#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCC4	10257	genome.wustl.edu	37	13	95696000	95696000	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr13:95696000G>A	ENST00000376887.4	-	29	3785	c.3671C>T	c.(3670-3672)gCc>gTc	p.A1224V	ABCC4_ENST00000412704.1_Missense_Mutation_p.A1177V	NM_005845.3	NP_005836.2	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 4	1224	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				blood coagulation (GO:0007596)|oxidation-reduction process (GO:0055114)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of smooth muscle cell proliferation (GO:0048661)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|response to organonitrogen compound (GO:0010243)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)	15-hydroxyprostaglandin dehydrogenase (NAD+) activity (GO:0016404)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(1)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cefazolin(DB01327)|Celecoxib(DB00482)|Conjugated Estrogens(DB00286)|Diclofenac(DB00586)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Flurbiprofen(DB00712)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Lamivudine(DB00709)|Leucovorin(DB00650)|Meloxicam(DB00814)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Nateglinide(DB00731)|Oseltamivir(DB00198)|Probenecid(DB01032)|Rosuvastatin(DB01098)|Sildenafil(DB00203)|Sorafenib(DB00398)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tenofovir(DB00300)|Tioguanine(DB00352)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Zidovudine(DB00495)	GGTGCAGTGGGCAAATTTCTC	0.393																																																	0													149.0	139.0	143.0					13																	95696000		2203	4300	6503	SO:0001583	missense	0			U66682	CCDS9474.1	13q31	2012-03-14			ENSG00000125257	ENSG00000125257		"""ATP binding cassette transporters / subfamily C"""	55	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter (ABC superfamily)"", ""bA464I2.1 (ATP-binding cassette, sub-family C (CFTR/MRP), member 4)"", ""multidrug resistance-associated protein 4"", ""multispecific organic anion transporter B"""	605250				8894702, 9661885	Standard	NM_005845		Approved	MRP4, EST170205, MOAT-B, MOATB	uc001vmd.4	O15439	OTTHUMG00000017216	ENST00000376887.4:c.3671C>T	13.37:g.95696000G>A	ENSP00000366084:p.Ala1224Val		A9Z1Z7|Q8IVZ4|Q8IZN6|Q8NEW8|Q9Y6J2	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,prints_CysFib_conduc_TM	p.A1224V	ENST00000376887.4	37	c.3671	CCDS9474.1	13	.	.	.	.	.	.	.	.	.	.	G	14.37	2.514312	0.44763	.	.	ENSG00000125257	ENST00000412704;ENST00000376887	T;T	0.80824	-1.42;-1.42	5.8	3.83	0.44106	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.574622	0.18988	N	0.125685	T	0.73822	0.3636	L	0.39085	1.19	0.80722	D	1	B;B	0.14805	0.001;0.011	B;B	0.13407	0.003;0.009	T	0.70414	-0.4878	10	0.48119	T	0.1	.	15.6662	0.77230	0.0:0.0:0.6933:0.3067	.	1177;1224	O15439-2;O15439	.;MRP4_HUMAN	V	1177;1224	ENSP00000388657:A1177V;ENSP00000366084:A1224V	ENSP00000366084:A1224V	A	-	2	0	ABCC4	94494001	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.595000	0.46197	1.377000	0.46286	0.650000	0.86243	GCC	ABCC4	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000125257		0.393	ABCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC4	HGNC	protein_coding	OTTHUMT00000045478.2		0.00	48	0	G	NM_005845		95696000	-1			no_errors	ENST00000376887	ensembl	human	known	74_37	missense	5.26	71	4	SNP	0.996	A
ACSS3	79611	genome.wustl.edu	37	12	81624851	81624851	+	Silent	SNP	T	T	C			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr12:81624851T>C	ENST00000548058.1	+	12	2440	c.1530T>C	c.(1528-1530)ccT>ccC	p.P510P	ACSS3_ENST00000548324.1_Silent_p.P192P|ACSS3_ENST00000261206.3_Silent_p.P509P			Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	510						mitochondrion (GO:0005739)	acetate-CoA ligase activity (GO:0003987)|ATP binding (GO:0005524)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(7)|liver(3)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	51						CATTGCCACCTGGGGCTTTTT	0.308																																																	0													65.0	67.0	66.0					12																	81624851		2203	4299	6502	SO:0001819	synonymous_variant	0				CCDS9022.1	12q21.31	2014-08-08			ENSG00000111058	ENSG00000111058		"""Acyl-CoA synthetase family"""	24723	protein-coding gene	gene with protein product		614356				17762044	Standard	NM_024560		Approved	FLJ21963	uc001szl.1	Q9H6R3	OTTHUMG00000170179	ENST00000548058.1:c.1530T>C	12.37:g.81624851T>C			Q8NC66	Silent	SNP	pfam_AMP-dep_Synth/Lig	p.P510	ENST00000548058.1	37	c.1530	CCDS9022.1	12																																																																																			ACSS3	-	pfam_AMP-dep_Synth/Lig	ENSG00000111058		0.308	ACSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACSS3	HGNC	protein_coding	OTTHUMT00000407794.1	-	0.00	50	0	T	NM_024560		81624851	+1	tier1	-	no_errors	ENST00000548058	ensembl	human	known	74_37	silent	33.61	81	41	SNP	0.994	C
ACTA1	58	genome.wustl.edu	37	1	229567918	229567918	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr1:229567918C>T	ENST00000366684.3	-	5	733	c.631G>A	c.(631-633)Gtg>Atg	p.V211M	ACTA1_ENST00000366683.2_Missense_Mutation_p.V123M	NM_001100.3	NP_001091.1	P68133	ACTS_HUMAN	actin, alpha 1, skeletal muscle	211					cell growth (GO:0016049)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to extracellular stimulus (GO:0009991)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to steroid hormone (GO:0048545)|skeletal muscle fiber adaptation (GO:0043503)|skeletal muscle fiber development (GO:0048741)|skeletal muscle thin filament assembly (GO:0030240)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|striated muscle thin filament (GO:0005865)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|myosin binding (GO:0017022)|structural constituent of cytoskeleton (GO:0005200)			endometrium(4)|large_intestine(4)|lung(18)|prostate(1)|urinary_tract(1)	28	Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.167)				ATGTCGCGCACGATCTCGCGC	0.692																																																	0													35.0	30.0	32.0					1																	229567918		2203	4300	6503	SO:0001583	missense	0			J00068	CCDS1578.1	1q42.13	2014-09-17			ENSG00000143632	ENSG00000143632			129	protein-coding gene	gene with protein product	"""nemaline myopathy type 3"""	102610		ACTA		10072583, 6865942	Standard	NM_001100		Approved	NEM3	uc001htm.3	P68133	OTTHUMG00000038006	ENST00000366684.3:c.631G>A	1.37:g.229567918C>T	ENSP00000355645:p.Val211Met		P02568|P99020|Q5T8M9	Missense_Mutation	SNP	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.V211M	ENST00000366684.3	37	c.631	CCDS1578.1	1	.	.	.	.	.	.	.	.	.	.	C	16.00	2.997654	0.54147	.	.	ENSG00000143632	ENST00000366684;ENST00000308794;ENST00000366683;ENST00000366682	D;D	0.95171	-3.63;-3.63	4.28	4.28	0.50868	.	0.153298	0.41097	D	0.000944	D	0.97901	0.9310	H	0.94345	3.525	0.58432	D	0.999999	D	0.71674	0.998	D	0.81914	0.995	D	0.98206	1.0470	10	0.40728	T	0.16	.	16.8952	0.86098	0.0:1.0:0.0:0.0	.	211	P68133	ACTS_HUMAN	M	211;121;123;176	ENSP00000355645:V211M;ENSP00000355644:V123M	ENSP00000312351:V121M	V	-	1	0	ACTA1	227634541	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	4.626000	0.61269	2.201000	0.70794	0.563000	0.77884	GTG	ACTA1	-	pfam_Actin-related,smart_Actin-related	ENSG00000143632		0.692	ACTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTA1	HGNC	protein_coding	OTTHUMT00000092781.1	-	0.00	40	0	C	NM_001100		229567918	-1	tier1	-	no_errors	ENST00000366684	ensembl	human	known	74_37	missense	10.17	53	6	SNP	1.000	T
ADAM19	8728	genome.wustl.edu	37	5	156908845	156908845	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr5:156908845C>A	ENST00000517905.1	-	22	2701	c.2657G>T	c.(2656-2658)gGt>gTt	p.G886V	ADAM19_ENST00000394020.1_Missense_Mutation_p.G888V|ADAM19_ENST00000430702.2_Intron|ADAM19_ENST00000257527.4_Missense_Mutation_p.G886V			Q9H013	ADA19_HUMAN	ADAM metallopeptidase domain 19	886					heart development (GO:0007507)|membrane protein ectodomain proteolysis (GO:0006509)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AGGGCCAGCACCAGGGGGCCG	0.697																																																	0													12.0	13.0	13.0					5																	156908845		2194	4294	6488	SO:0001583	missense	0			AF311317	CCDS4338.1	5q33.3	2010-06-24	2010-06-24		ENSG00000135074	ENSG00000135074		"""ADAM metallopeptidase domain containing"""	197	protein-coding gene	gene with protein product	"""meltrin beta"""	603640	"""a disintegrin and metalloproteinase domain 19 (meltrin beta)"""			9806848	Standard	NM_033274		Approved	MLTNB	uc003lwz.4	Q9H013	OTTHUMG00000130242	ENST00000517905.1:c.2657G>T	5.37:g.156908845C>A	ENSP00000428654:p.Gly886Val		Q9BZL5|Q9UHP2	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.G888V	ENST00000517905.1	37	c.2663		5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.863|7.863	0.726423|0.726423	0.15439|0.15439	.|.	.|.	ENSG00000135074|ENSG00000135074	ENST00000257527;ENST00000394020;ENST00000517905|ENST00000517374	T;T;T|.	0.01474|.	4.87;4.89;4.85|.	5.28|5.28	3.5|3.5	0.40072|0.40072	.|.	0.741456|.	0.12825|.	N|.	0.436061|.	T|T	0.18800|0.18800	0.0451|0.0451	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	0.999997|0.999997	B;B|.	0.10296|.	0.003;0.001|.	B;B|.	0.06405|.	0.002;0.002|.	T|T	0.23868|0.23868	-1.0176|-1.0176	10|5	0.27082|.	T|.	0.32|.	.|.	8.6324|8.6324	0.33928|0.33928	0.0809:0.3012:0.6179:0.0|0.0809:0.3012:0.6179:0.0	.|.	886;886|.	Q9H013-2;Q9H013|.	.;ADA19_HUMAN|.	V|L	886;888;886|457	ENSP00000257527:G886V;ENSP00000377588:G888V;ENSP00000428654:G886V|.	ENSP00000257527:G886V|.	G|V	-|-	2|1	0|0	ADAM19|ADAM19	156841423|156841423	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.003000|0.003000	0.03518|0.03518	0.182000|0.182000	0.16900|0.16900	0.626000|0.626000	0.30322|0.30322	-0.311000|-0.311000	0.09066|0.09066	GGT|GTG	ADAM19	-	NULL	ENSG00000135074		0.697	ADAM19-003	PUTATIVE	basic	protein_coding	ADAM19	HGNC	protein_coding	OTTHUMT00000373918.1	-	0.00	56	0	C	NM_033274		156908845	-1	tier1	-	no_errors	ENST00000394020	ensembl	human	known	74_37	missense	15.25	50	9	SNP	0.001	A
ADAMTS18	170692	genome.wustl.edu	37	16	77353798	77353798	+	Missense_Mutation	SNP	C	C	T	rs149031657	byFrequency	TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr16:77353798C>T	ENST00000282849.5	-	16	2898	c.2480G>A	c.(2479-2481)cGc>cAc	p.R827H		NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	827	Spacer.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.R827H(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						ACGTTCCGGGCGGTTGAAAGA	0.542																																																	1	Substitution - Missense(1)	kidney(1)											58.0	58.0	58.0					16																	77353798		2198	4300	6498	SO:0001583	missense	0			AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.2480G>A	16.37:g.77353798C>T	ENSP00000282849:p.Arg827His		Q6P4R5|Q6ZWJ9	Missense_Mutation	SNP	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.R827H	ENST00000282849.5	37	c.2480	CCDS10926.1	16	.	.	.	.	.	.	.	.	.	.	C	12.84	2.058475	0.36277	.	.	ENSG00000140873	ENST00000282849	T	0.52057	0.68	5.54	-7.54	0.01332	ADAM-TS Spacer 1 (1);	0.503008	0.22144	N	0.064016	T	0.20333	0.0489	N	0.11313	0.125	0.25930	N	0.983009	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.003	T	0.05084	-1.0907	10	0.40728	T	0.16	.	9.665	0.39979	0.1016:0.2297:0.0:0.6687	.	827;827	Q8TE60-2;Q8TE60	.;ATS18_HUMAN	H	827	ENSP00000282849:R827H	ENSP00000282849:R827H	R	-	2	0	ADAMTS18	75911299	0.001000	0.12720	0.137000	0.22149	0.730000	0.41778	-0.759000	0.04761	-1.307000	0.02321	-1.603000	0.00810	CGC	ADAMTS18	-	pfam_ADAM_spacer1	ENSG00000140873		0.542	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS18	HGNC	protein_coding	OTTHUMT00000269037.1	-	0.00	55	0	C			77353798	-1	tier1	rs149031657	no_errors	ENST00000282849	ensembl	human	known	74_37	missense	25.58	32	11	SNP	0.786	T
ADCY8	114	genome.wustl.edu	37	8	132052045	132052045	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr8:132052045G>A	ENST00000286355.5	-	1	2627	c.535C>T	c.(535-537)Cgc>Tgc	p.R179C	ADCY8_ENST00000377928.3_Missense_Mutation_p.R179C	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	179					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			TCCGATTTGCGCCTTTGGCCC	0.567										HNSCC(32;0.087)																																							0													81.0	82.0	82.0					8																	132052045		2203	4300	6503	SO:0001583	missense	0			Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.535C>T	8.37:g.132052045G>A	ENSP00000286355:p.Arg179Cys			Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.R179C	ENST00000286355.5	37	c.535	CCDS6363.1	8	.	.	.	.	.	.	.	.	.	.	G	24.6	4.554126	0.86231	.	.	ENSG00000155897	ENST00000286355;ENST00000377928	T;T	0.66815	-0.23;-0.23	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.77011	0.4068	L	0.48642	1.525	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.75020	0.985;0.985	T	0.76570	-0.2911	10	0.44086	T	0.13	.	17.6088	0.88046	0.0:0.0:1.0:0.0	.	179;179	E7EVL1;P40145	.;ADCY8_HUMAN	C	179	ENSP00000286355:R179C;ENSP00000367161:R179C	ENSP00000286355:R179C	R	-	1	0	ADCY8	132121227	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.167000	0.94773	2.412000	0.81896	0.455000	0.32223	CGC	ADCY8	-	NULL	ENSG00000155897		0.567	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY8	HGNC	protein_coding	OTTHUMT00000380080.1	-	0.00	39	0	G			132052045	-1	tier1	-	no_errors	ENST00000286355	ensembl	human	known	74_37	missense	21.82	42	12	SNP	1.000	A
ALAD	210	genome.wustl.edu	37	9	116151931	116151931	+	Missense_Mutation	SNP	C	C	A	rs143028530		TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr9:116151931C>A	ENST00000409155.3	-	9	858	c.662G>T	c.(661-663)cGc>cTc	p.R221L	ALAD_ENST00000277315.5_Missense_Mutation_p.R204L|ALAD_ENST00000482001.1_5'Flank	NM_000031.5	NP_000022.3	P13716	HEM2_HUMAN	aminolevulinate dehydratase	221					cellular response to interleukin-4 (GO:0071353)|heme biosynthetic process (GO:0006783)|porphyrin-containing compound metabolic process (GO:0006778)|protein homooligomerization (GO:0051260)|protoporphyrinogen IX biosynthetic process (GO:0006782)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|identical protein binding (GO:0042802)|lead ion binding (GO:0032791)|porphobilinogen synthase activity (GO:0004655)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)|stomach(1)	9					Aminolevulinic acid(DB00855)	GTAGCAGCGGCGGTCCCCAAA	0.632																																																	0													31.0	34.0	33.0					9																	116151931		2203	4300	6503	SO:0001583	missense	0			M13928	CCDS6794.2	9q32	2010-04-29	2010-04-29		ENSG00000148218	ENSG00000148218	4.2.1.24		395	protein-coding gene	gene with protein product	"""porphobilinogen synthase"""	125270	"""aminolevulinate, delta-, dehydratase"""			6839527, 6378062	Standard	NM_000031		Approved	ALADH, PBGS	uc011lxf.2	P13716	OTTHUMG00000020522	ENST00000409155.3:c.662G>T	9.37:g.116151931C>A	ENSP00000386284:p.Arg221Leu		A8K375|B2R6F2|Q16870|Q16871|Q9BVQ9	Missense_Mutation	SNP	pfam_Porphobilinogen_synth,pirsf_Porphobilinogen_synth,prints_Porphobilinogen_synth	p.R221L	ENST00000409155.3	37	c.662	CCDS6794.2	9	.	.	.	.	.	.	.	.	.	.	C	33	5.262773	0.95399	.	.	ENSG00000148218	ENST00000409155;ENST00000277315	D;D	0.90261	-2.64;-2.64	5.41	5.41	0.78517	Aldolase-type TIM barrel (1);	0.000000	0.85682	D	0.000000	D	0.97480	0.9175	H	0.98542	4.26	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.99078	1.0836	10	0.87932	D	0	-11.8612	18.1838	0.89787	0.0:1.0:0.0:0.0	.	221;204;250	P13716;B7Z3I9;P13716-2	HEM2_HUMAN;.;.	L	221;204	ENSP00000386284:R221L;ENSP00000277315:R204L	ENSP00000277315:R204L	R	-	2	0	ALAD	115191752	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.385000	0.79763	2.524000	0.85096	0.655000	0.94253	CGC	ALAD	-	pfam_Porphobilinogen_synth,pirsf_Porphobilinogen_synth	ENSG00000148218		0.632	ALAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALAD	HGNC	protein_coding	OTTHUMT00000053724.3		0.00	21	0	C	NM_001003945		116151931	-1			no_errors	ENST00000409155	ensembl	human	known	74_37	missense	11.11	24	3	SNP	1.000	A
AQP9	366	genome.wustl.edu	37	15	58430744	58430744	+	5'UTR	SNP	A	A	C			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr15:58430744A>C	ENST00000219919.4	+	0	350				AQP9_ENST00000536493.1_5'UTR|AQP9_ENST00000559443.1_3'UTR|ALDH1A2_ENST00000558231.1_Intron|AQP9_ENST00000558772.1_Intron	NM_020980.3	NP_066190.2	O43315	AQP9_HUMAN	aquaporin 9						amine transport (GO:0015837)|canalicular bile acid transport (GO:0015722)|carboxylic acid transport (GO:0046942)|cellular response to cAMP (GO:0071320)|excretion (GO:0007588)|glycerol transport (GO:0015793)|immune response (GO:0006955)|metabolic process (GO:0008152)|polyol transport (GO:0015791)|purine nucleobase transport (GO:0006863)|pyrimidine nucleobase transport (GO:0015855)|pyrimidine-containing compound transmembrane transport (GO:0072531)|response to mercury ion (GO:0046689)|response to organic substance (GO:0010033)|response to osmotic stress (GO:0006970)|transmembrane transport (GO:0055085)|transport (GO:0006810)|water homeostasis (GO:0030104)|water transport (GO:0006833)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	amine transmembrane transporter activity (GO:0005275)|carboxylic acid transmembrane transporter activity (GO:0046943)|glycerol channel activity (GO:0015254)|polyol transmembrane transporter activity (GO:0015166)|porin activity (GO:0015288)|purine nucleobase transmembrane transporter activity (GO:0005345)|pyrimidine nucleobase transmembrane transporter activity (GO:0005350)|water channel activity (GO:0015250)|water transmembrane transporter activity (GO:0005372)			endometrium(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)	21				GBM - Glioblastoma multiforme(80;0.16)		TAGAAACAGGAGTCCTCAGAG	0.483																																																	0													69.0	67.0	68.0					15																	58430744		2192	4292	6484	SO:0001623	5_prime_UTR_variant	0			AF016495	CCDS10165.1	15q	2005-09-20			ENSG00000103569	ENSG00000103569		"""Ion channels / Aquaporins"""	643	protein-coding gene	gene with protein product		602914					Standard	NM_020980		Approved	SSC1, HsT17287	uc002aez.2	O43315	OTTHUMG00000132631	ENST00000219919.4:c.-21A>C	15.37:g.58430744A>C			Q9NP32	RNA	SNP	-	NULL	ENST00000219919.4	37	NULL	CCDS10165.1	15																																																																																			ALDH1A2	-	-	ENSG00000128918		0.483	AQP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1A2	HGNC	protein_coding	OTTHUMT00000255878.2	-	0.00	21	0	A	NM_020980		58430744	-1	tier1	-	no_errors	ENST00000558504	ensembl	human	known	74_37	rna	20.00	32	8	SNP	0.000	C
ALG1	56052	genome.wustl.edu	37	16	5125388	5125388	+	Splice_Site	SNP	G	G	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr16:5125388G>A	ENST00000262374.5	+	4	421		c.e4-1		ALG1_ENST00000544428.1_Splice_Site|ALG1_ENST00000588623.1_Splice_Site	NM_019109.4	NP_061982.3	Q9BT22	ALG1_HUMAN	ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|lipopolysaccharide biosynthetic process (GO:0009103)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	chitobiosyldiphosphodolichol beta-mannosyltransferase activity (GO:0004578)|mannosyltransferase activity (GO:0000030)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		Ovarian(90;0.0164)				ATCTTTCCTAGAACCCCCCAG	0.488																																																	0													165.0	147.0	153.0					16																	5125388		2197	4300	6497	SO:0001630	splice_region_variant	0			AB019038	CCDS10528.1	16p13.3	2013-02-22	2013-02-22		ENSG00000033011	ENSG00000033011	2.4.1.142	"""Glycosyltransferase group 1 domain containing"""	18294	protein-coding gene	gene with protein product		605907	"""asparagine-linked glycosylation 1 homolog (yeast, beta-1,4-mannosyltransferase)"", ""asparagine-linked glycosylation 1, beta-1,4-mannosyltransferase homolog (S. cerevisiae)"""			10704531	Standard	NM_019109		Approved	HMT-1, HMAT1	uc002cym.3	Q9BT22	OTTHUMG00000129529	ENST00000262374.5:c.391-1G>A	16.37:g.5125388G>A			B4DP08|Q6UVZ9|Q8N5Y4|Q9P2Y2	Splice_Site	SNP	-	e4-1	ENST00000262374.5	37	c.391-1	CCDS10528.1	16	.	.	.	.	.	.	.	.	.	.	G	18.81	3.702541	0.68501	.	.	ENSG00000033011	ENST00000262374;ENST00000544428	.	.	.	5.74	4.78	0.61160	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.7815	0.52018	0.0842:0.0:0.9158:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ALG1	5065389	1.000000	0.71417	0.997000	0.53966	0.836000	0.47400	8.764000	0.91719	2.716000	0.92895	0.650000	0.86243	.	ALG1	-	-	ENSG00000033011		0.488	ALG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG1	HGNC	protein_coding	OTTHUMT00000251716.2	-	0.00	34	0	G	NM_019109	Intron	5125388	+1	tier1	-	no_errors	ENST00000262374	ensembl	human	known	74_37	splice_site	41.07	33	23	SNP	1.000	A
AMMECR1	9949	genome.wustl.edu	37	X	109561058	109561060	+	In_Frame_Del	DEL	CCG	CCG	-			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	CCG	CCG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chrX:109561058_109561060delCCG	ENST00000262844.5	-	1	407_409	c.240_242delCGG	c.(238-243)ggcggg>ggg	p.80_81GG>G	AMMECR1_ENST00000496695.1_5'Flank|AMMECR1_ENST00000372059.2_In_Frame_Del_p.80_81GG>G|AMMECR1_ENST00000372057.1_5'UTR	NM_015365.2	NP_056180.1	Q9Y4X0	AMMR1_HUMAN	Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1	80	Gly/Ser-rich.									large_intestine(1)|lung(4)|ovary(1)|stomach(1)	7						GGCGATCCCCCCGCCGCCGCCGC	0.734																																																	0									,,	57,2761		4,39,10,1217,288					,,	4.4	1.0			10	122,4848		9,60,44,1818,1152	no	coding,utr-5,coding	AMMECR1	NM_015365.2,NM_001171689.1,NM_001025580.1	,,	13,99,54,3035,1440	A1A1,A1R,A1,RR,R		2.4547,2.0227,2.2984	,,	,,		179,7609				SO:0001651	inframe_deletion	0			AJ007014	CCDS14551.1, CCDS35368.1, CCDS55476.1	Xq22.3	2014-06-17	2008-09-12		ENSG00000101935	ENSG00000101935			467	protein-coding gene	gene with protein product		300195				10049589, 9480748	Standard	NM_001171689		Approved		uc004eoo.3	Q9Y4X0	OTTHUMG00000022197	ENST00000262844.5:c.240_242delCGG	X.37:g.109561067_109561069delCCG	ENSP00000262844:p.Gly82del		Q5JYV9|Q6P9D8|Q8WX22|Q9UIQ8	In_Frame_Del	DEL	pfam_AMMECR1_domain,superfamily_AMMECR1_domain,pfscan_AMMECR1_domain,tigrfam_AMMECR1	p.G82in_frame_del	ENST00000262844.5	37	c.242_240	CCDS14551.1	X																																																																																			AMMECR1	-	NULL	ENSG00000101935		0.734	AMMECR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMMECR1	HGNC	protein_coding	OTTHUMT00000057907.1		0.00	15	0	CCG			109561060	-1			no_errors	ENST00000262844	ensembl	human	known	74_37	in_frame_del	8.00	69	6	DEL	1.000:1.000:0.999	0
ANKRD36C	400986	genome.wustl.edu	37	2	96604645	96604645	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr2:96604645G>A	ENST00000456556.1	-	22	1649	c.1565C>T	c.(1564-1566)aCg>aTg	p.T522M				Q5JPF3	AN36C_HUMAN	ankyrin repeat domain 36C	522							ion channel inhibitor activity (GO:0008200)			breast(1)|endometrium(8)|kidney(5)|lung(4)	18						GTCTTTCACCGTATGCTGAAT	0.308																																																	0																																										SO:0001583	missense	0			AL832836		2q11.1	2013-01-10			ENSG00000174501	ENSG00000174501		"""Ankyrin repeat domain containing"""	32946	protein-coding gene	gene with protein product	"""protein immuno-reactive with anti-PTH polyclonal antibodies"""						Standard	XR_251121		Approved	DKFZp667P0924	uc002suz.1	Q5JPF3	OTTHUMG00000155211	ENST00000456556.1:c.1565C>T	2.37:g.96604645G>A	ENSP00000403302:p.Thr522Met		C9JZ08|Q15694|Q53S06|Q658V2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.T522M	ENST00000456556.1	37	c.1565		2	.	.	.	.	.	.	.	.	.	.	N	8.766	0.924776	0.18056	.	.	ENSG00000174501	ENST00000456556	T	0.17528	2.27	1.22	-0.783	0.10958	.	.	.	.	.	T	0.07863	0.0197	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.33059	-0.9883	7	0.49607	T	0.09	.	4.0741	0.09895	0.4602:0.0:0.5398:0.0	.	.	.	.	M	522	ENSP00000403302:T522M	ENSP00000403302:T522M	T	-	2	0	AC073995.2	95968372	0.003000	0.15002	0.002000	0.10522	0.008000	0.06430	0.235000	0.17948	-0.334000	0.08463	-0.795000	0.03280	ACG	ANKRD36C	-	NULL	ENSG00000174501		0.308	ANKRD36C-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	ANKRD36C	HGNC	protein_coding	OTTHUMT00000338799.2	-	0.00	123	0	G	NM_001010914		96604645	-1	tier1	-	no_errors	ENST00000456556	ensembl	human	known	74_37	missense	5.61	185	11	SNP	0.005	A
ANKUB1	389161	genome.wustl.edu	37	3	149485656	149485656	+	Silent	SNP	G	G	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr3:149485656G>A	ENST00000383050.3	-	5	1249	c.793C>T	c.(793-795)Ctg>Ttg	p.L265L	ANKUB1_ENST00000446160.1_Silent_p.L265L|ANKUB1_ENST00000462519.2_Silent_p.L265L			A6NFN9	ANKUB_HUMAN	ankyrin repeat and ubiquitin domain containing 1	265										breast(1)|kidney(1)|lung(1)|skin(1)	4						TCCAGGCACAGCACACTGTAG	0.453																																																	0													107.0	90.0	95.0					3																	149485656		692	1591	2283	SO:0001819	synonymous_variant	0			AK027233		3q25.1	2013-01-11	2011-05-10	2011-05-10	ENSG00000206199	ENSG00000206199		"""Ankyrin repeat domain containing"""	29642	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 16"""	C3orf16			Standard	NM_001144960		Approved		uc003exl.3	A6NFN9	OTTHUMG00000159615	ENST00000383050.3:c.793C>T	3.37:g.149485656G>A			B4E2N8	Silent	SNP	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ubiquitin_supergroup	p.L265	ENST00000383050.3	37	c.793		3																																																																																			ANKUB1	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt	ENSG00000206199		0.453	ANKUB1-201	KNOWN	basic	protein_coding	ANKUB1	HGNC	protein_coding			0.00	43	0	G	NM_001144960		149485656	-1			no_errors	ENST00000446160	ensembl	human	known	74_37	silent	5.36	53	3	SNP	0.980	A
ANKS1B	56899	genome.wustl.edu	37	12	99128582	99128582	+	IGR	SNP	A	A	G			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr12:99128582A>G	ENST00000547776.2	-	0	3885				APAF1_ENST00000547666.1_3'UTR|APAF1_ENST00000357310.1_3'UTR|APAF1_ENST00000550527.1_3'UTR|APAF1_ENST00000359972.2_3'UTR|ANKS1B_ENST00000549558.2_3'UTR|APAF1_ENST00000333991.1_3'UTR|ANKS1B_ENST00000341752.7_3'UTR|APAF1_ENST00000339433.3_3'UTR	NM_152788.4	NP_690001.3	Q7Z6G8	ANS1B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1B							cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ephrin receptor binding (GO:0046875)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(15)|lung(38)|pancreas(1)|prostate(2)|skin(1)	70		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		GAATACCCAAATCATAATTTT	0.313																																																	0																																										SO:0001628	intergenic_variant	0			AF145204	CCDS55864.1, CCDS55865.1, CCDS55866.1, CCDS55867.1, CCDS55868.1, CCDS55869.1, CCDS55870.1, CCDS55871.1, CCDS55872.1	12q23.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	24600	protein-coding gene	gene with protein product		607815				10490826, 12415113	Standard	NM_020140		Approved	EB-1, AIDA-1, cajalin-2, ANKS2	uc001tge.2	Q7Z6G8			12.37:g.99128582A>G			A5PKY5|A7E259|A8K153|A8MSN4|B4DFP6|B4DH98|F8VPM3|F8VZR9|F8WC27|Q5XLJ0|Q6IVB5|Q6NUS4|Q7Z6G6|Q7Z6G7|Q8TAP3|Q9NRX7|Q9Y5K9	RNA	SNP	-	NULL	ENST00000547776.2	37	NULL	CCDS55872.1	12																																																																																			APAF1	-	-	ENSG00000120868		0.313	ANKS1B-003	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	APAF1	HGNC	protein_coding	OTTHUMT00000408421.3	-	0.00	23	0	A	NM_020140		99128582	+1	tier1	-	no_errors	ENST00000547666	ensembl	human	putative	74_37	rna	60.00	16	24	SNP	0.000	G
ANO4	121601	genome.wustl.edu	37	12	101505402	101505402	+	Silent	SNP	C	C	G			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr12:101505402C>G	ENST00000392977.3	+	24	2574	c.2364C>G	c.(2362-2364)gtC>gtG	p.V788V	ANO4_ENST00000550015.1_Silent_p.V308V|ANO4_ENST00000392979.3_Silent_p.V753V|ANO4_ENST00000299222.9_Silent_p.V308V			Q32M45	ANO4_HUMAN	anoctamin 4	788					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						ATGCATTTGTCATAGCGATAA	0.383										HNSCC(74;0.22)																																							0													143.0	131.0	135.0					12																	101505402		2203	4300	6503	SO:0001819	synonymous_variant	0			AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.2364C>G	12.37:g.101505402C>G			Q8NAJ0|Q8NB39|Q8NB53	Silent	SNP	pfam_Anoctamin	p.V788	ENST00000392977.3	37	c.2364		12																																																																																			ANO4	-	pfam_Anoctamin	ENSG00000151572		0.383	ANO4-002	KNOWN	basic	protein_coding	ANO4	HGNC	protein_coding	OTTHUMT00000409295.1	-	0.00	36	0	C	NM_178826		101505402	+1	tier1	-	no_errors	ENST00000392977	ensembl	human	known	74_37	silent	15.38	55	10	SNP	1.000	G
ARAP3	64411	genome.wustl.edu	37	5	141033939	141033939	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr5:141033939C>T	ENST00000239440.4	-	33	4278	c.4213G>A	c.(4213-4215)Gag>Aag	p.E1405K	FCHSD1_ENST00000522783.1_5'Flank|FCHSD1_ENST00000519800.1_5'Flank|FCHSD1_ENST00000435817.2_5'Flank|ARAP3_ENST00000513878.1_Missense_Mutation_p.E1054K|ARAP3_ENST00000508305.1_Missense_Mutation_p.E1236K|ARAP3_ENST00000512390.1_5'UTR	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	1405					cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						TACACTGGCTCCTCGTACACA	0.567																																																	0													103.0	103.0	103.0					5																	141033939		2203	4300	6503	SO:0001583	missense	0			AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.4213G>A	5.37:g.141033939C>T	ENSP00000239440:p.Glu1405Lys		B4DIT1|D3DQE3	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ras-assoc,pfam_SAM_2,pfam_SAM_type1,superfamily_Rho_GTPase_activation_prot,superfamily_SAM/pointed,smart_SAM,smart_Pleckstrin_homology,smart_ArfGAP,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SAM,pfscan_ArfGAP,pfscan_RhoGAP_dom,prints_ArfGAP	p.E1405K	ENST00000239440.4	37	c.4213	CCDS4266.1	5	.	.	.	.	.	.	.	.	.	.	C	19.12	3.765636	0.69878	.	.	ENSG00000120318	ENST00000508305;ENST00000239440;ENST00000513878	T;T;T	0.48836	0.8;0.8;0.8	4.78	4.78	0.61160	.	0.000000	0.85682	D	0.000000	T	0.58864	0.2152	L	0.34521	1.04	0.47737	D	0.999508	D;D;D	0.67145	0.993;0.996;0.993	D;D;D	0.76071	0.971;0.987;0.971	T	0.59595	-0.7425	10	0.46703	T	0.11	.	17.5927	0.88001	0.0:1.0:0.0:0.0	.	1054;1236;1405	B4DIT1;G5E9Y3;Q8WWN8	.;.;ARAP3_HUMAN	K	1236;1405;1054	ENSP00000421826:E1236K;ENSP00000239440:E1405K;ENSP00000421468:E1054K	ENSP00000239440:E1405K	E	-	1	0	ARAP3	141014123	1.000000	0.71417	1.000000	0.80357	0.405000	0.30901	5.531000	0.67148	2.449000	0.82847	0.591000	0.81541	GAG	ARAP3	-	NULL	ENSG00000120318		0.567	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARAP3	HGNC	protein_coding	OTTHUMT00000251805.1	-	0.00	45	0	C	NM_022481		141033939	-1	tier1	-	no_errors	ENST00000239440	ensembl	human	known	74_37	missense	20.00	56	14	SNP	1.000	T
ARHGEF39	84904	genome.wustl.edu	37	9	35662967	35662967	+	Missense_Mutation	SNP	G	G	T	rs143394421		TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr9:35662967G>T	ENST00000378387.3	-	6	766	c.649C>A	c.(649-651)Cgc>Agc	p.R217S	ARHGEF39_ENST00000343259.3_Intron|ARHGEF39_ENST00000490970.1_Intron|ARHGEF39_ENST00000378395.2_Missense_Mutation_p.R181S	NM_032818.2	NP_116207.2	Q8N4T4	ARG39_HUMAN	Rho guanine nucleotide exchange factor (GEF) 39	217					positive regulation of cell migration (GO:0030335)	plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)										TTTGCCTGGCGTCCACTGAGC	0.517																																																	0													73.0	64.0	67.0					9																	35662967		2203	4300	6503	SO:0001583	missense	0			AK001187	CCDS6584.2	9p13.3	2012-08-08	2012-08-08	2012-08-08	ENSG00000137135	ENSG00000137135			25909	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 100"""	C9orf100		22327280	Standard	XR_242516		Approved	FLJ14642	uc003zxm.1	Q8N4T4	OTTHUMG00000019869	ENST00000378387.3:c.649C>A	9.37:g.35662967G>T	ENSP00000367638:p.Arg217Ser		Q49AG0|Q6TPQ2|Q96ST6	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.R217S	ENST00000378387.3	37	c.649	CCDS6584.2	9	.	.	.	.	.	.	.	.	.	.	G	20.7	4.038947	0.75617	.	.	ENSG00000137135	ENST00000378387;ENST00000378395	T;T	0.41400	1.0;1.0	5.83	4.93	0.64822	Pleckstrin homology-type (1);	0.113495	0.64402	D	0.000017	T	0.45115	0.1326	M	0.64997	1.995	0.80722	D	1	D	0.55605	0.972	P	0.49047	0.599	T	0.36016	-0.9765	10	0.18710	T	0.47	-7.0221	10.7632	0.46277	0.0874:0.0:0.9126:0.0	.	217	Q8N4T4	CI100_HUMAN	S	217;181	ENSP00000367638:R217S;ENSP00000367648:R181S	ENSP00000367638:R217S	R	-	1	0	C9orf100	35652967	0.993000	0.37304	0.996000	0.52242	0.999000	0.98932	2.342000	0.43992	1.451000	0.47736	0.650000	0.86243	CGC	ARHGEF39	-	NULL	ENSG00000137135		0.517	ARHGEF39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF39	HGNC	protein_coding	OTTHUMT00000052330.1		0.00	36	0	G	NM_032818		35662967	-1			no_errors	ENST00000378387	ensembl	human	known	74_37	missense	5.00	37	2	SNP	0.974	T
ARL5C	390790	genome.wustl.edu	37	17	37318973	37318973	+	Silent	SNP	G	G	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr17:37318973G>A	ENST00000269586.7	-	3	245	c.246C>T	c.(244-246)tcC>tcT	p.S82S	ARL5C_ENST00000583123.1_5'Flank|ARL5C_ENST00000444555.1_Silent_p.S82S	NM_001143968.1	NP_001137440.1	A6NH57	ARL5C_HUMAN	ADP-ribosylation factor-like 5C	82					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)										CCTCAGTGTTGGAGTAGTATG	0.522																																																	0													86.0	68.0	74.0					17																	37318973		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS45664.1	17q12	2014-05-09	2005-11-08	2005-11-08	ENSG00000141748	ENSG00000141748		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	31111	protein-coding gene	gene with protein product			"""ADP-ribosylation factor-like 12"""	ARL12			Standard	NM_001143968		Approved		uc010wea.2	A6NH57		ENST00000269586.7:c.246C>T	17.37:g.37318973G>A				Silent	SNP	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,pfam_MIRO-like,superfamily_P-loop_NTPase,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,prints_Small_GTPase_ARF/SAR,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.S82	ENST00000269586.7	37	c.246	CCDS45664.1	17																																																																																			ARL5C	-	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,pfam_MIRO-like,superfamily_P-loop_NTPase,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,prints_Small_GTPase_ARF/SAR,tigrfam_Small_GTP-bd_dom	ENSG00000141748		0.522	ARL5C-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ARL5C	HGNC	protein_coding	OTTHUMT00000444566.1	-	0.00	58	0	G	NM_001143968		37318973	-1	tier1	-	no_errors	ENST00000269586	ensembl	human	known	74_37	silent	39.34	37	24	SNP	0.999	A
