.3	Q6IC98	OTTHUMG00000150402	ENST00000406902.1:c.1592C>G	22.37:g.47072525C>G	ENSP00000385689:p.Ser531*		A9IN51|A9IN57|Q68EN0|Q9UGE6|Q9Y4B9	Nonsense_Mutation	SNP	pfam_GRAM,smart_GRAM	p.S531*	ENST00000406902.1	37	c.1592	CCDS33672.1	22	.	.	.	.	.	.	.	.	.	.	c	26.9	4.785738	0.90282	.	.	ENSG00000075240	ENST00000406902;ENST00000361034;ENST00000408031	.	.	.	4.24	4.24	0.50183	.	0.370808	0.21435	U	0.074589	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-0.4015	13.3649	0.60678	0.0:1.0:0.0:0.0	.	.	.	.	X	531;531;54	.	ENSP00000354313:S531X	S	+	2	0	GRAMD4	45451189	0.527000	0.26306	0.711000	0.30485	0.631000	0.37964	2.116000	0.41930	1.901000	0.55032	0.448000	0.29417	TCA	GRAMD4	-	NULL	ENSG00000075240		0.662	GRAMD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRAMD4	HGNC	protein_coding	OTTHUMT00000317969.1	-	0.00	74	0	C	NM_015124		47072525	+1	tier1	-	no_errors	ENST00000361034	ensembl	human	known	74_37	nonsense	16.30	77	15	SNP	0.780	G
GRIP1	23426	genome.wustl.edu	37	12	66839162	66839162	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr12:66839162G>T	ENST00000398016.3	-	11	1393	c.1325C>A	c.(1324-1326)aCa>aAa	p.T442K	GRIP1_ENST00000359742.4_Missense_Mutation_p.T494K|GRIP1_ENST00000286445.7_Missense_Mutation_p.T494K	NM_021150.3	NP_066973.2	Q96DT0	LEG12_HUMAN	glutamate receptor interacting protein 1	0					intrinsic apoptotic signaling pathway (GO:0097193)	nucleus (GO:0005634)	lactose binding (GO:0030395)			NS(3)|breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(19)|ovary(2)|prostate(2)|skin(1)	50			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		GAGAGTTTCTGTGGCAAACAC	0.507																																																	0													101.0	105.0	103.0					12																	66839162		1973	4168	6141	SO:0001583	missense	0			AJ133439	CCDS41807.1	12q13.13	2008-05-02			ENSG00000155974	ENSG00000155974			18708	protein-coding gene	gene with protein product		604597				10197531	Standard	NM_021150		Approved		uc001stk.3	Q9Y3R0	OTTHUMG00000169019	ENST00000398016.3:c.1325C>A	12.37:g.66839162G>T	ENSP00000381098:p.Thr442Lys		B2R9N2|G5E970|Q96DS9|Q96PR9|Q9H258|Q9H259|Q9NZ02	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.T494K	ENST00000398016.3	37	c.1481	CCDS41807.1	12	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	21.8|21.8|21.8	4.196812|4.196812|4.196812	0.79015|0.79015|0.79015	.|.|.	.|.|.	ENSG00000155974|ENSG00000155974|ENSG00000155974	ENST00000543172|ENST00000538164|ENST00000398016;ENST00000359742;ENST00000286445;ENST00000538211;ENST00000540433;ENST00000536215	.|.|T;T;T;T;T;T	.|.|0.25579	.|.|1.79;1.79;1.79;1.79;1.79;1.79	4.75|4.75|4.75	4.75|4.75|4.75	0.60458|0.60458|0.60458	.|.|PDZ/DHR/GLGF (4);	.|.|0.000000	.|.|0.85682	.|.|D	.|.|0.000000	T|T|T	0.48960|0.48960|0.48960	0.1529|0.1529|0.1529	M|M|M	0.62154|0.62154|0.62154	1.92|1.92|1.92	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|.|D;D;D;D	.|.|0.89917	.|.|1.0;0.979;0.993;0.999	.|.|D;D;D;D	.|.|0.81914	.|.|0.995;0.946;0.923;0.982	T|T|T	0.45440|0.45440|0.45440	-0.9261|-0.9261|-0.9261	5|5|9	.|.|.	.|.|.	.|.|.	-10.7717|-10.7717|-10.7717	17.7406|17.7406|17.7406	0.88406|0.88406|0.88406	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	.|.|442;494;442;494	.|.|F5H4N6;Q9Y3R0;Q9Y3R0-3;Q9Y3R0-2	.|.|.;GRIP1_HUMAN;.;.	Q|K|K	261|309|442;494;494;442;386;334	.|.|ENSP00000381098:T442K;ENSP00000352780:T494K;ENSP00000286445:T494K;ENSP00000446047:T442K;ENSP00000446024:T386K;ENSP00000446011:T334K	.|.|.	H|Q|T	-|-|-	3|1|2	2|0|0	GRIP1|GRIP1|GRIP1	65125429|65125429|65125429	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.998000|0.998000|0.998000	0.56505|0.56505|0.56505	0.684000|0.684000|0.684000	0.39900|0.39900|0.39900	9.471000|9.471000|9.471000	0.97696|0.97696|0.97696	2.172000|2.172000|2.172000	0.68678|0.68678|0.68678	0.442000|0.442000|0.442000	0.29010|0.29010|0.29010	CAC|CAG|ACA	GRIP1	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000155974		0.507	GRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIP1	HGNC	protein_coding	OTTHUMT00000401975.2	-	0.00	38	0	G			66839162	-1	tier1	-	no_errors	ENST00000359742	ensembl	human	known	74_37	missense	26.47	50	18	SNP	1.000	T
GSTT2B	653689	genome.wustl.edu	37	22	24300541	24300541	+	Silent	SNP	C	C	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr22:24300541C>A	ENST00000290765.4	-	4	510	c.456G>T	c.(454-456)ggG>ggT	p.G152G	GSTT2B_ENST00000404172.3_Silent_p.G152G	NM_001080843.2	NP_001074312.1	P0CG30	GSTT2_HUMAN	glutathione S-transferase theta 2B (gene/pseudogene)	152	GST C-terminal.				glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glutathione transferase activity (GO:0004364)										AGGGCCTGTCCCCCAGGAACT	0.642																																																	0													13.0	11.0	12.0					22																	24300541		2182	4247	6429	SO:0001819	synonymous_variant	0			BC071700	CCDS33617.1	22q11.23	2012-06-21			ENSG00000133433	ENSG00000133433	2.5.1.18	"""Glutathione S-transferases / Soluble"""	33437	protein-coding gene	gene with protein product						9729470	Standard	NM_001080843		Approved	GSTT2P		P0CG30	OTTHUMG00000150774	ENST00000290765.4:c.456G>T	22.37:g.24300541C>A			O60665|P30712|Q6IPV7|Q9HD76	Silent	SNP	pfam_Glutathione_S-Trfase_N,pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold	p.G152	ENST00000290765.4	37	c.456	CCDS33617.1	22																																																																																			GSTT2B	-	pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like	ENSG00000133433		0.642	GSTT2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSTT2B	HGNC	protein_coding	OTTHUMT00000320012.1	-	0.00	63	0	C	NM_001080843		24300541	-1	tier1	-	no_errors	ENST00000290765	ensembl	human	known	74_37	silent	43.86	32	25	SNP	0.489	A
GSTT2	2953	genome.wustl.edu	37	22	24325166	24325166	+	Silent	SNP	G	G	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr22:24325166G>T	ENST00000215780.5	+	4	506	c.456G>T	c.(454-456)ggG>ggT	p.G152G	GSTT2_ENST00000402588.3_Silent_p.G152G|DDT_ENST00000404092.1_5'Flank	NM_000854.3	NP_000845.1	P0CG29	GST2_HUMAN	glutathione S-transferase theta 2	152	GST C-terminal.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	glutathione transferase activity (GO:0004364)			lung(1)	1						AGTTCCTGGGGGACAGGCCCT	0.632																																																	0													14.0	15.0	15.0					22																	24325166		2049	3955	6004	SO:0001819	synonymous_variant	0			L38503		22q11.23	2012-06-21			ENSG00000099984	ENSG00000099984	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4642	protein-coding gene	gene with protein product		600437				7789971, 9729470	Standard	NM_000854		Approved		uc002zyw.4	P0CG29	OTTHUMG00000150786	ENST00000215780.5:c.456G>T	22.37:g.24325166G>T			O60665|P30712|Q6IPV7|Q9HD76	Silent	SNP	pfam_Glutathione_S-Trfase_N,pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold	p.G152	ENST00000215780.5	37	c.456	CCDS13821.1	22																																																																																			GSTT2	-	pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like	ENSG00000099984		0.632	GSTT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSTT2	HGNC	protein_coding	OTTHUMT00000320080.1		0.00	45	0	G	NM_000854		24325166	+1			no_errors	ENST00000215780	ensembl	human	known	74_37	silent	7.27	49	4	SNP	0.504	T
GTF2H1	2965	genome.wustl.edu	37	11	18361125	18361125	+	Silent	SNP	C	C	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr11:18361125C>G	ENST00000265963.4	+	5	688	c.528C>G	c.(526-528)ccC>ccG	p.P176P	GTF2H1_ENST00000524753.4_5'UTR|GTF2H1_ENST00000534641.1_Silent_p.P60P|GTF2H1_ENST00000453096.2_Silent_p.P176P	NM_005316.3	NP_005307.1	P32780	TF2H1_HUMAN	general transcription factor IIH, polypeptide 1, 62kDa	176					7-methylguanosine mRNA capping (GO:0006370)|ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|gene expression (GO:0010467)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	core TFIIH complex (GO:0000439)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	20						ATGTCCGGCCCCAAACTGATG	0.438								Nucleotide excision repair (NER)																																									0													140.0	127.0	132.0					11																	18361125		2199	4293	6492	SO:0001819	synonymous_variant	0				CCDS7838.1	11p15.1-p14	2012-11-05	2002-08-29		ENSG00000110768	ENSG00000110768		"""General transcription factors"", ""General transcription factor IIH complex subunits"""	4655	protein-coding gene	gene with protein product		189972	"""general transcription factor IIH, polypeptide 1 (62kD subunit)"""			1529339, 8162052	Standard	NM_005316		Approved	BTF2, P62, TFIIH	uc001moh.2	P32780	OTTHUMG00000167690	ENST00000265963.4:c.528C>G	11.37:g.18361125C>G			B3KXE0|D3DQY2|Q6I9Y7|Q9H5K5|Q9NQD9	Silent	SNP	pfam_BSD,pfam_TFIIH_BTF_p62_N,smart_BSD,pfscan_BSD	p.P176	ENST00000265963.4	37	c.528	CCDS7838.1	11																																																																																			GTF2H1	-	NULL	ENSG00000110768		0.438	GTF2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF2H1	HGNC	protein_coding	OTTHUMT00000395627.2	-	0.00	84	0	C	NM_005316		18361125	+1	tier1	-	no_errors	ENST00000265963	ensembl	human	known	74_37	silent	31.15	42	19	SNP	0.993	G
H1FX	8971	genome.wustl.edu	37	3	129034552	129034552	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr3:129034552G>C	ENST00000333762.4	-	1	568	c.194C>G	c.(193-195)tCg>tGg	p.S65W	H1FX-AS1_ENST00000433902.2_RNA|H1FX-AS1_ENST00000511998.1_RNA|H1FX-AS1_ENST00000383461.2_RNA|H1FX-AS1_ENST00000537780.1_RNA|H1FX-AS1_ENST00000502789.2_RNA	NM_006026.3	NP_006017.1	Q92522	H1X_HUMAN	H1 histone family, member X	65	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)	nucleolus (GO:0005730)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			kidney(1)|ovary(1)|urinary_tract(2)	4						GGCCAGCGACGAGCCGTTGCG	0.582																																																	0													47.0	29.0	35.0					3																	129034552		2203	4298	6501	SO:0001583	missense	0			D64142	CCDS3057.1	3q21.3	2011-08-16			ENSG00000184897	ENSG00000184897		"""Histones / Replication-independent"""	4722	protein-coding gene	gene with protein product		602785				8964515, 9439656	Standard	NM_006026		Approved	MGC15959, MGC8350, H1X	uc003elx.3	Q92522	OTTHUMG00000159450	ENST00000333762.4:c.194C>G	3.37:g.129034552G>C	ENSP00000329662:p.Ser65Trp			Missense_Mutation	SNP	pfam_Histone_H1/H5_H15,smart_Histone_H1/H5_H15,prints_Histone_H5	p.S65W	ENST00000333762.4	37	c.194	CCDS3057.1	3	.	.	.	.	.	.	.	.	.	.	G	12.19	1.862199	0.32884	.	.	ENSG00000184897	ENST00000333762	T	0.38560	1.13	3.53	2.64	0.31445	Histone H1/H5 (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.64402	U	0.000009	T	0.70413	0.3221	H	0.95043	3.615	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.73030	-0.4111	10	0.87932	D	0	-16.9495	8.6275	0.33899	0.1207:0.0:0.8793:0.0	.	65	Q92522	H1X_HUMAN	W	65	ENSP00000329662:S65W	ENSP00000329662:S65W	S	-	2	0	H1FX	130517242	1.000000	0.71417	0.991000	0.47740	0.125000	0.20455	2.679000	0.46909	0.459000	0.27016	0.462000	0.41574	TCG	H1FX	-	pfam_Histone_H1/H5_H15,smart_Histone_H1/H5_H15	ENSG00000184897		0.582	H1FX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	H1FX	HGNC	protein_coding	OTTHUMT00000355455.2	-	0.00	33	0	G	NM_006026		129034552	-1	tier1	-	no_errors	ENST00000333762	ensembl	human	known	74_37	missense	17.39	38	8	SNP	0.999	C
HCAR2	338442	genome.wustl.edu	37	12	123187417	123187417	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr12:123187417C>G	ENST00000328880.5	-	1	473	c.414G>C	c.(412-414)aaG>aaC	p.K138N	HCAR1_ENST00000356987.2_Intron|RP11-324E6.6_ENST00000543611.1_lincRNA	NM_177551.3	NP_808219.1	Q8TDS4	HCAR2_HUMAN	hydroxycarboxylic acid receptor 2	138					negative regulation of lipid catabolic process (GO:0050995)|neutrophil apoptotic process (GO:0001781)|positive regulation of adiponectin secretion (GO:0070165)|positive regulation of neutrophil apoptotic process (GO:0033031)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nicotinic acid receptor activity (GO:0070553)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	15					Niacin(DB00627)	GATTGGAGATCTTGTTCAGGG	0.552																																																	0													129.0	115.0	120.0					12																	123187417		2203	4300	6503	SO:0001583	missense	0			AY148884	CCDS9235.1	12q24.31	2012-08-08	2011-05-30	2011-05-30	ENSG00000182782	ENSG00000182782		"""GPCR / Class A : Hydroxy-carboxylic acid receptors"""	24827	protein-coding gene	gene with protein product	"""niacin receptor 1"""	609163	"""G protein-coupled receptor 109A"""	GPR109A		21167710, 12522134, 12646212, 19141678, 18983141, 21454438	Standard	NM_177551		Approved	HCA2, HM74A, PUMAG, Puma-g, NIACR1	uc001ucx.1	Q8TDS4	OTTHUMG00000162722	ENST00000328880.5:c.414G>C	12.37:g.123187417C>G	ENSP00000375066:p.Lys138Asn		A0PJL5|A7LGG3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.K138N	ENST00000328880.5	37	c.414	CCDS9235.1	12	.	.	.	.	.	.	.	.	.	.	C	16.54	3.152617	0.57259	.	.	ENSG00000182782	ENST00000328880;ENST00000536970	T	0.73258	-0.73	5.55	2.6	0.31112	GPCR, rhodopsin-like superfamily (1);	0.312349	0.26746	N	0.022711	T	0.66742	0.2820	L	0.52759	1.655	0.27401	N	0.954857	P	0.43633	0.813	P	0.50270	0.636	T	0.56013	-0.8049	10	0.28530	T	0.3	-18.8221	4.5217	0.11962	0.1461:0.4908:0.2836:0.0796	.	138	Q8TDS4	HCAR2_HUMAN	N	138	ENSP00000375066:K138N	ENSP00000375066:K138N	K	-	3	2	HCAR2	121753370	0.929000	0.31497	1.000000	0.80357	0.995000	0.86356	0.380000	0.20602	0.885000	0.36088	0.655000	0.94253	AAG	HCAR2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000182782		0.552	HCAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCAR2	HGNC	protein_coding	OTTHUMT00000370202.1	-	0.00	75	0	C	NM_177551		123187417	-1	tier1	-	no_errors	ENST00000328880	ensembl	human	known	74_37	missense	42.70	51	38	SNP	0.998	G
HCLS1	3059	genome.wustl.edu	37	3	121356020	121356020	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr3:121356020C>T	ENST00000314583.3	-	7	629	c.538G>A	c.(538-540)Gag>Aag	p.E180K	HCLS1_ENST00000428394.2_Intron|HCLS1_ENST00000473883.1_5'UTR	NM_005335.4	NP_005326	P14317	HCLS1_HUMAN	hematopoietic cell-specific Lyn substrate 1	180					actin filament polymerization (GO:0030041)|cellular response to cytokine stimulus (GO:0071345)|erythrocyte differentiation (GO:0030218)|intracellular signal transduction (GO:0035556)|negative regulation of leukocyte apoptotic process (GO:2000107)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell proliferation (GO:0008284)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|regulation of actin filament polymerization (GO:0030833)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	protein kinase binding (GO:0019901)|RNA polymerase II transcription factor binding (GO:0001085)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				GBM - Glioblastoma multiforme(114;0.0912)		TTCTCCGTCTCTCCCTTGTAG	0.542																																																	0													176.0	150.0	159.0					3																	121356020		2203	4300	6503	SO:0001583	missense	0				CCDS3003.1	3q13	2007-08-03			ENSG00000180353	ENSG00000180353			4844	protein-coding gene	gene with protein product	"""cortactin-like"""	601306				8978766, 15710041	Standard	NM_001292041		Approved	HS1, CTTNL	uc003eeh.4	P14317	OTTHUMG00000159409	ENST00000314583.3:c.538G>A	3.37:g.121356020C>T	ENSP00000320176:p.Glu180Lys		B4DQ69|Q53Y93|Q6IBK9|Q9UDK0	Missense_Mutation	SNP	pfam_Hs1_Cortactin,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_Hs1_Cortactin,pfscan_SH3_domain,prints_SH3_domain,prints_p67phox	p.E180K	ENST00000314583.3	37	c.538	CCDS3003.1	3	.	.	.	.	.	.	.	.	.	.	C	14.55	2.568213	0.45798	.	.	ENSG00000180353	ENST00000314583	T	0.15952	2.38	5.15	5.15	0.70609	.	0.096585	0.64402	D	0.000001	T	0.14442	0.0349	N	0.03209	-0.39	0.80722	D	1	D	0.55605	0.972	P	0.60012	0.867	T	0.06516	-1.0822	10	0.02654	T	1	-24.1848	16.1241	0.81380	0.0:1.0:0.0:0.0	.	180	P14317	HCLS1_HUMAN	K	180	ENSP00000320176:E180K	ENSP00000320176:E180K	E	-	1	0	HCLS1	122838710	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.140000	0.50585	2.398000	0.81561	0.655000	0.94253	GAG	HCLS1	-	pfam_Hs1_Cortactin,pfscan_Hs1_Cortactin	ENSG00000180353		0.542	HCLS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCLS1	HGNC	protein_coding	OTTHUMT00000355144.1	-	0.00	96	0	C	NM_005335		121356020	-1	tier1	-	no_errors	ENST00000314583	ensembl	human	known	74_37	missense	40.69	86	59	SNP	1.000	T
HDHD1	8226	genome.wustl.edu	37	X	6995436	6995436	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chrX:6995436G>A	ENST00000381077.5	-	3	411	c.335C>T	c.(334-336)gCc>gTc	p.A112V	HDHD1_ENST00000424830.2_Missense_Mutation_p.A135V|HDHD1_ENST00000540122.1_Missense_Mutation_p.A112V|HDHD1_ENST00000412827.2_Missense_Mutation_p.A69V	NM_001178136.1|NM_012080.4	NP_001171607.1|NP_036212.3	Q08623	HDHD1_HUMAN	haloacid dehalogenase-like hydrolase domain containing 1	112					nucleotide metabolic process (GO:0009117)	extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|phosphatase activity (GO:0016791)			breast(2)|large_intestine(1)|lung(3)	6						CGAGCTGGTGGCCAGTGCAAA	0.597																																																	0													50.0	50.0	50.0					X																	6995436		2070	4189	6259	SO:0001583	missense	0			M86934	CCDS48075.1, CCDS48076.1, CCDS55366.1, CCDS55367.1	Xp22.32	2010-07-21	2010-07-21	2010-07-21	ENSG00000130021	ENSG00000130021			16818	protein-coding gene	gene with protein product		306480	"""family with sequence similarity 16, member A, X-linked"", ""haloacid dehalogenase-like hydrolase domain containing 1A"""	FAM16AX, HDHD1A		1734713, 1284467	Standard	NM_012080		Approved	DXF68S1E, GS1	uc011mhm.1	Q08623	OTTHUMG00000021101	ENST00000381077.5:c.335C>T	X.37:g.6995436G>A	ENSP00000370467:p.Ala112Val		B2R7X6|B4DV93|B7Z6Q3|E9PAV8|F5GWZ2|Q53F84|Q96EB8	Missense_Mutation	SNP	pfam_HAD-like_dom,superfamily_HAD-like_dom,tigrfam_HAD-SF_hydro_IA	p.A135V	ENST00000381077.5	37	c.404	CCDS48075.1	X	.	.	.	.	.	.	.	.	.	.	G	15.71	2.912814	0.52439	.	.	ENSG00000130021	ENST00000381077;ENST00000544385;ENST00000412827;ENST00000424830;ENST00000540122;ENST00000486446	T;T;T;T;T	0.04603	3.59;3.59;3.59;3.59;3.59	3.88	3.88	0.44766	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (2);	0.108992	0.64402	D	0.000008	T	0.17619	0.0423	M	0.64260	1.97	0.80722	D	1	D;P;D;D	0.89917	1.0;0.817;0.979;0.967	D;P;P;P	0.74674	0.984;0.692;0.905;0.793	T	0.00763	-1.1576	10	0.72032	D	0.01	-23.8194	14.2329	0.65906	0.0:0.0:1.0:0.0	.	112;69;135;112	Q08623-3;Q08623-2;E9PAV8;Q08623	.;.;.;HDHD1_HUMAN	V	112;128;69;135;112;112	ENSP00000370467:A112V;ENSP00000406260:A69V;ENSP00000396452:A135V;ENSP00000441208:A112V;ENSP00000430995:A112V	ENSP00000370467:A112V	A	-	2	0	HDHD1	7005436	1.000000	0.71417	0.966000	0.40874	0.061000	0.15899	4.811000	0.62606	1.713000	0.51359	0.513000	0.50165	GCC	HDHD1	-	pfam_HAD-like_dom,superfamily_HAD-like_dom,tigrfam_HAD-SF_hydro_IA	ENSG00000130021		0.597	HDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDHD1	HGNC	protein_coding	OTTHUMT00000055683.2	-	0.00	69	0	G	NM_012080		6995436	-1	tier1	-	no_errors	ENST00000424830	ensembl	human	known	74_37	missense	88.00	12	88	SNP	1.000	A
HECTD4	283450	genome.wustl.edu	37	12	112607445	112607445	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr12:112607445C>T	ENST00000430131.2	-	69	11949	c.10804G>A	c.(10804-10806)Gaa>Aaa	p.E3602K	HECTD4_ENST00000550722.1_Missense_Mutation_p.E3878K|HECTD4_ENST00000377560.5_Missense_Mutation_p.E3852K			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	3602					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										TAGGAGTTTTCAGAAGCTCTG	0.607																																																	0													44.0	51.0	49.0					12																	112607445		2010	4171	6181	SO:0001583	missense	0			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.10804G>A	12.37:g.112607445C>T	ENSP00000404379:p.Glu3602Lys		L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,superfamily_ConA-like_lec_gl_sf,smart_HECT,pfscan_HECT	p.E3852K	ENST00000430131.2	37	c.11554		12	.	.	.	.	.	.	.	.	.	.	C	23.1	4.375414	0.82682	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722;ENST00000547085	T;T;T	0.44083	0.93;0.93;0.93	5.88	5.88	0.94601	.	.	.	.	.	T	0.46889	0.1416	N	0.08118	0	0.58432	D	0.999999	P	0.52842	0.956	D	0.65010	0.931	T	0.56025	-0.8047	9	0.59425	D	0.04	.	20.2207	0.98324	0.0:1.0:0.0:0.0	.	3602	Q9Y4D8	K0614_HUMAN	K	3852;3602;3878;67	ENSP00000366783:E3852K;ENSP00000404379:E3602K;ENSP00000449784:E3878K	ENSP00000366783:E3852K	E	-	1	0	C12orf51	111091828	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.304000	0.78882	2.790000	0.95986	0.591000	0.81541	GAA	HECTD4	-	NULL	ENSG00000173064		0.607	HECTD4-202	KNOWN	basic	protein_coding	HECTD4	HGNC	protein_coding		-	0.00	20	0	C	NM_173813		112607445	-1	tier1	-	no_errors	ENST00000377560	ensembl	human	known	74_37	missense	25.00	18	6	SNP	1.000	T
HELZ2	85441	genome.wustl.edu	37	20	62194954	62194954	+	Silent	SNP	G	G	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr20:62194954G>A	ENST00000467148.1	-	8	5290	c.5221C>T	c.(5221-5223)Ctg>Ttg	p.L1741L	HELZ2_ENST00000427522.2_Silent_p.L1172L	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	1741					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										ACGAAGCCCAGCTTGTCCAGA	0.706																																																	0													7.0	9.0	8.0					20																	62194954		2096	4173	6269	SO:0001819	synonymous_variant	0			AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.5221C>T	20.37:g.62194954G>A			Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Silent	SNP	superfamily_P-loop_NTPase	p.L1741	ENST00000467148.1	37	c.5221	CCDS33508.1	20																																																																																			HELZ2	-	NULL	ENSG00000130589		0.706	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HELZ2	HGNC	protein_coding	OTTHUMT00000354127.1	-	0.00	31	0	G	NM_001037335		62194954	-1	tier1	-	no_errors	ENST00000467148	ensembl	human	known	74_37	silent	47.62	11	10	SNP	0.996	A
HGF	3082	genome.wustl.edu	37	7	81372751	81372752	+	Missense_Mutation	DNP	GC	GC	AA			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G|C	G|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr7:81372751_81372752GC>AA	ENST00000222390.5	-	7	1008_1009	c.782_783GC>TT	c.(781-783)cGC>cTT	p.R261L	HGF_ENST00000457544.2_Missense_Mutation_p.R256L|HGF_ENST00000453411.1_Missense_Mutation_p.R256L|HGF_ENST00000444829.2_Missense_Mutation_p.R261L	NM_000601.4	NP_000592.3	P14210	HGF_HUMAN	hepatocyte growth factor (hepapoietin A; scatter factor)	261	Kringle 2. {ECO:0000255|PROSITE- ProRule:PRU00121}.				activation of MAPK activity (GO:0000187)|blood coagulation (GO:0007596)|cell chemotaxis (GO:0060326)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epithelial to mesenchymal transition (GO:0001837)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|hyaluronan metabolic process (GO:0030212)|liver development (GO:0001889)|mitotic nuclear division (GO:0007067)|myoblast proliferation (GO:0051450)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of hydrogen peroxide-mediated programmed cell death (GO:1901299)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|organ regeneration (GO:0031100)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of cell migration (GO:0030335)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	catalytic activity (GO:0003824)|chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|identical protein binding (GO:0042802)			NS(2)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(41)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	75						CATCGGGATTGCGGCAATAATT	0.5																																																	0																																										SO:0001583	missense	0				CCDS5597.1, CCDS47626.1, CCDS47627.1, CCDS47628.1, CCDS47629.1	7q21.1	2009-09-11			ENSG00000019991	ENSG00000019991			4893	protein-coding gene	gene with protein product	"""hepatopoietin A"", ""fibroblast-derived tumor cytotoxic factor"", ""scatter factor"", ""lung fibroblast-derived mitogen"""	142409	"""deafness, autosomal recessive 39"""	DFNB39		1837206, 19576567	Standard	XM_006715956		Approved	SF, F-TCF, HGFB, HPTA	uc003uhl.3	P14210	OTTHUMG00000023804	ENST00000222390.5:c.782_783delinsAA	7.37:g.81372751_81372752delinsAA	ENSP00000222390:p.Arg261Leu		A1L3U6|Q02935|Q13494|Q14519|Q3KRB2|Q8TCE2|Q9BYL9|Q9BYM0|Q9UDU6	Silent|Missense_Mutation	SNP	pfam_Kringle,pfam_Peptidase_S1,pfam_PAN-1_domain,superfamily_Trypsin-like_Pept_dom,superfamily_Kringle-like,smart_Pan_app,smart_Kringle,smart_Peptidase_S1,pfscan_Pan_app,pfscan_Kringle,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.R261|p.R261L	ENST00000222390.5	37	c.783|c.782	CCDS5597.1	7																																																																																			HGF	-	pfam_Kringle,superfamily_Kringle-like,smart_Kringle,pfscan_Kringle	ENSG00000019991		0.500	HGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HGF	HGNC	protein_coding	OTTHUMT00000253315.2	-	0.00	46	0	G|C	NM_000601		81372751|81372752	-1	tier1	-	no_errors	ENST00000222390	ensembl	human	known	74_37	silent|missense	47.67	45	41	SNP	1.000	A
HMCN2	256158	genome.wustl.edu	37	9	133269907	133269907	+	3'UTR	SNP	C	C	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr9:133269907C>A	ENST00000487727.2	+	0	1724							Q8NDA2	HMCN2_HUMAN	hemicentin 2						response to stimulus (GO:0050896)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)										CAGGCCCTGACCAGGCTGGAG	0.682																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK074396		9q34.11	2013-01-29			ENSG00000148357	ENSG00000148357		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21293	protein-coding gene	gene with protein product							Standard	XM_006710218		Approved	DKFZp434P0216, FLJ23816		Q8NDA2	OTTHUMG00000140096	ENST00000487727.2:c.*1721C>A	9.37:g.133269907C>A			Q8N225|Q8TCI8	RNA	SNP	-	NULL	ENST00000487727.2	37	NULL		9																																																																																			HMCN2	-	-	ENSG00000148357		0.682	HMCN2-006	KNOWN	mRNA_start_NF|basic	processed_transcript	HMCN2	HGNC	protein_coding	OTTHUMT00000054659.3	-	0.00	67	0	C	XM_175125		133269907	+1	tier1	-	no_errors	ENST00000487727	ensembl	human	known	74_37	rna	85.29	15	87	SNP	0.000	A
IFNL2	282616	genome.wustl.edu	37	19	39759317	39759317	+	Splice_Site	SNP	A	A	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr19:39759317A>G	ENST00000331982.5	+	2	66	c.11A>G	c.(10-12)gAc>gGc	p.D4G		NM_172138.1	NP_742150.1	Q8IZJ0	IFNL2_HUMAN	interferon, lambda 2	4					defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|mucosal immune response (GO:0002385)|positive regulation of immune response (GO:0050778)	extracellular space (GO:0005615)											TGTGACACAGACATGACTGGG	0.637																																																	0													59.0	64.0	62.0					19																	39759317		2202	4300	6502	SO:0001630	splice_region_variant	0			AY129148	CCDS42567.1	19q13.13	2014-05-22	2012-11-26	2012-11-26	ENSG00000183709	ENSG00000183709		"""Interferons"""	18364	protein-coding gene	gene with protein product		607401	"""interleukin 28A"", ""interleukin 28A (interferon, lambda 2)"""	IL28A			Standard	NM_172138		Approved	IL-28A	uc002oku.1	Q8IZJ0		ENST00000331982.5:c.11-1A>G	19.37:g.39759317A>G			Q45KQ8|Q6VN55|Q8IWL7	Missense_Mutation	SNP	NULL	p.D4G	ENST00000331982.5	37	c.11	CCDS42567.1	19	.	.	.	.	.	.	.	.	.	.	A	8.746	0.920170	0.17982	.	.	ENSG00000183709	ENST00000331982	T	0.21031	2.03	3.29	1.15	0.20763	.	.	.	.	.	T	0.12050	0.0293	N	0.25647	0.755	0.09310	N	1	B	0.10296	0.003	B	0.12156	0.007	T	0.33624	-0.9861	8	.	.	.	.	4.5278	0.11990	0.7036:0.0:0.2964:0.0	.	4	Q8IZJ0	IL28A_HUMAN	G	4	ENSP00000333639:D4G	.	D	+	2	0	IL28A	44451157	0.033000	0.19621	0.085000	0.20634	0.132000	0.20833	-0.093000	0.11111	0.428000	0.26173	0.164000	0.16699	GAC	IFNL2	-	NULL	ENSG00000183709		0.637	IFNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNL2	HGNC	protein_coding	OTTHUMT00000463833.1	-	0.00	67	0	A	NM_172138	Missense_Mutation	39759317	+1	tier1	-	no_errors	ENST00000331982	ensembl	human	known	74_37	missense	41.94	36	26	SNP	0.102	G
IFT80	57560	genome.wustl.edu	37	3	160099401	160099401	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr3:160099401A>G	ENST00000326448.7	-	3	581	c.149T>C	c.(148-150)aTa>aCa	p.I50T	IFT80_ENST00000477495.1_5'UTR|IFT80_ENST00000496589.1_5'UTR|IFT80_ENST00000483465.1_5'UTR|RP11-432B6.3_ENST00000483754.1_Intron	NM_020800.2	NP_065851.1	Q9P2H3	IFT80_HUMAN	intraflagellar transport 80	50					bone morphogenesis (GO:0060349)|chondrocyte differentiation (GO:0002062)|cilium assembly (GO:0042384)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of non-canonical Wnt signaling pathway (GO:2000051)|osteoblast differentiation (GO:0001649)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)				NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(12)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	36			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			AAGCTTTACTATTTGAGTTGT	0.403																																																	0													108.0	105.0	106.0					3																	160099401		2203	4300	6503	SO:0001583	missense	0			AB037795	CCDS3188.1, CCDS54668.1	3q25.33	2014-07-03	2014-07-03	2005-11-02	ENSG00000068885	ENSG00000068885		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29262	protein-coding gene	gene with protein product		611177	"""WD repeat domain 56"", ""intraflagellar transport 80 homolog (Chlamydomonas)"""	WDR56		10718198	Standard	NM_020800		Approved	KIAA1374	uc021xgq.1	Q9P2H3	OTTHUMG00000158953	ENST00000326448.7:c.149T>C	3.37:g.160099401A>G	ENSP00000312778:p.Ile50Thr		B4E0K1|C9J8I0|Q3MJC4|Q86YF4|Q9UIX1	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.I50T	ENST00000326448.7	37	c.149	CCDS3188.1	3	.	.	.	.	.	.	.	.	.	.	A	17.72	3.460042	0.63401	.	.	ENSG00000068885	ENST00000326448;ENST00000498409;ENST00000489004;ENST00000478536	T;T;T;T	0.68181	1.75;0.18;-0.31;-0.31	5.86	5.86	0.93980	WD40 repeat-like-containing domain (1);	0.111999	0.35838	U	0.002951	T	0.58004	0.2092	L	0.46157	1.445	0.80722	D	1	B	0.27498	0.18	B	0.19946	0.027	T	0.55392	-0.8148	10	0.12103	T	0.63	.	16.2405	0.82405	1.0:0.0:0.0:0.0	.	50	Q9P2H3	IFT80_HUMAN	T	50	ENSP00000312778:I50T;ENSP00000420001:I50T;ENSP00000418455:I50T;ENSP00000419468:I50T	ENSP00000312778:I50T	I	-	2	0	IFT80	161582095	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	7.117000	0.77129	2.238000	0.73509	0.477000	0.44152	ATA	IFT80	-	superfamily_WD40_repeat_dom	ENSG00000068885		0.403	IFT80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT80	HGNC	protein_coding	OTTHUMT00000352651.2	-	0.00	45	0	A	NM_020800		160099401	-1	tier1	-	no_errors	ENST00000326448	ensembl	human	known	74_37	missense	13.58	70	11	SNP	0.997	G
IGSF9B	22997	genome.wustl.edu	37	11	133790066	133790066	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr11:133790066C>A	ENST00000321016.8	-	18	3784	c.3554G>T	c.(3553-3555)aGg>aTg	p.R1185M	IGSF9B_ENST00000533871.2_Missense_Mutation_p.R1185M			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	1185	Pro-rich.				homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		CTCGGCGCGCCTGGCCTGCCG	0.721																																																	0													27.0	33.0	31.0					11																	133790066		1876	4077	5953	SO:0001583	missense	0			AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.3554G>T	11.37:g.133790066C>A	ENSP00000317980:p.Arg1185Met		G5EA26	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.R1185M	ENST00000321016.8	37	c.3554		11	.	.	.	.	.	.	.	.	.	.	C	21.1	4.101707	0.76983	.	.	ENSG00000080854	ENST00000321016;ENST00000533871	T;T	0.76709	-0.75;-1.04	5.08	5.08	0.68730	.	0.000000	0.45126	D	0.000396	T	0.82015	0.4945	L	0.27053	0.805	0.45995	D	0.998809	D	0.76494	0.999	D	0.74674	0.984	D	0.84861	0.0819	10	0.87932	D	0	.	18.0591	0.89371	0.0:1.0:0.0:0.0	.	1185	Q9UPX0	TUTLB_HUMAN	M	1185;1027	ENSP00000317980:R1185M;ENSP00000436552:R1027M	ENSP00000317980:R1185M	R	-	2	0	IGSF9B	133295276	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.527000	0.60573	2.358000	0.79984	0.455000	0.32223	AGG	IGSF9B	-	NULL	ENSG00000080854		0.721	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	IGSF9B	HGNC	protein_coding		-	0.00	107	0	C	XM_290502		133790066	-1	tier1	-	no_errors	ENST00000321016	ensembl	human	known	74_37	missense	73.02	34	92	SNP	1.000	A
IL4R	3566	genome.wustl.edu	37	16	27357918	27357918	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr16:27357918G>C	ENST00000395762.2	+	6	751	c.492G>C	c.(490-492)tgG>tgC	p.W164C	IL4R_ENST00000543915.2_Missense_Mutation_p.W164C|IL4R_ENST00000380922.3_Missense_Mutation_p.W149C|IL4R_ENST00000170630.2_Missense_Mutation_p.W164C|IL4R_ENST00000449195.1_Missense_Mutation_p.W164C	NM_000418.3	NP_000409.1	P24394	IL4RA_HUMAN	interleukin 4 receptor	164	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|ovulation (GO:0030728)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|production of molecular mediator involved in inflammatory response (GO:0002532)|regulation of cell proliferation (GO:0042127)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	interleukin-4 receptor activity (GO:0004913)|receptor signaling protein activity (GO:0005057)			breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	33						TCAACATTTGGAGTGAAAACG	0.532																																																	0													124.0	120.0	122.0					16																	27357918		2197	4300	6497	SO:0001583	missense	0			X52425	CCDS10629.1, CCDS58441.1	16p12.1-p11.2	2008-05-14			ENSG00000077238	ENSG00000077238		"""Interleukins and interleukin receptors"", ""CD molecules"""	6015	protein-coding gene	gene with protein product		147781				1679753	Standard	NM_000418		Approved	CD124	uc010bxy.4	P24394	OTTHUMG00000097015	ENST00000395762.2:c.492G>C	16.37:g.27357918G>C	ENSP00000379111:p.Trp164Cys		B4E076|B9EKU8|H3BSY5|Q96P01|Q9H181|Q9H182|Q9H183|Q9H184|Q9H185|Q9H186|Q9H187|Q9H188	Missense_Mutation	SNP	pfam_IL-4_rcpt-alpha_N,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.W164C	ENST00000395762.2	37	c.492	CCDS10629.1	16	.	.	.	.	.	.	.	.	.	.	G	10.29	1.308667	0.23821	.	.	ENSG00000077238	ENST00000380925;ENST00000449195;ENST00000395762;ENST00000543915;ENST00000380922;ENST00000170630	T;T;T;T;T	0.69435	-0.4;-0.4;-0.4;-0.4;-0.4	3.39	-6.77	0.01727	Fibronectin, type III (3);Immunoglobulin-like fold (1);	3.536260	0.00669	N	0.000624	T	0.53965	0.1829	L	0.34521	1.04	0.09310	N	0.999993	P;D;P	0.52996	0.945;0.957;0.933	B;P;P	0.45881	0.393;0.496;0.496	T	0.58532	-0.7620	10	0.39692	T	0.17	-14.5819	4.4438	0.11588	0.1305:0.4355:0.3327:0.1013	.	149;164;164	B4E076;P24394;P24394-2	.;IL4RA_HUMAN;.	C	164;164;164;164;149;164	ENSP00000410322:W164C;ENSP00000379111:W164C;ENSP00000441667:W164C;ENSP00000370309:W149C;ENSP00000170630:W164C	ENSP00000170630:W164C	W	+	3	0	IL4R	27265419	0.000000	0.05858	0.001000	0.08648	0.018000	0.09664	-1.546000	0.02188	-1.640000	0.01525	-0.499000	0.04595	TGG	IL4R	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000077238		0.532	IL4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL4R	HGNC	protein_coding	OTTHUMT00000214104.4	-	0.00	74	0	G			27357918	+1	tier1	-	no_errors	ENST00000170630	ensembl	human	known	74_37	missense	33.33	36	18	SNP	0.001	C
INADL	10207	genome.wustl.edu	37	1	62253574	62253574	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr1:62253574C>T	ENST00000371158.2	+	8	1112	c.998C>T	c.(997-999)tCa>tTa	p.S333L	INADL_ENST00000316485.6_Missense_Mutation_p.S333L	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	333					cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						GGTGACATTTCAGTCACCCCC	0.507																																																	0													96.0	84.0	88.0					1																	62253574		2203	4300	6503	SO:0001583	missense	0			AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.998C>T	1.37:g.62253574C>T	ENSP00000360200:p.Ser333Leu		O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Missense_Mutation	SNP	pfam_PDZ,pfam_L27_2,superfamily_PDZ,smart_L27,smart_PDZ,pfscan_L27,pfscan_PDZ	p.S333L	ENST00000371158.2	37	c.998	CCDS617.2	1	.	.	.	.	.	.	.	.	.	.	C	10.41	1.342915	0.24339	.	.	ENSG00000132849	ENST00000371158;ENST00000316485;ENST00000371156;ENST00000395513;ENST00000255202	T;T	0.14893	2.64;2.47	5.07	0.0643	0.14352	PDZ/DHR/GLGF (1);	0.628220	0.14442	N	0.319353	T	0.10294	0.0252	N	0.19112	0.55	0.09310	N	1	B;B;B	0.24368	0.102;0.022;0.011	B;B;B	0.20384	0.029;0.006;0.012	T	0.25745	-1.0123	10	0.39692	T	0.17	.	10.2542	0.43388	0.0:0.5951:0.0:0.4049	.	333;333;333	F8W8T2;Q8NI35;Q8NI35-4	.;INADL_HUMAN;.	L	333	ENSP00000360200:S333L;ENSP00000326199:S333L	ENSP00000255202:S333L	S	+	2	0	INADL	62026162	0.000000	0.05858	0.022000	0.16811	0.231000	0.25187	1.035000	0.30216	-0.134000	0.11516	-0.373000	0.07131	TCA	INADL	-	superfamily_PDZ	ENSG00000132849		0.507	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INADL	HGNC	protein_coding	OTTHUMT00000023639.2	-	0.00	46	0	C	NM_170605		62253574	+1	tier1	-	no_errors	ENST00000371158	ensembl	human	known	74_37	missense	9.38	174	18	SNP	0.000	T
ILDR2	387597	genome.wustl.edu	37	1	166888577	166888578	+	3'UTR	DNP	GA	GA	TT			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G|A	G|A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr1:166888577_166888578GA>TT	ENST00000271417.3	-	0	1989_1990				ILDR2_ENST00000528703.1_3'UTR|ILDR2_ENST00000529071.1_3'UTR|ILDR2_ENST00000526687.1_3'UTR|ILDR2_ENST00000529387.1_3'UTR|ILDR2_ENST00000469934.2_Missense_Mutation_p.S421N|ILDR2_ENST00000525740.1_3'UTR	NM_199351.2	NP_955383.1	Q71H61	ILDR2_HUMAN	immunoglobulin-like domain containing receptor 2						cell differentiation (GO:0030154)|homeostasis of number of cells within a tissue (GO:0048873)|insulin secretion (GO:0030073)|pancreas development (GO:0031016)|response to glucose (GO:0009749)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(3)|breast(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	22						ATTATCCAGAGAAATGTTGACA	0.45																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF503509	CCDS1256.1	1q24.1	2008-12-18	2008-12-18	2008-12-18	ENSG00000143195	ENSG00000143195			18131	protein-coding gene	gene with protein product	"""LISCH-like"""		"""chromosome 1 open reading frame 32"""	C1orf32			Standard	NM_199351		Approved		uc001gdx.2	Q71H61	OTTHUMG00000034320	ENST00000271417.3:c.1918_1918delinsTT	1.37:g.166888577_166888578delinsTT				Missense_Mutation	SNP	pfam_LISCH7,smart_Ig_sub	p.S421Y|p.S421T	ENST00000271417.3	37	c.1262|c.1261	CCDS1256.1	1																																																																																			ILDR2	-	NULL	ENSG00000143195		0.450	ILDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ILDR2	HGNC	protein_coding	OTTHUMT00000082880.2	-	0.00	57	0	G|A	NM_199351		166888577|166888578	-1	tier1	-	no_errors	ENST00000469934	ensembl	human	putative	74_37	missense	27.27|25.97	56|57	21|20	SNP	0.007|0.008	T
ING5	84289	genome.wustl.edu	37	2	242662655	242662655	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr2:242662655G>T	ENST00000313552.6	+	7	675	c.649G>T	c.(649-651)Gtg>Ttg	p.V217L	ING5_ENST00000406941.1_Missense_Mutation_p.V217L|AC114730.11_ENST00000435195.1_RNA	NM_032329.4	NP_115705.2	Q8WYH8	ING5_HUMAN	inhibitor of growth family, member 5	217					chromatin organization (GO:0006325)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth (GO:0045926)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|skin(1)	3		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;2.16e-33)|all cancers(36;4.99e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.6e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.65e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0839)		CTTTGCCTGCGTGGACCTTAC	0.517																																																	0													244.0	242.0	243.0					2																	242662655		2203	4300	6503	SO:0001583	missense	0			AF189286	CCDS33425.1	2q37.3	2013-01-28			ENSG00000168395	ENSG00000168395		"""Zinc fingers, PHD-type"""	19421	protein-coding gene	gene with protein product		608525				12750254	Standard	NM_032329		Approved	FLJ23842, p28ING5	uc002wcd.3	Q8WYH8	OTTHUMG00000151501	ENST00000313552.6:c.649G>T	2.37:g.242662655G>T	ENSP00000322142:p.Val217Leu		A8K1P3|Q53NU6|Q57Z54|Q9BS30	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.V217L	ENST00000313552.6	37	c.649	CCDS33425.1	2	.	.	.	.	.	.	.	.	.	.	G	34	5.382950	0.95967	.	.	ENSG00000168395	ENST00000313552;ENST00000406941	D;D	0.84660	-1.88;-1.88	5.66	5.66	0.87406	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	D	0.92980	0.7766	M	0.79926	2.475	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92839	0.6287	10	0.56958	D	0.05	-16.4716	19.7533	0.96277	0.0:0.0:1.0:0.0	.	217	Q8WYH8	ING5_HUMAN	L	217	ENSP00000322142:V217L;ENSP00000385937:V217L	ENSP00000322142:V217L	V	+	1	0	ING5	242311328	1.000000	0.71417	0.995000	0.50966	0.976000	0.68499	8.665000	0.91144	2.669000	0.90835	0.643000	0.83706	GTG	ING5	-	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	ENSG00000168395		0.517	ING5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ING5	HGNC	protein_coding	OTTHUMT00000322901.3	-	0.00	155	0	G	NM_032329		242662655	+1	tier1	-	no_errors	ENST00000313552	ensembl	human	known	74_37	missense	77.21	31	105	SNP	1.000	T
INSL6	11172	genome.wustl.edu	37	9	5185534	5185534	+	Silent	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr9:5185534C>T	ENST00000381641.3	-	1	134	c.69G>A	c.(67-69)ctG>ctA	p.L23L		NM_007179.2	NP_009110.2	Q9Y581	INSL6_HUMAN	insulin-like 6	23					fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|lung(2)	15	all_hematologic(13;0.137)	Breast(48;0.147)|Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0128)|Lung(218;0.145)		TGATGTCGCTCAGTTCACGAG	0.582																																																	0													46.0	43.0	44.0					9																	5185534		2203	4300	6503	SO:0001819	synonymous_variant	0			AF156094	CCDS6458.1	9p24	2008-07-21			ENSG00000120210	ENSG00000120210			6089	protein-coding gene	gene with protein product	"""relaxin/insulin-like factor 1"""	606414				10819760	Standard	NM_007179		Approved	RIF1	uc003zix.3	Q9Y581	OTTHUMG00000019489	ENST00000381641.3:c.69G>A	9.37:g.5185534C>T			A0AVS0|Q9NS16	Silent	SNP	pfam_Insulin-like,superfamily_Insulin-like,smart_Insulin-like,pirsf_Insulin-like_pep_6	p.L23	ENST00000381641.3	37	c.69	CCDS6458.1	9																																																																																			INSL6	-	superfamily_Insulin-like,pirsf_Insulin-like_pep_6	ENSG00000120210		0.582	INSL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INSL6	HGNC	protein_coding	OTTHUMT00000051608.3	-	0.00	29	0	C	NM_007179		5185534	-1	tier1	-	no_errors	ENST00000381641	ensembl	human	known	74_37	silent	28.57	20	8	SNP	0.009	T
ITGAV	3685	genome.wustl.edu	37	2	187523819	187523819	+	Missense_Mutation	SNP	C	C	T	rs200949549		TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr2:187523819C>T	ENST00000261023.3	+	18	2048	c.1774C>T	c.(1774-1776)Cgg>Tgg	p.R592W	ITGAV_ENST00000433736.2_Missense_Mutation_p.R546W|AC017101.10_ENST00000453665.1_RNA|ITGAV_ENST00000374907.3_Missense_Mutation_p.R556W	NM_002210.3	NP_002201	P06756	ITAV_HUMAN	integrin, alpha V	592					angiogenesis (GO:0001525)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|apoptotic cell clearance (GO:0043277)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|endodermal cell differentiation (GO:0035987)|entry of symbiont into host cell by promotion of host phagocytosis (GO:0052066)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|negative chemotaxis (GO:0050919)|negative regulation of entry of bacterium into host cell (GO:2000536)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast proliferation (GO:0033690)|regulation of apoptotic cell clearance (GO:2000425)|regulation of phagocytosis (GO:0050764)|substrate adhesion-dependent cell spreading (GO:0034446)|viral entry into host cell (GO:0046718)	alphav-beta3 integrin-IGF-1-IGF1R complex (GO:0035867)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin alphav-beta5 complex (GO:0034684)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	extracellular matrix binding (GO:0050840)|extracellular matrix protein binding (GO:1990430)|fibronectin binding (GO:0001968)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|transforming growth factor beta binding (GO:0050431)|virus receptor activity (GO:0001618)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)	Antithymocyte globulin(DB00098)	TATGGAATATCGGTTGGATTA	0.368													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16295	0.0		0.0	False		,,,				2504	0.0				Melanoma(58;108 1995 6081)												0													101.0	100.0	100.0					2																	187523819		2203	4300	6503	SO:0001583	missense	0				CCDS2292.1, CCDS46470.1, CCDS46471.1	2q31-q32	2012-04-20	2012-04-20		ENSG00000138448	ENSG00000138448		"""CD molecules"", ""Integrins"""	6150	protein-coding gene	gene with protein product		193210	"""antigen identified by monoclonal antibody L230"", ""vitronectin receptor"", ""integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51)"""	VNRA, MSK8, VTNR		2454952	Standard	NM_001144999		Approved	CD51	uc002upq.4	P06756	OTTHUMG00000132635	ENST00000261023.3:c.1774C>T	2.37:g.187523819C>T	ENSP00000261023:p.Arg592Trp		A0AV67|B0LPF4|B7Z883|B7ZLX0|D3DPG8|E7EWZ6|Q53SK4|Q59EB7|Q6LD15	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.R592W	ENST00000261023.3	37	c.1774	CCDS2292.1	2	.	.	.	.	.	.	.	.	.	.	C	12.75	2.032038	0.35893	.	.	ENSG00000138448	ENST00000261023;ENST00000374907;ENST00000433736	T;T;T	0.46451	0.87;0.87;0.87	6.07	1.1	0.20463	Integrin alpha-2 (1);	0.746850	0.13319	N	0.396837	T	0.30135	0.0755	L	0.29908	0.895	0.26108	N	0.980723	B;B;B	0.13145	0.007;0.003;0.007	B;B;B	0.08055	0.003;0.002;0.003	T	0.20806	-1.0264	10	0.54805	T	0.06	.	10.3236	0.43780	0.0:0.6914:0.0932:0.2155	.	546;556;592	E7EWZ6;P06756-2;P06756	.;.;ITAV_HUMAN	W	592;556;546	ENSP00000261023:R592W;ENSP00000364042:R556W;ENSP00000404291:R546W	ENSP00000261023:R592W	R	+	1	2	ITGAV	187232064	0.993000	0.37304	0.961000	0.40146	0.908000	0.53690	1.303000	0.33470	-0.048000	0.13401	-1.761000	0.00669	CGG	ITGAV	-	pfam_Integrin_alpha-2,prints_Integrin_alpha	ENSG00000138448		0.368	ITGAV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGAV	HGNC	protein_coding	OTTHUMT00000255882.2	-	0.00	42	0	C	NM_002210		187523819	+1	tier1	rs200949549	no_errors	ENST00000261023	ensembl	human	known	74_37	missense	71.05	11	27	SNP	0.535	T
ITPR1	3708	genome.wustl.edu	37	3	4687130	4687130	+	Silent	SNP	T	T	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr3:4687130T>C	ENST00000443694.2	+	7	684	c.684T>C	c.(682-684)gaT>gaC	p.D228D	ITPR1_ENST00000302640.8_Silent_p.D228D|ITPR1_ENST00000357086.4_Silent_p.D228D|ITPR1_ENST00000544951.1_Silent_p.D228D|ITPR1_ENST00000423119.2_Silent_p.D228D|ITPR1_ENST00000456211.2_Silent_p.D228D|ITPR1_ENST00000354582.6_Silent_p.D228D			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	228					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	AATGGAGTGATAACAAAGACG	0.403																																																	0													76.0	75.0	75.0					3																	4687130		1947	4130	6077	SO:0001819	synonymous_variant	0			D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.684T>C	3.37:g.4687130T>C			E7EPX7|E9PDE9|Q14660|Q99897	Silent	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.D228	ENST00000443694.2	37	c.684	CCDS54551.1	3																																																																																			ITPR1	-	pfam_Ins145_P3_rcpt	ENSG00000150995		0.403	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	ITPR1	HGNC	protein_coding	OTTHUMT00000337982.3	-	0.00	72	0	T	NM_002222		4687130	+1	tier1	-	no_errors	ENST00000302640	ensembl	human	known	74_37	silent	28.12	46	18	SNP	0.270	C
KDM7A	80853	genome.wustl.edu	37	7	139791832	139791832	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr7:139791832C>G	ENST00000397560.2	-	19	2600	c.2503G>C	c.(2503-2505)Gaa>Caa	p.E835Q	Y_RNA_ENST00000515919.1_RNA	NM_030647.1	NP_085150.1	Q6ZMT4	KDM7A_HUMAN		835					histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|midbrain development (GO:0030901)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|stomach(1)	22	Melanoma(164;0.0142)					TGACTAATTTCTGATGAACCT	0.428																																																	0													137.0	117.0	124.0					7																	139791832		1897	4129	6026	SO:0001583	missense	0																														ENST00000397560.2:c.2503G>C	7.37:g.139791832C>G	ENSP00000380692:p.Glu835Gln		A4D1S9|C9JJH9|C9JQU2|Q6MZL8|Q9C0E5	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_JmjC_dom,pfscan_JmjC_dom,pfscan_Znf_PHD-finger	p.E835Q	ENST00000397560.2	37	c.2503	CCDS43658.1	7	.	.	.	.	.	.	.	.	.	.	C	17.30	3.353536	0.61293	.	.	ENSG00000006459	ENST00000397560	T	0.13778	2.56	5.9	5.9	0.94986	.	0.505809	0.22406	N	0.060471	T	0.16085	0.0387	L	0.46157	1.445	0.80722	D	1	B	0.27229	0.172	B	0.21917	0.037	T	0.02031	-1.1226	10	0.37606	T	0.19	-26.2024	18.4436	0.90676	0.0:1.0:0.0:0.0	.	835	Q6ZMT4	KDM7_HUMAN	Q	835	ENSP00000380692:E835Q	ENSP00000380692:E835Q	E	-	1	0	JHDM1D	139438301	1.000000	0.71417	0.854000	0.33618	0.990000	0.78478	5.674000	0.68117	2.788000	0.95919	0.655000	0.94253	GAA	JHDM1D	-	NULL	ENSG00000006459		0.428	JHDM1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JHDM1D	HGNC	protein_coding	OTTHUMT00000348460.1	-	0.00	100	0	C			139791832	-1	tier1	-	no_errors	ENST00000397560	ensembl	human	known	74_37	missense	29.13	89	37	SNP	0.994	G
KAT6A	7994	genome.wustl.edu	37	8	41806773	41806773	+	Silent	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr8:41806773C>T	ENST00000396930.3	-	11	2250	c.1707G>A	c.(1705-1707)gaG>gaA	p.E569E	KAT6A_ENST00000406337.1_Silent_p.E569E|KAT6A_ENST00000265713.2_Silent_p.E569E|KAT6A_ENST00000485568.1_Silent_p.E569E	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	569	Catalytic.|Interaction with PML.|Interaction with RUNX1-1.|MYST-type HAT.|Mediates interaction with BRPF1, required for histone H3 acetyltransferase activity.				aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										TTCTGTAAATCTCATTGGCAG	0.343																																																	0													61.0	49.0	53.0					8																	41806773		2195	4288	6483	SO:0001819	synonymous_variant	0			U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.1707G>A	8.37:g.41806773C>T			Q76L81	Silent	SNP	pfam_MOZ_SAS,pfam_Znf_PHD-finger,superfamily_Acyl_CoA_acyltransferase,superfamily_Znf_FYVE_PHD,smart_Histone_H1/H5_H15,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.E569	ENST00000396930.3	37	c.1707	CCDS6124.1	8																																																																																			KAT6A	-	pfam_MOZ_SAS,superfamily_Acyl_CoA_acyltransferase	ENSG00000083168		0.343	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KAT6A	HGNC	protein_coding	OTTHUMT00000318163.1	-	0.00	56	0	C	NM_006766		41806773	-1	tier1	-	no_errors	ENST00000265713	ensembl	human	known	74_37	silent	29.51	43	18	SNP	1.000	T
