#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCB5	340273	genome.wustl.edu	37	7	20766663	20766663	+	Splice_Site	SNP	A	A	G			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr7:20766663A>G	ENST00000404938.2	+	22	3278	c.2626A>G	c.(2626-2628)Ata>Gta	p.I876V	ABCB5_ENST00000258738.6_Splice_Site_p.I431V	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	876	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						GTTTTATAAGATAGCAACTGA	0.338																																																	0													74.0	78.0	76.0					7																	20766663		2203	4300	6503	SO:0001630	splice_region_variant	0			U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.2626-1A>G	7.37:g.20766663A>G			A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,pfam_ABC_ATPase_put,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.I431V	ENST00000404938.2	37	c.1291	CCDS55090.1	7	.	.	.	.	.	.	.	.	.	.	A	12.52	1.962847	0.34659	.	.	ENSG00000004846	ENST00000404938;ENST00000258738	D;D	0.87491	-2.26;-2.26	4.54	4.54	0.55810	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.64402	D	0.000004	D	0.84737	0.5538	L	0.31752	0.955	0.36815	D	0.886091	B;B;P	0.36465	0.439;0.216;0.554	P;B;B	0.47786	0.557;0.193;0.371	D	0.84774	0.0769	9	.	.	.	.	12.5018	0.55960	1.0:0.0:0.0:0.0	.	876;54;431	A7BKA4;A0ASV4;Q2M3G0	.;.;ABCB5_HUMAN	V	876;431	ENSP00000384881:I876V;ENSP00000258738:I431V	.	I	+	1	0	ABCB5	20733188	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	2.453000	0.44970	2.263000	0.75096	0.533000	0.62120	ATA	ABCB5	-	pfam_ABC_transptr_TM_dom,superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom	ENSG00000004846		0.338	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	ABCB5	HGNC	protein_coding	OTTHUMT00000326736.2	-	0.00	43	0	A	NM_178559	Missense_Mutation	20766663	+1	tier1	-	no_errors	ENST00000258738	ensembl	human	known	74_37	missense	34.15	27	14	SNP	1.000	G
ABHD14B	84836	genome.wustl.edu	37	3	52003994	52003994	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr3:52003994C>G	ENST00000483233.1	-	4	924	c.418G>C	c.(418-420)Gac>Cac	p.D140H	PCBP4_ENST00000428823.2_5'Flank|ABHD14B_ENST00000315877.10_Missense_Mutation_p.D138H|ABHD14B_ENST00000395008.2_Missense_Mutation_p.D140H|RP11-155D18.12_ENST00000488257.1_RNA|ABHD14B_ENST00000487005.1_5'UTR|ABHD14B_ENST00000361143.5_Missense_Mutation_p.D140H|PCBP4_ENST00000355852.2_5'Flank|PCBP4_ENST00000484633.1_5'Flank|RP11-155D18.14_ENST00000489595.2_Intron|ABHD14B_ENST00000461108.1_Missense_Mutation_p.D140H|PCBP4_ENST00000395013.3_5'Flank|PCBP4_ENST00000461554.1_5'Flank|ABHD14B_ENST00000525795.1_Missense_Mutation_p.D140H			Q96IU4	ABHEB_HUMAN	abhydrolase domain containing 14B	140					metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)			large_intestine(2)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000548)|KIRC - Kidney renal clear cell carcinoma(197;0.00072)		TTGATTTTGTCAGTGCAGATG	0.592																																																	0													74.0	80.0	78.0					3																	52003994		2203	4300	6503	SO:0001583	missense	0			AK075112	CCDS2842.1	3p21.2	2009-01-12			ENSG00000114779	ENSG00000114779		"""Abhydrolase domain containing"""	28235	protein-coding gene	gene with protein product							Standard	NM_032750		Approved	MGC15429, CIB	uc011bdy.2	Q96IU4	OTTHUMG00000157816	ENST00000483233.1:c.418G>C	3.37:g.52003994C>G	ENSP00000420065:p.Asp140His		Q86VK8|Q8N8W5	Missense_Mutation	SNP	NULL	p.D140H	ENST00000483233.1	37	c.418	CCDS2842.1	3	.	.	.	.	.	.	.	.	.	.	C	32	5.160564	0.94727	.	.	ENSG00000114779	ENST00000483233;ENST00000315877;ENST00000395008;ENST00000361143;ENST00000439982;ENST00000461108;ENST00000525795	T;T;T;T;T	0.25912	1.77;1.77;1.77;1.77;1.77	5.58	5.58	0.84498	.	0.214071	0.47852	D	0.000220	T	0.48660	0.1512	L	0.58302	1.8	0.80722	D	1	D;D	0.76494	0.999;0.988	D;P	0.66602	0.945;0.84	T	0.44174	-0.9345	10	0.72032	D	0.01	-16.0208	19.1914	0.93667	0.0:1.0:0.0:0.0	.	140;140	B4DQI4;Q96IU4	.;ABHEB_HUMAN	H	140;138;140;140;115;140;140	ENSP00000420065:D140H;ENSP00000318248:D138H;ENSP00000378455:D140H;ENSP00000354841:D140H;ENSP00000433388:D140H	ENSP00000318248:D138H	D	-	1	0	ABHD14B	51979034	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.628000	0.61282	2.626000	0.88956	0.655000	0.94253	GAC	ABHD14B	-	NULL	ENSG00000114779		0.592	ABHD14B-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ABHD14B	HGNC	protein_coding	OTTHUMT00000349673.1	-	0.00	55	0	C	NM_032750		52003994	-1	tier1	-	no_errors	ENST00000361143	ensembl	human	known	74_37	missense	60.53	15	23	SNP	1.000	G
PXYLP1	92370	genome.wustl.edu	37	3	141006278	141006278	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr3:141006278G>A	ENST00000286353.4	+	5	625	c.488G>A	c.(487-489)gGa>gAa	p.G163E	ACPL2_ENST00000502783.1_Missense_Mutation_p.G125E|ACPL2_ENST00000504264.1_Missense_Mutation_p.G146E|ACPL2_ENST00000393007.1_Missense_Mutation_p.G147E|ACPL2_ENST00000393010.2_Missense_Mutation_p.G163E|RP11-438D8.2_ENST00000507698.1_RNA|ACPL2_ENST00000508812.1_Missense_Mutation_p.G154E	NM_001037172.1|NM_001282728.1	NP_001032249.1|NP_001269657.1	Q8TE99	PXYP1_HUMAN		163						extracellular region (GO:0005576)	acid phosphatase activity (GO:0003993)			endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|prostate(2)|skin(2)	23						TGTGAGATGGGAGAGCTCACA	0.547																																																	0													111.0	107.0	109.0					3																	141006278		2203	4300	6503	SO:0001583	missense	0																														ENST00000286353.4:c.488G>A	3.37:g.141006278G>A	ENSP00000286353:p.Gly163Glu		D3DNF5|Q49AJ2|W0TR04	Missense_Mutation	SNP	pfam_His_Pase_superF_clade-2	p.G163E	ENST00000286353.4	37	c.488	CCDS3116.1	3	.	.	.	.	.	.	.	.	.	.	G	27.3	4.814459	0.90790	.	.	ENSG00000155893	ENST00000286353;ENST00000502783;ENST00000393010;ENST00000512457;ENST00000504264;ENST00000508812;ENST00000393007	D;D;D;D;D;D;D	0.83591	-1.74;-1.74;-1.74;-1.74;-1.74;-1.74;-1.74	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	D	0.90397	0.6994	M	0.89287	3.02	0.80722	D	1	D;P	0.58268	0.982;0.827	P;B	0.53809	0.735;0.42	D	0.91868	0.5505	10	0.72032	D	0.01	.	17.4922	0.87707	0.0:0.0:1.0:0.0	.	146;163	B7Z3R9;Q8TE99	.;ACPL2_HUMAN	E	163;125;163;125;146;154;147	ENSP00000286353:G163E;ENSP00000422558:G125E;ENSP00000376733:G163E;ENSP00000423702:G125E;ENSP00000426877:G146E;ENSP00000422901:G154E;ENSP00000376731:G147E	ENSP00000286353:G163E	G	+	2	0	ACPL2	142488968	1.000000	0.71417	0.976000	0.42696	0.736000	0.42039	9.771000	0.98977	2.724000	0.93272	0.561000	0.74099	GGA	ACPL2	-	pfam_His_Pase_superF_clade-2	ENSG00000155893		0.547	ACPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACPL2	HGNC	protein_coding	OTTHUMT00000359533.2	-	0.00	36	0	G			141006278	+1	tier1	-	no_errors	ENST00000286353	ensembl	human	known	74_37	missense	17.78	37	8	SNP	1.000	A
ADAM12	8038	genome.wustl.edu	37	10	127708373	127708373	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr10:127708373G>C	ENST00000368679.4	-	22	2869	c.2560C>G	c.(2560-2562)Cct>Gct	p.P854A		NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12	854					cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		GGCTTCTGAGGGGGGTTTGGC	0.617																																																	0													37.0	38.0	38.0					10																	127708373		2203	4300	6503	SO:0001583	missense	0			AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.2560C>G	10.37:g.127708373G>C	ENSP00000357668:p.Pro854Ala		O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.P854A	ENST00000368679.4	37	c.2560	CCDS7653.1	10	.	.	.	.	.	.	.	.	.	.	G	22.4	4.288281	0.80803	.	.	ENSG00000148848	ENST00000368679	T	0.03663	3.85	5.37	5.37	0.77165	.	0.000000	0.64402	D	0.000001	T	0.19604	0.0471	M	0.78456	2.415	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.00106	-1.2055	10	0.72032	D	0.01	.	16.905	0.86124	0.0:0.0:1.0:0.0	.	854	O43184	ADA12_HUMAN	A	854	ENSP00000357668:P854A	ENSP00000357668:P854A	P	-	1	0	ADAM12	127698363	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.288000	0.72679	2.510000	0.84645	0.650000	0.86243	CCT	ADAM12	-	NULL	ENSG00000148848		0.617	ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM12	HGNC	protein_coding	OTTHUMT00000050961.1	-	0.00	102	0	G			127708373	-1	tier1	-	no_errors	ENST00000368679	ensembl	human	known	74_37	missense	21.00	79	21	SNP	1.000	C
ADAM23	8745	genome.wustl.edu	37	2	207406859	207406859	+	Splice_Site	SNP	G	G	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr2:207406859G>T	ENST00000264377.3	+	5	984		c.e5+1		ADAM23_ENST00000374416.1_Splice_Site|ADAM23_ENST00000374415.3_Splice_Site	NM_003812.2	NP_003803.1	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23						cell adhesion (GO:0007155)|central nervous system development (GO:0007417)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(6)|kidney(3)|large_intestine(5)|liver(2)|lung(22)|ovary(2)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	51				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		ATGGACTTCAGTAAGTGGGAA	0.443																																					Melanoma(194;1127 2130 19620 24042 27855)												0													112.0	103.0	106.0					2																	207406859		2203	4300	6503	SO:0001630	splice_region_variant	0			AB009672	CCDS2369.1	2q33	2008-06-12	2005-08-18		ENSG00000114948	ENSG00000114948		"""ADAM metallopeptidase domain containing"""	202	protein-coding gene	gene with protein product		603710	"""a disintegrin and metalloproteinase domain 23"""			9693107	Standard	NM_003812		Approved	MDC3	uc002vbq.4	O75077	OTTHUMG00000132919	ENST00000264377.3:c.656+1G>T	2.37:g.207406859G>T			A2RU59	Splice_Site	SNP	-	e5+1	ENST00000264377.3	37	c.656+1	CCDS2369.1	2	.	.	.	.	.	.	.	.	.	.	G	19.52	3.842333	0.71488	.	.	ENSG00000114948	ENST00000264377;ENST00000374416;ENST00000431817;ENST00000374415	.	.	.	5.31	5.31	0.75309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5769	0.91158	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ADAM23	207115104	1.000000	0.71417	1.000000	0.80357	0.813000	0.45954	7.837000	0.86796	2.471000	0.83476	0.650000	0.86243	.	ADAM23	-	-	ENSG00000114948		0.443	ADAM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADAM23	HGNC	protein_coding	OTTHUMT00000256431.2	-	0.00	59	0	G	NM_003812	Intron	207406859	+1	tier1	-	no_errors	ENST00000264377	ensembl	human	known	74_37	splice_site	73.26	23	63	SNP	1.000	T
ADAM29	11086	genome.wustl.edu	37	4	175897785	175897785	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr4:175897785G>T	ENST00000359240.3	+	5	1779	c.1109G>T	c.(1108-1110)aGt>aTt	p.S370I	ADAM29_ENST00000514159.1_Missense_Mutation_p.S370I|ADAM29_ENST00000445694.1_Missense_Mutation_p.S370I|RP13-577H12.2_ENST00000507525.1_RNA|ADAM29_ENST00000404450.4_Missense_Mutation_p.S370I	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	370	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		AGCAATTGTAGTTATGGTGAT	0.388																																					Ovarian(140;1727 1835 21805 25838 41440)												0													125.0	125.0	125.0					4																	175897785		2203	4300	6503	SO:0001583	missense	0			AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.1109G>T	4.37:g.175897785G>T	ENSP00000352177:p.Ser370Ile		Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.S370I	ENST00000359240.3	37	c.1109	CCDS3823.1	4	.	.	.	.	.	.	.	.	.	.	G	14.77	2.633421	0.47049	.	.	ENSG00000168594	ENST00000359240;ENST00000445694;ENST00000404450;ENST00000514159	T;T;T;T	0.32272	1.46;1.46;1.46;1.46	3.6	2.72	0.32119	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.37136	U	0.002221	T	0.63943	0.2554	H	0.95224	3.64	0.22213	N	0.999282	D	0.89917	1.0	D	0.87578	0.998	T	0.60156	-0.7318	9	.	.	.	.	10.9848	0.47516	0.0:0.192:0.808:0.0	.	370	Q9UKF5	ADA29_HUMAN	I	370	ENSP00000352177:S370I;ENSP00000414544:S370I;ENSP00000384229:S370I;ENSP00000423517:S370I	.	S	+	2	0	ADAM29	176134360	1.000000	0.71417	0.102000	0.21198	0.004000	0.04260	4.823000	0.62694	1.044000	0.40200	0.579000	0.79373	AGT	ADAM29	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000168594		0.388	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ADAM29	HGNC	protein_coding		-	0.00	39	0	G			175897785	+1	tier1	-	no_errors	ENST00000359240	ensembl	human	known	74_37	missense	12.90	54	8	SNP	0.528	T
AMY2B	280	genome.wustl.edu	37	1	104114305	104114305	+	Silent	SNP	T	T	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr1:104114305T>C	ENST00000361355.4	+	3	697	c.81T>C	c.(79-81)tcT>tcC	p.S27S	AMY2B_ENST00000491397.1_3'UTR	NM_020978.3	NP_066188.1	P19961	AMY2B_HUMAN	amylase, alpha 2B (pancreatic)	27					carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|kidney(4)|large_intestine(1)|lung(30)|prostate(1)|skin(1)|urinary_tract(1)	46		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		GACGGACATCTATTGTTCATC	0.433																																																	0													105.0	97.0	99.0					1																	104114305		2202	4280	6482	SO:0001819	synonymous_variant	0			M24895	CCDS782.1	1p21	2010-08-02	2006-04-27		ENSG00000240038	ENSG00000240038	3.2.1.1		478	protein-coding gene	gene with protein product		104660	"""amylase, alpha 2B; pancreatic"""	AMY2		8268204	Standard	NM_020978		Approved		uc001duq.3	P19961	OTTHUMG00000011024	ENST00000361355.4:c.81T>C	1.37:g.104114305T>C			B3KTI1|B3KXB7|D3DT76|Q9UBH3	Silent	SNP	pfam_Glyco_hydro_13_cat_dom,pfam_A-amylase_b_C,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom,smart_A-amylase_b_C,prints_Alpha_amylase	p.S27	ENST00000361355.4	37	c.81	CCDS782.1	1																																																																																			AMY2B	-	superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom	ENSG00000240038		0.433	AMY2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMY2B	HGNC	protein_coding	OTTHUMT00000030318.1	-	0.00	164	0	T	NM_020978		104114305	+1	tier1	-	no_errors	ENST00000361355	ensembl	human	known	74_37	silent	50.66	75	77	SNP	1.000	C
ANKK1	255239	genome.wustl.edu	37	11	113270738	113270738	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr11:113270738G>A	ENST00000303941.3	+	8	2141	c.2047G>A	c.(2047-2049)Gca>Aca	p.A683T		NM_178510.1	NP_848605.1	Q8NFD2	ANKK1_HUMAN	ankyrin repeat and kinase domain containing 1	683							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|stomach(1)	29		all_cancers(61;1.53e-11)|all_epithelial(67;3e-06)|Melanoma(852;4.04e-05)|all_hematologic(158;0.000315)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0461)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Prostate(24;0.194)		BRCA - Breast invasive adenocarcinoma(274;4.82e-06)|Epithelial(105;5.41e-05)|all cancers(92;0.000442)|OV - Ovarian serous cystadenocarcinoma(223;0.238)		AGAACATCACGCAAATGTCCA	0.632																																																	0													62.0	69.0	66.0					11																	113270738		2067	4198	6265	SO:0001583	missense	0			AJ541797	CCDS44734.1	11q23.2	2013-01-10			ENSG00000170209	ENSG00000170209		"""Ankyrin repeat domain containing"""	21027	protein-coding gene	gene with protein product		608774				15146457	Standard	NM_178510		Approved	X-kinase	uc001pny.3	Q8NFD2	OTTHUMG00000167715	ENST00000303941.3:c.2047G>A	11.37:g.113270738G>A	ENSP00000306678:p.Ala683Thr			Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom	p.A683T	ENST00000303941.3	37	c.2047	CCDS44734.1	11	.	.	.	.	.	.	.	.	.	.	G	8.861	0.946966	0.18356	.	.	ENSG00000170209	ENST00000303941	T	0.25912	1.77	4.53	2.66	0.31614	Ankyrin repeat-containing domain (4);	0.103393	0.40908	D	0.000990	T	0.36908	0.0984	M	0.90252	3.1	0.27878	N	0.939807	B	0.30114	0.269	B	0.34038	0.174	T	0.38200	-0.9672	10	0.59425	D	0.04	-3.745	9.6143	0.39681	0.1699:0.0:0.8301:0.0	.	683	Q8NFD2	ANKK1_HUMAN	T	683	ENSP00000306678:A683T	ENSP00000306678:A683T	A	+	1	0	ANKK1	112775948	0.967000	0.33354	0.001000	0.08648	0.001000	0.01503	3.335000	0.52105	0.542000	0.28846	0.514000	0.50259	GCA	ANKK1	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000170209		0.632	ANKK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKK1	HGNC	protein_coding	OTTHUMT00000395830.1	-	0.00	57	0	G	NM_178510		113270738	+1	tier1	-	no_errors	ENST00000303941	ensembl	human	known	74_37	missense	17.72	64	14	SNP	0.409	A
ANKRD30B	374860	genome.wustl.edu	37	18	14850253	14850253	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr18:14850253G>C	ENST00000358984.4	+	35	3259	c.3079G>C	c.(3079-3081)Gat>Cat	p.D1027H		NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	1027										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						AAGAAATGTCGATATATTAAA	0.284																																																	0													48.0	41.0	43.0					18																	14850253		691	1575	2266	SO:0001583	missense	0			BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.3079G>C	18.37:g.14850253G>C	ENSP00000351875:p.Asp1027His		B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.D1027H	ENST00000358984.4	37	c.3079	CCDS54182.1	18	.	.	.	.	.	.	.	.	.	.	G	7.340	0.620620	0.14193	.	.	ENSG00000180777	ENST00000358984;ENST00000320584;ENST00000277669	T	0.18810	2.19	1.48	1.48	0.22813	.	.	.	.	.	T	0.39332	0.1074	M	0.68317	2.08	0.80722	D	1	D;D	0.89917	1.0;1.0	P;D	0.76575	0.895;0.988	T	0.31586	-0.9938	9	0.87932	D	0	.	8.9515	0.35792	0.0:0.0:1.0:0.0	.	1112;1027	Q9BXX2;F8WAG3	AN30B_HUMAN;.	H	1027;421;447	ENSP00000351875:D1027H	ENSP00000277669:D447H	D	+	1	0	ANKRD30B	14840253	0.990000	0.36364	0.089000	0.20774	0.075000	0.17131	3.342000	0.52159	1.139000	0.42245	0.173000	0.16961	GAT	ANKRD30B	-	NULL	ENSG00000180777		0.284	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD30B	HGNC	protein_coding	OTTHUMT00000443557.1	-	0.00	36	0	G	NM_001145029		14850253	+1	tier1	-	no_errors	ENST00000358984	ensembl	human	known	74_37	missense	60.34	22	35	SNP	0.900	C
ANKRD36BP2	645784	genome.wustl.edu	37	2	89100923	89100924	+	RNA	INS	-	-	G	rs369765448		TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr2:89100923_89100924insG	ENST00000393525.3	+	0	1397_1398									ankyrin repeat domain 36B pseudogene 2																		AATATAAAAAAGATACATATGA	0.282																																																	0																																												0					2q11.2	2010-09-30			ENSG00000230006	ENSG00000230006			33607	pseudogene	pseudogene							Standard	NR_015424		Approved		uc010fhg.4		OTTHUMG00000151690		2.37:g.89100924_89100924dupG				RNA	INS	-	NULL	ENST00000393525.3	37	NULL		2																																																																																			ANKRD36BP2	-	-	ENSG00000230006		0.282	ANKRD36BP2-003	KNOWN	basic	processed_transcript	ANKRD36BP2	HGNC	pseudogene	OTTHUMT00000323523.1		0.00	21	0	0			89100924	+1			no_errors	ENST00000393525	ensembl	human	known	74_37	rna	17.07	34	7	INS	0.049:0.030	G
ARHGAP5	394	genome.wustl.edu	37	14	32561296	32561296	+	Missense_Mutation	SNP	T	T	C	rs200111638		TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr14:32561296T>C	ENST00000345122.3	+	2	1736	c.1421T>C	c.(1420-1422)gTa>gCa	p.V474A	ARHGAP5_ENST00000432921.1_Missense_Mutation_p.V474A|ARHGAP5_ENST00000433497.1_Intron|ARHGAP5_ENST00000396582.2_Intron|ARHGAP5_ENST00000539826.2_Missense_Mutation_p.V474A|ARHGAP5_ENST00000556611.1_Missense_Mutation_p.V474A	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	474	FF 3.				cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		AGCAAAGAGGTATATGGTAGG	0.368																																					NSCLC(9;77 350 3443 29227 41353)												0													74.0	77.0	76.0					14																	32561296		2203	4297	6500	SO:0001583	missense	0			U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.1421T>C	14.37:g.32561296T>C	ENSP00000371897:p.Val474Ala		A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_FF_domain,pfam_Small_GTPase,superfamily_Rho_GTPase_activation_prot,superfamily_P-loop_NTPase,superfamily_FF_domain,smart_FF_domain,smart_RhoGAP_dom,pfscan_RhoGAP_dom,prints_Small_GTPase	p.V474A	ENST00000345122.3	37	c.1421	CCDS32062.1	14	.	.	.	.	.	.	.	.	.	.	T	17.13	3.311365	0.60414	.	.	ENSG00000100852	ENST00000556611;ENST00000539826;ENST00000345122;ENST00000432921	T;T;T;T	0.12039	2.72;2.72;2.72;2.72	6.02	6.02	0.97574	FF domain (1);	0.000000	0.85682	D	0.000000	T	0.25457	0.0619	L	0.40543	1.245	0.80722	D	1	P;P	0.49961	0.93;0.885	P;P	0.56042	0.79;0.622	T	0.00254	-1.1874	10	0.56958	D	0.05	.	16.5494	0.84464	0.0:0.0:0.0:1.0	.	474;474	Q13017-2;Q13017	.;RHG05_HUMAN	A	474	ENSP00000452222:V474A;ENSP00000441692:V474A;ENSP00000371897:V474A;ENSP00000393307:V474A	ENSP00000371897:V474A	V	+	2	0	ARHGAP5	31631047	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	8.040000	0.89188	2.299000	0.77371	0.528000	0.53228	GTA	ARHGAP5	-	superfamily_FF_domain,smart_FF_domain	ENSG00000100852		0.368	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP5	HGNC	protein_coding	OTTHUMT00000409735.1	-	0.00	93	0	T	NM_001030055		32561296	+1	tier1	rs200111638	no_errors	ENST00000345122	ensembl	human	known	74_37	missense	9.70	149	16	SNP	1.000	C
ARHGEF18	23370	genome.wustl.edu	37	19	7506809	7506809	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr19:7506809G>A	ENST00000359920.6	+	3	920	c.667G>A	c.(667-669)Gcc>Acc	p.A223T	CTD-2207O23.3_ENST00000593531.1_Silent_p.P180P|ARHGEF18_ENST00000319670.9_Missense_Mutation_p.A65T	NM_001130955.1	NP_001124427.1	Q6ZSZ5	ARHGI_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 18	223					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transforming growth factor beta receptor signaling pathway (GO:0007179)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(2)|stomach(1)|urinary_tract(1)	23		Renal(5;0.0902)				TCCCTACACCGCCTCGCTGAG	0.612																																																	0													132.0	137.0	135.0					19																	7506809		2203	4300	6503	SO:0001583	missense	0			AK074372	CCDS12177.1, CCDS45946.1	19p13.3	2013-01-10	2009-06-12			ENSG00000104880		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	17090	protein-coding gene	gene with protein product	"""Rho-specific guanine nucleotide exchange factor p114"""		"""rho/rac guanine nucleotide exchange factor (GEF) 18"""			9628581, 11318610	Standard	NM_015318		Approved	P114-RhoGEF, KIAA0521, MGC15913	uc002mgi.3	Q6ZSZ5		ENST00000359920.6:c.667G>A	19.37:g.7506809G>A	ENSP00000352995:p.Ala223Thr		A8MV62|B5ME81|O60274|Q6DD92	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.A223T	ENST00000359920.6	37	c.667	CCDS45946.1	19	.	.	.	.	.	.	.	.	.	.	G	13.98	2.399522	0.42512	.	.	ENSG00000104880	ENST00000319670;ENST00000359920	T;T	0.35789	1.32;1.29	5.54	5.54	0.83059	.	0.249459	0.28209	N	0.016187	T	0.37320	0.0999	L	0.56396	1.775	0.58432	D	0.999995	B	0.10296	0.003	B	0.17433	0.018	T	0.09751	-1.0660	10	0.35671	T	0.21	-30.3277	14.9733	0.71251	0.0:0.0:1.0:0.0	.	223	Q6ZSZ5	ARHGI_HUMAN	T	65;223	ENSP00000319200:A65T;ENSP00000352995:A223T	ENSP00000319200:A65T	A	+	1	0	ARHGEF18	7412809	0.974000	0.33945	0.930000	0.37139	0.032000	0.12392	2.406000	0.44557	2.612000	0.88384	0.505000	0.49811	GCC	ARHGEF18	-	NULL	ENSG00000104880		0.612	ARHGEF18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGEF18	HGNC	protein_coding	OTTHUMT00000436340.1	-	0.00	39	0	G	NM_015318		7506809	+1	tier1	-	no_errors	ENST00000359920	ensembl	human	known	74_37	missense	10.26	35	4	SNP	0.998	A
ARHGEF2	9181	genome.wustl.edu	37	1	155928115	155928115	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr1:155928115G>T	ENST00000361247.4	-	12	1640	c.1541C>A	c.(1540-1542)aCc>aAc	p.T514N	ARHGEF2_ENST00000313667.4_Missense_Mutation_p.T513N|ARHGEF2_ENST00000368316.1_Missense_Mutation_p.T486N|ARHGEF2_ENST00000462460.2_Missense_Mutation_p.T559N|ARHGEF2_ENST00000313695.7_Missense_Mutation_p.T486N|ARHGEF2_ENST00000368315.4_Missense_Mutation_p.T515N|ARHGEF2_ENST00000477754.2_Intron	NM_001162383.1|NM_001162384.1	NP_001155855.1|NP_001155856.1	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 2	514	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin filament organization (GO:0007015)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular hyperosmotic response (GO:0071474)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to tumor necrosis factor (GO:0071356)|establishment of mitotic spindle orientation (GO:0000132)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress (GO:1902219)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of necroptotic process (GO:0060546)|negative regulation of neurogenesis (GO:0050768)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cell proliferation (GO:0042127)|regulation of Rho protein signal transduction (GO:0035023)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|Rac GTPase binding (GO:0048365)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(4)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|skin(2)	40	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					TCTCACCAGGGTAGGAAAGAT	0.498																																					Melanoma(178;35 2768 6610 28839)												0													126.0	102.0	110.0					1																	155928115		2203	4300	6503	SO:0001583	missense	0			AB014551	CCDS1125.1, CCDS53375.1, CCDS53376.1	1q21-q22	2013-01-10	2009-06-12		ENSG00000116584	ENSG00000116584		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	682	protein-coding gene	gene with protein product		607560	"""rho/rac guanine nucleotide exchange factor (GEF) 2"""			9857026, 9734811	Standard	NM_004723		Approved	LFP40, GEF-H1, KIAA0651, P40	uc001fmt.2	Q92974	OTTHUMG00000017464	ENST00000361247.4:c.1541C>A	1.37:g.155928115G>T	ENSP00000354837:p.Thr514Asn		D3DVA6|O75142|Q15079|Q5VY92|Q8TDA3|Q8WUG4|Q9H023	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain	p.T515N	ENST00000361247.4	37	c.1544	CCDS53376.1	1	.	.	.	.	.	.	.	.	.	.	G	13.23	2.175874	0.38413	.	.	ENSG00000116584	ENST00000313695;ENST00000361247;ENST00000368315;ENST00000368316;ENST00000313667	T;T;T;T;T	0.74737	-0.87;-0.87;-0.87;-0.87;-0.87	4.77	4.77	0.60923	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.914888	0.09202	N	0.834507	T	0.63686	0.2532	M	0.63843	1.955	0.09310	N	1	B;B;B	0.18610	0.019;0.029;0.015	B;B;B	0.25759	0.063;0.055;0.06	T	0.59252	-0.7489	10	0.48119	T	0.1	-3.461	15.6642	0.77213	0.0:0.0:1.0:0.0	.	558;514;513	D3DVA5;Q92974;Q92974-2	.;ARHG2_HUMAN;.	N	486;514;515;486;513	ENSP00000315325:T486N;ENSP00000354837:T514N;ENSP00000357298:T515N;ENSP00000357299:T486N;ENSP00000314787:T513N	ENSP00000314787:T513N	T	-	2	0	ARHGEF2	154194739	0.007000	0.16637	0.798000	0.32154	0.853000	0.48598	1.447000	0.35101	2.615000	0.88500	0.650000	0.86243	ACC	ARHGEF2	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000116584		0.498	ARHGEF2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	ARHGEF2	HGNC	protein_coding	OTTHUMT00000046204.2	-	0.00	70	0	G	NM_004723		155928115	-1	tier1	-	no_errors	ENST00000368315	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.151	T
ASB2	51676	genome.wustl.edu	37	14	94413850	94413850	+	Silent	SNP	C	C	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr14:94413850C>A	ENST00000315988.4	-	5	1241	c.753G>T	c.(751-753)acG>acT	p.T251T	ASB2_ENST00000555019.1_Silent_p.T299T|ASB2_ENST00000556337.1_Intron|MIR4506_ENST00000584693.1_RNA	NM_016150.4	NP_057234.2	Q96Q27	ASB2_HUMAN	ankyrin repeat and SOCS box containing 2	251					intracellular signal transduction (GO:0035556)|myoblast differentiation (GO:0045445)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)	Cul5-RING ubiquitin ligase complex (GO:0031466)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|soft_tissue(1)|urinary_tract(1)	27		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.217)|Epithelial(152;0.232)		CGCTGGCCTGCGTGTTGATGT	0.592																																																	0													139.0	112.0	121.0					14																	94413850		2203	4300	6503	SO:0001819	synonymous_variant	0			AF159164	CCDS9915.1, CCDS55940.1	14q31-q32	2013-01-10	2011-01-25					"""Ankyrin repeat domain containing"""	16012	protein-coding gene	gene with protein product		605759	"""ankyrin repeat and SOCS box-containing 2"""				Standard	NM_016150		Approved	ASB-2	uc001ycd.3	Q96Q27		ENST00000315988.4:c.753G>T	14.37:g.94413850C>A			B2RDP9|B4E166|Q9NSU5|Q9Y567	Silent	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C,prints_Ankyrin_rpt	p.T251	ENST00000315988.4	37	c.753	CCDS9915.1	14																																																																																			ASB2	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000100628		0.592	ASB2-001	KNOWN	basic|CCDS	protein_coding	ASB2	HGNC	protein_coding	OTTHUMT00000412845.1	-	0.00	71	0	C			94413850	-1	tier1	-	no_errors	ENST00000315988	ensembl	human	known	74_37	silent	5.56	68	4	SNP	0.379	A
ASCC3	10973	genome.wustl.edu	37	6	101099510	101099510	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr6:101099510G>C	ENST00000369162.2	-	19	3345	c.3001C>G	c.(3001-3003)Ctc>Gtc	p.L1001V		NM_006828.2	NP_006819.2	Q8N3C0	ASCC3_HUMAN	activating signal cointegrator 1 complex subunit 3	1001	SEC63 1.				cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA duplex unwinding (GO:0032508)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		GCATCAAAGAGTTCATTAAAG	0.239																																																	0													103.0	101.0	102.0					6																	101099510		2203	4297	6500	SO:0001583	missense	0			AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249			18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1		10218103	Standard	NM_006828		Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.3001C>G	6.37:g.101099510G>C	ENSP00000358159:p.Leu1001Val		E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	Missense_Mutation	SNP	pfam_Sec63-dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_AAA+_ATPase,smart_Helicase_C,smart_Sec63-dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.L1001V	ENST00000369162.2	37	c.3001	CCDS5046.1	6	.	.	.	.	.	.	.	.	.	.	G	13.77	2.336329	0.41398	.	.	ENSG00000112249	ENST00000369162	T	0.61627	0.09	5.87	4.1	0.47936	Sec63 domain (3);	0.211924	0.37809	N	0.001928	T	0.38188	0.1031	M	0.63843	1.955	0.80722	D	1	B	0.20459	0.045	B	0.35353	0.201	T	0.24333	-1.0163	10	0.17369	T	0.5	.	8.9016	0.35499	0.2978:0.0:0.7022:0.0	.	1001	Q8N3C0	HELC1_HUMAN	V	1001	ENSP00000358159:L1001V	ENSP00000358159:L1001V	L	-	1	0	ASCC3	101206231	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.271000	0.43364	0.834000	0.34852	0.650000	0.86243	CTC	ASCC3	-	pfam_Sec63-dom,smart_Sec63-dom	ENSG00000112249		0.239	ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASCC3	HGNC	protein_coding	OTTHUMT00000041632.2	-	0.00	157	0	G	NM_006828		101099510	-1	tier1	-	no_errors	ENST00000369162	ensembl	human	known	74_37	missense	21.97	135	38	SNP	1.000	C
ASPG	374569	genome.wustl.edu	37	14	104573571	104573571	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr14:104573571C>T	ENST00000551177.1	+	12	1414	c.1322C>T	c.(1321-1323)gCc>gTc	p.A441V	ASPG_ENST00000546892.2_Missense_Mutation_p.A441V|ASPG_ENST00000455920.2_Missense_Mutation_p.A441V	NM_001080464.2	NP_001073933.2	Q86U10	LPP60_HUMAN	asparaginase	441					asparagine metabolic process (GO:0006528)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)		1-alkyl-2-acetylglycerophosphocholine esterase activity (GO:0003847)|asparaginase activity (GO:0004067)|lysophospholipase activity (GO:0004622)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	11						CTGCACGCGGCCGCCCGGGGA	0.667																																																	0													32.0	41.0	38.0					14																	104573571		2065	4195	6260	SO:0001583	missense	0				CCDS45170.1, CCDS45170.2	14q32.33	2014-03-14	2014-03-14	2008-11-06	ENSG00000166183	ENSG00000166183	3.1.1.5, 3.5.1.1	"""Ankyrin repeat domain containing"""	20123	protein-coding gene	gene with protein product	"""60-kDa-lysophospholipase"""		"""chromosome 14 open reading frame 76"", ""asparaginase homolog (S. cerevisiae)"""	C14orf76			Standard	NM_001080464		Approved		uc001yoq.2	Q86U10		ENST00000551177.1:c.1322C>T	14.37:g.104573571C>T	ENSP00000450040:p.Ala441Val		B9EGQ2|Q8IV80	Missense_Mutation	SNP	pfam_Asparaginase/glutaminase,pfam_Ankyrin_rpt,superfamily_Asparaginase/glutaminase,superfamily_Ankyrin_rpt-contain_dom,smart_Asparaginase/glutaminase,smart_Ankyrin_rpt,prints_Asparaginase/glutaminase,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,tigrfam_AsnASEI	p.A441V	ENST00000551177.1	37	c.1322	CCDS45170.2	14	.	.	.	.	.	.	.	.	.	.	C	16.48	3.136518	0.56936	.	.	ENSG00000166183	ENST00000551177;ENST00000299234;ENST00000546892;ENST00000455920;ENST00000550583	T;T;T;T	0.80909	-0.67;-1.43;-0.67;-0.67	4.62	4.62	0.57501	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	D	0.90421	0.7001	M	0.89163	3.01	0.54753	D	0.99998	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.92066	0.5660	10	0.87932	D	0	-21.1878	12.9635	0.58472	0.0:1.0:0.0:0.0	.	441;441;441;469	G3V1Y8;Q86U10;Q86U10-3;E5RFC2	.;LPP60_HUMAN;.;.	V	441;469;441;441;2	ENSP00000450040:A441V;ENSP00000448911:A441V;ENSP00000389003:A441V;ENSP00000446856:A2V	ENSP00000299234:A469V	A	+	2	0	ASPG	103643324	0.997000	0.39634	0.035000	0.18076	0.003000	0.03518	3.915000	0.56409	2.108000	0.64289	0.462000	0.41574	GCC	ASPG	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000166183		0.667	ASPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASPG	HGNC	protein_coding	OTTHUMT00000407005.1	-	0.00	99	0	C	NM_001080464		104573571	+1	tier1	-	no_errors	ENST00000455920	ensembl	human	known	74_37	missense	5.26	72	4	SNP	0.839	T
ATAD2	29028	genome.wustl.edu	37	8	124358392	124358392	+	Silent	SNP	T	T	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr8:124358392T>C	ENST00000287394.5	-	18	2573	c.2466A>G	c.(2464-2466)gtA>gtG	p.V822V	MIR548AA1_ENST00000384971.2_RNA|ATAD2_ENST00000521903.1_Silent_p.V140V	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	822					ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			CTAATGTATATACAGTAAACT	0.398																																																	0													98.0	96.0	96.0					8																	124358392		2203	4300	6503	SO:0001819	synonymous_variant	0			BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.2466A>G	8.37:g.124358392T>C			Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Silent	SNP	pfam_ATPase_AAA_core,pfam_Bromodomain,superfamily_P-loop_NTPase,superfamily_Bromodomain,smart_AAA+_ATPase,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.V822	ENST00000287394.5	37	c.2466	CCDS6343.1	8																																																																																			ATAD2	-	superfamily_P-loop_NTPase	ENSG00000156802		0.398	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD2	HGNC	protein_coding	OTTHUMT00000381766.2	-	0.00	70	0	T	NM_014109		124358392	-1	tier1	-	no_errors	ENST00000287394	ensembl	human	known	74_37	silent	41.30	54	38	SNP	0.463	C
ATP2B2	491	genome.wustl.edu	37	3	10442741	10442741	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr3:10442741C>T	ENST00000352432.4	-	4	746	c.677G>A	c.(676-678)gGc>gAc	p.G226D	ATP2B2_ENST00000343816.4_Missense_Mutation_p.G226D|ATP2B2_ENST00000397077.1_Missense_Mutation_p.G226D|ATP2B2_ENST00000383800.4_Missense_Mutation_p.G226D|ATP2B2_ENST00000360273.2_Missense_Mutation_p.G226D			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	226					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						GATGAAGAGGCCGTCGGCAGG	0.572																																					Ovarian(125;1619 1709 15675 19819 38835)												0													90.0	83.0	85.0					3																	10442741		2203	4300	6503	SO:0001583	missense	0			X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.677G>A	3.37:g.10442741C>T	ENSP00000324172:p.Gly226Asp		O00766|Q12994|Q16818	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_plasma,tigrfam_Cation_transp_P_typ_ATPase	p.G226D	ENST00000352432.4	37	c.677	CCDS33701.1	3	.	.	.	.	.	.	.	.	.	.	C	34	5.379919	0.95945	.	.	ENSG00000157087	ENST00000352432;ENST00000383800;ENST00000397077;ENST00000360273;ENST00000343816;ENST00000535386;ENST00000452124;ENST00000342354	D;D;D;D;D;D	0.92965	-3.14;-3.14;-3.14;-3.14;-3.14;-3.14	5.6	5.6	0.85130	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.85682	D	0.000000	D	0.97804	0.9279	H	0.97564	4.03	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98853	1.0759	10	0.87932	D	0	-38.1487	19.6187	0.95647	0.0:1.0:0.0:0.0	.	226;238;226	Q01814-7;Q4LE63;Q01814	.;.;AT2B2_HUMAN	D	226;226;226;226;226;192;113;226	ENSP00000324172:G226D;ENSP00000373311:G226D;ENSP00000380267:G226D;ENSP00000353414:G226D;ENSP00000344677:G226D;ENSP00000414854:G113D	ENSP00000342954:G226D	G	-	2	0	ATP2B2	10417741	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.818000	0.86416	2.627000	0.88993	0.650000	0.86243	GGC	ATP2B2	-	pfam_ATPase_P-typ_transduc_dom_A,tigrfam_Cation_transp_P_typ_ATPase	ENSG00000157087		0.572	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	ATP2B2	HGNC	protein_coding	OTTHUMT00000250576.2	-	0.00	73	0	C	NM_001683		10442741	-1	tier1	-	no_errors	ENST00000352432	ensembl	human	known	74_37	missense	22.47	69	20	SNP	1.000	T
ATP4B	496	genome.wustl.edu	37	13	114307313	114307313	+	Missense_Mutation	SNP	C	C	T	rs202021919		TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr13:114307313C>T	ENST00000335288.4	-	4	471	c.430G>A	c.(430-432)Gct>Act	p.A144T		NM_000705.3	NP_000696.1	P51164	ATP4B_HUMAN	ATPase, H+/K+ exchanging, beta polypeptide	144					cell adhesion (GO:0007155)|hydrogen ion transmembrane transport (GO:1902600)|ion transmembrane transport (GO:0034220)|response to lipopolysaccharide (GO:0032496)|response to organonitrogen compound (GO:0010243)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	hydrogen:potassium-exchanging ATPase activity (GO:0008900)			breast(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.00696)|all_epithelial(44;0.00347)|all_lung(25;0.0221)|Breast(118;0.0411)|Lung NSC(25;0.0839)	all cancers(43;0.171)			TGGTTGGGAGCGCGGAAACTC	0.587																																																	0								C	THR/ALA	3,4403	6.2+/-15.9	0,3,2200	114.0	101.0	106.0		430	4.7	0.3	13		106	0,8600		0,0,4300	yes	missense	ATP4B	NM_000705.3	58	0,3,6500	TT,TC,CC		0.0,0.0681,0.0231	possibly-damaging	144/292	114307313	3,13003	2203	4300	6503	SO:0001583	missense	0				CCDS9539.1	13q34	2011-08-01			ENSG00000186009	ENSG00000186009	3.6.3.10	"""ATPases / P-type"""	820	protein-coding gene	gene with protein product		137217				1330887, 15057823	Standard	NM_000705		Approved	ATP6B	uc001vtz.3	P51164	OTTHUMG00000140234	ENST00000335288.4:c.430G>A	13.37:g.114307313C>T	ENSP00000334216:p.Ala144Thr		B1B0N8	Missense_Mutation	SNP	pfam_Na/K_ATPase_sub_beta,tigrfam_Na/K_ATPase_sub_beta	p.A144T	ENST00000335288.4	37	c.430	CCDS9539.1	13	.	.	.	.	.	.	.	.	.	.	C	15.81	2.944085	0.53079	6.81E-4	0.0	ENSG00000186009	ENST00000335288	T	0.30448	1.53	4.7	4.7	0.59300	.	0.079246	0.47852	D	0.000205	T	0.50257	0.1605	M	0.79123	2.44	0.40287	D	0.978464	D	0.69078	0.997	P	0.62560	0.904	T	0.50224	-0.8853	10	0.14252	T	0.57	-8.0652	14.9312	0.70916	0.0:1.0:0.0:0.0	.	144	P51164	ATP4B_HUMAN	T	144	ENSP00000334216:A144T	ENSP00000334216:A144T	A	-	1	0	ATP4B	113355314	0.979000	0.34478	0.260000	0.24451	0.079000	0.17450	5.635000	0.67841	2.303000	0.77524	0.491000	0.48974	GCT	ATP4B	-	pfam_Na/K_ATPase_sub_beta,tigrfam_Na/K_ATPase_sub_beta	ENSG00000186009		0.587	ATP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP4B	HGNC	protein_coding	OTTHUMT00000276703.2		0.00	29	0	C	NM_000705		114307313	-1			no_errors	ENST00000335288	ensembl	human	known	74_37	missense	8.70	21	2	SNP	0.944	T
B3GAT2	135152	genome.wustl.edu	37	6	71666093	71666093	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr6:71666093G>A	ENST00000230053.6	-	1	648	c.40C>T	c.(40-42)Ccc>Tcc	p.P14S		NM_080742.2	NP_542780.1	Q9NPZ5	B3GA2_HUMAN	beta-1,3-glucuronyltransferase 2	14					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity (GO:0015018)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(2)|urinary_tract(1)	16						AGGATCCAGGGCAGGAGGATA	0.657																																																	0													11.0	14.0	13.0					6																	71666093		1970	3931	5901	SO:0001583	missense	0			AB075843	CCDS4974.1	6q12	2014-07-08	2014-07-08		ENSG00000112309	ENSG00000112309	2.4.1.135	"""Beta-1,3-glucuronyltransferases"""	922	protein-coding gene	gene with protein product	"""glucuronosyltransferase S"", ""galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 2"""	607497				12383500	Standard	NM_080742		Approved	GlcAT-S	uc003pfv.3	Q9NPZ5	OTTHUMG00000014997	ENST00000230053.6:c.40C>T	6.37:g.71666093G>A	ENSP00000230053:p.Pro14Ser		Q5JS09|Q8TF38|Q96NK4	Missense_Mutation	SNP	pfam_Glyco_trans_43	p.P14S	ENST00000230053.6	37	c.40	CCDS4974.1	6	.	.	.	.	.	.	.	.	.	.	G	20.5	3.996778	0.74818	.	.	ENSG00000112309	ENST00000230053	T	0.68181	-0.31	4.54	3.59	0.41128	.	0.060067	0.64402	D	0.000002	T	0.64692	0.2621	M	0.66939	2.045	0.58432	D	0.999995	D;D	0.64830	0.994;0.964	P;P	0.53102	0.718;0.466	T	0.68644	-0.5354	10	0.52906	T	0.07	-3.1491	11.9629	0.53019	0.0:0.0:0.8256:0.1744	.	14;14	Q29RV3;Q9NPZ5	.;B3GA2_HUMAN	S	14	ENSP00000230053:P14S	ENSP00000230053:P14S	P	-	1	0	B3GAT2	71722814	1.000000	0.71417	1.000000	0.80357	0.722000	0.41435	5.107000	0.64603	2.050000	0.60909	0.555000	0.69702	CCC	B3GAT2	-	NULL	ENSG00000112309		0.657	B3GAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GAT2	HGNC	protein_coding	OTTHUMT00000041150.2	-	0.00	87	0	G	NM_080742		71666093	-1	tier1	-	no_errors	ENST00000230053	ensembl	human	known	74_37	missense	37.18	48	29	SNP	1.000	A
B4GALT3	8703	genome.wustl.edu	37	1	161143503	161143503	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr1:161143503T>C	ENST00000319769.5	-	6	917	c.695A>G	c.(694-696)cAg>cGg	p.Q232R	PPOX_ENST00000535223.1_Intron|PPOX_ENST00000495483.1_Intron|PPOX_ENST00000432542.2_Intron|B4GALT3_ENST00000367998.1_Missense_Mutation_p.Q232R|B4GALT3_ENST00000470882.1_5'UTR	NM_001199873.1|NM_003779.3	NP_001186802.1|NP_003770.1	O60512	B4GT3_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3	232					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|galactosyltransferase activity (GO:0008378)|metal ion binding (GO:0046872)|N-acetyllactosamine synthase activity (GO:0003945)			cervix(1)|endometrium(5)|large_intestine(6)|lung(6)	18	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)		N-Acetyl-D-glucosamine(DB00141)	TCCGAAGTACTGGGGGTACGG	0.552																																																	0													130.0	119.0	123.0					1																	161143503		2203	4300	6503	SO:0001583	missense	0			BC006099	CCDS1222.1	1q21-q23	2013-02-19			ENSG00000158850	ENSG00000158850		"""Beta 4-glycosyltransferases"""	926	protein-coding gene	gene with protein product		604014				9405390, 9597550	Standard	NM_001199873		Approved	beta4Gal-T3	uc001fys.2	O60512	OTTHUMG00000034348	ENST00000319769.5:c.695A>G	1.37:g.161143503T>C	ENSP00000320965:p.Gln232Arg		D3DVG3|O60910|Q9BPZ4|Q9H8T2	Missense_Mutation	SNP	pfam_Galactosyl_T_C,prints_Galactosyl_T	p.Q232R	ENST00000319769.5	37	c.695	CCDS1222.1	1	.	.	.	.	.	.	.	.	.	.	T	15.50	2.851641	0.51270	.	.	ENSG00000158850	ENST00000319769;ENST00000407555;ENST00000367998;ENST00000367997	D;D	0.81499	-1.5;-1.5	5.44	5.44	0.79542	.	0.286608	0.39985	N	0.001213	T	0.57784	0.2077	N	0.25485	0.75	0.46849	D	0.999223	B	0.23185	0.081	B	0.30029	0.11	T	0.57027	-0.7881	10	0.19147	T	0.46	.	13.1234	0.59340	0.0:0.0:0.0:1.0	.	232	O60512	B4GT3_HUMAN	R	232;209;232;232	ENSP00000320965:Q232R;ENSP00000356977:Q232R	ENSP00000320965:Q232R	Q	-	2	0	B4GALT3	159410127	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.112000	0.50368	2.288000	0.76882	0.533000	0.62120	CAG	B4GALT3	-	pfam_Galactosyl_T_C,prints_Galactosyl_T	ENSG00000158850		0.552	B4GALT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALT3	HGNC	protein_coding	OTTHUMT00000083054.1	-	0.00	118	0	T	NM_003779		161143503	-1	tier1	-	no_errors	ENST00000319769	ensembl	human	known	74_37	missense	28.18	79	31	SNP	1.000	C
BACH1	571	genome.wustl.edu	37	21	30693632	30693632	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr21:30693632T>C	ENST00000399921.1	+	2	274	c.31T>C	c.(31-33)Tat>Cat	p.Y11H	BACH1_ENST00000286800.3_Missense_Mutation_p.Y11H	NM_206866.1	NP_996749.1	Q9BX63	FANCJ_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 1	0	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|urinary_tract(2)	27						GGTTTTTGCCTATGAATCTTC	0.443																																																	0													122.0	105.0	111.0					21																	30693632		2203	4300	6503	SO:0001583	missense	0			AF026200	CCDS13585.1	21q22.1	2013-01-10			ENSG00000156273	ENSG00000156273		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	935	protein-coding gene	gene with protein product		602751				9544839, 9479503	Standard	NR_027655		Approved	BACH-1, BTBD24	uc002ynj.3	O14867	OTTHUMG00000078878	ENST00000399921.1:c.31T>C	21.37:g.30693632T>C	ENSP00000382805:p.Tyr11His		Q3MJE2|Q8NCI5	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_bZIP,superfamily_BTB/POZ_fold,superfamily_TF_DNA-bd,smart_BTB/POZ-like,smart_bZIP,pfscan_BTB/POZ-like,pfscan_bZIP	p.Y11H	ENST00000399921.1	37	c.31	CCDS13585.1	21	.	.	.	.	.	.	.	.	.	.	T	18.02	3.529953	0.64860	.	.	ENSG00000156273	ENST00000548219;ENST00000550131;ENST00000547141;ENST00000546469;ENST00000286800;ENST00000399921;ENST00000548467;ENST00000451655;ENST00000447177;ENST00000435072	T;T;T;T;T	0.22539	1.95;1.95;1.95;1.95;1.95	5.31	5.31	0.75309	BTB/POZ fold (1);	0.084818	0.50627	D	0.000102	T	0.32556	0.0833	L	0.49455	1.56	0.47214	D	0.999352	P	0.47191	0.891	P	0.51453	0.67	T	0.02683	-1.1124	10	0.54805	T	0.06	-27.6458	15.5563	0.76196	0.0:0.0:0.0:1.0	.	11	O14867	BACH1_HUMAN	H	11	ENSP00000286800:Y11H;ENSP00000382805:Y11H;ENSP00000400576:Y11H;ENSP00000408605:Y11H;ENSP00000392202:Y11H	ENSP00000286800:Y11H	Y	+	1	0	BACH1	29615503	1.000000	0.71417	0.995000	0.50966	0.986000	0.74619	7.451000	0.80668	2.136000	0.66102	0.377000	0.23210	TAT	BACH1	-	superfamily_BTB/POZ_fold	ENSG00000156273		0.443	BACH1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BACH1	HGNC	protein_coding	OTTHUMT00000171974.1	-	0.00	38	0	T	NM_206866		30693632	+1	tier1	-	no_errors	ENST00000286800	ensembl	human	known	74_37	missense	27.27	24	9	SNP	1.000	C
BCL7A	605	genome.wustl.edu	37	12	122473259	122473259	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr12:122473259G>T	ENST00000261822.4	+	3	403	c.197G>T	c.(196-198)gGc>gTc	p.G66V	BCL7A_ENST00000538010.1_Missense_Mutation_p.G66V	NM_001024808.1	NP_001019979.1	Q4VC05	BCL7A_HUMAN	B-cell CLL/lymphoma 7A	66					negative regulation of transcription, DNA-templated (GO:0045892)					haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000202)|Epithelial(86;0.000386)|BRCA - Breast invasive adenocarcinoma(302;0.231)		AAGAAAAAAGGCAAGGACGAG	0.547			T	MYC	BNHL																																GBM(17;197 467 16477 23242 44349)			Dom	yes		12	12q24.1	605	B-cell CLL/lymphoma 7A		L	0													93.0	83.0	86.0					12																	122473259		2203	4300	6503	SO:0001583	missense	0			X89984	CCDS9226.1, CCDS53841.1	12q24.1	2008-07-03			ENSG00000110987	ENSG00000110987			1004	protein-coding gene	gene with protein product		601406		BCL7		8605326, 9931421	Standard	NM_020993		Approved		uc001ubo.3	Q4VC05	OTTHUMG00000168951	ENST00000261822.4:c.197G>T	12.37:g.122473259G>T	ENSP00000261822:p.Gly66Val		B4DJN6|B7ZB21|Q13843|Q14CT7	Missense_Mutation	SNP	pfam_BCL7	p.G66V	ENST00000261822.4	37	c.197	CCDS53841.1	12	.	.	.	.	.	.	.	.	.	.	G	22.1	4.248602	0.80024	.	.	ENSG00000110987	ENST00000538010;ENST00000261822	T;T	0.49139	0.79;0.79	6.17	5.29	0.74685	.	0.153108	0.64402	D	0.000015	T	0.35307	0.0927	N	0.24115	0.695	0.80722	D	1	P;P	0.45827	0.79;0.867	B;B	0.44085	0.255;0.44	T	0.09662	-1.0664	10	0.26408	T	0.33	.	10.1789	0.42955	0.072:0.1362:0.7918:0.0	.	66;66	Q4VC05;Q4VC05-2	BCL7A_HUMAN;.	V	66	ENSP00000445868:G66V;ENSP00000261822:G66V	ENSP00000261822:G66V	G	+	2	0	BCL7A	120957642	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.957000	0.76019	1.636000	0.50526	0.655000	0.94253	GGC	BCL7A	-	NULL	ENSG00000110987		0.547	BCL7A-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	BCL7A	HGNC	protein_coding	OTTHUMT00000401712.1	-	0.00	71	0	G			122473259	+1	tier1	-	no_errors	ENST00000538010	ensembl	human	known	74_37	missense	5.80	65	4	SNP	1.000	T
BMP6	654	genome.wustl.edu	37	6	7880462	7880462	+	Silent	SNP	G	G	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr6:7880462G>A	ENST00000283147.6	+	7	1587	c.1428G>A	c.(1426-1428)ccG>ccA	p.P476P		NM_001718.4	NP_001709.1	P22004	BMP6_HUMAN	bone morphogenetic protein 6	476			P -> L (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular response to mechanical stimulus (GO:0071260)|endochondral ossification (GO:0001958)|eye development (GO:0001654)|growth (GO:0040007)|immune response (GO:0006955)|inflammatory response (GO:0006954)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|osteoblast differentiation (GO:0001649)|positive regulation of aldosterone biosynthetic process (GO:0032349)|positive regulation of aldosterone secretion (GO:2000860)|positive regulation of bone mineralization (GO:0030501)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to activity (GO:0014823)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to retinoic acid (GO:0032526)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|type B pancreatic cell development (GO:0003323)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)|protein heterodimerization activity (GO:0046982)			breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(6)|ovary(1)|prostate(1)	23	Ovarian(93;0.0721)					TCCCCAAACCGTGCTGTGCGC	0.443																																																	0													188.0	198.0	195.0					6																	7880462		2203	4300	6503	SO:0001819	synonymous_variant	0			AF083030	CCDS4503.1	6p24-p23	2014-01-30	2003-10-06		ENSG00000153162	ENSG00000153162		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1073	protein-coding gene	gene with protein product		112266	"""vegetal related growth factor (TGFB-related)"""	VGR		1427904, 1453478	Standard	NM_001718		Approved	VGR1	uc003mxu.4	P22004	OTTHUMG00000014217	ENST00000283147.6:c.1428G>A	6.37:g.7880462G>A			Q5TCP3	Silent	SNP	pfam_TGF-b_N,pfam_TGF-b_C,smart_TGF-b_C	p.P476	ENST00000283147.6	37	c.1428	CCDS4503.1	6																																																																																			BMP6	-	pfam_TGF-b_C,smart_TGF-b_C	ENSG00000153162		0.443	BMP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP6	HGNC	protein_coding	OTTHUMT00000039794.1	-	0.00	72	0	G	NM_001718		7880462	+1	tier1	-	no_errors	ENST00000283147	ensembl	human	known	74_37	silent	6.90	54	4	SNP	0.942	A
BMX	660	genome.wustl.edu	37	X	15525518	15525518	+	5'UTR	SNP	T	T	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chrX:15525518T>A	ENST00000342014.6	+	0	78				BMX_ENST00000357607.2_Intron|BMX_ENST00000348343.6_Intron|BMX_ENST00000463891.1_3'UTR	NM_001721.6	NP_001712.1	P51813	BMX_HUMAN	BMX non-receptor tyrosine kinase						apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to stress (GO:0006950)|signal transduction (GO:0007165)	cytosol (GO:0005829)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|signal transducer activity (GO:0004871)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(14)|ovary(2)|urinary_tract(3)	30	Hepatocellular(33;0.183)					ATACTTCGGCTCTAGCGAGTC	0.393																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AF045459	CCDS14168.1	Xp22.2	2013-05-14			ENSG00000102010	ENSG00000102010		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1079	protein-coding gene	gene with protein product	"""BTK-like on X chromosome"""	300101				7970727	Standard	NM_203281		Approved	ETK, PSCTK3	uc004cwx.4	P51813	OTTHUMG00000021180	ENST00000342014.6:c.-24T>A	X.37:g.15525518T>A			A6NIH9|O60564|Q12871	RNA	SNP	-	NULL	ENST00000342014.6	37	NULL	CCDS14168.1	X																																																																																			BMX	-	-	ENSG00000102010		0.393	BMX-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BMX	HGNC	protein_coding	OTTHUMT00000055873.1	-	0.00	28	0	T	NM_001721		15525518	+1	tier1	-	no_errors	ENST00000463891	ensembl	human	known	74_37	rna	70.00	9	21	SNP	0.000	A
BRAT1	221927	genome.wustl.edu	37	7	2581386	2581386	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr7:2581386C>T	ENST00000340611.4	-	8	1356	c.1100G>A	c.(1099-1101)cGc>cAc	p.R367H	BRAT1_ENST00000473879.1_5'Flank	NM_152743.3	NP_689956.2	Q6PJG6	BRAT1_HUMAN	BRCA1-associated ATM activator 1	367					response to ionizing radiation (GO:0010212)	membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	23						AGCCAGGGTGCGGCACAGGAG	0.701																																																	0													18.0	27.0	24.0					7																	2581386		2202	4296	6498	SO:0001583	missense	0			BC015632	CCDS5334.1	7p22.3	2011-03-22	2011-02-28	2011-03-22	ENSG00000106009	ENSG00000106009			21701	protein-coding gene	gene with protein product	"""BRCA1-associated protein required for ATM activation protein 1"""	614506	"""chromosome 7 open reading frame 27"""	C7orf27, BAAT1		16452482	Standard	NM_152743		Approved	MGC22916	uc003smi.3	Q6PJG6	OTTHUMG00000119091	ENST00000340611.4:c.1100G>A	7.37:g.2581386C>T	ENSP00000339637:p.Arg367His		A4D200|C9JY24|Q8IW85|Q8IZ43|Q8WVR8|Q96IV9|Q9H7J8|Q9UFA3	Missense_Mutation	SNP	pfam_HEAT,superfamily_ARM-type_fold	p.R367H	ENST00000340611.4	37	c.1100	CCDS5334.1	7	.	.	.	.	.	.	.	.	.	.	C	15.25	2.776769	0.49786	.	.	ENSG00000106009	ENST00000340611	T	0.68025	-0.3	5.0	-4.25	0.03766	Armadillo-type fold (1);	0.566223	0.18304	N	0.145302	T	0.48205	0.1487	L	0.40543	1.245	0.18873	N	0.999985	P	0.49783	0.928	B	0.36504	0.226	T	0.52245	-0.8601	10	0.40728	T	0.16	-1.0081	13.1816	0.59657	0.0:0.1096:0.0:0.8904	.	367	Q6PJG6	BRAT1_HUMAN	H	367	ENSP00000339637:R367H	ENSP00000339637:R367H	R	-	2	0	BRAT1	2547912	0.726000	0.28059	0.014000	0.15608	0.892000	0.51952	0.112000	0.15479	-0.861000	0.04094	0.462000	0.41574	CGC	BRAT1	-	superfamily_ARM-type_fold	ENSG00000106009		0.701	BRAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRAT1	HGNC	protein_coding	OTTHUMT00000239305.2		0.00	58	0	C	NM_152743		2581386	-1			no_errors	ENST00000340611	ensembl	human	known	74_37	missense	9.52	38	4	SNP	0.323	T
BUB1B	701	genome.wustl.edu	37	15	40509785	40509785	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr15:40509785G>T	ENST00000287598.6	+	21	2962	c.2767G>T	c.(2767-2769)Gat>Tat	p.D923Y	BUB1B_ENST00000412359.3_Missense_Mutation_p.D937Y|PAK6_ENST00000441369.1_5'UTR|PAK6_ENST00000453867.1_5'UTR|RP11-133K1.2_ENST00000558658.1_5'Flank	NM_001211.5	NP_001202	O60566	BUB1B_HUMAN	BUB1 mitotic checkpoint serine/threonine kinase B	923	Protein kinase.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|protein localization to chromosome, centromeric region (GO:0071459)|protein localization to kinetochore (GO:0034501)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|condensed chromosome kinetochore (GO:0000777)|condensed chromosome outer kinetochore (GO:0000940)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|perinuclear region of cytoplasm (GO:0048471)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|liver(2)|lung(17)|ovary(1)|stomach(2)|urinary_tract(2)	36		all_cancers(109;1.12e-18)|all_epithelial(112;1.61e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0556)		GGTGCAGCTGGATGTTTTTAC	0.453			"""Mis, N, F, S"""			rhabdomyosarcoma			Mosaic Variegated Aneuploidy Syndrome																														yes	Rec		Mosaic variegated aneuploidy	15	15q15	701	BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast)		M	0													238.0	237.0	237.0					15																	40509785		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	MVA, MVA syndrome, VMA syndrome, variegated mosaic aneuploidy syndrome, premature centromere division	AF107297	CCDS10053.1	15q15	2014-09-17	2013-01-17		ENSG00000156970	ENSG00000156970			1149	protein-coding gene	gene with protein product		602860	"""budding uninhibited by benzimidazoles 1 (yeast homolog), beta"", ""budding uninhibited by benzimidazoles 1 homolog beta (yeast)"""			9889005	Standard	NM_001211		Approved	BUBR1, MAD3L, Bub1A, SSK1	uc001zkx.4	O60566	OTTHUMG00000129877	ENST00000287598.6:c.2767G>T	15.37:g.40509785G>T	ENSP00000287598:p.Asp923Tyr		B2R6U0|B4DL09|B4DLG3|O60501|O60627|O60758|O75389|Q59HH6|Q8WV50|Q96KM4	Missense_Mutation	SNP	pfam_Mad3_BUB1_I,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Mad3_BUB1_I	p.D937Y	ENST00000287598.6	37	c.2809	CCDS10053.1	15	.	.	.	.	.	.	.	.	.	.	G	14.80	2.642976	0.47153	.	.	ENSG00000156970	ENST00000287598;ENST00000412359;ENST00000442874	T;T	0.21361	2.01;2.01	5.7	5.7	0.88788	.	0.321542	0.29185	N	0.012896	T	0.34919	0.0914	L	0.46885	1.475	0.50813	D	0.999896	D	0.57571	0.98	P	0.57425	0.82	T	0.01909	-1.1249	10	0.66056	D	0.02	-19.0139	14.7201	0.69300	0.0:0.1549:0.845:0.0	.	923	O60566	BUB1B_HUMAN	Y	923;937;806	ENSP00000287598:D923Y;ENSP00000398470:D937Y	ENSP00000287598:D923Y	D	+	1	0	BUB1B	38297077	0.168000	0.22989	0.171000	0.22900	0.840000	0.47671	2.787000	0.47798	2.675000	0.91044	0.591000	0.81541	GAT	BUB1B	-	NULL	ENSG00000156970		0.453	BUB1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BUB1B	HGNC	protein_coding	OTTHUMT00000252122.4	-	0.00	84	0	G			40509785	+1	tier1	-	no_errors	ENST00000412359	ensembl	human	known	74_37	missense	21.21	52	14	SNP	0.074	T
C14orf166	51637	genome.wustl.edu	37	14	52466445	52466445	+	Silent	SNP	G	G	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr14:52466445G>A	ENST00000261700.3	+	5	558	c.393G>A	c.(391-393)aaG>aaA	p.K131K	C14orf166_ENST00000556760.1_Silent_p.K131K	NM_016039.2	NP_057123.1	Q9Y224	CN166_HUMAN	chromosome 14 open reading frame 166	131					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|RNA transport (GO:0050658)|transcription, DNA-templated (GO:0006351)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|tRNA-splicing ligase complex (GO:0072669)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA polymerase II core binding (GO:0000993)			endometrium(1)|large_intestine(3)|lung(2)	6	Breast(41;0.0639)|all_epithelial(31;0.101)					CTGATTTTAAGGCTGGTGTGA	0.338																																																	0													111.0	99.0	103.0					14																	52466445		2203	4300	6503	SO:0001819	synonymous_variant	0			AF151857	CCDS9705.1	14q22.1	2014-05-29			ENSG00000087302	ENSG00000087302			23169	protein-coding gene	gene with protein product	"""RLL motif containing 1"""	610858				10810093, 24608264	Standard	NM_016039		Approved	CGI-99, RLLM1, CLE, CLE7, LCRP369	uc010aod.3	Q9Y224	OTTHUMG00000152332	ENST00000261700.3:c.393G>A	14.37:g.52466445G>A				Silent	SNP	pfam_UPF0568	p.K131	ENST00000261700.3	37	c.393	CCDS9705.1	14																																																																																			C14orf166	-	pfam_UPF0568	ENSG00000087302		0.338	C14orf166-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf166	HGNC	protein_coding	OTTHUMT00000276887.1	-	0.00	49	0	G	NM_016039		52466445	+1	tier1	-	no_errors	ENST00000261700	ensembl	human	known	74_37	silent	39.62	32	21	SNP	1.000	A
C16orf62	57020	genome.wustl.edu	37	16	19590313	19590313	+	Intron	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr16:19590313C>T	ENST00000251143.5	+	6	445				C16orf62_ENST00000538853.1_Intron|C16orf62_ENST00000438132.3_Intron|C16orf62_ENST00000448695.1_Missense_Mutation_p.P3S|C16orf62_ENST00000543152.1_5'UTR|C16orf62_ENST00000417362.2_Intron|C16orf62_ENST00000542263.1_Intron			Q7Z3J2	CP062_HUMAN	chromosome 16 open reading frame 62							integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	36						AAAGATGCCTCCACTGGGGGT	0.423																																																	0													49.0	47.0	48.0					16																	19590313		692	1591	2283	SO:0001627	intron_variant	0				CCDS32397.1, CCDS32397.2, CCDS73840.1	16p12.3	2012-05-30			ENSG00000103544	ENSG00000103544			24641	protein-coding gene	gene with protein product						10493829	Standard	NM_020314		Approved	MGC16824	uc002dgn.3	Q7Z3J2	OTTHUMG00000167925	ENST00000251143.5:c.434-61C>T	16.37:g.19590313C>T			A8K2M1|O43329|Q69YI1|Q6PDA0|Q7L371|Q86W66|Q8WXA5|Q9H0L7|Q9H7C8	Missense_Mutation	SNP	NULL	p.P3S	ENST00000251143.5	37	c.7		16	.	.	.	.	.	.	.	.	.	.	C	8.817	0.936585	0.18206	.	.	ENSG00000103544	ENST00000448695	T	0.29655	1.56	5.05	-5.45	0.02616	.	.	.	.	.	T	0.26268	0.0641	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.43130	-0.9410	6	0.87932	D	0	.	5.9891	0.19450	0.0:0.2499:0.2507:0.4994	.	.	.	.	S	3	ENSP00000398009:P3S	ENSP00000398009:P3S	P	+	1	0	C16orf62	19497814	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-0.273000	0.08548	-1.137000	0.02888	-0.367000	0.07326	CCA	C16orf62	-	NULL	ENSG00000103544		0.423	C16orf62-201	KNOWN	basic|appris_principal	protein_coding	C16orf62	HGNC	protein_coding		-	0.00	36	0	C	NM_020314		19590313	+1	tier1	-	no_errors	ENST00000448695	ensembl	human	known	74_37	missense	38.64	27	17	SNP	0.000	T
C2orf68	388969	genome.wustl.edu	37	2	85839075	85839075	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr2:85839075G>T	ENST00000306336.5	-	1	77	c.33C>A	c.(31-33)caC>caA	p.H11Q	USP39_ENST00000450066.2_5'Flank|C2orf68_ENST00000478626.1_5'Flank|C2orf68_ENST00000409734.3_Missense_Mutation_p.H11Q|USP39_ENST00000459775.1_Intron	NM_001013649.3	NP_001013671.2	Q2NKX9	CB068_HUMAN	chromosome 2 open reading frame 68	11										breast(1)|central_nervous_system(1)|endometrium(1)	3						GCTTGCAGCAGTGCCCCGGCC	0.731																																																	0													11.0	17.0	15.0					2																	85839075		1860	4037	5897	SO:0001583	missense	0				CCDS42704.1	2p11.2	2008-07-18			ENSG00000168887	ENSG00000168887			34353	protein-coding gene	gene with protein product							Standard	NM_001013649		Approved		uc002sqc.2	Q2NKX9	OTTHUMG00000153088	ENST00000306336.5:c.33C>A	2.37:g.85839075G>T	ENSP00000304410:p.His11Gln		B4DT10|Q4G0J7|Q6ZVA6	Missense_Mutation	SNP	pfam_UPF0561	p.H11Q	ENST00000306336.5	37	c.33	CCDS42704.1	2	.	.	.	.	.	.	.	.	.	.	G	11.35	1.613596	0.28712	.	.	ENSG00000168887	ENST00000306336;ENST00000409734	.	.	.	5.44	1.54	0.23209	.	0.403945	0.21281	N	0.077144	T	0.16727	0.0402	N	0.14661	0.345	0.19300	N	0.99997	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.003	T	0.12656	-1.0539	9	0.40728	T	0.16	-4.293	2.4159	0.04436	0.1496:0.2943:0.414:0.1421	.	11;11	Q2NKX9-3;Q2NKX9	.;CB068_HUMAN	Q	11	.	ENSP00000304410:H11Q	H	-	3	2	C2orf68	85692586	0.312000	0.24545	0.546000	0.28166	0.181000	0.23173	0.153000	0.16323	0.102000	0.17638	0.585000	0.79938	CAC	C2orf68	-	pfam_UPF0561	ENSG00000168887		0.731	C2orf68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf68	HGNC	protein_coding	OTTHUMT00000329451.1	-	0.00	14	0	G	NM_001013649		85839075	-1	tier1	-	no_errors	ENST00000306336	ensembl	human	known	74_37	missense	40.00	9	6	SNP	0.491	T
C9orf91	203197	genome.wustl.edu	37	9	117386549	117386549	+	Intron	SNP	G	G	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr9:117386549G>A	ENST00000288502.4	+	3	543				C9orf91_ENST00000471206.1_3'UTR|C9orf91_ENST00000374049.4_Intron			Q5VZI3	CI091_HUMAN	chromosome 9 open reading frame 91							integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(3)|lung(5)|pancreas(1)|skin(1)|urinary_tract(1)	13						CCAGAGGTGTGATGCCGCCAG	0.577																																																	0																																										SO:0001627	intron_variant	0			BX649023	CCDS6808.1	9q33.1	2008-02-05			ENSG00000157693	ENSG00000157693			24513	protein-coding gene	gene with protein product						14702039	Standard	NM_153045		Approved	DKFZp547P234, FLJ38045	uc004bjd.4	Q5VZI3	OTTHUMG00000020541	ENST00000288502.4:c.107-81G>A	9.37:g.117386549G>A			A0PJA3|Q3KNS4|Q5VZI2|Q6P5Z7|Q8N1P3|Q8ND43	RNA	SNP	-	NULL	ENST00000288502.4	37	NULL	CCDS6808.1	9																																																																																			C9orf91	-	-	ENSG00000157693		0.577	C9orf91-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	C9orf91	HGNC	protein_coding	OTTHUMT00000053780.1	-	0.00	15	0	G	NM_153045		117386549	+1	tier1	-	no_errors	ENST00000471206	ensembl	human	known	74_37	rna	62.50	9	15	SNP	0.005	A
CBFA2T2	9139	genome.wustl.edu	37	20	32212784	32212784	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr20:32212784C>G	ENST00000346541.3	+	7	1471	c.934C>G	c.(934-936)Cta>Gta	p.L312V	CBFA2T2_ENST00000491618.1_3'UTR|CBFA2T2_ENST00000397800.1_Missense_Mutation_p.L283V|CBFA2T2_ENST00000359606.3_Missense_Mutation_p.L322V|CBFA2T2_ENST00000375279.2_Missense_Mutation_p.L312V|CBFA2T2_ENST00000492345.1_Missense_Mutation_p.L283V|CBFA2T2_ENST00000342704.6_Missense_Mutation_p.L303V	NM_005093.3	NP_005084.1	O43439	MTG8R_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 2	312					epithelial cell differentiation (GO:0030855)|negative regulation of neuron projection development (GO:0010977)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)	20						CAACAAGATGCTAGAGCATCG	0.473																																					Esophageal Squamous(174;142 1955 14837 21276 28041)												0													93.0	79.0	84.0					20																	32212784		2203	4300	6503	SO:0001583	missense	0			AF052210	CCDS13221.1, CCDS46590.1	20q11	2007-01-29			ENSG00000078699	ENSG00000078699		"""Zinc fingers, MYND-type"""	1536	protein-coding gene	gene with protein product		603672				9790752	Standard	XM_006723886		Approved	MTGR1, ZMYND3	uc002wze.1	O43439	OTTHUMG00000032261	ENST00000346541.3:c.934C>G	20.37:g.32212784C>G	ENSP00000262653:p.Leu312Val		B2RAE6|F8W6D7|Q5TGE4|Q5TGE5|Q5TGE6|Q5TGE7|Q8IWF3|Q96B06|Q96L00|Q9H436|Q9UJP8|Q9UJP9|Q9UP24	Missense_Mutation	SNP	pfam_NHR2,pfam_TAFH_NHR1,pfam_Znf_MYND,smart_TAFH_NHR1,pfscan_TAFH_NHR1,pfscan_Znf_MYND,prints_ETO,prints_MTGR1	p.L312V	ENST00000346541.3	37	c.934	CCDS13221.1	20	.	.	.	.	.	.	.	.	.	.	C	9.147	1.015324	0.19355	.	.	ENSG00000078699	ENST00000397803;ENST00000375279;ENST00000342704;ENST00000346541;ENST00000397800;ENST00000359606	T;T;T;T;T	0.44083	0.93;0.93;0.93;0.94;1.52	5.73	0.186	0.15105	.	0.492494	0.21336	N	0.076220	T	0.14527	0.0351	N	0.08118	0	0.49299	D	0.99977	B;B	0.33171	0.278;0.4	B;B	0.31101	0.084;0.124	T	0.09509	-1.0671	10	0.15499	T	0.54	-5.9758	1.2921	0.02062	0.3155:0.3121:0.2058:0.1666	.	312;303	O43439;F8W6D7	MTG8R_HUMAN;.	V	86;312;303;312;283;322	ENSP00000364428:L312V;ENSP00000345810:L303V;ENSP00000262653:L312V;ENSP00000380902:L283V;ENSP00000352622:L322V	ENSP00000345810:L303V	L	+	1	2	CBFA2T2	31676445	0.110000	0.22057	0.990000	0.47175	0.870000	0.49936	-0.432000	0.06956	-0.172000	0.10779	-0.182000	0.12963	CTA	CBFA2T2	-	prints_MTGR1	ENSG00000078699		0.473	CBFA2T2-201	KNOWN	basic|CCDS	protein_coding	CBFA2T2	HGNC	protein_coding	OTTHUMT00000078708.2	-	0.00	76	0	C	NM_001032999		32212784	+1	tier1	-	no_errors	ENST00000346541	ensembl	human	known	74_37	missense	5.26	108	6	SNP	0.692	G
CCDC102B	79839	genome.wustl.edu	37	18	66504325	66504325	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr18:66504325G>T	ENST00000360242.5	+	2	442	c.325G>T	c.(325-327)Gtt>Ttt	p.V109F	CCDC102B_ENST00000584156.1_Missense_Mutation_p.V109F|CCDC102B_ENST00000358653.5_Missense_Mutation_p.V109F|CCDC102B_ENST00000577772.1_3'UTR|CCDC102B_ENST00000319445.6_Missense_Mutation_p.V109F	NM_024781.2	NP_079057	Q68D86	C102B_HUMAN	coiled-coil domain containing 102B	109										breast(2)|endometrium(3)|large_intestine(5)|lung(19)|ovary(1)|skin(5)|stomach(1)	36		Esophageal squamous(42;0.0559)|Colorectal(73;0.0604)				ATGGAGTAAAGTTCGAGCTGA	0.478																																																	0													91.0	90.0	91.0					18																	66504325		1953	4136	6089	SO:0001583	missense	0			AK027247	CCDS11996.2	18q22.1	2007-11-14	2006-04-10	2006-04-10	ENSG00000150636	ENSG00000150636			26295	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 14"", ""aminoacylase 1-like"""	C18orf14, ACY1L		14702039	Standard	NM_001093729		Approved	FLJ23594, HsT1731, AN	uc002lkk.2	Q68D86	OTTHUMG00000132808	ENST00000360242.5:c.325G>T	18.37:g.66504325G>T	ENSP00000353377:p.Val109Phe		Q7Z467|Q8NDK7|Q9H5C1	Missense_Mutation	SNP	NULL	p.V109F	ENST00000360242.5	37	c.325	CCDS11996.2	18	.	.	.	.	.	.	.	.	.	.	G	14.27	2.486740	0.44249	.	.	ENSG00000150636	ENST00000319445;ENST00000358653;ENST00000360242	T;T;T	0.50813	0.73;0.73;0.73	5.24	4.35	0.52113	.	0.120536	0.36854	N	0.002366	T	0.35008	0.0917	L	0.29908	0.895	0.42761	D	0.993804	P;P	0.46020	0.871;0.725	B;B	0.38500	0.275;0.204	T	0.23691	-1.0181	10	0.54805	T	0.06	-14.266	12.5647	0.56304	0.0:0.0:0.8335:0.1665	.	109;109	Q68D86-3;Q68D86	.;C102B_HUMAN	F	109	ENSP00000316237:V109F;ENSP00000351479:V109F;ENSP00000353377:V109F	ENSP00000316237:V109F	V	+	1	0	CCDC102B	64655305	1.000000	0.71417	0.912000	0.35992	0.993000	0.82548	6.280000	0.72626	1.180000	0.42898	0.460000	0.39030	GTT	CCDC102B	-	NULL	ENSG00000150636		0.478	CCDC102B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC102B	HGNC	protein_coding	OTTHUMT00000256225.2	-	0.00	65	0	G	NM_024781		66504325	+1	tier1	-	no_errors	ENST00000319445	ensembl	human	known	74_37	missense	67.57	24	50	SNP	1.000	T
CCDC148	130940	genome.wustl.edu	37	2	159028672	159028672	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr2:159028672G>A	ENST00000283233.5	-	14	2042	c.1729C>T	c.(1729-1731)Caa>Taa	p.Q577*	CCDC148_ENST00000409187.1_Nonsense_Mutation_p.Q586*|CCDC148-AS1_ENST00000412781.2_RNA	NM_138803.3	NP_620158.3	Q8NFR7	CC148_HUMAN	coiled-coil domain containing 148	577								p.Q577*(1)		endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23						GGAGGTTTTTGAGGACTAATT	0.343																																																	1	Substitution - Nonsense(1)	upper_aerodigestive_tract(1)											68.0	71.0	70.0					2																	159028672		2203	4299	6502	SO:0001587	stop_gained	0				CCDS33304.1	2q24.1	2007-12-07			ENSG00000153237	ENSG00000153237			25191	protein-coding gene	gene with protein product							Standard	NM_138803		Approved	MGC125588	uc002tzq.3	Q8NFR7	OTTHUMG00000153973	ENST00000283233.5:c.1729C>T	2.37:g.159028672G>A	ENSP00000283233:p.Gln577*		F5H839|Q3B7I3|Q3B7I4|Q3KR41|Q4ZG12|Q4ZG23|Q53TM6|Q96BN5|Q96LM2	Nonsense_Mutation	SNP	NULL	p.Q577*	ENST00000283233.5	37	c.1729	CCDS33304.1	2	.	.	.	.	.	.	.	.	.	.	G	37	6.567178	0.97671	.	.	ENSG00000153237	ENST00000283233;ENST00000409187	.	.	.	5.93	4.88	0.63580	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.722	14.7351	0.69409	0.0823:0.0:0.9177:0.0	.	.	.	.	X	577;586	.	ENSP00000283233:Q577X	Q	-	1	0	CCDC148	158736918	0.993000	0.37304	1.000000	0.80357	0.825000	0.46686	3.047000	0.49854	2.812000	0.96745	0.555000	0.69702	CAA	CCDC148	-	NULL	ENSG00000153237		0.343	CCDC148-001	KNOWN	basic|CCDS	protein_coding	CCDC148	HGNC	protein_coding	OTTHUMT00000333270.1	-	0.00	38	0	G	NM_138803		159028672	-1	tier1	-	no_errors	ENST00000283233	ensembl	human	known	74_37	nonsense	30.61	34	15	SNP	0.984	A