ASCC2	84164	genome.wustl.edu	37	22	30189408	30189408	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr22:30189408G>T	ENST00000397771.2	-	18	2037	c.1860C>A	c.(1858-1860)taC>taA	p.Y620*	ASCC2_ENST00000542393.1_Nonsense_Mutation_p.Y544*|ASCC2_ENST00000307790.3_Nonsense_Mutation_p.Y620*			Q9H1I8	ASCC2_HUMAN	activating signal cointegrator 1 complex subunit 2	620					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					endometrium(3)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(5;0.000103)|Epithelial(10;0.0169)|all cancers(5;0.0259)			GGTTGCCATCGTATGTGTCAT	0.597																																																	0													93.0	68.0	76.0					22																	30189408		2203	4300	6503	SO:0001587	stop_gained	0			AY013289	CCDS13869.1, CCDS56226.1	22q12.1	2004-07-27			ENSG00000100325	ENSG00000100325			24103	protein-coding gene	gene with protein product	"""ASC 1 complex subunit P100"""	614216				12077347, 9847074	Standard	NM_032204		Approved	ASC1p100, FLJ21588, DKFZp586O0223	uc003agr.3	Q9H1I8	OTTHUMG00000067658	ENST00000397771.2:c.1860C>A	22.37:g.30189408G>T	ENSP00000380877:p.Tyr620*		B7Z8E0|F5H6J9|Q4TT54|Q8TAZ0|Q9H711|Q9H9D6	Nonsense_Mutation	SNP	pfam_CUE,superfamily_UBA-like,smart_CUE,pfscan_CUE	p.Y620*	ENST00000397771.2	37	c.1860	CCDS13869.1	22	.	.	.	.	.	.	.	.	.	.	G	35	5.458873	0.96240	.	.	ENSG00000100325	ENST00000307790;ENST00000397771;ENST00000542393	.	.	.	5.23	-3.2	0.05156	.	0.056863	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.5068	11.0476	0.47867	0.5595:0.0:0.4405:0.0	.	.	.	.	X	620;620;544	.	ENSP00000305502:Y620X	Y	-	3	2	ASCC2	28519408	0.171000	0.23029	0.103000	0.21229	0.925000	0.55904	-0.569000	0.05902	-0.643000	0.05473	-0.192000	0.12808	TAC	ASCC2	-	NULL	ENSG00000100325		0.597	ASCC2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ASCC2	HGNC	protein_coding	OTTHUMT00000322127.1		0.00	28	0	G	NM_032204		30189408	-1			no_errors	ENST00000307790	ensembl	human	known	74_37	nonsense	6.67	28	2	SNP	0.986	T
ATP8B5P	158381	genome.wustl.edu	37	9	35451103	35451104	+	RNA	INS	-	-	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr9:35451103_35451104insA	ENST00000430846.1	+	0	3953_3954									ATPase, class I, type 8B, member 5, pseudogene																		AGGAAAACCAGAAAAAAAAAGT	0.347																																																	0																																												0					9p13.3	2010-09-22			ENSG00000179766	ENSG00000179766		"""ATPases / P-type"""	27245	pseudogene	pseudogene	"""flippase expressed in testis splicing form A pseudogene"""					20210903, 19657017	Standard	NR_003582		Approved	FetA	uc010mkn.2		OTTHUMG00000019862		9.37:g.35451112_35451112dupA				RNA	INS	-	NULL	ENST00000430846.1	37	NULL		9																																																																																			ATP8B5P	-	-	ENSG00000179766		0.347	ATP8B5P-002	KNOWN	basic	processed_transcript	ATP8B5P	HGNC	pseudogene	OTTHUMT00000052312.1		0.00	22	0	-	NR_003581.1		35451104	+1	tier1		no_errors	ENST00000430846	ensembl	human	known	74_37	rna	13.33	26	4	INS	0.651:0.639	A
ATXN1	6310	genome.wustl.edu	37	6	16327921	16327921	+	Missense_Mutation	SNP	C	C	A	rs201030692		TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr6:16327921C>A	ENST00000244769.4	-	8	1557	c.621G>T	c.(619-621)caG>caT	p.Q207H	ATXN1_ENST00000436367.1_Missense_Mutation_p.Q207H	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	207	Poly-Gln.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)	p.Q207H(2)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				gctgatgctgctgctgctgct	0.662																																																	2	Substitution - Missense(2)	lung(1)|prostate(1)											5.0	8.0	7.0					6																	16327921		1605	3502	5107	SO:0001583	missense	0			X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.621G>T	6.37:g.16327921C>A	ENSP00000244769:p.Gln207His		Q17S02|Q9UJG2|Q9Y4J1	Missense_Mutation	SNP	pfam_Ataxin-1_HBP1,pfam_Capicua_tscrpt_rep_mod,superfamily_Ataxin-1_HBP1,smart_Ataxin_AXH_dom,pfscan_Ataxin-1_HBP1	p.Q207H	ENST00000244769.4	37	c.621	CCDS34342.1	6	.	.	.	.	.	.	.	.	.	.	c	0.699	-0.791581	0.02884	.	.	ENSG00000124788	ENST00000244769;ENST00000450222;ENST00000436367	T;T	0.56275	0.47;0.47	0.0465	-0.093	0.13652	.	.	.	.	.	T	0.07908	0.0198	N	0.08118	0	0.09310	N	1	D	0.54964	0.969	B	0.38106	0.265	T	0.21042	-1.0257	8	0.35671	T	0.21	.	.	.	.	.	207	P54253	ATX1_HUMAN	H	207	ENSP00000244769:Q207H;ENSP00000416360:Q207H	ENSP00000244769:Q207H	Q	-	3	2	ATXN1	16435900	0.128000	0.22383	0.017000	0.16124	0.068000	0.16541	-0.076000	0.11412	-1.412000	0.02030	-1.404000	0.01136	CAG	ATXN1	-	NULL	ENSG00000124788		0.662	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN1	HGNC	protein_coding	OTTHUMT00000039943.3		0.00	43	0	C	NM_000332		16327921	-1			no_errors	ENST00000244769	ensembl	human	known	74_37	missense	6.25	45	3	SNP	0.022	A
AVPR1A	552	genome.wustl.edu	37	12	63541286	63541286	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr12:63541286C>A	ENST00000299178.2	-	2	1215	c.1110G>T	c.(1108-1110)aaG>aaT	p.K370N		NM_000706.4	NP_000697.1	P37288	V1AR_HUMAN	arginine vasopressin receptor 1A	370					activation of phospholipase C activity (GO:0007202)|blood circulation (GO:0008015)|calcium-mediated signaling (GO:0019722)|cellular response to water deprivation (GO:0042631)|G-protein coupled receptor signaling pathway (GO:0007186)|generation of precursor metabolites and energy (GO:0006091)|grooming behavior (GO:0007625)|maternal aggressive behavior (GO:0002125)|maternal behavior (GO:0042711)|myotube differentiation (GO:0014902)|negative regulation of female receptivity (GO:0007621)|negative regulation of transmission of nerve impulse (GO:0051970)|penile erection (GO:0043084)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular pH reduction (GO:0032849)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of glutamate secretion (GO:0014049)|positive regulation of heart rate (GO:0010460)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of systemic arterial blood pressure (GO:0003084)|positive regulation of vasoconstriction (GO:0045907)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)|response to corticosterone (GO:0051412)|social behavior (GO:0035176)|sperm ejaculation (GO:0042713)|telencephalon development (GO:0021537)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	peptide hormone binding (GO:0017046)|protein kinase C binding (GO:0005080)|vasopressin receptor activity (GO:0005000)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(12)|prostate(2)|skin(1)	26			BRCA - Breast invasive adenocarcinoma(9;0.193)	GBM - Glioblastoma multiforme(28;0.0569)	Conivaptan(DB00872)|Desmopressin(DB00035)|Felypressin(DB00093)|Terlipressin(DB02638)|Tolvaptan(DB06212)|Vasopressin(DB00067)	TGAATTTTTCCTTCATGTTTT	0.403																																																	0													199.0	190.0	193.0					12																	63541286		2203	4300	6503	SO:0001583	missense	0			L25615	CCDS8965.1	12q14-q15	2012-08-08				ENSG00000166148		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	895	protein-coding gene	gene with protein product		600821		AVPR1		8106369	Standard	NM_000706		Approved		uc001sro.2	P37288		ENST00000299178.2:c.1110G>T	12.37:g.63541286C>A	ENSP00000299178:p.Lys370Asn			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_DUF1856,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_Vprs_V1A_rcpt,prints_Vasoprsn_rcpt,prints_GPCR_Rhodpsn	p.K370N	ENST00000299178.2	37	c.1110	CCDS8965.1	12	.	.	.	.	.	.	.	.	.	.	C	1.503	-0.551447	0.03996	.	.	ENSG00000166148	ENST00000550940;ENST00000299178	T;T	0.38077	1.16;1.16	6.06	4.14	0.48551	.	0.652152	0.15926	N	0.237914	T	0.29524	0.0736	L	0.42487	1.325	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.17961	-1.0352	9	.	.	.	-4.6033	10.305	0.43674	0.1324:0.795:0.0:0.0726	.	370	P37288	V1AR_HUMAN	N	151;370	ENSP00000449822:K151N;ENSP00000299178:K370N	.	K	-	3	2	AVPR1A	61827553	0.971000	0.33674	0.017000	0.16124	0.002000	0.02628	0.695000	0.25527	0.797000	0.33971	0.655000	0.94253	AAG	AVPR1A	-	prints_Vprs_V1A_rcpt	ENSG00000166148		0.403	AVPR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AVPR1A	HGNC	protein_coding	OTTHUMT00000406734.1	-	0.00	52	0	C			63541286	-1	tier1	-	no_errors	ENST00000299178	ensembl	human	known	74_37	missense	27.03	54	20	SNP	0.116	A
BAI2	576	genome.wustl.edu	37	1	32222184	32222184	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr1:32222184C>T	ENST00000373658.3	-	4	595	c.254G>A	c.(253-255)cGc>cAc	p.R85H	BAI2_ENST00000398556.3_Missense_Mutation_p.R88H|BAI2_ENST00000398542.1_Missense_Mutation_p.R73H|BAI2_ENST00000257070.4_Missense_Mutation_p.R85H|BAI2_ENST00000373655.2_Missense_Mutation_p.R85H|BAI2_ENST00000398538.1_Missense_Mutation_p.R73H|BAI2_ENST00000527361.1_Missense_Mutation_p.R85H|MIR4254_ENST00000581063.1_RNA|BAI2_ENST00000398547.1_Missense_Mutation_p.R73H	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	85					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		CTGCTCCTGGCGGTTGAAGCG	0.647																																																	0													42.0	41.0	42.0					1																	32222184		2203	4300	6503	SO:0001583	missense	0			AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.254G>A	1.37:g.32222184C>T	ENSP00000362762:p.Arg85His		B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.R85H	ENST00000373658.3	37	c.254	CCDS346.2	1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.185459	0.78677	.	.	ENSG00000121753	ENST00000398556;ENST00000398547;ENST00000373658;ENST00000373655;ENST00000398542;ENST00000257070;ENST00000527361;ENST00000398538;ENST00000420125;ENST00000533175	T;T;T;T;T;T;T;T;T;T	0.53206	1.27;1.47;0.68;0.68;1.64;0.63;0.63;0.71;1.24;1.11	5.04	5.04	0.67666	.	0.000000	0.42964	D	0.000639	T	0.50274	0.1606	L	0.33485	1.01	0.80722	D	1	P;D;B;P;P;B	0.63046	0.834;0.992;0.354;0.916;0.552;0.241	B;P;B;B;B;B	0.56751	0.362;0.805;0.086;0.346;0.124;0.039	T	0.52563	-0.8559	10	0.87932	D	0	.	11.1071	0.48210	0.0:0.9131:0.0:0.0869	.	73;85;73;73;85;85	A2A3C3;O60241-4;O60241-3;A2A3C1;O60241-2;O60241	.;.;.;.;.;BAI2_HUMAN	H	88;73;85;85;73;85;85;73;78;119	ENSP00000381564:R88H;ENSP00000381555:R73H;ENSP00000362762:R85H;ENSP00000362759:R85H;ENSP00000381550:R73H;ENSP00000257070:R85H;ENSP00000435397:R85H;ENSP00000381548:R73H;ENSP00000410921:R78H;ENSP00000437219:R119H	ENSP00000257070:R85H	R	-	2	0	BAI2	31994771	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.694000	0.54742	2.506000	0.84524	0.462000	0.41574	CGC	BAI2	-	NULL	ENSG00000121753		0.647	BAI2-015	KNOWN	basic|CCDS	protein_coding	BAI2	HGNC	protein_coding	OTTHUMT00000381838.1	-	0.00	56	0	C	NM_001703		32222184	-1	tier1	-	no_errors	ENST00000373658	ensembl	human	known	74_37	missense	22.00	39	11	SNP	1.000	T
BCL9L	283149	genome.wustl.edu	37	11	118770824	118770824	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr11:118770824G>T	ENST00000334801.3	-	7	4172	c.3208C>A	c.(3208-3210)Cca>Aca	p.P1070T	BCL9L_ENST00000526143.1_5'UTR	NM_182557.2	NP_872363.1	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	1070	Pro-rich.				canonical Wnt signaling pathway (GO:0060070)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell morphogenesis (GO:0022604)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|transcription coactivator activity (GO:0003713)			NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	56	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		GAAGTGAATGGTAGGCTGGGG	0.637																																																	0													109.0	104.0	106.0					11																	118770824		2200	4295	6495	SO:0001583	missense	0			AB094091	CCDS8403.1	11q23.3	2012-06-06				ENSG00000186174			23688	protein-coding gene	gene with protein product		609004				12964048	Standard	NM_182557		Approved	DLNB11	uc001pug.3	Q86UU0		ENST00000334801.3:c.3208C>A	11.37:g.118770824G>T	ENSP00000335320:p.Pro1070Thr		A1A4C1|Q67FY1|Q6ZWJ0|Q6ZWK2	Missense_Mutation	SNP	pfam_BCL9_beta-catenin-bd_dom	p.P1070T	ENST00000334801.3	37	c.3208	CCDS8403.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.34|17.34	3.365856|3.365856	0.61513|0.61513	.|.	.|.	ENSG00000186174|ENSG00000186174	ENST00000334801;ENST00000526143;ENST00000525300;ENST00000392849;ENST00000431085|ENST00000530293	T|.	0.49139|.	0.79|.	4.38|4.38	4.38|4.38	0.52667|0.52667	.|.	0.000000|.	0.50627|.	D|.	0.000108|.	T|.	0.52141|.	0.1716|.	L|L	0.29908|0.29908	0.895|0.895	0.41569|0.41569	D|D	0.988672|0.988672	B;B|.	0.32573|.	0.376;0.259|.	B;B|.	0.31686|.	0.134;0.063|.	T|.	0.48317|.	-0.9046|.	10|.	0.72032|.	D|.	0.01|.	-8.7603|-8.7603	12.2803|12.2803	0.54760|0.54760	0.0:0.0:0.8306:0.1694|0.0:0.0:0.8306:0.1694	.|.	1065;1070|.	Q86UU0-2;Q86UU0|.	.;BCL9L_HUMAN|.	T|X	1070;1033;363;1070;1070|89	ENSP00000335320:P1070T|.	ENSP00000335320:P1070T|.	P|Y	-|-	1|3	0|2	BCL9L|BCL9L	118276034|118276034	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	5.987000|5.987000	0.70571|0.70571	2.262000|2.262000	0.75019|0.75019	0.561000|0.561000	0.74099|0.74099	CCA|TAC	BCL9L	-	NULL	ENSG00000186174		0.637	BCL9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL9L	HGNC	protein_coding	OTTHUMT00000389653.1		0.00	57	0	G	NM_182557		118770824	-1			no_errors	ENST00000334801	ensembl	human	known	74_37	missense	11.11	32	4	SNP	1.000	T
BMP6	654	genome.wustl.edu	37	6	7845488	7845488	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr6:7845488G>T	ENST00000283147.6	+	2	939	c.780G>T	c.(778-780)aaG>aaT	p.K260N		NM_001718.4	NP_001709.1	P22004	BMP6_HUMAN	bone morphogenetic protein 6	260					BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular response to mechanical stimulus (GO:0071260)|endochondral ossification (GO:0001958)|eye development (GO:0001654)|growth (GO:0040007)|immune response (GO:0006955)|inflammatory response (GO:0006954)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|osteoblast differentiation (GO:0001649)|positive regulation of aldosterone biosynthetic process (GO:0032349)|positive regulation of aldosterone secretion (GO:2000860)|positive regulation of bone mineralization (GO:0030501)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to activity (GO:0014823)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to retinoic acid (GO:0032526)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|type B pancreatic cell development (GO:0003323)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)|protein heterodimerization activity (GO:0046982)			breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(6)|ovary(1)|prostate(1)	23	Ovarian(93;0.0721)					GCATCTACAAGGACTGTGTTA	0.468																																																	0													110.0	109.0	109.0					6																	7845488		2203	4300	6503	SO:0001583	missense	0			AF083030	CCDS4503.1	6p24-p23	2014-01-30	2003-10-06		ENSG00000153162	ENSG00000153162		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1073	protein-coding gene	gene with protein product		112266	"""vegetal related growth factor (TGFB-related)"""	VGR		1427904, 1453478	Standard	NM_001718		Approved	VGR1	uc003mxu.4	P22004	OTTHUMG00000014217	ENST00000283147.6:c.780G>T	6.37:g.7845488G>T	ENSP00000283147:p.Lys260Asn		Q5TCP3	Missense_Mutation	SNP	pfam_TGF-b_N,pfam_TGF-b_C,smart_TGF-b_C	p.K260N	ENST00000283147.6	37	c.780	CCDS4503.1	6	.	.	.	.	.	.	.	.	.	.	G	19.76	3.888233	0.72524	.	.	ENSG00000153162	ENST00000537240;ENST00000283147;ENST00000540959	T	0.67865	-0.29	5.41	3.62	0.41486	Transforming growth factor-beta, N-terminal (1);	0.098532	0.64402	D	0.000002	T	0.75583	0.3869	M	0.82132	2.575	0.58432	D	0.999995	D	0.89917	1.0	D	0.91635	0.999	T	0.79636	-0.1721	10	0.87932	D	0	.	11.0898	0.48108	0.149:0.0:0.851:0.0	.	260	P22004	BMP6_HUMAN	N	182;260;223	ENSP00000283147:K260N	ENSP00000283147:K260N	K	+	3	2	BMP6	7790487	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.377000	0.59562	1.278000	0.44430	0.557000	0.71058	AAG	BMP6	-	pfam_TGF-b_N	ENSG00000153162		0.468	BMP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP6	HGNC	protein_coding	OTTHUMT00000039794.1		0.00	45	0	G	NM_001718		7845488	+1			no_errors	ENST00000283147	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	T
C5orf42	65250	genome.wustl.edu	37	5	37198846	37198846	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr5:37198846C>A	ENST00000508244.1	-	19	3723	c.3630G>T	c.(3628-3630)tgG>tgT	p.W1210C	C5orf42_ENST00000425232.2_Missense_Mutation_p.W1210C|C5orf42_ENST00000274258.7_Missense_Mutation_p.W91C			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	1210						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			GCAATATATACCACTGTGCTA	0.393																																																	0													94.0	96.0	95.0					5																	37198846		2203	4300	6503	SO:0001583	missense	0				CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.3630G>T	5.37:g.37198846C>A	ENSP00000421690:p.Trp1210Cys		A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	superfamily_Quino_amine_DH_bsu	p.W1210C	ENST00000508244.1	37	c.3630	CCDS34146.2	5	.	.	.	.	.	.	.	.	.	.	C	29.1	4.975235	0.92919	.	.	ENSG00000197603	ENST00000508244;ENST00000425232;ENST00000274258;ENST00000514429;ENST00000388739	T;T;T;T	0.76709	-0.89;-0.89;-1.04;-1.02	5.28	5.28	0.74379	.	0.000000	0.45126	D	0.000382	D	0.83184	0.5199	L	0.29908	0.895	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.85181	0.1004	10	0.87932	D	0	.	19.2722	0.94015	0.0:1.0:0.0:0.0	.	1210;91	E9PH94;Q9H799	.;CE042_HUMAN	C	1210;1210;91;258;91	ENSP00000421690:W1210C;ENSP00000389014:W1210C;ENSP00000274258:W91C;ENSP00000424223:W258C	ENSP00000274258:W91C	W	-	3	0	C5orf42	37234603	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	6.539000	0.73856	2.626000	0.88956	0.655000	0.94253	TGG	C5orf42	-	NULL	ENSG00000197603		0.393	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C5orf42	HGNC	protein_coding	OTTHUMT00000360806.1	-	0.00	54	0	C	NM_023073		37198846	-1	tier1	-	no_errors	ENST00000425232	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	A
C6orf222	389384	genome.wustl.edu	37	6	36290146	36290146	+	Silent	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr6:36290146G>T	ENST00000437635.2	-	9	1722	c.1545C>A	c.(1543-1545)tcC>tcA	p.S515S		NM_001010903.4	NP_001010903.3	P0C671	CF222_HUMAN	chromosome 6 open reading frame 222	515										breast(4)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|skin(4)|urinary_tract(4)	26						CTCTAGCCTGGGAGGGTGCTT	0.577																																																	0													135.0	110.0	119.0					6																	36290146		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS34439.1	6p21.31	2012-02-22			ENSG00000189325	ENSG00000189325			33769	protein-coding gene	gene with protein product							Standard	NM_001010903		Approved	DKFZp779B1540	uc003oly.3	P0C671	OTTHUMG00000014591	ENST00000437635.2:c.1545C>A	6.37:g.36290146G>T			B2RTY8	Silent	SNP	NULL	p.S515	ENST00000437635.2	37	c.1545	CCDS34439.1	6																																																																																			C6orf222	-	NULL	ENSG00000189325		0.577	C6orf222-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf222	HGNC	protein_coding	OTTHUMT00000040338.2		0.00	62	0	G	NM_001010903		36290146	-1			no_errors	ENST00000437635	ensembl	human	known	74_37	silent	5.71	66	4	SNP	0.713	T
C6orf118	168090	genome.wustl.edu	37	6	165693522	165693522	+	3'UTR	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr6:165693522G>T	ENST00000230301.8	-	0	1454				C6orf118_ENST00000494696.2_5'UTR	NM_144980.3	NP_659417.2	Q5T5N4	CF118_HUMAN	chromosome 6 open reading frame 118											breast(1)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)		ATTTCCACTGGCCATTTGTTC	0.328																																																	0													145.0	128.0	134.0					6																	165693522		2203	4298	6501	SO:0001624	3_prime_UTR_variant	0				CCDS5288.1	6q27	2012-02-06			ENSG00000112539	ENSG00000112539			21233	protein-coding gene	gene with protein product							Standard	NM_144980		Approved	MGC23884, bA85G2.1	uc003qum.4	Q5T5N4	OTTHUMG00000015984	ENST00000230301.8:c.*24C>A	6.37:g.165693522G>T			Q8TC11	RNA	SNP	-	NULL	ENST00000230301.8	37	NULL	CCDS5288.1	6																																																																																			C6orf118	-	-	ENSG00000112539		0.328	C6orf118-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C6orf118	HGNC	protein_coding	OTTHUMT00000043026.1	-	0.00	30	0	G	NM_144980		165693522	-1	tier1	-	no_errors	ENST00000491176	ensembl	human	known	74_37	rna	6.67	56	4	SNP	0.000	T
CACNA1B	774	genome.wustl.edu	37	9	140777281	140777281	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr9:140777281G>T	ENST00000371372.1	+	3	621	c.476G>T	c.(475-477)gGc>gTc	p.G159V	CACNA1B_ENST00000371357.1_Missense_Mutation_p.G159V|CACNA1B_ENST00000371355.4_Missense_Mutation_p.G159V|CACNA1B_ENST00000277551.2_Missense_Mutation_p.G159V|CACNA1B_ENST00000277549.5_5'UTR|RP11-188C12.3_ENST00000371390.1_RNA|CACNA1B_ENST00000371363.1_Missense_Mutation_p.G159V	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	159					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	TTCCACAAGGGCTCTTACCTG	0.592																																																	0													205.0	217.0	213.0					9																	140777281		2118	4221	6339	SO:0001583	missense	0			AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.476G>T	9.37:g.140777281G>T	ENSP00000360423:p.Gly159Val		B1AQK5	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_hand_dom,prints_VDCCAlpha1,prints_VDCC_N_a1su,prints_PKD_2	p.G159V	ENST00000371372.1	37	c.476	CCDS59522.1	9	.	.	.	.	.	.	.	.	.	.	G	17.97	3.517734	0.64634	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000371363;ENST00000371357;ENST00000371355	D;D;D;D;D	0.98381	-4.9;-4.9;-4.9;-4.9;-4.9	4.57	4.57	0.56435	.	0.062490	0.64402	D	0.000004	D	0.99067	0.9680	M	0.89287	3.02	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99651	1.0991	10	0.87932	D	0	.	17.3563	0.87336	0.0:0.0:1.0:0.0	.	159	B1AQK6	.	V	159	ENSP00000360423:G159V;ENSP00000277551:G159V;ENSP00000360414:G159V;ENSP00000360408:G159V;ENSP00000360406:G159V	ENSP00000277551:G159V	G	+	2	0	CACNA1B	139897102	1.000000	0.71417	1.000000	0.80357	0.715000	0.41141	9.633000	0.98432	2.070000	0.61991	0.467000	0.42956	GGC	CACNA1B	-	pfam_Ion_trans_dom	ENSG00000148408		0.592	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1B	HGNC	protein_coding	OTTHUMT00000055380.1		0.00	118	0	G	NM_000718		140777281	+1			no_errors	ENST00000371355	ensembl	human	known	74_37	missense	5.38	88	5	SNP	1.000	T
CARD10	29775	genome.wustl.edu	37	22	37891912	37891912	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr22:37891912C>A	ENST00000403299.1	-	15	2374	c.2158G>T	c.(2158-2160)Gat>Tat	p.D720Y	CARD10_ENST00000251973.5_Missense_Mutation_p.D720Y|CARD10_ENST00000406271.3_Missense_Mutation_p.D434Y			Q9BWT7	CAR10_HUMAN	caspase recruitment domain family, member 10	720					activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein complex assembly (GO:0006461)|regulation of apoptotic process (GO:0042981)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)	receptor signaling complex scaffold activity (GO:0030159)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	17	Melanoma(58;0.0574)					GCATGGGGATCTGCCCTCTCA	0.607																																																	0													76.0	65.0	69.0					22																	37891912		2203	4300	6503	SO:0001583	missense	0			AF086324	CCDS13948.1	22q13.1	2008-05-22			ENSG00000100065	ENSG00000100065			16422	protein-coding gene	gene with protein product		607209				11259443, 11356195	Standard	NM_014550		Approved	CARMA3, BIMP1	uc003asu.1	Q9BWT7	OTTHUMG00000150592	ENST00000403299.1:c.2158G>T	22.37:g.37891912C>A	ENSP00000384570:p.Asp720Tyr		Q14CQ8|Q5TFG6|Q8NC81|Q9UGR5|Q9UGR6|Q9Y3H0	Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like_dom,pfscan_CARD	p.D720Y	ENST00000403299.1	37	c.2158	CCDS13948.1	22	.	.	.	.	.	.	.	.	.	.	C	21.6	4.174980	0.78564	.	.	ENSG00000100065	ENST00000403299;ENST00000406271;ENST00000251973;ENST00000437756;ENST00000433485	T;T;T;T	0.50001	0.76;2.49;0.76;1.18	4.98	3.96	0.45880	.	0.115718	0.56097	D	0.000029	T	0.62233	0.2411	M	0.66939	2.045	0.38870	D	0.956669	P;D	0.67145	0.938;0.996	P;D	0.65773	0.671;0.938	T	0.68006	-0.5523	10	0.87932	D	0	-30.9919	11.0453	0.47855	0.0:0.9136:0.0:0.0864	.	720;434	Q9BWT7;Q8NC81	CAR10_HUMAN;.	Y	720;434;720;361;192	ENSP00000384570:D720Y;ENSP00000385799:D434Y;ENSP00000251973:D720Y;ENSP00000416239:D361Y	ENSP00000251973:D720Y	D	-	1	0	CARD10	36221858	0.996000	0.38824	0.794000	0.32065	0.980000	0.70556	3.803000	0.55560	2.289000	0.77006	0.561000	0.74099	GAT	CARD10	-	NULL	ENSG00000100065		0.607	CARD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD10	HGNC	protein_coding	OTTHUMT00000318997.1		0.00	34	0	C	NM_014550		37891912	-1			no_errors	ENST00000251973	ensembl	human	known	74_37	missense	5.13	37	2	SNP	0.972	A
CASZ1	54897	genome.wustl.edu	37	1	10707929	10707929	+	Silent	SNP	C	C	T	rs61736954	byFrequency	TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr1:10707929C>T	ENST00000377022.3	-	16	3743	c.3426G>A	c.(3424-3426)tcG>tcA	p.S1142S	CASZ1_ENST00000344008.5_Silent_p.S1142S|RP4-734G22.3_ENST00000606802.1_RNA	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	1142	Pro-rich.				multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		TTGCCAAGGGCGAGGCGGGCA	0.642													C|||	73	0.0145767	0.0537	0.0029	5008	,	,		17031	0.0		0.0	False		,,,				2504	0.0																0								C	,	210,4196	127.4+/-164.3	6,198,1999	75.0	79.0	78.0		3426,3426	-1.4	0.9	1	dbSNP_129	78	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	CASZ1	NM_001079843.1,NM_017766.3	,	6,199,6298	TT,TC,CC		0.0116,4.7662,1.6223	,	1142/1760,1142/1167	10707929	211,12795	2203	4300	6503	SO:0001819	synonymous_variant	0			AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.3426G>A	1.37:g.10707929C>T			Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S1142	ENST00000377022.3	37	c.3426	CCDS41246.1	1																																																																																			CASZ1	-	NULL	ENSG00000130940		0.642	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CASZ1	HGNC	protein_coding	OTTHUMT00000005673.2		0.00	53	0	C	NM_017766		10707929	-1			no_errors	ENST00000377022	ensembl	human	known	74_37	silent	5.63	67	4	SNP	0.560	T
CCDC103	388389	genome.wustl.edu	37	17	42980014	42980015	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr17:42980014_42980015delAG	ENST00000417826.2	+	4	653_654	c.558_559delAG	c.(556-561)gcagagfs	p.E187fs	FAM187A_ENST00000412523.2_Intron|AC015936.3_ENST00000441312.1_RNA|FAM187A_ENST00000331733.4_5'UTR|CCDC103_ENST00000410006.2_Frame_Shift_Del_p.E187fs|EFTUD2_ENST00000426333.2_5'Flank	NM_001258399.1|NM_213607.2	NP_001245328.1|NP_998772.1	Q8IW40	CC103_HUMAN	coiled-coil domain containing 103	187					axonemal dynein complex assembly (GO:0070286)|cell projection organization (GO:0030030)|cilium movement (GO:0003341)|determination of digestive tract left/right asymmetry (GO:0071907)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|inner dynein arm assembly (GO:0036159)|outer dynein arm assembly (GO:0036158)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|motile cilium (GO:0031514)	protein homodimerization activity (GO:0042803)	p.E187K(1)		endometrium(1)|kidney(1)|large_intestine(3)|prostate(1)|skin(1)	7		Prostate(33;0.109)				TGAGCCGGGCAGAGAGAGAGAG	0.644																																																	1	Substitution - Missense(1)	large_intestine(1)																																								SO:0001589	frameshift_variant	0			AK023156	CCDS11490.1, CCDS58554.1	17q21.31	2013-02-22			ENSG00000167131	ENSG00000167131			32700	protein-coding gene	gene with protein product		614677				22581229	Standard	NM_213607		Approved	FLJ13094, FLJ34211, PR46b, CILD17	uc031ray.1	Q8IW40	OTTHUMG00000154264	ENST00000417826.2:c.558_559delAG	17.37:g.42980024_42980025delAG	ENSP00000391692:p.Glu187fs		A8K145|B8ZZU0	Frame_Shift_Del	DEL	NULL	p.S190fs	ENST00000417826.2	37	c.558_559	CCDS11490.1	17																																																																																			CCDC103	-	NULL	ENSG00000167131		0.644	CCDC103-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC103	HGNC	protein_coding	OTTHUMT00000334578.1		0.00	36	0	AG	NM_213607		42980015	+1	tier1		no_errors	ENST00000410006	ensembl	human	known	74_37	frame_shift_del	16.67	20	4	DEL	0.000:0.999	-
CCDC151	115948	genome.wustl.edu	37	19	11537295	11537295	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr19:11537295C>G	ENST00000356392.4	-	6	898	c.811G>C	c.(811-813)Gag>Cag	p.E271Q	CCDC151_ENST00000586836.1_Missense_Mutation_p.E80Q|CCDC151_ENST00000545100.1_Missense_Mutation_p.E217Q|CCDC151_ENST00000591179.1_Missense_Mutation_p.E211Q	NM_145045.4	NP_659482.3	A5D8V7	CC151_HUMAN	coiled-coil domain containing 151	271										endometrium(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)	12						TTGAGGGCCTCTTGGTTCACC	0.622																																																	0													66.0	75.0	72.0					19																	11537295		2139	4235	6374	SO:0001583	missense	0				CCDS42501.1	19p13.2	2014-02-20				ENSG00000198003			28303	protein-coding gene	gene with protein product		615956				24067530	Standard	NM_145045		Approved	MGC20983	uc002mrs.3	A5D8V7		ENST00000356392.4:c.811G>C	19.37:g.11537295C>G	ENSP00000348757:p.Glu271Gln		B4DXT0|Q96CG5	Missense_Mutation	SNP	NULL	p.E271Q	ENST00000356392.4	37	c.811	CCDS42501.1	19	.	.	.	.	.	.	.	.	.	.	C	17.58	3.425253	0.62733	.	.	ENSG00000198003	ENST00000545100;ENST00000356392;ENST00000543934	D;D	0.83992	-1.79;-1.79	4.57	2.41	0.29592	.	0.388420	0.27976	N	0.017082	D	0.86108	0.5854	L	0.57536	1.79	0.29858	N	0.827909	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.76575	0.988;0.988;0.988	T	0.78949	-0.2002	10	0.27785	T	0.31	-23.4808	8.2506	0.31715	0.0:0.7994:0.0:0.2006	.	271;271;251	B3KPH7;A5D8V7;B4DG09	.;CC151_HUMAN;.	Q	217;271;250	ENSP00000442987:E217Q;ENSP00000348757:E271Q	ENSP00000348757:E271Q	E	-	1	0	CCDC151	11398295	0.940000	0.31905	0.977000	0.42913	0.872000	0.50106	1.928000	0.40104	1.052000	0.40392	0.561000	0.74099	GAG	CCDC151	-	NULL	ENSG00000198003		0.622	CCDC151-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC151	HGNC	protein_coding	OTTHUMT00000458800.1	-	0.00	39	0	C	NM_145045		11537295	-1	tier1	-	no_errors	ENST00000356392	ensembl	human	known	74_37	missense	20.00	32	8	SNP	0.849	G
CCDC180	100499483	genome.wustl.edu	37	9	100133895	100133895	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr9:100133895G>T	ENST00000357054.1	+	46	5409	c.4474G>T	c.(4474-4476)Ggc>Tgc	p.G1492C	CCDC180_ENST00000529487.1_Missense_Mutation_p.G1547C|RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000375202.2_Missense_Mutation_p.G1547C|CCDC180_ENST00000395220.1_3'UTR			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	1492						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.G1492C(1)|p.G1547C(1)									CAGAAGGAATGGCCAGGTTTT	0.507																																																	2	Substitution - Missense(2)	lung(2)											130.0	109.0	116.0					9																	100133895		2203	4300	6503	SO:0001583	missense	0			AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.4474G>T	9.37:g.100133895G>T	ENSP00000349562:p.Gly1492Cys		Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Missense_Mutation	SNP	NULL	p.G1547C	ENST00000357054.1	37	c.4639		9	.	.	.	.	.	.	.	.	.	.	G	14.67	2.604942	0.46423	.	.	ENSG00000197816	ENST00000357054;ENST00000375202;ENST00000529487	T;T;T	0.49139	0.79;0.79;0.79	5.29	-0.949	0.10376	.	0.667620	0.14901	N	0.291805	T	0.52008	0.1708	L	0.40543	1.245	0.09310	N	1	D;D	0.64830	0.994;0.994	P;D	0.64410	0.861;0.925	T	0.47535	-0.9110	10	0.66056	D	0.02	-3.4992	8.9795	0.35957	0.4892:0.0:0.5108:0.0	.	1686;1492	B7ZMG3;Q9P1Z9	.;CI174_HUMAN	C	1492;1547;1547	ENSP00000349562:G1492C;ENSP00000364348:G1547C;ENSP00000434727:G1547C	ENSP00000349562:G1492C	G	+	1	0	C9orf174	99173716	0.000000	0.05858	0.000000	0.03702	0.051000	0.14879	-0.254000	0.08781	-0.389000	0.07786	0.561000	0.74099	GGC	CCDC180	-	NULL	ENSG00000197816		0.507	CCDC180-201	KNOWN	basic	protein_coding	CCDC180	HGNC	protein_coding			0.00	45	0	G	NM_020893		100133895	+1			no_errors	ENST00000375202	ensembl	human	known	74_37	missense	6.25	30	2	SNP	0.002	T
CCDC65	85478	genome.wustl.edu	37	12	49298842	49298842	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr12:49298842G>C	ENST00000320516.4	+	2	434	c.246G>C	c.(244-246)gaG>gaC	p.E82D	RP11-302B13.5_ENST00000398092.4_Intron|CCDC65_ENST00000266984.5_Missense_Mutation_p.E82D	NM_033124.4	NP_149115.2	Q8IXS2	CCD65_HUMAN	coiled-coil domain containing 65	82										breast(1)|large_intestine(4)|lung(7)|ovary(1)|skin(2)	15						AGGACATTGAGATCCTCAGCC	0.453																																																	0													178.0	145.0	157.0					12																	49298842		2203	4300	6503	SO:0001583	missense	0				CCDS8772.1	12q13.12	2014-07-18			ENSG00000139537	ENSG00000139537			29937	protein-coding gene	gene with protein product		611088				17089017, 21700706	Standard	NM_033124		Approved	NYD-SP28, FLJ35732, FAP250, CILD27	uc001rso.3	Q8IXS2		ENST00000320516.4:c.246G>C	12.37:g.49298842G>C	ENSP00000312706:p.Glu82Asp		A6NJG5|B2RBE2|Q8N7G4|Q8NA91|Q96JA0	Missense_Mutation	SNP	NULL	p.E82D	ENST00000320516.4	37	c.246	CCDS8772.1	12	.	.	.	.	.	.	.	.	.	.	G	18.10	3.547423	0.65311	.	.	ENSG00000139537	ENST00000266984;ENST00000552942;ENST00000320516	T;T;T	0.37411	1.2;4.29;1.21	5.0	3.1	0.35709	.	0.312795	0.33772	N	0.004573	T	0.47673	0.1458	L	0.56124	1.755	0.34898	D	0.746217	D	0.69078	0.997	D	0.64042	0.921	T	0.56414	-0.7983	10	0.34782	T	0.22	-26.0924	9.7827	0.40658	0.1709:0.0:0.8291:0.0	.	82	Q8IXS2	CCD65_HUMAN	D	82	ENSP00000266984:E82D;ENSP00000446569:E82D;ENSP00000312706:E82D	ENSP00000266984:E82D	E	+	3	2	CCDC65	47585109	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.939000	0.40213	0.758000	0.33059	0.655000	0.94253	GAG	CCDC65	-	NULL	ENSG00000139537		0.453	CCDC65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC65	HGNC	protein_coding	OTTHUMT00000408922.1	-	0.00	25	0	G	NM_033124		49298842	+1	tier1	-	no_errors	ENST00000266984	ensembl	human	known	74_37	missense	32.73	37	18	SNP	1.000	C
CDH18	1016	genome.wustl.edu	37	5	19721493	19721493	+	Silent	SNP	G	G	T	rs201475677		TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr5:19721493G>T	ENST00000507958.1	-	7	1596	c.606C>A	c.(604-606)ctC>ctA	p.L202L	CDH18_ENST00000382275.1_Silent_p.L202L|CDH18_ENST00000502796.1_Silent_p.L202L|CDH18_ENST00000511273.1_Silent_p.L202L|CDH18_ENST00000274170.4_Silent_p.L202L|CDH18_ENST00000506372.1_Silent_p.L202L			Q13634	CAD18_HUMAN	cadherin 18, type 2	202	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					GTTGTCCTTGGAGAATGCTGT	0.473																																																	0													164.0	144.0	151.0					5																	19721493		2203	4300	6503	SO:0001819	synonymous_variant	0			U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.606C>A	5.37:g.19721493G>T			A8K0I2|B4DHG6|Q8N5Z2	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L202	ENST00000507958.1	37	c.606	CCDS3889.1	5																																																																																			CDH18	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000145526		0.473	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CDH18	HGNC	protein_coding	OTTHUMT00000366747.1		0.00	66	0	G	NM_004934		19721493	-1			no_errors	ENST00000274170	ensembl	human	known	74_37	silent	5.56	68	4	SNP	1.000	T