KCNN2	3781	genome.wustl.edu	37	5	113740169	113740169	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr5:113740169G>A	ENST00000512097.3	+	4	1635	c.617G>A	c.(616-618)aGa>aAa	p.R206K	KCNN2_ENST00000507750.1_Intron|KCNN2_ENST00000264773.3_Missense_Mutation_p.R206K			Q9H2S1	KCNN2_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2	206					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transport (GO:1901379)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|protein homodimerization activity (GO:0042803)|small conductance calcium-activated potassium channel activity (GO:0016286)			breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(21)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)	Miconazole(DB01110)|Procaine(DB00721)	GATGACTGGAGAATAGCCATG	0.413																																																	0													178.0	168.0	172.0					5																	113740169		2202	4300	6502	SO:0001583	missense	0			AF239613	CCDS4114.1, CCDS43352.1	5q22.3	2012-07-05			ENSG00000080709	ENSG00000080709		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6291	protein-coding gene	gene with protein product		605879				16382103	Standard	NM_001278204		Approved	KCa2.2, hSK2	uc003kqo.3	Q9H2S1	OTTHUMG00000128836	ENST00000512097.3:c.617G>A	5.37:g.113740169G>A	ENSP00000427120:p.Arg206Lys		A6NF94|Q0VFZ4|Q6PJI0|Q6X2Y2	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_SK,pfam_CaM-bd_dom,pfam_2pore_dom_K_chnl_dom,superfamily_CaM-bd_dom,prints_K_chnl_Ca-activ_SK	p.R206K	ENST00000512097.3	37	c.617	CCDS4114.1	5	.	.	.	.	.	.	.	.	.	.	G	31	5.060431	0.93846	.	.	ENSG00000080709	ENST00000512097;ENST00000264773	D;D	0.98926	-5.24;-5.24	5.29	5.29	0.74685	Potassium channel, calcium-activated, SK, conserved region (1);	0.000000	0.85682	D	0.000000	D	0.99227	0.9731	M	0.92026	3.265	0.80722	D	1	D	0.55605	0.972	P	0.60609	0.877	D	0.99253	1.0888	10	0.72032	D	0.01	.	18.5281	0.90980	0.0:0.0:1.0:0.0	.	206	Q9H2S1	KCNN2_HUMAN	K	206	ENSP00000427120:R206K;ENSP00000264773:R206K	ENSP00000264773:R206K	R	+	2	0	KCNN2	113768068	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.827000	0.86722	2.467000	0.83353	0.462000	0.41574	AGA	KCNN2	-	pfam_K_chnl_Ca-activ_SK	ENSG00000080709		0.413	KCNN2-001	KNOWN	not_organism_supported|upstream_ATG|basic|appris_principal|CCDS	protein_coding	KCNN2	HGNC	protein_coding	OTTHUMT00000250775.2	-	0.00	48	0	G	NM_021614		113740169	+1	tier1	-	no_errors	ENST00000264773	ensembl	human	known	74_37	missense	53.66	19	22	SNP	1.000	A
KDM5A	5927	genome.wustl.edu	37	12	419007	419007	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr12:419007C>T	ENST00000399788.2	-	22	3702	c.3340G>A	c.(3340-3342)Gag>Aag	p.E1114K	KDM5A_ENST00000382815.4_Missense_Mutation_p.E1114K	NM_001042603.1	NP_001036068.1	P29375	KDM5A_HUMAN	lysine (K)-specific demethylase 5A	1114					chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|multicellular organismal development (GO:0007275)|negative regulation of histone deacetylase activity (GO:1901726)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(29)|ovary(1)|prostate(5)|skin(6)|stomach(1)|urinary_tract(2)	77						AATCCTTCCTCCAGATCACTC	0.393			T	NUP98	AML																																			Dom	yes		12	12p11	5927	"""lysine (K)-specific demethylase 5A, JARID1A"""		L	0													131.0	128.0	129.0					12																	419007		1843	4094	5937	SO:0001583	missense	0				CCDS41736.1	12p13.33	2013-01-28	2009-04-06	2009-04-06	ENSG00000073614	ENSG00000073614		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	9886	protein-coding gene	gene with protein product		180202	"""retinoblastoma-binding protein 2"", ""Jumonji, AT rich interactive domain 1A (RBBP2-like)"", ""jumonji, AT rich interactive domain 1A"""	RBBP2, JARID1A		1857421	Standard	NM_001042603		Approved		uc001qif.1	P29375	OTTHUMG00000168055	ENST00000399788.2:c.3340G>A	12.37:g.419007C>T	ENSP00000382688:p.Glu1114Lys		A8MV76|Q4LE72|Q86XZ1	Missense_Mutation	SNP	pfam_Lys_sp_deMease_like_dom,pfam_JmjC_dom,pfam_Znf_PHD-finger,pfam_ARID/BRIGHT_DNA-bd,pfam_Znf_C5HC2,pfam_TF_JmjN,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_Znf_PHD,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_ARID/BRIGHT_DNA-bd	p.E1114K	ENST00000399788.2	37	c.3340	CCDS41736.1	12	.	.	.	.	.	.	.	.	.	.	C	21.7	4.193007	0.78902	.	.	ENSG00000073614	ENST00000399788;ENST00000382815	D;D	0.84660	-1.88;-1.71	5.92	5.92	0.95590	.	0.049468	0.85682	D	0.000000	D	0.86560	0.5962	M	0.64404	1.975	0.52501	D	0.999954	B;B;B	0.25206	0.012;0.004;0.12	B;B;B	0.31946	0.037;0.004;0.138	T	0.83111	-0.0123	10	0.62326	D	0.03	-10.9778	20.3081	0.98638	0.0:1.0:0.0:0.0	.	1114;1114;1114	F5H1F7;P29375;P29375-2	.;KDM5A_HUMAN;.	K	1114	ENSP00000382688:E1114K;ENSP00000372265:E1114K	ENSP00000372265:E1114K	E	-	1	0	KDM5A	289268	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	5.818000	0.69236	2.795000	0.96236	0.655000	0.94253	GAG	KDM5A	-	NULL	ENSG00000073614		0.393	KDM5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM5A	HGNC	protein_coding	OTTHUMT00000397812.1	-	0.00	44	0	C	NM_005056		419007	-1	tier1	-	no_errors	ENST00000399788	ensembl	human	known	74_37	missense	38.71	38	24	SNP	1.000	T
KIAA0196	9897	genome.wustl.edu	37	8	126071704	126071704	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr8:126071704C>T	ENST00000318410.7	-	13	1951	c.1602G>A	c.(1600-1602)atG>atA	p.M534I	KIAA0196_ENST00000517845.1_Missense_Mutation_p.M386I	NM_014846.3	NP_055661.3	Q12768	STRUM_HUMAN	KIAA0196	534					cell death (GO:0008219)|endosomal transport (GO:0016197)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|WASH complex (GO:0071203)				NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	42	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			TGGTTCTGATCATTTGATGAA	0.408																																																	0													90.0	89.0	89.0					8																	126071704		2203	4300	6503	SO:0001583	missense	0				CCDS6355.1	8q24.13	2014-05-09			ENSG00000164961	ENSG00000164961			28984	protein-coding gene	gene with protein product	"""strumpellin"""	610657	"""spastic paraplegia 8 (autosomal dominant)"""	SPG8		9973294, 17160902, 23085491	Standard	NM_014846		Approved		uc003yrt.3	Q12768	OTTHUMG00000164991	ENST00000318410.7:c.1602G>A	8.37:g.126071704C>T	ENSP00000318016:p.Met534Ile		A8K4R7|Q3KQX5|Q8TBQ2	Missense_Mutation	SNP	pfam_WASH_strumpellin,superfamily_Ig_E-set	p.M534I	ENST00000318410.7	37	c.1602	CCDS6355.1	8	.	.	.	.	.	.	.	.	.	.	C	34	5.293669	0.95546	.	.	ENSG00000164961	ENST00000318410;ENST00000517845	D;D	0.88741	-2.42;-2.42	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	D	0.95510	0.8541	M	0.87456	2.885	0.80722	D	1	D;P	0.89917	1.0;0.705	D;P	0.87578	0.998;0.785	D	0.95424	0.8510	10	0.72032	D	0.01	-33.1849	20.1271	0.97986	0.0:1.0:0.0:0.0	.	386;534	E7EQI7;Q12768	.;STRUM_HUMAN	I	534;386	ENSP00000318016:M534I;ENSP00000429676:M386I	ENSP00000318016:M534I	M	-	3	0	KIAA0196	126140886	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.743000	0.85020	2.834000	0.97654	0.650000	0.86243	ATG	KIAA0196	-	pfam_WASH_strumpellin	ENSG00000164961		0.408	KIAA0196-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0196	HGNC	protein_coding	OTTHUMT00000381369.1		0.00	15	0	C	NM_014846		126071704	-1			no_errors	ENST00000318410	ensembl	human	known	74_37	missense	13.51	32	5	SNP	1.000	T
NWD2	57495	genome.wustl.edu	37	4	37448096	37448096	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr4:37448096T>C	ENST00000309447.5	+	7	5334	c.4486T>C	c.(4486-4488)Ttt>Ctt	p.F1496L		NM_001144990.1	NP_001138462.1	Q9ULI1	NWD2_HUMAN		1496										breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(2)|skin(2)	16						TATCATCGTGTTTATCACATC	0.438																																																	0													98.0	80.0	86.0					4																	37448096		692	1591	2283	SO:0001583	missense	0																														ENST00000309447.5:c.4486T>C	4.37:g.37448096T>C	ENSP00000309501:p.Phe1496Leu		A8MRU1	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,superfamily_P-loop_NTPase,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.F1496L	ENST00000309447.5	37	c.4486	CCDS47040.1	4	.	.	.	.	.	.	.	.	.	.	T	13.60	2.285892	0.40394	.	.	ENSG00000174145	ENST00000309447	T	0.69685	-0.42	5.84	5.84	0.93424	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.66406	0.2786	N	0.17082	0.46	0.80722	D	1	P	0.52842	0.956	D	0.65010	0.931	T	0.61637	-0.7022	10	0.10636	T	0.68	.	16.222	0.82265	0.0:0.0:0.0:1.0	.	1496	Q9ULI1	K1239_HUMAN	L	1496	ENSP00000309501:F1496L	ENSP00000309501:F1496L	F	+	1	0	KIAA1239	37124491	1.000000	0.71417	0.978000	0.43139	0.171000	0.22731	7.615000	0.83006	2.226000	0.72624	0.533000	0.62120	TTT	KIAA1239	-	superfamily_WD40_repeat_dom	ENSG00000174145		0.438	KIAA1239-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1239	HGNC	protein_coding	OTTHUMT00000347551.2	-	0.00	52	0	T			37448096	+1	tier1	-	no_errors	ENST00000309447	ensembl	human	known	74_37	missense	31.58	39	18	SNP	1.000	C
KLHDC1	122773	genome.wustl.edu	37	14	50201373	50201373	+	Missense_Mutation	SNP	G	G	A	rs370596217		TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr14:50201373G>A	ENST00000359332.2	+	10	980	c.890G>A	c.(889-891)aGa>aAa	p.R297K	KLHDC1_ENST00000554512.1_3'UTR	NM_172193.2	NP_751943.1	Q8N7A1	KLDC1_HUMAN	kelch domain containing 1	297						cytoplasm (GO:0005737)				kidney(1)|large_intestine(1)|liver(2)|lung(5)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	12	all_epithelial(31;0.00244)|Breast(41;0.00964)					CCTAAAACAAGACCTAGGTAA	0.279																																																	0													87.0	84.0	85.0					14																	50201373		2202	4298	6500	SO:0001583	missense	0			AF111806	CCDS9692.1	14q21.3	2007-08-01			ENSG00000197776	ENSG00000197776			19836	protein-coding gene	gene with protein product		611281					Standard	NM_172193		Approved	MST025	uc001www.3	Q8N7A1	OTTHUMG00000140295	ENST00000359332.2:c.890G>A	14.37:g.50201373G>A	ENSP00000352282:p.Arg297Lys		B3KXD9|Q8WYI1	Missense_Mutation	SNP	pfam_Kelch_2,pfam_Kelch_1,superfamily_Gal_Oxase/kelch_b-propeller	p.R297K	ENST00000359332.2	37	c.890	CCDS9692.1	14	.	.	.	.	.	.	.	.	.	.	G	5.108	0.205578	0.09704	.	.	ENSG00000197776	ENST00000359332;ENST00000557128	T;T	0.10960	2.82;4.07	5.63	3.77	0.43336	Galactose oxidase/kelch, beta-propeller (1);Kelch-type beta propeller (1);	0.147419	0.64402	N	0.000009	T	0.05273	0.0140	N	0.14661	0.345	0.33123	D	0.54198	B;B	0.06786	0.0;0.001	B;B	0.08055	0.003;0.003	T	0.23583	-1.0184	10	0.02654	T	1	-15.0194	10.6403	0.45590	0.1574:0.0:0.8426:0.0	.	168;297	G3V3T1;Q8N7A1	.;KLDC1_HUMAN	K	297;168	ENSP00000352282:R297K;ENSP00000451407:R168K	ENSP00000352282:R297K	R	+	2	0	KLHDC1	49271123	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	1.881000	0.39638	1.340000	0.45581	0.561000	0.74099	AGA	KLHDC1	-	superfamily_Gal_Oxase/kelch_b-propeller	ENSG00000197776		0.279	KLHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHDC1	HGNC	protein_coding	OTTHUMT00000276882.2	-	0.00	13	0	G	NM_172193		50201373	+1	tier1	-	no_errors	ENST00000359332	ensembl	human	known	74_37	missense	26.92	19	7	SNP	1.000	A
KMT2B	9757	genome.wustl.edu	37	19	36212661	36212661	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr19:36212661C>G	ENST00000222270.7	+	3	2412	c.2412C>G	c.(2410-2412)ttC>ttG	p.F804L	KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000420124.1_Missense_Mutation_p.F804L	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	804					chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										TGCAGCTATTCAAGATCGATC	0.592																																																	0													26.0	31.0	29.0					19																	36212661		2171	4278	6449	SO:0001583	missense	0			AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.2412C>G	19.37:g.36212661C>G	ENSP00000222270:p.Phe804Leu		O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Missense_Mutation	SNP	pirsf_MeTrfase_trithorax,pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.F804L	ENST00000222270.7	37	c.2412	CCDS46055.1	19	.	.	.	.	.	.	.	.	.	.	C	9.029	0.986754	0.18889	.	.	ENSG00000105663	ENST00000222270;ENST00000420124	D;D	0.82344	-1.6;-1.6	5.38	3.18	0.36537	.	0.546329	0.15222	N	0.273916	T	0.71584	0.3357	L	0.36672	1.1	0.31782	N	0.630752	B	0.10296	0.003	B	0.10450	0.005	T	0.63945	-0.6522	10	0.11182	T	0.66	.	9.0348	0.36280	0.0:0.8087:0.0:0.1913	.	804	Q9UMN6	MLL4_HUMAN	L	804	ENSP00000222270:F804L;ENSP00000398837:F804L	ENSP00000222270:F804L	F	+	3	2	AD000671.1	40904501	1.000000	0.71417	0.987000	0.45799	0.004000	0.04260	3.645000	0.54389	1.505000	0.48720	0.650000	0.86243	TTC	KMT2B	-	pirsf_MeTrfase_trithorax	ENSG00000272333		0.592	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2B	Uniprot_gn	protein_coding		-	0.00	42	0	C	NM_014727		36212661	+1	tier1	-	no_errors	ENST00000222270	ensembl	human	known	74_37	missense	41.94	18	13	SNP	0.994	G
KMT2C	58508	genome.wustl.edu	37	7	151962290	151962290	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr7:151962290C>G	ENST00000262189.6	-	8	1235	c.1017G>C	c.(1015-1017)aaG>aaC	p.K339N	KMT2C_ENST00000355193.2_Missense_Mutation_p.K339N	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	339					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TTGCATCTTCCTTCGCTATAA	0.368																																																	0													77.0	71.0	73.0					7																	151962290		2203	4299	6502	SO:0001583	missense	0			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.1017G>C	7.37:g.151962290C>G	ENSP00000262189:p.Lys339Asn		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.K339N	ENST00000262189.6	37	c.1017	CCDS5931.1	7	.	.	.	.	.	.	.	.	.	.	C	6.180	0.401340	0.11696	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.98822	-5.16;-5.16	4.65	3.77	0.43336	Zinc finger, RING/FYVE/PHD-type (1);Protein kinase C-like, phorbol ester/diacylglycerol binding (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.43416	U	0.000576	D	0.97807	0.9280	L	0.34521	1.04	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	D	0.95779	0.8815	10	0.14656	T	0.56	.	11.2491	0.49015	0.0:0.8451:0.0:0.1549	.	339	Q8NEZ4	MLL3_HUMAN	N	339	ENSP00000262189:K339N;ENSP00000347325:K339N	ENSP00000262189:K339N	K	-	3	2	MLL3	151593223	1.000000	0.71417	1.000000	0.80357	0.006000	0.05464	1.789000	0.38724	1.072000	0.40860	-0.262000	0.10625	AAG	KMT2C	-	superfamily_Znf_FYVE_PHD	ENSG00000055609		0.368	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2C	HGNC	protein_coding	OTTHUMT00000318887.3	-	0.00	37	0	C			151962290	-1	tier1	-	no_errors	ENST00000355193	ensembl	human	known	74_37	missense	15.52	49	9	SNP	1.000	G
KRTAP5-1	387264	genome.wustl.edu	37	11	1606186	1606186	+	Silent	SNP	A	A	G	rs137999496		TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr11:1606186A>G	ENST00000382171.2	-	1	327	c.294T>C	c.(292-294)ggT>ggC	p.G98G	KRTAP5-AS1_ENST00000532922.1_RNA|KRTAP5-AS1_ENST00000524947.1_RNA|KRTAP5-AS1_ENST00000424148.1_RNA|KRTAP5-AS1_ENST00000534077.1_RNA	NM_001005922.1	NP_001005922.1	Q6L8H4	KRA51_HUMAN	keratin associated protein 5-1	98	8 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(3)|kidney(1)|lung(9)|skin(2)|upper_aerodigestive_tract(1)	16		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		AGGAGCCACAACCCCCCTTGG	0.677																																																	0													35.0	51.0	46.0					11																	1606186		2176	4272	6448	SO:0001819	synonymous_variant	0			AB126070	CCDS31330.1	11p15.5	2008-02-05			ENSG00000205869	ENSG00000205869		"""Keratin associated proteins"""	23596	protein-coding gene	gene with protein product		148022	"""keratin, cuticle, ultrahigh sulphur 1-like"""	KRN1L		15144888	Standard	NM_001005922		Approved	KRTAP5.1	uc001ltu.1	Q6L8H4	OTTHUMG00000057557	ENST00000382171.2:c.294T>C	11.37:g.1606186A>G				Silent	SNP	NULL	p.G98	ENST00000382171.2	37	c.294	CCDS31330.1	11																																																																																			KRTAP5-1	-	NULL	ENSG00000205869		0.677	KRTAP5-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-1	HGNC	protein_coding	OTTHUMT00000127922.1		0.00	64	0	A	NM_001005922		1606186	-1			no_errors	ENST00000382171	ensembl	human	known	74_37	silent	33.93	37	19	SNP	1.000	G
KRTAP5-1	387264	genome.wustl.edu	37	11	1606198	1606198	+	Silent	SNP	T	T	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr11:1606198T>G	ENST00000382171.2	-	1	315	c.282A>C	c.(280-282)ggA>ggC	p.G94G	KRTAP5-AS1_ENST00000532922.1_RNA|KRTAP5-AS1_ENST00000524947.1_RNA|KRTAP5-AS1_ENST00000424148.1_RNA|KRTAP5-AS1_ENST00000534077.1_RNA	NM_001005922.1	NP_001005922.1	Q6L8H4	KRA51_HUMAN	keratin associated protein 5-1	94	8 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(3)|kidney(1)|lung(9)|skin(2)|upper_aerodigestive_tract(1)	16		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CCCCCTTGGATCCCCCACAAG	0.677																																																	0													34.0	50.0	45.0					11																	1606198		2195	4285	6480	SO:0001819	synonymous_variant	0			AB126070	CCDS31330.1	11p15.5	2008-02-05			ENSG00000205869	ENSG00000205869		"""Keratin associated proteins"""	23596	protein-coding gene	gene with protein product		148022	"""keratin, cuticle, ultrahigh sulphur 1-like"""	KRN1L		15144888	Standard	NM_001005922		Approved	KRTAP5.1	uc001ltu.1	Q6L8H4	OTTHUMG00000057557	ENST00000382171.2:c.282A>C	11.37:g.1606198T>G				Silent	SNP	NULL	p.G94	ENST00000382171.2	37	c.282	CCDS31330.1	11																																																																																			KRTAP5-1	-	NULL	ENSG00000205869		0.677	KRTAP5-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-1	HGNC	protein_coding	OTTHUMT00000127922.1	-	0.00	58	0	T	NM_001005922		1606198	-1	tier1	-	no_errors	ENST00000382171	ensembl	human	known	74_37	silent	35.59	38	21	SNP	0.006	G
LIAS	11019	genome.wustl.edu	37	4	39465225	39465225	+	Splice_Site	SNP	G	G	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr4:39465225G>T	ENST00000261434.3	+	4	511	c.393G>T	c.(391-393)atG>atT	p.M131I	LIAS_ENST00000340169.2_Splice_Site_p.M131I|LIAS_ENST00000515061.1_3'UTR|LIAS_ENST00000381846.1_Splice_Site_p.M131I|LIAS_ENST00000513731.1_Intron	NM_006859.2	NP_006850.2			lipoic acid synthetase											breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(2)|ovary(2)	12						CCACGATCATGGTAGGGCCAG	0.463																																																	0													70.0	65.0	67.0					4																	39465225		2203	4300	6503	SO:0001630	splice_region_variant	0			AJ224162	CCDS3453.1, CCDS3454.1, CCDS63950.1	4p14	2008-02-05			ENSG00000121897	ENSG00000121897			16429	protein-coding gene	gene with protein product		607031				11124703	Standard	NM_006859		Approved	LAS	uc003guf.3	O43766	OTTHUMG00000099369	ENST00000261434.3:c.393+1G>T	4.37:g.39465225G>T				Missense_Mutation	SNP	pfam_rSAM,smart_Elp3/MiaB/NifB,pirsf_Lipoyl_synth,tigrfam_Lipoyl_synth	p.M131I	ENST00000261434.3	37	c.393	CCDS3453.1	4	.	.	.	.	.	.	.	.	.	.	G	28.6	4.931068	0.92389	.	.	ENSG00000121897	ENST00000340169;ENST00000261434;ENST00000381846	T;T;T	0.75938	-0.98;-0.98;-0.98	5.28	5.28	0.74379	Elongator protein 3/MiaB/NifB (1);Aldolase-type TIM barrel (1);	0.038631	0.85682	D	0.000000	D	0.90861	0.7129	H	0.97516	4.02	0.80722	D	1	P;P;D	0.76494	0.929;0.868;0.999	P;P;D	0.71870	0.839;0.85;0.975	D	0.93924	0.7208	10	0.87932	D	0	-18.2236	16.0604	0.80836	0.0:0.0:1.0:0.0	.	131;131;131	C9JCF6;O43766;Q6P5Q6	.;LIAS_HUMAN;.	I	131	ENSP00000340676:M131I;ENSP00000261434:M131I;ENSP00000371270:M131I	ENSP00000261434:M131I	M	+	3	0	LIAS	39141620	1.000000	0.71417	1.000000	0.80357	0.724000	0.41520	9.343000	0.97047	2.473000	0.83533	0.655000	0.94253	ATG	LIAS	-	smart_Elp3/MiaB/NifB,pirsf_Lipoyl_synth,tigrfam_Lipoyl_synth	ENSG00000121897		0.463	LIAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIAS	HGNC	protein_coding	OTTHUMT00000216815.1	-	0.00	45	0	G	NM_194451	Missense_Mutation	39465225	+1	tier1	-	no_errors	ENST00000261434	ensembl	human	known	74_37	missense	38.60	35	22	SNP	1.000	T
LIG3	3980	genome.wustl.edu	37	17	33318128	33318128	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr17:33318128G>A	ENST00000378526.4	+	5	1169	c.1036G>A	c.(1036-1038)Gag>Aag	p.E346K	LIG3_ENST00000262327.5_Missense_Mutation_p.E346K	NM_013975.3	NP_039269.2	P49916	DNLI3_HUMAN	ligase III, DNA, ATP-dependent	346					base-excision repair (GO:0006284)|base-excision repair, DNA ligation (GO:0006288)|DNA biosynthetic process (GO:0071897)|DNA repair (GO:0006281)|double-strand break repair via nonhomologous end joining (GO:0006303)|lagging strand elongation (GO:0006273)|mitochondrial DNA repair (GO:0043504)|negative regulation of DNA recombination (GO:0045910)|nucleotide-excision repair (GO:0006289)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(8)|lung(9)|ovary(3)|pancreas(2)|prostate(1)|skin(3)|stomach(1)	31		Ovarian(249;0.17)			Bleomycin(DB00290)	ACGGGACCTAGAGCAGGTCAG	0.483								Other BER factors																																									0													73.0	68.0	70.0					17																	33318128		2203	4300	6503	SO:0001583	missense	0				CCDS11284.2, CCDS11285.2	17q11.2-q12	2008-10-29			ENSG00000005156	ENSG00000005156			6600	protein-coding gene	gene with protein product		600940	"""ligase II, DNA, ATP-dependent"""	LIG2		7760816	Standard	NM_002311		Approved		uc002hik.2	P49916	OTTHUMG00000128519	ENST00000378526.4:c.1036G>A	17.37:g.33318128G>A	ENSP00000367787:p.Glu346Lys		Q16714|Q6NVK3	Missense_Mutation	SNP	pfam_DNA_ligase_ATP-dep_cent,pfam_DNA_ligase_ATP-dep_N,pfam_Znf_PARP,pfam_DNA_ligase_ATP-dep_C,superfamily_NA-bd_OB-fold,superfamily_BRCT_dom,superfamily_DNA_ligase_ATP-dep_N,smart_BRCT_dom,pfscan_BRCT_dom,pfscan_Znf_PARP,pfscan_DNA_ligase_ATP-dep_cent,tigrfam_DNA_ligase_ATP-dep	p.E346K	ENST00000378526.4	37	c.1036	CCDS11284.2	17	.	.	.	.	.	.	.	.	.	.	G	37	6.051416	0.97236	.	.	ENSG00000005156	ENST00000378526;ENST00000262327	T;T	0.17370	2.28;2.28	5.65	5.65	0.86999	DNA ligase, ATP-dependent, N-terminal (3);	0.000000	0.85682	D	0.000000	T	0.45074	0.1324	M	0.85197	2.74	0.80722	D	1	D;D;D	0.54601	0.967;0.967;0.967	P;P;P	0.62014	0.897;0.897;0.897	T	0.19257	-1.0311	10	0.30078	T	0.28	-33.4762	18.891	0.92403	0.0:0.0:1.0:0.0	.	346;346;346	E5KLB5;P49916;E5KLB6	.;DNLI3_HUMAN;.	K	346	ENSP00000367787:E346K;ENSP00000262327:E346K	ENSP00000262327:E346K	E	+	1	0	LIG3	30342241	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.419000	0.97397	2.941000	0.99782	0.655000	0.94253	GAG	LIG3	-	pfam_DNA_ligase_ATP-dep_N,superfamily_DNA_ligase_ATP-dep_N,tigrfam_DNA_ligase_ATP-dep	ENSG00000005156		0.483	LIG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIG3	HGNC	protein_coding	OTTHUMT00000250330.3	-	0.00	36	0	G	NM_013975		33318128	+1	tier1	-	no_errors	ENST00000378526	ensembl	human	known	74_37	missense	24.24	25	8	SNP	1.000	A
SLC7A5P1	81893	genome.wustl.edu	37	16	21484504	21484504	+	IGR	SNP	C	C	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr16:21484504C>A								CTD-2547E10.2 (6023 upstream) : MIR3680-1 (32865 downstream)																							ATGCACTTAACACATTTGCAA	0.403																																																	0																																										SO:0001628	intergenic_variant	0																															16.37:g.21484504C>A				RNA	SNP	-	NULL		37	NULL		16																																																																																			CTD-2547E10.2	-	-	ENSG00000180747	0	0.403					LOC101060604	Clone_based_vega_gene			-	0.00	23	0	C			21484504	-1	tier1	-	no_errors	ENST00000522841	ensembl	human	known	74_37	rna	25.00	9	3	SNP	1.000	A
LINC00304	283860	genome.wustl.edu	37	16	89226472	89226472	+	lincRNA	SNP	G	G	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr16:89226472G>T	ENST00000321214.2	+	0	345					NR_024347.2		Q8N9R0	CP081_HUMAN	long intergenic non-protein coding RNA 304																		TGTGGTCTGTGGCAGCCGGTC	0.672																																																	0																																												0			AK094020		16q24.3	2012-11-19	2011-08-10	2011-08-10	ENSG00000180422	ENSG00000180422		"""Long non-coding RNAs"""	26713	non-coding RNA	RNA, long non-coding			"""chromosome 16 open reading frame 81"", ""non-protein coding RNA 304"""	C16orf81, NCRNA00304			Standard	NR_024347		Approved	FLJ36701	uc002fms.3	Q8N9R0	OTTHUMG00000175524		16.37:g.89226472G>T				RNA	SNP	-	NULL	ENST00000321214.2	37	NULL		16																																																																																			LINC00304	-	-	ENSG00000180422		0.672	LINC00304-001	KNOWN	basic	lincRNA	LINC00304	HGNC	lincRNA	OTTHUMT00000430368.1	-	0.00	52	0	G	NR_024347		89226472	+1	tier1	-	no_errors	ENST00000562248	ensembl	human	known	74_37	rna	40.85	42	29	SNP	0.002	T
LRP12	29967	genome.wustl.edu	37	8	105601196	105601198	+	5'UTR	DEL	CGA	CGA	-	rs188974664|rs550024348	byFrequency	TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	CGA	CGA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr8:105601196_105601198delCGA	ENST00000276654.5	-	0	36_38				LRP12_ENST00000424843.2_5'UTR|RP11-127H5.1_ENST00000521923.1_5'Flank	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12						endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			TAGACGAcgccgacgccgccgcc	0.729																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.-73TCG>-	8.37:g.105601196_105601198delCGA			A8K137|B4DRQ2	RNA	DEL	-	NULL	ENST00000276654.5	37	NULL	CCDS6303.1	8																																																																																			LRP12	-	-	ENSG00000147650		0.729	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LRP12	HGNC	protein_coding	OTTHUMT00000380821.1		0.00	16	0	CGA	NM_013437		105601198	-1	tier1		no_errors	ENST00000520770	ensembl	human	known	74_37	rna	30.77	18	8	DEL	0.797:0.784:0.683	-
LRP1B	53353	genome.wustl.edu	37	2	141128844	141128844	+	Silent	SNP	A	A	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr2:141128844A>G	ENST00000389484.3	-	70	11750	c.10779T>C	c.(10777-10779)acT>acC	p.T3593T		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3593	LDL-receptor class A 28. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GTGATGAGCAAGTAGGAGAAG	0.289										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												0													33.0	33.0	33.0					2																	141128844		2200	4291	6491	SO:0001819	synonymous_variant	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.10779T>C	2.37:g.141128844A>G			Q8WY29|Q8WY30|Q8WY31	Silent	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.T3593	ENST00000389484.3	37	c.10779	CCDS2182.1	2																																																																																			LRP1B	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000168702		0.289	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	-	0.00	30	0	A	NM_018557		141128844	-1	tier1	-	no_errors	ENST00000389484	ensembl	human	known	74_37	silent	36.36	21	12	SNP	0.985	G
LRRIQ1	84125	genome.wustl.edu	37	12	85449856	85449856	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr12:85449856G>T	ENST00000393217.2	+	8	1346	c.1285G>T	c.(1285-1287)Gaa>Taa	p.E429*		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	429										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		TCTAGTGGATGAAAATTCAAA	0.299																																																	0													83.0	95.0	91.0					12																	85449856		2200	4296	6496	SO:0001587	stop_gained	0			AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.1285G>T	12.37:g.85449856G>T	ENSP00000376910:p.Glu429*		Q567P4|Q9BS17|Q9HA36	Nonsense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,smart_Leu-rich_rpt_typical-subtyp,pfscan_IQ_motif_EF-hand-BS	p.E429*	ENST00000393217.2	37	c.1285	CCDS41816.1	12	.	.	.	.	.	.	.	.	.	.	g	18.39	3.614593	0.66672	.	.	ENSG00000133640	ENST00000256007;ENST00000378580;ENST00000393217	.	.	.	4.75	1.82	0.25136	.	0.509272	0.17322	N	0.178462	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	.	1.2708	0.02020	0.273:0.1576:0.4089:0.1604	.	.	.	.	X	429;404;429	.	ENSP00000256007:E429X	E	+	1	0	LRRIQ1	83973987	0.001000	0.12720	0.000000	0.03702	0.165000	0.22458	0.693000	0.25497	0.530000	0.28619	-0.648000	0.03929	GAA	LRRIQ1	-	NULL	ENSG00000133640		0.299	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRIQ1	HGNC	protein_coding	OTTHUMT00000388249.2		0.00	45	0	G	NM_032165		85449856	+1			no_errors	ENST00000393217	ensembl	human	known	74_37	nonsense	8.33	33	3	SNP	0.000	T
LYG2	254773	genome.wustl.edu	37	2	99858936	99858936	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr2:99858936G>T	ENST00000409238.1	-	5	550	c.530C>A	c.(529-531)tCa>tAa	p.S177*	LYG2_ENST00000423800.1_3'UTR|LYG2_ENST00000333017.2_Nonsense_Mutation_p.S177*			Q86SG7	LYG2_HUMAN	lysozyme G-like 2	177				GLSAFKSG -> RLYSEYFY (in Ref. 4). {ECO:0000305}.	cell wall macromolecule catabolic process (GO:0016998)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)	lysozyme activity (GO:0003796)			large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(1)|stomach(1)	12						CTTAAAAGCTGAGAGACCACC	0.388																																																	0													127.0	123.0	124.0					2																	99858936		2203	4300	6503	SO:0001587	stop_gained	0			AF323919	CCDS2042.1	2q11.2	2008-02-05			ENSG00000185674	ENSG00000185674			29615	protein-coding gene	gene with protein product						8889548, 12574869	Standard	NM_175735		Approved	LYGH	uc002szw.1	Q86SG7	OTTHUMG00000130643	ENST00000409238.1:c.530C>A	2.37:g.99858936G>T	ENSP00000386939:p.Ser177*		Q496G2|Q53RW0	Nonsense_Mutation	SNP	pfam_TGlycosylase-like_SLT,superfamily_Lysozyme-like_dom,pirsf_Glyco_hydro_23,prints_Glyco_hydro_23	p.S177*	ENST00000409238.1	37	c.530	CCDS2042.1	2	.	.	.	.	.	.	.	.	.	.	G	14.57	2.575210	0.45902	.	.	ENSG00000185674	ENST00000409238;ENST00000333017	.	.	.	5.03	0.916	0.19373	.	0.744300	0.11862	N	0.522252	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-11.5428	1.8737	0.03214	0.1813:0.1585:0.497:0.1632	.	.	.	.	X	177	.	.	S	-	2	0	LYG2	99225368	0.494000	0.26043	0.843000	0.33291	0.846000	0.48090	0.549000	0.23329	0.282000	0.22254	0.563000	0.77884	TCA	LYG2	-	pfam_TGlycosylase-like_SLT,superfamily_Lysozyme-like_dom,pirsf_Glyco_hydro_23,prints_Glyco_hydro_23	ENSG00000185674		0.388	LYG2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	LYG2	HGNC	protein_coding	OTTHUMT00000330307.1	-	0.00	45	0	G	NM_175735		99858936	-1	tier1	-	no_errors	ENST00000333017	ensembl	human	known	74_37	nonsense	55.56	16	20	SNP	0.656	T
MAATS1	89876	genome.wustl.edu	37	3	119426309	119426309	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr3:119426309C>G	ENST00000273390.5	+	3	337	c.260C>G	c.(259-261)tCt>tGt	p.S87C	MAATS1_ENST00000463700.1_Missense_Mutation_p.S87C	NM_033364.3	NP_203528	Q7Z4T9	MAAT1_HUMAN	MYCBP-associated, testis expressed 1	87						mitochondrion (GO:0005739)											CCAAGATATTCTCTATATTGG	0.438																																																	0													68.0	71.0	70.0					3																	119426309		2203	4300	6503	SO:0001583	missense	0			AB063296	CCDS2994.1	3q12-q13.3	2014-07-31	2012-12-07	2012-09-26	ENSG00000183833	ENSG00000183833			24010	protein-coding gene	gene with protein product	"""AMY-1-associating protein expressed in testis 1"", ""MYCBP-binding protein"", ""spermatogenesis associated 26"""	609910	"""chromosome 3 open reading frame 15"", ""MYCBP/AMY-1-associated, testis expressed 1"""	C3orf15		12223483, 14551891, 17967944	Standard	NM_033364		Approved	AAT1, AAT1alpha, SPATA26, CaM-IP2	uc003ede.4	Q7Z4T9	OTTHUMG00000159422	ENST00000273390.5:c.260C>G	3.37:g.119426309C>G	ENSP00000273390:p.Ser87Cys		A0AVK2|A8K1J9|B3KP23|B4DG52|B4DZ14|C9JUG4|Q68DX2|Q8TD41|Q96A45|Q96JE8	Missense_Mutation	SNP	superfamily_S-AdoMet_deCO2ase_core	p.S87C	ENST00000273390.5	37	c.260	CCDS2994.1	3	.	.	.	.	.	.	.	.	.	.	C	20.3	3.967712	0.74131	.	.	ENSG00000183833	ENST00000383667;ENST00000273390;ENST00000463700	T;T	0.48522	1.82;0.81	5.8	4.92	0.64577	.	0.662158	0.15334	N	0.267850	T	0.67173	0.2865	M	0.70275	2.135	0.40621	D	0.981763	D;D;D;D;D	0.89917	0.997;0.998;0.999;0.996;1.0	D;P;D;P;D	0.68943	0.917;0.893;0.952;0.855;0.961	T	0.70212	-0.4934	10	0.87932	D	0	-2.8021	14.0308	0.64615	0.0:0.8484:0.1516:0.0	.	87;25;87;87;87	Q7Z4T9;Q7Z4T9-3;Q4G0Y0;Q7Z4T9-7;Q7Z4T9-2	AAT1_HUMAN;.;.;.;.	C	87	ENSP00000273390:S87C;ENSP00000419489:S87C	ENSP00000273390:S87C	S	+	2	0	C3orf15	120908999	0.018000	0.18449	0.998000	0.56505	0.997000	0.91878	0.812000	0.27211	1.430000	0.47334	0.650000	0.86243	TCT	MAATS1	-	NULL	ENSG00000183833		0.438	MAATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAATS1	HGNC	protein_coding	OTTHUMT00000355222.1	-	0.00	29	0	C	NM_033364		119426309	+1	tier1	-	no_errors	ENST00000273390	ensembl	human	known	74_37	missense	15.38	55	10	SNP	0.958	G
MAGEB4	4115	genome.wustl.edu	37	X	30260669	30260669	+	Silent	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chrX:30260669C>T	ENST00000378982.2	+	1	613	c.417C>T	c.(415-417)atC>atT	p.I139I	MAGEB1_ENST00000397550.1_5'Flank|MAGEB1_ENST00000378981.3_5'Flank	NM_002367.3	NP_002358.1	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	139	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27						TGAAGATCATCAGCAAAAAGT	0.468																																																	0													57.0	43.0	48.0					X																	30260669		2202	4300	6502	SO:0001819	synonymous_variant	0				CCDS14221.1	Xp21.3	2009-03-17			ENSG00000120289	ENSG00000120289			6811	protein-coding gene	gene with protein product	"""melanoma-associated antigen B4"", ""cancer/testis antigen family 3, member 6"""	300153				9441743	Standard	NM_002367		Approved	MGC33144, CT3.6	uc004dcb.3	O15481	OTTHUMG00000021321	ENST00000378982.2:c.417C>T	X.37:g.30260669C>T			B2R9G0|Q6FHH4|Q8IZ00	Silent	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.I139	ENST00000378982.2	37	c.417	CCDS14221.1	X																																																																																			MAGEB4	-	pfam_MAGE,pfscan_MAGE	ENSG00000120289		0.468	MAGEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB4	HGNC	protein_coding	OTTHUMT00000056159.1	-	0.00	10	0	C	NM_002367		30260669	+1	tier1	-	no_errors	ENST00000378982	ensembl	human	known	74_37	silent	37.50	15	9	SNP	0.000	T
MAP10	54627	genome.wustl.edu	37	1	232943711	232943711	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr1:232943711C>A	ENST00000418460.1	+	1	3069	c.2942C>A	c.(2941-2943)tCt>tAt	p.S981Y		NM_019090.2	NP_061963.2	Q9P2G4	MAP10_HUMAN	microtubule-associated protein 10	839					cytoplasmic microtubule organization (GO:0031122)|positive regulation of cytokinesis (GO:0032467)|regulation of microtubule-based process (GO:0032886)|spindle midzone assembly involved in mitosis (GO:0051256)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|mitotic spindle pole (GO:0097431)	microtubule binding (GO:0008017)										AGTTGGAAATCTTTAGAAAAA	0.373																																																	0													106.0	107.0	107.0					1																	232943711		1866	4109	5975	SO:0001583	missense	0			AB037804	CCDS44334.1	1q42.2	2013-02-12	2013-02-12	2013-02-12	ENSG00000212916	ENSG00000212916			29265	protein-coding gene	gene with protein product	"""microtubule regulator 120 KDa"""		"""KIAA1383"""	KIAA1383		23264731	Standard	NM_019090		Approved	MTR120	uc001hvh.2	Q9P2G4	OTTHUMG00000037819	ENST00000418460.1:c.2942C>A	1.37:g.232943711C>A	ENSP00000403208:p.Ser981Tyr		A8K2F1|Q32MI1|Q58EZ9|Q5VV83	Missense_Mutation	SNP	NULL	p.S981Y	ENST00000418460.1	37	c.2942	CCDS44334.1	1	.	.	.	.	.	.	.	.	.	.	C	11.05	1.524824	0.27299	.	.	ENSG00000212916	ENST00000418460	.	.	.	5.94	3.02	0.34903	.	0.000000	0.38058	U	0.001823	T	0.39118	0.1066	M	0.71581	2.175	0.09310	N	1	P	0.37122	0.583	B	0.38428	0.273	T	0.40701	-0.9549	9	0.66056	D	0.02	-1.9356	4.4868	0.11794	0.1296:0.615:0.1247:0.1307	.	839	Q9P2G4	K1383_HUMAN	Y	981	.	ENSP00000403208:S981Y	S	+	2	0	KIAA1383	231010334	0.998000	0.40836	0.117000	0.21633	0.198000	0.23893	2.827000	0.48112	0.387000	0.25024	-0.282000	0.10007	TCT	MAP10	-	NULL	ENSG00000212916		0.373	MAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP10	HGNC	protein_coding	OTTHUMT00000092317.3	-	0.00	35	0	C	NM_019090		232943711	+1	tier1	-	no_errors	ENST00000418460	ensembl	human	known	74_37	missense	25.81	23	8	SNP	0.038	A
MAST3	23031	genome.wustl.edu	37	19	18234138	18234138	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr19:18234138G>A	ENST00000262811.6	+	6	424	c.424G>A	c.(424-426)Gaa>Aaa	p.E142K	MAST3_ENST00000608648.1_3'UTR	NM_015016.1	NP_055831.1	O60307	MAST3_HUMAN	microtubule associated serine/threonine kinase 3	142							ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(6)|ovary(4)|pancreas(1)|stomach(1)	31						GCTTGATGAGGAAGGCGGCCG	0.692																																																	0													28.0	30.0	29.0					19																	18234138		1958	4132	6090	SO:0001583	missense	0			AB011133	CCDS46014.1	19p13	2008-02-05				ENSG00000099308			19036	protein-coding gene	gene with protein product		612258					Standard	NM_015016		Approved	KIAA0561	uc002nhz.4	O60307		ENST00000262811.6:c.424G>A	19.37:g.18234138G>A	ENSP00000262811:p.Glu142Lys		Q7LDZ8|Q9UPI0	Missense_Mutation	SNP	pfam_MA_Ser/Thr_Kinase_dom,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,superfamily_Kinase-like_dom,superfamily_MAST_pre-PK_dom,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PDZ,pfscan_PDZ,pfscan_Prot_kinase_dom	p.E142K	ENST00000262811.6	37	c.424	CCDS46014.1	19	.	.	.	.	.	.	.	.	.	.	G	17.09	3.301254	0.60195	.	.	ENSG00000099308	ENST00000262811	T	0.29917	1.55	4.69	4.69	0.59074	Microtubule-associated serine/threonine-protein kinase, domain (1);	.	.	.	.	T	0.38746	0.1052	L	0.43152	1.355	0.41376	D	0.987528	B	0.30104	0.268	B	0.42593	0.392	T	0.38735	-0.9647	9	0.56958	D	0.05	-9.1073	16.9486	0.86237	0.0:0.0:1.0:0.0	.	142	O60307	MAST3_HUMAN	K	142	ENSP00000262811:E142K	ENSP00000262811:E142K	E	+	1	0	MAST3	18095138	1.000000	0.71417	1.000000	0.80357	0.102000	0.19082	9.336000	0.96533	2.324000	0.78689	0.484000	0.47621	GAA	MAST3	-	pfam_MA_Ser/Thr_Kinase_dom	ENSG00000099308		0.692	MAST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAST3	HGNC	protein_coding	OTTHUMT00000466526.2	-	0.00	33	0	G	XM_038150		18234138	+1	tier1	-	no_errors	ENST00000262811	ensembl	human	known	74_37	missense	26.09	17	6	SNP	1.000	A
MDC1	9656	genome.wustl.edu	37	6	30679848	30679848	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr6:30679848C>G	ENST00000376406.3	-	5	2518	c.1871G>C	c.(1870-1872)gGg>gCg	p.G624A	MDC1_ENST00000494654.1_5'Flank|MDC1-AS1_ENST00000442150.1_RNA|MDC1_ENST00000376405.2_Missense_Mutation_p.G624A	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	624					DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)			breast(2)|kidney(1)|ovary(1)	4						ACCCTGGGCCCCCACCTCATG	0.572								Other conserved DNA damage response genes																																									0													55.0	51.0	52.0					6																	30679848		1511	2709	4220	SO:0001583	missense	0			D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.1871G>C	6.37:g.30679848C>G	ENSP00000365588:p.Gly624Ala		A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Missense_Mutation	SNP	pfam_FHA_dom,superfamily_BRCT_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_BRCT_dom,pfscan_FHA_dom	p.G624A	ENST00000376406.3	37	c.1871	CCDS34384.1	6	.	.	.	.	.	.	.	.	.	.	C	9.625	1.134755	0.21123	.	.	ENSG00000137337	ENST00000376406;ENST00000376405;ENST00000429610;ENST00000422104	T;T	0.06449	3.42;3.3	5.1	2.19	0.27852	.	0.699813	0.11833	N	0.525053	T	0.01222	0.0040	L	0.47716	1.5	0.09310	N	1	B;P;B;B	0.40731	0.297;0.728;0.384;0.087	B;B;B;B	0.37451	0.112;0.25;0.113;0.104	T	0.35400	-0.9790	10	0.02654	T	1	-3.0882	4.0387	0.09741	0.1622:0.59:0.1574:0.0904	.	624;496;624;624	Q14676-2;B4DYH4;Q14676;Q14676-4	.;.;MDC1_HUMAN;.	A	624;624;624;496	ENSP00000365588:G624A;ENSP00000365587:G624A	ENSP00000365587:G624A	G	-	2	0	MDC1	30787827	0.000000	0.05858	0.001000	0.08648	0.291000	0.27294	0.201000	0.17276	0.498000	0.27948	0.462000	0.41574	GGG	MDC1	-	NULL	ENSG00000137337		0.572	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MDC1	HGNC	protein_coding	OTTHUMT00000076103.1	-	0.00	78	0	C	NM_014641		30679848	-1	tier1	-	no_errors	ENST00000376406	ensembl	human	known	74_37	missense	35.82	43	24	SNP	0.001	G
MEI1	150365	genome.wustl.edu	37	22	42180391	42180391	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr22:42180391A>T	ENST00000401548.3	+	25	3176	c.3136A>T	c.(3136-3138)Agc>Tgc	p.S1046C	MEI1_ENST00000400107.1_Missense_Mutation_p.S379C|MEI1_ENST00000476893.1_3'UTR|MEI1_ENST00000300398.4_Missense_Mutation_p.S54C	NM_152513.3	NP_689726.3			meiosis inhibitor 1											breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						GAAGGCTCTCAGCTTTCCAAA	0.502																																																	0													72.0	71.0	72.0					22																	42180391		1884	4108	5992	SO:0001583	missense	0			AK092934	CCDS46718.1	22q13.2	2013-10-11			ENSG00000167077	ENSG00000167077			28613	protein-coding gene	gene with protein product	"""spermatogenesis associated 38"""	608797				16683055	Standard	XM_006724154		Approved	MGC40042, SPATA38	uc003baz.1	Q5TIA1	OTTHUMG00000030083	ENST00000401548.3:c.3136A>T	22.37:g.42180391A>T	ENSP00000384115:p.Ser1046Cys			Missense_Mutation	SNP	superfamily_ARM-type_fold	p.S1046C	ENST00000401548.3	37	c.3136	CCDS46718.1	22	.	.	.	.	.	.	.	.	.	.	A	17.88	3.497660	0.64186	.	.	ENSG00000167077	ENST00000401548;ENST00000400107;ENST00000300398;ENST00000419798;ENST00000403492	T;T;T;T	0.67523	-0.24;-0.24;-0.27;-0.27	5.56	5.56	0.83823	.	0.435874	0.27345	N	0.019782	T	0.76183	0.3952	L	0.56769	1.78	0.35147	D	0.769392	D;D;D;D;D;D;D	0.89917	1.0;0.999;0.999;0.99;0.99;0.999;1.0	D;D;D;P;P;P;D	0.91635	0.964;0.995;0.912;0.723;0.723;0.871;0.999	T	0.82466	-0.0443	10	0.59425	D	0.04	-20.3804	8.3212	0.32130	0.9121:0.0:0.0879:0.0	.	60;156;379;156;289;414;1046	B7Z735;Q6ZRK7;Q5TIA1-3;E9PB79;Q5TIA1-5;Q5TIA1-2;Q5TIA1	.;.;.;.;.;.;MEI1_HUMAN	C	1046;379;54;156;54	ENSP00000384115:S1046C;ENSP00000382978:S379C;ENSP00000300398:S54C;ENSP00000385298:S54C	ENSP00000300398:S54C	S	+	1	0	MEI1	40510337	1.000000	0.71417	1.000000	0.80357	0.409000	0.31022	3.795000	0.55499	2.122000	0.65172	0.460000	0.39030	AGC	MEI1	-	NULL	ENSG00000167077		0.502	MEI1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MEI1	HGNC	protein_coding	OTTHUMT00000074937.3	-	0.00	59	0	A	NM_152513		42180391	+1	tier1	-	no_errors	ENST00000401548	ensembl	human	known	74_37	missense	43.55	35	27	SNP	1.000	T
MGAT5	4249	genome.wustl.edu	37	2	135028024	135028024	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr2:135028024G>T	ENST00000409645.1	+	3	561	c.309G>T	c.(307-309)aaG>aaT	p.K103N	MGAT5_ENST00000281923.2_Missense_Mutation_p.K103N			Q09328	MGT5A_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase	103					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|pancreas(1)|skin(3)	36				BRCA - Breast invasive adenocarcinoma(221;0.0964)		TGGAGTCGAAGGTGGACAATC	0.413																																																	0													130.0	117.0	121.0					2																	135028024		2203	4300	6503	SO:0001583	missense	0			D17716	CCDS2171.1	2q21	2013-02-25			ENSG00000152127	ENSG00000152127	2.4.1.155	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7049	protein-coding gene	gene with protein product		601774				8292036	Standard	NM_002410		Approved	GNT-V	uc002ttw.4	Q09328	OTTHUMG00000131681	ENST00000409645.1:c.309G>T	2.37:g.135028024G>T	ENSP00000386377:p.Lys103Asn		D3DP70	Missense_Mutation	SNP	NULL	p.K103N	ENST00000409645.1	37	c.309	CCDS2171.1	2	.	.	.	.	.	.	.	.	.	.	G	15.62	2.886571	0.51908	.	.	ENSG00000152127	ENST00000409645;ENST00000281923	.	.	.	5.8	4.01	0.46588	.	0.087790	0.85682	D	0.000000	T	0.71151	0.3306	M	0.66939	2.045	0.54753	D	0.999983	D	0.76494	0.999	D	0.80764	0.994	T	0.71069	-0.4699	9	0.54805	T	0.06	-11.6812	10.6663	0.45732	0.2561:0.0:0.7439:0.0	.	103	Q09328	MGT5A_HUMAN	N	103	.	ENSP00000281923:K103N	K	+	3	2	MGAT5	134744494	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	3.903000	0.56318	0.808000	0.34231	0.650000	0.86243	AAG	MGAT5	-	NULL	ENSG00000152127		0.413	MGAT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGAT5	HGNC	protein_coding	OTTHUMT00000254584.3	-	0.00	69	0	G	NM_002410		135028024	+1	tier1	-	no_errors	ENST00000281923	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	T
C3orf52	79669	genome.wustl.edu	37	3	111831724	111831724	+	Intron	DEL	A	A	-	rs76778672		TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr3:111831724delA	ENST00000264848.5	+	5	526				C3orf52_ENST00000430855.1_Intron|MIR567_ENST00000385205.1_RNA|C3orf52_ENST00000431717.2_Intron|C3orf52_ENST00000467942.2_Intron	NM_024616.2	NP_078892	Q5BVD1	TTMP_HUMAN	chromosome 3 open reading frame 52							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4						ATGCAAAACTAAAAAAAAAAA	0.323																																																	0													45.0	42.0	43.0					3																	111831724		1560	3556	5116	SO:0001627	intron_variant	0			AY830714	CCDS46887.1, CCDS54620.1	3q13.2	2006-01-30			ENSG00000114529	ENSG00000114529			26255	protein-coding gene	gene with protein product	"""TPA induced trans-membrane protein"""	611956				15737651	Standard	NM_024616		Approved	FLJ23186, TTMP	uc011bhs.2	Q5BVD1	OTTHUMG00000159230	ENST00000264848.5:c.468-87A>-	3.37:g.111831724delA			B4DNV2|B4E0Z2|Q96AJ4|Q9H5Q1	RNA	DEL	-	NULL	ENST00000264848.5	37	NULL	CCDS46887.1	3																																																																																			MIR567	-	-	ENSG00000207940		0.323	C3orf52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR567	HGNC	protein_coding	OTTHUMT00000353961.1		0.00	35	0	A	NM_024616		111831724	+1	tier1		no_errors	ENST00000385205	ensembl	human	known	74_37	rna	9.26	49	5	DEL	0.000	-
MLLT3	4300	genome.wustl.edu	37	9	20413721	20413721	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr9:20413721C>T	ENST00000380338.4	-	5	1409	c.1123G>A	c.(1123-1125)Gat>Aat	p.D375N	MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000475957.1_5'UTR|MIR4473_ENST00000583731.1_RNA|MLLT3_ENST00000429426.2_Missense_Mutation_p.D372N	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	375		KMT2A/MLL1 fusion point (in acute myeloid leukemia patient CO).			anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		CTACTCACATCAGATTTAGAG	0.358			T	MLL	ALL																																			Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	0													98.0	88.0	91.0					9																	20413721		2203	4300	6503	SO:0001583	missense	0			L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.1123G>A	9.37:g.20413721C>T	ENSP00000369695:p.Asp375Asn		B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Missense_Mutation	SNP	pfam_YEATS,pfscan_YEATS	p.D375N	ENST00000380338.4	37	c.1123	CCDS6494.1	9	.	.	.	.	.	.	.	.	.	.	C	18.86	3.713806	0.68730	.	.	ENSG00000171843	ENST00000380338;ENST00000429426;ENST00000540751	.	.	.	5.95	5.95	0.96441	.	0.203920	0.49305	D	0.000143	T	0.49779	0.1577	N	0.22421	0.69	0.80722	D	1	P;P	0.37525	0.598;0.598	B;B	0.37346	0.247;0.247	T	0.51980	-0.8636	9	0.56958	D	0.05	-8.9355	20.3802	0.98930	0.0:1.0:0.0:0.0	.	372;375	B7Z755;P42568	.;AF9_HUMAN	N	375;372;414	.	ENSP00000369695:D375N	D	-	1	0	MLLT3	20403721	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.656000	0.83736	2.822000	0.97130	0.563000	0.77884	GAT	MLLT3	-	NULL	ENSG00000171843		0.358	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLLT3	HGNC	protein_coding	OTTHUMT00000051872.1	-	0.00	80	0	C	NM_004529		20413721	-1	tier1	-	no_errors	ENST00000380338	ensembl	human	known	74_37	missense	65.52	20	38	SNP	1.000	T
MPL	4352	genome.wustl.edu	37	1	43804213	43804213	+	Splice_Site	SNP	G	G	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr1:43804213G>A	ENST00000372470.3	+	3	255	c.213G>A	c.(211-213)cgG>cgA	p.R71R	MPL_ENST00000413998.2_Splice_Site_p.R71R	NM_005373.2	NP_005364.1	P40238	TPOR_HUMAN	MPL proto-oncogene, thrombopoietin receptor	71					blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|homeostasis of number of cells (GO:0048872)|platelet activation (GO:0030168)|regulation of chemokine production (GO:0032642)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(551)|large_intestine(3)|lung(7)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	567	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)			Eltrombopag(DB06210)|Romiplostim(DB05332)	ATGCCAACAGGGAGAAGCCCC	0.587			Mis		MPD	MPD	congenital amegakaryocytic thrombocytopenia																														NSCLC(52;534 1204 10016 41452 44427)		yes	Dom	yes	Familial essential thrombocythemia	1	p34	4352	"""myeloproliferative leukemia virus oncogene, thrombopoietin receptor"""	yes	L	0													69.0	67.0	68.0					1																	43804213		2203	4300	6503	SO:0001630	splice_region_variant	0			M90102	CCDS483.1	1p34	2014-09-17	2014-06-26		ENSG00000117400	ENSG00000117400		"""CD molecules"", ""Fibronectin type III domain containing"""	7217	protein-coding gene	gene with protein product		159530	"""myeloproliferative leukemia virus oncogene"""			1608974	Standard	NM_005373		Approved	CD110, TPOR	uc001ciw.3	P40238	OTTHUMG00000007429	ENST00000372470.3:c.213-1G>A	1.37:g.43804213G>A			Q5JUZ0	Silent	SNP	pfam_Growth/epo_recpt_lig-bind,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.R71	ENST00000372470.3	37	c.213	CCDS483.1	1																																																																																			MPL	-	pfam_Growth/epo_recpt_lig-bind,superfamily_Fibronectin_type3	ENSG00000117400		0.587	MPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPL	HGNC	protein_coding	OTTHUMT00000019522.1	-	0.00	51	0	G	NM_005373	Silent	43804213	+1	tier1	-	no_errors	ENST00000372470	ensembl	human	known	74_37	silent	12.07	102	14	SNP	1.000	A
MUM1	84939	genome.wustl.edu	37	19	1373090	1373090	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr19:1373090C>G	ENST00000591806.1	+	12	2076	c.2009C>G	c.(2008-2010)tCt>tGt	p.S670C	MUM1_ENST00000415183.3_Silent_p.L722L|MUM1_ENST00000591453.1_3'UTR|MUM1_ENST00000344663.3_Missense_Mutation_p.S670C|MUM1_ENST00000311401.5_Missense_Mutation_p.S601C	NM_032853.3	NP_116242.2	Q2TAK8	MUM1_HUMAN	melanoma associated antigen (mutated) 1	669					chromatin organization (GO:0006325)|DNA repair (GO:0006281)	nucleus (GO:0005634)	nucleosome binding (GO:0031491)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGTGCGATCTCTGCGGTGGAC	0.632																																																	0													116.0	90.0	99.0					19																	1373090		2203	4300	6503	SO:0001583	missense	0			AK075241	CCDS12062.1	19p13.3	2008-02-05				ENSG00000160953			29641	protein-coding gene	gene with protein product						11042152, 7644523	Standard	NM_032853		Approved	MUM-1	uc002lrz.2	Q2TAK8		ENST00000591806.1:c.2009C>G	19.37:g.1373090C>G	ENSP00000467083:p.Ser670Cys		A1L489|B5ME02|B7ZLY8|J3KQD6|Q13109|Q5XKB9|Q8N2I4|Q96A67	Missense_Mutation	SNP	pfam_PWWP_dom	p.S670C	ENST00000591806.1	37	c.2009	CCDS12062.1	19	.	.	.	.	.	.	.	.	.	.	C	18.39	3.612629	0.66672	.	.	ENSG00000160953	ENST00000344663;ENST00000311401	T;T	0.55052	0.54;0.54	4.47	4.47	0.54385	.	0.403617	0.27495	N	0.019102	T	0.70064	0.3181	M	0.65498	2.005	0.25075	N	0.990967	D;D	0.76494	0.999;0.999	D;P	0.68353	0.957;0.855	T	0.64635	-0.6361	10	0.87932	D	0	.	16.9872	0.86342	0.0:1.0:0.0:0.0	.	601;669	Q2TAK8-2;Q2TAK8	.;MUM1_HUMAN	C	670;601	ENSP00000345789:S670C;ENSP00000309135:S601C	ENSP00000309135:S601C	S	+	2	0	MUM1	1324090	0.795000	0.28851	0.007000	0.13788	0.657000	0.38888	6.094000	0.71431	2.417000	0.82017	0.455000	0.32223	TCT	MUM1	-	NULL	ENSG00000160953		0.632	MUM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUM1	HGNC	protein_coding	OTTHUMT00000449508.1	-	0.00	46	0	C	NM_032853		1373090	+1	tier1	-	no_errors	ENST00000344663	ensembl	human	known	74_37	missense	35.09	37	20	SNP	0.349	G
MYH6	4624	genome.wustl.edu	37	14	23865995	23865995	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr14:23865995C>T	ENST00000356287.3	-	18	2229	c.2200G>A	c.(2200-2202)Gag>Aag	p.E734K	MYH6_ENST00000405093.3_Missense_Mutation_p.E734K			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	734	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)			breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		AACTGTCCCTCAGGGATGGCC	0.537																																																	0													109.0	87.0	94.0					14																	23865995		2203	4300	6503	SO:0001583	missense	0			D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.2200G>A	14.37:g.23865995C>T	ENSP00000348634:p.Glu734Lys		A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E734K	ENST00000356287.3	37	c.2200	CCDS9600.1	14	.	.	.	.	.	.	.	.	.	.	.	24.2	4.504771	0.85176	.	.	ENSG00000197616	ENST00000405093;ENST00000356287	D;D	0.86956	-2.19;-2.19	4.46	4.46	0.54185	Myosin head, motor domain (2);	.	.	.	.	D	0.84065	0.5390	N	0.16602	0.42	0.58432	D	0.999995	P	0.37688	0.605	P	0.48400	0.576	T	0.81660	-0.0832	9	0.22109	T	0.4	.	17.4868	0.87691	0.0:1.0:0.0:0.0	.	734	P13533	MYH6_HUMAN	K	734	ENSP00000386041:E734K;ENSP00000348634:E734K	ENSP00000348634:E734K	E	-	1	0	MYH6	22935835	1.000000	0.71417	0.748000	0.31131	0.802000	0.45316	7.455000	0.80726	2.208000	0.71279	0.650000	0.86243	GAG	MYH6	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000197616		0.537	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH6	HGNC	protein_coding	OTTHUMT00000071796.3	-	0.00	86	0	C			23865995	-1	tier1	-	no_errors	ENST00000356287	ensembl	human	known	74_37	missense	32.88	49	24	SNP	1.000	T