CCDC27	148870	genome.wustl.edu	37	1	3680269	3680269	+	Splice_Site	SNP	G	G	T	rs139984517		TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr1:3680269G>T	ENST00000294600.2	+	8	1405		c.e8-1			NM_152492.2	NP_689705.2	Q2M243	CCD27_HUMAN	coiled-coil domain containing 27									p.?(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(2)|lung(17)|prostate(1)|skin(2)|urinary_tract(2)	36	all_cancers(77;0.0385)|Ovarian(185;0.0634)|Lung NSC(156;0.21)|all_lung(157;0.218)	all_epithelial(116;5.52e-17)|all_lung(118;1.04e-06)|Lung NSC(185;0.000214)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Lung SC(97;0.0367)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)		Epithelial(90;1.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.35e-22)|GBM - Glioblastoma multiforme(42;3.46e-16)|Colorectal(212;1.17e-05)|COAD - Colon adenocarcinoma(227;5.76e-05)|Kidney(185;0.00036)|BRCA - Breast invasive adenocarcinoma(365;0.000696)|KIRC - Kidney renal clear cell carcinoma(229;0.00558)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		TCTGTGCCCAGGAGTGATTGC	0.592																																																	1	Unknown(1)	skin(1)											112.0	114.0	113.0					1																	3680269		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS50.1	1p36.32	2008-02-05			ENSG00000162592	ENSG00000162592			26546	protein-coding gene	gene with protein product							Standard	NM_152492		Approved	FLJ32825	uc001akv.2	Q2M243	OTTHUMG00000003504	ENST00000294600.2:c.1322-1G>T	1.37:g.3680269G>T			Q5TBV3|Q96M50	Splice_Site	SNP	-	e8-1	ENST00000294600.2	37	c.1322-1	CCDS50.1	1	.	.	.	.	.	.	.	.	.	.	G	12.41	1.928880	0.34002	.	.	ENSG00000162592	ENST00000294600	.	.	.	4.34	4.34	0.51931	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.0592	0.58997	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CCDC27	3670129	1.000000	0.71417	0.805000	0.32314	0.096000	0.18686	4.514000	0.60482	2.356000	0.79943	0.462000	0.41574	.	CCDC27	-	-	ENSG00000162592		0.592	CCDC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC27	HGNC	protein_coding	OTTHUMT00000009740.1		0.00	55	0	G	NM_152492	Intron	3680269	+1			no_errors	ENST00000294600	ensembl	human	known	74_37	splice_site	7.41	25	2	SNP	0.958	T
CCDC80	151887	genome.wustl.edu	37	3	112358594	112358594	+	Silent	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr3:112358594C>T	ENST00000206423.3	-	2	1112	c.159G>A	c.(157-159)agG>agA	p.R53R	CCDC80_ENST00000475181.1_5'UTR|CCDC80_ENST00000439685.2_Silent_p.R53R	NM_199511.1|NM_199512.1	NP_955805.1|NP_955806.1	Q76M96	CCD80_HUMAN	coiled-coil domain containing 80	53					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(21)|ovary(3)|pancreas(2)|prostate(4)	51						TCCCAGTGTGCCTCAGAAACC	0.572																																																	0													77.0	67.0	70.0					3																	112358594		2203	4300	6503	SO:0001819	synonymous_variant	0			AY333429	CCDS2968.1	3q13.2	2010-12-24			ENSG00000091986	ENSG00000091986			30649	protein-coding gene	gene with protein product	"""steroid sensitive gene 1"""	608298				15325258, 18178152	Standard	XM_005247135		Approved	URB, SSG1, DRO1	uc003dzf.3	Q76M96	OTTHUMG00000159265	ENST00000206423.3:c.159G>A	3.37:g.112358594C>T			D3DN67|Q5PR20|Q6GPG9|Q8IVT6|Q8NBV1|Q8NHY8	Silent	SNP	NULL	p.R53	ENST00000206423.3	37	c.159	CCDS2968.1	3																																																																																			CCDC80	-	NULL	ENSG00000091986		0.572	CCDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC80	HGNC	protein_coding	OTTHUMT00000354219.1	-	0.00	79	0	C	NM_199511		112358594	-1	tier1	-	no_errors	ENST00000206423	ensembl	human	known	74_37	silent	5.15	92	5	SNP	1.000	T
CD1B	910	genome.wustl.edu	37	1	158299306	158299306	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr1:158299306C>T	ENST00000368168.3	-	4	847	c.740G>A	c.(739-741)gGc>gAc	p.G247D		NM_001764.2	NP_001755.1	P29016	CD1B_HUMAN	CD1b molecule	247	Ig-like.				antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	cell surface (GO:0009986)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)				breast(2)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	30	all_hematologic(112;0.0378)					TAGCTGAGTGCCCTGCTGCTC	0.612																																																	0													136.0	121.0	126.0					1																	158299306		2203	4300	6503	SO:0001583	missense	0			M28826	CCDS1176.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158485	ENSG00000158485		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1635	protein-coding gene	gene with protein product		188360	"""CD1B antigen, b polypeptide"", ""CD1b antigen"""	CD1		2447586	Standard	NM_001764		Approved		uc001frx.3	P29016	OTTHUMG00000017513	ENST00000368168.3:c.740G>A	1.37:g.158299306C>T	ENSP00000357150:p.Gly247Asp		Q5TDK9|Q5TDL0|Q9UMM2	Missense_Mutation	SNP	pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like_dom	p.G247D	ENST00000368168.3	37	c.740	CCDS1176.1	1	.	.	.	.	.	.	.	.	.	.	C	4.399	0.073647	0.08485	.	.	ENSG00000158485	ENST00000368168	T	0.03212	4.01	4.13	2.61	0.31194	Immunoglobulin-like (1);MHC class I-like antigen recognition (1);Immunoglobulin C1-set (2);	0.189133	0.26800	N	0.022422	T	0.01287	0.0042	L	0.35854	1.095	0.09310	N	1	B	0.31125	0.309	B	0.39503	0.301	T	0.49254	-0.8959	10	0.19590	T	0.45	-4.8212	6.3999	0.21632	0.0:0.7983:0.0:0.2017	.	247	P29016	CD1B_HUMAN	D	247	ENSP00000357150:G247D	ENSP00000357150:G247D	G	-	2	0	CD1B	156565930	0.000000	0.05858	0.013000	0.15412	0.026000	0.11368	0.077000	0.14738	0.638000	0.30545	0.561000	0.74099	GGC	CD1B	-	pfam_Ig_C1-set,smart_Ig_C1-set,pfscan_Ig-like_dom	ENSG00000158485		0.612	CD1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD1B	HGNC	protein_coding	OTTHUMT00000046350.2	-	0.00	93	0	C	NM_001764		158299306	-1	tier1	-	no_errors	ENST00000368168	ensembl	human	known	74_37	missense	26.55	83	30	SNP	0.029	T
CDH12	1010	genome.wustl.edu	37	5	21760720	21760720	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr5:21760720C>G	ENST00000382254.1	-	13	2666	c.1580G>C	c.(1579-1581)aGa>aCa	p.R527T	CDH12_ENST00000522262.1_Missense_Mutation_p.R487T|CDH12_ENST00000504376.2_Missense_Mutation_p.R527T|RP11-804N13.1_ENST00000522350.1_RNA|CDH12_ENST00000521384.1_5'UTR	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	527	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						AGGTGATAATCTAAAGGAGAA	0.383										HNSCC(59;0.17)																																							0													132.0	139.0	137.0					5																	21760720		2203	4300	6503	SO:0001583	missense	0			L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.1580G>C	5.37:g.21760720C>G	ENSP00000371689:p.Arg527Thr		B2RBT1|B7Z2U6|Q86UD2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R527T	ENST00000382254.1	37	c.1580	CCDS3890.1	5	.	.	.	.	.	.	.	.	.	.	C	13.67	2.306353	0.40795	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	T;T;T	0.52295	0.67;0.67;0.67	5.19	4.3	0.51218	Cadherin (4);Cadherin-like (1);	0.130079	0.64402	D	0.000001	T	0.36963	0.0986	N	0.21583	0.68	0.40890	D	0.984066	B;B	0.30542	0.001;0.284	B;B	0.36719	0.016;0.231	T	0.30446	-0.9978	10	0.45353	T	0.12	.	11.0434	0.47844	0.0:0.8406:0.0:0.1594	.	487;527	B7Z2U6;P55289	.;CAD12_HUMAN	T	527;527;487	ENSP00000423577:R527T;ENSP00000371689:R527T;ENSP00000428786:R487T	ENSP00000371689:R527T	R	-	2	0	CDH12	21796477	0.998000	0.40836	1.000000	0.80357	0.998000	0.95712	0.603000	0.24149	1.272000	0.44329	0.650000	0.86243	AGA	CDH12	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000154162		0.383	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH12	HGNC	protein_coding	OTTHUMT00000207139.1	-	0.00	86	0	C	NM_004061		21760720	-1	tier1	-	no_errors	ENST00000382254	ensembl	human	known	74_37	missense	6.03	109	7	SNP	1.000	G
CEP290	80184	genome.wustl.edu	37	12	88478393	88478393	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr12:88478393C>A	ENST00000552810.1	-	35	5017	c.4674G>T	c.(4672-4674)aaG>aaT	p.K1558N	CEP290_ENST00000397838.3_Missense_Mutation_p.K618N|CEP290_ENST00000309041.7_Missense_Mutation_p.K1560N|CEP290_ENST00000547691.2_Missense_Mutation_p.K618N	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	1558					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)				breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						GACGTTGATACTTCTTTAATA	0.294																																																	0													153.0	143.0	146.0					12																	88478393		1801	4065	5866	SO:0001583	missense	0			AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.4674G>T	12.37:g.88478393C>A	ENSP00000448012:p.Lys1558Asn		Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Missense_Mutation	SNP	NULL	p.K1560N	ENST00000552810.1	37	c.4680	CCDS55858.1	12	.	.	.	.	.	.	.	.	.	.	C	16.66	3.185360	0.57909	.	.	ENSG00000198707	ENST00000547691;ENST00000552810;ENST00000309041;ENST00000397838	D;D;D;D	0.92805	-3.11;-3.11;-3.11;-3.11	5.52	-5.74	0.02391	.	0.000000	0.85682	D	0.000000	D	0.92987	0.7768	M	0.64997	1.995	0.41995	D	0.990866	D	0.76494	0.999	D	0.72625	0.978	D	0.90932	0.4791	10	0.39692	T	0.17	.	13.3396	0.60537	0.0:0.3635:0.0:0.6365	.	1558	O15078	CE290_HUMAN	N	618;1558;1560;618	ENSP00000446905:K618N;ENSP00000448012:K1558N;ENSP00000308021:K1560N;ENSP00000380938:K618N	ENSP00000308021:K1560N	K	-	3	2	CEP290	87002524	0.766000	0.28496	0.892000	0.35008	0.834000	0.47266	-0.218000	0.09240	-0.747000	0.04759	-1.105000	0.02106	AAG	CEP290	-	NULL	ENSG00000198707		0.294	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CEP290	HGNC	protein_coding	OTTHUMT00000406344.1	-	0.00	81	0	C	NM_025114		88478393	-1	tier1	-	no_errors	ENST00000309041	ensembl	human	known	74_37	missense	18.45	84	19	SNP	0.966	A
CES1	1066	genome.wustl.edu	37	16	55866958	55866958	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr16:55866958G>A	ENST00000361503.4	-	1	140	c.10C>T	c.(10-12)Cgt>Tgt	p.R4C	CES1_ENST00000422046.2_Missense_Mutation_p.R4C|CES1_ENST00000360526.3_Missense_Mutation_p.R4C			P23141	EST1_HUMAN	carboxylesterase 1	4				RAFI -> PALV (in Ref. 3; BAA04650, 8; BAC87749/BAC87751, 9; BAF83312/BAF84898 and 11; AAH12418). {ECO:0000305}.	epithelial cell differentiation (GO:0030855)|metabolic process (GO:0008152)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)	carboxylic ester hydrolase activity (GO:0052689)|methylumbelliferyl-acetate deacetylase activity (GO:0047374)								all cancers(182;0.13)|Epithelial(162;0.137)	Benzocaine(DB01086)|Capecitabine(DB01101)|Ciclesonide(DB01410)|Clopidogrel(DB00758)|Cyclandelate(DB04838)|Dabigatran etexilate(DB06695)|Indomethacin(DB00328)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Mycophenolate mofetil(DB00688)|Oseltamivir(DB00198)|Probucol(DB01599)|Rufinamide(DB06201)|Tamoxifen(DB00675)|Trandolapril(DB00519)	ATAAAGGCACGGAGCCACATC	0.602																																					NSCLC(162;1801 2756 42904 52896)												0													74.0	61.0	65.0					16																	55866958		2156	4192	6348	SO:0001583	missense	0			BC012418	CCDS32450.1, CCDS45488.1, CCDS45489.1	16q22.2	2010-10-12	2010-10-12		ENSG00000198848	ENSG00000198848	3.1.1.1	"""Carboxylesterases"""	1863	protein-coding gene	gene with protein product	"""human monocyte/macrophage serine esterase 1"""	114835	"""carboxylesterase 1 (monocyte/macrophage serine esterase 1)"""			2070086, 20931200	Standard	XM_005255774		Approved	HMSE, CES2, HMSE1, SES1, CEH, CES1A1, CES1A2	uc002eil.3	P23141		ENST00000361503.4:c.10C>T	16.37:g.55866958G>A	ENSP00000355193:p.Arg4Cys		A6NIM1|A8K3K8|A8K844|E9PAU8|P82127|Q00015|Q13657|Q14062|Q16737|Q16788|Q549X7|Q549X8|Q86UK2|Q96EE8|Q9UC52|Q9UDG8|Q9UK77|Q9ULY2	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3	p.R4C	ENST00000361503.4	37	c.10	CCDS45488.1	16	.	.	.	.	.	.	.	.	.	.	.	8.233	0.805192	0.16467	.	.	ENSG00000198848	ENST00000360526;ENST00000361503;ENST00000422046	T;T;T	0.66460	-0.21;-0.21;-0.21	3.81	-0.024	0.13941	Carboxylesterase, type B (1);	2.527660	0.01798	N	0.032705	T	0.40767	0.1130	N	0.03016	-0.435	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.002;0.001	T	0.27434	-1.0074	10	0.38643	T	0.18	.	3.3834	0.07262	0.5679:0.2054:0.2266:0.0	.	4;4;4	E9PAU8;P23141;P23141-2	.;EST1_HUMAN;.	C	4	ENSP00000353720:R4C;ENSP00000355193:R4C;ENSP00000390492:R4C	ENSP00000353720:R4C	R	-	1	0	CES1	54424459	0.000000	0.05858	0.000000	0.03702	0.041000	0.13682	-2.029000	0.01430	0.006000	0.14734	-0.309000	0.09137	CGT	CES1	-	pfam_CarbesteraseB	ENSG00000198848		0.602	CES1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	CES1	HGNC	protein_coding	OTTHUMT00000433285.1	-	0.00	258	0	G	NM_001266		55866958	-1	tier1	-	no_errors	ENST00000360526	ensembl	human	known	74_37	missense	16.26	242	47	SNP	0.000	A
CHAT	1103	genome.wustl.edu	37	10	50835782	50835782	+	Silent	SNP	G	G	A	rs529337162	byFrequency	TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr10:50835782G>A	ENST00000337653.2	+	7	1215	c.1062G>A	c.(1060-1062)acG>acA	p.T354T	CHAT_ENST00000455728.2_Silent_p.T236T|CHAT_ENST00000395559.2_Silent_p.T236T|CHAT_ENST00000339797.1_Silent_p.T236T|CHAT_ENST00000351556.3_Silent_p.T236T|CHAT_ENST00000395562.2_Silent_p.T272T	NM_001142929.1|NM_020549.4	NP_001136401.1|NP_065574	P28329	CLAT_HUMAN	choline O-acetyltransferase	354					adult walking behavior (GO:0007628)|dendrite development (GO:0016358)|establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|rhythmic behavior (GO:0007622)|rhythmic excitation (GO:0043179)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	choline O-acetyltransferase activity (GO:0004102)			central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(11)|lung(34)|prostate(3)|urinary_tract(1)	56		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)|Nicotine(DB00184)	GCCTGCTGACGTCTGACGGGA	0.592													G|||	8	0.00159744	0.0	0.0	5008	,	,		21417	0.0		0.0	False		,,,				2504	0.0082																0													99.0	82.0	88.0					10																	50835782		2203	4300	6503	SO:0001819	synonymous_variant	0			AF305907	CCDS7232.1, CCDS7233.1, CCDS44389.1	10q11.2	2010-05-11	2010-05-11		ENSG00000070748	ENSG00000070748	2.3.1.6		1912	protein-coding gene	gene with protein product		118490	"""choline acetyltransferase"""			1840566	Standard	NM_020984		Approved		uc001jhz.2	P28329	OTTHUMG00000018198	ENST00000337653.2:c.1062G>A	10.37:g.50835782G>A			A2BDF4|A2BDF5|Q16488|Q9BQ23|Q9BQ35|Q9BQE1	Silent	SNP	pfam_Carn_acyl_trans	p.T354	ENST00000337653.2	37	c.1062	CCDS7232.1	10																																																																																			CHAT	-	pfam_Carn_acyl_trans	ENSG00000070748		0.592	CHAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHAT	HGNC	protein_coding	OTTHUMT00000047997.1		0.00	46	0	G	NM_020549		50835782	+1			no_errors	ENST00000337653	ensembl	human	known	74_37	silent	12.50	14	2	SNP	0.736	A
CHD9	80205	genome.wustl.edu	37	16	53279712	53279712	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr16:53279712A>G	ENST00000398510.3	+	14	3491	c.3404A>G	c.(3403-3405)aAt>aGt	p.N1135S	CHD9_ENST00000566029.1_Missense_Mutation_p.N1135S|CHD9_ENST00000564845.1_Missense_Mutation_p.N1135S|CHD9_ENST00000447540.1_Missense_Mutation_p.N1135S			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	1135					cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				AACTTGGTCAATACCATGATG	0.313																																																	0													55.0	54.0	54.0					16																	53279712		1829	4083	5912	SO:0001583	missense	0			AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.3404A>G	16.37:g.53279712A>G	ENSP00000381522:p.Asn1135Ser		B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Missense_Mutation	SNP	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.N1135S	ENST00000398510.3	37	c.3404		16	.	.	.	.	.	.	.	.	.	.	A	25.5	4.648319	0.87958	.	.	ENSG00000177200	ENST00000447540;ENST00000398510;ENST00000219084	T;T	0.75589	-0.95;-0.95	5.95	5.95	0.96441	SNF2-related (1);	0.000000	0.64402	D	0.000010	D	0.84347	0.5452	L	0.58302	1.8	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;0.998	D;D;D;D	0.85130	0.997;0.997;0.996;0.994	D	0.85733	0.1332	10	0.87932	D	0	-22.9634	16.4237	0.83790	1.0:0.0:0.0:0.0	.	661;1135;1135;1135	B4DR07;Q3L8U1-3;Q3L8U1;Q3L8U1-2	.;.;CHD9_HUMAN;.	S	1135;1135;661	ENSP00000396345:N1135S;ENSP00000381522:N1135S	ENSP00000219084:N661S	N	+	2	0	CHD9	51837213	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.281000	0.95811	2.279000	0.76181	0.533000	0.62120	AAT	CHD9	-	pfam_SNF2_N,superfamily_P-loop_NTPase	ENSG00000177200		0.313	CHD9-020	KNOWN	basic	protein_coding	CHD9	HGNC	protein_coding	OTTHUMT00000422345.1	-	0.00	114	0	A	NM_025134		53279712	+1	tier1	-	no_errors	ENST00000398510	ensembl	human	known	74_37	missense	35.51	69	38	SNP	1.000	G
CNOT1	23019	genome.wustl.edu	37	16	58577401	58577401	+	Intron	SNP	T	T	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr16:58577401T>C	ENST00000317147.5	-	31	4767				CNOT1_ENST00000569240.1_Intron|CNOT1_ENST00000441024.2_Missense_Mutation_p.N1515S|CNOT1_ENST00000245138.4_Intron	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1						gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		aatatggtgattattaagaat	0.308																																																	0													41.0	47.0	45.0					16																	58577401		1270	2283	3553	SO:0001627	intron_variant	0			AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.4434+109A>G	16.37:g.58577401T>C			Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.N1515S	ENST00000317147.5	37	c.4544	CCDS10799.1	16	.	.	.	.	.	.	.	.	.	.	T	10.14	1.269341	0.23221	.	.	ENSG00000125107	ENST00000441024	T	0.44083	0.93	3.62	-7.24	0.01475	.	.	.	.	.	T	0.21718	0.0523	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29882	-0.9997	8	0.87932	D	0	.	0.5533	0.00666	0.3477:0.318:0.1232:0.2111	.	1515	A5YKK6-4	.	S	1515	ENSP00000413113:N1515S	ENSP00000413113:N1515S	N	-	2	0	CNOT1	57134902	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.292000	0.02772	-1.482000	0.01860	-1.295000	0.01343	AAT	CNOT1	-	NULL	ENSG00000125107		0.308	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNOT1	HGNC	protein_coding	OTTHUMT00000257385.3	-	0.00	90	0	T	NM_016284		58577401	-1	tier1	-	no_errors	ENST00000441024	ensembl	human	known	74_37	missense	41.24	57	40	SNP	0.000	C
CNTN1	1272	genome.wustl.edu	37	12	41408076	41408076	+	Silent	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr12:41408076C>T	ENST00000551295.2	+	18	2277	c.2160C>T	c.(2158-2160)aaC>aaT	p.N720N	CNTN1_ENST00000348761.2_Silent_p.N709N|CNTN1_ENST00000347616.1_Silent_p.N720N|CNTN1_ENST00000550305.1_3'UTR	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	720	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				GTGGAAGAAACAGAGAGCTGA	0.398																																																	0													151.0	137.0	142.0					12																	41408076		2203	4300	6503	SO:0001819	synonymous_variant	0			Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.2160C>T	12.37:g.41408076C>T			A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.N720	ENST00000551295.2	37	c.2160	CCDS8737.1	12																																																																																			CNTN1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000018236		0.398	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN1	HGNC	protein_coding	OTTHUMT00000403692.2		0.00	68	0	C	NM_001843		41408076	+1			no_errors	ENST00000347616	ensembl	human	known	74_37	silent	5.63	67	4	SNP	1.000	T
CNTNAP2	26047	genome.wustl.edu	37	7	147092722	147092722	+	Missense_Mutation	SNP	A	A	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr7:147092722A>C	ENST00000361727.3	+	10	2036	c.1520A>C	c.(1519-1521)aAc>aCc	p.N507T		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	507	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			CAGATGAATAACTCAAGTCAC	0.398										HNSCC(39;0.1)																																							0													171.0	162.0	165.0					7																	147092722		2203	4299	6502	SO:0001583	missense	0			AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.1520A>C	7.37:g.147092722A>C	ENSP00000354778:p.Asn507Thr		D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,pfam_EG-like_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.N507T	ENST00000361727.3	37	c.1520	CCDS5889.1	7	.	.	.	.	.	.	.	.	.	.	A	10.12	1.262586	0.23051	.	.	ENSG00000174469	ENST00000361727	T	0.77489	-1.1	5.26	2.63	0.31362	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.536625	0.18107	N	0.151494	T	0.48642	0.1511	N	0.01668	-0.77	0.80722	D	1	B	0.22146	0.065	B	0.30251	0.113	T	0.26573	-1.0099	10	0.15499	T	0.54	.	7.143	0.25566	0.7439:0.1593:0.0968:0.0	.	507	Q9UHC6	CNTP2_HUMAN	T	507	ENSP00000354778:N507T	ENSP00000354778:N507T	N	+	2	0	CNTNAP2	146723655	1.000000	0.71417	0.946000	0.38457	0.996000	0.88848	2.146000	0.42216	0.878000	0.35920	0.477000	0.44152	AAC	CNTNAP2	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	ENSG00000174469		0.398	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP2	HGNC	protein_coding	OTTHUMT00000327668.1	-	0.00	61	0	A			147092722	+1	tier1	-	no_errors	ENST00000361727	ensembl	human	known	74_37	missense	24.53	80	26	SNP	0.972	C
COCH	1690	genome.wustl.edu	37	14	31348140	31348140	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr14:31348140C>A	ENST00000396618.3	+	5	419	c.363C>A	c.(361-363)ttC>ttA	p.F121L	RP11-829H16.3_ENST00000555108.1_RNA|COCH_ENST00000382493.4_5'Flank|COCH_ENST00000216361.4_Missense_Mutation_p.F121L|COCH_ENST00000475087.1_Missense_Mutation_p.F121L|COCH_ENST00000460581.2_Missense_Mutation_p.F9L	NM_004086.2	NP_004077.1	O43405	COCH_HUMAN	cochlin	121	LCCL. {ECO:0000255|PROSITE- ProRule:PRU00123}.				defense response to bacterium (GO:0042742)|positive regulation of innate immune response (GO:0045089)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|pancreas(1)|skin(3)	19	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.00645)		CTGCTTCTTTCACAGTAACTA	0.413																																																	0													152.0	144.0	147.0					14																	31348140		2203	4300	6503	SO:0001583	missense	0				CCDS9640.1	14q11.2-q13	2013-05-01	2013-05-01		ENSG00000100473	ENSG00000100473			2180	protein-coding gene	gene with protein product		603196	"""coagulation factor C (Limulus polyphemus homolog); cochlin"", ""coagulation factor C homolog, cochlin (Limulus polyphemus)"""	DFNA31, DFNA9		9806553	Standard	NM_004086		Approved	COCH-5B2	uc001wqp.2	O43405	OTTHUMG00000029432	ENST00000396618.3:c.363C>A	14.37:g.31348140C>A	ENSP00000379862:p.Phe121Leu		A8K9K9|D3DS84|Q96IU6	Missense_Mutation	SNP	pfam_VWF_A,pfam_LCCL,superfamily_LCCL,smart_LCCL,smart_VWF_A,pfscan_LCCL,pfscan_VWF_A	p.F121L	ENST00000396618.3	37	c.363	CCDS9640.1	14	.	.	.	.	.	.	.	.	.	.	C	19.22	3.786294	0.70337	.	.	ENSG00000100473	ENST00000216361;ENST00000396618;ENST00000475087;ENST00000556908;ENST00000460581;ENST00000542225	D;D;D;D;T	0.90620	-2.7;-2.7;-2.7;-2.7;-0.29	5.87	5.87	0.94306	LCCL (4);	0.000000	0.85682	D	0.000000	D	0.95478	0.8531	M	0.80183	2.485	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.77004	0.989;0.989	D	0.95237	0.8348	10	0.59425	D	0.04	-14.7785	17.979	0.89134	0.0:1.0:0.0:0.0	.	121;121	Q96IU6;O43405	.;COCH_HUMAN	L	121;121;121;105;9;9	ENSP00000216361:F121L;ENSP00000379862:F121L;ENSP00000451528:F121L;ENSP00000452541:F105L;ENSP00000451713:F9L	ENSP00000216361:F121L	F	+	3	2	COCH	30417891	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.681000	0.54648	2.785000	0.95823	0.655000	0.94253	TTC	COCH	-	pfam_LCCL,superfamily_LCCL,pfscan_LCCL	ENSG00000100473		0.413	COCH-005	KNOWN	basic|appris_principal|CCDS	protein_coding	COCH	HGNC	protein_coding	OTTHUMT00000276608.1	-	0.00	48	0	C	NM_004086		31348140	+1	tier1	-	no_errors	ENST00000216361	ensembl	human	known	74_37	missense	43.10	33	25	SNP	1.000	A
COL9A2	1298	genome.wustl.edu	37	1	40782797	40782797	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr1:40782797T>A	ENST00000372748.3	-	1	169	c.73A>T	c.(73-75)Att>Ttt	p.I25F		NM_001852.3	NP_001843.1	Q14055	CO9A2_HUMAN	collagen, type IX, alpha 2	25					axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(4)|stomach(2)|urinary_tract(2)	22	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.08e-17)			AAACTTACAATCTGCGCCAGA	0.692																																																	0													18.0	20.0	19.0					1																	40782797		2180	4278	6458	SO:0001583	missense	0			M95610	CCDS450.1	1p33-p32	2013-01-16			ENSG00000049089	ENSG00000049089		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2218	protein-coding gene	gene with protein product		120260		EDM2		8454052, 8528240, 1429648	Standard	NM_001852		Approved	MED	uc001cfh.1	Q14055	OTTHUMG00000005761	ENST00000372748.3:c.73A>T	1.37:g.40782797T>A	ENSP00000361834:p.Ile25Phe		B2RMP9	Missense_Mutation	SNP	pfam_Collagen	p.I25F	ENST00000372748.3	37	c.73	CCDS450.1	1	.	.	.	.	.	.	.	.	.	.	t	13.14	2.149266	0.37923	.	.	ENSG00000049089	ENST00000372748;ENST00000372736	D;D	0.90563	-2.69;-2.69	4.33	4.33	0.51752	.	0.146269	0.45867	D	0.000337	D	0.86439	0.5933	L	0.49350	1.555	0.35964	D	0.83482	B	0.31413	0.322	B	0.31191	0.125	D	0.87625	0.2512	10	0.44086	T	0.13	.	10.1526	0.42803	0.0:0.0:0.0:1.0	.	25	Q14055	CO9A2_HUMAN	F	25	ENSP00000361834:I25F;ENSP00000361821:I25F	ENSP00000361821:I25F	I	-	1	0	COL9A2	40555384	1.000000	0.71417	1.000000	0.80357	0.144000	0.21451	1.064000	0.30579	1.729000	0.51567	0.397000	0.26171	ATT	COL9A2	-	NULL	ENSG00000049089		0.692	COL9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL9A2	HGNC	protein_coding	OTTHUMT00000015764.3	-	0.00	71	0	T	NM_001852		40782797	-1	tier1	-	no_errors	ENST00000372748	ensembl	human	known	74_37	missense	68.32	51	110	SNP	1.000	A
COL24A1	255631	genome.wustl.edu	37	1	86512550	86512550	+	Silent	SNP	G	G	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr1:86512550G>T	ENST00000370571.2	-	12	2274	c.1908C>A	c.(1906-1908)ggC>ggA	p.G636G	COL24A1_ENST00000436319.1_Silent_p.G636G	NM_152890.5	NP_690850.2	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1	636					extracellular matrix organization (GO:0030198)|hematopoietic progenitor cell differentiation (GO:0002244)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			NS(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(9)|liver(1)|lung(56)|ovary(4)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	101				all cancers(265;0.0627)|Epithelial(280;0.0689)		tcccaggaatgccctagaata	0.318																																																	0													102.0	101.0	102.0					1																	86512550		1803	4053	5856	SO:0001819	synonymous_variant	0			AF410793	CCDS41353.1	1p22.3-p22.2	2013-01-16			ENSG00000171502	ENSG00000171502		"""Collagens"""	20821	protein-coding gene	gene with protein product		610025					Standard	NM_152890		Approved		uc001dlj.3	Q17RW2	OTTHUMG00000010629	ENST00000370571.2:c.1908C>A	1.37:g.86512550G>T			C9J1X6|Q14BD7|Q59EX5|Q5VY50|Q7Z5L5	Silent	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_Fib_collagen_C	p.G636	ENST00000370571.2	37	c.1908	CCDS41353.1	1																																																																																			COL24A1	-	pfam_Collagen	ENSG00000171502		0.318	COL24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL24A1	HGNC	protein_coding	OTTHUMT00000029335.4		0.00	75	0	G	NM_152890		86512550	-1			no_errors	ENST00000370571	ensembl	human	known	74_37	silent	5.26	90	5	SNP	0.692	T
CRIM1	51232	genome.wustl.edu	37	2	36691738	36691738	+	Missense_Mutation	SNP	A	A	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr2:36691738A>C	ENST00000280527.2	+	5	1298	c.931A>C	c.(931-933)Ata>Cta	p.I311L		NM_016441.2	NP_057525.1	Q9NZV1	CRIM1_HUMAN	cysteine rich transmembrane BMP regulator 1 (chordin-like)	311					insulin-like growth factor receptor signaling pathway (GO:0048009)|nervous system development (GO:0007399)|regulation of cell growth (GO:0001558)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	insulin-like growth factor-activated receptor activity (GO:0005010)|PDZ domain binding (GO:0030165)|serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(15)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	45		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)				CACTCCCCGCATAGTCTCTCG	0.483																																																	0													287.0	262.0	271.0					2																	36691738		2203	4300	6503	SO:0001583	missense	0			AF168681	CCDS1783.1	2p21	2010-06-29	2005-07-25		ENSG00000150938	ENSG00000150938			2359	protein-coding gene	gene with protein product		606189	"""cysteine-rich motor neuron 1"""	S52		10642437	Standard	NM_016441		Approved		uc002rpd.3	Q9NZV1	OTTHUMG00000099419	ENST00000280527.2:c.931A>C	2.37:g.36691738A>C	ENSP00000280527:p.Ile311Leu		Q2M2G4|Q59GH0|Q7LCQ5|Q9H318	Missense_Mutation	SNP	pfam_VWF_C,pfam_Antistasin-like,superfamily_Hirudin/antistatin,smart_IGFBP-like,smart_VWC_out,smart_VWF_C,pfscan_VWF_C	p.I311L	ENST00000280527.2	37	c.931	CCDS1783.1	2	.	.	.	.	.	.	.	.	.	.	A	16.98	3.271939	0.59649	.	.	ENSG00000150938	ENST00000280527;ENST00000426856	T	0.04502	3.61	5.94	4.8	0.61643	.	0.228767	0.45126	D	0.000389	T	0.04543	0.0124	L	0.43152	1.355	0.39210	D	0.963298	B	0.26195	0.144	B	0.19148	0.024	T	0.35101	-0.9802	10	0.10636	T	0.68	-13.8217	10.7613	0.46266	0.9265:0.0:0.0735:0.0	.	311	Q9NZV1	CRIM1_HUMAN	L	311;203	ENSP00000280527:I311L	ENSP00000280527:I311L	I	+	1	0	CRIM1	36545242	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.715000	0.47210	2.275000	0.75901	0.528000	0.53228	ATA	CRIM1	-	NULL	ENSG00000150938		0.483	CRIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRIM1	HGNC	protein_coding	OTTHUMT00000216878.2	-	0.00	101	0	A	NM_016441		36691738	+1	tier1	-	no_errors	ENST00000280527	ensembl	human	known	74_37	missense	21.13	112	30	SNP	1.000	C
CSF1R	1436	genome.wustl.edu	37	5	149459676	149459676	+	Silent	SNP	G	G	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr5:149459676G>A	ENST00000286301.3	-	4	822	c.531C>T	c.(529-531)tgC>tgT	p.C177C	CSF1R_ENST00000543093.1_Silent_p.C177C	NM_005211.3	NP_005202.2	P07333	CSF1R_HUMAN	colony stimulating factor 1 receptor	177	Ig-like C2-type 2.				cell proliferation (GO:0008283)|cell-cell junction maintenance (GO:0045217)|cellular response to cytokine stimulus (GO:0071345)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cytokine-mediated signaling pathway (GO:0019221)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage differentiation (GO:0030225)|mammary gland duct morphogenesis (GO:0060603)|monocyte differentiation (GO:0030224)|multicellular organismal development (GO:0007275)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell motility (GO:2000147)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of bone resorption (GO:0045124)|regulation of cell shape (GO:0008360)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|macrophage colony-stimulating factor receptor activity (GO:0005011)|protein homodimerization activity (GO:0042803)			NS(2)|breast(2)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(38)|kidney(2)|large_intestine(6)|liver(3)|lung(23)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	93			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Imatinib(DB00619)|Sunitinib(DB01268)	TCAGGGCACTGCATTGATAGT	0.607																																																	0													91.0	74.0	80.0					5																	149459676		2203	4300	6503	SO:0001819	synonymous_variant	0			U63963	CCDS4302.1	5q32	2013-01-11	2008-08-01		ENSG00000182578	ENSG00000182578		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	2433	protein-coding gene	gene with protein product		164770	"""McDonough feline sarcoma viral (v-fms) oncogene homolog"""	FMS		1611909	Standard	NM_005211		Approved	C-FMS, CSFR, CD115	uc003lrm.3	P07333	OTTHUMG00000130050	ENST00000286301.3:c.531C>T	5.37:g.149459676G>A			B5A955|D3DQG2|Q6LDW5|Q6LDY4|Q86VW7	Silent	SNP	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.C177	ENST00000286301.3	37	c.531	CCDS4302.1	5																																																																																			CSF1R	-	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,smart_Ig_sub	ENSG00000182578		0.607	CSF1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSF1R	HGNC	protein_coding	OTTHUMT00000252329.2		0.00	26	0	G	NM_005211		149459676	-1			no_errors	ENST00000286301	ensembl	human	known	74_37	silent	7.69	48	4	SNP	0.232	A
CSMD3	114788	genome.wustl.edu	37	8	113563014	113563014	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr8:113563014C>A	ENST00000297405.5	-	27	4694	c.4450G>T	c.(4450-4452)Gaa>Taa	p.E1484*	CSMD3_ENST00000455883.2_Nonsense_Mutation_p.E1380*|CSMD3_ENST00000343508.3_Nonsense_Mutation_p.E1444*|CSMD3_ENST00000352409.3_Nonsense_Mutation_p.E1484*	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1484	CUB 8. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CCACTAATTTCCTTTAAAAGC	0.398										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							0													77.0	76.0	76.0					8																	113563014		2203	4300	6503	SO:0001587	stop_gained	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.4450G>T	8.37:g.113563014C>A	ENSP00000297405:p.Glu1484*		Q96PZ3	Nonsense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.E1484*	ENST00000297405.5	37	c.4450	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	C	46	12.384200	0.99663	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	.	.	.	4.36	4.36	0.52297	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	.	17.4138	0.87494	0.0:1.0:0.0:0.0	.	.	.	.	X	1444;1484;824;1380;1484	.	ENSP00000297405:E1484X	E	-	1	0	CSMD3	113632190	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.609000	0.82925	2.412000	0.81896	0.591000	0.81541	GAA	CSMD3	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000164796		0.398	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	-	0.00	76	0	C	NM_052900		113563014	-1	tier1	-	no_errors	ENST00000297405	ensembl	human	known	74_37	nonsense	30.89	84	38	SNP	1.000	A
CSN2	1447	genome.wustl.edu	37	4	70823225	70823225	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr4:70823225G>T	ENST00000353151.3	-	5	453	c.442C>A	c.(442-444)Ccc>Acc	p.P148T		NM_001891.2	NP_001882.1	P61201	CSN2_HUMAN	casein beta	0					cell proliferation (GO:0008283)|cullin deneddylation (GO:0010388)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)	signal transducer activity (GO:0004871)|transcription corepressor activity (GO:0003714)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|skin(2)	12						TGCATCAAGGGCTGGAGCAGA	0.522																																																	0													81.0	87.0	85.0					4																	70823225		2203	4300	6503	SO:0001583	missense	0			X17070	CCDS3532.1	4q21.1	2008-02-05			ENSG00000135222	ENSG00000135222			2447	protein-coding gene	gene with protein product		115460		CASB		1577486	Standard	NM_001891		Approved		uc003hes.4	P05814	OTTHUMG00000129409	ENST00000353151.3:c.442C>A	4.37:g.70823225G>T	ENSP00000341030:p.Pro148Thr		O88950|Q15647|Q6FGP4|Q9BY54|Q9R249|Q9UNI2|Q9UNQ5	Missense_Mutation	SNP	pfam_Casein,pirsf_Casein_beta	p.P148T	ENST00000353151.3	37	c.442	CCDS3532.1	4	.	.	.	.	.	.	.	.	.	.	G	15.70	2.912280	0.52439	.	.	ENSG00000135222	ENST00000353151	.	.	.	4.59	-0.149	0.13420	.	0.751830	0.11934	N	0.515442	T	0.41719	0.1171	L	0.50333	1.59	0.09310	N	0.999999	P	0.44139	0.827	P	0.47827	0.558	T	0.33214	-0.9877	9	0.87932	D	0	-25.3033	7.288	0.26350	0.5318:0.0:0.4682:0.0	.	148	P05814	CASB_HUMAN	T	148	.	ENSP00000341030:P148T	P	-	1	0	CSN2	70857814	0.312000	0.24545	0.085000	0.20634	0.457000	0.32468	0.221000	0.17680	-0.072000	0.12864	-0.142000	0.14014	CCC	CSN2	-	pfam_Casein,pirsf_Casein_beta	ENSG00000135222		0.522	CSN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSN2	HGNC	protein_coding	OTTHUMT00000251565.1	-	0.00	67	0	G			70823225	-1	tier1	-	no_errors	ENST00000353151	ensembl	human	known	74_37	missense	26.76	52	19	SNP	0.084	T
CX3CR1	1524	genome.wustl.edu	37	3	39307268	39307268	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr3:39307268T>C	ENST00000541347.1	-	2	972	c.733A>G	c.(733-735)Aca>Gca	p.T245A	CX3CR1_ENST00000399220.2_Missense_Mutation_p.T245A|CX3CR1_ENST00000358309.3_Missense_Mutation_p.T277A|CX3CR1_ENST00000542107.1_Missense_Mutation_p.T245A	NM_001171171.1	NP_001164642.1	P49238	CX3C1_HUMAN	chemokine (C-X3-C motif) receptor 1	245					cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cerebral cortex cell migration (GO:0021795)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|macrophage chemotaxis (GO:0048246)|microglial cell activation involved in immune response (GO:0002282)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|positive regulation of angiogenesis (GO:0045766)|response to wounding (GO:0009611)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|neuronal cell body membrane (GO:0032809)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	C-X3-C chemokine receptor activity (GO:0016495)|chemokine receptor activity (GO:0004950)			endometrium(3)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|urinary_tract(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.0557)|Kidney(284;0.0699)		TTGTAGGGTGTCCAGAAGAGG	0.468																																																	0													110.0	114.0	113.0					3																	39307268		1931	4136	6067	SO:0001583	missense	0			BC028078	CCDS43069.1, CCDS54571.1	3p21.3	2012-08-08	2002-08-22		ENSG00000168329	ENSG00000168329		"""GPCR / Class A : Chemokine receptors : C-X-3-C motif"""	2558	protein-coding gene	gene with protein product		601470	"""chemokine (C-X3-C) receptor 1"""	GPR13, CMKBRL1		9726990, 7646814	Standard	NM_001171171		Approved	CMKDR1, V28, CCRL1	uc021wwc.1	P49238	OTTHUMG00000156249	ENST00000541347.1:c.733A>G	3.37:g.39307268T>C	ENSP00000439140:p.Thr245Ala		A0N0N6|B2R5Z4|J3KP17	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CX3CR1,prints_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Duffy_chemokine_rcpt,prints_Chemokine_CXCR4	p.T277A	ENST00000541347.1	37	c.829	CCDS43069.1	3	.	.	.	.	.	.	.	.	.	.	T	9.845	1.192006	0.21954	.	.	ENSG00000168329	ENST00000399220;ENST00000538756;ENST00000358309;ENST00000541347;ENST00000542107	T;T;T;T	0.72051	-0.62;-0.62;-0.62;-0.62	5.77	5.77	0.91146	GPCR, rhodopsin-like superfamily (1);	0.115558	0.64402	D	0.000012	T	0.59032	0.2164	L	0.42487	1.325	0.43808	D	0.996363	P	0.43788	0.817	B	0.40534	0.332	T	0.57010	-0.7884	10	0.10636	T	0.68	.	10.1288	0.42665	0.0:0.0785:0.0:0.9215	.	245	P49238	CX3C1_HUMAN	A	245;253;277;245;245	ENSP00000382166:T245A;ENSP00000351059:T277A;ENSP00000439140:T245A;ENSP00000444928:T245A	ENSP00000351059:T277A	T	-	1	0	CX3CR1	39282272	1.000000	0.71417	0.999000	0.59377	0.980000	0.70556	0.660000	0.25009	2.200000	0.70718	0.533000	0.62120	ACA	CX3CR1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000168329		0.468	CX3CR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CX3CR1	HGNC	protein_coding	OTTHUMT00000343613.1	-	0.00	44	0	T	NM_001337		39307268	-1	tier1	-	no_errors	ENST00000358309	ensembl	human	known	74_37	missense	58.82	14	20	SNP	0.997	C
CYP1A1	1543	genome.wustl.edu	37	15	75014841	75014841	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr15:75014841C>G	ENST00000379727.3	-	2	796	c.598G>C	c.(598-600)Gcc>Ccc	p.A200P	CYP1A1_ENST00000395048.2_Missense_Mutation_p.A200P|CYP1A1_ENST00000564596.1_5'UTR|CYP1A1_ENST00000395049.4_Missense_Mutation_p.A200P|CYP1A1_ENST00000567032.1_Missense_Mutation_p.A200P			P04798	CP1A1_HUMAN	cytochrome P450, family 1, subfamily A, polypeptide 1	200					9-cis-retinoic acid biosynthetic process (GO:0042904)|aging (GO:0007568)|amine metabolic process (GO:0009308)|arachidonic acid metabolic process (GO:0019369)|camera-type eye development (GO:0043010)|cell proliferation (GO:0008283)|cellular lipid metabolic process (GO:0044255)|cellular response to organic cyclic compound (GO:0071407)|coumarin metabolic process (GO:0009804)|dibenzo-p-dioxin catabolic process (GO:0019341)|digestive tract development (GO:0048565)|drug metabolic process (GO:0017144)|embryo development ending in birth or egg hatching (GO:0009792)|epoxygenase P450 pathway (GO:0019373)|flavonoid metabolic process (GO:0009812)|hepatocyte differentiation (GO:0070365)|hydrogen peroxide biosynthetic process (GO:0050665)|insecticide metabolic process (GO:0017143)|maternal process involved in parturition (GO:0060137)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound metabolic process (GO:0006778)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|response to antibiotic (GO:0046677)|response to arsenic-containing substance (GO:0046685)|response to drug (GO:0042493)|response to food (GO:0032094)|response to herbicide (GO:0009635)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to iron(III) ion (GO:0010041)|response to lipopolysaccharide (GO:0032496)|response to nematode (GO:0009624)|response to virus (GO:0009615)|response to vitamin A (GO:0033189)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|vitamin D metabolic process (GO:0042359)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|mitochondrion (GO:0005739)	aromatase activity (GO:0070330)|demethylase activity (GO:0032451)|flavonoid 3'-monooxygenase activity (GO:0016711)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on diphenols and related substances as donors (GO:0016679)|oxygen binding (GO:0019825)|steroid hydroxylase activity (GO:0008395)|vitamin D 24-hydroxylase activity (GO:0070576)			autonomic_ganglia(1)|breast(2)|endometrium(1)|large_intestine(7)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34					Acetaminophen(DB00316)|Albendazole(DB00518)|Amiodarone(DB01118)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Arsenic trioxide(DB01169)|Azelastine(DB00972)|Benzyl alcohol(DB06770)|Bezafibrate(DB01393)|Bortezomib(DB00188)|Caffeine(DB00201)|Carvedilol(DB01136)|Chloroquine(DB00608)|Chlorzoxazone(DB00356)|Cholecalciferol(DB00169)|Cinnarizine(DB00568)|Clenbuterol(DB01407)|Clobetasol propionate(DB01013)|Clofibrate(DB00636)|Clomifene(DB00882)|Clonidine(DB00575)|Clozapine(DB00363)|Dacarbazine(DB00851)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Dexamethasone(DB01234)|Dexmedetomidine(DB00633)|Diclofenac(DB00586)|Dicyclomine(DB00804)|Dronabinol(DB00470)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Ethanol(DB00898)|Flunarizine(DB04841)|Fluorescein(DB00693)|Flutamide(DB00499)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Granisetron(DB00889)|Haloperidol(DB00502)|Isoprenaline(DB01064)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Lorcaserin(DB04871)|Mebendazole(DB00643)|Melatonin(DB01065)|Menadione(DB00170)|Methoxsalen(DB00553)|Nicotine(DB00184)|Nifedipine(DB01115)|Nitroprusside(DB00325)|Norfloxacin(DB01059)|Omeprazole(DB00338)|Ouabain(DB01092)|Oxaliplatin(DB00526)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Prazosin(DB00457)|Primaquine(DB01087)|Progesterone(DB00396)|Propofol(DB00818)|Propranolol(DB00571)|Pyridoxine(DB00165)|Quinidine(DB00908)|Quinine(DB00468)|Rabeprazole(DB01129)|Riluzole(DB00740)|Sildenafil(DB00203)|Streptozocin(DB00428)|Sulindac(DB00605)|Tamoxifen(DB00675)|Testosterone(DB00624)|Thalidomide(DB01041)|Theophylline(DB00277)|Thiabendazole(DB00730)|Ticlopidine(DB00208)|Toremifene(DB00539)|Tretinoin(DB00755)|Vitamin A(DB00162)|Warfarin(DB00682)	AAGCAAATGGCACAGATGACA	0.527									Endometrial Cancer, Familial Clustering of;ACTH-independent macronodular adrenal hyperplasia																																								0													97.0	94.0	95.0					15																	75014841		2197	4296	6493	SO:0001583	missense	0	Familial Cancer Database	;AIMAH, Cushing disease, Adrenal, Familial	BC023019	CCDS10268.1	15q24.1	2007-12-14	2003-01-14		ENSG00000140465	ENSG00000140465	1.14.14.1	"""Cytochrome P450s"""	2595	protein-coding gene	gene with protein product		108330	"""cytochrome P450, subfamily I (aromatic compound-inducible), polypeptide 1"""	CYP1		15128046	Standard	NM_000499		Approved	P450DX, P1-450, P450-C, CP11	uc002ayp.4	P04798	OTTHUMG00000142812	ENST00000379727.3:c.598G>C	15.37:g.75014841C>G	ENSP00000369050:p.Ala200Pro		A4F3V9|A4F3W0|Q53G18	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-I_CYP1,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450	p.A200P	ENST00000379727.3	37	c.598	CCDS10268.1	15	.	.	.	.	.	.	.	.	.	.	C	18.23	3.578048	0.65878	.	.	ENSG00000140465	ENST00000379727;ENST00000395048;ENST00000395049;ENST00000268062	T;T;T	0.69435	-0.4;-0.4;-0.4	5.04	5.04	0.67666	.	0.047913	0.85682	D	0.000000	D	0.86406	0.5925	M	0.92880	3.355	0.50467	D	0.999878	D;D	0.89917	1.0;1.0	D;D	0.83275	0.995;0.996	D	0.90033	0.4136	10	0.87932	D	0	.	18.4037	0.90526	0.0:1.0:0.0:0.0	.	200;200	E7EMT5;P04798	.;CP1A1_HUMAN	P	200	ENSP00000369050:A200P;ENSP00000378488:A200P;ENSP00000378489:A200P	ENSP00000268062:A200P	A	-	1	0	CYP1A1	72801894	1.000000	0.71417	0.997000	0.53966	0.219000	0.24729	7.692000	0.84203	2.327000	0.79052	0.561000	0.74099	GCC	CYP1A1	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I	ENSG00000140465		0.527	CYP1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP1A1	HGNC	protein_coding	OTTHUMT00000286396.1	-	0.00	78	0	C	NM_000499		75014841	-1	tier1	-	no_errors	ENST00000379727	ensembl	human	known	74_37	missense	32.69	34	17	SNP	1.000	G
CYP1B1	1545	genome.wustl.edu	37	2	38297742	38297742	+	3'UTR	SNP	T	T	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr2:38297742T>A	ENST00000260630.3	-	0	2156				CYP1B1_ENST00000494864.1_5'UTR|CYP1B1_ENST00000407341.1_3'UTR	NM_000104.3	NP_000095	Q16678	CP1B1_HUMAN	cytochrome P450, family 1, subfamily B, polypeptide 1						angiogenesis (GO:0001525)|arachidonic acid metabolic process (GO:0019369)|blood vessel morphogenesis (GO:0048514)|cell adhesion (GO:0007155)|cellular aromatic compound metabolic process (GO:0006725)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to organic cyclic compound (GO:0071407)|collagen fibril organization (GO:0030199)|endothelial cell migration (GO:0043542)|endothelial cell-cell adhesion (GO:0071603)|epoxygenase P450 pathway (GO:0019373)|estrogen metabolic process (GO:0008210)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|membrane lipid catabolic process (GO:0046466)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nitric oxide biosynthetic process (GO:0006809)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of gene expression involved in extracellular matrix organization (GO:1901313)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to toxic substance (GO:0009636)|retinal blood vessel morphogenesis (GO:0061304)|retinal metabolic process (GO:0042574)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|toxin metabolic process (GO:0009404)|trabecular meshwork development (GO:0002930)|visual perception (GO:0007601)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|mitochondrion (GO:0005739)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)	13		all_hematologic(82;0.21)			Amodiaquine(DB00613)|Arsenic trioxide(DB01169)|Biotin(DB00121)|Caffeine(DB00201)|Clozapine(DB00363)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Flutamide(DB00499)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Melatonin(DB01065)|Mitoxantrone(DB01204)|Omeprazole(DB00338)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Primaquine(DB01087)|Procarbazine(DB01168)|Progesterone(DB00396)|Propofol(DB00818)|Tamoxifen(DB00675)|Testosterone(DB00624)|Theophylline(DB00277)	GGACAGTTGATTTATGCTCAC	0.413																																																	0																																										SO:0001624	3_prime_UTR_variant	0			U56438	CCDS1793.1	2p22.2	2008-02-05	2003-01-14		ENSG00000138061	ENSG00000138061		"""Cytochrome P450s"""	2597	protein-coding gene	gene with protein product		601771	"""cytochrome P450, subfamily I (dioxin-inducible), polypeptide 1 (glaucoma 3, primary infantile)"""	GLC3A		8175734, 15128046	Standard	NM_000104		Approved	CP1B	uc002rqo.2	Q16678	OTTHUMG00000100970	ENST00000260630.3:c.*123A>T	2.37:g.38297742T>A			Q5TZW8|Q93089|Q9H316	RNA	SNP	-	NULL	ENST00000260630.3	37	NULL	CCDS1793.1	2																																																																																			CYP1B1	-	-	ENSG00000138061		0.413	CYP1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP1B1	HGNC	protein_coding	OTTHUMT00000218580.3	-	0.00	8	0	T	NM_000104		38297742	-1	tier1	-	no_errors	ENST00000494864	ensembl	human	known	74_37	rna	75.00	2	6	SNP	0.000	A
CYP4F35P	284233	genome.wustl.edu	37	18	14337526	14337526	+	lincRNA	SNP	C	C	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr18:14337526C>A	ENST00000582957.1	+	0	105					NR_026756.1				cytochrome P450, family 4, subfamily F, polypeptide 35, pseudogene																		CCCTGCCCTACAGACCGTAAA	0.517																																																	0																																												0					18p11.21	2013-11-11			ENSG00000265787	ENSG00000265787		"""Cytochrome P450s"""	39954	pseudogene	pseudogene							Standard	NR_026756		Approved	CYP4F-se8[6:7:8]	uc002ktb.3		OTTHUMG00000178670		18.37:g.14337526C>A				RNA	SNP	-	NULL	ENST00000582957.1	37	NULL		18																																																																																			CYP4F35P	-	-	ENSG00000265787		0.517	CYP4F35P-001	KNOWN	basic	lincRNA	CYP4F35P	HGNC	lincRNA	OTTHUMT00000442865.1	-	0.00	38	0	C	NR_026756		14337526	+1	tier1	-	no_errors	ENST00000582957	ensembl	human	known	74_37	rna	57.14	12	16	SNP	0.090	A
DHRS2	10202	genome.wustl.edu	37	14	24114459	24114459	+	Silent	SNP	C	C	G	rs144980250		TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr14:24114459C>G	ENST00000250383.6	+	9	1316	c.840C>G	c.(838-840)ctC>ctG	p.L280L	DHRS2_ENST00000344777.7_Missense_Mutation_p.S284C	NM_005794.3	NP_005785.1	Q13268	DHRS2_HUMAN	dehydrogenase/reductase (SDR family) member 2	280					C21-steroid hormone metabolic process (GO:0008207)|cellular response to oxidative stress (GO:0034599)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|response to toxic substance (GO:0009636)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	carbonyl reductase (NADPH) activity (GO:0004090)			endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14				GBM - Glioblastoma multiforme(265;0.00659)		CCACTCGGCTCTGAGAGGAGT	0.602																																																	0									,CYS/SER	0,4406		0,0,2203	75.0	71.0	73.0		840,851	1.2	0.4	14	dbSNP_134	73	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,missense	DHRS2	NM_005794.3,NM_182908.4	,112	0,1,6502	GG,GC,CC		0.0116,0.0,0.0077	,benign	280/281,284/301	24114459	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS9604.1, CCDS41927.1	14q11.2	2011-09-14			ENSG00000100867	ENSG00000100867		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	18349	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 25C, member 1"""	615194				7556196, 11944995, 16685466, 19027726	Standard	NM_182908		Approved	HEP27, SDR25C1	uc001wkt.4	Q13268	OTTHUMG00000028771	ENST00000250383.6:c.840C>G	14.37:g.24114459C>G			D3DS54|Q53GS4|Q7Z789|Q9H2R2	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH,prints_DHB_DH,prints_DH_sc/Rdtase_SDR,prints_ADH_insect	p.S284C	ENST00000250383.6	37	c.851	CCDS9604.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.13|16.13	3.037095|3.037095	0.54896|0.54896	0.0|0.0	1.16E-4|1.16E-4	ENSG00000100867|ENSG00000100867	ENST00000557535|ENST00000344777	D|D	0.85955|0.82619	-2.05|-1.63	4.51|4.51	1.19|1.19	0.21007|0.21007	.|.	.|0.411149	.|0.26911	.|N	.|0.021868	T|T	0.76278|0.76278	0.3965|0.3965	.|.	.|.	.|.	0.20489|0.20489	N|N	0.999897|0.999897	.|B	.|0.19935	.|0.04	.|B	.|0.23018	.|0.043	T|T	0.69506|0.69506	-0.5127|-0.5127	5|9	.|0.66056	.|D	.|0.02	.|.	12.4401|12.4401	0.55619|0.55619	0.0:0.384:0.616:0.0|0.0:0.384:0.616:0.0	.|.	.|262	.|Q13268-2	.|.	V|C	180|284	ENSP00000451895:L180V|ENSP00000344674:S284C	.|ENSP00000344674:S284C	L|S	+|+	1|2	2|0	DHRS2|DHRS2	23184299|23184299	0.976000|0.976000	0.34144|0.34144	0.355000|0.355000	0.25773|0.25773	0.107000|0.107000	0.19398|0.19398	-0.165000|-0.165000	0.09968|0.09968	0.505000|0.505000	0.28104|0.28104	0.557000|0.557000	0.71058|0.71058	CTG|TCT	DHRS2	-	NULL	ENSG00000100867		0.602	DHRS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DHRS2	HGNC	protein_coding	OTTHUMT00000071842.2	-	0.00	35	0	C	NM_182908		24114459	+1	tier1	rs144980250	no_errors	ENST00000344777	ensembl	human	known	74_37	missense	38.46	32	20	SNP	0.676	G
DHX9	1660	genome.wustl.edu	37	1	182850531	182850531	+	Silent	SNP	A	A	G			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr1:182850531A>G	ENST00000367549.3	+	23	2867	c.2757A>G	c.(2755-2757)ttA>ttG	p.L919L	DHX9_ENST00000485081.1_3'UTR	NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	919					ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						TAGCCCTTTTATCAGTATTCC	0.418																																					Colon(69;210 1162 3697 13559 39565)												0													145.0	135.0	138.0					1																	182850531		1855	4103	5958	SO:0001819	synonymous_variant	0			L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.2757A>G	1.37:g.182850531A>G			B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Silent	SNP	pfam_dsRNA-bd_dom,pfam_Helicase-assoc_dom,pfam_Helicase_C,pfam_DUF1605,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_dsRNA-bd_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_dsRNA-bd_dom	p.L919	ENST00000367549.3	37	c.2757	CCDS41444.1	1																																																																																			DHX9	-	pfam_Helicase-assoc_dom,smart_Helicase-assoc_dom	ENSG00000135829		0.418	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX9	HGNC	protein_coding	OTTHUMT00000085522.2	-	0.00	43	0	A	NM_030588		182850531	+1	tier1	-	no_errors	ENST00000367549	ensembl	human	known	74_37	silent	30.00	42	18	SNP	0.968	G
DIDO1	11083	genome.wustl.edu	37	20	61513761	61513761	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr20:61513761C>G	ENST00000266070.4	-	16	3872	c.3547G>C	c.(3547-3549)Gag>Cag	p.E1183Q	DIDO1_ENST00000395343.1_Missense_Mutation_p.E1183Q	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	1183					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					CGTGGTGACTCAAGACCTGAA	0.393																																					Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)												0													70.0	74.0	73.0					20																	61513761		2203	4298	6501	SO:0001583	missense	0			AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.3547G>C	20.37:g.61513761C>G	ENSP00000266070:p.Glu1183Gln		A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	pfam_TFIIS_cen_dom,pfam_SPOC_C,pfam_Znf_PHD-finger,superfamily_TFIIS_cen_dom,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_TFS2M,pfscan_Znf_PHD-finger	p.E1183Q	ENST00000266070.4	37	c.3547	CCDS33506.1	20	.	.	.	.	.	.	.	.	.	.	C	29.3	4.993003	0.93167	.	.	ENSG00000101191	ENST00000266070;ENST00000395343	T;T	0.12879	2.64;2.64	5.46	5.46	0.80206	.	0.000000	0.43416	D	0.000571	T	0.43277	0.1240	M	0.84433	2.695	0.80722	D	1	D	0.71674	0.998	D	0.64687	0.928	T	0.45396	-0.9264	10	0.87932	D	0	-36.2071	19.6754	0.95930	0.0:1.0:0.0:0.0	.	1183	Q9BTC0	DIDO1_HUMAN	Q	1183	ENSP00000266070:E1183Q;ENSP00000378752:E1183Q	ENSP00000266070:E1183Q	E	-	1	0	DIDO1	60984206	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	7.293000	0.78740	2.724000	0.93272	0.462000	0.41574	GAG	DIDO1	-	NULL	ENSG00000101191		0.393	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIDO1	HGNC	protein_coding	OTTHUMT00000080091.2	-	0.00	66	0	C	NM_080796		61513761	-1	tier1	-	no_errors	ENST00000266070	ensembl	human	known	74_37	missense	43.42	43	33	SNP	1.000	G
DNAH5	1767	genome.wustl.edu	37	5	13719067	13719067	+	Silent	SNP	T	T	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr5:13719067T>C	ENST00000265104.4	-	72	12527	c.12423A>G	c.(12421-12423)acA>acG	p.T4141T		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	4141	AAA 6. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TCTGAAGGAGTGTAATGGGAA	0.463									Kartagener syndrome																																								0													152.0	150.0	151.0					5																	13719067		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.12423A>G	5.37:g.13719067T>C			Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.T4141	ENST00000265104.4	37	c.12423	CCDS3882.1	5																																																																																			DNAH5	-	pfam_Dynein_heavy_dom	ENSG00000039139		0.463	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	-	0.00	32	0	T	NM_001369		13719067	-1	tier1	-	no_errors	ENST00000265104	ensembl	human	known	74_37	silent	20.24	67	17	SNP	0.555	C
DNAH5	1767	genome.wustl.edu	37	5	13719141	13719141	+	Missense_Mutation	SNP	T	T	A	rs145501076	byFrequency	TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr5:13719141T>A	ENST00000265104.4	-	72	12453	c.12349A>T	c.(12349-12351)Ata>Tta	p.I4117L		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	4117	AAA 6. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TCAGTTTCTATGATTATGTCC	0.458									Kartagener syndrome																																								0													119.0	116.0	117.0					5																	13719141		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.12349A>T	5.37:g.13719141T>A	ENSP00000265104:p.Ile4117Leu		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.I4117L	ENST00000265104.4	37	c.12349	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	T	0.017	-1.501469	0.01001	.	.	ENSG00000039139	ENST00000265104	T	0.08102	3.13	5.59	-1.14	0.09741	Dynein heavy chain (1);	0.789109	0.12377	N	0.474265	T	0.03263	0.0095	N	0.04018	-0.295	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.44421	-0.9329	10	0.26408	T	0.33	.	6.5576	0.22469	0.1219:0.4048:0.0:0.4732	.	4117	Q8TE73	DYH5_HUMAN	L	4117	ENSP00000265104:I4117L	ENSP00000265104:I4117L	I	-	1	0	DNAH5	13772141	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	0.385000	0.20685	-0.426000	0.07360	0.528000	0.53228	ATA	DNAH5	-	pfam_Dynein_heavy_dom	ENSG00000039139		0.458	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	-	0.00	24	0	T	NM_001369		13719141	-1	tier1	-	no_errors	ENST00000265104	ensembl	human	known	74_37	missense	29.09	39	16	SNP	0.003	A
DPPA3P2	400206	genome.wustl.edu	37	14	36840759	36840759	+	RNA	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr14:36840759C>T	ENST00000557188.1	+	0	390									developmental pluripotency associated 3 pseudogene 2																		TGACTATCAACGCTAGTAGCG	0.488																																																	0																																												0					14q13.3	2012-07-04			ENSG00000188831	ENSG00000188831			20417	pseudogene	pseudogene							Standard	NG_023379		Approved	STELLAR			OTTHUMG00000170728		14.37:g.36840759C>T				RNA	SNP	-	NULL	ENST00000557188.1	37	NULL		14																																																																																			DPPA3P2	-	-	ENSG00000188831		0.488	DPPA3P2-002	KNOWN	basic	processed_transcript	DPPA3P2	HGNC	pseudogene	OTTHUMT00000410122.1	-	0.00	122	0	C			36840759	+1	tier1	-	no_errors	ENST00000557188	ensembl	human	known	74_37	rna	25.00	105	35	SNP	0.066	T
DYRK4	8798	genome.wustl.edu	37	12	4705422	4705422	+	Silent	SNP	G	G	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr12:4705422G>A	ENST00000540757.2	+	5	550	c.390G>A	c.(388-390)gtG>gtA	p.V130V	DYRK4_ENST00000010132.5_Silent_p.V130V|DYRK4_ENST00000543431.1_Silent_p.V130V	NM_001282285.1|NM_001282286.1|NM_003845.1	NP_001269214.1|NP_001269215.1|NP_003836.1	Q9NR20	DYRK4_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4	130	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27			Colorectal(7;0.103)			ATGAGCTGGTGGCCCTGAAAA	0.537																																																	0													116.0	114.0	115.0					12																	4705422		2203	4300	6503	SO:0001819	synonymous_variant	0			Y09305	CCDS8530.1	12p13.32	2014-09-11			ENSG00000010219	ENSG00000010219			3095	protein-coding gene	gene with protein product		609181				9748265	Standard	NM_003845		Approved		uc001qmx.3	Q9NR20	OTTHUMG00000168204	ENST00000540757.2:c.390G>A	12.37:g.4705422G>A			A8K8F7|Q8NEF2|Q92631	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.V130	ENST00000540757.2	37	c.390	CCDS8530.1	12																																																																																			DYRK4	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000010219		0.537	DYRK4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DYRK4	HGNC	protein_coding	OTTHUMT00000398780.2	-	0.00	48	0	G			4705422	+1	tier1	-	no_errors	ENST00000010132	ensembl	human	known	74_37	silent	52.63	9	10	SNP	1.000	A
EDN2	1907	genome.wustl.edu	37	1	41945149	41945149	+	Frame_Shift_Del	DEL	G	G	-			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr1:41945149delG	ENST00000372587.4	-	5	537	c.468delC	c.(466-468)ctcfs	p.L156fs	EDN2_ENST00000490783.1_5'UTR	NM_001956.3	NP_001947.1	P20800	EDN2_HUMAN	endothelin 2	156					artery smooth muscle contraction (GO:0014824)|calcium-mediated signaling (GO:0019722)|cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|energy homeostasis (GO:0097009)|hormonal regulation of the force of heart contraction (GO:0003058)|inositol phosphate-mediated signaling (GO:0048016)|lung alveolus development (GO:0048286)|macrophage activation (GO:0042116)|macrophage chemotaxis (GO:0048246)|neutrophil chemotaxis (GO:0030593)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of heart rate (GO:0010460)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of prostaglandin-endoperoxide synthase activity (GO:0060585)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of the force of heart contraction by chemical signal (GO:0003099)|prostaglandin biosynthetic process (GO:0001516)|regulation of systemic arterial blood pressure by endothelin (GO:0003100)|regulation of vasoconstriction (GO:0019229)|temperature homeostasis (GO:0001659)|vasoconstriction (GO:0042310)|vein smooth muscle contraction (GO:0014826)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)			endometrium(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	8	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GCTTGGCAAAGAGGCTCTTGA	0.542																																																	0													128.0	111.0	117.0					1																	41945149		2203	4300	6503	SO:0001589	frameshift_variant	0			M65199	CCDS462.1	1p34	2013-02-26			ENSG00000127129	ENSG00000127129		"""Endogenous ligands"""	3177	protein-coding gene	gene with protein product		131241					Standard	NM_001956		Approved	ET2	uc009vwh.3	P20800	OTTHUMG00000006362	ENST00000372587.4:c.468delC	1.37:g.41945149delG	ENSP00000361668:p.Leu156fs		Q5T1R3	Frame_Shift_Del	DEL	pfam_Endothln-like_toxin,smart_Endothln-like_toxin,prints_Bibrotoxin/Sarafotoxin-D	p.F157fs	ENST00000372587.4	37	c.468	CCDS462.1	1																																																																																			EDN2	-	NULL	ENSG00000127129		0.542	EDN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDN2	HGNC	protein_coding	OTTHUMT00000016983.1		0.00	81	0	G	NM_001956		41945149	-1			no_errors	ENST00000372587	ensembl	human	known	74_37	frame_shift_del	8.51	129	12	DEL	0.001	0
EEF2	1938	genome.wustl.edu	37	19	3982015	3982015	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr19:3982015G>A	ENST00000309311.6	-	6	915	c.827C>T	c.(826-828)tCa>tTa	p.S276L	SNORD37_ENST00000384048.1_RNA|EEF2_ENST00000600720.1_5'Flank	NM_001961.3	NP_001952.1	P13639	EF2_HUMAN	eukaryotic translation elongation factor 2	276	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|hematopoietic progenitor cell differentiation (GO:0002244)|positive regulation of gene expression (GO:0010628)|positive regulation of translation (GO:0045727)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation activator activity (GO:0008494)|translation elongation factor activity (GO:0003746)			endometrium(4)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|GBM - Glioblastoma multiforme(1328;0.0223)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTGGTGGCTGACTTGCTGAA	0.612																																					Colon(165;1804 1908 4071 6587 18799)												0													104.0	95.0	98.0					19																	3982015		2203	4300	6503	SO:0001583	missense	0			Z11692	CCDS12117.1	19p13.3	2012-09-20			ENSG00000167658	ENSG00000167658			3214	protein-coding gene	gene with protein product	"""polypeptidyl-tRNA translocase"""	130610		EF2		2610926, 6427766	Standard	NM_001961		Approved	EEF-2	uc002lze.3	P13639		ENST00000309311.6:c.827C>T	19.37:g.3982015G>A	ENSP00000307940:p.Ser276Leu		B2RMP5|D6W618|Q58J86	Missense_Mutation	SNP	pfam_EF_GTP-bd_dom,pfam_Transl_elong_EFG/EF2_IV,pfam_EFG_V,pfam_Transl_elong_EFTu/EF1A_2,superfamily_P-loop_NTPase,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_Transl_B-barrel,superfamily_EFG_III-V,smart_Transl_elong_EFG/EF2_IV,smart_EFG_V,prints_EF_GTP-bd_dom,tigrfam_Small_GTP-bd_dom	p.S276L	ENST00000309311.6	37	c.827	CCDS12117.1	19	.	.	.	.	.	.	.	.	.	.	G	20.4	3.988684	0.74589	.	.	ENSG00000167658	ENST00000543343;ENST00000309311	T	0.33438	1.41	6.05	6.05	0.98169	Protein synthesis factor, GTP-binding (1);	0.115078	0.64402	D	0.000011	T	0.45115	0.1326	M	0.85630	2.765	0.80722	D	1	B	0.15141	0.012	B	0.18561	0.022	T	0.40757	-0.9546	10	0.62326	D	0.03	-30.8316	19.5816	0.95469	0.0:0.0:1.0:0.0	.	276	P13639	EF2_HUMAN	L	276	ENSP00000307940:S276L	ENSP00000307940:S276L	S	-	2	0	EEF2	3933015	1.000000	0.71417	0.971000	0.41717	0.696000	0.40369	7.823000	0.86660	2.872000	0.98467	0.650000	0.86243	TCA	EEF2	-	pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase	ENSG00000167658		0.612	EEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEF2	HGNC	protein_coding	OTTHUMT00000457615.2	-	0.00	83	0	G	NM_001961		3982015	-1	tier1	-	no_errors	ENST00000309311	ensembl	human	known	74_37	missense	22.78	61	18	SNP	1.000	A
EGR1	1958	genome.wustl.edu	37	5	137803304	137803304	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr5:137803304C>T	ENST00000239938.4	+	2	1438	c.1166C>T	c.(1165-1167)aCc>aTc	p.T389I		NM_001964.2	NP_001955.1	P18146	EGR1_HUMAN	early growth response 1	389					BMP signaling pathway (GO:0030509)|cellular response to antibiotic (GO:0071236)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to gamma radiation (GO:0071480)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heparin (GO:0071504)|cellular response to hyperoxia (GO:0071455)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|cellular response to isoquinoline alkaloid (GO:0071317)|cellular response to mechanical stimulus (GO:0071260)|cellular response to mycophenolic acid (GO:0071506)|cellular response to steroid hormone stimulus (GO:0071383)|circadian rhythm (GO:0007623)|cytokine-mediated signaling pathway (GO:0019221)|glomerular mesangial cell proliferation (GO:0072110)|interleukin-1-mediated signaling pathway (GO:0070498)|learning or memory (GO:0007611)|long-term synaptic potentiation (GO:0060291)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oligodendrocyte differentiation (GO:0048709)|positive regulation of glomerular metanephric mesangial cell proliferation (GO:0072303)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of protein sumoylation (GO:0033233)|response to amphetamine (GO:0001975)|response to carbon monoxide (GO:0034465)|response to cocaine (GO:0042220)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to norepinephrine (GO:0071873)|response to nutrient levels (GO:0031667)|skeletal muscle cell differentiation (GO:0035914)|T cell differentiation (GO:0030217)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|histone acetyltransferase binding (GO:0035035)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|ovary(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			CACATCCGCACCCACACAGGC	0.597																																																	0													82.0	82.0	82.0					5																	137803304		2203	4300	6503	SO:0001583	missense	0			M62829	CCDS4206.1	5q23-q31	2013-01-08			ENSG00000120738	ENSG00000120738		"""Zinc fingers, C2H2-type"""	3238	protein-coding gene	gene with protein product	"""nerve growth factor-induced protein A"", ""transcription factor ETR103"", ""zinc finger protein 225"", ""early growth response protein 1"""	128990				3127059	Standard	NM_001964		Approved	TIS8, G0S30, NGFI-A, KROX-24, ZIF-268, AT225, ZNF225	uc003ldb.1	P18146	OTTHUMG00000129197	ENST00000239938.4:c.1166C>T	5.37:g.137803304C>T	ENSP00000239938:p.Thr389Ile			Missense_Mutation	SNP	pfam_DUF3432,pfam_DUF3446,pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T389I	ENST00000239938.4	37	c.1166	CCDS4206.1	5	.	.	.	.	.	.	.	.	.	.	C	15.82	2.947286	0.53186	.	.	ENSG00000120738	ENST00000239938	T	0.51817	0.69	4.2	4.2	0.49525	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.50257	0.1605	N	0.11427	0.14	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.62053	-0.6935	10	0.87932	D	0	-25.9182	15.72	0.77700	0.0:1.0:0.0:0.0	.	389	P18146	EGR1_HUMAN	I	389	ENSP00000239938:T389I	ENSP00000239938:T389I	T	+	2	0	EGR1	137831203	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	7.651000	0.83577	2.177000	0.69029	0.563000	0.77884	ACC	EGR1	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000120738		0.597	EGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EGR1	HGNC	protein_coding	OTTHUMT00000251274.1		0.00	52	0	C	NM_001964		137803304	+1			no_errors	ENST00000239938	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	T