CDHR3	222256	genome.wustl.edu	37	7	105603730	105603730	+	De_novo_Start_OutOfFrame	SNP	T	T	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr7:105603730T>A	ENST00000317716.9	+	0	46				CDHR3_ENST00000541203.1_5'Flank|CDHR3_ENST00000478080.1_De_novo_Start_OutOfFrame|CDHR3_ENST00000542731.1_De_novo_Start_OutOfFrame|CDHR3_ENST00000470188.1_Intron|CDHR3_ENST00000343407.5_De_novo_Start_OutOfFrame	NM_152750.4	NP_689963.2	Q6ZTQ4	CDHR3_HUMAN	cadherin-related family member 3						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(1)	23						CTGTGGCTAATGTGCTGGAAG	0.493																																																	0													188.0	184.0	185.0					7																	105603730		1984	4160	6144			0			AK126338	CCDS47684.1, CCDS75651.1	7q22.2	2011-07-01			ENSG00000128536	ENSG00000128536		"""Cadherins / Cadherin-related"""	26308	protein-coding gene	gene with protein product		615610					Standard	NM_152750		Approved	FLJ44366, FLJ23834, CDH28	uc003vdl.4	Q6ZTQ4	OTTHUMG00000157520	ENST00000317716.9:c.-35T>A	7.37:g.105603730T>A			Q8TCI7	RNA	SNP	-	NULL	ENST00000317716.9	37	NULL	CCDS47684.1	7																																																																																			CDHR3	-	-	ENSG00000128536		0.493	CDHR3-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDHR3	HGNC	protein_coding	OTTHUMT00000349025.2	-	0.00	42	0	T	NM_152750		105603730	+1	tier1	-	no_errors	ENST00000461766	ensembl	human	known	74_37	rna	31.43	24	11	SNP	0.000	A
CEP250	11190	genome.wustl.edu	37	20	34084539	34084539	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr20:34084539G>T	ENST00000397527.1	+	25	4021	c.3301G>T	c.(3301-3303)Gct>Tct	p.A1101S	CEP250_ENST00000342580.4_Missense_Mutation_p.A1045S	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa	1101	Gln/Glu-rich.				centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			AGAGCTCAGTGCTCAGGTACT	0.527																																																	0													48.0	46.0	47.0					20																	34084539		2203	4300	6503	SO:0001583	missense	0			AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.3301G>T	20.37:g.34084539G>T	ENSP00000380661:p.Ala1101Ser		E1P5Q3|O14812|O60588|Q9H450	Missense_Mutation	SNP	superfamily_Prefoldin	p.A1101S	ENST00000397527.1	37	c.3301	CCDS13255.1	20	.	.	.	.	.	.	.	.	.	.	G	8.020	0.759440	0.15846	.	.	ENSG00000126001	ENST00000397527;ENST00000342580	T;T	0.10005	2.92;2.93	4.81	0.603	0.17541	.	1.012730	0.07905	N	0.973345	T	0.04861	0.0131	N	0.12182	0.205	0.20196	N	0.999927	B	0.13145	0.007	B	0.14023	0.01	T	0.45745	-0.9240	10	0.09084	T	0.74	.	3.679	0.08304	0.3582:0.0:0.4772:0.1646	.	1101	Q9BV73	CP250_HUMAN	S	1101;1045	ENSP00000380661:A1101S;ENSP00000341541:A1045S	ENSP00000341541:A1045S	A	+	1	0	CEP250	33547953	0.101000	0.21875	0.952000	0.39060	0.926000	0.56050	0.213000	0.17521	-0.004000	0.14419	0.650000	0.86243	GCT	CEP250	-	NULL	ENSG00000126001		0.527	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP250	HGNC	protein_coding	OTTHUMT00000078877.7	-	0.00	48	0	G	NM_007186		34084539	+1	tier1	-	no_errors	ENST00000397527	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.931	T
CHMP1A	5119	genome.wustl.edu	37	16	89720321	89720321	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr16:89720321G>T	ENST00000397901.3	-	2	274	c.18C>A	c.(16-18)ttC>ttA	p.F6L	CHMP1A_ENST00000253475.5_Intron|CHMP1A_ENST00000535997.2_Intron|CHMP1A_ENST00000547614.1_Intron|CHMP1A_ENST00000550102.1_Missense_Mutation_p.F6L	NM_002768.3	NP_002759.2	Q9HD42	CHM1A_HUMAN	charged multivesicular body protein 1A	6					cytokinesis (GO:0000910)|gene silencing (GO:0016458)|mitotic chromosome condensation (GO:0007076)|negative regulation of transcription by glucose (GO:0045014)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|proteolysis (GO:0006508)|transcription, DNA-templated (GO:0006351)|vesicle-mediated transport (GO:0016192)	condensed nuclear chromosome (GO:0000794)|early endosome (GO:0005769)|endomembrane system (GO:0012505)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|nuclear matrix (GO:0016363)	metallopeptidase activity (GO:0008237)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(1)|ovary(1)	3		all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.048)		CCTTCAACTGGAACAGGGTAT	0.502																																																	0													149.0	147.0	148.0					16																	89720321		1991	4160	6151	SO:0001583	missense	0			U58048	CCDS45552.1	16q24.3	2011-09-21	2011-09-21	2007-03-20	ENSG00000131165	ENSG00000131165		"""Charged multivesicular body proteins"""	8740	protein-coding gene	gene with protein product		164010	"""procollagen (type III) N-endopeptidase"", ""chromatin modifying protein 1A"""	PRSM1, PCOLN3		11559748, 11559747	Standard	NM_002768		Approved	KIAA0047, CHMP1, Vps46A	uc002fnu.4	Q9HD42	OTTHUMG00000169521	ENST00000397901.3:c.18C>A	16.37:g.89720321G>T	ENSP00000380998:p.Phe6Leu		A2RU09|Q14468|Q15779|Q96G31	Missense_Mutation	SNP	pfam_Snf7	p.F6L	ENST00000397901.3	37	c.18	CCDS45552.1	16	.	.	.	.	.	.	.	.	.	.	G	16.85	3.236828	0.58886	.	.	ENSG00000131165	ENST00000397901;ENST00000550102	T;T	0.70164	-0.46;-0.46	5.47	5.47	0.80525	.	.	.	.	.	T	0.68577	0.3016	M	0.82433	2.59	0.80722	D	1	B	0.15719	0.014	B	0.17722	0.019	T	0.66172	-0.5990	9	0.39692	T	0.17	.	12.3155	0.54953	0.078:0.0:0.922:0.0	.	6	Q9HD42	CHM1A_HUMAN	L	6	ENSP00000380998:F6L;ENSP00000449243:F6L	ENSP00000380998:F6L	F	-	3	2	CHMP1A	88247822	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.504000	0.53347	2.562000	0.86427	0.561000	0.74099	TTC	CHMP1A	-	pfam_Snf7	ENSG00000131165		0.502	CHMP1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHMP1A	HGNC	protein_coding	OTTHUMT00000404581.1	-	0.00	51	0	G	NM_002768		89720321	-1	tier1	-	no_errors	ENST00000397901	ensembl	human	known	74_37	missense	9.52	57	6	SNP	1.000	T
CHPF	79586	genome.wustl.edu	37	2	220404553	220404553	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr2:220404553C>T	ENST00000243776.6	-	4	2128	c.1880G>A	c.(1879-1881)cGc>cAc	p.R627H	CHPF_ENST00000535926.1_Missense_Mutation_p.R465H	NM_024536.5	NP_078812	Q8IZ52	CHSS2_HUMAN	chondroitin polymerizing factor	627					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	21		Renal(207;0.0183)		Epithelial(149;3.02e-08)|all cancers(144;3.41e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		CATGCGGCAGCGGTTCAGGAA	0.637																																																	0													83.0	87.0	86.0					2																	220404553		2202	4296	6498	SO:0001583	missense	0			BC008878	CCDS2443.1, CCDS56169.1	2q35	2014-02-12			ENSG00000123989	ENSG00000123989	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24291	protein-coding gene	gene with protein product	"""chondroitin sulfate synthase 2"""	610405				11230166, 12716890	Standard	NM_024536		Approved	CSS2, CHSY2	uc002vmc.4	Q8IZ52	OTTHUMG00000058929	ENST00000243776.6:c.1880G>A	2.37:g.220404553C>T	ENSP00000243776:p.Arg627His		B4DXU0|Q6UXD6|Q7L4G1|Q9H0F8|Q9H618	Missense_Mutation	SNP	pfam_Chond_GalNAc	p.R627H	ENST00000243776.6	37	c.1880	CCDS2443.1	2	.	.	.	.	.	.	.	.	.	.	C	26.9	4.777538	0.90195	.	.	ENSG00000123989	ENST00000243776;ENST00000535926	T;T	0.53206	0.63;0.63	4.62	4.62	0.57501	.	0.000000	0.85682	D	0.000000	T	0.72803	0.3506	M	0.85859	2.78	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.78440	-0.2203	10	0.87932	D	0	-25.6743	18.0261	0.89269	0.0:1.0:0.0:0.0	.	627	Q8IZ52	CHSS2_HUMAN	H	627;465	ENSP00000243776:R627H;ENSP00000445571:R465H	ENSP00000243776:R627H	R	-	2	0	CHPF	220112797	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.247000	0.78257	2.563000	0.86464	0.561000	0.74099	CGC	CHPF	-	pfam_Chond_GalNAc	ENSG00000123989		0.637	CHPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHPF	HGNC	protein_coding	OTTHUMT00000130268.1		0.00	18	0	C	NM_024536		220404553	-1			no_errors	ENST00000243776	ensembl	human	known	74_37	missense	20.00	16	4	SNP	1.000	T
CLCNKA	1187	genome.wustl.edu	37	1	16360282	16360282	+	3'UTR	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr1:16360282G>T	ENST00000331433.4	+	0	2212				CLCNKA_ENST00000464764.1_3'UTR|CLCNKA_ENST00000375692.1_3'UTR|CLCNKA_ENST00000420078.1_3'UTR			P51800	CLCKA_HUMAN	chloride channel, voltage-sensitive Ka						excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|metal ion binding (GO:0046872)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(1)	19		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)	Niflumic Acid(DB04552)	TGGCATAACAGGCAACTCTAA	0.577																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS167.1, CCDS41269.1, CCDS57973.1	1p36	2012-09-26	2012-02-23		ENSG00000186510	ENSG00000186510		"""Ion channels / Chloride channels : Voltage-sensitive"""	2026	protein-coding gene	gene with protein product		602024	"""chloride channel Ka"""			8544406	Standard	NM_004070		Approved	hClC-Ka	uc001axu.3	P51800	OTTHUMG00000009529	ENST00000331433.4:c.*129G>T	1.37:g.16360282G>T			B4DPD3|E7EPH6|Q5T5P8|Q5T5Q4|Q7Z6D1|Q86VT1	RNA	SNP	-	NULL	ENST00000331433.4	37	NULL	CCDS167.1	1																																																																																			CLCNKA	-	-	ENSG00000186510		0.577	CLCNKA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLCNKA	HGNC	protein_coding	OTTHUMT00000026326.1	-	0.00	30	0	G			16360282	+1	tier1	-	no_errors	ENST00000464764	ensembl	human	known	74_37	rna	9.30	39	4	SNP	0.001	T
CNST	163882	genome.wustl.edu	37	1	246811175	246811175	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr1:246811175G>C	ENST00000366513.4	+	9	1941	c.1672G>C	c.(1672-1674)Gat>Cat	p.D558H	CNST_ENST00000366512.3_Missense_Mutation_p.D558H|CNST_ENST00000483271.1_3'UTR	NM_152609.2	NP_689822.2	Q6PJW8	CNST_HUMAN	consortin, connexin sorting protein	558					negative regulation of phosphatase activity (GO:0010923)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)	connexin binding (GO:0071253)|phosphatase binding (GO:0019902)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|prostate(1)|urinary_tract(2)	28						ATGTTTAAAAGATACTGAAGA	0.423																																																	0													142.0	148.0	146.0					1																	246811175		2203	4300	6503	SO:0001583	missense	0			AK056563	CCDS1628.1, CCDS44343.1	1q44	2012-04-17	2009-11-03	2009-11-03	ENSG00000162852	ENSG00000162852		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	26486	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 64"""	613439	"""chromosome 1 open reading frame 71"""	C1orf71		19864490	Standard	NM_152609		Approved	FLJ32001, PPP1R64	uc001ibp.3	Q6PJW8	OTTHUMG00000040090	ENST00000366513.4:c.1672G>C	1.37:g.246811175G>C	ENSP00000355470:p.Asp558His		Q5VSY9|Q5VTM7|Q8IYA9|Q8N3L5|Q8NB09|Q8TEI2|Q96MR5	Missense_Mutation	SNP	NULL	p.D558H	ENST00000366513.4	37	c.1672	CCDS1628.1	1	.	.	.	.	.	.	.	.	.	.	G	13.95	2.388955	0.42308	.	.	ENSG00000162852	ENST00000366513;ENST00000366512	T;T	0.31247	1.6;1.5	5.5	3.58	0.41010	.	0.161083	0.43579	D	0.000556	T	0.49304	0.1549	M	0.66939	2.045	0.80722	D	1	D;D	0.76494	0.999;0.998	D;P	0.68039	0.955;0.898	T	0.49551	-0.8928	10	0.87932	D	0	-14.8663	10.6327	0.45547	0.0689:0.0:0.7983:0.1328	.	558;558	Q6PJW8;Q6PJW8-2	CNST_HUMAN;.	H	558	ENSP00000355470:D558H;ENSP00000355469:D558H	ENSP00000355469:D558H	D	+	1	0	CNST	244877798	1.000000	0.71417	0.009000	0.14445	0.537000	0.34900	3.510000	0.53393	0.772000	0.33382	0.467000	0.42956	GAT	CNST	-	NULL	ENSG00000162852		0.423	CNST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNST	HGNC	protein_coding	OTTHUMT00000096780.1	-	0.00	17	0	G	NM_152609		246811175	+1	tier1	-	no_errors	ENST00000366513	ensembl	human	known	74_37	missense	22.22	21	6	SNP	0.761	C
CNTLN	54875	genome.wustl.edu	37	9	17236494	17236494	+	Missense_Mutation	SNP	C	C	T	rs200620921		TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr9:17236494C>T	ENST00000380647.3	+	5	841	c.757C>T	c.(757-759)Cgc>Tgc	p.R253C	CNTLN_ENST00000425824.1_Missense_Mutation_p.R253C|CNTLN_ENST00000262360.5_Missense_Mutation_p.R253C|CNTLN_ENST00000380641.4_Missense_Mutation_p.R253C			Q9NXG0	CNTLN_HUMAN	centlein, centrosomal protein	253					centriole-centriole cohesion (GO:0010457)|protein localization to organelle (GO:0033365)	centriole (GO:0005814)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)|protein binding, bridging (GO:0030674)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)	p.R253S(1)|p.R253G(1)		breast(6)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53				GBM - Glioblastoma multiforme(50;6.14e-10)		ATTAAGTACCCGCTGCACTGA	0.373																																																	2	Substitution - Missense(2)	lung(1)|breast(1)						C	CYS/ARG,CYS/ARG	0,3666		0,0,1833	97.0	98.0	98.0		757,757	3.8	0.6	9		98	1,8171		0,1,4085	no	missense,missense	CNTLN	NM_017738.2,NM_001114395.1	180,180	0,1,5918	TT,TC,CC		0.0122,0.0,0.0084	benign,benign	253/1407,253/392	17236494	1,11837	1833	4086	5919	SO:0001583	missense	0			AK000283	CCDS43789.1, CCDS47953.1	9p22.2-p22.1	2008-11-11	2008-02-08	2008-02-08	ENSG00000044459	ENSG00000044459			23432	protein-coding gene	gene with protein product		611870	"""chromosome 9 open reading frame 101"", ""chromosome 9 open reading frame 39"""	C9orf101, C9orf39		18086554	Standard	XM_005251492		Approved	FLJ20276, bA340N12.1, OTTHUMG00000019597	uc003zmy.3	Q9NXG0	OTTHUMG00000019599	ENST00000380647.3:c.757C>T	9.37:g.17236494C>T	ENSP00000370021:p.Arg253Cys		A5Z2X6|Q5VYJ0|Q8N1G9|Q9HAJ5	Missense_Mutation	SNP	superfamily_Prefoldin	p.R253C	ENST00000380647.3	37	c.757	CCDS43789.1	9	.	.	.	.	.	.	.	.	.	.	C	13.33	2.205083	0.39003	0.0	1.22E-4	ENSG00000044459	ENST00000380647;ENST00000425824;ENST00000262360;ENST00000380641	T;T;T;T	0.11495	2.77;2.77;3.2;3.2	5.59	3.76	0.43208	.	.	.	.	.	T	0.15955	0.0384	L	0.47716	1.5	0.30496	N	0.770906	B;B;D	0.71674	0.038;0.038;0.998	B;B;P	0.53861	0.007;0.007;0.736	T	0.09015	-1.0694	9	0.54805	T	0.06	.	5.4835	0.16737	0.1409:0.6353:0.0:0.2238	.	253;253;253	C9J1F9;Q9NXG0-2;Q9NXG0-3	.;.;.	C	253	ENSP00000370021:R253C;ENSP00000392798:R253C;ENSP00000262360:R253C;ENSP00000370015:R253C	ENSP00000262360:R253C	R	+	1	0	CNTLN	17226494	1.000000	0.71417	0.567000	0.28434	0.940000	0.58332	1.788000	0.38714	0.719000	0.32188	0.655000	0.94253	CGC	CNTLN	-	superfamily_Prefoldin	ENSG00000044459		0.373	CNTLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNTLN	HGNC	protein_coding	OTTHUMT00000051793.3		0.00	31	0	C	NM_017738		17236494	+1			no_errors	ENST00000380647	ensembl	human	known	74_37	missense	13.33	13	2	SNP	0.541	T
CNTNAP2	26047	genome.wustl.edu	37	7	148114542	148114542	+	3'UTR	SNP	T	T	C			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr7:148114542T>C	ENST00000361727.3	+	0	6346				CNTNAP2_ENST00000463592.2_3'UTR	NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2						adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			TTACCATTGCTGGTTGAGCTC	0.358										HNSCC(39;0.1)																																							0																																										SO:0001624	3_prime_UTR_variant	0			AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.*1834T>C	7.37:g.148114542T>C			D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	RNA	SNP	-	NULL	ENST00000361727.3	37	NULL	CCDS5889.1	7																																																																																			CNTNAP2	-	-	ENSG00000174469		0.358	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP2	HGNC	protein_coding	OTTHUMT00000327668.1	-	0.00	19	0	T			148114542	+1	tier1	-	no_errors	ENST00000463592	ensembl	human	known	74_37	rna	30.51	41	18	SNP	0.000	C
COL6A3	1293	genome.wustl.edu	37	2	238232763	238232763	+	3'UTR	SNP	C	C	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr2:238232763C>A	ENST00000295550.4	-	0	10640				COL6A3_ENST00000473258.1_5'UTR|COL6A3_ENST00000472056.1_3'UTR|COL6A3_ENST00000353578.4_3'UTR|COL6A3_ENST00000347401.3_3'UTR	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		AAAAAAAAAACACACAACATT	0.279																																																	0																																										SO:0001624	3_prime_UTR_variant	0			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.*654G>T	2.37:g.238232763C>A			A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	RNA	SNP	-	NULL	ENST00000295550.4	37	NULL	CCDS33412.1	2																																																																																			COL6A3	-	-	ENSG00000163359		0.279	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A3	HGNC	protein_coding	OTTHUMT00000315790.2	-	0.00	65	0	C	NM_004369		238232763	-1	tier1	-	no_errors	ENST00000473258	ensembl	human	known	74_37	rna	8.25	89	8	SNP	0.001	A
CPSF6	11052	genome.wustl.edu	37	12	69656329	69656329	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr12:69656329G>T	ENST00000435070.2	+	9	1756	c.1646G>T	c.(1645-1647)cGt>cTt	p.R549L	CPSF6_ENST00000456847.3_Missense_Mutation_p.R476L|CPSF6_ENST00000266679.8_Missense_Mutation_p.R586L|CPSF6_ENST00000551516.1_Missense_Mutation_p.V52F	NM_007007.2	NP_008938.2	Q16630	CPSF6_HUMAN	cleavage and polyadenylation specific factor 6, 68kDa	549	Arg-rich.|Sufficient for nuclear targeting.				mRNA polyadenylation (GO:0006378)|mRNA processing (GO:0006397)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|mRNA cleavage factor complex (GO:0005849)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R549H(2)		endometrium(1)|large_intestine(7)|lung(8)	16	all_epithelial(5;2.47e-36)|Lung NSC(4;1.1e-32)|all_lung(4;6.26e-31)|Breast(13;1.59e-06)|Esophageal squamous(21;0.187)		Epithelial(6;4.89e-17)|BRCA - Breast invasive adenocarcinoma(5;8.5e-10)|Lung(24;6.04e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.171)|Kidney(9;0.241)			cgCGAATATCGTCATCGTTAG	0.463																																																	2	Substitution - Missense(2)	large_intestine(2)											197.0	133.0	155.0					12																	69656329		2203	4300	6503	SO:0001583	missense	0			X67336	CCDS8988.1, CCDS73494.1	12q15	2013-06-18	2002-08-29			ENSG00000111605		"""RNA binding motif (RRM) containing"""	13871	protein-coding gene	gene with protein product	"""cleavage factor Im complex 68 kDa subunit"""	604979	"""cleavage and polyadenylation specific factor 6, 68kD subunit"""			9659921, 17267687	Standard	NM_007007		Approved	CFIM, HPBRII-4, HPBRII-7, CFIM68	uc001sut.4	Q16630		ENST00000435070.2:c.1646G>T	12.37:g.69656329G>T	ENSP00000391774:p.Arg549Leu		A8K7K9|Q53ES1|Q9BSJ7|Q9BW18	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.R586L	ENST00000435070.2	37	c.1757	CCDS8988.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.5|22.5	4.299485|4.299485	0.81136|0.81136	.|.	.|.	ENSG00000111605|ENSG00000111605	ENST00000435070;ENST00000456847;ENST00000266679|ENST00000551516	T;T;T|.	0.72167|.	-0.63;-0.63;-0.63|.	5.75|5.75	5.75|5.75	0.90469|0.90469	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.71358|0.71358	0.3330|0.3330	L|L	0.52573|0.52573	1.65|1.65	0.41967|0.41967	D|D	0.990732|0.990732	B;B;B|.	0.33103|.	0.023;0.397;0.276|.	B;B;B|.	0.29524|.	0.031;0.103;0.048|.	T|T	0.66348|0.66348	-0.5946|-0.5946	9|5	.|.	.|.	.|.	-9.6562|-9.6562	19.9374|19.9374	0.97146|0.97146	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	298;586;549|.	B4DSU9;Q16630-2;Q16630|.	.;.;CPSF6_HUMAN|.	L|F	549;476;586|52	ENSP00000391774:R549L;ENSP00000391437:R476L;ENSP00000266679:R586L|.	.|.	R|V	+|+	2|1	0|0	CPSF6|CPSF6	67942596|67942596	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	9.869000|9.869000	0.99810|0.99810	2.885000|2.885000	0.99019|0.99019	0.655000|0.655000	0.94253|0.94253	CGT|GTC	CPSF6	-	NULL	ENSG00000111605		0.463	CPSF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPSF6	HGNC	protein_coding	OTTHUMT00000403609.1		0.00	41	0	G	NM_007007		69656329	+1			no_errors	ENST00000266679	ensembl	human	known	74_37	missense	10.71	25	3	SNP	1.000	T
CR2	1380	genome.wustl.edu	37	1	207639910	207639910	+	Missense_Mutation	SNP	G	G	A	rs368072577		TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr1:207639910G>A	ENST00000367058.3	+	2	287	c.98G>A	c.(97-99)cGg>cAg	p.R33Q	CR2_ENST00000458541.2_Missense_Mutation_p.R33Q|CR2_ENST00000367057.3_Missense_Mutation_p.R33Q|CR2_ENST00000367059.3_Missense_Mutation_p.R33Q	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	33	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						CTAAATGGCCGGATTAGTTAT	0.413																																																	0								G	GLN/ARG,GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	124.0	129.0	128.0		98,98	2.2	0.0	1		128	0,8600		0,0,4300	no	missense,missense	CR2	NM_001006658.2,NM_001877.4	43,43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	33/1093,33/1034	207639910	1,13005	2203	4300	6503	SO:0001583	missense	0			M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.98G>A	1.37:g.207639910G>A	ENSP00000356025:p.Arg33Gln		C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.R33Q	ENST00000367058.3	37	c.98	CCDS1478.1	1	.	.	.	.	.	.	.	.	.	.	G	15.82	2.947560	0.53186	2.27E-4	0.0	ENSG00000117322	ENST00000367058;ENST00000367057;ENST00000367059;ENST00000458541	T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11	5.09	2.21	0.28008	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.68081	0.2962	L	0.53671	1.685	0.09310	N	1	D;D;D	0.76494	0.997;0.999;0.999	P;D;D	0.65443	0.906;0.928;0.935	T	0.54629	-0.8265	9	0.52906	T	0.07	.	4.3542	0.11170	0.1849:0.0:0.6356:0.1795	.	33;33;33	Q5SR47;P20023;P20023-3	.;CR2_HUMAN;.	Q	33	ENSP00000356025:R33Q;ENSP00000356024:R33Q;ENSP00000356026:R33Q;ENSP00000404222:R33Q	ENSP00000356024:R33Q	R	+	2	0	CR2	205706533	0.002000	0.14202	0.000000	0.03702	0.001000	0.01503	1.222000	0.32515	0.329000	0.23460	-0.169000	0.13324	CGG	CR2	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000117322		0.413	CR2-001	KNOWN	basic|CCDS	protein_coding	CR2	HGNC	protein_coding	OTTHUMT00000088274.1	-	0.00	47	0	G	NM_001877		207639910	+1	tier1	-	no_errors	ENST00000367057	ensembl	human	known	74_37	missense	16.82	89	18	SNP	0.000	A
CREBBP	1387	genome.wustl.edu	37	16	3820668	3820668	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr16:3820668G>T	ENST00000262367.5	-	14	3592	c.2783C>A	c.(2782-2784)cCg>cAg	p.P928Q	CREBBP_ENST00000382070.3_Missense_Mutation_p.P890Q	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	928					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		TTGAGGCTGCGGGGTCACCTG	0.672			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																																	Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	0													71.0	84.0	79.0					16																	3820668		2197	4300	6497	SO:0001583	missense	0			U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.2783C>A	16.37:g.3820668G>T	ENSP00000262367:p.Pro928Gln		D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX_dom,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX_dom,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX_dom,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.P928Q	ENST00000262367.5	37	c.2783	CCDS10509.1	16	.	.	.	.	.	.	.	.	.	.	G	13.71	2.317456	0.40996	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070	D;D	0.84589	-1.87;-1.77	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.75729	0.3889	N	0.04090	-0.28	0.80722	D	1	D;D	0.55385	0.971;0.971	P;P	0.46320	0.512;0.512	T	0.76105	-0.3081	10	0.23302	T	0.38	-6.4181	20.181	0.98201	0.0:0.0:1.0:0.0	.	958;928	Q4LE28;Q92793	.;CBP_HUMAN	Q	928;958;890	ENSP00000262367:P928Q;ENSP00000371502:P890Q	ENSP00000262367:P928Q	P	-	2	0	CREBBP	3760669	1.000000	0.71417	0.999000	0.59377	0.450000	0.32258	8.841000	0.92131	2.840000	0.97914	0.655000	0.94253	CCG	CREBBP	-	NULL	ENSG00000005339		0.672	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREBBP	HGNC	protein_coding	OTTHUMT00000251591.2	-	0.00	35	0	G	NM_004380		3820668	-1	tier1	-	no_errors	ENST00000262367	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	T
CRYBG3	131544	genome.wustl.edu	37	3	97599990	97599990	+	Missense_Mutation	SNP	G	G	T	rs373418086		TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr3:97599990G>T	ENST00000182096.4	+	4	1299	c.1235G>T	c.(1234-1236)cGt>cTt	p.R412L		NM_153605.3	NP_705833.3	Q68DQ2	CRBG3_HUMAN	beta-gamma crystallin domain containing 3	2360							carbohydrate binding (GO:0030246)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(10)|stomach(1)|upper_aerodigestive_tract(2)	32						GTGTTAAATCGTGACTGGATT	0.358																																																	0													87.0	87.0	87.0					3																	97599990		1828	4078	5906	SO:0001583	missense	0					3q11.2	2008-09-30			ENSG00000080200	ENSG00000080200			34427	protein-coding gene	gene with protein product							Standard	NM_153605		Approved	DKFZp667G2110	uc021xbn.2	Q68DQ2	OTTHUMG00000159187	ENST00000182096.4:c.1235G>T	3.37:g.97599990G>T	ENSP00000182096:p.Arg412Leu		B4DLE8|F6VHI2|Q4G0V8|Q7Z4R9|Q86VD0|Q8N262|Q8N7F1|Q8NDQ8	Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,pfam_Ricin_B_lectin,superfamily_G_crystallin-rel,superfamily_Ricin_B_lectin,smart_Beta/gamma_crystallin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.R412L	ENST00000182096.4	37	c.1235		3	.	.	.	.	.	.	.	.	.	.	G	8.699	0.909280	0.17833	.	.	ENSG00000080200	ENST00000182096	T	0.76839	-1.05	4.89	-1.58	0.08479	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	1.093000	0.06854	N	0.797911	T	0.69314	0.3097	L	0.39898	1.24	0.30824	N	0.737458	B	0.25609	0.13	B	0.29077	0.098	T	0.56938	-0.7896	10	0.25106	T	0.35	.	11.1781	0.48612	0.6691:0.0:0.3309:0.0	.	412	Q68DQ2	CRBG3_HUMAN	L	412	ENSP00000182096:R412L	ENSP00000182096:R412L	R	+	2	0	CRYBG3	99082680	0.001000	0.12720	0.832000	0.32986	0.983000	0.72400	-0.212000	0.09319	-0.606000	0.05746	-0.145000	0.13849	CGT	CRYBG3	-	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin	ENSG00000080200		0.358	CRYBG3-001	KNOWN	basic|appris_principal	protein_coding	CRYBG3	HGNC	protein_coding	OTTHUMT00000353751.1		0.00	28	0	G	NM_153605		97599990	+1			no_errors	ENST00000182096	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.593	T
CUX2	23316	genome.wustl.edu	37	12	111758235	111758237	+	In_Frame_Del	DEL	TCC	TCC	-			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	TCC	TCC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr12:111758235_111758237delTCC	ENST00000261726.6	+	17	2576_2578	c.2422_2424delTCC	c.(2422-2424)tccdel	p.S813del		NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	813	Poly-Ser.				cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						GCCCTCGCTGTCCTCCTCCTCCT	0.749																																																	0										26,3520		1,24,1748						0.6	1.0			21	65,7379		5,55,3662	no	coding	CUX2	NM_015267.3		6,79,5410	A1A1,A1R,RR		0.8732,0.7332,0.828				91,10899				SO:0001651	inframe_deletion	0			AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.2422_2424delTCC	12.37:g.111758244_111758246delTCC	ENSP00000261726:p.Ser813del		A7E2Y4	In_Frame_Del	DEL	pfam_Hmoeo_CUT,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,superfamily_Prefoldin,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Hmoeo_CUT	p.S811in_frame_del	ENST00000261726.6	37	c.2422_2424	CCDS41837.1	12																																																																																			CUX2	-	NULL	ENSG00000111249		0.749	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUX2	HGNC	protein_coding	OTTHUMT00000404765.1		0.00	18	0	TCC	NM_015267		111758237	+1	tier1		no_errors	ENST00000261726	ensembl	human	known	74_37	in_frame_del	16.67	20	4	DEL	1.000:1.000:1.000	-
CXCR4	7852	genome.wustl.edu	37	2	136873012	136873012	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr2:136873012G>C	ENST00000241393.3	-	2	590	c.486C>G	c.(484-486)atC>atG	p.I162M	CXCR4_ENST00000409817.1_Missense_Mutation_p.I166M|CXCR4_ENST00000466288.1_5'UTR	NM_003467.2	NP_003458.1	P61073	CXCR4_HUMAN	chemokine (C-X-C motif) receptor 4	162					activation of MAPK activity (GO:0000187)|ameboidal cell migration (GO:0001667)|apoptotic process (GO:0006915)|brain development (GO:0007420)|calcium-mediated signaling (GO:0019722)|cellular response to cytokine stimulus (GO:0071345)|chemokine-mediated signaling pathway (GO:0070098)|dendritic cell chemotaxis (GO:0002407)|entry into host cell (GO:0030260)|G-protein coupled receptor signaling pathway (GO:0007186)|germ cell development (GO:0007281)|germ cell migration (GO:0008354)|inflammatory response (GO:0006954)|motor neuron axon guidance (GO:0008045)|myelin maintenance (GO:0043217)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|neutrophil activation (GO:0042119)|patterning of blood vessels (GO:0001569)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of cell migration (GO:0030334)|regulation of chemotaxis (GO:0050920)|response to hypoxia (GO:0001666)|response to virus (GO:0009615)|T cell proliferation (GO:0042098)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|G-protein coupled receptor activity (GO:0004930)|myosin light chain binding (GO:0032027)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|virus receptor activity (GO:0001618)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.155)	Framycetin(DB00452)|Plerixafor(DB06809)	GGAGGGCAGGGATCCAGACGC	0.542																																																	0													181.0	152.0	162.0					2																	136873012		2203	4300	6503	SO:0001583	missense	0			AF005058	CCDS33295.1, CCDS46420.1	2q21	2014-09-17	2002-08-22		ENSG00000121966	ENSG00000121966		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	2561	protein-coding gene	gene with protein product		162643	"""chemokine (C-X-C motif), receptor 4 (fusin)"""			9599023, 9379028	Standard	NM_001008540		Approved	LESTR, NPY3R, HM89, NPYY3R, D2S201E, fusin, HSY3RR, NPYR, CD184	uc002tuz.3	P61073	OTTHUMG00000153583	ENST00000241393.3:c.486C>G	2.37:g.136873012G>C	ENSP00000241393:p.Ile162Met		B2R5N0|O60835|P30991|P56438|Q53S69|Q9BXA0|Q9UKN2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_Chemokine_CXCR4_N_dom,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CXCR4,prints_GPCR_Rhodpsn,prints_Chemokine_rcpt	p.I166M	ENST00000241393.3	37	c.498	CCDS46420.1	2	.	.	.	.	.	.	.	.	.	.	G	5.178	0.218430	0.09810	.	.	ENSG00000121966	ENST00000409817;ENST00000241393;ENST00000537957	T;T	0.40756	1.02;1.02	5.97	1.47	0.22746	GPCR, rhodopsin-like superfamily (1);	0.176879	0.51477	D	0.000089	T	0.24084	0.0583	L	0.33189	0.99	0.44515	D	0.997468	B;P	0.39157	0.007;0.662	B;B	0.37239	0.072;0.244	T	0.03910	-1.0993	10	0.37606	T	0.19	.	1.8247	0.03118	0.2339:0.1458:0.4665:0.1538	.	162;166	P61073;P61073-2	CXCR4_HUMAN;.	M	166;162;32	ENSP00000386884:I166M;ENSP00000241393:I162M	ENSP00000241393:I162M	I	-	3	3	CXCR4	136589482	0.357000	0.24938	1.000000	0.80357	0.263000	0.26337	-0.338000	0.07842	0.271000	0.22005	0.655000	0.94253	ATC	CXCR4	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000121966		0.542	CXCR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CXCR4	HGNC	protein_coding	OTTHUMT00000331732.1	-	0.00	27	0	G			136873012	-1	tier1	-	no_errors	ENST00000409817	ensembl	human	known	74_37	missense	41.67	21	15	SNP	0.997	C
CYFIP2	26999	genome.wustl.edu	37	5	156727761	156727761	+	Silent	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr5:156727761G>T	ENST00000521420.1	+	5	439	c.348G>T	c.(346-348)cgG>cgT	p.R116R	CYFIP2_ENST00000318218.6_Silent_p.R142R|CYFIP2_ENST00000442283.2_5'UTR|CYFIP2_ENST00000541131.1_Silent_p.R67R|CYFIP2_ENST00000377576.3_Silent_p.R142R|CYFIP2_ENST00000522463.1_Intron|CYFIP2_ENST00000347377.6_Silent_p.R142R					cytoplasmic FMR1 interacting protein 2											breast(1)|endometrium(12)|kidney(2)|lung(23)	38	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AGGTGAAGCGGCTGTGCCATG	0.597																																																	0													69.0	71.0	70.0					5																	156727761		2119	4255	6374	SO:0001819	synonymous_variant	0			AF160973	CCDS75364.1	5q34	2008-07-18				ENSG00000055163			13760	protein-coding gene	gene with protein product	"""p53 inducible protein"""	606323				11438699	Standard	NM_001037333		Approved	PIR121	uc021ygm.1	Q96F07		ENST00000521420.1:c.348G>T	5.37:g.156727761G>T				Silent	SNP	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub,prints_Cytoplasmic_FMR1-int	p.R142	ENST00000521420.1	37	c.426		5																																																																																			CYFIP2	-	pirsf_Cytoplasmic_FMR1-int_sub,prints_Cytoplasmic_FMR1-int	ENSG00000055163		0.597	CYFIP2-001	NOVEL	basic	protein_coding	CYFIP2	HGNC	protein_coding	OTTHUMT00000373710.1		0.00	21	0	G	NM_001037332		156727761	+1			no_errors	ENST00000318218	ensembl	human	known	74_37	silent	9.38	29	3	SNP	0.122	T
DAXX	1616	genome.wustl.edu	37	6	33286968	33286968	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr6:33286968C>G	ENST00000374542.5	-	7	2173	c.1969G>C	c.(1969-1971)Gag>Cag	p.E657Q	DAXX_ENST00000266000.6_Missense_Mutation_p.E657Q|ZBTB22_ENST00000431845.2_5'Flank|ZBTB22_ENST00000418724.1_5'Flank|DAXX_ENST00000414083.2_Missense_Mutation_p.E582Q|DAXX_ENST00000477162.1_5'Flank	NM_001141969.1|NM_001141970.1|NM_001350.4	NP_001135441.1|NP_001135442.1|NP_001341.1	Q9UER7	DAXX_HUMAN	death-domain associated protein	657	Interaction with SPOP.				activation of JUN kinase activity (GO:0007257)|androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|chromatin remodeling (GO:0006338)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|mitotic cytokinesis (GO:0000281)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of neuron death (GO:1901216)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|PML body (GO:0016605)|SWI/SNF superfamily-type complex (GO:0070603)	androgen receptor binding (GO:0050681)|enzyme binding (GO:0019899)|heat shock protein binding (GO:0031072)|histone binding (GO:0042393)|p53 binding (GO:0002039)|protein homodimerization activity (GO:0042803)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|receptor signaling protein activity (GO:0005057)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(2)|lung(7)|ovary(3)|pancreas(18)|prostate(3)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	55						CCATTCTTCTCATGCACTGAC	0.542			"""Mis, F, N"""		Pancreatic neuroendocrine tumors. Paediatric GBM																																			Rec	yes		6	6p21.3	1616	death-domain associated protein		E	0													94.0	99.0	97.0					6																	33286968		2203	4300	6503	SO:0001583	missense	0			AF006041	CCDS4776.1, CCDS59008.1	6p21.3	2008-08-29	2008-08-29			ENSG00000204209			2681	protein-coding gene	gene with protein product		603186	"""death-associated protein 6"""			9407001, 9215629	Standard	NM_001141970		Approved	DAP6	uc011dre.2	Q9UER7		ENST00000374542.5:c.1969G>C	6.37:g.33286968C>G	ENSP00000363668:p.Glu657Gln		B4E1I3|F5H082|O14747|O15141|O15208|Q5STK9|Q9BWI3	Missense_Mutation	SNP	pfam_Daxx	p.E657Q	ENST00000374542.5	37	c.1969	CCDS4776.1	6	.	.	.	.	.	.	.	.	.	.	C	0.006	-2.042755	0.00402	.	.	ENSG00000204209	ENST00000266000;ENST00000374542;ENST00000414083	.	.	.	4.47	0.282	0.15692	.	1.055030	0.07462	N	0.900756	T	0.04003	0.0112	N	0.02736	-0.51	0.09310	N	1	B;B	0.12630	0.006;0.006	B;B	0.12837	0.008;0.006	T	0.40794	-0.9544	9	0.17369	T	0.5	-4.0447	4.8067	0.13323	0.0:0.3857:0.3961:0.2182	.	669;657	B4E1C1;Q9UER7	.;DAXX_HUMAN	Q	657;657;582	.	ENSP00000266000:E657Q	E	-	1	0	DAXX	33394946	0.000000	0.05858	0.002000	0.10522	0.116000	0.19942	0.372000	0.20467	0.138000	0.18790	0.579000	0.79373	GAG	DAXX	-	pfam_Daxx	ENSG00000204209		0.542	DAXX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAXX	HGNC	protein_coding	OTTHUMT00000076403.1	-	0.00	27	0	C			33286968	-1	tier1	-	no_errors	ENST00000266000	ensembl	human	known	74_37	missense	9.30	39	4	SNP	0.000	G