MYO18B	84700	genome.wustl.edu	37	22	26298604	26298604	+	Silent	SNP	C	C	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr22:26298604C>A	ENST00000407587.2	+	30	5020	c.4851C>A	c.(4849-4851)gcC>gcA	p.A1617A	CTA-125H2.2_ENST00000609570.1_RNA|MYO18B_ENST00000536204.1_3'UTR|CTA-125H2.2_ENST00000453457.3_RNA|CTA-125H2.2_ENST00000597548.1_RNA|CTA-125H2.2_ENST00000609889.1_RNA|CTA-125H2.2_ENST00000599792.1_RNA|CTA-125H2.2_ENST00000608257.1_RNA|CTA-125H2.2_ENST00000609823.1_RNA|CTA-125H2.2_ENST00000608115.1_RNA|CTA-125H2.2_ENST00000595093.1_RNA|MYO18B_ENST00000335473.7_Silent_p.A1616A|CTA-125H2.2_ENST00000597284.1_RNA|CTA-125H2.2_ENST00000599080.1_RNA|CTA-125H2.2_ENST00000594585.1_RNA|CTA-125H2.2_ENST00000609157.1_RNA|MYO18B_ENST00000536101.1_Silent_p.A1616A|CTA-125H2.2_ENST00000609275.1_RNA|CTA-125H2.2_ENST00000607895.1_RNA|CTA-125H2.2_ENST00000600211.1_RNA|CTA-125H2.2_ENST00000600269.1_RNA			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1616	Tail.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						TGGCCCAGGCCCTAGGTGAGT	0.622																																																	0													41.0	44.0	43.0					22																	26298604		1980	4163	6143	SO:0001819	synonymous_variant	0			AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.4851C>A	22.37:g.26298604C>A			B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Silent	SNP	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,superfamily_tRNA-bd_arm,superfamily_Ribosomal_zn-bd,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.A1616	ENST00000407587.2	37	c.4848		22																																																																																			MYO18B	-	NULL	ENSG00000133454		0.622	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	MYO18B	HGNC	protein_coding	OTTHUMT00000400691.1	-	0.00	70	0	C	NM_032608		26298604	+1	tier1	-	no_errors	ENST00000335473	ensembl	human	known	74_37	silent	29.76	59	25	SNP	0.996	A
MYO9B	4650	genome.wustl.edu	37	19	17264866	17264866	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr19:17264866A>T	ENST00000594824.1	+	5	1235	c.1088A>T	c.(1087-1089)tAc>tTc	p.Y363F	CTD-3032J10.2_ENST00000599360.1_RNA|MYO9B_ENST00000397274.2_Missense_Mutation_p.Y363F|MYO9B_ENST00000595618.1_Missense_Mutation_p.Y363F|CTD-3032J10.2_ENST00000597216.1_RNA			Q13459	MYO9B_HUMAN	myosin IXB	363	Myosin motor.				actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						GATTATTTCTACCTCAACCAG	0.498																																																	0													82.0	85.0	84.0					19																	17264866		1944	4133	6077	SO:0001583	missense	0				CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.1088A>T	19.37:g.17264866A>T	ENSP00000471367:p.Tyr363Phe		O75314|Q9NUJ2|Q9UHN0	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_RhoGAP_dom,pfam_Ras-assoc,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Rho_GTPase_activation_prot,smart_Ras-assoc,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_IQ_motif_EF-hand-BS,pfscan_Ras-assoc,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom,prints_Myosin_head_motor_dom	p.Y363F	ENST00000594824.1	37	c.1088		19	.	.	.	.	.	.	.	.	.	.	A	25.9	4.689845	0.88735	.	.	ENSG00000099331	ENST00000397274	D	0.89552	-2.53	4.94	4.94	0.65067	Myosin head, motor domain (2);	0.000000	0.47455	D	0.000221	D	0.91958	0.7453	L	0.56769	1.78	0.45806	D	0.998686	P;P;P	0.50272	0.933;0.933;0.877	P;P;P	0.62014	0.897;0.897;0.781	D	0.92247	0.5805	10	0.59425	D	0.04	.	12.3461	0.55122	1.0:0.0:0.0:0.0	.	363;363;369	Q13459;B0I1T6;Q4LE74	MYO9B_HUMAN;.;.	F	363	ENSP00000380444:Y363F	ENSP00000380444:Y363F	Y	+	2	0	MYO9B	17125866	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.165000	0.94761	1.864000	0.54056	0.459000	0.35465	TAC	MYO9B	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000099331		0.498	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	MYO9B	HGNC	protein_coding	OTTHUMT00000463236.1	-	0.00	35	0	A			17264866	+1	tier1	-	no_errors	ENST00000594824	ensembl	human	known	74_37	missense	48.84	22	21	SNP	1.000	T
MYOM2	9172	genome.wustl.edu	37	8	2020437	2020437	+	Missense_Mutation	SNP	C	C	G	rs202106832	byFrequency	TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr8:2020437C>G	ENST00000262113.4	+	9	947	c.806C>G	c.(805-807)tCg>tGg	p.S269W	MYOM2_ENST00000523438.1_Intron	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	269	Ig-like C2-type 2.				muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		CCCCTGTCATCGATGATTCCG	0.577																																																	0													100.0	83.0	88.0					8																	2020437		2203	4300	6503	SO:0001583	missense	0				CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.806C>G	8.37:g.2020437C>G	ENSP00000262113:p.Ser269Trp		Q7Z3Y2	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.S269W	ENST00000262113.4	37	c.806	CCDS5957.1	8	.	.	.	.	.	.	.	.	.	.	C	8.323	0.824652	0.16678	.	.	ENSG00000036448	ENST00000262113	T	0.54071	0.59	5.13	3.34	0.38264	Immunoglobulin-like (1);	0.463601	0.21168	N	0.079030	T	0.43765	0.1262	L	0.50333	1.59	0.09310	N	0.999999	P	0.51933	0.949	B	0.43889	0.435	T	0.32025	-0.9922	10	0.38643	T	0.18	.	5.2624	0.15582	0.1541:0.6093:0.0:0.2366	.	269	P54296	MYOM2_HUMAN	W	269	ENSP00000262113:S269W	ENSP00000262113:S269W	S	+	2	0	MYOM2	2007844	0.004000	0.15560	0.000000	0.03702	0.001000	0.01503	2.039000	0.41193	0.556000	0.29098	0.655000	0.94253	TCG	MYOM2	-	pfscan_Ig-like_dom	ENSG00000036448		0.577	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOM2	HGNC	protein_coding	OTTHUMT00000251249.1	-	0.00	85	0	C	NM_003970		2020437	+1	tier1	-	no_errors	ENST00000262113	ensembl	human	known	74_37	missense	44.68	52	42	SNP	0.000	G
NBPF20	100288142	genome.wustl.edu	37	1	148262266	148262266	+	Silent	SNP	T	T	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr1:148262266T>C	ENST00000369202.1	-	98	12347	c.12150A>G	c.(12148-12150)ccA>ccG	p.P4050P				Q3BBV1	NBPFK_HUMAN	neuroblastoma breakpoint family, member 20	615						cytoplasm (GO:0005737)				breast(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|urinary_tract(1)	27						ACCTGGGGCATGGTGGGGTTT	0.433																																																	0																																										SO:0001819	synonymous_variant	0				CCDS72856.1	1q21.2	2014-01-16			ENSG00000203832			"""neuroblastoma breakpoint family"""	32000	protein-coding gene	gene with protein product		614007				16079250	Standard	NM_001278267		Approved			Q3BBV1	OTTHUMG00000042439	ENST00000369202.1:c.12150A>G	1.37:g.148262266T>C				Silent	SNP	pfam_NBPF_dom	p.P4050	ENST00000369202.1	37	c.12150		1																																																																																			NBPF20	-	pfam_NBPF_dom	ENSG00000203832		0.433	NBPF20-001	KNOWN	basic|appris_principal	protein_coding	NBPF20	HGNC	protein_coding	OTTHUMT00000100689.2	-	0.00	391	0	T			148262266	-1	tier1	-	no_errors	ENST00000369202	ensembl	human	known	74_37	silent	17.57	366	78	SNP	0.223	C
NCAM1	4684	genome.wustl.edu	37	11	113103878	113103878	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr11:113103878C>A	ENST00000533760.1	+	12	1747	c.1148C>A	c.(1147-1149)tCt>tAt	p.S383Y	NCAM1_ENST00000401611.2_Missense_Mutation_p.S510Y|NCAM1_ENST00000397957.4_3'UTR|NCAM1_ENST00000316851.7_Missense_Mutation_p.S501Y	NM_001242608.1	NP_001229537.1	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1	511	Ig-like C2-type 4.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		GACACCCCCTCTTCACCATCC	0.532																																																	0													67.0	68.0	68.0					11																	113103878		2027	4183	6210	SO:0001583	missense	0				CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000533760.1:c.1148C>A	11.37:g.113103878C>A	ENSP00000473281:p.Ser383Tyr		A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom,prints_Neural_cell_adh	p.S501Y	ENST00000533760.1	37	c.1502		11	.	.	.	.	.	.	.	.	.	.	C	29.5	5.013037	0.93346	.	.	ENSG00000149294	ENST00000531044;ENST00000401611;ENST00000316851	T;T	0.58797	0.83;0.31	6.06	6.06	0.98353	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	U	0.000001	T	0.79557	0.4466	.	.	.	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.80188	-0.1486	9	0.87932	D	0	-19.8651	20.6208	0.99490	0.0:1.0:0.0:0.0	.	511;501;511;501	P13591-5;P13591-1;P13591;P13591-3	.;.;NCAM1_HUMAN;.	Y	383;510;501	ENSP00000384055:S510Y;ENSP00000318472:S501Y	ENSP00000318472:S501Y	S	+	2	0	NCAM1	112609088	1.000000	0.71417	0.971000	0.41717	0.989000	0.77384	7.818000	0.86416	2.882000	0.98803	0.655000	0.94253	TCT	NCAM1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000149294		0.532	NCAM1-003	NOVEL	basic|appris_principal	protein_coding	NCAM1	HGNC	protein_coding	OTTHUMT00000394068.2	-	0.00	50	0	C	NM_000615		113103878	+1	tier1	-	no_errors	ENST00000316851	ensembl	human	known	74_37	missense	44.44	20	16	SNP	1.000	A
NCAM1	4684	genome.wustl.edu	37	11	113144552	113144552	+	Intron	SNP	G	G	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr11:113144552G>A	ENST00000397957.4	+	20	2667				NCAM1-AS1_ENST00000526229.1_RNA|NCAM1-AS1_ENST00000533638.1_RNA|NCAM1_ENST00000316851.7_Intron			P13591	NCAM1_HUMAN	neural cell adhesion molecule 1						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		CTCCTTGTTAGATGTGTCTTC	0.587																																																	0																																										SO:0001627	intron_variant	0				CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000397957.4:c.2668-1437G>A	11.37:g.113144552G>A			A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	RNA	SNP	-	NULL	ENST00000397957.4	37	NULL		11																																																																																			NCAM1-AS1	-	-	ENSG00000227487		0.587	NCAM1-001	KNOWN	basic	processed_transcript	NCAM1-AS1	HGNC	protein_coding	OTTHUMT00000393677.2	-	0.00	24	0	G	NM_000615		113144552	-1	tier1	-	no_errors	ENST00000526229	ensembl	human	known	74_37	rna	75.00	7	21	SNP	0.999	A
NCOR1	9611	genome.wustl.edu	37	17	16004598	16004598	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr17:16004598C>T	ENST00000268712.3	-	20	2913	c.2656G>A	c.(2656-2658)Gat>Aat	p.D886N	NCOR1_ENST00000395848.1_Missense_Mutation_p.D793N|NCOR1_ENST00000395851.1_Missense_Mutation_p.D902N|NCOR1_ENST00000583226.1_5'Flank|RNU6-314P_ENST00000516574.1_RNA	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	886					CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		ACATCCTCATCAGCGCTGCAC	0.547																																																	0													154.0	144.0	148.0					17																	16004598		2203	4300	6503	SO:0001583	missense	0			AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.2656G>A	17.37:g.16004598C>T	ENSP00000268712:p.Asp886Asn		B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Missense_Mutation	SNP	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.D886N	ENST00000268712.3	37	c.2656	CCDS11175.1	17	.	.	.	.	.	.	.	.	.	.	C	33	5.250934	0.95305	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849;ENST00000395848	T;T;T	0.48201	0.82;0.82;0.82	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.63593	0.2524	L	0.45352	1.415	0.80722	D	1	D;D;D	0.89917	1.0;0.997;0.998	D;D;D	0.87578	0.998;0.989;0.995	T	0.64914	-0.6295	10	0.72032	D	0.01	-16.089	18.423	0.90598	0.0:1.0:0.0:0.0	.	793;886;902	E9PGV6;O75376;O75376-2	.;NCOR1_HUMAN;.	N	886;902;793;793	ENSP00000268712:D886N;ENSP00000379192:D902N;ENSP00000379189:D793N	ENSP00000268712:D886N	D	-	1	0	NCOR1	15945323	1.000000	0.71417	0.845000	0.33349	0.980000	0.70556	6.451000	0.73481	2.607000	0.88179	0.650000	0.86243	GAT	NCOR1	-	NULL	ENSG00000141027		0.547	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOR1	HGNC	protein_coding	OTTHUMT00000131751.5	-	0.00	85	0	C	NM_006311		16004598	-1	tier1	-	no_errors	ENST00000268712	ensembl	human	known	74_37	missense	39.02	50	32	SNP	1.000	T
NDST4	64579	genome.wustl.edu	37	4	115997552	115997552	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr4:115997552G>A	ENST00000264363.2	-	2	1319	c.641C>T	c.(640-642)cCt>cTt	p.P214L		NM_022569.1	NP_072091.1	Q9H3R1	NDST4_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4	214	Heparan sulfate N-deacetylase 4.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(43)|ovary(1)|prostate(7)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	81		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		CCCAGGAAGAGGGCCTTTCTC	0.413																																																	0													74.0	75.0	75.0					4																	115997552		2203	4300	6503	SO:0001583	missense	0			AB036429	CCDS3706.1	4q26	2008-02-05			ENSG00000138653	ENSG00000138653		"""Sulfotransferases, membrane-bound"""	20779	protein-coding gene	gene with protein product		615039				11087757	Standard	NM_022569		Approved		uc003ibu.3	Q9H3R1	OTTHUMG00000132916	ENST00000264363.2:c.641C>T	4.37:g.115997552G>A	ENSP00000264363:p.Pro214Leu		Q2KHM8	Missense_Mutation	SNP	pfam_Heparan_SO4_deacetylase,pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.P214L	ENST00000264363.2	37	c.641	CCDS3706.1	4	.	.	.	.	.	.	.	.	.	.	G	17.23	3.336102	0.60963	.	.	ENSG00000138653	ENST00000264363	T	0.36520	1.25	5.25	5.25	0.73442	.	0.229463	0.44285	D	0.000473	T	0.41880	0.1178	M	0.69358	2.11	0.80722	D	1	B	0.12013	0.005	B	0.21151	0.033	T	0.26189	-1.0110	10	0.35671	T	0.21	.	18.8669	0.92296	0.0:0.0:1.0:0.0	.	214	Q9H3R1	NDST4_HUMAN	L	214	ENSP00000264363:P214L	ENSP00000264363:P214L	P	-	2	0	NDST4	116217001	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	9.709000	0.98729	2.437000	0.82529	0.591000	0.81541	CCT	NDST4	-	pfam_Heparan_SO4_deacetylase	ENSG00000138653		0.413	NDST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDST4	HGNC	protein_coding	OTTHUMT00000256427.1	-	0.00	25	0	G	NM_022569		115997552	-1	tier1	-	no_errors	ENST00000264363	ensembl	human	known	74_37	missense	20.45	35	9	SNP	1.000	A
NHLRC2	374354	genome.wustl.edu	37	10	115618346	115618346	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr10:115618346A>G	ENST00000369301.3	+	2	450	c.238A>G	c.(238-240)Ata>Gta	p.I80V		NM_198514.3	NP_940916.2	Q8NBF2	NHLC2_HUMAN	NHL repeat containing 2	80	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.									breast(1)|endometrium(2)|kidney(4)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	15				Epithelial(162;0.017)|all cancers(201;0.0187)		ATGTGGAAAAATAGTCGTCCT	0.343																																																	0													160.0	149.0	153.0					10																	115618346		2203	4300	6503	SO:0001583	missense	0			AK090631	CCDS7585.1	10q26.11	2006-03-31			ENSG00000196865	ENSG00000196865			24731	protein-coding gene	gene with protein product						12477932	Standard	NM_198514		Approved	FLJ25621, FLJ20147, FLJ33312, MGC45492, DKFZp779F115	uc001lax.2	Q8NBF2	OTTHUMG00000019078	ENST00000369301.3:c.238A>G	10.37:g.115618346A>G	ENSP00000358307:p.Ile80Val		Q8N1H1|Q8N5A6	Missense_Mutation	SNP	pfam_NHL_repeat,superfamily_Thioredoxin-like_fold,pfscan_NHL_repeat_subgr	p.I80V	ENST00000369301.3	37	c.238	CCDS7585.1	10	.	.	.	.	.	.	.	.	.	.	A	3.716	-0.058588	0.07317	.	.	ENSG00000196865	ENST00000369301	T	0.79653	-1.29	5.67	4.76	0.60689	Thioredoxin-like fold (3);	0.132015	0.51477	N	0.000097	T	0.52645	0.1747	N	0.02120	-0.675	0.32594	N	0.526743	B	0.02656	0.0	B	0.01281	0.0	T	0.53258	-0.8464	10	0.02654	T	1	-8.3684	12.1907	0.54270	0.0802:0.0:0.9198:0.0	.	80	Q8NBF2	NHLC2_HUMAN	V	80	ENSP00000358307:I80V	ENSP00000358307:I80V	I	+	1	0	NHLRC2	115608336	1.000000	0.71417	0.996000	0.52242	0.804000	0.45430	6.160000	0.71862	1.359000	0.45940	-0.462000	0.05337	ATA	NHLRC2	-	superfamily_Thioredoxin-like_fold	ENSG00000196865		0.343	NHLRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NHLRC2	HGNC	protein_coding	OTTHUMT00000050446.1	-	0.00	69	0	A	NM_198514		115618346	+1	tier1	-	no_errors	ENST00000369301	ensembl	human	known	74_37	missense	39.71	41	27	SNP	1.000	G
NIN	51199	genome.wustl.edu	37	14	51239778	51239778	+	Silent	SNP	G	G	A	rs369292594		TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr14:51239778G>A	ENST00000382041.3	-	8	892	c.702C>T	c.(700-702)gaC>gaT	p.D234D	NIN_ENST00000245441.5_Silent_p.D234D|NIN_ENST00000324330.9_Silent_p.D234D|NIN_ENST00000389868.3_Silent_p.D234D|NIN_ENST00000530997.2_Silent_p.D234D|NIN_ENST00000453196.1_Silent_p.D234D|NIN_ENST00000382043.4_Silent_p.D234D	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)	234	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					TCATTGTACCGTCAGGATCAA	0.348			T	PDGFRB	MPD																																			Dom	yes		14	14q24	51199	ninein (GSK3B interacting protein)		L	0								G	,,,	1,4405	2.1+/-5.4	0,1,2202	97.0	95.0	96.0		702,702,702,702	2.4	1.0	14		96	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	NIN	NM_016350.4,NM_020921.3,NM_182944.2,NM_182946.1	,,,	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	,,,	234/1378,234/2134,234/2047,234/2091	51239778	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0			AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.702C>T	14.37:g.51239778G>A			A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Silent	SNP	superfamily_tRNA-bd_arm,pfscan_EF_hand_dom	p.D234	ENST00000382041.3	37	c.702	CCDS32079.1	14																																																																																			NIN	-	NULL	ENSG00000100503		0.348	NIN-016	KNOWN	basic|CCDS	protein_coding	NIN	HGNC	protein_coding	OTTHUMT00000395207.2	-	0.00	38	0	G	NM_182946		51239778	-1	tier1	-	no_errors	ENST00000245441	ensembl	human	known	74_37	silent	22.39	52	15	SNP	0.995	A
NLRP2	55655	genome.wustl.edu	37	19	55501422	55501422	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr19:55501422G>T	ENST00000543010.1	+	9	2542	c.2399G>T	c.(2398-2400)tGg>tTg	p.W800L	NLRP2_ENST00000537859.1_Missense_Mutation_p.W778L|NLRP2_ENST00000391721.4_Missense_Mutation_p.W776L|NLRP2_ENST00000427260.2_Missense_Mutation_p.W777L|NLRP2_ENST00000448584.2_Missense_Mutation_p.W800L|NLRP2_ENST00000263437.6_Missense_Mutation_p.W797L|NLRP2_ENST00000538819.1_Missense_Mutation_p.W776L|NLRP2_ENST00000339757.7_Missense_Mutation_p.W778L	NM_001174081.1	NP_001167552.1	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	800					positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|Pyrin domain binding (GO:0032090)			large_intestine(4)|liver(1)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	11			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		ACTCAGCAGTGGGCTGATCTC	0.488																																																	0													122.0	107.0	112.0					19																	55501422		2203	4300	6503	SO:0001583	missense	0			AK000517	CCDS12913.1, CCDS54318.1, CCDS54319.1	19q13.42	2008-02-05	2006-12-08	2006-12-08	ENSG00000022556	ENSG00000022556		"""Nucleotide-binding domain and leucine rich repeat containing"""	22948	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 2"""	609364	"""NACHT, leucine rich repeat and PYD containing 2"""	NALP2		12563287, 11270363	Standard	NM_001174081		Approved	FLJ20510, PYPAF2, NBS1, PAN1, CLR19.9	uc021vbq.1	Q9NX02	OTTHUMG00000167763	ENST00000543010.1:c.2399G>T	19.37:g.55501422G>T	ENSP00000445135:p.Trp800Leu		B4DZL7|I3L0G4|Q53FL5|Q59G09|Q8IXT0|Q9BVN5|Q9H6G6|Q9HAV9|Q9NWK3	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.W800L	ENST00000543010.1	37	c.2399	CCDS12913.1	19	.	.	.	.	.	.	.	.	.	.	G	10.40	1.340304	0.24339	.	.	ENSG00000022556	ENST00000543010;ENST00000391721;ENST00000339757;ENST00000448584;ENST00000537859;ENST00000427260;ENST00000538819;ENST00000263437	T;T;T;T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89;0.89;0.89;0.89	2.51	1.4	0.22301	.	.	.	.	.	T	0.48277	0.1491	M	0.76002	2.32	0.09310	N	1	B;P;P;P;P	0.47034	0.349;0.889;0.714;0.811;0.714	B;P;B;P;B	0.49665	0.143;0.618;0.414;0.618;0.414	T	0.33523	-0.9865	9	0.46703	T	0.11	.	6.3452	0.21345	0.0:0.0:0.7062:0.2938	.	777;778;797;776;800	B4DZL7;Q9NX02-2;A8K9G6;Q9NX02-4;Q9NX02	.;.;.;.;NALP2_HUMAN	L	800;776;778;800;778;777;776;797	ENSP00000445135:W800L;ENSP00000375601:W776L;ENSP00000344074:W778L;ENSP00000409370:W800L;ENSP00000440601:W778L;ENSP00000402474:W777L;ENSP00000441133:W776L;ENSP00000263437:W797L	ENSP00000263437:W797L	W	+	2	0	NLRP2	60193234	0.848000	0.29623	0.048000	0.18961	0.029000	0.11900	0.920000	0.28705	0.579000	0.29504	0.650000	0.86243	TGG	NLRP2	-	NULL	ENSG00000022556		0.488	NLRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP2	HGNC	protein_coding	OTTHUMT00000396152.1	-	0.00	30	0	G	NM_017852		55501422	+1	tier1	-	no_errors	ENST00000448584	ensembl	human	known	74_37	missense	32.14	19	9	SNP	0.067	T
NUDCD3	23386	genome.wustl.edu	37	7	44530051	44530051	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr7:44530051C>A	ENST00000355451.7	-	1	428	c.149G>T	c.(148-150)cGc>cTc	p.R50L		NM_015332.3	NP_056147.2	Q8IVD9	NUDC3_HUMAN	NudC domain containing 3	50										endometrium(2)|large_intestine(1)|lung(3)|skin(1)	7						GAAGCCCATGCGGTCCGATGG	0.697																																																	0													18.0	23.0	22.0					7																	44530051		1928	4144	6072	SO:0001583	missense	0			BC003691	CCDS5490.2	7p13-p12	2005-03-18			ENSG00000015676	ENSG00000015676			22208	protein-coding gene	gene with protein product		610296					Standard	NM_015332		Approved	KIAA1068	uc003tkz.3	Q8IVD9	OTTHUMG00000129174	ENST00000355451.7:c.149G>T	7.37:g.44530051C>A	ENSP00000347626:p.Arg50Leu		Q9BTI3|Q9H7W9|Q9UPT4	Missense_Mutation	SNP	pfam_CS_dom,superfamily_HSP20-like_chaperone,pfscan_CS_dom	p.R50L	ENST00000355451.7	37	c.149	CCDS5490.2	7	.	.	.	.	.	.	.	.	.	.	c	28.8	4.948831	0.92660	.	.	ENSG00000015676	ENST00000355451	T	0.56444	0.46	4.3	4.3	0.51218	.	0.129364	0.47455	D	0.000225	T	0.62221	0.2410	L	0.46157	1.445	0.45648	D	0.998579	D	0.61697	0.99	P	0.61800	0.894	T	0.65384	-0.6181	10	0.66056	D	0.02	-1.8662	13.9489	0.64104	0.0:1.0:0.0:0.0	.	50	Q8IVD9	NUDC3_HUMAN	L	50	ENSP00000347626:R50L	ENSP00000347626:R50L	R	-	2	0	NUDCD3	44496576	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.732000	0.47352	2.358000	0.79984	0.558000	0.71614	CGC	NUDCD3	-	NULL	ENSG00000015676		0.697	NUDCD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUDCD3	HGNC	protein_coding	OTTHUMT00000251248.3	-	0.00	40	0	C	NM_015332		44530051	-1	tier1	-	no_errors	ENST00000355451	ensembl	human	known	74_37	missense	65.71	12	23	SNP	1.000	A
NUDT16	131870	genome.wustl.edu	37	3	131102105	131102105	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr3:131102105C>A	ENST00000521288.1	+	3	539	c.508C>A	c.(508-510)Cag>Aag	p.Q170K	RP11-933H2.4_ENST00000502521.1_RNA|NUDT16_ENST00000359850.3_Missense_Mutation_p.Q137K|NUDT16_ENST00000537561.1_Missense_Mutation_p.Q124K|NUDT16_ENST00000502852.1_3'UTR			Q96DE0	NUD16_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 16	170	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				adenosine to inosine editing (GO:0006382)|dephosphorylation (GO:0016311)|dITP catabolic process (GO:0035863)|IDP catabolic process (GO:0046709)|mRNA catabolic process (GO:0006402)|negative regulation of rRNA processing (GO:2000233)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of cell cycle process (GO:0090068)|positive regulation of cell proliferation (GO:0008284)|positive regulation of double-strand break repair (GO:2000781)|proteolysis (GO:0006508)|small molecule metabolic process (GO:0044281)|snoRNA catabolic process (GO:0016077)|XDP catabolic process (GO:1901639)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cobalt ion binding (GO:0050897)|dIDP diphosphatase activity (GO:0097383)|dITP diphosphatase activity (GO:0035870)|GTP binding (GO:0005525)|inosine-diphosphatase activity (GO:0090450)|ITP binding (GO:1901641)|m7G(5')pppN diphosphatase activity (GO:0050072)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|metalloexopeptidase activity (GO:0008235)|mRNA binding (GO:0003729)|nucleotide phosphatase activity, acting on free nucleotides (GO:0098519)|protein homodimerization activity (GO:0042803)|snoRNA binding (GO:0030515)|XTP binding (GO:1901640)			large_intestine(1)|lung(6)	7						TGCGCGGGAGCAGTTACTTGA	0.577																																																	0													110.0	97.0	101.0					3																	131102105		2203	4300	6503	SO:0001583	missense	0			AK055827	CCDS3070.1, CCDS3070.2, CCDS54640.1, CCDS54641.1	3q21.3	2005-01-25						"""Nudix motif containing"""	26442	protein-coding gene	gene with protein product						12477932	Standard	NM_152395		Approved	FLJ31265	uc021xec.1	Q96DE0		ENST00000521288.1:c.508C>A	3.37:g.131102105C>A	ENSP00000429274:p.Gln170Lys		B4E3B4|E9PED4|F5GYJ1|Q96N82	Missense_Mutation	SNP	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like	p.Q170K	ENST00000521288.1	37	c.508	CCDS3070.2	3	.	.	.	.	.	.	.	.	.	.	C	12.86	2.063511	0.36373	.	.	ENSG00000198585	ENST00000537561;ENST00000359850;ENST00000521288	T;T;T	0.51574	0.7;0.7;0.7	2.95	2.02	0.26589	NUDIX hydrolase domain (1);NUDIX hydrolase domain-like (1);	0.088854	0.47093	U	0.000242	T	0.39860	0.1094	M	0.61703	1.905	0.45005	D	0.998022	P	0.35139	0.486	B	0.28385	0.089	T	0.43196	-0.9406	10	0.87932	D	0	-17.218	9.8468	0.41032	0.0:0.7878:0.2122:0.0	.	170	Q96DE0	NUD16_HUMAN	K	124;137;170	ENSP00000440230:Q124K;ENSP00000352911:Q137K;ENSP00000429274:Q170K	ENSP00000352911:Q137K	Q	+	1	0	NUDT16	132584795	1.000000	0.71417	1.000000	0.80357	0.688000	0.40055	3.773000	0.55333	0.754000	0.32968	0.491000	0.48974	CAG	NUDT16	-	superfamily_NUDIX_hydrolase_dom-like	ENSG00000198585		0.577	NUDT16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUDT16	HGNC	protein_coding	OTTHUMT00000356537.9	-	0.00	65	0	C	NM_152395		131102105	+1	tier1	-	no_errors	ENST00000521288	ensembl	human	known	74_37	missense	28.57	75	30	SNP	1.000	A
NUP88	4927	genome.wustl.edu	37	17	5289551	5289551	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr17:5289551T>C	ENST00000573584.1	-	17	2710	c.2201A>G	c.(2200-2202)gAt>gGt	p.D734G	NUP88_ENST00000573169.1_5'Flank	NM_002532.4	NP_002523.2	Q99567	NUP88_HUMAN	nucleoporin 88kDa	734					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	transporter activity (GO:0005215)			endometrium(4)|kidney(4)|large_intestine(4)|lung(3)	15						ATTGCGGATATCATTGATTTG	0.358																																																	0													266.0	242.0	250.0					17																	5289551		2203	4300	6503	SO:0001583	missense	0			Y08612	CCDS11070.1	17p13	2004-02-18	2002-08-29		ENSG00000108559	ENSG00000108559			8067	protein-coding gene	gene with protein product		602552	"""nucleoporin 88kD"""			9049309	Standard	NM_002532		Approved	MGC8530	uc002gbo.2	Q99567	OTTHUMG00000099453	ENST00000573584.1:c.2201A>G	17.37:g.5289551T>C	ENSP00000458954:p.Asp734Gly		D3DTM2|Q9BWE5	Missense_Mutation	SNP	pfam_Nucleoporin_Nup88	p.D734G	ENST00000573584.1	37	c.2201	CCDS11070.1	17	.	.	.	.	.	.	.	.	.	.	T	22.5	4.294498	0.81025	.	.	ENSG00000108559	ENST00000225696;ENST00000543132	.	.	.	4.94	4.94	0.65067	.	0.105124	0.64402	D	0.000007	T	0.61553	0.2356	L	0.57536	1.79	0.54753	D	0.999981	P;P	0.47253	0.81;0.892	P;P	0.49085	0.6;0.492	T	0.60850	-0.7181	9	0.33940	T	0.23	-14.977	14.243	0.65969	0.0:0.0:0.0:1.0	.	619;734	B4DP20;Q99567	.;NUP88_HUMAN	G	734;619	.	ENSP00000225696:D734G	D	-	2	0	NUP88	5230275	1.000000	0.71417	0.978000	0.43139	0.997000	0.91878	5.026000	0.64103	2.207000	0.71202	0.533000	0.62120	GAT	NUP88	-	pfam_Nucleoporin_Nup88	ENSG00000108559		0.358	NUP88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP88	HGNC	protein_coding	OTTHUMT00000216918.3	-	0.00	98	0	T	NM_002532		5289551	-1	tier1	-	no_errors	ENST00000573584	ensembl	human	known	74_37	missense	34.62	51	27	SNP	1.000	C
OMA1	115209	genome.wustl.edu	37	1	59004831	59004831	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr1:59004831T>C	ENST00000371226.3	-	2	249	c.136A>G	c.(136-138)Ata>Gta	p.I46V	OMA1_ENST00000467063.1_Intron|OMA1_ENST00000358603.2_Missense_Mutation_p.I46V|DAB1_ENST00000485760.1_Intron	NM_145243.3	NP_660286.1	Q96E52	OMA1_HUMAN	OMA1 zinc metallopeptidase	46					cristae formation (GO:0042407)|diet induced thermogenesis (GO:0002024)|energy homeostasis (GO:0097009)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|mitochondrial protein processing (GO:0034982)|negative regulation of mitochondrial fusion (GO:0010637)|response to stress (GO:0006950)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|breast(1)|large_intestine(6)|liver(2)|lung(6)|prostate(1)|skin(1)	18	all_cancers(7;6.54e-05)					TTATTTACTATATGGTTAACT	0.368																																																	0													106.0	109.0	108.0					1																	59004831		2203	4300	6503	SO:0001583	missense	0			AK091101	CCDS608.1	1p32.2-p32.1	2013-05-03	2013-05-03		ENSG00000162600	ENSG00000162600			29661	protein-coding gene	gene with protein product	"""overlapping activity with M-AAA protease"", ""zinc metallopeptidase OMA1"""		"""OMA1 zinc metallopeptidase homolog (S. cerevisiae)"""			12477932	Standard	NM_145243		Approved	MPRP-1, YKR087C, ZMPOMA1, FLJ33782	uc001cyy.3	Q96E52	OTTHUMG00000010068	ENST00000371226.3:c.136A>G	1.37:g.59004831T>C	ENSP00000360270:p.Ile46Val		D3DQ54|Q5T3G6|Q5T3G7|Q5T3G8|Q5T3G9|Q5T3H0|Q8NBB3	Missense_Mutation	SNP	pfam_Peptidase_M48	p.I46V	ENST00000371226.3	37	c.136	CCDS608.1	1	.	.	.	.	.	.	.	.	.	.	T	1.386	-0.582059	0.03827	.	.	ENSG00000162600	ENST00000358603;ENST00000371226;ENST00000456980;ENST00000419242;ENST00000426139;ENST00000453710	T;T;T;T;T;T	0.26223	2.7;2.74;2.16;2.17;2.17;1.75	5.32	-6.65	0.01795	.	1.609900	0.02799	N	0.122928	T	0.16685	0.0401	L	0.36672	1.1	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.0;0.001	T	0.15435	-1.0437	9	.	.	.	2.8949	5.438	0.16492	0.1158:0.5011:0.2346:0.1486	.	46;46	Q96E52;Q96E52-2	OMA1_HUMAN;.	V	46	ENSP00000351417:I46V;ENSP00000360270:I46V;ENSP00000395053:I46V;ENSP00000409589:I46V;ENSP00000416495:I46V;ENSP00000392978:I46V	.	I	-	1	0	OMA1	58777419	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.185000	0.03073	-1.122000	0.02945	-0.313000	0.08912	ATA	OMA1	-	NULL	ENSG00000162600		0.368	OMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OMA1	HGNC	protein_coding	OTTHUMT00000027819.1	-	0.00	41	0	T	NM_145243		59004831	-1	tier1	-	no_errors	ENST00000371226	ensembl	human	known	74_37	missense	20.55	289	75	SNP	0.000	C
OBSCN	84033	genome.wustl.edu	37	1	228487030	228487030	+	Intron	SNP	A	A	C	rs562894992		TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr1:228487030A>C	ENST00000422127.1	+	43	11703				OBSCN_ENST00000359599.6_3'UTR|OBSCN_ENST00000366707.4_Missense_Mutation_p.Q1117H|RP5-1139B12.4_ENST00000602778.1_RNA|OBSCN_ENST00000366709.4_Intron|OBSCN_ENST00000284548.11_Intron|OBSCN_ENST00000570156.2_Missense_Mutation_p.Q4427H	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF						apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CCACACTGCAATGTGAGCTGA	0.582																																																	0													104.0	89.0	94.0					1																	228487030		876	1991	2867	SO:0001627	intron_variant	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.11659+4286A>C	1.37:g.228487030A>C			Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_DH-domain,pfam_Fibronectin_type3,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.Q1117H	ENST00000422127.1	37	c.3351	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	A	9.307	1.054467	0.19907	.	.	ENSG00000154358	ENST00000366707	T	0.68181	-0.31	4.45	-1.64	0.08318	.	.	.	.	.	T	0.59059	0.2166	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54984	-0.8211	6	0.42905	T	0.14	.	2.4773	0.04579	0.1741:0.4272:0.2214:0.1773	.	.	.	.	H	1117	ENSP00000355668:Q1117H	ENSP00000355668:Q1117H	Q	+	3	2	OBSCN	226553653	0.000000	0.05858	0.322000	0.25334	0.143000	0.21401	-4.179000	0.00279	-0.089000	0.12484	-1.145000	0.01858	CAA	OBSCN	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000154358		0.582	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		-	0.00	83	0	A	NM_052843		228487030	+1	tier1	-	no_errors	ENST00000366707	ensembl	human	known	74_37	missense	30.85	65	29	SNP	0.031	C
OR14C36	127066	genome.wustl.edu	37	1	248512820	248512820	+	Silent	SNP	C	C	T	rs142764213		TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr1:248512820C>T	ENST00000317861.1	+	1	744	c.744C>T	c.(742-744)gtC>gtT	p.V248V		NM_001001918.1	NP_001001918.1	Q8NHC7	O14CZ_HUMAN	olfactory receptor, family 14, subfamily C, member 36	248						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|liver(2)|lung(20)|ovary(2)|prostate(3)|skin(7)|upper_aerodigestive_tract(2)	43						TGGTGTCAGTCTTCCTCAGTT	0.512																																																	0								C		0,4406		0,0,2203	203.0	134.0	158.0		744	-1.0	0.1	1	dbSNP_134	158	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	OR14C36	NM_001001918.1		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		248/313	248512820	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			BK004466	CCDS31112.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000177174	ENSG00000177174		"""GPCR / Class A : Olfactory receptors"""	15026	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily BF, member 1"""	OR5BF1			Standard	NM_001001918		Approved		uc010pzl.2	Q8NHC7	OTTHUMG00000040463	ENST00000317861.1:c.744C>T	1.37:g.248512820C>T			Q6IEZ6	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V248	ENST00000317861.1	37	c.744	CCDS31112.1	1																																																																																			OR14C36	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000177174		0.512	OR14C36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR14C36	HGNC	protein_coding	OTTHUMT00000097359.1	-	0.00	28	0	C	NM_001001918		248512820	+1	tier1	rs142764213	no_errors	ENST00000317861	ensembl	human	known	74_37	silent	31.82	15	7	SNP	0.119	T
OR4N2	390429	genome.wustl.edu	37	14	20296476	20296476	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr14:20296476G>A	ENST00000315947.1	+	1	869	c.869G>A	c.(868-870)cGc>cAc	p.R290H	OR4N2_ENST00000568211.1_3'UTR	NM_001004723.1	NP_001004723.1	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N, member 2	290						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(32)|ovary(2)|prostate(1)|skin(2)|stomach(2)	52	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TATACCCTTCGCAACCAGGAA	0.403																																																	0													47.0	50.0	49.0					14																	20296476		2203	4296	6499	SO:0001583	missense	0				CCDS32022.1	14q11.2	2013-09-23				ENSG00000176294		"""GPCR / Class A : Olfactory receptors"""	14742	protein-coding gene	gene with protein product							Standard	NM_001004723		Approved		uc010tkv.2	Q8NGD1		ENST00000315947.1:c.869G>A	14.37:g.20296476G>A	ENSP00000319601:p.Arg290His		Q6IEY9|Q6IFA2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R290H	ENST00000315947.1	37	c.869	CCDS32022.1	14	.	.	.	.	.	.	.	.	.	.	.	7.943	0.743201	0.15642	.	.	ENSG00000176294	ENST00000315947	T	0.41065	1.01	4.57	2.73	0.32206	.	0.000000	0.39909	N	0.001237	T	0.49372	0.1553	M	0.93462	3.42	0.19945	N	0.999941	B	0.32302	0.363	B	0.27715	0.082	T	0.53844	-0.8381	10	0.87932	D	0	-6.4057	8.7854	0.34818	0.1889:0.0:0.8111:0.0	.	290	Q8NGD1	OR4N2_HUMAN	H	290	ENSP00000319601:R290H	ENSP00000319601:R290H	R	+	2	0	OR4N2	19366316	0.173000	0.23056	0.675000	0.29917	0.112000	0.19704	2.979000	0.49313	0.651000	0.30788	0.591000	0.81541	CGC	OR4N2	-	prints_Olfact_rcpt,prints_GPCR_Rhodpsn	ENSG00000176294		0.403	OR4N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4N2	HGNC	protein_coding	OTTHUMT00000409821.2	-	0.00	114	0	G			20296476	+1	tier1	-	no_errors	ENST00000315947	ensembl	human	known	74_37	missense	44.62	72	58	SNP	0.519	A
OR6N2	81442	genome.wustl.edu	37	1	158746611	158746611	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr1:158746611C>T	ENST00000339258.1	-	1	814	c.815G>A	c.(814-816)cGa>cAa	p.R272Q		NM_001005278.1	NP_001005278.1	Q8NGY6	OR6N2_HUMAN	olfactory receptor, family 6, subfamily N, member 2	272						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(6)|lung(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_hematologic(112;0.0378)					AGCAAGTGTTCGGTCAAGGGT	0.433																																																	0													132.0	124.0	126.0					1																	158746611		2203	4300	6503	SO:0001583	missense	0			BK004200	CCDS30906.1	1q23.1	2012-08-09			ENSG00000188340	ENSG00000188340		"""GPCR / Class A : Olfactory receptors"""	15035	protein-coding gene	gene with protein product							Standard	NM_001005278		Approved		uc010pir.2	Q8NGY6	OTTHUMG00000022775	ENST00000339258.1:c.815G>A	1.37:g.158746611C>T	ENSP00000344101:p.Arg272Gln		Q6IFR2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R272Q	ENST00000339258.1	37	c.815	CCDS30906.1	1	.	.	.	.	.	.	.	.	.	.	C	11.06	1.526299	0.27299	.	.	ENSG00000188340	ENST00000339258	T	0.00084	8.75	4.74	3.83	0.44106	GPCR, rhodopsin-like superfamily (1);	0.000000	0.32204	N	0.006423	T	0.00039	0.0001	N	0.25647	0.755	0.26308	N	0.977873	B	0.24533	0.105	B	0.19391	0.025	T	0.20140	-1.0284	10	0.62326	D	0.03	-2.3327	7.396	0.26936	0.0:0.8058:0.0:0.1942	.	272	Q8NGY6	OR6N2_HUMAN	Q	272	ENSP00000344101:R272Q	ENSP00000344101:R272Q	R	-	2	0	OR6N2	157013235	0.000000	0.05858	0.927000	0.36925	0.817000	0.46193	-0.158000	0.10070	1.201000	0.43203	0.650000	0.86243	CGA	OR6N2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000188340		0.433	OR6N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6N2	HGNC	protein_coding	OTTHUMT00000059068.1	-	0.00	92	0	C			158746611	-1	tier1	-	no_errors	ENST00000339258	ensembl	human	known	74_37	missense	27.27	56	21	SNP	0.761	T
OSR2	116039	genome.wustl.edu	37	8	99963089	99963089	+	Intron	SNP	G	G	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr8:99963089G>C	ENST00000297565.4	+	3	1252				OSR2_ENST00000522510.1_Intron|OSR2_ENST00000435298.2_Intron|OSR2_ENST00000457907.2_Intron|OSR2_ENST00000523368.1_Missense_Mutation_p.D288H	NM_001142462.1	NP_001135934.1	Q8N2R0	OSR2_HUMAN	odd-skipped related transciption factor 2						bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|chondrocyte differentiation (GO:0002062)|embryo development (GO:0009790)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal joint development (GO:0072498)|embryonic skeletal joint morphogenesis (GO:0060272)|embryonic skeletal limb joint morphogenesis (GO:0036023)|embryonic skeletal system morphogenesis (GO:0048704)|eyelid development in camera-type eye (GO:0061029)|head development (GO:0060322)|mesonephros development (GO:0001823)|metanephros development (GO:0001656)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis (GO:0042476)|osteoblast proliferation (GO:0033687)|palate development (GO:0060021)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gastrulation (GO:2000543)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Breast(36;4.14e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.0136)			GCTCTATTTAGATTAGTTCTC	0.308																																																	0																																										SO:0001627	intron_variant	0			AY038072	CCDS47901.1, CCDS47902.1, CCDS69520.1	8q22.2	2013-10-17	2013-10-17			ENSG00000164920		"""Zinc fingers, C2H2-type"""	15830	protein-coding gene	gene with protein product		611297	"""odd-skipped related 2 (Drosophila)"""				Standard	XM_005250779		Approved	FLJ90037	uc003yir.3	Q8N2R0		ENST00000297565.4:c.756+106G>C	8.37:g.99963089G>C			A8K626|B4E3B7|Q96AM6|Q96LB6|Q96LB7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D288H	ENST00000297565.4	37	c.862	CCDS47901.1	8	.	.	.	.	.	.	.	.	.	.	G	2.823	-0.244379	0.05906	.	.	ENSG00000164920	ENST00000523368	T	0.07444	3.19	5.24	0.102	0.14522	.	.	.	.	.	T	0.04227	0.0117	.	.	.	0.09310	N	1	B	0.19445	0.036	B	0.15870	0.014	T	0.45308	-0.9270	7	.	.	.	.	4.2291	0.10594	0.242:0.0:0.4808:0.2771	.	288	E5RH04	.	H	288	ENSP00000430041:D288H	.	D	+	1	0	OSR2	100032265	0.040000	0.19996	0.006000	0.13384	0.843000	0.47879	0.311000	0.19380	0.346000	0.23899	0.655000	0.94253	GAT	OSR2	-	NULL	ENSG00000164920		0.308	OSR2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	OSR2	HGNC	protein_coding	OTTHUMT00000379505.1	-	0.00	70	0	G	NM_053001		99963089	+1	tier1	-	no_errors	ENST00000523368	ensembl	human	putative	74_37	missense	23.93	89	28	SNP	0.000	C
P2RX2	22953	genome.wustl.edu	37	12	133197878	133197878	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr12:133197878C>A	ENST00000389110.3	+	9	980	c.943C>A	c.(943-945)Cgc>Agc	p.R315S	P2RX2_ENST00000348800.5_Missense_Mutation_p.R315S|P2RX2_ENST00000449132.2_Missense_Mutation_p.R281S|P2RX2_ENST00000343948.4_Missense_Mutation_p.R315S|P2RX2_ENST00000352418.4_Missense_Mutation_p.R243S|P2RX2_ENST00000351222.4_Missense_Mutation_p.R223S|P2RX2_ENST00000350048.5_Missense_Mutation_p.R291S	NM_170682.2|NM_170683.2|NM_174873.1	NP_733782.1|NP_733783.1|NP_777362.1	Q9UBL9	P2RX2_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 2	315					behavioral response to pain (GO:0048266)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of hypoxic conditions in blood by carotid body chemoreceptor signaling (GO:0003029)|ion transmembrane transport (GO:0034220)|neuromuscular junction development (GO:0007528)|neuromuscular synaptic transmission (GO:0007274)|neuronal action potential (GO:0019228)|peristalsis (GO:0030432)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|response to ATP (GO:0033198)|response to carbohydrate (GO:0009743)|response to hypoxia (GO:0001666)|sensory perception of sound (GO:0007605)|sensory perception of taste (GO:0050909)|skeletal muscle fiber development (GO:0048741)|urinary bladder smooth muscle contraction (GO:0014832)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|dendritic spine (GO:0043197)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|cadmium ion binding (GO:0046870)|cobalt ion binding (GO:0050897)|copper ion binding (GO:0005507)|drug binding (GO:0008144)|extracellular ATP-gated cation channel activity (GO:0004931)|identical protein binding (GO:0042802)|ligand-gated ion channel activity (GO:0015276)|mercury ion binding (GO:0045340)|nickel cation binding (GO:0016151)|phosphatidylinositol binding (GO:0035091)|purinergic nucleotide receptor activity (GO:0001614)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|kidney(2)|large_intestine(2)|liver(2)|lung(8)|ovary(1)|prostate(3)	20	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0767)		OV - Ovarian serous cystadenocarcinoma(86;2.32e-08)|Epithelial(86;8.62e-08)|all cancers(50;4.5e-06)		CACCACCACCCGCACGCTCAT	0.612																																																	0													196.0	175.0	182.0					12																	133197878		2203	4300	6503	SO:0001583	missense	0			AF109387	CCDS31930.1, CCDS31931.1, CCDS31932.1, CCDS31933.1, CCDS31934.1, CCDS31935.1, CCDS61286.1, CCDS73548.1	12q24.33	2013-03-22			ENSG00000187848	ENSG00000187848		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	15459	protein-coding gene	gene with protein product		600844	"""deafness, autosomal dominant 41"""	DFNA41		10570044, 7523952, 23345450	Standard	XM_005266154		Approved	P2X2	uc001ukk.1	Q9UBL9	OTTHUMG00000168018	ENST00000389110.3:c.943C>A	12.37:g.133197878C>A	ENSP00000373762:p.Arg315Ser		A6NGB4|A6NH93|A6NHC2|A6NHU3|A6NIG9|Q6V9R6|Q9NR37|Q9NR38|Q9UHD5|Q9UHD6|Q9UHD7|Q9Y637|Q9Y638	Missense_Mutation	SNP	pfam_P2X_purnocptor,prints_P2X2_purnocptor,prints_P2X_purnocptor,tigrfam_P2X_purnocptor	p.R315S	ENST00000389110.3	37	c.943	CCDS31931.1	12	.	.	.	.	.	.	.	.	.	.	C	23.5	4.429465	0.83776	.	.	ENSG00000187848	ENST00000389110;ENST00000449132;ENST00000343948;ENST00000352418;ENST00000350048;ENST00000351222;ENST00000348800	T;T;T;T;T;T;T	0.13778	2.56;2.56;2.56;2.56;2.56;2.56;2.56	4.96	4.03	0.46877	.	0.000000	0.85682	D	0.000000	T	0.47002	0.1422	M	0.93594	3.435	0.58432	D	0.999999	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	1.0;0.999;1.0;1.0;1.0;1.0;1.0;1.0	T	0.60449	-0.7261	10	0.72032	D	0.01	-31.9191	14.4493	0.67374	0.1476:0.8524:0.0:0.0	.	315;281;223;243;291;315;315;315	Q32MC3;Q9UBL9-7;Q9UBL9-5;Q9UBL9-6;Q9UBL9-3;Q9UBL9-4;Q9UBL9;Q9UBL9-2	.;.;.;.;.;.;P2RX2_HUMAN;.	S	315;281;315;243;291;223;315	ENSP00000373762:R315S;ENSP00000405531:R281S;ENSP00000343339:R315S;ENSP00000341419:R243S;ENSP00000343904:R291S;ENSP00000344502:R223S;ENSP00000345095:R315S	ENSP00000343339:R315S	R	+	1	0	P2RX2	131707951	0.987000	0.35691	0.999000	0.59377	0.881000	0.50899	2.745000	0.47459	2.584000	0.87258	0.561000	0.74099	CGC	P2RX2	-	pfam_P2X_purnocptor,tigrfam_P2X_purnocptor	ENSG00000187848		0.612	P2RX2-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	P2RX2	HGNC	protein_coding	OTTHUMT00000397542.1	-	0.00	54	0	C			133197878	+1	tier1	-	no_errors	ENST00000343948	ensembl	human	known	74_37	missense	41.54	38	27	SNP	1.000	A
PALM2	114299	genome.wustl.edu	37	9	112705216	112705216	+	Missense_Mutation	SNP	C	C	G	rs148645046		TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr9:112705216C>G	ENST00000374531.2	+	7	725	c.651C>G	c.(649-651)caC>caG	p.H217Q	PALM2_ENST00000314527.4_Missense_Mutation_p.H249Q|PALM2-AKAP2_ENST00000302798.7_Intron|PALM2_ENST00000448454.2_Missense_Mutation_p.H251Q|PALM2-AKAP2_ENST00000374530.3_Intron|PALM2_ENST00000483909.1_Missense_Mutation_p.H215Q|AKAP2_ENST00000555236.1_Intron|AKAP2_ENST00000510514.5_Intron	NM_001037293.2	NP_001032370.1	Q8IXS6	PALM2_HUMAN	paralemmin 2	217					regulation of cell shape (GO:0008360)	plasma membrane (GO:0005886)				breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(1)	18						GAGGAGGGCACGTGTCTGAAA	0.463																																																	0													87.0	76.0	80.0					9																	112705216		2203	4300	6503	SO:0001583	missense	0			AJ312216	CCDS35099.1, CCDS48002.1, CCDS48002.2	9q31.3	2009-10-16			ENSG00000243444	ENSG00000243444			15845	protein-coding gene	gene with protein product						11478809	Standard	NM_001037293		Approved			Q8IXS6	OTTHUMG00000020479	ENST00000374531.2:c.651C>G	9.37:g.112705216C>G	ENSP00000363656:p.His217Gln		A9Z1X9|Q8N9D5|Q96DU1	Missense_Mutation	SNP	pfam_Paralemmin	p.H251Q	ENST00000374531.2	37	c.753	CCDS35099.1	9	.	.	.	.	.	.	.	.	.	.	C	2.545	-0.305345	0.05495	.	.	ENSG00000243444;ENSG00000243444;ENSG00000243444;ENSG00000243444;ENSG00000157654	ENST00000374531;ENST00000448454;ENST00000483909;ENST00000314527;ENST00000413420	T;T;T;T;T	0.21734	1.99;2.0;1.99;2.0;2.0	6.17	-2.18	0.07037	.	.	.	.	.	T	0.05777	0.0151	N	0.03115	-0.41	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.40040	-0.9584	9	0.08179	T	0.78	.	1.7925	0.03054	0.1265:0.1849:0.2484:0.4402	.	217;251	Q8IXS6;D3YTA4	PALM2_HUMAN;.	Q	217;251;215;249;249	ENSP00000363656:H217Q;ENSP00000400206:H251Q;ENSP00000417525:H215Q;ENSP00000323805:H249Q;ENSP00000397839:H249Q	ENSP00000397839:H249Q	H	+	3	2	PALM2-AKAP2;PALM2	111745037	0.008000	0.16893	0.003000	0.11579	0.805000	0.45488	0.075000	0.14686	-0.025000	0.13918	0.655000	0.94253	CAC	PALM2	-	pfam_Paralemmin	ENSG00000243444		0.463	PALM2-002	KNOWN	basic|CCDS	protein_coding	PALM2	HGNC	protein_coding	OTTHUMT00000053604.1	-	0.00	25	0	C	NM_001037293		112705216	+1	tier1	-	no_errors	ENST00000448454	ensembl	human	known	74_37	missense	88.10	5	37	SNP	0.004	G
PAPSS2	9060	genome.wustl.edu	37	10	89487163	89487163	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr10:89487163G>A	ENST00000361175.4	+	8	1357	c.988G>A	c.(988-990)Gac>Aac	p.D330N	PAPSS2_ENST00000427144.2_Missense_Mutation_p.D334N|PAPSS2_ENST00000456849.1_Missense_Mutation_p.D335N	NM_004670.3	NP_004661.2	O95340	PAPS2_HUMAN	3'-phosphoadenosine 5'-phosphosulfate synthase 2	330					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|blood coagulation (GO:0007596)|bone development (GO:0060348)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sulfate assimilation (GO:0000103)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	adenylylsulfate kinase activity (GO:0004020)|ATP binding (GO:0005524)|nucleotidyltransferase activity (GO:0016779)|sulfate adenylyltransferase (ATP) activity (GO:0004781)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|stomach(1)	20		Melanoma(5;0.019)|Colorectal(252;0.123)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00164)|Colorectal(12;0.000323)|COAD - Colon adenocarcinoma(12;0.00124)		TATCTTACGAGACGCTGAATT	0.498																																																	0													119.0	96.0	103.0					10																	89487163		2203	4300	6503	SO:0001583	missense	0			AF091242	CCDS7385.1, CCDS44453.1	10q24	2008-02-07			ENSG00000198682	ENSG00000198682	2.7.7.4, 2.7.1.25		8604	protein-coding gene	gene with protein product		603005				9771708	Standard	NM_004670		Approved	ATPSK2	uc001kex.3	O95340	OTTHUMG00000018683	ENST00000361175.4:c.988G>A	10.37:g.89487163G>A	ENSP00000354436:p.Asp330Asn		Q9BZL2|Q9P0G6|Q9UHM1|Q9UKD3|Q9UP30	Missense_Mutation	SNP	pfam_Sulfurylase_cat_dom,pfam_APS_kinase,superfamily_PUA-like_domain,superfamily_P-loop_NTPase,tigrfam_Sulphate_adenylyltransferase,tigrfam_APS_kinase	p.D335N	ENST00000361175.4	37	c.1003	CCDS7385.1	10	.	.	.	.	.	.	.	.	.	.	G	4.349	0.064158	0.08388	.	.	ENSG00000198682	ENST00000361175;ENST00000456849;ENST00000427144;ENST00000371981	T;T;T	0.21932	1.98;1.98;1.98	5.74	4.81	0.61882	Sulphate adenylyltransferase (2);PUA-like domain (1);	0.088582	0.85682	N	0.000000	T	0.08133	0.0203	N	0.03999	-0.3	0.45852	D	0.998714	B;B	0.09022	0.0;0.002	B;B	0.15052	0.004;0.012	T	0.14615	-1.0466	10	0.06757	T	0.87	-27.8331	8.4902	0.33095	0.2429:0.0:0.7571:0.0	.	330;335	O95340;O95340-2	PAPS2_HUMAN;.	N	330;335;334;334	ENSP00000354436:D330N;ENSP00000406157:D335N;ENSP00000397123:D334N	ENSP00000354436:D330N	D	+	1	0	PAPSS2	89477143	1.000000	0.71417	0.216000	0.23742	0.294000	0.27393	4.164000	0.58190	1.355000	0.45865	0.561000	0.74099	GAC	PAPSS2	-	pfam_Sulfurylase_cat_dom,superfamily_PUA-like_domain,tigrfam_Sulphate_adenylyltransferase	ENSG00000198682		0.498	PAPSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPSS2	HGNC	protein_coding	OTTHUMT00000049229.1	-	0.00	28	0	G			89487163	+1	tier1	-	no_errors	ENST00000456849	ensembl	human	known	74_37	missense	30.43	16	7	SNP	0.943	A
PARP1	142	genome.wustl.edu	37	1	226576388	226576388	+	Missense_Mutation	SNP	T	T	A	rs535937365		TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr1:226576388T>A	ENST00000366794.5	-	5	829	c.686A>T	c.(685-687)gAc>gTc	p.D229V		NM_001618.3	NP_001609.2	P09874	PARP1_HUMAN	poly (ADP-ribose) polymerase 1	229					base-excision repair (GO:0006284)|cellular response to insulin stimulus (GO:0032869)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|gene expression (GO:0010467)|macrophage differentiation (GO:0030225)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein ADP-ribosylation (GO:0006471)|protein autoprocessing (GO:0016540)|protein poly-ADP-ribosylation (GO:0070212)|regulation of growth rate (GO:0040009)|signal transduction involved in regulation of gene expression (GO:0023019)|telomere maintenance (GO:0000723)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|NAD binding (GO:0051287)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(4)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	44	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)		ACTATCCTTGTCTTTTTCTTT	0.433								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA																																									0													180.0	180.0	180.0					1																	226576388		2203	4299	6502	SO:0001583	missense	0			BC037545	CCDS1554.1	1q41-q42	2010-02-16	2008-07-28	2004-08-26	ENSG00000143799	ENSG00000143799	2.4.2.30	"""Poly (ADP-ribose) polymerases"""	270	protein-coding gene	gene with protein product		173870	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)"", ""poly (ADP-ribose) polymerase family, member 1"""	PPOL, ADPRT		10964595	Standard	NM_001618		Approved	PARP	uc001hqd.4	P09874	OTTHUMG00000037556	ENST00000366794.5:c.686A>T	1.37:g.226576388T>A	ENSP00000355759:p.Asp229Val		B1ANJ4|Q8IUZ9	Missense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfam_Poly(ADP-ribose)pol_reg_dom,pfam_Znf_PARP,pfam_PADR1,pfam_WGR_domain,pfam_BRCT_dom,superfamily_Poly(ADP-ribose)pol_reg_dom,superfamily_WGR_domain,superfamily_BRCT_dom,smart_BRCT_dom,smart_WGR_domain,pirsf_NAD_ADPRT,pfscan_BRCT_dom,pfscan_Znf_PARP,pfscan_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_reg_dom	p.D229V	ENST00000366794.5	37	c.686	CCDS1554.1	1	.	.	.	.	.	.	.	.	.	.	T	17.65	3.440954	0.63067	.	.	ENSG00000143799	ENST00000432338;ENST00000366794	T	0.09911	2.93	5.33	5.33	0.75918	.	0.135540	0.64402	D	0.000003	T	0.11239	0.0274	L	0.39898	1.24	0.80722	D	1	B	0.11235	0.004	B	0.06405	0.002	T	0.05289	-1.0894	10	0.40728	T	0.16	.	14.4268	0.67220	0.0:0.0:0.0:1.0	.	229	P09874	PARP1_HUMAN	V	229	ENSP00000355759:D229V	ENSP00000355759:D229V	D	-	2	0	PARP1	224643011	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.925000	0.70062	2.157000	0.67596	0.533000	0.62120	GAC	PARP1	-	pirsf_NAD_ADPRT	ENSG00000143799		0.433	PARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP1	HGNC	protein_coding	OTTHUMT00000091519.1	-	0.00	28	0	T	NM_001618		226576388	-1	tier1	-	no_errors	ENST00000366794	ensembl	human	known	74_37	missense	40.00	18	12	SNP	1.000	A