ELMSAN1	91748	genome.wustl.edu	37	14	74196531	74196531	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr14:74196531G>C	ENST00000286523.5	-	4	2689	c.1907C>G	c.(1906-1908)tCt>tGt	p.S636C	ELMSAN1_ENST00000394071.2_Missense_Mutation_p.S636C	NM_194278.3	NP_919254.2	Q6PJG2	EMSA1_HUMAN	ELM2 and Myb/SANT-like domain containing 1	636					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)										GCGCACGGGAGAGCGCAGGTG	0.672																																																	0													60.0	58.0	59.0					14																	74196531		2203	4300	6503	SO:0001583	missense	0			BF971739	CCDS9819.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000156030	ENSG00000156030			19853	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 117"", ""chromosome 14 open reading frame 43"""	C14orf117, C14orf43			Standard	NM_194278		Approved	LSR68	uc001xou.3	Q6PJG2	OTTHUMG00000150359	ENST00000286523.5:c.1907C>G	14.37:g.74196531G>C	ENSP00000286523:p.Ser636Cys		Q6PK13|Q6PK59|Q6ZS23	Missense_Mutation	SNP	pfam_ELM2_dom,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_ELM2_dom	p.S636C	ENST00000286523.5	37	c.1907	CCDS9819.1	14	.	.	.	.	.	.	.	.	.	.	G	27.3	4.817877	0.90790	.	.	ENSG00000156030	ENST00000394071;ENST00000286523;ENST00000423556;ENST00000435371	T;T;T;T	0.23147	1.92;1.92;1.92;1.93	5.27	5.27	0.74061	.	0.000000	0.64402	D	0.000013	T	0.56156	0.1966	M	0.80616	2.505	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.61973	-0.6952	10	0.87932	D	0	-15.0593	18.8794	0.92351	0.0:0.0:1.0:0.0	.	636;636	A0PJD3;Q6PJG2	.;CN043_HUMAN	C	636	ENSP00000377634:S636C;ENSP00000286523:S636C;ENSP00000407767:S636C;ENSP00000402380:S636C	ENSP00000286523:S636C	S	-	2	0	C14orf43	73266284	1.000000	0.71417	0.969000	0.41365	0.908000	0.53690	9.859000	0.99545	2.441000	0.82636	0.478000	0.44815	TCT	ELMSAN1	-	NULL	ENSG00000156030		0.672	ELMSAN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ELMSAN1	HGNC	protein_coding	OTTHUMT00000317793.1	-	0.00	51	0	G	NM_194278		74196531	-1	tier1	-	no_errors	ENST00000286523	ensembl	human	known	74_37	missense	36.62	45	26	SNP	1.000	C
EML3	256364	genome.wustl.edu	37	11	62379057	62379057	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr11:62379057C>T	ENST00000394773.2	-	2	341	c.34G>A	c.(34-36)Gct>Act	p.A12T	EML3_ENST00000494176.2_5'UTR|ROM1_ENST00000534093.1_5'Flank|EML3_ENST00000529309.1_Missense_Mutation_p.A12T|EML3_ENST00000531557.1_5'Flank|ROM1_ENST00000278833.3_5'Flank|EML3_ENST00000278845.4_Missense_Mutation_p.A12T	NM_153265.2	NP_694997.2	Q32P44	EMAL3_HUMAN	echinoderm microtubule associated protein like 3	12						cytoplasm (GO:0005737)|microtubule (GO:0005874)				biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(1)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						GCCTCCCGAGCAGGGCCGTCA	0.587																																																	0													19.0	20.0	20.0					11																	62379057		2202	4297	6499	SO:0001583	missense	0			AK093146	CCDS8023.2	11q12.3	2013-01-10			ENSG00000149499	ENSG00000149499		"""WD repeat domain containing"""	26666	protein-coding gene	gene with protein product						15225882, 14744259	Standard	NM_153265		Approved	FLJ35827, ELP95	uc001ntu.1	Q32P44	OTTHUMG00000149817	ENST00000394773.2:c.34G>A	11.37:g.62379057C>T	ENSP00000378254:p.Ala12Thr		Q6ZQW7|Q8NA55	Missense_Mutation	SNP	pfam_HELP,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A12T	ENST00000394773.2	37	c.34	CCDS8023.2	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.32|16.32	3.090087|3.090087	0.55968|0.55968	.|.	.|.	ENSG00000149499|ENSG00000149499	ENST00000394773;ENST00000278845;ENST00000529309|ENST00000394776	T;T;T|.	0.27890|.	1.79;1.75;1.64|.	3.55|3.55	1.66|1.66	0.24008|0.24008	.|.	0.339424|.	0.20319|.	U|.	0.094661|.	T|T	0.23289|0.23289	0.0563|0.0563	N|N	0.24115|0.24115	0.695|0.695	0.25355|0.25355	N|N	0.988837|0.988837	B;B|.	0.10296|.	0.003;0.001|.	B;B|.	0.10450|.	0.005;0.001|.	T|T	0.23476|0.23476	-1.0187|-1.0187	10|5	0.62326|.	D|.	0.03|.	-1.6662|-1.6662	5.6302|5.6302	0.17506|0.17506	0.0:0.7486:0.0:0.2514|0.0:0.7486:0.0:0.2514	.|.	12;12|.	Q32P44-2;Q32P44|.	.;EMAL3_HUMAN|.	T|Y	12|5	ENSP00000378254:A12T;ENSP00000278845:A12T;ENSP00000434513:A12T|.	ENSP00000278845:A12T|.	A|C	-|-	1|2	0|0	EML3|EML3	62135633|62135633	0.003000|0.003000	0.15002|0.15002	0.998000|0.998000	0.56505|0.56505	0.890000|0.890000	0.51754|0.51754	0.006000|0.006000	0.13152|0.13152	0.500000|0.500000	0.27991|0.27991	0.462000|0.462000	0.41574|0.41574	GCT|TGC	EML3	-	NULL	ENSG00000149499		0.587	EML3-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	EML3	HGNC	protein_coding	OTTHUMT00000313432.1	-	0.00	72	0	C	NM_153265		62379057	-1	tier1	-	no_errors	ENST00000529309	ensembl	human	known	74_37	missense	7.69	48	4	SNP	0.995	T
EML6	400954	genome.wustl.edu	37	2	55074758	55074758	+	Silent	SNP	C	C	G			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr2:55074758C>G	ENST00000356458.6	+	8	1705	c.1185C>G	c.(1183-1185)gtC>gtG	p.V395V	RNU7-81P_ENST00000516698.1_RNA	NM_001039753.2	NP_001034842.2	Q6ZMW3	EMAL6_HUMAN	echinoderm microtubule associated protein like 6	395						cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|endometrium(6)	7						TTCTCCGAGTCAGGCACGTAC	0.468																																																	0													84.0	67.0	72.0					2																	55074758		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS46286.1	2p16.1	2013-01-10			ENSG00000214595	ENSG00000214595		"""WD repeat domain containing"""	35412	protein-coding gene	gene with protein product							Standard	NM_001039753		Approved	FLJ42562	uc002ryb.4	Q6ZMW3	OTTHUMG00000152035	ENST00000356458.6:c.1185C>G	2.37:g.55074758C>G			A8MUB5|B6ZDG7	Silent	SNP	pfam_WD40_repeat,pfam_HELP,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V395	ENST00000356458.6	37	c.1185	CCDS46286.1	2																																																																																			EML6	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom	ENSG00000214595		0.468	EML6-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	EML6	HGNC	protein_coding	OTTHUMT00000324997.3	-	0.00	72	0	C	XM_001725002		55074758	+1	tier1	-	no_errors	ENST00000356458	ensembl	human	novel	74_37	silent	52.17	33	36	SNP	1.000	G
LINC01164	399827	genome.wustl.edu	37	10	133608085	133608085	+	Missense_Mutation	SNP	G	G	C	rs563550083		TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr10:133608085G>C	ENST00000341866.3	-	3	879	c.291C>G	c.(289-291)atC>atG	p.I97M																								TTGGCTTCTCGATGGGACTGG	0.597																																																	0																																										SO:0001583	missense	0																														ENST00000341866.3:c.291C>G	10.37:g.133608085G>C	ENSP00000340261:p.Ile97Met			Missense_Mutation	SNP	NULL	p.I97M	ENST00000341866.3	37	c.291		10	.	.	.	.	.	.	.	.	.	.	G	0.577	-0.838662	0.02692	.	.	ENSG00000189275	ENST00000341866	.	.	.	1.32	0.385	0.16249	.	.	.	.	.	T	0.36276	0.0961	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.37361	-0.9709	5	0.87932	D	0	.	3.834	0.08886	0.2451:0.0:0.7549:0.0	.	.	.	.	M	97	.	ENSP00000340261:I97M	I	-	3	3	AL450307.1	133458075	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.042000	0.12063	0.141000	0.18875	-0.362000	0.07510	ATC	AL450307.1	-	NULL	ENSG00000189275		0.597	AL450307.1-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000189275	Clone_based_ensembl_gene	protein_coding		-	0.00	48	0	G			133608085	-1	tier1	-	no_errors	ENST00000341866	ensembl	human	known	74_37	missense	20.00	32	8	SNP	0.000	C
PTPRU	10076	genome.wustl.edu	37	1	29580122	29580122	+	Intron	SNP	A	A	G			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr1:29580122A>G	ENST00000345512.3	+	2	202				PTPRU_ENST00000323874.8_Intron|AL645859.1_ENST00000408623.1_RNA|PTPRU_ENST00000428026.2_Intron|PTPRU_ENST00000356870.3_Intron|PTPRU_ENST00000460170.2_Intron|PTPRU_ENST00000373779.3_Intron	NM_005704.4	NP_005695.3	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U						canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|homotypic cell-cell adhesion (GO:0034109)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|organ regeneration (GO:0031100)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|response to glucocorticoid (GO:0051384)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(26)|ovary(1)|prostate(3)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	79		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		tgtttttgccattactttaaa	0.284																																																	0																																										SO:0001627	intron_variant	0			U71075	CCDS334.1, CCDS335.1, CCDS44098.1, CCDS44098.2, CCDS53290.1	1p35.3	2013-02-11			ENSG00000060656	ENSG00000060656		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9683	protein-coding gene	gene with protein product	"""pi R-PTP-Psi"""	602454				8700514, 9434160	Standard	NM_133178		Approved	PTPRO, hPTP-J, PCP-2, FMI, PTP	uc001bru.3	Q92729	OTTHUMG00000003699	ENST00000345512.3:c.74-1665A>G	1.37:g.29580122A>G			A6H8L1|O00197|P78399|Q59HA4|Q5SYU4|Q5SYU5|Q92735|Q92850	RNA	SNP	-	NULL	ENST00000345512.3	37	NULL	CCDS334.1	1																																																																																			AL645859.1	-	-	ENSG00000221550		0.284	PTPRU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000221550	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000010447.1	-	0.00	48	0	A			29580122	-1	tier1	-	no_errors	ENST00000408623	ensembl	human	novel	74_37	rna	37.93	18	11	SNP	0.096	G
LOC101927209	101927209	genome.wustl.edu	37	1	142714797	142714797	+	lincRNA	SNP	A	A	G			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr1:142714797A>G	ENST00000610091.1	-	0	861																											ATCTTTATCAATAGGTTATCA	0.259																																																	0																																												0																															1.37:g.142714797A>G				RNA	SNP	-	NULL	ENST00000610091.1	37	NULL		1																																																																																			RP11-417J8.6	-	-	ENSG00000203849		0.259	RP11-417J8.6-001	KNOWN	basic	lincRNA	ENSG00000203849	Clone_based_vega_gene	lincRNA	OTTHUMT00000037265.2	-	0.00	20	0	A			142714797	-1	tier1	-	no_errors	ENST00000610091	ensembl	human	known	74_37	rna	23.08	20	6	SNP	0.001	G
AL159977.1	0	genome.wustl.edu	37	13	27894248	27894248	+	RNA	SNP	T	T	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr13:27894248T>A	ENST00000408829.1	+	0	99																											tactaaaaaatttttgttgtt	0.318																																																	0																																												0																															13.37:g.27894248T>A				RNA	SNP	-	NULL	ENST00000408829.1	37	NULL		13																																																																																			AL159977.1	-	-	ENSG00000221756		0.318	AL159977.1-201	NOVEL	basic	miRNA	ENSG00000221756	Clone_based_ensembl_gene	miRNA		-	0.00	84	0	T			27894248	+1	tier1	-	no_errors	ENST00000408829	ensembl	human	novel	74_37	rna	52.17	33	36	SNP	0.124	A
RPL7P60	100289264	genome.wustl.edu	37	7	99737930	99737930	+	RNA	SNP	G	G	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr7:99737930G>T	ENST00000376482.3	+	0	210																											ATTAATTGAAGCCTTGTAGAG	0.473																																																	0																																												0																															7.37:g.99737930G>T				RNA	SNP	-	NULL	ENST00000376482.3	37	NULL		7																																																																																			AC073842.19	-	-	ENSG00000235077		0.473	AC073842.19-001	KNOWN	basic	antisense	ENSG00000235077	Clone_based_vega_gene	antisense	OTTHUMT00000337349.1	-	0.00	45	0	G			99737930	+1	tier1	-	no_errors	ENST00000376482	ensembl	human	known	74_37	rna	36.96	29	17	SNP	1.000	T
AJ239322.1	0	genome.wustl.edu	37	2	132724261	132724261	+	lincRNA	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr2:132724261C>T	ENST00000419362.1	-	0	251				AJ239322.3_ENST00000421696.2_lincRNA																							ctaggtgcggcgaagtcctgc	0.582																																																	0													9.0	10.0	9.0					2																	132724261		690	1591	2281			0																															2.37:g.132724261C>T				RNA	SNP	-	NULL	ENST00000419362.1	37	NULL		2																																																																																			AJ239322.1	-	-	ENSG00000235615		0.582	AJ239322.1-001	KNOWN	basic|exp_conf	lincRNA	ENSG00000235615	Clone_based_vega_gene	lincRNA	OTTHUMT00000316881.1	-	0.00	38	0	C			132724261	-1	tier1	-	no_errors	ENST00000419362	ensembl	human	known	74_37	rna	6.41	73	5	SNP	0.002	T
RP3-470B24.5	0	genome.wustl.edu	37	6	168377135	168377136	+	lincRNA	INS	-	-	G	rs377136730|rs372663828		TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr6:168377135_168377136insG	ENST00000538528.1	-	0	483_484																											CTGCAGTGTGTTGGGAGGAGGA	0.619																																																	0																																												0																															6.37:g.168377135_168377136insG				RNA	INS	-	NULL	ENST00000538528.1	37	NULL		6																																																																																			RP3-470B24.5	-	-	ENSG00000235994		0.619	RP3-470B24.5-201	KNOWN	basic	lincRNA	ENSG00000235994	Clone_based_vega_gene	lincRNA			0.00	159	0	-			168377136	-1	tier1		no_errors	ENST00000538528	ensembl	human	known	74_37	rna	7.04	66	5	INS	0.990:0.992	G
RP3-470B24.5	0	genome.wustl.edu	37	6	168377136	168377137	+	lincRNA	INS	-	-	GTG	rs377136730		TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr6:168377136_168377137insGTG	ENST00000538528.1	-	0	482_483																											TGCAGTGTGTTGGGAGGAGGAG	0.624																																																	0																																												0																															6.37:g.168377136_168377137insGTG				RNA	INS	-	NULL	ENST00000538528.1	37	NULL		6																																																																																			RP3-470B24.5	-	-	ENSG00000235994		0.624	RP3-470B24.5-201	KNOWN	basic	lincRNA	ENSG00000235994	Clone_based_vega_gene	lincRNA			0.00	157	0	-			168377137	-1	tier1		no_errors	ENST00000538528	ensembl	human	known	74_37	rna	7.04	66	5	INS	0.992:0.996	GTG
RP3-470B24.5	0	genome.wustl.edu	37	6	168377161	168377161	+	lincRNA	SNP	T	T	C	rs113533593		TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr6:168377161T>C	ENST00000538528.1	-	0	458																											GTGGGGGTCATTCCCCCTGCA	0.612																																																	0													5.0	6.0	6.0					6																	168377161		673	1548	2221			0																															6.37:g.168377161T>C				RNA	SNP	-	NULL	ENST00000538528.1	37	NULL		6																																																																																			RP3-470B24.5	-	-	ENSG00000235994		0.612	RP3-470B24.5-201	KNOWN	basic	lincRNA	ENSG00000235994	Clone_based_vega_gene	lincRNA		-	0.00	136	0	T			168377161	-1	tier1	rs113533593	no_errors	ENST00000538528	ensembl	human	known	74_37	rna	9.84	55	6	SNP	0.306	C
RP11-146E13.4	0	genome.wustl.edu	37	14	19856372	19856372	+	lincRNA	SNP	A	A	G			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr14:19856372A>G	ENST00000548109.1	+	0	72																											TATACGTGGGAAAAAAAAAAG	0.358																																																	0																																												0																															14.37:g.19856372A>G				RNA	SNP	-	NULL	ENST00000548109.1	37	NULL		14																																																																																			CTD-2314B22.3	-	-	ENSG00000244306		0.358	RP11-146E13.4-001	KNOWN	basic	lincRNA	ENSG00000244306	Clone_based_vega_gene	lincRNA	OTTHUMT00000409408.1		0.00	21	0	A			19856372	-1			no_errors	ENST00000551334	ensembl	human	known	74_37	rna	9.38	29	3	SNP	0.001	G
KRT7	3855	genome.wustl.edu	37	12	52639132	52639132	+	Intron	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr12:52639132C>T	ENST00000331817.5	+	7	1167				KRT7_ENST00000552322.1_Intron|RP3-416H24.1_ENST00000546686.1_RNA	NM_005556.3	NP_005547.3	P08729	K2C7_HUMAN	keratin 7						viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(2)|stomach(1)|urinary_tract(1)	14				BRCA - Breast invasive adenocarcinoma(357;0.105)	Primaquine(DB01087)	GTGCTCACTGCAGGATGGGCA	0.577																																																	0																																										SO:0001627	intron_variant	0				CCDS8822.1	12q13.13	2013-01-16			ENSG00000135480	ENSG00000135480		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6445	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 7"", ""cytokeratin 7"", ""sarcolectin"", ""keratin, 55K type II cytoskeletal"""	148059				1713141, 16831889	Standard	XR_245927		Approved	K7, CK7, K2C7, SCL	uc001saa.1	P08729	OTTHUMG00000169580	ENST00000331817.5:c.985-64C>T	12.37:g.52639132C>T			Q92676|Q9BUD8|Q9Y3R7	RNA	SNP	-	NULL	ENST00000331817.5	37	NULL	CCDS8822.1	12																																																																																			RP3-416H24.1	-	-	ENSG00000257671		0.577	KRT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000257671	Clone_based_vega_gene	protein_coding	OTTHUMT00000404897.1	-	0.00	54	0	C	NM_005556		52639132	-1	tier1	-	no_errors	ENST00000546686	ensembl	human	known	74_37	rna	5.63	67	4	SNP	0.005	T
RASGRP1	10125	genome.wustl.edu	37	15	38795603	38795603	+	Intron	SNP	C	C	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr15:38795603C>A	ENST00000310803.5	-	11	1501				RP11-102L12.2_ENST00000560231.1_RNA|RASGRP1_ENST00000559830.1_Intron|RASGRP1_ENST00000450598.2_Intron|RASGRP1_ENST00000561180.1_Intron|RASGRP1_ENST00000558164.1_Intron|RASGRP1_ENST00000539159.1_Intron	NM_001128602.1|NM_005739.3	NP_001122074.1|NP_005730.2	O95267	GRP1_HUMAN	RAS guanyl releasing protein 1 (calcium and DAG-regulated)						activation of Rho GTPase activity (GO:0032862)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response to antigenic stimulus (GO:0002437)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|platelet activation (GO:0030168)|Ras protein signal transduction (GO:0007265)|regulation of phosphatidylinositol 3-kinase signaling (GO:0014066)|secretory granule localization (GO:0032252)|signal transduction (GO:0007165)|vesicle transport along microtubule (GO:0047496)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20		all_cancers(109;6.38e-17)|all_epithelial(112;5.51e-15)|Lung NSC(122;2.12e-11)|all_lung(180;5.63e-10)|Melanoma(134;0.0574)		GBM - Glioblastoma multiforme(113;1.97e-07)|BRCA - Breast invasive adenocarcinoma(123;0.00248)		TAGAGAAATCCTCATGACTAC	0.398																																																	0													66.0	58.0	60.0					15																	38795603		1860	4099	5959	SO:0001627	intron_variant	0			AF106071	CCDS45221.1, CCDS45222.1	15q15	2013-01-10				ENSG00000172575		"""EF-hand domain containing"""	9878	protein-coding gene	gene with protein product		603962				10087292, 9789079	Standard	NM_005739		Approved	CalDAG-GEFII, RASGRP	uc001zke.4	O95267		ENST00000310803.5:c.1324-26G>T	15.37:g.38795603C>A			Q56CZ0|Q58G75|Q59HB1|Q5I3A8|Q6GV31|Q6NX39|Q7LDG6|Q9UI94|Q9UNN9	RNA	SNP	-	NULL	ENST00000310803.5	37	NULL	CCDS45222.1	15																																																																																			RP11-102L12.2	-	-	ENSG00000259326		0.398	RASGRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000259326	Clone_based_vega_gene	protein_coding	OTTHUMT00000418223.1	-	0.00	48	0	C	NM_005739		38795603	+1	tier1	-	no_errors	ENST00000560231	ensembl	human	known	74_37	rna	16.33	41	8	SNP	0.000	A
ALDH1A3	220	genome.wustl.edu	37	15	101454857	101454857	+	Intron	SNP	G	G	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr15:101454857G>T	ENST00000329841.5	+	13	1998				ALDH1A3_ENST00000346623.6_Intron|RP11-66B24.4_ENST00000560351.1_RNA|RP11-66B24.4_ENST00000560461.1_RNA|RP11-66B24.4_ENST00000560068.1_RNA	NM_000693.2	NP_000684.2	P47895	AL1A3_HUMAN	aldehyde dehydrogenase 1 family, member A3						embryonic eye morphogenesis (GO:0048048)|face development (GO:0060324)|inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|nucleus accumbens development (GO:0021768)|olfactory pit development (GO:0060166)|optic cup morphogenesis involved in camera-type eye development (GO:0002072)|positive regulation of apoptotic process (GO:0043065)|retinal metabolic process (GO:0042574)|retinoic acid biosynthetic process (GO:0002138)|retinoic acid metabolic process (GO:0042573)|retinol metabolic process (GO:0042572)|righting reflex (GO:0060013)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)|NAD+ binding (GO:0070403)|protein homodimerization activity (GO:0042803)|thyroid hormone binding (GO:0070324)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(7)|lung(9)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	27	Lung NSC(78;0.00144)|all_lung(78;0.0018)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)		Vitamin A(DB00162)	TCTACACAATGGCTAAGGGAT	0.423																																																	0													63.0	49.0	54.0					15																	101454857		2203	4300	6503	SO:0001627	intron_variant	0			U07919	CCDS10389.1	15q26	2010-05-07			ENSG00000184254	ENSG00000184254	1.2.1.5	"""Aldehyde dehydrogenases"""	409	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 3"""	600463		ALDH6		7698756	Standard	XR_111558		Approved	RALDH3	uc002bwn.4	P47895	OTTHUMG00000149870	ENST00000329841.5:c.1467-49G>T	15.37:g.101454857G>T			Q6NT64	RNA	SNP	-	NULL	ENST00000329841.5	37	NULL	CCDS10389.1	15																																																																																			RP11-66B24.4	-	-	ENSG00000259583		0.423	ALDH1A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000259583	Clone_based_vega_gene	protein_coding	OTTHUMT00000313620.2	-	0.00	35	0	G			101454857	-1	tier1	-	no_errors	ENST00000560068	ensembl	human	known	74_37	rna	12.90	27	4	SNP	0.000	T
RP11-652G5.1	0	genome.wustl.edu	37	16	32611670	32611670	+	RNA	SNP	C	C	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr16:32611670C>A	ENST00000562976.1	+	0	51																											aactgccactctggcaactga	0.413																																																	0																																												0																															16.37:g.32611670C>A				RNA	SNP	-	NULL	ENST00000562976.1	37	NULL		16																																																																																			RP11-652G5.1	-	-	ENSG00000259966		0.413	RP11-652G5.1-002	KNOWN	basic	processed_transcript	ENSG00000259966	Clone_based_vega_gene	pseudogene	OTTHUMT00000432347.1	-	0.00	82	0	C			32611670	+1	tier1	-	no_errors	ENST00000562976	ensembl	human	known	74_37	rna	21.43	88	24	SNP	0.017	A
EPHA2	1969	genome.wustl.edu	37	1	16456798	16456798	+	Missense_Mutation	SNP	G	G	T	rs572281924		TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr1:16456798G>T	ENST00000358432.5	-	15	2746	c.2592C>A	c.(2590-2592)ttC>ttA	p.F864L		NM_004431.3	NP_004422.2	P29317	EPHA2_HUMAN	EPH receptor A2	864	Mediates interaction with ARHGEF16 and ELMO2.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|axial mesoderm formation (GO:0048320)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|ephrin receptor signaling pathway (GO:0048013)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|keratinocyte differentiation (GO:0030216)|lens fiber cell morphogenesis (GO:0070309)|mammary gland epithelial cell proliferation (GO:0033598)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase B signaling (GO:0051898)|neural tube development (GO:0021915)|neuron differentiation (GO:0030182)|notochord cell development (GO:0060035)|notochord formation (GO:0014028)|osteoblast differentiation (GO:0001649)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|post-anal tail morphogenesis (GO:0036342)|protein kinase B signaling (GO:0043491)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of lamellipodium assembly (GO:0010591)|response to growth factor (GO:0070848)|skeletal system development (GO:0001501)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell projection (GO:0042995)|cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|Colorectal(212;3.63e-07)|COAD - Colon adenocarcinoma(227;2.25e-05)|BRCA - Breast invasive adenocarcinoma(304;9.58e-05)|Kidney(64;0.000175)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(313;0.00669)|READ - Rectum adenocarcinoma(331;0.0649)	Dasatinib(DB01254)|Regorafenib(DB08896)	CGATGTCAGCGAACTTGGGGC	0.622																																																	0													75.0	71.0	73.0					1																	16456798		2203	4300	6503	SO:0001583	missense	0			BC037166	CCDS169.1	1p36	2013-02-11	2004-10-28		ENSG00000142627	ENSG00000142627	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3386	protein-coding gene	gene with protein product		176946	"""EphA2"""	ECK		9119409	Standard	NM_004431		Approved		uc001aya.2	P29317	OTTHUMG00000009527	ENST00000358432.5:c.2592C>A	1.37:g.16456798G>T	ENSP00000351209:p.Phe864Leu		B5A968|Q8N3Z2	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.F864L	ENST00000358432.5	37	c.2592	CCDS169.1	1	.	.	.	.	.	.	.	.	.	.	G	19.69	3.874373	0.72180	.	.	ENSG00000142627	ENST00000358432	D	0.87103	-2.21	5.63	-1.77	0.07982	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000011	D	0.93164	0.7823	M	0.89904	3.07	0.54753	D	0.999988	D	0.89917	1.0	D	0.87578	0.998	D	0.92429	0.5952	10	0.87932	D	0	.	12.7002	0.57026	0.4497:0.0:0.5503:0.0	.	864	P29317	EPHA2_HUMAN	L	864	ENSP00000351209:F864L	ENSP00000351209:F864L	F	-	3	2	EPHA2	16329385	0.003000	0.15002	0.583000	0.28640	0.918000	0.54935	0.083000	0.14871	-0.333000	0.08476	-0.797000	0.03246	TTC	EPHA2	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000142627		0.622	EPHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA2	HGNC	protein_coding	OTTHUMT00000026322.1	-	0.00	87	0	G	NM_004431		16456798	-1	tier1	-	no_errors	ENST00000358432	ensembl	human	known	74_37	missense	12.73	48	7	SNP	0.637	T
EPS8	2059	genome.wustl.edu	37	12	15777165	15777165	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr12:15777165G>C	ENST00000281172.5	-	19	2657	c.2221C>G	c.(2221-2223)Cct>Gct	p.P741A	EPS8_ENST00000543523.1_Missense_Mutation_p.P741A|EPS8_ENST00000542903.1_Missense_Mutation_p.P481A|EPS8_ENST00000540613.1_Missense_Mutation_p.P481A|EPS8_ENST00000543612.1_Missense_Mutation_p.P741A	NM_004447.5	NP_004438.3	Q12929	EPS8_HUMAN	epidermal growth factor receptor pathway substrate 8	741	Effector region. {ECO:0000250}.				actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|actin filament bundle assembly (GO:0051017)|actin polymerization-dependent cell motility (GO:0070358)|adult locomotory behavior (GO:0008344)|barbed-end actin filament capping (GO:0051016)|behavioral response to ethanol (GO:0048149)|cell proliferation (GO:0008283)|dendritic cell migration (GO:0036336)|epidermal growth factor receptor signaling pathway (GO:0007173)|exit from mitosis (GO:0010458)|positive regulation of signal transduction (GO:0009967)|Rac protein signal transduction (GO:0016601)|regulation of actin filament length (GO:0030832)|regulation of cell shape (GO:0008360)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|ruffle membrane (GO:0032587)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actin binding (GO:0003779)|Rac GTPase binding (GO:0048365)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33		all_epithelial(100;1.87e-05)|Breast(259;0.000286)|Hepatocellular(102;0.244)		BRCA - Breast invasive adenocarcinoma(232;4.29e-05)|GBM - Glioblastoma multiforme(207;0.0264)		ACTCACACAGGGTTGAATCCC	0.408																																																	0													141.0	110.0	120.0					12																	15777165		2203	4300	6503	SO:0001583	missense	0			U12535	CCDS31753.1	12p12.3	2008-05-02				ENSG00000151491			3420	protein-coding gene	gene with protein product		600206				8084614	Standard	NM_004447		Approved		uc001rdb.3	Q12929		ENST00000281172.5:c.2221C>G	12.37:g.15777165G>C	ENSP00000281172:p.Pro741Ala		A6NMC3|A8K6W2|A8KA66|B4DX66|Q8N6J0	Missense_Mutation	SNP	pfam_PTB,pfam_SH3_domain,pfam_PTB/PI_dom,pfam_SH3_2,superfamily_SH3_domain,superfamily_SAM/pointed,smart_PTB/PI_dom,smart_SH3_domain,pfscan_SH3_domain	p.P741A	ENST00000281172.5	37	c.2221	CCDS31753.1	12	.	.	.	.	.	.	.	.	.	.	G	5.127	0.209039	0.09757	.	.	ENSG00000151491	ENST00000543523;ENST00000281172;ENST00000543612;ENST00000540613;ENST00000542903	T;T;T;T;T	0.23754	1.89;1.89;1.89;1.89;1.89	5.43	5.43	0.79202	.	0.112539	0.64402	D	0.000008	T	0.20861	0.0502	L	0.41236	1.265	0.40111	D	0.976487	B	0.28378	0.209	B	0.24155	0.051	T	0.03175	-1.1064	10	0.29301	T	0.29	.	12.7092	0.57080	0.0744:0.0:0.9256:0.0	.	741	Q12929	EPS8_HUMAN	A	741;741;741;481;481	ENSP00000441867:P741A;ENSP00000281172:P741A;ENSP00000442388:P741A;ENSP00000441888:P481A;ENSP00000437806:P481A	ENSP00000281172:P741A	P	-	1	0	EPS8	15668432	1.000000	0.71417	0.996000	0.52242	0.037000	0.13140	3.780000	0.55386	2.827000	0.97445	0.650000	0.86243	CCT	EPS8	-	superfamily_SAM/pointed	ENSG00000151491		0.408	EPS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPS8	HGNC	protein_coding	OTTHUMT00000401093.1	-	0.00	69	0	G			15777165	-1	tier1	-	no_errors	ENST00000281172	ensembl	human	known	74_37	missense	42.11	33	24	SNP	1.000	C
ERCC5	2073	genome.wustl.edu	37	13	103524642	103524642	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr13:103524642C>T	ENST00000355739.4	+	13	4196	c.2773C>T	c.(2773-2775)Cct>Tct	p.P925S	ERCC5_ENST00000375954.1_Missense_Mutation_p.P158S|BIVM-ERCC5_ENST00000602836.1_Missense_Mutation_p.P1350L	NM_000123.3	NP_000114	P28715	ERCC5_HUMAN	excision repair cross-complementation group 5	925					DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|response to UV (GO:0009411)|response to UV-C (GO:0010225)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	bubble DNA binding (GO:0000405)|double-stranded DNA binding (GO:0003690)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	51	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					GCAACTCACCCCTGGCTTTCC	0.458			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																														yes	Rec		Xeroderma pigmentosum (G)	13	13q33	2073	"""excision repair cross-complementing rodent repair deficiency, complementation group 5 (xeroderma pigmentosum, complementation group G (Cockayne syndrome))"""		E	0													89.0	85.0	86.0					13																	103524642		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	X71342	CCDS32004.1	13q22-q34	2014-09-17	2014-03-07		ENSG00000134899	ENSG00000134899			3437	protein-coding gene	gene with protein product	"""Cockayne syndrome"""	133530	"""xeroderma pigmentosum, complementation group G"", ""excision repair cross-complementing rodent repair deficiency, complementation group 5"""	ERCM2, XPGC		8088806	Standard	NM_000123		Approved			P28715	OTTHUMG00000017310	ENST00000355739.4:c.2773C>T	13.37:g.103524642C>T	ENSP00000347978:p.Pro925Ser		A6NGT4|Q5JUS4|Q5JUS5|Q7Z2V3|Q8IZL6|Q8N1B7|Q9HD59|Q9HD60	Missense_Mutation	SNP	pfam_XPG_DNA_repair_N,pfam_XPG-I_dom,superfamily_5-3_exonuclease_C,smart_XPG_DNA_repair_N,smart_XPG-I_dom,smart_HhH2,prints_XPG/Rad2_eukaryotes,prints_XPG/Rad2,tigrfam_XPG/Rad2_eukaryotes	p.P925S	ENST00000355739.4	37	c.2773	CCDS32004.1	13	.	.	.	.	.	.	.	.	.	.	C	12.05	1.822189	0.32237	.	.	ENSG00000134899	ENST00000418659;ENST00000355739;ENST00000375955;ENST00000375954	T;T	0.62941	-0.01;-0.01	5.69	4.85	0.62838	-3&apos (1); exonuclease, C-terminal domain (1);5&apos (1);	0.169892	0.52532	D	0.000062	T	0.44456	0.1294	L	0.31752	0.955	0.80722	D	1	B;B	0.29085	0.232;0.073	B;B	0.23419	0.039;0.046	T	0.30090	-0.9990	10	0.10636	T	0.68	-18.8248	10.6466	0.45623	0.0:0.7891:0.1347:0.0762	.	925;1350	P28715;Q59FZ7	ERCC5_HUMAN;.	S	1350;925;757;158	ENSP00000347978:P925S;ENSP00000365121:P158S	ENSP00000347978:P925S	P	+	1	0	ERCC5	102322643	0.301000	0.24444	0.872000	0.34217	0.697000	0.40408	1.373000	0.34272	1.398000	0.46701	-0.150000	0.13652	CCT	ERCC5	-	superfamily_5-3_exonuclease_C,tigrfam_XPG/Rad2_eukaryotes	ENSG00000134899		0.458	ERCC5-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	ERCC5	HGNC	protein_coding	OTTHUMT00000045708.1	-	0.00	65	0	C			103524642	+1	tier1	-	no_errors	ENST00000355739	ensembl	human	known	74_37	missense	53.25	36	41	SNP	0.940	T
TNFRSF25	8718	genome.wustl.edu	37	1	6521428	6521428	+	3'UTR	SNP	T	T	G			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr1:6521428T>G	ENST00000356876.3	-	0	1407				TNFRSF25_ENST00000461703.2_5'Flank|TNFRSF25_ENST00000351959.5_3'UTR|TNFRSF25_ENST00000377782.3_3'UTR	NM_003790.2|NM_148967.1	NP_003781.1|NP_683868.1	Q93038	TNR25_HUMAN	tumor necrosis factor receptor superfamily, member 25						apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell surface receptor signaling pathway (GO:0007166)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|tumor necrosis factor-activated receptor activity (GO:0005031)			breast(1)|central_nervous_system(2)|endometrium(1)|lung(4)|prostate(1)|stomach(1)	10	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Acute lymphoblastic leukemia(12;0.00157)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;4.58e-35)|GBM - Glioblastoma multiforme(13;3.06e-27)|Colorectal(212;6.01e-08)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|BRCA - Breast invasive adenocarcinoma(365;0.00105)|STAD - Stomach adenocarcinoma(132;0.00158)|READ - Rectum adenocarcinoma(331;0.0419)		TCTACACGCATAAGTAACCGT	0.627																																																	0																																										SO:0001624	3_prime_UTR_variant	0			U72763	CCDS71.1, CCDS72.1, CCDS73.1, CCDS74.1, CCDS75.1	1p36.2	2008-02-05	2002-12-20	2002-12-20	ENSG00000215788	ENSG00000215788		"""Tumor necrosis factor receptor superfamily"""	11910	protein-coding gene	gene with protein product		603366	"""tumor necrosis factor receptor superfamily, member 12 (translocating chain-association membrane protein)"""	TNFRSF12		9052839, 8934525	Standard	NM_003790		Approved	DR3, TRAMP, WSL-1, LARD, WSL-LR, DDR3, TR3, APO-3	uc001anh.3	Q93038	OTTHUMG00000000831	ENST00000356876.3:c.*66A>C	1.37:g.6521428T>G			B1ALX2|B1ALX3|B7ZLL7|O00275|O00276|O00277|O00278|O00279|O00280|O14865|O14866|P78507|P78515|Q17RU4|Q92983|Q93036|Q93037|Q99722|Q99830|Q99831|Q9BY86|Q9UME0|Q9UME1|Q9UME5	RNA	SNP	-	NULL	ENST00000356876.3	37	NULL	CCDS71.1	1																																																																																			ESPN	-	-	ENSG00000187017		0.627	TNFRSF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESPN	HGNC	protein_coding	OTTHUMT00000002259.1	-	0.00	24	0	T	NM_148965		6521428	+1	tier1	-	no_errors	ENST00000468561	ensembl	human	known	74_37	rna	25.00	12	4	SNP	1.000	G
FAIM	55179	genome.wustl.edu	37	3	138341108	138341108	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr3:138341108A>G	ENST00000393035.2	+	3	299	c.190A>G	c.(190-192)Acc>Gcc	p.T64A	FAIM_ENST00000464668.1_Missense_Mutation_p.T64A|FAIM_ENST00000360570.3_Missense_Mutation_p.T86A|FAIM_ENST00000338446.4_Missense_Mutation_p.T98A|FAIM_ENST00000393034.2_Missense_Mutation_p.T64A	NM_001033032.1	NP_001028204.1	Q9NVQ4	FAIM1_HUMAN	Fas apoptotic inhibitory molecule	64					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)	cytoplasm (GO:0005737)				kidney(1)|upper_aerodigestive_tract(1)	2						GACAAAAGCGACCATAAATAT	0.343																																																	0													85.0	87.0	86.0					3																	138341108		2203	4300	6503	SO:0001583	missense	0			AK001444	CCDS3103.1, CCDS33864.1, CCDS33865.1	3q23	2008-07-18			ENSG00000158234	ENSG00000158234			18703	protein-coding gene	gene with protein product						10075978	Standard	NM_018147		Approved	FLJ10582, FAIM1	uc003esq.3	Q9NVQ4	OTTHUMG00000159885	ENST00000393035.2:c.190A>G	3.37:g.138341108A>G	ENSP00000376755:p.Thr64Ala		Q6IAN2	Missense_Mutation	SNP	pfam_FAIM	p.T98A	ENST00000393035.2	37	c.292	CCDS3103.1	3	.	.	.	.	.	.	.	.	.	.	A	13.37	2.217804	0.39201	.	.	ENSG00000158234	ENST00000338446;ENST00000360570;ENST00000393035;ENST00000393034;ENST00000464668;ENST00000479848	T;T;T;T;T;T	0.31510	1.49;1.49;1.49;1.49;1.49;1.49	6.02	4.8	0.61643	.	0.000000	0.85682	D	0.000000	T	0.27697	0.0681	L	0.61218	1.895	0.58432	D	0.999998	B;B;B;B	0.10296	0.001;0.003;0.003;0.001	B;B;B;B	0.16289	0.003;0.009;0.009;0.015	T	0.06991	-1.0796	10	0.10902	T	0.67	-11.8255	10.3934	0.44185	0.8535:0.0:0.0:0.1465	.	64;86;98;64	Q9NVQ4;Q9NVQ4-3;Q9NVQ4-2;C9JDZ2	FAIM1_HUMAN;.;.;.	A	98;86;64;64;64;64	ENSP00000342805:T98A;ENSP00000353775:T86A;ENSP00000376755:T64A;ENSP00000376754:T64A;ENSP00000417642:T64A;ENSP00000420543:T64A	ENSP00000342805:T98A	T	+	1	0	FAIM	139823798	1.000000	0.71417	0.999000	0.59377	0.978000	0.69477	5.183000	0.65065	2.299000	0.77371	0.528000	0.53228	ACC	FAIM	-	pfam_FAIM	ENSG00000158234		0.343	FAIM-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FAIM	HGNC	protein_coding	OTTHUMT00000357979.1	-	0.00	134	0	A	NM_001033032		138341108	+1	tier1	-	no_errors	ENST00000338446	ensembl	human	known	74_37	missense	39.82	132	88	SNP	1.000	G
FAM102A	399665	genome.wustl.edu	37	9	130742450	130742450	+	5'UTR	SNP	G	G	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr9:130742450G>A	ENST00000373095.1	-	0	342					NM_001035254.2	NP_001030331.1	Q5T9C2	F102A_HUMAN	family with sequence similarity 102, member A											breast(1)|cervix(1)|large_intestine(3)|lung(1)|ovary(4)	10						CCCCGAAGGCGAAAAAAGGTG	0.547																																																	0													58.0	67.0	64.0					9																	130742450		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0				CCDS6888.1, CCDS35150.1	9q34.11	2012-11-05	2005-11-17	2005-11-17	ENSG00000167106	ENSG00000167106			31419	protein-coding gene	gene with protein product	"""sym-3 homolog A (C. elegans)"""	610891	"""chromosome 9 open reading frame 132"""	C9orf132			Standard	NM_001035254		Approved	Eeig1, bA203J24.7, SYM-3A	uc004bsx.2	Q5T9C2	OTTHUMG00000020720	ENST00000373095.1:c.-34C>T	9.37:g.130742450G>A			A2A329|Q8TEL4	RNA	SNP	-	NULL	ENST00000373095.1	37	NULL	CCDS35150.1	9																																																																																			FAM102A	-	-	ENSG00000167106		0.547	FAM102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM102A	HGNC	protein_coding	OTTHUMT00000054298.2	-	0.00	54	0	G			130742450	-1	tier1	-	no_errors	ENST00000494606	ensembl	human	known	74_37	rna	67.44	14	29	SNP	0.950	A
FAM105A	54491	genome.wustl.edu	37	5	14610525	14610525	+	3'UTR	SNP	T	T	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr5:14610525T>A	ENST00000274217.3	+	0	1293				FAM105A_ENST00000506258.2_3'UTR	NM_019018.2	NP_061891.1	Q9NUU6	F105A_HUMAN	family with sequence similarity 105, member A											large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	Lung NSC(4;0.00592)					ATGGAAGGAATTAGGACCTTT	0.468																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS3884.1	5p15.2	2014-02-24			ENSG00000145569	ENSG00000145569		"""OTU domain containing"""	25629	protein-coding gene	gene with protein product						12477932	Standard	NM_019018		Approved	FLJ11127, NET20	uc003jfj.3	Q9NUU6	OTTHUMG00000131056	ENST00000274217.3:c.*102T>A	5.37:g.14610525T>A			Q53H50|Q9H037	RNA	SNP	-	NULL	ENST00000274217.3	37	NULL	CCDS3884.1	5																																																																																			FAM105A	-	-	ENSG00000145569		0.468	FAM105A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM105A	HGNC	protein_coding	OTTHUMT00000253710.1	-	0.00	25	0	T	NM_019018		14610525	+1	tier1	-	no_errors	ENST00000506258	ensembl	human	putative	74_37	rna	25.58	32	11	SNP	0.000	A
FAM129B	64855	genome.wustl.edu	37	9	130286098	130286098	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr9:130286098G>A	ENST00000373312.3	-	5	662	c.449C>T	c.(448-450)cCc>cTc	p.P150L	FAM129B_ENST00000468379.1_Intron|FAM129B_ENST00000373314.3_Missense_Mutation_p.P137L	NM_022833.2	NP_073744.2	Q96TA1	NIBL1_HUMAN	family with sequence similarity 129, member B	150	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				negative regulation of apoptotic process (GO:0043066)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						CTTGAGGATGGGGGCACTGCC	0.582											OREG0019507	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													121.0	108.0	112.0					9																	130286098		2203	4300	6503	SO:0001583	missense	0			AF151783	CCDS35144.1, CCDS35145.1	9q34.13	2010-02-01	2006-11-23	2006-11-23	ENSG00000136830	ENSG00000136830			25282	protein-coding gene	gene with protein product		614045	"""chromosome 9 open reading frame 88"""	C9orf88		14702039, 19362540	Standard	XM_005252135		Approved	DKFZP434H0820, FLJ13518, FLJ22151, FLJ22298, bA356B19.6, MINERVA	uc004brh.3	Q96TA1	OTTHUMG00000020705	ENST00000373312.3:c.449C>T	9.37:g.130286098G>A	ENSP00000362409:p.Pro150Leu	1579	Q4LE55|Q5VVW6|Q5VVW7|Q9BUS2|Q9NT35	Missense_Mutation	SNP	pfscan_Pleckstrin_homology	p.P150L	ENST00000373312.3	37	c.449	CCDS35145.1	9	.	.	.	.	.	.	.	.	.	.	G	22.8	4.334215	0.81801	.	.	ENSG00000136830	ENST00000373314;ENST00000373312	T;T	0.15834	2.39;2.39	5.42	5.42	0.78866	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.115346	0.64402	D	0.000014	T	0.35566	0.0936	M	0.71036	2.16	0.58432	D	0.999999	D;D	0.61080	0.989;0.989	P;P	0.59424	0.857;0.857	T	0.07065	-1.0792	10	0.72032	D	0.01	-37.5813	11.7781	0.51997	0.0:0.0:0.8245:0.1755	.	137;150	Q96TA1-2;Q96TA1	.;NIBL1_HUMAN	L	137;150	ENSP00000362411:P137L;ENSP00000362409:P150L	ENSP00000362409:P150L	P	-	2	0	FAM129B	129325919	1.000000	0.71417	1.000000	0.80357	0.779000	0.44077	6.129000	0.71657	2.551000	0.86045	0.561000	0.74099	CCC	FAM129B	-	pfscan_Pleckstrin_homology	ENSG00000136830		0.582	FAM129B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM129B	HGNC	protein_coding	OTTHUMT00000054196.1	-	0.00	39	0	G	NM_022833		130286098	-1	tier1	-	no_errors	ENST00000373312	ensembl	human	known	74_37	missense	55.00	9	11	SNP	1.000	A
FAM179B	23116	genome.wustl.edu	37	14	45542728	45542728	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr14:45542728G>C	ENST00000361577.3	+	19	5341	c.5127G>C	c.(5125-5127)gaG>gaC	p.E1709D	FAM179B_ENST00000361462.2_Missense_Mutation_p.E1762D|FAM179B_ENST00000382233.2_3'UTR	NM_015091.2	NP_055906.2	Q9Y4F4	F179B_HUMAN	family with sequence similarity 179, member B	1709										endometrium(4)|kidney(5)|large_intestine(12)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	45						AGAGTTTGGAGGAATTACTCG	0.338																																																	0													71.0	69.0	69.0					14																	45542728		2203	4300	6503	SO:0001583	missense	0			AB007883	CCDS9681.1	14q21.3	2008-07-21	2008-07-21	2008-07-21	ENSG00000198718	ENSG00000198718			19959	protein-coding gene	gene with protein product			"""KIAA0423"""	KIAA0423			Standard	XM_005267451		Approved		uc001wvv.3	Q9Y4F4	OTTHUMG00000140264	ENST00000361577.3:c.5127G>C	14.37:g.45542728G>C	ENSP00000355045:p.Glu1709Asp		Q68D66|Q6PG27	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.E1709D	ENST00000361577.3	37	c.5127	CCDS9681.1	14	.	.	.	.	.	.	.	.	.	.	G	15.72	2.918146	0.52546	.	.	ENSG00000198718	ENST00000361577;ENST00000361462;ENST00000556823	T;T;T	0.21543	2.0;2.0;2.0	5.78	0.928	0.19443	Armadillo-type fold (1);	0.106415	0.64402	D	0.000004	T	0.25827	0.0629	L	0.36672	1.1	0.80722	D	1	P;P	0.52316	0.694;0.952	B;P	0.53649	0.403;0.731	T	0.01312	-1.1388	10	0.72032	D	0.01	-18.3756	12.1981	0.54309	0.1755:0.0:0.8245:0.0	.	1762;1709	G3XAE9;Q9Y4F4	.;F179B_HUMAN	D	1709;1762;144	ENSP00000355045:E1709D;ENSP00000354917:E1762D;ENSP00000450465:E144D	ENSP00000354917:E1762D	E	+	3	2	FAM179B	44612478	0.992000	0.36948	0.998000	0.56505	0.979000	0.70002	0.268000	0.18571	-0.070000	0.12908	0.655000	0.94253	GAG	FAM179B	-	superfamily_ARM-type_fold	ENSG00000198718		0.338	FAM179B-001	KNOWN	basic|CCDS	protein_coding	FAM179B	HGNC	protein_coding	OTTHUMT00000276791.1	-	0.00	37	0	G	XM_113781		45542728	+1	tier1	-	no_errors	ENST00000361577	ensembl	human	known	74_37	missense	35.82	43	24	SNP	0.992	C
FAM19A5	25817	genome.wustl.edu	37	22	49103579	49103579	+	Missense_Mutation	SNP	G	G	T	rs201684030		TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr22:49103579G>T	ENST00000402357.1	+	3	446	c.313G>T	c.(313-315)Ggg>Tgg	p.G105W	FAM19A5_ENST00000358295.5_Missense_Mutation_p.G98W|FAM19A5_ENST00000473898.1_3'UTR|FAM19A5_ENST00000406880.1_Missense_Mutation_p.G26W	NM_001082967.1	NP_001076436.1	Q7Z5A7	F19A5_HUMAN	family with sequence similarity 19 (chemokine (C-C motif)-like), member A5	105						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				large_intestine(1)|lung(6)	7		all_cancers(38;2.95e-11)|all_epithelial(38;3.07e-10)|all_lung(38;2.89e-05)|Breast(42;0.000396)|Lung NSC(38;0.000471)|Ovarian(80;0.00934)|Lung SC(80;0.195)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0227)|BRCA - Breast invasive adenocarcinoma(115;0.119)		GTGTCTGGAGGGGGAAGGCTG	0.567																																																	0													84.0	91.0	88.0					22																	49103579		2125	4238	6363	SO:0001583	missense	0			AY325118	CCDS46728.1, CCDS46729.1	22q13.32	2005-09-20			ENSG00000219438	ENSG00000219438			21592	protein-coding gene	gene with protein product						15028294	Standard	NM_015381		Approved	TAFA-5	uc003bim.4	Q7Z5A7	OTTHUMG00000150308	ENST00000402357.1:c.313G>T	22.37:g.49103579G>T	ENSP00000383933:p.Gly105Trp		A6NII9|B0QZ13|B0QZ14|B0QZ15|O95902|Q5H9C4|Q6UWC9|Q8IXR8	Missense_Mutation	SNP	pfam_Chemokine-like_FAM19A2	p.G98W	ENST00000402357.1	37	c.292	CCDS46728.1	22	.	.	.	.	.	.	.	.	.	.	G	22.0	4.236003	0.79800	.	.	ENSG00000219438	ENST00000402357;ENST00000336769;ENST00000358295;ENST00000406880	.	.	.	4.45	4.45	0.53987	.	.	.	.	.	T	0.74473	0.3721	L	0.55990	1.75	0.42793	D	0.993909	D;D	0.89917	0.999;1.0	D;D	0.77004	0.989;0.975	T	0.78147	-0.2317	8	0.87932	D	0	.	14.9931	0.71406	0.0:0.0:1.0:0.0	.	98;105	Q7Z5A7-2;Q7Z5A7	.;F19A5_HUMAN	W	105;105;98;26	.	ENSP00000336812:G105W	G	+	1	0	FAM19A5	47489585	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	8.369000	0.90118	2.186000	0.69663	0.558000	0.71614	GGG	FAM19A5	-	pfam_Chemokine-like_FAM19A2	ENSG00000219438		0.567	FAM19A5-003	PUTATIVE	basic|CCDS	protein_coding	FAM19A5	HGNC	protein_coding	OTTHUMT00000317504.1		0.00	67	0	G	NM_015381		49103579	+1			no_errors	ENST00000358295	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	T
FAM43B	163933	genome.wustl.edu	37	1	20879570	20879570	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr1:20879570G>C	ENST00000332947.4	+	1	639	c.104G>C	c.(103-105)aGc>aCc	p.S35T		NM_207334.2	NP_997217.1	Q6ZT52	FA43B_HUMAN	family with sequence similarity 43, member B	35										large_intestine(1)|lung(2)	3		Colorectal(325;0.000147)|Renal(390;0.000469)|Lung NSC(340;0.00412)|all_lung(284;0.00419)|Breast(348;0.00979)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|COAD - Colon adenocarcinoma(152;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000132)|Kidney(64;0.00016)|GBM - Glioblastoma multiforme(114;0.000399)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.195)		CTGCTCTCCAGCTTCCTGCGC	0.657																																																	0													39.0	40.0	40.0					1																	20879570		2203	4300	6503	SO:0001583	missense	0			AK126900	CCDS209.1	1p36.12	2014-08-14			ENSG00000183114	ENSG00000183114			31791	protein-coding gene	gene with protein product						21461611	Standard	NM_207334		Approved	FLJ44952	uc001bdj.3	Q6ZT52	OTTHUMG00000057491	ENST00000332947.4:c.104G>C	1.37:g.20879570G>C	ENSP00000331397:p.Ser35Thr		A5PKT8|A5PL01	Missense_Mutation	SNP	smart_PTB/PI_dom	p.S35T	ENST00000332947.4	37	c.104	CCDS209.1	1	.	.	.	.	.	.	.	.	.	.	G	13.21	2.169596	0.38315	.	.	ENSG00000183114	ENST00000332947	.	.	.	4.17	3.22	0.36961	.	0.233857	0.34223	U	0.004147	T	0.25082	0.0609	N	0.16656	0.425	0.29507	N	0.854521	B	0.10296	0.003	B	0.12156	0.007	T	0.12372	-1.0550	9	0.38643	T	0.18	-7.6016	9.493	0.38971	0.0:0.4255:0.5745:0.0	.	35	Q6ZT52	FA43B_HUMAN	T	35	.	ENSP00000331397:S35T	S	+	2	0	FAM43B	20752157	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.821000	0.62679	1.875000	0.54330	0.455000	0.32223	AGC	FAM43B	-	NULL	ENSG00000183114		0.657	FAM43B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM43B	HGNC	protein_coding	OTTHUMT00000127759.1	-	0.00	44	0	G	NM_207334		20879570	+1	tier1	-	no_errors	ENST00000332947	ensembl	human	known	74_37	missense	40.00	15	10	SNP	1.000	C
FAM83G	644815	genome.wustl.edu	37	17	18874831	18874831	+	Silent	SNP	G	G	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr17:18874831G>A	ENST00000388995.6	-	6	2536	c.2313C>T	c.(2311-2313)acC>acT	p.T771T	SLC5A10_ENST00000395643.2_Intron|SLC5A10_ENST00000395642.1_Intron|SLC5A10_ENST00000417251.2_Intron|FAM83G_ENST00000345041.4_Silent_p.T771T|SLC5A10_ENST00000395647.2_Intron|FAM83G_ENST00000585154.2_Silent_p.T771T|SLC5A10_ENST00000317977.6_Intron|SLC5A10_ENST00000395645.3_Intron			A6ND36	FA83G_HUMAN	family with sequence similarity 83, member G	771					BMP signaling pathway (GO:0030509)	cytosol (GO:0005829)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(3)|stomach(1)	22						CCCTGCCATCGGTCATGGGGC	0.647																																																	0													85.0	95.0	92.0					17																	18874831		1984	4151	6135	SO:0001819	synonymous_variant	0			AK123558	CCDS42276.1	17p11.2	2014-05-01	2006-03-22		ENSG00000188522	ENSG00000188522			32554	protein-coding gene	gene with protein product	"""protein associated with SMAD1"""	615886				24554596	Standard	NM_001039999		Approved	FLJ41564, PAWS1	uc002guw.3	A6ND36	OTTHUMG00000059411	ENST00000388995.6:c.2313C>T	17.37:g.18874831G>A			Q3KQZ4|Q6ZW60	Silent	SNP	pfam_DUF1669	p.T771	ENST00000388995.6	37	c.2313	CCDS42276.1	17																																																																																			FAM83G	-	NULL	ENSG00000188522		0.647	FAM83G-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FAM83G	HGNC	protein_coding	OTTHUMT00000253108.4	-	0.00	119	0	G			18874831	-1	tier1	-	no_errors	ENST00000345041	ensembl	human	known	74_37	silent	62.50	48	80	SNP	0.135	A
FBLN2	2199	genome.wustl.edu	37	3	13670421	13670421	+	Silent	SNP	G	G	A	rs370055863		TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr3:13670421G>A	ENST00000295760.7	+	11	2514	c.2445G>A	c.(2443-2445)acG>acA	p.T815T	FBLN2_ENST00000404922.3_Silent_p.T862T|FBLN2_ENST00000492059.1_Silent_p.T862T|FBLN2_ENST00000535798.1_Silent_p.T841T	NM_001998.2	NP_001989.2	P98095	FBLN2_HUMAN	fibulin 2	815	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			ACGAGTGCACGTCACTGTCCG	0.662																																																	0								G	,,	1,4349		0,1,2174	37.0	42.0	40.0		2586,2586,2445	-10.2	0.0	3		40	0,8570		0,0,4285	no	coding-synonymous,coding-synonymous,coding-synonymous	FBLN2	NM_001004019.1,NM_001165035.1,NM_001998.2	,,	0,1,6459	AA,AG,GG		0.0,0.023,0.0077	,,	862/1232,862/1232,815/1185	13670421	1,12919	2175	4285	6460	SO:0001819	synonymous_variant	0			X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520		"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821				7806230	Standard	NM_001165035		Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000295760.7:c.2445G>A	3.37:g.13670421G>A			B7Z9C5|Q8IUI0|Q8IUI1	Silent	SNP	pfam_EGF-like_Ca-bd_dom,pfam_Anaphylatoxin/fibulin,superfamily_Anaphylatoxin_comp_syst,smart_EG-like_dom,smart_Anaphylatoxin/fibulin,smart_EGF-like_Ca-bd_dom,pfscan_Anaphylatoxin/fibulin,pfscan_EG-like_dom	p.T862	ENST00000295760.7	37	c.2586	CCDS46762.1	3																																																																																			FBLN2	-	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom	ENSG00000163520		0.662	FBLN2-002	KNOWN	basic|CCDS	protein_coding	FBLN2	HGNC	protein_coding	OTTHUMT00000340083.3	-	0.00	73	0	G	NM_001004019		13670421	+1	tier1	-	no_errors	ENST00000404922	ensembl	human	known	74_37	silent	36.25	51	29	SNP	0.002	A
FCAMR	83953	genome.wustl.edu	37	1	207139152	207139152	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr1:207139152T>C	ENST00000324852.4	-	4	695	c.221A>G	c.(220-222)gAg>gGg	p.E74G	FCAMR_ENST00000450945.2_Missense_Mutation_p.E74G|FCAMR_ENST00000400962.3_Missense_Mutation_p.E74G	NM_001170631.1	NP_001164102.1	Q8WWV6	FCAMR_HUMAN	Fc receptor, IgA, IgM, high affinity	29	Ig-like V-type.				immune system process (GO:0002376)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|skin(1)|stomach(1)	11						GAGAGAGCCCTCCCACAGCCA	0.602																																					Ovarian(199;1883 2142 16966 44409 45154)												0													43.0	45.0	44.0					1																	207139152		1568	3582	5150	SO:0001583	missense	0			AF354295	CCDS41460.1, CCDS53468.1	1q32.1	2013-01-14			ENSG00000162897	ENSG00000162897		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	24692	protein-coding gene	gene with protein product		605484				11779189	Standard	NM_001122979		Approved	FKSG87, FCA/MR, CD351	uc001hfa.4	Q8WWV6	OTTHUMG00000036579	ENST00000324852.4:c.221A>G	1.37:g.207139152T>C	ENSP00000316491:p.Glu74Gly		Q32M82|Q8WWV5|Q96SA2	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	p.E74G	ENST00000324852.4	37	c.221	CCDS53468.1	1	.	.	.	.	.	.	.	.	.	.	T	10.91	1.483694	0.26598	.	.	ENSG00000162897	ENST00000400962;ENST00000324852;ENST00000450945;ENST00000367087	T;T;T	0.08720	3.06;3.35;3.06	3.04	-6.09	0.02145	.	2.861610	0.01895	N	0.038849	T	0.06872	0.0175	L	0.36672	1.1	0.09310	N	1	B;B;B;B	0.18610	0.008;0.0;0.029;0.004	B;B;B;B	0.16289	0.007;0.0;0.015;0.005	T	0.26573	-1.0099	10	0.33940	T	0.23	6.0778	6.2398	0.20785	0.1936:0.0:0.1675:0.6389	.	29;49;29;29	Q8WWV6-4;D2KTA8;Q8WWV6-2;Q8WWV6	.;.;.;FCAMR_HUMAN	G	74;74;74;50	ENSP00000383746:E74G;ENSP00000316491:E74G;ENSP00000392707:E74G	ENSP00000316491:E74G	E	-	2	0	FCAMR	205205775	0.000000	0.05858	0.000000	0.03702	0.381000	0.30169	-1.726000	0.01861	-1.834000	0.01193	0.528000	0.53228	GAG	FCAMR	-	NULL	ENSG00000162897		0.602	FCAMR-002	NOVEL	basic|appris_principal|CCDS	protein_coding	FCAMR	HGNC	protein_coding	OTTHUMT00000088969.2	-	0.00	108	0	T	NM_032029		207139152	-1	tier1	-	no_errors	ENST00000400962	ensembl	human	known	74_37	missense	67.35	32	66	SNP	0.000	C
FIG4	9896	genome.wustl.edu	37	6	110112640	110112640	+	Frame_Shift_Del	DEL	C	C	-			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr6:110112640delC	ENST00000230124.3	+	20	2366	c.2242delC	c.(2242-2244)cccfs	p.P749fs	FIG4_ENST00000441478.2_Frame_Shift_Del_p.P472fs	NM_014845.5	NP_055660.1	Q92562	FIG4_HUMAN	FIG4 phosphoinositide 5-phosphatase	749	Poly-Pro.				cell death (GO:0008219)|locomotory behavior (GO:0007626)|myelin assembly (GO:0032288)|negative regulation of myelination (GO:0031642)|neuron development (GO:0048666)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of neuron projection development (GO:0010976)|small molecule metabolic process (GO:0044281)|vacuole organization (GO:0007033)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)	phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphatidylinositol-4-phosphate phosphatase activity (GO:0043812)			central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)	32		all_cancers(87;8.63e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000124)|all_lung(197;0.0187)|Colorectal(196;0.0492)|Lung SC(18;0.0548)		OV - Ovarian serous cystadenocarcinoma(136;0.0355)|Epithelial(106;0.038)|all cancers(137;0.0425)|BRCA - Breast invasive adenocarcinoma(108;0.079)		CGCCCCGCCGCCCCCCAGCGA	0.517																																																	0													59.0	69.0	66.0					6																	110112640		2203	4300	6503	SO:0001589	frameshift_variant	0			D87464	CCDS5078.1	6q21	2014-09-17	2014-08-04	2007-07-30	ENSG00000112367	ENSG00000112367			16873	protein-coding gene	gene with protein product		609390	"""KIAA0274"", ""FIG4 homolog (S. cerevisiae)"", ""FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae)"""	KIAA0274		9039502, 11274189, 17572665	Standard	NM_014845		Approved	SAC3, hSac3, dJ249I4.1, ALS11, CMT4J	uc003ptt.2	Q92562	OTTHUMG00000015352	ENST00000230124.3:c.2242delC	6.37:g.110112640delC	ENSP00000230124:p.Pro749fs		Q53H49|Q5TCS6	Frame_Shift_Del	DEL	pfam_Syja_N,pfscan_Syja_N	p.S750fs	ENST00000230124.3	37	c.2242	CCDS5078.1	6																																																																																			FIG4	-	NULL	ENSG00000112367		0.517	FIG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FIG4	HGNC	protein_coding	OTTHUMT00000041768.1		0.00	53	0	C	NM_014845		110112640	+1	tier1		no_errors	ENST00000230124	ensembl	human	known	74_37	frame_shift_del	5.13	37	2	DEL	0.999	-
FN1	2335	genome.wustl.edu	37	2	216269251	216269251	+	Silent	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr2:216269251C>T	ENST00000359671.1	-	20	3379	c.3114G>A	c.(3112-3114)caG>caA	p.Q1038Q	FN1_ENST00000354785.4_Silent_p.Q1038Q|FN1_ENST00000443816.1_Silent_p.Q1038Q|FN1_ENST00000432072.2_Silent_p.Q1038Q|FN1_ENST00000446046.1_Silent_p.Q1038Q|FN1_ENST00000356005.4_Silent_p.Q1038Q|FN1_ENST00000323926.6_Silent_p.Q1038Q|FN1_ENST00000346544.3_Silent_p.Q1038Q|FN1_ENST00000357009.2_Silent_p.Q1038Q|FN1_ENST00000345488.5_Silent_p.Q1038Q|FN1_ENST00000357867.4_Silent_p.Q1038Q|FN1_ENST00000421182.1_Silent_p.Q1038Q|FN1_ENST00000336916.4_Silent_p.Q1038Q			P02751	FINC_HUMAN	fibronectin 1	1038	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316, ECO:0000255|PROSITE-ProRule:PRU00478, ECO:0000255|PROSITE-ProRule:PRU00479}.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	ACTGCCTGGGCTGTCCTCTTC	0.547																																																	0													113.0	101.0	105.0					2																	216269251		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.3114G>A	2.37:g.216269251C>T			B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Silent	SNP	pfam_Fibronectin_type3,pfam_Fibronectin_type1,pfam_FN_type2_col-bd,superfamily_Kringle-like,superfamily_Fibronectin_type3,smart_Fibronectin_type1,smart_FN_type2_col-bd,smart_Fibronectin_type3,pfscan_Fibronectin_type1,pfscan_FN_type2_col-bd,pfscan_Fibronectin_type3	p.Q1038	ENST00000359671.1	37	c.3114		2																																																																																			FN1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000115414		0.547	FN1-204	KNOWN	basic	protein_coding	FN1	HGNC	protein_coding			0.00	88	0	C	NM_212476		216269251	-1			no_errors	ENST00000354785	ensembl	human	known	74_37	silent	5.06	75	4	SNP	0.988	T
FOXE1	2304	genome.wustl.edu	37	9	100616701	100616706	+	In_Frame_Del	DEL	GCCGCC	GCCGCC	-	rs371516340|rs565664344|rs71369530	byFrequency	TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	GCCGCC	GCCGCC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr9:100616701_100616706delGCCGCC	ENST00000375123.3	+	1	1166_1171	c.505_510delGCCGCC	c.(505-510)gccgccdel	p.AA177del		NM_004473.3	NP_004464.2	O00358	FOXE1_HUMAN	forkhead box E1 (thyroid transcription factor 2)	177	Ala-rich.|Poly-Ala.				anatomical structure morphogenesis (GO:0009653)|cell migration (GO:0016477)|embryonic organ morphogenesis (GO:0048562)|hair follicle morphogenesis (GO:0031069)|hard palate development (GO:0060022)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pharynx development (GO:0060465)|positive regulation of transcription, DNA-templated (GO:0045893)|soft palate development (GO:0060023)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|lung(2)|upper_aerodigestive_tract(1)	5		Acute lymphoblastic leukemia(62;0.158)				Ggctgccgcagccgccgccgccgccg	0.767																																																	0																																										SO:0001651	inframe_deletion	0			U89995	CCDS35078.1	9q22	2008-09-05			ENSG00000178919	ENSG00000178919		"""Forkhead boxes"""	3806	protein-coding gene	gene with protein product		602617	"""forkhead box E2"""	FKHL15, TITF2, FOXE2		9169137, 9697705	Standard	NM_004473		Approved	TTF-2, HFKH4	uc004axu.3	O00358	OTTHUMG00000020333	ENST00000375123.3:c.505_510delGCCGCC	9.37:g.100616707_100616712delGCCGCC	ENSP00000364265:p.Ala177_Ala178del		O75765|Q5T109|Q99526	In_Frame_Del	DEL	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.AA172in_frame_del	ENST00000375123.3	37	c.505_510	CCDS35078.1	9																																																																																			FOXE1	-	NULL	ENSG00000178919		0.767	FOXE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXE1	HGNC	protein_coding	OTTHUMT00000053341.1		0.00	9	0	GCCGCC			100616706	+1			no_errors	ENST00000375123	ensembl	human	known	74_37	in_frame_del	30.00	7	3	DEL	0.602:0.620:0.614:0.750:0.779:0.753	0
FOXG1	2290	genome.wustl.edu	37	14	29237879	29237879	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr14:29237879C>T	ENST00000313071.4	+	1	1593	c.1394C>T	c.(1393-1395)aCg>aTg	p.T465M	FOXG1_ENST00000382535.3_Missense_Mutation_p.T465M	NM_005249.4	NP_005240.3	P55316	FOXG1_HUMAN	forkhead box G1	465					aging (GO:0007568)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|dorsal/ventral pattern formation (GO:0009953)|inner ear morphogenesis (GO:0042472)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron fate determination (GO:0048664)|positive regulation of cell cycle (GO:0045787)|positive regulation of neuroblast proliferation (GO:0002052)|pyramidal neuron migration (GO:0021852)|regulation of mitotic cell cycle (GO:0007346)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T465M(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(2)	43			LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)		AGTTTTACGACGGGACTGTCT	0.542																																																	1	Substitution - Missense(1)	endometrium(1)											86.0	85.0	86.0					14																	29237879		2203	4300	6503	SO:0001583	missense	0				CCDS9636.1	14q11-q13	2007-10-05	2007-05-16	2007-05-16	ENSG00000176165	ENSG00000176165		"""Forkhead boxes"""	3811	protein-coding gene	gene with protein product		164874	"""forkhead box G1B"", ""forkhead box G1C"", ""forkhead box G1A"""	FKHL2, FOXG1B, FKHL4, FKH2, FKHL1, FOXG1C, FKHL3, FOXG1A		7959731, 17260156	Standard	NM_005249		Approved	HFK2, QIN, BF1, HFK1, HFK3, HBF-3	uc001wqe.4	P55316	OTTHUMG00000140187	ENST00000313071.4:c.1394C>T	14.37:g.29237879C>T	ENSP00000339004:p.Thr465Met		A6NFY2|P55315|Q14488|Q86XT7	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.T465M	ENST00000313071.4	37	c.1394	CCDS9636.1	14	.	.	.	.	.	.	.	.	.	.	C	15.93	2.979189	0.53827	.	.	ENSG00000176165	ENST00000382535;ENST00000313071	D;D	0.94184	-3.37;-3.37	4.14	4.14	0.48551	.	0.135902	0.49305	U	0.000141	D	0.88385	0.6422	N	0.08118	0	0.45621	D	0.998552	D	0.61080	0.989	P	0.47470	0.548	D	0.91427	0.5163	10	0.87932	D	0	.	16.7792	0.85559	0.0:1.0:0.0:0.0	.	465	P55316	FOXG1_HUMAN	M	465	ENSP00000371975:T465M;ENSP00000339004:T465M	ENSP00000339004:T465M	T	+	2	0	FOXG1	28307630	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.293000	0.78740	2.006000	0.58801	0.491000	0.48974	ACG	FOXG1	-	NULL	ENSG00000176165		0.542	FOXG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXG1	HGNC	protein_coding	OTTHUMT00000276559.3	-	0.00	83	0	C			29237879	+1	tier1	-	no_errors	ENST00000313071	ensembl	human	known	74_37	missense	9.01	100	10	SNP	1.000	T
FRAT1	10023	genome.wustl.edu	37	10	99079857	99079857	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr10:99079857C>T	ENST00000371021.3	+	1	836	c.647C>T	c.(646-648)gCc>gTc	p.A216V		NM_005479.3	NP_005470.2	Q92837	FRAT1_HUMAN	frequently rearranged in advanced T-cell lymphomas 1	216	Involved in GSK-3 binding.				embryonic axis specification (GO:0000578)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)				prostate(1)	1		Colorectal(252;0.0846)		Epithelial(162;2.76e-09)|all cancers(201;1.57e-07)		ATCAAGGAGGCCGTGCGAAGG	0.647																																																	0													22.0	25.0	24.0					10																	99079857		2200	4299	6499	SO:0001583	missense	0			U58975	CCDS7455.1	10q24.1	2014-05-09	2014-05-09		ENSG00000165879	ENSG00000165879			3944	protein-coding gene	gene with protein product		602503	"""frequently rearranged in advanced T-cell lymphomas"""			9034327	Standard	NM_005479		Approved		uc001knc.1	Q92837	OTTHUMG00000018848	ENST00000371021.3:c.647C>T	10.37:g.99079857C>T	ENSP00000360060:p.Ala216Val		Q5JTI1|Q8NE74|Q8TDW9	Missense_Mutation	SNP	pfam_GSK3-bd	p.A216V	ENST00000371021.3	37	c.647	CCDS7455.1	10	.	.	.	.	.	.	.	.	.	.	C	28.1	4.890011	0.91889	.	.	ENSG00000165879	ENST00000371021	.	.	.	3.6	3.6	0.41247	.	0.000000	0.64402	U	0.000008	T	0.74869	0.3773	M	0.62723	1.935	0.50039	D	0.999848	D	0.89917	1.0	D	0.87578	0.998	T	0.78257	-0.2274	9	0.87932	D	0	-14.1043	13.0827	0.59123	0.0:1.0:0.0:0.0	.	216	Q92837	FRAT1_HUMAN	V	216	.	ENSP00000360060:A216V	A	+	2	0	FRAT1	99069847	0.998000	0.40836	0.916000	0.36221	0.974000	0.67602	4.064000	0.57506	2.001000	0.58596	0.484000	0.47621	GCC	FRAT1	-	pfam_GSK3-bd	ENSG00000165879		0.647	FRAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRAT1	HGNC	protein_coding	OTTHUMT00000049673.1	-	0.00	58	0	C	NM_005479		99079857	+1	tier1	-	no_errors	ENST00000371021	ensembl	human	known	74_37	missense	17.91	54	12	SNP	0.989	T
FRMD1	79981	genome.wustl.edu	37	6	168461507	168461507	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr6:168461507C>T	ENST00000283309.6	-	9	1340	c.1276G>A	c.(1276-1278)Gag>Aag	p.E426K	FRMD1_ENST00000537786.1_Missense_Mutation_p.E197K|FRMD1_ENST00000432403.1_5'UTR|FRMD1_ENST00000440994.2_Missense_Mutation_p.E358K	NM_024919.3	NP_079195.3	Q8N878	FRMD1_HUMAN	FERM domain containing 1	426						cytoskeleton (GO:0005856)				endometrium(3)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	19		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		GGCTCCTTCTCATGGAGCCCG	0.652																																					GBM(50;8 1094 9538 34399)|Ovarian(80;676 1857 8675 49015)												0													43.0	40.0	41.0					6																	168461507		2203	4300	6503	SO:0001583	missense	0				CCDS5306.1, CCDS47518.1	6q27	2008-10-23			ENSG00000153303	ENSG00000153303			21240	protein-coding gene	gene with protein product							Standard	NM_001122841		Approved	FLJ00181, DKFZp434O0117, FLJ40260, FLJ22615, bA164L23.1	uc003qwo.4	Q8N878	OTTHUMG00000016037	ENST00000283309.6:c.1276G>A	6.37:g.168461507C>T	ENSP00000283309:p.Glu426Lys		B2RNV8|B3KUM6|Q5SZU7|Q9UFB0	Missense_Mutation	SNP	pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	p.E426K	ENST00000283309.6	37	c.1276	CCDS5306.1	6	.	.	.	.	.	.	.	.	.	.	C	9.055	0.993021	0.19043	.	.	ENSG00000153303	ENST00000283309;ENST00000440994;ENST00000537786	T;T;T	0.41400	1.0;1.0;1.0	2.48	1.59	0.23543	.	3.986040	0.01554	U	0.019796	T	0.12732	0.0309	L	0.36672	1.1	0.09310	N	1	B;B;B;B	0.33266	0.032;0.404;0.366;0.155	B;B;B;B	0.30401	0.013;0.096;0.115;0.084	T	0.09662	-1.0664	10	0.30854	T	0.27	.	3.0334	0.06113	0.0:0.3782:0.2254:0.3964	.	361;426;358;321	B7Z8G9;Q8N878;Q8N878-2;Q5SZU5	.;FRMD1_HUMAN;.;.	K	426;358;197	ENSP00000283309:E426K;ENSP00000414115:E358K;ENSP00000440078:E197K	ENSP00000283309:E426K	E	-	1	0	FRMD1	168204356	0.000000	0.05858	0.000000	0.03702	0.094000	0.18550	-0.572000	0.05881	0.382000	0.24878	0.313000	0.20887	GAG	FRMD1	-	NULL	ENSG00000153303		0.652	FRMD1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMD1	HGNC	protein_coding	OTTHUMT00000362513.2	-	0.00	63	0	C	NM_024919		168461507	-1	tier1	-	no_errors	ENST00000283309	ensembl	human	known	74_37	missense	37.18	49	29	SNP	0.001	T
FXR1	8087	genome.wustl.edu	37	3	180666281	180666281	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr3:180666281G>T	ENST00000357559.4	+	5	801	c.417G>T	c.(415-417)gaG>gaT	p.E139D	FXR1_ENST00000445140.2_Missense_Mutation_p.E139D|FXR1_ENST00000491062.1_Missense_Mutation_p.E90D|FXR1_ENST00000468861.1_Missense_Mutation_p.E54D|FXR1_ENST00000480918.1_Missense_Mutation_p.E126D|FXR1_ENST00000305586.7_Missense_Mutation_p.E54D	NM_001013438.2|NM_005087.3	NP_001013456.1|NP_005078.2	P51114	FXR1_HUMAN	fragile X mental retardation, autosomal homolog 1	139					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|negative regulation of translation (GO:0017148)	costamere (GO:0043034)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysome (GO:0005844)	G-quadruplex RNA binding (GO:0002151)|mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|endometrium(4)|large_intestine(5)|lung(12)|skin(2)	26	all_cancers(143;6.07e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.4e-22)			ATTTGAGAGAGGCGTGAGTAA	0.343																																																	0													57.0	60.0	59.0					3																	180666281		2194	4296	6490	SO:0001583	missense	0			M67468	CCDS3238.1, CCDS33894.1, CCDS46965.1	3q28	2014-01-28			ENSG00000114416	ENSG00000114416			4023	protein-coding gene	gene with protein product		600819				7781595, 9642279	Standard	NM_005087		Approved		uc003fkq.3	P51114	OTTHUMG00000158138	ENST00000357559.4:c.417G>T	3.37:g.180666281G>T	ENSP00000350170:p.Glu139Asp		A8K9B8|Q7Z450|Q8N6R8	Missense_Mutation	SNP	pfam_Frag_X_MRP_fam,pfam_KH_dom_type_1,pfam_Agenet-like_dom,superfamily_NA-bd_OB-fold,smart_KH_dom,pfscan_KH_dom_type_1	p.E139D	ENST00000357559.4	37	c.417	CCDS3238.1	3	.	.	.	.	.	.	.	.	.	.	G	11.88	1.770751	0.31320	.	.	ENSG00000114416	ENST00000469882;ENST00000484790;ENST00000465551;ENST00000357559;ENST00000305586;ENST00000491062;ENST00000468861;ENST00000445140;ENST00000484958;ENST00000480918;ENST00000484042	T;T;T;T;T;T;T;T;T;T;T	0.50277	0.82;0.75;0.8;1.85;1.66;1.19;1.17;1.2;0.83;1.69;0.8	5.98	4.89	0.63831	.	0.152638	0.64402	D	0.000018	T	0.30759	0.0775	L	0.31207	0.915	0.43564	D	0.99588	B;B;B;B;B;B	0.13594	0.0;0.001;0.004;0.001;0.008;0.0	B;B;B;B;B;B	0.19666	0.002;0.004;0.012;0.002;0.026;0.001	T	0.23619	-1.0183	10	0.41790	T	0.15	-28.2355	2.0195	0.03505	0.1979:0.1347:0.51:0.1574	.	126;90;54;54;139;139	B4DXZ6;E9PFF5;E7EU85;E7ERF5;P51114-2;P51114	.;.;.;.;.;FXR1_HUMAN	D	54;54;54;139;54;90;54;139;54;126;143	ENSP00000419793:E54D;ENSP00000417125:E54D;ENSP00000418724:E54D;ENSP00000350170:E139D;ENSP00000307633:E54D;ENSP00000420643:E90D;ENSP00000420515:E54D;ENSP00000388828:E139D;ENSP00000419933:E54D;ENSP00000418097:E126D;ENSP00000417513:E143D	ENSP00000307633:E54D	E	+	3	2	FXR1	182148975	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.300000	0.33436	1.189000	0.43028	0.650000	0.86243	GAG	FXR1	-	NULL	ENSG00000114416		0.343	FXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FXR1	HGNC	protein_coding	OTTHUMT00000350265.5		0.00	23	0	G			180666281	+1			no_errors	ENST00000357559	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	T