DCAF13	25879	genome.wustl.edu	37	8	104439377	104439377	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr8:104439377G>A	ENST00000297579.5	+	5	1254	c.977G>A	c.(976-978)tGt>tAt	p.C326Y	DCAF13_ENST00000519682.1_Missense_Mutation_p.C170Y|DCAF13_ENST00000521971.1_Missense_Mutation_p.C134Y|DCAF13_ENST00000521999.1_3'UTR	NM_015420.6	NP_056235.4	Q9NV06	DCA13_HUMAN	DDB1 and CUL4 associated factor 13	174					protein ubiquitination (GO:0016567)|rRNA processing (GO:0006364)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|kidney(2)|large_intestine(8)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25						TTTGCCACATGTGGACAGCAA	0.338																																																	0													90.0	85.0	87.0					8																	104439377		2203	4298	6501	SO:0001583	missense	0			AK074725	CCDS34934.1	8q22.3	2013-01-09	2009-07-17	2009-07-17	ENSG00000164934	ENSG00000164934		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	24535	protein-coding gene	gene with protein product			"""WD repeats and SOF1 domain containing"""	WDSOF1		11042152	Standard	NM_015420		Approved	DKFZP564O0463, Gm83, HSPC064	uc003yln.3	Q9NV06	OTTHUMG00000164888	ENST00000297579.5:c.977G>A	8.37:g.104439377G>A	ENSP00000297579:p.Cys326Tyr		Q3MII9|Q8NCH8|Q8TC51|Q96JY7|Q9NZX3	Missense_Mutation	SNP	pfam_Sof1,pfam_WD40_repeat,pfam_TIF_beta_prop-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.C326Y	ENST00000297579.5	37	c.977	CCDS34934.1	8	.	.	.	.	.	.	.	.	.	.	G	27.0	4.787917	0.90367	.	.	ENSG00000164934	ENST00000297579;ENST00000521971;ENST00000519682	T;T;T	0.01388	4.95;4.95;4.95	5.86	5.86	0.93980	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.11623	0.0283	M	0.85630	2.765	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.984	T	0.00066	-1.2145	10	0.87932	D	0	-22.7852	20.1739	0.98173	0.0:0.0:1.0:0.0	.	174;174	B3KME9;Q9NV06	.;DCA13_HUMAN	Y	326;134;170	ENSP00000297579:C326Y;ENSP00000430883:C134Y;ENSP00000430411:C170Y	ENSP00000297579:C326Y	C	+	2	0	DCAF13	104508553	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.229000	0.95273	2.774000	0.95407	0.585000	0.79938	TGT	DCAF13	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom	ENSG00000164934		0.338	DCAF13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF13	HGNC	protein_coding	OTTHUMT00000380797.2	-	0.00	49	0	G	NM_015420		104439377	+1	tier1	-	no_errors	ENST00000297579	ensembl	human	known	74_37	missense	22.12	81	23	SNP	1.000	A
DHX8	1659	genome.wustl.edu	37	17	41582146	41582146	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr17:41582146C>T	ENST00000262415.3	+	12	1753	c.1681C>T	c.(1681-1683)Cag>Tag	p.Q561*	DHX8_ENST00000540306.1_Nonsense_Mutation_p.Q561*	NM_004941.1	NP_004932.1	Q14562	DHX8_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 8	561					ATP catabolic process (GO:0006200)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.08)		AATCCTTGAGCAGAGGGAGAG	0.458																																					NSCLC(56;1548 1661 49258 49987)												0													107.0	106.0	106.0					17																	41582146		2203	4300	6503	SO:0001587	stop_gained	0			D50487	CCDS11464.1	17q21.31	2005-08-19	2003-06-13	2003-06-20		ENSG00000067596		"""DEAH-boxes"""	2749	protein-coding gene	gene with protein product		600396	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 8 (RNA helicase)"""	DDX8		7935475	Standard	NM_004941		Approved	HRH1, PRP22, PRPF22	uc002idu.1	Q14562		ENST00000262415.3:c.1681C>T	17.37:g.41582146C>T	ENSP00000262415:p.Gln561*			Nonsense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_DUF1605,pfam_Rbsml_prot_S1_RNA-bd_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_NA-bd_OB-fold,smart_RNA-binding_domain_S1,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Rbsml_prot_S1_RNA-bd_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.Q561*	ENST00000262415.3	37	c.1681	CCDS11464.1	17	.	.	.	.	.	.	.	.	.	.	C	37	6.232507	0.97399	.	.	ENSG00000067596	ENST00000540306;ENST00000262415	.	.	.	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.0709	0.89405	0.0:1.0:0.0:0.0	.	.	.	.	X	561	.	ENSP00000262415:Q561X	Q	+	1	0	DHX8	38937672	1.000000	0.71417	1.000000	0.80357	0.542000	0.35054	7.734000	0.84928	2.526000	0.85167	0.555000	0.69702	CAG	DHX8	-	superfamily_P-loop_NTPase	ENSG00000067596		0.458	DHX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX8	HGNC	protein_coding	OTTHUMT00000453485.1	-	0.00	46	0	C			41582146	+1	tier1	-	no_errors	ENST00000262415	ensembl	human	known	74_37	nonsense	44.64	30	25	SNP	1.000	T
DIP2A	23181	genome.wustl.edu	37	21	47954536	47954536	+	Silent	SNP	A	A	G			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr21:47954536A>G	ENST00000417564.2	+	13	1599	c.1578A>G	c.(1576-1578)acA>acG	p.T526T	DIP2A_ENST00000457905.3_Silent_p.T526T|DIP2A_ENST00000318711.7_Silent_p.T527T|Metazoa_SRP_ENST00000607098.1_RNA|DIP2A_ENST00000435722.3_Silent_p.T526T|DIP2A_ENST00000400274.1_Silent_p.T522T|DIP2A_ENST00000466639.1_Silent_p.T483T|DIP2A_ENST00000427143.2_Silent_p.T462T			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	526					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		TGGGGGTCACAGTGTCCCACG	0.552																																																	0													40.0	42.0	41.0					21																	47954536		1918	4128	6046	SO:0001819	synonymous_variant	0			AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.1578A>G	21.37:g.47954536A>G			A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Silent	SNP	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.T527	ENST00000417564.2	37	c.1581	CCDS46655.1	21																																																																																			DIP2A	-	pfam_AMP-dep_Synth/Lig	ENSG00000160305		0.552	DIP2A-012	KNOWN	basic|CCDS	protein_coding	DIP2A	HGNC	protein_coding	OTTHUMT00000376736.1	-	0.00	54	0	A	NM_015151		47954536	+1	tier1	-	no_errors	ENST00000318711	ensembl	human	known	74_37	silent	9.76	37	4	SNP	0.029	G
DNAH5	1767	genome.wustl.edu	37	5	13810233	13810233	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr5:13810233G>A	ENST00000265104.4	-	45	7648	c.7544C>T	c.(7543-7545)aCg>aTg	p.T2515M		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2515					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CAGCTCCAGCGTCCCTGTGGG	0.731									Kartagener syndrome																																								0													8.0	8.0	8.0					5																	13810233		2046	4048	6094	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.7544C>T	5.37:g.13810233G>A	ENSP00000265104:p.Thr2515Met		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.T2515M	ENST00000265104.4	37	c.7544	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	G	11.72	1.723504	0.30593	.	.	ENSG00000039139	ENST00000265104	T	0.25579	1.79	5.1	0.471	0.16752	.	1.015230	0.07841	N	0.963030	T	0.20251	0.0487	L	0.50333	1.59	0.09310	N	1	B	0.20780	0.048	B	0.17433	0.018	T	0.35375	-0.9791	10	0.45353	T	0.12	.	1.7466	0.02963	0.1728:0.1077:0.259:0.4606	.	2515	Q8TE73	DYH5_HUMAN	M	2515	ENSP00000265104:T2515M	ENSP00000265104:T2515M	T	-	2	0	DNAH5	13863233	0.000000	0.05858	0.002000	0.10522	0.035000	0.12851	0.852000	0.27764	0.263000	0.21812	0.655000	0.94253	ACG	DNAH5	-	NULL	ENSG00000039139		0.731	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	-	0.00	40	0	G	NM_001369		13810233	-1	tier1	-	no_errors	ENST00000265104	ensembl	human	known	74_37	missense	26.79	41	15	SNP	0.000	A
DMXL1	1657	genome.wustl.edu	37	5	118484613	118484613	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr5:118484613G>T	ENST00000311085.8	+	18	3171	c.3091G>T	c.(3091-3093)Gaa>Taa	p.E1031*	DMXL1_ENST00000539542.1_Nonsense_Mutation_p.E1031*	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	1031										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		ATTACTTATTGAAGATGGACT	0.403																																																	0													145.0	136.0	139.0					5																	118484613		2202	4300	6502	SO:0001587	stop_gained	0			AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.3091G>T	5.37:g.118484613G>T	ENSP00000309690:p.Glu1031*			Nonsense_Mutation	SNP	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E1031*	ENST00000311085.8	37	c.3091	CCDS4125.1	5	.	.	.	.	.	.	.	.	.	.	G	41	8.547326	0.98859	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	.	.	.	5.5	5.5	0.81552	.	0.044239	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	-20.8566	19.7739	0.96383	0.0:0.0:1.0:0.0	.	.	.	.	X	1031	.	ENSP00000309690:E1031X	E	+	1	0	DMXL1	118512512	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.601000	0.82783	2.744000	0.94065	0.655000	0.94253	GAA	DMXL1	-	superfamily_WD40_repeat_dom	ENSG00000172869		0.403	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMXL1	HGNC	protein_coding	OTTHUMT00000250862.1		0.00	17	0	G	NM_005509		118484613	+1			no_errors	ENST00000539542	ensembl	human	known	74_37	nonsense	5.41	35	2	SNP	1.000	T
DST	667	genome.wustl.edu	37	6	56417998	56417998	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr6:56417998G>A	ENST00000361203.3	-	57	14966	c.14959C>T	c.(14959-14961)Cct>Tct	p.P4987S	DST_ENST00000244364.6_Missense_Mutation_p.P2575S|DST_ENST00000312431.6_3'UTR|DST_ENST00000370788.2_Missense_Mutation_p.P2901S|DST_ENST00000421834.2_Missense_Mutation_p.P2901S|DST_ENST00000370769.4_Missense_Mutation_p.P4989S|DST_ENST00000446842.2_Missense_Mutation_p.P4663S|DST_ENST00000370754.5_Missense_Mutation_p.P5167S			Q03001	DYST_HUMAN	dystonin	4987					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CCTTCAGCAGGATCCAAGCAA	0.398																																																	0													181.0	184.0	183.0					6																	56417998		1842	4075	5917	SO:0001583	missense	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.14959C>T	6.37:g.56417998G>A	ENSP00000354508:p.Pro4987Ser		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.P5167S	ENST00000361203.3	37	c.15499		6	.	.	.	.	.	.	.	.	.	.	G	14.32	2.500324	0.44455	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.35973	1.28;1.28;1.28;1.28;1.28;1.28;1.28	5.76	5.76	0.90799	.	0.000000	0.52532	D	0.000071	T	0.19446	0.0467	M	0.66939	2.045	0.27210	N	0.95994	P;B;B;P;B	0.39391	0.671;0.354;0.354;0.651;0.313	B;B;B;B;B	0.36092	0.202;0.217;0.217;0.084;0.126	T	0.06250	-1.0837	9	0.09843	T	0.71	.	13.5255	0.61593	0.0713:0.0:0.9287:0.0	.	2901;4989;5167;4987;2575	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	S	2575;5167;4989;2901;4663;2901;4987	ENSP00000244364:P2575S;ENSP00000359790:P5167S;ENSP00000359805:P4989S;ENSP00000400883:P2901S;ENSP00000393645:P4663S;ENSP00000359824:P2901S;ENSP00000354508:P4987S	ENSP00000244364:P2575S	P	-	1	0	DST	56525957	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	6.629000	0.74267	2.882000	0.98803	0.655000	0.94253	CCT	DST	-	superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin	ENSG00000151914		0.398	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3		0.00	44	0	G	NM_001723		56417998	-1			no_errors	ENST00000370754	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	A
DST	667	genome.wustl.edu	37	6	56480403	56480403	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr6:56480403G>T	ENST00000370765.6	-	24	7969	c.7862C>A	c.(7861-7863)gCt>gAt	p.A2621D	DST_ENST00000244364.6_Intron|DST_ENST00000312431.6_Intron|DST_ENST00000370788.2_Intron|DST_ENST00000421834.2_Intron|DST_ENST00000370769.4_Intron|DST_ENST00000446842.2_Intron|DST_ENST00000370754.5_Intron|DST_ENST00000361203.3_Intron	NM_001723.5	NP_001714.1	Q03001	DYST_HUMAN	dystonin	1917					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			ATCAAAATCAGCTTTTTCTAA	0.358																																																	0													107.0	113.0	111.0					6																	56480403		2203	4300	6503	SO:0001583	missense	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000370765.6:c.7862C>A	6.37:g.56480403G>T	ENSP00000359801:p.Ala2621Asp		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	pfam_Plectin_repeat,pfam_Spectrin_repeat,superfamily_Ig/albumin-bd,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.A2621D	ENST00000370765.6	37	c.7862	CCDS4959.1	6	.	.	.	.	.	.	.	.	.	.	G	15.24	2.774625	0.49786	.	.	ENSG00000151914	ENST00000370765	T	0.66995	-0.24	5.94	5.94	0.96194	.	.	.	.	.	T	0.68851	0.3046	.	.	.	0.19300	N	0.99998	D	0.57571	0.98	P	0.51229	0.663	T	0.67968	-0.5533	7	0.45353	T	0.12	.	20.3593	0.98849	0.0:0.0:1.0:0.0	.	2621	Q03001-3	.	D	2621	ENSP00000359801:A2621D	ENSP00000359801:A2621D	A	-	2	0	DST	56588362	1.000000	0.71417	0.974000	0.42286	0.996000	0.88848	7.018000	0.76406	2.822000	0.97130	0.557000	0.71058	GCT	DST	-	smart_Plectin_repeat	ENSG00000151914		0.358	DST-010	KNOWN	basic|CCDS	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041027.2	-	0.00	49	0	G	NM_001723		56480403	-1	tier1	-	no_errors	ENST00000370765	ensembl	human	known	74_37	missense	5.95	79	5	SNP	0.997	T
EIF2AK1	27102	genome.wustl.edu	37	7	6066493	6066493	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr7:6066493G>T	ENST00000199389.6	-	14	1776	c.1630C>A	c.(1630-1632)Cag>Aag	p.Q544K	EIF2AK1_ENST00000536084.1_Missense_Mutation_p.Q420K	NM_001134335.1|NM_014413.3	NP_001127807.1|NP_055228.2	Q9BQI3	E2AK1_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 1	544	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of cell proliferation (GO:0008285)|negative regulation of hemoglobin biosynthetic process (GO:0046986)|negative regulation of translational initiation by iron (GO:0045993)|protein autophosphorylation (GO:0046777)|protoporphyrinogen IX metabolic process (GO:0046501)|regulation of eIF2 alpha phosphorylation by heme (GO:0010999)|response to external stimulus (GO:0009605)|response to stress (GO:0006950)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|heme binding (GO:0020037)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	27		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.106)|OV - Ovarian serous cystadenocarcinoma(56;5.22e-14)		TCCGGCAACTGACCAGTTCTT	0.488																																																	0													130.0	121.0	124.0					7																	6066493		2203	4300	6503	SO:0001583	missense	0			BC006524	CCDS5345.1	7p22	2005-01-20			ENSG00000086232	ENSG00000086232			24921	protein-coding gene	gene with protein product	"""heme regulated initiation factor 2 alpha kinase"""	613635				7709427, 10718198	Standard	NM_014413		Approved	HRI, KIAA1369	uc003spp.3	Q9BQI3	OTTHUMG00000090689	ENST00000199389.6:c.1630C>A	7.37:g.6066493G>T	ENSP00000199389:p.Gln544Lys		A8K2R2|Q549K6|Q8NBW3|Q9HC02|Q9NYE0|Q9P0V6|Q9P1J5|Q9P2H8|Q9UHG4	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.Q544K	ENST00000199389.6	37	c.1630	CCDS5345.1	7	.	.	.	.	.	.	.	.	.	.	G	7.093	0.572589	0.13623	.	.	ENSG00000086232	ENST00000199389;ENST00000536084	T;T	0.63580	-0.05;-0.05	5.72	5.72	0.89469	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.743599	0.13511	N	0.382534	T	0.35508	0.0934	N	0.02775	-0.495	0.18873	N	0.999984	B;B;B	0.18166	0.026;0.012;0.008	B;B;B	0.20384	0.029;0.008;0.026	T	0.05273	-1.0895	10	0.05721	T	0.95	-4.0374	13.3688	0.60701	0.0:0.0:0.7247:0.2752	.	420;543;544	B4DIP4;Q9BQI3-2;Q9BQI3	.;.;E2AK1_HUMAN	K	544;420	ENSP00000199389:Q544K;ENSP00000445784:Q420K	ENSP00000199389:Q544K	Q	-	1	0	EIF2AK1	6033019	0.996000	0.38824	0.112000	0.21494	0.990000	0.78478	3.713000	0.54882	2.711000	0.92665	0.655000	0.94253	CAG	EIF2AK1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000086232		0.488	EIF2AK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2AK1	HGNC	protein_coding	OTTHUMT00000207373.2	-	0.00	35	0	G	NM_014413		6066493	-1	tier1	-	no_errors	ENST00000199389	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.472	T
EIF4ENIF1	56478	genome.wustl.edu	37	22	31836038	31836038	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr22:31836038G>A	ENST00000397525.1	-	19	3009	c.2786C>T	c.(2785-2787)cCc>cTc	p.P929L	EIF4ENIF1_ENST00000441289.1_5'Flank|EIF4ENIF1_ENST00000344710.5_Missense_Mutation_p.P755L|EIF4ENIF1_ENST00000397523.1_Missense_Mutation_p.P905L|EIF4ENIF1_ENST00000330125.5_Missense_Mutation_p.P929L|EIF4ENIF1_ENST00000382180.2_Missense_Mutation_p.P584L	NM_001164501.1	NP_001157973.1	Q9NRA8	4ET_HUMAN	eukaryotic translation initiation factor 4E nuclear import factor 1	929						cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						TGACCGGCTGGGCACGTTCTG	0.592																																																	0													57.0	56.0	56.0					22																	31836038		2203	4300	6503	SO:0001583	missense	0			AF240775	CCDS13898.1, CCDS54520.1	22q11.2	2007-01-16			ENSG00000184708	ENSG00000184708			16687	protein-coding gene	gene with protein product		607445				10856257	Standard	NM_019843		Approved	4E-T, FLJ21601, Clast4, 2610509L04Rik	uc003akz.2	Q9NRA8	OTTHUMG00000030793	ENST00000397525.1:c.2786C>T	22.37:g.31836038G>A	ENSP00000380659:p.Pro929Leu		B1AKL2|B1AKL3|B2RBF1|Q8NCF2|Q9H708	Missense_Mutation	SNP	pfam_eIF4E_transporter	p.P929L	ENST00000397525.1	37	c.2786	CCDS13898.1	22	.	.	.	.	.	.	.	.	.	.	G	17.87	3.494151	0.64186	.	.	ENSG00000184708	ENST00000344710;ENST00000397525;ENST00000330125;ENST00000397523;ENST00000382180	.	.	.	5.93	5.93	0.95920	.	0.170141	0.52532	D	0.000076	T	0.40546	0.1121	N	0.24115	0.695	0.58432	D	0.999998	P;P;B;B	0.39665	0.546;0.682;0.152;0.0	B;B;B;B	0.37239	0.244;0.244;0.08;0.0	T	0.39418	-0.9615	9	0.56958	D	0.05	-6.0085	14.5059	0.67752	0.0715:0.0:0.9285:0.0	.	755;929;754;905	B1AKL3;Q9NRA8;Q9NRA8-2;B1AKL4	.;4ET_HUMAN;.;.	L	755;929;929;905;584	.	ENSP00000328103:P929L	P	-	2	0	EIF4ENIF1	30166038	1.000000	0.71417	1.000000	0.80357	0.646000	0.38490	5.130000	0.64745	2.826000	0.97356	0.655000	0.94253	CCC	EIF4ENIF1	-	NULL	ENSG00000184708		0.592	EIF4ENIF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF4ENIF1	HGNC	protein_coding	OTTHUMT00000127926.1	-	0.00	35	0	G	NM_019843		31836038	-1	tier1	-	no_errors	ENST00000330125	ensembl	human	known	74_37	missense	42.31	30	22	SNP	0.997	A
AC018755.1	0	genome.wustl.edu	37	19	52097516	52097516	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr19:52097516G>A	ENST00000301439.3	-	1	114	c.59C>T	c.(58-60)gCg>gTg	p.A20V	AC018755.16_ENST00000598755.1_RNA																							CTCTTTCTCCGCCCCCTCAAA	0.522																																																	0																																										SO:0001583	missense	0																														ENST00000301439.3:c.59C>T	19.37:g.52097516G>A	ENSP00000301439:p.Ala20Val			Missense_Mutation	SNP	NULL	p.A20V	ENST00000301439.3	37	c.59		19	.	.	.	.	.	.	.	.	.	.	G	13.18	2.161398	0.38119	.	.	ENSG00000167765	ENST00000301439	.	.	.	2.76	1.7	0.24286	.	.	.	.	.	T	0.44498	0.1296	.	.	.	0.09310	N	1	D	0.60575	0.988	P	0.50825	0.651	T	0.28776	-1.0033	7	0.87932	D	0	.	7.2547	0.26168	0.0:0.5425:0.4575:0.0	.	20	Q96NP5	.	V	20	.	ENSP00000301439:A20V	A	-	2	0	AC018755.11	56789328	0.000000	0.05858	0.002000	0.10522	0.239000	0.25481	-3.023000	0.00641	0.765000	0.33221	0.440000	0.28878	GCG	AC018755.1	-	NULL	ENSG00000167765		0.522	AC018755.1-201	KNOWN	basic|appris_principal|exp_conf	protein_coding	ENSG00000167765	Clone_based_ensembl_gene	protein_coding			0.00	66	0	G			52097516	-1			no_errors	ENST00000301439	ensembl	human	known	74_37	missense	5.13	74	4	SNP	0.002	A
SNORA11	677799	genome.wustl.edu	37	14	70270921	70270922	+	RNA	INS	-	-	T	rs566317626|rs200703304		TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr14:70270921_70270922insT	ENST00000408133.1	-	0	126_127									small nucleolar RNA, H/ACA box 11																		CATGGATTCTCTTTTTTTTTTT	0.351																																																	0																																												0			AM055729		Xp11.21	2013-09-05			ENSG00000221716	ENSG00000221716		"""ncRNAs / Small nucleolar RNAs : H/ACA box containing"""	32599	non-coding RNA	RNA, small nucleolar	"""small nucleolar RNA, H/ACA box 11A"""	300662				16361266, 16381836	Standard	NR_002953		Approved	U107, SNORA11A	uc021ptl.1				14.37:g.70270932_70270932dupT				RNA	INS	-	NULL	ENST00000408133.1	37	NULL		14																																																																																			SNORA11	-	-	ENSG00000221060		0.351	SNORA11.1-201	NOVEL	basic	snoRNA	ENSG00000221060	RFAM	snoRNA			0.00	20	0	-	NR_002953		70270922	-1	tier1		no_errors	ENST00000408133	ensembl	human	novel	74_37	rna	12.82	34	5	INS	0.001:0.003	T
AC011718.2	0	genome.wustl.edu	37	22	20639449	20639450	+	lincRNA	INS	-	-	TA	rs544044522|rs201855843	byFrequency	TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr22:20639449_20639450insTA	ENST00000577456.1	-	0	2110_2111																											ctttttttttttatatatactt	0.421																																																	0																																												0																															22.37:g.20639456_20639457dupTA				RNA	INS	-	NULL	ENST00000577456.1	37	NULL		22																																																																																			AC011718.2	-	-	ENSG00000223579		0.421	AC011718.2-004	KNOWN	basic	lincRNA	ENSG00000223579	Clone_based_vega_gene	lincRNA	OTTHUMT00000444810.1		0.00	13	0	0			20639450	-1			no_errors	ENST00000577456	ensembl	human	known	74_37	rna	30.77	9	4	INS	0.984:0.986	TA
Unknown	0	genome.wustl.edu	37	1	144615246	144615247	+	IGR	INS	-	-	AG	rs371124631|rs200815869	byFrequency	TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr1:144615246_144615247insAG								RP11-640M9.2 (9355 upstream) : NBPF9 (196496 downstream)																							GTAAACCTCAAAGAGATGTTTT	0.47														1285	0.256589	0.0703	0.2709	5008	,	,		13502	0.4583		0.2247	False		,,,				2504	0.3231																0																																										SO:0001628	intergenic_variant	0																															1.37:g.144615249_144615250dupAG				RNA	INS	-	NULL		37	NULL		1																																																																																			RP11-640M9.2	-	-	ENSG00000225241	0	0.470					ENSG00000225241	Clone_based_vega_gene				0.00	19	0	-			144615247	+1	tier1		no_errors	ENST00000421407	ensembl	human	known	74_37	rna	19.44	29	7	INS	0.030:0.047	AG
FAM66C	440078	genome.wustl.edu	37	12	8359249	8359249	+	RNA	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr12:8359249G>T	ENST00000454799.2	+	0	1821				FAM66C_ENST00000535567.1_RNA|RP11-266K4.1_ENST00000542600.1_RNA|FAM66C_ENST00000456135.2_RNA|FAM66C_ENST00000372173.5_RNA					family with sequence similarity 66, member C																		CAACTTACCTGGGGATAAGAG	0.468																																																	0																																												0					12p13.31	2013-07-05			ENSG00000226711	ENSG00000226711		"""Long non-coding RNAs"""	21644	non-coding RNA	RNA, long non-coding							Standard	NR_026788		Approved		uc001que.4		OTTHUMG00000168638		12.37:g.8359249G>T				RNA	SNP	-	NULL	ENST00000454799.2	37	NULL		12																																																																																			RP11-266K4.1	-	-	ENSG00000244050		0.468	FAM66C-001	KNOWN	basic	antisense	ENSG00000244050	Clone_based_vega_gene	antisense	OTTHUMT00000400453.1	-	0.00	173	0	G	NR_026788		8359249	-1	tier1	-	no_errors	ENST00000542600	ensembl	human	known	74_37	rna	7.17	285	22	SNP	0.016	T
KSR2	283455	genome.wustl.edu	37	12	117890935	117890935	+	3'UTR	SNP	C	C	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr12:117890935C>T	ENST00000425217.1	-	0	16889				RP11-227B21.2_ENST00000540161.1_RNA|NOS1_ENST00000549189.1_5'Flank	NM_173598.4	NP_775869.3	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2						intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(25)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ACACAAGAAACAACAGGCTTG	0.348																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AY345972	CCDS61250.1	12q24.22-q24.23	2014-08-12			ENSG00000171435	ENSG00000171435			18610	protein-coding gene	gene with protein product		610737				12471243	Standard	NM_173598		Approved	FLJ25965	uc001two.2	Q6VAB6	OTTHUMG00000169020	ENST00000425217.1:c.*14069G>A	12.37:g.117890935C>T			A0PJT2|Q3B828|Q8N775	RNA	SNP	-	NULL	ENST00000425217.1	37	NULL		12																																																																																			RP11-227B21.2	-	-	ENSG00000255686		0.348	KSR2-202	KNOWN	basic	protein_coding	ENSG00000255686	Clone_based_vega_gene	protein_coding		-	0.00	25	0	C	NM_173598		117890935	+1	tier1	-	no_errors	ENST00000540161	ensembl	human	known	74_37	rna	12.90	27	4	SNP	0.979	T
CTD-2311B13.7	0	genome.wustl.edu	37	14	19969402	19969402	+	lincRNA	DEL	T	T	-	rs543184938	byFrequency	TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr14:19969402delT	ENST00000547399.1	-	0	2890																											TCCTGTTGTATTTTTTTATAG	0.269													ttttttt|TTTTTTT|TTTTTT|deletion	3	0.000599042	0.0015	0.0	5008	,	,		14810	0.001		0.0	False		,,,				2504	0.0																0																																												0																															14.37:g.19969402delT				RNA	DEL	-	NULL	ENST00000547399.1	37	NULL		14																																																																																			CTD-2311B13.7	-	-	ENSG00000257931		0.269	CTD-2311B13.7-001	KNOWN	basic	lincRNA	ENSG00000257931	Clone_based_vega_gene	lincRNA	OTTHUMT00000409457.1		0.00	27	0	T			19969402	-1	tier1		no_errors	ENST00000547399	ensembl	human	known	74_37	rna	25.00	45	15	DEL	0.163	-
RP11-643G16.4	0	genome.wustl.edu	37	14	68083198	68083198	+	RNA	DEL	A	A	-	rs530475377|rs79536299|rs34690600	byFrequency	TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr14:68083198delA	ENST00000559968.1	+	0	1553				Y_RNA_ENST00000364659.1_RNA																							CTGTAATTGCAAAAAAAAAAA	0.279																																																	0																																												0																															14.37:g.68083198delA				RNA	DEL	-	NULL	ENST00000559968.1	37	NULL		14																																																																																			RP11-643G16.4	-	-	ENSG00000259648		0.279	RP11-643G16.4-002	KNOWN	basic	processed_transcript	ENSG00000259648	Clone_based_vega_gene	pseudogene	OTTHUMT00000417022.1		0.00	12	0	A			68083198	+1	tier1		no_errors	ENST00000559968	ensembl	human	known	74_37	rna	12.90	27	4	DEL	1.000	-
HEATR4	399671	genome.wustl.edu	37	14	73987345	73987345	+	Intron	SNP	A	A	G			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr14:73987345A>G	ENST00000553558.1	-	4	1391				RP3-414A15.11_ENST00000553394.1_RNA|RP3-414A15.2_ENST00000555972.2_RNA|HEATR4_ENST00000334988.2_Intron|HEATR4_ENST00000560393.1_Intron	NM_001220484.1	NP_001207413.1	Q86WZ0	HEAT4_HUMAN	HEAT repeat containing 4											breast(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00386)|OV - Ovarian serous cystadenocarcinoma(108;0.0719)		AGGGATAGAGAAAGCGGGGAG	0.488																																																	0																																										SO:0001627	intron_variant	0			BC047590	CCDS9815.1, CCDS9815.2	14q24.3	2013-09-20			ENSG00000187105	ENSG00000187105			16761	protein-coding gene	gene with protein product						15489334	Standard	NM_203309		Approved	MGC48595	uc021rwf.2	Q86WZ0	OTTHUMG00000171602	ENST00000553558.1:c.1069+210T>C	14.37:g.73987345A>G			B7Z7V9|E9KL41	RNA	SNP	-	NULL	ENST00000553558.1	37	NULL	CCDS9815.2	14																																																																																			RP3-414A15.11	-	-	ENSG00000258443		0.488	HEATR4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ENSG00000258443	Clone_based_vega_gene	protein_coding	OTTHUMT00000414422.2	-	0.00	21	0	A	NM_203309		73987345	-1	tier1	-	no_errors	ENST00000553394	ensembl	human	known	74_37	rna	45.00	11	9	SNP	0.000	G
ENTHD1	150350	genome.wustl.edu	37	22	40140021	40140021	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr22:40140021T>C	ENST00000325157.6	-	7	1737	c.1487A>G	c.(1486-1488)aAt>aGt	p.N496S		NM_152512.3	NP_689725.2	Q8IYW4	ENTD1_HUMAN	ENTH domain containing 1	496										breast(2)|endometrium(1)|kidney(6)|large_intestine(6)|lung(11)|ovary(3)|skin(3)	32	Melanoma(58;0.0749)					ATCAGAGTTATTTGGAAGAAT	0.433																																																	0													57.0	60.0	59.0					22																	40140021		2203	4300	6503	SO:0001583	missense	0			AK093154	CCDS13998.1	22q13.1	2006-06-26			ENSG00000176177	ENSG00000176177			26352	protein-coding gene	gene with protein product						12477932	Standard	NM_152512		Approved	FLJ25421	uc003ayg.3	Q8IYW4	OTTHUMG00000151098	ENST00000325157.6:c.1487A>G	22.37:g.40140021T>C	ENSP00000317431:p.Asn496Ser		B0QYD5|Q5H9F7|Q96LK3	Missense_Mutation	SNP	pfam_Epsin_dom_N,pfam_VHS,superfamily_ENTH_VHS,smart_Epsin-like_N,pfscan_Epsin-like_N	p.N496S	ENST00000325157.6	37	c.1487	CCDS13998.1	22	.	.	.	.	.	.	.	.	.	.	T	3.814	-0.039055	0.07497	.	.	ENSG00000176177	ENST00000325157	T	0.29397	1.57	5.75	2.38	0.29361	.	1.156520	0.06369	N	0.713117	T	0.24470	0.0593	L	0.34521	1.04	0.09310	N	1	B	0.12013	0.005	B	0.08055	0.003	T	0.28933	-1.0028	10	0.52906	T	0.07	0.097	6.32	0.21213	0.0:0.0827:0.3371:0.5802	.	496	Q8IYW4	ENTD1_HUMAN	S	496	ENSP00000317431:N496S	ENSP00000317431:N496S	N	-	2	0	ENTHD1	38469967	0.060000	0.20803	0.000000	0.03702	0.026000	0.11368	0.654000	0.24918	0.087000	0.17167	0.528000	0.53228	AAT	ENTHD1	-	NULL	ENSG00000176177		0.433	ENTHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENTHD1	HGNC	protein_coding	OTTHUMT00000321302.1	-	0.00	21	0	T	NM_152512		40140021	-1	tier1	-	no_errors	ENST00000325157	ensembl	human	known	74_37	missense	18.42	62	14	SNP	0.000	C
ENTPD5	957	genome.wustl.edu	37	14	74440671	74440671	+	Silent	SNP	C	C	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr14:74440671C>T	ENST00000334696.6	-	12	1114	c.795G>A	c.(793-795)ggG>ggA	p.G265G	ENTPD5_ENST00000557325.1_Silent_p.G265G	NM_001249.2	NP_001240.1	O75356	ENTP5_HUMAN	ectonucleoside triphosphate diphosphohydrolase 5	265					'de novo' posttranslational protein folding (GO:0051084)|ATP metabolic process (GO:0046034)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|positive regulation of glycolytic process (GO:0045821)|protein N-linked glycosylation (GO:0006487)|regulation of phosphatidylinositol 3-kinase signaling (GO:0014066)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	guanosine-diphosphatase activity (GO:0004382)|uridine-diphosphatase activity (GO:0045134)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	10				BRCA - Breast invasive adenocarcinoma(234;0.00394)		GGAAAGTGTGCCCATCAGTCC	0.498																																																	0													98.0	85.0	90.0					14																	74440671		2203	4300	6503	SO:0001819	synonymous_variant	0			AF039918	CCDS9825.1	14q24	2003-10-03	2003-10-03			ENSG00000187097			3367	protein-coding gene	gene with protein product		603162	"""proto-oncogene CPH"""	CD39L4, PCPH		9271669, 9676430	Standard	NM_001249		Approved	NTPDase-5	uc010tuo.2	O75356		ENST00000334696.6:c.795G>A	14.37:g.74440671C>T			A1L4C5|Q96RX0	Silent	SNP	pfam_GDA1_CD39_NTPase	p.G265	ENST00000334696.6	37	c.795	CCDS9825.1	14																																																																																			ENTPD5	-	pfam_GDA1_CD39_NTPase	ENSG00000187097		0.498	ENTPD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENTPD5	HGNC	protein_coding	OTTHUMT00000412637.1		0.00	33	0	C	NM_001249		74440671	-1			no_errors	ENST00000334696	ensembl	human	known	74_37	silent	5.71	66	4	SNP	0.998	T
EP300	2033	genome.wustl.edu	37	22	41558785	41558785	+	Splice_Site	SNP	T	T	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr22:41558785T>A	ENST00000263253.7	+	21	4947		c.e21+2			NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300						apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						TCCTGAACTGTAAGTACGATC	0.363			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																															Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	0													144.0	136.0	139.0					22																	41558785		2203	4300	6503	SO:0001630	splice_region_variant	0	Familial Cancer Database	Broad Thumb-Hallux syndrome	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.3728+2T>A	22.37:g.41558785T>A			B1AKC2	Splice_Site	SNP	-	e21+2	ENST00000263253.7	37	c.3728+2	CCDS14010.1	22	.	.	.	.	.	.	.	.	.	.	T	28.7	4.946840	0.92593	.	.	ENSG00000100393	ENST00000263253	.	.	.	5.8	5.8	0.92144	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3246	0.74150	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	EP300	39888731	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.329000	0.79170	2.212000	0.71576	0.528000	0.53228	.	EP300	-	-	ENSG00000100393		0.363	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EP300	HGNC	protein_coding	OTTHUMT00000320600.1		0.00	44	0	T	NM_001429	Intron	41558785	+1			no_errors	ENST00000263253	ensembl	human	known	74_37	splice_site	30.95	17	13	SNP	1.000	A
EP300	2033	genome.wustl.edu	37	22	41558785	41558785	+	Splice_Site	DEL	T	T	-			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr22:41558785delT	ENST00000263253.7	+	21	4947		c.e21+2			NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300						apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						TCCTGAACTGTAAGTACGATC	0.363			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																															Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	0													144.0	136.0	139.0					22																	41558785		2203	4300	6503	SO:0001630	splice_region_variant	0	Familial Cancer Database	Broad Thumb-Hallux syndrome	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.3728+2T>-	22.37:g.41558785delT			B1AKC2	Splice_Site	DEL	-	e21+2	ENST00000263253.7	37	c.3728+2	CCDS14010.1	22																																																																																			EP300	-	-	ENSG00000100393		0.363	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EP300	HGNC	protein_coding	OTTHUMT00000320600.1		0.00	44	0	T	NM_001429	Intron	41558785	+1	tier1		no_errors	ENST00000263253	ensembl	human	known	74_37	splice_site_del	28.57	30	12	DEL	1.000	-
EP400	57634	genome.wustl.edu	37	12	132547096	132547096	+	Silent	SNP	G	G	A	rs74479394|rs113304321	byFrequency	TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr12:132547096G>A	ENST00000333577.4	+	48	8401	c.8292G>A	c.(8290-8292)caG>caA	p.Q2764Q	EP400_ENST00000332482.4_Silent_p.Q2691Q|EP400_ENST00000389561.2_Silent_p.Q2728Q|EP400_ENST00000330386.6_Silent_p.Q2647Q|EP400_ENST00000389562.2_Silent_p.Q2727Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2764	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcaacaacagcagcagcagc	0.567													G|||	734	0.146565	0.3215	0.0432	5008	,	,		15582	0.1111		0.0417	False		,,,				2504	0.1278																0								G		0,4324		0,0,2162	24.0	29.0	27.0		8184	0.5	0.9	12	dbSNP_131	27	1,8349		0,1,4174	no	coding-synonymous	EP400	NM_015409.4		0,1,6336	AA,AG,GG		0.012,0.0,0.0079		2728/3124	132547096	1,12673	2162	4175	6337	SO:0001819	synonymous_variant	0			U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8292G>A	12.37:g.132547096G>A			O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	pfam_SNF2_N,pfam_Helicase/SANT-assoc_DNA-bd,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Homeodomain-like,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Myb-like_dom,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.Q2764	ENST00000333577.4	37	c.8292		12																																																																																			EP400	-	NULL	ENSG00000183495		0.567	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	EP400	HGNC	protein_coding		-	0.00	50	0	G	NM_015409		132547096	+1	tier1	rs74479394	no_errors	ENST00000333577	ensembl	human	known	74_37	silent	10.87	41	5	SNP	0.957	A