PCDHA10	56139	genome.wustl.edu	37	5	140237666	140237666	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr5:140237666C>T	ENST00000307360.5	+	1	2033	c.2033C>T	c.(2032-2034)tCg>tTg	p.S678L	PCDHA5_ENST00000529619.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA6_ENST00000527624.1_Intron	NM_018901.2	NP_061724.1	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10	678	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(11)|cervix(1)|endometrium(11)|kidney(5)|large_intestine(13)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	79			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCAAGGCCTCGTCGCGGGCT	0.667																																																	0													20.0	21.0	20.0					5																	140237666		1322	2287	3609	SO:0001583	missense	0			AF152475	CCDS34255.1, CCDS54921.1, CCDS75325.1	5q31	2010-11-26			ENSG00000250120	ENSG00000250120		"""Cadherins / Protocadherins : Clustered"""	8664	other	complex locus constituent	"""KIAA0345-like 4"", ""ortholog to mouse CNR8"""	606316		CNRS8		10380929	Standard	NM_018901		Approved	CNR8, CRNR8, CNRN8, PCDH-ALPHA10		Q9Y5I2	OTTHUMG00000163372	ENST00000307360.5:c.2033C>T	5.37:g.140237666C>T	ENSP00000304234:p.Ser678Leu		A1L493|O75280|Q9NRU2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.S678L	ENST00000307360.5	37	c.2033	CCDS54921.1	5	.	.	.	.	.	.	.	.	.	.	C	9.896	1.205484	0.22205	.	.	ENSG00000250120	ENST00000307360	T	0.53640	0.61	3.6	2.73	0.32206	Cadherin (1);	.	.	.	.	T	0.37945	0.1022	M	0.70903	2.155	0.09310	N	1	B;B	0.27192	0.171;0.128	B;B	0.21151	0.03;0.033	T	0.30001	-0.9993	9	0.11485	T	0.65	.	3.5852	0.07969	0.2602:0.5227:0.0:0.2171	.	678;678	Q9Y5I2-3;Q9Y5I2	.;PCDAA_HUMAN	L	678	ENSP00000304234:S678L	ENSP00000304234:S678L	S	+	2	0	PCDHA10	140217850	0.000000	0.05858	0.006000	0.13384	0.053000	0.15095	-2.165000	0.01274	0.843000	0.35070	-0.339000	0.08088	TCG	PCDHA10	-	pfscan_Cadherin	ENSG00000250120		0.667	PCDHA10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA10	HGNC	protein_coding	OTTHUMT00000372895.2	-	0.00	91	0	C	NM_018901		140237666	+1	tier1	-	no_errors	ENST00000307360	ensembl	human	known	74_37	missense	32.35	46	22	SNP	0.000	T
PCDHA13	56136	genome.wustl.edu	37	5	140261985	140261985	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr5:140261985C>G	ENST00000289272.2	+	1	132	c.132C>G	c.(130-132)ttC>ttG	p.F44L	PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA13_ENST00000409494.1_Missense_Mutation_p.F44L|PCDHA11_ENST00000398640.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA10_ENST00000307360.5_Intron	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13	44	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|biliary_tract(2)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(18)|liver(3)|lung(23)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACGGCACCTTCGTGGGCCGCA	0.652																																					Melanoma(147;1739 1852 5500 27947 37288)												0													61.0	69.0	66.0					5																	140261985		2203	4300	6503	SO:0001583	missense	0			AF152478	CCDS4240.1	5q31	2010-11-26			ENSG00000239389	ENSG00000239389		"""Cadherins / Protocadherins : Clustered"""	8667	other	complex locus constituent	"""KIAA0345-like 1"", ""ortholog of mouse CNR5"""	606319		CNRS5		10380929, 10662547	Standard	NM_018904		Approved	CNR5, CRNR5, CNRN5, PCDH-ALPHA13		Q9Y5I0	OTTHUMG00000129614	ENST00000289272.2:c.132C>G	5.37:g.140261985C>G	ENSP00000289272:p.Phe44Leu		O75277	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.F44L	ENST00000289272.2	37	c.132	CCDS4240.1	5	.	.	.	.	.	.	.	.	.	.	c	10.42	1.344668	0.24426	.	.	ENSG00000239389	ENST00000409494;ENST00000289272	T;T	0.28069	1.63;1.63	5.58	2.85	0.33270	Cadherin, N-terminal (1);Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.24774	0.0601	L	0.49256	1.55	0.28475	N	0.915234	P;B;P	0.44344	0.833;0.156;0.627	B;B;B	0.39152	0.292;0.169;0.118	T	0.13415	-1.0510	9	0.46703	T	0.11	.	5.5414	0.17039	0.0:0.5135:0.1323:0.3542	.	44;44;44	Q9Y5I0;C9JA99;Q9Y5I0-2	PCDAD_HUMAN;.;.	L	44	ENSP00000386821:F44L;ENSP00000289272:F44L	ENSP00000289272:F44L	F	+	3	2	PCDHA13	140242169	0.000000	0.05858	1.000000	0.80357	0.357000	0.29423	-1.762000	0.01803	0.738000	0.32606	-0.215000	0.12644	TTC	PCDHA13	-	pfam_Cadherin_N,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000239389		0.652	PCDHA13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA13	HGNC	protein_coding	OTTHUMT00000335000.1	-	0.00	121	0	C	NM_018904		140261985	+1	tier1	-	no_errors	ENST00000289272	ensembl	human	known	74_37	missense	33.64	71	36	SNP	0.993	G
PCMT1	5110	genome.wustl.edu	37	6	150123514	150123514	+	Nonstop_Mutation	SNP	G	G	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr6:150123514G>C	ENST00000367380.5	+	7	890	c.683G>C	c.(682-684)tGa>tCa	p.*228S	PCMT1_ENST00000544496.1_Nonstop_Mutation_p.*193S|PCMT1_ENST00000367378.1_Nonstop_Mutation_p.*286S|PCMT1_ENST00000464889.1_Nonstop_Mutation_p.*286S|PCMT1_ENST00000367384.2_Intron	NM_001252049.1|NM_001252050.1|NM_001252051.1|NM_001252052.1|NM_005389.2	NP_001238978.1|NP_001238979.1|NP_001238980.1|NP_001238981.1|NP_005380.2	P22061	PIMT_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase	0					protein methylation (GO:0006479)|protein repair (GO:0030091)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			kidney(1)|large_intestine(2)|lung(4)|ovary(1)	8		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.221)	OV - Ovarian serous cystadenocarcinoma(155;5.63e-13)|GBM - Glioblastoma multiforme(68;0.207)		AGGTGGAAGTGATTTTATCTT	0.408																																																	0													96.0	93.0	94.0					6																	150123514		2203	4300	6503	SO:0001578	stop_lost	0				CCDS5219.1, CCDS5219.2, CCDS59041.1, CCDS75533.1, CCDS75534.1	6q22.3-q24	2008-02-05			ENSG00000120265	ENSG00000120265	2.1.1.77		8728	protein-coding gene	gene with protein product		176851				1478665, 10343128	Standard	NM_005389		Approved		uc003qne.3	P22061	OTTHUMG00000015794	ENST00000367380.5:c.683G>C	6.37:g.150123514G>C	ENSP00000356350:p.*228Serext*78		A8K109|J3KP72|Q14661|Q16556|Q5VYC1|Q5VYC2|Q93061|Q96II9|Q99625|Q9BQV7|Q9BQV8|Q9NP03	Nonstop_Mutation	SNP	pfam_PCMT,tigrfam_PCMT	p.*286S	ENST00000367380.5	37	c.857		6	.	.	.	.	.	.	.	.	.	.	G	22.0	4.236258	0.79800	.	.	ENSG00000120265	ENST00000367378;ENST00000464889;ENST00000367380;ENST00000544496	.	.	.	5.89	5.89	0.94794	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2578	0.98434	0.0:0.0:1.0:0.0	.	.	.	.	S	286;286;228;193	.	.	X	+	2	2	PCMT1	150165207	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.053000	0.89449	2.784000	0.95788	0.643000	0.83706	TGA	PCMT1	-	NULL	ENSG00000120265		0.408	PCMT1-201	KNOWN	basic|appris_principal	protein_coding	PCMT1	HGNC	protein_coding		-	0.00	34	0	G			150123514	+1	tier1	-	no_errors	ENST00000367378	ensembl	human	known	74_37	nonstop	47.62	11	10	SNP	1.000	C
PDP1	54704	genome.wustl.edu	37	8	94935557	94935557	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr8:94935557A>G	ENST00000297598.4	+	2	1539	c.1270A>G	c.(1270-1272)Atg>Gtg	p.M424V	PDP1_ENST00000517764.1_Missense_Mutation_p.M424V|PDP1_ENST00000396200.3_Missense_Mutation_p.M449V|PDP1_ENST00000520728.1_Missense_Mutation_p.M424V	NM_001161781.1|NM_018444.3	NP_001155253.1|NP_060914.2	Q9P0J1	PDP1_HUMAN	pyruvate dehyrogenase phosphatase catalytic subunit 1	424					cellular metabolic process (GO:0044237)|peptidyl-threonine dephosphorylation (GO:0035970)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	[pyruvate dehydrogenase (lipoamide)] phosphatase activity (GO:0004741)|metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|liver(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)	18						GTGGGAGACTATGCATAGGCA	0.502																																																	0													106.0	101.0	103.0					8																	94935557		2203	4300	6503	SO:0001583	missense	0			AF155661	CCDS6259.1, CCDS55262.1	8q22.1	2012-04-17	2009-06-12	2009-06-12	ENSG00000164951	ENSG00000164951	3.1.3.43	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9279	protein-coding gene	gene with protein product		605993	"""protein phosphatase 2C, magnesium-dependent, catalytic subunit"""	PPM2C		8396421	Standard	NM_001161779		Approved	PDP, PDH	uc003ygf.3	Q9P0J1		ENST00000297598.4:c.1270A>G	8.37:g.94935557A>G	ENSP00000297598:p.Met424Val		B3KX71|J3KPU0|Q5U5K1	Missense_Mutation	SNP	pfam_PP2C-like_dom,superfamily_PP2C-like_dom,smart_PP2C-like_dom	p.M449V	ENST00000297598.4	37	c.1345	CCDS6259.1	8	.	.	.	.	.	.	.	.	.	.	A	11.35	1.613066	0.28712	.	.	ENSG00000164951	ENST00000297598;ENST00000520728;ENST00000396200;ENST00000517764	T;T;T;T	0.14766	2.48;2.48;2.48;2.48	6.03	6.03	0.97812	Protein phosphatase 2C-like (5);	0.042441	0.85682	D	0.000000	T	0.14399	0.0348	N	0.25380	0.74	0.58432	D	0.999994	B;B	0.28178	0.202;0.202	B;B	0.33960	0.173;0.173	T	0.05257	-1.0896	10	0.59425	D	0.04	-21.3364	16.5582	0.84512	1.0:0.0:0.0:0.0	.	475;424	B4DYX8;Q9P0J1	.;PDP1_HUMAN	V	424;424;449;424	ENSP00000297598:M424V;ENSP00000428317:M424V;ENSP00000379503:M449V;ENSP00000430380:M424V	ENSP00000297598:M424V	M	+	1	0	PDP1	95004733	1.000000	0.71417	0.985000	0.45067	0.999000	0.98932	4.563000	0.60823	2.308000	0.77769	0.533000	0.62120	ATG	PDP1	-	pfam_PP2C-like_dom,superfamily_PP2C-like_dom,smart_PP2C-like_dom	ENSG00000164951		0.502	PDP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PDP1	HGNC	protein_coding	OTTHUMT00000378415.2	-	0.00	161	0	A	NM_018444		94935557	+1	tier1	-	no_errors	ENST00000396200	ensembl	human	known	74_37	missense	21.33	225	61	SNP	0.998	G
PIP5K1C	23396	genome.wustl.edu	37	19	3656454	3656454	+	Silent	SNP	G	G	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr19:3656454G>A	ENST00000335312.3	-	6	658	c.570C>T	c.(568-570)gtC>gtT	p.V190V	PIP5K1C_ENST00000589578.1_Silent_p.V190V|PIP5K1C_ENST00000537021.1_Silent_p.V190V|PIP5K1C_ENST00000587482.1_5'UTR|PIP5K1C_ENST00000539785.1_Silent_p.V190V	NM_001195733.1|NM_012398.2	NP_001182662.1|NP_036530.1	O60331	PI51C_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type I, gamma	190	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				actin cytoskeleton organization (GO:0030036)|adherens junction assembly (GO:0034333)|axon guidance (GO:0007411)|clathrin-mediated endocytosis (GO:0072583)|cytoskeletal anchoring at plasma membrane (GO:0007016)|neutrophil chemotaxis (GO:0030593)|phagocytosis (GO:0006909)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet aggregation (GO:0070527)|single organismal cell-cell adhesion (GO:0016337)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle exocytosis (GO:0016079)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|uropod (GO:0001931)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)			large_intestine(3)|ovary(1)|skin(3)|stomach(2)	9		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.95e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0026)|STAD - Stomach adenocarcinoma(1328;0.183)		CCTTGTGCATGACGGTCTTGA	0.627																																					Esophageal Squamous(135;99 1744 12852 27186 39851)												0													82.0	83.0	82.0					19																	3656454		2203	4300	6503	SO:0001819	synonymous_variant	0			AB011161	CCDS32872.1, CCDS56074.1, CCDS74257.1	19p13.3	2012-10-02			ENSG00000186111	ENSG00000186111			8996	protein-coding gene	gene with protein product		606102				9535851	Standard	NM_001195733		Approved	PIP5Kgamma, KIAA0589, LCCS3	uc002lyj.2	O60331	OTTHUMG00000180870	ENST00000335312.3:c.570C>T	19.37:g.3656454G>A			B7Z9E7|C6GIJ7|C6GIJ8|Q7LE07	Silent	SNP	pfam_PInositol-4-P-5-kinase_core,smart_PInositol-4P-5-kinase_core_sub	p.V190	ENST00000335312.3	37	c.570	CCDS32872.1	19																																																																																			PIP5K1C	-	pfam_PInositol-4-P-5-kinase_core,smart_PInositol-4P-5-kinase_core_sub	ENSG00000186111		0.627	PIP5K1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PIP5K1C	HGNC	protein_coding	OTTHUMT00000453432.2	-	0.00	69	0	G	NM_012398		3656454	-1	tier1	-	no_errors	ENST00000537021	ensembl	human	known	74_37	silent	33.33	42	21	SNP	0.996	A
PKHD1L1	93035	genome.wustl.edu	37	8	110376784	110376784	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr8:110376784C>A	ENST00000378402.5	+	2	186	c.82C>A	c.(82-84)Caa>Aaa	p.Q28K		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	28					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			AGATGGCTCTCAAATAATCCC	0.343										HNSCC(38;0.096)																																							0													51.0	47.0	49.0					8																	110376784		1806	4067	5873	SO:0001583	missense	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.82C>A	8.37:g.110376784C>A	ENSP00000367655:p.Gln28Lys		Q567P2|Q9UF27	Missense_Mutation	SNP	pfam_IPT,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT,smart_PA14,smart_PbH1	p.Q28K	ENST00000378402.5	37	c.82	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	C	0.280	-0.986712	0.02180	.	.	ENSG00000205038	ENST00000378402	D	0.84873	-1.91	4.95	-0.583	0.11706	Immunoglobulin-like fold (1);	0.669254	0.13220	N	0.404445	T	0.58047	0.2095	N	0.03608	-0.345	0.22896	N	0.998596	B	0.02656	0.0	B	0.01281	0.0	T	0.50617	-0.8807	10	0.05620	T	0.96	.	4.429	0.11518	0.4739:0.1769:0.3491:0.0	.	28	Q86WI1	PKHL1_HUMAN	K	28	ENSP00000367655:Q28K	ENSP00000367655:Q28K	Q	+	1	0	PKHD1L1	110445960	0.825000	0.29262	0.952000	0.39060	0.736000	0.42039	0.552000	0.23376	-0.246000	0.09611	-0.234000	0.12200	CAA	PKHD1L1	-	NULL	ENSG00000205038		0.343	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	-	0.00	76	0	C	NM_177531		110376784	+1	tier1	-	no_errors	ENST00000378402	ensembl	human	known	74_37	missense	17.09	97	20	SNP	0.962	A
PLA1A	51365	genome.wustl.edu	37	3	119347680	119347680	+	Silent	SNP	G	G	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr3:119347680G>A	ENST00000273371.4	+	10	1326	c.1254G>A	c.(1252-1254)aaG>aaA	p.K418K	PLA1A_ENST00000495992.1_Silent_p.K402K|PLA1A_ENST00000494440.1_Silent_p.K402K|PLA1A_ENST00000488919.1_Silent_p.K245K	NM_015900.3	NP_056984.1	Q53H76	PLA1A_HUMAN	phospholipase A1 member A	418	Involved in the recognition of diacyl- phospholipids.				lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)|phosphatidylserine metabolic process (GO:0006658)	extracellular vesicular exosome (GO:0070062)	phosphatidylcholine 1-acylhydrolase activity (GO:0008970)			NS(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						TTATTGGGAAGTTCTGCACTG	0.468																																																	0													125.0	122.0	123.0					3																	119347680		2203	4300	6503	SO:0001819	synonymous_variant	0			AF035268	CCDS2991.1, CCDS56268.1, CCDS56269.1	3q13.13-q13.2	2002-11-28			ENSG00000144837	ENSG00000144837			17661	protein-coding gene	gene with protein product		607460				10196188	Standard	NM_015900		Approved	ps-PLA1	uc003ecu.3	Q53H76	OTTHUMG00000159425	ENST00000273371.4:c.1254G>A	3.37:g.119347680G>A			B2R8V2|B4DXA2|O95991|Q86WX6|Q9UPD2	Silent	SNP	pfam_Lipase_N,pirsf_Lipoprotein_lipase_LIPH,prints_Lipase	p.K418	ENST00000273371.4	37	c.1254	CCDS2991.1	3																																																																																			PLA1A	-	pirsf_Lipoprotein_lipase_LIPH	ENSG00000144837		0.468	PLA1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA1A	HGNC	protein_coding	OTTHUMT00000355252.2	-	0.00	45	0	G			119347680	+1	tier1	-	no_errors	ENST00000273371	ensembl	human	known	74_37	silent	35.62	47	26	SNP	0.092	A
PMM1	5372	genome.wustl.edu	37	22	41980059	41980059	+	Silent	SNP	T	T	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr22:41980059T>C	ENST00000216259.7	-	5	462	c.378A>G	c.(376-378)ggA>ggG	p.G126G	PMM1_ENST00000466645.1_5'UTR	NM_002676.2	NP_002667.2	Q92871	PMM1_HUMAN	phosphomannomutase 1	126					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|mannose biosynthetic process (GO:0019307)|mannose metabolic process (GO:0006013)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)	metal ion binding (GO:0046872)|phosphomannomutase activity (GO:0004615)			NS(1)|large_intestine(4)|lung(3)|ovary(1)|urinary_tract(2)	11						CGATGAAGGTTCCACTGGTGG	0.592																																																	0													83.0	75.0	78.0					22																	41980059		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS14020.1	22q13	2008-12-01			ENSG00000100417	ENSG00000100417	5.4.2.8		9114	protein-coding gene	gene with protein product	"""brain glucose-1,6-bisphosphatase"""	601786				9070917, 9271215	Standard	NM_002676		Approved	Sec53	uc003bal.2	Q92871	OTTHUMG00000150972	ENST00000216259.7:c.378A>G	22.37:g.41980059T>C			A8K003|Q92586	Silent	SNP	pfam_PMM,pfam_HAD-like_dom,superfamily_HAD-like_dom,tigrfam_HAD-SF_hydro_IIB	p.G126	ENST00000216259.7	37	c.378	CCDS14020.1	22																																																																																			PMM1	-	pfam_PMM,pfam_HAD-like_dom,superfamily_HAD-like_dom,tigrfam_HAD-SF_hydro_IIB	ENSG00000100417		0.592	PMM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMM1	HGNC	protein_coding	OTTHUMT00000320711.3	-	0.00	37	0	T	NM_002676		41980059	-1	tier1	-	no_errors	ENST00000216259	ensembl	human	known	74_37	silent	24.39	31	10	SNP	0.433	C
PON2	5445	genome.wustl.edu	37	7	95039233	95039233	+	Missense_Mutation	SNP	G	G	C	rs528805572		TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr7:95039233G>C	ENST00000222572.3	-	6	921	c.675C>G	c.(673-675)atC>atG	p.I225M	PON2_ENST00000483292.1_5'UTR|PON2_ENST00000433091.2_Missense_Mutation_p.I213M|PON2_ENST00000536183.1_Missense_Mutation_p.I246M			Q15165	PON2_HUMAN	paraoxonase 2	225					aromatic compound catabolic process (GO:0019439)|response to oxidative stress (GO:0006979)	extracellular region (GO:0005576)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	arylesterase activity (GO:0004064)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|prostate(1)	9	all_cancers(62;9.35e-11)|all_epithelial(64;3.37e-09)		STAD - Stomach adenocarcinoma(171;0.0151)			GTGAAATATTGATCCCATTTG	0.348																																					GBM(42;803 823 13649 23368 31463)												0													153.0	153.0	153.0					7																	95039233		2203	4300	6503	SO:0001583	missense	0			M63012, AF001601	CCDS5640.1, CCDS47644.1	7q21.3	2014-03-14			ENSG00000105854	ENSG00000105854	3.1.1.2	"""Paraoxonases"""	9205	protein-coding gene	gene with protein product	"""paraoxonase nirs"", ""arylesterase 2"""	602447				8661009, 9714608	Standard	XM_005250453		Approved		uc003unv.3	Q15165	OTTHUMG00000153948	ENST00000222572.3:c.675C>G	7.37:g.95039233G>C	ENSP00000222572:p.Ile225Met		A4D1H7|B2RCP9|B4DJD5|O15114|O15115|O75856|Q5FBX7|Q86YL0	Missense_Mutation	SNP	pfam_Arylesterase,pfam_SGL,prints_Arylesterase,prints_Paraoxonase2	p.I246M	ENST00000222572.3	37	c.738	CCDS5640.1	7	.	.	.	.	.	.	.	.	.	.	G	12.02	1.812015	0.32053	.	.	ENSG00000105854	ENST00000536183;ENST00000355659;ENST00000433091;ENST00000222572	T;T;T	0.63096	-0.02;-0.02;-0.02	4.62	4.62	0.57501	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	T	0.77890	0.4198	M	0.88377	2.95	0.50632	D	0.999888	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.80025	-0.1555	10	0.87932	D	0	-7.4261	4.4598	0.11661	0.1325:0.0:0.6469:0.2206	.	225;225	A4D1H7;Q15165	.;PON2_HUMAN	M	246;223;213;225	ENSP00000440282:I246M;ENSP00000404622:I213M;ENSP00000222572:I225M	ENSP00000222572:I225M	I	-	3	3	PON2	94877169	1.000000	0.71417	0.990000	0.47175	0.209000	0.24338	1.759000	0.38420	2.568000	0.86640	0.557000	0.71058	ATC	PON2	-	pfam_Arylesterase,pfam_SGL	ENSG00000105854		0.348	PON2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PON2	HGNC	protein_coding	OTTHUMT00000333142.1	-	0.00	26	0	G	NM_000305		95039233	-1	tier1	-	no_errors	ENST00000536183	ensembl	human	known	74_37	missense	18.52	44	10	SNP	0.982	C
PODXL	5420	genome.wustl.edu	37	7	131195718	131195718	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr7:131195718G>A	ENST00000378555.3	-	2	822	c.575C>T	c.(574-576)cCc>cTc	p.P192L	PODXL_ENST00000537928.1_Missense_Mutation_p.P192L|PODXL_ENST00000322985.9_Missense_Mutation_p.P192L|PODXL_ENST00000465001.1_5'Flank|PODXL_ENST00000541194.1_Missense_Mutation_p.P194L			O00592	PODXL_HUMAN	podocalyxin-like	192	Thr-rich.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					CGTCGAAGTGGGTTGTCGGGG	0.547																																																	0													221.0	191.0	202.0					7																	131195718		2203	4300	6503	SO:0001583	missense	0				CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.575C>T	7.37:g.131195718G>A	ENSP00000367817:p.Pro192Leu		A6NHX8|Q52LZ7|Q53ER6	Missense_Mutation	SNP	pfam_CD34/Podocalyxin,pirsf_Podocalyxin-like_p1	p.P194L	ENST00000378555.3	37	c.581	CCDS34755.1	7	.	.	.	.	.	.	.	.	.	.	G	13.87	2.366317	0.41902	.	.	ENSG00000128567	ENST00000541194;ENST00000537928;ENST00000544955;ENST00000378555;ENST00000322985	T;T;T;T	0.16743	2.9;2.32;2.9;2.51	3.06	-0.0158	0.13974	.	25.699300	0.00166	N	0.000003	T	0.11580	0.0282	N	0.19112	0.55	0.09310	N	0.999999	B;B	0.16603	0.018;0.01	B;B	0.14023	0.01;0.005	T	0.31364	-0.9946	10	0.72032	D	0.01	-2.311	2.2106	0.03946	0.3152:0.0:0.4387:0.2461	.	192;192	O00592-2;O00592	.;PODXL_HUMAN	L	194;192;182;192;192	ENSP00000440518:P194L;ENSP00000442655:P192L;ENSP00000367817:P192L;ENSP00000319782:P192L	ENSP00000319782:P192L	P	-	2	0	PODXL	130846258	0.000000	0.05858	0.000000	0.03702	0.041000	0.13682	-1.510000	0.02262	-0.021000	0.14009	0.561000	0.74099	CCC	PODXL	-	pirsf_Podocalyxin-like_p1	ENSG00000128567		0.547	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	PODXL	HGNC	protein_coding	OTTHUMT00000337627.2	-	0.00	176	0	G	NM_001018111		131195718	-1	tier1	-	no_errors	ENST00000541194	ensembl	human	known	74_37	missense	15.35	171	31	SNP	0.000	A
PPL	5493	genome.wustl.edu	37	16	4942146	4942146	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr16:4942146G>C	ENST00000345988.2	-	15	1808	c.1719C>G	c.(1717-1719)ttC>ttG	p.F573L	PPL_ENST00000590782.2_Missense_Mutation_p.F571L	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	573					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						GGGCCTGGATGAAGGCTTCGC	0.617																																																	0													63.0	59.0	60.0					16																	4942146		2197	4300	6497	SO:0001583	missense	0			AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.1719C>G	16.37:g.4942146G>C	ENSP00000340510:p.Phe573Leu		O60314|O60454|Q14C98	Missense_Mutation	SNP	pfam_Plectin_repeat,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.F573L	ENST00000345988.2	37	c.1719	CCDS10526.1	16	.	.	.	.	.	.	.	.	.	.	G	10.28	1.307507	0.23821	.	.	ENSG00000118898	ENST00000345988	T	0.31247	1.5	5.35	-1.35	0.09114	.	0.000000	0.85682	D	0.000000	T	0.26774	0.0655	L	0.60455	1.87	0.35062	D	0.761706	B	0.13145	0.007	B	0.12156	0.007	T	0.21965	-1.0230	10	0.56958	D	0.05	.	10.7408	0.46152	0.4708:0.0:0.5292:0.0	.	573	O60437	PEPL_HUMAN	L	573	ENSP00000340510:F573L	ENSP00000340510:F573L	F	-	3	2	PPL	4882147	0.015000	0.18098	0.003000	0.11579	0.279000	0.26890	-0.224000	0.09164	-0.222000	0.09958	0.549000	0.68633	TTC	PPL	-	smart_Spectrin/alpha-actinin	ENSG00000118898		0.617	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPL	HGNC	protein_coding	OTTHUMT00000251715.1	-	0.00	56	0	G	NM_002705		4942146	-1	tier1	-	no_errors	ENST00000345988	ensembl	human	known	74_37	missense	29.85	47	20	SNP	0.175	C
PPP1R14D	54866	genome.wustl.edu	37	15	41108162	41108162	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr15:41108162C>T	ENST00000299174.5	-	3	437	c.370G>A	c.(370-372)Gag>Aag	p.E124K	PPP1R14D_ENST00000427255.2_Silent_p.Q162Q	NM_017726.7	NP_060196.1	Q9NXH3	PP14D_HUMAN	protein phosphatase 1, regulatory (inhibitor) subunit 14D	124					regulation of phosphorylation (GO:0042325)	cytoplasm (GO:0005737)	protein phosphatase inhibitor activity (GO:0004864)			breast(1)|large_intestine(2)|lung(2)|skin(1)	6		all_cancers(109;6.29e-14)|all_epithelial(112;1.48e-11)|Lung NSC(122;5.77e-09)|all_lung(180;1.08e-07)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;2.88e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		TCCCTTACCTCTGTGGGGCGG	0.567																																																	0													55.0	60.0	58.0					15																	41108162		2203	4300	6503	SO:0001583	missense	0			AK000258	CCDS10066.1, CCDS45230.1	15q11.2-q14	2012-04-17			ENSG00000166143	ENSG00000166143		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14953	protein-coding gene	gene with protein product	"""gut and brain phosphatase inhibitor 1"", ""PKC-dependent PP1 inhibitory protein"""	613256				11948623	Standard	NM_017726		Approved	CPI17-like, FLJ20251, GBPI-1, MGC119014, MGC119016	uc001zmz.3	Q9NXH3	OTTHUMG00000130064	ENST00000299174.5:c.370G>A	15.37:g.41108162C>T	ENSP00000299174:p.Glu124Lys		Q4V773	Missense_Mutation	SNP	pfam_PP1_inhibitor,superfamily_PP1_inhibitor	p.E124K	ENST00000299174.5	37	c.370	CCDS10066.1	15	.	.	.	.	.	.	.	.	.	.	C	21.2	4.111792	0.77210	.	.	ENSG00000166143	ENST00000299174	.	.	.	5.01	5.01	0.66863	.	0.156867	0.39985	N	0.001204	T	0.78591	0.4307	.	.	.	0.80722	D	1	D	0.69078	0.997	D	0.79108	0.992	T	0.81353	-0.0971	8	0.87932	D	0	-15.5125	14.1526	0.65395	0.0:1.0:0.0:0.0	.	124	Q9NXH3	PP14D_HUMAN	K	124	.	ENSP00000299174:E124K	E	-	1	0	PPP1R14D	38895454	1.000000	0.71417	1.000000	0.80357	0.638000	0.38207	3.731000	0.55013	2.492000	0.84095	0.655000	0.94253	GAG	PPP1R14D	-	pfam_PP1_inhibitor,superfamily_PP1_inhibitor	ENSG00000166143		0.567	PPP1R14D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R14D	HGNC	protein_coding	OTTHUMT00000252355.2	-	0.00	35	0	C	NM_017726		41108162	-1	tier1	-	no_errors	ENST00000299174	ensembl	human	known	74_37	missense	42.86	24	18	SNP	1.000	T
PPP4R1	9989	genome.wustl.edu	37	18	9550118	9550118	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr18:9550118C>G	ENST00000400556.3	-	18	2552	c.2479G>C	c.(2479-2481)Gag>Cag	p.E827Q	PPP4R1_ENST00000400555.3_Missense_Mutation_p.E810Q	NM_001042388.2	NP_001035847.1	Q8TF05	PP4R1_HUMAN	protein phosphatase 4, regulatory subunit 1	827					dephosphorylation (GO:0016311)|protein phosphorylation (GO:0006468)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	protein phosphatase 4 complex (GO:0030289)	protein phosphatase type 4 regulator activity (GO:0030362)			large_intestine(1)|skin(2)	3						TCCACAAGCTCATTGATGAGG	0.552																																					Melanoma(188;1232 2082 5061 11948 35994)												0													82.0	94.0	90.0					18																	9550118		2040	4196	6236	SO:0001583	missense	0			AF111106	CCDS42412.1, CCDS42413.1	18p11.22	2010-06-18			ENSG00000154845	ENSG00000154845		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	9320	protein-coding gene	gene with protein product		604908				10026142	Standard	NM_001042388		Approved	PP4R1	uc002koe.2	Q8TF05	OTTHUMG00000137466	ENST00000400556.3:c.2479G>C	18.37:g.9550118C>G	ENSP00000383402:p.Glu827Gln		Q99774|Q9UNQ7	Missense_Mutation	SNP	pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.E827Q	ENST00000400556.3	37	c.2479	CCDS42412.1	18	.	.	.	.	.	.	.	.	.	.	C	19.21	3.783350	0.70222	.	.	ENSG00000154845	ENST00000400556;ENST00000400555	T;T	0.32753	1.44;1.44	5.62	5.62	0.85841	Armadillo-like helical (1);Armadillo-type fold (1);	0.144866	0.49305	D	0.000156	T	0.49847	0.1581	M	0.79475	2.455	0.51233	D	0.999918	P;D;B	0.52996	0.82;0.957;0.079	B;P;B	0.50970	0.374;0.655;0.138	T	0.48636	-0.9018	9	.	.	.	-29.8235	20.0247	0.97519	0.0:1.0:0.0:0.0	.	810;827;810	A8K923;Q8TF05;Q8TF05-2	.;PP4R1_HUMAN;.	Q	827;810	ENSP00000383402:E827Q;ENSP00000383401:E810Q	.	E	-	1	0	PPP4R1	9540118	1.000000	0.71417	0.646000	0.29493	0.734000	0.41952	5.713000	0.68415	2.804000	0.96469	0.655000	0.94253	GAG	PPP4R1	-	superfamily_ARM-type_fold	ENSG00000154845		0.552	PPP4R1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPP4R1	HGNC	protein_coding	OTTHUMT00000268571.1	-	0.00	91	0	C	NM_005134		9550118	-1	tier1	-	no_errors	ENST00000400556	ensembl	human	known	74_37	missense	27.27	55	21	SNP	1.000	G
PRAMENP	649179	genome.wustl.edu	37	22	22345724	22345724	+	RNA	SNP	C	C	G	rs544623916	byFrequency	TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr22:22345724C>G	ENST00000337471.4	-	0	2810									PRAME N-terminal-like, pseudogene																		AGCTTGTCCTCGTTCACAGGA	0.582																																																	0																																												0					22q11.22	2013-09-27	2013-09-27	2013-09-27	ENSG00000197549	ENSG00000197549		"""-"""	34302	pseudogene	pseudogene			"""preferentially expressed antigen in melanoma-like"", ""PRAME family member 24, pseudogene"""	PRAMEL, PRAMEF24P			Standard	XR_425303		Approved	FLJ16327			OTTHUMG00000150836		22.37:g.22345724C>G				RNA	SNP	-	NULL	ENST00000337471.4	37	NULL		22																																																																																			PRAMENP	-	-	ENSG00000197549		0.582	PRAMENP-001	KNOWN	basic|exp_conf	processed_transcript	PRAMENP	HGNC	pseudogene	OTTHUMT00000320276.2	-	0.00	27	0	C			22345724	-1	tier1	-	no_errors	ENST00000337471	ensembl	human	known	74_37	rna	30.30	23	10	SNP	0.283	G
PRKAG3	53632	genome.wustl.edu	37	2	219695486	219695486	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr2:219695486G>A	ENST00000529249.1	-	3	527	c.212C>T	c.(211-213)cCa>cTa	p.P71L	PRKAG3_ENST00000439262.2_Missense_Mutation_p.P46L|PRKAG3_ENST00000392098.3_Missense_Mutation_p.P71L|PRKAG3_ENST00000545803.1_5'UTR			Q9UGI9	AAKG3_HUMAN	protein kinase, AMP-activated, gamma 3 non-catalytic subunit	71			P -> A (in dbSNP:rs692243). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:17878938}.		cell cycle arrest (GO:0007050)|fatty acid biosynthetic process (GO:0006633)|glucose transport (GO:0015758)|glycogen biosynthetic process (GO:0005978)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|protein phosphorylation (GO:0006468)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|extracellular space (GO:0005615)	AMP-activated protein kinase activity (GO:0004679)|ATP binding (GO:0005524)|protein kinase binding (GO:0019901)			large_intestine(7)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	20		Renal(207;0.0474)		Epithelial(149;4.35e-07)|all cancers(144;8.96e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	Acetylsalicylic acid(DB00945)	CTGACCTGGTGGCTCCCCTTC	0.612																																																	0													145.0	120.0	128.0					2																	219695486		2203	4300	6503	SO:0001583	missense	0			AF214519	CCDS2424.1	2q35	2012-09-20			ENSG00000115592	ENSG00000115592			9387	protein-coding gene	gene with protein product		604976				10818001	Standard	NM_017431		Approved		uc002vjb.1	Q9UGI9	OTTHUMG00000133078	ENST00000529249.1:c.212C>T	2.37:g.219695486G>A	ENSP00000436068:p.Pro71Leu		Q4QQG8|Q4V779|Q9NRL1	Missense_Mutation	SNP	pfam_CBS_dom,smart_CBS_dom	p.P71L	ENST00000529249.1	37	c.212	CCDS2424.1	2	.	.	.	.	.	.	.	.	.	.	G	1.605	-0.525503	0.04141	.	.	ENSG00000115592	ENST00000439262;ENST00000529249;ENST00000392098;ENST00000430489	D;D;T;T	0.83837	-1.64;-1.77;-0.06;0.8	4.78	0.347	0.16022	.	0.360067	0.23775	N	0.044685	T	0.60547	0.2277	N	0.11201	0.11	0.09310	N	1	B;B;B	0.23442	0.085;0.001;0.001	B;B;B	0.24155	0.051;0.003;0.001	T	0.46190	-0.9209	10	0.15952	T	0.53	-0.0387	5.3958	0.16268	0.1757:0.0:0.6657:0.1586	.	71;46;71	B4DUK8;Q9UGI9-2;Q9UGI9	.;.;AAKG3_HUMAN	L	46;71;71;71	ENSP00000397133:P46L;ENSP00000436068:P71L;ENSP00000375947:P71L;ENSP00000416100:P71L	ENSP00000233944:P71L	P	-	2	0	PRKAG3	219403730	0.309000	0.24518	0.006000	0.13384	0.375000	0.29983	0.739000	0.26173	-0.239000	0.09710	0.655000	0.94253	CCA	PRKAG3	-	NULL	ENSG00000115592		0.612	PRKAG3-006	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PRKAG3	HGNC	protein_coding	OTTHUMT00000385992.1	-	0.00	110	0	G			219695486	-1	tier1	-	no_errors	ENST00000233944	ensembl	human	known	74_37	missense	70.53	28	67	SNP	0.001	A
PRSS21	10942	genome.wustl.edu	37	16	2871496	2871496	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr16:2871496G>C	ENST00000005995.3	+	6	877	c.835G>C	c.(835-837)Gag>Cag	p.E279Q	PRSS21_ENST00000455114.1_Missense_Mutation_p.E277Q|PRSS21_ENST00000450020.3_Missense_Mutation_p.E265Q|PRSS21_ENST00000575739.1_Intron			Q9Y6M0	TEST_HUMAN	protease, serine, 21 (testisin)	279	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				spermatogenesis (GO:0007283)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|skin(2)	15						CCACCACTTTGAGTGGATCCA	0.587																																																	0													72.0	75.0	74.0					16																	2871496		2198	4300	6498	SO:0001583	missense	0			AF058300	CCDS10478.1, CCDS45388.1	16p13.3	2010-05-07			ENSG00000007038	ENSG00000007038		"""Serine peptidases / Serine peptidases"""	9485	protein-coding gene	gene with protein product		608159				10397266, 9826525	Standard	NM_006799		Approved	ESP-1, TEST1, TESTISIN	uc002crt.4	Q9Y6M0	OTTHUMG00000128931	ENST00000005995.3:c.835G>C	16.37:g.2871496G>C	ENSP00000005995:p.Glu279Gln		Q9NS34|Q9P2V6	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_Peptidase_S1	p.E279Q	ENST00000005995.3	37	c.835	CCDS10478.1	16	.	.	.	.	.	.	.	.	.	.	g	3.081	-0.189016	0.06299	.	.	ENSG00000007038	ENST00000455114;ENST00000450020;ENST00000005995	D;D;D	0.81996	-1.56;-1.56;-1.56	3.75	-7.5	0.01351	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	T	0.69024	0.3065	L	0.35723	1.085	0.09310	N	1	B;B;B	0.18166	0.026;0.021;0.021	B;B;B	0.17979	0.02;0.012;0.012	T	0.52193	-0.8608	9	0.16896	T	0.51	.	9.8724	0.41182	0.1597:0.6303:0.2101:0.0	.	279;277;265	Q9Y6M0;Q9Y6M0-2;Q9Y6M0-3	TEST_HUMAN;.;.	Q	277;265;279	ENSP00000400632:E277Q;ENSP00000407741:E265Q;ENSP00000005995:E279Q	ENSP00000005995:E279Q	E	+	1	0	PRSS21	2811497	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.069000	0.01381	-2.199000	0.00748	-0.321000	0.08615	GAG	PRSS21	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000007038		0.587	PRSS21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRSS21	HGNC	protein_coding	OTTHUMT00000250910.1	-	0.00	87	0	G	NM_006799		2871496	+1	tier1	-	no_errors	ENST00000005995	ensembl	human	known	74_37	missense	17.95	64	14	SNP	0.000	C
PRSS53	339105	genome.wustl.edu	37	16	31098169	31098169	+	Missense_Mutation	SNP	T	T	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr16:31098169T>G	ENST00000280606.6	-	4	446	c.293A>C	c.(292-294)cAg>cCg	p.Q98P		NM_001039503.2	NP_001034592.1	Q2L4Q9	PRS53_HUMAN	protease, serine, 53	98	Peptidase S1 1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			large_intestine(1)|lung(3)	4						TCCCTCACGCTGCAGAGAACC	0.622																																																	0													41.0	44.0	43.0					16																	31098169		2070	4208	6278	SO:0001583	missense	0				CCDS42153.1	16p11.2	2010-05-07			ENSG00000151006	ENSG00000151006		"""Serine peptidases / Serine peptidases"""	34407	protein-coding gene	gene with protein product	"""polyserase 3"""	610561				16566820	Standard	NM_001039503		Approved	POL3S	uc002eaq.3	Q2L4Q9	OTTHUMG00000047358	ENST00000280606.6:c.293A>C	16.37:g.31098169T>G	ENSP00000280606:p.Gln98Pro			Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.Q98P	ENST00000280606.6	37	c.293	CCDS42153.1	16	.	.	.	.	.	.	.	.	.	.	T	12.04	1.818014	0.32145	.	.	ENSG00000151006	ENST00000280606	D	0.81499	-1.5	5.75	2.1	0.27182	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.529463	0.14076	U	0.343097	T	0.70988	0.3287	L	0.38692	1.165	0.26490	N	0.974966	B	0.24576	0.106	B	0.34346	0.18	T	0.60642	-0.7223	10	0.38643	T	0.18	.	4.477	0.11748	0.1438:0.1597:0.0:0.6965	.	98	Q2L4Q9	PRS53_HUMAN	P	98	ENSP00000280606:Q98P	ENSP00000280606:Q98P	Q	-	2	0	PRSS53	31005670	0.966000	0.33281	0.794000	0.32065	0.488000	0.33401	0.697000	0.25556	0.447000	0.26695	-0.274000	0.10170	CAG	PRSS53	-	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000151006		0.622	PRSS53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS53	HGNC	protein_coding	OTTHUMT00000108580.4	-	0.00	43	0	T	NM_001081268		31098169	-1	tier1	-	no_errors	ENST00000280606	ensembl	human	known	74_37	missense	36.73	31	18	SNP	0.944	G
PRSS58	136541	genome.wustl.edu	37	7	141952041	141952041	+	Nonstop_Mutation	SNP	T	T	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr7:141952041T>A	ENST00000552471.1	-	5	1045	c.726A>T	c.(724-726)tgA>tgT	p.*242C	PRSS58_ENST00000547058.2_Nonstop_Mutation_p.*242C			Q8IYP2	PRS58_HUMAN	protease, serine, 58	0						extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			kidney(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(2)|skin(2)	19						CTGCCACAGCTCAGTTATTTT	0.398																																																	0													67.0	80.0	76.0					7																	141952041		2203	4300	6503	SO:0001578	stop_lost	0				CCDS5871.1	7q34	2012-10-03			ENSG00000258223	ENSG00000258223	3.4.21.4	"""Serine peptidases / Serine peptidases"""	39125	protein-coding gene	gene with protein product	"""trypsin X3"""						Standard	NM_001001317		Approved	TRYX3	uc003vxc.4	Q8IYP2	OTTHUMG00000158565	ENST00000552471.1:c.726A>T	7.37:g.141952041T>A			B3KVJ6|D3DXD2	Nonstop_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.*242C	ENST00000552471.1	37	c.726	CCDS5871.1	7	.	.	.	.	.	.	.	.	.	.	T	13.89	2.372746	0.42003	.	.	ENSG00000258223	ENST00000547058;ENST00000552471	.	.	.	4.98	4.98	0.66077	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.981	0.47494	0.0:0.0:0.0:1.0	.	.	.	.	C	242	.	.	X	-	3	0	PRSS58	141598519	1.000000	0.71417	0.963000	0.40424	0.044000	0.14063	4.731000	0.62022	2.082000	0.62665	0.533000	0.62120	TGA	PRSS58	-	NULL	ENSG00000258223		0.398	PRSS58-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PRSS58	HGNC	protein_coding	OTTHUMT00000351328.2	-	0.00	28	0	T	NM_001001317		141952041	-1	tier1	-	no_errors	ENST00000547058	ensembl	human	known	74_37	nonstop	53.85	12	14	SNP	1.000	A
PRX	57716	genome.wustl.edu	37	19	40904703	40904703	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr19:40904703G>C	ENST00000324001.7	-	6	475	c.205C>G	c.(205-207)Cga>Gga	p.R69G	PRX_ENST00000291825.7_Missense_Mutation_p.R69G	NM_181882.2	NP_870998.2	Q9BXM0	PRAX_HUMAN	periaxin	69	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				axon ensheathment (GO:0008366)|cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(9)	47			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AAGAACACTCGGGCACTCAGC	0.642																																																	0													59.0	54.0	55.0					19																	40904703		2203	4300	6503	SO:0001583	missense	0			AB046840	CCDS12556.1, CCDS33028.1	19q13.2	2014-09-17				ENSG00000105227			13797	protein-coding gene	gene with protein product		605725				10839370, 9143514	Standard	NM_181882		Approved	KIAA1620	uc002onr.3	Q9BXM0		ENST00000324001.7:c.205C>G	19.37:g.40904703G>C	ENSP00000326018:p.Arg69Gly		Q9BXL9|Q9HCF2	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.R69G	ENST00000324001.7	37	c.205	CCDS33028.1	19	.	.	.	.	.	.	.	.	.	.	G	18.36	3.606622	0.66558	.	.	ENSG00000105227	ENST00000324001;ENST00000291825;ENST00000341562	T;T	0.23552	1.9;1.9	5.18	4.13	0.48395	PDZ/DHR/GLGF (3);	0.118493	0.51477	D	0.000100	T	0.28764	0.0713	N	0.05441	-0.05	0.38784	D	0.954822	D;D	0.71674	0.974;0.998	P;D	0.75484	0.7;0.986	T	0.30060	-0.9991	10	0.44086	T	0.13	-13.7952	12.4478	0.55662	0.0:0.0:0.6964:0.3035	.	69;69	Q9BXM0-2;Q9BXM0	.;PRAX_HUMAN	G	69	ENSP00000326018:R69G;ENSP00000291825:R69G	ENSP00000291825:R69G	R	-	1	2	PRX	45596543	1.000000	0.71417	0.991000	0.47740	0.987000	0.75469	2.630000	0.46494	1.177000	0.42855	0.561000	0.74099	CGA	PRX	-	superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000105227		0.642	PRX-001	KNOWN	basic|CCDS	protein_coding	PRX	HGNC	protein_coding	OTTHUMT00000462582.1		0.00	23	0	G	NM_020956		40904703	-1			no_errors	ENST00000324001	ensembl	human	known	74_37	missense	35.71	9	5	SNP	0.998	C
PTP4A3	11156	genome.wustl.edu	37	8	142437153	142437153	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr8:142437153G>T	ENST00000521578.1	+	4	1258	c.313G>T	c.(313-315)Gtg>Ttg	p.V105L	PTP4A3_ENST00000524028.1_Intron|PTP4A3_ENST00000329397.1_Missense_Mutation_p.V105L|PTP4A3_ENST00000349124.1_Missense_Mutation_p.V105L|PTP4A3_ENST00000520105.1_Missense_Mutation_p.V105L			O75365	TP4A3_HUMAN	protein tyrosine phosphatase type IVA, member 3	105	Tyrosine-protein phosphatase.				peptidyl-tyrosine dephosphorylation (GO:0035335)	endosome (GO:0005768)|plasma membrane (GO:0005886)	prenylated protein tyrosine phosphatase activity (GO:0004727)			endometrium(2)|large_intestine(1)|lung(3)	6	all_cancers(97;2.55e-15)|all_epithelial(106;1.39e-13)|Lung NSC(106;2.07e-05)|all_lung(105;2.89e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0474)			TGTGCACTGCGTGGCGGGCCT	0.682																																																	0													55.0	66.0	62.0					8																	142437153		2203	4297	6500	SO:0001583	missense	0			AF041434	CCDS6382.1, CCDS6383.1	8q24.3	2011-06-09				ENSG00000184489		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PRLs"""	9636	protein-coding gene	gene with protein product		606449					Standard	NM_032611		Approved	PRL-3, PRL-R, PRL3	uc003ywg.1	O75365		ENST00000521578.1:c.313G>T	8.37:g.142437153G>T	ENSP00000428976:p.Val105Leu		Q8IVN5|Q99849|Q9BTW5	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Dual-sp_phosphatase_cat-dom,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-sp_Pase	p.V105L	ENST00000521578.1	37	c.313	CCDS6383.1	8	.	.	.	.	.	.	.	.	.	.	G	34	5.407505	0.96051	.	.	ENSG00000184489	ENST00000521578;ENST00000520105;ENST00000329397;ENST00000349124	D;T;D;T	0.82893	-1.66;0.7;-1.66;0.7	5.27	5.27	0.74061	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.85682	D	0.000000	D	0.92254	0.7543	M	0.86343	2.81	0.80722	D	1	D;P	0.76494	0.999;0.461	D;P	0.79784	0.993;0.519	D	0.93335	0.6704	10	0.87932	D	0	-4.1849	17.8229	0.88655	0.0:0.0:1.0:0.0	.	105;105	O75365-2;O75365	.;TP4A3_HUMAN	L	105	ENSP00000428976:V105L;ENSP00000428758:V105L;ENSP00000332274:V105L;ENSP00000331730:V105L	ENSP00000332274:V105L	V	+	1	0	PTP4A3	142506335	1.000000	0.71417	0.988000	0.46212	0.984000	0.73092	9.712000	0.98738	2.619000	0.88677	0.561000	0.74099	GTG	PTP4A3	-	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Dual-sp_phosphatase_cat-dom,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-sp_Pase	ENSG00000184489		0.682	PTP4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTP4A3	HGNC	protein_coding	OTTHUMT00000378977.1	-	0.00	197	0	G	NM_032611		142437153	+1	tier1	-	no_errors	ENST00000329397	ensembl	human	known	74_37	missense	60.98	112	175	SNP	1.000	T
PTPRZ1	5803	genome.wustl.edu	37	7	121513382	121513383	+	5'UTR	INS	-	-	CA	rs35113798|rs386360108|rs3069073|rs4988976|rs370737965	byFrequency	TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr7:121513382_121513383insCA	ENST00000393386.2	+	0	240_241				PTPRZ1_ENST00000449182.1_5'Flank	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1						axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						tctctctctctcacacacacac	0.49														1511	0.301717	0.3374	0.2464	5008	,	,		12284	0.2679		0.2753	False		,,,				2504	0.3548																0																																										SO:0001623	5_prime_UTR_variant	0			M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.-171->CA	7.37:g.121513391_121513392dupCA			A4D0W5|C9JFM0|O76043|Q9UDR6	RNA	INS	-	NULL	ENST00000393386.2	37	NULL	CCDS34740.1	7																																																																																			PTPRZ1	-	-	ENSG00000106278		0.490	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRZ1	HGNC	protein_coding	OTTHUMT00000347288.1		0.00	9	0	-	NM_002851		121513383	+1	tier1		no_errors	ENST00000471837	ensembl	human	known	74_37	rna	30.77	9	4	INS	0.000:0.002	CA
PTRH1	138428	genome.wustl.edu	37	9	130478320	130478320	+	5'UTR	SNP	G	G	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr9:130478320G>C	ENST00000419060.1	-	0	1055				PTRH1_ENST00000429848.1_5'UTR|PTRH1_ENST00000423807.1_5'Flank|TTC16_ENST00000393748.4_5'Flank|TTC16_ENST00000373289.3_5'Flank|PTRH1_ENST00000543175.1_5'Flank			Q86Y79	PTH_HUMAN	peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae)							mitochondrion (GO:0005739)	aminoacyl-tRNA hydrolase activity (GO:0004045)|poly(A) RNA binding (GO:0044822)			NS(1)	1						GGCGTGGCCAGAGGGGTGGGG	0.632																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AK090922	CCDS35147.1	9q34.11	2006-02-13	2006-02-13	2006-02-13	ENSG00000187024	ENSG00000187024			27039	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 115"""	C9orf115			Standard	NM_001002913		Approved	PTH1	uc004bro.3	Q86Y79	OTTHUMG00000020710	ENST00000419060.1:c.-402C>G	9.37:g.130478320G>C				RNA	SNP	-	NULL	ENST00000419060.1	37	NULL	CCDS35147.1	9																																																																																			PTRH1	-	-	ENSG00000187024		0.632	PTRH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTRH1	HGNC	protein_coding	OTTHUMT00000054219.4	-	0.00	71	0	G	NM_001002913		130478320	-1	tier1	-	no_errors	ENST00000429848	ensembl	human	putative	74_37	rna	25.98	94	33	SNP	0.000	C
PVR	5817	genome.wustl.edu	37	19	45150678	45150678	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr19:45150678A>T	ENST00000425690.3	+	2	562	c.263A>T	c.(262-264)gAg>gTg	p.E88V	PVR_ENST00000403059.4_Missense_Mutation_p.E88V|PVR_ENST00000406449.4_Missense_Mutation_p.E88V|CTB-171A8.1_ENST00000590796.1_RNA|PVR_ENST00000344956.4_Missense_Mutation_p.E88V	NM_006505.3	NP_006496.3	P15151	PVR_HUMAN	poliovirus receptor	88	Ig-like V-type.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|regulation of immune response (GO:0050776)|susceptibility to natural killer cell mediated cytotoxicity (GO:0042271)|susceptibility to T cell mediated cytotoxicity (GO:0060370)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|receptor activity (GO:0004872)			large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	6	Lung NSC(12;0.00608)|all_lung(12;0.0148)	Medulloblastoma(540;0.0425)|Ovarian(192;0.0728)|Prostate(69;0.081)|all_neural(266;0.112)		Epithelial(262;0.000601)		AGCTATTCGGAGTCCAAACGG	0.602																																																	0													47.0	38.0	41.0					19																	45150678		2203	4300	6503	SO:0001583	missense	0			BC015542	CCDS12640.1, CCDS46105.1, CCDS46106.1, CCDS46107.1	19q13.2	2013-01-29			ENSG00000073008	ENSG00000073008		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9705	protein-coding gene	gene with protein product	"""nectin-like 5"""	173850		PVS		2170108	Standard	XM_005259120		Approved	CD155, HVED, Necl-5, NECL5, Tage4	uc002ozm.3	P15151	OTTHUMG00000151527	ENST00000425690.3:c.263A>T	19.37:g.45150678A>T	ENSP00000402060:p.Glu88Val		B4DTS9|P15152|Q15267|Q15268|Q96BJ1	Missense_Mutation	SNP	pfam_CD80_C2-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.E88V	ENST00000425690.3	37	c.263	CCDS12640.1	19	.	.	.	.	.	.	.	.	.	.	A	16.81	3.226728	0.58668	.	.	ENSG00000073008	ENST00000344956;ENST00000425690;ENST00000406449;ENST00000403059	T;T;T;T	0.68765	-0.35;-0.35;-0.35;-0.35	4.79	2.3	0.28687	Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin V-set, subgroup (1);Immunoglobulin-like fold (1);	1.516800	0.03923	N	0.283891	T	0.79736	0.4497	M	0.74647	2.275	0.09310	N	1	D;D;D;P	0.71674	0.998;0.974;0.987;0.858	D;P;D;D	0.70716	0.97;0.892;0.94;0.922	T	0.54583	-0.8272	10	0.33940	T	0.23	.	6.4197	0.21736	0.7609:0.0:0.2391:0.0	.	88;88;88;88	P15151-2;P15151-3;P15151-4;P15151	.;.;.;PVR_HUMAN	V	88	ENSP00000340870:E88V;ENSP00000402060:E88V;ENSP00000383907:E88V;ENSP00000385344:E88V	ENSP00000340870:E88V	E	+	2	0	PVR	49842518	0.001000	0.12720	0.001000	0.08648	0.005000	0.04900	0.990000	0.29642	0.693000	0.31634	0.386000	0.25728	GAG	PVR	-	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	ENSG00000073008		0.602	PVR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PVR	HGNC	protein_coding	OTTHUMT00000323017.2	-	0.00	62	0	A	NM_006505		45150678	+1	tier1	-	no_errors	ENST00000425690	ensembl	human	known	74_37	missense	22.39	52	15	SNP	0.000	T
QARS	5859	genome.wustl.edu	37	3	49133372	49133372	+	3'UTR	SNP	G	G	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr3:49133372G>C	ENST00000306125.6	-	0	2755				QRICH1_ENST00000424300.1_5'Flank|QARS_ENST00000414533.1_3'UTR|QRICH1_ENST00000395443.2_5'Flank|QRICH1_ENST00000357496.2_5'Flank			P47897	SYQ_HUMAN	glutaminyl-tRNA synthetase						brain development (GO:0007420)|gene expression (GO:0010467)|glutaminyl-tRNA aminoacylation (GO:0006425)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|glutamine-tRNA ligase activity (GO:0004819)			breast(1)|endometrium(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	L-Glutamine(DB00130)	GACTCTAGGAGAATTTAGCTG	0.502																																																	0																																										SO:0001624	3_prime_UTR_variant	0			X76013	CCDS2788.1, CCDS63633.1	3p21.31	2011-07-01			ENSG00000172053	ENSG00000172053	6.1.1.18	"""Aminoacyl tRNA synthetases / Class I"""	9751	protein-coding gene	gene with protein product	"""glutamine tRNA ligase"""	603727				8078941, 10393422	Standard	NM_005051		Approved		uc003cvx.4	P47897	OTTHUMG00000156774	ENST00000306125.6:c.*90C>G	3.37:g.49133372G>C			B4DWJ2	RNA	SNP	-	NULL	ENST00000306125.6	37	NULL	CCDS2788.1	3																																																																																			QARS	-	-	ENSG00000172053		0.502	QARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QARS	HGNC	protein_coding	OTTHUMT00000345689.2	-	0.00	49	0	G	NM_005051		49133372	-1	tier1	-	no_errors	ENST00000475599	ensembl	human	known	74_37	rna	23.08	40	12	SNP	0.001	C
PVRL3	25945	genome.wustl.edu	37	3	110852704	110852704	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr3:110852704G>A	ENST00000485303.1	+	6	1567	c.1292G>A	c.(1291-1293)aGa>aAa	p.R431K	PVRL3_ENST00000319792.3_3'UTR|PVRL3_ENST00000493615.1_Intron	NM_001243286.1|NM_015480.2	NP_001230215.1|NP_056295.1	Q9NQS3	PVRL3_HUMAN	poliovirus receptor-related 3	431					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|fertilization (GO:0009566)|homophilic cell adhesion (GO:0007156)|lens morphogenesis in camera-type eye (GO:0002089)|retina morphogenesis in camera-type eye (GO:0060042)|single organismal cell-cell adhesion (GO:0016337)	apical junction complex (GO:0043296)|cell-cell adherens junction (GO:0005913)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	cell adhesion molecule binding (GO:0050839)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(3)	19						TATAGGAGAAGACGGACGTTT	0.413																																																	0													146.0	144.0	144.0					3																	110852704		2203	4300	6503	SO:0001583	missense	0			AF282874	CCDS2957.1, CCDS58842.1, CCDS58843.1	3q13	2013-01-29			ENSG00000177707	ENSG00000177707		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17664	protein-coding gene	gene with protein product		607147				11024295	Standard	NM_015480		Approved	nectin-3, PPR3, PVRR3, DKFZP566B0846, CDw113, CD113	uc003dxt.2	Q9NQS3	OTTHUMG00000159239	ENST00000485303.1:c.1292G>A	3.37:g.110852704G>A	ENSP00000418070:p.Arg431Lys		E9PFR0|Q6NVZ3|Q8NC05|Q8WVU4|Q9BVA9|Q9Y412	Missense_Mutation	SNP	pfam_CD80_C2-set,pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	p.R431K	ENST00000485303.1	37	c.1292	CCDS2957.1	3	.	.	.	.	.	.	.	.	.	.	G	13.89	2.371564	0.42003	.	.	ENSG00000177707	ENST00000485303	T	0.14022	2.54	5.87	5.87	0.94306	Cytochrome c1, transmembrane anchor, C-terminal (1);	0.052772	0.64402	N	0.000001	T	0.09642	0.0237	L	0.31752	0.955	0.80722	D	1	B	0.28512	0.214	B	0.20767	0.031	T	0.24977	-1.0145	10	0.21014	T	0.42	.	11.0918	0.48121	0.0834:0.0:0.9166:0.0	.	431	Q9NQS3	PVRL3_HUMAN	K	431	ENSP00000418070:R431K	ENSP00000418070:R431K	R	+	2	0	PVRL3	112335394	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.808000	0.75206	2.801000	0.96364	0.454000	0.30748	AGA	PVRL3	-	NULL	ENSG00000177707		0.413	PVRL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PVRL3	HGNC	protein_coding	OTTHUMT00000354045.1	-	0.00	40	0	G	NM_015480		110852704	+1	tier1	-	no_errors	ENST00000485303	ensembl	human	known	74_37	missense	32.31	44	21	SNP	1.000	A