GAS6	2621	genome.wustl.edu	37	13	114541138	114541138	+	Missense_Mutation	SNP	C	C	A	rs376538659		TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr13:114541138C>A	ENST00000327773.6	-	6	639	c.493G>T	c.(493-495)Ggg>Tgg	p.G165W	GAS6_ENST00000450766.1_5'Flank|GAS6_ENST00000355761.4_Missense_Mutation_p.G111W|GAS6-AS1_ENST00000458001.1_RNA|GAS6_ENST00000357389.3_Missense_Mutation_p.G165W	NM_000820.2	NP_000811.1	Q14393	GAS6_HUMAN	growth arrest-specific 6	165	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				activation of protein kinase B activity (GO:0032148)|apoptotic cell clearance (GO:0043277)|B cell chemotaxis (GO:0035754)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-substrate adhesion (GO:0031589)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|cellular response to growth factor stimulus (GO:0071363)|cellular response to interferon-alpha (GO:0035457)|cellular response to starvation (GO:0009267)|cellular response to vitamin K (GO:0071307)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|extracellular matrix assembly (GO:0085029)|fusion of virus membrane with host plasma membrane (GO:0019064)|hematopoietic stem cell migration to bone marrow (GO:0097241)|leukocyte migration (GO:0050900)|macrophage cytokine production (GO:0010934)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biomineral tissue development (GO:0070168)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-6 secretion (GO:1900165)|negative regulation of oligodendrocyte apoptotic process (GO:1900142)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of renal albumin absorption (GO:2000533)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|peptidyl-glutamic acid carboxylation (GO:0017187)|peptidyl-serine phosphorylation (GO:0018105)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of gene expression (GO:0010628)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phagocytosis (GO:0050766)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of TOR signaling (GO:0032008)|post-translational protein modification (GO:0043687)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|protein targeting to plasma membrane (GO:0072661)|proteolysis (GO:0006508)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|viral entry into host cell (GO:0046718)|viral genome replication (GO:0019079)	cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|platelet alpha granule lumen (GO:0031093)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|phosphatidylserine binding (GO:0001786)|protein tyrosine kinase activator activity (GO:0030296)|receptor agonist activity (GO:0048018)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|voltage-gated calcium channel activity (GO:0005245)			central_nervous_system(4)|ovary(1)	5	Lung NSC(43;0.00976)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0176)|all_epithelial(44;0.0104)|all_lung(25;0.0249)|Lung NSC(25;0.0908)|Breast(118;0.188)				AGGCAGCCCCCGTTCTCCTGG	0.602																																																	0													101.0	93.0	96.0					13																	114541138		2203	4300	6503	SO:0001583	missense	0				CCDS45072.1	13q34	2008-07-18			ENSG00000183087	ENSG00000183087			4168	protein-coding gene	gene with protein product	"""AXL stimulatory factor"""	600441		AXLLG		8336730	Standard	NM_000820		Approved	AXSF, FLJ34709, DKFZp666G247	uc001vud.3	Q14393	OTTHUMG00000017395	ENST00000327773.6:c.493G>T	13.37:g.114541138C>A	ENSP00000331831:p.Gly165Trp		B3KRQ7|B3KVL4|E9PBL7|Q6IMN1|Q7Z7N3	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF-like_Ca-bd_dom,pfam_GLA_domain,superfamily_ConA-like_lec_gl_sf,superfamily_GLA_domain,smart_GLA_domain,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_GLA_domain,pfscan_Laminin_G,prints_GLA_domain	p.G165W	ENST00000327773.6	37	c.493	CCDS45072.1	13	.	.	.	.	.	.	.	.	.	.	c	17.55	3.417118	0.62511	.	.	ENSG00000183087	ENST00000357389;ENST00000355761;ENST00000327773	D;D;D	0.98493	-4.96;-4.96;-4.96	4.99	4.99	0.66335	.	.	.	.	.	D	0.99492	0.9819	H	0.99074	4.42	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97828	1.0261	9	0.87932	D	0	-44.5122	18.2836	0.90107	0.0:1.0:0.0:0.0	.	165	Q14393-2	.	W	165;111;165	ENSP00000349962:G165W;ENSP00000348003:G111W;ENSP00000331831:G165W	ENSP00000331831:G165W	G	-	1	0	GAS6	113572805	0.991000	0.36638	0.865000	0.33974	0.316000	0.28119	3.722000	0.54948	2.305000	0.77605	0.486000	0.48141	GGG	GAS6	-	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000183087		0.602	GAS6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GAS6	HGNC	protein_coding	OTTHUMT00000045946.2	-	0.00	115	0	C	NM_000820		114541138	-1	tier1	-	no_errors	ENST00000357389	ensembl	human	known	74_37	missense	54.00	46	54	SNP	0.999	A
GAS7	8522	genome.wustl.edu	37	17	9846480	9846480	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr17:9846480C>T	ENST00000432992.2	-	7	849	c.689G>A	c.(688-690)gGc>gAc	p.G230D	GAS7_ENST00000578655.1_5'Flank|GAS7_ENST00000583882.1_Intron|GAS7_ENST00000437099.2_Missense_Mutation_p.G166D|GAS7_ENST00000585266.1_Missense_Mutation_p.G170D|GAS7_ENST00000323816.4_Missense_Mutation_p.G170D|GAS7_ENST00000396115.2_Intron|GAS7_ENST00000540214.1_Intron|GAS7_ENST00000580865.1_Missense_Mutation_p.G90D|GAS7_ENST00000542249.1_Missense_Mutation_p.G166D|GAS7_ENST00000579158.1_Missense_Mutation_p.G166D	NM_201433.1	NP_958839.1	O60861	GAS7_HUMAN	growth arrest-specific 7	230	FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.				actin filament bundle assembly (GO:0051017)|actin filament polymerization (GO:0030041)|cell cycle arrest (GO:0007050)|neuron projection morphogenesis (GO:0048812)|regulation of cell shape (GO:0008360)|regulation of transcription, DNA-templated (GO:0006355)	actin filament (GO:0005884)|cytoplasm (GO:0005737)|ruffle (GO:0001726)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(7)|lung(18)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	39						CATTTGTTTGCCCTTCAGCTG	0.577			T	MLL	AML*																																			Dom	yes		17	17p	8522	growth arrest-specific 7		L	0													187.0	166.0	173.0					17																	9846480		2203	4300	6503	SO:0001583	missense	0			AB007854	CCDS11152.1, CCDS42263.1, CCDS45611.1, CCDS58518.1	17p13.1	2004-02-18							4169	protein-coding gene	gene with protein product		603127				9736752	Standard	NM_001130831		Approved	KIAA0394, MGC1348	uc002gmg.1	O60861		ENST00000432992.2:c.689G>A	17.37:g.9846480C>T	ENSP00000407552:p.Gly230Asp		A8KAC2|B2RCK9|O43144|Q53Y77|Q7Z571	Missense_Mutation	SNP	pfam_FCH_dom,pfam_WW_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_WW_dom,smart_SH3_domain,smart_WW_dom,smart_FCH_dom,pfscan_FCH_dom,pfscan_SH3_domain,pfscan_WW_dom	p.G230D	ENST00000432992.2	37	c.689	CCDS11152.1	17	.	.	.	.	.	.	.	.	.	.	C	32	5.133687	0.94517	.	.	ENSG00000007237	ENST00000323816;ENST00000396115;ENST00000437099;ENST00000432992;ENST00000537970;ENST00000541114	T	0.23147	1.92	5.36	5.36	0.76844	Fps/Fes/Fer/CIP4 homology (3);	0.000000	0.64402	D	0.000001	T	0.56978	0.2022	M	0.85373	2.75	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.81914	0.989;0.995;0.98;0.995	T	0.60627	-0.7226	9	.	.	.	-0.3862	18.2231	0.89907	0.0:1.0:0.0:0.0	.	182;170;90;230	B7Z2L1;A8KAC2;O60861-2;O60861	.;.;.;GAS7_HUMAN	D	230;170;169;90;170;44	ENSP00000379421:G170D	.	G	-	2	0	GAS7	9787205	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.095000	0.76952	2.676000	0.91093	0.655000	0.94253	GGC	GAS7	-	pfam_FCH_dom,smart_FCH_dom,pfscan_FCH_dom	ENSG00000007237		0.577	GAS7-017	KNOWN	basic|appris_principal|CCDS	protein_coding	GAS7	HGNC	protein_coding	OTTHUMT00000439883.1	-	0.00	58	0	C	NM_003644, NM_201432, NM_201433		9846480	-1	tier1	-	no_errors	ENST00000432992	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	T
GBP1P1	400759	genome.wustl.edu	37	1	89886764	89886764	+	RNA	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr1:89886764C>T	ENST00000513638.1	+	0	542					NR_003133.2				guanylate binding protein 1, interferon-inducible pseudogene 1																		CCTTTGTGACCCAGAACAGCA	0.478																																																	0																																												0					1p22.2	2011-03-09			ENSG00000225492	ENSG00000225492			39561	pseudogene	pseudogene							Standard	NR_003133		Approved		uc009wcy.1		OTTHUMG00000010128		1.37:g.89886764C>T				RNA	SNP	-	NULL	ENST00000513638.1	37	NULL		1																																																																																			GBP1P1	-	-	ENSG00000225492		0.478	GBP1P1-002	KNOWN	basic	processed_transcript	GBP1P1	HGNC	pseudogene	OTTHUMT00000360073.1	-	0.00	129	0	C	NR_003133		89886764	+1	tier1	-	no_errors	ENST00000513638	ensembl	human	known	74_37	rna	18.71	112	26	SNP	0.000	T
GCN1L1	10985	genome.wustl.edu	37	12	120586115	120586115	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr12:120586115C>T	ENST00000300648.6	-	37	4594	c.4582G>A	c.(4582-4584)Gct>Act	p.A1528T		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	1528					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TGCTTAGGAGCACAGTACGCC	0.552																																																	0													85.0	92.0	89.0					12																	120586115		2140	4242	6382	SO:0001583	missense	0			U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.4582G>A	12.37:g.120586115C>T	ENSP00000300648:p.Ala1528Thr		A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Missense_Mutation	SNP	pfam_DUF3554,pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.A1528T	ENST00000300648.6	37	c.4582	CCDS41847.1	12	.	.	.	.	.	.	.	.	.	.	C	23.0	4.357303	0.82243	.	.	ENSG00000089154	ENST00000300648	T	0.64803	-0.12	5.19	5.19	0.71726	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.82706	0.5095	M	0.88450	2.955	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.84314	0.0512	10	0.44086	T	0.13	.	18.7095	0.91651	0.0:1.0:0.0:0.0	.	1528	Q92616	GCN1L_HUMAN	T	1528	ENSP00000300648:A1528T	ENSP00000300648:A1528T	A	-	1	0	GCN1L1	119070498	1.000000	0.71417	1.000000	0.80357	0.234000	0.25298	7.583000	0.82559	2.435000	0.82474	0.313000	0.20887	GCT	GCN1L1	-	superfamily_ARM-type_fold	ENSG00000089154		0.552	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCN1L1	HGNC	protein_coding	OTTHUMT00000403592.1	-	0.00	62	0	C			120586115	-1	tier1	-	no_errors	ENST00000300648	ensembl	human	known	74_37	missense	6.35	59	4	SNP	1.000	T
GHRHR	2692	genome.wustl.edu	37	7	31003737	31003737	+	Silent	SNP	G	G	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr7:31003737G>C	ENST00000326139.2	+	1	100	c.54G>C	c.(52-54)ccG>ccC	p.P18P		NM_000823.3	NP_000814.2	Q02643	GHRHR_HUMAN	growth hormone releasing hormone receptor	18					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cAMP-mediated signaling (GO:0019933)|cell maturation (GO:0048469)|cellular response to insulin stimulus (GO:0032869)|determination of adult lifespan (GO:0008340)|growth hormone secretion (GO:0030252)|hormone metabolic process (GO:0042445)|lactation (GO:0007595)|multicellular organismal reproductive process (GO:0048609)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell proliferation (GO:0008284)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of multicellular organism growth (GO:0040018)|regulation of intracellular steroid hormone receptor signaling pathway (GO:0033143)|regulation of protein metabolic process (GO:0051246)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to insulin (GO:0032868)|somatotropin secreting cell development (GO:0060133)|water homeostasis (GO:0030104)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nuclear inner membrane (GO:0005637)|nuclear matrix (GO:0016363)|nuclear outer membrane (GO:0005640)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	G-protein coupled receptor activity (GO:0004930)|growth factor binding (GO:0019838)|growth hormone-releasing hormone receptor activity (GO:0016520)|peptide hormone binding (GO:0017046)			biliary_tract(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(18)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35					Sermorelin(DB00010)|Tesamorelin(DB08869)	GCCCGTTACCGACCGTGAGTA	0.652																																																	0													57.0	42.0	47.0					7																	31003737		1944	3676	5620	SO:0001819	synonymous_variant	0				CCDS5432.1	7p14	2012-08-10			ENSG00000106128	ENSG00000106128		"""GPCR / Class B : Glucagon receptors"""	4266	protein-coding gene	gene with protein product		139191				7680413, 7514564	Standard	NM_000823		Approved		uc003tbx.3	Q02643	OTTHUMG00000152801	ENST00000326139.2:c.54G>C	7.37:g.31003737G>C			Q99863	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_GHRH_rcpt,prints_GPCR_2_secretin-like,prints_GPCR_2_VIP_rcpt_1	p.P18	ENST00000326139.2	37	c.54	CCDS5432.1	7																																																																																			GHRHR	-	prints_GPCR_2_GHRH_rcpt	ENSG00000106128		0.652	GHRHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GHRHR	HGNC	protein_coding	OTTHUMT00000327967.2	-	0.00	145	0	G			31003737	+1	tier1	-	no_errors	ENST00000326139	ensembl	human	known	74_37	silent	30.00	105	45	SNP	0.000	C
GPS1	2873	genome.wustl.edu	37	17	80013949	80013949	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr17:80013949C>T	ENST00000306823.6	+	8	942	c.919C>T	c.(919-921)Cag>Tag	p.Q307*	GPS1_ENST00000355130.2_Nonsense_Mutation_p.Q343*|GPS1_ENST00000320548.4_Nonsense_Mutation_p.Q287*|GPS1_ENST00000578552.1_Nonsense_Mutation_p.Q303*|GPS1_ENST00000392358.2_Nonsense_Mutation_p.Q343*			Q13098	CSN1_HUMAN	G protein pathway suppressor 1	307					cell cycle (GO:0007049)|cullin deneddylation (GO:0010388)|inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)			breast(1)|central_nervous_system(1)|endometrium(3)|liver(1)|lung(4)|prostate(1)|skin(2)	13	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0211)			GCAGGAGCTGCAGCGCAATGT	0.652																																																	0													34.0	29.0	30.0					17																	80013949		2198	4298	6496	SO:0001587	stop_gained	0				CCDS11800.1, CCDS32774.1	17q25.3	2013-03-14				ENSG00000169727			4549	protein-coding gene	gene with protein product	"""COP9 signalosome subunit 1"""	601934				9535219	Standard	NM_212492		Approved	COPS1, CSN1	uc002kdl.1	Q13098		ENST00000306823.6:c.919C>T	17.37:g.80013949C>T	ENSP00000302873:p.Gln307*		Q8NA10|Q9BWL1	Nonsense_Mutation	SNP	pfam_26S_proteasome_reg_su-Rpn7,pfam_PCI_dom,smart_PCI_dom	p.Q343*	ENST00000306823.6	37	c.1027	CCDS32774.1	17	.	.	.	.	.	.	.	.	.	.	c	40	8.439063	0.98813	.	.	ENSG00000169727	ENST00000392358;ENST00000320548;ENST00000306823;ENST00000355130	.	.	.	4.2	4.2	0.49525	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	-37.2199	16.7173	0.85400	0.0:1.0:0.0:0.0	.	.	.	.	X	343;293;307;343	.	ENSP00000302873:Q307X	Q	+	1	0	GPS1	77607238	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	7.123000	0.77176	2.177000	0.69029	0.558000	0.71614	CAG	GPS1	-	pfam_26S_proteasome_reg_su-Rpn7	ENSG00000169727		0.652	GPS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPS1	HGNC	protein_coding	OTTHUMT00000442176.1	-	0.00	51	0	C	NM_212492		80013949	+1	tier1	-	no_errors	ENST00000355130	ensembl	human	known	74_37	nonsense	8.16	45	4	SNP	1.000	T
GRIA2	2891	genome.wustl.edu	37	4	158256846	158256846	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr4:158256846G>C	ENST00000264426.9	+	10	1569	c.1290G>C	c.(1288-1290)aaG>aaC	p.K430N	GRIA2_ENST00000449365.1_Missense_Mutation_p.K383N|GRIA2_ENST00000507898.1_Missense_Mutation_p.K383N|GRIA2_ENST00000393815.2_Missense_Mutation_p.K383N|GRIA2_ENST00000296526.7_Missense_Mutation_p.K430N	NM_001083619.1	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2	430					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(2)|lung(32)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	79	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	TTATGATGAAGAAAAATCATG	0.373																																																	0													100.0	91.0	94.0					4																	158256846		2203	4300	6503	SO:0001583	missense	0				CCDS3797.1, CCDS43274.1, CCDS43275.1	4q32.1	2012-08-29			ENSG00000120251	ENSG00000120251		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4572	protein-coding gene	gene with protein product		138247		GLUR2		1311100	Standard	NM_001083619		Approved	GluA2, GLURB	uc003ipl.4	P42262	OTTHUMG00000133836	ENST00000264426.9:c.1290G>C	4.37:g.158256846G>C	ENSP00000264426:p.Lys430Asn		A8MT92|I6L997|Q96FP6	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.K430N	ENST00000264426.9	37	c.1290	CCDS43274.1	4	.	.	.	.	.	.	.	.	.	.	G	17.79	3.476252	0.63737	.	.	ENSG00000120251	ENST00000507898;ENST00000393815;ENST00000296526;ENST00000264426;ENST00000449365	T;T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24;-1.24	5.86	4.94	0.65067	Glutamate receptor, L-glutamate/glycine-binding (2);Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	D	0.88551	0.6467	M	0.82517	2.595	0.80722	D	1	B;D;D	0.89917	0.285;1.0;0.997	B;D;D	0.91635	0.191;0.999;0.994	D	0.90276	0.4311	10	0.87932	D	0	.	14.8816	0.70537	0.0735:0.0:0.9265:0.0	.	430;430;383	P42262;P42262-2;A8MT92	GRIA2_HUMAN;.;.	N	383;383;430;430;383	ENSP00000426845:K383N;ENSP00000377403:K383N;ENSP00000296526:K430N;ENSP00000264426:K430N;ENSP00000389837:K383N	ENSP00000264426:K430N	K	+	3	2	GRIA2	158476296	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.665000	0.61547	1.460000	0.47911	0.650000	0.86243	AAG	GRIA2	-	pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd	ENSG00000120251		0.373	GRIA2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA2	HGNC	protein_coding	OTTHUMT00000258367.2	-	0.00	63	0	G			158256846	+1	tier1	-	no_errors	ENST00000264426	ensembl	human	known	74_37	missense	39.80	59	39	SNP	1.000	C
GRIN2B	2904	genome.wustl.edu	37	12	13761566	13761566	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr12:13761566C>G	ENST00000609686.1	-	9	2190	c.1981G>C	c.(1981-1983)Gac>Cac	p.D661H		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	661					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GAAACCTGGTCCACATATTCC	0.478																																																	0													109.0	96.0	101.0					12																	13761566		2203	4300	6503	SO:0001583	missense	0				CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.1981G>C	12.37:g.13761566C>G	ENSP00000477455:p.Asp661His		Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Missense_Mutation	SNP	pfam_NMDAR2_C,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.D661H	ENST00000609686.1	37	c.1981	CCDS8662.1	12	.	.	.	.	.	.	.	.	.	.	C	24.2	4.510376	0.85389	.	.	ENSG00000150086	ENST00000279593	T	0.53640	0.61	5.57	5.57	0.84162	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.64567	-0.6377	10	0.87932	D	0	.	19.5508	0.95319	0.0:1.0:0.0:0.0	.	661	Q13224	NMDE2_HUMAN	H	661	ENSP00000279593:D661H	ENSP00000279593:D661H	D	-	1	0	GRIN2B	13652833	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.813000	0.86123	2.607000	0.88179	0.655000	0.94253	GAC	GRIN2B	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000273079		0.478	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2B	HGNC	protein_coding	OTTHUMT00000268014.2	-	0.00	91	0	C			13761566	-1	tier1	-	no_errors	ENST00000609686	ensembl	human	known	74_37	missense	53.41	41	47	SNP	1.000	G
HBG2	3048	genome.wustl.edu	37	11	5275727	5275727	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr11:5275727G>T	ENST00000380259.2	-	7	1350	c.110C>A	c.(109-111)cCa>cAa	p.P37Q	HBG2_ENST00000336906.4_Missense_Mutation_p.P37Q|HBG2_ENST00000380252.1_Missense_Mutation_p.P27Q			P69892	HBG2_HUMAN	hemoglobin, gamma G	37					blood coagulation (GO:0007596)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|hemoglobin complex (GO:0005833)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)			endometrium(1)|large_intestine(2)|lung(7)|prostate(1)|skin(2)	13		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTGGGTCCATGGGTAGACAAC	0.532																																																	0													41.0	37.0	39.0					11																	5275727		2200	4272	6472	SO:0001583	missense	0			BC029387	CCDS7755.1	11p15.5	2014-05-19			ENSG00000196565	ENSG00000196565			4832	protein-coding gene	gene with protein product		142250				2649166	Standard	NM_000184		Approved	HBG-T1		P69892	OTTHUMG00000066673	ENST00000380259.2:c.110C>A	11.37:g.5275727G>T	ENSP00000369609:p.Pro37Gln		A8MZE0|P02096|P62027|Q14491|Q68NH9|Q96FH6|Q96FH7	Missense_Mutation	SNP	pfam_Globin,superfamily_Globin-like,pfscan_Globin,prints_Haemoglobin_b,prints_Myoglobin	p.P37Q	ENST00000380259.2	37	c.110	CCDS7755.1	11	.	.	.	.	.	.	.	.	.	.	G	20.8	4.049759	0.75846	.	.	ENSG00000196565	ENST00000380252;ENST00000380259;ENST00000336906;ENST00000380247	D;D;D	0.99113	-5.44;-5.44;-5.44	3.88	3.88	0.44766	Globin-like (2);Globin, structural domain (2);	.	.	.	.	D	0.99554	0.9840	H	0.98199	4.17	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.996	D	0.97606	1.0126	9	0.87932	D	0	.	14.93	0.70908	0.0:0.0:1.0:0.0	.	37;37	P69892;P69891	HBG2_HUMAN;HBG1_HUMAN	Q	27;37;37;37	ENSP00000369602:P27Q;ENSP00000369609:P37Q;ENSP00000338082:P37Q	ENSP00000338082:P37Q	P	-	2	0	HBG2	5232303	1.000000	0.71417	0.794000	0.32065	0.998000	0.95712	7.341000	0.79300	2.128000	0.65567	0.650000	0.86243	CCA	HBG2	-	pfam_Globin,superfamily_Globin-like,pfscan_Globin,prints_Haemoglobin_b	ENSG00000196565		0.532	HBG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HBG2	HGNC	protein_coding	OTTHUMT00000142967.2		0.00	92	0	G	NM_000184		5275727	-1			no_errors	ENST00000336906	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	T
HERC2P3	283755	genome.wustl.edu	37	15	20657659	20657659	+	RNA	SNP	C	C	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr15:20657659C>A	ENST00000428453.1	-	0	2299							Q9BVR0	HRC23_HUMAN	hect domain and RLD 2 pseudogene 3								metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(1)|lung(14)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	35						GGCCAGCGTGCCGGAATTGAG	0.552																																																	0													3.0	3.0	3.0					15																	20657659		1188	2641	3829			0			AF041081		15q11.2	2010-08-02			ENSG00000180229	ENSG00000180229			4871	pseudogene	pseudogene						9730612	Standard	NR_036432		Approved	D15F37S4, LOC283755	uc001ytg.3	Q9BVR0	OTTHUMG00000157175		15.37:g.20657659C>A				RNA	SNP	-	NULL	ENST00000428453.1	37	NULL		15																																																																																			HERC2P3	-	-	ENSG00000180229		0.552	HERC2P3-014	KNOWN	basic	processed_transcript	HERC2P3	HGNC	pseudogene	OTTHUMT00000347772.2	-	0.00	116	0	C	NG_008269		20657659	-1	tier1	-	no_errors	ENST00000426501	ensembl	human	known	74_37	rna	21.62	87	24	SNP	1.000	A
HERC4	26091	genome.wustl.edu	37	10	69751986	69751986	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr10:69751986G>C	ENST00000395198.3	-	11	1488	c.1241C>G	c.(1240-1242)cCt>cGt	p.P414R	HERC4_ENST00000277817.6_Missense_Mutation_p.P304R|HERC4_ENST00000412272.2_Missense_Mutation_p.P414R|HERC4_ENST00000373700.4_Missense_Mutation_p.P414R|HERC4_ENST00000395187.2_3'UTR	NM_022079.2	NP_071362.1	Q5GLZ8	HERC4_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 4	414					cell differentiation (GO:0030154)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	27						CCTTCCAGAAGGATAGCTCAG	0.483																																																	0													110.0	95.0	100.0					10																	69751986		2203	4300	6503	SO:0001583	missense	0			AY221963	CCDS7274.1, CCDS41533.1, CCDS60541.1, CCDS60542.1	10q21.3	2013-09-20	2012-02-23		ENSG00000148634	ENSG00000148634			24521	protein-coding gene	gene with protein product		609248	"""hect domain and RLD 4"""			10997877	Standard	NM_022079		Approved	DKFZP564G092, KIAA1593	uc001jng.4	Q5GLZ8	OTTHUMG00000018343	ENST00000395198.3:c.1241C>G	10.37:g.69751986G>C	ENSP00000378624:p.Pro414Arg		Q5GC98|Q5GC99|Q5GCA0|Q8IXP9|Q9HCH9	Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,superfamily_HECT,superfamily_RCC1/BLIP-II,smart_HECT,pfscan_HECT,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.P414R	ENST00000395198.3	37	c.1241	CCDS41533.1	10	.	.	.	.	.	.	.	.	.	.	G	11.23	1.577039	0.28092	.	.	ENSG00000148634	ENST00000277817;ENST00000412272;ENST00000395198;ENST00000373700	T;T;T;T	0.44482	1.18;0.92;0.93;0.93	5.25	5.25	0.73442	.	0.487986	0.24935	N	0.034434	T	0.34658	0.0905	L	0.29908	0.895	0.80722	D	1	B;B;B;B;B	0.20459	0.045;0.0;0.013;0.022;0.013	B;B;B;B;B	0.24848	0.04;0.001;0.025;0.056;0.025	T	0.08785	-1.0705	10	0.23302	T	0.38	.	17.0279	0.86453	0.0:0.0:1.0:0.0	.	414;414;264;414;414	Q5GLZ8-3;A8K9U4;Q5VXS9;Q5GLZ8-2;Q5GLZ8	.;.;.;.;HERC4_HUMAN	R	304;414;414;414	ENSP00000277817:P304R;ENSP00000416504:P414R;ENSP00000378624:P414R;ENSP00000362804:P414R	ENSP00000277817:P304R	P	-	2	0	HERC4	69421992	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.968000	0.76086	2.437000	0.82529	0.650000	0.86243	CCT	HERC4	-	NULL	ENSG00000148634		0.483	HERC4-009	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC4	HGNC	protein_coding	OTTHUMT00000359262.1	-	0.00	40	0	G	NM_015601		69751986	-1	tier1	-	no_errors	ENST00000395198	ensembl	human	known	74_37	missense	17.86	23	5	SNP	1.000	C
HIST1H3C	8352	genome.wustl.edu	37	6	26045940	26045940	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr6:26045940T>A	ENST00000540144.1	+	1	302	c.302T>A	c.(301-303)cTg>cAg	p.L101Q	HIST1H2BB_ENST00000357905.2_5'Flank	NM_003531.2	NP_003522.1	P68431	H31_HUMAN	histone cluster 1, H3c	101					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(1)|skin(1)	8						GAGGCCTACCTGGTGGGACTC	0.577																																																	0													64.0	58.0	60.0					6																	26045940		2203	4300	6503	SO:0001583	missense	0			X57128	CCDS4576.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196532	ENSG00000278272		"""Histones / Replication-dependent"""	4768	protein-coding gene	gene with protein product		602812	"""H3 histone family, member C"", ""histone 1, H3c"""	H3FC		8227173, 9119399, 12408966	Standard	NM_003531		Approved	H3/c, H3.1	uc003nfv.3	P68431	OTTHUMG00000014416	ENST00000540144.1:c.302T>A	6.37:g.26045940T>A	ENSP00000439493:p.Leu101Gln		A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.L101Q	ENST00000540144.1	37	c.302	CCDS4576.1	6	.	.	.	.	.	.	.	.	.	.	T	14.16	2.452247	0.43531	.	.	ENSG00000196532	ENST00000540144	T	0.55930	0.49	4.38	4.38	0.52667	.	.	.	.	.	T	0.57169	0.2035	.	.	.	0.42764	D	0.993813	.	.	.	.	.	.	T	0.64179	-0.6468	6	0.72032	D	0.01	.	13.4755	0.61306	0.0:0.0:0.0:1.0	.	.	.	.	Q	101	ENSP00000439493:L101Q	ENSP00000439493:L101Q	L	+	2	0	HIST1H3C	26153919	1.000000	0.71417	1.000000	0.80357	0.310000	0.27922	4.921000	0.63397	1.927000	0.55829	0.402000	0.26972	CTG	HIST1H3C	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	ENSG00000196532		0.577	HIST1H3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H3C	HGNC	protein_coding	OTTHUMT00000040078.1	-	0.00	129	0	T	NM_003531		26045940	+1	tier1	-	no_errors	ENST00000540144	ensembl	human	known	74_37	missense	37.78	56	34	SNP	1.000	A
HIST1H2AH	85235	genome.wustl.edu	37	6	27115271	27115271	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr6:27115271G>C	ENST00000377459.1	+	1	411	c.364G>C	c.(364-366)Gag>Cag	p.E122Q	HIST1H2BK_ENST00000356950.1_5'Flank|HIST1H2BK_ENST00000396891.4_5'Flank|MIR3143_ENST00000584253.1_RNA	NM_080596.1	NP_542163.1	Q96KK5	H2A1H_HUMAN	histone cluster 1, H2ah	122						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)|prostate(1)|skin(1)	12						TAAGAAGACTGAGAGCCACCA	0.522																																																	0													59.0	62.0	61.0					6																	27115271		2203	4300	6503	SO:0001583	missense	0			AY131988	CCDS4622.1	6p22.1	2011-01-27	2006-10-11			ENSG00000274997		"""Histones / Replication-dependent"""	13671	protein-coding gene	gene with protein product		615013	"""histone 1, H2ah"""			12408966	Standard	NM_080596		Approved	H2AFALii, dJ86C11.1, H2A/S	uc003niz.4	Q96KK5		ENST00000377459.1:c.364G>C	6.37:g.27115271G>C	ENSP00000366679:p.Glu122Gln			Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.E122Q	ENST00000377459.1	37	c.364	CCDS4622.1	6	.	.	.	.	.	.	.	.	.	.	G	11.48	1.649965	0.29336	.	.	ENSG00000184825	ENST00000377459	D	0.90563	-2.69	4.06	4.06	0.47325	Histone-fold (2);Histone H2A (1);	0.000000	0.41500	D	0.000879	T	0.78898	0.4356	L	0.35288	1.05	0.35814	D	0.824071	B	0.09022	0.002	B	0.04013	0.001	T	0.75950	-0.3137	10	0.37606	T	0.19	.	14.5447	0.68020	0.0:0.0:1.0:0.0	.	122	Q96KK5	H2A1H_HUMAN	Q	122	ENSP00000366679:E122Q	ENSP00000366679:E122Q	E	+	1	0	HIST1H2AH	27223250	1.000000	0.71417	0.997000	0.53966	0.484000	0.33280	8.660000	0.91121	2.201000	0.70794	0.655000	0.94253	GAG	HIST1H2AH	-	superfamily_Histone-fold,smart_Histone_H2A	ENSG00000184825		0.522	HIST1H2AH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2AH	HGNC	protein_coding	OTTHUMT00000040136.1	-	0.00	103	0	G	NM_080596		27115271	+1	tier1	-	no_errors	ENST00000377459	ensembl	human	known	74_37	missense	38.61	62	39	SNP	1.000	C
HMGN2	3151	genome.wustl.edu	37	1	26800609	26800609	+	Frame_Shift_Del	DEL	A	A	-			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr1:26800609delA	ENST00000361427.5	+	4	218	c.124delA	c.(124-126)aaafs	p.K43fs	HMGN2_ENST00000493418.1_3'UTR	NM_005517.3	NP_005508.1	P05204	HMGN2_HUMAN	high mobility group nucleosomal binding domain 2	43						chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|lung(2)	3		all_cancers(24;1.9e-24)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.38e-49)|OV - Ovarian serous cystadenocarcinoma(117;5.38e-28)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.026)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.153)|LUSC - Lung squamous cell carcinoma(448;0.227)		GCCCAAGCCTAAAAAGGCCCC	0.433																																																	0													67.0	71.0	70.0					1																	26800609		2203	4300	6503	SO:0001589	frameshift_variant	0			BC081567	CCDS283.1	1p36.1	2011-07-01	2011-04-05	2002-08-16	ENSG00000198830	ENSG00000198830		"""High-mobility group / Canonical"""	4986	protein-coding gene	gene with protein product		163910	"""high-mobility group (nonhistone chromosomal) protein 17"", ""high-mobility group nucleosomal binding domain 2"""	HMG17		2037294	Standard	NM_005517		Approved		uc001bmp.4	P05204	OTTHUMG00000003555	ENST00000361427.5:c.124delA	1.37:g.26800609delA	ENSP00000355228:p.Lys43fs		Q0VGD5|Q6FGI5|Q96C64	Frame_Shift_Del	DEL	pfam_HMGN_fam,smart_HMGN_fam,prints_HMGN_fam	p.K43fs	ENST00000361427.5	37	c.124	CCDS283.1	1																																																																																			HMGN2	-	pfam_HMGN_fam,smart_HMGN_fam,prints_HMGN_fam	ENSG00000198830		0.433	HMGN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGN2	HGNC	protein_coding	OTTHUMT00000009901.1		0.00	45	0	A	NM_005517		26800609	+1	tier1		no_errors	ENST00000361427	ensembl	human	known	74_37	frame_shift_del	8.16	45	4	DEL	1.000	-
HRCT1	646962	genome.wustl.edu	37	9	35906584	35906586	+	In_Frame_Del	DEL	CCA	CCA	-	rs143611048	byFrequency	TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	CCA	CCA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr9:35906584_35906586delCCA	ENST00000354323.2	+	1	396_398	c.300_302delCCA	c.(298-303)ctccac>ctc	p.H105del	LINC00961_ENST00000443779.1_lincRNA	NM_001039792.1	NP_001034881.1	Q6UXD1	HRCT1_HUMAN	histidine rich carboxyl terminus 1	105	His-rich.					integral component of membrane (GO:0016021)				NS(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(1)	4						ctcaccacctccaccaccaccac	0.66														929	0.185503	0.1619	0.1268	5008	,	,		6334	0.3085		0.1213	False		,,,				2504	0.1984																0																																										SO:0001651	inframe_deletion	0				CCDS35012.1	9p13.3	2008-09-30			ENSG00000196196	ENSG00000196196			33872	protein-coding gene	gene with protein product						12975309	Standard	NM_001039792		Approved	LGLL338, PRO537, UNQ338	uc003zyr.1	Q6UXD1	OTTHUMG00000154146	ENST00000354323.2:c.300_302delCCA	9.37:g.35906593_35906595delCCA	ENSP00000346283:p.His105del		B7ZBJ1	In_Frame_Del	DEL	NULL	p.H104in_frame_del	ENST00000354323.2	37	c.300_302	CCDS35012.1	9																																																																																			HRCT1	-	NULL	ENSG00000196196		0.660	HRCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRCT1	HGNC	protein_coding	OTTHUMT00000334099.1		0.00	22	0	CCA	NM_001039792		35906586	+1	tier1		no_errors	ENST00000354323	ensembl	human	known	74_37	in_frame_del	26.09	17	6	DEL	0.016:0.009:0.003	-
HS6ST1	9394	genome.wustl.edu	37	2	129025972	129025972	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr2:129025972T>C	ENST00000259241.6	-	2	1013	c.1000A>G	c.(1000-1002)Atc>Gtc	p.I334V		NM_004807.2	NP_004798.3	O60243	H6ST1_HUMAN	heparan sulfate 6-O-sulfotransferase 1	334					angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|labyrinthine layer blood vessel development (GO:0060716)|lung alveolus development (GO:0048286)|neuron development (GO:0048666)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)|sulfotransferase activity (GO:0008146)			endometrium(3)|liver(1)|lung(7)|pancreas(1)|prostate(2)|skin(1)	15	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.117)		ATGCGCCGGATGGTGTCTTCA	0.607																																																	0													57.0	62.0	60.0					2																	129025972		2175	4280	6455	SO:0001583	missense	0			AB006179	CCDS42748.1	2q21	2010-03-19		2002-08-23	ENSG00000136720	ENSG00000136720		"""Sulfotransferases, membrane-bound"""	5201	protein-coding gene	gene with protein product		604846		HS6ST		9535912	Standard	NM_004807		Approved		uc002tpt.4	O60243	OTTHUMG00000153542	ENST00000259241.6:c.1000A>G	2.37:g.129025972T>C	ENSP00000259241:p.Ile334Val		B4DEP2|B4DJ29|Q53SL2|Q9BVI1	Missense_Mutation	SNP	pfam_Sulfotransferase,superfamily_P-loop_NTPase	p.I334V	ENST00000259241.6	37	c.1000	CCDS42748.1	2	.	.	.	.	.	.	.	.	.	.	T	10.27	1.303877	0.23736	.	.	ENSG00000136720	ENST00000259241	T	0.74106	-0.81	4.48	2.06	0.26882	.	0.048437	0.85682	D	0.000000	T	0.56992	0.2023	L	0.28115	0.83	0.52099	D	0.999944	B	0.11235	0.004	B	0.17722	0.019	T	0.38067	-0.9678	9	.	.	.	-2.109	8.6194	0.33851	0.0:0.1598:0.0:0.8402	.	334	O60243	H6ST1_HUMAN	V	334	ENSP00000259241:I334V	.	I	-	1	0	HS6ST1	128742442	1.000000	0.71417	0.994000	0.49952	0.978000	0.69477	2.918000	0.48829	0.213000	0.20722	0.379000	0.24179	ATC	HS6ST1	-	pfam_Sulfotransferase	ENSG00000136720		0.607	HS6ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS6ST1	HGNC	protein_coding	OTTHUMT00000331572.1	-	0.00	77	0	T	NM_004807		129025972	-1	tier1	-	no_errors	ENST00000259241	ensembl	human	known	74_37	missense	35.96	73	41	SNP	1.000	C
HSP90AB2P	391634	genome.wustl.edu	37	4	13335101	13335108	+	RNA	DEL	AAACAACA	AAACAACA	-			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	AAACAACA	AAACAACA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr4:13335101_13335108delAAACAACA	ENST00000602906.1	+	0	64_71							Q58FF8	H90B2_HUMAN	heat shock protein 90kDa alpha (cytosolic), class B member 2, pseudogene						protein folding (GO:0006457)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			kidney(3)|lung(1)	4						gtgctattgcaaacaacattcagcaagg	0.486																																																	0																																												0			AY956763		4p15.33	2012-04-18	2011-04-15		ENSG00000205940	ENSG00000205940			32537	pseudogene	pseudogene			"""heat shock protein 90kDa alpha (cytosolic), class B member 2 (pseudogene)"""			16269234	Standard	NG_032979		Approved	HSP90BB		Q58FF8			4.37:g.13335101_13335108delAAACAACA				RNA	DEL	-	NULL	ENST00000602906.1	37	NULL		4																																																																																			HSP90AB2P	-	-	ENSG00000205940		0.486	HSP90AB2P-001	KNOWN	basic	processed_transcript	HSP90AB2P	HGNC	pseudogene	OTTHUMT00000359156.2		0.00	57	0	AAACAACA			13335108	+1			no_errors	ENST00000602906	ensembl	human	known	74_37	rna	12.96	47	7	DEL	0.003:0.002:0.007:0.003:0.000:0.000:0.000:0.000	0
HSPA1A	3303	genome.wustl.edu	37	6	31783686	31783686	+	Silent	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr6:31783686C>T	ENST00000375651.5	+	1	396	c.153C>T	c.(151-153)atC>atT	p.I51I	HSPA1A_ENST00000458062.2_Intron|HSPA1A_ENST00000608703.1_Intron|HSPA1L_ENST00000375654.4_5'Flank|HSPA1L_ENST00000417199.3_5'Flank	NM_005345.5	NP_005336.3	P08107	HSP71_HUMAN	heat shock 70kDa protein 1A	51					ATP catabolic process (GO:0006200)|cellular heat acclimation (GO:0070370)|cellular response to heat (GO:0034605)|gene expression (GO:0010467)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of inclusion body assembly (GO:0090084)|negative regulation of protein ubiquitination (GO:0031397)|positive regulation of erythrocyte differentiation (GO:0045648)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)|RNA metabolic process (GO:0016070)	aggresome (GO:0016235)|blood microparticle (GO:0072562)|centriole (GO:0005814)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|inclusion body (GO:0016234)|mitochondrion (GO:0005739)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)|vesicle (GO:0031982)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|double-stranded RNA binding (GO:0003725)|enzyme binding (GO:0019899)|G-protein coupled receptor binding (GO:0001664)|heat shock protein binding (GO:0031072)|poly(A) RNA binding (GO:0044822)|protein binding involved in protein folding (GO:0044183)|protein N-terminus binding (GO:0047485)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)|virus receptor activity (GO:0001618)			endometrium(1)|ovary(1)|stomach(1)	3						AGCGGCTCATCGGGGATGCGG	0.647																																																	0													8.0	9.0	9.0					6																	31783686		2115	4150	6265	SO:0001819	synonymous_variant	0			BC002453	CCDS34414.1	6p21.3	2012-10-02	2002-08-29		ENSG00000204389	ENSG00000204389		"""Heat shock proteins / HSP70"""	5232	protein-coding gene	gene with protein product		140550	"""heat shock 70kD protein 1A"""	HSPA1			Standard	NM_005345		Approved	HSP70-1	uc003nxj.3	P08107	OTTHUMG00000031201	ENST00000375651.5:c.153C>T	6.37:g.31783686C>T			B4E3B6|P19790|Q5JQI4|Q5SP17|Q9UQL9|Q9UQM0	Silent	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.I51	ENST00000375651.5	37	c.153	CCDS34414.1	6																																																																																			HSPA1A	-	pfam_Hsp_70_fam	ENSG00000204389		0.647	HSPA1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA1A	HGNC	protein_coding	OTTHUMT00000076401.2	-	0.00	34	0	C			31783686	+1	tier1	-	no_errors	ENST00000375651	ensembl	human	known	74_37	silent	65.38	9	17	SNP	1.000	T
ICAM4	3386	genome.wustl.edu	37	19	10397718	10397719	+	Frame_Shift_Ins	INS	-	-	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr19:10397718_10397719insT	ENST00000380770.3	+	1	76_77	c.30_31insT	c.(31-33)tttfs	p.F11fs	ICAM4_ENST00000340992.4_Frame_Shift_Ins_p.F11fs|ICAM5_ENST00000221980.4_5'Flank|ICAM4_ENST00000393717.2_Frame_Shift_Ins_p.F11fs|CTD-2369P2.5_ENST00000592893.1_RNA|CTD-2369P2.8_ENST00000589379.1_RNA	NM_001544.4	NP_001535.1	Q14773	ICAM4_HUMAN	intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)	11					extracellular matrix organization (GO:0030198)|regulation of immune response (GO:0050776)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)	p.L13fs*40(1)		breast(1)|large_intestine(3)|lung(2)|pancreas(1)	7			OV - Ovarian serous cystadenocarcinoma(20;2.64e-09)|Epithelial(33;4.31e-06)|all cancers(31;9.75e-06)			TGTCGCTGCTGTTTTTTTTGGC	0.673																																																	1	Deletion - Frameshift(1)	large_intestine(1)																																								SO:0001589	frameshift_variant	0			X93093	CCDS12232.1, CCDS32904.1, CCDS42500.1	19p13.2	2014-07-19	2006-02-23		ENSG00000105371	ENSG00000105371		"""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5347	protein-coding gene	gene with protein product		614088	"""intercellular adhesion molecule 4, Landsteiner-Wiener blood group"", ""Landsteiner-Wiener blood group"", ""intercellular adhesion molecule 4 (LW blood group)"""	LW		8639917, 6431896	Standard	NM_001039132		Approved	CD242	uc002mnr.2	Q14773	OTTHUMG00000180405	ENST00000380770.3:c.38dupT	19.37:g.10397726_10397726dupT	ENSP00000370147:p.Phe11fs		A0M8X2|Q14771|Q14772|Q16375|Q9BWR0	Frame_Shift_Ins	INS	pfam_ICAM_N	p.L12fs	ENST00000380770.3	37	c.30_31	CCDS12232.1	19																																																																																			ICAM4	-	NULL	ENSG00000105371		0.673	ICAM4-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ICAM4	HGNC	protein_coding	OTTHUMT00000451214.1		0.00	18	0	-	NM_001544		10397719	+1	tier1		no_errors	ENST00000340992	ensembl	human	known	74_37	frame_shift_ins	21.43	11	3	INS	0.002:0.004	T
IGDCC4	57722	genome.wustl.edu	37	15	65703488	65703488	+	Silent	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr15:65703488C>T	ENST00000352385.2	-	2	500	c.291G>A	c.(289-291)caG>caA	p.Q97Q		NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4	97	Ig-like C2-type 1.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						GTGCTAGTGGCTGGGACAGCC	0.632																																																	0													56.0	47.0	50.0					15																	65703488		2200	4299	6499	SO:0001819	synonymous_variant	0				CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.291G>A	15.37:g.65703488C>T			Q9HCE4	Silent	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.Q97	ENST00000352385.2	37	c.291	CCDS10206.1	15																																																																																			IGDCC4	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000103742		0.632	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	IGDCC4	HGNC	protein_coding	OTTHUMT00000256825.2	-	0.00	78	0	C	NM_020962		65703488	-1	tier1	-	no_errors	ENST00000352385	ensembl	human	novel	74_37	silent	6.25	60	4	SNP	0.326	T
IL1F10	84639	genome.wustl.edu	37	2	113831923	113831923	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr2:113831923A>G	ENST00000393197.2	+	2	471	c.50A>G	c.(49-51)cAg>cGg	p.Q17R	IL1F10_ENST00000337569.3_Intron|IL1F10_ENST00000341010.2_Missense_Mutation_p.Q17R	NM_032556.5	NP_115945.4	Q8WWZ1	IL1FA_HUMAN	interleukin 1 family, member 10 (theta)	17						extracellular space (GO:0005615)				endometrium(1)|lung(6)|ovary(1)	8						TATGCAGACCAGAAGGCTCTA	0.532																																																	0													106.0	95.0	99.0					2																	113831923		2203	4300	6503	SO:0001583	missense	0			AY026753	CCDS2112.1	2q13	2011-07-14			ENSG00000136697	ENSG00000136697		"""Interleukins and interleukin receptors"""	15552	protein-coding gene	gene with protein product	"""FIL1- theta"", ""interleukin-1 receptor antagonist FKSG75"""	615296				11747621, 11991723, 11991722	Standard	NM_173161		Approved	FKSG75, IL-1HY2, IL-1F10, IL1-theta, MGC11983, MGC119832, MGC119833	uc002tiu.3	Q8WWZ1	OTTHUMG00000131339	ENST00000393197.2:c.50A>G	2.37:g.113831923A>G	ENSP00000376893:p.Gln17Arg		Q53SR9|Q56AT8|Q7RTZ5|Q969H5|Q9BYX1	Missense_Mutation	SNP	pfam_IL-1,superfamily_Cytokine_IL1-like,smart_IL-1,prints_IL-1RA/IL-36,prints_IL-1,prints_IL-1_beta	p.Q17R	ENST00000393197.2	37	c.50	CCDS2112.1	2	.	.	.	.	.	.	.	.	.	.	a	11.28	1.591560	0.28357	.	.	ENSG00000136697	ENST00000341010;ENST00000393197	T;T	0.11169	2.8;2.8	4.76	4.76	0.60689	.	2.278500	0.02388	N	0.079472	T	0.36524	0.0970	M	0.74258	2.255	0.80722	D	1	D	0.57899	0.981	D	0.65140	0.932	T	0.00263	-1.1866	10	0.62326	D	0.03	0.0357	11.2227	0.48864	1.0:0.0:0.0:0.0	.	17	Q8WWZ1	IL1FA_HUMAN	R	17	ENSP00000341794:Q17R;ENSP00000376893:Q17R	ENSP00000341794:Q17R	Q	+	2	0	IL1F10	113548394	1.000000	0.71417	0.976000	0.42696	0.472000	0.32918	3.976000	0.56867	2.081000	0.62600	0.529000	0.55759	CAG	IL1F10	-	superfamily_Cytokine_IL1-like,smart_IL-1,prints_IL-1RA/IL-36	ENSG00000136697		0.532	IL1F10-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	IL1F10	HGNC	protein_coding	OTTHUMT00000330725.1	-	0.00	48	0	A	NM_173161		113831923	+1	tier1	-	no_errors	ENST00000341010	ensembl	human	known	74_37	missense	36.73	31	18	SNP	0.997	G
ISOC2	79763	genome.wustl.edu	37	19	55966407	55966407	+	Silent	SNP	T	T	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr19:55966407T>C	ENST00000425675.2	-	5	546	c.486A>G	c.(484-486)gaA>gaG	p.E162E	ISOC2_ENST00000085068.3_Silent_p.E178E|ISOC2_ENST00000438389.2_Silent_p.E92E			Q96AB3	ISOC2_HUMAN	isochorismatase domain containing 2	162					protein destabilization (GO:0031648)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			endometrium(1)|lung(4)|ovary(1)|stomach(1)	7	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0535)		GAATGAGCCCTTCGCTGGTGG	0.642											OREG0025682	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													45.0	44.0	44.0					19																	55966407		2203	4300	6503	SO:0001819	synonymous_variant	0			AK027122	CCDS12925.1, CCDS46194.1, CCDS46195.1	19q13.42	2011-07-14			ENSG00000063241	ENSG00000063241			26278	protein-coding gene	gene with protein product		612928				17658461	Standard	NM_024710		Approved	FLJ23469	uc002qla.3	Q96AB3		ENST00000425675.2:c.486A>G	19.37:g.55966407T>C		1011	Q6ZN91|Q9H5G0	Silent	SNP	pfam_Isochorismatase-like,superfamily_Isochorismatase-like	p.E178	ENST00000425675.2	37	c.534	CCDS46195.1	19																																																																																			ISOC2	-	pfam_Isochorismatase-like,superfamily_Isochorismatase-like	ENSG00000063241		0.642	ISOC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ISOC2	HGNC	protein_coding	OTTHUMT00000453179.1	-	0.00	152	0	T	NM_024710		55966407	-1	tier1	-	no_errors	ENST00000085068	ensembl	human	known	74_37	silent	40.14	85	57	SNP	0.995	C
KBTBD7	84078	genome.wustl.edu	37	13	41767432	41767434	+	In_Frame_Del	DEL	CTG	CTG	-	rs552076358		TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	CTG	CTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr13:41767432_41767434delCTG	ENST00000379483.3	-	1	1268_1270	c.960_962delCAG	c.(958-963)agcagt>agt	p.320_321SS>S		NM_032138.4	NP_115514.2	Q8WVZ9	KBTB7_HUMAN	kelch repeat and BTB (POZ) domain containing 7	320										central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(8)|ovary(4)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24		Lung NSC(96;0.000105)|Breast(139;0.00715)|Prostate(109;0.0233)|Lung SC(185;0.0367)		all cancers(112;6.21e-09)|Epithelial(112;6.99e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000196)|GBM - Glioblastoma multiforme(144;0.000857)|BRCA - Breast invasive adenocarcinoma(63;0.0669)		gctgctgctactgctgctgctgc	0.512																																																	0																																										SO:0001651	inframe_deletion	0			AL136782	CCDS9377.1	13q13.3	2013-01-08			ENSG00000120696	ENSG00000120696		"""BTB/POZ domain containing"""	25266	protein-coding gene	gene with protein product						11230166	Standard	NM_032138		Approved	DKFZP434E2318	uc001uxw.1	Q8WVZ9	OTTHUMG00000016789	ENST00000379483.3:c.960_962delCAG	13.37:g.41767441_41767443delCTG	ENSP00000368797:p.Ser324del		B5TZ86|Q5T6Y7|Q8NB99|Q9H0I6	In_Frame_Del	DEL	pfam_BTB_POZ,pfam_BACK,pfam_Kelch_1,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.S324in_frame_del	ENST00000379483.3	37	c.962_960	CCDS9377.1	13																																																																																			KBTBD7	-	pirsf_Kelch-like_gigaxonin	ENSG00000120696		0.512	KBTBD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KBTBD7	HGNC	protein_coding	OTTHUMT00000044660.1		0.00	32	0	CTG	NM_032138		41767434	-1	tier1		no_errors	ENST00000379483	ensembl	human	known	74_37	in_frame_del	13.64	19	3	DEL	0.559:0.829:0.997	-
KIAA1033	23325	genome.wustl.edu	37	12	105551051	105551051	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr12:105551051G>T	ENST00000332180.5	+	28	2950	c.2863G>T	c.(2863-2865)Gaa>Taa	p.E955*		NM_015275.1	NP_056090.1			KIAA1033											breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	41						AAATTTTGAAGAACTAGTAAA	0.284																																																	0													69.0	63.0	65.0					12																	105551051		1788	4062	5850	SO:0001587	stop_gained	0			AB028956	CCDS41826.1, CCDS73514.1	12q24.11	2014-05-09				ENSG00000136051			29174	protein-coding gene	gene with protein product		615748				20376207, 20498093, 21498477	Standard	XM_005268742		Approved	SWIP	uc001tld.3	Q2M389		ENST00000332180.5:c.2863G>T	12.37:g.105551051G>T	ENSP00000328062:p.Glu955*			Nonsense_Mutation	SNP	NULL	p.E955*	ENST00000332180.5	37	c.2863	CCDS41826.1	12	.	.	.	.	.	.	.	.	.	.	G	40	8.384988	0.98789	.	.	ENSG00000136051	ENST00000332180;ENST00000552203;ENST00000551224	.	.	.	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	18.8868	0.92381	0.0:0.0:1.0:0.0	.	.	.	.	X	955;33;33	.	ENSP00000328062:E955X	E	+	1	0	KIAA1033	104075181	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	9.532000	0.98057	2.460000	0.83146	0.467000	0.42956	GAA	KIAA1033	-	NULL	ENSG00000136051		0.284	KIAA1033-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1033	HGNC	protein_coding	OTTHUMT00000406138.4	-	0.00	61	0	G	NM_015275		105551051	+1	tier1	-	no_errors	ENST00000332180	ensembl	human	known	74_37	nonsense	29.03	44	18	SNP	1.000	T
KIAA1468	57614	genome.wustl.edu	37	18	59925833	59925833	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr18:59925833C>T	ENST00000398130.2	+	15	2358	c.2126C>T	c.(2125-2127)gCg>gTg	p.A709V	KIAA1468_ENST00000256858.6_Missense_Mutation_p.A709V	NM_020854.3	NP_065905.2	Q9P260	K1468_HUMAN	KIAA1468	709										autonomic_ganglia(1)|breast(4)|endometrium(4)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47		Colorectal(73;0.186)				GCTTACGCTGCGTGGACTACA	0.378																																																	0													97.0	93.0	94.0					18																	59925833		2203	4300	6503	SO:0001583	missense	0			BC011992	CCDS11979.2	18q21.33	2005-11-03			ENSG00000134444	ENSG00000134444			29289	protein-coding gene	gene with protein product						11973628	Standard	NM_020854		Approved	HsT885, HsT3308, FLJ33841	uc002lil.3	Q9P260	OTTHUMG00000132780	ENST00000398130.2:c.2126C>T	18.37:g.59925833C>T	ENSP00000381198:p.Ala709Val			Missense_Mutation	SNP	pfam_HEAT,superfamily_ARM-type_fold,smart_LisH_dimerisation,pfscan_HEAT_type_2,pfscan_LisH_dimerisation	p.A709V	ENST00000398130.2	37	c.2126	CCDS11979.2	18	.	.	.	.	.	.	.	.	.	.	C	23.3	4.397960	0.83120	.	.	ENSG00000134444	ENST00000398130;ENST00000256858	T;T	0.66995	-0.24;-0.24	5.81	5.81	0.92471	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.77778	0.4181	L	0.50333	1.59	0.80722	D	1	D;D;D	0.76494	0.989;0.998;0.999	P;P;D	0.64595	0.772;0.824;0.927	T	0.74469	-0.3655	9	.	.	.	-8.351	20.089	0.97809	0.0:1.0:0.0:0.0	.	709;709;353	Q9P260-2;Q9P260;B2RD46	.;K1468_HUMAN;.	V	709	ENSP00000381198:A709V;ENSP00000256858:A709V	.	A	+	2	0	KIAA1468	58076813	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	5.488000	0.66869	2.752000	0.94435	0.557000	0.71058	GCG	KIAA1468	-	superfamily_ARM-type_fold	ENSG00000134444		0.378	KIAA1468-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1468	HGNC	protein_coding	OTTHUMT00000256187.1	-	0.00	61	0	C	NM_020854		59925833	+1	tier1	-	no_errors	ENST00000256858	ensembl	human	known	74_37	missense	67.19	21	43	SNP	1.000	T
CIPC	85457	genome.wustl.edu	37	14	77572068	77572068	+	Missense_Mutation	SNP	C	C	G	rs377615689		TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr14:77572068C>G	ENST00000361786.2	+	2	334	c.17C>G	c.(16-18)cCa>cGa	p.P6R	KIAA1737_ENST00000555437.1_Missense_Mutation_p.P6R|RP11-463C8.4_ENST00000557752.1_Missense_Mutation_p.P6R|KIAA1737_ENST00000555611.1_Missense_Mutation_p.P6R	NM_033426.2	NP_219494.2	Q9C0C6	CIPC_HUMAN		6					negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				endometrium(2)|lung(4)|prostate(3)	9			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0284)		AGGAAAAACCCATCCAGAGAG	0.473																																																	0													99.0	102.0	101.0					14																	77572068		2203	4300	6503	SO:0001583	missense	0																														ENST00000361786.2:c.17C>G	14.37:g.77572068C>G	ENSP00000355319:p.Pro6Arg		B2RCI1|Q8N389|Q8NDZ1	Missense_Mutation	SNP	NULL	p.P6R	ENST00000361786.2	37	c.17	CCDS9855.1	14	.	.	.	.	.	.	.	.	.	.	C	12.51	1.961003	0.34565	.	.	ENSG00000198894	ENST00000361786;ENST00000555437;ENST00000555611;ENST00000554658;ENST00000557115;ENST00000554447;ENST00000555200	T;T;T;T;T;T;T	0.58940	1.2;0.3;0.64;0.69;0.71;0.66;0.68	5.63	5.63	0.86233	.	0.282367	0.35407	N	0.003234	T	0.51770	0.1694	L	0.27053	0.805	0.09310	N	1	B	0.29162	0.235	B	0.39840	0.311	T	0.52215	-0.8605	10	0.44086	T	0.13	-1.0163	13.4756	0.61306	0.1558:0.8442:0.0:0.0	.	6	Q9C0C6	K1737_HUMAN	R	6	ENSP00000355319:P6R;ENSP00000451997:P6R;ENSP00000450972:P6R;ENSP00000451522:P6R;ENSP00000452589:P6R;ENSP00000452380:P6R;ENSP00000451493:P6R	ENSP00000355319:P6R	P	+	2	0	KIAA1737	76641821	0.008000	0.16893	0.140000	0.22221	0.641000	0.38312	1.415000	0.34748	2.661000	0.90470	0.637000	0.83480	CCA	KIAA1737	-	NULL	ENSG00000198894		0.473	KIAA1737-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1737	HGNC	protein_coding	OTTHUMT00000414278.1	-	0.00	58	0	C			77572068	+1	tier1	-	no_errors	ENST00000361786	ensembl	human	known	74_37	missense	28.85	37	15	SNP	0.073	G
KIF26B	55083	genome.wustl.edu	37	1	245849500	245849500	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr1:245849500G>T	ENST00000407071.2	+	12	3655	c.3215G>T	c.(3214-3216)aGc>aTc	p.S1072I	KIF26B_ENST00000366518.4_Missense_Mutation_p.S691I	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	1072					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			GGCATCGCCAGCCTGTCCAAG	0.667																																																	0													26.0	32.0	30.0					1																	245849500		1959	4125	6084	SO:0001583	missense	0			AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.3215G>T	1.37:g.245849500G>T	ENSP00000385545:p.Ser1072Ile		Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.S1072I	ENST00000407071.2	37	c.3215	CCDS44342.1	1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.272888	0.80580	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	T;T	0.80824	-1.42;-1.41	5.77	5.77	0.91146	.	.	.	.	.	D	0.89996	0.6877	M	0.73962	2.25	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.996	D	0.89380	0.3681	9	0.52906	T	0.07	.	19.9961	0.97386	0.0:0.0:1.0:0.0	.	691;1072	B7WPD9;Q2KJY2	.;KI26B_HUMAN	I	1072;691;688	ENSP00000385545:S1072I;ENSP00000355475:S691I	ENSP00000355475:S691I	S	+	2	0	KIF26B	243916123	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.754000	0.98908	2.744000	0.94065	0.561000	0.74099	AGC	KIF26B	-	NULL	ENSG00000162849		0.667	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF26B	HGNC	protein_coding	OTTHUMT00000381037.1	-	0.00	14	0	G	XM_371354		245849500	+1	tier1	-	no_errors	ENST00000407071	ensembl	human	known	74_37	missense	59.09	9	13	SNP	1.000	T
KIR3DL1	3811	genome.wustl.edu	37	19	55329985	55329985	+	Silent	SNP	C	C	A	rs200379896	byFrequency	TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr19:55329985C>A	ENST00000391728.4	+	3	319	c.286C>A	c.(286-288)Cgg>Agg	p.R96R	KIR3DL1_ENST00000538269.1_Silent_p.R96R|KIR3DL1_ENST00000541392.1_Silent_p.R96R|KIR3DL1_ENST00000402254.2_Silent_p.R96R|KIR3DL1_ENST00000358178.4_Intron|KIR3DL1_ENST00000326542.7_Silent_p.R96R	NM_013289.2	NP_037421.2	P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1	96	Ig-like C2-type 1.				immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		CTACACATGTCGGGGTTCACA	0.557																																																	0													60.0	62.0	61.0					19																	55329985		2174	4116	6290	SO:0001819	synonymous_variant	0			L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000391728.4:c.286C>A	19.37:g.55329985C>A			O43473|Q14946|Q16541	Silent	SNP	pfam_Immunoglobulin,smart_Ig_sub	p.R96	ENST00000391728.4	37	c.286	CCDS42621.1	19																																																																																			KIR3DL1	-	pfam_Immunoglobulin,smart_Ig_sub	ENSG00000167633		0.557	KIR3DL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIR3DL1	HGNC	protein_coding	OTTHUMT00000141238.1	-	0.00	61	0	C	NM_013289		55329985	+1	tier1	-	no_errors	ENST00000402254	ensembl	human	known	74_37	silent	21.13	56	15	SNP	0.000	A
KLC2	64837	genome.wustl.edu	37	11	66032654	66032654	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr11:66032654A>G	ENST00000417856.1	+	11	1525	c.1282A>G	c.(1282-1284)Agc>Ggc	p.S428G	KLC2_ENST00000421552.1_Missense_Mutation_p.S351G|KLC2_ENST00000394066.2_Missense_Mutation_p.S351G|KLC2_ENST00000394067.2_Missense_Mutation_p.S428G|KLC2_ENST00000394078.1_Intron|KLC2_ENST00000394065.2_Missense_Mutation_p.S289G|KLC2_ENST00000316924.5_Missense_Mutation_p.S428G|RP11-867G23.2_ENST00000533287.1_RNA|RP11-867G23.1_ENST00000530805.1_RNA	NM_001134775.1	NP_001128247.1	Q9H0B6	KLC2_HUMAN	kinesin light chain 2	428					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon cargo transport (GO:0008088)|blood coagulation (GO:0007596)|microtubule-based movement (GO:0007018)	ciliary rootlet (GO:0035253)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinesin I complex (GO:0016938)|membrane (GO:0016020)|microtubule (GO:0005874)|neuron projection (GO:0043005)|protein complex (GO:0043234)	kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)			breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	24						GCGCCGGGACAGCGCCCCCTA	0.662											OREG0021098	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													54.0	63.0	60.0					11																	66032654		2200	4295	6495	SO:0001583	missense	0			AK022449	CCDS8130.1, CCDS44653.1	11q13.1	2013-01-10			ENSG00000174996	ENSG00000174996		"""Tetratricopeptide (TTC) repeat domain containing"""	20716	protein-coding gene	gene with protein product		611729				9624122	Standard	NM_022822		Approved	FLJ12387	uc001ohb.2	Q9H0B6	OTTHUMG00000133757	ENST00000417856.1:c.1282A>G	11.37:g.66032654A>G	ENSP00000399403:p.Ser428Gly	1088	A8MXL7|B2RDY4|Q9H9C8|Q9HA20	Missense_Mutation	SNP	pfam_Rabaptin_Rab5-bd_dom,pfam_TPR_1,smart_TPR_repeat,prints_Kinesin_light,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.S428G	ENST00000417856.1	37	c.1282	CCDS8130.1	11	.	.	.	.	.	.	.	.	.	.	A	15.42	2.827014	0.50739	.	.	ENSG00000174996	ENST00000417856;ENST00000394067;ENST00000316924;ENST00000421552;ENST00000394066;ENST00000394065	T;T;T;T;T;D	0.83506	-1.08;-1.08;-1.08;-1.08;-1.08;-1.73	4.37	3.19	0.36642	.	0.228743	0.37348	N	0.002130	T	0.60183	0.2249	N	0.03903	-0.33	0.39449	D	0.967375	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.57195	-0.7853	10	0.33141	T	0.24	-24.6533	7.0626	0.25133	0.8143:0.0:0.1857:0.0	.	289;351;428	A8MZ87;A8MXL7;Q9H0B6	.;.;KLC2_HUMAN	G	428;428;428;351;351;289	ENSP00000399403:S428G;ENSP00000377631:S428G;ENSP00000314837:S428G;ENSP00000408484:S351G;ENSP00000377630:S351G;ENSP00000377629:S289G	ENSP00000314837:S428G	S	+	1	0	KLC2	65789230	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	1.626000	0.37039	1.831000	0.53308	0.459000	0.35465	AGC	KLC2	-	NULL	ENSG00000174996		0.662	KLC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	KLC2	HGNC	protein_coding	OTTHUMT00000258200.1		0.00	64	0	A	NM_022822		66032654	+1			no_errors	ENST00000316924	ensembl	human	known	74_37	missense	5.26	72	4	SNP	0.998	G
KRT79	338785	genome.wustl.edu	37	12	53223862	53223862	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr12:53223862C>T	ENST00000330553.5	-	4	834	c.800G>A	c.(799-801)gGc>gAc	p.G267D		NM_175834.2	NP_787028.1	Q5XKE5	K2C79_HUMAN	keratin 79	267	Coil 1B.|Rod.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	enzyme binding (GO:0019899)|structural molecule activity (GO:0005198)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GCCCACTTTGCCATGCAGATC	0.547																																																	0													146.0	120.0	129.0					12																	53223862		2203	4300	6503	SO:0001583	missense	0			AJ564105	CCDS8839.1	12q13.13	2014-02-12	2007-07-03		ENSG00000185640	ENSG00000185640		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28930	protein-coding gene	gene with protein product	"""keratin 6-like"""	611160				11683385	Standard	NM_175834		Approved	K6L, KRT6L	uc001sbb.3	Q5XKE5	OTTHUMG00000169878	ENST00000330553.5:c.800G>A	12.37:g.53223862C>T	ENSP00000328358:p.Gly267Asp		Q6P465|Q7Z793	Missense_Mutation	SNP	pfam_IF,superfamily_STAT_TF_coiled-coil,prints_Keratin_II	p.G267D	ENST00000330553.5	37	c.800	CCDS8839.1	12	.	.	.	.	.	.	.	.	.	.	C	18.92	3.724980	0.68959	.	.	ENSG00000185640	ENST00000330553	D	0.88431	-2.38	4.54	4.54	0.55810	Filament (1);	0.304109	0.23760	N	0.044833	T	0.81259	0.4785	N	0.14661	0.345	0.38174	D	0.939405	P	0.34615	0.459	B	0.38755	0.281	D	0.83535	0.0093	10	0.87932	D	0	.	11.0019	0.47611	0.0:0.8118:0.1881:0.0	.	267	Q5XKE5	K2C79_HUMAN	D	267	ENSP00000328358:G267D	ENSP00000328358:G267D	G	-	2	0	KRT79	51510129	0.002000	0.14202	0.127000	0.21898	0.031000	0.12232	1.229000	0.32600	2.804000	0.96469	0.655000	0.94253	GGC	KRT79	-	pfam_IF	ENSG00000185640		0.547	KRT79-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT79	HGNC	protein_coding	OTTHUMT00000406376.1	-	0.00	64	0	C	NM_175834		53223862	-1	tier1	-	no_errors	ENST00000330553	ensembl	human	known	74_37	missense	5.00	76	4	SNP	0.978	T
KRTAP10-6	386674	genome.wustl.edu	37	21	46011332	46011332	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr21:46011332C>A	ENST00000400368.1	-	1	1054	c.1034G>T	c.(1033-1035)tGc>tTc	p.C345F	TSPEAR_ENST00000323084.4_Intron	NM_198688.2	NP_941961.2	P60371	KR106_HUMAN	keratin associated protein 10-6	345						keratin filament (GO:0045095)		p.C345Y(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(6)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23						CATGGGGCGGCAGAGGAGGGA	0.672																																																	1	Substitution - Missense(1)	large_intestine(1)											45.0	57.0	53.0					21																	46011332		2199	4300	6499	SO:0001583	missense	0			AB076353	CCDS42959.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000188155	ENSG00000188155		"""Keratin associated proteins"""	20523	protein-coding gene	gene with protein product			"""keratin associated protein 18-6"""	KRTAP18-6			Standard	NM_198688		Approved	KRTAP18.6, KAP18.6, KAP10.6	uc002zfm.3	P60371	OTTHUMG00000057634	ENST00000400368.1:c.1034G>T	21.37:g.46011332C>A	ENSP00000383219:p.Cys345Phe			Missense_Mutation	SNP	NULL	p.C345F	ENST00000400368.1	37	c.1034	CCDS42959.1	21	.	.	.	.	.	.	.	.	.	.	c	8.961	0.970503	0.18659	.	.	ENSG00000188155	ENST00000400368	T	0.01159	5.25	2.84	2.84	0.33178	.	.	.	.	.	T	0.05823	0.0152	M	0.84326	2.69	0.30091	N	0.808301	D	0.89917	1.0	D	0.85130	0.997	T	0.03969	-1.0988	9	0.72032	D	0.01	.	5.7875	0.18340	0.0:0.8469:0.0:0.1531	.	345	P60371	KR106_HUMAN	F	345	ENSP00000383219:C345F	ENSP00000383219:C345F	C	-	2	0	KRTAP10-6	44835760	0.891000	0.30450	1.000000	0.80357	0.036000	0.12997	1.173000	0.31920	1.588000	0.49971	0.205000	0.17691	TGC	KRTAP10-6	-	NULL	ENSG00000188155		0.672	KRTAP10-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-6	HGNC	protein_coding	OTTHUMT00000128037.1	-	0.00	75	0	C	NM_198688		46011332	-1	tier1	-	no_errors	ENST00000400368	ensembl	human	known	74_37	missense	43.56	56	44	SNP	1.000	A
KSR2	283455	genome.wustl.edu	37	12	117977636	117977636	+	Silent	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr12:117977636C>T	ENST00000339824.5	-	10	2302	c.1575G>A	c.(1573-1575)acG>acA	p.T525T	KSR2_ENST00000425217.1_Silent_p.T496T|KSR2_ENST00000545002.1_5'UTR|KSR2_ENST00000302438.5_Silent_p.T222T			Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	525	Pro-rich.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(25)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GCGTGGAGGACGTCGTGGAGG	0.637																																																	0													93.0	115.0	108.0					12																	117977636		2154	4246	6400	SO:0001819	synonymous_variant	0			AY345972	CCDS61250.1	12q24.22-q24.23	2014-08-12			ENSG00000171435	ENSG00000171435			18610	protein-coding gene	gene with protein product		610737				12471243	Standard	NM_173598		Approved	FLJ25965	uc001two.2	Q6VAB6	OTTHUMG00000169020	ENST00000339824.5:c.1575G>A	12.37:g.117977636C>T			A0PJT2|Q3B828|Q8N775	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom	p.T525	ENST00000339824.5	37	c.1575		12																																																																																			KSR2	-	NULL	ENSG00000171435		0.637	KSR2-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	KSR2	HGNC	protein_coding	OTTHUMT00000401987.2	-	0.00	38	0	C	NM_173598		117977636	-1	tier1	-	no_errors	ENST00000339824	ensembl	human	known	74_37	silent	62.16	14	23	SNP	0.850	T
LIPH	200879	genome.wustl.edu	37	3	185245348	185245348	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr3:185245348G>C	ENST00000296252.4	-	4	693	c.552C>G	c.(550-552)ttC>ttG	p.F184L	LIPH_ENST00000424591.2_Intron	NM_139248.2	NP_640341.1	Q8WWY8	LIPH_HUMAN	lipase, member H	184			Missing (in HYPT7). {ECO:0000269|PubMed:17095700}.		lipid catabolic process (GO:0016042)	extracellular space (GO:0005615)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|phospholipase activity (GO:0004620)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(2)	20	all_cancers(143;8.87e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)			GTTTCCCGTTGAATAAAGGGC	0.532																																																	0													211.0	179.0	190.0					3																	185245348		2203	4300	6503	SO:0001583	missense	0			AY093498	CCDS3272.1	3q27	2012-07-31			ENSG00000163898	ENSG00000163898			18483	protein-coding gene	gene with protein product		607365				12213196, 12063250	Standard	XM_006713529		Approved	mPA-PLA1, PLA1B, mPA-PLA1alpha, LPDLR	uc003fpm.3	Q8WWY8	OTTHUMG00000156657	ENST00000296252.4:c.552C>G	3.37:g.185245348G>C	ENSP00000296252:p.Phe184Leu		A2IBA7|Q8TEC7	Missense_Mutation	SNP	pfam_Lipase_N,superfamily_Lipase_LipOase,pirsf_Lipoprotein_lipase_LIPH,prints_Lipase	p.F184L	ENST00000296252.4	37	c.552	CCDS3272.1	3	.	.	.	.	.	.	.	.	.	.	G	25.2	4.616515	0.87359	.	.	ENSG00000163898	ENST00000296252	D	0.91945	-2.94	5.8	4.92	0.64577	Lipase, N-terminal (1);	0.094778	0.64402	D	0.000001	D	0.96750	0.8939	H	0.95437	3.67	0.80722	D	1	D	0.71674	0.998	D	0.71414	0.973	D	0.96833	0.9612	10	0.87932	D	0	-20.6908	10.6695	0.45749	0.1465:0.0:0.8535:0.0	.	184	Q8WWY8	LIPH_HUMAN	L	184	ENSP00000296252:F184L	ENSP00000296252:F184L	F	-	3	2	LIPH	186728042	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	3.672000	0.54583	2.741000	0.93983	0.561000	0.74099	TTC	LIPH	-	pfam_Lipase_N,pirsf_Lipoprotein_lipase_LIPH	ENSG00000163898		0.532	LIPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIPH	HGNC	protein_coding	OTTHUMT00000345153.1	-	0.00	85	0	G			185245348	-1	tier1	-	no_errors	ENST00000296252	ensembl	human	known	74_37	missense	70.80	33	80	SNP	1.000	C
MUC20	200958	genome.wustl.edu	37	3	195456375	195456375	+	Intron	SNP	C	C	T	rs3762740		TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr3:195456375C>T	ENST00000447234.2	+	3	2095				MUC20_ENST00000445522.2_Intron|MUC20_ENST00000320736.6_Intron|MUC20_ENST00000436408.1_Intron	NM_001282506.1	NP_001269435.1	Q8N307	MUC20_HUMAN	mucin 20, cell surface associated						activation of MAPK activity (GO:0000187)|cellular protein metabolic process (GO:0044267)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein homooligomerization (GO:0051260)	basal plasma membrane (GO:0009925)|cell projection (GO:0042995)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)				NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)	23	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		ttagtaaagacgggatttctc	0.557																																																	0																																										SO:0001627	intron_variant	0			AB037780	CCDS63877.1	3q29	2008-08-07	2006-03-14		ENSG00000176945	ENSG00000176945		"""Mucins"""	23282	protein-coding gene	gene with protein product		610360				14565953	Standard	NM_001282506		Approved	FLJ14408, KIAA1359	uc010hzo.3	Q8N307	OTTHUMG00000155823	ENST00000447234.2:c.1970-144C>T	3.37:g.195456375C>T			Q6UX97|Q76I83|Q76I85|Q86ST8|Q8NBY6|Q96KA1|Q9P2I8	RNA	SNP	-	NULL	ENST00000447234.2	37	NULL		3																																																																																			LINC00969	-	-	ENSG00000242086		0.557	MUC20-001	KNOWN	basic|appris_candidate	protein_coding	LINC00969	HGNC	protein_coding	OTTHUMT00000341835.1	-	0.00	9	0	C	NM_152673		195456375	+1	tier1	rs3762740	no_errors	ENST00000594446	ensembl	human	known	74_37	rna	57.14	3	4	SNP	0.002	T
LMX1A	4009	genome.wustl.edu	37	1	165322387	165322387	+	Silent	SNP	G	G	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr1:165322387G>T	ENST00000342310.3	-	3	571	c.189C>A	c.(187-189)gcC>gcA	p.A63A	LMX1A_ENST00000367893.4_Silent_p.A63A|LMX1A_ENST00000294816.2_Silent_p.A63A	NM_177398.3	NP_796372.1	Q8TE12	LMX1A_HUMAN	LIM homeobox transcription factor 1, alpha	63	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				axon guidance (GO:0007411)|central nervous system neuron differentiation (GO:0021953)|cerebellum development (GO:0021549)|dentate gyrus development (GO:0021542)|dopaminergic neuron differentiation (GO:0071542)|midbrain development (GO:0030901)|negative regulation of neuron differentiation (GO:0045665)|regulation of cell growth (GO:0001558)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(2)|biliary_tract(1)|central_nervous_system(3)|cervix(2)|endometrium(4)|large_intestine(6)|lung(10)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)	35	all_hematologic(923;0.248)					CTTTGCAGGAGGCGCACTGCA	0.602																																																	0													83.0	80.0	81.0					1																	165322387		2203	4300	6503	SO:0001819	synonymous_variant	0			AY078391	CCDS1247.1	1q24.1	2011-06-20			ENSG00000162761	ENSG00000162761		"""Homeoboxes / LIM class"""	6653	protein-coding gene	gene with protein product		600298		LMX1		7698771	Standard	NM_177398		Approved	LMX1.1	uc001gcz.2	Q8TE12	OTTHUMG00000034575	ENST00000342310.3:c.189C>A	1.37:g.165322387G>T			B3KXP6|Q0VDB5|Q5VWG4|Q8TE11	Silent	SNP	pfam_Znf_LIM,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Znf_LIM,smart_Homeobox_dom,pfscan_Znf_LIM,pfscan_Homeobox_dom	p.A63	ENST00000342310.3	37	c.189	CCDS1247.1	1																																																																																			LMX1A	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	ENSG00000162761		0.602	LMX1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMX1A	HGNC	protein_coding	OTTHUMT00000083668.2	-	0.00	67	0	G	NM_177398		165322387	-1	tier1	-	no_errors	ENST00000294816	ensembl	human	known	74_37	silent	7.14	65	5	SNP	1.000	T
LOC100128239	100128239	genome.wustl.edu	37	11	133902537	133902538	+	lincRNA	DNP	GC	GC	AA			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G|C	G|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr11:133902537_133902538GC>AA	ENST00000533922.1	+	0	371_372					NR_027276.1																						TCCAGGCCCAGCACAGCCTCCT	0.653																																																	0																																												0																														Exception_encountered	11.37:g.133902537_133902538delinsAA				RNA	SNP	-	NULL	ENST00000533922.1	37	NULL		11																																																																																			RP11-713P17.3	-	-	ENSG00000204241		0.653	RP11-713P17.3-001	KNOWN	mRNA_end_NF|basic	lincRNA	LOC100128239	Clone_based_vega_gene	lincRNA	OTTHUMT00000393290.1	-	0.00	39	0	G|C			133902537|133902538	+1	tier1	-	no_errors	ENST00000532706	ensembl	human	known	74_37	rna	30.65	43	19	SNP	0.735|0.010	A