EPB41L2	2037	genome.wustl.edu	37	6	131191073	131191075	+	In_Frame_Del	DEL	CTG	CTG	-	rs147222924		TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	CTG	CTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr6:131191073_131191075delCTG	ENST00000337057.3	-	15	2416_2418	c.2235_2237delCAG	c.(2233-2238)agcagt>agt	p.745_746SS>S	EPB41L2_ENST00000527659.1_In_Frame_Del_p.675_676SS>S|EPB41L2_ENST00000527411.1_In_Frame_Del_p.675_676SS>S|EPB41L2_ENST00000524581.1_In_Frame_Del_p.123_124SS>S|EPB41L2_ENST00000530757.1_Intron|EPB41L2_ENST00000368128.2_In_Frame_Del_p.745_746SS>S|EPB41L2_ENST00000530481.1_In_Frame_Del_p.675_676SS>S|EPB41L2_ENST00000445890.2_Intron|EPB41L2_ENST00000529208.1_In_Frame_Del_p.675_676SS>S|EPB41L2_ENST00000525271.1_Intron|EPB41L2_ENST00000531410.1_Intron|EPB41L2_ENST00000525193.1_Intron|EPB41L2_ENST00000392427.3_Intron|EPB41L2_ENST00000528282.1_Intron	NM_001431.3	NP_001422.1	O43491	E41L2_HUMAN	erythrocyte membrane protein band 4.1-like 2	745					cortical actin cytoskeleton organization (GO:0030866)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|spectrin (GO:0008091)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(23)|prostate(1)|skin(2)	44	Breast(56;0.0639)			OV - Ovarian serous cystadenocarcinoma(155;0.0271)|GBM - Glioblastoma multiforme(226;0.0355)		CTCACTCTCACTGCTGCTGCTGC	0.562																																																	0																																										SO:0001651	inframe_deletion	0			AF027299	CCDS5141.1, CCDS47474.1, CCDS56450.1, CCDS59037.1	6q23	2008-08-29			ENSG00000079819	ENSG00000079819			3379	protein-coding gene	gene with protein product		603237				9598318, 9828140	Standard	NM_001431		Approved	4.1-G	uc003qch.2	O43491	OTTHUMG00000015560	ENST00000337057.3:c.2235_2237delCAG	6.37:g.131191082_131191084delCTG	ENSP00000338481:p.Ser746del		B4DHI8|E9PPD9|Q5T4F0|Q68DV2	In_Frame_Del	DEL	pirsf_Band_41_protein,pfam_Band_4.1_C,pfam_SAB_dom,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like,pfscan_FERM_domain	p.S746in_frame_del	ENST00000337057.3	37	c.2237_2235	CCDS5141.1	6																																																																																			EPB41L2	-	pirsf_Band_41_protein	ENSG00000079819		0.562	EPB41L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPB41L2	HGNC	protein_coding	OTTHUMT00000042204.3		0.00	12	0	CTG			131191075	-1	tier1		no_errors	ENST00000337057	ensembl	human	known	74_37	in_frame_del	27.27	8	3	DEL	1.000:1.000:1.000	-
FAM46D	169966	genome.wustl.edu	37	X	79698376	79698376	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chrX:79698376C>A	ENST00000308293.5	+	3	577	c.338C>A	c.(337-339)cCa>cAa	p.P113Q	FAM46D_ENST00000538312.1_Missense_Mutation_p.P113Q	NM_152630.4	NP_689843.1	Q8NEK8	FA46D_HUMAN	family with sequence similarity 46, member D	113										kidney(1)|large_intestine(6)|liver(3)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23						GACTTTTTACCAAAAGATGTA	0.388																																																	0													91.0	87.0	88.0					X																	79698376		2203	4299	6502	SO:0001583	missense	0			BX537938	CCDS14446.1	Xq21.1	2009-08-18			ENSG00000174016	ENSG00000174016			28399	protein-coding gene	gene with protein product	"""cancer/testis antigen 112"""					12477932	Standard	NM_152630		Approved	MGC26999, CT1.26, CT112	uc004edl.1	Q8NEK8	OTTHUMG00000021902	ENST00000308293.5:c.338C>A	X.37:g.79698376C>A	ENSP00000308575:p.Pro113Gln		B2R9Q6|Q7Z3F6|Q8NHU1	Missense_Mutation	SNP	pfam_DUF1693	p.P113Q	ENST00000308293.5	37	c.338	CCDS14446.1	X	.	.	.	.	.	.	.	.	.	.	C	14.13	2.443202	0.43429	.	.	ENSG00000174016	ENST00000538312;ENST00000308293	T;T	0.48522	0.81;0.81	4.27	4.27	0.50696	Domain of unknown function DUF1693 (1);	0.000000	0.85682	D	0.000000	T	0.72630	0.3484	M	0.88842	2.985	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.79624	-0.1726	10	0.87932	D	0	-7.9	14.5078	0.67764	0.0:1.0:0.0:0.0	.	113	Q8NEK8	FA46D_HUMAN	Q	113	ENSP00000443410:P113Q;ENSP00000308575:P113Q	ENSP00000308575:P113Q	P	+	2	0	FAM46D	79585032	1.000000	0.71417	0.999000	0.59377	0.233000	0.25261	7.323000	0.79105	1.965000	0.57142	0.538000	0.68166	CCA	FAM46D	-	pfam_DUF1693	ENSG00000174016		0.388	FAM46D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM46D	HGNC	protein_coding	OTTHUMT00000057338.1	-	0.00	9	0	C	NM_152630		79698376	+1	tier1	-	no_errors	ENST00000308293	ensembl	human	known	74_37	missense	84.44	7	38	SNP	1.000	A
FAM91A1	157769	genome.wustl.edu	37	8	124790938	124790938	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr8:124790938A>G	ENST00000334705.7	+	6	721	c.475A>G	c.(475-477)Ata>Gta	p.I159V	FAM91A1_ENST00000521166.1_Missense_Mutation_p.I159V	NM_144963.2	NP_659400	Q658Y4	F91A1_HUMAN	family with sequence similarity 91, member A1	159										breast(4)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28	Lung NSC(37;8.76e-13)|Ovarian(258;0.00744)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00192)			TCTTCTACCAATAAAGCCAGT	0.388																																																	0													52.0	48.0	50.0					8																	124790938		1835	4081	5916	SO:0001583	missense	0			AK074370	CCDS6346.2	8q24.13	2005-10-04			ENSG00000176853	ENSG00000176853			26306	protein-coding gene	gene with protein product						12477932	Standard	XM_005250806		Approved	FLJ23790	uc003yqv.3	Q658Y4	OTTHUMG00000133021	ENST00000334705.7:c.475A>G	8.37:g.124790938A>G	ENSP00000335082:p.Ile159Val		B6YY23|Q658T5|Q8TE89	Missense_Mutation	SNP	NULL	p.I159V	ENST00000334705.7	37	c.475	CCDS6346.2	8	.	.	.	.	.	.	.	.	.	.	A	10.23	1.292200	0.23564	.	.	ENSG00000176853	ENST00000521166;ENST00000334705	T;T	0.40476	1.03;1.62	5.63	-3.31	0.04988	.	0.388626	0.25497	N	0.030261	T	0.14830	0.0358	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.12993	-1.0526	10	0.26408	T	0.33	.	7.5188	0.27616	0.5491:0.0:0.3374:0.1135	.	159;159	E7ER68;Q658Y4	.;F91A1_HUMAN	V	159	ENSP00000429491:I159V;ENSP00000335082:I159V	ENSP00000335082:I159V	I	+	1	0	FAM91A1	124860119	0.163000	0.22920	0.002000	0.10522	0.983000	0.72400	0.628000	0.24522	-0.997000	0.03450	-0.242000	0.12053	ATA	FAM91A1	-	NULL	ENSG00000176853		0.388	FAM91A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM91A1	HGNC	protein_coding	OTTHUMT00000256607.1	-	0.00	68	0	A	NM_144963		124790938	+1	tier1	-	no_errors	ENST00000334705	ensembl	human	known	74_37	missense	15.24	138	25	SNP	0.008	G
FAT3	120114	genome.wustl.edu	37	11	92532036	92532036	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr11:92532036C>A	ENST00000298047.6	+	9	5874	c.5857C>A	c.(5857-5859)Ctg>Atg	p.L1953M	FAT3_ENST00000409404.2_Missense_Mutation_p.L1953M|FAT3_ENST00000525166.1_Missense_Mutation_p.L1803M			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1953	Cadherin 17. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TCACTACATGCTGATAGTTAA	0.413										TCGA Ovarian(4;0.039)																																							0													95.0	90.0	92.0					11																	92532036		1904	4130	6034	SO:0001583	missense	0			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.5857C>A	11.37:g.92532036C>A	ENSP00000298047:p.Leu1953Met		B5MDB0|Q96AU6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.L1953M	ENST00000298047.6	37	c.5857		11	.	.	.	.	.	.	.	.	.	.	C	13.62	2.290519	0.40494	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.71341	-0.56;-0.56;-0.56	6.02	2.99	0.34606	.	.	.	.	.	T	0.81211	0.4775	M	0.80332	2.49	0.80722	D	1	D	0.65815	0.995	D	0.63793	0.918	T	0.80739	-0.1248	9	0.87932	D	0	.	9.8042	0.40783	0.0:0.7639:0.0:0.2361	.	1953	Q8TDW7-3	.	M	1953;1953;1803	ENSP00000298047:L1953M;ENSP00000387040:L1953M;ENSP00000432586:L1803M	ENSP00000298047:L1953M	L	+	1	2	FAT3	92171684	1.000000	0.71417	0.967000	0.41034	0.989000	0.77384	1.904000	0.39868	0.350000	0.24002	0.655000	0.94253	CTG	FAT3	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000165323		0.413	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		-	0.00	25	0	C	NM_001008781		92532036	+1	tier1	-	no_errors	ENST00000298047	ensembl	human	known	74_37	missense	58.33	10	14	SNP	1.000	A
FBN2	2201	genome.wustl.edu	37	5	127866299	127866299	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr5:127866299C>T	ENST00000508053.1	-	9	1399	c.425G>A	c.(424-426)gGa>gAa	p.G142E	FBN2_ENST00000262464.4_Missense_Mutation_p.G142E|FBN2_ENST00000508989.1_Intron			P35556	FBN2_HUMAN	fibrillin 2	142	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TGATTTTGATCCACAGGTTGA	0.398																																																	0													110.0	100.0	103.0					5																	127866299		2203	4300	6503	SO:0001583	missense	0			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.425G>A	5.37:g.127866299C>T	ENSP00000424571:p.Gly142Glu		B4DU01|Q59ES6	Missense_Mutation	SNP	pirsf_FBN,pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Cadherin-like,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.G142E	ENST00000508053.1	37	c.425	CCDS34222.1	5	.	.	.	.	.	.	.	.	.	.	C	16.51	3.144650	0.57044	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000502468	D;D;T	0.83419	-1.72;-1.72;0.13	4.59	3.72	0.42706	.	0.297605	0.28665	N	0.014542	D	0.88407	0.6428	M	0.64997	1.995	0.51012	D	0.999906	D;D	0.76494	0.999;0.994	D;P	0.72982	0.979;0.881	D	0.86374	0.1725	10	0.23891	T	0.37	.	15.5037	0.75722	0.0:0.8607:0.1393:0.0	.	142;142	E9PHW4;P35556	.;FBN2_HUMAN	E	142	ENSP00000262464:G142E;ENSP00000424571:G142E;ENSP00000424753:G142E	ENSP00000262464:G142E	G	-	2	0	FBN2	127894198	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.859000	0.48364	1.528000	0.49103	0.655000	0.94253	GGA	FBN2	-	pirsf_FBN	ENSG00000138829		0.398	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN2	HGNC	protein_coding	OTTHUMT00000371618.2	-	0.00	45	0	C	NM_001999		127866299	-1	tier1	-	no_errors	ENST00000262464	ensembl	human	known	74_37	missense	20.41	39	10	SNP	1.000	T
FKBPL	63943	genome.wustl.edu	37	6	32097535	32097535	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr6:32097535G>T	ENST00000375156.3	-	2	293	c.23C>A	c.(22-24)aCa>aAa	p.T8K	ATF6B_ENST00000375203.3_5'Flank|ATF6B_ENST00000468502.1_5'Flank|ATF6B_ENST00000375201.4_5'Flank	NM_022110.3	NP_071393.2	Q9UIM3	FKBPL_HUMAN	FK506 binding protein like	8					chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)|response to radiation (GO:0009314)	endoplasmic reticulum membrane (GO:0005789)	FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)										TTCTCCAATTGTATTGACTGG	0.498																																																	0													30.0	33.0	32.0					6																	32097535		2196	4296	6492	SO:0001583	missense	0			AF139374	CCDS4738.1	6p21.3	2013-12-13	2001-11-28		ENSG00000204315	ENSG00000204315		"""Tetratricopeptide (TTC) repeat domain containing"""	13949	protein-coding gene	gene with protein product	"""WAF-1/CIP1 stabilizing protein 39"""		"""FK506-binding protein like"""			9056895	Standard	NM_022110		Approved	DIR1, NG7, WISp39	uc003nzr.3	Q9UIM3	OTTHUMG00000031129	ENST00000375156.3:c.23C>A	6.37:g.32097535G>T	ENSP00000364298:p.Thr8Lys		A8K5V3|B0UYX8|Q9H5G3	Missense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.T8K	ENST00000375156.3	37	c.23	CCDS4738.1	6	.	.	.	.	.	.	.	.	.	.	G	13.11	2.139686	0.37728	.	.	ENSG00000204315	ENST00000375156	T	0.80304	-1.36	5.24	2.39	0.29439	.	1.570140	0.04009	N	0.297927	T	0.43523	0.1251	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.41556	-0.9502	10	0.56958	D	0.05	0.1297	5.0382	0.14445	0.178:0.0:0.6558:0.1661	.	8	Q9UIM3	FKBPL_HUMAN	K	8	ENSP00000364298:T8K	ENSP00000364298:T8K	T	-	2	0	FKBPL	32205513	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	-0.217000	0.09253	0.749000	0.32854	0.462000	0.41574	ACA	FKBPL	-	NULL	ENSG00000204315		0.498	FKBPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBPL	HGNC	protein_coding	OTTHUMT00000076221.2	-	0.00	37	0	G			32097535	-1	tier1	-	no_errors	ENST00000375156	ensembl	human	known	74_37	missense	5.80	65	4	SNP	0.000	T
FLOT2	2319	genome.wustl.edu	37	17	27210170	27210170	+	Frame_Shift_Del	DEL	T	T	-			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr17:27210170delT	ENST00000394908.4	-	4	406	c.302delA	c.(301-303)aacfs	p.N101fs	FLOT2_ENST00000577789.1_5'UTR|FLOT2_ENST00000585169.1_Frame_Shift_Del_p.N101fs|FLOT2_ENST00000394906.2_Frame_Shift_Del_p.N156fs	NM_004475.2	NP_004466.2	Q14254	FLOT2_HUMAN	flotillin 2	101					cell adhesion (GO:0007155)|epidermis development (GO:0008544)|establishment of protein localization to plasma membrane (GO:0090002)|negative regulation of amyloid precursor protein catabolic process (GO:1902992)|negative regulation of gene expression (GO:0010629)|protein stabilization (GO:0050821)	acrosomal membrane (GO:0002080)|caveola (GO:0005901)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|flotillin complex (GO:0016600)|focal adhesion (GO:0005925)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				endometrium(3)|lung(6)|prostate(1)|urinary_tract(1)	11	all_cancers(5;2.12e-15)|all_epithelial(6;3.44e-19)|Lung NSC(42;0.01)		Epithelial(11;3.26e-06)|all cancers(11;1.76e-05)|BRCA - Breast invasive adenocarcinoma(11;0.00015)|OV - Ovarian serous cystadenocarcinoma(11;0.0602)			CAGGACGACGTTTTTGATGTC	0.582																																																	0													104.0	119.0	114.0					17																	27210170		2027	4189	6216	SO:0001589	frameshift_variant	0			M60922	CCDS11245.2	17q11-q12	2008-07-18			ENSG00000132589	ENSG00000132589			3758	protein-coding gene	gene with protein product	"""Flotillin 2 (epidermal surface antigen 1)"", ""membrane component, chromosome 17, surface marker 1 (35kD protein identified by monoclonal antibody ECS-1)"""	131560		M17S1		1769667	Standard	XM_005257950		Approved	ESA, ESA1, ECS-1, ECS1	uc002hdc.3	Q14254	OTTHUMG00000132674	ENST00000394908.4:c.302delA	17.37:g.27210170delT	ENSP00000378368:p.Asn101fs			Frame_Shift_Del	DEL	pfam_Band_7,smart_Band_7	p.N101fs	ENST00000394908.4	37	c.302	CCDS11245.2	17																																																																																			FLOT2	-	pfam_Band_7,smart_Band_7	ENSG00000132589		0.582	FLOT2-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	FLOT2	HGNC	protein_coding	OTTHUMT00000255935.3		0.00	42	0	T	NM_004475		27210170	-1	tier1		no_errors	ENST00000394908	ensembl	human	known	74_37	frame_shift_del	5.13	37	2	DEL	1.000	-
FOCAD	54914	genome.wustl.edu	37	9	20951011	20951011	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr9:20951011G>T	ENST00000380249.1	+	36	4329	c.3965G>T	c.(3964-3966)gGg>gTg	p.G1322V	FOCAD_ENST00000338382.6_Missense_Mutation_p.G1322V|FOCAD_ENST00000605086.1_Missense_Mutation_p.G758V	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin	1322						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)											AGTGTCTCTGGGGTGATTGGT	0.403																																																	0													222.0	206.0	212.0					9																	20951011		2203	4300	6503	SO:0001583	missense	0			AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.3965G>T	9.37:g.20951011G>T	ENSP00000369599:p.Gly1322Val		D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Missense_Mutation	SNP	pfam_DUF3028,pfam_DUF3730,superfamily_ARM-type_fold	p.G1322V	ENST00000380249.1	37	c.3965	CCDS34993.1	9	.	.	.	.	.	.	.	.	.	.	G	17.34	3.365209	0.61513	.	.	ENSG00000188352	ENST00000380249;ENST00000338382	T;T	0.30448	1.53;1.53	5.87	4.92	0.64577	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.50360	0.1611	M	0.67953	2.075	0.80722	D	1	D	0.61080	0.989	P	0.61003	0.882	T	0.50759	-0.8790	10	0.66056	D	0.02	-21.9872	15.4228	0.75025	0.0:0.1396:0.8604:0.0	.	1322	Q5VW36	K1797_HUMAN	V	1322	ENSP00000369599:G1322V;ENSP00000344307:G1322V	ENSP00000344307:G1322V	G	+	2	0	KIAA1797	20941011	1.000000	0.71417	1.000000	0.80357	0.687000	0.40016	4.454000	0.60068	2.775000	0.95449	0.650000	0.86243	GGG	FOCAD	-	pfam_DUF3028,superfamily_ARM-type_fold	ENSG00000188352		0.403	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOCAD	HGNC	protein_coding	OTTHUMT00000143442.1	-	0.00	76	0	G	NM_017794		20951011	+1	tier1	-	no_errors	ENST00000338382	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	T
FOXF2	2295	genome.wustl.edu	37	6	1390978	1390980	+	In_Frame_Del	DEL	CAC	CAC	-			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	CAC	CAC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr6:1390978_1390980delCAC	ENST00000259806.1	+	1	910_912	c.796_798delCAC	c.(796-798)cacdel	p.H272del		NM_001452.1	NP_001443.1	Q12947	FOXF2_HUMAN	forkhead box F2	272	Poly-His.				embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digestive tract development (GO:0048566)|epithelial to mesenchymal transition (GO:0001837)|establishment of planar polarity of embryonic epithelium (GO:0042249)|extracellular matrix organization (GO:0030198)|genitalia development (GO:0048806)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			large_intestine(2)|lung(5)|prostate(1)	8	Ovarian(93;0.0733)	all_lung(73;0.0713)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.095)		CGCGCACCCTcaccaccaccacc	0.768																																																	0										14,1482		3,8,737						-5.5	0.6			2	53,3199		10,33,1583	no	coding	FOXF2	NM_001452.1		13,41,2320	A1A1,A1R,RR		1.6298,0.9358,1.4111				67,4681				SO:0001651	inframe_deletion	0			U13220	CCDS4472.1	6p25.3	2008-04-10			ENSG00000137273	ENSG00000137273		"""Forkhead boxes"""	3810	protein-coding gene	gene with protein product		603250		FKHL6		9799607, 7957066	Standard	NM_001452		Approved	FREAC2	uc003mtm.3	Q12947	OTTHUMG00000016243	ENST00000259806.1:c.796_798delCAC	6.37:g.1390987_1390989delCAC	ENSP00000259806:p.His272del		Q5TGJ1|Q9UQ85	In_Frame_Del	DEL	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.H269in_frame_del	ENST00000259806.1	37	c.796_798	CCDS4472.1	6																																																																																			FOXF2	-	NULL	ENSG00000137273		0.768	FOXF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXF2	HGNC	protein_coding	OTTHUMT00000043558.1		0.00	16	0	CAC			1390980	+1	tier1		no_errors	ENST00000259806	ensembl	human	known	74_37	in_frame_del	17.39	19	4	DEL	0.969:0.975:0.979	-
FSIP2	401024	genome.wustl.edu	37	2	186655921	186655921	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr2:186655921T>C	ENST00000424728.1	+	16	4058	c.4058T>C	c.(4057-4059)tTg>tCg	p.L1353S	AC008174.3_ENST00000429929.1_RNA|AC008174.3_ENST00000436557.1_RNA|FSIP2_ENST00000343098.5_Missense_Mutation_p.L1442S			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	1353										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						GATGACATTTTGGCGAGTCCA	0.343																																																	0																																										SO:0001583	missense	0			AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.4058T>C	2.37:g.186655921T>C	ENSP00000401306:p.Leu1353Ser		Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	NULL	p.L1442S	ENST00000424728.1	37	c.4325		2	.	.	.	.	.	.	.	.	.	.	T	6.817	0.519849	0.13005	.	.	ENSG00000188738	ENST00000343098;ENST00000424728;ENST00000326147	T;T	0.53206	0.63;0.64	5.01	-1.85	0.07784	.	0.666605	0.14691	N	0.304157	T	0.21145	0.0509	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.15578	-1.0432	8	0.87932	D	0	.	0.9154	0.01303	0.1519:0.2617:0.1573:0.4291	.	.	.	.	S	1442;1353;1353	ENSP00000344403:L1442S;ENSP00000401306:L1353S	ENSP00000321903:L1353S	L	+	2	0	FSIP2	186364166	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.026000	0.12392	-0.478000	0.06823	-0.297000	0.09499	TTG	FSIP2	-	NULL	ENSG00000188738		0.343	FSIP2-001	KNOWN	basic	protein_coding	FSIP2	HGNC	protein_coding	OTTHUMT00000332778.3	-	0.00	11	0	T	NM_173651		186655921	+1	tier1	-	no_errors	ENST00000343098	ensembl	human	known	74_37	missense	44.44	30	24	SNP	0.000	C
GCM1	8521	genome.wustl.edu	37	6	52993048	52993048	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr6:52993048G>T	ENST00000259803.7	-	6	1478	c.1267C>A	c.(1267-1269)Cac>Aac	p.H423N	RP11-506E9.3_ENST00000566420.1_RNA	NM_003643.3	NP_003634.2	Q9NP62	GCM1_HUMAN	glial cells missing homolog 1 (Drosophila)	423					anatomical structure morphogenesis (GO:0009653)|astrocyte fate commitment (GO:0060018)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|cell differentiation involved in embryonic placenta development (GO:0060706)|positive regulation of syncytium formation by plasma membrane fusion (GO:0060143)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.H423N(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(15)|ovary(1)|skin(1)	24	Lung NSC(77;0.0755)					TTGTTGCAGTGATCCAAACCC	0.458																																																	1	Substitution - Missense(1)	lung(1)											221.0	222.0	222.0					6																	52993048		2203	4300	6503	SO:0001583	missense	0			D88613	CCDS4950.1	6p21-p12	2008-08-29	2001-11-28	2002-09-27	ENSG00000137270	ENSG00000137270			4197	protein-coding gene	gene with protein product		603715	"""glial cells missing (Drosophila) homolog a"""	GCMA		8962155	Standard	NM_003643		Approved	hGCMa	uc003pbp.3	Q9NP62	OTTHUMG00000014871	ENST00000259803.7:c.1267C>A	6.37:g.52993048G>T	ENSP00000259803:p.His423Asn		Q4VAQ7|Q5T0X0|Q99468|Q9P1X3	Missense_Mutation	SNP	pfam_Tscrpt_reg_GCM_motif,superfamily_Tscrpt_reg_GCM_motif,pfscan_Tscrpt_reg_GCM_motif	p.H423N	ENST00000259803.7	37	c.1267	CCDS4950.1	6	.	.	.	.	.	.	.	.	.	.	G	7.861	0.726017	0.15439	.	.	ENSG00000137270	ENST00000259803	T	0.74106	-0.81	5.82	4.02	0.46733	.	0.172920	0.41294	D	0.000918	T	0.40570	0.1122	L	0.34521	1.04	0.25402	N	0.988434	P	0.38335	0.627	B	0.34722	0.188	T	0.33214	-0.9877	10	0.66056	D	0.02	-15.3325	5.1125	0.14817	0.2075:0.1687:0.6239:0.0	.	423	Q9NP62	GCM1_HUMAN	N	423	ENSP00000259803:H423N	ENSP00000259803:H423N	H	-	1	0	GCM1	53101007	1.000000	0.71417	0.993000	0.49108	0.055000	0.15305	2.269000	0.43346	0.795000	0.33922	-0.136000	0.14681	CAC	GCM1	-	NULL	ENSG00000137270		0.458	GCM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCM1	HGNC	protein_coding	OTTHUMT00000040953.1		0.00	25	0	G			52993048	-1			no_errors	ENST00000259803	ensembl	human	known	74_37	missense	8.82	31	3	SNP	0.787	T
GGT3P	2679	genome.wustl.edu	37	22	18769843	18769843	+	RNA	SNP	T	T	C			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr22:18769843T>C	ENST00000412448.1	-	0	835							A6NGU5	GGT3_HUMAN	gamma-glutamyltransferase 3 pseudogene						glutathione biosynthetic process (GO:0006750)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)										CCGACAGCCCTCCTGGGGAGA	0.652																																																	0																																												0					22q11.21	2008-08-05	2008-03-10	2008-03-10	ENSG00000197421	ENSG00000197421		"""Gamma-glutamyltransferases"""	4252	pseudogene	pseudogene			"""gamma-glutamyltransferase 3"""	GGT3		8104871, 18357469	Standard	NR_003267		Approved		uc002zob.1	A6NGU5	OTTHUMG00000150161		22.37:g.18769843T>C				RNA	SNP	-	NULL	ENST00000412448.1	37	NULL		22																																																																																			GGT3P	-	-	ENSG00000197421		0.652	GGT3P-002	KNOWN	basic	processed_transcript	GGT3P	HGNC	pseudogene	OTTHUMT00000341281.1		0.00	46	0	T	NR_003267		18769843	-1			no_errors	ENST00000412448	ensembl	human	known	74_37	rna	5.56	68	4	SNP	0.856	C
GNA12	2768	genome.wustl.edu	37	7	2770886	2770886	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr7:2770886C>T	ENST00000275364.3	-	4	1237	c.1075G>A	c.(1075-1077)Gtc>Atc	p.V359I	GNA12_ENST00000407653.1_Missense_Mutation_p.V283I|GNA12_ENST00000491117.1_5'UTR|GNA12_ENST00000407904.3_Missense_Mutation_p.V300I|GNA12_ENST00000396960.3_Missense_Mutation_p.V211I|AMZ1_ENST00000489665.1_Intron|GNA12_ENST00000544127.1_Missense_Mutation_p.V266I	NM_007353.2	NP_031379.2	Q03113	GNA12_HUMAN	guanine nucleotide binding protein (G protein) alpha 12	359					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|embryonic digit morphogenesis (GO:0042733)|G-protein coupled receptor signaling pathway (GO:0007186)|in utero embryonic development (GO:0001701)|platelet activation (GO:0030168)|regulation of cell shape (GO:0008360)|regulation of fibroblast migration (GO:0010762)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|regulation of TOR signaling (GO:0032006)|response to drug (GO:0042493)|Rho protein signal transduction (GO:0007266)	brush border membrane (GO:0031526)|focal adhesion (GO:0005925)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	D5 dopamine receptor binding (GO:0031752)|G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			endometrium(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.02e-13)		ACGAAGCGGACGTTCTCGGTG	0.587																																																	0													139.0	137.0	138.0					7																	2770886		2203	4300	6503	SO:0001583	missense	0			L01694	CCDS5335.1, CCDS64584.1, CCDS64583.1	7p22.3	2006-07-08			ENSG00000146535	ENSG00000146535			4380	protein-coding gene	gene with protein product		604394				8423800, 16247467	Standard	NM_007353		Approved	gep	uc003smu.3	Q03113	OTTHUMG00000023064	ENST00000275364.3:c.1075G>A	7.37:g.2770886C>T	ENSP00000275364:p.Val359Ile		A4D204|B3KXS2|B7Z3F7|Q2T9L1|Q5PPR5|Q86UM8|Q8TD71|Q9UDU9	Missense_Mutation	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su,prints_Gprotein_alpha_12	p.V359I	ENST00000275364.3	37	c.1075	CCDS5335.1	7	.	.	.	.	.	.	.	.	.	.	C	4.985	0.183019	0.09495	.	.	ENSG00000146535	ENST00000275364;ENST00000407904;ENST00000407653;ENST00000396960;ENST00000544127	D;D;D;D;D	0.89270	-2.49;-2.49;-2.49;-2.49;-2.49	5.79	4.65	0.58169	.	0.150474	0.64402	N	0.000016	T	0.58949	0.2158	N	0.00152	-1.975	0.32855	D	0.507195	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.62445	-0.6853	10	0.02654	T	1	.	11.0969	0.48150	0.0:0.0733:0.0:0.9267	.	359;359;300	Q5PPR5;Q03113;B3KXS2	.;GNA12_HUMAN;.	I	359;300;283;211;266	ENSP00000275364:V359I;ENSP00000385935:V300I;ENSP00000386054:V283I;ENSP00000380160:V211I;ENSP00000437469:V266I	ENSP00000275364:V359I	V	-	1	0	GNA12	2737412	1.000000	0.71417	1.000000	0.80357	0.756000	0.42949	6.171000	0.71926	1.033000	0.39918	-0.302000	0.09304	GTC	GNA12	-	pfam_Gprotein_alpha_su,superfamily_P-loop_NTPase,smart_Gprotein_alpha_su	ENSG00000146535		0.587	GNA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNA12	HGNC	protein_coding	OTTHUMT00000241608.1	-	0.00	35	0	C	NM_007353		2770886	-1	tier1	-	no_errors	ENST00000275364	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	T
GNAS	2778	genome.wustl.edu	37	20	57467171	57467171	+	Intron	SNP	G	G	C			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr20:57467171G>C	ENST00000371085.3	+	1	563				GNAS_ENST00000265620.7_Intron|GNAS_ENST00000371095.3_Intron|GNAS_ENST00000306090.10_Intron|GNAS_ENST00000313949.7_Intron|GNAS_ENST00000371081.1_Intron|GNAS_ENST00000464624.2_Intron|GNAS_ENST00000371100.4_Intron|GNAS_ENST00000354359.7_Intron|GNAS_ENST00000371075.3_Intron|GNAS_ENST00000371102.4_Intron|GNAS_ENST00000371098.2_Intron	NM_000516.4	NP_000507.1	P63092	GNAS2_HUMAN	GNAS complex locus						activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			cggccTGCCCGCTCAGTGtct	0.701			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)			Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	0																																										SO:0001627	intron_variant	0			M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371085.3:c.139+251G>C	20.37:g.57467171G>C			A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	RNA	SNP	-	NULL	ENST00000371085.3	37	NULL	CCDS13472.1	20																																																																																			GNAS	-	-	ENSG00000087460		0.701	GNAS-015	KNOWN	basic|CCDS	protein_coding	GNAS	HGNC	protein_coding	OTTHUMT00000080431.2	-	0.00	33	0	G	NM_000516		57467171	+1	tier1	-	no_errors	ENST00000476935	ensembl	human	known	74_37	rna	44.12	19	15	SNP	0.006	C
GNB5	10681	genome.wustl.edu	37	15	52425597	52425597	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr15:52425597C>T	ENST00000261837.7	-	9	906	c.841G>A	c.(841-843)Gaa>Aaa	p.E281K	CTD-2184D3.7_ENST00000557898.1_RNA|GNB5_ENST00000559348.1_5'UTR|GNB5_ENST00000358784.7_Missense_Mutation_p.E239K|GNB5_ENST00000396335.4_Missense_Mutation_p.E169K	NM_016194.3	NP_057278.2	O14775	GBB5_HUMAN	guanine nucleotide binding protein (G protein), beta 5	281					GTP catabolic process (GO:0006184)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	chaperone binding (GO:0051087)|G-protein gamma-subunit binding (GO:0031682)|GTPase activity (GO:0003924)|signal transducer activity (GO:0004871)			large_intestine(1)|lung(1)	2				all cancers(107;0.0163)		ATGTCAGATTCATGTGTTTCA	0.517																																																	0													154.0	116.0	129.0					15																	52425597		2195	4293	6488	SO:0001583	missense	0			AF017656	CCDS10149.1, CCDS45261.1	15q21.1	2013-01-10			ENSG00000069966	ENSG00000069966		"""WD repeat domain containing"""	4401	protein-coding gene	gene with protein product		604447				9606987	Standard	NM_016194		Approved	GB5	uc031qrz.1	O14775	OTTHUMG00000131892	ENST00000261837.7:c.841G>A	15.37:g.52425597C>T	ENSP00000261837:p.Glu281Lys		B2RBR5|Q9HAU9|Q9UFT3	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_Guanine_nucleotide-bd_bsu,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Gprotein_B,prints_G-protein_beta_WD-40_rep	p.E281K	ENST00000261837.7	37	c.841	CCDS10149.1	15	.	.	.	.	.	.	.	.	.	.	C	23.5	4.419306	0.83559	.	.	ENSG00000069966	ENST00000261837;ENST00000396335;ENST00000544480;ENST00000358784	T	0.62364	0.03	5.78	5.78	0.91487	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.106561	0.64402	D	0.000007	T	0.51143	0.1657	N	0.16478	0.41	0.80722	D	1	B;B	0.27625	0.183;0.002	B;B	0.25614	0.062;0.005	T	0.50980	-0.8763	10	0.66056	D	0.02	-31.9117	20.0139	0.97470	0.0:1.0:0.0:0.0	.	281;169	O14775;O14775-3	GBB5_HUMAN;.	K	281;239;79;169	ENSP00000261837:E281K	ENSP00000261837:E281K	E	-	1	0	GNB5	50212889	1.000000	0.71417	0.694000	0.30210	0.987000	0.75469	7.291000	0.78721	2.724000	0.93272	0.563000	0.77884	GAA	GNB5	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_Guanine_nucleotide-bd_bsu,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000069966		0.517	GNB5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GNB5	HGNC	protein_coding	OTTHUMT00000254842.1	-	0.00	59	0	C			52425597	-1	tier1	-	no_errors	ENST00000261837	ensembl	human	known	74_37	missense	50.85	29	30	SNP	1.000	T
GPR135	64582	genome.wustl.edu	37	14	59930820	59930820	+	Silent	SNP	C	C	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr14:59930820C>T	ENST00000395116.1	-	1	1240	c.1125G>A	c.(1123-1125)ctG>ctA	p.L375L		NM_022571.5	NP_072093.2	Q8IZ08	GP135_HUMAN	G protein-coupled receptor 135	375						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(108;0.134)		TGGCCCAGGTCAGCCAGACGG	0.672																																																	0													29.0	25.0	26.0					14																	59930820		2194	4294	6488	SO:0001819	synonymous_variant	0			AY288418	CCDS9738.1	14q23.1	2012-08-21			ENSG00000181619	ENSG00000181619		"""GPCR / Class A : Orphans"""	19991	protein-coding gene	gene with protein product		607970				14623098	Standard	NM_022571		Approved	HUMNPIIY20, PAFR	uc010apj.3	Q8IZ08	OTTHUMG00000140325	ENST00000395116.1:c.1125G>A	14.37:g.59930820C>T			Q7Z604|Q86SM3|Q8NH39	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.L375	ENST00000395116.1	37	c.1125	CCDS9738.1	14																																																																																			GPR135	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000181619		0.672	GPR135-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR135	HGNC	protein_coding	OTTHUMT00000276941.1	-	0.00	69	0	C	NM_022571		59930820	-1	tier1	-	no_errors	ENST00000395116	ensembl	human	known	74_37	silent	6.02	78	5	SNP	1.000	T
GPRASP2	114928	genome.wustl.edu	37	X	101970762	101970762	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chrX:101970762G>T	ENST00000535209.1	+	4	1796	c.965G>T	c.(964-966)aGa>aTa	p.R322I	GPRASP2_ENST00000543253.1_Missense_Mutation_p.R322I|GPRASP2_ENST00000332262.5_Missense_Mutation_p.R322I			Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting protein 2	322						cytoplasm (GO:0005737)	beta-amyloid binding (GO:0001540)			breast(3)|endometrium(5)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	30						AGGACAAATAGAGAAGATTGT	0.448																																																	0													106.0	103.0	104.0					X																	101970762		2203	4300	6503	SO:0001583	missense	0			AK094646	CCDS14501.1	Xq22.1	2014-03-21			ENSG00000158301	ENSG00000158301		"""Armadillo repeat containing"""	25169	protein-coding gene	gene with protein product						15086532, 16221301	Standard	NM_138437		Approved	GASP2, FLJ37327		Q96D09	OTTHUMG00000022059	ENST00000535209.1:c.965G>T	X.37:g.101970762G>T	ENSP00000437394:p.Arg322Ile		D3DXA0|Q8NAB4	Missense_Mutation	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	p.R322I	ENST00000535209.1	37	c.965	CCDS14501.1	X	.	.	.	.	.	.	.	.	.	.	G	1.885	-0.456896	0.04540	.	.	ENSG00000158301	ENST00000543253;ENST00000535209;ENST00000332262	T;T;T	0.10005	2.92;2.92;2.92	4.2	2.44	0.29823	.	0.000000	0.49305	D	0.000142	T	0.12689	0.0308	L	0.58101	1.795	0.43662	D	0.996089	P	0.48911	0.917	P	0.47470	0.548	T	0.06607	-1.0817	10	0.39692	T	0.17	.	3.888	0.09107	0.2254:0.197:0.5777:0.0	.	322	Q96D09	GASP2_HUMAN	I	322	ENSP00000437872:R322I;ENSP00000437394:R322I;ENSP00000339057:R322I	ENSP00000339057:R322I	R	+	2	0	GPRASP2	101857418	1.000000	0.71417	0.937000	0.37676	0.034000	0.12701	0.849000	0.27723	0.545000	0.28902	-0.192000	0.12808	AGA	GPRASP2	-	NULL	ENSG00000158301		0.448	GPRASP2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRASP2	HGNC	protein_coding	OTTHUMT00000057626.2	-	0.00	36	0	G	NM_138437		101970762	+1	tier1	-	no_errors	ENST00000332262	ensembl	human	known	74_37	missense	5.63	67	4	SNP	0.832	T
GRIN3A	116443	genome.wustl.edu	37	9	104499884	104499884	+	Silent	SNP	G	G	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr9:104499884G>A	ENST00000361820.3	-	1	978	c.378C>T	c.(376-378)gaC>gaT	p.D126D		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	126					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	ATAGGAGGGCGTCCCGTGGCC	0.701																																																	0													37.0	37.0	37.0					9																	104499884		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.378C>T	9.37:g.104499884G>A			B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Silent	SNP	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,superfamily_Peripla_BP_I,smart_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,prints_NMDA_rcpt	p.D126	ENST00000361820.3	37	c.378	CCDS6758.1	9																																																																																			GRIN3A	-	superfamily_Peripla_BP_I	ENSG00000198785		0.701	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN3A	HGNC	protein_coding	OTTHUMT00000053453.1	-	0.00	24	0	G			104499884	-1	tier1	-	no_errors	ENST00000361820	ensembl	human	known	74_37	silent	28.57	15	6	SNP	0.601	A