QTRTD1	79691	genome.wustl.edu	37	3	113801479	113801479	+	Intron	SNP	C	C	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr3:113801479C>G	ENST00000493014.1	+	5	648				QTRTD1_ENST00000479882.1_Intron|QTRTD1_ENST00000281273.4_Intron|QTRTD1_ENST00000485050.1_Intron	NM_001256836.1	NP_001243765.1			queuine tRNA-ribosyltransferase domain containing 1											central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|skin(2)	10						ATGGCCACTTCTTATCTGATC	0.299																																																	0													50.0	55.0	53.0					3																	113801479		2203	4286	6489	SO:0001627	intron_variant	0			AK023022	CCDS33828.1, CCDS58846.1, CCDS58845.1, CCDS58844.1	3q13.31	2010-11-16			ENSG00000151576	ENSG00000151576			25771	protein-coding gene	gene with protein product						12477932	Standard	NM_024638		Approved	FLJ12960	uc003eaz.4	Q9H974	OTTHUMG00000159336	ENST00000493014.1:c.581-45C>G	3.37:g.113801479C>G				RNA	SNP	-	NULL	ENST00000493014.1	37	NULL	CCDS58845.1	3																																																																																			QTRTD1	-	-	ENSG00000151576		0.299	QTRTD1-004	PUTATIVE	basic|exp_conf|CCDS	protein_coding	QTRTD1	HGNC	protein_coding	OTTHUMT00000354711.1	-	0.00	25	0	C	NM_024638		113801479	+1	tier1	-	no_errors	ENST00000462869	ensembl	human	putative	74_37	rna	18.92	30	7	SNP	0.000	G
RABL2A	11159	genome.wustl.edu	37	2	114399798	114399798	+	3'UTR	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr2:114399798C>T	ENST00000393167.3	+	0	1004				RABL2A_ENST00000409875.1_3'UTR|RABL2A_ENST00000393166.3_Intron|RABL2A_ENST00000376439.3_Intron|RABL2A_ENST00000478880.1_3'UTR|RABL2A_ENST00000409842.1_3'UTR|RABL2A_ENST00000393165.3_Intron	NM_013412.2	NP_038198.1	Q9UBK7	RBL2A_HUMAN	RAB, member of RAS oncogene family-like 2A						GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)		GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)|stomach(3)	9						TCTAGGCCATCCCCTCTTCTA	0.552																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS2118.1	2q13	2014-05-09			ENSG00000144134	ENSG00000144134		"""RAB, member RAS oncogene"""	9799	protein-coding gene	gene with protein product		605412				10444334	Standard	NM_007082		Approved		uc010flb.3	Q9UBK7	OTTHUMG00000047828	ENST00000393167.3:c.*92C>T	2.37:g.114399798C>T			B7ZBD6|Q9NU37	RNA	SNP	-	NULL	ENST00000393167.3	37	NULL	CCDS2118.1	2																																																																																			RABL2A	-	-	ENSG00000144134		0.552	RABL2A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	RABL2A	HGNC	protein_coding	OTTHUMT00000109047.2	-	0.00	25	0	C			114399798	+1	tier1	-	no_errors	ENST00000478880	ensembl	human	known	74_37	rna	33.33	22	11	SNP	0.012	T
RBM24	221662	genome.wustl.edu	37	6	17292855	17292855	+	3'UTR	SNP	C	C	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr6:17292855C>G	ENST00000379052.5	+	0	1452				RBM24_ENST00000508508.1_3'UTR|RBM24_ENST00000318204.5_3'UTR	NM_001143942.1	NP_001137414.1	Q9BX46	RBM24_HUMAN	RNA binding motif protein 24						cell differentiation (GO:0030154)|regulation of mRNA stability (GO:0043488)|regulation of myotube differentiation (GO:0010830)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)			endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(1)	13	Breast(50;0.0615)|Ovarian(93;0.0733)	all_hematologic(90;0.062)	all cancers(50;0.131)|Epithelial(50;0.15)			GAACTTTTTTCAAGTCGGAAG	0.388																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC040928	CCDS4538.1, CCDS47378.1, CCDS47379.1	6p22.3	2013-02-12	2004-04-23	2004-04-23	ENSG00000112183	ENSG00000112183		"""RNA binding motif (RRM) containing"""	21539	protein-coding gene	gene with protein product			"""RNA-binding region (RNP1, RRM) containing 6"""	RNPC6			Standard	NM_153020		Approved	FLJ30829, dJ259A10.1	uc003nbz.4	Q9BX46	OTTHUMG00000014306	ENST00000379052.5:c.*505C>G	6.37:g.17292855C>G			E9PAY4|Q6QDA4|Q8N9D3|Q96NI3	RNA	SNP	-	NULL	ENST00000379052.5	37	NULL	CCDS47378.1	6																																																																																			RBM24	-	-	ENSG00000112183		0.388	RBM24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM24	HGNC	protein_coding	OTTHUMT00000039946.2	-	0.00	50	0	C	NM_153020		17292855	+1	tier1	-	no_errors	ENST00000508508	ensembl	human	known	74_37	rna	27.94	49	19	SNP	0.000	G
RAET1E	135250	genome.wustl.edu	37	6	150209742	150209742	+	Silent	SNP	G	G	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr6:150209742G>A	ENST00000357183.4	-	4	816	c.684C>T	c.(682-684)atC>atT	p.I228I	RAET1E_ENST00000532335.1_Intron|RAET1E_ENST00000367363.3_Silent_p.I192I|RAET1E-AS1_ENST00000446954.2_RNA|RAET1E-AS1_ENST00000605899.1_RNA|RP11-244K5.8_ENST00000606915.1_RNA	NM_139165.2	NP_631904.1	Q8TD07	N2DL4_HUMAN	retinoic acid early transcript 1E	228					antigen processing and presentation (GO:0019882)|natural killer cell mediated cytotoxicity (GO:0042267)|regulation of immune response (GO:0050776)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	natural killer cell lectin-like receptor binding (GO:0046703)			cervix(1)|kidney(2)|large_intestine(3)|lung(3)|skin(1)	10		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.58e-12)		CCCCCAGGATGATCCATCTAT	0.423																																																	0													97.0	91.0	93.0					6																	150209742		2203	4300	6503	SO:0001819	synonymous_variant	0			AF359243	CCDS5221.1, CCDS59042.1, CCDS59043.1, CCDS59044.1	6q24.3	2011-02-09			ENSG00000164520	ENSG00000164520			16793	protein-coding gene	gene with protein product		609243				11827464	Standard	NM_139165		Approved	LETAL, bA350J20.7, ULBP4	uc003qnl.1	Q8TD07	OTTHUMG00000015796	ENST00000357183.4:c.684C>T	6.37:g.150209742G>A			A6YF59|Q5VYB7|Q5VYB8|Q8TEZ2|Q96L41	Silent	SNP	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog	p.I228	ENST00000357183.4	37	c.684	CCDS5221.1	6																																																																																			RAET1E	-	NULL	ENSG00000164520		0.423	RAET1E-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RAET1E	HGNC	protein_coding	OTTHUMT00000042659.1	-	0.00	45	0	G	NM_139165		150209742	-1	tier1	-	no_errors	ENST00000357183	ensembl	human	known	74_37	silent	37.84	23	14	SNP	0.008	A
RDH16	8608	genome.wustl.edu	37	12	57348715	57348715	+	Missense_Mutation	SNP	C	C	A	rs572909088		TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr12:57348715C>A	ENST00000398138.3	-	2	1403	c.547G>T	c.(547-549)Gtg>Ttg	p.V183L	RDH16_ENST00000360752.4_Intron	NM_003708.3	NP_003699.3	O75452	RDH16_HUMAN	retinol dehydrogenase 16 (all-trans)	183					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	electron carrier activity (GO:0009055)|retinol dehydrogenase activity (GO:0004745)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)	16						AAGGCTTCCACGCCATACTTG	0.592																																					GBM(179;741 2921 43105 45298)												0													60.0	67.0	65.0					12																	57348715		2056	4216	6272	SO:0001583	missense	0				CCDS41797.1	12q13.3	2011-09-14	2006-05-09			ENSG00000139547		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	29674	protein-coding gene	gene with protein product	"""microsomal NAD+ dependent retinol dehydrogenase 4"", ""short chain dehydrogenase/reductase family 9C, member 8"""		"""retinol dehydrogenase 16 (all-trans and 13-cis)"""			9677409, 10329026, 19027726	Standard	NM_003708		Approved	RODH-4, SDR9C8	uc001smi.4	O75452		ENST00000398138.3:c.547G>T	12.37:g.57348715C>A	ENSP00000381206:p.Val183Leu		Q9UNV2	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.V183L	ENST00000398138.3	37	c.547	CCDS41797.1	12	.	.	.	.	.	.	.	.	.	.	C	9.757	1.168984	0.21621	.	.	ENSG00000139547	ENST00000398138	D	0.84442	-1.85	4.98	-2.83	0.05769	Short-chain dehydrogenase/reductase, conserved site (1);NAD(P)-binding domain (1);	0.317289	0.25543	N	0.029946	T	0.72581	0.3478	N	0.13043	0.29	0.09310	N	0.999996	B	0.33103	0.397	B	0.42214	0.38	T	0.65623	-0.6123	10	0.46703	T	0.11	.	6.8959	0.24255	0.0:0.4593:0.1117:0.429	.	183	O75452	RDH16_HUMAN	L	183	ENSP00000381206:V183L	ENSP00000381206:V183L	V	-	1	0	RDH16	55634982	0.422000	0.25473	0.000000	0.03702	0.005000	0.04900	1.095000	0.30964	-0.863000	0.04084	-1.000000	0.02509	GTG	RDH16	-	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	ENSG00000139547		0.592	RDH16-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RDH16	HGNC	protein_coding	OTTHUMT00000410898.1	-	0.00	26	0	C	NM_003708		57348715	-1	tier1	-	no_errors	ENST00000398138	ensembl	human	known	74_37	missense	43.33	17	13	SNP	0.034	A
REXO1L1P	254958	genome.wustl.edu	37	8	86574539	86574539	+	Silent	SNP	G	G	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr8:86574539G>T	ENST00000379010.2	-	1	1187	c.1188C>A	c.(1186-1188)gcC>gcA	p.A396A		NM_172239.4	NP_758439.4														endometrium(1)|lung(4)	5						TGAAGAGGACGGCGCCTCCGG	0.701																																																	0													1.0	1.0	1.0					8																	86574539		353	1458	1811	SO:0001819	synonymous_variant	0																														ENST00000379010.2:c.1188C>A	8.37:g.86574539G>T				Silent	SNP	pfam_Exonuclease_RNaseT/DNA_pol3,superfamily_RNaseH-like_dom,smart_Exonuclease	p.A396	ENST00000379010.2	37	c.1188		8																																																																																			REXO1L1	-	NULL	ENSG00000205176		0.701	REXO1L1-001	PUTATIVE	basic|appris_principal	protein_coding	REXO1L1	HGNC	protein_coding	OTTHUMT00000381106.1	-	0.00	119	0	G			86574539	-1	tier1	-	no_errors	ENST00000379010	ensembl	human	putative	74_37	silent	22.83	168	50	SNP	0.982	T
RGSL1	353299	genome.wustl.edu	37	1	182517507	182517507	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr1:182517507G>A	ENST00000294854.8	+	16	2745	c.2725G>A	c.(2725-2727)Gag>Aag	p.E909K	RGSL1_ENST00000542961.1_Missense_Mutation_p.E944K	NM_001137669.1	NP_001131141.1	A5PLK6	RGSL_HUMAN	regulator of G-protein signaling like 1	909					termination of G-protein coupled receptor signaling pathway (GO:0038032)	integral component of membrane (GO:0016021)				central_nervous_system(2)|skin(4)	6						GGCATATAATGAGAATGATGT	0.413																																					Ovarian(71;11 616 11292 12944 18021 32289 33994 41738 46526)												0													158.0	130.0	138.0					1																	182517507		692	1591	2283	SO:0001583	missense	0			AF510428	CCDS58049.1	1q25	2013-04-02	2007-08-14		ENSG00000121446	ENSG00000121446			18636	protein-coding gene	gene with protein product		611012	"""regulator of G-protein signalling like 1"", ""regulator of G-protein signaling like 2"", ""regulator of G-protein signalling like 2"""	RGSL2		12801632	Standard	NM_001137669		Approved		uc009wxw.3	A5PLK6	OTTHUMG00000035217	ENST00000294854.8:c.2725G>A	1.37:g.182517507G>A	ENSP00000457748:p.Glu909Lys		A2A2Z0|A6PVM2|A6PVM3|Q0VAJ4|Q0VAJ5|Q6ZRL0|Q86UV0|Q9H084	Missense_Mutation	SNP	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam	p.E909K	ENST00000294854.8	37	c.2725	CCDS58049.1	1																																																																																			RGSL1	-	superfamily_Regulat_G_prot_signal_superfam	ENSG00000121446		0.413	RGSL1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	RGSL1	HGNC	protein_coding	OTTHUMT00000320710.3	-	0.00	30	0	G	NM_181572		182517507	+1	tier1	-	no_errors	ENST00000294854	ensembl	human	known	74_37	missense	37.21	27	16	SNP	0.878	A
RHOA	387	genome.wustl.edu	37	3	49405948	49405948	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr3:49405948C>G	ENST00000418115.1	-	3	574	c.190G>C	c.(190-192)Gaa>Caa	p.E64Q	RHOA_ENST00000422781.1_Missense_Mutation_p.E64Q|RHOA-IT1_ENST00000428083.1_RNA|RHOA_ENST00000454011.2_Intron	NM_001664.2	NP_001655.1	P61586	RHOA_HUMAN	ras homolog family member A	64					actin cytoskeleton organization (GO:0030036)|androgen receptor signaling pathway (GO:0030521)|apical junction assembly (GO:0043297)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cerebral cortex cell migration (GO:0021795)|cleavage furrow formation (GO:0036089)|forebrain radial glial cell differentiation (GO:0021861)|negative chemotaxis (GO:0050919)|negative regulation of axonogenesis (GO:0050771)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification involved in bone maturation (GO:0043931)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of podosome assembly (GO:0071803)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of translation (GO:0045727)|positive regulation of vasoconstriction (GO:0045907)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion transport (GO:0051924)|regulation of cell migration (GO:0030334)|regulation of dendrite development (GO:0050773)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of osteoblast proliferation (GO:0033688)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|Rho protein signal transduction (GO:0007266)|skeletal muscle tissue development (GO:0007519)|small GTPase mediated signal transduction (GO:0007264)|spindle assembly involved in mitosis (GO:0090307)|stress fiber assembly (GO:0043149)|stress-activated protein kinase signaling cascade (GO:0031098)|substantia nigra development (GO:0021762)|trabecula morphogenesis (GO:0061383)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	apical junction complex (GO:0043296)|axon (GO:0030424)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin binding (GO:0017022)			cervix(1)|kidney(1)|large_intestine(5)|lung(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.58e-05)|Kidney(197;0.0023)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		TCATAATCTTCCTGCCCAGCT	0.488																																																	0													117.0	112.0	114.0					3																	49405948		2203	4300	6503	SO:0001583	missense	0			BC001360	CCDS2795.1	3p21.3	2012-02-27	2012-02-27	2004-03-23	ENSG00000067560	ENSG00000067560			667	protein-coding gene	gene with protein product		165390	"""ras homolog gene family, member A"""	ARH12, ARHA		9605859	Standard	NM_001664		Approved	RhoA, Rho12, RHOH12	uc003cwu.3	P61586	OTTHUMG00000156838	ENST00000418115.1:c.190G>C	3.37:g.49405948C>G	ENSP00000400175:p.Glu64Gln		P06749|Q53HM4|Q5U024|Q9UDJ0|Q9UEJ4	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.E64Q	ENST00000418115.1	37	c.190	CCDS2795.1	3	.	.	.	.	.	.	.	.	.	.	C	33	5.267730	0.95399	.	.	ENSG00000067560	ENST00000418115;ENST00000422781;ENST00000445425	D;D;D	0.83914	-1.78;-1.78;-1.78	5.78	5.78	0.91487	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.94082	0.8103	H	0.95151	3.63	0.80722	D	1	D	0.67145	0.996	D	0.75484	0.986	D	0.95267	0.8374	10	0.87932	D	0	.	18.6067	0.91268	0.0:1.0:0.0:0.0	.	64	P61586	RHOA_HUMAN	Q	64	ENSP00000400175:E64Q;ENSP00000413587:E64Q;ENSP00000408402:E64Q	ENSP00000400175:E64Q	E	-	1	0	RHOA	49380952	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.675000	0.84002	2.749000	0.94314	0.551000	0.68910	GAA	RHOA	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000067560		0.488	RHOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHOA	HGNC	protein_coding	OTTHUMT00000346157.3	-	0.00	44	0	C	NM_001664		49405948	-1	tier1	-	no_errors	ENST00000418115	ensembl	human	known	74_37	missense	50.00	15	15	SNP	1.000	G
RIMS1	22999	genome.wustl.edu	37	6	73043490	73043490	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr6:73043490G>T	ENST00000521978.1	+	29	4318	c.4318G>T	c.(4318-4320)Gcc>Tcc	p.A1440S	RIMS1_ENST00000538414.1_Missense_Mutation_p.A246S|RIMS1_ENST00000348717.5_Missense_Mutation_p.A1223S|RIMS1_ENST00000264839.7_Missense_Mutation_p.A1289S|RIMS1_ENST00000517960.1_Missense_Mutation_p.A1223S|RIMS1_ENST00000520567.1_Intron|RIMS1_ENST00000517827.1_Intron|RIMS1_ENST00000522291.1_Intron|RIMS1_ENST00000401910.3_Missense_Mutation_p.A760S|RIMS1_ENST00000518273.1_Intron|RIMS1_ENST00000523963.1_Intron|RIMS1_ENST00000425662.2_Intron|RIMS1_ENST00000491071.2_Missense_Mutation_p.A1263S	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	1440					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				CAAAGTGGTTGCCATAGTGTC	0.468																																																	0													73.0	77.0	75.0					6																	73043490		2027	4188	6215	SO:0001583	missense	0			AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.4318G>T	6.37:g.73043490G>T	ENSP00000428417:p.Ala1440Ser		A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ,pfscan_Znf_FYVE-typ,pfscan_Znf_FYVE-rel	p.A1440S	ENST00000521978.1	37	c.4318	CCDS47449.1	6	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	24.5|24.5|24.5	4.533220|4.533220|4.533220	0.85812|0.85812|0.85812	.|.|.	.|.|.	ENSG00000079841|ENSG00000079841|ENSG00000079841	ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000264839;ENST00000517960;ENST00000521978;ENST00000401910;ENST00000453976;ENST00000370420;ENST00000538414|ENST00000517433|ENST00000522211	T;T;T;T;T;T;T;T;T|.|.	0.24151|.|.	2.12;2.54;2.24;2.53;2.16;2.33;2.36;1.89;1.87|.|.	5.57|5.57|5.57	5.57|5.57|5.57	0.84162|0.84162|0.84162	.|.|.	0.000000|.|.	0.64402|.|.	D|.|.	0.000005|.|.	T|T|T	0.66187|0.66187|0.66187	0.2764|0.2764|0.2764	L|L|L	0.55481|0.55481|0.55481	1.735|1.735|1.735	0.80722|0.80722|0.80722	D|D|D	1|1|1	D;D;D;D;D;D;D|.|.	0.89917|.|.	0.997;0.995;1.0;0.993;0.997;0.997;0.994|.|.	D;D;D;D;D;D;D|.|.	0.87578|.|.	0.935;0.978;0.998;0.978;0.985;0.985;0.97|.|.	T|T|T	0.61202|0.61202|0.61202	-0.7110|-0.7110|-0.7110	10|5|5	0.45353|.|.	T|.|.	0.12|.|.	-21.2205|-21.2205|-21.2205	19.9152|19.9152|19.9152	0.97057|0.97057|0.97057	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	246;1289;760;1223;516;1263;1440|.|.	B7Z7W2;E9PHR1;E9PF48;E7ENC2;Q5JY21;C9JNW6;Q86UR5|.|.	.;.;.;.;.;.;RIMS1_HUMAN|.|.	S|F|F	1263;1289;1263;1223;1289;1223;1440;760;605;488;246|785|357	ENSP00000430101:A1263S;ENSP00000275037:A1223S;ENSP00000264839:A1289S;ENSP00000429959:A1223S;ENSP00000428417:A1440S;ENSP00000385649:A760S;ENSP00000389503:A605S;ENSP00000359448:A488S;ENSP00000439730:A246S|.|.	ENSP00000264839:A1289S|.|.	A|C|L	+|+|+	1|2|3	0|0|2	RIMS1|RIMS1|RIMS1	73100211|73100211|73100211	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.714000|0.714000|0.714000	0.41099|0.41099|0.41099	9.813000|9.813000|9.813000	0.99286|0.99286|0.99286	2.784000|2.784000|2.784000	0.95788|0.95788|0.95788	0.585000|0.585000|0.585000	0.79938|0.79938|0.79938	GCC|TGC|TTG	RIMS1	-	NULL	ENSG00000079841		0.468	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMS1	HGNC	protein_coding	OTTHUMT00000374968.1	-	0.00	70	0	G			73043490	+1	tier1	-	no_errors	ENST00000521978	ensembl	human	known	74_37	missense	39.34	37	24	SNP	1.000	T
RNF169	254225	genome.wustl.edu	37	11	74546963	74546963	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr11:74546963C>T	ENST00000299563.4	+	6	1328	c.1315C>T	c.(1315-1317)Cag>Tag	p.Q439*		NM_001098638.1	NP_001092108.1	Q8NCN4	RN169_HUMAN	ring finger protein 169	439					cellular response to DNA damage stimulus (GO:0006974)|negative regulation of double-strand break repair (GO:2000780)|protein ubiquitination (GO:0016567)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|site of double-strand break (GO:0035861)	K63-linked polyubiquitin binding (GO:0070530)|ligase activity (GO:0016874)|nucleosome binding (GO:0031491)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|urinary_tract(1)	15						ACAGATCTTTCAGGAGCGGCA	0.473																																																	0													81.0	82.0	82.0					11																	74546963		1841	4094	5935	SO:0001587	stop_gained	0			AB082522	CCDS41691.1	11q13.4	2008-02-05			ENSG00000166439	ENSG00000166439		"""RING-type (C3HC4) zinc fingers"""	26961	protein-coding gene	gene with protein product						12056414	Standard	NM_001098638		Approved	KIAA1991	uc001ovl.4	Q8NCN4	OTTHUMG00000165516	ENST00000299563.4:c.1315C>T	11.37:g.74546963C>T	ENSP00000299563:p.Gln439*		Q6N015	Nonsense_Mutation	SNP	smart_Znf_RING,pfscan_Znf_RING	p.Q439*	ENST00000299563.4	37	c.1315	CCDS41691.1	11	.	.	.	.	.	.	.	.	.	.	C	36	5.862293	0.97036	.	.	ENSG00000166439	ENST00000299563	.	.	.	5.99	5.99	0.97316	.	0.225948	0.40469	N	0.001082	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-30.5872	17.9695	0.89108	0.0:1.0:0.0:0.0	.	.	.	.	X	439	.	ENSP00000299563:Q439X	Q	+	1	0	RNF169	74224611	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.253000	0.51469	2.847000	0.97988	0.655000	0.94253	CAG	RNF169	-	NULL	ENSG00000166439		0.473	RNF169-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF169	HGNC	protein_coding	OTTHUMT00000384741.1	-	0.00	23	0	C	XM_495886		74546963	+1	tier1	-	no_errors	ENST00000299563	ensembl	human	known	74_37	nonsense	39.13	14	9	SNP	0.999	T
RPE65	6121	genome.wustl.edu	37	1	68895504	68895504	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr1:68895504C>G	ENST00000262340.5	-	14	1610	c.1557G>C	c.(1555-1557)gaG>gaC	p.E519D		NM_000329.2	NP_000320.1	Q16518	RPE65_HUMAN	retinal pigment epithelium-specific protein 65kDa	519					cellular response to electrical stimulus (GO:0071257)|detection of light stimulus involved in visual perception (GO:0050908)|insulin receptor signaling pathway (GO:0008286)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin gene expression (GO:0007468)|retina homeostasis (GO:0001895)|retina morphogenesis in camera-type eye (GO:0060042)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|visual perception (GO:0007601)|vitamin A metabolic process (GO:0006776)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	all-trans-retinyl-ester hydrolase, 11-cis retinol forming activity (GO:0052885)|all-trans-retinyl-palmitate hydrolase, 11-cis retinol forming activity (GO:0052884)|metal ion binding (GO:0046872)|retinal isomerase activity (GO:0004744)			central_nervous_system(1)|kidney(3)|large_intestine(12)|lung(15)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	35						GGATGTTAATCTCCACTTCAG	0.453																																																	0													90.0	84.0	86.0					1																	68895504		2203	4300	6503	SO:0001583	missense	0			U18991	CCDS643.1	1p31	2014-05-13	2002-08-29		ENSG00000116745	ENSG00000116745	3.1.1.64		10294	protein-coding gene	gene with protein product	"""retinol isomerase"", ""all-trans-retinyl-palmitate hydrolase"", ""retinoid isomerohydrolase"", ""BCO family, member 3"""	180069	"""retinal pigment epithelium-specific protein (65kD)"""	RP20		8340400	Standard	XM_006710811		Approved	LCA2, rd12, BCO3	uc001dei.1	Q16518	OTTHUMG00000009208	ENST00000262340.5:c.1557G>C	1.37:g.68895504C>G	ENSP00000262340:p.Glu519Asp		A8K1L0|Q5T9U3	Missense_Mutation	SNP	pfam_Carotenoid_Oase	p.E519D	ENST00000262340.5	37	c.1557	CCDS643.1	1	.	.	.	.	.	.	.	.	.	.	C	4.880	0.163615	0.09287	.	.	ENSG00000116745	ENST00000262340	D	0.94758	-3.51	5.52	2.2	0.27929	.	0.209113	0.49916	N	0.000127	T	0.75309	0.3832	N	0.05351	-0.065	0.44447	D	0.997372	B	0.02656	0.0	B	0.01281	0.0	T	0.68337	-0.5435	10	0.30854	T	0.27	-4.9393	6.8299	0.23905	0.0:0.54:0.2249:0.2351	.	519	Q16518	RPE65_HUMAN	D	519	ENSP00000262340:E519D	ENSP00000262340:E519D	E	-	3	2	RPE65	68668092	0.988000	0.35896	1.000000	0.80357	0.996000	0.88848	0.254000	0.18314	0.710000	0.31997	-0.136000	0.14681	GAG	RPE65	-	pfam_Carotenoid_Oase	ENSG00000116745		0.453	RPE65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPE65	HGNC	protein_coding	OTTHUMT00000025509.1	-	0.00	13	0	C	NM_000329		68895504	-1	tier1	-	no_errors	ENST00000262340	ensembl	human	known	74_37	missense	15.62	27	5	SNP	0.998	G
RPL34	6164	genome.wustl.edu	37	4	109546356	109546356	+	Missense_Mutation	SNP	G	G	C	rs1065701		TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr4:109546356G>C	ENST00000394668.2	+	5	408	c.342G>C	c.(340-342)caG>caC	p.Q114H	RPL34_ENST00000394667.3_Missense_Mutation_p.Q114H|RPL34_ENST00000394665.1_Missense_Mutation_p.Q114H|RPL34_ENST00000506397.1_Missense_Mutation_p.Q114H|RPL34_ENST00000502534.1_Missense_Mutation_p.Q114H	NM_033625.2	NP_296374.1	P49207	RL34_HUMAN	ribosomal protein L34	114					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			kidney(2)|lung(1)|upper_aerodigestive_tract(1)	4		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000286)		CACAGAGTCAGAAAGCTAAAT	0.318																																																	0																																										SO:0001583	missense	0			AB007181	CCDS3680.1	4q25	2011-04-06			ENSG00000109475	ENSG00000109475		"""L ribosomal proteins"""	10340	protein-coding gene	gene with protein product						9582194, 7490091	Standard	XM_005263172		Approved	L34	uc003hyz.3	P49207	OTTHUMG00000131839	ENST00000394668.2:c.342G>C	4.37:g.109546356G>C	ENSP00000378163:p.Gln114His		Q6FG66|Q9BUZ2	Missense_Mutation	SNP	pfam_Ribosomal_L34Ae,prints_Ribosomal_L34Ae	p.Q114H	ENST00000394668.2	37	c.342	CCDS3680.1	4	.	.	.	.	.	.	.	.	.	.	G	11.53	1.665224	0.29604	.	.	ENSG00000109475	ENST00000394667;ENST00000502534;ENST00000394665;ENST00000506397;ENST00000394668	.	.	.	4.61	0.222	0.15288	.	0.122383	0.56097	N	0.000031	T	0.57489	0.2057	M	0.71036	2.16	0.48395	D	0.999641	B	0.10296	0.003	B	0.08055	0.003	T	0.54899	-0.8224	9	0.56958	D	0.05	.	11.0861	0.48089	0.4193:0.0:0.5807:0.0	rs1065701;rs1065701	114	P49207	RL34_HUMAN	H	114	.	ENSP00000378160:Q114H	Q	+	3	2	RPL34	109765805	1.000000	0.71417	0.997000	0.53966	0.864000	0.49448	2.241000	0.43097	-0.070000	0.12908	-0.797000	0.03246	CAG	RPL34	-	NULL	ENSG00000109475		0.318	RPL34-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL34	HGNC	protein_coding	OTTHUMT00000363468.1	-	0.00	44	0	G	NM_033625, NM_000995		109546356	+1	tier1	rs1065701	no_errors	ENST00000394665	ensembl	human	known	74_37	missense	21.05	30	8	SNP	0.994	C
SDHAP1	255812	genome.wustl.edu	37	3	195711538	195711538	+	RNA	SNP	T	T	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr3:195711538T>C	ENST00000427841.1	-	0	409					NR_003264.2				succinate dehydrogenase complex, subunit A, flavoprotein pseudogene 1																		GTCGGAGCCCTTCACGGTGTC	0.602																																					Ovarian(67;1158 1227 12109 20189 43170)												0																																												0			BC071730		3q29	2009-12-02	2006-11-21	2009-12-02	ENSG00000185485	ENSG00000185485			32455	pseudogene	pseudogene			"""succinate dehydrogenase complex, subunit A, flavoprotein-like 1"""	SDHAL1, SDHALP1			Standard	NR_003264		Approved		uc003fvy.3		OTTHUMG00000155716		3.37:g.195711538T>C				RNA	SNP	-	NULL	ENST00000427841.1	37	NULL		3																																																																																			SDHAP1	-	-	ENSG00000185485		0.602	SDHAP1-002	KNOWN	basic	processed_transcript	SDHAP1	HGNC	pseudogene	OTTHUMT00000341367.1	-	0.00	227	0	T			195711538	-1	tier1	-	no_errors	ENST00000427841	ensembl	human	known	74_37	rna	19.73	234	58	SNP	1.000	C
SDK2	54549	genome.wustl.edu	37	17	71334666	71334666	+	3'UTR	SNP	G	G	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr17:71334666G>C	ENST00000392650.3	-	0	6579				SDK2_ENST00000410094.1_5'UTR|SDK2_ENST00000388726.3_3'UTR	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2						cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						CAGGCAGTGAGAGGAGGGGTG	0.473																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.*60C>G	17.37:g.71334666G>C			A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	RNA	SNP	-	NULL	ENST00000392650.3	37	NULL	CCDS45769.1	17																																																																																			SDK2	-	-	ENSG00000069188		0.473	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK2	HGNC	protein_coding	OTTHUMT00000327598.2	-	0.00	97	0	G	NM_019064		71334666	-1	tier1	-	no_errors	ENST00000410094	ensembl	human	known	74_37	rna	25.86	86	30	SNP	0.002	C
SDR16C6P	442388	genome.wustl.edu	37	8	57294613	57294613	+	RNA	SNP	A	A	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr8:57294613A>T	ENST00000517787.1	-	0	295					NR_103832.1				short chain dehydrogenase/reductase family 16C, member 6, pseudogene																		TTCAAAAAAGAGAGATTCAGC	0.353																																																	0													62.0	53.0	56.0					8																	57294613		692	1591	2283			0					8q12.1	2011-09-20	2010-12-20	2010-12-20	ENSG00000253542	ENSG00000253542		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	35413	pseudogene	pseudogene			"""short chain dehydrogenase/reductase family 16C, member 6"""	SDR16C6		19027726	Standard	NR_103832		Approved				OTTHUMG00000164408		8.37:g.57294613A>T				RNA	SNP	-	NULL	ENST00000517787.1	37	NULL		8																																																																																			SDR16C6P	-	-	ENSG00000253542		0.353	SDR16C6P-001	KNOWN	basic	processed_transcript	SDR16C6P	HGNC	pseudogene	OTTHUMT00000378641.3	-	0.00	23	0	A			57294613	-1	tier1	-	no_errors	ENST00000517787	ensembl	human	known	74_37	rna	23.08	40	12	SNP	0.957	T
SEPHS2	22928	genome.wustl.edu	37	16	30456364	30456364	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr16:30456364C>G	ENST00000478753.2	-	1	1138	c.685G>C	c.(685-687)Gta>Cta	p.V229L	SEPHS2_ENST00000500504.2_Missense_Mutation_p.V229L|SEPHS2_ENST00000542752.1_Missense_Mutation_p.V172L			Q99611	SPS2_HUMAN	selenophosphate synthetase 2	229					selenocysteine biosynthetic process (GO:0016260)		ATP binding (GO:0005524)|selenide, water dikinase activity (GO:0004756)			breast(3)|cervix(1)|kidney(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	10						TGGCATACTACAGTGGCAACT	0.552																																					Esophageal Squamous(81;1142 1261 11202 24614 35697)												0													99.0	100.0	99.0					16																	30456364		2126	4240	6366	SO:0001583	missense	0			BC002381		16p11.2	2013-02-15			ENSG00000179918	ENSG00000179918			19686	protein-coding gene	gene with protein product		606218				10608886	Standard	NM_012248		Approved	SPS2, SPS2b	uc021tgl.1	Q99611	OTTHUMG00000176988	ENST00000478753.2:c.685G>C	16.37:g.30456364C>G	ENSP00000418669:p.Val229Leu		Q9BUQ2	Missense_Mutation	SNP	pfam_AIR_synth_C_dom,pfam_AIR_synth_N_dom,superfamily_AIR_synth_C_dom,superfamily_PurM_N-like,pirsf_SelD,tigrfam_SelD	p.V172L	ENST00000478753.2	37	c.514		16	.	.	.	.	.	.	.	.	.	.	C	13.27	2.187249	0.38609	.	.	ENSG00000179918	ENST00000478753;ENST00000542752;ENST00000418751;ENST00000500504	T;T;T	0.44881	0.91;0.93;0.92	5.64	5.64	0.86602	PurM, N-terminal-like (1);	0.124166	0.52532	D	0.000064	T	0.37571	0.1008	L	0.38175	1.15	0.80722	D	1	B;B	0.27498	0.18;0.02	B;B	0.24701	0.042;0.055	T	0.17440	-1.0369	10	0.62326	D	0.03	-30.025	17.5809	0.87968	0.0:1.0:0.0:0.0	.	229;172	Q99611;F5H8F9	SPS2_HUMAN;.	L	229;172;180;229	ENSP00000418669:V229L;ENSP00000443601:V172L;ENSP00000426234:V229L	ENSP00000390233:V180L	V	-	1	0	SEPHS2	30363865	0.990000	0.36364	0.999000	0.59377	0.449000	0.32228	3.040000	0.49799	2.828000	0.97474	0.655000	0.94253	GTA	SEPHS2	-	superfamily_PurM_N-like,pirsf_SelD,tigrfam_SelD	ENSG00000179918		0.552	SEPHS2-001	KNOWN	basic|seleno	protein_coding	SEPHS2	HGNC	protein_coding	OTTHUMT00000109640.11	-	0.00	61	0	C	NM_012248		30456364	-1	tier1	-	no_errors	ENST00000542752	ensembl	human	known	74_37	missense	39.66	35	23	SNP	1.000	G
SERPINI2	5276	genome.wustl.edu	37	3	167185064	167185064	+	Missense_Mutation	SNP	A	A	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr3:167185064A>C	ENST00000476257.1	-	4	555	c.257T>G	c.(256-258)tTt>tGt	p.F86C	SERPINI2_ENST00000471111.1_Missense_Mutation_p.F86C|SERPINI2_ENST00000465031.1_5'Flank|SERPINI2_ENST00000264677.4_Missense_Mutation_p.F86C|SERPINI2_ENST00000461846.1_Missense_Mutation_p.F86C			O75830	SPI2_HUMAN	serpin peptidase inhibitor, clade I (pancpin), member 2	86					cellular component movement (GO:0006928)|negative regulation of endopeptidase activity (GO:0010951)|regulation of cell adhesion (GO:0030155)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(20)|prostate(1)|skin(5)|urinary_tract(1)	41						CAGTACAAAAAATTCTTCCCC	0.323																																																	0													51.0	53.0	52.0					3																	167185064		2187	4292	6479	SO:0001583	missense	0			AB006423	CCDS3200.1, CCDS75047.1	3q26.1	2014-02-18	2005-08-18		ENSG00000114204	ENSG00000114204		"""Serine (or cysteine) peptidase inhibitors"""	8945	protein-coding gene	gene with protein product		605587	"""serine (or cysteine) proteinase inhibitor, clade I (neuroserpin), member 2"", ""serine (or cysteine) proteinase inhibitor, clade I (pancpin), member 2"""	PI14		9624529, 24172014	Standard	NM_006217		Approved	PANCPIN, TSA2004, MEPI, pancpin	uc003fes.2	O75830	OTTHUMG00000158231	ENST00000476257.1:c.257T>G	3.37:g.167185064A>C	ENSP00000420621:p.Phe86Cys			Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.F86C	ENST00000476257.1	37	c.257	CCDS3200.1	3	.	.	.	.	.	.	.	.	.	.	A	15.34	2.805313	0.50315	.	.	ENSG00000114204	ENST00000476257;ENST00000461846;ENST00000264677;ENST00000471111;ENST00000466903	T;T;T;T;T	0.74526	-0.85;-0.85;-0.85;-0.85;-0.85	5.41	5.41	0.78517	Serpin domain (3);	0.000000	0.85682	D	0.000000	D	0.82701	0.5094	L	0.49455	1.56	0.45852	D	0.998713	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.83400	0.0022	10	0.51188	T	0.08	.	15.4555	0.75311	1.0:0.0:0.0:0.0	.	86;86	B4DDY9;O75830	.;SPI2_HUMAN	C	86	ENSP00000420621:F86C;ENSP00000417692:F86C;ENSP00000264677:F86C;ENSP00000419407:F86C;ENSP00000417752:F86C	ENSP00000264677:F86C	F	-	2	0	SERPINI2	168667758	1.000000	0.71417	1.000000	0.80357	0.528000	0.34623	6.357000	0.73051	2.067000	0.61834	0.533000	0.62120	TTT	SERPINI2	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	ENSG00000114204		0.323	SERPINI2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SERPINI2	HGNC	protein_coding	OTTHUMT00000350450.1	-	0.00	41	0	A	NM_006217		167185064	-1	tier1	-	no_errors	ENST00000264677	ensembl	human	known	74_37	missense	30.36	39	17	SNP	1.000	C
SEZ6L	23544	genome.wustl.edu	37	22	26773696	26773696	+	Missense_Mutation	SNP	G	G	C	rs529920388		TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr22:26773696G>C	ENST00000248933.6	+	16	3095	c.3000G>C	c.(2998-3000)caG>caC	p.Q1000H	SEZ6L_ENST00000343706.4_Missense_Mutation_p.Q924H|SEZ6L_ENST00000411842.2_3'UTR|SEZ6L_ENST00000529632.2_Missense_Mutation_p.Q989H|SEZ6L_ENST00000403121.1_Missense_Mutation_p.Q696H|SEZ6L_ENST00000360929.3_Missense_Mutation_p.Q925H|SEZ6L_ENST00000402979.1_Missense_Mutation_p.Q772H|SEZ6L_ENST00000404234.3_Missense_Mutation_p.Q999H			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	1000					adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)				breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						CCTACAGCCAGATCACCGTGG	0.522																																																	0													188.0	157.0	167.0					22																	26773696		2203	4300	6503	SO:0001583	missense	0			AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.3000G>C	22.37:g.26773696G>C	ENSP00000248933:p.Gln1000His		A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.Q1000H	ENST00000248933.6	37	c.3000	CCDS13833.1	22	.	.	.	.	.	.	.	.	.	.	G	19.85	3.904180	0.72754	.	.	ENSG00000100095	ENST00000404234;ENST00000529632;ENST00000360929;ENST00000248933;ENST00000343706;ENST00000403121;ENST00000402979	T;T;T;T;T;T;T	0.29397	1.86;2.01;2.15;1.88;1.7;1.57;1.85	4.58	4.58	0.56647	.	0.000000	0.53938	D	0.000050	T	0.41858	0.1177	L	0.27053	0.805	0.80722	D	1	D;D;D;D;D;D;D	0.76494	0.998;0.999;0.997;0.999;0.995;0.999;0.999	D;D;D;D;D;D;D	0.85130	0.995;0.997;0.989;0.997;0.989;0.997;0.997	T	0.17289	-1.0374	10	0.30854	T	0.27	.	16.127	0.81402	0.0:0.0:1.0:0.0	.	987;989;696;924;925;999;1000	B7ZLJ8;B7ZLJ6;B0QYH4;Q9BYH1-5;Q9BYH1-4;B0QYG3;Q9BYH1	.;.;.;.;.;.;SE6L1_HUMAN	H	999;989;925;1000;924;696;772	ENSP00000384772:Q999H;ENSP00000437037:Q989H;ENSP00000354185:Q925H;ENSP00000248933:Q1000H;ENSP00000342661:Q924H;ENSP00000384838:Q696H;ENSP00000384733:Q772H	ENSP00000248933:Q1000H	Q	+	3	2	SEZ6L	25103696	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.746000	0.55127	2.379000	0.81126	0.462000	0.41574	CAG	SEZ6L	-	NULL	ENSG00000100095		0.522	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEZ6L	HGNC	protein_coding	OTTHUMT00000320359.3	-	0.00	59	0	G			26773696	+1	tier1	-	no_errors	ENST00000248933	ensembl	human	known	74_37	missense	12.31	57	8	SNP	1.000	C
SLC12A1	6557	genome.wustl.edu	37	15	48577319	48577319	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr15:48577319A>T	ENST00000558405.1	+	20	2516	c.2502A>T	c.(2500-2502)ttA>ttT	p.L834F	SLC12A1_ENST00000380993.3_Missense_Mutation_p.L834F|SLC12A1_ENST00000396577.3_Missense_Mutation_p.L834F			Q13621	S12A1_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 1	834					cell death (GO:0008219)|chemical homeostasis (GO:0048878)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|kidney development (GO:0001822)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:potassium:chloride symporter activity (GO:0008511)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|prostate(2)|skin(1)	59		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Potassium Chloride(DB00761)|Quinethazone(DB01325)|Torasemide(DB00214)|Trichlormethiazide(DB01021)	TAGAGAGATTAGAACAGGAGA	0.348																																																	0													119.0	125.0	123.0					15																	48577319		2198	4297	6495	SO:0001583	missense	0				CCDS10129.2, CCDS53940.1	15q15-q21	2013-07-18	2013-07-18		ENSG00000074803	ENSG00000074803		"""Solute carriers"""	10910	protein-coding gene	gene with protein product		600839				8640224	Standard	NM_000338		Approved	NKCC2	uc010bem.3	Q13621	OTTHUMG00000131495	ENST00000558405.1:c.2502A>T	15.37:g.48577319A>T	ENSP00000453409:p.Leu834Phe		A8JYA2|E9PDW4	Missense_Mutation	SNP	pfam_AA-permease/SLC12A_dom,pfam_AA_permease_N,prints_Na/K/Cl_cotranspt2,prints_Na/K/Cl_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.L834F	ENST00000558405.1	37	c.2502	CCDS10129.2	15	.	.	.	.	.	.	.	.	.	.	A	13.45	2.240184	0.39598	.	.	ENSG00000074803	ENST00000380993;ENST00000396577	D;D	0.85258	-1.96;-1.96	5.37	-2.81	0.05805	.	0.220102	0.39210	N	0.001439	T	0.80859	0.4704	L	0.50333	1.59	0.42961	D	0.994406	P;P	0.44344	0.833;0.74	B;B	0.41988	0.372;0.243	T	0.79808	-0.1647	10	0.56958	D	0.05	.	16.7843	0.85570	0.1917:0.0:0.8083:0.0	.	834;834	E9PDW4;Q13621	.;S12A1_HUMAN	F	834	ENSP00000370381:L834F;ENSP00000379822:L834F	ENSP00000370381:L834F	L	+	3	2	SLC12A1	46364611	0.999000	0.42202	0.950000	0.38849	0.532000	0.34746	0.425000	0.21346	-0.407000	0.07576	-0.408000	0.06270	TTA	SLC12A1	-	tigrfam_Na/K/Cl_cotransptS	ENSG00000074803		0.348	SLC12A1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC12A1	HGNC	protein_coding	OTTHUMT00000417131.1	-	0.00	54	0	A			48577319	+1	tier1	-	no_errors	ENST00000380993	ensembl	human	known	74_37	missense	76.09	11	35	SNP	0.989	T
SLC5A3	6526	genome.wustl.edu	37	21	35468056	35468056	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr21:35468056C>G	ENST00000381151.3	+	2	1071	c.559C>G	c.(559-561)Ctg>Gtg	p.L187V	SLC5A3_ENST00000608209.1_Missense_Mutation_p.L187V|MRPS6_ENST00000399312.2_Intron|AP000320.7_ENST00000362077.4_RNA			P53794	SC5A3_HUMAN	solute carrier family 5 (sodium/myo-inositol cotransporter), member 3	187					inositol metabolic process (GO:0006020)|peripheral nervous system development (GO:0007422)|regulation of respiratory gaseous exchange (GO:0043576)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	myo-inositol:sodium symporter activity (GO:0005367)	p.L187M(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	20						CACAGACACTCTGCAGGCTCT	0.463																																																	1	Substitution - Missense(1)	large_intestine(1)											101.0	94.0	96.0					21																	35468056		2203	4300	6503	SO:0001583	missense	0				CCDS33549.1	21q22.11	2013-05-22	2008-09-02		ENSG00000198743	ENSG00000198743		"""Solute carriers"""	11038	protein-coding gene	gene with protein product		600444	"""solute carrier family 5 (inositol transporter), member 3"""			7789985	Standard	NM_006933		Approved	SMIT, SMIT1	uc002yto.3	P53794	OTTHUMG00000065821	ENST00000381151.3:c.559C>G	21.37:g.35468056C>G	ENSP00000370543:p.Leu187Val		O43489	Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.L187V	ENST00000381151.3	37	c.559	CCDS33549.1	21	.	.	.	.	.	.	.	.	.	.	C	9.157	1.017790	0.19355	.	.	ENSG00000198743	ENST00000381151	D	0.88354	-2.37	5.72	3.92	0.45320	.	0.000000	0.85682	D	0.000000	T	0.80576	0.4649	L	0.31752	0.955	0.44175	D	0.996986	P	0.43857	0.819	B	0.39771	0.309	T	0.75291	-0.3369	10	0.30854	T	0.27	.	8.4507	0.32869	0.0:0.7311:0.1277:0.1413	.	187	P53794	SC5A3_HUMAN	V	187	ENSP00000370543:L187V	ENSP00000370543:L187V	L	+	1	2	SLC5A3	34389926	0.818000	0.29161	0.468000	0.27192	0.992000	0.81027	1.639000	0.37176	0.774000	0.33427	0.609000	0.83330	CTG	SLC5A3	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	ENSG00000198743		0.463	SLC5A3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	SLC5A3	HGNC	protein_coding	OTTHUMT00000141037.1	-	0.00	48	0	C			35468056	+1	tier1	-	no_errors	ENST00000381151	ensembl	human	known	74_37	missense	36.67	19	11	SNP	0.962	G
SLC6A10P	386757	genome.wustl.edu	37	16	32888910	32888910	+	RNA	SNP	G	G	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr16:32888910G>A	ENST00000330048.5	-	0	3725					NR_003083.2				solute carrier family 6 (neurotransmitter transporter), member 10, pseudogene																		CTGTCCGGGTGTCAGGGAAGC	0.562																																																	0																																												0			U41163		16p11.2	2013-07-19	2013-07-19	2013-07-19	ENSG00000214617	ENSG00000214617		"""Solute carriers"""	11043	pseudogene	pseudogene	"""creatine transporter-2"""		"""solute carrier family 6 (neurotransmitter transporter, creatine), member 10"""	SLC6A10		9154116	Standard	NR_003083		Approved	CT-2	uc002edh.1		OTTHUMG00000132481		16.37:g.32888910G>A				RNA	SNP	-	NULL	ENST00000330048.5	37	NULL		16																																																																																			SLC6A10P	-	-	ENSG00000214617		0.562	SLC6A10P-002	KNOWN	basic	processed_transcript	SLC6A10P	HGNC	pseudogene	OTTHUMT00000432081.2	-	0.00	165	0	G			32888910	-1	tier1	-	no_errors	ENST00000330048	ensembl	human	known	74_37	rna	18.55	101	23	SNP	0.014	A
SNRPF	6636	genome.wustl.edu	37	12	96259806	96259806	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr12:96259806G>C	ENST00000266735.5	+	4	364	c.218G>C	c.(217-219)aGa>aCa	p.R73T	SNRPF_ENST00000553192.1_Intron|SNRPF_ENST00000552085.1_Intron	NM_003095.2	NP_003086.1	P62306	RUXF_HUMAN	small nuclear ribonucleoprotein polypeptide F	73					gene expression (GO:0010467)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|methylosome (GO:0034709)|nucleoplasm (GO:0005654)|pICln-Sm protein complex (GO:0034715)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN-Sm protein complex (GO:0034719)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U12-type spliceosomal complex (GO:0005689)|U4 snRNP (GO:0005687)|U7 snRNP (GO:0005683)	RNA binding (GO:0003723)			kidney(1)|lung(1)	2						CTTTATATCAGAGGTGTGGAA	0.299																																					Melanoma(51;669 1224 3250 18967 46236)												0													52.0	55.0	54.0					12																	96259806		2203	4296	6499	SO:0001583	missense	0			X85372	CCDS9055.1	12q23.1	2011-10-11			ENSG00000139343	ENSG00000139343			11162	protein-coding gene	gene with protein product		603541				7744013	Standard	NM_003095		Approved	Sm-F	uc001tej.3	P62306		ENST00000266735.5:c.218G>C	12.37:g.96259806G>C	ENSP00000266735:p.Arg73Thr		A2VCR2|B2R498|Q15356|Q6IBQ1|Q6P4I0	Missense_Mutation	SNP	pfam_Ribonucl_LSM,superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc,pirsf_snRNP_SmF	p.R73T	ENST00000266735.5	37	c.218	CCDS9055.1	12	.	.	.	.	.	.	.	.	.	.	G	23.7	4.446084	0.84101	.	.	ENSG00000139343	ENST00000266735	T	0.42900	0.96	5.59	5.59	0.84812	Like-Sm ribonucleoprotein (LSM) domain, eukaryotic/archaea-type (1);Like-Sm ribonucleoprotein (LSM)-related domain (1);	0.000000	0.85682	D	0.000000	T	0.50309	0.1608	.	.	.	0.80722	D	1	P	0.41159	0.74	P	0.44673	0.457	T	0.51988	-0.8635	9	0.62326	D	0.03	8.6033	19.1852	0.93641	0.0:0.0:1.0:0.0	.	73	P62306	RUXF_HUMAN	T	73	ENSP00000266735:R73T	ENSP00000266735:R73T	R	+	2	0	SNRPF	94783937	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.631000	0.90991	2.634000	0.89283	0.591000	0.81541	AGA	SNRPF	-	superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc,pirsf_snRNP_SmF	ENSG00000139343		0.299	SNRPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNRPF	HGNC	protein_coding	OTTHUMT00000408626.1	-	0.00	62	0	G	NM_003095		96259806	+1	tier1	-	no_errors	ENST00000266735	ensembl	human	known	74_37	missense	56.96	34	45	SNP	1.000	C
SOAT1	6646	genome.wustl.edu	37	1	179304721	179304721	+	Silent	SNP	A	A	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr1:179304721A>G	ENST00000367619.3	+	4	401	c.258A>G	c.(256-258)tcA>tcG	p.S86S	SOAT1_ENST00000540564.1_Silent_p.S28S|SOAT1_ENST00000535686.1_5'UTR|SOAT1_ENST00000539888.1_Silent_p.S21S	NM_003101.5	NP_003092.4	P35610	SOAT1_HUMAN	sterol O-acyltransferase 1	86					cholesterol efflux (GO:0033344)|cholesterol esterification (GO:0034435)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol storage (GO:0010878)|macrophage derived foam cell differentiation (GO:0010742)|positive regulation of amyloid precursor protein biosynthetic process (GO:0042986)|very-low-density lipoprotein particle assembly (GO:0034379)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	cholesterol binding (GO:0015485)|cholesterol O-acyltransferase activity (GO:0034736)|fatty-acyl-CoA binding (GO:0000062)|sterol O-acyltransferase activity (GO:0004772)			central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(10)|prostate(1)|skin(3)|stomach(1)	20					Ezetimibe(DB00973)|Hesperetin(DB01094)	AGTCAGCATCATTAGATAATG	0.353																																																	0													107.0	105.0	106.0					1																	179304721		2203	4300	6503	SO:0001819	synonymous_variant	0			L21934	CCDS1330.1, CCDS58047.1, CCDS58048.1	1q25	2008-08-26	2008-08-26		ENSG00000057252	ENSG00000057252	2.3.1.26		11177	protein-coding gene	gene with protein product	"""acyl-Coenzyme A: cholesterol acyltransferase"""	102642	"""sterol O-acyltransferase (acyl-Coenzyme A: cholesterol acyltransferase) 1"""	SOAT, STAT		8407899	Standard	NM_003101		Approved	ACAT	uc001gml.3	P35610	OTTHUMG00000035253	ENST00000367619.3:c.258A>G	1.37:g.179304721A>G			A6NC40|A8K3P4|A9Z1V7|B4DU95|Q5T0X4|Q8N1E4	Silent	SNP	pfam_MBOAT_fam	p.S86	ENST00000367619.3	37	c.258	CCDS1330.1	1																																																																																			SOAT1	-	NULL	ENSG00000057252		0.353	SOAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOAT1	HGNC	protein_coding	OTTHUMT00000085286.2	-	0.00	40	0	A	NM_003101		179304721	+1	tier1	-	no_errors	ENST00000367619	ensembl	human	known	74_37	silent	42.86	20	15	SNP	0.048	G
SORCS1	114815	genome.wustl.edu	37	10	108439039	108439039	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr10:108439039G>A	ENST00000263054.6	-	12	1722	c.1715C>T	c.(1714-1716)tCa>tTa	p.S572L	SORCS1_ENST00000344440.6_Missense_Mutation_p.S572L|SORCS1_ENST00000369698.1_Missense_Mutation_p.S107L	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	572					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		CCCTGCATCTGAAGAGACAAA	0.403																																																	0													98.0	99.0	99.0					10																	108439039		2203	4300	6503	SO:0001583	missense	0			AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.1715C>T	10.37:g.108439039G>A	ENSP00000263054:p.Ser572Leu		A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	pfam_PKD_dom,superfamily_PKD_dom,smart_VPS10,pfscan_PKD_dom	p.S572L	ENST00000263054.6	37	c.1715	CCDS7559.1	10	.	.	.	.	.	.	.	.	.	.	G	33	5.228791	0.95173	.	.	ENSG00000108018	ENST00000369698;ENST00000263054;ENST00000344440	T;T;T	0.54479	0.57;0.57;0.57	5.81	5.81	0.92471	VPS10 (1);	0.126310	0.56097	D	0.000038	T	0.78578	0.4305	M	0.88377	2.95	0.58432	D	0.999997	D;D;D;D;D	0.71674	0.997;0.998;0.998;0.997;0.998	D;D;D;D;D	0.76071	0.96;0.987;0.987;0.971;0.987	T	0.80609	-0.1306	9	.	.	.	-11.6056	20.0833	0.97789	0.0:0.0:1.0:0.0	.	572;572;572;572;572	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	L	107;572;572	ENSP00000358712:S107L;ENSP00000263054:S572L;ENSP00000345964:S572L	.	S	-	2	0	SORCS1	108429029	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.476000	0.97823	2.756000	0.94617	0.655000	0.94253	TCA	SORCS1	-	smart_VPS10	ENSG00000108018		0.403	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORCS1	HGNC	protein_coding	OTTHUMT00000050232.4		0.00	16	0	G	NM_052918		108439039	-1			no_errors	ENST00000344440	ensembl	human	known	74_37	missense	18.75	13	3	SNP	1.000	A
SPECC1L	23384	genome.wustl.edu	37	22	24807589	24807589	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr22:24807589A>G	ENST00000314328.9	+	15	3406	c.3121A>G	c.(3121-3123)Aat>Gat	p.N1041D	SPECC1L-ADORA2A_ENST00000358654.2_3'UTR|SPECC1L_ENST00000437398.1_Missense_Mutation_p.N1041D|SPECC1L_ENST00000541492.1_Intron	NM_001254733.1|NM_015330.3	NP_001241662.1|NP_056145	Q69YQ0	CYTSA_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1-like	1041	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.			N -> K (in Ref. 4; BAA21574). {ECO:0000305}.	actin cytoskeleton organization (GO:0030036)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell migration (GO:0016477)|negative regulation of actin filament depolymerization (GO:0030835)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|gap junction (GO:0005921)|microtubule organizing center (GO:0005815)		p.N1041D(1)		breast(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(6)|ovary(1)|prostate(1)|skin(3)|stomach(2)|urinary_tract(1)	27						CAGCAGCTGGAATGATGGGCT	0.493																																																	1	Substitution - Missense(1)	large_intestine(1)											132.0	119.0	123.0					22																	24807589		2203	4300	6503	SO:0001583	missense	0			AK025531	CCDS33619.1, CCDS58797.1	22q11.23	2012-12-20	2010-09-17	2010-09-17	ENSG00000100014	ENSG00000100014			29022	protein-coding gene	gene with protein product	"""cytokinesis and spindle organization A"", ""cytospin A"""	614140	"""SPECC1-like"""			9205841	Standard	NM_001254733		Approved	KIAA0376, CYTSA	uc002zzv.4	Q69YQ0	OTTHUMG00000171450	ENST00000314328.9:c.3121A>G	22.37:g.24807589A>G	ENSP00000325785:p.Asn1041Asp		B7Z758|F5H1H6|O15081	Missense_Mutation	SNP	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_bHLH_dom,smart_CH-domain,pfscan_CH-domain	p.N1041D	ENST00000314328.9	37	c.3121	CCDS33619.1	22	.	.	.	.	.	.	.	.	.	.	A	24.0	4.477335	0.84640	.	.	ENSG00000100014	ENST00000437398;ENST00000314328	D;D	0.94931	-3.56;-3.56	5.65	5.65	0.86999	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	D	0.97445	0.9164	M	0.87381	2.88	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.98085	1.0406	10	0.66056	D	0.02	-37.4973	15.0577	0.71927	1.0:0.0:0.0:0.0	.	1041	Q69YQ0	CYTSA_HUMAN	D	1041	ENSP00000393363:N1041D;ENSP00000325785:N1041D	ENSP00000325785:N1041D	N	+	1	0	SPECC1L	23137589	1.000000	0.71417	1.000000	0.80357	0.725000	0.41563	8.625000	0.90965	2.154000	0.67381	0.459000	0.35465	AAT	SPECC1L	-	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000100014		0.493	SPECC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPECC1L	HGNC	protein_coding	OTTHUMT00000319986.2	-	0.00	45	0	A	NM_015330		24807589	+1	tier1	-	no_errors	ENST00000314328	ensembl	human	known	74_37	missense	40.74	32	22	SNP	1.000	G