FAR2	55711	genome.wustl.edu	37	12	29460831	29460831	+	Intron	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr12:29460831C>T	ENST00000536681.3	+	5	969				FAR2_ENST00000547116.1_Intron|RP11-996F15.2_ENST00000553105.1_RNA|FAR2_ENST00000182377.4_Intron	NM_001271783.1|NM_001271784.1	NP_001258712.1|NP_001258713.1	Q96K12	FACR2_HUMAN	fatty acyl CoA reductase 2						cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	fatty-acyl-CoA reductase (alcohol-forming) activity (GO:0080019)|long-chain-fatty-acyl-CoA reductase activity (GO:0050062)			central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|prostate(1)|stomach(1)	29						AGTCCAATTACTTTCTGATGT	0.438																																																	0																																										SO:0001627	intron_variant	0			AL136843	CCDS8717.1, CCDS61084.1	12p11.23	2013-07-30	2008-06-06	2008-06-06	ENSG00000064763	ENSG00000064763	1.2.1.-	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	25531	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 10E, member 2"""		"""male sterility domain containing 1"""	MLSTD1		15220348, 15220349, 19027726	Standard	NM_001271783		Approved	FLJ10462, SDR10E2	uc001ris.5	Q96K12	OTTHUMG00000169320	ENST00000536681.3:c.723+63C>T	12.37:g.29460831C>T			F8VV73|Q9H0D5|Q9NVW8	RNA	SNP	-	NULL	ENST00000536681.3	37	NULL	CCDS8717.1	12																																																																																			RP11-996F15.2	-	-	ENSG00000257176		0.438	FAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100506606	Clone_based_vega_gene	protein_coding	OTTHUMT00000403479.2	-	0.00	58	0	C	NM_018099		29460831	-1	tier1	-	no_errors	ENST00000553105	ensembl	human	known	74_37	rna	8.00	46	4	SNP	0.000	T
FAR2	55711	genome.wustl.edu	37	12	29460854	29460854	+	Intron	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr12:29460854C>T	ENST00000536681.3	+	5	969				FAR2_ENST00000547116.1_Intron|RP11-996F15.2_ENST00000553105.1_RNA|FAR2_ENST00000182377.4_Intron	NM_001271783.1|NM_001271784.1	NP_001258712.1|NP_001258713.1	Q96K12	FACR2_HUMAN	fatty acyl CoA reductase 2						cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	fatty-acyl-CoA reductase (alcohol-forming) activity (GO:0080019)|long-chain-fatty-acyl-CoA reductase activity (GO:0050062)			central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|prostate(1)|stomach(1)	29						TTCTTCTTCTCCTCCTCAGGA	0.433																																																	0																																										SO:0001627	intron_variant	0			AL136843	CCDS8717.1, CCDS61084.1	12p11.23	2013-07-30	2008-06-06	2008-06-06	ENSG00000064763	ENSG00000064763	1.2.1.-	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	25531	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 10E, member 2"""		"""male sterility domain containing 1"""	MLSTD1		15220348, 15220349, 19027726	Standard	NM_001271783		Approved	FLJ10462, SDR10E2	uc001ris.5	Q96K12	OTTHUMG00000169320	ENST00000536681.3:c.723+86C>T	12.37:g.29460854C>T			F8VV73|Q9H0D5|Q9NVW8	RNA	SNP	-	NULL	ENST00000536681.3	37	NULL	CCDS8717.1	12																																																																																			RP11-996F15.2	-	-	ENSG00000257176		0.433	FAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100506606	Clone_based_vega_gene	protein_coding	OTTHUMT00000403479.2	-	0.00	43	0	C	NM_018099		29460854	-1	tier1	-	no_errors	ENST00000553105	ensembl	human	known	74_37	rna	10.81	33	4	SNP	0.000	T
LRBA	987	genome.wustl.edu	37	4	151357951	151357951	+	Missense_Mutation	SNP	A	A	T	rs138518902		TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr4:151357951A>T	ENST00000357115.3	-	46	7122	c.6879T>A	c.(6877-6879)gaT>gaA	p.D2293E	LRBA_ENST00000535741.1_Missense_Mutation_p.D2282E|LRBA_ENST00000510413.1_Missense_Mutation_p.D2282E|LRBA_ENST00000507224.1_Missense_Mutation_p.D2282E|LRBA_ENST00000503716.1_5'UTR	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	2293	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.					cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					GAACTTGATCATCTTCCCATG	0.393																																																	0								A	GLU/ASP,GLU/ASP	1,4405	2.1+/-5.4	0,1,2202	97.0	85.0	89.0		6879,6879	-2.5	1.0	4	dbSNP_134	89	0,8600		0,0,4300	no	missense,missense	LRBA	NM_001199282.2,NM_006726.4	45,45	0,1,6502	TT,TA,AA		0.0,0.0227,0.0077	probably-damaging,probably-damaging	2293/2864,2293/2864	151357951	1,13005	2203	4300	6503	SO:0001583	missense	0			AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.6879T>A	4.37:g.151357951A>T	ENSP00000349629:p.Asp2293Glu		Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_DUF1088,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_ConA-like_lec_gl_sf,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom	p.D2293E	ENST00000357115.3	37	c.6879	CCDS3773.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.93|15.93	2.977662|2.977662	0.53720|0.53720	2.27E-4|2.27E-4	0.0|0.0	ENSG00000198589|ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224|ENST00000509835	T;T;T;T|.	0.63096|.	-0.02;-0.02;-0.02;-0.02|.	5.93|5.93	-2.53|-2.53	0.06326|0.06326	BEACH domain (4);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.51312|0.51312	0.1667|0.1667	L|L	0.35793|0.35793	1.09|1.09	0.80722|0.80722	D|D	1|1	P;B;B|.	0.40282|.	0.711;0.004;0.002|.	B;B;B|.	0.37508|.	0.252;0.015;0.006|.	T|T	0.42865|0.42865	-0.9426|-0.9426	10|5	0.56958|.	D|.	0.05|.	.|.	13.2165|13.2165	0.59863|0.59863	0.6591:0.0:0.3409:0.0|0.6591:0.0:0.3409:0.0	.|.	2293;2282;183|.	P50851;P50851-2;Q68D03|.	LRBA_HUMAN;.;.|.	E|K	2282;2282;2293;2282|935	ENSP00000446299:D2282E;ENSP00000421552:D2282E;ENSP00000349629:D2293E;ENSP00000422180:D2282E|.	ENSP00000349629:D2293E|.	D|M	-|-	3|2	2|0	LRBA|LRBA	151577401|151577401	0.997000|0.997000	0.39634|0.39634	0.974000|0.974000	0.42286|0.42286	0.873000|0.873000	0.50193|0.50193	0.788000|0.788000	0.26872|0.26872	-0.644000|-0.644000	0.05465|0.05465	-2.021000|-2.021000	0.00431|0.00431	GAT|ATG	LRBA	-	pfam_BEACH_dom,superfamily_BEACH_dom,pfscan_BEACH_dom	ENSG00000198589		0.393	LRBA-002	KNOWN	basic|CCDS	protein_coding	LRBA	HGNC	protein_coding	OTTHUMT00000364939.1	-	0.00	52	0	A			151357951	-1	tier1	rs138518902	no_errors	ENST00000357115	ensembl	human	known	74_37	missense	20.29	55	14	SNP	0.940	T
LRP6	4040	genome.wustl.edu	37	12	12397568	12397568	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr12:12397568G>A	ENST00000261349.4	-	2	153	c.77C>T	c.(76-78)gCa>gTa	p.A26V	LRP6_ENST00000543091.1_Missense_Mutation_p.A26V	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	26	Beta-propeller 1.				anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				CCGTCTGTTTGCATAAAGCAA	0.418																																																	0													69.0	64.0	65.0					12																	12397568		2203	4300	6503	SO:0001583	missense	0			AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.77C>T	12.37:g.12397568G>A	ENSP00000261349:p.Ala26Val		Q17RZ2	Missense_Mutation	SNP	pirsf_Low_density_Lipo_rcpt-rel_p5/6,pfam_LDLR_classB_rpt,pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDLR_classB_rpt,smart_EG-like_dom,smart_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.A26V	ENST00000261349.4	37	c.77	CCDS8647.1	12	.	.	.	.	.	.	.	.	.	.	G	26.1	4.709149	0.89018	.	.	ENSG00000070018	ENST00000261349;ENST00000543091	D;D	0.91631	-2.88;-2.88	4.8	4.8	0.61643	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.48767	U	0.000167	D	0.96800	0.8955	M	0.92026	3.265	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.75020	0.978;0.985	D	0.96947	0.9692	10	0.49607	T	0.09	.	18.1251	0.89583	0.0:0.0:1.0:0.0	.	26;26	F5H7J9;O75581	.;LRP6_HUMAN	V	26	ENSP00000261349:A26V;ENSP00000442472:A26V	ENSP00000261349:A26V	A	-	2	0	LRP6	12288835	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.260000	0.95568	2.524000	0.85096	0.454000	0.30748	GCA	LRP6	-	pirsf_Low_density_Lipo_rcpt-rel_p5/6	ENSG00000070018		0.418	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP6	HGNC	protein_coding	OTTHUMT00000400137.1	-	0.00	56	0	G			12397568	-1	tier1	-	no_errors	ENST00000261349	ensembl	human	known	74_37	missense	9.30	39	4	SNP	1.000	A
LRRC69	100130742	genome.wustl.edu	37	8	92145500	92145500	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr8:92145500G>T	ENST00000448384.2	+	4	546	c.546G>T	c.(544-546)ttG>ttT	p.L182F	LRRC69_ENST00000343709.3_Intron	NM_001129890.1	NP_001123362.1	Q6ZNQ3	LRC69_HUMAN	leucine rich repeat containing 69	182										endometrium(1)	1						AGAAGCTTTTGCTAGCCAGAA	0.388																																																	0													46.0	40.0	42.0					8																	92145500		692	1591	2283	SO:0001583	missense	0			AK130865		8q21.3	2010-07-14			ENSG00000214954	ENSG00000214954			34303	protein-coding gene	gene with protein product							Standard	NM_001129890		Approved		uc010mal.1	Q6ZNQ3	OTTHUMG00000164023	ENST00000448384.2:c.546G>T	8.37:g.92145500G>T	ENSP00000400803:p.Leu182Phe			Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.L182F	ENST00000448384.2	37	c.546		8	.	.	.	.	.	.	.	.	.	.	G	0.011	-1.694627	0.00731	.	.	ENSG00000214954	ENST00000448384	T	0.24723	1.84	5.24	0.388	0.16264	.	.	.	.	.	T	0.09818	0.0241	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.38628	-0.9652	9	0.10111	T	0.7	2.3971	5.0688	0.14596	0.0:0.2365:0.1588:0.6046	.	182	Q6ZNQ3	LRC69_HUMAN	F	182	ENSP00000400803:L182F	ENSP00000400803:L182F	L	+	3	2	LRRC69	92214676	0.057000	0.20700	0.053000	0.19242	0.104000	0.19210	0.084000	0.14891	0.334000	0.23590	-0.485000	0.04761	TTG	LRRC69	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000214954		0.388	LRRC69-007	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	LRRC69	HGNC	protein_coding	OTTHUMT00000415207.1	-	0.00	89	0	G	NM_001129890		92145500	+1	tier1	-	no_errors	ENST00000448384	ensembl	human	novel	74_37	missense	5.00	76	4	SNP	0.045	T
MAL	4118	genome.wustl.edu	37	2	95691529	95691529	+	5'UTR	SNP	C	C	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr2:95691529C>A	ENST00000309988.4	+	0	101				AC103563.8_ENST00000448734.1_RNA|MAL_ENST00000354078.3_5'Flank|MAL_ENST00000489399.1_3'UTR|MAL_ENST00000349807.3_5'Flank|MAL_ENST00000353004.3_5'Flank	NM_002371.3	NP_002362.1	P21145	MAL_HUMAN	mal, T-cell differentiation protein						apical protein localization (GO:0045176)|apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|central nervous system development (GO:0007417)|membrane raft polarization (GO:0001766)|myelination (GO:0042552)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extrinsic component of membrane (GO:0019898)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	channel activity (GO:0015267)|lipid binding (GO:0008289)|peptidase activator activity involved in apoptotic process (GO:0016505)|structural constituent of myelin sheath (GO:0019911)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|prostate(2)	10				STAD - Stomach adenocarcinoma(1183;0.18)		CCGACGCCAGCACGCCGTCAT	0.721																																																	0													51.0	47.0	49.0					2																	95691529		2154	4218	6372	SO:0001623	5_prime_UTR_variant	0				CCDS2006.1, CCDS2007.1, CCDS2008.1, CCDS2009.1	2q11.1	2008-07-29			ENSG00000172005	ENSG00000172005			6817	protein-coding gene	gene with protein product		188860					Standard	NM_002371		Approved		uc002stx.2	P21145	OTTHUMG00000132011	ENST00000309988.4:c.-9C>A	2.37:g.95691529C>A			Q6FH77	RNA	SNP	-	NULL	ENST00000309988.4	37	NULL	CCDS2006.1	2																																																																																			MAL	-	-	ENSG00000172005		0.721	MAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAL	HGNC	protein_coding	OTTHUMT00000254982.3	-	0.00	16	0	C	NM_002371		95691529	+1	tier1	-	no_errors	ENST00000489399	ensembl	human	known	74_37	rna	62.50	6	10	SNP	0.386	A
MAP3K8	1326	genome.wustl.edu	37	10	30739243	30739243	+	Silent	SNP	C	C	T	rs569267728		TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr10:30739243C>T	ENST00000263056.1	+	5	1257	c.561C>T	c.(559-561)caC>caT	p.H187H	MAP3K8_ENST00000542547.1_Silent_p.H187H|MAP3K8_ENST00000375321.1_Silent_p.H187H	NM_001244134.1|NM_005204.3	NP_001231063.1|NP_005195.2	P41279	M3K8_HUMAN	mitogen-activated protein kinase kinase kinase 8	187	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|protein phosphorylation (GO:0006468)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23		Prostate(175;0.151)				GCTTCCGGCACGAGAACATCG	0.478																																																	0													108.0	106.0	106.0					10																	30739243		2203	4300	6503	SO:0001819	synonymous_variant	0			D14497	CCDS7166.1	10p11.2	2011-06-09			ENSG00000107968	ENSG00000107968		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6860	protein-coding gene	gene with protein product		191195		COT, ESTF		2072910, 8479752	Standard	NM_005204		Approved	Tpl-2, EST, c-COT, MEKK8	uc009xlf.2	P41279	OTTHUMG00000017889	ENST00000263056.1:c.561C>T	10.37:g.30739243C>T			A8K2Q5|D3DRX1|Q14275|Q5T855|Q9HC81	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.H187	ENST00000263056.1	37	c.561	CCDS7166.1	10	.	.	.	.	.	.	.	.	.	.	C	8.037	0.763043	0.15914	.	.	ENSG00000107968	ENST00000430603	.	.	.	5.06	-4.36	0.03645	.	.	.	.	.	T	0.63082	0.2481	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62937	-0.6748	4	.	.	.	.	14.4608	0.67448	0.0:0.3902:0.0:0.6098	.	.	.	.	M	108	.	.	T	+	2	0	MAP3K8	30779249	0.000000	0.05858	0.964000	0.40570	0.748000	0.42578	-2.597000	0.00894	-0.839000	0.04212	-0.143000	0.13931	ACG	MAP3K8	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000107968		0.478	MAP3K8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MAP3K8	HGNC	protein_coding	OTTHUMT00000047416.2	-	0.00	58	0	C	NM_005204		30739243	+1	tier1	-	no_errors	ENST00000263056	ensembl	human	known	74_37	silent	21.28	37	10	SNP	0.972	T
MDM2	4193	genome.wustl.edu	37	12	69229656	69229656	+	Silent	SNP	G	G	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr12:69229656G>A	ENST00000350057.5	+	7	639	c.639G>A	c.(637-639)caG>caA	p.Q213Q	MDM2_ENST00000517852.1_Intron|MDM2_ENST00000428863.2_Silent_p.Q43Q|MDM2_ENST00000478070.1_Intron|MDM2_ENST00000540827.1_Silent_p.Q43Q|MDM2_ENST00000544561.1_Intron|MDM2_ENST00000356290.4_Silent_p.Q68Q|MDM2_ENST00000393412.3_Intron|MDM2_ENST00000258149.5_Silent_p.Q183Q|MDM2_ENST00000462284.1_Silent_p.Q244Q|MDM2_ENST00000393410.1_Intron|MDM2_ENST00000258148.7_Silent_p.Q189Q|MDM2_ENST00000360430.2_Silent_p.Q43Q|MDM2_ENST00000545204.1_Intron|MDM2_ENST00000348801.2_Silent_p.Q38Q|MDM2_ENST00000299252.4_Silent_p.Q68Q|MDM2_ENST00000393413.3_Intron			Q00987	MDM2_HUMAN	MDM2 proto-oncogene, E3 ubiquitin protein ligase	238	ARF-binding.|Interaction with MTBP. {ECO:0000250}.|Interaction with PYHIN1 and necessary for interaction with RFFL and RNF34. {ECO:0000269|PubMed:16479015, ECO:0000269|PubMed:18382127}.|Poly-Ser.				cellular response to acid chemical (GO:0071229)|cellular response to alkaloid (GO:0071312)|cellular response to antibiotic (GO:0071236)|cellular response to estrogen stimulus (GO:0071391)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to UV-C (GO:0071494)|cellular response to vitamin B1 (GO:0071301)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment of protein localization (GO:0045184)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of protein processing (GO:0010955)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-lysine modification (GO:0018205)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein export from nucleus (GO:0046827)|protein complex assembly (GO:0006461)|protein destabilization (GO:0031648)|protein localization to nucleus (GO:0034504)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of protein catabolic process (GO:0042176)|response to antibiotic (GO:0046677)|response to carbohydrate (GO:0009743)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ether (GO:0045472)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to morphine (GO:0043278)|synaptic transmission (GO:0007268)|traversing start control point of mitotic cell cycle (GO:0007089)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|p53 binding (GO:0002039)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(8)|prostate(1)|urinary_tract(1)	19	all_cancers(1;8.46e-121)|all_epithelial(5;3.21e-36)|Lung NSC(4;2.16e-33)|all_lung(4;3.03e-31)|Glioma(1;1.9e-09)|Breast(13;1.59e-06)|all_neural(1;1.03e-05)|Melanoma(1;0.0171)|Renal(347;0.0684)		all cancers(2;8.67e-65)|GBM - Glioblastoma multiforme(2;8.89e-62)|BRCA - Breast invasive adenocarcinoma(5;2.43e-08)|Lung(24;1.5e-05)|LUAD - Lung adenocarcinoma(15;8.5e-05)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)			GGTTGGATCAGGATTCAGTTT	0.358			A		"""sarcoma, glioma, colorectal, other"""																																			Dom	yes		12	12q15	4193	Mdm2 p53 binding protein homolog		"""M, O, E, L"""	0													221.0	206.0	210.0					12																	69229656		1853	4114	5967	SO:0001819	synonymous_variant	0				CCDS8986.2, CCDS61189.1	12q13-q14	2014-06-26	2014-06-26		ENSG00000135679	ENSG00000135679			6973	protein-coding gene	gene with protein product		164785	"""mouse double minute 2, human homolog of; p53-binding protein"", ""Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse)"", ""Mdm2 p53 binding protein homolog (mouse)"""			1614537, 16905769	Standard	NM_002392		Approved	HDM2, MGC5370	uc001sui.4	Q00987	OTTHUMG00000142827	ENST00000350057.5:c.639G>A	12.37:g.69229656G>A			A6NL51|A8K2S6|Q13226|Q13297|Q13298|Q13299|Q13300|Q13301|Q53XW0|Q71TW9|Q8WYJ1|Q8WYJ2|Q9UGI3|Q9UMT8	Silent	SNP	pfam_SWIB_MDM2_domain,pfam_Znf_RanBP2,superfamily_SWIB_MDM2_domain,pirsf_p53_neg-reg_MDM_2/4,pfscan_Znf_RanBP2,pfscan_Znf_RING	p.Q244	ENST00000350057.5	37	c.732		12																																																																																			MDM2	-	superfamily_SWIB_MDM2_domain,pirsf_p53_neg-reg_MDM_2/4	ENSG00000135679		0.358	MDM2-033	NOVEL	basic|exp_conf	protein_coding	MDM2	HGNC	protein_coding	OTTHUMT00000402665.1	-	0.00	63	0	G	NM_006880		69229656	+1	tier1	-	no_errors	ENST00000462284	ensembl	human	known	74_37	silent	15.62	54	10	SNP	1.000	A
MED13	9969	genome.wustl.edu	37	17	60033165	60033165	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr17:60033165C>A	ENST00000397786.2	-	25	5734	c.5658G>T	c.(5656-5658)caG>caT	p.Q1886H		NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	1886					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						TACTTAGAGACTGCAAGTTTC	0.388																																																	0													90.0	90.0	90.0					17																	60033165		1885	4112	5997	SO:0001583	missense	0			AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.5658G>T	17.37:g.60033165C>A	ENSP00000380888:p.Gln1886His		B2RU05|O60334	Missense_Mutation	SNP	pfam_Mediator_Med13,pfam_Mediator_Med13_N_met/fun	p.Q1886H	ENST00000397786.2	37	c.5658	CCDS42366.1	17	.	.	.	.	.	.	.	.	.	.	C	17.63	3.437878	0.62955	.	.	ENSG00000108510	ENST00000397786;ENST00000262436	T	0.75367	-0.93	5.65	0.0543	0.14310	.	0.000000	0.85682	D	0.000000	T	0.79423	0.4443	L	0.55103	1.725	0.80722	D	1	D	0.71674	0.998	D	0.83275	0.996	T	0.74680	-0.3584	10	0.33940	T	0.23	-5.0503	10.7783	0.46363	0.0:0.682:0.0:0.318	.	1886	Q9UHV7	MED13_HUMAN	H	1886;1885	ENSP00000380888:Q1886H	ENSP00000262436:Q1885H	Q	-	3	2	MED13	57387947	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	0.914000	0.28624	0.060000	0.16281	0.467000	0.42956	CAG	MED13	-	pfam_Mediator_Med13	ENSG00000108510		0.388	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED13	HGNC	protein_coding	OTTHUMT00000445461.1	-	0.00	24	0	C	NM_005121		60033165	-1	tier1	-	no_errors	ENST00000397786	ensembl	human	known	74_37	missense	37.14	22	13	SNP	1.000	A
MIOS	54468	genome.wustl.edu	37	7	7628156	7628156	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr7:7628156A>G	ENST00000340080.4	+	8	2267	c.1846A>G	c.(1846-1848)Aga>Gga	p.R616G	MIOS_ENST00000405785.1_Missense_Mutation_p.R616G	NM_019005.3	NP_061878.3	Q9NXC5	MIO_HUMAN	missing oocyte, meiosis regulator, homolog (Drosophila)	616						lysosomal membrane (GO:0005765)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						AGTACGTGACAGAGTGGCATT	0.343																																																	0													98.0	97.0	98.0					7																	7628156		1854	4102	5956	SO:0001583	missense	0				CCDS43554.1	7p21.3	2011-09-12			ENSG00000164654	ENSG00000164654			21905	protein-coding gene	gene with protein product	"""WD repeat-containing protein mio"""	615359				14973288	Standard	NM_019005		Approved	FLJ20323	uc003srf.3	Q9NXC5	OTTHUMG00000152440	ENST00000340080.4:c.1846A>G	7.37:g.7628156A>G	ENSP00000339881:p.Arg616Gly		B2RTV6|O75216|Q7L551|Q9H092	Missense_Mutation	SNP	smart_WD40_repeat	p.R616G	ENST00000340080.4	37	c.1846	CCDS43554.1	7	.	.	.	.	.	.	.	.	.	.	A	19.34	3.809732	0.70797	.	.	ENSG00000164654	ENST00000340080;ENST00000405785	T;T	0.67171	-0.25;-0.25	5.26	2.67	0.31697	.	0.000000	0.85682	D	0.000000	T	0.82093	0.4962	M	0.87038	2.855	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84588	0.0665	10	0.87932	D	0	-20.9955	12.0538	0.53522	0.5861:0.4139:0.0:0.0	.	616	Q9NXC5	MIO_HUMAN	G	616	ENSP00000339881:R616G;ENSP00000384088:R616G	ENSP00000339881:R616G	R	+	1	2	MIOS	7594681	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.832000	0.39151	0.927000	0.37143	0.477000	0.44152	AGA	MIOS	-	NULL	ENSG00000164654		0.343	MIOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIOS	HGNC	protein_coding	OTTHUMT00000326218.1	-	0.00	64	0	A	NM_019005		7628156	+1	tier1	-	no_errors	ENST00000340080	ensembl	human	known	74_37	missense	12.70	55	8	SNP	1.000	G
MAP2K4	6416	genome.wustl.edu	37	17	11985275	11985275	+	Intron	SNP	C	C	T	rs572154384		TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr17:11985275C>T	ENST00000353533.5	+	3	456				MAP2K4_ENST00000415385.3_Intron|MIR744_ENST00000578242.1_RNA|MAP2K4_ENST00000581941.1_Intron	NM_003010.2	NP_003001.1	P45985	MP2K4_HUMAN	mitogen-activated protein kinase kinase 4						apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to sorbitol (GO:0072709)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of DNA replication (GO:0045740)|positive regulation of neuron apoptotic process (GO:0043525)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|nucleus (GO:0005634)|perikaryon (GO:0043204)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.0?(10)|p.?(1)		NS(1)|biliary_tract(2)|breast(22)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(26)|lung(15)|ovary(8)|pancreas(11)|skin(3)|stomach(2)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	100		all_cancers(5;0.0413)|Breast(5;0.000625)|all_epithelial(5;0.00978)|all_lung(20;0.0449)|Lung NSC(33;0.163)		Epithelial(2;4.12e-09)|all cancers(2;6.86e-07)|BRCA - Breast invasive adenocarcinoma(2;8.74e-07)|Colorectal(4;5.32e-05)|COAD - Colon adenocarcinoma(4;0.0039)|READ - Rectum adenocarcinoma(10;0.0681)		CTGGAAACCACGCACATGCTG	0.552			"""D, Mis, N"""		"""pancreatic, breast, colorectal"""								C|||	1	0.000199681	0.0	0.0	5008	,	,		19271	0.0		0.0	False		,,,				2504	0.001							Rec	yes		17	17p11.2	6416	mitogen-activated protein kinase kinase 4		E	11	Whole gene deletion(10)|Unknown(1)	ovary(4)|breast(4)|biliary_tract(1)|large_intestine(1)|pancreas(1)											112.0	112.0	112.0					17																	11985275		1568	3582	5150	SO:0001627	intron_variant	0			L36870	CCDS11162.1, CCDS62095.1	17p12	2012-03-23			ENSG00000065559	ENSG00000065559	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6844	protein-coding gene	gene with protein product		601335		SERK1		7716521	Standard	NM_003010		Approved	MEK4, JNKK1, PRKMK4, MKK4	uc002gnj.3	P45985		ENST00000353533.5:c.393+428C>T	17.37:g.11985275C>T			B2R7N7|B3KYB2|D3DTS5|Q5U0B8|Q6FHX4|Q6P9H2|Q6PIE6	RNA	SNP	-	NULL	ENST00000353533.5	37	NULL	CCDS11162.1	17																																																																																			MIR744	-	-	ENSG00000266297		0.552	MAP2K4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MIR744	HGNC	protein_coding	OTTHUMT00000441226.1	-	0.00	51	0	C			11985275	+1	tier1	-	no_errors	ENST00000578242	ensembl	human	known	74_37	rna	48.33	31	29	SNP	0.960	T
MT-ND5	4540	genome.wustl.edu	37	M	13586	13586	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chrM:13586C>T	ENST00000361567.2	+	1	1250	c.1250C>T	c.(1249-1251)tCc>tTc	p.S417F	MT-TH_ENST00000387441.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-CYB_ENST00000361789.2_5'Flank			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	417					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						CATCGCTACCTCCCTGACAAG	0.463																																																	0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.1250C>T	M.37:g.13586C>T	ENSP00000354813:p.Ser417Phe		Q34773|Q8WCY3	Missense_Mutation	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.S417F	ENST00000361567.2	37	c.1250		MT																																																																																			MT-ND5	-	tigrfam_NADHpl_OxRdtase_5	ENSG00000198786		0.463	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	HGNC	protein_coding		-	0.00	10	0	C	YP_003024036		13586	+1	tier1	-	no_errors	ENST00000361567	ensembl	human	known	74_37	missense	55.56	4	5	SNP	NULL	T
MT-ND6	4541	genome.wustl.edu	37	M	14162	14162	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chrM:14162G>A	ENST00000361681.2	-	1	511	c.512C>T	c.(511-513)gCt>gTt	p.A171V	MT-TH_ENST00000387441.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-CYB_ENST00000361789.2_5'Flank			P03923	NU6M_HUMAN	mitochondrially encoded NADH dehydrogenase 6	171					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain (GO:0070469)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(10)|kidney(17)|urinary_tract(1)	29						TATTCCCCCGAGCAATCTCAA	0.403																																																	0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198695	ENSG00000198695	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7462	protein-coding gene	gene with protein product	"""complex I ND6 subunit"", ""NADH-ubiquinone oxidoreductase chain 6"""	516006	"""NADH dehydrogenase 6"""	MTND6			Standard			Approved	NAD6, ND6		P03923		ENST00000361681.2:c.512C>T	M.37:g.14162G>A	ENSP00000354665:p.Ala171Val		Q34774|Q8HG30	Missense_Mutation	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase_su6	p.A171V	ENST00000361681.2	37	c.512		MT																																																																																			MT-ND6	-	pfam_NADH_UbQ/plastoQ_OxRdtase_su6	ENSG00000198695		0.403	MT-ND6-201	KNOWN	basic|appris_principal	protein_coding	MT-ND6	HGNC	protein_coding		-	0.00	33	0	G	YP_003024037		14162	-1	tier1	-	no_errors	ENST00000361681	ensembl	human	known	74_37	missense	36.67	19	11	SNP	NULL	A
MTMR14	64419	genome.wustl.edu	37	3	9739484	9739484	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr3:9739484G>A	ENST00000296003.4	+	18	1825	c.1703G>A	c.(1702-1704)cGg>cAg	p.R568Q	MTMR14_ENST00000351233.5_Intron|MTMR14_ENST00000420925.1_Intron|MTMR14_ENST00000353332.5_Intron	NM_001077525.2	NP_001070993.1	Q8NCE2	MTMRE_HUMAN	myotubularin related protein 14	568					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(2)|lung(10)|skin(3)|upper_aerodigestive_tract(2)	21	Medulloblastoma(99;0.227)					ATTCAGGAGCGGGCTGTCCTG	0.577																																																	0													215.0	224.0	221.0					3																	9739484		2052	4193	6245	SO:0001583	missense	0			BC001674	CCDS43043.1, CCDS43044.1, CCDS43045.1	3p26	2011-06-09	2006-12-18	2006-12-18	ENSG00000163719	ENSG00000163719		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	26190	protein-coding gene	gene with protein product	"""egg-derived tyrosine phosphatase homolog (Drosophila)"""	611089	"""chromosome 3 open reading frame 29"""	C3orf29		15186772	Standard	NM_022485		Approved	FLJ22405, FLJ90311, hJumpy, hEDTP	uc003brz.3	Q8NCE2	OTTHUMG00000155111	ENST00000296003.4:c.1703G>A	3.37:g.9739484G>A	ENSP00000296003:p.Arg568Gln		Q0JTH5|Q0JU83|Q6PIZ4|Q6QE21|Q86VK9|Q8IYK1|Q8TCM7|Q9H6C0	Missense_Mutation	SNP	NULL	p.R568Q	ENST00000296003.4	37	c.1703	CCDS43043.1	3	.	.	.	.	.	.	.	.	.	.	G	15.80	2.941282	0.53079	.	.	ENSG00000163719	ENST00000296003	T	0.22539	1.95	5.75	3.96	0.45880	.	0.185394	0.49916	D	0.000137	T	0.10078	0.0247	N	0.13043	0.29	0.80722	D	1	B	0.18166	0.026	B	0.04013	0.001	T	0.16630	-1.0396	10	0.23891	T	0.37	-4.7525	5.5454	0.17061	0.3633:0.0:0.6367:0.0	.	568	Q8NCE2	MTMRE_HUMAN	Q	568	ENSP00000296003:R568Q	ENSP00000296003:R568Q	R	+	2	0	MTMR14	9714484	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	4.499000	0.60380	1.438000	0.47492	0.655000	0.94253	CGG	MTMR14	-	NULL	ENSG00000163719		0.577	MTMR14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MTMR14	HGNC	protein_coding	OTTHUMT00000338435.1	-	0.00	50	0	G	NM_022485		9739484	+1	tier1	-	no_errors	ENST00000296003	ensembl	human	known	74_37	missense	33.33	28	14	SNP	1.000	A
MUC12	10071	genome.wustl.edu	37	7	100616293	100616293	+	Missense_Mutation	SNP	G	G	A	rs202012524		TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr7:100616293G>A	ENST00000379442.3	+	3	256	c.256G>A	c.(256-258)Gtg>Atg	p.V86M	MUC12_ENST00000536621.1_Intron			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	86					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						TGGATGGAGCGTGATGTTTGC	0.517																																																	0																																										SO:0001583	missense	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.256G>A	7.37:g.100616293G>A	ENSP00000368755:p.Val86Met		A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA_dom	p.V86M	ENST00000379442.3	37	c.256		7	.	.	.	.	.	.	.	.	.	.	G	0.478	-0.881060	0.02530	.	.	ENSG00000205277	ENST00000379442	T	0.13196	2.61	0.848	-0.0672	0.13761	.	.	.	.	.	T	0.13157	0.0319	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.30851	-0.9964	6	0.87932	D	0	.	3.315	0.07030	0.308:0.0:0.692:0.0	.	.	.	.	M	86	ENSP00000368755:V86M	ENSP00000368755:V86M	V	+	1	0	MUC12	100403013	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.976000	0.03786	-0.036000	0.13669	-0.501000	0.04562	GTG	MUC12	-	NULL	ENSG00000205277		0.517	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	-	0.00	28	0	G	XM_379904		100616293	+1	tier1	rs202012524	no_errors	ENST00000379442	ensembl	human	novel	74_37	missense	15.69	43	8	SNP	0.001	A
MUC16	94025	genome.wustl.edu	37	19	9045688	9045688	+	Silent	SNP	T	T	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr19:9045688T>C	ENST00000397910.4	-	5	36146	c.35943A>G	c.(35941-35943)acA>acG	p.T11981T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	11983	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GACTGGAACCTGTGGTAGCTA	0.498																																																	0													188.0	188.0	188.0					19																	9045688		1987	4161	6148	SO:0001819	synonymous_variant	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.35943A>G	19.37:g.9045688T>C			Q6ZQW5|Q96RK2	Silent	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.T11981	ENST00000397910.4	37	c.35943	CCDS54212.1	19																																																																																			MUC16	-	NULL	ENSG00000181143		0.498	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	138	0	T	NM_024690		9045688	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	silent	10.08	116	13	SNP	0.080	C
MUC16	94025	genome.wustl.edu	37	19	9090317	9090317	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr19:9090317G>T	ENST00000397910.4	-	1	1701	c.1498C>A	c.(1498-1500)Cac>Aac	p.H500N		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	500	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GAGCTCCCGTGGGCAGCTGTG	0.542																																																	0													101.0	98.0	99.0					19																	9090317		2076	4213	6289	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.1498C>A	19.37:g.9090317G>T	ENSP00000381008:p.His500Asn		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.H500N	ENST00000397910.4	37	c.1498	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	1.865	-0.461785	0.04508	.	.	ENSG00000181143	ENST00000397910	T	0.02525	4.26	1.45	0.317	0.15861	.	.	.	.	.	T	0.01320	0.0043	N	0.08118	0	.	.	.	P	0.41041	0.736	B	0.28784	0.094	T	0.47156	-0.9139	8	0.87932	D	0	.	5.5227	0.16941	0.0:0.3533:0.6467:0.0	.	500	B5ME49	.	N	500	ENSP00000381008:H500N	ENSP00000381008:H500N	H	-	1	0	MUC16	8951317	0.000000	0.05858	0.001000	0.08648	0.012000	0.07955	0.009000	0.13219	0.159000	0.19401	0.313000	0.20887	CAC	MUC16	-	NULL	ENSG00000181143		0.542	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	52	0	G	NM_024690		9090317	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.001	T
MUC6	4588	genome.wustl.edu	37	11	1027330	1027330	+	Silent	SNP	G	G	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr11:1027330G>A	ENST00000421673.2	-	17	2219	c.2169C>T	c.(2167-2169)tgC>tgT	p.C723C		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	723					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CCTCCAGTATGCACGGGCACT	0.652																																																	0													126.0	147.0	140.0					11																	1027330		2167	4249	6416	SO:0001819	synonymous_variant	0			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.2169C>T	11.37:g.1027330G>A			O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C	p.C723	ENST00000421673.2	37	c.2169	CCDS44513.1	11																																																																																			MUC6	-	NULL	ENSG00000184956		0.652	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC6	HGNC	protein_coding	OTTHUMT00000382120.2		0.00	79	0	G	XM_290540		1027330	-1			no_errors	ENST00000421673	ensembl	human	known	74_37	silent	5.06	75	4	SNP	0.991	A
MYLK	4638	genome.wustl.edu	37	3	123452795	123452795	+	Missense_Mutation	SNP	C	C	T	rs532659627		TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr3:123452795C>T	ENST00000475616.1	-	7	1047	c.1048G>A	c.(1048-1050)Gca>Aca	p.A350T	MYLK_ENST00000360772.3_Missense_Mutation_p.A350T|MYLK_ENST00000359169.1_Missense_Mutation_p.A350T|MYLK_ENST00000360304.3_Missense_Mutation_p.A350T|MYLK_ENST00000346322.5_Missense_Mutation_p.A350T			Q15746	MYLK_HUMAN	myosin light chain kinase	350					actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)	p.A350T(1)|p.A350P(1)|p.A350S(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		TGAACTCTTGCGGCCTGCAGG	0.632													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16789	0.0		0.0	False		,,,				2504	0.0																3	Substitution - Missense(3)	lung(3)											72.0	79.0	76.0					3																	123452795		2203	4300	6503	SO:0001583	missense	0			X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.1048G>A	3.37:g.123452795C>T	ENSP00000418335:p.Ala350Thr		B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Prot_kinase_dom,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.A350T	ENST00000475616.1	37	c.1048	CCDS46896.1	3	.	.	.	.	.	.	.	.	.	.	C	9.192	1.026194	0.19512	.	.	ENSG00000065534	ENST00000360772;ENST00000360304;ENST00000359169;ENST00000346322;ENST00000475616	T;T;T;T;T	0.66099	-0.19;-0.14;-0.19;-0.09;-0.14	5.43	-7.78	0.01223	.	.	.	.	.	T	0.36276	0.0961	L	0.27053	0.805	0.09310	N	0.999999	B;B;B;B;B	0.17038	0.02;0.001;0.02;0.0;0.005	B;B;B;B;B	0.13407	0.006;0.001;0.009;0.001;0.001	T	0.20472	-1.0274	9	0.14656	T	0.56	.	4.3246	0.11034	0.1071:0.2038:0.1012:0.5879	.	350;350;350;350;350	Q15746-6;Q15746-4;Q15746-3;Q15746-2;Q15746	.;.;.;.;MYLK_HUMAN	T	350	ENSP00000354004:A350T;ENSP00000353452:A350T;ENSP00000352088:A350T;ENSP00000320622:A350T;ENSP00000418335:A350T	ENSP00000320622:A350T	A	-	1	0	MYLK	124935485	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.939000	0.03933	-1.950000	0.01030	-0.844000	0.03045	GCA	MYLK	-	NULL	ENSG00000065534		0.632	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYLK	HGNC	protein_coding	OTTHUMT00000356464.1	-	0.00	44	0	C	NM_053025		123452795	-1	tier1	-	no_errors	ENST00000360304	ensembl	human	known	74_37	missense	44.59	41	33	SNP	0.000	T
MYO1F	4542	genome.wustl.edu	37	19	8587613	8587613	+	Silent	SNP	C	C	G	rs201007272		TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr19:8587613C>G	ENST00000338257.8	-	26	3222	c.2955G>C	c.(2953-2955)ccG>ccC	p.P985P		NM_012335.3	NP_036467.2	O00160	MYO1F_HUMAN	myosin IF	985				IMSGGGTHRPPRGPPSTSLG -> KFIWPRGHPQASPALRP HPWD (in Ref. 5; CAA67058). {ECO:0000305}.	defense response to Gram-positive bacterium (GO:0050830)|negative regulation of cell adhesion (GO:0007162)|neutrophil degranulation (GO:0043312)|positive regulation of cell migration (GO:0030335)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of innate immune response (GO:0045088)	cortical actin cytoskeleton (GO:0030864)|filamentous actin (GO:0031941)|unconventional myosin complex (GO:0016461)	actin binding (GO:0003779)|ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(7)|lung(13)|ovary(3)|prostate(3)|skin(3)|urinary_tract(1)	42						GGGATGTGGACGGAGGGCCCC	0.692																																																	0													18.0	20.0	19.0					19																	8587613		1895	4106	6001	SO:0001819	synonymous_variant	0			X98411	CCDS42494.1	19p13.3-p13.2	2011-09-27			ENSG00000142347	ENSG00000142347		"""Myosins / Myosin superfamily : Class I"""	7600	protein-coding gene	gene with protein product		601480				9119401, 8884266	Standard	NM_012335		Approved		uc002mkg.3	O00160	OTTHUMG00000156005	ENST00000338257.8:c.2955G>C	19.37:g.8587613C>G			Q8WWN7	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,pfam_SH3_domain,pfam_SH3_2,superfamily_P-loop_NTPase,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_SH3_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_SH3_domain,prints_Myosin_head_motor_dom,prints_SH3_domain	p.P985	ENST00000338257.8	37	c.2955	CCDS42494.1	19	.	.	.	.	.	.	.	.	.	.	C	0.844	-0.740889	0.03088	.	.	ENSG00000142347	ENST00000305795	.	.	.	5.27	-10.4	0.00318	.	0.565717	0.17509	N	0.171720	T	0.45597	0.1350	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60464	-0.7258	6	0.19147	T	0.46	.	12.9493	0.58389	0.0:0.1362:0.0994:0.7644	.	.	.	.	P	1029	.	ENSP00000304899:R1029P	R	-	2	0	MYO1F	8493613	0.000000	0.05858	0.009000	0.14445	0.238000	0.25445	-1.731000	0.01853	-1.526000	0.01760	0.455000	0.32223	CGT	MYO1F	-	NULL	ENSG00000142347		0.692	MYO1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO1F	HGNC	protein_coding	OTTHUMT00000342716.2	-	0.00	52	0	C			8587613	-1	tier1	-	no_errors	ENST00000338257	ensembl	human	known	74_37	silent	29.58	50	21	SNP	0.001	G
MYO7A	4647	genome.wustl.edu	37	11	76883843	76883843	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr11:76883843G>A	ENST00000409709.3	+	16	2119	c.1847G>A	c.(1846-1848)cGg>cAg	p.R616Q	MYO7A_ENST00000458637.2_Missense_Mutation_p.R616Q|MYO7A_ENST00000409893.1_Missense_Mutation_p.R616Q|MYO7A_ENST00000409619.2_Missense_Mutation_p.R605Q	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	616	Myosin motor.				actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						CAGTTCAAGCGGTCACTGGAG	0.642																																																	0													20.0	23.0	22.0					11																	76883843		2039	4109	6148	SO:0001583	missense	0			U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.1847G>A	11.37:g.76883843G>A	ENSP00000386331:p.Arg616Gln		B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_FERM_central,pfam_FERM_N,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_Band_41_domain,smart_SH3_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_SH3_domain,prints_Myosin_head_motor_dom	p.R616Q	ENST00000409709.3	37	c.1847	CCDS53683.1	11	.	.	.	.	.	.	.	.	.	.	G	16.28	3.080151	0.55753	.	.	ENSG00000137474	ENST00000409709;ENST00000409893;ENST00000458637;ENST00000409619;ENST00000358342;ENST00000343356;ENST00000341717;ENST00000343419	T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56	4.77	4.77	0.60923	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	T	0.56292	0.1975	N	0.02391	-0.57	0.58432	D	0.999993	D;B;P	0.57257	0.979;0.066;0.951	P;B;P	0.53649	0.731;0.017;0.714	T	0.58589	-0.7610	10	0.09843	T	0.71	.	18.1567	0.89693	0.0:0.0:1.0:0.0	.	616;616;616	B9A012;F8VUN5;Q13402	.;.;MYO7A_HUMAN	Q	616;616;616;605;615;615;492;615	ENSP00000386331:R616Q;ENSP00000386689:R616Q;ENSP00000392185:R616Q;ENSP00000386635:R605Q	ENSP00000345075:R492Q	R	+	2	0	MYO7A	76561491	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.435000	0.80391	2.368000	0.80403	0.549000	0.68633	CGG	MYO7A	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000137474		0.642	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	MYO7A	HGNC	protein_coding	OTTHUMT00000328133.1	-	0.00	46	0	G	NM_000260		76883843	+1	tier1	-	no_errors	ENST00000409709	ensembl	human	known	74_37	missense	20.29	55	14	SNP	1.000	A
MYO7B	4648	genome.wustl.edu	37	2	128391782	128391782	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr2:128391782G>A	ENST00000409816.2	+	39	5497	c.5465G>A	c.(5464-5466)cGg>cAg	p.R1822Q	MYO7B_ENST00000428314.1_Missense_Mutation_p.R1822Q|MYO7B_ENST00000389524.4_Missense_Mutation_p.R1823Q|MYO7B_ENST00000409090.1_Missense_Mutation_p.R675Q			Q6PIF6	MYO7B_HUMAN	myosin VIIB	1822	FERM 2. {ECO:0000255|PROSITE- ProRule:PRU00084}.|MyTH4 3. {ECO:0000255|PROSITE- ProRule:PRU00359}.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		ACACGGGTGCGGGATGTGTGT	0.642																																																	0													26.0	30.0	29.0					2																	128391782		2021	4178	6199	SO:0001583	missense	0				CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.5465G>A	2.37:g.128391782G>A	ENSP00000386461:p.Arg1822Gln		Q14786|Q8TEE1	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,pfam_SH3_2,superfamily_P-loop_NTPase,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_Band_41_domain,smart_SH3_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_SH3_domain,prints_Myosin_head_motor_dom	p.R1823Q	ENST00000409816.2	37	c.5468	CCDS46405.1	2	.	.	.	.	.	.	.	.	.	.	g	19.50	3.840069	0.71488	.	.	ENSG00000169994	ENST00000389524;ENST00000428314;ENST00000272666;ENST00000409816;ENST00000409090	T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07	5.14	4.05	0.47172	Band 4.1 domain (1);FERM domain (1);	0.127661	0.50627	D	0.000102	T	0.82250	0.4996	L	0.59436	1.845	0.27555	N	0.950382	D	0.76494	0.999	P	0.61533	0.89	T	0.73757	-0.3882	10	0.25751	T	0.34	.	13.489	0.61384	0.1373:0.0:0.8627:0.0	.	1822	Q6PIF6	MYO7B_HUMAN	Q	1823;1822;918;1822;675	ENSP00000374175:R1823Q;ENSP00000415090:R1822Q;ENSP00000386461:R1822Q;ENSP00000386850:R675Q	ENSP00000272666:R918Q	R	+	2	0	MYO7B	128108252	1.000000	0.71417	0.991000	0.47740	0.560000	0.35617	2.828000	0.48120	2.386000	0.81285	0.556000	0.70494	CGG	MYO7B	-	smart_Band_41_domain,pfscan_FERM_domain	ENSG00000169994		0.642	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYO7B	HGNC	protein_coding	OTTHUMT00000331124.3	-	0.00	61	0	G	XM_291001		128391782	+1	tier1	-	no_errors	ENST00000389524	ensembl	human	known	74_37	missense	41.84	57	41	SNP	0.993	A
NAA15	80155	genome.wustl.edu	37	4	140282928	140282928	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr4:140282928G>C	ENST00000296543.5	+	14	1913	c.1590G>C	c.(1588-1590)atG>atC	p.M530I	NAA15_ENST00000398947.1_Missense_Mutation_p.M530I	NM_057175.3	NP_476516.1	Q9BXJ9	NAA15_HUMAN	N(alpha)-acetyltransferase 15, NatA auxiliary subunit	530	Interaction with HYPK.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	N-acetyltransferase activity (GO:0008080)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)			NS(1)|endometrium(3)|large_intestine(7)|liver(2)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29						CATACTGTATGAGGAAGATTA	0.328																																																	0													65.0	60.0	62.0					4																	140282928		1840	4080	5920	SO:0001583	missense	0			AY039242	CCDS43270.1	4q31.1	2010-01-14	2010-01-14	2010-01-14	ENSG00000164134	ENSG00000164134		"""N(alpha)-acetyltransferase subunits"""	30782	protein-coding gene	gene with protein product		608000	"""NMDA receptor regulated 1"""	NARG1		12140756, 11478804, 19660095	Standard	XM_005263236		Approved	TBDN100, NATH, FLJ13340	uc003ihu.1	Q9BXJ9	OTTHUMG00000137363	ENST00000296543.5:c.1590G>C	4.37:g.140282928G>C	ENSP00000296543:p.Met530Ile		D3DNY6|Q52LG9|Q8IWH4|Q8NEV2|Q9H8P6	Missense_Mutation	SNP	pfam_NatA_aux_su,smart_TPR_repeat,pirsf_NatA_aux_su,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.M530I	ENST00000296543.5	37	c.1590	CCDS43270.1	4	.	.	.	.	.	.	.	.	.	.	G	25.2	4.618124	0.87359	.	.	ENSG00000164134	ENST00000296543;ENST00000544077;ENST00000398947	T;T	0.41758	0.99;0.99	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.48840	0.1522	L	0.55213	1.73	0.80722	D	1	P	0.38223	0.623	B	0.42882	0.401	T	0.26326	-1.0106	10	0.33940	T	0.23	-16.9726	20.547	0.99278	0.0:0.0:1.0:0.0	.	530	Q9BXJ9	NAA15_HUMAN	I	530;404;530	ENSP00000296543:M530I;ENSP00000381920:M530I	ENSP00000296543:M530I	M	+	3	0	NAA15	140502378	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.420000	0.97426	2.850000	0.98022	0.650000	0.86243	ATG	NAA15	-	pirsf_NatA_aux_su	ENSG00000164134		0.328	NAA15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NAA15	HGNC	protein_coding	OTTHUMT00000267839.2	-	0.00	69	0	G	NM_057175		140282928	+1	tier1	-	no_errors	ENST00000296543	ensembl	human	known	74_37	missense	36.56	59	34	SNP	1.000	C
NBEAL2	23218	genome.wustl.edu	37	3	47044496	47044496	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr3:47044496C>T	ENST00000450053.3	+	34	5688	c.5509C>T	c.(5509-5511)Cgc>Tgc	p.R1837C	NBEAL2_ENST00000383740.2_Missense_Mutation_p.R116C|NBEAL2_ENST00000292309.5_Missense_Mutation_p.R1653C	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	1837					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		GACATATTCACGCATGCGTCT	0.602																																																	0													65.0	71.0	69.0					3																	47044496		2066	4193	6259	SO:0001583	missense	0			AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.5509C>T	3.37:g.47044496C>T	ENSP00000415034:p.Arg1837Cys		O60288|Q6P994|Q6UX91|Q8NAC9	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl_sf,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R1837C	ENST00000450053.3	37	c.5509	CCDS46817.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.1|23.1	4.373763|4.373763	0.82573|0.82573	.|.	.|.	ENSG00000160796|ENSG00000160796	ENST00000292309;ENST00000383740;ENST00000450053|ENST00000443829	T;T;T|.	0.65364|.	-0.12;0.54;-0.15|.	5.01|5.01	5.01|5.01	0.66863|0.66863	.|.	0.057947|.	0.64402|.	D|.	0.000004|.	T|T	0.75729|0.75729	0.3889|0.3889	M|M	0.82323|0.82323	2.585|2.585	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.66351|.	0.938;0.943|.	T|T	0.77360|0.77360	-0.2617|-0.2617	10|5	0.87932|.	D|.	0|.	.|.	12.198|12.198	0.54309|0.54309	0.1706:0.8294:0.0:0.0|0.1706:0.8294:0.0:0.0	.|.	1653;1837|.	Q6ZNJ1-2;Q6ZNJ1|.	.;NBEL2_HUMAN|.	C|M	1653;116;1837|205	ENSP00000292309:R1653C;ENSP00000373246:R116C;ENSP00000415034:R1837C|.	ENSP00000292309:R1653C|.	R|T	+|+	1|2	0|0	NBEAL2|NBEAL2	47019500|47019500	0.890000|0.890000	0.30428|0.30428	0.975000|0.975000	0.42487|0.42487	0.908000|0.908000	0.53690|0.53690	1.887000|1.887000	0.39698|0.39698	2.610000|2.610000	0.88304|0.88304	0.655000|0.655000	0.94253|0.94253	CGC|ACG	NBEAL2	-	NULL	ENSG00000160796		0.602	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBEAL2	HGNC	protein_coding	OTTHUMT00000344363.3	-	0.00	26	0	C	XM_291064		47044496	+1	tier1	-	no_errors	ENST00000450053	ensembl	human	known	74_37	missense	20.00	12	3	SNP	0.990	T
NCOA7	135112	genome.wustl.edu	37	6	126210540	126210540	+	Missense_Mutation	SNP	G	G	A	rs377026001		TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr6:126210540G>A	ENST00000368357.3	+	10	1692	c.1340G>A	c.(1339-1341)cGa>cAa	p.R447Q	NCOA7_ENST00000229634.9_Missense_Mutation_p.R332Q|NCOA7_ENST00000392477.2_Missense_Mutation_p.R447Q	NM_001199619.1|NM_001199620.1	NP_001186548.1|NP_001186549.1	Q8NI08	NCOA7_HUMAN	nuclear receptor coactivator 7	447					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(1)|urinary_tract(2)	39				UCEC - Uterine corpus endometrioid carcinoma (4;0.0803)|GBM - Glioblastoma multiforme(226;0.0193)|all cancers(137;0.237)		CCAGAGGAACGAAAGAAAGCT	0.443																																																	0								G	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	1,4403	2.1+/-5.4	0,1,2201	58.0	62.0	61.0		1307,1340,1340,995,1340	-5.5	0.0	6		61	0,8598		0,0,4299	no	missense,missense,missense,missense,missense	NCOA7	NM_001122842.2,NM_001199619.1,NM_001199620.1,NM_001199621.1,NM_181782.4	43,43,43,43,43	0,1,6500	AA,AG,GG		0.0,0.0227,0.0077	benign,benign,benign,benign,benign	436/932,447/943,447/943,332/828,447/943	126210540	1,13001	2202	4299	6501	SO:0001583	missense	0			AJ420542	CCDS5132.1, CCDS56448.1	6q22.33	2013-03-14			ENSG00000111912	ENSG00000111912			21081	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 4"""	609752				11971969	Standard	NM_001199619		Approved	ERAP140, dJ187J11.3, TLDC4	uc003qai.3	Q8NI08	OTTHUMG00000015513	ENST00000368357.3:c.1340G>A	6.37:g.126210540G>A	ENSP00000357341:p.Arg447Gln		B2RNS2|B7Z2C4|B9EH71|G8JL91|Q3LID6|Q4G0V1|Q5TF95|Q6IPQ4|Q6NE83|Q86T89|Q8N1W4	Missense_Mutation	SNP	pfam_TLDc,pfam_LysM_dom,pfam_GRAM,smart_LysM_dom,smart_TLDc	p.R447Q	ENST00000368357.3	37	c.1340	CCDS5132.1	6	.	.	.	.	.	.	.	.	.	.	G	0.022	-1.415080	0.01145	2.27E-4	0.0	ENSG00000111912	ENST00000368357;ENST00000392477;ENST00000229634;ENST00000413085	T;T;T;T	0.31510	2.75;2.75;2.74;1.49	5.09	-5.49	0.02584	.	1.324370	0.05063	N	0.480222	T	0.02807	0.0084	N	0.08118	0	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.04013	0.0;0.001;0.0	T	0.27123	-1.0083	10	0.12766	T	0.61	-21.7387	2.1022	0.03683	0.4735:0.1099:0.1078:0.3088	.	436;436;447	B3KXK4;Q8NI08-2;Q8NI08	.;.;NCOA7_HUMAN	Q	447;447;332;245	ENSP00000357341:R447Q;ENSP00000376269:R447Q;ENSP00000229634:R332Q;ENSP00000389186:R245Q	ENSP00000229634:R332Q	R	+	2	0	NCOA7	126252233	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.097000	0.11042	-0.960000	0.03613	-0.894000	0.02916	CGA	NCOA7	-	NULL	ENSG00000111912		0.443	NCOA7-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCOA7	HGNC	protein_coding	OTTHUMT00000042083.4		0.00	56	0	G	XM_059748		126210540	+1			no_errors	ENST00000368357	ensembl	human	known	74_37	missense	6.45	58	4	SNP	0.000	A
NCOR1	9611	genome.wustl.edu	37	17	16024424	16024424	+	Silent	SNP	A	A	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr17:16024424A>T	ENST00000268712.3	-	16	2051	c.1794T>A	c.(1792-1794)gcT>gcA	p.A598A	NCOR1_ENST00000395848.1_Silent_p.A489A|NCOR1_ENST00000395851.1_Silent_p.A598A|NCOR1_ENST00000583226.1_5'UTR	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	598	Poly-Ala.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		CTGCGGCTGCAGCACTGGCAG	0.597																																																	0													49.0	55.0	53.0					17																	16024424		2203	4300	6503	SO:0001819	synonymous_variant	0			AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.1794T>A	17.37:g.16024424A>T			B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Silent	SNP	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.A598	ENST00000268712.3	37	c.1794	CCDS11175.1	17																																																																																			NCOR1	-	NULL	ENSG00000141027		0.597	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOR1	HGNC	protein_coding	OTTHUMT00000131751.5	-	0.00	45	0	A	NM_006311		16024424	-1	tier1	-	no_errors	ENST00000268712	ensembl	human	known	74_37	silent	30.43	16	7	SNP	0.999	T
NFYB	4801	genome.wustl.edu	37	12	104519955	104519955	+	Silent	SNP	A	A	G			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr12:104519955A>G	ENST00000240055.3	-	4	395	c.168T>C	c.(166-168)gaT>gaC	p.D56D	RNA5SP370_ENST00000362545.1_RNA|NFYB_ENST00000551727.1_Silent_p.D56D	NM_006166.3	NP_006157.1	P25208	NFYB_HUMAN	nuclear transcription factor Y, beta	56	B domain.				cellular lipid metabolic process (GO:0044255)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	CCAAT-binding factor complex (GO:0016602)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			large_intestine(1)|lung(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	6						GAAGATATATATCTTGTTCTC	0.333																																																	0													168.0	153.0	158.0					12																	104519955		2203	4299	6502	SO:0001819	synonymous_variant	0				CCDS9098.1	12q22-q23	2008-11-11				ENSG00000120837			7805	protein-coding gene	gene with protein product		189904				1774067, 9612081	Standard	NM_006166		Approved	CBF-A, HAP3, NF-YB	uc001tkl.1	P25208	OTTHUMG00000170176	ENST00000240055.3:c.168T>C	12.37:g.104519955A>G			A8K7B9|Q96IY8	Silent	SNP	pfam_CBFA_NFYB_domain,pfam_Histone_core_D,superfamily_Histone-fold,prints_Transcrpt_fac_NFYB/HAP3	p.D56	ENST00000240055.3	37	c.168	CCDS9098.1	12																																																																																			NFYB	-	superfamily_Histone-fold	ENSG00000120837		0.333	NFYB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFYB	HGNC	protein_coding	OTTHUMT00000407786.1	-	0.00	61	0	A			104519955	-1	tier1	-	no_errors	ENST00000240055	ensembl	human	known	74_37	silent	37.68	43	26	SNP	0.999	G
NOC2L	26155	genome.wustl.edu	37	1	880079	880079	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr1:880079C>T	ENST00000327044.6	-	19	2294	c.2245G>A	c.(2245-2247)Gac>Aac	p.D749N		NM_015658.3	NP_056473	Q9Y3T9	NOC2L_HUMAN	nucleolar complex associated 2 homolog (S. cerevisiae)	749	Asp/Glu-rich (acidic).				apoptotic process (GO:0006915)|cellular response to UV (GO:0034644)|chromatin assembly (GO:0031497)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of histone acetylation (GO:0035067)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleolus to nucleoplasm transport (GO:0032066)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|nucleosome binding (GO:0031491)|poly(A) RNA binding (GO:0044822)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)			endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|skin(2)|urinary_tract(1)	16	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;1.86e-38)|OV - Ovarian serous cystadenocarcinoma(86;6.08e-23)|Colorectal(212;0.000161)|COAD - Colon adenocarcinoma(227;0.000194)|BRCA - Breast invasive adenocarcinoma(365;0.000475)|Kidney(185;0.00231)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0344)|Lung(427;0.2)		CTGCCTCAGTCGTCCTCTGAG	0.697																																																	0													10.0	13.0	12.0					1																	880079		2147	4269	6416	SO:0001583	missense	0			AL050019	CCDS3.1	1p36.33	2014-06-12			ENSG00000188976	ENSG00000188976			24517	protein-coding gene	gene with protein product	"""novel INHAT repressor"", ""protein phosphatase 1, regulatory subunit 12"""	610770					Standard	NM_015658		Approved	DKFZP564C186, NET7, NET15, NIR, PPP1R112	uc001abz.4	Q9Y3T9	OTTHUMG00000040720	ENST00000327044.6:c.2245G>A	1.37:g.880079C>T	ENSP00000317992:p.Asp749Asn		Q5SVA3|Q9BTN6	Missense_Mutation	SNP	pfam_Noc2,superfamily_ARM-type_fold	p.D749N	ENST00000327044.6	37	c.2245	CCDS3.1	1	.	.	.	.	.	.	.	.	.	.	c	13.77	2.336056	0.41398	.	.	ENSG00000188976	ENST00000327044	T	0.30448	1.53	4.88	3.97	0.46021	.	0.111656	0.64402	N	0.000016	T	0.32315	0.0825	N	0.19112	0.55	0.40195	D	0.977444	D;D;D	0.69078	0.997;0.997;0.997	P;P;P	0.56088	0.791;0.791;0.791	T	0.16630	-1.0396	10	0.54805	T	0.06	.	12.598	0.56481	0.0:0.9192:0.0:0.0808	.	749;749;521	B3KNC3;Q9Y3T9;Q9H9J5	.;NOC2L_HUMAN;.	N	749	ENSP00000317992:D749N	ENSP00000317992:D749N	D	-	1	0	NOC2L	869942	0.997000	0.39634	0.569000	0.28460	0.006000	0.05464	3.710000	0.54860	1.297000	0.44761	-0.282000	0.10007	GAC	NOC2L	-	NULL	ENSG00000188976		0.697	NOC2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOC2L	HGNC	protein_coding	OTTHUMT00000097869.1	-	0.00	30	0	C	NM_015658		880079	-1	tier1	-	no_errors	ENST00000327044	ensembl	human	known	74_37	missense	18.18	18	4	SNP	0.996	T
NOD1	10392	genome.wustl.edu	37	7	30491759	30491759	+	Missense_Mutation	SNP	A	A	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr7:30491759A>C	ENST00000222823.4	-	6	1799	c.1274T>G	c.(1273-1275)tTc>tGc	p.F425C	NOD1_ENST00000423334.2_3'UTR	NM_006092.2	NP_006083.1	Q9Y239	NOD1_HUMAN	nucleotide-binding oligomerization domain containing 1	425	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPK activity (GO:0000187)|apoptotic process (GO:0006915)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-8 biosynthetic process (GO:0042228)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of tumor necrosis factor production (GO:0032760)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|identical protein binding (GO:0042802)|peptidoglycan binding (GO:0042834)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|skin(2)	39						GACCAGGAGGAAGACATCTGT	0.617																																																	0													69.0	66.0	67.0					7																	30491759		2203	4300	6503	SO:0001583	missense	0			AF126484	CCDS5427.1	7p15-p14	2006-12-08	2006-12-08	2006-12-08	ENSG00000106100	ENSG00000106100		"""Nucleotide-binding domain and leucine rich repeat containing"""	16390	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 1"", ""NLR family, CARD domain containing 1"""	605980	"""caspase recruitment domain family, member 4"""	CARD4		10224040, 10329646	Standard	NM_006092		Approved	NLRC1, CLR7.1	uc003tav.3	Q9Y239	OTTHUMG00000023923	ENST00000222823.4:c.1274T>G	7.37:g.30491759A>C	ENSP00000222823:p.Phe425Cys		B4DTU3|Q549U4|Q8IWF5	Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_CARD	p.F425C	ENST00000222823.4	37	c.1274	CCDS5427.1	7	.	.	.	.	.	.	.	.	.	.	A	14.72	2.619211	0.46736	.	.	ENSG00000106100	ENST00000222823	T	0.72725	-0.68	5.71	4.54	0.55810	NACHT nucleoside triphosphatase (1);	0.000000	0.85682	D	0.000000	D	0.82318	0.5011	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.83283	-0.0037	10	0.87932	D	0	.	11.3409	0.49533	0.864:0.0:0.0:0.136	.	425	Q9Y239	NOD1_HUMAN	C	425	ENSP00000222823:F425C	ENSP00000222823:F425C	F	-	2	0	NOD1	30458284	1.000000	0.71417	1.000000	0.80357	0.519000	0.34347	5.028000	0.64115	0.951000	0.37770	0.460000	0.39030	TTC	NOD1	-	pfscan_NACHT_NTPase	ENSG00000106100		0.617	NOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOD1	HGNC	protein_coding	OTTHUMT00000250443.2	-	0.00	47	0	A			30491759	-1	tier1	-	no_errors	ENST00000222823	ensembl	human	known	74_37	missense	65.22	8	15	SNP	1.000	C
NOS2	4843	genome.wustl.edu	37	17	26091136	26091136	+	Silent	SNP	G	G	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr17:26091136G>T	ENST00000313735.6	-	21	2696	c.2463C>A	c.(2461-2463)ccC>ccA	p.P821P		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	821	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	TGAGTGAGCAGGGGGGCAGCC	0.602																																																	0													18.0	21.0	20.0					17																	26091136		2203	4296	6499	SO:0001819	synonymous_variant	0			U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.2463C>A	17.37:g.26091136G>T			A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Silent	SNP	pfam_NO_synthase_oxygenase_dom,pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,superfamily_NO_synthase_oxygenase_dom,superfamily_Riboflavin_synthase-like_b-brl,pirsf_NOS_euk,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.P821	ENST00000313735.6	37	c.2463	CCDS11223.1	17																																																																																			NOS2	-	pfam_FAD-binding_1,superfamily_Riboflavin_synthase-like_b-brl,pirsf_NOS_euk	ENSG00000007171		0.602	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOS2	HGNC	protein_coding	OTTHUMT00000255597.1	-	0.00	69	0	G	NM_000625		26091136	-1	tier1	-	no_errors	ENST00000313735	ensembl	human	known	74_37	silent	63.49	23	40	SNP	1.000	T
NRD1	4898	genome.wustl.edu	37	1	52303157	52303157	+	Splice_Site	SNP	A	A	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr1:52303157A>T	ENST00000354831.7	-	3	954		c.e3+1		NRD1_ENST00000485608.1_Intron|NRD1_ENST00000352171.7_Intron|NRD1_ENST00000539524.1_Splice_Site|MIR761_ENST00000390787.1_RNA|NRD1_ENST00000544028.1_Intron	NM_002525.2	NP_002516.2	O43847	NRDC_HUMAN	nardilysin (N-arginine dibasic convertase)						cell migration (GO:0016477)|cell proliferation (GO:0008283)|neuromuscular junction development (GO:0007528)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)	cell surface (GO:0009986)|cytosol (GO:0005829)	epidermal growth factor binding (GO:0048408)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)	27						TAGGTGCCTAACCTGCTTTCA	0.388																																																	0													143.0	137.0	139.0					1																	52303157		2203	4300	6503	SO:0001630	splice_region_variant	0			X93207	CCDS559.1, CCDS41335.1, CCDS55599.1	1p32.2-p32.1	2008-07-18			ENSG00000078618	ENSG00000078618			7995	protein-coding gene	gene with protein product		602651				9581555, 9479496	Standard	NM_002525		Approved	hNRD1, hNRD2	uc001ctc.4	O43847	OTTHUMG00000008278	ENST00000354831.7:c.764+1T>A	1.37:g.52303157A>T			A6NI41|O15241|O15242|Q5VUL0|Q96HB2|Q9NU57	Splice_Site	SNP	-	e3+2	ENST00000354831.7	37	c.764+2	CCDS559.1	1	.	.	.	.	.	.	.	.	.	.	A	16.41	3.116647	0.56505	.	.	ENSG00000078618	ENST00000354831;ENST00000539524	.	.	.	5.09	3.95	0.45737	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.083	0.19952	0.884:0.0:0.116:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NRD1	52075745	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.512000	0.45485	2.127000	0.65507	0.533000	0.62120	.	NRD1	-	-	ENSG00000078618		0.388	NRD1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NRD1	HGNC	protein_coding	OTTHUMT00000023045.1	-	0.00	58	0	A	NM_002525	Intron	52303157	-1	tier1	-	no_errors	ENST00000354831	ensembl	human	known	74_37	splice_site	29.33	53	22	SNP	1.000	T
NRG2	9542	genome.wustl.edu	37	5	139422532	139422534	+	In_Frame_Del	DEL	GCT	GCT	-			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	GCT	GCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr5:139422532_139422534delGCT	ENST00000361474.1	-	1	345_347	c.121_123delAGC	c.(121-123)agcdel	p.S41del	NRG2_ENST00000289422.7_In_Frame_Del_p.S41del|NRG2_ENST00000541337.1_In_Frame_Del_p.S41del|NRG2_ENST00000394770.1_In_Frame_Del_p.S41del|NRG2_ENST00000545385.1_In_Frame_Del_p.S41del|NRG2_ENST00000289409.4_In_Frame_Del_p.S41del|NRG2_ENST00000358522.3_In_Frame_Del_p.S41del	NM_004883.2	NP_004874.1	O14511	NRG2_HUMAN	neuregulin 2	41	Poly-Ser.				embryo development (GO:0009790)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.S41delS(2)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	25			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			tgccgctctcgctgctgctgctg	0.7																																																	2	Deletion - In frame(2)	soft_tissue(1)|central_nervous_system(1)							,,,,	9,5,109,1819		2,0,0,5,1,0,3,19,71,870					,,,,	0.6	0.8			4	20,40,281,3927		5,0,1,9,12,0,16,38,204,1849	no	codingComplex,codingComplex,codingComplex,codingComplex,codingComplex	NRG2	NM_013983.2,NM_013982.2,NM_013981.3,NM_004883.2,NM_001184935.1	,,,,	7,0,1,14,13,0,19,57,275,2719	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		7.9897,6.3337,7.4718	,,,,	,,,,		29,45,390,5746				SO:0001651	inframe_deletion	0				CCDS4217.1, CCDS54910.1	5q23-q33	2013-01-11			ENSG00000158458	ENSG00000158458		"""Immunoglobulin superfamily / I-set domain containing"""	7998	protein-coding gene	gene with protein product	"""neural- and thymus-derived activator for ErbB kinases"", ""divergent of neuregulin-1"""	603818				9168114, 9168115	Standard	NM_004883		Approved	Don-1, NTAK, HRG2	uc003lev.2	O14511	OTTHUMG00000129241	ENST00000361474.1:c.121_123delAGC	5.37:g.139422541_139422543delGCT	ENSP00000354910:p.Ser41del			In_Frame_Del	DEL	pfam_Neuregulin_1_C,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_EG-like_dom,pfscan_Ig-like_dom	p.S41in_frame_del	ENST00000361474.1	37	c.123_121	CCDS4217.1	5																																																																																			NRG2	-	NULL	ENSG00000158458		0.700	NRG2-001	KNOWN	basic|CCDS	protein_coding	NRG2	HGNC	protein_coding	OTTHUMT00000251340.1		0.00	23	0	GCT	NM_013982		139422534	-1	tier1		no_errors	ENST00000545385	ensembl	human	known	74_37	in_frame_del	25.00	9	3	DEL	0.905:0.938:0.962	-
NXPH2	11249	genome.wustl.edu	37	2	139429033	139429033	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr2:139429033G>T	ENST00000272641.3	-	2	360	c.254C>A	c.(253-255)gCc>gAc	p.A85D		NM_007226.2	NP_009157.1	O95156	NXPH2_HUMAN	neurexophilin 2	85	II.				neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				endometrium(1)|large_intestine(3)|lung(6)|ovary(3)|prostate(3)|skin(3)|urinary_tract(3)	22				BRCA - Breast invasive adenocarcinoma(221;0.101)		CGTGATGTTGGCCAGCCAATC	0.488																																																	0													86.0	85.0	85.0					2																	139429033		1881	4103	5984	SO:0001583	missense	0			AF043467	CCDS46421.1	2q22.1	2008-05-15			ENSG00000144227	ENSG00000144227			8076	protein-coding gene	gene with protein product		604635				9570794	Standard	NM_007226		Approved	NPH2	uc002tvi.3	O95156	OTTHUMG00000153636	ENST00000272641.3:c.254C>A	2.37:g.139429033G>T	ENSP00000272641:p.Ala85Asp		B7WP24|Q494R1|Q75QC3	Missense_Mutation	SNP	pfam_NXPH/NXPE,pirsf_Neurexophilin	p.A85D	ENST00000272641.3	37	c.254	CCDS46421.1	2	.	.	.	.	.	.	.	.	.	.	G	16.79	3.220100	0.58560	.	.	ENSG00000144227	ENST00000272641	.	.	.	5.66	5.66	0.87406	.	0.050946	0.85682	D	0.000000	T	0.38639	0.1048	N	0.03608	-0.345	0.58432	D	0.999991	B	0.26809	0.16	B	0.30943	0.122	T	0.28650	-1.0037	8	.	.	.	-19.2737	20.1253	0.97977	0.0:0.0:1.0:0.0	.	85	O95156	NXPH2_HUMAN	D	85	.	.	A	-	2	0	NXPH2	139145503	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.841000	0.86834	2.832000	0.97577	0.655000	0.94253	GCC	NXPH2	-	pfam_NXPH/NXPE,pirsf_Neurexophilin	ENSG00000144227		0.488	NXPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NXPH2	HGNC	protein_coding	OTTHUMT00000331901.1	-	0.00	47	0	G			139429033	-1	tier1	-	no_errors	ENST00000272641	ensembl	human	known	74_37	missense	17.65	56	12	SNP	1.000	T
OAT	4942	genome.wustl.edu	37	10	126097428	126097428	+	Silent	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr10:126097428C>T	ENST00000368845.5	-	3	398	c.306G>A	c.(304-306)aaG>aaA	p.K102K	OAT_ENST00000467675.1_5'Flank|OAT_ENST00000539214.1_5'UTR	NM_000274.3	NP_000265.1	P04181	OAT_HUMAN	ornithine aminotransferase	102					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-proline biosynthetic process (GO:0055129)|protein hexamerization (GO:0034214)|small molecule metabolic process (GO:0044281)|visual perception (GO:0007601)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ornithine-oxo-acid transaminase activity (GO:0004587)|pyridoxal phosphate binding (GO:0030170)			endometrium(2)|large_intestine(1)|lung(2)	5		all_lung(145;0.0271)|Lung NSC(174;0.0436)|Colorectal(57;0.102)|all_neural(114;0.116)			L-Ornithine(DB00129)	CCACTTGACTCTTCAGAGCAT	0.378																																																	0													96.0	94.0	95.0					10																	126097428		2203	4300	6503	SO:0001819	synonymous_variant	0			BC016928	CCDS7639.1, CCDS53586.1	10q26	2014-09-17	2010-01-20		ENSG00000065154	ENSG00000065154	2.6.1.13		8091	protein-coding gene	gene with protein product	"""Ornithine aminotransferase"", ""ornithine aminotransferase precursor"", ""gyrate atrophy"""	613349				1682785	Standard	NM_000274		Approved	HOGA	uc001lhp.3	P04181	OTTHUMG00000019213	ENST00000368845.5:c.306G>A	10.37:g.126097428C>T			D3DRF0|Q16068|Q16069|Q68CS0|Q6IAV9|Q9UD03	Silent	SNP	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase,tigrfam_Orn_aminotrans	p.K102	ENST00000368845.5	37	c.306	CCDS7639.1	10																																																																																			OAT	-	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase,tigrfam_Orn_aminotrans	ENSG00000065154		0.378	OAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OAT	HGNC	protein_coding	OTTHUMT00000050863.1	-	0.00	98	0	C	NM_000274		126097428	-1	tier1	-	no_errors	ENST00000368845	ensembl	human	known	74_37	silent	40.45	52	36	SNP	0.021	T
OR10G8	219869	genome.wustl.edu	37	11	123900843	123900843	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr11:123900843T>C	ENST00000431524.1	+	1	547	c.514T>C	c.(514-516)Tgg>Cgg	p.W172R		NM_001004464.1	NP_001004464.1	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G, member 8	172						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|large_intestine(2)|lung(21)|ovary(1)|prostate(5)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	44		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		TGGACCCAACTGGATCCAGCA	0.517																																																	0													208.0	186.0	194.0					11																	123900843		2201	4299	6500	SO:0001583	missense	0			AB065755	CCDS31704.1	11q24.1	2012-08-09			ENSG00000234560	ENSG00000234560		"""GPCR / Class A : Olfactory receptors"""	14845	protein-coding gene	gene with protein product							Standard	NM_001004464		Approved		uc001pzp.1	Q8NGN5	OTTHUMG00000165968	ENST00000431524.1:c.514T>C	11.37:g.123900843T>C	ENSP00000389072:p.Trp172Arg		B2RNJ3|Q6IEV2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.W172R	ENST00000431524.1	37	c.514	CCDS31704.1	11	.	.	.	.	.	.	.	.	.	.	C	0.040	-1.286985	0.01387	.	.	ENSG00000234560	ENST00000431524	T	0.00069	8.77	3.04	3.04	0.35103	GPCR, rhodopsin-like superfamily (1);	0.574633	0.14652	N	0.306536	T	0.00039	0.0001	N	0.00289	-1.7	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.10753	-1.0616	10	0.16896	T	0.51	.	2.3258	0.04222	0.1673:0.4712:0.2445:0.117	.	172	Q8NGN5	O10G8_HUMAN	R	172	ENSP00000389072:W172R	ENSP00000389072:W172R	W	+	1	0	OR10G8	123406053	0.000000	0.05858	0.573000	0.28510	0.004000	0.04260	-0.740000	0.04861	0.606000	0.29965	-0.128000	0.14901	TGG	OR10G8	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000234560		0.517	OR10G8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10G8	HGNC	protein_coding	OTTHUMT00000387270.1	-	0.00	97	0	T	NM_001004464		123900843	+1	tier1	-	no_errors	ENST00000431524	ensembl	human	known	74_37	missense	7.07	184	14	SNP	0.000	C