HFM1	164045	genome.wustl.edu	37	1	91727919	91727919	+	Silent	SNP	G	G	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr1:91727919G>A	ENST00000370425.3	-	38	4215	c.4117C>T	c.(4117-4119)Ctg>Ttg	p.L1373L	HFM1_ENST00000462405.1_5'UTR|Y_RNA_ENST00000384090.1_RNA|HFM1_ENST00000370424.3_Silent_p.L1052L|HFM1_ENST00000294696.5_3'UTR	NM_001017975.3	NP_001017975.3	A2PYH4	HFM1_HUMAN	HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)	1373					resolution of meiotic recombination intermediates (GO:0000712)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(33)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	75		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		TCTGGTGACAGATTTTGTGGT	0.284																																																	0													65.0	70.0	68.0					1																	91727919		2101	4267	6368	SO:0001819	synonymous_variant	0			AB204867	CCDS30769.2	1p22.2	2008-03-26			ENSG00000162669	ENSG00000162669			20193	protein-coding gene	gene with protein product		615684	"""SEC63 domain containing 1"""	SEC63D1		14702039, 17286053	Standard	XM_006710395		Approved	MER3, FLJ39011, FLJ36760	uc001doa.4	A2PYH4	OTTHUMG00000010093	ENST00000370425.3:c.4117C>T	1.37:g.91727919G>A			B1B0B6|Q8N9Q0	Silent	SNP	pfam_Sec63-dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Sec63-dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.L1373	ENST00000370425.3	37	c.4117	CCDS30769.2	1																																																																																			HFM1	-	NULL	ENSG00000162669		0.284	HFM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HFM1	HGNC	protein_coding	OTTHUMT00000316716.2	-	0.00	90	0	G	NM_001017975		91727919	-1	tier1	-	no_errors	ENST00000370425	ensembl	human	known	74_37	silent	31.33	103	47	SNP	0.639	A
HIC1	3090	genome.wustl.edu	37	17	1961209	1961209	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr17:1961209G>T	ENST00000322941.3	+	2	1282	c.1282G>T	c.(1282-1284)Gag>Tag	p.E428*	HIC1_ENST00000399849.3_Nonsense_Mutation_p.E409*|SMG6_ENST00000573166.1_5'Flank	NM_001098202.1	NP_001091672.1	Q14526	HIC1_HUMAN	hypermethylated in cancer 1	428					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(1)|lung(1)|prostate(1)	3				READ - Rectum adenocarcinoma(1115;0.236)		GGCCTATGGCGAGCCCGAGAG	0.667																																																	0													13.0	16.0	15.0					17																	1961209		2185	4286	6471	SO:0001587	stop_gained	0				CCDS42229.1, CCDS42230.1	17p13.3	2013-01-09				ENSG00000177374		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	4909	protein-coding gene	gene with protein product		603825					Standard	NM_006497		Approved	ZBTB29, ZNF901	uc010cjy.3	Q14526		ENST00000322941.3:c.1282G>T	17.37:g.1961209G>T	ENSP00000314080:p.Glu428*		D3DTI4	Nonsense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.E428*	ENST00000322941.3	37	c.1282	CCDS42229.1	17	.	.	.	.	.	.	.	.	.	.	g	37	6.060163	0.97246	.	.	ENSG00000177374	ENST00000399849;ENST00000322941	.	.	.	3.7	3.7	0.42460	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	.	15.2633	0.73640	0.0:0.0:1.0:0.0	.	.	.	.	X	409;428	.	ENSP00000314080:E428X	E	+	1	0	HIC1	1907959	0.982000	0.34865	0.895000	0.35142	0.921000	0.55340	3.010000	0.49559	1.917000	0.55516	0.401000	0.26515	GAG	HIC1	-	NULL	ENSG00000177374		0.667	HIC1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	HIC1	HGNC	protein_coding	OTTHUMT00000438878.1		0.00	53	0	G	NM_006497		1961209	+1			no_errors	ENST00000322941	ensembl	human	known	74_37	nonsense	5.88	64	4	SNP	0.994	T
HIST1H2AB	8335	genome.wustl.edu	37	6	26033433	26033433	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr6:26033433C>T	ENST00000259791.2	-	1	363	c.364G>A	c.(364-366)Gag>Aag	p.E122K	HIST1H3B_ENST00000244661.2_5'Flank	NM_003513.2	NP_003504.2	P04908	H2A1B_HUMAN	histone cluster 1, H2ab	122						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	8						TGATGGCTCTCAGTTTTCTTA	0.488																																																	0													59.0	61.0	60.0					6																	26033433		2203	4300	6503	SO:0001583	missense	0			X00089	CCDS4574.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000137259	ENSG00000278463		"""Histones / Replication-dependent"""	4734	protein-coding gene	gene with protein product		602795	"""H2A histone family, member M"", ""histone 1, H2ab"""	H2AFM		9439656, 9119399, 12408966	Standard	NM_003513		Approved	H2A/m	uc003nft.1	P04908	OTTHUMG00000014420	ENST00000259791.2:c.364G>A	6.37:g.26033433C>T	ENSP00000259791:p.Glu122Lys		P28001|Q76P63	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.E122K	ENST00000259791.2	37	c.364	CCDS4574.1	6	.	.	.	.	.	.	.	.	.	.	c	14.98	2.696463	0.48202	.	.	ENSG00000137259	ENST00000259791	T	0.40225	1.04	5.35	5.35	0.76521	Histone-fold (2);Histone H2A (1);	0.000000	0.35646	U	0.003064	T	0.23806	0.0576	.	.	.	0.39607	D	0.969829	B	0.02656	0.0	B	0.01281	0.0	T	0.02639	-1.1130	9	0.39692	T	0.17	.	18.4224	0.90595	0.0:1.0:0.0:0.0	.	122	P04908	H2A1B_HUMAN	K	122	ENSP00000259791:E122K	ENSP00000259791:E122K	E	-	1	0	HIST1H2AB	26141412	1.000000	0.71417	1.000000	0.80357	0.513000	0.34164	5.660000	0.68018	2.648000	0.89879	0.561000	0.74099	GAG	HIST1H2AB	-	superfamily_Histone-fold,smart_Histone_H2A	ENSG00000137259		0.488	HIST1H2AB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2AB	HGNC	protein_coding	OTTHUMT00000040082.1	-	0.00	68	0	C	NM_003513		26033433	-1	tier1	-	no_errors	ENST00000259791	ensembl	human	known	74_37	missense	5.62	84	5	SNP	1.000	T
HIST1H1C	3006	genome.wustl.edu	37	6	26056024	26056024	+	Silent	SNP	C	C	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr6:26056024C>T	ENST00000343677.2	-	1	675	c.633G>A	c.(631-633)aaG>aaA	p.K211K		NM_005319.3	NP_005310.1	P16403	H12_HUMAN	histone cluster 1, H1c	211					nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	34						CCTATTTCTTCTTGGGCGCCG	0.488																																																	0													48.0	51.0	50.0					6																	26056024		2202	4300	6502	SO:0001819	synonymous_variant	0			X57129	CCDS4577.1	6p21.3	2012-10-02	2006-10-11	2003-02-21	ENSG00000187837	ENSG00000187837		"""Histones / Replication-dependent"""	4716	protein-coding gene	gene with protein product		142710	"""H1 histone family, member 2"", ""histone 1, H1c"""	H1F2		2759094, 12408966	Standard	NM_005319		Approved	H1.2, H1s-1, H1c	uc003nfw.3	P16403	OTTHUMG00000016140	ENST00000343677.2:c.633G>A	6.37:g.26056024C>T			A8K4I2	Silent	SNP	pfam_Histone_H1/H5_H15,smart_Histone_H1/H5_H15,prints_Histone_H5	p.K211	ENST00000343677.2	37	c.633	CCDS4577.1	6																																																																																			HIST1H1C	-	NULL	ENSG00000187837		0.488	HIST1H1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H1C	HGNC	protein_coding	OTTHUMT00000043372.1	-	0.00	52	0	C	NM_005319		26056024	-1	tier1	-	no_errors	ENST00000343677	ensembl	human	known	74_37	silent	42.50	23	17	SNP	1.000	T
HIVEP2	3097	genome.wustl.edu	37	6	143081380	143081380	+	Silent	SNP	T	T	C			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr6:143081380T>C	ENST00000367604.1	-	8	6684	c.6045A>G	c.(6043-6045)agA>agG	p.R2015R	HIVEP2_ENST00000367603.2_Silent_p.R2015R|HIVEP2_ENST00000012134.2_Silent_p.R2015R			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	2015					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		GTATGTCCAATCTGTCTTTGT	0.488																																					Esophageal Squamous(107;843 1510 13293 16805 42198)												0													293.0	269.0	277.0					6																	143081380		1978	4168	6146	SO:0001819	synonymous_variant	0			M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.6045A>G	6.37:g.143081380T>C			Q02646|Q5THT5|Q9NS05	Silent	SNP	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R2015	ENST00000367604.1	37	c.6045	CCDS43510.1	6																																																																																			HIVEP2	-	NULL	ENSG00000010818		0.488	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP2	HGNC	protein_coding	OTTHUMT00000042495.1	-	0.00	23	0	T			143081380	-1	tier1	-	no_errors	ENST00000012134	ensembl	human	known	74_37	silent	51.16	21	22	SNP	0.878	C
HSD17B7P2	158160	genome.wustl.edu	37	10	38654432	38654432	+	RNA	SNP	A	A	G	rs2257765		TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr10:38654432A>G	ENST00000494540.1	+	0	599					NR_003086.1				hydroxysteroid (17-beta) dehydrogenase 7 pseudogene 2																		TCATCTCGCAATGCAAGGAAA	0.453																																																	0																																												0					10p11.1	2011-06-29			ENSG00000099251	ENSG00000099251			28120	pseudogene	pseudogene						10544267	Standard	NR_003086		Approved	HSD17B7, bA291L22.1	uc010qex.1		OTTHUMG00000017993		10.37:g.38654432A>G				RNA	SNP	-	NULL	ENST00000494540.1	37	NULL		10																																																																																			HSD17B7P2	-	-	ENSG00000099251		0.453	HSD17B7P2-001	KNOWN	basic	processed_transcript	HSD17B7P2	HGNC	pseudogene	OTTHUMT00000047631.2		0.00	51	0	A	NR_003086		38654432	+1			no_errors	ENST00000494540	ensembl	human	known	74_37	rna	5.26	54	3	SNP	1.000	G
ICAM5	7087	genome.wustl.edu	37	19	10403825	10403825	+	Silent	SNP	G	G	A	rs370079975		TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr19:10403825G>A	ENST00000221980.4	+	6	1431	c.1368G>A	c.(1366-1368)ctG>ctA	p.L456L		NM_003259.3	NP_003250.3	Q9UMF0	ICAM5_HUMAN	intercellular adhesion molecule 5, telencephalin	456	Ig-like C2-type 5.				phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(20;2.64e-09)|Epithelial(33;4.31e-06)|all cancers(31;9.75e-06)			CTCTGGGCCTGCTGGGTCCAG	0.682																																																	0													36.0	35.0	35.0					19																	10403825		2200	4296	6496	SO:0001819	synonymous_variant	0			U72671	CCDS12233.1	19p13.2	2013-01-14				ENSG00000105376		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5348	protein-coding gene	gene with protein product	"""telencephalin"""	601852		TLCN		8995416, 9828136	Standard	NM_003259		Approved	TLN	uc002mnu.4	Q9UMF0		ENST00000221980.4:c.1368G>A	19.37:g.10403825G>A			Q9Y6F3	Silent	SNP	pfam_Ig_I-set,pfam_ICAM_N,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom,prints_ICAM_VCAM_N,prints_ICAM	p.L456	ENST00000221980.4	37	c.1368	CCDS12233.1	19																																																																																			ICAM5	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000105376		0.682	ICAM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ICAM5	HGNC	protein_coding	OTTHUMT00000451217.1	-	0.00	56	0	G	NM_003259		10403825	+1	tier1	-	no_errors	ENST00000221980	ensembl	human	known	74_37	silent	5.71	66	4	SNP	0.932	A
INO80	54617	genome.wustl.edu	37	15	41362726	41362726	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr15:41362726G>A	ENST00000361937.3	-	13	2049	c.1625C>T	c.(1624-1626)gCt>gTt	p.A542V	INO80_ENST00000401393.3_Missense_Mutation_p.A542V			Q9ULG1	INO80_HUMAN	INO80 complex subunit	542	Assembles INO80 complex module consisting of conserved components INO80B, INO80C, ACTR5, RVBL1, RVBL2.|Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|mitotic sister chromatid segregation (GO:0000070)|positive regulation of cell growth (GO:0030307)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|spindle assembly (GO:0051225)|UV-damage excision repair (GO:0070914)	Ino80 complex (GO:0031011)|microtubule (GO:0005874)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			NS(1)|breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						CATTTCATCAGCAAGAATGCC	0.413																																																	0													142.0	120.0	128.0					15																	41362726		2203	4300	6503	SO:0001583	missense	0			AB033085	CCDS10071.1	15q15.1	2013-08-21	2013-08-21	2008-08-07	ENSG00000128908	ENSG00000128908	3.6.1.3	"""INO80 complex subunits"""	26956	protein-coding gene	gene with protein product	"""INO80 complex subunit A"""	610169	"""INO80 complex homolog 1 (S. cerevisiae)"", ""INO80 homolog (S. cerevisiae)"""	INOC1		16298340, 16230350, 20237820	Standard	NM_017553		Approved	KIAA1259, Ino80, hINO80, INO80A	uc001zni.3	Q9ULG1	OTTHUMG00000130209	ENST00000361937.3:c.1625C>T	15.37:g.41362726G>A	ENSP00000355205:p.Ala542Val		A6H8X4|Q9NTG6	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.A542V	ENST00000361937.3	37	c.1625	CCDS10071.1	15	.	.	.	.	.	.	.	.	.	.	G	34	5.389204	0.95988	.	.	ENSG00000128908	ENST00000361937;ENST00000401393	D;D	0.95518	-3.73;-3.73	5.32	5.32	0.75619	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.98751	0.9580	H	0.97829	4.085	0.80722	D	1	D	0.69078	0.997	D	0.80764	0.994	D	0.99402	1.0928	10	0.87932	D	0	.	19.1997	0.93707	0.0:0.0:1.0:0.0	.	542	Q9ULG1	INO80_HUMAN	V	542	ENSP00000355205:A542V;ENSP00000384686:A542V	ENSP00000355205:A542V	A	-	2	0	INO80	39150018	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	9.636000	0.98440	2.753000	0.94483	0.655000	0.94253	GCT	INO80	-	pfam_SNF2_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000128908		0.413	INO80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INO80	HGNC	protein_coding	OTTHUMT00000252527.2	-	0.00	64	0	G	NM_017553		41362726	-1	tier1	-	no_errors	ENST00000361937	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	A
IGF1R	3480	genome.wustl.edu	37	15	99250893	99250893	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr15:99250893A>G	ENST00000268035.6	+	2	808	c.197A>G	c.(196-198)aAg>aGg	p.K66R	IGF1R_ENST00000558762.1_Missense_Mutation_p.K66R	NM_000875.3	NP_000866.1	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor	66					axonogenesis (GO:0007409)|brain development (GO:0007420)|epidermis development (GO:0008544)|establishment of cell polarity (GO:0030010)|exocrine pancreas development (GO:0031017)|immune response (GO:0006955)|inactivation of MAPKK activity (GO:0051389)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|male sex determination (GO:0030238)|mammary gland development (GO:0030879)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|peptidyl-tyrosine autophosphorylation (GO:0038083)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of DNA replication (GO:0045740)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|prostate gland epithelium morphogenesis (GO:0060740)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein tetramerization (GO:0051262)|regulation of JNK cascade (GO:0046328)|response to vitamin E (GO:0033197)|signal transduction (GO:0007165)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor-activated receptor activity (GO:0005010)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(13)|lung(20)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		"""""""Insulin(DB00071)|Insulin Glargine(DB00047)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	CTCATCTCCAAGGCCGAGGAC	0.612																																																	0													105.0	74.0	85.0					15																	99250893		2197	4297	6494	SO:0001583	missense	0			M69229	CCDS10378.1, CCDS73785.1	15q26.3	2013-02-11			ENSG00000140443	ENSG00000140443		"""CD molecules"", ""Fibronectin type III domain containing"""	5465	protein-coding gene	gene with protein product		147370				1316909	Standard	XM_006720486		Approved	JTK13, CD221, IGFIR, MGC18216, IGFR	uc002bul.3	P08069	OTTHUMG00000149851	ENST00000268035.6:c.197A>G	15.37:g.99250893A>G	ENSP00000268035:p.Lys66Arg		B1B5Y2|Q14CV2|Q9UCC0	Missense_Mutation	SNP	pirsf_Tyr_kinase_insulin-like_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_dom,pfam_Furin-like_Cys-rich_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_Fibronectin_type3,smart_Furin_repeat,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom	p.K66R	ENST00000268035.6	37	c.197	CCDS10378.1	15	.	.	.	.	.	.	.	.	.	.	A	13.88	2.368633	0.42003	.	.	ENSG00000140443	ENST00000268035	T	0.80033	-1.33	5.36	5.36	0.76844	EGF receptor, L domain (1);	0.101685	0.40728	N	0.001021	T	0.70351	0.3214	L	0.41236	1.265	0.47698	D	0.999499	B;B	0.32526	0.374;0.005	B;B	0.23852	0.049;0.012	T	0.67837	-0.5567	10	0.17369	T	0.5	.	14.824	0.70097	1.0:0.0:0.0:0.0	.	66;66	C9J5X1;P08069	.;IGF1R_HUMAN	R	66	ENSP00000268035:K66R	ENSP00000268035:K66R	K	+	2	0	IGF1R	97068416	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.150000	0.94667	2.148000	0.66965	0.460000	0.39030	AAG	IGF1R	-	pirsf_Tyr_kinase_insulin-like_rcpt,pfam_EGF_rcpt_L	ENSG00000140443		0.612	IGF1R-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	IGF1R	HGNC	protein_coding	OTTHUMT00000313537.2	-	0.00	53	0	A	NM_000875		99250893	+1	tier1	-	no_errors	ENST00000268035	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	G
INPP5J	27124	genome.wustl.edu	37	22	31521386	31521386	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr22:31521386G>A	ENST00000331075.5	+	2	710	c.661G>A	c.(661-663)Gca>Aca	p.A221T	INPP5J_ENST00000412277.2_Missense_Mutation_p.A154T|INPP5J_ENST00000405300.1_Intron|INPP5J_ENST00000401755.1_5'Flank|INPP5J_ENST00000400294.2_Intron|INPP5J_ENST00000402238.1_5'Flank|INPP5J_ENST00000404390.3_Intron|INPP5J_ENST00000404453.1_5'Flank	NM_001284285.1	NP_001271214.1	Q15735	PI5PA_HUMAN	inositol polyphosphate-5-phosphatase J	221	Pro-rich.				inositol phosphate metabolic process (GO:0043647)|negative regulation of microtubule polymerization (GO:0031115)|negative regulation of neuron projection development (GO:0010977)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	inositol-1,3,4,5-tetrakisphosphate 5-phosphatase activity (GO:0052659)|inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|inositol-polyphosphate 5-phosphatase activity (GO:0004445)|phosphatidylinositol-3,4,5-trisphosphate 5-phosphatase activity (GO:0034485)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|skin(1)	12						CCTGGCTCCAGCATCCACGGC	0.637																																																	0																																										SO:0001583	missense	0			U45975	CCDS46687.1, CCDS63453.1, CCDS63454.1, CCDS63455.1, CCDS74847.1	22q12.2	2008-09-09	2008-09-09	2008-09-09	ENSG00000185133	ENSG00000185133			8956	protein-coding gene	gene with protein product		606481	"""phosphatidylinositol (4,5) bisphosphate 5-phosphatase, A"""	PIB5PA		10591208	Standard	NM_001284287		Approved	INPP5	uc003aju.4	Q15735	OTTHUMG00000151206	ENST00000331075.5:c.661G>A	22.37:g.31521386G>A	ENSP00000333262:p.Ala221Thr		B3KS54|Q32M61|Q6ZTH6|Q8N902|Q9UDT9	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc	p.A221T	ENST00000331075.5	37	c.661		22	.	.	.	.	.	.	.	.	.	.	G	10.65	1.409180	0.25378	.	.	ENSG00000185133	ENST00000331075;ENST00000412277	D;D	0.98044	-4.68;-4.65	4.56	1.24	0.21308	.	0.554792	0.16157	N	0.226947	D	0.93455	0.7912	.	.	.	0.23386	N	0.997783	B	0.14805	0.011	B	0.08055	0.003	D	0.86661	0.1904	9	0.72032	D	0.01	.	1.6893	0.02849	0.1878:0.1631:0.4813:0.1677	.	221	Q15735	PI5PA_HUMAN	T	221;154	ENSP00000333262:A221T;ENSP00000392924:A154T	ENSP00000333262:A221T	A	+	1	0	INPP5J	29851386	0.000000	0.05858	0.187000	0.23214	0.375000	0.29983	-0.663000	0.05299	0.136000	0.18733	0.456000	0.33151	GCA	INPP5J	-	NULL	ENSG00000185133		0.637	INPP5J-002	KNOWN	basic|appris_candidate_longest	protein_coding	INPP5J	HGNC	protein_coding	OTTHUMT00000321784.1	-	0.00	68	0	G	NM_001002837		31521386	+1	tier1	-	no_errors	ENST00000331075	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.038	A
ISLR	3671	genome.wustl.edu	37	15	74467244	74467244	+	Silent	SNP	G	G	T	rs137923011	byFrequency	TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr15:74467244G>T	ENST00000249842.3	+	2	402	c.45G>T	c.(43-45)ctG>ctT	p.L15L	RP11-665J16.1_ENST00000561647.1_RNA|ISLR_ENST00000395118.1_Silent_p.L15L	NM_005545.3	NP_005536.1	O14498	ISLR_HUMAN	immunoglobulin superfamily containing leucine-rich repeat	15					cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)	20						TCCTGGGCCTGGCTCAGGCCT	0.632																																																	0													41.0	38.0	39.0					15																	74467244		2198	4297	6495	SO:0001819	synonymous_variant	0			AB003184	CCDS10260.1	15q23-q24	2013-01-11			ENSG00000129009	ENSG00000129009		"""Immunoglobulin superfamily / I-set domain containing"""	6133	protein-coding gene	gene with protein product		602059				9325048	Standard	NM_005545		Approved	HsT17563	uc002axh.1	O14498	OTTHUMG00000137623	ENST00000249842.3:c.45G>T	15.37:g.74467244G>T				Silent	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub2,pfscan_Ig-like_dom	p.L15	ENST00000249842.3	37	c.45	CCDS10260.1	15																																																																																			ISLR	-	NULL	ENSG00000129009		0.632	ISLR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISLR	HGNC	protein_coding	OTTHUMT00000269044.1		0.00	34	0	G	NM_005545		74467244	+1			no_errors	ENST00000249842	ensembl	human	known	74_37	silent	5.13	37	2	SNP	0.000	T
ADGB	79747	genome.wustl.edu	37	6	147123946	147123946	+	Intron	SNP	T	T	C			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr6:147123946T>C	ENST00000397944.3	+	35	4894				ADGB_ENST00000367493.3_Intron|KATNBL1P6_ENST00000562413.2_RNA|ADGB_ENST00000367488.1_Intron	NM_024694.3	NP_078970.3	Q8N7X0	ADGB_HUMAN	androglobin						oxygen transport (GO:0015671)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			breast(1)|endometrium(2)|kidney(2)	5						GTAACTGTAATAAATAAGCAT	0.323																																																	0																																										SO:0001627	intron_variant	0			AK026774		6q24.2	2012-02-03	2012-02-03	2012-02-03	ENSG00000118492	ENSG00000118492			21212	protein-coding gene	gene with protein product		614630	"""chromosome 6 open reading frame 103"""	C6orf103		22115833	Standard	NM_024694		Approved	FLJ23121, dJ408K24.1	uc010khx.3	Q8N7X0	OTTHUMG00000015758	ENST00000397944.3:c.4818+799T>C	6.37:g.147123946T>C			Q5T402|Q5T904|Q5T905	RNA	SNP	-	NULL	ENST00000397944.3	37	NULL		6																																																																																			KATNBL1P6	-	-	ENSG00000228283		0.323	ADGB-009	KNOWN	basic|appris_principal	protein_coding	KATNBL1P6	HGNC	protein_coding	OTTHUMT00000376350.2	-	0.00	82	0	T	NM_024694		147123946	-1	tier1	-	no_errors	ENST00000562413	ensembl	human	known	74_37	rna	43.56	92	71	SNP	1.000	C
KCNE1L	23630	genome.wustl.edu	37	X	108868055	108868055	+	Silent	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chrX:108868055G>T	ENST00000372101.2	-	1	338	c.195C>A	c.(193-195)ctC>ctA	p.L65L		NM_012282.2	NP_036414.1	Q9UJ90	KCE1L_HUMAN	KCNE1-like	65					atrial cardiac muscle cell action potential (GO:0086014)|cardiac muscle contraction (GO:0060048)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cation channel activity (GO:2001257)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|ventricular cardiac muscle cell action potential (GO:0086005)	voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)	6						AGATCATGATGAGCAGGATGT	0.657																																																	0													45.0	40.0	42.0					X																	108868055		2202	4300	6502	SO:0001819	synonymous_variant	0			AJ012743	CCDS14547.1	Xq22.3	2008-02-05	2004-06-09		ENSG00000176076	ENSG00000176076		"""Potassium channels"""	6241	protein-coding gene	gene with protein product		300328	"""potassium voltage-gated channel, Isk-related family, member 1-like"""			10493825	Standard	NM_012282		Approved		uc004eoh.3	Q9UJ90	OTTHUMG00000022189	ENST00000372101.2:c.195C>A	X.37:g.108868055G>T				Silent	SNP	NULL	p.L65	ENST00000372101.2	37	c.195	CCDS14547.1	X																																																																																			KCNE1L	-	NULL	ENSG00000176076		0.657	KCNE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNE1L	HGNC	protein_coding	OTTHUMT00000057892.1		0.00	17	0	G	NM_012282		108868055	-1			no_errors	ENST00000372101	ensembl	human	known	74_37	silent	9.76	37	4	SNP	1.000	T
KDM2A	22992	genome.wustl.edu	37	11	67023792	67023792	+	3'UTR	SNP	C	C	G			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr11:67023792C>G	ENST00000529006.2	+	0	5201				KDM2A_ENST00000398645.2_3'UTR|KDM2A_ENST00000530342.1_3'UTR|KDM2A_ENST00000526258.1_3'UTR|KDM2A_ENST00000308783.5_3'UTR	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A						histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						AAGATCCTCTCTCTAGGGCAG	0.468																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.*1266C>G	11.37:g.67023792C>G			D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	RNA	SNP	-	NULL	ENST00000529006.2	37	NULL	CCDS44657.1	11																																																																																			KDM2A	-	-	ENSG00000173120		0.468	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM2A	HGNC	protein_coding	OTTHUMT00000393140.2	-	0.00	24	0	C	NM_012308		67023792	+1	tier1	-	no_errors	ENST00000524657	ensembl	human	known	74_37	rna	32.20	40	19	SNP	1.000	G
KDM5C	8242	genome.wustl.edu	37	X	53223826	53223826	+	Missense_Mutation	SNP	G	G	A	rs370672146		TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chrX:53223826G>A	ENST00000375401.3	-	23	4065	c.3533C>T	c.(3532-3534)tCg>tTg	p.S1178L	KDM5C_ENST00000375379.3_Missense_Mutation_p.S1178L|KDM5C_ENST00000404049.3_Missense_Mutation_p.S1177L|KDM5C_ENST00000452825.3_Missense_Mutation_p.S1111L|KDM5C_ENST00000375383.3_Missense_Mutation_p.S1137L	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	1178					histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						GGCCGTGCTCGATGATGCCAG	0.607			"""N, F, S"""		clear cell renal carcinoma																																			Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	0								G	LEU/SER,LEU/SER	0,3835		0,0,0,1632,571	232.0	165.0	188.0		3332,3533	1.8	0.0	X		188	1,6727		0,0,1,2428,1871	no	missense,missense	KDM5C	NM_001146702.1,NM_004187.3	145,145	0,0,1,4060,2442	AA,AG,A,GG,G		0.0149,0.0,0.0095	benign,benign	1111/1380,1178/1561	53223826	1,10562	2203	4300	6503	SO:0001583	missense	0			Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.3533C>T	X.37:g.53223826G>A	ENSP00000364550:p.Ser1178Leu		B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Missense_Mutation	SNP	pfam_Lys_sp_deMease_like_dom,pfam_JmjC_dom,pfam_ARID/BRIGHT_DNA-bd,pfam_Znf_C5HC2,pfam_Znf_PHD-finger,pfam_TF_JmjN,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_Znf_PHD,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_ARID/BRIGHT_DNA-bd	p.S1178L	ENST00000375401.3	37	c.3533	CCDS14351.1	X	.	.	.	.	.	.	.	.	.	.	g	0.006	-2.099365	0.00360	0.0	1.49E-4	ENSG00000126012	ENST00000452825;ENST00000375401;ENST00000404049;ENST00000375379;ENST00000375383	D;D;D;D;D	0.86694	-2.16;-1.87;-1.87;-1.87;-2.01	4.61	1.82	0.25136	Zinc finger, FYVE/PHD-type (1);	0.976137	0.08428	N	0.947356	T	0.75177	0.3814	N	0.12831	0.26	0.09310	N	1	B;B;B	0.09022	0.002;0.001;0.001	B;B;B	0.04013	0.001;0.001;0.001	T	0.60546	-0.7242	10	0.45353	T	0.12	0.0046	7.0758	0.25203	0.2851:0.0:0.7149:0.0	.	1111;1177;1178	F5H3T1;B0QZ44;P41229	.;.;KDM5C_HUMAN	L	1111;1178;1177;1178;1137	ENSP00000445176:S1111L;ENSP00000364550:S1178L;ENSP00000385394:S1177L;ENSP00000364528:S1178L;ENSP00000364532:S1137L	ENSP00000364528:S1178L	S	-	2	0	KDM5C	53240551	0.000000	0.05858	0.002000	0.10522	0.104000	0.19210	0.236000	0.17967	-0.027000	0.13873	0.525000	0.51046	TCG	KDM5C	-	superfamily_Znf_FYVE_PHD	ENSG00000126012		0.607	KDM5C-005	KNOWN	basic|CCDS	protein_coding	KDM5C	HGNC	protein_coding	OTTHUMT00000056737.2	-	0.00	44	0	G	NM_004187		53223826	-1	tier1	-	no_errors	ENST00000375401	ensembl	human	known	74_37	missense	52.50	19	21	SNP	0.005	A
KIAA0825	285600	genome.wustl.edu	37	5	93798218	93798218	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr5:93798218G>A	ENST00000513200.3	-	11	2192	c.2120C>T	c.(2119-2121)aCa>aTa	p.T707I	KIAA0825_ENST00000312498.7_Missense_Mutation_p.T707I|KIAA0825_ENST00000427991.2_Missense_Mutation_p.T707I	NM_001145678.1	NP_001139150.1	Q8IV33	K0825_HUMAN	KIAA0825	707										breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(1)|pancreas(1)|prostate(1)|skin(1)	13						CTGTACAGATGTACAAACTGA	0.289																																																	0													114.0	98.0	103.0					5																	93798218		692	1588	2280	SO:0001583	missense	0			BX648338	CCDS4070.1	5q15	2011-02-23	2011-02-23	2011-02-23	ENSG00000185261	ENSG00000185261			28532	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 36"""	C5orf36		12477932	Standard	NM_173665		Approved	DKFZp686F0372, MGC34713	uc011cuk.2	Q8IV33	OTTHUMG00000131331	ENST00000513200.3:c.2120C>T	5.37:g.93798218G>A	ENSP00000424618:p.Thr707Ile		O94914|Q6ZNN2	Missense_Mutation	SNP	NULL	p.T707I	ENST00000513200.3	37	c.2120		5	.	.	.	.	.	.	.	.	.	.	G	11.89	1.772679	0.31411	.	.	ENSG00000185261	ENST00000513200;ENST00000427991;ENST00000312498	T;T;T	0.45668	0.9;0.9;0.89	5.37	4.45	0.53987	.	0.347372	0.26362	N	0.024820	T	0.35068	0.0919	L	0.43152	1.355	0.20764	N	0.999852	P	0.49559	0.925	B	0.42422	0.387	T	0.32214	-0.9915	10	0.46703	T	0.11	.	10.4504	0.44518	0.0:0.2085:0.6754:0.1162	.	707	Q8IV33	K0825_HUMAN	I	707	ENSP00000424618:T707I;ENSP00000400288:T707I;ENSP00000312205:T707I	ENSP00000312205:T707I	T	-	2	0	KIAA0825	93823974	0.629000	0.27146	0.992000	0.48379	0.903000	0.53119	2.640000	0.46579	2.659000	0.90383	0.655000	0.94253	ACA	KIAA0825	-	NULL	ENSG00000185261		0.289	KIAA0825-001	KNOWN	not_organism_supported|basic	protein_coding	KIAA0825	HGNC	protein_coding	OTTHUMT00000254102.5		0.00	20	0	G	NM_173665		93798218	-1			no_errors	ENST00000427991	ensembl	human	known	74_37	missense	7.02	53	4	SNP	0.895	A
KLHL4	56062	genome.wustl.edu	37	X	86873036	86873036	+	Nonsense_Mutation	SNP	A	A	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chrX:86873036A>T	ENST00000373119.4	+	4	974	c.829A>T	c.(829-831)Aag>Tag	p.K277*	KLHL4_ENST00000373114.4_Nonsense_Mutation_p.K277*	NM_019117.4	NP_061990.2	Q9C0H6	KLHL4_HUMAN	kelch-like family member 4	277						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(29)|ovary(2)|prostate(1)|skin(1)	67						TTTTCTCATAAAGCAGCTCCA	0.433																																																	0													105.0	87.0	93.0					X																	86873036		2203	4300	6503	SO:0001587	stop_gained	0			AF284765	CCDS14456.1, CCDS14457.1	Xq21.3	2013-01-30	2013-01-30		ENSG00000102271	ENSG00000102271		"""Kelch-like"", ""BTB/POZ domain containing"""	6355	protein-coding gene	gene with protein product		300348	"""kelch (Drosophila)-like 4"", ""kelch-like 4 (Drosophila)"""			11401425	Standard	NM_019117		Approved	KIAA1687, DKELCHL, KHL4	uc004efa.2	Q9C0H6	OTTHUMG00000021946	ENST00000373119.4:c.829A>T	X.37:g.86873036A>T	ENSP00000362211:p.Lys277*		B2RTW2|Q9Y3J5	Nonsense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pfscan_BTB/POZ-like	p.K277*	ENST00000373119.4	37	c.829	CCDS14457.1	X	.	.	.	.	.	.	.	.	.	.	A	38	6.708327	0.97780	.	.	ENSG00000102271	ENST00000373119;ENST00000373114	.	.	.	4.74	4.74	0.60224	.	0.058199	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.6502	0.56757	1.0:0.0:0.0:0.0	.	.	.	.	X	277	.	ENSP00000362206:K277X	K	+	1	0	KLHL4	86759692	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.636000	0.91010	1.575000	0.49775	0.408000	0.27601	AAG	KLHL4	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	ENSG00000102271		0.433	KLHL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL4	HGNC	protein_coding	OTTHUMT00000057413.1	-	0.00	23	0	A			86873036	+1	tier1	-	no_errors	ENST00000373114	ensembl	human	known	74_37	nonsense	28.36	47	19	SNP	1.000	T
KLK11	11012	genome.wustl.edu	37	19	51527571	51527571	+	Intron	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr19:51527571G>T	ENST00000594768.1	-	4	479				KLK11_ENST00000453757.3_Intron|KLK11_ENST00000391804.3_Missense_Mutation_p.L90I|KLK11_ENST00000594458.1_Intron|KLK11_ENST00000319720.7_Intron|KLK11_ENST00000600362.1_Intron	NM_144947.1	NP_659196.1	Q9UBX7	KLK11_HUMAN	kallikrein-related peptidase 11							extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|skin(1)	7		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|GBM - Glioblastoma multiforme(134;0.00878)		TAGCGGCTGAGGTGGGAGAGA	0.587																																																	0													77.0	88.0	84.0					19																	51527571		2203	4300	6503	SO:0001627	intron_variant	0			AB012917	CCDS12818.1, CCDS12819.1, CCDS54297.1	19q13.33	2011-09-07	2006-10-27			ENSG00000167757		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6359	protein-coding gene	gene with protein product		604434	"""kallikrein 11"""	PRSS20		9765601, 10662548, 16800724, 16800723	Standard	NM_006853		Approved	TLSP	uc002pvb.2	Q9UBX7		ENST00000594768.1:c.294-5C>A	19.37:g.51527571G>T			O75837|Q0WXX5|Q8IXD7|Q9NS65	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.L90I	ENST00000594768.1	37	c.268	CCDS12818.1	19	.	.	.	.	.	.	.	.	.	.	g	6.517	0.463620	0.12402	.	.	ENSG00000167757	ENST00000391804	D	0.88664	-2.41	4.28	0.846	0.18955	.	.	.	.	.	T	0.79112	0.4391	.	.	.	0.51767	D	0.999933	B	0.18166	0.026	B	0.22152	0.038	T	0.65138	-0.6241	7	.	.	.	.	6.4569	0.21934	0.4452:0.0:0.5548:0.0	.	90	Q8IXD7	.	I	90	ENSP00000375680:L90I	.	L	-	1	0	KLK11	56219383	0.998000	0.40836	0.996000	0.52242	0.764000	0.43329	0.871000	0.28023	0.404000	0.25506	0.462000	0.41574	CTC	KLK11	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000167757		0.587	KLK11-002	KNOWN	basic|CCDS	protein_coding	KLK11	HGNC	protein_coding	OTTHUMT00000464314.2		0.00	40	0	G	NM_006853		51527571	-1			no_errors	ENST00000391804	ensembl	human	known	74_37	missense	5.48	69	4	SNP	0.569	T
KMT2D	8085	genome.wustl.edu	37	12	49431850	49431850	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr12:49431850C>T	ENST00000301067.7	-	34	9288	c.9289G>A	c.(9289-9291)Gag>Aag	p.E3097K	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3097					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										GGGCGCTCCTCAGGGCCCAAG	0.642																																																	0													30.0	30.0	30.0					12																	49431850		1965	4143	6108	SO:0001583	missense	0			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.9289G>A	12.37:g.49431850C>T	ENSP00000301067:p.Glu3097Lys		O14687	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.E3097K	ENST00000301067.7	37	c.9289	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	C	12.01	1.809660	0.31961	.	.	ENSG00000167548	ENST00000301067	T	0.81163	-1.46	5.2	5.2	0.72013	.	0.000000	0.39020	N	0.001494	T	0.70527	0.3234	N	0.14661	0.345	0.30681	N	0.752357	P	0.47409	0.895	P	0.46975	0.533	T	0.74041	-0.3792	10	0.87932	D	0	.	10.1962	0.43056	0.0:0.9082:0.0:0.0918	.	3097	O14686	MLL2_HUMAN	K	3097	ENSP00000301067:E3097K	ENSP00000301067:E3097K	E	-	1	0	MLL2	47718117	0.998000	0.40836	0.998000	0.56505	0.993000	0.82548	4.419000	0.59835	2.597000	0.87782	0.655000	0.94253	GAG	KMT2D	-	NULL	ENSG00000167548		0.642	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2D	HGNC	protein_coding	OTTHUMT00000390183.2	-	0.00	101	0	C			49431850	-1	tier1	-	no_errors	ENST00000301067	ensembl	human	known	74_37	missense	5.19	127	7	SNP	0.997	T
KRT77	374454	genome.wustl.edu	37	12	53086350	53086350	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr12:53086350G>T	ENST00000341809.3	-	7	1310	c.1282C>A	c.(1282-1284)Ctg>Atg	p.L428M	KRT77_ENST00000537195.1_Missense_Mutation_p.L195M|RP11-641A6.3_ENST00000547533.1_RNA	NM_175078.2	NP_778253.2	Q7Z794	K2C1B_HUMAN	keratin 77	428	Coil 2.|Rod.					cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(2)|endometrium(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						AGGTCCTGCAGCTTCTGCCAC	0.612																																																	0													46.0	42.0	43.0					12																	53086350		2202	4271	6473	SO:0001583	missense	0			BK000975	CCDS8837.1	12q13.13	2013-06-25	2006-07-17	2006-07-17	ENSG00000189182	ENSG00000189182		"""-"", ""Intermediate filaments type II, keratins (basic)"""	20411	protein-coding gene	gene with protein product		611158	"""keratin 1B"""	KRT1B		11683385, 16831889	Standard	NM_175078		Approved		uc001saw.3	Q7Z794	OTTHUMG00000169450	ENST00000341809.3:c.1282C>A	12.37:g.53086350G>T	ENSP00000342710:p.Leu428Met		Q7RTS8	Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.L428M	ENST00000341809.3	37	c.1282	CCDS8837.1	12	.	.	.	.	.	.	.	.	.	.	G	12.53	1.966552	0.34659	.	.	ENSG00000189182	ENST00000341809;ENST00000537195	D;D	0.90444	-2.67;-2.67	4.29	3.39	0.38822	Filament (1);	.	.	.	.	D	0.95162	0.8432	M	0.84683	2.71	0.32592	N	0.527033	D	0.60575	0.988	D	0.70935	0.971	D	0.95775	0.8812	9	0.62326	D	0.03	.	13.6702	0.62420	0.0:0.0:0.8438:0.1562	.	428	Q7Z794	K2C1B_HUMAN	M	428;195	ENSP00000342710:L428M;ENSP00000440803:L195M	ENSP00000342710:L428M	L	-	1	2	KRT77	51372617	1.000000	0.71417	0.655000	0.29622	0.037000	0.13140	3.400000	0.52594	0.910000	0.36722	0.407000	0.27541	CTG	KRT77	-	pfam_IF,prints_Keratin_II	ENSG00000189182		0.612	KRT77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT77	HGNC	protein_coding	OTTHUMT00000404111.1	-	0.00	36	0	G	NM_175078		53086350	-1	tier1	-	no_errors	ENST00000341809	ensembl	human	known	74_37	missense	40.54	22	15	SNP	1.000	T