SPOPL	339745	genome.wustl.edu	37	2	139308489	139308489	+	Missense_Mutation	SNP	C	C	A	rs141678968		TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr2:139308489C>A	ENST00000280098.4	+	4	596	c.217C>A	c.(217-219)Cca>Aca	p.P73T		NM_001001664.2	NP_001001664.1	Q6IQ16	SPOPL_HUMAN	speckle-type POZ protein-like	73	MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.				negative regulation of protein ubiquitination (GO:0031397)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nucleus (GO:0005634)		p.P73S(1)		breast(2)|cervix(2)|endometrium(2)|large_intestine(2)|lung(11)|skin(2)	21				BRCA - Breast invasive adenocarcinoma(221;0.0296)		GAGGGTAAACCCAAAGGGATT	0.378																																																	1	Substitution - Missense(1)	skin(1)											81.0	86.0	84.0					2																	139308489		2203	4299	6502	SO:0001583	missense	0				CCDS33298.1	2q22.1	2013-01-09			ENSG00000144228	ENSG00000144228		"""BTB/POZ domain containing"""	27934	protein-coding gene	gene with protein product	"""HIB homolog 2"", ""roadkill homolog 2"""						Standard	NM_001001664		Approved	BTBD33	uc002tvh.3	Q6IQ16	OTTHUMG00000153635	ENST00000280098.4:c.217C>A	2.37:g.139308489C>A	ENSP00000280098:p.Pro73Thr			Missense_Mutation	SNP	pfam_BTB_POZ,pfam_MATH,superfamily_TRAF-like,superfamily_BTB/POZ_fold,smart_MATH,smart_BTB/POZ-like,pfscan_BTB/POZ-like,pfscan_MATH	p.P73T	ENST00000280098.4	37	c.217	CCDS33298.1	2	.	.	.	.	.	.	.	.	.	.	C	25.4	4.637274	0.87760	.	.	ENSG00000144228	ENST00000280098	D	0.83419	-1.72	5.78	5.78	0.91487	TRAF-type (1);TRAF-like (1);MATH (3);	0.000000	0.85682	D	0.000000	D	0.92996	0.7771	M	0.88105	2.93	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93567	0.6900	10	0.87932	D	0	-1.8083	20.0044	0.97430	0.0:1.0:0.0:0.0	.	73	Q6IQ16	SPOPL_HUMAN	T	73	ENSP00000280098:P73T	ENSP00000280098:P73T	P	+	1	0	SPOPL	139024959	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.714000	0.92807	0.650000	0.86243	CCA	SPOPL	-	pfam_MATH,superfamily_TRAF-like,smart_MATH,pfscan_MATH	ENSG00000144228		0.378	SPOPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPOPL	HGNC	protein_coding	OTTHUMT00000331897.1		0.00	39	0	C			139308489	+1			no_errors	ENST00000280098	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	A
SSX4	6759	genome.wustl.edu	37	X	48243539	48243539	+	Silent	SNP	T	T	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chrX:48243539T>A	ENST00000376886.2	+	2	208	c.45T>A	c.(43-45)gcT>gcA	p.A15A	SSX4_ENST00000375517.3_Silent_p.A15A	NM_005636.3	NP_005627.1	O60224	SSX4_HUMAN	synovial sarcoma, X breakpoint 4	15					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)		SS18/SSX4(12)	lung(1)	1						GGGATGATGCTCAAATATCAG	0.572			T	SS18	synovial sarcoma																																			Dom	yes		X	Xp11.23	6759	"""synovial sarcoma, X breakpoint 4"""		M	0													1.0	1.0	1.0					X																	48243539		471	1327	1798	SO:0001819	synonymous_variant	0				CCDS35240.1, CCDS43934.1	Xp11.23	2009-06-17			ENSG00000204645	ENSG00000268009			11338	protein-coding gene	gene with protein product		300326					Standard	NM_005636		Approved	CT5.4		O60224	OTTHUMG00000022698	ENST00000376886.2:c.45T>A	X.37:g.48243539T>A			A8MYD4|B2RPE3|Q3SYD4|Q5JQZ0|Q9UJU9	Silent	SNP	pfam_SSXRD_motif,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.A15	ENST00000376886.2	37	c.45	CCDS35240.1	X																																																																																			SSX4	-	NULL	ENSG00000204645		0.572	SSX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSX4	HGNC	protein_coding	OTTHUMT00000058902.2	-	0.00	12	0	T			48243539	+1	tier1	-	no_errors	ENST00000376886	ensembl	human	known	74_37	silent	61.54	5	8	SNP	0.000	A
ST18	9705	genome.wustl.edu	37	8	53084980	53084980	+	Silent	SNP	T	T	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr8:53084980T>C	ENST00000276480.7	-	10	1124	c.441A>G	c.(439-441)gaA>gaG	p.E147E		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	147					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				CATTTAAATTTTCACTTACAG	0.383																																																	0													93.0	92.0	92.0					8																	53084980		2203	4300	6503	SO:0001819	synonymous_variant	0			AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.441A>G	8.37:g.53084980T>C			Q17RY1	Silent	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.E147	ENST00000276480.7	37	c.441	CCDS6149.1	8																																																																																			ST18	-	NULL	ENSG00000147488		0.383	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST18	HGNC	protein_coding	OTTHUMT00000377867.1	-	0.00	40	0	T			53084980	-1	tier1	-	no_errors	ENST00000276480	ensembl	human	known	74_37	silent	36.36	41	24	SNP	0.963	C
STK25	10494	genome.wustl.edu	37	2	242441214	242441214	+	Intron	SNP	C	C	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr2:242441214C>A	ENST00000316586.4	-	3	380				STK25_ENST00000401869.1_Intron|STK25_ENST00000405883.3_Intron|STK25_ENST00000403346.3_Intron|STK25_ENST00000543554.1_Intron|STK25_ENST00000405585.1_Intron|STK25_ENST00000535007.1_Intron|STK25_ENST00000478403.1_5'Flank	NM_001271977.1|NM_001271978.1|NM_001282308.1	NP_001258906.1|NP_001258907.1|NP_001269237.1	O00506	STK25_HUMAN	serine/threonine kinase 25						establishment or maintenance of cell polarity (GO:0007163)|Golgi localization (GO:0051645)|positive regulation of axonogenesis (GO:0050772)|response to oxidative stress (GO:0006979)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|kidney(1)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	10		all_cancers(19;2.09e-34)|all_epithelial(40;2.09e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Ovarian(221;0.069)|Lung NSC(271;0.0886)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.2)		Epithelial(32;8.24e-34)|all cancers(36;3.46e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.6e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.1e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0839)		GAGGAAGGGACCTGTAGGGAA	0.612																																					NSCLC(99;1100 1566 7679 28647 48345)												0																																										SO:0001627	intron_variant	0			D63780	CCDS2549.1, CCDS63199.1, CCDS63200.1	2q37.3	2010-06-25	2010-06-25		ENSG00000115694	ENSG00000115694			11404	protein-coding gene	gene with protein product		602255	"""serine/threonine kinase 25 (Ste20, yeast homolog)"""			8887545, 9160885, 15037601	Standard	NM_001271977		Approved	SOK1, YSK1	uc002wbp.4	O00506	OTTHUMG00000133408	ENST00000316586.4:c.31-91G>T	2.37:g.242441214C>A			A8K6Z3|A8K7D2|B7Z9K1|Q15522|Q5BJF1	RNA	SNP	-	NULL	ENST00000316586.4	37	NULL	CCDS2549.1	2																																																																																			STK25	-	-	ENSG00000115694		0.612	STK25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK25	HGNC	protein_coding	OTTHUMT00000257265.4	-	0.00	10	0	C	NM_006374		242441214	-1	tier1	-	no_errors	ENST00000483603	ensembl	human	known	74_37	rna	92.86	1	13	SNP	0.001	A
STMN1	3925	genome.wustl.edu	37	1	26228032	26228032	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr1:26228032C>T	ENST00000399728.1	-	4	691	c.328G>A	c.(328-330)Gag>Aag	p.E110K	STMN1_ENST00000357865.2_Missense_Mutation_p.E110K|STMN1_ENST00000426559.2_Missense_Mutation_p.E110K|STMN1_ENST00000465604.1_5'UTR|STMN1_ENST00000374291.1_Missense_Mutation_p.E110K|STMN1_ENST00000455785.2_Missense_Mutation_p.E110K	NM_203401.1	NP_981946.1	P16949	STMN1_HUMAN	stathmin 1	110	SLD. {ECO:0000255|PROSITE- ProRule:PRU00998}.				axonogenesis (GO:0007409)|intracellular signal transduction (GO:0035556)|microtubule depolymerization (GO:0007019)|mitotic spindle organization (GO:0007052)|negative regulation of microtubule polymerization (GO:0031115)|positive regulation of cellular component movement (GO:0051272)|response to virus (GO:0009615)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|microtubule (GO:0005874)	signal transducer activity (GO:0004871)|tubulin binding (GO:0015631)			breast(2)|large_intestine(2)|skin(2)	6		Colorectal(325;3.46e-05)|Lung NSC(340;0.000163)|all_lung(284;0.000234)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0505)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.85e-25)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.013)|READ - Rectum adenocarcinoma(331;0.0649)		TCTCGGTTCTCTTTATTAGCT	0.428																																																	0													245.0	232.0	237.0					1																	26228032		2203	4300	6503	SO:0001583	missense	0			J04991	CCDS269.1, CCDS44090.1	1p36.11	2011-02-09	2009-04-28	2001-07-13	ENSG00000117632	ENSG00000117632			6510	protein-coding gene	gene with protein product	"""oncoprotein 18"""	151442	"""chromosome 1 open reading frame 215"", ""stathmin 1/oncoprotein 18"""	LAP18, C1orf215		2917975	Standard	NM_005563		Approved	SMN, OP18, PR22, PP19, PP17, Lag, FLJ32206	uc010oev.2	P16949	OTTHUMG00000007389	ENST00000399728.1:c.328G>A	1.37:g.26228032C>T	ENSP00000382633:p.Glu110Lys		A2A2D1|B2R4E7|B7Z8N4|D3DPJ5	Missense_Mutation	SNP	pfam_Stathmin_fam,superfamily_Stathmin_fam,pirsf_Stathmin_fam,prints_Stathmin_fam	p.E110K	ENST00000399728.1	37	c.328	CCDS269.1	1	.	.	.	.	.	.	.	.	.	.	C	37	5.987591	0.97173	.	.	ENSG00000117632	ENST00000426559;ENST00000455785;ENST00000399728;ENST00000357865;ENST00000374291	.	.	.	5.87	5.87	0.94306	.	0.107942	0.64402	D	0.000004	D	0.85617	0.5738	M	0.89785	3.06	0.44890	D	0.997906	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.998	D	0.86138	0.1579	9	0.46703	T	0.11	.	18.9906	0.92789	0.0:1.0:0.0:0.0	.	110;110;110	P16949-2;B5BU83;P16949	.;.;STMN1_HUMAN	K	110	.	ENSP00000350531:E110K	E	-	1	0	STMN1	26100619	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.715000	0.84713	2.780000	0.95670	0.655000	0.94253	GAG	STMN1	-	pfam_Stathmin_fam,superfamily_Stathmin_fam,pirsf_Stathmin_fam,prints_Stathmin_fam	ENSG00000117632		0.428	STMN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	STMN1	HGNC	protein_coding	OTTHUMT00000019359.1	-	0.00	55	0	C	NM_005563		26228032	-1	tier1	-	no_errors	ENST00000426559	ensembl	human	known	74_37	missense	44.19	24	19	SNP	1.000	T
STXBP5L	9515	genome.wustl.edu	37	3	120840538	120840538	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr3:120840538G>C	ENST00000273666.6	+	7	927	c.656G>C	c.(655-657)aGa>aCa	p.R219T	STXBP5L_ENST00000472879.1_Missense_Mutation_p.R219T|STXBP5L_ENST00000471454.1_Missense_Mutation_p.R219T|STXBP5L_ENST00000492541.1_Missense_Mutation_p.R219T|STXBP5L_ENST00000497029.1_Missense_Mutation_p.R219T	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	219					exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		GATAGCCCAAGAGATGAAGGC	0.289																																																	0													135.0	124.0	128.0					3																	120840538		1829	4079	5908	SO:0001583	missense	0			AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.656G>C	3.37:g.120840538G>C	ENSP00000273666:p.Arg219Thr		Q4G1B4|Q6PIC3	Missense_Mutation	SNP	pfam_LLGL2,pfam_WD40_repeat,pfam_Lgl_C_dom,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,pfscan_Synaptobrevin,prints_Lethal2_giant	p.R219T	ENST00000273666.6	37	c.656	CCDS43137.1	3	.	.	.	.	.	.	.	.	.	.	G	7.270	0.606916	0.14002	.	.	ENSG00000145087	ENST00000273666;ENST00000471454;ENST00000472879;ENST00000497029;ENST00000492541;ENST00000471262	T;T;T;T;T;T	0.52983	0.64;1.68;0.64;0.64;1.68;1.68	5.92	5.92	0.95590	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.045520	0.85682	D	0.000000	T	0.28665	0.0710	N	0.11560	0.145	0.47698	D	0.999496	P;P	0.38922	0.651;0.651	B;B	0.32677	0.15;0.15	T	0.11891	-1.0569	10	0.12430	T	0.62	-30.8505	19.925	0.97099	0.0:0.0:1.0:0.0	.	219;219	E9PFI2;Q9Y2K9	.;STB5L_HUMAN	T	219	ENSP00000273666:R219T;ENSP00000420019:R219T;ENSP00000419627:R219T;ENSP00000420287:R219T;ENSP00000420666:R219T;ENSP00000420167:R219T	ENSP00000273666:R219T	R	+	2	0	STXBP5L	122323228	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.212000	0.32394	2.810000	0.96702	0.585000	0.79938	AGA	STXBP5L	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000145087		0.289	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STXBP5L	HGNC	protein_coding	OTTHUMT00000355256.3	-	0.00	53	0	G			120840538	+1	tier1	-	no_errors	ENST00000273666	ensembl	human	known	74_37	missense	19.28	67	16	SNP	1.000	C
SUPT20H	55578	genome.wustl.edu	37	13	37618315	37618315	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr13:37618315G>T	ENST00000350612.6	-	7	516	c.296C>A	c.(295-297)tCc>tAc	p.S99Y	SUPT20H_ENST00000470359.2_5'UTR|SUPT20H_ENST00000360252.4_Missense_Mutation_p.S100Y|SUPT20H_ENST00000356185.3_Missense_Mutation_p.S100Y|SUPT20H_ENST00000464744.1_Missense_Mutation_p.S100Y|SUPT20H_ENST00000542180.1_Missense_Mutation_p.S87Y|SUPT20H_ENST00000475892.1_Missense_Mutation_p.S99Y	NM_001014286.2	NP_001014308.2	Q8NEM7	SP20H_HUMAN	suppressor of Ty 20 homolog (S. cerevisiae)	99					autophagy (GO:0006914)|chromatin organization (GO:0006325)|gastrulation (GO:0007369)	SAGA complex (GO:0000124)|SAGA-type complex (GO:0070461)	transcription cofactor activity (GO:0003712)										AATGGTCTCGGAATCTTAATT	0.338																																																	0													67.0	70.0	69.0					13																	37618315		2203	4300	6503	SO:0001583	missense	0			AF093250	CCDS9362.1, CCDS31959.1, CCDS61311.1	13q13	2012-11-29	2012-11-29	2012-11-29	ENSG00000102710	ENSG00000102710			20596	protein-coding gene	gene with protein product	"""p38 interacting protein"", ""transcription factor (p38 interacting protein)"""	613417	"""chromosome 13 open reading frame 19"", ""family with sequence similarity 48, member A"""	C13orf19, FAM48A		12070015 , 16685401	Standard	NM_001278480		Approved	SPT20, bA421P11.4, P38IP	uc001uwg.3	Q8NEM7	OTTHUMG00000016747	ENST00000350612.6:c.296C>A	13.37:g.37618315G>T	ENSP00000218894:p.Ser99Tyr		E7ER46|Q71RF3|Q9Y6A6	Missense_Mutation	SNP	pfam_Spt20	p.S99Y	ENST00000350612.6	37	c.296	CCDS31959.1	13	.	.	.	.	.	.	.	.	.	.	G	28.7	4.939928	0.92526	.	.	ENSG00000102710	ENST00000360252;ENST00000475892;ENST00000350612;ENST00000356185;ENST00000536874;ENST00000464744;ENST00000542180;ENST00000497318	T;T;T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89;0.89;0.89	6.01	6.01	0.97437	.	0.000000	0.85682	D	0.000000	T	0.67951	0.2948	M	0.73598	2.24	0.80722	D	1	D;D;D;D;D;D	0.89917	0.997;0.999;0.999;1.0;0.999;0.999	D;D;D;D;D;D	0.83275	0.986;0.989;0.986;0.996;0.991;0.996	T	0.67776	-0.5583	10	0.66056	D	0.02	-11.1982	20.5211	0.99222	0.0:0.0:1.0:0.0	.	87;99;99;100;100;99	B4E2D5;B3KNI1;E7ER46;A8K8L1;Q8NEM7-2;Q8NEM7	.;.;.;.;.;FA48A_HUMAN	Y	100;99;99;100;99;100;87;100	ENSP00000353388:S100Y;ENSP00000417510:S99Y;ENSP00000218894:S99Y;ENSP00000348512:S100Y;ENSP00000419754:S100Y;ENSP00000439000:S87Y;ENSP00000420170:S100Y	ENSP00000218894:S99Y	S	-	2	0	FAM48A	36516315	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.405000	0.97313	2.861000	0.98227	0.650000	0.86243	TCC	SUPT20H	-	pfam_Spt20	ENSG00000102710		0.338	SUPT20H-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SUPT20H	HGNC	protein_coding	OTTHUMT00000354766.1		0.00	37	0	G	NM_017569		37618315	-1			no_errors	ENST00000350612	ensembl	human	known	74_37	missense	5.88	32	2	SNP	1.000	T
SYCP2L	221711	genome.wustl.edu	37	6	10930703	10930703	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr6:10930703C>A	ENST00000283141.6	+	19	1885	c.1589C>A	c.(1588-1590)tCa>tAa	p.S530*		NM_001040274.2	NP_001035364.2	Q5T4T6	SYC2L_HUMAN	synaptonemal complex protein 2-like	530						nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(10)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	36	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)	Epithelial(50;0.239)			TCCCTAAAATCATATTCCAGT	0.338																																																	0													61.0	58.0	59.0					6																	10930703		1816	4073	5889	SO:0001587	stop_gained	0			AK128130	CCDS43423.1	6p24.2	2008-11-06	2007-07-02	2007-07-02	ENSG00000153157	ENSG00000153157			21537	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 177"""	C6orf177			Standard	NM_001040274		Approved	dJ62D2.1, NO145	uc003mzo.3	Q5T4T6	OTTHUMG00000014250	ENST00000283141.6:c.1589C>A	6.37:g.10930703C>A	ENSP00000283141:p.Ser530*		A6NDS5|Q08GK5|Q6ZRM2|Q96EJ2	Nonsense_Mutation	SNP	NULL	p.S530*	ENST00000283141.6	37	c.1589	CCDS43423.1	6	.	.	.	.	.	.	.	.	.	.	C	37	6.098060	0.97281	.	.	ENSG00000153157	ENST00000283141	.	.	.	5.39	3.62	0.41486	.	0.783877	0.11821	N	0.526252	.	.	.	.	.	.	0.18873	N	0.999987	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	-5.7769	8.3542	0.32321	0.0:0.8196:0.0:0.1803	.	.	.	.	X	530	.	ENSP00000283141:S530X	S	+	2	0	SYCP2L	11038689	0.066000	0.20996	0.004000	0.12327	0.009000	0.06853	1.136000	0.31467	0.766000	0.33244	-0.145000	0.13849	TCA	SYCP2L	-	NULL	ENSG00000153157		0.338	SYCP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP2L	HGNC	protein_coding	OTTHUMT00000039845.3	-	0.00	24	0	C	NM_194299		10930703	+1	tier1	-	no_errors	ENST00000283141	ensembl	human	known	74_37	nonsense	22.58	24	7	SNP	0.070	A
SYNDIG1	79953	genome.wustl.edu	37	20	24524206	24524206	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr20:24524206A>G	ENST00000376862.3	+	2	1106	c.473A>G	c.(472-474)gAg>gGg	p.E158G		NM_024893.1	NP_079169.1	Q9H7V2	SYNG1_HUMAN	synapse differentiation inducing 1	158					intracellular protein transport (GO:0006886)|positive regulation of synapse assembly (GO:0051965)|response to biotic stimulus (GO:0009607)|synaptic vesicle clustering (GO:0097091)	cell body (GO:0044297)|cell junction (GO:0030054)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	glutamate receptor binding (GO:0035254)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(1)|large_intestine(3)|lung(14)|prostate(1)|skin(3)	24						GAGTTCCAGGAGCTGGAGGTC	0.527																																																	0													75.0	81.0	79.0					20																	24524206		2202	4298	6500	SO:0001583	missense	0			AK024282	CCDS13164.1	20p11.21	2011-06-30	2011-06-30	2011-06-30	ENSG00000101463	ENSG00000101463			15885	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 5"", ""synapse differentiation induced gene 1"""	614311	"""chromosome 20 open reading frame 39"", ""transmembrane protein 90B"""	C20orf39, TMEM90B		20152115	Standard	NM_024893		Approved	FLJ14220, IFITMD5, SynDIG1	uc002wtw.1	Q9H7V2	OTTHUMG00000032104	ENST00000376862.3:c.473A>G	20.37:g.24524206A>G	ENSP00000366058:p.Glu158Gly		Q6IA30|Q9H514	Missense_Mutation	SNP	pfam_CD225/Dispanin_fam	p.E158G	ENST00000376862.3	37	c.473	CCDS13164.1	20	.	.	.	.	.	.	.	.	.	.	A	19.02	3.746588	0.69418	.	.	ENSG00000101463	ENST00000376862	D	0.92446	-3.04	5.7	5.7	0.88788	.	0.120960	0.53938	D	0.000043	D	0.91998	0.7465	M	0.73962	2.25	0.80722	D	1	P	0.46395	0.877	B	0.43360	0.417	D	0.92198	0.5765	10	0.51188	T	0.08	-27.4696	13.9287	0.63981	1.0:0.0:0.0:0.0	.	158	Q9H7V2	SYNG1_HUMAN	G	158	ENSP00000366058:E158G	ENSP00000366058:E158G	E	+	2	0	SYNDIG1	24472206	1.000000	0.71417	1.000000	0.80357	0.608000	0.37181	8.519000	0.90563	2.186000	0.69663	0.533000	0.62120	GAG	SYNDIG1	-	NULL	ENSG00000101463		0.527	SYNDIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNDIG1	HGNC	protein_coding	OTTHUMT00000078376.1	-	0.00	11	0	A	NM_024893		24524206	+1	tier1	-	no_errors	ENST00000376862	ensembl	human	known	74_37	missense	23.33	23	7	SNP	1.000	G
SZT2	23334	genome.wustl.edu	37	1	43902856	43902856	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr1:43902856G>A	ENST00000562955.1	+	42	5878	c.5878G>A	c.(5878-5880)Gag>Aag	p.E1960K	SZT2_ENST00000372442.1_Missense_Mutation_p.E1118K	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)	2017					central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)				NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						TGCTGCTGATGAGAGCTGTGC	0.567																																																	0													114.0	112.0	113.0					1																	43902856		2203	4300	6503	SO:0001583	missense	0			AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.5878G>A	1.37:g.43902856G>A	ENSP00000457168:p.Glu1960Lys		A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Missense_Mutation	SNP	NULL	p.E1960K	ENST00000562955.1	37	c.5878	CCDS30694.2	1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.472675	0.84640	.	.	ENSG00000198198	ENST00000372442	.	.	.	5.86	5.86	0.93980	.	0.052409	0.85682	D	0.000000	T	0.62925	0.2468	L	0.43152	1.355	0.43300	D	0.995293	P	0.51791	0.948	P	0.50490	0.642	T	0.61138	-0.7123	9	0.46703	T	0.11	.	20.1865	0.98220	0.0:0.0:1.0:0.0	.	1960	Q5T011-5	.	K	1118	.	ENSP00000361519:E1118K	E	+	1	0	SZT2	43675443	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	9.688000	0.98670	2.775000	0.95449	0.655000	0.94253	GAG	SZT2	-	NULL	ENSG00000198198		0.567	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SZT2	HGNC	protein_coding	OTTHUMT00000019517.3	-	0.00	42	0	G	NM_015284		43902856	+1	tier1	-	no_errors	ENST00000562955	ensembl	human	known	74_37	missense	16.81	94	19	SNP	1.000	A
TAB1	10454	genome.wustl.edu	37	22	39824121	39824121	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr22:39824121C>T	ENST00000216160.6	+	10	1302	c.1240C>T	c.(1240-1242)Cag>Tag	p.Q414*	TAB1_ENST00000331454.3_Nonsense_Mutation_p.Q414*	NM_006116.2	NP_006107.1	Q15750	TAB1_HUMAN	TGF-beta activated kinase 1/MAP3K7 binding protein 1	414					activation of MAPK activity (GO:0000187)|activation of MAPKKK activity (GO:0000185)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart morphogenesis (GO:0003007)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|lung development (GO:0030324)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|protein complex (GO:0043234)	catalytic activity (GO:0003824)|enzyme activator activity (GO:0008047)|kinase activator activity (GO:0019209)			breast(1)|endometrium(2)|large_intestine(2)|lung(8)|urinary_tract(1)	14						CATGCCCTCCCAGGGCCAGAT	0.632																																																	0													153.0	113.0	127.0					22																	39824121		2203	4300	6503	SO:0001587	stop_gained	0			U49928	CCDS13992.1, CCDS13993.1	22q13.1	2010-02-05	2010-02-05	2010-02-05	ENSG00000100324	ENSG00000100324			18157	protein-coding gene	gene with protein product	"""TAK1-binding protein 1"", ""mitogen-activated protein kinase kinase kinase 7 interacting protein 1"""	602615	"""mitogen-activated protein kinase kinase kinase 7 interacting protein 1"""	MAP3K7IP1		8638164, 10187861	Standard	NM_153497		Approved		uc003axt.3	Q15750	OTTHUMG00000151102	ENST00000216160.6:c.1240C>T	22.37:g.39824121C>T	ENSP00000216160:p.Gln414*		Q2PP09|Q8IZW2	Nonsense_Mutation	SNP	pfam_PP2C-like_dom,superfamily_PP2C-like_dom,smart_PP2C-like_dom	p.Q414*	ENST00000216160.6	37	c.1240	CCDS13993.1	22	.	.	.	.	.	.	.	.	.	.	C	32	5.168903	0.94768	.	.	ENSG00000100324	ENST00000216160;ENST00000331454	.	.	.	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	-23.4367	19.4258	0.94741	0.0:1.0:0.0:0.0	.	.	.	.	X	414	.	ENSP00000216160:Q414X	Q	+	1	0	TAB1	38154067	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	7.360000	0.79487	2.582000	0.87167	0.650000	0.86243	CAG	TAB1	-	NULL	ENSG00000100324		0.632	TAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAB1	HGNC	protein_coding	OTTHUMT00000321313.1		0.00	27	0	C	NM_153497		39824121	+1			no_errors	ENST00000216160	ensembl	human	known	74_37	nonsense	8.57	32	3	SNP	1.000	T
TACC3	10460	genome.wustl.edu	37	4	1732903	1732903	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr4:1732903G>C	ENST00000313288.4	+	6	1572	c.1466G>C	c.(1465-1467)aGa>aCa	p.R489T		NM_006342.2	NP_006333.1	Q9Y6A5	TACC3_HUMAN	transforming, acidic coiled-coil containing protein 3	489					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|cytoplasmic sequestering of transcription factor (GO:0042994)|hemopoiesis (GO:0030097)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of cell cycle (GO:0051726)|regulation of microtubule-based process (GO:0032886)|response to hypoxia (GO:0001666)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(4)|large_intestine(1)|lung(10)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	25		Breast(71;0.212)|all_epithelial(65;0.241)	OV - Ovarian serous cystadenocarcinoma(23;0.00765)|Epithelial(3;0.0126)			CTCCAGGAGAGAGCCTTGAAC	0.592																																					Ovarian(120;482 2294 11894 35824)												0													116.0	113.0	114.0					4																	1732903		2203	4300	6503	SO:0001583	missense	0			AF093543	CCDS3352.1	4p16.3	2008-07-29			ENSG00000013810	ENSG00000013810			11524	protein-coding gene	gene with protein product		605303				17675670	Standard	NM_006342		Approved	ERIC1	uc003gdo.3	Q9Y6A5	OTTHUMG00000089535	ENST00000313288.4:c.1466G>C	4.37:g.1732903G>C	ENSP00000326550:p.Arg489Thr		Q2NKK4|Q3KQS5|Q9UMQ1	Missense_Mutation	SNP	pfam_TACC	p.R489T	ENST00000313288.4	37	c.1466	CCDS3352.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	3.938|3.938	-0.014861|-0.014861	0.07681|0.07681	.|.	.|.	ENSG00000013810|ENSG00000013810	ENST00000343760;ENST00000470136|ENST00000485989;ENST00000313288	T|T;T	0.47528|0.43294	0.84|0.95;2.99	4.1|4.1	1.36|1.36	0.22044|0.22044	.|.	.|1.277740	.|0.05929	.|N	.|0.634780	T|T	0.32526|0.32526	0.0832|0.0832	L|L	0.44542|0.44542	1.39|1.39	0.09310|0.09310	N|N	1|1	.|B;B;B	.|0.20550	.|0.017;0.008;0.046	.|B;B;B	.|0.18263	.|0.018;0.015;0.021	T|T	0.24512|0.24512	-1.0158|-1.0158	7|10	0.87932|0.30854	D|T	0|0.27	-6.0E-4|-6.0E-4	3.7296|3.7296	0.08488|0.08488	0.228:0.2084:0.5636:0.0|0.228:0.2084:0.5636:0.0	.|.	.|489;129;489	.|B4DYJ1;C9JWI7;Q9Y6A5	.|.;.;TACC3_HUMAN	D|T	129;155|129;489	ENSP00000420838:E155D|ENSP00000419210:R129T;ENSP00000326550:R489T	ENSP00000345465:E129D|ENSP00000326550:R489T	E|R	+|+	3|2	2|0	TACC3|TACC3	1702701|1702701	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.013000|0.013000	0.08279|0.08279	-0.506000|-0.506000	0.06359|0.06359	0.478000|0.478000	0.27488|0.27488	0.563000|0.563000	0.77884|0.77884	GAG|AGA	TACC3	-	NULL	ENSG00000013810		0.592	TACC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TACC3	HGNC	protein_coding	OTTHUMT00000203730.2	-	0.00	51	0	G			1732903	+1	tier1	-	no_errors	ENST00000313288	ensembl	human	known	74_37	missense	28.85	37	15	SNP	0.000	C
TACC3	10460	genome.wustl.edu	37	4	1733001	1733001	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr4:1733001G>C	ENST00000313288.4	+	6	1670	c.1564G>C	c.(1564-1566)Gag>Cag	p.E522Q		NM_006342.2	NP_006333.1	Q9Y6A5	TACC3_HUMAN	transforming, acidic coiled-coil containing protein 3	522					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|cytoplasmic sequestering of transcription factor (GO:0042994)|hemopoiesis (GO:0030097)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of cell cycle (GO:0051726)|regulation of microtubule-based process (GO:0032886)|response to hypoxia (GO:0001666)	centrosome (GO:0005813)|cytoplasm (GO:0005737)		p.E522Q(1)		central_nervous_system(1)|endometrium(4)|large_intestine(1)|lung(10)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	25		Breast(71;0.212)|all_epithelial(65;0.241)	OV - Ovarian serous cystadenocarcinoma(23;0.00765)|Epithelial(3;0.0126)			GGAGCTGAAAGAGGAGAGCTT	0.627																																					Ovarian(120;482 2294 11894 35824)												1	Substitution - Missense(1)	urinary_tract(1)											67.0	69.0	69.0					4																	1733001		2203	4299	6502	SO:0001583	missense	0			AF093543	CCDS3352.1	4p16.3	2008-07-29			ENSG00000013810	ENSG00000013810			11524	protein-coding gene	gene with protein product		605303				17675670	Standard	NM_006342		Approved	ERIC1	uc003gdo.3	Q9Y6A5	OTTHUMG00000089535	ENST00000313288.4:c.1564G>C	4.37:g.1733001G>C	ENSP00000326550:p.Glu522Gln		Q2NKK4|Q3KQS5|Q9UMQ1	Missense_Mutation	SNP	pfam_TACC	p.E522Q	ENST00000313288.4	37	c.1564	CCDS3352.1	4	.	.	.	.	.	.	.	.	.	.	G	15.68	2.903902	0.52333	.	.	ENSG00000013810	ENST00000485989;ENST00000313288	T;T	0.50001	0.76;2.62	4.02	2.76	0.32466	.	0.497335	0.17984	N	0.155423	T	0.55194	0.1905	M	0.66939	2.045	0.09310	N	1	D;P;D	0.65815	0.991;0.557;0.995	P;B;P	0.57101	0.813;0.167;0.769	T	0.43877	-0.9364	10	0.54805	T	0.06	-14.4895	6.1157	0.20126	0.1869:0.0:0.8131:0.0	.	522;162;522	B4DYJ1;C9JWI7;Q9Y6A5	.;.;TACC3_HUMAN	Q	162;522	ENSP00000419210:E162Q;ENSP00000326550:E522Q	ENSP00000326550:E522Q	E	+	1	0	TACC3	1702799	0.964000	0.33143	0.105000	0.21289	0.271000	0.26615	1.605000	0.36815	0.898000	0.36418	0.462000	0.41574	GAG	TACC3	-	NULL	ENSG00000013810		0.627	TACC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TACC3	HGNC	protein_coding	OTTHUMT00000203730.2	-	0.00	36	0	G			1733001	+1	tier1	-	no_errors	ENST00000313288	ensembl	human	known	74_37	missense	27.78	13	5	SNP	0.117	C
TAF2	6873	genome.wustl.edu	37	8	120795769	120795769	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr8:120795769T>C	ENST00000378164.2	-	16	2262	c.1964A>G	c.(1963-1965)tAt>tGt	p.Y655C		NM_003184.3	NP_003175	Q6P1X5	TAF2_HUMAN	TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa	655					G2/M transition of mitotic cell cycle (GO:0000086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to organic cyclic compound (GO:0014070)|transcription initiation from RNA polymerase II promoter (GO:0006367)	transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	metallopeptidase activity (GO:0008237)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(21)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	49	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			ATCTCTCTCATAGCGGAGCTG	0.433																																																	0													103.0	98.0	100.0					8																	120795769		2203	4300	6503	SO:0001583	missense	0			AF040701	CCDS34937.1	8q24	2012-07-18	2002-08-29	2001-12-07	ENSG00000064313	ENSG00000064313			11536	protein-coding gene	gene with protein product		604912	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, B, 150kD"""	TAF2B		9774672, 9418870	Standard	NM_003184		Approved	TAFII150, CIF150	uc003you.3	Q6P1X5	OTTHUMG00000165009	ENST00000378164.2:c.1964A>G	8.37:g.120795769T>C	ENSP00000367406:p.Tyr655Cys		B2RE82|O43487|O43604|O60668|Q86WW7|Q8IWK4	Missense_Mutation	SNP	pfam_Peptidase_M1_N,superfamily_ARM-type_fold	p.Y655C	ENST00000378164.2	37	c.1964	CCDS34937.1	8	.	.	.	.	.	.	.	.	.	.	T	25.5	4.648409	0.87958	.	.	ENSG00000064313	ENST00000378164	T	0.48522	0.81	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.66877	0.2834	M	0.64404	1.975	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.68644	-0.5354	10	0.66056	D	0.02	-33.8218	16.6407	0.85098	0.0:0.0:0.0:1.0	.	655	Q6P1X5	TAF2_HUMAN	C	655	ENSP00000367406:Y655C	ENSP00000367406:Y655C	Y	-	2	0	TAF2	120864950	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.057000	0.64294	2.326000	0.78906	0.533000	0.62120	TAT	TAF2	-	NULL	ENSG00000064313		0.433	TAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF2	HGNC	protein_coding	OTTHUMT00000381436.1	-	0.00	33	0	T	NM_003184		120795769	-1	tier1	-	no_errors	ENST00000378164	ensembl	human	known	74_37	missense	24.32	28	9	SNP	1.000	C
TAF5	6877	genome.wustl.edu	37	10	105127805	105127805	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr10:105127805C>A	ENST00000369839.3	+	1	82	c.59C>A	c.(58-60)cCg>cAg	p.P20Q	TAF5_ENST00000351396.4_Missense_Mutation_p.P20Q	NM_006951.3	NP_008882.2	Q15542	TAF5_HUMAN	TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa	20					chromatin modification (GO:0016568)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	protein dimerization activity (GO:0046983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)	15		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;1.83e-09)|all cancers(201;1.4e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)		CCTGAGGGACCGCCAACGCTG	0.706																																																	0													4.0	6.0	5.0					10																	105127805		1412	2527	3939	SO:0001583	missense	0			X95525	CCDS7547.1	10q24-q25.2	2013-01-10	2002-08-29	2001-12-07	ENSG00000148835	ENSG00000148835		"""WD repeat domain containing"""	11539	protein-coding gene	gene with protein product		601787	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, D, 100kD"""	TAF2D		8884287, 8942982	Standard	NM_006951		Approved	TAFII100	uc001kwv.3	Q15542	OTTHUMG00000018985	ENST00000369839.3:c.59C>A	10.37:g.105127805C>A	ENSP00000358854:p.Pro20Gln		A8K5B4|B2RMR0|B7ZKJ6|Q53EM4|Q5SYD5|Q86UZ7|Q9Y4K5	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_TFIID-su_WD40-assoc_reg,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_LisH_dimerisation,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.P20Q	ENST00000369839.3	37	c.59	CCDS7547.1	10	.	.	.	.	.	.	.	.	.	.	C	17.37	3.371767	0.61624	.	.	ENSG00000148835	ENST00000369839;ENST00000351396	T;T	0.60672	0.44;0.17	4.33	4.33	0.51752	.	0.388401	0.21481	N	0.073836	T	0.53110	0.1776	N	0.04508	-0.205	0.41931	D	0.990563	D;D	0.76494	0.999;0.998	D;D	0.75020	0.985;0.965	T	0.55360	-0.8153	10	0.22109	T	0.4	-6.6677	15.1393	0.72599	0.0:1.0:0.0:0.0	.	20;20	Q15542-2;Q15542	.;TAF5_HUMAN	Q	20	ENSP00000358854:P20Q;ENSP00000311024:P20Q	ENSP00000311024:P20Q	P	+	2	0	TAF5	105117795	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.533000	0.45667	2.380000	0.81148	0.491000	0.48974	CCG	TAF5	-	NULL	ENSG00000148835		0.706	TAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF5	HGNC	protein_coding	OTTHUMT00000050144.1	-	0.00	20	0	C			105127805	+1	tier1	-	no_errors	ENST00000369839	ensembl	human	known	74_37	missense	73.68	10	28	SNP	1.000	A
TANGO6	79613	genome.wustl.edu	37	16	68900993	68900993	+	Silent	SNP	T	T	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr16:68900993T>C	ENST00000261778.1	+	4	876	c.864T>C	c.(862-864)gaT>gaC	p.D288D		NM_024562.1	NP_078838.1	Q9C0B7	TNG6_HUMAN	transport and golgi organization 6 homolog (Drosophila)	288						integral component of membrane (GO:0016021)											CCTGCACAGATGTGAAGACAC	0.473																																																	0													92.0	91.0	91.0					16																	68900993		1907	4127	6034	SO:0001819	synonymous_variant	0				CCDS45516.1	16q22.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000103047	ENSG00000103047			25749	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 7"""	TMCO7		11214970	Standard	NM_024562		Approved	FLJ12688, KIAA1746	uc002ewi.4	Q9C0B7	OTTHUMG00000176743	ENST00000261778.1:c.864T>C	16.37:g.68900993T>C			Q569F9|Q9H9K1	Silent	SNP	pfam_DUF2435,pfam_DUF2411,superfamily_ARM-type_fold	p.D288	ENST00000261778.1	37	c.864	CCDS45516.1	16																																																																																			TANGO6	-	NULL	ENSG00000103047		0.473	TANGO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TANGO6	HGNC	protein_coding	OTTHUMT00000433471.2	-	0.00	50	0	T	XM_928235.2		68900993	+1	tier1	-	no_errors	ENST00000261778	ensembl	human	known	74_37	silent	53.33	35	40	SNP	0.261	C
TEAD4	7004	genome.wustl.edu	37	12	3104056	3104056	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr12:3104056G>T	ENST00000359864.2	+	3	314	c.124G>T	c.(124-126)Gtg>Ttg	p.V42L	TEAD4_ENST00000397122.2_Intron|TEAD4_ENST00000358409.2_Missense_Mutation_p.V42L	NM_003213.3	NP_003204	Q15561	TEAD4_HUMAN	TEA domain family member 4	42					gene expression (GO:0010467)|hippo signaling (GO:0035329)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	10	Ovarian(42;0.211)		OV - Ovarian serous cystadenocarcinoma(31;0.000563)|COAD - Colon adenocarcinoma(12;0.0831)			CGCAGAGGGCGTGTGGAGCCC	0.622																																																	0													125.0	132.0	130.0					12																	3104056		2203	4300	6503	SO:0001583	missense	0			X94438	CCDS31729.1, CCDS31730.1, CCDS41737.1	12p13.3-p13.2	2008-05-14				ENSG00000197905			11717	protein-coding gene	gene with protein product		601714		TCF13L1		9889009, 8921372	Standard	NM_003213		Approved	TEF-3, TEFR-1, EFTR-2, RTEF-1	uc010sej.2	Q15561		ENST00000359864.2:c.124G>T	12.37:g.3104056G>T	ENSP00000352926:p.Val42Leu		H0Y308|Q6MZR9|Q8NEV5|Q92883|Q96BK2	Missense_Mutation	SNP	pfam_TEA/ATTS,smart_TEA/ATTS,pirsf_TEF,pfscan_TEA/ATTS,prints_TEA/ATTS	p.V42L	ENST00000359864.2	37	c.124	CCDS31729.1	12	.	.	.	.	.	.	.	.	.	.	G	34	5.381723	0.95967	.	.	ENSG00000197905	ENST00000358409;ENST00000536826;ENST00000359864;ENST00000543035	T;T;T;T	0.44881	0.91;0.91;0.91;0.91	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.74068	0.3668	M	0.93898	3.47	0.80722	D	1	D	0.60160	0.987	D	0.74674	0.984	T	0.81714	-0.0807	10	0.87932	D	0	-20.3223	18.1043	0.89515	0.0:0.0:1.0:0.0	.	42	Q15561	TEAD4_HUMAN	L	42	ENSP00000351184:V42L;ENSP00000438453:V42L;ENSP00000352926:V42L;ENSP00000444528:V42L	ENSP00000351184:V42L	V	+	1	0	TEAD4	2974317	1.000000	0.71417	0.991000	0.47740	0.989000	0.77384	9.869000	0.99810	2.513000	0.84729	0.650000	0.86243	GTG	TEAD4	-	pfam_TEA/ATTS,smart_TEA/ATTS,pirsf_TEF,pfscan_TEA/ATTS	ENSG00000197905		0.622	TEAD4-001	KNOWN	non_ATG_start|basic|CCDS	protein_coding	TEAD4	HGNC	protein_coding	OTTHUMT00000398475.1	-	0.00	93	0	G	NM_003213		3104056	+1	tier1	-	no_errors	ENST00000359864	ensembl	human	known	74_37	missense	71.43	18	45	SNP	1.000	T
TES	26136	genome.wustl.edu	37	7	115889258	115889258	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr7:115889258G>T	ENST00000358204.4	+	3	513	c.298G>T	c.(298-300)Gcc>Tcc	p.A100S	TES_ENST00000485009.1_3'UTR|AC002066.1_ENST00000446355.2_RNA|TES_ENST00000537767.1_Intron|TES_ENST00000393481.2_Missense_Mutation_p.A91S|AC073130.3_ENST00000444244.1_RNA	NM_015641.3	NP_056456.1	Q9UGI8	TES_HUMAN	testis derived transcript (3 LIM domains)	100	PET. {ECO:0000255|PROSITE- ProRule:PRU00636}.				negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|protein complex (GO:0043234)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(4)|lung(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	12	Lung NSC(10;0.0137)|all_lung(10;0.0148)	Breast(660;0.0602)	STAD - Stomach adenocarcinoma(10;0.00878)			TCCAGTTGCTGCCAAGAAGAA	0.383																																																	0													127.0	119.0	122.0					7																	115889258		2203	4300	6503	SO:0001583	missense	0			AJ250865	CCDS5763.1, CCDS5764.1	7q31.2	2004-04-20			ENSG00000135269	ENSG00000135269			14620	protein-coding gene	gene with protein product		606085				10950921	Standard	NM_015641		Approved	DKFZP586B2022, TESS-2, TESTIN	uc003vho.3	Q9UGI8	OTTHUMG00000023092	ENST00000358204.4:c.298G>T	7.37:g.115889258G>T	ENSP00000350937:p.Ala100Ser		A4D0U6|Q9GZQ1|Q9HAJ9	Missense_Mutation	SNP	pfam_PET_domain,pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.A100S	ENST00000358204.4	37	c.298	CCDS5763.1	7	.	.	.	.	.	.	.	.	.	.	G	15.63	2.889937	0.52014	.	.	ENSG00000135269	ENST00000358204;ENST00000455989;ENST00000257721;ENST00000393481	D;D;D	0.84944	-1.92;-1.92;-1.92	5.53	4.65	0.58169	PET domain (2);	0.000000	0.64402	D	0.000002	T	0.80613	0.4656	L	0.28115	0.83	0.80722	D	1	D;B	0.52996	0.957;0.095	P;B	0.52646	0.705;0.141	T	0.77370	-0.2613	10	0.02654	T	1	-15.216	14.6664	0.68910	0.0699:0.0:0.9301:0.0	.	100;100	B7Z5L5;Q9UGI8	.;TES_HUMAN	S	100;15;100;91	ENSP00000350937:A100S;ENSP00000413002:A15S;ENSP00000377121:A91S	ENSP00000257721:A100S	A	+	1	0	TES	115676494	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.001000	0.57046	1.473000	0.48159	0.650000	0.86243	GCC	TES	-	pfam_PET_domain	ENSG00000135269		0.383	TES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TES	HGNC	protein_coding	OTTHUMT00000059413.2	-	0.00	51	0	G	NM_015641		115889258	+1	tier1	-	no_errors	ENST00000358204	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	T
TEX11	56159	genome.wustl.edu	37	X	69964046	69964046	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chrX:69964046A>G	ENST00000395889.2	-	11	916	c.761T>C	c.(760-762)aTg>aCg	p.M254T	TEX11_ENST00000374333.2_Missense_Mutation_p.M239T|TEX11_ENST00000344304.3_Missense_Mutation_p.M254T	NM_001003811.1	NP_001003811.1	Q8IYF3	TEX11_HUMAN	testis expressed 11	254					chiasma assembly (GO:0051026)|fertilization (GO:0009566)|male gonad development (GO:0008584)|male meiosis chromosome segregation (GO:0007060)|meiotic gene conversion (GO:0006311)|negative regulation of apoptotic process (GO:0043066)|reciprocal meiotic recombination (GO:0007131)|resolution of meiotic recombination intermediates (GO:0000712)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)				breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(13)|ovary(3)|prostate(3)|skin(3)	48	Renal(35;0.156)					TTTCTTATCCATCTTCCCAAT	0.239																																																	0													45.0	38.0	41.0					X																	69964046		2203	4289	6492	SO:0001583	missense	0			AF285594	CCDS35323.1, CCDS43968.1	Xp11	2008-02-05	2007-03-13		ENSG00000120498	ENSG00000120498			11733	protein-coding gene	gene with protein product		300311	"""testis expressed sequence 11"""			11279525	Standard	NM_001003811		Approved	TSGA3, TGC1	uc004dyl.3	Q8IYF3	OTTHUMG00000021782	ENST00000395889.2:c.761T>C	X.37:g.69964046A>G	ENSP00000379226:p.Met254Thr		A8K8V6|Q5JQQ8|Q96LZ4|Q96M47|Q9BXU6	Missense_Mutation	SNP	pfam_Meiosis_specific_SPO22,smart_TPR_repeat	p.M254T	ENST00000395889.2	37	c.761	CCDS35323.1	X	.	.	.	.	.	.	.	.	.	.	A	6.478	0.456337	0.12283	.	.	ENSG00000120498	ENST00000374333;ENST00000395889;ENST00000344304	T;T;T	0.61859	0.07;0.07;0.07	3.66	1.1	0.20463	Tetratricopeptide-like helical (1);	0.338675	0.28349	N	0.015678	T	0.38825	0.1055	L	0.39397	1.21	0.24058	N	0.996026	B;B	0.21520	0.046;0.057	B;B	0.20955	0.019;0.032	T	0.14448	-1.0472	9	.	.	.	-3.3767	2.4536	0.04524	0.6244:0.0:0.1373:0.2384	.	239;254	Q8IYF3-3;Q8IYF3	.;TEX11_HUMAN	T	239;254;254	ENSP00000363453:M239T;ENSP00000379226:M254T;ENSP00000340995:M254T	.	M	-	2	0	TEX11	69880771	1.000000	0.71417	0.826000	0.32828	0.704000	0.40688	1.982000	0.40638	-0.045000	0.13468	0.412000	0.27726	ATG	TEX11	-	pfam_Meiosis_specific_SPO22	ENSG00000120498		0.239	TEX11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TEX11	HGNC	protein_coding	OTTHUMT00000359072.1	-	0.00	34	0	A			69964046	-1	tier1	-	no_errors	ENST00000344304	ensembl	human	known	74_37	missense	75.00	12	36	SNP	0.676	G
TGFB2	7042	genome.wustl.edu	37	1	218607722	218607722	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr1:218607722G>T	ENST00000366930.4	+	4	1153	c.686G>T	c.(685-687)tGc>tTc	p.C229F	TGFB2_ENST00000479322.1_3'UTR|TGFB2_ENST00000366929.4_Missense_Mutation_p.C257F	NM_003238.3	NP_003229.1	P61812	TGFB2_HUMAN	transforming growth factor, beta 2	229					activation of protein kinase activity (GO:0032147)|angiogenesis (GO:0001525)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell proliferation (GO:0060038)|cardioblast differentiation (GO:0010002)|cartilage condensation (GO:0001502)|catagen (GO:0042637)|cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|collagen fibril organization (GO:0030199)|dopamine biosynthetic process (GO:0042416)|embryo development (GO:0009790)|embryonic digestive tract development (GO:0048566)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|face morphogenesis (GO:0060325)|generation of neurons (GO:0048699)|glial cell migration (GO:0008347)|hair follicle development (GO:0001942)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|hemopoiesis (GO:0030097)|menstrual cycle phase (GO:0022601)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of immune response (GO:0050777)|negative regulation of macrophage cytokine production (GO:0010936)|neuron development (GO:0048666)|neuron fate commitment (GO:0048663)|neutrophil chemotaxis (GO:0030593)|odontogenesis (GO:0042476)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of activation-induced cell death of T cells (GO:0070237)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of catagen (GO:0051795)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell division (GO:0051781)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of gene expression (GO:0010628)|positive regulation of heart contraction (GO:0045823)|positive regulation of immune response (GO:0050778)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of ossification (GO:0045778)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein secretion (GO:0050714)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein phosphorylation (GO:0006468)|regulation of transforming growth factor beta2 production (GO:0032909)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to progesterone (GO:0032570)|response to wounding (GO:0009611)|salivary gland morphogenesis (GO:0007435)|signal transduction by phosphorylation (GO:0023014)|SMAD protein import into nucleus (GO:0007184)|somatic stem cell division (GO:0048103)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	axon (GO:0030424)|endosome (GO:0005768)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|platelet alpha granule lumen (GO:0031093)	beta-amyloid binding (GO:0001540)|cytokine activity (GO:0005125)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta receptor binding (GO:0005160)|type II transforming growth factor beta receptor binding (GO:0005114)			breast(1)|endometrium(1)|large_intestine(11)|lung(15)|upper_aerodigestive_tract(2)|urinary_tract(1)	31				all cancers(67;0.0459)|OV - Ovarian serous cystadenocarcinoma(81;0.049)|GBM - Glioblastoma multiforme(131;0.0776)		TGTCCCTGCTGCACTTTTGTA	0.388																																																	0													72.0	69.0	70.0					1																	218607722		2203	4300	6503	SO:0001583	missense	0			M19154	CCDS1521.1, CCDS44318.1	1q41	2014-01-30			ENSG00000092969	ENSG00000092969		"""Endogenous ligands"""	11768	protein-coding gene	gene with protein product	"""prepro-transforming growth factor beta-2"""	190220					Standard	NM_003238		Approved		uc001hln.3	P61812	OTTHUMG00000039521	ENST00000366930.4:c.686G>T	1.37:g.218607722G>T	ENSP00000355897:p.Cys229Phe		B4DKC5|P08112|Q15579|Q15581|Q4VAV9	Missense_Mutation	SNP	pirsf_TGF-beta,pfam_TGF-b_N,pfam_TGF-b_C,smart_TGF-b_C,prints_TGFb2,prints_TGF-beta	p.C257F	ENST00000366930.4	37	c.770	CCDS1521.1	1	.	.	.	.	.	.	.	.	.	.	G	11.71	1.721144	0.30503	.	.	ENSG00000092969	ENST00000366930;ENST00000366929	T;T	0.74315	-0.76;-0.83	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.72510	0.3469	L	0.46741	1.465	0.80722	D	1	B;B	0.19935	0.04;0.014	B;B	0.25405	0.06;0.056	T	0.65442	-0.6167	10	0.39692	T	0.17	.	20.2822	0.98520	0.0:0.0:1.0:0.0	.	257;229	P61812-2;P61812	.;TGFB2_HUMAN	F	229;257	ENSP00000355897:C229F;ENSP00000355896:C257F	ENSP00000355896:C257F	C	+	2	0	TGFB2	216674345	1.000000	0.71417	0.996000	0.52242	0.957000	0.61999	6.350000	0.73017	2.806000	0.96561	0.655000	0.94253	TGC	TGFB2	-	pirsf_TGF-beta	ENSG00000092969		0.388	TGFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGFB2	HGNC	protein_coding	OTTHUMT00000095359.2	-	0.00	54	0	G	NM_003238		218607722	+1	tier1	-	no_errors	ENST00000366929	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	T
THPO	7066	genome.wustl.edu	37	3	184090495	184090495	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr3:184090495G>A	ENST00000204615.7	-	6	1082	c.868C>T	c.(868-870)Cct>Tct	p.P290S	THPO_ENST00000421442.2_Missense_Mutation_p.A251V|EIF2B5_ENST00000444495.1_Intron|THPO_ENST00000477594.1_5'Flank|THPO_ENST00000445696.2_Missense_Mutation_p.P286S	NM_000460.2|NM_001177597.1|NM_001177598.1	NP_000451.1|NP_001171068.1|NP_001171069.1	P40225	TPO_HUMAN	thrombopoietin	290	Pro-rich.				blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|myeloid cell differentiation (GO:0030099)|platelet activation (GO:0030168)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|thrombopoietin-mediated signaling pathway (GO:0038163)	extracellular space (GO:0005615)	growth factor activity (GO:0008083)			NS(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)	16	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GAATATCCAGGCTGGAGGTTG	0.597																																																	0													178.0	193.0	188.0					3																	184090495		2203	4300	6503	SO:0001583	missense	0				CCDS3265.1, CCDS54693.1	3q27	2014-01-30	2008-07-31		ENSG00000090534	ENSG00000090534		"""Endogenous ligands"""	11795	protein-coding gene	gene with protein product	"""prepro-thrombopoietin"", ""megakaryocyte stimulating factor"", ""myeloproliferative leukemia virus oncogene ligand"", ""megakaryocyte growth and development factor"", ""MPL ligand"", ""megakaryocyte colony-stimulating factor"", ""c-mpl ligand"", ""thrombopoietin nirs variant 1"""	600044		MGDF		8202154	Standard	XM_006713738		Approved	TPO, MPLLG	uc003fol.1	P40225	OTTHUMG00000156745	ENST00000204615.7:c.868C>T	3.37:g.184090495G>A	ENSP00000204615:p.Pro290Ser		A1L3Y0|B7ZLR8|B9EGA8|Q13020|Q15790|Q15791|Q15792	Missense_Mutation	SNP	pfam_EPO_TPO,superfamily_4_helix_cytokine-like_core,prints_Thrombopoeitin	p.P290S	ENST00000204615.7	37	c.868	CCDS3265.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.527|8.527	0.870068|0.870068	0.17322|0.17322	.|.	.|.	ENSG00000090534|ENSG00000090534	ENST00000421442|ENST00000204615;ENST00000445696;ENST00000353488	T|T;T	0.37915|0.29917	1.17|1.55;1.56	4.07|4.07	-2.08|-2.08	0.07254|0.07254	.|Four-helical cytokine, core (1);	.|1.153560	.|0.06474	.|N	.|0.731674	T|T	0.15696|0.15696	0.0378|0.0378	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	B|B;B	0.09022|0.14012	0.002|0.009;0.005	B|B;B	0.08055|0.14023	0.003|0.01;0.004	T|T	0.26710|0.26710	-1.0095|-1.0095	9|10	0.48119|0.40728	T|T	0.1|0.16	-27.3793|-27.3793	0.4789|0.4789	0.00544|0.00544	0.3028:0.1434:0.3311:0.2227|0.3028:0.1434:0.3311:0.2227	.|.	251|286;290	F8W6L1|P40225-2;P40225	.|.;TPO_HUMAN	V|S	251|290;286;251	ENSP00000411704:A251V|ENSP00000204615:P290S;ENSP00000410763:P286S	ENSP00000411704:A251V|ENSP00000204615:P290S	A|P	-|-	2|1	0|0	THPO|THPO	185573189|185573189	0.002000|0.002000	0.14202|0.14202	0.033000|0.033000	0.17914|0.17914	0.642000|0.642000	0.38348|0.38348	0.044000|0.044000	0.13992|0.13992	-0.361000|-0.361000	0.08125|0.08125	-0.373000|-0.373000	0.07131|0.07131	GCC|CCT	THPO	-	NULL	ENSG00000090534		0.597	THPO-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	THPO	HGNC	protein_coding	OTTHUMT00000345554.1	-	0.00	41	0	G	NM_000460		184090495	-1	tier1	-	no_errors	ENST00000204615	ensembl	human	known	74_37	missense	40.54	44	30	SNP	0.005	A
TICRR	90381	genome.wustl.edu	37	15	90163009	90163009	+	Silent	SNP	T	T	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr15:90163009T>C	ENST00000268138.7	+	18	3195	c.3090T>C	c.(3088-3090)taT>taC	p.Y1030Y	KIF7_ENST00000558928.1_Intron|TICRR_ENST00000560985.1_Silent_p.Y1029Y			Q7Z2Z1	TICRR_HUMAN	TOPBP1-interacting checkpoint and replication regulator	1030					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|formation of translation preinitiation complex (GO:0001731)|mitotic DNA replication checkpoint (GO:0033314)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	chromatin binding (GO:0003682)										CCTCCTTCTATTCTGTGTCTC	0.463																																																	0													129.0	124.0	126.0					15																	90163009		1951	4150	6101	SO:0001819	synonymous_variant	0			AK123612	CCDS10352.2	15q26.1	2012-07-11	2012-07-11	2012-07-11	ENSG00000140534	ENSG00000140534			28704	protein-coding gene	gene with protein product	"""TOPBP1-interacting replication-stimulating protein"", ""SLD3 homolog (S. cerevisiae)"""	613298	"""chromosome 15 open reading frame 42"""	C15orf42		20116089, 20080954	Standard	NM_152259		Approved	MGC45866, FLJ41618, Treslin, SLD3	uc002boe.3	Q7Z2Z1	OTTHUMG00000149648	ENST00000268138.7:c.3090T>C	15.37:g.90163009T>C			B2RE07|B3KVV9|D3IUT4|Q8N4X8|Q8NCH6|Q9BU55	Silent	SNP	NULL	p.Y1030	ENST00000268138.7	37	c.3090	CCDS10352.2	15																																																																																			TICRR	-	NULL	ENSG00000140534		0.463	TICRR-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TICRR	HGNC	protein_coding	OTTHUMT00000312856.1	-	0.00	56	0	T	NM_152259		90163009	+1	tier1	-	no_errors	ENST00000268138	ensembl	human	known	74_37	silent	46.75	41	36	SNP	0.345	C