OR10G8	219869	genome.wustl.edu	37	11	123900856	123900856	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr11:123900856A>G	ENST00000431524.1	+	1	560	c.527A>G	c.(526-528)tAt>tGt	p.Y176C		NM_001004464.1	NP_001004464.1	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G, member 8	176						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|large_intestine(2)|lung(21)|ovary(1)|prostate(5)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	44		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		ATCCAGCACTATTTGTGTGAT	0.542																																																	0													206.0	185.0	192.0					11																	123900856		2201	4299	6500	SO:0001583	missense	0			AB065755	CCDS31704.1	11q24.1	2012-08-09			ENSG00000234560	ENSG00000234560		"""GPCR / Class A : Olfactory receptors"""	14845	protein-coding gene	gene with protein product							Standard	NM_001004464		Approved		uc001pzp.1	Q8NGN5	OTTHUMG00000165968	ENST00000431524.1:c.527A>G	11.37:g.123900856A>G	ENSP00000389072:p.Tyr176Cys		B2RNJ3|Q6IEV2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Y176C	ENST00000431524.1	37	c.527	CCDS31704.1	11	.	.	.	.	.	.	.	.	.	.	A	7.651	0.682857	0.14907	.	.	ENSG00000234560	ENST00000431524	T	0.00158	8.65	3.04	3.04	0.35103	GPCR, rhodopsin-like superfamily (1);	0.172946	0.27901	N	0.017398	T	0.00328	0.0010	M	0.65677	2.01	0.35176	D	0.772039	D	0.76494	0.999	D	0.76071	0.987	T	0.72769	-0.4193	10	0.87932	D	0	.	6.2529	0.20856	0.586:0.0:0.0:0.414	.	176	Q8NGN5	O10G8_HUMAN	C	176	ENSP00000389072:Y176C	ENSP00000389072:Y176C	Y	+	2	0	OR10G8	123406066	0.000000	0.05858	0.785000	0.31869	0.058000	0.15608	-0.114000	0.10757	1.377000	0.46286	0.528000	0.53228	TAT	OR10G8	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000234560		0.542	OR10G8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10G8	HGNC	protein_coding	OTTHUMT00000387270.1	-	0.00	98	0	A	NM_001004464		123900856	+1	tier1	-	no_errors	ENST00000431524	ensembl	human	known	74_37	missense	6.44	189	13	SNP	0.950	G
OR2W1	26692	genome.wustl.edu	37	6	29012660	29012660	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr6:29012660A>T	ENST00000377175.1	-	1	357	c.293T>A	c.(292-294)aTc>aAc	p.I98N		NM_030903.3	NP_112165.1	Q9Y3N9	OR2W1_HUMAN	olfactory receptor, family 2, subfamily W, member 1	98						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|skin(1)	23						GAGTTGGATGATACAACCCAC	0.433																																																	0													88.0	73.0	79.0					6																	29012660		1511	2709	4220	SO:0001583	missense	0			AL035402	CCDS4656.1	6p22.1	2012-08-09			ENSG00000204704	ENSG00000204704		"""GPCR / Class A : Olfactory receptors"""	8281	protein-coding gene	gene with protein product							Standard	NM_030903		Approved	hs6M1-15	uc003nlw.2	Q9Y3N9	OTTHUMG00000031048	ENST00000377175.1:c.293T>A	6.37:g.29012660A>T	ENSP00000366380:p.Ile98Asn		B0S7Y5|Q5JNZ1|Q6IEU0|Q96R17|Q9GZL0|Q9GZL1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I98N	ENST00000377175.1	37	c.293	CCDS4656.1	6	.	.	.	.	.	.	.	.	.	.	A	11.29	1.594662	0.28445	.	.	ENSG00000204704	ENST00000377175	T	0.00507	6.92	4.78	3.64	0.41730	GPCR, rhodopsin-like superfamily (1);	0.956675	0.08619	N	0.918734	T	0.00300	0.0009	M	0.80616	2.505	0.09310	N	1	P	0.41041	0.736	B	0.37387	0.248	T	0.43458	-0.9390	10	0.87932	D	0	.	5.3017	0.15781	0.7936:0.0:0.2064:0.0	.	98	Q9Y3N9	OR2W1_HUMAN	N	98	ENSP00000366380:I98N	ENSP00000366380:I98N	I	-	2	0	OR2W1	29120639	0.000000	0.05858	0.523000	0.27875	0.531000	0.34715	0.943000	0.29030	1.762000	0.52044	0.477000	0.44152	ATC	OR2W1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000204704		0.433	OR2W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2W1	HGNC	protein_coding	OTTHUMT00000076053.2	-	0.00	32	0	A			29012660	-1	tier1	-	no_errors	ENST00000377175	ensembl	human	known	74_37	missense	56.00	11	14	SNP	0.022	T
OR5B3	441608	genome.wustl.edu	37	11	58170145	58170145	+	Silent	SNP	G	G	A	rs78975225	byFrequency	TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr11:58170145G>A	ENST00000309403.2	-	1	737	c.738C>T	c.(736-738)gtC>gtT	p.V246V		NM_001005469.1	NP_001005469.1	Q8NH48	OR5B3_HUMAN	olfactory receptor, family 5, subfamily B, member 3	246						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V246V(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(6)|upper_aerodigestive_tract(1)	34	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				AGAAGATGCCGACTGCAATGA	0.428													g|||	33	0.00658946	0.0234	0.0029	5008	,	,		22426	0.0		0.0	False		,,,				2504	0.0																1	Substitution - coding silent(1)	skin(1)						A		94,4308	76.2+/-114.5	0,94,2107	86.0	86.0	86.0		738	-7.0	0.0	11	dbSNP_131	86	2,8588	2.2+/-6.3	0,2,4293	no	coding-synonymous	OR5B3	NM_001005469.1		0,96,6400	AA,AG,GG		0.0233,2.1354,0.7389		246/315	58170145	96,12896	2201	4295	6496	SO:0001819	synonymous_variant	0			AB065545	CCDS31549.1	11q12.1	2012-08-09			ENSG00000172769	ENSG00000172769		"""GPCR / Class A : Olfactory receptors"""	8324	protein-coding gene	gene with protein product				OR5B13			Standard	NM_001005469		Approved	OST129	uc010rkf.2	Q8NH48	OTTHUMG00000167516	ENST00000309403.2:c.738C>T	11.37:g.58170145G>A			Q6IEV6	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V246	ENST00000309403.2	37	c.738	CCDS31549.1	11																																																																																			OR5B3	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000172769		0.428	OR5B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5B3	HGNC	protein_coding	OTTHUMT00000394886.1		0.00	59	0	G	NM_001005469		58170145	-1			no_errors	ENST00000309403	ensembl	human	known	74_37	silent	5.00	57	3	SNP	0.000	A
OR5K4	403278	genome.wustl.edu	37	3	98073474	98073474	+	Silent	SNP	T	T	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr3:98073474T>C	ENST00000354924.2	+	1	777	c.777T>C	c.(775-777)atT>atC	p.I259I	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005517.1	NP_001005517.1	A6NMS3	OR5K4_HUMAN	olfactory receptor, family 5, subfamily K, member 4	259						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(13)|upper_aerodigestive_tract(1)	21						TCATGTATATTGGACCATCTG	0.348																																																	0													120.0	121.0	121.0					3																	98073474		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS33802.1	3q11.2	2013-09-23			ENSG00000196098	ENSG00000196098		"""GPCR / Class A : Olfactory receptors"""	31291	protein-coding gene	gene with protein product							Standard	NM_001005517		Approved		uc011bgv.2	A6NMS3	OTTHUMG00000160081	ENST00000354924.2:c.777T>C	3.37:g.98073474T>C				Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I259	ENST00000354924.2	37	c.777	CCDS33802.1	3																																																																																			OR5K4	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000196098		0.348	OR5K4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5K4	HGNC	protein_coding	OTTHUMT00000359114.1	-	0.00	88	0	T			98073474	+1	tier1	-	no_errors	ENST00000354924	ensembl	human	known	74_37	silent	41.86	25	18	SNP	0.859	C
OR8U1	219417	genome.wustl.edu	37	11	56143125	56143125	+	Missense_Mutation	SNP	C	C	T	rs74467122	byFrequency	TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr11:56143125C>T	ENST00000302270.1	+	1	26	c.26C>T	c.(25-27)gCg>gTg	p.A9V		NM_001005204.1	NP_001005204.1	Q8NH10	OR8U1_HUMAN	olfactory receptor, family 8, subfamily U, member 1	9						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(23)|ovary(4)|skin(1)|stomach(1)	39	Esophageal squamous(21;0.00448)					TGCACCCAGGCGACAGAGTTT	0.418																																																	0													106.0	98.0	100.0					11																	56143125		1861	4096	5957	SO:0001583	missense	0			AB065603	CCDS41647.1	11q11	2012-08-09			ENSG00000172199	ENSG00000172199		"""GPCR / Class A : Olfactory receptors"""	19611	protein-coding gene	gene with protein product							Standard	NM_001005204		Approved			Q8NH10	OTTHUMG00000166860	ENST00000302270.1:c.26C>T	11.37:g.56143125C>T	ENSP00000304188:p.Ala9Val			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A9V	ENST00000302270.1	37	c.26	CCDS41647.1	11	.	.	.	.	.	.	.	.	.	.	C	0.007	-1.976196	0.00452	.	.	ENSG00000172199	ENST00000302270	T	0.00287	8.29	5.87	3.53	0.40419	.	0.161649	0.29106	N	0.013133	T	0.00073	0.0002	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.30504	-0.9976	9	0.02654	T	1	.	5.851	0.18694	0.0:0.1444:0.1404:0.7152	.	9	Q8NH10	OR8U1_HUMAN	V	9	ENSP00000304188:A9V	ENSP00000304188:A9V	A	+	2	0	OR8U1	55899701	0.206000	0.23470	0.061000	0.19648	0.026000	0.11368	0.878000	0.28126	0.440000	0.26502	-0.386000	0.06593	GCG	OR8U1	-	NULL	ENSG00000172199		0.418	OR8U1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8U1	HGNC	protein_coding	OTTHUMT00000391607.1		0.00	44	0	C	NM_001005204		56143125	+1			no_errors	ENST00000302270	ensembl	human	known	74_37	missense	5.41	35	2	SNP	0.033	T
OR8B4	283162	genome.wustl.edu	37	11	124294378	124294378	+	Silent	SNP	G	G	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr11:124294378G>T	ENST00000356130.3	-	1	411	c.390C>A	c.(388-390)ctC>ctA	p.L130L		NM_001005196.1	NP_001005196.1	Q96RC9	OR8B4_HUMAN	olfactory receptor, family 8, subfamily B, member 4	130						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(7)|lung(15)|ovary(1)|skin(6)|stomach(1)|urinary_tract(1)	32		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		TGACCATGTAGAGCAGGGGGT	0.498																																																	0													90.0	85.0	87.0					11																	124294378		2201	4299	6500	SO:0001819	synonymous_variant	0			AB065831	CCDS31710.1	11q24	2012-08-09		2001-06-29	ENSG00000198657	ENSG00000198657		"""GPCR / Class A : Olfactory receptors"""	8473	protein-coding gene	gene with protein product				OR8B4P			Standard	NM_001005196		Approved		uc010sak.2	Q96RC9	OTTHUMG00000165916	ENST00000356130.3:c.390C>A	11.37:g.124294378G>T			B2RNF8|Q6IFQ7	Silent	SNP	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.L130	ENST00000356130.3	37	c.390	CCDS31710.1	11																																																																																			OR8B4	-	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_7TM	ENSG00000198657		0.498	OR8B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8B4	HGNC	protein_coding	OTTHUMT00000387055.1	-	0.00	33	0	G	NM_001005196		124294378	-1	tier1	-	no_errors	ENST00000356130	ensembl	human	known	74_37	silent	39.74	47	31	SNP	0.843	T
OTOGL	283310	genome.wustl.edu	37	12	80714314	80714314	+	Silent	SNP	G	G	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr12:80714314G>A	ENST00000547103.1	+	33	3894	c.3888G>A	c.(3886-3888)cgG>cgA	p.R1296R	OTOGL_ENST00000458043.2_Silent_p.R1296R			Q3ZCN5	OTOGL_HUMAN	otogelin-like	1296					L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						CCTTTCATCGGAGAGCAACAT	0.428																																																	0													79.0	76.0	77.0					12																	80714314		1890	4121	6011	SO:0001819	synonymous_variant	0			AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.3888G>A	12.37:g.80714314G>A			F8W0C3|Q495U8|Q8N8G5|Q8NC28	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_AbfB,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C	p.R1296	ENST00000547103.1	37	c.3888		12																																																																																			OTOGL	-	pfam_AbfB,superfamily_AbfB	ENSG00000165899		0.428	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	OTOGL	HGNC	protein_coding	OTTHUMT00000407438.1	-	0.00	40	0	G	NM_173591		80714314	+1	tier1	-	no_errors	ENST00000458043	ensembl	human	known	74_37	silent	12.00	44	6	SNP	0.109	A
P2RY10	27334	genome.wustl.edu	37	X	78216849	78216849	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chrX:78216849C>T	ENST00000171757.2	+	4	1112	c.832C>T	c.(832-834)Ccc>Tcc	p.P278S	P2RY10_ENST00000544091.1_Missense_Mutation_p.P278S	NM_014499.2	NP_055314.1	O00398	P2Y10_HUMAN	purinergic receptor P2Y, G-protein coupled, 10	278						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(22)|ovary(3)|skin(2)	42						TAGCAGTTGTCCCGTTGTCCG	0.418																																																	0													231.0	212.0	218.0					X																	78216849		2203	4300	6503	SO:0001583	missense	0			AF000545	CCDS14442.1	Xq21.1	2012-08-23			ENSG00000078589	ENSG00000078589		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	19906	protein-coding gene	gene with protein product		300529				11004484, 9755289	Standard	NM_014499		Approved	P2Y10	uc004edf.3	O00398	OTTHUMG00000021896	ENST00000171757.2:c.832C>T	X.37:g.78216849C>T	ENSP00000171757:p.Pro278Ser		D3DTE5|Q4VBN7|Q86V16	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.P278S	ENST00000171757.2	37	c.832	CCDS14442.1	X	.	.	.	.	.	.	.	.	.	.	C	0.001	-2.940467	0.00052	.	.	ENSG00000078589	ENST00000544091;ENST00000171757	T;T	0.41758	0.99;0.99	4.99	-1.48	0.08745	GPCR, rhodopsin-like superfamily (1);	1.292910	0.05032	N	0.474769	T	0.22166	0.0534	N	0.12663	0.25	0.09310	N	0.999998	B	0.02656	0.0	B	0.09377	0.004	T	0.21793	-1.0235	10	0.08599	T	0.76	.	8.2375	0.31636	0.0:0.2166:0.1288:0.6545	.	278	O00398	P2Y10_HUMAN	S	278	ENSP00000443138:P278S;ENSP00000171757:P278S	ENSP00000171757:P278S	P	+	1	0	P2RY10	78103505	0.000000	0.05858	0.128000	0.21923	0.167000	0.22549	-1.513000	0.02256	-0.790000	0.04492	-0.195000	0.12781	CCC	P2RY10	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000078589		0.418	P2RY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RY10	HGNC	protein_coding	OTTHUMT00000057323.1	-	0.00	9	0	C			78216849	+1	tier1	-	no_errors	ENST00000171757	ensembl	human	known	74_37	missense	72.73	6	16	SNP	0.009	T
PAPPA2	60676	genome.wustl.edu	37	1	176734935	176734935	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr1:176734935C>T	ENST00000367662.3	+	15	5449	c.4285C>T	c.(4285-4287)Ctt>Ttt	p.L1429F		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	1429	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						GGGATTTGCCCTTCAGGCCAG	0.512																																																	0													128.0	124.0	125.0					1																	176734935		2031	4202	6233	SO:0001583	missense	0			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.4285C>T	1.37:g.176734935C>T	ENSP00000356634:p.Leu1429Phe		A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	pfam_Notch_dom,pfam_Sushi_SCR_CCP,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.L1429F	ENST00000367662.3	37	c.4285	CCDS41438.1	1	.	.	.	.	.	.	.	.	.	.	C	19.56	3.850925	0.71719	.	.	ENSG00000116183	ENST00000367662	T	0.80738	-1.41	5.69	5.69	0.88448	Sushi/SCR/CCP (1);	0.247323	0.34986	N	0.003522	D	0.84781	0.5548	M	0.79258	2.445	0.80722	D	1	P	0.51449	0.945	P	0.47162	0.54	D	0.86832	0.2011	10	0.66056	D	0.02	-15.5259	17.592	0.87999	0.0:1.0:0.0:0.0	.	1429	Q9BXP8	PAPP2_HUMAN	F	1429	ENSP00000356634:L1429F	ENSP00000356634:L1429F	L	+	1	0	PAPPA2	175001558	0.994000	0.37717	0.997000	0.53966	0.578000	0.36192	3.376000	0.52417	2.691000	0.91804	0.655000	0.94253	CTT	PAPPA2	-	superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP	ENSG00000116183		0.512	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA2	HGNC	protein_coding	OTTHUMT00000084763.1	-	0.00	63	0	C			176734935	+1	tier1	-	no_errors	ENST00000367662	ensembl	human	known	74_37	missense	8.16	45	4	SNP	0.989	T
PCDHB2	56133	genome.wustl.edu	37	5	140475258	140475258	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr5:140475258G>T	ENST00000194155.4	+	1	1032	c.884G>T	c.(883-885)cGa>cTa	p.R295L		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	295	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AAAACGTTTCGATTAAGTGCA	0.428																																																	0													81.0	83.0	82.0					5																	140475258		2203	4300	6503	SO:0001583	missense	0			AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.884G>T	5.37:g.140475258G>T	ENSP00000194155:p.Arg295Leu		Q4KMU1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R295L	ENST00000194155.4	37	c.884	CCDS4244.1	5	.	.	.	.	.	.	.	.	.	.	G	3.152	-0.174038	0.06421	.	.	ENSG00000112852	ENST00000194155	T	0.55413	0.52	5.42	-7.99	0.01131	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.32852	0.0843	L	0.31845	0.965	0.09310	N	1	B	0.06786	0.001	B	0.12156	0.007	T	0.30621	-0.9972	9	0.54805	T	0.06	.	4.9524	0.14021	0.5645:0.0814:0.1904:0.1638	.	295	Q9Y5E7	PCDB2_HUMAN	L	295	ENSP00000194155:R295L	ENSP00000194155:R295L	R	+	2	0	PCDHB2	140455442	0.000000	0.05858	0.155000	0.22561	0.190000	0.23558	-1.964000	0.01512	-1.669000	0.01470	-0.768000	0.03414	CGA	PCDHB2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000112852		0.428	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB2	HGNC	protein_coding	OTTHUMT00000251801.2		0.00	61	0	G	NM_018936		140475258	+1			no_errors	ENST00000194155	ensembl	human	known	74_37	missense	6.25	45	3	SNP	0.000	T
PCDHB12	56124	genome.wustl.edu	37	5	140588791	140588791	+	Silent	SNP	G	G	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr5:140588791G>A	ENST00000239450.2	+	1	501	c.312G>A	c.(310-312)ctG>ctA	p.L104L	PCDHB12_ENST00000541609.1_Intron	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	104	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTTGTGTGCTGTATTTCCAAG	0.448																																																	0													79.0	88.0	85.0					5																	140588791		2203	4300	6503	SO:0001819	synonymous_variant	0			AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.312G>A	5.37:g.140588791G>A			B4DDU1	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L104	ENST00000239450.2	37	c.312	CCDS4254.1	5																																																																																			PCDHB12	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000120328		0.448	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB12	HGNC	protein_coding	OTTHUMT00000251815.2		0.00	67	0	G	NM_018932		140588791	+1			no_errors	ENST00000239450	ensembl	human	known	74_37	silent	5.41	70	4	SNP	0.002	A
PDCD6IP	10015	genome.wustl.edu	37	3	33906852	33906852	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr3:33906852C>G	ENST00000307296.3	+	17	2739	c.2362C>G	c.(2362-2364)Caa>Gaa	p.Q788E	PDCD6IP_ENST00000457054.2_Missense_Mutation_p.Q793E			Q8WUM4	PDC6I_HUMAN	programmed cell death 6 interacting protein	788	Interaction with EIAV p9.|Pro-rich.|Self-association.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell division (GO:0051301)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium-dependent protein binding (GO:0048306)|protein homodimerization activity (GO:0042803)			central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|skin(1)|stomach(1)	23						AGCTCCATCACAAACGCCTGG	0.597																																																	0													52.0	48.0	50.0					3																	33906852		2203	4300	6503	SO:0001583	missense	0			BC020066	CCDS2660.1, CCDS54561.1	3p22.3	2012-08-30	2001-11-29		ENSG00000170248	ENSG00000170248			8766	protein-coding gene	gene with protein product	"""ALG-2 interacting protein X"""	608074	"""programmed cell death 6-interacting protein"""			9880530	Standard	NM_001162429		Approved	Alix, AIP1, Hp95	uc003cfy.4	Q8WUM4	OTTHUMG00000130751	ENST00000307296.3:c.2362C>G	3.37:g.33906852C>G	ENSP00000307387:p.Gln788Glu		C5MQH7|E9PFU1|Q6NUS1|Q9BX86|Q9NUN0|Q9P2H2|Q9UKL5	Missense_Mutation	SNP	pfam_BRO1_dom,pfscan_BRO1_dom	p.Q793E	ENST00000307296.3	37	c.2377	CCDS2660.1	3	.	.	.	.	.	.	.	.	.	.	C	8.201	0.798204	0.16397	.	.	ENSG00000170248	ENST00000307296;ENST00000457054	T;T	0.14022	2.54;2.54	5.71	4.8	0.61643	.	4.427580	0.00496	N	0.000155	T	0.18002	0.0432	L	0.48642	1.525	0.09310	N	1	B;B;B	0.16396	0.017;0.017;0.017	B;B;B	0.09377	0.004;0.004;0.004	T	0.27297	-1.0078	10	0.30078	T	0.28	-0.5633	12.2192	0.54425	0.133:0.7388:0.1283:0.0	.	569;793;788	B7Z5C1;E9PFU1;Q8WUM4	.;.;PDC6I_HUMAN	E	788;793	ENSP00000307387:Q788E;ENSP00000411825:Q793E	ENSP00000307387:Q788E	Q	+	1	0	PDCD6IP	33881856	0.031000	0.19500	0.008000	0.14137	0.193000	0.23685	2.528000	0.45624	2.680000	0.91292	0.655000	0.94253	CAA	PDCD6IP	-	NULL	ENSG00000170248		0.597	PDCD6IP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PDCD6IP	HGNC	protein_coding	OTTHUMT00000253251.2	-	0.00	70	0	C			33906852	+1	tier1	-	no_errors	ENST00000457054	ensembl	human	known	74_37	missense	57.41	23	31	SNP	0.007	G
PDE4D	5144	genome.wustl.edu	37	5	58289273	58289273	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr5:58289273C>T	ENST00000340635.6	-	7	1116	c.941G>A	c.(940-942)cGg>cAg	p.R314Q	PDE4D_ENST00000360047.5_Missense_Mutation_p.R178Q|PDE4D_ENST00000317118.8_Missense_Mutation_p.R23Q|PDE4D_ENST00000546160.1_Missense_Mutation_p.R253Q|PDE4D_ENST00000503258.1_Missense_Mutation_p.R184Q|PDE4D_ENST00000405755.2_Missense_Mutation_p.R192Q|PDE4D_ENST00000507116.1_Missense_Mutation_p.R250Q|PDE4D_ENST00000358923.6_Missense_Mutation_p.R12Q|PDE4D_ENST00000502484.2_Missense_Mutation_p.R253Q	NM_001104631.1	NP_001098101.1	Q08499	PDE4D_HUMAN	phosphodiesterase 4D, cAMP-specific	314					adrenergic receptor signaling pathway (GO:0071875)|adrenergic receptor signaling pathway involved in positive regulation of heart rate (GO:0086024)|aging (GO:0007568)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|establishment of endothelial barrier (GO:0061028)|multicellular organism growth (GO:0035264)|negative regulation of heart contraction (GO:0045822)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-5 production (GO:0032754)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of receptor activity (GO:0010469)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|smooth muscle contraction (GO:0006939)|T cell receptor signaling pathway (GO:0050852)	calcium channel complex (GO:0034704)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|ATPase binding (GO:0051117)|beta-2 adrenergic receptor binding (GO:0031698)|cAMP binding (GO:0030552)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|pancreas(1)	15		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	GGTGAGCTCCCGATTAAGCAT	0.323																																																	0													77.0	74.0	75.0					5																	58289273		1801	4074	5875	SO:0001583	missense	0				CCDS47213.1, CCDS54858.1, CCDS54859.1, CCDS56369.1, CCDS56370.1, CCDS56371.1, CCDS56372.1, CCDS56373.1	5q12	2010-06-24	2010-06-24				3.1.4.17	"""Phosphodiesterases"""	8783	protein-coding gene	gene with protein product	"""phosphodiesterase E3 dunce homolog (Drosophila)"""	600129	"""phosphodiesterase 4D, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E3)"""	DPDE3			Standard	NM_006203		Approved		uc003jsa.2	Q08499		ENST00000340635.6:c.941G>A	5.37:g.58289273C>T	ENSP00000345502:p.Arg314Gln		O43433|Q13549|Q13550|Q13551|Q7Z2L8|Q8IV84|Q8IVA9|Q8IVD2|Q8IVD3|Q96HL4|Q9HCX7	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,prints_PDEase	p.R314Q	ENST00000340635.6	37	c.941	CCDS47213.1	5	.	.	.	.	.	.	.	.	.	.	c	32	5.145466	0.94603	.	.	ENSG00000113448	ENST00000340635;ENST00000356665;ENST00000360047;ENST00000507116;ENST00000358923;ENST00000317118;ENST00000503258;ENST00000405755;ENST00000502484;ENST00000546160;ENST00000505453	T;T;T;T;T;T;T;T;T;T	0.70749	-0.51;-0.47;-0.5;-0.22;-0.27;-0.47;-0.48;-0.51;-0.51;-0.31	5.04	5.04	0.67666	.	0.107666	0.64402	D	0.000010	D	0.87716	0.6247	M	0.92412	3.305	0.58432	D	0.999996	D;D;D;D;D;D;P;P	0.69078	0.997;0.994;0.997;0.965;0.965;0.997;0.789;0.955	D;D;D;P;P;D;P;B	0.69479	0.964;0.921;0.964;0.69;0.69;0.964;0.493;0.345	D	0.90456	0.4442	10	0.72032	D	0.01	.	18.6122	0.91290	0.0:1.0:0.0:0.0	.	253;314;250;177;192;184;89;23	Q08499-11;Q08499;Q08499-6;Q08499-2;Q08499-9;Q08499-10;Q08499-4;Q08499-8	.;PDE4D_HUMAN;.;.;.;.;.;.	Q	314;183;178;250;12;23;184;192;253;253;12	ENSP00000345502:R314Q;ENSP00000353152:R178Q;ENSP00000424852:R250Q;ENSP00000351800:R12Q;ENSP00000321739:R23Q;ENSP00000425605:R184Q;ENSP00000384806:R192Q;ENSP00000423094:R253Q;ENSP00000442734:R253Q;ENSP00000421013:R12Q	ENSP00000321739:R23Q	R	-	2	0	PDE4D	58325030	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.523000	0.81856	2.640000	0.89533	0.552000	0.68991	CGG	PDE4D	-	NULL	ENSG00000113448		0.323	PDE4D-001	KNOWN	basic|CCDS	protein_coding	PDE4D	HGNC	protein_coding	OTTHUMT00000367940.3	-	0.00	65	0	C			58289273	-1	tier1	-	no_errors	ENST00000340635	ensembl	human	known	74_37	missense	21.43	33	9	SNP	1.000	T
PDE4D	5144	genome.wustl.edu	37	5	58511631	58511631	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr5:58511631A>G	ENST00000340635.6	-	2	794	c.619T>C	c.(619-621)Tcc>Ccc	p.S207P	PDE4D_ENST00000503947.1_5'UTR|PDE4D_ENST00000360047.5_Missense_Mutation_p.S71P|PDE4D_ENST00000546160.1_Missense_Mutation_p.S146P|PDE4D_ENST00000503258.1_Missense_Mutation_p.S77P|PDE4D_ENST00000502575.1_Missense_Mutation_p.S143P|PDE4D_ENST00000405755.2_Missense_Mutation_p.S85P|PDE4D_ENST00000507116.1_Missense_Mutation_p.S143P|PDE4D_ENST00000502484.2_Missense_Mutation_p.S146P	NM_001104631.1	NP_001098101.1	Q08499	PDE4D_HUMAN	phosphodiesterase 4D, cAMP-specific	207					adrenergic receptor signaling pathway (GO:0071875)|adrenergic receptor signaling pathway involved in positive regulation of heart rate (GO:0086024)|aging (GO:0007568)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|establishment of endothelial barrier (GO:0061028)|multicellular organism growth (GO:0035264)|negative regulation of heart contraction (GO:0045822)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-5 production (GO:0032754)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of receptor activity (GO:0010469)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|smooth muscle contraction (GO:0006939)|T cell receptor signaling pathway (GO:0050852)	calcium channel complex (GO:0034704)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|ATPase binding (GO:0051117)|beta-2 adrenergic receptor binding (GO:0031698)|cAMP binding (GO:0030552)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|pancreas(1)	15		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	GAGTTCCGGGACATAGACTTT	0.443																																																	0													107.0	104.0	105.0					5																	58511631		1877	4116	5993	SO:0001583	missense	0				CCDS47213.1, CCDS54858.1, CCDS54859.1, CCDS56369.1, CCDS56370.1, CCDS56371.1, CCDS56372.1, CCDS56373.1	5q12	2010-06-24	2010-06-24				3.1.4.17	"""Phosphodiesterases"""	8783	protein-coding gene	gene with protein product	"""phosphodiesterase E3 dunce homolog (Drosophila)"""	600129	"""phosphodiesterase 4D, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E3)"""	DPDE3			Standard	NM_006203		Approved		uc003jsa.2	Q08499		ENST00000340635.6:c.619T>C	5.37:g.58511631A>G	ENSP00000345502:p.Ser207Pro		O43433|Q13549|Q13550|Q13551|Q7Z2L8|Q8IV84|Q8IVA9|Q8IVD2|Q8IVD3|Q96HL4|Q9HCX7	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,prints_PDEase	p.S207P	ENST00000340635.6	37	c.619	CCDS47213.1	5	.	.	.	.	.	.	.	.	.	.	A	27.0	4.795632	0.90453	.	.	ENSG00000113448	ENST00000340635;ENST00000356665;ENST00000360047;ENST00000507116;ENST00000503258;ENST00000405755;ENST00000502484;ENST00000546160;ENST00000502575	T;T;T;T;T;T;T;D	0.89939	-1.2;-1.16;-1.23;-1.16;-1.19;-1.23;-1.23;-2.59	4.66	4.66	0.58398	.	0.000000	0.85682	D	0.000000	D	0.94411	0.8202	M	0.82630	2.6	0.58432	D	0.999999	D;D;D;D;D;D;D;D	0.89917	0.981;1.0;0.981;0.967;0.981;0.999;0.999;0.981	D;D;D;D;D;D;D;D	0.91635	0.972;0.999;0.959;0.939;0.959;0.999;0.999;0.959	D	0.95220	0.8333	10	0.87932	D	0	.	14.4182	0.67165	1.0:0.0:0.0:0.0	.	87;143;146;207;143;70;85;77	Q9HCX6;Q08499-12;Q08499-11;Q08499;Q08499-6;Q08499-2;Q08499-9;Q08499-10	.;.;.;PDE4D_HUMAN;.;.;.;.	P	207;76;71;143;77;85;146;146;143	ENSP00000345502:S207P;ENSP00000353152:S71P;ENSP00000424852:S143P;ENSP00000425605:S77P;ENSP00000384806:S85P;ENSP00000423094:S146P;ENSP00000442734:S146P;ENSP00000425917:S143P	ENSP00000308485:S143P	S	-	1	0	PDE4D	58547388	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.287000	0.95975	1.863000	0.54032	0.482000	0.46254	TCC	PDE4D	-	NULL	ENSG00000113448		0.443	PDE4D-001	KNOWN	basic|CCDS	protein_coding	PDE4D	HGNC	protein_coding	OTTHUMT00000367940.3	-	0.00	57	0	A			58511631	-1	tier1	-	no_errors	ENST00000340635	ensembl	human	known	74_37	missense	35.71	27	15	SNP	1.000	G
PDE6H	5149	genome.wustl.edu	37	12	15134380	15134380	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr12:15134380G>T	ENST00000266395.2	+	4	328	c.222G>T	c.(220-222)ttG>ttT	p.L74F		NM_006205.2	NP_006196.1	Q13956	CNCG_HUMAN	phosphodiesterase 6H, cGMP-specific, cone, gamma	74					activation of MAPK activity (GO:0000187)|negative regulation of catalytic activity (GO:0043086)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|response to stimulus (GO:0050896)|visual perception (GO:0007601)		3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|cGMP binding (GO:0030553)|enzyme inhibitor activity (GO:0004857)			endometrium(1)|lung(6)|ovary(1)|skin(2)	10					Sildenafil(DB00203)|Vardenafil(DB00862)	ACCTGGAATTGCATGAGCTCG	0.483																																																	0													175.0	154.0	161.0					12																	15134380		2203	4300	6503	SO:0001583	missense	0				CCDS8672.1	12p13	2008-03-18					3.1.4.17	"""Phosphodiesterases"""	8790	protein-coding gene	gene with protein product		601190				8786098	Standard	NM_006205		Approved		uc001rcr.3	Q13956		ENST00000266395.2:c.222G>T	12.37:g.15134380G>T	ENSP00000266395:p.Leu74Phe		Q52LY7	Missense_Mutation	SNP	pfam_PDE6_gamma,pirsf_PDE6_gamma	p.L74F	ENST00000266395.2	37	c.222	CCDS8672.1	12	.	.	.	.	.	.	.	.	.	.	G	16.71	3.199077	0.58126	.	.	ENSG00000139053	ENST00000266395	T	0.60040	0.22	5.08	3.09	0.35607	.	0.000000	0.64402	D	0.000001	T	0.68732	0.3033	.	.	.	0.46586	D	0.999115	D	0.76494	0.999	D	0.87578	0.998	T	0.67385	-0.5684	9	0.72032	D	0.01	.	2.729	0.05222	0.3425:0.2515:0.406:0.0	.	74	Q13956	CNCG_HUMAN	F	74	ENSP00000266395:L74F	ENSP00000266395:L74F	L	+	3	2	PDE6H	15025647	1.000000	0.71417	0.981000	0.43875	0.828000	0.46876	1.138000	0.31491	0.651000	0.30788	0.591000	0.81541	TTG	PDE6H	-	pfam_PDE6_gamma,pirsf_PDE6_gamma	ENSG00000139053		0.483	PDE6H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE6H	HGNC	protein_coding	OTTHUMT00000400880.1	-	0.00	43	0	G			15134380	+1	tier1	-	no_errors	ENST00000266395	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	T
PDPR	55066	genome.wustl.edu	37	16	70187417	70187417	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr16:70187417A>G	ENST00000288050.4	+	18	3133	c.2176A>G	c.(2176-2178)Ata>Gta	p.I726V	PDPR_ENST00000568530.1_Missense_Mutation_p.I726V|PDPR_ENST00000542659.1_Missense_Mutation_p.I71V|RP11-296I10.3_ENST00000566989.1_RNA|PDPR_ENST00000562100.1_Intron|PDPR_ENST00000567046.1_Missense_Mutation_p.I84V|PDPR_ENST00000398122.3_Missense_Mutation_p.I626V	NM_017990.3	NP_060460.4	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory subunit	726					cellular metabolic process (GO:0044237)|glycine catabolic process (GO:0006546)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|oxidoreductase activity (GO:0016491)	p.I726V(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|skin(2)|stomach(3)	33				BRCA - Breast invasive adenocarcinoma(221;0.124)		GGGTCAGGATATAAATAACCT	0.488																																																	1	Substitution - Missense(1)	lung(1)											84.0	87.0	86.0					16																	70187417		1927	4140	6067	SO:0001583	missense	0				CCDS45520.1	16q22.1	2010-08-24			ENSG00000090857	ENSG00000090857			30264	protein-coding gene	gene with protein product						9395502	Standard	NM_017990		Approved	PDP3	uc002eyf.1	Q8NCN5		ENST00000288050.4:c.2176A>G	16.37:g.70187417A>G	ENSP00000288050:p.Ile726Val		A7E298|A8K8Y7|B3KSE1|Q6AI20|Q6AWC9	Missense_Mutation	SNP	pfam_FAD-dep_OxRdtase,pfam_GCV_T_N,pfam_GCV_T_C,pfam_FAD_bind_dom	p.I726V	ENST00000288050.4	37	c.2176	CCDS45520.1	16	.	.	.	.	.	.	.	.	.	.	A	16.79	3.221573	0.58560	.	.	ENSG00000090857	ENST00000288050;ENST00000398122;ENST00000542659	T;T;T	0.77750	-1.12;-1.12;-1.12	6.04	-1.32	0.09201	Glycine cleavage T-protein, N-terminal (1);	0.068192	0.64402	D	0.000011	T	0.71804	0.3383	M	0.62154	1.92	0.28016	N	0.934693	B	0.20164	0.042	B	0.32211	0.142	T	0.65598	-0.6129	10	0.66056	D	0.02	.	7.0701	0.25173	0.1492:0.5197:0.0:0.3312	.	726	Q8NCN5	PDPR_HUMAN	V	726;626;71	ENSP00000288050:I726V;ENSP00000381190:I626V;ENSP00000441690:I71V	ENSP00000288050:I726V	I	+	1	0	PDPR	68744918	1.000000	0.71417	0.988000	0.46212	0.971000	0.66376	1.659000	0.37387	-0.280000	0.09154	-0.527000	0.04329	ATA	PDPR	-	pfam_GCV_T_N	ENSG00000090857		0.488	PDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDPR	HGNC	protein_coding	OTTHUMT00000434502.1	-	0.00	111	0	A	NM_017990		70187417	+1	tier1	-	no_errors	ENST00000288050	ensembl	human	known	74_37	missense	17.65	98	21	SNP	0.993	G
PDZD3	79849	genome.wustl.edu	37	11	119056655	119056655	+	5'UTR	SNP	T	T	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr11:119056655T>C	ENST00000531114.1	+	0	472				PDZD3_ENST00000525131.1_5'UTR|PDZD3_ENST00000392817.2_5'Flank|PDZD3_ENST00000322712.4_Missense_Mutation_p.L13S|PDZD3_ENST00000355547.5_Missense_Mutation_p.L13S			Q86UT5	NHRF4_HUMAN	PDZ domain containing 3						cGMP-mediated signaling (GO:0019934)|ion transport (GO:0006811)|negative regulation of cGMP biosynthetic process (GO:0030827)|negative regulation of guanylate cyclase activity (GO:0031283)|receptor guanylyl cyclase signaling pathway (GO:0007168)|response to toxic substance (GO:0009636)|water transport (GO:0006833)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|subapical complex (GO:0035003)	guanylate cyclase inhibitor activity (GO:0030251)|ion channel inhibitor activity (GO:0008200)|protein C-terminus binding (GO:0008022)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(1)|lung(4)|ovary(1)	14	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;7.52e-05)		ACAGCCTCGTTAACTCTGTAA	0.527																																																	0													75.0	73.0	74.0					11																	119056655		2200	4295	6495	SO:0001623	5_prime_UTR_variant	0			AK091966	CCDS8417.1, CCDS53719.1	11q23.3	2008-02-05	2006-01-24	2006-01-24	ENSG00000172367	ENSG00000172367			19891	protein-coding gene	gene with protein product		607146	"""PDZ domain containing 2"""	PDZK2		11950846	Standard	NM_024791		Approved	FLJ22756, IKEPP	uc001pvz.3	Q86UT5	OTTHUMG00000166224	ENST00000531114.1:c.-78T>C	11.37:g.119056655T>C			Q8N6R4|Q8NAW7|Q8NEX7|Q9H5Z3	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.L13S	ENST00000531114.1	37	c.38		11	.	.	.	.	.	.	.	.	.	.	T	9.100	1.003933	0.19199	.	.	ENSG00000172367	ENST00000355547;ENST00000322712;ENST00000454065	T;T	0.81163	1.09;-1.46	4.36	4.36	0.52297	.	.	.	.	.	T	0.81346	0.4803	M	0.64997	1.995	0.19945	N	0.999944	P;P	0.50943	0.94;0.901	P;P	0.51135	0.66;0.458	T	0.71856	-0.4466	9	0.46703	T	0.11	.	6.6615	0.23016	0.0:0.1092:0.0:0.8908	.	13;13	Q86UT5-2;B0YJ61	.;.	S	13	ENSP00000347742:L13S;ENSP00000327107:L13S	ENSP00000327107:L13S	L	+	2	0	PDZD3	118561865	0.023000	0.18921	0.021000	0.16686	0.004000	0.04260	1.482000	0.35486	1.609000	0.50190	0.459000	0.35465	TTA	PDZD3	-	NULL	ENSG00000172367		0.527	PDZD3-004	KNOWN	basic	protein_coding	PDZD3	HGNC	protein_coding	OTTHUMT00000388471.1	-	0.00	60	0	T	NM_024791		119056655	+1	tier1	-	no_errors	ENST00000355547	ensembl	human	known	74_37	missense	56.38	41	53	SNP	0.029	C
PDZRN3	23024	genome.wustl.edu	37	3	73433779	73433779	+	Silent	SNP	G	G	A	rs377558165		TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr3:73433779G>A	ENST00000263666.4	-	10	2052	c.1938C>T	c.(1936-1938)ttC>ttT	p.F646F	PDZRN3_ENST00000479530.1_Silent_p.F363F|PDZRN3_ENST00000466348.1_5'Flank|PDZRN3_ENST00000535920.1_Silent_p.F368F|PDZRN3_ENST00000466780.1_Silent_p.F303F|PDZRN3_ENST00000462146.2_Silent_p.F303F	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	646					neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		GGAGCTCGCGGAAGCGCTCGC	0.657																																																	0								G		1,4405	2.1+/-5.4	0,1,2202	56.0	61.0	60.0		1938	2.2	1.0	3		60	0,8600		0,0,4300	no	coding-synonymous	PDZRN3	NM_015009.1		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		646/1067	73433779	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.1938C>T	3.37:g.73433779G>A			A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	Silent	SNP	pfam_PDZ,pfam_Znf_C3HC4_RING-type,superfamily_PDZ,superfamily_TRAF-like,smart_Znf_RING,smart_PDZ,pfscan_PDZ,pfscan_Znf_RING,pfscan_Znf_TRAF	p.F646	ENST00000263666.4	37	c.1938	CCDS33789.1	3																																																																																			PDZRN3	-	NULL	ENSG00000121440		0.657	PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZRN3	HGNC	protein_coding	OTTHUMT00000352460.1	-	0.00	32	0	G	XM_041363		73433779	-1	tier1	-	no_errors	ENST00000263666	ensembl	human	known	74_37	silent	56.52	10	13	SNP	1.000	A
PEAK1	79834	genome.wustl.edu	37	15	77473641	77473641	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr15:77473641T>A	ENST00000560626.2	-	4	1103	c.628A>T	c.(628-630)Att>Ttt	p.I210F	PEAK1_ENST00000312493.4_Missense_Mutation_p.I210F|PEAK1_ENST00000558305.1_Missense_Mutation_p.I210F			Q9H792	PEAK1_HUMAN	pseudopodium-enriched atypical kinase 1	210					cell migration (GO:0016477)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										CCACTCAGAATAACATGCTTG	0.443																																																	0													199.0	183.0	188.0					15																	77473641		1888	4115	6003	SO:0001583	missense	0				CCDS42062.1	15q24.3	2013-09-27			ENSG00000173517	ENSG00000173517			29431	protein-coding gene	gene with protein product		614248				16879967, 20534451	Standard	NM_024776		Approved	KIAA2002, sgk269		Q9H792	OTTHUMG00000172618	ENST00000560626.2:c.628A>T	15.37:g.77473641T>A	ENSP00000452796:p.Ile210Phe		Q6ZS78|Q8NAZ4|Q8NCM3|Q8TEG7	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	p.I210F	ENST00000560626.2	37	c.628	CCDS42062.1	15	.	.	.	.	.	.	.	.	.	.	T	9.045	0.990654	0.18966	.	.	ENSG00000173517	ENST00000312493	T	0.70282	-0.47	5.69	3.37	0.38596	.	0.520885	0.13192	U	0.406617	T	0.57110	0.2031	N	0.24115	0.695	0.19775	N	0.999959	P	0.34780	0.468	B	0.36030	0.216	T	0.50145	-0.8862	10	0.72032	D	0.01	-2.2957	8.6667	0.34125	0.0:0.383:0.0:0.617	.	210	Q9H792	PEAK1_HUMAN	F	210	ENSP00000309230:I210F	ENSP00000309230:I210F	I	-	1	0	AC087465.1	75260696	0.770000	0.28543	0.626000	0.29213	0.892000	0.51952	1.265000	0.33027	0.442000	0.26555	0.528000	0.53228	ATT	PEAK1	-	NULL	ENSG00000173517		0.443	PEAK1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PEAK1	HGNC	protein_coding	OTTHUMT00000419483.3	-	0.00	43	0	T			77473641	-1	tier1	-	no_errors	ENST00000312493	ensembl	human	known	74_37	missense	20.00	31	8	SNP	0.142	A
PHF14	9678	genome.wustl.edu	37	7	11068417	11068417	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr7:11068417G>T	ENST00000403050.3	+	7	1879	c.1427G>T	c.(1426-1428)gGt>gTt	p.G476V	PHF14_ENST00000445996.2_Missense_Mutation_p.G191V	NM_014660.3	NP_055475.2	O94880	PHF14_HUMAN	PHD finger protein 14	476					lung alveolus development (GO:0048286)|negative regulation of mesenchymal cell proliferation involved in lung development (GO:2000791)|negative regulation of platelet-derived growth factor receptor-alpha signaling pathway (GO:2000584)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	35				UCEC - Uterine corpus endometrioid carcinoma (126;0.205)		CAAAAGGAAGGTCTGCTTTCA	0.443																																																	0													126.0	119.0	121.0					7																	11068417		1950	4156	6106	SO:0001583	missense	0			AB018326	CCDS47542.1	7p21.3	2013-01-28			ENSG00000106443	ENSG00000106443		"""Zinc fingers, PHD-type"""	22203	protein-coding gene	gene with protein product						9872452	Standard	NM_014660		Approved	KIAA0783	uc003sry.2	O94880	OTTHUMG00000150463	ENST00000403050.3:c.1427G>T	7.37:g.11068417G>T	ENSP00000385795:p.Gly476Val		A7MCZ3|B4DI82	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.G476V	ENST00000403050.3	37	c.1427	CCDS47542.1	7	.	.	.	.	.	.	.	.	.	.	G	32	5.140060	0.94560	.	.	ENSG00000106443	ENST00000403050;ENST00000445996	T;T	0.18960	2.18;2.18	5.31	5.31	0.75309	Zinc finger, PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.63733	0.2536	H	0.96916	3.905	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;0.999;1.0;0.997	T	0.77284	-0.2645	10	0.87932	D	0	.	19.3605	0.94436	0.0:0.0:1.0:0.0	.	191;191;476;476	O94880-2;B4DG57;A8MSQ1;O94880	.;.;.;PHF14_HUMAN	V	476;191	ENSP00000385795:G476V;ENSP00000403907:G191V	ENSP00000385795:G476V	G	+	2	0	PHF14	11034942	1.000000	0.71417	0.997000	0.53966	0.973000	0.67179	9.752000	0.98900	2.630000	0.89119	0.650000	0.86243	GGT	PHF14	-	smart_Znf_PHD	ENSG00000106443		0.443	PHF14-001	KNOWN	basic|CCDS	protein_coding	PHF14	HGNC	protein_coding	OTTHUMT00000318212.1	-	0.00	62	0	G	NM_014660		11068417	+1	tier1	-	no_errors	ENST00000403050	ensembl	human	known	74_37	missense	34.78	30	16	SNP	1.000	T
PKN1	5585	genome.wustl.edu	37	19	14581013	14581013	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr19:14581013A>G	ENST00000242783.6	+	19	2497	c.2332A>G	c.(2332-2334)Acc>Gcc	p.T778A	PKN1_ENST00000342216.4_Missense_Mutation_p.T784A	NM_002741.3	NP_002732.3	Q16512	PKN1_HUMAN	protein kinase N1	778	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|epithelial cell migration (GO:0010631)|histone H3-T11 phosphorylation (GO:0035407)|hyperosmotic response (GO:0006972)|protein phosphorylation (GO:0006468)|regulation of cell motility (GO:2000145)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|GTP-Rho binding (GO:0017049)|histone binding (GO:0042393)|histone deacetylase binding (GO:0042826)|histone kinase activity (H3-T11 specific) (GO:0035402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)			breast(3)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)	31						ATTCTGTGGGACCCCGGAGTT	0.632																																					NSCLC(185;2539 2965 10733 52867)												0													78.0	87.0	84.0					19																	14581013		2202	4299	6501	SO:0001583	missense	0			S75546	CCDS42513.1, CCDS42514.1	19p13.12	2008-05-14	2004-07-01	2004-07-01	ENSG00000123143	ENSG00000123143			9405	protein-coding gene	gene with protein product		601032	"""protein kinase C-like 1"""	PRKCL1		9570957	Standard	NM_002741		Approved	DBK, PRK1, PKN, MGC46204, PAK1	uc002myq.3	Q16512	OTTHUMG00000039611	ENST00000242783.6:c.2332A>G	19.37:g.14581013A>G	ENSP00000242783:p.Thr778Ala		A8K7W5|B2R9R4|B3KVN3|Q15143|Q504U4|Q8IUV5|Q9UD44	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_HR1_rho-bd,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_HR1_rho-bd,superfamily_C2_dom,smart_HR1_rho-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_dom	p.T784A	ENST00000242783.6	37	c.2350	CCDS42513.1	19	.	.	.	.	.	.	.	.	.	.	A	18.21	3.574022	0.65765	.	.	ENSG00000123143	ENST00000242783;ENST00000342216	T;T	0.48201	0.82;0.82	4.06	4.06	0.47325	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	U	0.000001	T	0.70701	0.3254	M	0.88775	2.98	0.46222	D	0.998938	D;D	0.69078	0.996;0.997	D;D	0.79108	0.986;0.992	T	0.76578	-0.2908	10	0.87932	D	0	-13.4794	11.2607	0.49080	1.0:0.0:0.0:0.0	.	784;778	Q16512-2;Q16512	.;PKN1_HUMAN	A	778;784	ENSP00000242783:T778A;ENSP00000343325:T784A	ENSP00000242783:T778A	T	+	1	0	PKN1	14442013	1.000000	0.71417	0.988000	0.46212	0.410000	0.31052	8.992000	0.93519	1.828000	0.53243	0.402000	0.26972	ACC	PKN1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000123143		0.632	PKN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKN1	HGNC	protein_coding	OTTHUMT00000095510.1	-	0.00	59	0	A	NM_002741, NM_213560		14581013	+1	tier1	-	no_errors	ENST00000342216	ensembl	human	known	74_37	missense	39.62	32	21	SNP	1.000	G
PLEKHA5	54477	genome.wustl.edu	37	12	19496362	19496362	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr12:19496362G>T	ENST00000299275.6	+	17	2353	c.2347G>T	c.(2347-2349)Gaa>Taa	p.E783*	PLEKHA5_ENST00000543806.1_Nonsense_Mutation_p.E702*|PLEKHA5_ENST00000424268.1_Intron|PLEKHA5_ENST00000539256.1_Nonsense_Mutation_p.E541*|PLEKHA5_ENST00000359180.3_Nonsense_Mutation_p.E783*|PLEKHA5_ENST00000538714.1_Nonsense_Mutation_p.E841*|PLEKHA5_ENST00000355397.3_Nonsense_Mutation_p.E841*|PLEKHA5_ENST00000429027.2_Nonsense_Mutation_p.E886*|PLEKHA5_ENST00000317589.4_Nonsense_Mutation_p.E783*	NM_019012.5	NP_061885.2	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A member 5	783					reproductive system development (GO:0061458)	cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					AGGTACTACAGAAATAGGTAA	0.393																																					Pancreas(196;329 2193 11246 14234 19524)												0													102.0	105.0	104.0					12																	19496362		2203	4300	6503	SO:0001587	stop_gained	0			AF302150	CCDS8682.1, CCDS44840.1, CCDS44840.2, CCDS55809.1, CCDS58213.1, CCDS58214.1	12p12	2013-01-10			ENSG00000052126	ENSG00000052126		"""Pleckstrin homology (PH) domain containing"""	30036	protein-coding gene	gene with protein product		607770				11214970, 11001876	Standard	NM_001143821		Approved	PEPP2, KIAA1686, FLJ10667	uc031qgo.1	Q9HAU0	OTTHUMG00000167921	ENST00000299275.6:c.2347G>T	12.37:g.19496362G>T	ENSP00000299275:p.Glu783*		A0JP03|B4DGS1|E9PHQ3|F5H0I0|Q6NSF8|Q86ST7|Q8N3K6|Q96DY9|Q9BVR4|Q9C0H7|Q9H924|Q9NVK8	Nonsense_Mutation	SNP	pfam_Pleckstrin_homology,superfamily_WW_dom,smart_WW_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_WW_dom	p.E783*	ENST00000299275.6	37	c.2347	CCDS8682.1	12	.	.	.	.	.	.	.	.	.	.	G	15.67	2.903080	0.52227	.	.	ENSG00000052126	ENST00000317589;ENST00000355397;ENST00000359180;ENST00000429027;ENST00000299275;ENST00000539256;ENST00000538714;ENST00000543806;ENST00000536974;ENST00000538972	.	.	.	4.77	4.77	0.60923	.	0.894020	0.09833	N	0.749913	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	16.3423	0.83085	0.0:0.0:1.0:0.0	.	.	.	.	X	783;841;783;886;783;541;841;702;675;120	.	ENSP00000299275:E783X	E	+	1	0	PLEKHA5	19387629	1.000000	0.71417	0.946000	0.38457	0.661000	0.39034	7.049000	0.76613	2.377000	0.81083	0.591000	0.81541	GAA	PLEKHA5	-	NULL	ENSG00000052126		0.393	PLEKHA5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLEKHA5	HGNC	protein_coding	OTTHUMT00000397013.1		0.00	64	0	G	NM_019012		19496362	+1			no_errors	ENST00000317589	ensembl	human	known	74_37	nonsense	7.27	51	4	SNP	0.989	T
PLEKHM2	23207	genome.wustl.edu	37	1	16059221	16059221	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr1:16059221C>G	ENST00000375799.3	+	19	3147	c.2920C>G	c.(2920-2922)Cag>Gag	p.Q974E	PLEKHM2_ENST00000477849.1_3'UTR|RP11-288I21.1_ENST00000453804.1_RNA|PLEKHM2_ENST00000375793.2_Missense_Mutation_p.Q954E	NM_015164.2	NP_055979.2	Q8IWE5	PKHM2_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 2	974					Golgi organization (GO:0007030)	cytoplasm (GO:0005737)	kinesin binding (GO:0019894)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.000259)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00057)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		AACCATCTATCAGGTACCCAG	0.612																																																	0													47.0	52.0	50.0					1																	16059221		1990	4178	6168	SO:0001583	missense	0			AB020649	CCDS44063.1	1p36.13	2013-01-10			ENSG00000116786	ENSG00000116786		"""Pleckstrin homology (PH) domain containing"""	29131	protein-coding gene	gene with protein product		609613				10048485	Standard	NM_015164		Approved	KIAA0842	uc010obo.2	Q8IWE5	OTTHUMG00000003062	ENST00000375799.3:c.2920C>G	1.37:g.16059221C>G	ENSP00000364956:p.Gln974Glu		O94928|Q5VT65|Q6NUH9|Q7L8G1|Q8IVT7|Q8N2T4|Q96AY0|Q9NTF7	Missense_Mutation	SNP	pfam_Run,pfam_Pleckstrin_homology,smart_Run,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Run	p.Q974E	ENST00000375799.3	37	c.2920	CCDS44063.1	1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.073039	0.76415	.	.	ENSG00000116786	ENST00000375799;ENST00000375793	T;T	0.53423	0.64;0.62	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.58652	0.2137	L	0.34521	1.04	0.80722	D	1	D	0.65815	0.995	D	0.72625	0.978	T	0.57694	-0.7767	10	0.44086	T	0.13	-19.8694	17.1271	0.86717	0.0:1.0:0.0:0.0	.	974	Q8IWE5	PKHM2_HUMAN	E	974;954	ENSP00000364956:Q974E;ENSP00000364950:Q954E	ENSP00000364950:Q954E	Q	+	1	0	PLEKHM2	15931808	1.000000	0.71417	1.000000	0.80357	0.693000	0.40251	7.042000	0.76565	2.469000	0.83416	0.655000	0.94253	CAG	PLEKHM2	-	NULL	ENSG00000116786		0.612	PLEKHM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHM2	HGNC	protein_coding	OTTHUMT00000008463.1	-	0.00	57	0	C	NM_015164		16059221	+1	tier1	-	no_errors	ENST00000375799	ensembl	human	known	74_37	missense	28.00	36	14	SNP	1.000	G
PLXNA2	5362	genome.wustl.edu	37	1	208315682	208315682	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr1:208315682C>T	ENST00000367033.3	-	4	2255	c.1498G>A	c.(1498-1500)Gag>Aag	p.E500K		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	500	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		ACCTGTCTCTCAGACATGACG	0.498																																																	0													87.0	74.0	78.0					1																	208315682		2203	4300	6503	SO:0001583	missense	0			X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.1498G>A	1.37:g.208315682C>T	ENSP00000356000:p.Glu500Lys		A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semap_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.E500K	ENST00000367033.3	37	c.1498	CCDS31013.1	1	.	.	.	.	.	.	.	.	.	.	C	17.96	3.515773	0.64634	.	.	ENSG00000076356	ENST00000367033	T	0.04706	3.57	4.89	4.89	0.63831	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (2);	0.370895	0.29660	N	0.011540	T	0.09158	0.0226	M	0.78049	2.395	0.80722	D	1	P	0.38642	0.641	B	0.31812	0.136	T	0.10823	-1.0613	10	0.42905	T	0.14	.	17.6837	0.88251	0.0:1.0:0.0:0.0	.	500	O75051	PLXA2_HUMAN	K	500	ENSP00000356000:E500K	ENSP00000356000:E500K	E	-	1	0	PLXNA2	206382305	1.000000	0.71417	1.000000	0.80357	0.774000	0.43823	7.022000	0.76431	2.254000	0.74563	0.655000	0.94253	GAG	PLXNA2	-	superfamily_Semap_dom,pfscan_Semap_dom	ENSG00000076356		0.498	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA2	HGNC	protein_coding	OTTHUMT00000088932.6	-	0.00	86	0	C	NM_025179		208315682	-1	tier1	-	no_errors	ENST00000367033	ensembl	human	known	74_37	missense	46.03	34	29	SNP	1.000	T
PLXNA3	55558	genome.wustl.edu	37	X	153697205	153697205	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chrX:153697205A>T	ENST00000369682.3	+	25	4502	c.4327A>T	c.(4327-4329)Atc>Ttc	p.I1443F		NM_017514.3	NP_059984.3	P51805	PLXA3_HUMAN	plexin A3	1443					axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|hippocampus development (GO:0021766)|multicellular organismal development (GO:0007275)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|positive regulation of cytoskeleton organization (GO:0051495)|pyramidal neuron development (GO:0021860)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|trigeminal nerve structural organization (GO:0021637)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	48	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TTACTGTGCCATCAAGCAGCA	0.607																																																	0													107.0	84.0	92.0					X																	153697205		2203	4300	6503	SO:0001583	missense	0			X74609	CCDS14752.1	Xq28	2008-02-05			ENSG00000130827	ENSG00000130827		"""Plexins"""	9101	protein-coding gene	gene with protein product		300022		PLXN4		8248200, 8733135	Standard	NM_017514		Approved	SEX, XAP-6, 6.3, Plxn3	uc004flm.3	P51805	OTTHUMG00000033290	ENST00000369682.3:c.4327A>T	X.37:g.153697205A>T	ENSP00000358696:p.Ile1443Phe		Q5HY36	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semap_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.I1443F	ENST00000369682.3	37	c.4327	CCDS14752.1	X	.	.	.	.	.	.	.	.	.	.	A	21.5	4.163901	0.78226	.	.	ENSG00000130827	ENST00000369682	T	0.17054	2.3	5.51	5.51	0.81932	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.49966	0.1588	M	0.91920	3.255	0.80722	D	1	D	0.69078	0.997	D	0.78314	0.991	T	0.61471	-0.7056	10	0.87932	D	0	.	13.5074	0.61491	1.0:0.0:0.0:0.0	.	1443	P51805	PLXA3_HUMAN	F	1443	ENSP00000358696:I1443F	ENSP00000358696:I1443F	I	+	1	0	PLXNA3	153350399	1.000000	0.71417	1.000000	0.80357	0.779000	0.44077	9.332000	0.96446	1.832000	0.53329	0.486000	0.48141	ATC	PLXNA3	-	pfam_Plexin_cytoplasmic_RasGAP_dom,superfamily_Rho_GTPase_activation_prot	ENSG00000130827		0.607	PLXNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA3	HGNC	protein_coding	OTTHUMT00000081634.1	-	0.00	33	0	A	NM_017514		153697205	+1	tier1	-	no_errors	ENST00000369682	ensembl	human	known	74_37	missense	69.57	14	32	SNP	1.000	T
PLXND1	23129	genome.wustl.edu	37	3	129304794	129304794	+	Splice_Site	SNP	C	C	G			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr3:129304794C>G	ENST00000324093.4	-	5	2030		c.e5+1		PLXND1_ENST00000393239.1_Splice_Site	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1						angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)		PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						CCAGGACTCACTGGGTACTCC	0.672																																					Ovarian(97;366 1484 3738 22084 39045)												0													105.0	113.0	110.0					3																	129304794		2203	4300	6503	SO:0001630	splice_region_variant	0			AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.1851+1G>C	3.37:g.129304794C>G			A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Splice_Site	SNP	-	e5+1	ENST00000324093.4	37	c.1851+1	CCDS33854.1	3	.	.	.	.	.	.	.	.	.	.	C	11.29	1.596326	0.28445	.	.	ENSG00000004399	ENST00000324093;ENST00000393239	.	.	.	4.98	4.98	0.66077	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4084	0.74900	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PLXND1	130787484	0.995000	0.38212	0.966000	0.40874	0.141000	0.21300	4.243000	0.58721	2.317000	0.78254	0.561000	0.74099	.	PLXND1	-	-	ENSG00000004399		0.672	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXND1	HGNC	protein_coding	OTTHUMT00000356132.4	-	0.00	116	0	C	NM_015103	Intron	129304794	-1	tier1	-	no_errors	ENST00000324093	ensembl	human	known	74_37	splice_site	15.91	148	28	SNP	0.994	G
PODN	127435	genome.wustl.edu	37	1	53542922	53542922	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr1:53542922C>G	ENST00000312553.5	+	6	793	c.786C>G	c.(784-786)aaC>aaG	p.N262K	RP11-334A14.5_ENST00000447867.1_RNA|PODN_ENST00000371500.3_Missense_Mutation_p.N243K|PODN_ENST00000395871.2_Intron	NM_001199081.1|NM_153703.4	NP_001186010.1|NP_714914.2	Q7Z5L7	PODN_HUMAN	podocan	214					negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						ACATGTTCAACGGCTCCAGCA	0.632																																																	0													116.0	118.0	117.0					1																	53542922		2203	4300	6503	SO:0001583	missense	0			AY313607	CCDS573.1, CCDS55601.1, CCDS55602.1	1p32.3	2008-02-05			ENSG00000174348	ENSG00000174348		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	23174	protein-coding gene	gene with protein product	"""podocan proteoglycan"""	608661					Standard	NM_153703		Approved	PCAN, PODOCAN, MGC24995, SLRR5A	uc010onr.2	Q7Z5L7	OTTHUMG00000008934	ENST00000312553.5:c.786C>G	1.37:g.53542922C>G	ENSP00000308315:p.Asn262Lys		B4DKN5|B4E373|Q5VVZ2|Q5VVZ3|Q6PIR3|Q6UXL8|Q8N641	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_LRR-contain_N,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_typical-subtyp	p.N262K	ENST00000312553.5	37	c.786	CCDS573.1	1	.	.	.	.	.	.	.	.	.	.	C	10.25	1.298393	0.23650	.	.	ENSG00000174348	ENST00000371500;ENST00000312553	T;T	0.44881	3.68;0.91	5.11	-3.6	0.04570	.	0.000000	0.85682	D	0.000000	T	0.40247	0.1109	N	0.17564	0.495	0.80722	D	1	D;P	0.89917	1.0;0.567	D;B	0.87578	0.998;0.276	T	0.22487	-1.0215	10	0.23302	T	0.38	.	13.452	0.61176	0.0:0.3971:0.0:0.6029	.	243;262	Q7Z5L7-2;Q7Z5L7-3	.;.	K	243;262	ENSP00000360555:N243K;ENSP00000308315:N262K	ENSP00000308315:N262K	N	+	3	2	PODN	53315510	0.010000	0.17322	0.977000	0.42913	0.999000	0.98932	-1.076000	0.03420	-0.556000	0.06134	0.655000	0.94253	AAC	PODN	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000174348		0.632	PODN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PODN	HGNC	protein_coding	OTTHUMT00000024735.1	-	0.00	39	0	C	NM_153703		53542922	+1	tier1	-	no_errors	ENST00000312553	ensembl	human	known	74_37	missense	44.44	30	24	SNP	0.850	G
POGK	57645	genome.wustl.edu	37	1	166818285	166818285	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr1:166818285G>T	ENST00000367875.1	+	5	829	c.469G>T	c.(469-471)Gat>Tat	p.D157Y	POGK_ENST00000536514.1_Missense_Mutation_p.D72Y|POGK_ENST00000537173.1_Missense_Mutation_p.D39Y|POGK_ENST00000367876.4_Missense_Mutation_p.D157Y			Q9P215	POGK_HUMAN	pogo transposable element with KRAB domain	157					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.D157Y(1)		endometrium(2)|kidney(1)|large_intestine(8)|lung(4)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	22						TCTGCCTCGGGATATCACAGA	0.557																																					GBM(76;192 1530 30153 48742)												1	Substitution - Missense(1)	lung(1)											104.0	99.0	101.0					1																	166818285		2203	4300	6503	SO:0001583	missense	0			AB040946	CCDS1254.1	1q23.2	2013-01-08			ENSG00000143157	ENSG00000143157		"""-"""	18800	protein-coding gene	gene with protein product	"""KRAB box domain containing 2"""						Standard	NM_017542		Approved	KIAA15131, LST003, BASS2, KRBOX2	uc001gdt.1	Q9P215	OTTHUMG00000034325	ENST00000367875.1:c.469G>T	1.37:g.166818285G>T	ENSP00000356849:p.Asp157Tyr		Q5TIJ1|Q8TE07	Missense_Mutation	SNP	pfam_DDE_SF_endonuclease_CENPB-like,pfam_Brinker_DNA-bd,pfam_HTH_CenpB_DNA-bd_dom,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,superfamily_Homeodomain-like,smart_Krueppel-associated_box,smart_HTH_CenpB_DNA-bd_dom,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.D157Y	ENST00000367875.1	37	c.469	CCDS1254.1	1	.	.	.	.	.	.	.	.	.	.	G	11.48	1.650515	0.29336	.	.	ENSG00000143157	ENST00000537173;ENST00000536514;ENST00000449930;ENST00000367876;ENST00000367875	T;T;T;T;T	0.33438	1.44;1.41;4.33;4.5;4.5	5.3	4.37	0.52481	.	0.000000	0.50627	D	0.000107	T	0.27454	0.0674	N	0.24115	0.695	0.34900	D	0.746398	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.85130	0.997;0.993;0.993	T	0.24905	-1.0147	9	0.87932	D	0	-27.377	10.9821	0.47501	0.0:0.0:0.8139:0.1861	.	39;72;157	G3V1P0;B4DS22;Q9P215	.;.;POGK_HUMAN	Y	39;72;157;157;157	ENSP00000442763:D39Y;ENSP00000441187:D72Y;ENSP00000404402:D157Y;ENSP00000356850:D157Y;ENSP00000356849:D157Y	ENSP00000356849:D157Y	D	+	1	0	POGK	165084909	0.478000	0.25917	0.122000	0.21767	0.961000	0.63080	2.532000	0.45659	1.425000	0.47237	0.655000	0.94253	GAT	POGK	-	NULL	ENSG00000143157		0.557	POGK-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	POGK	HGNC	protein_coding	OTTHUMT00000082888.1		0.00	62	0	G	NM_017542		166818285	+1			no_errors	ENST00000367875	ensembl	human	known	74_37	missense	5.56	51	3	SNP	0.406	T
POM121L12	285877	genome.wustl.edu	37	7	53103931	53103931	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr7:53103931C>A	ENST00000408890.4	+	1	583	c.567C>A	c.(565-567)agC>agA	p.S189R		NM_182595.3	NP_872401.3	Q8N7R1	P1L12_HUMAN	POM121 transmembrane nucleoporin-like 12	189										endometrium(5)|kidney(1)|large_intestine(5)|lung(44)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	61						CCAAGGGAAGCGCTAGGTTCG	0.701																																																	0													42.0	49.0	47.0					7																	53103931		1942	4128	6070	SO:0001583	missense	0				CCDS43584.1	7p12.1	2012-03-13	2012-03-13		ENSG00000221900	ENSG00000221900			25369	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 12"""				Standard	NM_182595		Approved	DKFZp564N2472	uc003tpz.3	Q8N7R1	OTTHUMG00000155995	ENST00000408890.4:c.567C>A	7.37:g.53103931C>A	ENSP00000386133:p.Ser189Arg		Q8NDI9	Missense_Mutation	SNP	NULL	p.S189R	ENST00000408890.4	37	c.567	CCDS43584.1	7	.	.	.	.	.	.	.	.	.	.	C	3.044	-0.196934	0.06259	.	.	ENSG00000221900	ENST00000408890	T	0.11169	2.8	2.21	-4.42	0.03579	.	.	.	.	.	T	0.03220	0.0094	N	0.01874	-0.695	0.09310	N	1	P	0.45044	0.849	B	0.43508	0.422	T	0.16012	-1.0417	9	0.20519	T	0.43	.	2.8682	0.05608	0.5914:0.1608:0.1302:0.1177	.	189	Q8N7R1	P1L12_HUMAN	R	189	ENSP00000386133:S189R	ENSP00000386133:S189R	S	+	3	2	POM121L12	53071425	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.471000	0.06631	-2.294000	0.00663	-0.310000	0.09108	AGC	POM121L12	-	NULL	ENSG00000221900		0.701	POM121L12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POM121L12	HGNC	protein_coding	OTTHUMT00000342656.1	-	0.00	68	0	C	NM_182595		53103931	+1	tier1	-	no_errors	ENST00000408890	ensembl	human	known	74_37	missense	16.67	65	13	SNP	0.000	A
POTEC	388468	genome.wustl.edu	37	18	14542998	14542998	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr18:14542998C>A	ENST00000358970.5	-	1	147	c.148G>T	c.(148-150)Gac>Tac	p.D50Y	POTEC_ENST00000389891.4_5'UTR	NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	50										NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						AAGGAGTCGTCGTGGTCTCCA	0.592																																																	0													44.0	48.0	47.0					18																	14542998		692	1591	2283	SO:0001583	missense	0			BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.148G>T	18.37:g.14542998C>A	ENSP00000351856:p.Asp50Tyr			Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.D50Y	ENST00000358970.5	37	c.148	CCDS45835.1	18	.	.	.	.	.	.	.	.	.	.	c	9.617	1.132723	0.21041	.	.	ENSG00000183206	ENST00000358970;ENST00000389891	T	0.39406	1.08	0.448	0.448	0.16614	.	.	.	.	.	T	0.48295	0.1492	L	0.43152	1.355	0.09310	N	1	D	0.60575	0.988	P	0.61275	0.886	T	0.33420	-0.9869	8	0.87932	D	0	.	.	.	.	.	50	B2RU33	POTEC_HUMAN	Y	50	ENSP00000351856:D50Y	ENSP00000351856:D50Y	D	-	1	0	POTEC	14532998	0.002000	0.14202	0.002000	0.10522	0.034000	0.12701	0.423000	0.21313	0.479000	0.27511	0.186000	0.17326	GAC	POTEC	-	NULL	ENSG00000183206		0.592	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	POTEC	HGNC	protein_coding	OTTHUMT00000371179.1	-	0.00	243	0	C	XM_496269		14542998	-1	tier1	-	no_errors	ENST00000358970	ensembl	human	known	74_37	missense	6.87	217	16	SNP	0.003	A
POU4F3	5459	genome.wustl.edu	37	5	145719130	145719130	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr5:145719130G>A	ENST00000230732.4	+	2	229	c.140G>A	c.(139-141)gGa>gAa	p.G47E	CTC-359M8.1_ENST00000515598.1_RNA	NM_002700.2	NP_002691.1	Q15319	PO4F3_HUMAN	POU class 4 homeobox 3	47					auditory receptor cell differentiation (GO:0042491)|axon extension (GO:0048675)|inner ear morphogenesis (GO:0042472)|neuromuscular process controlling balance (GO:0050885)|neuron apoptotic process (GO:0051402)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AATATATTTGGAAGCTTTGAT	0.542																																																	0													61.0	64.0	63.0					5																	145719130		2203	4300	6503	SO:0001583	missense	0			U10060	CCDS4281.1	5q32	2011-06-20	2007-07-13		ENSG00000091010	ENSG00000091010		"""Homeoboxes / POU class"""	9220	protein-coding gene	gene with protein product		602460	"""POU domain class 4, transcription factor 3"""	DFNA15		9506947	Standard	NM_002700		Approved	BRN3C	uc003loa.2	Q15319	OTTHUMG00000129684	ENST00000230732.4:c.140G>A	5.37:g.145719130G>A	ENSP00000230732:p.Gly47Glu		O60557|Q2M3F8	Missense_Mutation	SNP	pfam_POU_specific,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_POU_specific,prints_POU	p.G47E	ENST00000230732.4	37	c.140	CCDS4281.1	5	.	.	.	.	.	.	.	.	.	.	G	18.21	3.574080	0.65765	.	.	ENSG00000091010	ENST00000230732	T	0.21361	2.01	4.35	4.35	0.52113	.	0.321385	0.30320	N	0.009887	T	0.23806	0.0576	L	0.59436	1.845	0.80722	D	1	P	0.48089	0.905	B	0.39935	0.314	T	0.14924	-1.0455	10	0.87932	D	0	.	15.8169	0.78608	0.0:0.0:1.0:0.0	.	47	Q15319	PO4F3_HUMAN	E	47	ENSP00000230732:G47E	ENSP00000230732:G47E	G	+	2	0	POU4F3	145699323	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.092000	0.50207	2.249000	0.74217	0.462000	0.41574	GGA	POU4F3	-	NULL	ENSG00000091010		0.542	POU4F3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU4F3	HGNC	protein_coding	OTTHUMT00000251887.2	-	0.00	89	0	G	NM_002700		145719130	+1	tier1	-	no_errors	ENST00000230732	ensembl	human	known	74_37	missense	58.67	31	44	SNP	1.000	A
PRAMEF1	65121	genome.wustl.edu	37	1	12854479	12854479	+	Missense_Mutation	SNP	C	C	T	rs1063775	byFrequency	TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr1:12854479C>T	ENST00000332296.7	+	3	806	c.703C>T	c.(703-705)Cgc>Tgc	p.R235C	PRAMEF1_ENST00000400814.3_5'Flank	NM_023013.2	NP_075389.1	O95521	PRAM1_HUMAN	PRAME family member 1	235					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GAAGAATCTTCGCAAACTCGT	0.438													c|||	35	0.00698882	0.0	0.0	5008	,	,		29731	0.001		0.0	False		,,,				2504	0.0348																0													158.0	163.0	161.0					1																	12854479		2203	4300	6503	SO:0001583	missense	0			AL049686	CCDS148.1	1p36.21	2013-01-17			ENSG00000116721	ENSG00000116721		"""-"""	28840	protein-coding gene	gene with protein product							Standard	NM_023013		Approved		uc001auj.2	O95521	OTTHUMG00000001928	ENST00000332296.7:c.703C>T	1.37:g.12854479C>T	ENSP00000332134:p.Arg235Cys		Q9UQP2	Missense_Mutation	SNP	NULL	p.R235C	ENST00000332296.7	37	c.703	CCDS148.1	1	.	.	.	.	.	.	.	.	.	.	.	7.979	0.750758	0.15778	.	.	ENSG00000116721	ENST00000332296	T	0.21734	1.99	1.61	1.61	0.23674	.	2.269980	0.01911	N	0.039880	T	0.23289	0.0563	L	0.54965	1.715	0.09310	N	0.999992	B	0.15141	0.012	B	0.04013	0.001	T	0.24404	-1.0161	10	0.48119	T	0.1	.	6.6557	0.22986	0.0:1.0:0.0:0.0	rs1063775;rs3204807	235	O95521	PRAM1_HUMAN	C	235	ENSP00000332134:R235C	ENSP00000332134:R235C	R	+	1	0	PRAMEF1	12777066	0.000000	0.05858	0.002000	0.10522	0.015000	0.08874	-0.124000	0.10595	1.196000	0.43129	0.436000	0.28706	CGC	PRAMEF1	-	NULL	ENSG00000116721		0.438	PRAMEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF1	HGNC	protein_coding	OTTHUMT00000005458.1	-	0.00	175	0	C	NM_023013		12854479	+1	tier1	rs1063775	no_errors	ENST00000332296	ensembl	human	known	74_37	missense	26.97	110	41	SNP	0.002	T
PRDM9	56979	genome.wustl.edu	37	5	23527472	23527472	+	Missense_Mutation	SNP	G	G	A	rs112666693		TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr5:23527472G>A	ENST00000296682.3	+	11	2457	c.2275G>A	c.(2275-2277)Gat>Aat	p.D759N		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	759					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)	p.D759N(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						GGGCTTTCGCGATAAGTCACA	0.572										HNSCC(3;0.000094)																																							1	Substitution - Missense(1)	kidney(1)											63.0	89.0	81.0					5																	23527472		2132	4296	6428	SO:0001583	missense	0			AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.2275G>A	5.37:g.23527472G>A	ENSP00000296682:p.Asp759Asn		B4DX22|Q27Q50	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_SSXRD_motif,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.D759N	ENST00000296682.3	37	c.2275	CCDS43307.1	5	.	.	.	.	.	.	.	.	.	.	G	0.007	-1.937166	0.00484	.	.	ENSG00000164256	ENST00000296682	T	0.35605	1.3	2.65	-1.92	0.07618	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.11324	0.0276	N	0.02275	-0.615	0.09310	N	1	P	0.35155	0.487	B	0.13407	0.009	T	0.13764	-1.0497	9	0.37606	T	0.19	.	9.3631	0.38208	0.0:0.3794:0.5202:0.1004	.	759	Q9NQV7	PRDM9_HUMAN	N	759	ENSP00000296682:D759N	ENSP00000296682:D759N	D	+	1	0	PRDM9	23563229	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-14.321000	0.00000	-0.886000	0.03966	-4.161000	0.00010	GAT	PRDM9	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000164256		0.572	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM9	HGNC	protein_coding	OTTHUMT00000366375.1	-	0.00	142	0	G	NM_020227		23527472	+1	tier1	rs112666693	no_errors	ENST00000296682	ensembl	human	known	74_37	missense	13.43	115	18	SNP	0.000	A
PRTFDC1	56952	genome.wustl.edu	37	10	25138797	25138797	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr10:25138797G>C	ENST00000320152.6	-	9	682	c.654C>G	c.(652-654)caC>caG	p.H218Q	PRTFDC1_ENST00000376378.1_3'UTR	NM_020200.5	NP_064585.1	Q9NRG1	PRDC1_HUMAN	phosphoribosyl transferase domain containing 1	218					nucleoside metabolic process (GO:0009116)	cytosol (GO:0005829)	magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	9						TTTCTTTACCGTGCTCATTGA	0.378																																																	0													215.0	183.0	194.0					10																	25138797		2203	4300	6503	SO:0001583	missense	0			AF226056	CCDS7145.1, CCDS60506.1	10p12.31	2003-11-10			ENSG00000099256	ENSG00000099256			23333	protein-coding gene	gene with protein product		610751					Standard	XM_005252537		Approved	HHGP	uc001ise.1	Q9NRG1	OTTHUMG00000017829	ENST00000320152.6:c.654C>G	10.37:g.25138797G>C	ENSP00000318602:p.His218Gln		B7Z1Z3|Q53HA7|Q59EL9|Q5VV18|Q5VV20	Missense_Mutation	SNP	pfam_PRibTrfase_dom,tigrfam_Hxn_phspho_trans	p.H218Q	ENST00000320152.6	37	c.654	CCDS7145.1	10	.	.	.	.	.	.	.	.	.	.	G	9.198	1.027766	0.19512	.	.	ENSG00000099256	ENST00000320152	D	0.98732	-5.1	5.55	-0.785	0.10950	.	0.445596	0.26227	N	0.025586	D	0.93177	0.7827	N	0.11201	0.11	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.82725	-0.0315	10	0.32370	T	0.25	.	6.9128	0.24344	0.5522:0.0:0.2849:0.1629	.	218	Q9NRG1	PRDC1_HUMAN	Q	218	ENSP00000318602:H218Q	ENSP00000318602:H218Q	H	-	3	2	PRTFDC1	25178803	0.007000	0.16637	0.938000	0.37757	0.974000	0.67602	-1.711000	0.01886	-0.390000	0.07774	0.563000	0.77884	CAC	PRTFDC1	-	NULL	ENSG00000099256		0.378	PRTFDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRTFDC1	HGNC	protein_coding	OTTHUMT00000047243.2	-	0.00	35	0	G	NM_020200		25138797	-1	tier1	-	no_errors	ENST00000320152	ensembl	human	known	74_37	missense	24.39	31	10	SNP	0.922	C
PTPLB	201562	genome.wustl.edu	37	3	123301134	123301134	+	Silent	SNP	A	A	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr3:123301134A>T	ENST00000383657.5	-	2	355	c.198T>A	c.(196-198)gcT>gcA	p.A66A		NM_198402.3	NP_940684.1	Q6Y1H2	HACD2_HUMAN	protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b	66					fatty acid biosynthetic process (GO:0006633)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	lyase activity (GO:0016829)			kidney(2)	2				GBM - Glioblastoma multiforme(114;0.1)		AGCTACCCTTAGCCAGGTATG	0.373																																																	0													46.0	44.0	44.0					3																	123301134		1809	4081	5890	SO:0001819	synonymous_variant	0			AK074605	CCDS46895.1	3q21.1	2010-04-30			ENSG00000206527	ENSG00000206527			9640	protein-coding gene	gene with protein product		615939				15024066	Standard	NM_198402		Approved		uc003egj.2	Q6Y1H2	OTTHUMG00000159529	ENST00000383657.5:c.198T>A	3.37:g.123301134A>T				Silent	SNP	pfam_Tyr_Pase-like_PTPLA	p.A66	ENST00000383657.5	37	c.198	CCDS46895.1	3																																																																																			PTPLB	-	NULL	ENSG00000206527		0.373	PTPLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPLB	HGNC	protein_coding	OTTHUMT00000356021.3	-	0.00	68	0	A	NM_198402		123301134	-1	tier1	-	no_errors	ENST00000383657	ensembl	human	known	74_37	silent	15.32	105	19	SNP	0.998	T