KSR1	8844	genome.wustl.edu	37	17	25931751	25931751	+	Silent	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr17:25931751G>T	ENST00000319524.6	+	14	1677	c.1677G>T	c.(1675-1677)gcG>gcT	p.A559A	KSR1_ENST00000268763.6_Silent_p.A422A|KSR1_ENST00000398988.3_Silent_p.A422A|KSR1_ENST00000509603.2_Silent_p.A537A|KSR1_ENST00000581975.1_3'UTR			Q8IVT5	KSR1_HUMAN	kinase suppressor of ras 1	559					Ras protein signal transduction (GO:0007265)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(12)|prostate(2)|urinary_tract(1)	28	Lung NSC(42;0.00836)		BRCA - Breast invasive adenocarcinoma(3;0.00122)	UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		CTCACGAAGCGGAGGTGAGGG	0.557																																					Esophageal Squamous(88;1120 1336 6324 10502 16832)												0													103.0	114.0	110.0					17																	25931751		2005	4178	6183	SO:0001819	synonymous_variant	0			U43586	CCDS58532.1	17q11.2	2012-05-23	2005-12-14	2005-12-14	ENSG00000141068	ENSG00000141068			6465	protein-coding gene	gene with protein product		601132	"""kinase suppressor of ras"""	KSR		8521512	Standard	XM_006722151		Approved	RSU2	uc031qzj.1	Q8IVT5	OTTHUMG00000132051	ENST00000319524.6:c.1677G>T	17.37:g.25931751G>T			F8WEA9|H7BYU0|Q13476	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.A559	ENST00000319524.6	37	c.1677		17	.	.	.	.	.	.	.	.	.	.	G	8.992	0.977989	0.18812	.	.	ENSG00000141068	ENST00000398988	.	.	.	5.52	-5.56	0.02529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.6079	0.28113	0.6589:0.0:0.2124:0.1287	.	.	.	.	X	273	.	.	G	+	1	0	KSR1	22955878	0.021000	0.18746	0.007000	0.13788	0.261000	0.26267	-0.148000	0.10219	-0.727000	0.04888	-0.254000	0.11334	GGA	KSR1	-	NULL	ENSG00000141068		0.557	KSR1-202	KNOWN	basic|appris_candidate_longest	protein_coding	KSR1	HGNC	protein_coding		-	0.00	56	0	G	NM_014238		25931751	+1	tier1	-	no_errors	ENST00000319524	ensembl	human	known	74_37	silent	6.33	74	5	SNP	0.005	T
LINC00238	440184	genome.wustl.edu	37	14	66959557	66959557	+	lincRNA	SNP	C	C	G	rs367585547	byFrequency	TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr14:66959557C>G	ENST00000556874.1	-	0	643				LINC00238_ENST00000389594.3_RNA																							TCTTATTAATCTTGCTGGAAT	0.373																																																	0																																												0																															14.37:g.66959557C>G				RNA	SNP	-	NULL	ENST00000556874.1	37	NULL		14																																																																																			LINC00238	-	-	ENSG00000196553		0.373	RP11-72M17.1-001	KNOWN	basic	lincRNA	LINC00238	HGNC	lincRNA	OTTHUMT00000412209.1	-	0.00	39	0	C			66959557	+1	tier1	-	no_errors	ENST00000411796	ensembl	human	known	74_37	rna	30.65	43	19	SNP	0.000	G
LINC00272	388719	genome.wustl.edu	37	1	182377037	182377037	+	lincRNA	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr1:182377037G>T	ENST00000367563.3	+	0	282					NR_034131.1				long intergenic non-protein coding RNA 272																		AGCCAAAGGTGGTGAATGATT	0.458																																																	0																																												0			AF508909		1q25.3	2012-10-12	2011-08-11	2011-08-11	ENSG00000203729	ENSG00000203729		"""Long non-coding RNAs"""	26898	non-coding RNA	RNA, long non-coding			"""chromosome 1 open reading frame 120"", ""non-protein coding RNA 272"""	C1orf120, NCRNA00272		12801632	Standard	NR_034131		Approved	RP1-223H12.3	uc009wxv.1		OTTHUMG00000037402		1.37:g.182377037G>T				RNA	SNP	-	NULL	ENST00000367563.3	37	NULL		1																																																																																			LINC00272	-	-	ENSG00000203729		0.458	LINC00272-001	KNOWN	basic	lincRNA	LINC00272	HGNC	lincRNA	OTTHUMT00000091036.2		0.00	33	0	G	NM_001010899		182377037	+1			no_errors	ENST00000367563	ensembl	human	known	74_37	rna	5.97	63	4	SNP	0.523	T
GAPDHS	26330	genome.wustl.edu	37	19	36033799	36033799	+	Intron	SNP	G	G	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr19:36033799G>A	ENST00000222286.4	+	7	775				TMEM147_ENST00000222284.5_5'Flank|TMEM147_ENST00000392205.1_5'Flank|TMEM147_ENST00000392204.2_5'Flank|AD000090.2_ENST00000589137.1_RNA|AD000090.2_ENST00000588286.1_RNA|AD000090.2_ENST00000590125.1_RNA|AD000090.2_ENST00000444728.1_RNA|AD000090.2_ENST00000590717.1_RNA	NM_014364.4	NP_055179.1	O14556	G3PT_HUMAN	glyceraldehyde-3-phosphate dehydrogenase, spermatogenic						carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|positive regulation of glycolytic process (GO:0045821)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	cytosol (GO:0005829)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity (GO:0004365)|NAD binding (GO:0051287)|NADP binding (GO:0050661)			endometrium(1)|kidney(1)|large_intestine(1)|lung(8)	11	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			TGGAGGGGTGGCTCTGCGACT	0.572																																																	0													114.0	76.0	89.0					19																	36033799		2203	4300	6503	SO:0001627	intron_variant	0			AJ005371	CCDS12465.1	19q13.1	2008-02-05		2005-05-06		ENSG00000105679			24864	protein-coding gene	gene with protein product		609169		GAPDS		10714828	Standard	NM_014364		Approved	GAPDH-2, GAPD2	uc002oaf.1	O14556		ENST00000222286.4:c.660-48G>A	19.37:g.36033799G>A			B2RC82|O60823|Q6JTT9|Q9HCU6	RNA	SNP	-	NULL	ENST00000222286.4	37	NULL	CCDS12465.1	19																																																																																			AD000090.2	-	-	ENSG00000236144		0.572	GAPDHS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100506469	Clone_based_vega_gene	protein_coding	OTTHUMT00000460423.1	-	0.00	36	0	G	NM_014364		36033799	-1	tier1	-	no_errors	ENST00000588286	ensembl	human	known	74_37	rna	9.76	37	4	SNP	0.154	A
LOC100507377	100507377	genome.wustl.edu	37	12	74686447	74686447	+	lincRNA	DEL	G	G	-			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr12:74686447delG	ENST00000515416.2	-	0	0																											ACCAGTACTTGGGCTCTCAAG	0.582																																																	0																																												0																															12.37:g.74686447delG				RNA	DEL	-	NULL	ENST00000515416.2	37	NULL		12																																																																																			RP11-81H3.2	-	-	ENSG00000251138		0.582	RP11-81H3.2-001	KNOWN	basic	lincRNA	LOC100507377	Clone_based_vega_gene	lincRNA	OTTHUMT00000405900.1		0.00	20	0	G			74686447	-1	tier1		no_errors	ENST00000548427	ensembl	human	known	74_37	rna	29.41	12	5	DEL	0.190	-
LOC729218	729218	genome.wustl.edu	37	4	119552234	119552234	+	lincRNA	SNP	A	A	C			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr4:119552234A>C	ENST00000567913.2	+	0	1745																											CTCTCCAGGCACAGCTCCTGT	0.582																																																	0																																												0																															4.37:g.119552234A>C				RNA	SNP	-	NULL	ENST00000567913.2	37	NULL		4																																																																																			RP11-384K6.6	-	-	ENSG00000260404		0.582	RP11-384K6.6-001	KNOWN	basic	lincRNA	LOC101929676	Clone_based_vega_gene	lincRNA	OTTHUMT00000364170.2		0.00	37	0	A			119552234	+1			no_errors	ENST00000567913	ensembl	human	known	74_37	rna	9.30	39	4	SNP	0.979	C
LOC645752	645752	genome.wustl.edu	37	15	78208199	78208199	+	lincRNA	SNP	C	C	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr15:78208199C>T	ENST00000565869.1	+	0	0				RN7SL214P_ENST00000487317.2_RNA|RP11-114H24.2_ENST00000567226.1_RNA																							GAAGGCTGGACGAATCCAAGC	0.602																																																	0																																												0																															15.37:g.78208199C>T				RNA	SNP	-	NULL	ENST00000565869.1	37	NULL		15																																																																																			RP11-114H24.2	-	-	ENSG00000260776		0.602	RP11-114H24.7-001	KNOWN	basic	lincRNA	LOC645752	Clone_based_vega_gene	lincRNA	OTTHUMT00000421587.1	-	0.00	125	0	C			78208199	-1	tier1	-	no_errors	ENST00000563349	ensembl	human	known	74_37	rna	7.50	111	9	SNP	0.999	T
LPGAT1	9926	genome.wustl.edu	37	1	211956837	211956837	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr1:211956837G>C	ENST00000366997.4	-	5	687	c.461C>G	c.(460-462)tCt>tGt	p.S154C	LPGAT1_ENST00000366996.1_Missense_Mutation_p.S154C	NM_014873.2	NP_055688.1	Q92604	LGAT1_HUMAN	lysophosphatidylglycerol acyltransferase 1	154					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity, transferring acyl groups (GO:0016746)			breast(1)|endometrium(2)|large_intestine(1)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16				OV - Ovarian serous cystadenocarcinoma(81;0.00773)|all cancers(67;0.0765)|Epithelial(68;0.114)		GTCACGATAAGATCTTCCCTA	0.358																																																	0													78.0	75.0	76.0					1																	211956837		2203	4300	6503	SO:0001583	missense	0			D86960	CCDS31018.1	1q32.3	2008-05-14	2004-11-25	2004-11-26	ENSG00000123684	ENSG00000123684			28985	protein-coding gene	gene with protein product		610473	"""family with sequence similarity 34, member A"""	FAM34A		9039502, 15485873	Standard	NM_014873		Approved	KIAA0205, FAM34A1, NET8	uc001hiv.3	Q92604	OTTHUMG00000037120	ENST00000366997.4:c.461C>G	1.37:g.211956837G>C	ENSP00000355964:p.Ser154Cys		Q53YL2	Missense_Mutation	SNP	pfam_Plipid/glycerol_acylTrfase,smart_Plipid/glycerol_acylTrfase	p.S154C	ENST00000366997.4	37	c.461	CCDS31018.1	1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.453742	0.84209	.	.	ENSG00000123684	ENST00000366997;ENST00000366996	D;D	0.93953	-3.32;-3.32	6.04	5.13	0.70059	Phospholipid/glycerol acyltransferase (2);	0.090760	0.85682	D	0.000000	D	0.91994	0.7464	L	0.32530	0.975	0.39974	D	0.974831	P	0.49783	0.928	P	0.50791	0.65	D	0.91868	0.5505	10	0.37606	T	0.19	-8.1716	15.5249	0.75894	0.0661:0.0:0.9339:0.0	.	154	Q92604	LGAT1_HUMAN	C	154	ENSP00000355964:S154C;ENSP00000355963:S154C	ENSP00000355963:S154C	S	-	2	0	LPGAT1	210023460	1.000000	0.71417	0.985000	0.45067	0.990000	0.78478	8.846000	0.92159	1.568000	0.49683	0.561000	0.74099	TCT	LPGAT1	-	pfam_Plipid/glycerol_acylTrfase,smart_Plipid/glycerol_acylTrfase	ENSG00000123684		0.358	LPGAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPGAT1	HGNC	protein_coding	OTTHUMT00000090150.1	-	0.00	22	0	G	NM_014873		211956837	-1	tier1	-	no_errors	ENST00000366997	ensembl	human	known	74_37	missense	23.40	36	11	SNP	1.000	C
LPIN3	64900	genome.wustl.edu	37	20	39986953	39986953	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr20:39986953G>T	ENST00000373257.3	+	18	2360	c.2269G>T	c.(2269-2271)Gga>Tga	p.G757*	LPIN3_ENST00000491528.1_3'UTR	NM_022896.1	NP_075047.1	Q9BQK8	LPIN3_HUMAN	lipin 3	757	C-LIP.				fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(7)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Myeloproliferative disorder(115;0.000739)				TCTGCCCCACGGACAGCCCTT	0.592																																																	0													102.0	91.0	95.0					20																	39986953		2203	4300	6503	SO:0001587	stop_gained	0			AL132654	CCDS33469.1	20q11.2-q12	2006-04-04	2002-05-23		ENSG00000132793	ENSG00000132793			14451	protein-coding gene	gene with protein product		605520	"""lipin 3-like"""	LIPN3L		11138012	Standard	XM_005260515		Approved	SMP2	uc002xjx.3	Q9BQK8	OTTHUMG00000033056	ENST00000373257.3:c.2269G>T	20.37:g.39986953G>T	ENSP00000362354:p.Gly757*		B2RTT5|Q5TDB9|Q9NPY8|Q9UJE5	Nonsense_Mutation	SNP	pfam_LNS2,pfam_Lipin_N,superfamily_HAD-like_dom,smart_LNS2	p.G757*	ENST00000373257.3	37	c.2269	CCDS33469.1	20	.	.	.	.	.	.	.	.	.	.	G	18.93	3.727716	0.69074	.	.	ENSG00000132793	ENST00000373257;ENST00000373259	.	.	.	5.55	-2.63	0.06133	.	0.775582	0.12143	N	0.495665	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	2.6689	7.763	0.28963	0.5826:0.1222:0.2951:0.0	.	.	.	.	X	757;390	.	.	G	+	1	0	LPIN3	39420367	0.000000	0.05858	0.000000	0.03702	0.044000	0.14063	0.025000	0.13577	-0.802000	0.04421	-0.157000	0.13467	GGA	LPIN3	-	pfam_LNS2,superfamily_HAD-like_dom,smart_LNS2	ENSG00000132793		0.592	LPIN3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LPIN3	HGNC	protein_coding	OTTHUMT00000080393.1		0.00	27	0	G	NM_022896		39986953	+1			no_errors	ENST00000373257	ensembl	human	known	74_37	nonsense	8.16	45	4	SNP	0.000	T
PLPPR1	54886	genome.wustl.edu	37	9	104071531	104071531	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr9:104071531G>T	ENST00000374874.3	+	5	863	c.424G>T	c.(424-426)Gta>Tta	p.V142L	LPPR1_ENST00000395056.2_Missense_Mutation_p.V142L	NM_207299.1	NP_997182.1	Q8TBJ4	LPPR1_HUMAN		142					nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)										TGACATTTTTGTAAACGCCGG	0.433																																																	0													174.0	160.0	165.0					9																	104071531		2203	4300	6503	SO:0001583	missense	0																														ENST00000374874.3:c.424G>T	9.37:g.104071531G>T	ENSP00000364008:p.Val142Leu		Q5VX23|Q9NXE2	Missense_Mutation	SNP	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	p.V142L	ENST00000374874.3	37	c.424	CCDS6751.1	9	.	.	.	.	.	.	.	.	.	.	G	19.48	3.834717	0.71373	.	.	ENSG00000148123	ENST00000374874;ENST00000374871;ENST00000395056	T;T	0.52526	0.66;0.66	5.32	5.32	0.75619	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.130586	0.51477	D	0.000091	T	0.54382	0.1855	M	0.73598	2.24	0.80722	D	1	B;P	0.43024	0.198;0.798	B;B	0.41466	0.206;0.358	T	0.62685	-0.6802	10	0.72032	D	0.01	-6.4621	18.3395	0.90300	0.0:0.0:1.0:0.0	.	126;142	B7Z8P4;Q8TBJ4	.;LPPR1_HUMAN	L	142	ENSP00000364008:V142L;ENSP00000378496:V142L	ENSP00000364005:V142L	V	+	1	0	RP11-35N6.1	103111352	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.420000	0.97426	2.660000	0.90430	0.591000	0.81541	GTA	LPPR1	-	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	ENSG00000148123		0.433	LPPR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LPPR1	Uniprot_gn	protein_coding	OTTHUMT00000053425.1		0.00	37	0	G			104071531	+1			no_errors	ENST00000374874	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
LRRC37A3	374819	genome.wustl.edu	37	17	62855652	62855652	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr17:62855652T>C	ENST00000584306.1	-	11	5142	c.4612A>G	c.(4612-4614)Aag>Gag	p.K1538E	LRRC37A3_ENST00000400877.3_Missense_Mutation_p.K576E|LRRC37A3_ENST00000319651.5_Missense_Mutation_p.K1538E|LRRC37A3_ENST00000339474.5_Missense_Mutation_p.K656E|LRRC37A3_ENST00000334962.5_Missense_Mutation_p.K515E	NM_199340.2	NP_955372.2	O60309	L37A3_HUMAN	leucine rich repeat containing 37, member A3	1538						integral component of membrane (GO:0016021)				NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|liver(1)|lung(10)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						CATTCTATCTTGGATGCCTTT	0.522																																																	0													165.0	172.0	169.0					17																	62855652		2202	4294	6496	SO:0001583	missense	0			AB011135	CCDS32708.1	17q24.1	2008-10-22			ENSG00000176809	ENSG00000176809			32427	protein-coding gene	gene with protein product							Standard	NM_199340		Approved	FLJ34306, KIAA0563	uc031rbi.1	O60309	OTTHUMG00000132307	ENST00000584306.1:c.4612A>G	17.37:g.62855652T>C	ENSP00000464535:p.Lys1538Glu		Q49A01|Q49A80|Q8NB33	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.K1538E	ENST00000584306.1	37	c.4612	CCDS32708.1	17	.	.	.	.	.	.	.	.	.	.	.	10.65	1.408868	0.25378	.	.	ENSG00000176809	ENST00000339474;ENST00000400877;ENST00000334962;ENST00000319651	T;T;T	0.51817	0.69;0.69;0.69	2.39	1.1	0.20463	.	.	.	.	.	T	0.56978	0.2022	M	0.65498	2.005	0.09310	N	1	P;D	0.53151	0.941;0.958	B;P	0.60682	0.323;0.878	T	0.42103	-0.9471	9	0.59425	D	0.04	.	4.8525	0.13543	0.0:0.0:0.3244:0.6756	.	656;1538	B4DG20;O60309	.;L37A3_HUMAN	E	619;576;515;1538	ENSP00000383674:K576E;ENSP00000335617:K515E;ENSP00000325713:K1538E	ENSP00000325713:K1538E	K	-	1	0	LRRC37A3	60286114	0.000000	0.05858	0.025000	0.17156	0.011000	0.07611	0.003000	0.13083	1.098000	0.41479	0.155000	0.16302	AAG	LRRC37A3	-	NULL	ENSG00000176809		0.522	LRRC37A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC37A3	HGNC	protein_coding	OTTHUMT00000445377.1		0.00	152	0	T	NM_199340		62855652	-1			no_errors	ENST00000319651	ensembl	human	known	74_37	missense	6.67	196	14	SNP	0.006	C
LRRC4B	94030	genome.wustl.edu	37	19	51021262	51021262	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr19:51021262C>T	ENST00000599957.1	-	3	1905	c.1708G>A	c.(1708-1710)Gac>Aac	p.D570N	LRRC4B_ENST00000389201.3_Missense_Mutation_p.D570N			Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B	570					positive regulation of synapse assembly (GO:0051965)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(1)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	30		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		TTCATGACGTCGTCCAGGTCC	0.622																																																	0													47.0	53.0	51.0					19																	51021262		2171	4275	6446	SO:0001583	missense	0			BC032460	CCDS42595.1	19q13.33	2014-01-30	2004-06-14	2004-06-16	ENSG00000131409	ENSG00000131409		"""Immunoglobulin superfamily / I-set domain containing"", ""Endogenous ligands"""	25042	protein-coding gene	gene with protein product	"""netrin-G3 ligand"""		"""leucine-rich repeats and immunoglobulin-like domains 4"""	LRIG4		11441184	Standard	NM_001080457		Approved	DKFZp761A179, HSM	uc002pss.3	Q9NT99		ENST00000599957.1:c.1708G>A	19.37:g.51021262C>T	ENSP00000471502:p.Asp570Asn		Q3ZCQ4|Q58F20	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.D570N	ENST00000599957.1	37	c.1708	CCDS42595.1	19	.	.	.	.	.	.	.	.	.	.	C	22.2	4.259215	0.80246	.	.	ENSG00000131409	ENST00000389201	T	0.29142	1.58	3.06	3.06	0.35304	.	0.000000	0.64402	U	0.000004	T	0.40767	0.1130	L	0.59436	1.845	0.49687	D	0.999817	D	0.62365	0.991	P	0.53760	0.734	T	0.42396	-0.9454	10	0.66056	D	0.02	.	11.9297	0.52839	0.0:1.0:0.0:0.0	.	570	Q9NT99	LRC4B_HUMAN	N	570	ENSP00000373853:D570N	ENSP00000373853:D570N	D	-	1	0	LRRC4B	55713074	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.278000	0.78587	1.709000	0.51313	0.462000	0.41574	GAC	LRRC4B	-	NULL	ENSG00000131409		0.622	LRRC4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC4B	HGNC	protein_coding	OTTHUMT00000464907.1	-	0.00	10	0	C	NM_001080457		51021262	-1	tier1	-	no_errors	ENST00000389201	ensembl	human	known	74_37	missense	40.00	6	4	SNP	1.000	T
LRRIQ1	84125	genome.wustl.edu	37	12	85638645	85638646	+	Frame_Shift_Ins	INS	-	-	A	rs5799725|rs398102301	byFrequency	TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr12:85638645_85638646insA	ENST00000393217.2	+	27	5156_5157	c.5095_5096insA	c.(5095-5097)gaafs	p.E1699fs	LRRIQ1_ENST00000528777.3_3'UTR	NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1699										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		TGTGAACAGAGAAAAAAAAAAT	0.391																																																	0																																										SO:0001589	frameshift_variant	0			AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.5105dupA	12.37:g.85638655_85638655dupA	ENSP00000376910:p.Glu1699fs		Q567P4|Q9BS17|Q9HA36	Frame_Shift_Ins	INS	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,smart_Leu-rich_rpt_typical-subtyp,pfscan_IQ_motif_EF-hand-BS	p.N1702fs	ENST00000393217.2	37	c.5095_5096	CCDS41816.1	12																																																																																			LRRIQ1	-	NULL	ENSG00000133640		0.391	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRIQ1	HGNC	protein_coding	OTTHUMT00000388249.2		0.00	30	0	-	NM_032165		85638646	+1	tier1		no_errors	ENST00000393217	ensembl	human	known	74_37	frame_shift_ins	11.90	37	5	INS	1.000:1.000	A
LSM14B	149986	genome.wustl.edu	37	20	60704986	60704986	+	Silent	SNP	G	G	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr20:60704986G>A	ENST00000279068.6	+	4	733	c.573G>A	c.(571-573)caG>caA	p.Q191Q	LSM14B_ENST00000253001.4_Intron	NM_144703.2	NP_653304.2	Q9BX40	LS14B_HUMAN	LSM14B, SCD6 homolog B (S. cerevisiae)	191					multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)	ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|lung(4)	8	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.28e-07)			GTCAGGCCCAGCCGAGCAGCA	0.512																																																	0													30.0	33.0	32.0					20																	60704986		2066	4194	6260	SO:0001819	synonymous_variant	0			AF172328	CCDS46626.1	20q13.33	2010-01-27	2006-12-21	2006-01-24	ENSG00000149657	ENSG00000149657			15887	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 40"", ""family with sequence similarity 61, member B"", ""LSM14 homolog B (SCD6, S. cerevisiae)"""	C20orf40, FAM61B			Standard	NM_144703		Approved	FT005, bA11M20.3, FLJ25473, LSM13, RAP55B	uc010gjy.1	Q9BX40	OTTHUMG00000032901	ENST00000279068.6:c.573G>A	20.37:g.60704986G>A			Q6PFW8|Q96LH8	Silent	SNP	pfam_FDF_dom,superfamily_LSM_dom	p.Q191	ENST00000279068.6	37	c.573	CCDS46626.1	20																																																																																			LSM14B	-	NULL	ENSG00000149657		0.512	LSM14B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LSM14B	HGNC	protein_coding	OTTHUMT00000079996.4		0.00	56	0	G	NM_144703		60704986	+1			no_errors	ENST00000279068	ensembl	human	known	74_37	silent	5.13	73	4	SNP	0.983	A
MALAT1	378938	genome.wustl.edu	37	11	65270090	65270091	+	lincRNA	DNP	CT	CT	AC	rs3842272	byFrequency	TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C|T	C|T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr11:65270090_65270091CT>AC	ENST00000534336.1	+	0	4858_4859					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		GGAGGGGAAACTTTTTTTTTTT	0.371																																																	0																																												0			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322	Exception_encountered	11.37:g.65270090_65270091delinsAC				RNA	SNP	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			MALAT1	-	-	ENSG00000251562		0.371	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1		0.00	20|8	0	C|T	NR_002819		65270090|65270091	+1			no_errors	ENST00000534336	ensembl	human	known	74_37	rna	9.33|8.16	66|46	7|8	SNP	0.929|0.911	A|C
MALAT1	378938	genome.wustl.edu	37	11	65273214	65273214	+	lincRNA	SNP	G	G	C	rs373484523		TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr11:65273214G>C	ENST00000534336.1	+	0	7982					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		GTTAACAGAAGGGTATTAAAA	0.368																																																	0								G		0,1748		0,0,874	100.0	97.0	98.0			-5.2	0.0	11		98	1,3975		0,1,1987	no	intergenic				0,1,2861	CC,CG,GG		0.0252,0.0,0.0175			65273214	1,5723	874	1988	2862			0			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65273214G>C				RNA	SNP	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			MALAT1	-	-	ENSG00000251562		0.368	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1	-	0.00	31	0	G	NR_002819		65273214	+1	tier1	-	no_errors	ENST00000534336	ensembl	human	known	74_37	rna	10.45	60	7	SNP	0.000	C
MED13	9969	genome.wustl.edu	37	17	60059880	60059880	+	Missense_Mutation	SNP	G	G	A	rs546862897		TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr17:60059880G>A	ENST00000397786.2	-	16	3560	c.3484C>T	c.(3484-3486)Cgt>Tgt	p.R1162C		NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	1162					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.R1162C(1)		breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						GCTTCAAAACGTTTTTCTGCT	0.353																																																	1	Substitution - Missense(1)	lung(1)											131.0	119.0	123.0					17																	60059880		1879	4105	5984	SO:0001583	missense	0			AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.3484C>T	17.37:g.60059880G>A	ENSP00000380888:p.Arg1162Cys		B2RU05|O60334	Missense_Mutation	SNP	pfam_Mediator_Med13,pfam_Mediator_Med13_N_met/fun	p.R1162C	ENST00000397786.2	37	c.3484	CCDS42366.1	17	.	.	.	.	.	.	.	.	.	.	G	16.28	3.079497	0.55753	.	.	ENSG00000108510	ENST00000397786;ENST00000262436	T	0.75938	-0.98	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.68247	0.2980	L	0.34521	1.04	0.80722	D	1	B	0.22746	0.074	B	0.13407	0.009	T	0.63107	-0.6711	10	0.54805	T	0.06	-0.3309	20.1356	0.98028	0.0:0.0:1.0:0.0	.	1162	Q9UHV7	MED13_HUMAN	C	1162;1161	ENSP00000380888:R1162C	ENSP00000262436:R1161C	R	-	1	0	MED13	57414662	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.159000	0.71856	2.755000	0.94549	0.650000	0.86243	CGT	MED13	-	NULL	ENSG00000108510		0.353	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED13	HGNC	protein_coding	OTTHUMT00000445461.1		0.00	24	0	G	NM_005121		60059880	-1			no_errors	ENST00000397786	ensembl	human	known	74_37	missense	6.67	28	2	SNP	1.000	A
MEF2A	4205	genome.wustl.edu	37	15	100252738	100252739	+	Frame_Shift_Del	DEL	AG	AG	-	rs560400205|rs201861701	byFrequency	TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr15:100252738_100252739delAG	ENST00000557785.1	+	11	1605_1606	c.1256_1257delAG	c.(1255-1257)cagfs	p.Q420fs	MEF2A_ENST00000558812.1_Frame_Shift_Del_p.Q360fs|MEF2A_ENST00000453228.2_Frame_Shift_Del_p.Q420fs|MEF2A_ENST00000449277.2_Frame_Shift_Del_p.Q352fs|MEF2A_ENST00000338042.6_Frame_Shift_Del_p.Q429fs|MEF2A_ENST00000354410.5_Frame_Shift_Del_p.Q422fs|MEF2A_ENST00000557942.1_Frame_Shift_Del_p.Q428fs	NM_001171894.1	NP_001165365.1	Q02078	MEF2A_HUMAN	myocyte enhancer factor 2A	430	Gln/Pro-rich.				apoptotic process (GO:0006915)|cardiac conduction (GO:0061337)|cellular response to calcium ion (GO:0071277)|dendrite morphogenesis (GO:0048813)|ERK5 cascade (GO:0070375)|heart development (GO:0007507)|innate immune response (GO:0045087)|MAPK cascade (GO:0000165)|mitochondrial genome maintenance (GO:0000002)|mitochondrion distribution (GO:0048311)|muscle cell differentiation (GO:0042692)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac myofibril assembly (GO:0055005)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)			endometrium(2)|large_intestine(2)|lung(7)|ovary(1)	12	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00085)			cagcagcagcagcagcCGCCGC	0.634																																																	0									,,,,	151,2619		26,99,1260					,,,,		0.0		dbSNP_129	7	953,4759		140,673,2043	no	frameshift,frameshift,frameshift,frameshift,frameshift	MEF2A	NM_005587.2,NM_001171894.1,NM_001130928.1,NM_001130927.1,NM_001130926.1	,,,,	166,772,3303	A1A1,A1R,RR		16.6842,5.4513,13.0158	,,,,	,,,,		1104,7378				SO:0001589	frameshift_variant	0				CCDS45362.1, CCDS45363.1, CCDS53978.1, CCDS58401.1	15q26	2008-02-05	2007-04-24			ENSG00000068305		"""Myocyte enhancer factors"""	6993	protein-coding gene	gene with protein product		600660				1516833	Standard	NM_005587		Approved	RSRFC4, RSRFC9	uc002bvf.3	Q02078		ENST00000557785.1:c.1256_1257delAG	15.37:g.100252738_100252739delAG	ENSP00000453441:p.Gln420fs		B4DFQ7|F6XG23|O43814|Q14223|Q14224|Q59GX4|Q7Z6C9|Q96D14	Frame_Shift_Del	DEL	pfam_TF_MADSbox,pfam_HJURP_C,superfamily_TF_MADSbox,smart_TF_MADSbox,pfscan_TF_MADSbox,prints_TF_MADSbox	p.Q428fs	ENST00000557785.1	37	c.1283_1284	CCDS53978.1	15																																																																																			MEF2A	-	NULL	ENSG00000068305		0.634	MEF2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MEF2A	HGNC	protein_coding	OTTHUMT00000415985.1		0.00	51	0	AG			100252739	+1	tier1		no_errors	ENST00000338042	ensembl	human	known	74_37	frame_shift_del	9.26	49	5	DEL	0.928:0.862	-
MIA3	375056	genome.wustl.edu	37	1	222791507	222791507	+	Silent	SNP	C	C	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr1:222791507C>A	ENST00000344922.5	+	1	80	c.55C>A	c.(55-57)Cgg>Agg	p.R19R	MIA3_ENST00000344507.1_Silent_p.R19R|MIA3_ENST00000344441.6_Silent_p.R19R|MIA3_ENST00000470521.1_3'UTR	NM_198551.2	NP_940953.2	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	19					chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|exocytosis (GO:0006887)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|positive regulation of bone mineralization (GO:0030501)|positive regulation of leukocyte migration (GO:0002687)|protein transport (GO:0015031)|wound healing (GO:0042060)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(5)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(15)|lung(37)|ovary(5)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|urinary_tract(1)	80				GBM - Glioblastoma multiforme(131;0.0199)		GCTGCCCTGGCGGGTGCCGGG	0.726																																																	0													2.0	4.0	3.0					1																	222791507		1517	3450	4967	SO:0001819	synonymous_variant	0				CCDS41470.1, CCDS73035.1	1p36.33	2012-12-13		2006-07-25	ENSG00000154305	ENSG00000154305			24008	protein-coding gene	gene with protein product	"""C219 reactive peptide"", ""transport and golgi organization"""	613455				15183315	Standard	XM_005273121		Approved	UNQ6077, FLJ39207, KIAA0268, TANGO	uc001hnl.3	Q5JRA6	OTTHUMG00000037543	ENST00000344922.5:c.55C>A	1.37:g.222791507C>A			A8K2S0|A8MT05|A8MT13|B7Z430|Q14083|Q3S4X3|Q5JRA5|Q5JRB0|Q5JRB1|Q5JRB2|Q6UVY8|Q86Y60|Q8N8M5|Q92580	Silent	SNP	pfam_SH3_2,superfamily_SH3_domain	p.R19	ENST00000344922.5	37	c.55	CCDS41470.1	1																																																																																			MIA3	-	NULL	ENSG00000154305		0.726	MIA3-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	MIA3	HGNC	protein_coding	OTTHUMT00000091489.4	-	0.00	10	0	C	NM_198551		222791507	+1	tier1	-	no_errors	ENST00000344441	ensembl	human	known	74_37	silent	60.00	4	6	SNP	0.001	A
TRIB2	28951	genome.wustl.edu	37	2	12877501	12877501	+	Intron	SNP	G	G	A	rs5829384|rs200503689	byFrequency	TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr2:12877501G>A	ENST00000155926.4	+	3	1982				TRIB2_ENST00000381465.2_Intron|MIR3125_ENST00000579927.1_RNA	NM_021643.3	NP_067675.1			tribbles pseudokinase 2											breast(1)|cervix(1)|endometrium(1)|large_intestine(8)|lung(5)|prostate(1)|skin(1)|stomach(1)	19	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GTGAGAATGGGTAGAGGAAGC	0.488																																																	0																																										SO:0001627	intron_variant	0			AY245544	CCDS1683.1	2p25.1	2013-10-03	2013-10-03		ENSG00000071575	ENSG00000071575			30809	protein-coding gene	gene with protein product		609462	"""tribbles homolog 2 (Drosophila)"""			12736262, 17097562, 16715410	Standard	NM_021643		Approved	TRB2, GS3955	uc002rbv.4	Q92519	OTTHUMG00000090575	ENST00000155926.4:c.564-2951G>A	2.37:g.12877501G>A				RNA	SNP	-	NULL	ENST00000155926.4	37	NULL	CCDS1683.1	2																																																																																			MIR3125	-	-	ENSG00000264370		0.488	TRIB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR3125	HGNC	protein_coding	OTTHUMT00000207114.2		0.00	70	0	G	NM_021643		12877501	+1			no_errors	ENST00000579927	ensembl	human	known	74_37	rna	7.77	95	8	SNP	0.001	A
MOCS2	4338	genome.wustl.edu	37	5	52396306	52396306	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr5:52396306C>T	ENST00000396954.3	-	6	1113	c.436G>A	c.(436-438)Gca>Aca	p.A146T	MOCS2_ENST00000361377.4_3'UTR|MOCS2_ENST00000510818.2_3'UTR|MOCS2_ENST00000584946.1_3'UTR|MOCS2_ENST00000450852.3_3'UTR|MOCS2_ENST00000527216.1_3'UTR|MOCS2_ENST00000508922.1_Intron|MOCS2_ENST00000582677.1_3'UTR	NM_004531.3	NP_004522.1			molybdenum cofactor synthesis 2											endometrium(1)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	5		Lung NSC(810;3.08e-05)|Breast(144;0.0848)				TCAAGAGATGCAGCTCTGTGG	0.398																																																	0													83.0	84.0	84.0					5																	52396306		2203	4300	6503	SO:0001583	missense	0			AF117815	CCDS3958.1, CCDS47205.1	5q11	2008-02-05			ENSG00000164172	ENSG00000164172			7193	protein-coding gene	gene with protein product		603708				10053004, 9889283	Standard	NM_004531		Approved	MOCO1	uc003joz.3	O96007	OTTHUMG00000096981	ENST00000396954.3:c.436G>A	5.37:g.52396306C>T	ENSP00000380157:p.Ala146Thr			Missense_Mutation	SNP	pfam_Mopterin_biosynth_MoaE,superfamily_Mopterin_biosynth_MoaE	p.A146T	ENST00000396954.3	37	c.436	CCDS3958.1	5	.	.	.	.	.	.	.	.	.	.	C	16.88	3.245934	0.59103	.	.	ENSG00000164172	ENST00000396954;ENST00000527216	T	0.23147	1.92	5.65	4.77	0.60923	.	0.178199	0.49916	D	0.000134	T	0.29588	0.0738	L	0.58583	1.82	0.80722	D	1	B	0.21520	0.057	B	0.30029	0.11	T	0.05305	-1.0893	10	0.25106	T	0.35	-5.5703	15.1413	0.72612	0.1497:0.8503:0.0:0.0	.	146	O96007	MOC2B_HUMAN	T	146	ENSP00000380157:A146T	ENSP00000380157:A146T	A	-	1	0	MOCS2	52432063	0.993000	0.37304	0.987000	0.45799	0.995000	0.86356	2.755000	0.47540	1.483000	0.48342	0.655000	0.94253	GCA	MOCS2	-	pfam_Mopterin_biosynth_MoaE,superfamily_Mopterin_biosynth_MoaE	ENSG00000164172		0.398	MOCS2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MOCS2	HGNC	protein_coding	OTTHUMT00000214053.3	-	0.00	36	0	C	NM_183418		52396306	-1	tier1	-	no_errors	ENST00000396954	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	T
MORF4L1	10933	genome.wustl.edu	37	15	79189830	79189830	+	3'UTR	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr15:79189830G>T	ENST00000331268.5	+	0	1714				MORF4L1_ENST00000426013.2_3'UTR|RNU6-415P_ENST00000516252.1_RNA|MORF4L1_ENST00000379535.4_3'UTR|MORF4L1_ENST00000561171.1_3'UTR	NM_206839.2	NP_996670.1	Q9UBU8	MO4L1_HUMAN	mortality factor 4 like 1						cell proliferation (GO:0008283)|chromatin organization (GO:0006325)|double-strand break repair via homologous recombination (GO:0000724)|histone deacetylation (GO:0016575)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|Sin3 complex (GO:0016580)	chromatin binding (GO:0003682)|protein N-terminus binding (GO:0047485)			breast(1)|large_intestine(3)|lung(4)|prostate(1)|urinary_tract(1)	10						TTGTGCTTTTGTTTTTTTTTA	0.343																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF100615	CCDS10307.1, CCDS32304.1, CCDS58393.1	15q25.1	2009-07-13			ENSG00000185787	ENSG00000185787			16989	protein-coding gene	gene with protein product	"""MORF-related gene on chromosome 15"", ""Esa1p-associated factor 3 homolog (S. cerevisiae)"""	607303				8619474, 9110174	Standard	NM_006791		Approved	MRG15, MORFRG15, HsT17725, Eaf3, MEAF3	uc002bel.4	Q9UBU8	OTTHUMG00000143865	ENST00000331268.5:c.*421G>T	15.37:g.79189830G>T			B4DKN6|B7Z6R1|D3DW88|O95899|Q5QTS1|Q6NVX8|Q86YT7|Q9HBP6|Q9NSW5	RNA	SNP	-	NULL	ENST00000331268.5	37	NULL	CCDS10307.1	15																																																																																			MORF4L1	-	-	ENSG00000185787		0.343	MORF4L1-001	KNOWN	basic|CCDS	protein_coding	MORF4L1	HGNC	protein_coding	OTTHUMT00000290131.4	-	0.00	35	0	G	NM_006791		79189830	+1	tier1	-	no_errors	ENST00000561171	ensembl	human	known	74_37	rna	8.20	56	5	SNP	0.000	T