TIGD4	201798	genome.wustl.edu	37	4	153691031	153691032	+	Frame_Shift_Ins	INS	-	-	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr4:153691031_153691032insA	ENST00000304337.2	-	2	1945_1946	c.1125_1126insT	c.(1123-1128)tatgaafs	p.E376fs		NM_145720.3	NP_663772.1	Q8IY51	TIGD4_HUMAN	tigger transposable element derived 4	376						nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(2)|large_intestine(9)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	26	all_hematologic(180;0.093)					CCTGCCTCTTCATAGCTTTTAA	0.421																																																	0																																										SO:0001589	frameshift_variant	0			AK058054	CCDS34079.1	4q31.23	2008-02-05							18335	protein-coding gene	gene with protein product							Standard	NM_145720		Approved		uc003imy.3	Q8IY51		ENST00000304337.2:c.1126dupT	4.37:g.153691032_153691032dupA	ENSP00000355162:p.Glu376fs		Q96LP5	Frame_Shift_Ins	INS	pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_CenpB_DNA-bd_dom,pfam_HTH_Psq,pfam_Centromere_CenpB_dimerisation,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_HTH_Psq	p.E375fs	ENST00000304337.2	37	c.1126_1125	CCDS34079.1	4																																																																																			TIGD4	-	pfam_DDE_SF_endonuclease_CENPB-like	ENSG00000169989		0.421	TIGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGD4	HGNC	protein_coding	OTTHUMT00000365028.1		0.00	62	0	-	NM_145720		153691032	-1	tier1		no_errors	ENST00000304337	ensembl	human	known	74_37	frame_shift_ins	24.00	57	18	INS	1.000:0.998	A
TIGD5	84948	genome.wustl.edu	37	8	144680307	144680307	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr8:144680307C>G	ENST00000504548.2	+	1	234	c.234C>G	c.(232-234)tgC>tgG	p.C78W	EEF1D_ENST00000529272.1_5'Flank|EEF1D_ENST00000423316.2_5'Flank|TIGD5_ENST00000321385.3_Missense_Mutation_p.C29W|EEF1D_ENST00000419152.2_5'Flank|EEF1D_ENST00000531621.1_5'Flank|EEF1D_ENST00000526838.1_5'Flank|EEF1D_ENST00000532400.1_5'Flank|EEF1D_ENST00000524624.1_5'Flank|EEF1D_ENST00000317198.6_5'Flank|EEF1D_ENST00000442189.2_5'Flank|EEF1D_ENST00000528610.1_5'Flank|EEF1D_ENST00000531770.1_5'Flank|EEF1D_ENST00000395119.3_5'Flank	NM_032862.4	NP_116251.4	Q53EQ6	TIGD5_HUMAN	tigger transposable element derived 5	78	HTH psq-type. {ECO:0000255|PROSITE- ProRule:PRU00320}.					nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|lung(3)|ovary(1)|soft_tissue(1)|urinary_tract(1)	7	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			CCAGTGTGTGCCGCGACTTCG	0.697																																																	0													10.0	11.0	11.0					8																	144680307		2140	4222	6362	SO:0001583	missense	0			AK027832	CCDS6406.1, CCDS6406.2	8q24.3	2008-02-01				ENSG00000179886			18336	protein-coding gene	gene with protein product							Standard	NM_032862		Approved	FLJ14926	uc003yyx.2	Q53EQ6		ENST00000504548.2:c.234C>G	8.37:g.144680307C>G	ENSP00000421489:p.Cys78Trp		E7EWS2|Q6NT83|Q8N5A1|Q96JW8	Missense_Mutation	SNP	pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_CenpB_DNA-bd_dom,pfam_HTH_Psq,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_HTH_Psq	p.C78W	ENST00000504548.2	37	c.234	CCDS6406.2	8	.	.	.	.	.	.	.	.	.	.	c	14.77	2.634835	0.47049	.	.	ENSG00000179886	ENST00000504548;ENST00000321385	T;T	0.42131	0.98;0.98	4.01	4.01	0.46588	Homeodomain-related (1);Homeodomain-like (1);Helix-turn-helix, Psq-like (1);Centromere protein Cenp-B, DNA-binding domain 1 (1);	0.149105	0.31290	U	0.007919	T	0.40932	0.1137	N	0.08118	0	0.34163	D	0.668922	D	0.76494	0.999	D	0.68943	0.961	T	0.58962	-0.7543	10	0.87932	D	0	.	11.2646	0.49104	0.0:0.8143:0.1857:0.0	.	29	Q53EQ6	TIGD5_HUMAN	W	78;29	ENSP00000421489:C78W;ENSP00000315906:C29W	ENSP00000315906:C29W	C	+	3	2	TIGD5	144751450	1.000000	0.71417	1.000000	0.80357	0.772000	0.43724	2.517000	0.45529	1.779000	0.52309	0.165000	0.16767	TGC	TIGD5	-	pfam_HTH_Psq,superfamily_Homeodomain-like,pfscan_HTH_Psq	ENSG00000179886		0.697	TIGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGD5	HGNC	protein_coding	OTTHUMT00000368269.1	-	0.00	9	0	C	NM_032862		144680307	+1	tier1	-	no_errors	ENST00000504548	ensembl	human	known	74_37	missense	31.25	11	5	SNP	1.000	G
TIGD7	91151	genome.wustl.edu	37	16	3348998	3348998	+	Silent	SNP	G	G	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr16:3348998G>A	ENST00000396862.1	-	2	3445	c.1617C>T	c.(1615-1617)ttC>ttT	p.F539F	TIGD7_ENST00000574598.1_5'Flank|TIGD7_ENST00000268674.2_Silent_p.F539F	NM_033208.3	NP_149985.2	Q6NT04	TIGD7_HUMAN	tigger transposable element derived 7	539						nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12						AAGGCCCACTGAAGGAGTCCT	0.358																																																	0													54.0	54.0	54.0					16																	3348998		2197	4300	6497	SO:0001819	synonymous_variant	0			AF251050	CCDS10500.1	16p13.11	2008-02-05			ENSG00000140993	ENSG00000140993			18331	protein-coding gene	gene with protein product		612969					Standard	NM_033208		Approved	Sancho	uc002cus.3	Q6NT04	OTTHUMG00000129325	ENST00000396862.1:c.1617C>T	16.37:g.3348998G>A			Q9BXZ0	Silent	SNP	pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_CenpB_DNA-bd_dom,pfam_HTH_Psq,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_HTH_Psq	p.F539	ENST00000396862.1	37	c.1617	CCDS10500.1	16																																																																																			TIGD7	-	NULL	ENSG00000140993		0.358	TIGD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGD7	HGNC	protein_coding	OTTHUMT00000251465.1	-	0.00	47	0	G	NM_033208		3348998	-1	tier1	-	no_errors	ENST00000268674	ensembl	human	known	74_37	silent	58.06	26	36	SNP	0.899	A
TIMELESS	8914	genome.wustl.edu	37	12	56827937	56827937	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr12:56827937C>T	ENST00000553532.1	-	2	168	c.18G>A	c.(16-18)atG>atA	p.M6I	TIMELESS_ENST00000229201.4_Missense_Mutation_p.M6I|TIMELESS_ENST00000554616.1_Missense_Mutation_p.M6I					timeless circadian clock											NS(1)|breast(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(8)|lung(14)|ovary(7)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	49						GTTCACAGTTCATCATGTGCA	0.438																																																	0													130.0	113.0	119.0					12																	56827937		2203	4300	6503	SO:0001583	missense	0			AF098162	CCDS8918.1	12q13.3	2012-12-14	2012-12-14		ENSG00000111602	ENSG00000111602			11813	protein-coding gene	gene with protein product	"""Tof1 homolog (S. cerevisiae)"", ""timeless circadian clock 1"""	603887	"""timeless (Drosophila) homolog"", ""timeless homolog (Drosophila)"""			9856465	Standard	NM_003920		Approved	hTIM, TIM, TIM1	uc001slf.2	Q9UNS1	OTTHUMG00000170600	ENST00000553532.1:c.18G>A	12.37:g.56827937C>T	ENSP00000450607:p.Met6Ile			Missense_Mutation	SNP	pfam_TIMELESS_C,pfam_Timeless	p.M6I	ENST00000553532.1	37	c.18	CCDS8918.1	12	.	.	.	.	.	.	.	.	.	.	C	28.8	4.954056	0.92726	.	.	ENSG00000111602	ENST00000229201;ENST00000553532;ENST00000554616	T;T;T	0.12147	3.1;3.11;2.71	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.25232	0.0613	L	0.31926	0.97	0.80722	D	1	D;D	0.65815	0.995;0.991	P;P	0.59171	0.853;0.718	T	0.00339	-1.1805	10	0.59425	D	0.04	-25.5175	18.4236	0.90600	0.0:1.0:0.0:0.0	.	6;6	Q9UNS1-2;Q9UNS1	.;TIM_HUMAN	I	6	ENSP00000229201:M6I;ENSP00000450607:M6I;ENSP00000450848:M6I	ENSP00000229201:M6I	M	-	3	0	TIMELESS	55114204	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	7.125000	0.77193	2.735000	0.93741	0.555000	0.69702	ATG	TIMELESS	-	NULL	ENSG00000111602		0.438	TIMELESS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TIMELESS	HGNC	protein_coding	OTTHUMT00000409771.1	-	0.00	37	0	C	NM_003920		56827937	-1	tier1	-	no_errors	ENST00000553532	ensembl	human	known	74_37	missense	40.48	25	17	SNP	1.000	T
TKT	7086	genome.wustl.edu	37	3	53264542	53264542	+	Silent	SNP	G	G	C	rs113369659		TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr3:53264542G>C	ENST00000462138.1	-	8	1126	c.1038C>G	c.(1036-1038)acC>acG	p.T346T	TKT_ENST00000423525.2_Silent_p.T346T|TKT_ENST00000423516.1_Silent_p.T354T|TKT_ENST00000296289.6_Silent_p.T299T|TKT_ENST00000461139.1_5'UTR			P29401	TKT_HUMAN	transketolase	346					carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|glyceraldehyde-3-phosphate biosynthetic process (GO:0046166)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, non-oxidative branch (GO:0009052)|regulation of growth (GO:0040008)|small molecule metabolic process (GO:0044281)|xylulose biosynthetic process (GO:0005999)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|peroxisome (GO:0005777)|vesicle (GO:0031982)	cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|transketolase activity (GO:0004802)			endometrium(5)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17		Prostate(884;0.0959)		BRCA - Breast invasive adenocarcinoma(193;0.000159)|OV - Ovarian serous cystadenocarcinoma(275;0.000314)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)		TCTCCGAGAAGGTGGAATTTT	0.597																																					Colon(133;1506 2347 35238 42177)												0													121.0	113.0	115.0					3																	53264542		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS2871.1, CCDS58834.1	3p14.3	2008-07-31	2008-07-31		ENSG00000163931	ENSG00000163931	2.2.1.1		11834	protein-coding gene	gene with protein product	"""Wernicke-Korsakoff syndrome"""	606781				1567394	Standard	NM_001064		Approved		uc011beq.2	P29401	OTTHUMG00000158192	ENST00000462138.1:c.1038C>G	3.37:g.53264542G>C			A8K089|B4DE31|E7EPA7|Q8TBA3|Q96HH3	Silent	SNP	pfam_Transketolase_N,pfam_Transketolase-like_Pyr-bd,pfam_Transketolase_C,pfam_DH_E1,superfamily_Transketo_C/Pyr-ferredox_oxred,smart_Transketolase-like_Pyr-bd	p.T346	ENST00000462138.1	37	c.1038	CCDS2871.1	3																																																																																			TKT	-	pfam_Transketolase-like_Pyr-bd,smart_Transketolase-like_Pyr-bd	ENSG00000163931		0.597	TKT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TKT	HGNC	protein_coding	OTTHUMT00000350356.1	-	0.00	151	0	G			53264542	-1	tier1	-	no_errors	ENST00000423525	ensembl	human	known	74_37	silent	74.83	35	107	SNP	1.000	C
TLE6	79816	genome.wustl.edu	37	19	2987362	2987362	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr19:2987362C>T	ENST00000246112.4	+	8	751	c.550C>T	c.(550-552)Cca>Tca	p.P184S	TLE6_ENST00000478073.2_3'UTR|TLE6_ENST00000452088.1_Missense_Mutation_p.P61S	NM_001143986.1	NP_001137458.1	Q9H808	TLE6_HUMAN	transducin-like enhancer of split 6	184					regulation of transcription, DNA-templated (GO:0006355)	cell cortex (GO:0005938)|nucleus (GO:0005634)|protein complex (GO:0043234)				breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|urinary_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGAGCAGGCACCAGGCCTGGT	0.637																																																	0													88.0	81.0	83.0					19																	2987362		2203	4300	6503	SO:0001583	missense	0			AK024071	CCDS12100.1, CCDS45910.1	19p13.3	2014-03-07	2014-03-07		ENSG00000104953	ENSG00000104953		"""WD repeat domain containing"""	30788	protein-coding gene	gene with protein product		612399	"""transducin-like enhancer of split 6 (E(sp1) homolog, Drosophila)"""			11486032	Standard	NM_024760		Approved	FLJ14009, GRG6	uc002lwt.2	Q9H808	OTTHUMG00000156793	ENST00000246112.4:c.550C>T	19.37:g.2987362C>T	ENSP00000246112:p.Pro184Ser		J3KMZ1	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom,prints_Groucho_enhance	p.P184S	ENST00000246112.4	37	c.550	CCDS45910.1	19	.	.	.	.	.	.	.	.	.	.	C	11.35	1.613564	0.28712	.	.	ENSG00000104953	ENST00000246112;ENST00000452088;ENST00000441927	T;T	0.22134	1.97;2.15	2.37	2.37	0.29283	.	.	.	.	.	T	0.29223	0.0727	L	0.29908	0.895	0.09310	N	1	D;D	0.76494	0.999;0.999	D;D	0.68483	0.958;0.952	T	0.05162	-1.0902	9	0.52906	T	0.07	.	8.3175	0.32108	0.0:1.0:0.0:0.0	.	61;61	Q9H808;Q6PJM9	TLE6_HUMAN;.	S	184;61;61	ENSP00000246112:P184S;ENSP00000406893:P61S	ENSP00000246112:P184S	P	+	1	0	TLE6	2938362	0.011000	0.17503	0.077000	0.20336	0.206000	0.24218	0.977000	0.29475	1.635000	0.50512	0.555000	0.69702	CCA	TLE6	-	NULL	ENSG00000104953		0.637	TLE6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TLE6	HGNC	protein_coding	OTTHUMT00000345996.3	-	0.00	22	0	C	NM_024760		2987362	+1	tier1	-	no_errors	ENST00000246112	ensembl	human	known	74_37	missense	37.93	18	11	SNP	0.252	T
TLR4	7099	genome.wustl.edu	37	9	120475807	120475807	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr9:120475807C>A	ENST00000355622.6	+	3	1502	c.1401C>A	c.(1399-1401)ttC>ttA	p.F467L	TLR4_ENST00000472304.1_3'UTR|TLR4_ENST00000394487.4_Missense_Mutation_p.F427L	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	467					activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	ATGGCATCTTCAATGGCTTGT	0.408																																																	0													99.0	101.0	100.0					9																	120475807		2203	4300	6503	SO:0001583	missense	0			U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.1401C>A	9.37:g.120475807C>A	ENSP00000363089:p.Phe467Leu		A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	pirsf_Toll-like_receptor,pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.F467L	ENST00000355622.6	37	c.1401	CCDS6818.1	9	.	.	.	.	.	.	.	.	.	.	C	12.26	1.883956	0.33255	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	T;T	0.67698	-0.28;-0.28	5.92	-0.756	0.11057	.	0.000000	0.64402	D	0.000001	T	0.66867	0.2833	L	0.28054	0.825	0.37441	D	0.914438	D	0.89917	1.0	D	0.81914	0.995	T	0.67345	-0.5694	10	0.48119	T	0.1	.	11.2992	0.49295	0.0:0.4634:0.0:0.5366	.	467	O00206	TLR4_HUMAN	L	427;467	ENSP00000377997:F427L;ENSP00000363089:F467L	ENSP00000363089:F467L	F	+	3	2	TLR4	119515628	0.001000	0.12720	0.091000	0.20842	0.004000	0.04260	-0.240000	0.08952	-0.063000	0.13065	-1.000000	0.02509	TTC	TLR4	-	pirsf_Toll-like_receptor	ENSG00000136869		0.408	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR4	HGNC	protein_coding	OTTHUMT00000055549.3	-	0.00	38	0	C	NM_138554		120475807	+1	tier1	-	no_errors	ENST00000355622	ensembl	human	known	74_37	missense	80.39	10	41	SNP	0.049	A
TMEM132D	121256	genome.wustl.edu	37	12	129559126	129559126	+	Missense_Mutation	SNP	T	T	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr12:129559126T>G	ENST00000422113.2	-	9	2920	c.2594A>C	c.(2593-2595)aAg>aCg	p.K865T	TMEM132D_ENST00000389441.4_Missense_Mutation_p.K403T	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	865					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		CTGGCCTTTCTTCTTCTGCAG	0.562																																																	0													88.0	89.0	89.0					12																	129559126		2203	4300	6503	SO:0001583	missense	0			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.2594A>C	12.37:g.129559126T>G	ENSP00000408581:p.Lys865Thr		Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	NULL	p.K865T	ENST00000422113.2	37	c.2594	CCDS9266.1	12	.	.	.	.	.	.	.	.	.	.	T	5.534	0.283443	0.10458	.	.	ENSG00000151952	ENST00000389441;ENST00000422113	T;T	0.10099	2.91;3.71	4.2	-1.68	0.08212	.	2.055660	0.02889	N	0.133948	T	0.09992	0.0245	L	0.41961	1.31	0.09310	N	1	B;B	0.16396	0.017;0.004	B;B	0.12837	0.008;0.006	T	0.32241	-0.9914	9	.	.	.	-12.9348	5.5095	0.16872	0.0:0.3327:0.1404:0.5268	.	865;403	Q14C87;Q14C87-2	T132D_HUMAN;.	T	403;865	ENSP00000374092:K403T;ENSP00000408581:K865T	.	K	-	2	0	TMEM132D	128125079	0.000000	0.05858	0.000000	0.03702	0.270000	0.26580	0.267000	0.18552	-0.566000	0.06054	0.379000	0.24179	AAG	TMEM132D	-	NULL	ENSG00000151952		0.562	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132D	HGNC	protein_coding	OTTHUMT00000399592.1	-	0.00	149	0	T	NM_133448		129559126	-1	tier1	-	no_errors	ENST00000422113	ensembl	human	known	74_37	missense	19.38	104	25	SNP	0.001	G
TNFRSF11B	4982	genome.wustl.edu	37	8	119945474	119945474	+	Silent	SNP	G	G	A	rs4876870	byFrequency	TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr8:119945474G>A	ENST00000297350.4	-	2	474	c.96C>T	c.(94-96)gaC>gaT	p.D32D		NM_002546.3	NP_002537.3	O00300	TR11B_HUMAN	tumor necrosis factor receptor superfamily, member 11b	32					apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|negative regulation of bone resorption (GO:0045779)|negative regulation of odontogenesis of dentin-containing tooth (GO:0042489)|response to arsenic-containing substance (GO:0046685)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to magnesium ion (GO:0032026)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|receptor activity (GO:0004872)			breast(1)|central_nervous_system(3)|endometrium(4)|large_intestine(6)|lung(7)|prostate(3)|skin(1)	25	all_cancers(13;3.71e-26)|Lung NSC(37;1.69e-07)|Ovarian(258;0.018)|all_neural(195;0.0592)|Hepatocellular(40;0.234)		STAD - Stomach adenocarcinoma(47;0.00193)			AGGTTTCTTCGTCATAATGAA	0.468													g|||	3	0.000599042	0.0008	0.0	5008	,	,		22584	0.0		0.001	False		,,,				2504	0.001																0								A		0,4406		0,0,2203	249.0	234.0	239.0		96	2.4	0.9	8	dbSNP_111	239	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	TNFRSF11B	NM_002546.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		32/402	119945474	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			U94332	CCDS6326.1	8q24	2008-07-31	2008-07-31		ENSG00000164761	ENSG00000164761		"""Tumor necrosis factor receptor superfamily"""	11909	protein-coding gene	gene with protein product		602643	"""osteoprotegerin"""	OPG		9108485	Standard	NM_002546		Approved	OCIF, TR1	uc003yon.4	O00300	OTTHUMG00000164969	ENST00000297350.4:c.96C>T	8.37:g.119945474G>A			B2R9A8|O60236|Q53FX6|Q9UHP4	Silent	SNP	pirsf_TNFR_11B,pfam_TNFR/NGFR_Cys_rich_reg,pfam_Death_domain,superfamily_DEATH-like_dom,smart_TNFR/NGFR_Cys_rich_reg,smart_Death_domain,prints_TNFR_11B,prints_TNFR_11,pfscan_TNFR/NGFR_Cys_rich_reg	p.D32	ENST00000297350.4	37	c.96	CCDS6326.1	8																																																																																			TNFRSF11B	-	pirsf_TNFR_11B,pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,prints_TNFR_11B	ENSG00000164761		0.468	TNFRSF11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF11B	HGNC	protein_coding	OTTHUMT00000381220.1	-	0.00	49	0	G			119945474	-1	tier1	rs4876870	no_errors	ENST00000297350	ensembl	human	known	74_37	silent	17.97	105	23	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7578528	7578528	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr17:7578528A>T	ENST00000269305.4	-	5	591	c.402T>A	c.(400-402)ttT>ttA	p.F134L	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.F134L|TP53_ENST00000455263.2_Missense_Mutation_p.F134L|TP53_ENST00000420246.2_Missense_Mutation_p.F134L|TP53_ENST00000413465.2_Missense_Mutation_p.F134L|TP53_ENST00000359597.4_Missense_Mutation_p.F134L	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	134	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		F -> C (in sporadic cancers; somatic mutation).|F -> I (in sporadic cancers; somatic mutation).|F -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|F -> S (in sporadic cancers; somatic mutation).|F -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.F134L(3)|p.M133fs*36(3)|p.N131fs*27(2)|p.V73fs*9(1)|p.F134_T140>S(1)|p.C135_T140delCQLAKT(1)|p.?(1)|p.C135fs*14(1)|p.Y126fs*11(1)|p.K132_A138delKMFCQLA(1)|p.F134F(1)|p.S127_Q136del10(1)|p.C135fs*36(1)|p.C135T(1)|p.F134fs*14(1)|p.M133fs*13(1)|p.M40fs*36(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCAGTTGGCAAAACATCTTGT	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	30	Deletion - Frameshift(10)|Whole gene deletion(8)|Substitution - Missense(4)|Deletion - In frame(3)|Insertion - Frameshift(2)|Complex - deletion inframe(1)|Unknown(1)|Substitution - coding silent(1)	breast(10)|bone(4)|large_intestine(3)|central_nervous_system(3)|lung(3)|urinary_tract(2)|oesophagus(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)											48.0	49.0	49.0					17																	7578528		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.402T>A	17.37:g.7578528A>T	ENSP00000269305:p.Phe134Leu		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.F134L	ENST00000269305.4	37	c.402	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	25.4	4.638381	0.87760	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99836	-7.05;-7.05;-7.05;-7.05;-7.05;-7.05;-7.05;-7.05;-7.05	5.48	-2.25	0.06888	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.054280	0.64402	D	0.000001	D	0.99732	0.9895	M	0.83483	2.645	0.52501	D	0.999957	D;D;D;D;D;D;D	0.89917	0.998;0.994;0.992;0.987;1.0;0.999;1.0	D;D;D;P;D;D;D	0.83275	0.931;0.98;0.95;0.765;0.996;0.993;0.971	D	0.97988	1.0353	10	0.87932	D	0	-24.5315	15.012	0.71557	0.2332:0.0:0.7668:0.0	.	95;134;134;41;134;134;134	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	L	134;134;134;134;134;134;123;41;2;41;2;134	ENSP00000410739:F134L;ENSP00000352610:F134L;ENSP00000269305:F134L;ENSP00000398846:F134L;ENSP00000391127:F134L;ENSP00000391478:F134L;ENSP00000425104:F2L;ENSP00000423862:F41L;ENSP00000424104:F134L	ENSP00000269305:F134L	F	-	3	2	TP53	7519253	1.000000	0.71417	0.990000	0.47175	0.793000	0.44817	1.912000	0.39946	-0.326000	0.08564	-0.256000	0.11100	TTT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	43	0	A	NM_000546		7578528	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	73.47	13	36	SNP	1.000	T
TOB1	10140	genome.wustl.edu	37	17	48941282	48941282	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr17:48941282C>G	ENST00000268957.3	-	3	525	c.97G>C	c.(97-99)Gaa>Caa	p.E33Q	TOB1-AS1_ENST00000416263.3_RNA|TOB1_ENST00000509385.1_5'UTR|TOB1_ENST00000499247.2_Missense_Mutation_p.E33Q|TOB1-AS1_ENST00000523470.1_RNA	NM_001243877.1	NP_001230806.1	P50616	TOB1_HUMAN	transducer of ERBB2, 1	33					negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060212)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of translation (GO:0017148)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of signal transduction (GO:0009967)|SMAD protein import into nucleus (GO:0007184)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	receptor tyrosine kinase binding (GO:0030971)|SH3/SH2 adaptor activity (GO:0005070)|transcription corepressor activity (GO:0003714)	p.R22fs*5(1)		breast(1)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			AGAAGTCTTTCAAGTTCTTCA	0.388																																					NSCLC(144;643 1919 24513 29423 40686)												1	Deletion - Frameshift(1)	liver(1)											106.0	108.0	108.0					17																	48941282		2203	4300	6503	SO:0001583	missense	0			D38305	CCDS11576.1	17q21.33	2012-08-14			ENSG00000141232	ENSG00000141232			11979	protein-coding gene	gene with protein product		605523		TROB1		8632892, 17785442	Standard	NM_005749		Approved	TOB, TROB	uc002isw.3	P50616	OTTHUMG00000162277	ENST00000268957.3:c.97G>C	17.37:g.48941282C>G	ENSP00000268957:p.Glu33Gln		B2R9T0|D3DTY3|Q4KMQ0	Missense_Mutation	SNP	pfam_Anti_prolifrtn,smart_Anti_prolifrtn,prints_Anti_prolifrtn	p.E33Q	ENST00000268957.3	37	c.97	CCDS11576.1	17	.	.	.	.	.	.	.	.	.	.	C	16.82	3.229830	0.58777	.	.	ENSG00000141232	ENST00000499247;ENST00000268957	T;T	0.50813	0.73;0.73	5.66	5.66	0.87406	Anti-proliferative protein (3);	0.000000	0.85682	D	0.000000	T	0.64305	0.2586	L	0.47016	1.485	0.80722	D	1	D	0.76494	0.999	D	0.70935	0.971	T	0.63637	-0.6592	10	0.56958	D	0.05	.	19.7503	0.96265	0.0:1.0:0.0:0.0	.	33	P50616	TOB1_HUMAN	Q	33	ENSP00000427695:E33Q;ENSP00000268957:E33Q	ENSP00000268957:E33Q	E	-	1	0	TOB1	46296281	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.487000	0.81328	2.648000	0.89879	0.655000	0.94253	GAA	TOB1	-	pfam_Anti_prolifrtn,smart_Anti_prolifrtn,prints_Anti_prolifrtn	ENSG00000141232		0.388	TOB1-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	TOB1	HGNC	protein_coding	OTTHUMT00000368364.1	-	0.00	39	0	C			48941282	-1	tier1	-	no_errors	ENST00000268957	ensembl	human	known	74_37	missense	27.08	35	13	SNP	1.000	G
TPRG1	285386	genome.wustl.edu	37	3	188933129	188933129	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr3:188933129G>C	ENST00000345063.3	+	3	426	c.259G>C	c.(259-261)Gag>Cag	p.E87Q	TPRG1_ENST00000433971.1_Missense_Mutation_p.E87Q	NM_198485.3	NP_940887.1	Q6ZUI0	TPRG1_HUMAN	tumor protein p63 regulated 1	87						cytoplasm (GO:0005737)				endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|skin(2)|urinary_tract(1)	16	all_cancers(143;6.12e-12)|all_hematologic(3;0.0359)|Ovarian(172;0.0925)	all_lung(153;8.23e-09)|Lung NSC(153;3.55e-06)|all_neural(597;0.0019)|Myeloproliferative disorder(1037;0.0255)	Lung(62;6.93e-06)	GBM - Glioblastoma multiforme(93;4.77e-14)		TCACGTAGCTGAGACTTCTGG	0.493																																																	0													83.0	76.0	78.0					3																	188933129		2203	4300	6503	SO:0001583	missense	0			AK125682	CCDS3292.1	3q28	2008-02-04	2008-01-16	2008-01-16	ENSG00000188001	ENSG00000188001			24759	protein-coding gene	gene with protein product			"""family with sequence similarity 79, member B"""	FAM79B			Standard	NM_198485		Approved	FLJ41238, FLJ43694	uc003frw.2	Q6ZUI0	OTTHUMG00000156321	ENST00000345063.3:c.259G>C	3.37:g.188933129G>C	ENSP00000341031:p.Glu87Gln			Missense_Mutation	SNP	pfam_Inositol_phosphatase	p.E87Q	ENST00000345063.3	37	c.259	CCDS3292.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.273|9.273	1.046111|1.046111	0.19748|0.19748	.|.	.|.	ENSG00000188001|ENSG00000188001	ENST00000433971;ENST00000412373;ENST00000345063;ENST00000456832|ENST00000425670	.|.	.|.	.|.	5.27|5.27	-0.219|-0.219	0.13135|0.13135	.|.	0.695370|.	0.15654|.	N|.	0.251227|.	T|.	0.14960|.	0.0361|.	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B|.	0.09022|.	0.002|.	B|.	0.10450|.	0.005|.	T|.	0.26780|.	-1.0093|.	9|.	0.30078|.	T|.	0.28|.	-2.6688|-2.6688	4.6986|4.6986	0.12816|0.12816	0.405:0.1683:0.4268:0.0|0.405:0.1683:0.4268:0.0	.|.	87|.	Q6ZUI0|.	TPRG1_HUMAN|.	Q|S	87|14	.|.	ENSP00000341031:E87Q|.	E|X	+|+	1|2	0|2	TPRG1|TPRG1	190415823|190415823	0.007000|0.007000	0.16637|0.16637	0.111000|0.111000	0.21465|0.21465	0.901000|0.901000	0.52897|0.52897	-0.170000|-0.170000	0.09897|0.09897	-0.265000|-0.265000	0.09352|0.09352	0.655000|0.655000	0.94253|0.94253	GAG|TGA	TPRG1	-	pfam_Inositol_phosphatase	ENSG00000188001		0.493	TPRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPRG1	HGNC	protein_coding	OTTHUMT00000343931.1	-	0.00	37	0	G	NM_198485		188933129	+1	tier1	-	no_errors	ENST00000345063	ensembl	human	known	74_37	missense	14.10	67	11	SNP	0.113	C
TPTEP1	387590	genome.wustl.edu	37	22	17131536	17131537	+	lincRNA	INS	-	-	CTG	rs34452519|rs145731851	byFrequency	TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr22:17131536_17131537insCTG	ENST00000426585.1	+	0	2562_2563									transmembrane phosphatase with tensin homology pseudogene 1																		TGCCCACTCTTCTGGTCTCATG	0.54														912	0.182109	0.0265	0.0865	5008	,	,		18499	0.2569		0.2256	False		,,,				2504	0.3384																0																																												0					22q11.1	2013-10-15			ENSG00000100181	ENSG00000100181			43648	pseudogene	pseudogene						14659893	Standard	NR_001591		Approved	psiTPTE22	uc002zlr.3		OTTHUMG00000141300		22.37:g.17131537_17131539dupCTG				RNA	INS	-	NULL	ENST00000426585.1	37	NULL		22																																																																																			TPTEP1	-	-	ENSG00000100181		0.540	TPTEP1-002	KNOWN	basic	lincRNA	TPTEP1	HGNC	lincRNA	OTTHUMT00000280575.1		0.00	18	0	-	NR_001591		17131537	+1	tier1		no_errors	ENST00000426585	ensembl	human	known	74_37	rna	22.22	14	4	INS	0.999:0.999	CTG
TRMT10C	54931	genome.wustl.edu	37	3	101284019	101284019	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr3:101284019T>C	ENST00000309922.6	+	2	548	c.394T>C	c.(394-396)Tat>Cat	p.Y132H		NM_017819.2	NP_060289.2	Q7L0Y3	MRRP1_HUMAN	tRNA methyltransferase 10 homolog C (S. cerevisiae)	132					mitochondrial RNA 5'-end processing (GO:0000964)|tRNA processing (GO:0008033)	mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)										aaaaaaaaaatatttaaaata	0.338																																																	0													18.0	17.0	17.0					3																	101284019		1749	3971	5720	SO:0001583	missense	0			AK000439	CCDS43122.1	3q12.3	2012-06-28	2012-06-28	2012-06-28	ENSG00000174173	ENSG00000174173			26022	protein-coding gene	gene with protein product	"""mitochondrial RNase P subunit 1"""	615423	"""RNA (guanine-9-) methyltransferase domain containing 1"""	RG9MTD1		18984158	Standard	NM_017819		Approved	FLJ20432, MRPP1	uc003duz.4	Q7L0Y3	OTTHUMG00000159114	ENST00000309922.6:c.394T>C	3.37:g.101284019T>C	ENSP00000312356:p.Tyr132His		Q9NRG5|Q9NX54|Q9Y596	Missense_Mutation	SNP	pfam_tRNA_m1G_MeTrfase	p.Y132H	ENST00000309922.6	37	c.394	CCDS43122.1	3	.	.	.	.	.	.	.	.	.	.	T	17.45	3.393368	0.62066	.	.	ENSG00000174173	ENST00000309922;ENST00000495642	T;T	0.40756	1.02;1.02	6.17	4.91	0.64330	.	0.360058	0.29579	N	0.011751	T	0.60573	0.2279	M	0.72894	2.215	0.48040	D	0.999571	D	0.76494	0.999	D	0.67231	0.95	T	0.59511	-0.7441	10	0.37606	T	0.19	-26.5936	13.8922	0.63747	0.1213:0.0:0.0:0.8787	.	132	Q7L0Y3	MRRP1_HUMAN	H	132	ENSP00000312356:Y132H;ENSP00000419389:Y132H	ENSP00000312356:Y132H	Y	+	1	0	RG9MTD1	102766709	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	4.588000	0.60999	2.371000	0.80710	0.533000	0.62120	TAT	TRMT10C	-	NULL	ENSG00000174173		0.338	TRMT10C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRMT10C	HGNC	protein_coding	OTTHUMT00000353400.2	-	0.00	18	0	T	NM_017819		101284019	+1	tier1	-	no_errors	ENST00000309922	ensembl	human	known	74_37	missense	28.57	15	6	SNP	1.000	C
TRPC6	7225	genome.wustl.edu	37	11	101323836	101323836	+	Splice_Site	SNP	C	C	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr11:101323836C>A	ENST00000344327.3	-	13	3070	c.2646G>T	c.(2644-2646)ggG>ggT	p.G882G	TRPC6_ENST00000348423.4_Splice_Site_p.G766G|TRPC6_ENST00000360497.4_Splice_Site_p.G827G|TRPC6_ENST00000532133.1_Splice_Site_p.G804G	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	882					aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		CCTTCAGTTCCCCTTTGAAAG	0.398																																					Colon(166;1315 1927 11094 12848 34731)												0													107.0	104.0	105.0					11																	101323836		2203	4300	6503	SO:0001630	splice_region_variant	0			AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.2645-1G>T	11.37:g.101323836C>A			Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Silent	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,pfam_PKD1_2_channel,superfamily_Ankyrin_rpt-contain_dom,superfamily_ARM-type_fold,smart_Ankyrin_rpt,prints_TRPC6_channel,prints_TRPC_channel,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,tigrfam_TRP_channel	p.G882	ENST00000344327.3	37	c.2646	CCDS8311.1	11																																																																																			TRPC6	-	superfamily_ARM-type_fold,tigrfam_TRP_channel	ENSG00000137672		0.398	TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC6	HGNC	protein_coding	OTTHUMT00000394770.1	-	0.00	36	0	C	NM_004621	Silent	101323836	-1	tier1	-	no_errors	ENST00000344327	ensembl	human	known	74_37	silent	32.14	19	9	SNP	1.000	A
TTC16	158248	genome.wustl.edu	37	9	130478440	130478440	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr9:130478440G>A	ENST00000373289.3	+	1	96	c.16G>A	c.(16-18)Gag>Aag	p.E6K	PTRH1_ENST00000419060.1_5'UTR|PTRH1_ENST00000429848.1_5'UTR|PTRH1_ENST00000423807.1_5'Flank|TTC16_ENST00000393748.4_5'UTR|PTRH1_ENST00000543175.1_5'Flank	NM_144965.1	NP_659402.1	Q8NEE8	TTC16_HUMAN	tetratricopeptide repeat domain 16	6										central_nervous_system(2)|endometrium(3)|lung(7)|ovary(3)|pancreas(2)|prostate(4)|skin(1)	22						AGATTCGGACGAGGTGCGGGC	0.652																																																	0													81.0	87.0	85.0					9																	130478440		2203	4300	6503	SO:0001583	missense	0			AK057342	CCDS6875.1	9q34.13	2013-01-10			ENSG00000167094	ENSG00000167094		"""Tetratricopeptide (TTC) repeat domain containing"""	26536	protein-coding gene	gene with protein product						12477932	Standard	NM_144965		Approved	FLJ32780	uc004brq.1	Q8NEE8	OTTHUMG00000020711	ENST00000373289.3:c.16G>A	9.37:g.130478440G>A	ENSP00000362386:p.Glu6Lys		B4DYG4|B5ME24|Q5JU66|Q96M72	Missense_Mutation	SNP	pfam_TPR_2,pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E6K	ENST00000373289.3	37	c.16	CCDS6875.1	9	.	.	.	.	.	.	.	.	.	.	G	10.86	1.469834	0.26423	.	.	ENSG00000167094	ENST00000373289	T	0.18174	2.23	3.55	-2.17	0.07059	.	0.385573	0.19079	N	0.123285	T	0.07683	0.0193	N	0.17082	0.46	0.30323	N	0.787444	B;B	0.25169	0.119;0.119	B;B	0.17979	0.02;0.02	T	0.11941	-1.0567	10	0.45353	T	0.12	-22.0649	5.6204	0.17453	0.2178:0.49:0.2922:0.0	.	6;6	B4DZ42;Q8NEE8	.;TTC16_HUMAN	K	6	ENSP00000362386:E6K	ENSP00000362386:E6K	E	+	1	0	TTC16	129518261	0.004000	0.15560	0.003000	0.11579	0.015000	0.08874	-0.150000	0.10189	-0.449000	0.07117	-0.448000	0.05591	GAG	TTC16	-	NULL	ENSG00000167094		0.652	TTC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC16	HGNC	protein_coding	OTTHUMT00000054224.1	-	0.00	69	0	G	NM_144965		130478440	+1	tier1	-	no_errors	ENST00000373289	ensembl	human	known	74_37	missense	26.61	79	29	SNP	0.003	A
TTC7B	145567	genome.wustl.edu	37	14	91110514	91110514	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr14:91110514C>A	ENST00000328459.6	-	15	1750	c.1629G>T	c.(1627-1629)caG>caT	p.Q543H	TTC7B_ENST00000554654.1_5'UTR|TTC7B_ENST00000357056.2_Missense_Mutation_p.Q543H|RP11-1078H9.5_ENST00000553826.1_RNA|RP11-1078H9.5_ENST00000557007.1_RNA	NM_001010854.1	NP_001010854.1	Q86TV6	TTC7B_HUMAN	tetratricopeptide repeat domain 7B	543										NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	36		Melanoma(154;0.222)				CACCTTGAAGCTGAAGAGCTT	0.507																																																	0													136.0	126.0	129.0					14																	91110514		2203	4300	6503	SO:0001583	missense	0			BC035865	CCDS32140.1	14q32.12	2013-01-11	2004-06-02	2004-06-04		ENSG00000165914		"""Tetratricopeptide (TTC) repeat domain containing"""	19858	protein-coding gene	gene with protein product			"""tetratricopeptide repeat domain 7 like 1"""	TTC7L1			Standard	XM_005267367		Approved		uc001xyp.3	Q86TV6		ENST00000328459.6:c.1629G>T	14.37:g.91110514C>A	ENSP00000336127:p.Gln543His		Q86U24|Q86VT3	Missense_Mutation	SNP	pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.Q543H	ENST00000328459.6	37	c.1629	CCDS32140.1	14	.	.	.	.	.	.	.	.	.	.	C	20.2	3.947747	0.73787	.	.	ENSG00000165914	ENST00000555768;ENST00000357056;ENST00000328459;ENST00000553972;ENST00000540938	T;T;T	0.79247	-1.25;-1.25;1.1	5.8	-5.65	0.02459	Protein prenyltransferase (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	D	0.83408	0.5248	M	0.61703	1.905	0.54753	D	0.999988	D	0.67145	0.996	D	0.75484	0.986	D	0.83450	0.0048	10	0.59425	D	0.04	-16.28	17.7439	0.88414	0.0:0.6882:0.0:0.3118	.	543	Q86TV6	TTC7B_HUMAN	H	441;543;543;13;285	ENSP00000349564:Q543H;ENSP00000336127:Q543H;ENSP00000451440:Q13H	ENSP00000336127:Q543H	Q	-	3	2	TTC7B	90180267	0.620000	0.27068	0.888000	0.34837	0.921000	0.55340	-0.155000	0.10115	-1.074000	0.03132	-0.982000	0.02568	CAG	TTC7B	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000165914		0.507	TTC7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC7B	HGNC	protein_coding	OTTHUMT00000411364.2	-	0.00	48	0	C			91110514	-1	tier1	-	no_errors	ENST00000357056	ensembl	human	known	74_37	missense	56.25	28	36	SNP	0.987	A
TTL	150465	genome.wustl.edu	37	2	113286627	113286627	+	3'UTR	SNP	G	G	A	rs540774000	byFrequency	TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr2:113286627G>A	ENST00000233336.6	+	0	1580				TTL_ENST00000460450.1_3'UTR	NM_153712.4	NP_714923.1	Q8NG68	TTL_HUMAN	tubulin tyrosine ligase						cellular protein modification process (GO:0006464)|microtubule cytoskeleton organization (GO:0000226)|regulation of axon extension (GO:0030516)		ATP binding (GO:0005524)|tubulin-tyrosine ligase activity (GO:0004835)			breast(1)|large_intestine(2)|ovary(1)	4		Ovarian(717;0.024)		BRCA - Breast invasive adenocarcinoma(221;6.17e-07)|STAD - Stomach adenocarcinoma(1183;0.00644)		GCAGCTTTGTGAGCAGAGCTC	0.592			T	ETV6	ALL								G|||	2	0.000399361	0.0	0.0	5008	,	,		21462	0.0		0.0	False		,,,				2504	0.002							Dom	yes		2	2q13	150465	tubulin tyrosine ligase		L	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS2096.1	2q13	2010-04-21			ENSG00000114999	ENSG00000114999	6.3.2.25		21586	protein-coding gene	gene with protein product		608291				11431336	Standard	NM_153712		Approved	MGC46235	uc002thu.3	Q8NG68	OTTHUMG00000131316	ENST00000233336.6:c.*255G>A	2.37:g.113286627G>A			Q585T3|Q7Z302|Q8N426	RNA	SNP	-	NULL	ENST00000233336.6	37	NULL	CCDS2096.1	2																																																																																			TTL	-	-	ENSG00000114999		0.592	TTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTL	HGNC	protein_coding	OTTHUMT00000254085.2	-	0.00	39	0	G	NM_153712		113286627	+1	tier1	-	no_errors	ENST00000460450	ensembl	human	known	74_37	rna	16.67	30	6	SNP	0.019	A
UMPS	7372	genome.wustl.edu	37	3	124459038	124459038	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr3:124459038A>G	ENST00000232607.2	+	4	1256	c.1150A>G	c.(1150-1152)Aga>Gga	p.R384G	UMPS_ENST00000538242.1_Missense_Mutation_p.R206G|UMPS_ENST00000536109.1_Missense_Mutation_p.R292G|UMPS_ENST00000413078.2_Intron	NM_000373.3	NP_000364.1	P11172	UMPS_HUMAN	uridine monophosphate synthetase	384	OMPdecase.				'de novo' pyrimidine nucleobase biosynthetic process (GO:0006207)|'de novo' UMP biosynthetic process (GO:0044205)|cellular response to drug (GO:0035690)|female pregnancy (GO:0007565)|lactation (GO:0007595)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside biosynthetic process (GO:0046134)|small molecule metabolic process (GO:0044281)|UMP biosynthetic process (GO:0006222)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	orotate phosphoribosyltransferase activity (GO:0004588)|orotidine-5'-phosphate decarboxylase activity (GO:0004590)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16				GBM - Glioblastoma multiforme(114;0.146)	Fluorouracil(DB00544)	GGACTACACTAGAGCAGCGGT	0.587																																																	0													72.0	79.0	77.0					3																	124459038		2203	4300	6503	SO:0001583	missense	0				CCDS3029.1	3q13	2008-02-04	2008-02-04		ENSG00000114491	ENSG00000114491	2.4.2.10, 4.1.1.23		12563	protein-coding gene	gene with protein product	"""orotate phosphoribosyl transferase and orotidine-5'-decarboxylase"""	613891				2767686	Standard	NM_000373		Approved		uc003ehl.4	P11172	OTTHUMG00000159431	ENST00000232607.2:c.1150A>G	3.37:g.124459038A>G	ENSP00000232607:p.Arg384Gly		B5LY68|B5LY72|O00758|O00759|O00760|Q16862|Q9H3Q2|Q9UG49	Missense_Mutation	SNP	pfam_OMPdeCOase_dom,pfam_PRibTrfase_dom,superfamily_RibuloseP-bd_barrel,smart_OMPdeCOase_dom,tigrfam_OMPdecase,tigrfam_Or_phspho_trans_dom	p.R384G	ENST00000232607.2	37	c.1150	CCDS3029.1	3	.	.	.	.	.	.	.	.	.	.	A	8.286	0.816617	0.16607	.	.	ENSG00000114491	ENST00000232607;ENST00000536109;ENST00000538242	T;T;T	0.62788	-0.0;-0.0;-0.0	6.07	-0.864	0.10666	Orotidine 5&apos (2);Aldolase-type TIM barrel (1);-phosphate decarboxylase domain (2);Ribulose-phosphate binding barrel (1);	0.827441	0.11453	N	0.562593	T	0.46092	0.1375	L	0.34521	1.04	0.09310	N	1	B;B	0.14805	0.011;0.001	B;B	0.18263	0.021;0.016	T	0.35574	-0.9783	10	0.45353	T	0.12	-1.6791	6.5387	0.22369	0.5782:0.1184:0.3034:0.0	.	206;384	B5LY70;P11172	.;UMPS_HUMAN	G	384;292;206	ENSP00000232607:R384G;ENSP00000443577:R292G;ENSP00000444988:R206G	ENSP00000232607:R384G	R	+	1	2	UMPS	125941728	0.004000	0.15560	0.133000	0.22050	0.412000	0.31113	0.429000	0.21412	-0.074000	0.12820	-0.313000	0.08912	AGA	UMPS	-	pfam_OMPdeCOase_dom,superfamily_RibuloseP-bd_barrel,smart_OMPdeCOase_dom,tigrfam_OMPdecase	ENSG00000114491		0.587	UMPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UMPS	HGNC	protein_coding	OTTHUMT00000355271.1	-	0.00	30	0	A	NM_000373		124459038	+1	tier1	-	no_errors	ENST00000232607	ensembl	human	known	74_37	missense	27.42	45	17	SNP	0.000	G
UPF3B	65109	genome.wustl.edu	37	X	118979254	118979254	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chrX:118979254C>T	ENST00000276201.2	-	4	445	c.376G>A	c.(376-378)Gaa>Aaa	p.E126K	UPF3B_ENST00000478840.1_5'Flank|UPF3B_ENST00000345865.2_Missense_Mutation_p.E126K	NM_080632.2	NP_542199.1	Q9BZI7	REN3B_HUMAN	UPF3 regulator of nonsense transcripts homolog B (yeast)	126	Necessary for interaction with UPF2.|Sufficient for association with EJC core.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(12)|ovary(2)|prostate(1)	30						GCGGGATATTCCTGACCTGTT	0.353																																																	0													87.0	79.0	82.0					X																	118979254		2202	4300	6502	SO:0001583	missense	0			AF318576	CCDS14587.1, CCDS14588.1	Xq25-q26	2014-01-31			ENSG00000125351	ENSG00000125351			20439	protein-coding gene	gene with protein product		300298	"""mental retardation, X-linked 62"""	MRX62		11113196, 11163187, 19238151	Standard	NM_023010		Approved	RENT3B, UPF3X, HUPF3B	uc004erz.2	Q9BZI7	OTTHUMG00000022282	ENST00000276201.2:c.376G>A	X.37:g.118979254C>T	ENSP00000276201:p.Glu126Lys		D3DWI3|D3DWI4|Q0VAK8|Q9H1J0	Missense_Mutation	SNP	pfam_Nonsense_mediated_decay_UPF3	p.E126K	ENST00000276201.2	37	c.376	CCDS14588.1	X	.	.	.	.	.	.	.	.	.	.	C	27.0	4.787597	0.90367	.	.	ENSG00000125351	ENST00000276201;ENST00000345865;ENST00000439808	T;T	0.63580	-0.05;-0.05	5.08	5.08	0.68730	Regulator of nonsense-mediated decay, UPF3 (1);Nucleotide-binding, alpha-beta plait (1);	0.000000	0.85682	D	0.000000	T	0.80407	0.4617	M	0.80422	2.495	0.80722	D	1	D;D	0.76494	0.996;0.999	D;D	0.83275	0.99;0.996	D	0.83768	0.0218	10	0.87932	D	0	.	16.5031	0.84262	0.0:1.0:0.0:0.0	.	126;126	Q9BZI7-2;Q9BZI7	.;REN3B_HUMAN	K	126	ENSP00000276201:E126K;ENSP00000245418:E126K	ENSP00000276201:E126K	E	-	1	0	UPF3B	118863282	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.413000	0.80104	2.098000	0.63641	0.506000	0.49869	GAA	UPF3B	-	pfam_Nonsense_mediated_decay_UPF3	ENSG00000125351		0.353	UPF3B-001	KNOWN	basic|CCDS	protein_coding	UPF3B	HGNC	protein_coding	OTTHUMT00000058068.1	-	0.00	27	0	C			118979254	-1	tier1	-	no_errors	ENST00000276201	ensembl	human	known	74_37	missense	54.17	11	13	SNP	1.000	T
USP21	27005	genome.wustl.edu	37	1	161133747	161133747	+	Missense_Mutation	SNP	T	T	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr1:161133747T>G	ENST00000289865.8	+	8	1415	c.1194T>G	c.(1192-1194)tgT>tgG	p.C398W	USP21_ENST00000493054.1_Intron|USP21_ENST00000368002.3_Missense_Mutation_p.C398W|PPOX_ENST00000432542.2_5'Flank|PPOX_ENST00000367999.4_5'Flank|PPOX_ENST00000544598.1_5'Flank|USP21_ENST00000368001.1_Missense_Mutation_p.C398W|PPOX_ENST00000535223.1_5'Flank|PPOX_ENST00000352210.5_5'Flank	NM_012475.4	NP_036607.3	Q9UK80	UBP21_HUMAN	ubiquitin specific peptidase 21	398	USP.				histone deubiquitination (GO:0016578)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	cysteine-type peptidase activity (GO:0008234)|metal ion binding (GO:0046872)|NEDD8-specific protease activity (GO:0019784)|transcription coactivator activity (GO:0003713)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(10)|ovary(3)|prostate(3)	29	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			AGGTTTTTTGTGACCTGTCCC	0.582																																																	0													111.0	102.0	105.0					1																	161133747		2203	4300	6503	SO:0001583	missense	0			AF177758	CCDS30920.1	1q22	2008-04-11	2005-08-08		ENSG00000143258	ENSG00000143258		"""Ubiquitin-specific peptidases"""	12620	protein-coding gene	gene with protein product		604729	"""ubiquitin specific protease 21"""	USP23		12838346, 10799498	Standard	XM_006711273		Approved	USP16	uc010pkd.2	Q9UK80	OTTHUMG00000033154	ENST00000289865.8:c.1194T>G	1.37:g.161133747T>G	ENSP00000289865:p.Cys398Trp		Q59H60|Q5BKT5|Q5VTW9|Q5VTX0|Q9BTV1|Q9HBS2|Q9NYN4	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.C398W	ENST00000289865.8	37	c.1194	CCDS30920.1	1	.	.	.	.	.	.	.	.	.	.	T	0.008	-1.906249	0.00512	.	.	ENSG00000143258	ENST00000368002;ENST00000289865;ENST00000368001	T;T;T	0.02682	4.2;4.2;4.2	4.91	3.76	0.43208	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.054508	0.85682	D	0.000000	T	0.00356	0.0011	N	0.03304	-0.355	0.80722	D	1	B	0.09022	0.002	B	0.12156	0.007	T	0.43605	-0.9381	10	0.02654	T	1	.	3.8443	0.08928	0.0:0.169:0.1931:0.6379	.	398	Q9UK80	UBP21_HUMAN	W	398	ENSP00000356981:C398W;ENSP00000289865:C398W;ENSP00000356980:C398W	ENSP00000289865:C398W	C	+	3	2	USP21	159400371	0.997000	0.39634	1.000000	0.80357	0.340000	0.28889	0.220000	0.17660	0.863000	0.35553	-0.466000	0.05196	TGT	USP21	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000143258		0.582	USP21-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	USP21	HGNC	protein_coding	OTTHUMT00000080801.1	-	0.00	76	0	T			161133747	+1	tier1	-	no_errors	ENST00000289865	ensembl	human	known	74_37	missense	43.02	49	37	SNP	1.000	G
URB2	9816	genome.wustl.edu	37	1	229771466	229771466	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr1:229771466A>G	ENST00000258243.2	+	4	1242	c.1106A>G	c.(1105-1107)aAc>aGc	p.N369S		NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	369						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						TCAGTGGCCAACAACAATATC	0.502																																																	0													52.0	52.0	52.0					1																	229771466		2203	4300	6503	SO:0001583	missense	0			D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	ENST00000258243.2:c.1106A>G	1.37:g.229771466A>G	ENSP00000258243:p.Asn369Ser		Q5VYC9	Missense_Mutation	SNP	pfam_Urb2/Npa2_C	p.N369S	ENST00000258243.2	37	c.1106	CCDS31052.1	1	.	.	.	.	.	.	.	.	.	.	A	0.004	-2.336941	0.00224	.	.	ENSG00000135763	ENST00000258243	T	0.25414	1.8	5.2	-5.99	0.02213	.	0.792301	0.12525	N	0.461313	T	0.07279	0.0184	N	0.02011	-0.69	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.41288	-0.9517	9	.	.	.	-1.1267	10.8584	0.46812	0.2223:0.2347:0.5431:0.0	.	369	Q14146	URB2_HUMAN	S	369	ENSP00000258243:N369S	.	N	+	2	0	URB2	227838089	0.000000	0.05858	0.000000	0.03702	0.102000	0.19082	0.083000	0.14871	-0.982000	0.03515	-0.417000	0.06048	AAC	URB2	-	NULL	ENSG00000135763		0.502	URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	URB2	HGNC	protein_coding	OTTHUMT00000095232.1	-	0.00	38	0	A	NM_014777		229771466	+1	tier1	-	no_errors	ENST00000258243	ensembl	human	known	74_37	missense	43.59	22	17	SNP	0.000	G
USP3	9960	genome.wustl.edu	37	15	63866552	63866552	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr15:63866552G>C	ENST00000380324.3	+	11	1175	c.1046G>C	c.(1045-1047)aGa>aCa	p.R349T	USP3_ENST00000268049.7_Missense_Mutation_p.R327T|USP3-AS1_ENST00000559861.1_RNA|USP3-AS1_ENST00000559357.1_RNA|USP3_ENST00000536001.1_3'UTR|USP3-AS1_ENST00000560350.1_RNA|USP3_ENST00000559711.1_Missense_Mutation_p.R260T|USP3_ENST00000539772.1_Missense_Mutation_p.R100T|USP3_ENST00000540797.1_Missense_Mutation_p.R305T|USP3_ENST00000558285.1_Missense_Mutation_p.R332T	NM_006537.3	NP_006528.2	Q9Y6I4	UBP3_HUMAN	ubiquitin specific peptidase 3	349	USP.				DNA repair (GO:0006281)|histone deubiquitination (GO:0016578)|mitotic cell cycle (GO:0000278)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	nuclear chromatin (GO:0000790)	histone binding (GO:0042393)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(7)|lung(4)	14				GBM - Glioblastoma multiforme(80;0.0187)		AGTCAGTTCAGAAGTAAGCGC	0.308																																																	0													100.0	101.0	100.0					15																	63866552		2203	4300	6503	SO:0001583	missense	0			AF073344	CCDS32265.1, CCDS58370.1	15q22.3	2008-04-11	2005-08-08			ENSG00000140455		"""Ubiquitin-specific peptidases"""	12626	protein-coding gene	gene with protein product		604728	"""ubiquitin specific protease 3"""			12838346	Standard	NM_006537		Approved		uc002amf.4	Q9Y6I4		ENST00000380324.3:c.1046G>C	15.37:g.63866552G>C	ENSP00000369681:p.Arg349Thr		B4DVU5|F5H1A6|Q8WVD0	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfam_Znf_UBP,smart_Znf_UBP,pfscan_Znf_UBP,pfscan_Peptidase_C19/C67	p.R349T	ENST00000380324.3	37	c.1046	CCDS32265.1	15	.	.	.	.	.	.	.	.	.	.	G	23.3	4.401925	0.83120	.	.	ENSG00000140455	ENST00000540797;ENST00000380324;ENST00000268049;ENST00000539772;ENST00000536848;ENST00000538686	T;T;T;T	0.29917	2.07;2.18;2.28;1.55	5.98	5.07	0.68467	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.041366	0.85682	D	0.000000	T	0.33990	0.0882	L	0.35793	1.09	0.48087	D	0.999586	P;P;D;D	0.53462	0.905;0.922;0.96;0.96	P;P;P;P	0.51833	0.553;0.569;0.681;0.681	T	0.03761	-1.1006	10	0.16420	T	0.52	.	15.1806	0.72956	0.0673:0.0:0.9327:0.0	.	305;305;327;349	F5H1A6;B4DVU5;Q6JHV3;Q9Y6I4	.;.;.;UBP3_HUMAN	T	305;349;327;100;264;180	ENSP00000445828:R305T;ENSP00000369681:R349T;ENSP00000268049:R327T;ENSP00000445642:R100T	ENSP00000268049:R327T	R	+	2	0	USP3	61653605	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.476000	0.97823	1.545000	0.49373	0.591000	0.81541	AGA	USP3	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000140455		0.308	USP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP3	HGNC	protein_coding	OTTHUMT00000417773.1	-	0.00	29	0	G			63866552	+1	tier1	-	no_errors	ENST00000380324	ensembl	human	known	74_37	missense	23.81	32	10	SNP	1.000	C
USP31	57478	genome.wustl.edu	37	16	23102050	23102050	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr16:23102050G>T	ENST00000219689.7	-	7	1309	c.1310C>A	c.(1309-1311)aCa>aAa	p.T437K		NM_020718.3	NP_065769.3	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 31	0					ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	57				GBM - Glioblastoma multiforme(48;0.0187)		CTTTGCTGCTGTTTGTGTAGG	0.433																																																	0													125.0	106.0	113.0					16																	23102050		2197	4300	6497	SO:0001583	missense	0			AB033029	CCDS10607.1	16p12.3	2008-02-05	2005-08-08		ENSG00000103404	ENSG00000103404		"""Ubiquitin-specific peptidases"""	20060	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"""			12838346	Standard	NM_020718		Approved	KIAA1203	uc002dll.3	Q70CQ4	OTTHUMG00000094793	ENST00000219689.7:c.1310C>A	16.37:g.23102050G>T	ENSP00000219689:p.Thr437Lys		B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.T437K	ENST00000219689.7	37	c.1310	CCDS10607.1	16	.	.	.	.	.	.	.	.	.	.	G	3.292	-0.144761	0.06627	.	.	ENSG00000103404	ENST00000219689	T	0.06933	3.24	5.83	4.88	0.63580	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	2.795500	0.02050	N	0.050018	T	0.05731	0.0150	N	0.10972	0.075	0.44995	D	0.99801	B	0.27625	0.183	B	0.25506	0.061	T	0.42172	-0.9467	10	0.05525	T	0.97	-0.0075	10.4373	0.44443	0.0747:0.1436:0.7817:0.0	.	437	Q70CQ4	UBP31_HUMAN	K	437	ENSP00000219689:T437K	ENSP00000219689:T437K	T	-	2	0	USP31	23009551	0.939000	0.31865	0.040000	0.18447	0.827000	0.46813	2.858000	0.48356	1.476000	0.48215	-0.145000	0.13849	ACA	USP31	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000103404		0.433	USP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP31	HGNC	protein_coding	OTTHUMT00000211607.1		0.00	86	0	G	NM_020718		23102050	-1			no_errors	ENST00000219689	ensembl	human	known	74_37	missense	5.36	53	3	SNP	0.044	T