PTPRQ	374462	genome.wustl.edu	37	12	80982205	80982205	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr12:80982205G>T	ENST00000266688.5	+	31	4571	c.4571G>T	c.(4570-4572)tGg>tTg	p.W1524L	RP11-272K23.3_ENST00000550634.1_RNA			Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	1570	Fibronectin type-III 16. {ECO:0000255|PROSITE-ProRule:PRU00316}.				regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						GCTTCAAACTGGATTTCTACA	0.373																																																	0													108.0	94.0	98.0					12																	80982205		692	1591	2283	SO:0001583	missense	0			AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.4571G>T	12.37:g.80982205G>T	ENSP00000266688:p.Trp1524Leu			Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.W1524L	ENST00000266688.5	37	c.4571		12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.79|15.79	2.935928|2.935928	0.52972|0.52972	.|.	.|.	ENSG00000139304|ENSG00000139304	ENST00000532722|ENST00000266688	.|T	.|0.52295	.|0.67	5.35|5.35	5.35|5.35	0.76521|0.76521	.|Fibronectin, type III (2);Immunoglobulin-like fold (1);	.|.	.|.	.|.	.|.	.|T	.|0.68732	.|0.3033	.|.	.|.	.|.	0.58432|0.58432	D|D	0.999995|0.999995	.|D	.|0.89917	.|1.0	.|D	.|0.83275	.|0.996	.|T	.|0.64765	.|-0.6330	.|8	.|0.32370	.|T	.|0.25	.|.	19.438|19.438	0.94806|0.94806	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1570	.|Q9UMZ3	.|PTPRQ_HUMAN	X|L	1225|1524	.|ENSP00000266688:W1524L	.|ENSP00000266688:W1524L	G|W	+|+	1|2	0|0	PTPRQ|PTPRQ	79506336|79506336	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.269000|0.269000	0.26545|0.26545	6.841000|6.841000	0.75374|0.75374	2.672000|2.672000	0.90937|0.90937	0.655000|0.655000	0.94253|0.94253	GGA|TGG	PTPRQ	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000139304		0.373	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	PTPRQ	HGNC	protein_coding		-	0.00	27	0	G	NM_001145026		80982205	+1	tier1	-	no_errors	ENST00000266688	ensembl	human	known	74_37	missense	19.44	28	7	SNP	1.000	T
PURB	5814	genome.wustl.edu	37	7	44924094	44924094	+	Missense_Mutation	SNP	C	C	A	rs140765435		TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr7:44924094C>A	ENST00000395699.2	-	1	866	c.854G>T	c.(853-855)cGa>cTa	p.R285L	MIR4657_ENST00000578157.1_RNA|RP4-673M15.1_ENST00000608450.1_RNA	NM_033224.3	NP_150093.1	Q96QR8	PURB_HUMAN	purine-rich element binding protein B	285					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of myeloid cell differentiation (GO:0045637)|transcription, DNA-templated (GO:0006351)	DNA replication factor A complex (GO:0005662)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)			large_intestine(2)|lung(3)|prostate(1)|skin(1)	7						ATCCCTCTGTCGTTCCTGGAT	0.587																																																	0													97.0	103.0	101.0					7																	44924094		2203	4300	6503	SO:0001583	missense	0				CCDS5499.1	7p13	2008-07-18			ENSG00000146676	ENSG00000146676			9702	protein-coding gene	gene with protein product		608887				1448097	Standard	NM_033224		Approved	PURBETA	uc003tme.3	Q96QR8	OTTHUMG00000023578	ENST00000395699.2:c.854G>T	7.37:g.44924094C>A	ENSP00000379051:p.Arg285Leu		A4D2L7	Missense_Mutation	SNP	pfam_PUR_DNA_RNA-bd,smart_PUR_DNA_RNA-bd	p.R285L	ENST00000395699.2	37	c.854	CCDS5499.1	7	.	.	.	.	.	.	.	.	.	.	C	21.2	4.106157	0.77096	.	.	ENSG00000146676	ENST00000395699	T	0.32988	1.43	4.45	4.45	0.53987	.	0.000000	0.64402	U	0.000015	T	0.31136	0.0787	L	0.27053	0.805	0.47949	D	0.999555	D	0.56035	0.974	P	0.50934	0.654	T	0.02713	-1.1120	10	0.38643	T	0.18	.	14.983	0.71324	0.0:1.0:0.0:0.0	.	285	Q96QR8	PURB_HUMAN	L	285	ENSP00000379051:R285L	ENSP00000379051:R285L	R	-	2	0	PURB	44890619	0.118000	0.22208	0.966000	0.40874	0.967000	0.64934	2.558000	0.45879	2.465000	0.83290	0.591000	0.81541	CGA	PURB	-	NULL	ENSG00000146676		0.587	PURB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PURB	HGNC	protein_coding	OTTHUMT00000251332.2	-	0.00	78	0	C	NM_033224		44924094	-1	tier1	-	no_errors	ENST00000395699	ensembl	human	known	74_37	missense	26.44	64	23	SNP	1.000	A
REST	5978	genome.wustl.edu	37	4	57796960	57796960	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr4:57796960C>T	ENST00000309042.7	+	4	2250	c.1936C>T	c.(1936-1938)Cct>Tct	p.P646S		NM_001193508.1|NM_005612.4	NP_001180437.1|NP_005603.3	Q13127	REST_HUMAN	RE1-silencing transcription factor	646	Pro-rich.				cardiac muscle cell myoblast differentiation (GO:0060379)|cellular response to drug (GO:0035690)|cellular response to electrical stimulus (GO:0071257)|cellular response to glucocorticoid stimulus (GO:0071385)|hematopoietic progenitor cell differentiation (GO:0002244)|histone H4 deacetylation (GO:0070933)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of amniotic stem cell differentiation (GO:2000798)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of dense core granule biogenesis (GO:2000706)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin secretion (GO:0046676)|negative regulation of mesenchymal stem cell differentiation (GO:2000740)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of transcription, DNA-templated (GO:0045893)|potassium ion transmembrane transport (GO:0071805)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|outward rectifier potassium channel activity (GO:0015271)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	50	Glioma(25;0.08)|all_neural(26;0.181)					CCAGATACGGCCTGCTCCTGA	0.652																																																	0													31.0	34.0	33.0					4																	57796960		2203	4300	6503	SO:0001583	missense	0			U13879	CCDS3509.1	4q12	2008-02-05			ENSG00000084093	ENSG00000084093			9966	protein-coding gene	gene with protein product		600571				7871435, 7697725	Standard	NM_005612		Approved	NRSF, XBR	uc003hci.3	Q13127	OTTHUMG00000128770	ENST00000309042.7:c.1936C>T	4.37:g.57796960C>T	ENSP00000311816:p.Pro646Ser		A2RUE0|B9EGJ0|Q12956|Q12957|Q13134|Q59ER1|Q8IWI3	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P646S	ENST00000309042.7	37	c.1936	CCDS3509.1	4	.	.	.	.	.	.	.	.	.	.	C	8.742	0.919132	0.17982	.	.	ENSG00000084093	ENST00000309042;ENST00000358605	T	0.07216	3.21	2.43	-0.433	0.12287	.	.	.	.	.	T	0.04588	0.0125	N	0.19112	0.55	0.09310	N	1	B;B	0.20550	0.035;0.046	B;B	0.14023	0.01;0.007	T	0.42565	-0.9444	9	0.31617	T	0.26	5.9724	4.2539	0.10708	0.0:0.5532:0.1929:0.2539	.	623;646	F8WAN5;Q13127	.;REST_HUMAN	S	646;623	ENSP00000311816:P646S	ENSP00000311816:P646S	P	+	1	0	REST	57491717	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	0.218000	0.17622	-0.146000	0.11274	-0.258000	0.10820	CCT	REST	-	NULL	ENSG00000084093		0.652	REST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	REST	HGNC	protein_coding	OTTHUMT00000250691.2		0.00	48	0	C	NM_005612		57796960	+1			no_errors	ENST00000309042	ensembl	human	known	74_37	missense	8.00	46	4	SNP	0.015	T
RFK	55312	genome.wustl.edu	37	9	79002561	79002561	+	Intron	SNP	A	A	G			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr9:79002561A>G	ENST00000376736.1	-	4	671				RFK_ENST00000479197.1_5'UTR	NM_018339.5	NP_060809.3	Q969G6	RIFK_HUMAN	riboflavin kinase						apoptotic process (GO:0006915)|FMN biosynthetic process (GO:0009398)|positive regulation of NAD(P)H oxidase activity (GO:0033864)|reactive oxygen species metabolic process (GO:0072593)|riboflavin biosynthetic process (GO:0009231)|riboflavin metabolic process (GO:0006771)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|riboflavin kinase activity (GO:0008531)			pancreas(1)|prostate(1)|urinary_tract(1)	3					Riboflavin(DB00140)	tgcacagggtagatacccaat	0.428																																																	0																																										SO:0001627	intron_variant	0			AK002011	CCDS35044.1, CCDS35044.2	9q21.31	2010-11-16			ENSG00000135002	ENSG00000135002			30324	protein-coding gene	gene with protein product		613010				14580199	Standard	NM_018339		Approved	FLJ11149, RIFK	uc004akd.2	Q969G6	OTTHUMG00000020040	ENST00000376736.1:c.338-116T>C	9.37:g.79002561A>G			Q5JSG9|Q9NUT7	RNA	SNP	-	NULL	ENST00000376736.1	37	NULL	CCDS35044.2	9																																																																																			RFK	-	-	ENSG00000135002		0.428	RFK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFK	HGNC	protein_coding	OTTHUMT00000052720.1	-	0.00	23	0	A	NM_018339		79002561	-1	tier1	-	no_errors	ENST00000479197	ensembl	human	known	74_37	rna	16.67	20	4	SNP	0.007	G
RINT1	60561	genome.wustl.edu	37	7	105189044	105189044	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr7:105189044T>C	ENST00000257700.2	+	7	1114	c.883T>C	c.(883-885)Tct>Cct	p.S295P		NM_021930.4	NP_068749.3	Q6NUQ1	RINT1_HUMAN	RAD50 interactor 1	295	RINT1/TIP20. {ECO:0000255|PROSITE- ProRule:PRU00717}.				G2 DNA damage checkpoint (GO:0031572)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						AGAAAAATACTCTCTTCCTGC	0.433																																																	0													196.0	170.0	179.0					7																	105189044		2203	4300	6503	SO:0001583	missense	0			AF317622	CCDS34726.1	7q22.2	2007-05-03			ENSG00000135249	ENSG00000135249			21876	protein-coding gene	gene with protein product		610089				11096100, 15029241	Standard	NM_021930		Approved	FLJ11785, RINT-1	uc003vda.1	Q6NUQ1	OTTHUMG00000157400	ENST00000257700.2:c.883T>C	7.37:g.105189044T>C	ENSP00000257700:p.Ser295Pro		Q75MG9|Q75MH0|Q96IW8|Q9H229|Q9HAD9	Missense_Mutation	SNP	pfam_RINT1_TIP1	p.S295P	ENST00000257700.2	37	c.883	CCDS34726.1	7	.	.	.	.	.	.	.	.	.	.	T	11.59	1.685147	0.29872	.	.	ENSG00000135249	ENST00000257700	T	0.26660	1.72	5.78	4.63	0.57726	.	0.556576	0.21067	N	0.080721	T	0.19525	0.0469	L	0.43152	1.355	0.22571	N	0.99898	B	0.02656	0.0	B	0.01281	0.0	T	0.19484	-1.0304	10	0.29301	T	0.29	-7.345	6.422	0.21748	0.0:0.1048:0.3062:0.589	.	295	Q6NUQ1	RINT1_HUMAN	P	295	ENSP00000257700:S295P	ENSP00000257700:S295P	S	+	1	0	RINT1	104976280	0.657000	0.27393	1.000000	0.80357	0.963000	0.63663	0.979000	0.29500	1.001000	0.39076	0.528000	0.53228	TCT	RINT1	-	NULL	ENSG00000135249		0.433	RINT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RINT1	HGNC	protein_coding	OTTHUMT00000348686.1	-	0.00	52	0	T	NM_021930		105189044	+1	tier1	-	no_errors	ENST00000257700	ensembl	human	known	74_37	missense	25.93	40	14	SNP	0.998	C
RPS27L	51065	genome.wustl.edu	37	15	63448736	63448736	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr15:63448736T>C	ENST00000462430.1	-	1	237	c.39A>G	c.(37-39)atA>atG	p.I13M	RPS27L_ENST00000439025.1_Intron|RPS27L_ENST00000455271.1_Intron|RPS27L_ENST00000411926.1_Intron|RPS27L_ENST00000330964.5_Intron|RPS27L_ENST00000559763.1_5'Flank					ribosomal protein S27-like											large_intestine(1)	1						CAAAGAAGCATATTATTACTA	0.363																																																	0													69.0	59.0	62.0					15																	63448736		1836	4080	5916	SO:0001583	missense	0			BC003667	CCDS42048.1	15q21.3	2008-07-18			ENSG00000185088	ENSG00000185088		"""S ribosomal proteins"""	18476	protein-coding gene	gene with protein product		612055				11042152	Standard	NM_015920		Approved		uc002aly.3	Q71UM5	OTTHUMG00000155301	ENST00000462430.1:c.39A>G	15.37:g.63448736T>C	ENSP00000453764:p.Ile13Met			Missense_Mutation	SNP	pfam_Ribosomal_S27e,superfamily_Ribosomal_zn-bd	p.I13M	ENST00000462430.1	37	c.39		15																																																																																			RPS27L	-	NULL	ENSG00000185088		0.363	RPS27L-006	PUTATIVE	basic	protein_coding	RPS27L	HGNC	protein_coding	OTTHUMT00000339352.2	-	0.00	65	0	T	NM_015920		63448736	-1	tier1	-	no_errors	ENST00000462430	ensembl	human	putative	74_37	missense	19.64	45	11	SNP	0.000	C
RPUSD4	84881	genome.wustl.edu	37	11	126080863	126080863	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr11:126080863T>C	ENST00000298317.4	-	2	330	c.277A>G	c.(277-279)Aag>Gag	p.K93E	FAM118B_ENST00000533050.1_5'Flank|RPUSD4_ENST00000533628.1_Missense_Mutation_p.K93E|RP11-50B3.4_ENST00000532866.1_RNA|RPUSD4_ENST00000534393.1_5'UTR|FAM118B_ENST00000360194.4_5'Flank|FAM118B_ENST00000529731.1_5'Flank	NM_032795.2	NP_116184.2	Q96CM3	RUSD4_HUMAN	RNA pseudouridylate synthase domain containing 4	93					pseudouridine synthesis (GO:0001522)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(8)|skin(1)	17	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0919)|all_lung(97;0.0994)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0761)		GTCAGTGCCTTAGCAAGCACG	0.552																																																	0													163.0	146.0	152.0					11																	126080863		2201	4299	6500	SO:0001583	missense	0			BC014131	CCDS8469.1, CCDS53721.1	11q24.2	2013-02-11			ENSG00000165526	ENSG00000165526		"""RNA pseudouridylate synthase domain containing"""	25898	protein-coding gene	gene with protein product							Standard	NM_032795		Approved	FLJ14494	uc001qde.3	Q96CM3	OTTHUMG00000165815	ENST00000298317.4:c.277A>G	11.37:g.126080863T>C	ENSP00000298317:p.Lys93Glu		E9PML2|Q96K56	Missense_Mutation	SNP	pfam_PsdUridine_synth_RsuA/RluD,superfamily_PsdUridine_synth_cat_dom	p.K93E	ENST00000298317.4	37	c.277	CCDS8469.1	11	.	.	.	.	.	.	.	.	.	.	T	31	5.088499	0.94100	.	.	ENSG00000165526	ENST00000298317;ENST00000533628;ENST00000532674	T;T;T	0.20200	2.09;2.09;2.09	5.3	5.3	0.74995	Pseudouridine synthase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.30572	0.0769	M	0.80183	2.485	0.48762	D	0.999709	B;P	0.34462	0.23;0.454	B;B	0.37780	0.119;0.258	T	0.06991	-1.0796	10	0.32370	T	0.25	-13.8884	12.9895	0.58610	0.0:0.0:0.0:1.0	.	93;93	E9PML2;Q96CM3	.;RUSD4_HUMAN	E	93	ENSP00000298317:K93E;ENSP00000433065:K93E;ENSP00000433709:K93E	ENSP00000298317:K93E	K	-	1	0	RPUSD4	125586073	1.000000	0.71417	1.000000	0.80357	0.838000	0.47535	7.046000	0.76592	2.003000	0.58678	0.459000	0.35465	AAG	RPUSD4	-	superfamily_PsdUridine_synth_cat_dom	ENSG00000165526		0.552	RPUSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPUSD4	HGNC	protein_coding	OTTHUMT00000386336.1	-	0.00	69	0	T	NM_032795		126080863	-1	tier1	-	no_errors	ENST00000298317	ensembl	human	known	74_37	missense	28.80	89	36	SNP	1.000	C
RRP7A	27341	genome.wustl.edu	37	22	42910199	42910199	+	Missense_Mutation	SNP	G	G	A	rs146958654	byFrequency	TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr22:42910199G>A	ENST00000323013.6	-	6	685	c.670C>T	c.(670-672)Cgg>Tgg	p.R224W	SERHL_ENST00000359906.2_RNA	NM_015703.4	NP_056518.2	Q9Y3A4	RRP7A_HUMAN	ribosomal RNA processing 7 homolog A (S. cerevisiae)	224							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|liver(2)|lung(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	10						TCCAGCACCCGCAAGCTGGCT	0.677																																																	0													31.0	24.0	27.0					22																	42910199		2203	4300	6503	SO:0001583	missense	0			BC035992	CCDS14036.1	22q13.2	2008-08-08			ENSG00000189306	ENSG00000189306			24286	protein-coding gene	gene with protein product						10810093, 12087473	Standard	NM_015703		Approved	CGI-96	uc003bcq.3	Q9Y3A4	OTTHUMG00000150891	ENST00000323013.6:c.670C>T	22.37:g.42910199G>A	ENSP00000321449:p.Arg224Trp		A4FTX2|B2RBG4|Q0VAD0|Q5JZ94|Q6P4B5|Q8IVR9|Q8IVY0|Q8N5Q3|Q8NEY6|Q9Y3H5	Missense_Mutation	SNP	NULL	p.R224W	ENST00000323013.6	37	c.670	CCDS14036.1	22	.	.	.	.	.	.	.	.	.	.	.	14.87	2.665709	0.47677	.	.	ENSG00000189306	ENST00000323013	T	0.25579	1.79	3.66	3.66	0.41972	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.052803	0.85682	D	0.000000	T	0.55162	0.1903	M	0.84683	2.71	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.983	T	0.66500	-0.5908	10	0.87932	D	0	-30.8823	15.7164	0.77672	0.0:0.0:1.0:0.0	.	224;48	Q9Y3A4;Q9NSQ0	RRP7A_HUMAN;RRP7B_HUMAN	W	224	ENSP00000321449:R224W	ENSP00000321449:R224W	R	-	1	2	RRP7A	41240143	1.000000	0.71417	0.996000	0.52242	0.095000	0.18619	5.665000	0.68052	1.747000	0.51819	0.205000	0.17691	CGG	RRP7A	-	NULL	ENSG00000189306		0.677	RRP7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRP7A	HGNC	protein_coding	OTTHUMT00000320451.1	-	0.00	56	0	G	NM_015703		42910199	-1	tier1	rs146958654	no_errors	ENST00000323013	ensembl	human	known	74_37	missense	17.31	43	9	SNP	1.000	A
RXFP1	59350	genome.wustl.edu	37	4	159493861	159493861	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr4:159493861G>A	ENST00000307765.5	+	2	312	c.61G>A	c.(61-63)Ggt>Agt	p.G21S	RXFP1_ENST00000343542.5_Missense_Mutation_p.G21S|RXFP1_ENST00000470033.1_Missense_Mutation_p.G21S|RXFP1_ENST00000460056.2_De_novo_Start_OutOfFrame|RXFP1_ENST00000423548.1_Missense_Mutation_p.G21S|RXFP1_ENST00000448688.2_De_novo_Start_OutOfFrame	NM_001253727.1|NM_001253728.1|NM_001253730.1|NM_001253732.1|NM_001253733.1|NM_021634.3	NP_001240656.1|NP_001240657.1|NP_001240659.1|NP_001240661.1|NP_001240662.1|NP_067647.2	Q9HBX9	RXFP1_HUMAN	relaxin/insulin-like family peptide receptor 1	21					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|lung connective tissue development (GO:0060427)|nipple morphogenesis (GO:0060658)|parturition (GO:0007567)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|hormone binding (GO:0042562)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|liver(2)|lung(22)|prostate(1)|skin(10)	49	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)		TTCTCATGGGGGTGGACAGGA	0.488																																																	0													141.0	140.0	140.0					4																	159493861		1982	4160	6142	SO:0001583	missense	0			AF190500	CCDS43276.1, CCDS58929.1, CCDS58930.1, CCDS75204.1, CCDS75205.1, CCDS75206.1	4q31.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000171509	ENSG00000171509		"""GPCR / Class A : Relaxin family peptide receptors"""	19718	protein-coding gene	gene with protein product		606654	"""leucine-rich repeat-containing G protein-coupled receptor 7"""	LGR7		15956688, 16507880	Standard	NM_021634		Approved	RXFPR1	uc003ipz.3	Q9HBX9	OTTHUMG00000149973	ENST00000307765.5:c.61G>A	4.37:g.159493861G>A	ENSP00000303248:p.Gly21Ser		B4DHD1|B4DTV2|Q2M215|Q3KU24|Q3KU25|Q3KU26	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_Leu-rich_rpt,pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Leu-rich_rpt_typical-subtyp,pfscan_LDrepeatLR_classA_rpt,pfscan_GPCR_Rhodpsn_7TM,prints_Relaxin_rcpt,prints_GPCR_Rhodpsn,prints_Gphrmn_rcpt_fam	p.G21S	ENST00000307765.5	37	c.61	CCDS43276.1	4	.	.	.	.	.	.	.	.	.	.	G	8.554	0.876142	0.17395	.	.	ENSG00000171509	ENST00000307765;ENST00000423548;ENST00000343542;ENST00000470033	T;T;T;T	0.68331	-0.27;-0.23;-0.32;-0.25	4.85	-0.396	0.12427	.	1.111290	0.06862	N	0.799366	T	0.23727	0.0574	N	0.00554	-1.385	0.09310	N	0.999998	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.001;0.0	T	0.34004	-0.9846	10	0.02654	T	1	.	1.2119	0.01906	0.4493:0.1455:0.2638:0.1414	.	21;21;21;21	B4DGP2;Q9HBX9-4;Q9HBX9-2;Q9HBX9	.;.;.;RXFP1_HUMAN	S	21	ENSP00000303248:G21S;ENSP00000405841:G21S;ENSP00000345889:G21S;ENSP00000420712:G21S	ENSP00000303248:G21S	G	+	1	0	RXFP1	159713311	0.329000	0.24696	0.000000	0.03702	0.332000	0.28634	0.609000	0.24238	-0.063000	0.13065	-0.471000	0.05019	GGT	RXFP1	-	NULL	ENSG00000171509		0.488	RXFP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RXFP1	HGNC	protein_coding	OTTHUMT00000314865.1	-	0.00	70	0	G	NM_021634		159493861	+1	tier1	-	no_errors	ENST00000307765	ensembl	human	known	74_37	missense	26.92	76	28	SNP	0.000	A
RXFP1	59350	genome.wustl.edu	37	4	159569710	159569710	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr4:159569710G>T	ENST00000307765.5	+	17	2067	c.1816G>T	c.(1816-1818)Gtt>Ttt	p.V606F	RXFP1_ENST00000343542.5_Missense_Mutation_p.V558F|RXFP1_ENST00000470033.1_Missense_Mutation_p.V573F|RXFP1_ENST00000460056.2_Missense_Mutation_p.V525F|RXFP1_ENST00000448688.2_Missense_Mutation_p.V501F	NM_001253727.1|NM_001253728.1|NM_001253730.1|NM_001253732.1|NM_001253733.1|NM_021634.3	NP_001240656.1|NP_001240657.1|NP_001240659.1|NP_001240661.1|NP_001240662.1|NP_067647.2	Q9HBX9	RXFP1_HUMAN	relaxin/insulin-like family peptide receptor 1	606					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|lung connective tissue development (GO:0060427)|nipple morphogenesis (GO:0060658)|parturition (GO:0007567)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|hormone binding (GO:0042562)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|liver(2)|lung(22)|prostate(1)|skin(10)	49	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)		GTTTTATAGTGTTCATCAAAG	0.299																																																	0													106.0	99.0	101.0					4																	159569710		1824	4075	5899	SO:0001583	missense	0			AF190500	CCDS43276.1, CCDS58929.1, CCDS58930.1, CCDS75204.1, CCDS75205.1, CCDS75206.1	4q31.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000171509	ENSG00000171509		"""GPCR / Class A : Relaxin family peptide receptors"""	19718	protein-coding gene	gene with protein product		606654	"""leucine-rich repeat-containing G protein-coupled receptor 7"""	LGR7		15956688, 16507880	Standard	NM_021634		Approved	RXFPR1	uc003ipz.3	Q9HBX9	OTTHUMG00000149973	ENST00000307765.5:c.1816G>T	4.37:g.159569710G>T	ENSP00000303248:p.Val606Phe		B4DHD1|B4DTV2|Q2M215|Q3KU24|Q3KU25|Q3KU26	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_Leu-rich_rpt,pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Leu-rich_rpt_typical-subtyp,pfscan_LDrepeatLR_classA_rpt,pfscan_GPCR_Rhodpsn_7TM,prints_Relaxin_rcpt,prints_GPCR_Rhodpsn,prints_Gphrmn_rcpt_fam	p.V606F	ENST00000307765.5	37	c.1816	CCDS43276.1	4	.	.	.	.	.	.	.	.	.	.	G	15.59	2.879168	0.51801	.	.	ENSG00000171509	ENST00000460056;ENST00000307765;ENST00000448688;ENST00000343542;ENST00000470033;ENST00000440678	T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0	5.79	0.584	0.17422	GPCR, rhodopsin-like superfamily (1);	0.242184	0.42420	D	0.000715	T	0.52853	0.1760	M	0.63843	1.955	0.43430	D	0.99559	P;P;P;B;P;B;P;P	0.50528	0.936;0.936;0.544;0.133;0.682;0.134;0.851;0.911	P;P;P;B;B;B;P;P	0.59889	0.836;0.865;0.493;0.138;0.361;0.217;0.756;0.853	T	0.50857	-0.8778	10	0.72032	D	0.01	.	10.2176	0.43177	0.5586:0.0:0.4414:0.0	.	617;633;501;558;573;525;476;606	B3KV27;B4DGP2;B4DHD1;Q9HBX9-4;Q9HBX9-2;E9PCA3;Q59H16;Q9HBX9	.;.;.;.;.;.;.;RXFP1_HUMAN	F	525;606;501;558;573;476	ENSP00000423306:V525F;ENSP00000303248:V606F;ENSP00000414885:V501F;ENSP00000345889:V558F;ENSP00000420712:V573F	ENSP00000303248:V606F	V	+	1	0	RXFP1	159789160	0.782000	0.28689	0.823000	0.32752	0.988000	0.76386	0.804000	0.27098	-0.229000	0.09854	-0.136000	0.14681	GTT	RXFP1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000171509		0.299	RXFP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RXFP1	HGNC	protein_coding	OTTHUMT00000314865.1	-	0.00	43	0	G	NM_021634		159569710	+1	tier1	-	no_errors	ENST00000307765	ensembl	human	known	74_37	missense	5.06	75	4	SNP	0.951	T
RYK	6259	genome.wustl.edu	37	3	133913932	133913932	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr3:133913932T>C	ENST00000427044.2	-	8	917	c.307A>G	c.(307-309)Atc>Gtc	p.I103V	RYK_ENST00000296084.4_Missense_Mutation_p.I293V			P34925	RYK_HUMAN	receptor-like tyrosine kinase	292	WIF. {ECO:0000255|PROSITE- ProRule:PRU00222}.				axon guidance (GO:0007411)|corpus callosum development (GO:0022038)|neuron differentiation (GO:0030182)|neuron projection development (GO:0031175)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of MAPK cascade (GO:0043410)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)			lung(1)|ovary(3)	4						TTACTGGTGATAGGAGTTGCA	0.468																																																	0													112.0	110.0	110.0					3																	133913932		1959	4142	6101	SO:0001583	missense	0			S59184	CCDS75016.1	3q22.1	2012-02-28	2012-02-28		ENSG00000163785	ENSG00000163785	2.7.10.1		10481	protein-coding gene	gene with protein product		600524	"""JTK5A protein tyrosine kinase"", ""RYK receptor-like tyrosine kinase"""	JTK5A		8386829	Standard	NM_001005861		Approved	D3S3195, RYK1, JTK5	uc003eqc.1	P34925	OTTHUMG00000159750	ENST00000427044.2:c.307A>G	3.37:g.133913932T>C	ENSP00000399527:p.Ile103Val		Q04696	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.I103V	ENST00000427044.2	37	c.307		3	.	.	.	.	.	.	.	.	.	.	T	4.164	0.029016	0.08054	.	.	ENSG00000163785	ENST00000296084;ENST00000427044	T;T	0.76839	2.01;-1.05	5.63	1.5	0.22942	.	0.166402	0.52532	N	0.000065	T	0.49389	0.1554	N	0.04508	-0.205	0.35919	D	0.831674	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.38178	-0.9673	10	0.11485	T	0.65	-1.9831	7.6605	0.28400	0.0:0.4159:0.0:0.5841	.	292;292	P34925;P34925-2	RYK_HUMAN;.	V	293;103	ENSP00000296084:I293V;ENSP00000399527:I103V	ENSP00000296084:I293V	I	-	1	0	RYK	135396622	0.962000	0.33011	0.998000	0.56505	0.995000	0.86356	1.955000	0.40372	0.464000	0.27142	0.460000	0.39030	ATC	RYK	-	NULL	ENSG00000163785		0.468	RYK-202	KNOWN	basic|appris_principal	protein_coding	RYK	HGNC	protein_coding		-	0.00	43	0	T	NM_001005861		133913932	-1	tier1	-	no_errors	ENST00000427044	ensembl	human	known	74_37	missense	20.78	61	16	SNP	0.970	C
SACS	26278	genome.wustl.edu	37	13	23911518	23911518	+	Missense_Mutation	SNP	C	C	T	rs200888451		TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr13:23911518C>T	ENST00000382292.3	-	9	6770	c.6497G>A	c.(6496-6498)cGt>cAt	p.R2166H	SACS_ENST00000382298.3_Missense_Mutation_p.R2166H|SACS_ENST00000402364.1_Missense_Mutation_p.R1416H			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	2166					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		TGACACTGCACGTTCTAGCAT	0.328																																																	0													72.0	69.0	70.0					13																	23911518		2203	4299	6502	SO:0001583	missense	0			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.6497G>A	13.37:g.23911518C>T	ENSP00000371729:p.Arg2166His		O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	pfam_HEPN,pfam_Ubiquitin_dom,superfamily_HATPase_ATP-bd,superfamily_DnaJ_domain,smart_HEPN,pfscan_HEPN,pfscan_DnaJ_domain,pfscan_Ubiquitin_supergroup	p.R2166H	ENST00000382292.3	37	c.6497	CCDS9300.2	13	.	.	.	.	.	.	.	.	.	.	C	18.19	3.567978	0.65651	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.90261	-2.5;-2.64;-2.5	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	D	0.94374	0.8191	M	0.65498	2.005	0.51482	D	0.999928	D	0.76494	0.999	P	0.59948	0.866	D	0.94248	0.7491	10	0.87932	D	0	.	20.3311	0.98718	0.0:1.0:0.0:0.0	.	2166	Q9NZJ4	SACS_HUMAN	H	2166;1416;2166	ENSP00000371729:R2166H;ENSP00000385844:R1416H;ENSP00000371735:R2166H	ENSP00000371729:R2166H	R	-	2	0	SACS	22809518	1.000000	0.71417	0.940000	0.37924	0.362000	0.29581	7.487000	0.81328	2.803000	0.96430	0.650000	0.86243	CGT	SACS	-	NULL	ENSG00000151835		0.328	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SACS	HGNC	protein_coding	OTTHUMT00000044148.3	-	0.00	28	0	C	NM_014363		23911518	-1	tier1	rs200888451	no_errors	ENST00000382292	ensembl	human	known	74_37	missense	59.38	13	19	SNP	1.000	T
SATB2	23314	genome.wustl.edu	37	2	200322723	200322723	+	5'UTR	SNP	A	A	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr2:200322723A>T	ENST00000417098.1	-	0	96				SATB2-AS1_ENST00000441234.1_RNA|SATB2-AS1_ENST00000442967.1_RNA|SATB2_ENST00000457245.1_Intron|SATB2_ENST00000428695.1_5'Flank|SATB2_ENST00000443023.1_5'UTR|SATB2_ENST00000260926.5_Intron	NM_001172509.1	NP_001165980.1	Q9UPW6	SATB2_HUMAN	SATB homeobox 2						cartilage development (GO:0051216)|cellular response to organic substance (GO:0071310)|chromatin remodeling (GO:0006338)|embryonic pattern specification (GO:0009880)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|osteoblast development (GO:0002076)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(40)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						GCGTTGAGTCATCAGGCAAAG	0.547																																					Colon(30;262 767 11040 24421 36230)												0																																										SO:0001623	5_prime_UTR_variant	0			AB028957	CCDS2327.1	2q33.1	2011-06-20	2007-02-15		ENSG00000119042	ENSG00000119042		"""Homeoboxes / CUT class"""	21637	protein-coding gene	gene with protein product		608148	"""SATB family member 2"""				Standard	NM_015265		Approved	KIAA1034, FLJ21474	uc002uva.2	Q9UPW6	OTTHUMG00000132767	ENST00000417098.1:c.-721T>A	2.37:g.200322723A>T			A8K5Z8|Q3ZB87|Q4V763	RNA	SNP	-	NULL	ENST00000417098.1	37	NULL	CCDS2327.1	2																																																																																			SATB2-AS1	-	-	ENSG00000225953		0.547	SATB2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SATB2-AS1	HGNC	protein_coding	OTTHUMT00000256140.1	-	0.00	67	0	A	NM_015265		200322723	+1	tier1	-	no_errors	ENST00000441234	ensembl	human	known	74_37	rna	9.59	66	7	SNP	1.000	T
SERINC2	347735	genome.wustl.edu	37	1	31901872	31901872	+	Silent	SNP	C	C	G			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr1:31901872C>G	ENST00000373709.3	+	7	978	c.828C>G	c.(826-828)ctC>ctG	p.L276L	SERINC2_ENST00000536859.1_Silent_p.L280L|SERINC2_ENST00000536384.1_Silent_p.L280L|SERINC2_ENST00000491976.1_3'UTR|SERINC2_ENST00000373710.1_Silent_p.L285L	NM_178865.4	NP_849196.2	Q96SA4	SERC2_HUMAN	serine incorporator 2	276					phosphatidylserine metabolic process (GO:0006658)|positive regulation of transferase activity (GO:0051347)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	L-serine transmembrane transporter activity (GO:0015194)			cervix(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(2)	12		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0629)|Breast(348;0.0707)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0541)|READ - Rectum adenocarcinoma(331;0.151)		TCATCACCCTCTACACCATGT	0.617																																																	0													152.0	138.0	143.0					1																	31901872		2203	4300	6503	SO:0001819	synonymous_variant	0			AY094595	CCDS30662.1, CCDS55583.1, CCDS55584.1, CCDS55585.1	1p35.1	2008-02-05	2005-11-01	2005-11-01	ENSG00000168528	ENSG00000168528			23231	protein-coding gene	gene with protein product		614549	"""tumor differentially expressed 2-like"""	TDE2L		12949800	Standard	NM_178865		Approved	FKSG84, PRO0899, TDE2	uc010ogh.2	Q96SA4	OTTHUMG00000003796	ENST00000373709.3:c.828C>G	1.37:g.31901872C>G			A0AVB4|B4DJK5|B7Z567|B7ZAP2|E7EUZ9|Q86Y23	Silent	SNP	pfam_TMS_TDE	p.L285	ENST00000373709.3	37	c.855	CCDS30662.1	1																																																																																			SERINC2	-	pfam_TMS_TDE	ENSG00000168528		0.617	SERINC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERINC2	HGNC	protein_coding	OTTHUMT00000010680.1	-	0.00	72	0	C	NM_018565		31901872	+1	tier1	-	no_errors	ENST00000373710	ensembl	human	known	74_37	silent	27.27	48	18	SNP	0.550	G
SFXN5	94097	genome.wustl.edu	37	2	73215478	73215478	+	Splice_Site	SNP	C	C	G			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr2:73215478C>G	ENST00000272433.2	-	10	665		c.e10-1		SFXN5_ENST00000474528.1_Splice_Site|SFXN5_ENST00000410065.1_Splice_Site	NM_144579.2	NP_653180.1	Q8TD22	SFXN5_HUMAN	sideroflexin 5						iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)|citrate transmembrane transporter activity (GO:0015137)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)	9						TAAGGCCCACCTTTGAAAGAA	0.498																																																	0													90.0	83.0	85.0					2																	73215478		2203	4300	6503	SO:0001630	splice_region_variant	0			AY044437	CCDS1922.1	2p13	2008-05-21			ENSG00000144040	ENSG00000144040		"""Sideroflexins"""	16073	protein-coding gene	gene with protein product		615572				12039050, 12150972	Standard	XM_005264648		Approved	BBG-TCC	uc002siq.3	Q8TD22	OTTHUMG00000129775	ENST00000272433.2:c.535-1G>C	2.37:g.73215478C>G			A8K116|Q494Y3|Q53T29	Splice_Site	SNP	-	e10-1	ENST00000272433.2	37	c.535-1	CCDS1922.1	2	.	.	.	.	.	.	.	.	.	.	C	16.06	3.016401	0.54468	.	.	ENSG00000144040	ENST00000272433;ENST00000411783;ENST00000410065	.	.	.	5.26	5.26	0.73747	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.732	0.85436	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SFXN5	73068986	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	6.318000	0.72866	2.630000	0.89119	0.491000	0.48974	.	SFXN5	-	-	ENSG00000144040		0.498	SFXN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFXN5	HGNC	protein_coding	OTTHUMT00000251991.1	-	0.00	31	0	C	NM_144579	Intron	73215478	-1	tier1	-	no_errors	ENST00000272433	ensembl	human	known	74_37	splice_site	20.00	36	9	SNP	1.000	G
PDXP	57026	genome.wustl.edu	37	22	38061677	38061677	+	Silent	SNP	C	C	T	rs35046948		TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr22:38061677C>T	ENST00000215904.6	+	2	746	c.690C>T	c.(688-690)ccC>ccT	p.P230P	SH3BP1_ENST00000599616.1_Silent_p.P539P|PDXP_ENST00000403251.1_Silent_p.P13P	NM_020315.4	NP_064711.1	Q96GD0	PLPP_HUMAN	pyridoxal (pyridoxine, vitamin B6) phosphatase	230					actin rod assembly (GO:0031247)|cellular response to ATP (GO:0071318)|positive regulation of actin filament depolymerization (GO:0030836)|protein dephosphorylation (GO:0006470)|pyridoxal phosphate catabolic process (GO:0032361)|regulation of cytokinesis (GO:0032465)|regulation of mitosis (GO:0007088)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	heat shock protein binding (GO:0031072)|magnesium ion binding (GO:0000287)|phosphoprotein phosphatase activity (GO:0004721)|phosphoserine phosphatase activity (GO:0004647)|pyridoxal phosphatase activity (GO:0033883)			kidney(1)|large_intestine(1)|lung(5)|ovary(2)	9	Melanoma(58;0.0574)					GCATCGACCCCGCACGCACGC	0.652																																																	0													132.0	115.0	121.0					22																	38061677		2203	4300	6503	SO:0001819	synonymous_variant	0			BC064922	CCDS13953.1	22q12.3	2005-08-16			ENSG00000241360	ENSG00000241360			30259	protein-coding gene	gene with protein product		609246				14522954	Standard	NM_020315		Approved	dJ37E16.5, FLJ32703		Q96GD0	OTTHUMG00000044618	ENST00000215904.6:c.690C>T	22.37:g.38061677C>T			Q9UGY2	Silent	SNP	pfam_RhoGAP_dom,pfam_BAR_dom,superfamily_Rho_GTPase_activation_prot,superfamily_HAD-like_dom,smart_RhoGAP_dom,pfscan_BAR_dom,pfscan_RhoGAP_dom	p.P539	ENST00000215904.6	37	c.1617	CCDS13953.1	22																																																																																			SH3BP1	-	superfamily_HAD-like_dom	ENSG00000100092		0.652	PDXP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3BP1	HGNC	protein_coding	OTTHUMT00000104105.2	-	0.00	74	0	C	NM_020315		38061677	+1	tier1	-	no_errors	ENST00000599616	ensembl	human	known	74_37	silent	44.26	34	27	SNP	0.018	T
SHPRH	257218	genome.wustl.edu	37	6	146243864	146243864	+	Silent	SNP	T	T	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr6:146243864T>C	ENST00000367505.2	-	19	3918	c.3654A>G	c.(3652-3654)ccA>ccG	p.P1218P	SHPRH_ENST00000367503.3_Silent_p.P1222P|SHPRH_ENST00000438092.2_Silent_p.P1222P|SHPRH_ENST00000275233.7_Silent_p.P1218P			Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase	1218					DNA repair (GO:0006281)|nucleosome assembly (GO:0006334)|protein polyubiquitination (GO:0000209)	nucleosome (GO:0000786)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(33)|ovary(3)|pancreas(2)|prostate(7)|skin(1)|urinary_tract(1)	79		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		CATTACGAGATGGAGGTCCCT	0.418																																																	0													93.0	92.0	92.0					6																	146243864		1883	4108	5991	SO:0001819	synonymous_variant	0			AB095943	CCDS43513.1, CCDS47496.1, CCDS43513.2	6q24.2	2012-02-23	2012-02-23		ENSG00000146414	ENSG00000146414		"""RING-type (C3HC4) zinc fingers"""	19336	protein-coding gene	gene with protein product		608048	"""SNF2 histone linker PHD RING helicase"""			12837266	Standard	NM_001042683		Approved	FLJ90837, KIAA2023, bA545I5.2	uc003qlf.3	Q149N8	OTTHUMG00000015750	ENST00000367505.2:c.3654A>G	6.37:g.146243864T>C			Q149N9|Q5VV79|Q68DS5|Q7Z5J5|Q8IVE8|Q8IWQ9|Q8N1S8|Q8NBR7	Silent	SNP	pfam_SNF2_N,pfam_Histone_H1/H5_H15,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,superfamily_WW_dom,smart_Helicase_ATP-bd,smart_Histone_H1/H5_H15,smart_Znf_PHD,smart_Znf_RING,smart_Helicase_C,pfscan_Znf_RING,pfscan_Helicase_C	p.P1222	ENST00000367505.2	37	c.3666	CCDS43513.2	6																																																																																			SHPRH	-	superfamily_P-loop_NTPase	ENSG00000146414		0.418	SHPRH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SHPRH	HGNC	protein_coding	OTTHUMT00000042571.2	-	0.00	66	0	T	NM_173082		146243864	-1	tier1	-	no_errors	ENST00000367503	ensembl	human	known	74_37	silent	18.60	70	16	SNP	0.807	C
SHROOM3	57619	genome.wustl.edu	37	4	77661903	77661903	+	Silent	SNP	C	C	G			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr4:77661903C>G	ENST00000296043.6	+	5	3530	c.2577C>G	c.(2575-2577)tcC>tcG	p.S859S		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	859					actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			AAGAGGCTTCCCGGCAGCCCT	0.632																																																	0													31.0	36.0	35.0					4																	77661903		2201	4295	6496	SO:0001819	synonymous_variant	0			AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.2577C>G	4.37:g.77661903C>G			Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Silent	SNP	pfam_ASD2,pfam_ASD1,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.S859	ENST00000296043.6	37	c.2577	CCDS3579.2	4																																																																																			SHROOM3	-	NULL	ENSG00000138771		0.632	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM3	HGNC	protein_coding	OTTHUMT00000252408.2	-	0.00	48	0	C	NM_020859		77661903	+1	tier1	-	no_errors	ENST00000296043	ensembl	human	known	74_37	silent	34.55	36	19	SNP	0.000	G
SLC16A1	6566	genome.wustl.edu	37	1	113460201	113460201	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr1:113460201C>T	ENST00000538576.1	-	4	1658	c.827G>A	c.(826-828)gGa>gAa	p.G276E	SLC16A1_ENST00000433570.4_Missense_Mutation_p.G276E|SLC16A1_ENST00000369626.3_Missense_Mutation_p.G276E	NM_001166496.1	NP_001159968.1	P53985	MOT1_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 1	276					behavioral response to nutrient (GO:0051780)|blood coagulation (GO:0007596)|cellular metabolic process (GO:0044237)|cellular response to organic cyclic compound (GO:0071407)|centrosome organization (GO:0051297)|glucose homeostasis (GO:0042593)|leukocyte migration (GO:0050900)|lipid metabolic process (GO:0006629)|mevalonate transport (GO:0015728)|monocarboxylic acid transport (GO:0015718)|plasma membrane lactate transport (GO:0035879)|pyruvate metabolic process (GO:0006090)|regulation of insulin secretion (GO:0050796)|response to food (GO:0032094)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	mevalonate transmembrane transporter activity (GO:0015130)|monocarboxylic acid transmembrane transporter activity (GO:0008028)|organic cyclic compound binding (GO:0097159)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(8)|skin(1)|urinary_tract(1)	20	Lung SC(450;0.246)	all_cancers(81;7.6e-08)|all_epithelial(167;3.82e-07)|all_lung(203;3.07e-05)|Lung NSC(69;5.51e-05)|Prostate(1639;0.00232)		Epithelial(280;7.31e-13)|all cancers(265;5.1e-10)|Kidney(133;5.29e-07)|KIRC - Kidney renal clear cell carcinoma(1967;8.63e-06)|OV - Ovarian serous cystadenocarcinoma(397;1.48e-05)|BRCA - Breast invasive adenocarcinoma(282;0.003)|LUSC - Lung squamous cell carcinoma(189;0.008)|Lung(183;0.00948)|Colorectal(144;0.0325)|COAD - Colon adenocarcinoma(174;0.0643)	Acetic acid(DB03166)|Aminohippurate(DB00345)|Ampicillin(DB00415)|Foscarnet(DB00529)|Gamma Hydroxybutyric Acid(DB01440)|Methotrexate(DB00563)|Nateglinide(DB00731)|Niacin(DB00627)|Niflumic Acid(DB04552)|Pravastatin(DB00175)|Probenecid(DB01032)|Pyruvic acid(DB00119)|Salicylic acid(DB00936)|Valproic Acid(DB00313)	TGCAAAGAGTCCAAAAAACAT	0.408																																																	0													79.0	81.0	81.0					1																	113460201		2203	4300	6503	SO:0001583	missense	0			BC026317	CCDS858.1	1p12	2013-07-18	2013-07-18		ENSG00000155380	ENSG00000155380		"""Solute carriers"""	10922	protein-coding gene	gene with protein product		600682	"""solute carrier family 16 (monocarboxylic acid transporters), member 1"", ""solute carrier family 16, member 1 (monocarboxylic acid transporter 1)"""			8124722, 7835905	Standard	NM_003051		Approved	MCT, MCT1	uc001ecy.3	P53985	OTTHUMG00000012129	ENST00000538576.1:c.827G>A	1.37:g.113460201C>T	ENSP00000441065:p.Gly276Glu		Q49A45|Q5T8R6|Q9NSJ9	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Monocarb_transpt	p.G276E	ENST00000538576.1	37	c.827	CCDS858.1	1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.423646	0.83559	.	.	ENSG00000155380	ENST00000369626;ENST00000538576;ENST00000458229;ENST00000433570;ENST00000443580	T;T;T;T;T	0.60672	0.17;0.17;0.17;0.17;0.17	5.74	4.81	0.61882	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.80722	0.4677	H	0.96398	3.815	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.79784	0.99;0.993	D	0.88097	0.2817	10	0.87932	D	0	.	16.6155	0.84915	0.0:0.8696:0.1304:0.0	.	276;276	Q49A45;P53985	.;MOT1_HUMAN	E	276	ENSP00000358640:G276E;ENSP00000441065:G276E;ENSP00000416167:G276E;ENSP00000445061:G276E;ENSP00000399104:G276E	ENSP00000358640:G276E	G	-	2	0	SLC16A1	113261724	1.000000	0.71417	0.998000	0.56505	0.945000	0.59286	7.767000	0.85331	1.528000	0.49103	0.563000	0.77884	GGA	SLC16A1	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Monocarb_transpt	ENSG00000155380		0.408	SLC16A1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC16A1	HGNC	protein_coding	OTTHUMT00000033539.1	-	0.00	56	0	C	NM_003051		113460201	-1	tier1	-	no_errors	ENST00000369626	ensembl	human	known	74_37	missense	44.07	33	26	SNP	1.000	T
SLC17A9	63910	genome.wustl.edu	37	20	61594982	61594982	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr20:61594982C>T	ENST00000370351.4	+	7	903	c.772C>T	c.(772-774)Ctc>Ttc	p.L258F	SLC17A9_ENST00000488738.1_3'UTR|SLC17A9_ENST00000370349.3_Missense_Mutation_p.L252F	NM_022082.3	NP_071365	Q9BYT1	S17A9_HUMAN	solute carrier family 17 (vesicular nucleotide transporter), member 9	258					exocytosis (GO:0006887)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	23						CTTCTTCATCCTCCTCTCCTG	0.687																																																	0													54.0	59.0	57.0					20																	61594982		2144	4247	6391	SO:0001583	missense	0			AK027065	CCDS42901.1	20q13.33	2013-07-18	2013-07-18	2009-01-22	ENSG00000101194	ENSG00000101194		"""Solute carriers"""	16192	protein-coding gene	gene with protein product		612107	"""chromosome 20 open reading frame 59"", ""solute carrier family 17, member 9"""	C20orf59		18375752	Standard	NM_022082		Approved	FLJ23412, VNUT	uc002yea.4	Q9BYT1	OTTHUMG00000032951	ENST00000370351.4:c.772C>T	20.37:g.61594982C>T	ENSP00000359376:p.Leu258Phe		B3KTF2|Q5W198|Q8TB07|Q8TBP4|Q8TEL5|Q9BYT0|Q9BYT2	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.L258F	ENST00000370351.4	37	c.772	CCDS42901.1	20	.	.	.	.	.	.	.	.	.	.	C	15.08	2.725810	0.48833	.	.	ENSG00000101194	ENST00000370351;ENST00000370349	T;T	0.60171	0.21;0.21	4.86	3.92	0.45320	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.065081	0.64402	D	0.000006	T	0.75019	0.3793	M	0.86651	2.83	0.80722	D	1	D;D;D	0.71674	0.998;0.996;0.995	D;D;D	0.70016	0.967;0.957;0.928	T	0.76852	-0.2806	10	0.87932	D	0	.	8.1861	0.31339	0.1552:0.7645:0.0:0.0802	.	278;258;252	B4DPU8;Q9BYT1;Q9BYT1-2	.;S17A9_HUMAN;.	F	258;252	ENSP00000359376:L258F;ENSP00000359374:L252F	ENSP00000359374:L252F	L	+	1	0	SLC17A9	61065427	1.000000	0.71417	0.998000	0.56505	0.050000	0.14768	5.017000	0.64047	1.042000	0.40150	0.313000	0.20887	CTC	SLC17A9	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000101194		0.687	SLC17A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A9	HGNC	protein_coding	OTTHUMT00000080100.1	-	0.00	39	0	C	NM_022082		61594982	+1	tier1	-	no_errors	ENST00000370351	ensembl	human	known	74_37	missense	44.44	20	16	SNP	1.000	T
SLC22A25	387601	genome.wustl.edu	37	11	62931426	62931426	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr11:62931426G>A	ENST00000306494.6	-	9	1513	c.1514C>T	c.(1513-1515)gCc>gTc	p.A505V	SLC22A10_ENST00000525620.1_Intron|SLC22A10_ENST00000535888.1_Intron	NM_199352.3	NP_955384.3			solute carrier family 22, member 25											NS(2)|breast(2)|endometrium(4)|kidney(2)|large_intestine(7)|lung(7)|ovary(3)|skin(7)	34						AGAGAGGATGGCAAAGACTCC	0.493																																																	0													148.0	151.0	150.0					11																	62931426		2201	4298	6499	SO:0001583	missense	0			AY437532	CCDS31592.1	11q12.3	2014-05-20			ENSG00000196600	ENSG00000196600		"""Solute carriers"""	32935	protein-coding gene	gene with protein product		610792	"""MGI:2442751, MGI:2385316, MGI:3042283, MGI:3645714, MGI:3605624, MGI:2442750"""			17714910	Standard	NM_199352		Approved	UST6, HIMTP, MGC120420	uc001nwr.1	Q6T423	OTTHUMG00000165340	ENST00000306494.6:c.1514C>T	11.37:g.62931426G>A	ENSP00000307443:p.Ala505Val			Missense_Mutation	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.A505V	ENST00000306494.6	37	c.1514	CCDS31592.1	11	.	.	.	.	.	.	.	.	.	.	G	12.25	1.880455	0.33255	.	.	ENSG00000196600	ENST00000306494	T	0.60424	0.19	4.73	2.77	0.32553	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.541895	0.20531	N	0.090514	T	0.56381	0.1981	M	0.73598	2.24	0.09310	N	0.999998	B	0.28552	0.215	B	0.25987	0.065	T	0.54159	-0.8335	10	0.72032	D	0.01	.	11.6427	0.51242	0.0:0.342:0.658:0.0	.	505	Q6T423	S22AP_HUMAN	V	505	ENSP00000307443:A505V	ENSP00000307443:A505V	A	-	2	0	SLC22A25	62688002	0.909000	0.30893	0.001000	0.08648	0.004000	0.04260	1.995000	0.40767	0.486000	0.27676	0.586000	0.80456	GCC	SLC22A25	-	pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000196600		0.493	SLC22A25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A25	HGNC	protein_coding	OTTHUMT00000383519.3	-	0.00	81	0	G	NM_199352		62931426	-1	tier1	-	no_errors	ENST00000306494	ensembl	human	known	74_37	missense	50.67	37	38	SNP	0.021	A
SLC22A12	116085	genome.wustl.edu	37	11	64368307	64368307	+	Silent	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr11:64368307C>T	ENST00000377574.1	+	9	2242	c.1495C>T	c.(1495-1497)Ctg>Ttg	p.L499L	SLC22A12_ENST00000377567.2_Silent_p.L391L|SLC22A12_ENST00000473690.1_Silent_p.L278L|SLC22A12_ENST00000336464.7_Silent_p.L465L|SLC22A12_ENST00000377572.1_Silent_p.L391L	NM_144585.2	NP_653186.2	Q96S37	S22AC_HUMAN	solute carrier family 22 (organic anion/urate transporter), member 12	499					cellular homeostasis (GO:0019725)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)|urate transport (GO:0015747)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|urate transmembrane transporter activity (GO:0015143)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27					Losartan(DB00678)|Probenecid(DB01032)	GCTGCCCTTGCTGGTGTATGG	0.667																																																	0													80.0	82.0	81.0					11																	64368307		2201	4297	6498	SO:0001819	synonymous_variant	0			AB071863	CCDS8075.1, CCDS60835.1, CCDS60836.1	11q13.1	2013-05-22	2008-01-11		ENSG00000197891	ENSG00000197891		"""Solute carriers"""	17989	protein-coding gene	gene with protein product		607096	"""solute carrier family 22 (organic anion/cation transporter), member 12"""			12024214	Standard	NM_144585		Approved	OAT4L, RST, URAT1	uc009yps.2	Q96S37	OTTHUMG00000045213	ENST00000377574.1:c.1495C>T	11.37:g.64368307C>T			B7WPG1|G3XAN7|Q19PF7|Q19PF8|Q19PF9|Q19PG0|Q6UXW3|Q96DT2	Silent	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.L499	ENST00000377574.1	37	c.1495	CCDS8075.1	11																																																																																			SLC22A12	-	superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000197891		0.667	SLC22A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A12	HGNC	protein_coding	OTTHUMT00000104966.2	-	0.00	47	0	C	NM_144585		64368307	+1	tier1	-	no_errors	ENST00000377574	ensembl	human	known	74_37	silent	7.84	47	4	SNP	0.013	T
SLC38A1	81539	genome.wustl.edu	37	12	46591568	46591568	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr12:46591568G>C	ENST00000398637.5	-	16	1991	c.1297C>G	c.(1297-1299)Ctt>Gtt	p.L433V	SLC38A1_ENST00000439706.1_Missense_Mutation_p.L433V|SLC38A1_ENST00000552197.1_Missense_Mutation_p.L433V|SLC38A1_ENST00000546893.1_Missense_Mutation_p.L433V|SLC38A1_ENST00000549049.1_Missense_Mutation_p.L433V|SLC38A1_ENST00000549633.1_5'Flank	NM_001077484.1|NM_001278387.1|NM_001278388.1|NM_001278389.1|NM_030674.3	NP_001070952.1|NP_001265316.1|NP_001265317.1|NP_001265318.1|NP_109599.3	Q9H2H9	S38A1_HUMAN	solute carrier family 38, member 1	433					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|neutral amino acid transport (GO:0015804)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neutral amino acid transmembrane transporter activity (GO:0015175)|sodium:amino acid symporter activity (GO:0005283)			NS(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(2)	23	Lung SC(27;0.137)|Renal(347;0.236)		all cancers(1;0.00805)|OV - Ovarian serous cystadenocarcinoma(5;0.0106)|Epithelial(2;0.0344)			GATGAAGGAAGAATGAAAATA	0.353																																																	0													114.0	116.0	115.0					12																	46591568		1821	4081	5902	SO:0001583	missense	0			AF271070	CCDS41774.1, CCDS61106.1	12q13.11	2013-05-22				ENSG00000111371		"""Solute carriers"""	13447	protein-coding gene	gene with protein product		608490				10891391	Standard	NM_030674		Approved	ATA1, NAT2, SAT1	uc001rpc.3	Q9H2H9		ENST00000398637.5:c.1297C>G	12.37:g.46591568G>C	ENSP00000381634:p.Leu433Val		Q8NC61|Q8NCF8|Q96JX2|Q9H2Q2	Missense_Mutation	SNP	pfam_AA_transpt_TM	p.L433V	ENST00000398637.5	37	c.1297	CCDS41774.1	12	.	.	.	.	.	.	.	.	.	.	G	19.27	3.795383	0.70452	.	.	ENSG00000111371	ENST00000549049;ENST00000439706;ENST00000398637;ENST00000546893;ENST00000552197	T;T;T;T;T	0.04317	3.65;3.65;3.65;3.65;3.65	5.95	4.99	0.66335	.	0.192990	0.36972	N	0.002302	T	0.20210	0.0486	M	0.69823	2.125	0.40752	D	0.982925	D;P	0.58268	0.982;0.955	P;D	0.64410	0.757;0.925	T	0.00082	-1.2105	10	0.72032	D	0.01	-22.9908	17.9075	0.88923	0.0:0.0:0.8704:0.1296	.	433;433	F8VX04;Q9H2H9	.;S38A1_HUMAN	V	433	ENSP00000449607:L433V;ENSP00000398142:L433V;ENSP00000381634:L433V;ENSP00000447853:L433V;ENSP00000449756:L433V	ENSP00000381634:L433V	L	-	1	0	SLC38A1	44877835	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.310000	0.59141	2.827000	0.97445	0.650000	0.86243	CTT	SLC38A1	-	pfam_AA_transpt_TM	ENSG00000111371		0.353	SLC38A1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC38A1	HGNC	protein_coding	OTTHUMT00000404218.2	-	0.00	90	0	G			46591568	-1	tier1	-	no_errors	ENST00000398637	ensembl	human	known	74_37	missense	23.17	63	19	SNP	1.000	C
SLC7A4	6545	genome.wustl.edu	37	22	21384088	21384088	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr22:21384088A>G	ENST00000382932.2	-	3	1602	c.1535T>C	c.(1534-1536)cTg>cCg	p.L512P	SLC7A4_ENST00000403586.1_Missense_Mutation_p.L512P|AC002472.11_ENST00000450652.1_RNA	NM_004173.2	NP_004164.2	O43246	CTR4_HUMAN	solute carrier family 7, member 4	512					basic amino acid transport (GO:0015802)|cellular amino acid metabolic process (GO:0006520)|transport (GO:0006810)	integral component of membrane (GO:0016021)	basic amino acid transmembrane transporter activity (GO:0015174)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(7)|ovary(1)|prostate(2)	18	all_cancers(11;2.85e-22)|Lung NSC(8;4.21e-14)|all_lung(8;6.08e-13)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0968)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)		L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	CAGGAGCAGCAGGATGTAACC	0.562																																																	0													67.0	50.0	56.0					22																	21384088		2203	4300	6503	SO:0001583	missense	0			AJ000730	CCDS33608.1	22q11.21	2013-07-19	2013-07-19		ENSG00000099960	ENSG00000099960		"""Solute carriers"""	11062	protein-coding gene	gene with protein product		603752	"""solute carrier family 7 (cationic amino acid transporter, y+ system), member 4"", ""solute carrier family 7 (orphan transporter), member 4"""			9598310, 11665818	Standard	NM_004173		Approved	HCAT3, CAT-4, VH	uc002zud.3	O43246	OTTHUMG00000150896	ENST00000382932.2:c.1535T>C	22.37:g.21384088A>G	ENSP00000372390:p.Leu512Pro		Q0P5U2|Q3KNQ6|Q4VC45|Q6IBY8|Q96H88	Missense_Mutation	SNP	pfam_AA-permease/SLC12A_dom,pirsf_AA/rel_permease1	p.L512P	ENST00000382932.2	37	c.1535	CCDS33608.1	22	.	.	.	.	.	.	.	.	.	.	A	12.95	2.090086	0.36855	.	.	ENSG00000099960	ENST00000403586;ENST00000382932	D;D	0.87650	-2.28;-2.28	5.46	5.46	0.80206	.	0.247588	0.33712	N	0.004627	D	0.91095	0.7197	M	0.69823	2.125	0.80722	D	1	D	0.59357	0.985	P	0.58780	0.845	D	0.91045	0.4874	10	0.46703	T	0.11	.	13.7984	0.63186	1.0:0.0:0.0:0.0	.	512	O43246	CTR4_HUMAN	P	512	ENSP00000384278:L512P;ENSP00000372390:L512P	ENSP00000372390:L512P	L	-	2	0	SLC7A4	19714088	1.000000	0.71417	0.981000	0.43875	0.147000	0.21601	7.086000	0.76885	2.203000	0.70933	0.459000	0.35465	CTG	SLC7A4	-	pirsf_AA/rel_permease1	ENSG00000099960		0.562	SLC7A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A4	HGNC	protein_coding	OTTHUMT00000320467.1	-	0.00	78	0	A	NM_004173		21384088	-1	tier1	-	no_errors	ENST00000382932	ensembl	human	known	74_37	missense	20.97	49	13	SNP	0.998	G
SLC9A9	285195	genome.wustl.edu	37	3	143551002	143551002	+	Silent	SNP	A	A	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr3:143551002A>C	ENST00000316549.6	-	2	445	c.237T>G	c.(235-237)acT>acG	p.T79T		NM_173653.3	NP_775924.1	Q8IVB4	SL9A9_HUMAN	solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9	79					ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|recycling endosome (GO:0055037)	sodium:proton antiporter activity (GO:0015385)			breast(2)|endometrium(5)|kidney(2)|large_intestine(13)|lung(29)|ovary(2)|skin(3)|stomach(1)	57						AGTCATAGACAGTTCCACTTT	0.338																																																	0													149.0	146.0	147.0					3																	143551002		2203	4300	6503	SO:0001819	synonymous_variant	0			AY254100	CCDS33872.1	3q23-q24	2014-01-28	2012-03-22		ENSG00000181804	ENSG00000181804		"""Solute carriers"""	20653	protein-coding gene	gene with protein product		608396	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 9"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 9"""			14569117	Standard	NM_173653		Approved	FLJ35613, NHE9	uc003evn.3	Q8IVB4	OTTHUMG00000159373	ENST00000316549.6:c.237T>G	3.37:g.143551002A>C			A6NMQ9|Q3LIC2|Q5JPI6|Q5WA58|Q8NAB9	Silent	SNP	pfam_Cation/H_exchanger,prints_Na/H_exchanger_6,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.T79	ENST00000316549.6	37	c.237	CCDS33872.1	3																																																																																			SLC9A9	-	pfam_Cation/H_exchanger	ENSG00000181804		0.338	SLC9A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A9	HGNC	protein_coding	OTTHUMT00000354994.1	-	0.00	47	0	A	NM_173653		143551002	-1	tier1	-	no_errors	ENST00000316549	ensembl	human	known	74_37	silent	10.87	82	10	SNP	0.999	C
SMC2	10592	genome.wustl.edu	37	9	106860801	106860801	+	Silent	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr9:106860801C>T	ENST00000286398.7	+	4	681	c.393C>T	c.(391-393)ttC>ttT	p.F131F	SMC2_ENST00000374787.3_Silent_p.F131F|SMC2_ENST00000374793.3_Silent_p.F131F|SMC2_ENST00000303219.8_Silent_p.F131F	NM_001042551.1|NM_001265602.1|NM_006444.2	NP_001036016.1|NP_001252531.1|NP_006435.2	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2	131					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(14)|ovary(5)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	48						AGGATCTCTTCTGTTCTGTTG	0.333																																																	0													207.0	197.0	201.0					9																	106860801		2203	4300	6503	SO:0001819	synonymous_variant	0			AF092563	CCDS35086.1	9q31.1	2008-05-14	2006-07-06	2006-07-06	ENSG00000136824	ENSG00000136824		"""Structural maintenance of chromosomes proteins"""	14011	protein-coding gene	gene with protein product		605576	"""SMC2 (structural maintenance of chromosomes 2, yeast)-like 1"", ""SMC2 structural maintenance of chromosomes 2-like 1 (yeast)"""	SMC2L1		9789013	Standard	NM_006444		Approved	hCAP-E, CAP-E	uc011lvl.2	O95347	OTTHUMG00000020401	ENST00000286398.7:c.393C>T	9.37:g.106860801C>T			Q6IEE0|Q9P1P2	Silent	SNP	pfam_RecF/RecN/SMC_N,pfam_SMC_hinge,superfamily_P-loop_NTPase,superfamily_SMC_hinge,smart_SMC_hinge	p.F131	ENST00000286398.7	37	c.393	CCDS35086.1	9																																																																																			SMC2	-	pfam_RecF/RecN/SMC_N,superfamily_P-loop_NTPase	ENSG00000136824		0.333	SMC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC2	HGNC	protein_coding	OTTHUMT00000053470.1	-	0.00	48	0	C			106860801	+1	tier1	-	no_errors	ENST00000286398	ensembl	human	known	74_37	silent	63.16	21	36	SNP	1.000	T
SMURF1	57154	genome.wustl.edu	37	7	98649881	98649881	+	Missense_Mutation	SNP	G	G	A	rs371859465		TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr7:98649881G>A	ENST00000361125.1	-	7	987	c.668C>T	c.(667-669)aCg>aTg	p.T223M	SMURF1_ENST00000480055.1_5'UTR|SMURF1_ENST00000361368.2_Missense_Mutation_p.T223M	NM_020429.2	NP_065162.1	Q9HCE7	SMUF1_HUMAN	SMAD specific E3 ubiquitin protein ligase 1	223					BMP signaling pathway (GO:0030509)|cell differentiation (GO:0030154)|ectoderm development (GO:0007398)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of ossification (GO:0030279)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein export from nucleus (GO:0006611)|protein localization to cell surface (GO:0034394)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|receptor catabolic process (GO:0032801)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	activin binding (GO:0048185)|I-SMAD binding (GO:0070411)|ligase activity (GO:0016874)|R-SMAD binding (GO:0070412)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(3)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|urinary_tract(1)	25	all_cancers(62;1.05e-08)|all_epithelial(64;4.34e-09)|Lung NSC(181;0.00902)|all_lung(186;0.0145)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)|Lung(104;0.224)			GTTCTGGGGCGTCTGTAGTGA	0.582																																																	0													158.0	141.0	147.0					7																	98649881		2203	4300	6503	SO:0001583	missense	0			AB046845	CCDS34689.1, CCDS34690.1	7q21.1-q31.1	2004-07-29			ENSG00000198742	ENSG00000198742			16807	protein-coding gene	gene with protein product		605568				10458166	Standard	NM_020429		Approved	KIAA1625	uc003upu.2	Q9HCE7	OTTHUMG00000150272	ENST00000361125.1:c.668C>T	7.37:g.98649881G>A	ENSP00000354621:p.Thr223Met		A4D279|B7ZMB6|B9EGV3|O75853|Q547Q3|Q9UJT8	Missense_Mutation	SNP	pfam_HECT,pfam_WW_dom,pfam_C2_dom,superfamily_HECT,superfamily_C2_dom,superfamily_WW_dom,smart_C2_dom,smart_WW_dom,smart_HECT,pfscan_HECT,pfscan_C2_dom,pfscan_WW_dom	p.T223M	ENST00000361125.1	37	c.668	CCDS34690.1	7	.	.	.	.	.	.	.	.	.	.	G	17.22	3.334475	0.60853	.	.	ENSG00000198742	ENST00000361368;ENST00000361125	T;T	0.46063	1.19;0.88	5.55	4.66	0.58398	.	0.044155	0.85682	N	0.000000	T	0.28400	0.0702	L	0.34521	1.04	0.58432	D	0.999997	B;P;B	0.43542	0.005;0.81;0.003	B;B;B	0.30495	0.004;0.116;0.002	T	0.06770	-1.0808	10	0.41790	T	0.15	.	14.2963	0.66316	0.0719:0.0:0.9281:0.0	.	223;223;223	Q9HCE7-2;Q9HCE7;B9EGV3	.;SMUF1_HUMAN;.	M	223	ENSP00000355326:T223M;ENSP00000354621:T223M	ENSP00000354621:T223M	T	-	2	0	SMURF1	98487817	1.000000	0.71417	0.983000	0.44433	0.979000	0.70002	4.531000	0.60602	1.335000	0.45486	0.650000	0.86243	ACG	SMURF1	-	NULL	ENSG00000198742		0.582	SMURF1-001	KNOWN	basic|CCDS	protein_coding	SMURF1	HGNC	protein_coding	OTTHUMT00000335001.2	-	0.00	39	0	G	NM_020429		98649881	-1	tier1	-	no_errors	ENST00000361125	ensembl	human	known	74_37	missense	21.62	58	16	SNP	0.999	A
SOGA3	387104	genome.wustl.edu	37	6	127834136	127834136	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr6:127834136C>A	ENST00000525778.1	-	4	2130	c.1385G>T	c.(1384-1386)aGa>aTa	p.R462I	SOGA3_ENST00000556132.1_Missense_Mutation_p.R462I|SOGA3_ENST00000465909.2_Missense_Mutation_p.R462I|SOGA3_ENST00000481848.2_Missense_Mutation_p.R462I|SOGA3_ENST00000368268.2_Missense_Mutation_p.R462I			Q5TF21	SOGA3_HUMAN	SOGA family member 3	462					regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											TGTTGTTGTTCTCTTTTCTTC	0.328																																																	0													159.0	138.0	144.0					6																	127834136		1835	4097	5932	SO:0001583	missense	0			AK096490	CCDS43505.1	6q22.33	2013-03-28	2012-02-27	2012-02-27	ENSG00000214338	ENSG00000214338			21494	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 174"""	C6orf174			Standard	NM_001012279		Approved	dJ403A15.3	uc003qbd.3	Q5TF21	OTTHUMG00000166438	ENST00000525778.1:c.1385G>T	6.37:g.127834136C>A	ENSP00000434570:p.Arg462Ile			Missense_Mutation	SNP	pfam_SOGA	p.R462I	ENST00000525778.1	37	c.1385	CCDS43505.1	6	.	.	.	.	.	.	.	.	.	.	C	31	5.070757	0.93950	.	.	ENSG00000214338	ENST00000556132;ENST00000368268;ENST00000525778;ENST00000465909	T;T;T;T	0.46819	0.86;0.86;0.86;0.86	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.68311	0.2987	M	0.81942	2.565	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	T	0.71461	-0.4586	10	0.87932	D	0	-12.4429	19.7987	0.96497	0.0:1.0:0.0:0.0	.	462	Q5TF21	CF174_HUMAN	I	462	ENSP00000451768:R462I;ENSP00000357251:R462I;ENSP00000434570:R462I;ENSP00000435559:R462I	ENSP00000435559:R462I	R	-	2	0	C6orf174	127875829	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.776000	0.85560	2.767000	0.95098	0.655000	0.94253	AGA	SOGA3	-	NULL	ENSG00000214338		0.328	SOGA3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SOGA3	HGNC	protein_coding	OTTHUMT00000388246.1	-	0.00	57	0	C	NM_001012279		127834136	-1	tier1	-	no_errors	ENST00000368268	ensembl	human	known	74_37	missense	35.82	43	24	SNP	1.000	A
SPTA1	6708	genome.wustl.edu	37	1	158622411	158622411	+	Missense_Mutation	SNP	C	C	T	rs551084590		TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr1:158622411C>T	ENST00000368147.4	-	23	3401	c.3221G>A	c.(3220-3222)cGc>cAc	p.R1074H		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1074					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.R1074H(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					ACGACGTCTGCGTTCTTCTGC	0.438													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18408	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	lung(1)											104.0	96.0	98.0					1																	158622411		1884	4114	5998	SO:0001583	missense	0			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.3221G>A	1.37:g.158622411C>T	ENSP00000357129:p.Arg1074His		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_hand_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.R1074H	ENST00000368147.4	37	c.3221	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	C	19.97	3.925236	0.73213	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.76060	-0.99;-0.99	5.3	5.3	0.74995	.	0.000000	0.32703	N	0.005753	D	0.82641	0.5081	M	0.66939	2.045	0.58432	D	0.999996	D	0.89917	1.0	D	0.71656	0.974	D	0.83848	0.0261	10	0.87932	D	0	.	17.7085	0.88315	0.0:1.0:0.0:0.0	.	1074	P02549	SPTA1_HUMAN	H	1074	ENSP00000357130:R1074H;ENSP00000357129:R1074H	ENSP00000357129:R1074H	R	-	2	0	SPTA1	156889035	1.000000	0.71417	0.997000	0.53966	0.069000	0.16628	4.986000	0.63851	2.769000	0.95229	0.655000	0.94253	CGC	SPTA1	-	smart_Spectrin/alpha-actinin	ENSG00000163554		0.438	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3		0.00	23	0	C	NM_003126		158622411	-1			no_errors	ENST00000368147	ensembl	human	known	74_37	missense	6.90	27	2	SNP	1.000	T
SPATA17	128153	genome.wustl.edu	37	1	217842377	217842377	+	Silent	SNP	A	A	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr1:217842377A>T	ENST00000366933.4	+	4	298	c.243A>T	c.(241-243)gtA>gtT	p.V81V		NM_138796.2	NP_620151.1	Q96L03	SPT17_HUMAN	spermatogenesis associated 17	81	IQ 2. {ECO:0000255|PROSITE- ProRule:PRU00116}.					cytoplasm (GO:0005737)				endometrium(1)|kidney(1)|large_intestine(9)|lung(6)|pancreas(2)|prostate(1)|urinary_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)		ATTCACAGGTAGCATATTATA	0.313																																																	0													135.0	138.0	137.0					1																	217842377		2203	4297	6500	SO:0001819	synonymous_variant	0			AK098591	CCDS1519.1	1q41	2008-02-05			ENSG00000162814	ENSG00000162814			25184	protein-coding gene	gene with protein product	"""IQ motif containing H"""	611032				16395525	Standard	NM_138796		Approved	IQCH	uc001hlh.1	Q96L03	OTTHUMG00000037875	ENST00000366933.4:c.243A>T	1.37:g.217842377A>T			A5D6N2	Silent	SNP	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.V81	ENST00000366933.4	37	c.243	CCDS1519.1	1																																																																																			SPATA17	-	superfamily_P-loop_NTPase	ENSG00000162814		0.313	SPATA17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA17	HGNC	protein_coding	OTTHUMT00000092433.2	-	0.00	40	0	A	NM_138796		217842377	+1	tier1	-	no_errors	ENST00000366933	ensembl	human	known	74_37	silent	13.89	62	10	SNP	1.000	T
ST18	9705	genome.wustl.edu	37	8	53025816	53025816	+	Missense_Mutation	SNP	G	G	A	rs533229892		TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr8:53025816G>A	ENST00000276480.7	-	26	3769	c.3086C>T	c.(3085-3087)cCg>cTg	p.P1029L		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	1029					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				TTTGCATTCCGGGGAATAGTC	0.448													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18756	0.0		0.0	False		,,,				2504	0.0																0													168.0	146.0	154.0					8																	53025816		2203	4300	6503	SO:0001583	missense	0			AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.3086C>T	8.37:g.53025816G>A	ENSP00000276480:p.Pro1029Leu		Q17RY1	Missense_Mutation	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.P1029L	ENST00000276480.7	37	c.3086	CCDS6149.1	8	.	.	.	.	.	.	.	.	.	.	G	35	5.541459	0.96474	.	.	ENSG00000147488	ENST00000276480	T	0.56444	0.46	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.73481	0.3592	M	0.68317	2.08	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.73811	-0.3865	10	0.87932	D	0	-13.9925	20.417	0.99027	0.0:0.0:1.0:0.0	.	1029	O60284	ST18_HUMAN	L	1029	ENSP00000276480:P1029L	ENSP00000276480:P1029L	P	-	2	0	ST18	53188369	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.832000	0.97577	0.585000	0.79938	CCG	ST18	-	NULL	ENSG00000147488		0.448	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST18	HGNC	protein_coding	OTTHUMT00000377867.1	-	0.00	54	0	G			53025816	-1	tier1	-	no_errors	ENST00000276480	ensembl	human	known	74_37	missense	46.97	35	31	SNP	1.000	A
TCF20	6942	genome.wustl.edu	37	22	42607581	42607581	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr22:42607581T>A	ENST00000359486.3	-	1	3867	c.3731A>T	c.(3730-3732)gAt>gTt	p.D1244V	TCF20_ENST00000404876.1_5'Flank|TCF20_ENST00000335626.4_Missense_Mutation_p.D1244V	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	1244					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						AGAAGAATGATCCTCCTGGCC	0.483																																																	0													121.0	111.0	115.0					22																	42607581		2203	4300	6503	SO:0001583	missense	0			U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.3731A>T	22.37:g.42607581T>A	ENSP00000352463:p.Asp1244Val		A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Missense_Mutation	SNP	smart_Znf_PHD	p.D1244V	ENST00000359486.3	37	c.3731	CCDS14033.1	22	.	.	.	.	.	.	.	.	.	.	T	14.19	2.460671	0.43736	.	.	ENSG00000100207	ENST00000359486;ENST00000335626	T;T	0.60672	0.17;0.17	5.52	5.52	0.82312	.	0.074009	0.56097	D	0.000032	T	0.66694	0.2815	L	0.36672	1.1	0.80722	D	1	D;D	0.71674	0.998;0.997	D;P	0.66351	0.943;0.879	T	0.69367	-0.5164	10	0.66056	D	0.02	-21.3001	15.8108	0.78561	0.0:0.0:0.0:1.0	.	1244;1244	Q9UGU0-2;Q9UGU0	.;TCF20_HUMAN	V	1244	ENSP00000352463:D1244V;ENSP00000335561:D1244V	ENSP00000335561:D1244V	D	-	2	0	TCF20	40937525	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	3.456000	0.53000	2.320000	0.78422	0.528000	0.53228	GAT	TCF20	-	NULL	ENSG00000100207		0.483	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCF20	HGNC	protein_coding	OTTHUMT00000320531.1	-	0.00	52	0	T	NM_181492		42607581	-1	tier1	-	no_errors	ENST00000359486	ensembl	human	known	74_37	missense	48.94	24	23	SNP	1.000	A
TDRD6	221400	genome.wustl.edu	37	6	46658264	46658264	+	Missense_Mutation	SNP	C	C	G	rs375428009		TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr6:46658264C>G	ENST00000316081.6	+	1	2399	c.2399C>G	c.(2398-2400)aCt>aGt	p.T800S	TDRD6_ENST00000544460.1_Missense_Mutation_p.T800S|RP11-446F17.3_ENST00000422284.2_RNA|RP11-446F17.3_ENST00000571590.1_RNA|RP11-446F17.3_ENST00000434329.2_RNA	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	800					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)				NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			GGACTTAAAACTCTAATGTCT	0.428																																																	0													93.0	95.0	95.0					6																	46658264		2203	4300	6503	SO:0001583	missense	0			AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.2399C>G	6.37:g.46658264C>G	ENSP00000346065:p.Thr800Ser		B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Missense_Mutation	SNP	pfam_Tudor,smart_Tudor,pfscan_Tudor	p.T800S	ENST00000316081.6	37	c.2399	CCDS34470.1	6	.	.	.	.	.	.	.	.	.	.	C	8.872	0.949481	0.18356	.	.	ENSG00000180113	ENST00000544460;ENST00000316081	T;T	0.08984	3.03;3.03	5.75	4.83	0.62350	Maternal tudor protein (1);	1.108360	0.06499	N	0.736001	T	0.01905	0.0060	L	0.27053	0.805	0.09310	N	1	B;B	0.17038	0.016;0.02	B;B	0.19666	0.015;0.026	T	0.46386	-0.9195	10	0.09843	T	0.71	-19.9356	6.5047	0.22188	0.1341:0.665:0.1298:0.071	.	800;800	F5H5M3;O60522	.;TDRD6_HUMAN	S	800	ENSP00000443299:T800S;ENSP00000346065:T800S	ENSP00000346065:T800S	T	+	2	0	TDRD6	46766223	0.000000	0.05858	0.155000	0.22561	0.868000	0.49771	0.527000	0.22987	2.711000	0.92665	0.655000	0.94253	ACT	TDRD6	-	pfam_Tudor	ENSG00000180113		0.428	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TDRD6	HGNC	protein_coding	OTTHUMT00000040800.1	-	0.00	42	0	C	XM_166443		46658264	+1	tier1	-	no_errors	ENST00000316081	ensembl	human	known	74_37	missense	31.82	30	14	SNP	0.000	G