USP45	85015	genome.wustl.edu	37	6	99894129	99894129	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr6:99894129G>A	ENST00000327681.6	-	14	2051	c.1519C>T	c.(1519-1521)Cct>Tct	p.P507S	USP45_ENST00000539675.1_Intron|USP45_ENST00000392738.2_Missense_Mutation_p.P187S|USP45_ENST00000369233.2_Missense_Mutation_p.P459S|USP45_ENST00000500704.2_Missense_Mutation_p.P507S	NM_001080481.1	NP_001073950.1	Q70EL2	UBP45_HUMAN	ubiquitin specific peptidase 45	507	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(6)|lung(2)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	22		all_cancers(76;0.000208)|Acute lymphoblastic leukemia(125;8.41e-11)|all_hematologic(75;2.56e-07)|all_epithelial(107;0.122)|Colorectal(196;0.133)		BRCA - Breast invasive adenocarcinoma(108;0.0718)		GATTCTGAAGGCTCACTGTCA	0.493																																																	0													88.0	74.0	79.0					6																	99894129		2203	4300	6503	SO:0001583	missense	0			AL832030	CCDS34501.1	6q16.2	2008-02-05	2005-08-08		ENSG00000123552	ENSG00000123552		"""Ubiquitin-specific peptidases"""	20080	protein-coding gene	gene with protein product			"""ubiquitin specific protease 45"""			12838346	Standard	NM_001080481		Approved	MGC14793	uc003ppx.2	Q70EL2	OTTHUMG00000015267	ENST00000327681.6:c.1519C>T	6.37:g.99894129G>A	ENSP00000333376:p.Pro507Ser		B2RXG0|Q5T062|Q86T44|Q86TC0|Q9BRU1	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfam_Znf_UBP,superfamily_Znf_FYVE_PHD,pfscan_Znf_UBP,pfscan_Peptidase_C19/C67	p.P507S	ENST00000327681.6	37	c.1519	CCDS34501.1	6	.	.	.	.	.	.	.	.	.	.	G	17.29	3.351492	0.61183	.	.	ENSG00000123552	ENST00000392738;ENST00000500704;ENST00000327681;ENST00000369233	T;T;T;T	0.16073	2.37;3.87;3.87;3.84	5.71	3.94	0.45596	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.055177	0.64402	D	0.000001	T	0.04048	0.0113	N	0.17474	0.49	0.80722	D	1	B;B	0.11235	0.003;0.004	B;B	0.14023	0.01;0.009	T	0.22800	-1.0206	10	0.11182	T	0.66	.	16.4569	0.84021	0.0:0.7497:0.2503:0.0	.	507;187	Q70EL2;Q70EL2-3	UBP45_HUMAN;.	S	187;507;507;459	ENSP00000376495:P187S;ENSP00000424372:P507S;ENSP00000333376:P507S;ENSP00000358236:P459S	ENSP00000333376:P507S	P	-	1	0	USP45	100000850	1.000000	0.71417	0.984000	0.44739	0.911000	0.54048	3.457000	0.53007	0.762000	0.33152	-0.133000	0.14855	CCT	USP45	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000123552		0.493	USP45-003	KNOWN	basic|appris_principal|CCDS	protein_coding	USP45	HGNC	protein_coding	OTTHUMT00000041609.2	-	0.00	38	0	G	NM_032929		99894129	-1	tier1	-	no_errors	ENST00000327681	ensembl	human	known	74_37	missense	35.71	17	10	SNP	1.000	A
VCP	7415	genome.wustl.edu	37	9	35067938	35067938	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr9:35067938C>T	ENST00000358901.6	-	3	1147	c.252G>A	c.(250-252)atG>atA	p.M84I		NM_007126.3	NP_009057.1	P55072	TERA_HUMAN	valosin containing protein	84					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|aggresome assembly (GO:0070842)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|establishment of protein localization (GO:0045184)|positive regulation of Lys63-specific deubiquitinase activity (GO:1903007)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein K63-linked deubiquitination (GO:1903006)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|retrograde protein transport, ER to cytosol (GO:0030970)|translesion synthesis (GO:0019985)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Hrd1p ubiquitin ligase complex (GO:0000836)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|proteasome complex (GO:0000502)|site of double-strand break (GO:0035861)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|deubiquitinase activator activity (GO:0035800)|lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|protein domain specific binding (GO:0019904)|protein phosphatase binding (GO:0019903)|ubiquitin-specific protease binding (GO:1990381)			breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			CAACTCTATTCATCCGAATCT	0.478																																																	0													152.0	126.0	135.0					9																	35067938		2203	4300	6503	SO:0001583	missense	0			AC004472	CCDS6573.1	9p13.3	2014-09-17	2011-01-25		ENSG00000165280	ENSG00000165280		"""ATPases / AAA-type"""	12666	protein-coding gene	gene with protein product		601023	"""valosin-containing protein"""			8595912, 7553851	Standard	NM_007126		Approved	IBMPFD, p97	uc003zvy.2	P55072	OTTHUMG00000019855	ENST00000358901.6:c.252G>A	9.37:g.35067938C>T	ENSP00000351777:p.Met84Ile		B2R5T8|Q0V924|Q2TAI5|Q969G7|Q9UCD5	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_CDC4_N-term_subdom,pfam_DNA_helicase_Holl-junc_RuvB_N,pfam_Cdc48_dom2,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-2,pfam_Vps4_C,superfamily_P-loop_NTPase,superfamily_Asp_de-COase-like_dom,smart_AAA+_ATPase,tigrfam_AAA_ATPase_CDC48	p.M84I	ENST00000358901.6	37	c.252	CCDS6573.1	9	.	.	.	.	.	.	.	.	.	.	C	15.45	2.836996	0.50951	.	.	ENSG00000165280	ENST00000358901;ENST00000448530;ENST00000417448	D;D;D	0.82344	-1.6;-1.6;-1.6	5.73	5.73	0.89815	ATPase, AAA-type, VAT, N-terminal (1);Aspartate decarboxylase-like fold (2);	0.000000	0.85682	D	0.000000	T	0.73575	0.3604	N	0.21373	0.66	0.80722	D	1	B	0.06786	0.001	B	0.09377	0.004	T	0.68119	-0.5493	10	0.09590	T	0.72	-16.7921	19.8966	0.96963	0.0:1.0:0.0:0.0	.	84	P55072	TERA_HUMAN	I	84;39;39	ENSP00000351777:M84I;ENSP00000392088:M39I;ENSP00000399456:M39I	ENSP00000351777:M84I	M	-	3	0	VCP	35057938	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.703000	0.84585	2.700000	0.92200	0.655000	0.94253	ATG	VCP	-	pfam_CDC4_N-term_subdom,superfamily_Asp_de-COase-like_dom,tigrfam_AAA_ATPase_CDC48	ENSG00000165280		0.478	VCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VCP	HGNC	protein_coding	OTTHUMT00000052290.1	-	0.00	54	0	C	NM_007126		35067938	-1	tier1	-	no_errors	ENST00000358901	ensembl	human	known	74_37	missense	32.35	46	22	SNP	1.000	T
VEPH1	79674	genome.wustl.edu	37	3	157082201	157082201	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr3:157082201G>T	ENST00000362010.2	-	8	1535	c.1228C>A	c.(1228-1230)Cag>Aag	p.Q410K	RP11-550I24.2_ENST00000487238.1_RNA|VEPH1_ENST00000392832.2_Missense_Mutation_p.Q410K|VEPH1_ENST00000392833.2_Missense_Mutation_p.Q410K|VEPH1_ENST00000543418.1_Missense_Mutation_p.Q410K	NM_001167912.1	NP_001161384.1	Q14D04	MELT_HUMAN	ventricular zone expressed PH domain-containing 1	410						plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|cervix(1)|kidney(3)|large_intestine(9)|lung(22)|ovary(1)|pancreas(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			TCAAAAGCCTGGATTTTAACT	0.373																																																	0													162.0	152.0	155.0					3																	157082201		2203	4300	6503	SO:0001583	missense	0			AL713656	CCDS3179.1, CCDS54661.1, CCDS54662.1, CCDS54663.1	3q24-q25	2013-01-10	2012-12-10		ENSG00000197415	ENSG00000197415		"""Pleckstrin homology (PH) domain containing"""	25735	protein-coding gene	gene with protein product		609594	"""ventricular zone expressed PH domain homolog 1 (zebrafish)"""			11214970, 15388229	Standard	NM_024621		Approved	FLJ12604, KIAA1692	uc003fbk.2	Q14D04	OTTHUMG00000158711	ENST00000362010.2:c.1228C>A	3.37:g.157082201G>T	ENSP00000354919:p.Gln410Lys		D3DNL0|F5GZ91|Q2TAA9|Q3MIX2|Q6PEL3|Q86TL5|Q8TCR3|Q96SP7|Q9C0H1|Q9H9Q7	Missense_Mutation	SNP	pfam_Pleckstrin_homology,superfamily_ARM-type_fold,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.Q410K	ENST00000362010.2	37	c.1228	CCDS3179.1	3	.	.	.	.	.	.	.	.	.	.	G	19.55	3.849609	0.71603	.	.	ENSG00000197415	ENST00000392833;ENST00000362010;ENST00000543418;ENST00000392832	T;T;T;T	0.09630	2.96;3.01;2.96;3.01	5.71	5.71	0.89125	.	0.116735	0.64402	D	0.000015	T	0.15305	0.0369	L	0.36672	1.1	0.80722	D	1	P;P	0.47762	0.802;0.9	B;P	0.47299	0.389;0.543	T	0.02526	-1.1146	10	0.24483	T	0.36	-9.0184	19.8555	0.96756	0.0:0.0:1.0:0.0	.	410;410	Q14D04-2;Q14D04	.;MELT_HUMAN	K	410	ENSP00000376578:Q410K;ENSP00000354919:Q410K;ENSP00000446258:Q410K;ENSP00000376577:Q410K	ENSP00000354919:Q410K	Q	-	1	0	VEPH1	158564895	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.970000	0.76099	2.691000	0.91804	0.650000	0.86243	CAG	VEPH1	-	NULL	ENSG00000197415		0.373	VEPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VEPH1	HGNC	protein_coding	OTTHUMT00000351845.3	-	0.00	47	0	G	NM_024621		157082201	-1	tier1	-	no_errors	ENST00000362010	ensembl	human	known	74_37	missense	16.51	91	18	SNP	1.000	T
VPS13C	54832	genome.wustl.edu	37	15	62214804	62214804	+	Missense_Mutation	SNP	G	G	A	rs200174382		TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr15:62214804G>A	ENST00000261517.5	-	54	6840	c.6767C>T	c.(6766-6768)aCg>aTg	p.T2256M	VPS13C_ENST00000249837.3_Missense_Mutation_p.T2213M|VPS13C_ENST00000395898.3_Missense_Mutation_p.T2213M|VPS13C_ENST00000395896.4_Missense_Mutation_p.T2256M	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						TTCTGTTGCCGTGTCAACACC	0.358																																																	0													152.0	146.0	148.0					15																	62214804		2203	4300	6503	SO:0001583	missense	0			AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.6767C>T	15.37:g.62214804G>A	ENSP00000261517:p.Thr2256Met			Missense_Mutation	SNP	pfam_VPSAP_dom,pfam_Autophagy-rel_C	p.T2256M	ENST00000261517.5	37	c.6767	CCDS32257.1	15	.	.	.	.	.	.	.	.	.	.	G	6.063	0.379986	0.11466	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.41065	1.01;1.01;1.01	5.31	-1.28	0.09318	.	0.791161	0.12638	N	0.451526	T	0.11965	0.0291	N	0.00358	-1.6	0.09310	N	1	B;B;B;B	0.12013	0.002;0.002;0.003;0.005	B;B;B;B	0.14023	0.01;0.01;0.004;0.001	T	0.31943	-0.9925	10	0.45353	T	0.12	.	9.9093	0.41394	0.6198:0.0:0.3802:0.0	.	2213;2256;2213;2256	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	M	2213;2256;2256;2256	ENSP00000249837:T2213M;ENSP00000261517:T2256M;ENSP00000379233:T2256M	ENSP00000249837:T2213M	T	-	2	0	VPS13C	60002096	0.001000	0.12720	0.242000	0.24170	0.327000	0.28475	0.555000	0.23422	-0.402000	0.07633	-1.043000	0.02367	ACG	VPS13C	-	NULL	ENSG00000129003		0.358	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13C	HGNC	protein_coding	OTTHUMT00000415997.1		0.00	31	0	G	NM_017684		62214804	-1			no_errors	ENST00000261517	ensembl	human	known	74_37	missense	6.67	28	2	SNP	0.151	A
VPS36	51028	genome.wustl.edu	37	13	53001132	53001132	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr13:53001132C>T	ENST00000378060.4	-	8	658	c.631G>A	c.(631-633)Gaa>Aaa	p.E211K		NM_001282168.1|NM_001282169.1|NM_016075.2	NP_001269097.1|NP_001269098.1|NP_057159.2	Q86VN1	VPS36_HUMAN	vacuolar protein sorting 36 homolog (S. cerevisiae)	211					endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylinositol-3-phosphate binding (GO:0032266)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	17		Breast(56;0.000207)|Lung NSC(96;0.00212)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.14e-08)		ACCTCATCTTCTGTGATGTCA	0.313																																																	0													152.0	140.0	144.0					13																	53001132		2203	4299	6502	SO:0001583	missense	0			AF151903	CCDS9434.1, CCDS73577.1	13q14.13	2008-02-05	2007-01-12	2005-08-02	ENSG00000136100	ENSG00000136100			20312	protein-coding gene	gene with protein product		610903	"""chromosome 13 open reading frame 9"", ""vacuolar protein sorting 36 homolog (yeast)"""	C13orf9		11278625, 15755741	Standard	NM_016075		Approved	CGI-145, Eap45	uc001vgs.3	Q86VN1	OTTHUMG00000016964	ENST00000378060.4:c.631G>A	13.37:g.53001132C>T	ENSP00000367299:p.Glu211Lys		A8K125|Q3ZCV7|Q5H9S1|Q5VXB6|Q9H8Z5|Q9Y3E3	Missense_Mutation	SNP	pfam_EAP30,pfam_VPS36_GLUE	p.E211K	ENST00000378060.4	37	c.631	CCDS9434.1	13	.	.	.	.	.	.	.	.	.	.	.	35	5.517509	0.96416	.	.	ENSG00000136100	ENST00000378060	.	.	.	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.67795	0.2931	M	0.84948	2.725	0.80722	D	1	P	0.35192	0.489	B	0.31390	0.129	T	0.67573	-0.5636	9	0.34782	T	0.22	-31.234	19.848	0.96722	0.0:1.0:0.0:0.0	.	211	Q86VN1	VPS36_HUMAN	K	211	.	ENSP00000367299:E211K	E	-	1	0	VPS36	51899133	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.427000	0.80284	2.937000	0.99478	0.650000	0.86243	GAA	VPS36	-	pfam_EAP30	ENSG00000136100		0.313	VPS36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS36	HGNC	protein_coding	OTTHUMT00000045059.3	-	0.00	86	0	C			53001132	-1	tier1	-	no_errors	ENST00000378060	ensembl	human	known	74_37	missense	43.18	50	38	SNP	1.000	T
WDR33	55339	genome.wustl.edu	37	2	128471464	128471464	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr2:128471464C>T	ENST00000322313.4	-	18	3159	c.3001G>A	c.(3001-3003)Gat>Aat	p.D1001N		NM_018383.4	NP_060853.3	Q9C0J8	WDR33_HUMAN	WD repeat domain 33	1001					mRNA processing (GO:0006397)|postreplication repair (GO:0006301)|spermatogenesis (GO:0007283)	collagen trimer (GO:0005581)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		CCACGCCTATCAGGGGGACCC	0.652																																																	0													98.0	107.0	104.0					2																	128471464		2203	4300	6503	SO:0001583	missense	0				CCDS2150.1, CCDS42746.1, CCDS46407.1	2q21.1	2013-01-09			ENSG00000136709	ENSG00000136709		"""WD repeat domain containing"""	25651	protein-coding gene	gene with protein product						11162572	Standard	NM_001006622		Approved	FLJ11294, WDC146, NET14	uc002tpg.2	Q9C0J8	OTTHUMG00000131534	ENST00000322313.4:c.3001G>A	2.37:g.128471464C>T	ENSP00000325377:p.Asp1001Asn		Q05DP8|Q53FG9|Q587J1|Q69YF7|Q6NUQ0|Q9NUL1	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Collagen,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D1001N	ENST00000322313.4	37	c.3001	CCDS2150.1	2	.	.	.	.	.	.	.	.	.	.	C	33	5.240071	0.95240	.	.	ENSG00000136709	ENST00000322313	D	0.89875	-2.58	5.81	5.81	0.92471	.	0.000000	0.64402	D	0.000002	T	0.82190	0.4983	N	0.14661	0.345	0.80722	D	1	P	0.40970	0.734	B	0.37015	0.239	D	0.84087	0.0388	10	0.56958	D	0.05	-1.7224	20.0726	0.97729	0.0:1.0:0.0:0.0	.	1001	Q9C0J8	WDR33_HUMAN	N	1001	ENSP00000325377:D1001N	ENSP00000325377:D1001N	D	-	1	0	WDR33	128187934	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.121000	0.64691	2.738000	0.93877	0.655000	0.94253	GAT	WDR33	-	NULL	ENSG00000136709		0.652	WDR33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR33	HGNC	protein_coding	OTTHUMT00000331141.2	-	0.00	97	0	C	NM_018383		128471464	-1	tier1	-	no_errors	ENST00000322313	ensembl	human	known	74_37	missense	38.82	52	33	SNP	1.000	T
ZAN	7455	genome.wustl.edu	37	7	100334441	100334441	+	RNA	SNP	A	A	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr7:100334441A>C	ENST00000348028.3	+	0	428				ZAN_ENST00000546213.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000546292.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			GAGGGCAGCTATCTGCATATG	0.652																																																	0													7.0	10.0	9.0					7																	100334441		1884	3838	5722			0			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100334441A>C			A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_MAM_dom,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_ConA-like_lec_gl_sf,superfamily_TIL_dom,smart_MAM_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_MAM_dom	p.Y88S	ENST00000348028.3	37	c.263		7	.	.	.	.	.	.	.	.	.	.	A	16.58	3.162590	0.57368	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	T;T;T	0.03920	3.76;3.76;3.76	4.7	3.52	0.40303	Concanavalin A-like lectin/glucanase (1);MAM domain (3);	0.000000	0.32068	N	0.006636	T	0.27063	0.0663	H	0.95611	3.695	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.73708	0.967;0.981	T	0.04495	-1.0947	10	0.87932	D	0	.	8.0678	0.30672	0.8194:0.0:0.0:0.1806	.	88;88	F5H0T8;Q9Y493	.;ZAN_HUMAN	S	88	ENSP00000445943:Y88S;ENSP00000445091:Y88S;ENSP00000444427:Y88S	ENSP00000423579:Y88S	Y	+	2	0	ZAN	100172377	0.999000	0.42202	0.987000	0.45799	0.783000	0.44284	2.302000	0.43637	0.873000	0.35799	0.459000	0.35465	TAT	ZAN	-	pfam_MAM_dom,superfamily_ConA-like_lec_gl_sf,smart_MAM_dom,pfscan_MAM_dom	ENSG00000146839		0.652	ZAN-006	KNOWN	basic	polymorphic_pseudogene	ZAN	HGNC	polymorphic_pseudogene	OTTHUMT00000347214.1	-	0.00	51	0	A	NM_003386		100334441	+1	tier1	-	no_errors	ENST00000546292	ensembl	human	known	74_37	missense	26.67	33	12	SNP	0.997	C
ZNF100	163227	genome.wustl.edu	37	19	21909915	21909915	+	Missense_Mutation	SNP	A	A	G	rs532890971		TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr19:21909915A>G	ENST00000358296.6	-	5	1397	c.1199T>C	c.(1198-1200)tTc>tCc	p.F400S	ZNF100_ENST00000305570.6_Missense_Mutation_p.F336S	NM_173531.3	NP_775802.2	Q8IYN0	ZN100_HUMAN	zinc finger protein 100	400					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(11)|skin(1)|upper_aerodigestive_tract(1)	21						ACATTTGTAGAATTTCTCTCC	0.388													N|||	1	0.000199681	0.0	0.0014	5008	,	,		21166	0.0		0.0	False		,,,				2504	0.0																0													57.0	63.0	61.0					19																	21909915		2164	4273	6437	SO:0001583	missense	0			BC035579	CCDS42538.1	19p13.1	2013-01-08	2003-12-19		ENSG00000197020	ENSG00000197020		"""Zinc fingers, C2H2-type"", ""-"""	12880	protein-coding gene	gene with protein product		603982	"""zinc finger protein 100 (Y1)"""			12477932	Standard	NM_173531		Approved		uc002nqi.3	Q8IYN0		ENST00000358296.6:c.1199T>C	19.37:g.21909915A>G	ENSP00000351042:p.Phe400Ser		Q7M4M0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F400S	ENST00000358296.6	37	c.1199	CCDS42538.1	19	.	.	.	.	.	.	.	.	.	.	.	0.935	-0.711272	0.03230	.	.	ENSG00000197020	ENST00000358296	T	0.17691	2.26	0.841	-1.68	0.08212	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05686	0.0149	N	0.01454	-0.855	0.22918	N	0.998568	B;B	0.18166	0.003;0.026	B;B	0.17098	0.012;0.017	T	0.34925	-0.9809	9	0.66056	D	0.02	.	5.9157	0.19053	0.4235:0.0:0.5765:0.0	.	400;454	Q8IYN0;Q4G131	ZN100_HUMAN;.	S	400	ENSP00000351042:F400S	ENSP00000351042:F400S	F	-	2	0	ZNF100	21701755	0.094000	0.21725	0.009000	0.14445	0.009000	0.06853	1.054000	0.30455	-1.393000	0.02079	-1.425000	0.01104	TTC	ZNF100	-	pfscan_Znf_C2H2	ENSG00000197020		0.388	ZNF100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF100	HGNC	protein_coding	OTTHUMT00000464087.1		0.00	55	0	A	NM_173531		21909915	-1			no_errors	ENST00000358296	ensembl	human	known	74_37	missense	19.05	34	8	SNP	0.843	G
ZNF341	84905	genome.wustl.edu	37	20	32341071	32341071	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr20:32341071C>T	ENST00000375200.1	+	5	948	c.583C>T	c.(583-585)Cag>Tag	p.Q195*	ZNF341_ENST00000342427.2_Nonsense_Mutation_p.Q195*	NM_001282933.1	NP_001269862.1	Q9BYN7	ZN341_HUMAN	zinc finger protein 341	195					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	31						gccaccacctcagcctccacc	0.672																																																	0													27.0	29.0	29.0					20																	32341071		2202	4299	6501	SO:0001587	stop_gained	0			AK027550	CCDS13227.1, CCDS74719.1	20q11.22	2013-01-08			ENSG00000131061	ENSG00000131061		"""Zinc fingers, C2H2-type"""	15992	protein-coding gene	gene with protein product							Standard	NM_001282933		Approved	dJ553F4.3	uc002wzx.3	Q9BYN7	OTTHUMG00000032275	ENST00000375200.1:c.583C>T	20.37:g.32341071C>T	ENSP00000364346:p.Gln195*		A2RUF4|B2RXE5|B7ZM09|Q5JXM8|Q96ST5	Nonsense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q195*	ENST00000375200.1	37	c.583		20	.	.	.	.	.	.	.	.	.	.	C	34	5.403416	0.96051	.	.	ENSG00000131061	ENST00000342427;ENST00000375200	.	.	.	5.12	5.12	0.69794	.	0.512436	0.20538	N	0.090380	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.5309	18.1691	0.89739	0.0:1.0:0.0:0.0	.	.	.	.	X	195	.	ENSP00000344308:Q195X	Q	+	1	0	ZNF341	31804732	0.990000	0.36364	0.247000	0.24249	0.102000	0.19082	5.983000	0.70540	2.393000	0.81446	0.563000	0.77884	CAG	ZNF341	-	NULL	ENSG00000131061		0.672	ZNF341-201	KNOWN	basic	protein_coding	ZNF341	HGNC	protein_coding		-	0.00	30	0	C			32341071	+1	tier1	-	no_errors	ENST00000375200	ensembl	human	known	74_37	nonsense	18.18	54	12	SNP	0.994	T
ZNF395	55893	genome.wustl.edu	37	8	28206685	28206685	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr8:28206685G>A	ENST00000344423.5	-	9	1518	c.1387C>T	c.(1387-1389)Cat>Tat	p.H463Y	ZNF395_ENST00000523202.1_Missense_Mutation_p.H463Y|ZNF395_ENST00000523095.1_Missense_Mutation_p.H463Y	NM_018660.2	NP_061130.1	Q9H8N7	ZN395_HUMAN	zinc finger protein 395	463					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(5)|large_intestine(6)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.102)|Kidney(114;0.123)|Colorectal(74;0.142)		ACGATCAGATGAGATTTCATC	0.632																																																	0													108.0	113.0	111.0					8																	28206685		2203	4300	6503	SO:0001583	missense	0			AB044750	CCDS6067.1	8p21	2008-05-02			ENSG00000186918	ENSG00000186918		"""Zinc fingers, C2H2-type"""	18737	protein-coding gene	gene with protein product		609494				14625278	Standard	NM_018660		Approved	PRF-1, HDBP2, PBF, DKFZp434K1210	uc003xgr.3	Q9H8N7	OTTHUMG00000102137	ENST00000344423.5:c.1387C>T	8.37:g.28206685G>A	ENSP00000340494:p.His463Tyr		B3KUY7|D3DST4|Q6F6H2|Q9BY72|Q9NPB2|Q9NS57|Q9NS58|Q9NS59	Missense_Mutation	SNP	pfscan_Znf_C2H2	p.H463Y	ENST00000344423.5	37	c.1387	CCDS6067.1	8	.	.	.	.	.	.	.	.	.	.	G	23.0	4.357366	0.82243	.	.	ENSG00000186918	ENST00000344423;ENST00000523202;ENST00000523095	T;T;T	0.49139	0.79;0.79;0.79	5.11	5.11	0.69529	.	0.309106	0.38897	N	0.001525	T	0.64560	0.2609	M	0.70275	2.135	0.80722	D	1	D	0.76494	0.999	D	0.62955	0.909	T	0.67201	-0.5730	10	0.66056	D	0.02	-25.4268	13.9073	0.63843	0.0:0.0:1.0:0.0	.	463	Q9H8N7	ZN395_HUMAN	Y	463	ENSP00000340494:H463Y;ENSP00000429640:H463Y;ENSP00000428452:H463Y	ENSP00000340494:H463Y	H	-	1	0	ZNF395	28262604	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	6.100000	0.71473	2.665000	0.90641	0.655000	0.94253	CAT	ZNF395	-	NULL	ENSG00000186918		0.632	ZNF395-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF395	HGNC	protein_coding	OTTHUMT00000219976.1	-	0.00	27	0	G			28206685	-1	tier1	-	no_errors	ENST00000344423	ensembl	human	known	74_37	missense	53.57	13	15	SNP	1.000	A
ZNF467	168544	genome.wustl.edu	37	7	149462695	149462695	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr7:149462695G>A	ENST00000302017.3	-	5	1309	c.896C>T	c.(895-897)cCc>cTc	p.P299L	ZNF467_ENST00000484747.1_Intron	NM_207336.1	NP_997219.1	Q7Z7K2	ZN467_HUMAN	zinc finger protein 467	299					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(2)|liver(1)|lung(7)|urinary_tract(1)	13	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GCACTGGTAGGGCCTCTCGCC	0.667																																																	0													30.0	20.0	23.0					7																	149462695		2201	4299	6500	SO:0001583	missense	0			BC029296	CCDS5899.1	7q36.1	2013-01-08			ENSG00000181444	ENSG00000181444		"""Zinc fingers, C2H2-type"""	23154	protein-coding gene	gene with protein product		614040				12426389	Standard	NM_207336		Approved	EZI, Zfp467	uc003wgd.2	Q7Z7K2	OTTHUMG00000157883	ENST00000302017.3:c.896C>T	7.37:g.149462695G>A	ENSP00000304769:p.Pro299Leu			Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P299L	ENST00000302017.3	37	c.896	CCDS5899.1	7	.	.	.	.	.	.	.	.	.	.	G	19.74	3.883732	0.72410	.	.	ENSG00000181444	ENST00000302017	T	0.17054	2.3	4.25	4.25	0.50352	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.32719	U	0.005723	T	0.43122	0.1233	M	0.74258	2.255	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.49351	-0.8949	10	0.87932	D	0	-25.4067	16.2993	0.82801	0.0:0.0:1.0:0.0	.	299	Q7Z7K2	ZN467_HUMAN	L	299	ENSP00000304769:P299L	ENSP00000304769:P299L	P	-	2	0	ZNF467	149093628	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	5.419000	0.66435	1.925000	0.55765	0.456000	0.33151	CCC	ZNF467	-	pfscan_Znf_C2H2	ENSG00000181444		0.667	ZNF467-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF467	HGNC	protein_coding	OTTHUMT00000349833.1	-	0.00	72	0	G	NM_207336		149462695	-1	tier1	-	no_errors	ENST00000302017	ensembl	human	known	74_37	missense	20.25	63	16	SNP	1.000	A
ZNF469	84627	genome.wustl.edu	37	16	88495087	88495087	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr16:88495087G>C	ENST00000437464.1	+	1	1209	c.1209G>C	c.(1207-1209)caG>caC	p.Q403H	ZNF469_ENST00000565624.1_Missense_Mutation_p.Q403H	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	403	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						CCCTACCCCAGAGGCACTTTC	0.672																																																	0													8.0	11.0	10.0					16																	88495087		682	1579	2261	SO:0001583	missense	0			AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.1209G>C	16.37:g.88495087G>C	ENSP00000402343:p.Gln403His			Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q403H	ENST00000437464.1	37	c.1209	CCDS45544.1	16	.	.	.	.	.	.	.	.	.	.	G	5.532	0.283123	0.10458	.	.	ENSG00000225614	ENST00000437464	T	0.22743	1.94	4.54	0.859	0.19036	.	.	.	.	.	T	0.22282	0.0537	N	0.14661	0.345	0.20926	N	0.999824	D	0.76494	0.999	P	0.62885	0.908	T	0.14117	-1.0484	9	0.87932	D	0	.	6.4255	0.21768	0.6862:0.0:0.3138:0.0	.	403	Q96JG9	ZN469_HUMAN	H	403	ENSP00000402343:Q403H	ENSP00000402343:Q403H	Q	+	3	2	ZNF469	87022588	0.972000	0.33761	0.114000	0.21550	0.038000	0.13279	0.353000	0.20130	-0.002000	0.14469	-0.481000	0.04817	CAG	ZNF469	-	NULL	ENSG00000225614		0.672	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF469	HGNC	protein_coding		-	0.00	61	0	G	NG_012236		88495087	+1	tier1	-	no_errors	ENST00000437464	ensembl	human	known	74_37	missense	31.34	46	21	SNP	0.957	C
ZNF519	162655	genome.wustl.edu	37	18	14105544	14105545	+	Frame_Shift_Ins	INS	-	-	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr18:14105544_14105545insT	ENST00000590202.1	-	3	1146_1147	c.994_995insA	c.(994-996)ggcfs	p.G332fs	RP11-411B10.3_ENST00000592926.1_RNA|ZNF519_ENST00000589498.1_Intron|ZNF519_ENST00000589203.1_Intron	NM_145287.3	NP_660330.2	Q8TB69	ZN519_HUMAN	zinc finger protein 519	332					negative regulation of transcription during meiosis (GO:0051038)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	18						AAGGTATGAGCCTCTGTTAAAA	0.421																																																	0																																										SO:0001589	frameshift_variant	0			BC024227	CCDS32797.1	18p11.21	2014-06-18			ENSG00000175322	ENSG00000175322		"""Zinc fingers, C2H2-type"", ""-"""	30574	protein-coding gene	gene with protein product	"""similar to Zinc finger protein 85 (Zinc finger protein HPF4) (HTF1)"""					12477932	Standard	NM_145287		Approved	HsT2362, FLJ36809	uc002kst.2	Q8TB69	OTTHUMG00000182055	ENST00000590202.1:c.994_995insA	18.37:g.14105544_14105545insT	ENSP00000464872:p.Gly332fs			Frame_Shift_Ins	INS	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G332fs	ENST00000590202.1	37	c.995_994	CCDS32797.1	18																																																																																			ZNF519	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000175322		0.421	ZNF519-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF519	HGNC	protein_coding	OTTHUMT00000459037.1		0.00	43	0	-	NM_145287		14105545	-1	tier1		no_errors	ENST00000590202	ensembl	human	known	74_37	frame_shift_ins	29.41	12	5	INS	0.000:0.000	T
ZNF519	162655	genome.wustl.edu	37	18	14105547	14105547	+	Frame_Shift_Del	DEL	C	C	-			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr18:14105547delC	ENST00000590202.1	-	3	1144	c.992delG	c.(991-993)agafs	p.R331fs	RP11-411B10.3_ENST00000592926.1_RNA|ZNF519_ENST00000589498.1_Intron|ZNF519_ENST00000589203.1_Intron	NM_145287.3	NP_660330.2	Q8TB69	ZN519_HUMAN	zinc finger protein 519	331					negative regulation of transcription during meiosis (GO:0051038)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	18						GTATGAGCCTCTGTTAAAAGC	0.423																																																	0													95.0	98.0	97.0					18																	14105547		2203	4300	6503	SO:0001589	frameshift_variant	0			BC024227	CCDS32797.1	18p11.21	2014-06-18			ENSG00000175322	ENSG00000175322		"""Zinc fingers, C2H2-type"", ""-"""	30574	protein-coding gene	gene with protein product	"""similar to Zinc finger protein 85 (Zinc finger protein HPF4) (HTF1)"""					12477932	Standard	NM_145287		Approved	HsT2362, FLJ36809	uc002kst.2	Q8TB69	OTTHUMG00000182055	ENST00000590202.1:c.992delG	18.37:g.14105547delC	ENSP00000464872:p.Arg331fs			Frame_Shift_Del	DEL	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R331fs	ENST00000590202.1	37	c.992	CCDS32797.1	18																																																																																			ZNF519	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000175322		0.423	ZNF519-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF519	HGNC	protein_coding	OTTHUMT00000459037.1		0.00	45	0	C	NM_145287		14105547	-1	tier1		no_errors	ENST00000590202	ensembl	human	known	74_37	frame_shift_del	31.25	11	5	DEL	0.000	-
ZNF519	162655	genome.wustl.edu	37	18	14105583	14105583	+	Frame_Shift_Del	DEL	G	G	-	rs552977206		TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr18:14105583delG	ENST00000590202.1	-	3	1108	c.956delC	c.(955-957)cctfs	p.P319fs	RP11-411B10.3_ENST00000592926.1_RNA|ZNF519_ENST00000589498.1_Intron|ZNF519_ENST00000589203.1_Intron	NM_145287.3	NP_660330.2	Q8TB69	ZN519_HUMAN	zinc finger protein 519	319					negative regulation of transcription during meiosis (GO:0051038)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	18						ACACTTGAAAGGCTTCTCTCC	0.393																																																	0													83.0	85.0	84.0					18																	14105583		2203	4300	6503	SO:0001589	frameshift_variant	0			BC024227	CCDS32797.1	18p11.21	2014-06-18			ENSG00000175322	ENSG00000175322		"""Zinc fingers, C2H2-type"", ""-"""	30574	protein-coding gene	gene with protein product	"""similar to Zinc finger protein 85 (Zinc finger protein HPF4) (HTF1)"""					12477932	Standard	NM_145287		Approved	HsT2362, FLJ36809	uc002kst.2	Q8TB69	OTTHUMG00000182055	ENST00000590202.1:c.956delC	18.37:g.14105583delG	ENSP00000464872:p.Pro319fs			Frame_Shift_Del	DEL	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P319fs	ENST00000590202.1	37	c.956	CCDS32797.1	18																																																																																			ZNF519	-	pfscan_Znf_C2H2	ENSG00000175322		0.393	ZNF519-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF519	HGNC	protein_coding	OTTHUMT00000459037.1		0.00	50	0	G	NM_145287		14105583	-1	tier1		no_errors	ENST00000590202	ensembl	human	known	74_37	frame_shift_del	33.33	10	5	DEL	0.986	-
ZNF519	162655	genome.wustl.edu	37	18	14105586	14105587	+	Frame_Shift_Ins	INS	-	-	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr18:14105586_14105587insC	ENST00000590202.1	-	3	1104_1105	c.952_953insG	c.(952-954)aagfs	p.K318fs	RP11-411B10.3_ENST00000592926.1_RNA|ZNF519_ENST00000589498.1_Intron|ZNF519_ENST00000589203.1_Intron	NM_145287.3	NP_660330.2	Q8TB69	ZN519_HUMAN	zinc finger protein 519	318					negative regulation of transcription during meiosis (GO:0051038)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	18						CTTGAAAGGCTTCTCTCCAGTA	0.386																																																	0																																										SO:0001589	frameshift_variant	0			BC024227	CCDS32797.1	18p11.21	2014-06-18			ENSG00000175322	ENSG00000175322		"""Zinc fingers, C2H2-type"", ""-"""	30574	protein-coding gene	gene with protein product	"""similar to Zinc finger protein 85 (Zinc finger protein HPF4) (HTF1)"""					12477932	Standard	NM_145287		Approved	HsT2362, FLJ36809	uc002kst.2	Q8TB69	OTTHUMG00000182055	ENST00000590202.1:c.952_953insG	18.37:g.14105586_14105587insC	ENSP00000464872:p.Lys318fs			Frame_Shift_Ins	INS	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K318fs	ENST00000590202.1	37	c.953_952	CCDS32797.1	18																																																																																			ZNF519	-	pfscan_Znf_C2H2	ENSG00000175322		0.386	ZNF519-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF519	HGNC	protein_coding	OTTHUMT00000459037.1		0.00	49	0	-	NM_145287		14105587	-1	tier1		no_errors	ENST00000590202	ensembl	human	known	74_37	frame_shift_ins	35.29	11	6	INS	0.998:1.000	C
ZNF519	162655	genome.wustl.edu	37	18	14105539	14105539	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr18:14105539A>G	ENST00000590202.1	-	3	1152	c.1000T>C	c.(1000-1002)Tac>Cac	p.Y334H	RP11-411B10.3_ENST00000592926.1_RNA|ZNF519_ENST00000589498.1_Intron|ZNF519_ENST00000589203.1_Intron	NM_145287.3	NP_660330.2	Q8TB69	ZN519_HUMAN	zinc finger protein 519	334					negative regulation of transcription during meiosis (GO:0051038)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	18						TGAGTAAGGTATGAGCCTCTG	0.423																																																	0													98.0	100.0	99.0					18																	14105539		2203	4300	6503	SO:0001583	missense	0			BC024227	CCDS32797.1	18p11.21	2014-06-18			ENSG00000175322	ENSG00000175322		"""Zinc fingers, C2H2-type"", ""-"""	30574	protein-coding gene	gene with protein product	"""similar to Zinc finger protein 85 (Zinc finger protein HPF4) (HTF1)"""					12477932	Standard	NM_145287		Approved	HsT2362, FLJ36809	uc002kst.2	Q8TB69	OTTHUMG00000182055	ENST00000590202.1:c.1000T>C	18.37:g.14105539A>G	ENSP00000464872:p.Tyr334His			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Y334H	ENST00000590202.1	37	c.1000	CCDS32797.1	18	.	.	.	.	.	.	.	.	.	.	A	0.008	-1.875496	0.00537	.	.	ENSG00000175322	ENST00000309305	.	.	.	0.646	-1.29	0.09288	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08044	0.0201	N	0.01761	-0.735	0.09310	N	1	B	0.09022	0.002	B	0.15484	0.013	T	0.25572	-1.0128	8	0.06757	T	0.87	.	2.5989	0.04861	0.2705:0.4834:0.0:0.2461	.	334	Q8TB69	ZN519_HUMAN	H	334	.	ENSP00000307908:Y334H	Y	-	1	0	ZNF519	14095539	0.000000	0.05858	0.000000	0.03702	0.529000	0.34654	-8.728000	0.00017	-1.260000	0.02465	0.076000	0.15429	TAC	ZNF519	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000175322		0.423	ZNF519-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF519	HGNC	protein_coding	OTTHUMT00000459037.1		0.00	43	0	A	NM_145287		14105539	-1			no_errors	ENST00000590202	ensembl	human	known	74_37	missense	44.44	10	8	SNP	0.000	G
ZNF519	162655	genome.wustl.edu	37	18	14105543	14105543	+	Silent	SNP	G	G	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr18:14105543G>A	ENST00000590202.1	-	3	1148	c.996C>T	c.(994-996)ggC>ggT	p.G332G	RP11-411B10.3_ENST00000592926.1_RNA|ZNF519_ENST00000589498.1_Intron|ZNF519_ENST00000589203.1_Intron	NM_145287.3	NP_660330.2	Q8TB69	ZN519_HUMAN	zinc finger protein 519	332					negative regulation of transcription during meiosis (GO:0051038)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	18						TAAGGTATGAGCCTCTGTTAA	0.423																																																	0													96.0	99.0	98.0					18																	14105543		2203	4300	6503	SO:0001819	synonymous_variant	0			BC024227	CCDS32797.1	18p11.21	2014-06-18			ENSG00000175322	ENSG00000175322		"""Zinc fingers, C2H2-type"", ""-"""	30574	protein-coding gene	gene with protein product	"""similar to Zinc finger protein 85 (Zinc finger protein HPF4) (HTF1)"""					12477932	Standard	NM_145287		Approved	HsT2362, FLJ36809	uc002kst.2	Q8TB69	OTTHUMG00000182055	ENST00000590202.1:c.996C>T	18.37:g.14105543G>A				Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G332	ENST00000590202.1	37	c.996	CCDS32797.1	18																																																																																			ZNF519	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000175322		0.423	ZNF519-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF519	HGNC	protein_coding	OTTHUMT00000459037.1		0.00	43	0	G	NM_145287		14105543	-1			no_errors	ENST00000590202	ensembl	human	known	74_37	silent	35.29	10	6	SNP	0.000	A
ZNF519	162655	genome.wustl.edu	37	18	14105572	14105572	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr18:14105572T>C	ENST00000590202.1	-	3	1119	c.967A>G	c.(967-969)Aag>Gag	p.K323E	RP11-411B10.3_ENST00000592926.1_RNA|ZNF519_ENST00000589498.1_Intron|ZNF519_ENST00000589203.1_Intron	NM_145287.3	NP_660330.2	Q8TB69	ZN519_HUMAN	zinc finger protein 519	323					negative regulation of transcription during meiosis (GO:0051038)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	18						CCACATTCCTTACACTTGAAA	0.398																																																	0													87.0	89.0	88.0					18																	14105572		2203	4300	6503	SO:0001583	missense	0			BC024227	CCDS32797.1	18p11.21	2014-06-18			ENSG00000175322	ENSG00000175322		"""Zinc fingers, C2H2-type"", ""-"""	30574	protein-coding gene	gene with protein product	"""similar to Zinc finger protein 85 (Zinc finger protein HPF4) (HTF1)"""					12477932	Standard	NM_145287		Approved	HsT2362, FLJ36809	uc002kst.2	Q8TB69	OTTHUMG00000182055	ENST00000590202.1:c.967A>G	18.37:g.14105572T>C	ENSP00000464872:p.Lys323Glu			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K323E	ENST00000590202.1	37	c.967	CCDS32797.1	18	.	.	.	.	.	.	.	.	.	.	T	0.013	-1.626251	0.00813	.	.	ENSG00000175322	ENST00000309305	.	.	.	0.646	0.646	0.17789	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07052	0.0179	N	0.00746	-1.225	0.09310	N	1	B	0.21753	0.06	B	0.25987	0.065	T	0.40646	-0.9552	8	0.02654	T	1	.	2.7884	0.05380	0.4188:0.0:0.0:0.5812	.	323	Q8TB69	ZN519_HUMAN	E	323	.	ENSP00000307908:K323E	K	-	1	0	ZNF519	14095572	0.000000	0.05858	0.698000	0.30274	0.541000	0.35023	-4.006000	0.00315	0.552000	0.29026	0.076000	0.15429	AAG	ZNF519	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000175322		0.398	ZNF519-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF519	HGNC	protein_coding	OTTHUMT00000459037.1		0.00	47	0	T	NM_145287		14105572	-1			no_errors	ENST00000590202	ensembl	human	known	74_37	missense	46.15	7	6	SNP	0.198	C
ZNF519	162655	genome.wustl.edu	37	18	14105576	14105576	+	Silent	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr18:14105576C>T	ENST00000590202.1	-	3	1115	c.963G>A	c.(961-963)aaG>aaA	p.K321K	RP11-411B10.3_ENST00000592926.1_RNA|ZNF519_ENST00000589498.1_Intron|ZNF519_ENST00000589203.1_Intron	NM_145287.3	NP_660330.2	Q8TB69	ZN519_HUMAN	zinc finger protein 519	321					negative regulation of transcription during meiosis (GO:0051038)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	18						ATTCCTTACACTTGAAAGGCT	0.398																																																	0													85.0	87.0	87.0					18																	14105576		2203	4300	6503	SO:0001819	synonymous_variant	0			BC024227	CCDS32797.1	18p11.21	2014-06-18			ENSG00000175322	ENSG00000175322		"""Zinc fingers, C2H2-type"", ""-"""	30574	protein-coding gene	gene with protein product	"""similar to Zinc finger protein 85 (Zinc finger protein HPF4) (HTF1)"""					12477932	Standard	NM_145287		Approved	HsT2362, FLJ36809	uc002kst.2	Q8TB69	OTTHUMG00000182055	ENST00000590202.1:c.963G>A	18.37:g.14105576C>T				Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K321	ENST00000590202.1	37	c.963	CCDS32797.1	18																																																																																			ZNF519	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000175322		0.398	ZNF519-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF519	HGNC	protein_coding	OTTHUMT00000459037.1		0.00	50	0	C	NM_145287		14105576	-1			no_errors	ENST00000590202	ensembl	human	known	74_37	silent	53.85	6	7	SNP	0.072	T
ZNF534	147658	genome.wustl.edu	37	19	52941164	52941164	+	Missense_Mutation	SNP	A	A	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr19:52941164A>C	ENST00000332323.6	+	4	551	c.490A>C	c.(490-492)Agt>Cgt	p.S164R	ZNF534_ENST00000433050.1_Missense_Mutation_p.S151R|ZNF534_ENST00000432303.2_Intron|ZNF534_ENST00000301085.4_Intron	NM_001143939.1	NP_001137411.1	Q76KX8	ZN534_HUMAN	zinc finger protein 534	164					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S164R(1)		central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	4						AGTTCAAATAAGTTTTTTCAG	0.323																																																	1	Substitution - Missense(1)	lung(1)											82.0	75.0	77.0					19																	52941164		1568	3582	5150	SO:0001583	missense	0			AK058073	CCDS46165.1, CCDS46166.1	19q13.41	2013-01-08	2004-02-06	2004-02-11	ENSG00000198633	ENSG00000198633		"""Zinc fingers, C2H2-type"", ""-"""	26337	protein-coding gene	gene with protein product			"""KRAB domain only 3"""	KRBO3			Standard	NM_001143938		Approved	FLJ25344	uc002pzk.3	Q76KX8	OTTHUMG00000156493	ENST00000332323.6:c.490A>C	19.37:g.52941164A>C	ENSP00000327538:p.Ser164Arg		Q76KX9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S164R	ENST00000332323.6	37	c.490	CCDS46165.1	19	.	.	.	.	.	.	.	.	.	.	A	10.49	1.364031	0.24684	.	.	ENSG00000198633	ENST00000332323;ENST00000433050;ENST00000391790	T;T	0.07114	3.22;3.27	1.61	1.61	0.23674	.	.	.	.	.	T	0.05410	0.0143	L	0.38692	1.165	0.09310	N	1	B;P	0.41102	0.002;0.738	B;B	0.32624	0.001;0.149	T	0.35525	-0.9785	9	0.56958	D	0.05	.	3.7291	0.08485	0.6629:0.0:0.0:0.337	.	151;164	Q76KX8-2;Q76KX8	.;ZN534_HUMAN	R	164;151;163	ENSP00000327538:S164R;ENSP00000391358:S151R	ENSP00000327538:S164R	S	+	1	0	ZNF534	57632976	0.001000	0.12720	0.003000	0.11579	0.164000	0.22412	0.753000	0.26376	0.712000	0.32039	0.164000	0.16699	AGT	ZNF534	-	NULL	ENSG00000198633		0.323	ZNF534-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF534	HGNC	protein_coding	OTTHUMT00000460877.1	-	0.00	12	0	A	NM_182512		52941164	+1	tier1	-	no_errors	ENST00000332323	ensembl	human	known	74_37	missense	28.57	10	4	SNP	0.001	C
ZNF653	115950	genome.wustl.edu	37	19	11598622	11598622	+	Missense_Mutation	SNP	G	G	A	rs373230491		TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr19:11598622G>A	ENST00000293771.5	-	4	792	c.656C>T	c.(655-657)gCg>gTg	p.A219V	CTC-398G3.6_ENST00000585656.1_Intron	NM_138783.3	NP_620138.2	Q96CK0	ZN653_HUMAN	zinc finger protein 653	219	Poly-Ala.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	17						TGCCGCTGCCGCAGCCTTGAC	0.662																																					Pancreas(83;980 1446 4542 6441 43352)												0								A	VAL/ALA	2,4058		0,2,2028	24.0	24.0	24.0		656	2.1	0.0	19		24	0,8008		0,0,4004	no	missense	ZNF653	NM_138783.3	64	0,2,6032	AA,AG,GG		0.0,0.0493,0.0166	benign	219/616	11598622	2,12066	2030	4004	6034	SO:0001583	missense	0			AY072704	CCDS12261.1	19p13.2	2013-01-08						"""Zinc fingers, C2H2-type"""	25196	protein-coding gene	gene with protein product		611371				12477932	Standard	NM_138783		Approved	Zip67	uc002mrz.2	Q96CK0		ENST00000293771.5:c.656C>T	19.37:g.11598622G>A	ENSP00000293771:p.Ala219Val		Q96AS7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A219V	ENST00000293771.5	37	c.656	CCDS12261.1	19	.	.	.	.	.	.	.	.	.	.	g	10.64	1.408290	0.25378	4.93E-4	0.0	ENSG00000161914	ENST00000293771	T	0.10382	2.88	4.25	2.07	0.26955	.	1.673800	0.03473	N	0.213896	T	0.07818	0.0196	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.31530	-0.9940	10	0.22109	T	0.4	.	8.7739	0.34749	0.198:0.0:0.802:0.0	.	219	Q96CK0	ZN653_HUMAN	V	219	ENSP00000293771:A219V	ENSP00000293771:A219V	A	-	2	0	ZNF653	11459622	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	0.148000	0.16224	0.934000	0.37316	-0.215000	0.12644	GCG	ZNF653	-	NULL	ENSG00000161914		0.662	ZNF653-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF653	HGNC	protein_coding	OTTHUMT00000458836.2	-	0.00	24	0	G	NM_138783		11598622	-1	tier1	-	no_errors	ENST00000293771	ensembl	human	known	74_37	missense	37.50	20	12	SNP	0.001	A
ZNF653	115950	genome.wustl.edu	37	19	11598670	11598670	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr19:11598670G>A	ENST00000293771.5	-	4	744	c.608C>T	c.(607-609)tCt>tTt	p.S203F	CTC-398G3.6_ENST00000585656.1_Intron	NM_138783.3	NP_620138.2	Q96CK0	ZN653_HUMAN	zinc finger protein 653	203	Poly-Ser.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	17						GTCAGAGGCAGAGCCAGAGCT	0.647																																					Pancreas(83;980 1446 4542 6441 43352)												0													18.0	18.0	18.0					19																	11598670		2193	4277	6470	SO:0001583	missense	0			AY072704	CCDS12261.1	19p13.2	2013-01-08						"""Zinc fingers, C2H2-type"""	25196	protein-coding gene	gene with protein product		611371				12477932	Standard	NM_138783		Approved	Zip67	uc002mrz.2	Q96CK0		ENST00000293771.5:c.608C>T	19.37:g.11598670G>A	ENSP00000293771:p.Ser203Phe		Q96AS7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S203F	ENST00000293771.5	37	c.608	CCDS12261.1	19	.	.	.	.	.	.	.	.	.	.	G	12.93	2.084193	0.36758	.	.	ENSG00000161914	ENST00000293771	T	0.11712	2.75	4.13	3.08	0.35506	.	0.437874	0.23492	N	0.047594	T	0.11793	0.0287	L	0.29908	0.895	0.09310	N	1	D	0.61080	0.989	P	0.50708	0.648	T	0.06023	-1.0850	10	0.87932	D	0	-14.3226	8.7385	0.34543	0.1104:0.0:0.8896:0.0	.	203	Q96CK0	ZN653_HUMAN	F	203	ENSP00000293771:S203F	ENSP00000293771:S203F	S	-	2	0	ZNF653	11459670	0.995000	0.38212	0.209000	0.23619	0.208000	0.24298	5.395000	0.66291	2.029000	0.59856	0.561000	0.74099	TCT	ZNF653	-	NULL	ENSG00000161914		0.647	ZNF653-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF653	HGNC	protein_coding	OTTHUMT00000458836.2		0.00	16	0	G	NM_138783		11598670	-1			no_errors	ENST00000293771	ensembl	human	known	74_37	missense	25.00	15	5	SNP	0.027	A
ZNF625	90589	genome.wustl.edu	37	19	12256319	12256319	+	Missense_Mutation	SNP	T	T	G			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr19:12256319T>G	ENST00000355738.1	-	4	1063	c.714A>C	c.(712-714)gaA>gaC	p.E238D	CTC-359D24.3_ENST00000472362.1_RNA|ZNF625_ENST00000439556.2_Missense_Mutation_p.E304D|ZNF625-ZNF20_ENST00000430024.1_Intron|ZNF625_ENST00000455799.1_3'UTR|ZNF625_ENST00000542938.1_Missense_Mutation_p.E238D			Q96I27	ZN625_HUMAN	zinc finger protein 625	238					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(1)|large_intestine(6)|lung(4)|skin(2)	14						ATTGCTTACATTCATAGGGCT	0.443																																																	0													118.0	113.0	115.0					19																	12256319		2203	4300	6503	SO:0001583	missense	0			BC007868	CCDS12269.1, CCDS12269.2	19p13.2	2013-01-08			ENSG00000257591	ENSG00000257591		"""Zinc fingers, C2H2-type"", ""-"""	30571	protein-coding gene	gene with protein product						12477932	Standard	NM_145233		Approved		uc010dyo.2	Q96I27	OTTHUMG00000156407	ENST00000355738.1:c.714A>C	19.37:g.12256319T>G	ENSP00000347977:p.Glu238Asp		A4FU45|I3L0E9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E304D	ENST00000355738.1	37	c.912		19	.	.	.	.	.	.	.	.	.	.	T	15.29	2.790539	0.50102	.	.	ENSG00000257591	ENST00000542938;ENST00000355738;ENST00000439556	T;T;T	0.07688	3.17;3.17;3.17	0.856	-0.244	0.13031	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.16938	0.0407	L	0.52823	1.66	0.09310	N	0.999998	P;D	0.89917	0.894;1.0	B;D	0.91635	0.213;0.999	T	0.17961	-1.0352	9	0.72032	D	0.01	.	1.401	0.02270	0.3277:0.2545:0.0:0.4178	.	238;238	A8K8U0;Q96I27	.;ZN625_HUMAN	D	238;238;304	ENSP00000438436:E238D;ENSP00000347977:E238D;ENSP00000394380:E304D	ENSP00000347977:E238D	E	-	3	2	AC022415.5	12117319	0.000000	0.05858	0.158000	0.22627	0.816000	0.46133	-4.876000	0.00175	-0.144000	0.11314	0.260000	0.18958	GAA	ZNF625	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000257591		0.443	ZNF625-201	KNOWN	basic	protein_coding	ZNF625	HGNC	protein_coding		-	0.00	83	0	T	NM_145233		12256319	-1	tier1	-	no_errors	ENST00000439556	ensembl	human	known	74_37	missense	49.25	34	33	SNP	0.017	G
ZNF737	100129842	genome.wustl.edu	37	19	20727799	20727799	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr19:20727799C>T	ENST00000427401.4	-	4	1304	c.1210G>A	c.(1210-1212)Gaa>Aaa	p.E404K		NM_001159293.1	NP_001152765.1	O75373	ZN737_HUMAN	zinc finger protein 737	404					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|lung(7)|ovary(1)|stomach(1)|urinary_tract(1)	13						TTAAAGGCTTCGCCACATTCT	0.423																																																	0													141.0	136.0	137.0					19																	20727799		692	1591	2283	SO:0001583	missense	0			BC015765	CCDS54238.1	19p12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	32468	protein-coding gene	gene with protein product		603984					Standard	NM_001159293		Approved	ZNF102	uc002npa.3	O75373		ENST00000427401.4:c.1210G>A	19.37:g.20727799C>T	ENSP00000395733:p.Glu404Lys		C9JHM3	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E404K	ENST00000427401.4	37	c.1210	CCDS54238.1	19	.	.	.	.	.	.	.	.	.	.	N	0.007	-1.937661	0.00484	.	.	ENSG00000237440	ENST00000427401	T	0.35605	1.3	0.801	-0.559	0.11792	.	.	.	.	.	T	0.05273	0.0140	N	0.00102	-2.13	0.23156	N	0.998205	B	0.12630	0.006	B	0.01281	0.0	T	0.39683	-0.9602	9	0.02654	T	1	.	2.136	0.03762	0.0:0.3371:0.3479:0.3149	.	404	C9JHM3	.	K	404	ENSP00000395733:E404K	ENSP00000395733:E404K	E	-	1	0	ZNF737	20519639	0.991000	0.36638	0.483000	0.27378	0.486000	0.33341	2.129000	0.42055	0.170000	0.19704	0.173000	0.16961	GAA	ZNF737	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000237440		0.423	ZNF737-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF737	HGNC	protein_coding	OTTHUMT00000447844.2	-	0.00	41	0	C	NM_145289		20727799	-1	tier1	-	no_errors	ENST00000427401	ensembl	human	known	74_37	missense	18.92	30	7	SNP	0.998	T
ZNF579	163033	genome.wustl.edu	37	19	56089494	56089494	+	Silent	SNP	G	G	T			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr19:56089494G>T	ENST00000325421.4	-	2	1540	c.1512C>A	c.(1510-1512)ctC>ctA	p.L504L	CTD-2537I9.5_ENST00000589396.1_lincRNA	NM_152600.2	NP_689813.2	Q8NAF0	ZN579_HUMAN	zinc finger protein 579	504	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(1)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	9			BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.106)		TAATGTTTGCGAGGGGCAGCG	0.721																																																	0													13.0	13.0	13.0					19																	56089494		2068	4098	6166	SO:0001819	synonymous_variant	0			AK092772	CCDS12927.1	19q13.42	2013-09-20			ENSG00000218891	ENSG00000218891		"""Zinc fingers, C2H2-type"""	26646	protein-coding gene	gene with protein product							Standard	NM_152600		Approved	FLJ35453	uc002qlh.3	Q8NAF0	OTTHUMG00000180857	ENST00000325421.4:c.1512C>A	19.37:g.56089494G>T				Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L504	ENST00000325421.4	37	c.1512	CCDS12927.1	19																																																																																			ZNF579	-	NULL	ENSG00000218891		0.721	ZNF579-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF579	HGNC	protein_coding	OTTHUMT00000453348.1		0.00	57	0	G	NM_152600		56089494	-1			no_errors	ENST00000325421	ensembl	human	known	74_37	silent	18.00	41	9	SNP	0.000	T
ZNF750	79755	genome.wustl.edu	37	17	80789643	80789643	+	Frame_Shift_Del	DEL	C	C	-			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr17:80789643delC	ENST00000269394.3	-	2	1521	c.688delG	c.(688-690)gccfs	p.A230fs	TBCD_ENST00000539345.2_Intron|ZNF750_ENST00000572562.1_Intron|TBCD_ENST00000397466.2_Intron|TBCD_ENST00000355528.4_Intron	NM_024702.2	NP_078978.2	Q32MQ0	ZN750_HUMAN	zinc finger protein 750	230					cell differentiation (GO:0030154)|epidermis development (GO:0008544)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	31	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0514)|all_epithelial(8;0.0748)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.149)			GGGGAAATGGCCCCAAGCCCC	0.562																																																	0													55.0	58.0	57.0					17																	80789643		2203	4300	6503	SO:0001589	frameshift_variant	0			AK023903	CCDS11819.1	17q25.3	2008-05-02				ENSG00000141579			25843	protein-coding gene	gene with protein product		610226				16751772	Standard	NM_024702		Approved	FLJ13841, Zfp750	uc002kga.3	Q32MQ0		ENST00000269394.3:c.688delG	17.37:g.80789643delC	ENSP00000269394:p.Ala230fs		Q9H899	Frame_Shift_Del	DEL	NULL	p.A230fs	ENST00000269394.3	37	c.688	CCDS11819.1	17																																																																																			ZNF750	-	NULL	ENSG00000141579		0.562	ZNF750-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF750	HGNC	protein_coding	OTTHUMT00000439074.2		0.00	79	0	C	NM_024702		80789643	-1	tier1		no_errors	ENST00000269394	ensembl	human	known	74_37	frame_shift_del	68.75	30	66	DEL	0.019	-
ZNF883	169834	genome.wustl.edu	37	9	115760042	115760042	+	lincRNA	SNP	T	T	C			TCGA-LN-A4A9-01A-11D-A28B-09	TCGA-LN-A4A9-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3312754b-57aa-47bc-80a3-611d5a6a0822	ea1b57ff-0f6b-4d15-bff4-aa31ed6452cd	g.chr9:115760042T>C	ENST00000427548.1	-	0	1771							P0CG24	ZN883_HUMAN	zinc finger protein 883						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										CAATTAGGTGTGTGCTGCGGC	0.403																																																	0													106.0	104.0	105.0					9																	115760042		2152	4281	6433			0			AK095843		9q32	2010-07-23			ENSG00000228623	ENSG00000228623		"""Zinc fingers, C2H2-type"""	27271	protein-coding gene	gene with protein product							Standard	NM_001101338		Approved		uc011lwy.2	P0CG24	OTTHUMG00000020514		9.37:g.115760042T>C				RNA	SNP	-	NULL	ENST00000427548.1	37	NULL		9																																																																																			ZNF883	-	-	ENSG00000228623		0.403	ZNF883-001	KNOWN	basic	lincRNA	ZNF883	HGNC	lincRNA	OTTHUMT00000053704.1	-	0.00	39	0	T	NM_001101338		115760042	-1	tier1	-	no_errors	ENST00000427548	ensembl	human	known	74_37	rna	68.97	18	40	SNP	0.004	C