TECPR2	9895	genome.wustl.edu	37	14	102880972	102880972	+	Splice_Site	SNP	G	G	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr14:102880972G>T	ENST00000359520.7	+	5	706		c.e5-1		TECPR2_ENST00000558678.1_Splice_Site|TECPR2_ENST00000561228.1_Splice_Site	NM_014844.3	NP_055659.2	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2						autophagy (GO:0006914)|cell death (GO:0008219)			p.?(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(21)|ovary(2)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	50						TTCTCTGCCAGGGGCTCTGTA	0.527																																																	1	Unknown(1)	lung(1)											137.0	125.0	129.0					14																	102880972		2203	4300	6503	SO:0001630	splice_region_variant	0			AB019441	CCDS32162.1, CCDS58337.1	14q32.33	2009-02-27	2009-02-27	2009-02-27		ENSG00000196663			19957	protein-coding gene	gene with protein product		615000	"""KIAA0329"""	KIAA0329		9205841	Standard	NM_014844		Approved		uc001ylw.2	O15040		ENST00000359520.7:c.481-1G>T	14.37:g.102880972G>T			A5PKY3|A6NFY9|A7E2X3|H0YMM9|Q9UEG6	Splice_Site	SNP	-	e4-1	ENST00000359520.7	37	c.481-1	CCDS32162.1	14	.	.	.	.	.	.	.	.	.	.	G	13.33	2.205430	0.39003	.	.	ENSG00000196663	ENST00000359520;ENST00000380088	.	.	.	4.89	4.89	0.63831	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.0633	0.89383	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TECPR2	101950725	1.000000	0.71417	0.998000	0.56505	0.107000	0.19398	9.349000	0.97066	2.228000	0.72767	0.561000	0.74099	.	TECPR2	-	-	ENSG00000196663		0.527	TECPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TECPR2	HGNC	protein_coding	OTTHUMT00000415056.2		0.00	62	0	G	NM_014844	Intron	102880972	+1			no_errors	ENST00000359520	ensembl	human	known	74_37	splice_site	6.82	41	3	SNP	1.000	T
TESK1	7016	genome.wustl.edu	37	9	35609251	35609251	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr9:35609251G>A	ENST00000336395.5	+	10	1643	c.1393G>A	c.(1393-1395)Gaa>Aaa	p.E465K	CD72_ENST00000490239.1_5'Flank|MIR4667_ENST00000578933.1_RNA|TESK1_ENST00000498522.1_3'UTR	NM_006285.2	NP_006276.2	Q15569	TESK1_HUMAN	testis-specific kinase 1	465					cell junction assembly (GO:0034329)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	27			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CCCCTCGGCTGAAGAGAAGAT	0.687																																																	0													41.0	47.0	45.0					9																	35609251		2203	4299	6502	SO:0001583	missense	0			D50863	CCDS6580.1	9p13	2010-04-27			ENSG00000107140	ENSG00000107140	2.7.12.1		11731	protein-coding gene	gene with protein product	"""testis-specific kinase-1"", ""testis specific kinase-1"""	601782				8537404	Standard	NM_006285		Approved		uc003zxa.3	Q15569	OTTHUMG00000019863	ENST00000336395.5:c.1393G>A	9.37:g.35609251G>A	ENSP00000338127:p.Glu465Lys		Q8IXZ8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E465K	ENST00000336395.5	37	c.1393	CCDS6580.1	9	.	.	.	.	.	.	.	.	.	.	G	12.76	2.036042	0.35893	.	.	ENSG00000107140	ENST00000336395	T	0.70516	-0.49	5.16	4.26	0.50523	.	0.000000	0.45867	D	0.000336	T	0.49253	0.1546	N	0.14661	0.345	0.22996	N	0.998454	B;B	0.21452	0.056;0.027	B;B	0.17722	0.019;0.006	T	0.25537	-1.0129	10	0.12766	T	0.61	-4.4542	10.7359	0.46124	0.0883:0.0:0.9117:0.0	.	383;465	B4DQQ3;Q15569	.;TESK1_HUMAN	K	465	ENSP00000338127:E465K	ENSP00000338127:E465K	E	+	1	0	TESK1	35599251	1.000000	0.71417	0.616000	0.29078	0.793000	0.44817	4.754000	0.62191	1.394000	0.46624	0.655000	0.94253	GAA	TESK1	-	NULL	ENSG00000107140		0.687	TESK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TESK1	HGNC	protein_coding	OTTHUMT00000052314.1	-	0.00	43	0	G	NM_006285		35609251	+1	tier1	-	no_errors	ENST00000336395	ensembl	human	known	74_37	missense	24.14	44	14	SNP	0.275	A
TLE1	7088	genome.wustl.edu	37	9	84249102	84249102	+	Missense_Mutation	SNP	C	C	T	rs143365960	byFrequency	TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr9:84249102C>T	ENST00000376499.3	-	7	1551	c.487G>A	c.(487-489)Ggc>Agc	p.G163S	TLE1_ENST00000376463.1_Missense_Mutation_p.G107S|TLE1_ENST00000376472.1_5'UTR	NM_005077.3	NP_005068.2	Q04724	TLE1_HUMAN	transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)	163	Gly/Pro-rich.				multicellular organismal development (GO:0007275)|negative regulation of anoikis (GO:2000811)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of gene expression (GO:0010628)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription factor binding (GO:0008134)			NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	29						GCAAGAAGGCCGGCACTGCCC	0.597																																					NSCLC(155;1437 1995 30668 39354 45875)|Melanoma(16;266 781 14000 47728 51870)												0								C	SER/GLY	2,4402		0,2,2200	21.0	19.0	20.0		487	4.8	1.0	9	dbSNP_134	20	3,8595		0,3,4296	yes	missense	TLE1	NM_005077.3	56	0,5,6496	TT,TC,CC		0.0349,0.0454,0.0385	benign	163/771	84249102	5,12997	2202	4299	6501	SO:0001583	missense	0				CCDS6661.1	9q21.32	2013-01-10	2001-11-28		ENSG00000196781	ENSG00000196781		"""WD repeat domain containing"""	11837	protein-coding gene	gene with protein product	"""enhancer of split groucho 1"""	600189	"""transducin-like enhancer of split 1, homolog of Drosophila E(sp1)"""			8365415, 8808280	Standard	NM_005077		Approved	ESG1, GRG1, ESG	uc004aly.3	Q04724	OTTHUMG00000021008	ENST00000376499.3:c.487G>A	9.37:g.84249102C>T	ENSP00000365682:p.Gly163Ser		A8K495|Q5T3G4|Q969V9	Missense_Mutation	SNP	pfam_Groucho/TLE_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Groucho_enhance	p.G163S	ENST00000376499.3	37	c.487	CCDS6661.1	9	.	.	.	.	.	.	.	.	.	.	C	23.5	4.425382	0.83667	4.54E-4	3.49E-4	ENSG00000196781	ENST00000376499;ENST00000355002;ENST00000418319;ENST00000376463	T;T;T	0.58940	0.51;0.91;0.3	5.7	4.76	0.60689	.	0.133963	0.51477	N	0.000090	T	0.51652	0.1687	M	0.69823	2.125	0.80722	D	1	B;B;P;B;P	0.42584	0.098;0.081;0.784;0.366;0.56	B;B;B;B;B	0.34385	0.02;0.013;0.181;0.023;0.124	T	0.54390	-0.8301	10	0.40728	T	0.16	-13.6867	10.8836	0.46953	0.0:0.9015:0.0:0.0985	.	163;173;190;173;163	B4DEF9;A6NFH2;Q59EF7;Q5T3G3;Q04724	.;.;.;.;TLE1_HUMAN	S	163;173;173;107	ENSP00000365682:G163S;ENSP00000391347:G173S;ENSP00000365646:G107S	ENSP00000347102:G173S	G	-	1	0	TLE1	83438922	1.000000	0.71417	0.989000	0.46669	0.979000	0.70002	4.672000	0.61597	1.282000	0.44496	0.655000	0.94253	GGC	TLE1	-	NULL	ENSG00000196781		0.597	TLE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLE1	HGNC	protein_coding	OTTHUMT00000055407.1	-	0.00	65	0	C	NM_005077		84249102	-1	tier1	rs143365960	no_errors	ENST00000376499	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	T
TMPO	7112	genome.wustl.edu	37	12	98927030	98927030	+	Intron	SNP	G	G	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr12:98927030G>C	ENST00000556029.1	+	3	921				TMPO_ENST00000393053.2_Intron|TMPO_ENST00000266732.4_Missense_Mutation_p.R332T|TMPO_ENST00000343315.5_Intron|TMPO_ENST00000261210.5_Intron	NM_001032283.2	NP_001027454.1	P42167	LAP2B_HUMAN	thymopoietin							cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)|lamin binding (GO:0005521)			breast(2)|endometrium(1)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						ATTTGCGGTAGAGAGAAAAGT	0.418																																																	0													49.0	53.0	52.0					12																	98927030		2203	4300	6503	SO:0001627	intron_variant	0				CCDS9064.1, CCDS31879.1, CCDS31880.1	12q22	2014-09-17			ENSG00000120802	ENSG00000120802			11875	protein-coding gene	gene with protein product	"""LEM domain containing 4"""	188380				7517549	Standard	NM_003276		Approved	TP, LAP2, LEMD4	uc001tfh.2	P42166	OTTHUMG00000170210	ENST00000556029.1:c.565+1414G>C	12.37:g.98927030G>C			A2T926|Q14861	Missense_Mutation	SNP	pfam_LAP2alpha,pfam_LEM-like_dom,pfam_LEM_dom,superfamily_LEM/LEM-like_dom,smart_LEM_dom,pfscan_LEM_dom,pfscan_LEM-like_dom	p.R332T	ENST00000556029.1	37	c.995	CCDS31879.1	12	.	.	.	.	.	.	.	.	.	.	G	4.282	0.051553	0.08291	.	.	ENSG00000120802	ENST00000266732	T	0.28069	1.63	5.32	4.42	0.53409	.	0.438446	0.23551	N	0.046967	T	0.16854	0.0405	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.04053	-1.0981	10	0.37606	T	0.19	-4.4764	12.2665	0.54681	0.0:0.1712:0.8288:0.0	.	332	P42166	LAP2A_HUMAN	T	332	ENSP00000266732:R332T	ENSP00000266732:R332T	R	+	2	0	TMPO	97451161	1.000000	0.71417	0.984000	0.44739	0.475000	0.33008	2.791000	0.47829	1.361000	0.45981	-0.181000	0.13052	AGA	TMPO	-	NULL	ENSG00000120802		0.418	TMPO-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPO	HGNC	protein_coding	OTTHUMT00000407973.2	-	0.00	50	0	G	NM_003276		98927030	+1	tier1	-	no_errors	ENST00000266732	ensembl	human	known	74_37	missense	21.88	50	14	SNP	0.998	C
TNKS2	80351	genome.wustl.edu	37	10	93609336	93609336	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr10:93609336A>G	ENST00000371627.4	+	20	3058	c.2679A>G	c.(2677-2679)atA>atG	p.I893M		NM_025235.3	NP_079511.1	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2	893	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				multicellular organism growth (GO:0035264)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein polyubiquitination (GO:0000209)|regulation of multicellular organism growth (GO:0040014)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			biliary_tract(1)|breast(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	48		Colorectal(252;0.162)				TAATGGATATATTTGAGAGAG	0.333																																																	0													105.0	101.0	102.0					10																	93609336		2203	4300	6503	SO:0001583	missense	0			AF342982	CCDS7417.1	10q23.3	2013-01-10			ENSG00000107854	ENSG00000107854		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15677	protein-coding gene	gene with protein product		607128					Standard	NM_025235		Approved	TNKL, TANK2, PARP-5b, PARP-5c, PARP5B, PARP5C, pART6	uc001khp.3	Q9H2K2	OTTHUMG00000018747	ENST00000371627.4:c.2679A>G	10.37:g.93609336A>G	ENSP00000360689:p.Ile893Met		B2RBD3|Q9H8F2|Q9HAS4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Poly(ADP-ribose)pol_cat_dom,pfam_SAM_2,pfam_SAM_type1,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SAM,pfscan_Poly(ADP-ribose)pol_cat_dom,prints_Ankyrin_rpt	p.I893M	ENST00000371627.4	37	c.2679	CCDS7417.1	10	.	.	.	.	.	.	.	.	.	.	A	16.85	3.237397	0.58886	.	.	ENSG00000107854	ENST00000371627	D	0.85013	-1.93	5.22	4.06	0.47325	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 2 (1);	0.086444	0.49916	D	0.000140	D	0.87071	0.6086	M	0.69823	2.125	0.44711	D	0.997702	P	0.48294	0.908	P	0.53062	0.717	D	0.85092	0.0952	10	0.46703	T	0.11	.	7.3501	0.26686	0.5898:0.2759:0.0:0.1344	.	893	Q9H2K2	TNKS2_HUMAN	M	893	ENSP00000360689:I893M	ENSP00000360689:I893M	I	+	3	3	TNKS2	93599316	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.034000	0.49751	0.895000	0.36342	0.477000	0.44152	ATA	TNKS2	-	pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	ENSG00000107854		0.333	TNKS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNKS2	HGNC	protein_coding	OTTHUMT00000049374.1	-	0.00	36	0	A	NM_025235		93609336	+1	tier1	-	no_errors	ENST00000371627	ensembl	human	known	74_37	missense	32.08	36	17	SNP	1.000	G
TNNT2	7139	genome.wustl.edu	37	1	201336929	201336929	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr1:201336929C>T	ENST00000509001.1	-	6	425	c.139G>A	c.(139-141)Gaa>Aaa	p.E47K	TNNT2_ENST00000367320.2_Missense_Mutation_p.E56K|TNNT2_ENST00000367322.1_Missense_Mutation_p.E47K|TNNT2_ENST00000367317.4_Missense_Mutation_p.E47K|TNNT2_ENST00000367315.2_Missense_Mutation_p.E47K|TNNT2_ENST00000360372.4_Missense_Mutation_p.E42K|TNNT2_ENST00000421663.2_Missense_Mutation_p.E49K|TNNT2_ENST00000458432.2_Missense_Mutation_p.E59K|TNNT2_ENST00000236918.7_Missense_Mutation_p.E52K|TNNT2_ENST00000367318.5_Missense_Mutation_p.E47K	NM_001276347.1	NP_001263276.1	P45379	TNNT2_HUMAN	troponin T type 2 (cardiac)	0					ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|muscle filament sliding (GO:0030049)|negative regulation of ATPase activity (GO:0032780)|positive regulation of ATPase activity (GO:0032781)|regulation of heart contraction (GO:0008016)|regulation of muscle contraction (GO:0006937)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytosol (GO:0005829)|sarcomere (GO:0030017)|striated muscle thin filament (GO:0005865)|troponin complex (GO:0005861)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|tropomyosin binding (GO:0005523)|troponin C binding (GO:0030172)|troponin I binding (GO:0031013)			breast(2)|cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(9)	20						TCTTCTTCTTCATCTTCTAAA	0.507																																																	0													260.0	261.0	261.0					1																	201336929		2203	4300	6503	SO:0001583	missense	0			X74819	CCDS30968.1, CCDS30969.1, CCDS60390.1, CCDS73002.1, CCDS73003.1	1q32	2014-09-17	2005-09-12		ENSG00000118194	ENSG00000118194			11949	protein-coding gene	gene with protein product		191045	"""troponin T2, cardiac"", ""cardiomyopathy, hypertrophic 2"", ""cardiomyopathy, dilated 1D (autosomal dominant)"""	CMH2, CMD1D		8088824, 8205619, 9482583	Standard	NM_001001430		Approved	CMPD2	uc001gwf.4	P45379	OTTHUMG00000035733	ENST00000509001.1:c.139G>A	1.37:g.201336929C>T	ENSP00000422031:p.Glu47Lys		A2TDB9|A8K3K6|O60214|Q99596|Q99597|Q9BUF6|Q9UM96	Missense_Mutation	SNP	pfam_Troponin	p.E59K	ENST00000509001.1	37	c.175	CCDS30969.1	1	.	.	.	.	.	.	.	.	.	.	C	10.12	1.262745	0.23051	.	.	ENSG00000118194	ENST00000367322;ENST00000367318;ENST00000458432;ENST00000421663;ENST00000236918;ENST00000367317;ENST00000367315;ENST00000360372;ENST00000357848;ENST00000367320;ENST00000509001;ENST00000438742;ENST00000455702;ENST00000422165;ENST00000412633	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.99660	-6.32;-6.32;-6.32;-6.32;-6.32;-6.32;-6.32;-6.32;-6.32;-6.32;-6.32;-6.32;-6.32;-6.32	3.57	3.57	0.40892	.	0.964771	0.08506	N	0.935735	D	0.97835	0.9289	N	0.19112	0.55	0.30764	N	0.743766	B;B;B;B	0.16396	0.017;0.01;0.01;0.017	B;B;B;B	0.18263	0.021;0.009;0.009;0.021	D	0.94334	0.7564	10	0.10377	T	0.69	-0.6819	15.1312	0.72527	0.0:1.0:0.0:0.0	.	56;57;47;57	P45379-3;P45379;Q9BUF6;P45379-10	.;TNNT2_HUMAN;.;.	K	47;47;59;49;52;47;47;42;43;56;47;42;57;52;46	ENSP00000356291:E47K;ENSP00000356287:E47K;ENSP00000387874:E59K;ENSP00000404134:E49K;ENSP00000236918:E52K;ENSP00000356286:E47K;ENSP00000356284:E47K;ENSP00000353535:E42K;ENSP00000356289:E56K;ENSP00000422031:E47K;ENSP00000414036:E42K;ENSP00000402238:E57K;ENSP00000395163:E52K;ENSP00000408731:E46K	ENSP00000236918:E52K	E	-	1	0	TNNT2	199603552	0.003000	0.15002	0.690000	0.30148	0.075000	0.17131	1.294000	0.33365	2.261000	0.74972	0.561000	0.74099	GAA	TNNT2	-	NULL	ENSG00000118194		0.507	TNNT2-008	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	TNNT2	HGNC	protein_coding	OTTHUMT00000360358.1	-	0.00	72	0	C	NM_000364		201336929	-1	tier1	-	no_errors	ENST00000458432	ensembl	human	known	74_37	missense	13.39	97	15	SNP	0.808	T
TNS3	64759	genome.wustl.edu	37	7	47408054	47408054	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr7:47408054G>T	ENST00000398879.1	-	17	2555	c.2189C>A	c.(2188-2190)tCt>tAt	p.S730Y	TNS3_ENST00000355730.3_Missense_Mutation_p.S490Y|TNS3_ENST00000311160.9_Missense_Mutation_p.S730Y			Q68CZ2	TENS3_HUMAN	tensin 3	730					cell migration (GO:0016477)|lung alveolus development (GO:0048286)|positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(17)|endometrium(5)|kidney(4)|large_intestine(7)|liver(1)|lung(16)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	64						TGGAGACACAGAGCCATTGGC	0.657																																																	0													82.0	95.0	91.0					7																	47408054		2034	4176	6210	SO:0001583	missense	0			AF378756	CCDS5506.2	7p12.3	2013-02-14	2005-05-13	2005-05-13	ENSG00000136205	ENSG00000136205		"""SH2 domain containing"""	21616	protein-coding gene	gene with protein product	"""tumor endothelial marker 6"""	606825	"""tensin-like SH2 domain-containing 1"""	TENS1		11559528	Standard	NM_022748		Approved	TEM6, H_NH0549I23.2, FLJ13732	uc003tnw.3	Q68CZ2	OTTHUMG00000074075	ENST00000398879.1:c.2189C>A	7.37:g.47408054G>T	ENSP00000381854:p.Ser730Tyr		B2RNV1|Q6IPQ2|Q8IZW7|Q8NAD0|Q96PE0|Q96S48	Missense_Mutation	SNP	pfam_PTB,pfam_Tensin_phosphatase_C2-dom,pfam_SH2,superfamily_C2_dom,smart_Tyr_Pase_cat,smart_SH2,smart_PTB/PI_dom,pfscan_SH2,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.S730Y	ENST00000398879.1	37	c.2189	CCDS5506.2	7	.	.	.	.	.	.	.	.	.	.	G	11.53	1.666476	0.29604	.	.	ENSG00000136205	ENST00000311160;ENST00000538633;ENST00000398879;ENST00000355730;ENST00000545849;ENST00000457718	D;D;D;D	0.94897	-3.08;-3.08;-3.55;-3.33	5.03	1.71	0.24356	.	2.760890	0.01040	N	0.004285	D	0.88698	0.6507	N	0.24115	0.695	0.09310	N	0.999998	P	0.49447	0.924	P	0.44732	0.459	T	0.79945	-0.1589	10	0.02654	T	1	-1.3555	3.6806	0.08309	0.2482:0.0:0.569:0.1828	.	730	Q68CZ2	TENS3_HUMAN	Y	730;840;730;490;186;833	ENSP00000312143:S730Y;ENSP00000381854:S730Y;ENSP00000347968:S490Y;ENSP00000414358:S833Y	ENSP00000312143:S730Y	S	-	2	0	TNS3	47374579	0.871000	0.30034	0.002000	0.10522	0.262000	0.26303	3.069000	0.50026	0.078000	0.16900	0.655000	0.94253	TCT	TNS3	-	NULL	ENSG00000136205		0.657	TNS3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	TNS3	HGNC	protein_coding	OTTHUMT00000157253.1	-	0.00	68	0	G	NM_022748		47408054	-1	tier1	-	no_errors	ENST00000311160	ensembl	human	known	74_37	missense	5.41	70	4	SNP	0.026	T
TP53	7157	genome.wustl.edu	37	17	7578179	7578179	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr17:7578179C>A	ENST00000269305.4	-	6	859	c.670G>T	c.(670-672)Gag>Tag	p.E224*	TP53_ENST00000413465.2_Nonsense_Mutation_p.E224*|TP53_ENST00000445888.2_Nonsense_Mutation_p.E224*|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Nonsense_Mutation_p.E224*|TP53_ENST00000420246.2_Nonsense_Mutation_p.E224*|TP53_ENST00000359597.4_Nonsense_Mutation_p.E224*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	224	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> V (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(13)|p.0?(8)|p.E224*(5)|p.E224K(5)|p.E224fs*4(1)|p.E224fs*5(1)|p.V218_E224delVPYEPPE(1)|p.E224fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AACCAGACCTCAGGCGGCTCA	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	35	Unknown(13)|Whole gene deletion(8)|Substitution - Nonsense(5)|Substitution - Missense(5)|Deletion - Frameshift(2)|Deletion - In frame(1)|Insertion - Frameshift(1)	biliary_tract(5)|endometrium(5)|bone(4)|stomach(3)|urinary_tract(3)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|skin(2)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)|soft_tissue(1)|large_intestine(1)|oesophagus(1)|breast(1)											82.0	77.0	79.0					17																	7578179		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.670G>T	17.37:g.7578179C>A	ENSP00000269305:p.Glu224*		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.E224*	ENST00000269305.4	37	c.670	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	31	5.081367	0.94050	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	.	.	.	5.28	3.13	0.36017	.	0.057313	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-13.9223	12.988	0.58602	0.0:0.555:0.445:0.0	.	.	.	.	X	224;224;224;224;224;224;213;131;92;131	.	ENSP00000269305:E224X	E	-	1	0	TP53	7518904	1.000000	0.71417	0.865000	0.33974	0.992000	0.81027	4.831000	0.62752	1.353000	0.45828	0.563000	0.77884	GAG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	77	0	C	NM_000546		7578179	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	nonsense	60.61	26	40	SNP	0.990	A
TPP2	7174	genome.wustl.edu	37	13	103266526	103266526	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr13:103266526G>A	ENST00000376065.4	+	3	406	c.370G>A	c.(370-372)Gca>Aca	p.A124T	TPP2_ENST00000376052.3_Missense_Mutation_p.A124T	NM_003291.2	NP_003282.2	P29144	TPP2_HUMAN	tripeptidyl peptidase II	124	Peptidase S8.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|tripeptidyl-peptidase activity (GO:0008240)			breast(2)|endometrium(5)|kidney(2)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	52	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CTATCCTAAGGCACTCAAGGA	0.368																																																	0													105.0	99.0	101.0					13																	103266526		2203	4300	6503	SO:0001583	missense	0			M55169	CCDS9502.1	13q32-q33	2008-02-05			ENSG00000134900	ENSG00000134900	3.4.14.10		12016	protein-coding gene	gene with protein product		190470				1670990	Standard	NM_003291		Approved		uc001vpi.4	P29144	OTTHUMG00000017305	ENST00000376065.4:c.370G>A	13.37:g.103266526G>A	ENSP00000365233:p.Ala124Thr		Q5VZU8	Missense_Mutation	SNP	pfam_Peptidase_S8/S53_dom,pfam_Peptidase_S8A_TPPII,superfamily_Peptidase_S8/S53_dom,prints_Peptidase_S8_subtilisin-rel	p.A124T	ENST00000376065.4	37	c.370	CCDS9502.1	13	.	.	.	.	.	.	.	.	.	.	G	21.8	4.205236	0.79127	.	.	ENSG00000134900	ENST00000376065;ENST00000376052	.	.	.	5.42	5.42	0.78866	Peptidase S8/S53, subtilisin/kexin/sedolisin (2);	0.000000	0.85682	D	0.000000	T	0.39809	0.1092	N	0.16368	0.405	0.80722	D	1	P	0.49185	0.92	B	0.42462	0.388	T	0.18681	-1.0329	9	0.14252	T	0.57	.	19.2242	0.93812	0.0:0.0:1.0:0.0	.	124	P29144	TPP2_HUMAN	T	124	.	ENSP00000365220:A124T	A	+	1	0	TPP2	102064527	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.529000	0.81952	2.553000	0.86117	0.591000	0.81541	GCA	TPP2	-	pfam_Peptidase_S8/S53_dom,superfamily_Peptidase_S8/S53_dom	ENSG00000134900		0.368	TPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPP2	HGNC	protein_coding	OTTHUMT00000045683.2	-	0.00	49	0	G			103266526	+1	tier1	-	no_errors	ENST00000376065	ensembl	human	known	74_37	missense	6.45	58	4	SNP	1.000	A
TRIML1	339976	genome.wustl.edu	37	4	189063453	189063453	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr4:189063453A>T	ENST00000332517.3	+	3	692	c.552A>T	c.(550-552)aaA>aaT	p.K184N	RP11-366H4.3_ENST00000501322.2_RNA	NM_178556.3	NP_848651.2	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1	184					multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(30)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	60		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		AATACATGAAAATGCACCAGT	0.438																																					Melanoma(31;213 1036 16579 23968 32372)												0													79.0	75.0	76.0					4																	189063453		2203	4300	6503	SO:0001583	missense	0			AK093499	CCDS3851.1	4q35.2	2013-01-09			ENSG00000184108	ENSG00000184108		"""RING-type (C3HC4) zinc fingers"""	26698	protein-coding gene	gene with protein product						12477932	Standard	NM_178556		Approved	FLJ36180, RNF209	uc003izm.1	Q8N9V2	OTTHUMG00000160237	ENST00000332517.3:c.552A>T	4.37:g.189063453A>T	ENSP00000327738:p.Lys184Asn		Q96BE5	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_RING,prints_Butyrophylin	p.K184N	ENST00000332517.3	37	c.552	CCDS3851.1	4	.	.	.	.	.	.	.	.	.	.	A	18.55	3.647669	0.67358	.	.	ENSG00000184108	ENST00000332517	T	0.09445	2.98	4.74	0.461	0.16689	.	0.000000	0.50627	D	0.000120	T	0.26085	0.0636	M	0.73430	2.235	0.30033	N	0.813317	D	0.76494	0.999	D	0.76071	0.987	T	0.04811	-1.0925	10	0.51188	T	0.08	-36.0948	7.785	0.29087	0.5882:0.0:0.4118:0.0	.	184	Q8N9V2	TRIML_HUMAN	N	184	ENSP00000327738:K184N	ENSP00000327738:K184N	K	+	3	2	TRIML1	189300447	0.068000	0.21057	0.998000	0.56505	0.962000	0.63368	-0.216000	0.09266	0.025000	0.15241	0.528000	0.53228	AAA	TRIML1	-	NULL	ENSG00000184108		0.438	TRIML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIML1	HGNC	protein_coding	OTTHUMT00000359813.1		0.00	22	0	A	NM_178556		189063453	+1			no_errors	ENST00000332517	ensembl	human	known	74_37	missense	13.21	46	7	SNP	0.997	T
TRPC4	7223	genome.wustl.edu	37	13	38266166	38266166	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr13:38266166C>A	ENST00000379705.3	-	4	2061	c.1204G>T	c.(1204-1206)Gtc>Ttc	p.V402F	TRPC4_ENST00000379679.1_Missense_Mutation_p.V229F|TRPC4_ENST00000447043.1_Missense_Mutation_p.V402F|TRPC4_ENST00000379673.2_Missense_Mutation_p.V402F|TRPC4_ENST00000355779.2_Missense_Mutation_p.V402F|TRPC4_ENST00000426868.2_Missense_Mutation_p.V402F|TRPC4_ENST00000379681.3_Missense_Mutation_p.V402F|TRPC4_ENST00000358477.2_Missense_Mutation_p.V402F|TRPC4_ENST00000338947.5_Missense_Mutation_p.V229F			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	402					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		ATCCACTCGACGATGGTTGGT	0.443																																																	0													97.0	88.0	91.0					13																	38266166		2203	4300	6503	SO:0001583	missense	0			U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.1204G>T	13.37:g.38266166C>A	ENSP00000369027:p.Val402Phe		B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_TRPC4_channel,prints_TRPC_channel,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,tigrfam_TRP_channel	p.V402F	ENST00000379705.3	37	c.1204	CCDS9365.1	13	.	.	.	.	.	.	.	.	.	.	C	28.7	4.946781	0.92593	.	.	ENSG00000133107	ENST00000379705;ENST00000379681;ENST00000338947;ENST00000379679;ENST00000426868;ENST00000355779;ENST00000358477;ENST00000379673;ENST00000447043	D;D;D;D;D;D;D;D;D	0.83591	-1.74;-1.74;-1.74;-1.74;-1.74;-1.74;-1.74;-1.74;-1.74	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.91482	0.7311	M	0.74647	2.275	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;0.999	D;D;D;D;D;D	0.87578	0.997;0.995;0.998;0.998;0.997;0.995	D	0.91431	0.5166	10	0.72032	D	0.01	-24.99	20.1931	0.98233	0.0:1.0:0.0:0.0	.	402;402;402;229;402;402	Q9UBN4-3;Q9UBN4-4;Q9UBN4-5;Q9UBN4-6;Q9UBN4-2;Q9UBN4	.;.;.;.;.;TRPC4_HUMAN	F	402;402;229;229;402;402;402;402;402	ENSP00000369027:V402F;ENSP00000369003:V402F;ENSP00000342580:V229F;ENSP00000369001:V229F;ENSP00000410133:V402F;ENSP00000348025:V402F;ENSP00000351264:V402F;ENSP00000368995:V402F;ENSP00000414316:V402F	ENSP00000342580:V229F	V	-	1	0	TRPC4	37164166	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.087000	0.71362	2.771000	0.95319	0.563000	0.77884	GTC	TRPC4	-	tigrfam_TRP_channel	ENSG00000133107		0.443	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC4	HGNC	protein_coding	OTTHUMT00000044574.2	-	0.00	48	0	C	NM_003306		38266166	-1	tier1	-	no_errors	ENST00000379681	ensembl	human	known	74_37	missense	59.38	13	19	SNP	1.000	A
TRPC5	7224	genome.wustl.edu	37	X	111155531	111155531	+	Silent	SNP	G	G	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chrX:111155531G>A	ENST00000262839.2	-	3	1806	c.888C>T	c.(886-888)taC>taT	p.Y296Y		NM_012471.2	NP_036603.1	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel, subfamily C, member 5	296					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			biliary_tract(1)|breast(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(38)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						CTTTCTGGTGGTATTTGATTG	0.478																																																	0													166.0	138.0	147.0					X																	111155531		2203	4300	6503	SO:0001819	synonymous_variant	0			AF054568	CCDS14561.1	Xq23	2014-06-13			ENSG00000072315	ENSG00000072315		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12337	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 159"""	300334				10493832, 16382100	Standard	NM_012471		Approved	PPP1R159	uc004epl.1	Q9UL62	OTTHUMG00000022212	ENST00000262839.2:c.888C>T	X.37:g.111155531G>A			B2RP53|O75233|Q5JXY8|Q9Y514	Silent	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_TRPC5_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.Y296	ENST00000262839.2	37	c.888	CCDS14561.1	X																																																																																			TRPC5	-	tigrfam_TRP_channel	ENSG00000072315		0.478	TRPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC5	HGNC	protein_coding	OTTHUMT00000057945.1	-	0.00	22	0	G	NM_012471		111155531	-1	tier1	-	no_errors	ENST00000262839	ensembl	human	known	74_37	silent	86.36	3	19	SNP	1.000	A
TRPM1	4308	genome.wustl.edu	37	15	31352747	31352747	+	Splice_Site	SNP	C	C	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr15:31352747C>A	ENST00000256552.6	-	11	1410	c.1263G>T	c.(1261-1263)ccG>ccT	p.P421P	TRPM1_ENST00000542188.1_Splice_Site_p.P438P|TRPM1_ENST00000397795.2_Splice_Site_p.P399P	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1											NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		ACAGTTTCACCGGCCAGTGGG	0.448																																																	0													47.0	51.0	50.0					15																	31352747		1930	4136	6066	SO:0001630	splice_region_variant	0			AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.1263+1G>T	15.37:g.31352747C>A				Silent	SNP	pfam_Ion_trans_dom	p.P438	ENST00000256552.6	37	c.1314	CCDS58346.1	15																																																																																			TRPM1	-	NULL	ENSG00000134160		0.448	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	TRPM1	HGNC	protein_coding	OTTHUMT00000417166.2	-	0.00	63	0	C	NM_002420	Silent	31352747	-1	tier1	-	no_errors	ENST00000542188	ensembl	human	known	74_37	silent	6.67	54	4	SNP	1.000	A
TSPAN15	23555	genome.wustl.edu	37	10	71266819	71266819	+	3'UTR	SNP	G	G	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr10:71266819G>A	ENST00000373290.2	+	0	1092					NM_012339.3	NP_036471.1	O95858	TSN15_HUMAN	tetraspanin 15						establishment of protein localization to plasma membrane (GO:0090002)|protein maturation (GO:0051604)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	enzyme binding (GO:0019899)			breast(1)|endometrium(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)	9						CAGGGCTGCGGCCCCTCTGCC	0.642																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AY358934	CCDS7294.1	10q22.1	2013-02-14	2005-03-21	2005-03-21	ENSG00000099282	ENSG00000099282		"""Tetraspanins"""	23298	protein-coding gene	gene with protein product		613140	"""transmembrane 4 superfamily member 15"""	TM4SF15		11739647, 10719184	Standard	NM_012339		Approved	NET-7	uc001jpo.1	O95858	OTTHUMG00000018381	ENST00000373290.2:c.*85G>A	10.37:g.71266819G>A			Q6UW79	RNA	SNP	-	NULL	ENST00000373290.2	37	NULL	CCDS7294.1	10																																																																																			TSPAN15	-	-	ENSG00000099282		0.642	TSPAN15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN15	HGNC	protein_coding	OTTHUMT00000048444.1	-	0.00	63	0	G	NM_012339		71266819	+1	tier1	-	no_errors	ENST00000486093	ensembl	human	known	74_37	rna	22.03	46	13	SNP	0.004	A
TTN	7273	genome.wustl.edu	37	2	179463508	179463508	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr2:179463508G>A	ENST00000591111.1	-	241	52230	c.52006C>T	c.(52006-52008)Cca>Tca	p.P17336S	TTN_ENST00000589042.1_Missense_Mutation_p.P18977S|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P16409S|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.P9912S|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P10037S|TTN_ENST00000342175.6_Missense_Mutation_p.P10104S			Q8WZ42	TITIN_HUMAN	titin	17336	Fibronectin type-III 25. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGGTCTGATGGCAGACTTGCT	0.423																																																	0													151.0	150.0	150.0					2																	179463508		1879	4090	5969	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.52006C>T	2.37:g.179463508G>A	ENSP00000465570:p.Pro17336Ser		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.P16409S	ENST00000591111.1	37	c.49225		2	.	.	.	.	.	.	.	.	.	.	G	15.30	2.791448	0.50102	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.55588	0.51;0.51;0.51;0.51	5.91	5.91	0.95273	Fibronectin, type III (2);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.71863	0.3390	L	0.60904	1.88	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.996;0.996;0.996;0.996	T	0.72134	-0.4382	9	0.87932	D	0	.	20.2885	0.98538	0.0:0.0:1.0:0.0	.	9912;10037;10104;17336	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	S	16409;9912;10104;10037;9910	ENSP00000343764:P16409S;ENSP00000434586:P9912S;ENSP00000340554:P10104S;ENSP00000352154:P10037S	ENSP00000340554:P10104S	P	-	1	0	TTN	179171753	1.000000	0.71417	0.996000	0.52242	0.841000	0.47740	6.609000	0.74173	2.791000	0.96007	0.650000	0.86243	CCA	TTN	-	superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,pfscan_Fibronectin_type3	ENSG00000155657		0.423	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1		0.00	24	0	G	NM_133378		179463508	-1			no_errors	ENST00000342992	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	A
TXN2	25828	genome.wustl.edu	37	22	36877656	36877656	+	5'UTR	SNP	C	C	G			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr22:36877656C>G	ENST00000216185.2	-	0	421				TXN2_ENST00000403313.1_5'Flank|TXN2_ENST00000416967.1_5'UTR|TXN2_ENST00000487725.1_5'UTR			Q99757	THIOM_HUMAN	thioredoxin 2						cell redox homeostasis (GO:0045454)|cellular response to nutrient levels (GO:0031669)|glycerol ether metabolic process (GO:0006662)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to glucose (GO:0009749)|response to hormone (GO:0009725)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|response to organic cyclic compound (GO:0014070)|response to oxidative stress (GO:0006979)	dendrite (GO:0030425)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)	protein disulfide oxidoreductase activity (GO:0015035)			breast(1)|lung(1)|prostate(1)	3						GCCCTCCCTGCCTGTCAAGGG	0.637																																																	0																																										SO:0001623	5_prime_UTR_variant	0			U78678	CCDS13928.1	22q13.1	2008-06-11			ENSG00000100348	ENSG00000100348			17772	protein-coding gene	gene with protein product		609063				9006939, 17220299	Standard	NM_012473		Approved	MT-TRX	uc003apk.1	Q99757	OTTHUMG00000150596	ENST00000216185.2:c.-46G>C	22.37:g.36877656C>G			Q5JZA0|Q6FH60|Q9UH29	RNA	SNP	-	NULL	ENST00000216185.2	37	NULL	CCDS13928.1	22																																																																																			TXN2	-	-	ENSG00000100348		0.637	TXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TXN2	HGNC	protein_coding	OTTHUMT00000319016.1	-	0.00	187	0	C	NM_012473		36877656	-1	tier1	-	no_errors	ENST00000487725	ensembl	human	known	74_37	rna	42.31	120	88	SNP	0.997	G
UGT2B4	7363	genome.wustl.edu	37	4	70351133	70351133	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr4:70351133G>T	ENST00000305107.6	-	5	1149	c.1103C>A	c.(1102-1104)aCc>aAc	p.T368N	UGT2B4_ENST00000506580.1_Intron|UGT2B4_ENST00000512583.1_Intron|UGT2B4_ENST00000381096.3_Missense_Mutation_p.T232N	NM_021139.2	NP_066962.2	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B4	368					cellular glucuronidation (GO:0052695)|estrogen catabolic process (GO:0006711)|metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(29)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	47					Canagliflozin(DB08907)|Codeine(DB00318)|Dapagliflozin(DB06292)|Flurbiprofen(DB00712)|Ibuprofen(DB01050)|Morphine(DB00295)	AAAAGCTCTGGTTTTTGGGTG	0.403																																																	0													104.0	109.0	107.0					4																	70351133		2203	4297	6500	SO:0001583	missense	0			BC026264	CCDS43234.1, CCDS75137.1	4q13	2008-02-05	2005-07-20			ENSG00000156096		"""UDP glucuronosyltransferases"""	12553	protein-coding gene	gene with protein product		600067	"""UDP glycosyltransferase 2 family, polypeptide B4"""			3109396, 7835904	Standard	NM_021139		Approved	UGT2B11	uc003hek.4	P06133		ENST00000305107.6:c.1103C>A	4.37:g.70351133G>T	ENSP00000305221:p.Thr368Asn		A6NCP7|B4DT75|G5E9X8|O60731|O60867|O75614|P36538|Q1HBF9|Q6QQX7	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.T368N	ENST00000305107.6	37	c.1103	CCDS43234.1	4	.	.	.	.	.	.	.	.	.	.	G	12.16	1.854028	0.32791	.	.	ENSG00000156096	ENST00000305107;ENST00000381096	T;T	0.64618	-0.11;3.07	1.96	1.07	0.20283	.	0.072167	0.53938	U	0.000054	D	0.82346	0.5017	H	0.96943	3.91	0.28944	N	0.890806	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	T	0.74996	-0.3473	10	0.66056	D	0.02	.	7.5777	0.27946	0.0:0.0:0.7439:0.2561	.	232;368	A6NCP7;P06133	.;UD2B4_HUMAN	N	368;232	ENSP00000305221:T368N;ENSP00000370486:T232N	ENSP00000305221:T368N	T	-	2	0	UGT2B4	70385722	1.000000	0.71417	0.993000	0.49108	0.154000	0.21943	6.829000	0.75314	0.382000	0.24878	0.305000	0.20034	ACC	UGT2B4	-	pfam_UDP_glucos_trans	ENSG00000156096		0.403	UGT2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2B4	HGNC	protein_coding	OTTHUMT00000365526.1	-	0.00	155	0	G	NM_021139		70351133	-1	tier1	-	no_errors	ENST00000305107	ensembl	human	known	74_37	missense	6.75	152	11	SNP	1.000	T
UTP14A	10813	genome.wustl.edu	37	X	129055622	129055622	+	Intron	DEL	A	A	-	rs3841681|rs397841716		TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chrX:129055622delA	ENST00000394422.3	+	11	1376				UTP14A_ENST00000498179.1_3'UTR|RP4-537K23.4_ENST00000432062.1_RNA|UTP14A_ENST00000425117.2_Intron|UTP14A_ENST00000371042.3_Intron|UTP14A_ENST00000371051.5_Intron	NM_006649.3	NP_006640.2	Q9BVJ6	UT14A_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)						rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(16)|ovary(3)|urinary_tract(1)	32						ACTATGGGAGAAAAAAAAAAT	0.463													|||unknown(HR)	516	0.136689	0.0303	0.0706	3775	,	,		14570	0.2113		0.0835	False		,,,				2504	0.1329																0																																										SO:0001627	intron_variant	0			AF039694	CCDS14615.1, CCDS55489.1	Xq26.1	2009-01-15	2004-06-01	2004-06-01	ENSG00000156697	ENSG00000156697			10665	protein-coding gene	gene with protein product		300508	"""serologically defined colon cancer antigen 16"""	SDCCAG16		9610721, 16354793	Standard	NM_006649		Approved	NY-CO-16	uc004euz.3	Q9BVJ6	OTTHUMG00000022378	ENST00000394422.3:c.1348+59A>-	X.37:g.129055622delA			A8K7A3|A8MVQ1|B4DQ08|E9PEL7|Q5JYF1	RNA	DEL	-	NULL	ENST00000394422.3	37	NULL	CCDS14615.1	X																																																																																			UTP14A	-	-	ENSG00000156697		0.463	UTP14A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UTP14A	HGNC	protein_coding	OTTHUMT00000058221.1		0.00	21	0	A	NM_006649		129055622	+1	tier1		no_errors	ENST00000498179	ensembl	human	known	74_37	rna	27.78	13	5	DEL	0.001	-
VN1R2	317701	genome.wustl.edu	37	19	53761868	53761868	+	Silent	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr19:53761868C>T	ENST00000341702.3	+	1	324	c.240C>T	c.(238-240)caC>caT	p.H80H		NM_173856.2	NP_776255.2	Q8NFZ6	VN1R2_HUMAN	vomeronasal 1 receptor 2	80					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(134;0.00301)		tctctgcacacggagagaaac	0.458																																																	0													40.0	40.0	40.0					19																	53761868		2191	4286	6477	SO:0001819	synonymous_variant	0			AF370359	CCDS12862.1	19q13.42	2012-08-22			ENSG00000196131	ENSG00000196131		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	19872	protein-coding gene	gene with protein product						12123587	Standard	NM_173856		Approved	V1RL2	uc002qbi.2	Q8NFZ6		ENST00000341702.3:c.240C>T	19.37:g.53761868C>T			A1L411|Q8TDU4	Silent	SNP	pfam_Vmron_rcpt_1,pfam_GPCR_Rhodpsn,pfam_TAS2_rcpt,pfscan_GPCR_Rhodpsn_7TM,prints_Vmron_rcpt_1	p.H80	ENST00000341702.3	37	c.240	CCDS12862.1	19																																																																																			VN1R2	-	NULL	ENSG00000196131		0.458	VN1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VN1R2	HGNC	protein_coding	OTTHUMT00000464285.1		0.00	46	0	C	NM_173856		53761868	+1			no_errors	ENST00000341702	ensembl	human	known	74_37	silent	5.19	73	4	SNP	0.038	T
VRK2	7444	genome.wustl.edu	37	2	58276079	58276079	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr2:58276079G>A	ENST00000435505.2	+	5	858	c.113G>A	c.(112-114)gGa>gAa	p.G38E	VRK2_ENST00000412104.2_Missense_Mutation_p.G38E|VRK2_ENST00000417641.2_Missense_Mutation_p.G38E|VRK2_ENST00000440705.2_Missense_Mutation_p.G15E|VRK2_ENST00000340157.4_Missense_Mutation_p.G38E			Q86Y07	VRK2_HUMAN	vaccinia related kinase 2	38	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to oxidative stress (GO:0034599)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interleukin-1-mediated signaling pathway (GO:2000659)|regulation of MAPK cascade (GO:0043408)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)	24						ATTGGCTCTGGAGGATTTGGA	0.343																																																	0													115.0	126.0	122.0					2																	58276079		2203	4300	6503	SO:0001583	missense	0			AK058199	CCDS1859.1, CCDS46291.1, CCDS46292.1	2p16.1	2008-05-15			ENSG00000028116	ENSG00000028116			12719	protein-coding gene	gene with protein product		602169					Standard	NM_001130480		Approved		uc002rzv.3	Q86Y07	OTTHUMG00000129348	ENST00000435505.2:c.113G>A	2.37:g.58276079G>A	ENSP00000408002:p.Gly38Glu		B4DKL0|D6W5D4|D6W5D6|Q49AK9|Q53EU9|Q53S39|Q53S77|Q53TU1|Q86Y08|Q86Y09|Q86Y10|Q86Y11|Q86Y12|Q8IXI5|Q99987	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	p.G38E	ENST00000435505.2	37	c.113	CCDS1859.1	2	.	.	.	.	.	.	.	.	.	.	G	24.8	4.566973	0.86439	.	.	ENSG00000028116	ENST00000435505;ENST00000417641;ENST00000423109;ENST00000412104;ENST00000340157;ENST00000394539;ENST00000440705;ENST00000428021	D;D;D;D;D;T	0.96334	-3.98;-3.98;-3.98;-3.98;-3.98;0.94	5.96	5.96	0.96718	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.99032	0.9669	H	0.98388	4.22	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.996	D	0.99160	1.0861	10	0.87932	D	0	-24.2392	18.5813	0.91172	0.0:0.0:1.0:0.0	.	38;38;38	Q86Y07-2;Q86Y07-5;Q86Y07	.;.;VRK2_HUMAN	E	38;38;38;38;38;38;15;43	ENSP00000408002:G38E;ENSP00000402375:G38E;ENSP00000404156:G38E;ENSP00000342381:G38E;ENSP00000398323:G15E;ENSP00000404961:G43E	ENSP00000342381:G38E	G	+	2	0	VRK2	58129583	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.370000	0.73114	2.826000	0.97356	0.655000	0.94253	GGA	VRK2	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	ENSG00000028116		0.343	VRK2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VRK2	HGNC	protein_coding	OTTHUMT00000325304.2	-	0.00	71	0	G	NM_006296		58276079	+1	tier1	-	no_errors	ENST00000340157	ensembl	human	known	74_37	missense	43.31	72	55	SNP	1.000	A
VWA2	340706	genome.wustl.edu	37	10	116048824	116048824	+	Silent	SNP	C	C	T	rs199884277		TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr10:116048824C>T	ENST00000392982.3	+	12	1948	c.1698C>T	c.(1696-1698)gaC>gaT	p.D566D	VWA2_ENST00000603594.1_Silent_p.D566D			Q5GFL6	VWA2_HUMAN	von Willebrand factor A domain containing 2	566	VWFA 3. {ECO:0000255|PROSITE- ProRule:PRU00219}.				calcium-independent cell-matrix adhesion (GO:0007161)|protein homooligomerization (GO:0051260)|regulation of insulin receptor signaling pathway (GO:0046626)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)	26				Epithelial(162;0.036)|all cancers(201;0.0793)		TGAACCCTGACGTGACACAGG	0.592																																																	0								C		1,4405	2.1+/-5.4	0,1,2202	72.0	66.0	68.0		1698	-7.7	0.3	10		68	0,8600		0,0,4300	no	coding-synonymous	VWA2	NM_198496.1		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		566/726	116048824	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AK127756	CCDS7589.1, CCDS7589.2	10q25.3	2009-11-06			ENSG00000165816	ENSG00000165816			24709	protein-coding gene	gene with protein product						15580307, 14506275	Standard	NM_001272046		Approved	FLJ45857, FLJ16213, CCSP-2, AMACO, NET42	uc001lbl.2	Q5GFL6	OTTHUMG00000019082	ENST00000392982.3:c.1698C>T	10.37:g.116048824C>T			A1A5D4|B5MDJ8|Q6ZS39|Q6ZWJ7|Q708C5|Q70UZ8	Silent	SNP	pfam_VWF_A,pfam_EG-like_dom,pfam_EGF_extracell,smart_VWF_A,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_VWF_A	p.D566	ENST00000392982.3	37	c.1698		10																																																																																			VWA2	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000165816		0.592	VWA2-001	KNOWN	basic|appris_principal	protein_coding	VWA2	HGNC	protein_coding	OTTHUMT00000050456.3	-	0.00	45	0	C	NM_198496		116048824	+1	tier1	rs199884277	no_errors	ENST00000392982	ensembl	human	known	74_37	silent	10.00	44	5	SNP	0.363	T
WDR45B	56270	genome.wustl.edu	37	17	80579621	80579621	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr17:80579621G>T	ENST00000392325.4	-	6	676	c.482C>A	c.(481-483)aCg>aAg	p.T161K	WDR45B_ENST00000571835.1_5'UTR	NM_019613.3	NP_062559.2	Q5MNZ6	WIPI3_HUMAN	WD repeat domain 45B	161								p.T161M(1)									GCCCGTGTGCGTGCCCGGAAA	0.572																																																	1	Substitution - Missense(1)	central_nervous_system(1)											57.0	48.0	51.0					17																	80579621		2203	4300	6503	SO:0001583	missense	0			AF091083	CCDS11815.2	17q25.3	2013-01-11	2013-01-11	2013-01-11	ENSG00000141580	ENSG00000141580		"""WD repeat domain containing"""	25072	protein-coding gene	gene with protein product		609226	"""WDR45-like"""	WDR45L		12477932	Standard	NM_019613		Approved	WIPI3	uc002kfq.3	Q5MNZ6	OTTHUMG00000150146	ENST00000392325.4:c.482C>A	17.37:g.80579621G>T	ENSP00000376139:p.Thr161Lys		O95328|Q2MCP6|Q6IBN2	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	p.T161K	ENST00000392325.4	37	c.482	CCDS11815.2	17	.	.	.	.	.	.	.	.	.	.	G	13.19	2.162030	0.38217	.	.	ENSG00000141580	ENST00000392325;ENST00000539012	T	0.56941	0.43	4.82	2.66	0.31614	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.152191	0.64402	D	0.000012	T	0.26195	0.0639	N	0.04508	-0.205	0.54753	D	0.999986	B	0.13594	0.008	B	0.09377	0.004	T	0.04946	-1.0916	10	0.20519	T	0.43	-10.4067	9.9339	0.41539	0.0771:0.1389:0.784:0.0	.	161	Q5MNZ6	WIPI3_HUMAN	K	161;133	ENSP00000376139:T161K	ENSP00000376139:T161K	T	-	2	0	WDR45L	78172910	1.000000	0.71417	0.966000	0.40874	0.944000	0.59088	6.145000	0.71769	1.162000	0.42619	0.563000	0.77884	ACG	WDR45B	-	superfamily_WD40_repeat_dom	ENSG00000141580		0.572	WDR45B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR45B	HGNC	protein_coding	OTTHUMT00000316536.1		0.00	57	0	G	NM_019613		80579621	-1			no_errors	ENST00000392325	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.997	T
WHAMMP3	339005	genome.wustl.edu	37	15	23201597	23201597	+	RNA	SNP	C	C	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr15:23201597C>A	ENST00000400153.2	-	0	855					NR_003521.1		Q1A5X7	WHAL1_HUMAN	WAS protein homolog associated with actin, golgi membranes and microtubules pseudogene 3																		TTCTCCAGGGCAACTACCCTT	0.418																																																	0																																												0			BC048987		15q11.2	2014-03-20	2011-06-24	2011-06-24	ENSG00000187667	ENSG00000276141			27892	pseudogene	pseudogene			"""WAS protein homology region 2 domain containing 1-like 1"", ""WAS protein homolog associated with actin, golgi membranes and microtubules-like 1"", ""WAS protein homolog associated with actin, golgi membranes and microtubules-like 1 (pseudogene)"""	WHDC1L1, WHAMML1		18226259	Standard	NR_003521		Approved		uc001yvg.3	Q1A5X7	OTTHUMG00000171921		15.37:g.23201597C>A			Q1A5X8|Q52M16|Q52M18	RNA	SNP	-	NULL	ENST00000400153.2	37	NULL		15																																																																																			WHAMMP3	-	-	ENSG00000187667		0.418	WHAMMP3-001	KNOWN	basic	processed_transcript	WHAMMP3	HGNC	pseudogene	OTTHUMT00000415907.1	-	0.00	44	0	C	NR_003521		23201597	-1	tier1	-	no_errors	ENST00000400153	ensembl	human	known	74_37	rna	38.30	29	18	SNP	1.000	A
YIPF2	78992	genome.wustl.edu	37	19	11034281	11034281	+	Missense_Mutation	SNP	C	C	T	rs372686960		TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr19:11034281C>T	ENST00000586748.1	-	8	896	c.724G>A	c.(724-726)Ggg>Agg	p.G242R	YIPF2_ENST00000590329.1_Missense_Mutation_p.G203R|YIPF2_ENST00000253031.2_Missense_Mutation_p.G242R			Q9BWQ6	YIPF2_HUMAN	Yip1 domain family, member 2	242						integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)				cervix(1)|endometrium(1)|lung(3)|ovary(2)	7						AATACCAGCCCGGCGGCTGAC	0.682													C|||	1	0.000199681	0.0	0.0	5008	,	,		15279	0.0		0.0	False		,,,				2504	0.001																0								C	ARG/GLY	0,4406		0,0,2203	28.0	33.0	31.0		724	-0.2	0.2	19		31	2,8594	2.2+/-6.3	0,2,4296	no	missense	YIPF2	NM_024029.3	125	0,2,6499	TT,TC,CC		0.0233,0.0,0.0154	possibly-damaging	242/317	11034281	2,13000	2203	4298	6501	SO:0001583	missense	0			BC013014	CCDS12251.1	19p13.2	2008-02-05				ENSG00000130733		"""Yip1 domain family"""	28476	protein-coding gene	gene with protein product						12477932	Standard	NM_024029		Approved	MGC3262, FinGER2	uc002mqc.3	Q9BWQ6		ENST00000586748.1:c.724G>A	19.37:g.11034281C>T	ENSP00000466055:p.Gly242Arg			Missense_Mutation	SNP	pfam_Yip1	p.G242R	ENST00000586748.1	37	c.724	CCDS12251.1	19	.	.	.	.	.	.	.	.	.	.	C	13.98	2.397488	0.42512	0.0	2.33E-4	ENSG00000130733	ENST00000253031	T	0.48201	0.82	4.56	-0.191	0.13252	Yip1 domain (1);	0.252598	0.38217	N	0.001778	T	0.37972	0.1023	N	0.22421	0.69	0.35759	D	0.820045	D	0.61080	0.989	P	0.53593	0.73	T	0.45293	-0.9271	10	0.59425	D	0.04	-10.0674	5.5526	0.17099	0.138:0.6193:0.0:0.2427	.	242	Q9BWQ6	YIPF2_HUMAN	R	242	ENSP00000253031:G242R	ENSP00000253031:G242R	G	-	1	0	YIPF2	10895281	0.968000	0.33430	0.234000	0.24042	0.005000	0.04900	2.328000	0.43867	0.159000	0.19401	0.563000	0.77884	GGG	YIPF2	-	pfam_Yip1	ENSG00000130733		0.682	YIPF2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	YIPF2	HGNC	protein_coding	OTTHUMT00000453045.1	-	0.00	79	0	C	NM_024029		11034281	-1	tier1	-	no_errors	ENST00000253031	ensembl	human	known	74_37	missense	11.11	64	8	SNP	0.849	T
ZBTB39	9880	genome.wustl.edu	37	12	57397269	57397269	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr12:57397269T>C	ENST00000300101.2	-	2	1518	c.1433A>G	c.(1432-1434)aAg>aGg	p.K478R		NM_014830.2	NP_055645.1	O15060	ZBT39_HUMAN	zinc finger and BTB domain containing 39	478					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|liver(1)|lung(3)|prostate(1)	16						GGCCTGGCCCTTCAAGTTTAG	0.572																																																	0													56.0	52.0	53.0					12																	57397269		2203	4300	6503	SO:0001583	missense	0			AB002350	CCDS31839.1	12q13.3	2013-01-09				ENSG00000166860		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	29014	protein-coding gene	gene with protein product						9205841	Standard	NM_014830		Approved	KIAA0352, ZNF922	uc001sml.2	O15060		ENST00000300101.2:c.1433A>G	12.37:g.57397269T>C	ENSP00000300101:p.Lys478Arg		A7MD38|Q9UD98	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.K478R	ENST00000300101.2	37	c.1433	CCDS31839.1	12	.	.	.	.	.	.	.	.	.	.	T	14.25	2.479991	0.44044	.	.	ENSG00000166860	ENST00000300101	T	0.18810	2.19	5.7	4.49	0.54785	.	0.194731	0.44097	D	0.000492	T	0.15349	0.0370	L	0.28458	0.855	0.34610	D	0.717466	B	0.26483	0.15	B	0.19946	0.027	T	0.14839	-1.0458	10	0.62326	D	0.03	-22.4486	10.691	0.45870	0.0:0.0:0.16:0.84	.	478	O15060	ZBT39_HUMAN	R	478	ENSP00000300101:K478R	ENSP00000300101:K478R	K	-	2	0	ZBTB39	55683536	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	3.743000	0.55104	2.179000	0.69175	0.533000	0.62120	AAG	ZBTB39	-	NULL	ENSG00000166860		0.572	ZBTB39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB39	HGNC	protein_coding	OTTHUMT00000411214.1	-	0.00	52	0	T	NM_014830		57397269	-1	tier1	-	no_errors	ENST00000300101	ensembl	human	known	74_37	missense	36.36	28	16	SNP	1.000	C
ZIC4	84107	genome.wustl.edu	37	3	147120593	147120593	+	5'UTR	SNP	T	T	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr3:147120593T>C	ENST00000383075.3	-	0	504				ZIC4_ENST00000491672.1_5'UTR|ZIC4_ENST00000525172.2_Missense_Mutation_p.S48G|ZIC4_ENST00000484399.1_5'UTR|ZIC4_ENST00000473123.1_5'UTR|ZIC4_ENST00000425731.3_Missense_Mutation_p.S36G	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4							nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						ATTTTCTGACTTTGAGCCTGT	0.383																																																	0													139.0	127.0	131.0					3																	147120593		1891	4108	5999	SO:0001623	5_prime_UTR_variant	0			AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.-9A>G	3.37:g.147120593T>C			A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S48G	ENST00000383075.3	37	c.142	CCDS43160.1	3	.	.	.	.	.	.	.	.	.	.	T	15.63	2.891362	0.52014	.	.	ENSG00000174963	ENST00000425731;ENST00000525172	T;T	0.12039	2.8;2.72	6.06	2.09	0.27110	.	.	.	.	.	T	0.07683	0.0193	N	0.14661	0.345	0.80722	D	1	B	0.12630	0.006	B	0.15870	0.014	T	0.26258	-1.0108	9	0.39692	T	0.17	.	7.8513	0.29457	0.0:0.067:0.2584:0.6746	.	48	B7Z2L2	.	G	36;48	ENSP00000397695:S36G;ENSP00000435509:S48G	ENSP00000397695:S36G	S	-	1	0	ZIC4	148603283	1.000000	0.71417	0.972000	0.41901	0.996000	0.88848	1.253000	0.32886	0.106000	0.17784	0.533000	0.62120	AGT	ZIC4	-	NULL	ENSG00000174963		0.383	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIC4	HGNC	protein_coding	OTTHUMT00000355504.1	-	0.00	79	0	T			147120593	-1	tier1	-	no_errors	ENST00000525172	ensembl	human	known	74_37	missense	5.92	159	10	SNP	0.997	C
ZNF100	163227	genome.wustl.edu	37	19	21909627	21909627	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr19:21909627C>T	ENST00000358296.6	-	5	1685	c.1487G>A	c.(1486-1488)cGa>cAa	p.R496Q	ZNF100_ENST00000305570.6_Missense_Mutation_p.R432Q	NM_173531.3	NP_775802.2	Q8IYN0	ZN100_HUMAN	zinc finger protein 100	496					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(11)|skin(1)|upper_aerodigestive_tract(1)	21						GGTTGAGGATCGGTTAAAAGC	0.398																																																	0													64.0	70.0	68.0					19																	21909627		2201	4298	6499	SO:0001583	missense	0			BC035579	CCDS42538.1	19p13.1	2013-01-08	2003-12-19		ENSG00000197020	ENSG00000197020		"""Zinc fingers, C2H2-type"", ""-"""	12880	protein-coding gene	gene with protein product		603982	"""zinc finger protein 100 (Y1)"""			12477932	Standard	NM_173531		Approved		uc002nqi.3	Q8IYN0		ENST00000358296.6:c.1487G>A	19.37:g.21909627C>T	ENSP00000351042:p.Arg496Gln		Q7M4M0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R496Q	ENST00000358296.6	37	c.1487	CCDS42538.1	19	.	.	.	.	.	.	.	.	.	.	.	0.005	-2.151095	0.00328	.	.	ENSG00000197020	ENST00000358296	T	0.35973	1.28	0.867	0.867	0.19085	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.19005	0.0456	L	0.35542	1.07	0.09310	N	1	B;B	0.18166	0.002;0.026	B;B	0.09377	0.001;0.004	T	0.30909	-0.9962	9	0.06365	T	0.9	.	3.5994	0.08019	0.0:0.4879:0.0:0.5121	.	496;550	Q8IYN0;Q4G131	ZN100_HUMAN;.	Q	496	ENSP00000351042:R496Q	ENSP00000351042:R496Q	R	-	2	0	ZNF100	21701467	0.000000	0.05858	0.212000	0.23672	0.213000	0.24496	-5.615000	0.00109	0.284000	0.22305	0.289000	0.19496	CGA	ZNF100	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197020		0.398	ZNF100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF100	HGNC	protein_coding	OTTHUMT00000464087.1	-	0.00	63	0	C	NM_173531		21909627	-1	tier1	-	no_errors	ENST00000358296	ensembl	human	known	74_37	missense	6.82	82	6	SNP	0.001	T
ZNF37A	7587	genome.wustl.edu	37	10	38406851	38406851	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr10:38406851C>A	ENST00000361085.5	+	7	1117	c.772C>A	c.(772-774)Ctt>Att	p.L258I	ZNF37A_ENST00000351773.3_Missense_Mutation_p.L258I	NM_001178101.1|NM_003421.2	NP_001171572.1|NP_003412.1	P17032	ZN37A_HUMAN	zinc finger protein 37A	258					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(13)|prostate(1)	28						AAAATTAGTCCTTCATTTACA	0.363																																																	0													62.0	66.0	64.0					10																	38406851		2203	4299	6502	SO:0001583	missense	0			X69115	CCDS31183.1	10p11.2	2013-01-08	2006-05-11		ENSG00000075407	ENSG00000075407		"""Zinc fingers, C2H2-type"", ""-"""	13102	protein-coding gene	gene with protein product			"""zinc finger protein 37a (KOX 21)"""			2014798, 8464732	Standard	NM_001178101		Approved	KOX21, ZNF37	uc001izl.3	P17032	OTTHUMG00000017990	ENST00000361085.5:c.772C>A	10.37:g.38406851C>A	ENSP00000354377:p.Leu258Ile		B3KRQ3|D3DRZ3|Q96B88	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L258I	ENST00000361085.5	37	c.772	CCDS31183.1	10	.	.	.	.	.	.	.	.	.	.	C	1.895	-0.454432	0.04540	.	.	ENSG00000075407	ENST00000351773;ENST00000361085	T;T	0.17691	2.26;2.26	2.01	-0.225	0.13111	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.23532	0.0569	M	0.90650	3.135	0.09310	N	1	B	0.13145	0.007	B	0.20955	0.032	T	0.41484	-0.9506	9	0.72032	D	0.01	.	2.702	0.05152	0.2675:0.5145:0.0:0.2179	.	258	P17032	ZN37A_HUMAN	I	258	ENSP00000329141:L258I;ENSP00000354377:L258I	ENSP00000329141:L258I	L	+	1	0	ZNF37A	38446857	0.003000	0.15002	0.001000	0.08648	0.015000	0.08874	-0.046000	0.11983	-0.058000	0.13177	-0.282000	0.10007	CTT	ZNF37A	-	pfscan_Znf_C2H2	ENSG00000075407		0.363	ZNF37A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF37A	HGNC	protein_coding	OTTHUMT00000047624.2	-	0.00	66	0	C	NM_003421		38406851	+1	tier1	-	no_errors	ENST00000351773	ensembl	human	known	74_37	missense	5.97	63	4	SNP	0.002	A
ZNF433	163059	genome.wustl.edu	37	19	12127157	12127157	+	Silent	SNP	G	G	A	rs374806336	byFrequency	TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr19:12127157G>A	ENST00000344980.6	-	4	695	c.525C>T	c.(523-525)tgC>tgT	p.C175C	CTD-2006C1.2_ENST00000406892.2_RNA|CTD-2006C1.2_ENST00000495324.1_RNA|CTD-2006C1.2_ENST00000476474.1_RNA|ZNF433_ENST00000419886.2_Silent_p.C140C	NM_001080411.1	NP_001073880.1	Q8N7K0	ZN433_HUMAN	zinc finger protein 433	175					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(1)|prostate(1)|skin(1)	14						ATGTTTTTCCGCATTCCTCAC	0.378													G|||	2	0.000399361	0.0	0.0029	5008	,	,		22464	0.0		0.0	False		,,,				2504	0.0																0								G		2,4302		0,2,2150	111.0	117.0	115.0		525	0.1	0.1	19		115	1,8539		0,1,4269	no	coding-synonymous	ZNF433	NM_001080411.1		0,3,6419	AA,AG,GG		0.0117,0.0465,0.0234		175/674	12127157	3,12841	2152	4270	6422	SO:0001819	synonymous_variant	0			AK098300	CCDS45983.1	19p13.13	2013-01-08			ENSG00000197647	ENSG00000197647		"""Zinc fingers, C2H2-type"", ""-"""	20811	protein-coding gene	gene with protein product							Standard	NM_001080411		Approved	FLJ40981	uc002msy.1	Q8N7K0	OTTHUMG00000156427	ENST00000344980.6:c.525C>T	19.37:g.12127157G>A			Q86VX3	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C175	ENST00000344980.6	37	c.525	CCDS45983.1	19																																																																																			ZNF433	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197647		0.378	ZNF433-005	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF433	HGNC	protein_coding	OTTHUMT00000403716.1	-	0.00	67	0	G	NM_152602		12127157	-1	tier1	-	no_errors	ENST00000344980	ensembl	human	known	74_37	silent	28.12	46	18	SNP	1.000	A
ZNF496	84838	genome.wustl.edu	37	1	247464330	247464330	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr1:247464330C>T	ENST00000294753.4	-	9	1719	c.1255G>A	c.(1255-1257)Gtc>Atc	p.V419I	ZNF496_ENST00000462139.1_5'UTR|ZNF496_ENST00000366498.2_Missense_Mutation_p.V455I	NM_032752.1	NP_116141.1	Q96IT1	ZN496_HUMAN	zinc finger protein 496	419					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear body (GO:0016604)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	36	all_cancers(71;0.000136)|all_epithelial(71;2.62e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)		OV - Ovarian serous cystadenocarcinoma(106;0.00703)			ATGAAGTTGACCCTCCAGCGG	0.652																																																	0													58.0	57.0	58.0					1																	247464330		2203	4300	6503	SO:0001583	missense	0			BC007263	CCDS1631.1	1q44	2013-01-09			ENSG00000162714	ENSG00000162714		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23713	protein-coding gene	gene with protein product		613911				12477932	Standard	NM_032752		Approved	ZKSCAN17, MGC15548, ZSCAN49	uc001ico.3	Q96IT1	OTTHUMG00000041164	ENST00000294753.4:c.1255G>A	1.37:g.247464330C>T	ENSP00000294753:p.Val419Ile		Q8TBS2	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.V455I	ENST00000294753.4	37	c.1363	CCDS1631.1	1	.	.	.	.	.	.	.	.	.	.	C	16.20	3.056502	0.55325	.	.	ENSG00000162714	ENST00000294753;ENST00000366498	T;T	0.51325	0.71;0.71	4.36	4.36	0.52297	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.281561	0.25456	N	0.030550	T	0.40322	0.1112	N	0.13272	0.32	0.23975	N	0.996299	D;P	0.57571	0.98;0.911	P;P	0.53035	0.716;0.589	T	0.22034	-1.0228	10	0.56958	D	0.05	-35.9857	9.9277	0.41503	0.203:0.797:0.0:0.0	.	455;419	Q96IT1-2;Q96IT1	.;ZN496_HUMAN	I	419;455	ENSP00000294753:V419I;ENSP00000355454:V455I	ENSP00000294753:V419I	V	-	1	0	ZNF496	245530953	0.000000	0.05858	0.987000	0.45799	0.977000	0.68977	0.269000	0.18589	2.410000	0.81850	0.655000	0.94253	GTC	ZNF496	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000162714		0.652	ZNF496-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF496	HGNC	protein_coding	OTTHUMT00000098655.2	-	0.00	61	0	C	NM_032752		247464330	-1	tier1	-	no_errors	ENST00000366498	ensembl	human	known	74_37	missense	6.67	56	4	SNP	0.907	T
ZNF563	147837	genome.wustl.edu	37	19	12430312	12430312	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr19:12430312T>A	ENST00000293725.5	-	4	732	c.527A>T	c.(526-528)aAa>aTa	p.K176I	ZNF563_ENST00000595977.1_Missense_Mutation_p.K176I	NM_145276.2	NP_660319.1	Q8TA94	ZN563_HUMAN	zinc finger protein 563	176					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20						ACTGAAGGTTTTTCCACATTC	0.438																																					GBM(39;623 795 5132 29510 31476)												0													217.0	199.0	205.0					19																	12430312		2203	4300	6503	SO:0001583	missense	0			BC022523	CCDS12270.1	19p13.2	2013-09-20			ENSG00000188868	ENSG00000188868		"""Zinc fingers, C2H2-type"", ""-"""	30498	protein-coding gene	gene with protein product							Standard	NM_145276		Approved	FLJ34797	uc002mtp.3	Q8TA94	OTTHUMG00000156413	ENST00000293725.5:c.527A>T	19.37:g.12430312T>A	ENSP00000293725:p.Lys176Ile		B2R9E7|Q8NAT7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K176I	ENST00000293725.5	37	c.527	CCDS12270.1	19	.	.	.	.	.	.	.	.	.	.	T	21.0	4.076367	0.76415	.	.	ENSG00000188868	ENST00000293725;ENST00000318168	T	0.28255	1.62	0.814	0.814	0.18756	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.61173	0.2326	H	0.95328	3.655	0.35721	D	0.817149	D;D	0.89917	1.0;0.992	D;D	0.91635	0.989;0.999	T	0.69277	-0.5187	9	0.87932	D	0	.	7.1423	0.25562	0.0:0.0:0.0:1.0	.	176;176	Q8TA94-2;Q8TA94	.;ZN563_HUMAN	I	176	ENSP00000293725:K176I	ENSP00000293725:K176I	K	-	2	0	ZNF563	12291312	0.996000	0.38824	0.013000	0.15412	0.784000	0.44337	3.970000	0.56824	0.607000	0.29982	0.260000	0.18958	AAA	ZNF563	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000188868		0.438	ZNF563-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF563	HGNC	protein_coding	OTTHUMT00000344114.1	-	0.00	110	0	T	NM_145276		12430312	-1	tier1	-	no_errors	ENST00000293725	ensembl	human	known	74_37	missense	34.23	73	38	SNP	0.987	A
ZNF665	79788	genome.wustl.edu	37	19	53669199	53669199	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr19:53669199C>T	ENST00000600412.1	-	2	464	c.349G>A	c.(349-351)Gaa>Aaa	p.E117K	ZNF665_ENST00000396424.3_Missense_Mutation_p.E182K|CTD-2245F17.2_ENST00000600257.1_RNA			Q9H7R5	ZN665_HUMAN	zinc finger protein 665	117					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	35				GBM - Glioblastoma multiforme(134;0.0196)		TTGCCACATTCATCACATTTA	0.378																																																	0													137.0	149.0	145.0					19																	53669199		2174	4289	6463	SO:0001583	missense	0				CCDS46169.1	19q13.42	2013-01-08				ENSG00000197497		"""Zinc fingers, C2H2-type"", ""-"""	25885	protein-coding gene	gene with protein product							Standard	NM_024733		Approved	FLJ14345	uc010eqm.1	Q9H7R5		ENST00000600412.1:c.349G>A	19.37:g.53669199C>T	ENSP00000469154:p.Glu117Lys		A8K5T8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E182K	ENST00000600412.1	37	c.544		19	.	.	.	.	.	.	.	.	.	.	C	7.928	0.740144	0.15642	.	.	ENSG00000197497	ENST00000396424	T	0.01152	5.26	1.87	-3.04	0.05412	.	.	.	.	.	T	0.00998	0.0033	L	0.33792	1.035	0.09310	N	1	B	0.17038	0.02	B	0.12156	0.007	T	0.44559	-0.9320	9	0.42905	T	0.14	.	4.6489	0.12585	0.0:0.54:0.1764:0.2835	.	182	Q9H7R5-2	.	K	182	ENSP00000379702:E182K	ENSP00000379702:E182K	E	-	1	0	ZNF665	58361011	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-4.748000	0.00190	-0.322000	0.08615	-0.300000	0.09419	GAA	ZNF665	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197497		0.378	ZNF665-002	PUTATIVE	not_organism_supported|basic	protein_coding	ZNF665	HGNC	protein_coding	OTTHUMT00000464179.1	-	0.00	53	0	C	NM_024733		53669199	-1	tier1	-	no_errors	ENST00000396424	ensembl	human	known	74_37	missense	25.71	52	18	SNP	0.000	T
ZNF678	339500	genome.wustl.edu	37	1	227843492	227843492	+	Missense_Mutation	SNP	A	A	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr1:227843492A>C	ENST00000343776.5	+	4	1886	c.1541A>C	c.(1540-1542)gAg>gCg	p.E514A	ZNF678_ENST00000608949.1_Intron|ZNF678_ENST00000397097.3_Missense_Mutation_p.E569A	NM_178549.3	NP_848644.2	Q5SXM1	ZN678_HUMAN	zinc finger protein 678	514					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(7)|pancreas(1)|prostate(1)	24		Prostate(94;0.0885)				TATACTGGAGAGGAACCTGAC	0.323																																																	0													43.0	47.0	45.0					1																	227843492		2202	4295	6497	SO:0001583	missense	0			BC042500		1q42.13	2013-01-08			ENSG00000181450	ENSG00000181450		"""Zinc fingers, C2H2-type"", ""-"""	28652	protein-coding gene	gene with protein product	"""hypothetical protein MGC42493"""					12477932	Standard	NM_178549		Approved	MGC42493	uc021pjy.1	Q5SXM1	OTTHUMG00000037700	ENST00000343776.5:c.1541A>C	1.37:g.227843492A>C	ENSP00000344828:p.Glu514Ala		Q8IVQ9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E569A	ENST00000343776.5	37	c.1706		1	.	.	.	.	.	.	.	.	.	.	A	13.86	2.361655	0.41801	.	.	ENSG00000181450	ENST00000343776;ENST00000397097	T;T	0.05855	3.38;3.47	1.08	-1.21	0.09524	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12902	0.0313	M	0.61703	1.905	0.24222	N	0.995436	D	0.60160	0.987	P	0.58520	0.84	T	0.17745	-1.0359	9	0.72032	D	0.01	.	3.7321	0.08496	0.6724:0.0:0.0:0.3276	.	514	Q5SXM1	ZN678_HUMAN	A	514;569	ENSP00000344828:E514A;ENSP00000440403:E569A	ENSP00000344828:E514A	E	+	2	0	ZNF678	225910115	0.242000	0.23868	0.004000	0.12327	0.004000	0.04260	2.176000	0.42500	0.338000	0.23692	0.329000	0.21502	GAG	ZNF678	-	pfscan_Znf_C2H2	ENSG00000181450		0.323	ZNF678-001	KNOWN	basic	protein_coding	ZNF678	HGNC	protein_coding	OTTHUMT00000091976.2	-	0.00	97	0	A	NM_178549		227843492	+1	tier1	-	no_errors	ENST00000397097	ensembl	human	known	74_37	missense	20.87	91	24	SNP	1.000	C
ZNF850	342892	genome.wustl.edu	37	19	37239777	37239777	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr19:37239777T>A	ENST00000591344.1	-	5	2323	c.2165A>T	c.(2164-2166)aAt>aTt	p.N722I	ZNF850_ENST00000589390.1_Intron	NM_001193552.1|NM_001267779.1	NP_001180481.1|NP_001254708.1	A8MQ14	ZN850_HUMAN	zinc finger protein 850	722					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										ATCAGTGTGATTTTGCTGATG	0.363																																																	0																																										SO:0001583	missense	0			BC052603	CCDS59379.1, CCDS74350.1	19q13.12	2013-01-08	2010-08-02	2010-08-02		ENSG00000267041		"""Zinc fingers, C2H2-type"", ""-"""	27994	protein-coding gene	gene with protein product			"""zinc finger protein 850 pseudogene"", ""zinc finger protein 850 (pseudogene)"""	ZNF850P		12477932	Standard	NM_001193552		Approved		uc010efc.3	A8MQ14		ENST00000591344.1:c.2165A>T	19.37:g.37239777T>A	ENSP00000464976:p.Asn722Ile			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.N722I	ENST00000591344.1	37	c.2165	CCDS59379.1	19																																																																																			ZNF850	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000267041		0.363	ZNF850-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF850	HGNC	protein_coding	OTTHUMT00000453557.1	-	0.00	147	0	T	XM_001720258		37239777	-1	tier1	-	no_errors	ENST00000591344	ensembl	human	known	74_37	missense	5.78	212	13	SNP	0.020	A
ZNF837	116412	genome.wustl.edu	37	19	58879599	58879599	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A7HY-01A-12D-A351-09	TCGA-LN-A7HY-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee35a606-caef-43b3-b7cd-bec8956caa5b	b0fc6d5a-b49d-4fd3-991c-0f18e31c3420	g.chr19:58879599G>C	ENST00000427624.2	-	3	1423	c.1101C>G	c.(1099-1101)gaC>gaG	p.D367E	CTD-2619J13.3_ENST00000599889.1_RNA|ZNF837_ENST00000597582.1_Missense_Mutation_p.D367E			Q96EG3	ZN837_HUMAN	zinc finger protein 837	367					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|skin(1)	2						CCTTGGCGCAGTCGGCGCACT	0.736																																																	0													15.0	15.0	15.0					19																	58879599		692	1590	2282	SO:0001583	missense	0			BC012365	CCDS46216.1	19q13.43	2013-01-08			ENSG00000152475	ENSG00000152475		"""Zinc fingers, C2H2-type"""	25164	protein-coding gene	gene with protein product						12477932	Standard	NM_138466		Approved		uc002qsl.4	Q96EG3		ENST00000427624.2:c.1101C>G	19.37:g.58879599G>C	ENSP00000405699:p.Asp367Glu			Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D367E	ENST00000427624.2	37	c.1101	CCDS46216.1	19	.	.	.	.	.	.	.	.	.	.	G	0	-2.672464	0.00104	.	.	ENSG00000152475	ENST00000427624	T	0.07327	3.2	1.1	-0.0785	0.13714	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02119	0.0066	N	0.01824	-0.7	0.09310	N	0.999998	B	0.02656	0.0	B	0.01281	0.0	T	0.45308	-0.9270	9	0.02654	T	1	.	3.7136	0.08430	0.0:0.5461:0.2721:0.1817	.	367	Q96EG3	ZN837_HUMAN	E	367	ENSP00000405699:D367E	ENSP00000405699:D367E	D	-	3	2	ZNF837	63571411	0.000000	0.05858	0.065000	0.19835	0.095000	0.18619	-1.915000	0.01578	0.032000	0.15435	-0.538000	0.04264	GAC	ZNF837	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000152475		0.736	ZNF837-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF837	HGNC	protein_coding	OTTHUMT00000466962.1		0.00	12	0	G	NM_138466		58879599	-1			no_errors	ENST00000427624	ensembl	human	known	74_37	missense	45.45	12	10	SNP	0.275	C