MTHFR	4524	genome.wustl.edu	37	1	11861267	11861267	+	Silent	SNP	C	C	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr1:11861267C>T	ENST00000376592.1	-	2	554	c.426G>A	c.(424-426)ctG>ctA	p.L142L	MTHFR_ENST00000376590.3_Silent_p.L142L|MTHFR_ENST00000376583.3_Silent_p.L183L|MTHFR_ENST00000376585.1_Silent_p.L183L			P42898	MTHR_HUMAN	methylenetetrahydrofolate reductase (NAD(P)H)	142					blood circulation (GO:0008015)|cellular amino acid metabolic process (GO:0006520)|folic acid metabolic process (GO:0046655)|homocysteine metabolic process (GO:0050667)|methionine biosynthetic process (GO:0009086)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to vitamin B2 (GO:0033274)|S-adenosylmethionine metabolic process (GO:0046500)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|neuron projection (GO:0043005)	flavin adenine dinucleotide binding (GO:0050660)|methylenetetrahydrofolate reductase (NAD(P)H) activity (GO:0004489)|modified amino acid binding (GO:0072341)|NADP binding (GO:0050661)	p.L142L(1)		NS(4)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(6)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	33	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Benazepril(DB00542)|Cyanocobalamin(DB00115)|Fluorouracil(DB00544)|Folic Acid(DB00158)|L-Methionine(DB00134)|Menadione(DB00170)|Methotrexate(DB00563)|Riboflavin(DB00140)|Tetrahydrofolic acid(DB00116)	TAGCTTTGTGCAGATGGCCCG	0.622																																																	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)											95.0	88.0	90.0					1																	11861267		2203	4300	6503	SO:0001819	synonymous_variant	0			BC053509	CCDS137.1	1p36.3	2014-09-17	2010-05-04		ENSG00000177000	ENSG00000177000	1.5.1.20		7436	protein-coding gene	gene with protein product		607093	"""5,10-methylenetetrahydrofolate reductase (NADPH)"""			7920641	Standard	NM_005957		Approved		uc001atc.2	P42898	OTTHUMG00000002277	ENST00000376592.1:c.426G>A	1.37:g.11861267C>T			B2R7A6|Q5SNW6|Q5SNW9|Q7Z6M6|Q8IU73|Q9UQR2	Silent	SNP	pfam_Mehydrof_redctse,tigrfam_Fadh2_euk	p.L183	ENST00000376592.1	37	c.549	CCDS137.1	1																																																																																			MTHFR	-	pfam_Mehydrof_redctse,tigrfam_Fadh2_euk	ENSG00000177000		0.622	MTHFR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MTHFR	HGNC	protein_coding	OTTHUMT00000006538.1		0.00	24	0	C	NM_005957		11861267	-1			no_errors	ENST00000376583	ensembl	human	known	74_37	silent	5.56	34	2	SNP	1.000	T
LINC01317	104355287	genome.wustl.edu	37	2	33951529	33951530	+	lincRNA	INS	-	-	T	rs397714251|rs146470076	byFrequency	TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr2:33951529_33951530insT	ENST00000366209.2	+	0	68				MYADML_ENST00000474610.1_RNA																							AGATACATACATTTTTTTTAAT	0.515														770	0.153754	0.2534	0.1254	5008	,	,		16160	0.0327		0.1252	False		,,,				2504	0.1933																0																																												0																															2.37:g.33951537_33951537dupT				RNA	INS	-	NULL	ENST00000366209.2	37	NULL		2																																																																																			MYADML	-	-	ENSG00000239649		0.515	AC009499.1-002	KNOWN	non_canonical_polymorphism|basic	lincRNA	MYADML	HGNC	lincRNA	OTTHUMT00000325406.1		0.00	15	0	-			33951530	-1	tier1		no_errors	ENST00000474610	ensembl	human	known	74_37	rna	37.50	20	12	INS	0.000:0.004	T
MYCBP2	23077	genome.wustl.edu	37	13	77641876	77641876	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr13:77641876C>G	ENST00000544440.2	-	71	12198	c.12181G>C	c.(12181-12183)Gac>Cac	p.D4061H	MYCBP2_ENST00000357337.6_Missense_Mutation_p.D4061H|MYCBP2_ENST00000407578.2_Missense_Mutation_p.D4099H					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		TTATTCCAGTCTCCTTTCTCT	0.473																																																	0													219.0	212.0	215.0					13																	77641876		2203	4300	6503	SO:0001583	missense	0			AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.12181G>C	13.37:g.77641876C>G	ENSP00000444596:p.Asp4061His			Missense_Mutation	SNP	pfam_PHR,pfam_Reg_chr_condens,pfam_Filamin/ABP280_repeat-like,superfamily_RCC1/BLIP-II,superfamily_Galactose-bd-like,superfamily_Ig_E-set,superfamily_ARM-type_fold,smart_Znf_RING,pfscan_Filamin/ABP280_repeat-like,pfscan_Znf_RING,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.D4099H	ENST00000544440.2	37	c.12295		13	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.4|27.4	4.831669|4.831669	0.91036|0.91036	.|.	.|.	ENSG00000005810|ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440|ENST00000429715	T;T;T|.	0.34667|.	1.36;1.35;1.36|.	5.95|5.95	5.95|5.95	0.96441|0.96441	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.71668|0.71668	0.3367|0.3367	L|L	0.50333|0.50333	1.59|1.59	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	P|.	0.62885|.	0.908|.	T|T	0.65768|0.65768	-0.6088|-0.6088	10|5	0.72032|.	D|.	0.01|.	.|.	20.3812|20.3812	0.98933|0.98933	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	4061|.	O75592|.	MYCB2_HUMAN|.	H|T	4061;4099;4061|481	ENSP00000349892:D4061H;ENSP00000384288:D4099H;ENSP00000444596:D4061H|.	ENSP00000349892:D4061H|.	D|R	-|-	1|2	0|0	MYCBP2|MYCBP2	76539877|76539877	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.814000|7.814000	0.86154|0.86154	2.821000|2.821000	0.97095|0.97095	0.650000|0.650000	0.86243|0.86243	GAC|AGA	MYCBP2	-	superfamily_ARM-type_fold	ENSG00000005810		0.473	MYCBP2-001	KNOWN	basic	protein_coding	MYCBP2	HGNC	protein_coding	OTTHUMT00000045326.1	-	0.00	50	0	C	NM_015057		77641876	-1	tier1	-	no_errors	ENST00000407578	ensembl	human	known	74_37	missense	70.27	22	52	SNP	1.000	G
MYOD1	4654	genome.wustl.edu	37	11	17741729	17741729	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr11:17741729C>T	ENST00000250003.3	+	1	615	c.400C>T	c.(400-402)Cgc>Tgc	p.R134C		NM_002478.4	NP_002469.2	P15172	MYOD1_HUMAN	myogenic differentiation 1	134	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cellular response to estradiol stimulus (GO:0071392)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to oxygen levels (GO:0071453)|cellular response to starvation (GO:0009267)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle organ development (GO:0007517)|myoblast fate determination (GO:0007518)|myotube cell development (GO:0014904)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast fusion (GO:1901741)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle fiber adaptation (GO:0043503)|skeletal muscle fiber development (GO:0048741)|skeletal muscle tissue development (GO:0007519)|transcription from RNA polymerase II promoter (GO:0006366)	myofibril (GO:0030016)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|E-box binding (GO:0070888)|nuclear hormone receptor binding (GO:0035257)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)	17						GACACTCAAGCGCTGCACGTC	0.637																																																	0													45.0	31.0	36.0					11																	17741729		2199	4293	6492	SO:0001583	missense	0			AF027148	CCDS7826.1	11p15	2013-05-21	2005-09-12			ENSG00000129152		"""Basic helix-loop-helix proteins"""	7611	protein-coding gene	gene with protein product	"""myoblast determination protein 1"""	159970	"""myogenic factor 3"""	MYF3			Standard	NM_002478		Approved	PUM, MYOD, bHLHc1	uc001mni.3	P15172		ENST00000250003.3:c.400C>T	11.37:g.17741729C>T	ENSP00000250003:p.Arg134Cys		O75321	Missense_Mutation	SNP	pfam_Basic,pfam_Myf5,pfam_bHLH_dom,superfamily_bHLH_dom,smart_Basic,smart_bHLH_dom,pfscan_bHLH_dom	p.R134C	ENST00000250003.3	37	c.400	CCDS7826.1	11	.	.	.	.	.	.	.	.	.	.	C	21.5	4.159958	0.78226	.	.	ENSG00000129152	ENST00000250003	D	0.98060	-4.69	4.88	4.88	0.63580	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.98573	0.9523	M	0.75615	2.305	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99816	1.1044	10	0.87932	D	0	-30.8373	18.2189	0.89895	0.0:1.0:0.0:0.0	.	134	P15172	MYOD1_HUMAN	C	134	ENSP00000250003:R134C	ENSP00000250003:R134C	R	+	1	0	MYOD1	17698305	1.000000	0.71417	1.000000	0.80357	0.822000	0.46500	1.750000	0.38329	2.541000	0.85698	0.561000	0.74099	CGC	MYOD1	-	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	ENSG00000129152		0.637	MYOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOD1	HGNC	protein_coding	OTTHUMT00000389387.1	-	0.00	55	0	C	NM_002478		17741729	+1	tier1	-	no_errors	ENST00000250003	ensembl	human	known	74_37	missense	11.43	31	4	SNP	1.000	T
NAP1L4	4676	genome.wustl.edu	37	11	2981115	2981115	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr11:2981115C>T	ENST00000380542.4	-	9	771	c.631G>A	c.(631-633)Gaa>Aaa	p.E211K	NAP1L4_ENST00000526115.1_Missense_Mutation_p.E211K	NM_005969.3	NP_005960.1	Q99733	NP1L4_HUMAN	nucleosome assembly protein 1-like 4	211					nucleosome assembly (GO:0006334)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			endometrium(2)|kidney(3)|large_intestine(1)|lung(6)|ovary(1)	13		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00301)|LUSC - Lung squamous cell carcinoma(625;0.211)		TCGTTGGGTTCAAAGTGGAAC	0.383																																																	0													125.0	112.0	116.0					11																	2981115		1845	4088	5933	SO:0001583	missense	0			AA573896, BC022090, U77456	CCDS41599.1	11p15.5	2007-12-06			ENSG00000205531	ENSG00000205531			7640	protein-coding gene	gene with protein product		601651				8923002	Standard	NM_005969		Approved	NAP2	uc001lxc.3	Q99733	OTTHUMG00000011009	ENST00000380542.4:c.631G>A	11.37:g.2981115C>T	ENSP00000369915:p.Glu211Lys		B2R6J4|F5HFY4	Missense_Mutation	SNP	pfam_NAP_family	p.E211K	ENST00000380542.4	37	c.631	CCDS41599.1	11	.	.	.	.	.	.	.	.	.	.	C	16.27	3.075207	0.55646	.	.	ENSG00000205531	ENST00000399624;ENST00000380542;ENST00000526115;ENST00000532325;ENST00000448187	T;T;T	0.25085	1.82;1.82;1.82	4.87	4.87	0.63330	.	0.104316	0.64402	D	0.000004	T	0.31702	0.0805	L	0.53729	1.69	0.58432	D	0.999994	P;B	0.36789	0.57;0.198	B;B	0.41666	0.363;0.1	T	0.03443	-1.1036	10	0.24483	T	0.36	-21.2683	18.2123	0.89874	0.0:1.0:0.0:0.0	.	211;211	F5HFY4;Q99733	.;NP1L4_HUMAN	K	211;211;211;96;223	ENSP00000369915:E211K;ENSP00000436397:E211K;ENSP00000387783:E223K	ENSP00000369915:E211K	E	-	1	0	NAP1L4	2937691	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	5.503000	0.66962	2.537000	0.85549	0.557000	0.71058	GAA	NAP1L4	-	pfam_NAP_family	ENSG00000205531		0.383	NAP1L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAP1L4	HGNC	protein_coding	OTTHUMT00000030273.3	-	0.00	63	0	C	NM_005969		2981115	-1	tier1	-	no_errors	ENST00000380542	ensembl	human	known	74_37	missense	63.75	29	51	SNP	1.000	T
NAALAD2	10003	genome.wustl.edu	37	11	89882266	89882266	+	Silent	SNP	C	C	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr11:89882266C>A	ENST00000534061.1	+	4	704	c.474C>A	c.(472-474)ggC>ggA	p.G158G	NAALAD2_ENST00000321955.4_Silent_p.G158G|NAALAD2_ENST00000375944.3_Silent_p.G158G|NAALAD2_ENST00000525171.1_Silent_p.G158G	NM_005467.3	NP_005458.1	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	158					neurotransmitter catabolic process (GO:0042135)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|N-formylglutamate deformylase activity (GO:0050129)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(32)|pancreas(1)|prostate(3)|skin(5)|stomach(2)	59		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				CAGCCCAAGGCATGCCAGAGG	0.363																																																	0													70.0	71.0	70.0					11																	89882266		2195	4284	6479	SO:0001819	synonymous_variant	0			AJ012370	CCDS8288.1, CCDS73364.1	11q14.3-q21	2011-08-16			ENSG00000077616	ENSG00000077616	3.4.17.21		14526	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase III"""	611636				10085079	Standard	NM_005467		Approved	NAALADASE2, NAADALASE2, GPCIII	uc001pdf.4	Q9Y3Q0	OTTHUMG00000166368	ENST00000534061.1:c.474C>A	11.37:g.89882266C>A			B3KQR4|Q4KKV4|Q4VAM9	Silent	SNP	pfam_TFR-like_dimer_dom,pfam_Peptidase_M28,pfam_Protease-assoc_domain,superfamily_TFR-like_dimer_dom	p.G158	ENST00000534061.1	37	c.474	CCDS8288.1	11																																																																																			NAALAD2	-	pfam_Protease-assoc_domain	ENSG00000077616		0.363	NAALAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAALAD2	HGNC	protein_coding	OTTHUMT00000389424.2	-	0.00	117	0	C	NM_005467		89882266	+1	tier1	-	no_errors	ENST00000534061	ensembl	human	known	74_37	silent	57.86	59	81	SNP	0.482	A
NBEAL1	65065	genome.wustl.edu	37	2	204053201	204053201	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr2:204053201G>C	ENST00000449802.1	+	44	6958	c.6625G>C	c.(6625-6627)Gaa>Caa	p.E2209Q		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	2209	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.									NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						CTAGGAGTCTGAATATGTTTC	0.318																																																	0													68.0	61.0	63.0					2																	204053201		1810	4070	5880	SO:0001583	missense	0			AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.6625G>C	2.37:g.204053201G>C	ENSP00000399903:p.Glu2209Gln		A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl_sf,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E2209Q	ENST00000449802.1	37	c.6625	CCDS46495.1	2	.	.	.	.	.	.	.	.	.	.	G	27.8	4.862235	0.91511	.	.	ENSG00000144426	ENST00000449802;ENST00000340268;ENST00000414576	T;T	0.77877	-1.13;-1.13	5.85	5.85	0.93711	BEACH domain (4);	0.000000	0.85682	D	0.000000	D	0.88235	0.6382	M	0.70595	2.14	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.88151	0.2851	10	0.66056	D	0.02	.	19.7613	0.96319	0.0:0.0:1.0:0.0	.	2209;2198	Q6ZS30;C9JGK5	NBEL1_HUMAN;.	Q	2209;2209;224	ENSP00000399903:E2209Q;ENSP00000388466:E224Q	ENSP00000344985:E2209Q	E	+	1	0	NBEAL1	203761446	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	9.751000	0.98889	2.773000	0.95371	0.585000	0.79938	GAA	NBEAL1	-	pfam_BEACH_dom,superfamily_BEACH_dom,pfscan_BEACH_dom	ENSG00000144426		0.318	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBEAL1	HGNC	protein_coding	OTTHUMT00000333982.4	-	0.00	48	0	G			204053201	+1	tier1	-	no_errors	ENST00000449802	ensembl	human	known	74_37	missense	22.47	69	20	SNP	1.000	C
NCAPG	64151	genome.wustl.edu	37	4	17839321	17839321	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr4:17839321C>T	ENST00000251496.2	+	16	2539	c.2363C>T	c.(2362-2364)tCt>tTt	p.S788F		NM_022346.4	NP_071741.2	Q9BPX3	CND3_HUMAN	non-SMC condensin I complex, subunit G	788					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	27				STAD - Stomach adenocarcinoma(129;0.18)		CCTGCATCTTCTCCTTTAGCT	0.393																																																	0													168.0	166.0	167.0					4																	17839321		2203	4300	6503	SO:0001583	missense	0			AF331796	CCDS3424.1	4p15.32	2014-01-15			ENSG00000109805	ENSG00000109805			24304	protein-coding gene	gene with protein product	"""chromosome condensation protein G"""	606280				10910072, 11136719	Standard	NM_022346		Approved	FLJ12450, hCAP-G, CAP-G, YCG1	uc003gpp.4	Q9BPX3	OTTHUMG00000128539	ENST00000251496.2:c.2363C>T	4.37:g.17839321C>T	ENSP00000251496:p.Ser788Phe		Q3MJE0|Q96SV9|Q9BUR3|Q9BVY1|Q9H914|Q9H9Z6|Q9HBI9	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.S788F	ENST00000251496.2	37	c.2363	CCDS3424.1	4	.	.	.	.	.	.	.	.	.	.	C	27.4	4.830225	0.91036	.	.	ENSG00000109805	ENST00000251496	T	0.50813	0.73	5.25	5.25	0.73442	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.72195	0.3430	M	0.81942	2.565	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.76075	-0.3092	10	0.87932	D	0	-14.7205	19.1974	0.93695	0.0:1.0:0.0:0.0	.	788	Q9BPX3	CND3_HUMAN	F	788	ENSP00000251496:S788F	ENSP00000251496:S788F	S	+	2	0	NCAPG	17448419	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.937000	0.75898	2.601000	0.87937	0.591000	0.81541	TCT	NCAPG	-	superfamily_ARM-type_fold	ENSG00000109805		0.393	NCAPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAPG	HGNC	protein_coding	OTTHUMT00000250375.1		0.00	36	0	C	NM_022346		17839321	+1			no_errors	ENST00000251496	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	T
NCOA3	8202	genome.wustl.edu	37	20	46279857	46279857	+	Silent	SNP	G	G	A	rs561036149	byFrequency	TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr20:46279857G>A	ENST00000371998.3	+	20	3974	c.3783G>A	c.(3781-3783)caG>caA	p.Q1261Q	NCOA3_ENST00000341724.6_Silent_p.Q1187Q|NCOA3_ENST00000371997.3_Silent_p.Q1252Q|NCOA3_ENST00000372004.3_Silent_p.Q1257Q			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	1261	Acetyltransferase.|Poly-Gln.				androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						agcagcagcagcagcagcaac	0.572													G|||	3	0.000599042	0.0008	0.0	5008	,	,		14246	0.0		0.0	False		,,,				2504	0.002																0													50.0	54.0	53.0					20																	46279857		2203	4300	6503	SO:0001819	synonymous_variant	0			AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.3783G>A	20.37:g.46279857G>A			A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Silent	SNP	pfam_Nuc_rcpt_coact_Ncoa-typ,pfam_SRC-1,pfam_PAS_fold,superfamily_PAS,superfamily_Nuc_rcpt_coact,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,pirsf_Nuclear_rcpt_coactivator,pfscan_PAS,pfscan_bHLH_dom	p.Q1261	ENST00000371998.3	37	c.3783	CCDS13407.1	20																																																																																			NCOA3	-	pirsf_Nuclear_rcpt_coactivator	ENSG00000124151		0.572	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCOA3	HGNC	protein_coding	OTTHUMT00000080405.1		0.00	46	0	G	NM_006534		46279857	+1			no_errors	ENST00000371998	ensembl	human	known	74_37	silent	5.62	84	5	SNP	0.971	A
NEFM	4741	genome.wustl.edu	37	8	24771823	24771823	+	Silent	SNP	C	C	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr8:24771823C>T	ENST00000221166.5	+	1	1299	c.517C>T	c.(517-519)Ctg>Ttg	p.L173L	RP11-624C23.1_ENST00000519689.1_RNA|NEFM_ENST00000433454.2_5'Flank|NEFM_ENST00000521540.1_3'UTR|GS1-72M22.1_ENST00000607058.1_RNA|NEFM_ENST00000437366.2_Silent_p.L173L|NEFM_ENST00000518131.1_Silent_p.L173L			P07197	NFM_HUMAN	neurofilament, medium polypeptide	173	Coil 1B.|Rod.				axon cargo transport (GO:0008088)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|regulation of axon diameter (GO:0031133)	axon (GO:0030424)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)|neuromuscular junction (GO:0031594)	microtubule binding (GO:0008017)|structural constituent of cytoskeleton (GO:0005200)			breast(3)|endometrium(7)|kidney(4)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|urinary_tract(1)	36		Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		TCAGGTGCAGCTGGACTCGGA	0.682																																																	0													36.0	38.0	37.0					8																	24771823		2202	4299	6501	SO:0001819	synonymous_variant	0			BC002421	CCDS6046.1, CCDS47831.1	8p21	2013-01-16	2008-09-19	2006-11-20	ENSG00000104722	ENSG00000104722		"""Intermediate filaments type IV"""	7734	protein-coding gene	gene with protein product		162250	"""neurofilament, medium polypeptide 150kDa"""	NEF3		1348579	Standard	NM_001105541		Approved	NFM, NF-M	uc003xed.4	P07197	OTTHUMG00000131990	ENST00000221166.5:c.517C>T	8.37:g.24771823C>T			B4DGN2|E9PBF7|Q4QRK6	Silent	SNP	pfam_IF,pfam_Intermed_filament_DNA-bd,superfamily_Prefoldin,prints_Keratin_I	p.L173	ENST00000221166.5	37	c.517	CCDS6046.1	8																																																																																			NEFM	-	pfam_IF	ENSG00000104722		0.682	NEFM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEFM	HGNC	protein_coding	OTTHUMT00000254954.2	-	0.00	62	0	C	NM_005382		24771823	+1	tier1	-	no_errors	ENST00000221166	ensembl	human	known	74_37	silent	5.80	65	4	SNP	1.000	T
NELFE	7936	genome.wustl.edu	37	6	31922591	31922591	+	Silent	SNP	A	A	G			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr6:31922591A>G	ENST00000375429.3	-	7	709	c.483T>C	c.(481-483)ggT>ggC	p.G161G	NELFE_ENST00000444811.2_Intron|NELFE_ENST00000375425.5_Silent_p.G168G|MIR1236_ENST00000408340.1_RNA	NM_002904.5	NP_002895.3	P18615	NELFE_HUMAN	negative elongation factor complex member E	161					gene expression (GO:0010467)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)										TTCGAGGGGGACCATCACCAG	0.602																																																	0													72.0	81.0	78.0					6																	31922591		2203	4300	6503	SO:0001819	synonymous_variant	0			M33230	CCDS4730.1	6p21.3	2013-02-12	2013-01-31	2013-01-31	ENSG00000204356	ENSG00000204356		"""RNA binding motif (RRM) containing"""	13974	protein-coding gene	gene with protein product		154040	"""RD RNA-binding protein"", ""RD RNA binding protein"""	RDBP			Standard	XM_006715205		Approved	RD, D6S45, NELF-E, RDP	uc003nyk.3	P18615	OTTHUMG00000031046	ENST00000375429.3:c.483T>C	6.37:g.31922591A>G			A2BE08|B4DUN1|B4DYX9|Q5JP74|Q5JP75|Q96F56|Q9NPK2	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.G161	ENST00000375429.3	37	c.483	CCDS4730.1	6																																																																																			NELFE	-	NULL	ENSG00000204356		0.602	NELFE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NELFE	HGNC	protein_coding	OTTHUMT00000076047.4		0.00	22	0	A			31922591	-1			no_errors	ENST00000375429	ensembl	human	known	74_37	silent	12.12	29	4	SNP	0.508	G
NLRP1	22861	genome.wustl.edu	37	17	5418260	5418260	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr17:5418260C>G	ENST00000572272.1	-	17	4235	c.4236G>C	c.(4234-4236)caG>caC	p.Q1412H	NLRP1_ENST00000345221.3_Missense_Mutation_p.Q1368H|RNU7-31P_ENST00000517262.1_RNA|NLRP1_ENST00000269280.4_Missense_Mutation_p.Q1368H|NLRP1_ENST00000577119.1_Missense_Mutation_p.Q1338H|NLRP1_ENST00000262467.5_Intron|NLRP1_ENST00000354411.3_Missense_Mutation_p.Q1382H			Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1	1412	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				CCCTCTCGTACTGCTCCTGGC	0.572																																																	0													75.0	79.0	78.0					17																	5418260		2140	4254	6394	SO:0001583	missense	0			AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000		ENST00000572272.1:c.4236G>C	17.37:g.5418260C>G	ENSP00000460475:p.Gln1412His		E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	Missense_Mutation	SNP	pfam_CARD,pfam_DAPIN,pfam_Leu-rich_rpt,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_CARD,pfscan_DAPIN,prints_Disease_R	p.Q1412H	ENST00000572272.1	37	c.4236	CCDS42246.1	17	.	.	.	.	.	.	.	.	.	.	C	13.39	2.223957	0.39300	.	.	ENSG00000091592	ENST00000269280;ENST00000354411;ENST00000345221	T;T	0.20881	2.04;2.04	5.07	0.6	0.17524	DEATH-like (2);Caspase Recruitment (2);	1.259230	0.05929	N	0.634760	T	0.43277	0.1240	M	0.78049	2.395	0.23221	N	0.998096	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.72075	0.953;0.953;0.972;0.976	T	0.12604	-1.0541	10	0.56958	D	0.05	.	4.2737	0.10799	0.2806:0.5042:0.1361:0.0791	.	1338;1382;1412;1368	Q9C000-3;Q9C000-4;Q9C000;Q9C000-2	.;.;NALP1_HUMAN;.	H	1412;1382;1368	ENSP00000346390:Q1382H;ENSP00000324366:Q1368H	ENSP00000269280:Q1412H	Q	-	3	2	NLRP1	5358984	1.000000	0.71417	0.024000	0.17045	0.254000	0.26022	0.702000	0.25631	-0.013000	0.14199	0.650000	0.86243	CAG	NLRP1	-	pfam_CARD,superfamily_DEATH-like_dom,pfscan_CARD	ENSG00000091592		0.572	NLRP1-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP1	HGNC	protein_coding	OTTHUMT00000439517.1	-	0.00	38	0	C	NM_033004		5418260	-1	tier1	-	no_errors	ENST00000572272	ensembl	human	known	74_37	missense	35.71	27	15	SNP	0.951	G
NME7	29922	genome.wustl.edu	37	1	169292492	169292493	+	Frame_Shift_Ins	INS	-	-	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr1:169292492_169292493insA	ENST00000367811.3	-	3	396_397	c.140_141insT	c.(139-141)ttafs	p.L47fs	RP4-800F24.1_ENST00000432081.1_RNA|NME7_ENST00000469474.1_5'UTR|NME7_ENST00000472647.1_Frame_Shift_Ins_p.L11fs	NM_013330.3	NP_037462.1	Q9Y5B8	NDK7_HUMAN	NME/NM23 family member 7	47	DM10. {ECO:0000255|PROSITE- ProRule:PRU00665}.				brain development (GO:0007420)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|CTP biosynthetic process (GO:0006241)|determination of left/right symmetry (GO:0007368)|epithelial cilium movement (GO:0003351)|GTP biosynthetic process (GO:0006183)|intraciliary transport (GO:0042073)|left/right pattern formation (GO:0060972)|UTP biosynthetic process (GO:0006228)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside diphosphate kinase activity (GO:0004550)			central_nervous_system(1)|kidney(1)|large_intestine(5)|lung(8)|skin(1)	16	all_hematologic(923;0.208)					TGGTCCGCTTTAAAAAGGTGCG	0.327																																																	0																																										SO:0001589	frameshift_variant	0			AF153191	CCDS1277.1, CCDS44274.1	1q24.2	2014-07-31	2012-05-18		ENSG00000143156	ENSG00000143156			20461	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 67"""	613465	"""non-metastatic cells 7, protein expressed in (nucleoside-diphosphate kinase)"""			19852809	Standard	NM_197972		Approved	FLJ37194, NM23-H7, CFAP67	uc001gfu.3	Q9Y5B8	OTTHUMG00000034586	ENST00000367811.3:c.141dupT	1.37:g.169292497_169292497dupA	ENSP00000356785:p.Leu47fs		A8K3T6|A8MY09|B3KSW9|Q5TGZ4	Frame_Shift_Ins	INS	pfam_Nucleoside_diP_kinase,superfamily_Nucleoside_diP_kinase,smart_Uncharacterised_DM10,smart_Nucleoside_diP_kinase,pirsf_NDK7,prints_Nucleoside_diP_kinase	p.L47fs	ENST00000367811.3	37	c.141_140	CCDS1277.1	1																																																																																			NME7	-	smart_Uncharacterised_DM10,pirsf_NDK7	ENSG00000143156		0.327	NME7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NME7	HGNC	protein_coding	OTTHUMT00000083688.1		0.00	32	0	-	NM_013330		169292493	-1	tier1		no_errors	ENST00000367811	ensembl	human	known	74_37	frame_shift_ins	13.95	37	6	INS	0.998:1.000	A
NOP58	51602	genome.wustl.edu	37	2	203149089	203149089	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr2:203149089A>T	ENST00000264279.5	+	5	545	c.319A>T	c.(319-321)Atc>Ttc	p.I107F	NOP58_ENST00000467734.1_3'UTR	NM_015934.3	NP_057018.1	Q9Y2X3	NOP58_HUMAN	NOP58 ribonucleoprotein	107					cell growth (GO:0016049)|rRNA processing (GO:0006364)|snRNP protein import into nucleus (GO:0006608)	box C/D snoRNP complex (GO:0031428)|Cajal body (GO:0015030)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|pre-snoRNP complex (GO:0070761)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)			breast(2)|cervix(1)|endometrium(3)|large_intestine(4)|lung(4)|prostate(2)	16						TCTCAGTTGTATCCATAGTCC	0.338																																																	0													99.0	91.0	94.0					2																	203149089		2203	4300	6503	SO:0001583	missense	0				CCDS2353.1	2q33.1	2012-12-10	2012-12-10		ENSG00000055044	ENSG00000055044			29926	protein-coding gene	gene with protein product			"""NOP58 ribonucleoprotein homolog (yeast)"""			10606270, 10925205	Standard	NM_015934		Approved	NOP5, HSPC120	uc002uzb.3	Q9Y2X3	OTTHUMG00000132840	ENST00000264279.5:c.319A>T	2.37:g.203149089A>T	ENSP00000264279:p.Ile107Phe		Q53SA4|Q6PK08|Q9P036|Q9UFN3	Missense_Mutation	SNP	pfam_Nop_dom,pfam_NOSIC,pfam_NOP5_N,smart_NOSIC	p.I107F	ENST00000264279.5	37	c.319	CCDS2353.1	2	.	.	.	.	.	.	.	.	.	.	A	16.82	3.227677	0.58668	.	.	ENSG00000055044	ENST00000264279	T	0.61392	0.11	5.39	5.39	0.77823	.	0.126884	0.56097	D	0.000030	T	0.54532	0.1864	M	0.69358	2.11	0.58432	D	0.999993	B;B	0.25007	0.056;0.116	B;B	0.25614	0.036;0.062	T	0.55379	-0.8150	10	0.45353	T	0.12	-8.5694	10.1252	0.42646	0.9251:0.0:0.0749:0.0	.	107;107	B4DUY3;Q9Y2X3	.;NOP58_HUMAN	F	107	ENSP00000264279:I107F	ENSP00000264279:I107F	I	+	1	0	NOP58	202857334	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.006000	0.70724	2.167000	0.68274	0.533000	0.62120	ATC	NOP58	-	NULL	ENSG00000055044		0.338	NOP58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOP58	HGNC	protein_coding	OTTHUMT00000256313.2	-	0.00	46	0	A	NM_015934		203149089	+1	tier1	-	no_errors	ENST00000264279	ensembl	human	known	74_37	missense	26.32	70	25	SNP	1.000	T
NPR3	4883	genome.wustl.edu	37	5	32739001	32739001	+	Silent	SNP	C	C	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr5:32739001C>T	ENST00000265074.8	+	3	1267	c.924C>T	c.(922-924)caC>caT	p.H308H	NPR3_ENST00000415685.2_Silent_p.H92H|NPR3_ENST00000415167.2_Silent_p.H308H|NPR3_ENST00000434067.2_Silent_p.H92H	NM_000908.3|NM_001204375.1	NP_000899.1|NP_001191304.1	P17342	ANPRC_HUMAN	natriuretic peptide receptor 3	308					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of smooth muscle cell proliferation (GO:0048662)|osteoclast proliferation (GO:0002158)|pancreatic juice secretion (GO:0030157)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of urine volume (GO:0035810)|regulation of blood pressure (GO:0008217)|regulation of osteoblast proliferation (GO:0033688)|skeletal system development (GO:0001501)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	G-protein coupled peptide receptor activity (GO:0008528)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)	p.H308H(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24					Nesiritide(DB04899)	GAGACAAACACGACTTTGAAG	0.428																																																	1	Substitution - coding silent(1)	large_intestine(1)											133.0	127.0	129.0					5																	32739001		1886	4121	6007	SO:0001819	synonymous_variant	0				CCDS47196.1, CCDS56356.1, CCDS56357.1	5p13.3	2014-03-03	2014-03-03		ENSG00000113389	ENSG00000113389			7945	protein-coding gene	gene with protein product	"""guanylate cyclase C"""	108962	"""chromosome 5 open reading frame 23"", ""atrionatriuretic peptide receptor C"", ""natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)"", ""natriuretic peptide receptor C"""	NPRC, ANPRC, C5orf23		2162522, 1979052	Standard	NM_000908		Approved	GUCY2B, FLJ14054	uc003jhv.3	P17342	OTTHUMG00000150316	ENST00000265074.8:c.924C>T	5.37:g.32739001C>T			A2RRD1|B4DT84|E7EPG9	Silent	SNP	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,prints_Ntpep_rcpt	p.H308	ENST00000265074.8	37	c.924	CCDS56357.1	5																																																																																			NPR3	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I	ENSG00000113389		0.428	NPR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NPR3	HGNC	protein_coding	OTTHUMT00000317550.3		0.00	33	0	C	NM_000908		32739001	+1			no_errors	ENST00000265074	ensembl	human	known	74_37	silent	6.00	47	3	SNP	0.946	T
NRDE2	55051	genome.wustl.edu	37	14	90778760	90778760	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr14:90778760G>T	ENST00000354366.3	-	4	767	c.535C>A	c.(535-537)Ctc>Atc	p.L179I	NRDE2_ENST00000357904.3_5'UTR	NM_017970.3	NP_060440.2	Q9H7Z3	NRDE2_HUMAN	NRDE-2, necessary for RNA interference, domain containing	179																	CCTCGGTAGAGAGACTTGTAC	0.478																																																	0													132.0	112.0	119.0					14																	90778760		2203	4300	6503	SO:0001583	missense	0			AK000870	CCDS9890.1	14q32.11	2012-12-14	2012-09-25	2012-09-25	ENSG00000119720	ENSG00000119720			20186	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 102"""	C14orf102			Standard	NM_017970		Approved	FLJ14051	uc001xyi.2	Q9H7Z3	OTTHUMG00000171020	ENST00000354366.3:c.535C>A	14.37:g.90778760G>T	ENSP00000346335:p.Leu179Ile		B4DH71|Q4G0A7|Q9NWH6	Missense_Mutation	SNP	pfam_NRDE-2	p.L179I	ENST00000354366.3	37	c.535	CCDS9890.1	14	.	.	.	.	.	.	.	.	.	.	G	24.8	4.567993	0.86439	.	.	ENSG00000119720	ENST00000354366	T	0.31247	1.5	5.35	5.35	0.76521	.	0.068330	0.64402	D	0.000010	T	0.53965	0.1829	M	0.77103	2.36	0.80722	D	1	D	0.67145	0.996	D	0.66497	0.944	T	0.51818	-0.8657	10	0.38643	T	0.18	-13.6814	14.6376	0.68702	0.072:0.0:0.928:0.0	.	179	Q9H7Z3	CN102_HUMAN	I	179	ENSP00000346335:L179I	ENSP00000346335:L179I	L	-	1	0	C14orf102	89848513	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.636000	0.67848	2.657000	0.90304	0.549000	0.68633	CTC	NRDE2	-	NULL	ENSG00000119720		0.478	NRDE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRDE2	HGNC	protein_coding	OTTHUMT00000411264.1		0.00	36	0	G	NM_017970		90778760	-1			no_errors	ENST00000354366	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	T
NUP107	57122	genome.wustl.edu	37	12	69126365	69126365	+	Intron	SNP	T	T	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr12:69126365T>A	ENST00000229179.4	+	23	2330				NUP107_ENST00000539906.1_Intron|NUP107_ENST00000378905.2_Intron|NUP107_ENST00000401003.3_3'UTR	NM_020401.2	NP_065134.1	P57740	NU107_HUMAN	nucleoporin 107kDa						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|structural constituent of nuclear pore (GO:0017056)		NUP107/LGR5(2)	breast(3)|endometrium(4)|kidney(4)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(2)	39	Breast(13;6.25e-06)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)			AGAATATCTTTAAAAAAAAAA	0.284																																																	0													11.0	11.0	11.0					12																	69126365		871	1976	2847	SO:0001627	intron_variant	0			AK055629	CCDS8985.1	12q14	2004-03-19			ENSG00000111581	ENSG00000111581			29914	protein-coding gene	gene with protein product		607617				12552102, 12705868	Standard	XM_005269037		Approved	NUP84	uc001suf.3	P57740	OTTHUMG00000169265	ENST00000229179.4:c.1999-52T>A	12.37:g.69126365T>A			B4DZ67|Q6PJE1	RNA	SNP	-	NULL	ENST00000229179.4	37	NULL	CCDS8985.1	12																																																																																			NUP107	-	-	ENSG00000111581		0.284	NUP107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP107	HGNC	protein_coding	OTTHUMT00000403195.1	-	0.00	43	0	T	NM_020401		69126365	+1	tier1	-	no_errors	ENST00000401003	ensembl	human	known	74_37	rna	8.11	68	6	SNP	0.000	A
NUP153	9972	genome.wustl.edu	37	6	17706534	17706534	+	Missense_Mutation	SNP	A	A	C			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr6:17706534A>C	ENST00000262077.2	-	1	84	c.85T>G	c.(85-87)Tac>Gac	p.Y29D	RP11-500C11.3_ENST00000606771.1_RNA|NUP153_ENST00000537253.1_Missense_Mutation_p.Y29D	NM_005124.2	NP_005115.2	P49790	NU153_HUMAN	nucleoporin 153kDa	29					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of RNA export from nucleus (GO:0046832)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleocytoplasmic transporter activity (GO:0005487)|protein anchor (GO:0043495)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			NS(2)|breast(6)|endometrium(4)|kidney(3)|large_intestine(7)|lung(23)|ovary(3)|skin(3)|urinary_tract(2)	53	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			CCCTGCTGGTAAGGCTTAATT	0.721																																																	0													71.0	60.0	64.0					6																	17706534		2202	4299	6501	SO:0001583	missense	0			Z25535	CCDS4541.1, CCDS64359.1, CCDS75407.1	6p22.3	2008-07-29	2002-08-29		ENSG00000124789	ENSG00000124789			8062	protein-coding gene	gene with protein product		603948	"""nucleoporin 153kD"""			8110839	Standard	NM_001278209		Approved	HNUP153	uc003ncd.2	P49790	OTTHUMG00000014312	ENST00000262077.2:c.85T>G	6.37:g.17706534A>C	ENSP00000262077:p.Tyr29Asp		B4DIK2|E7EPX5|F6QR24|Q4LE47|Q5T9I7|Q7Z743	Missense_Mutation	SNP	pfam_Nucleoporin_Nup153,pfam_Znf_RanBP2,pfam_Retro-transposon_transp_CS,smart_Znf_RanBP2,pfscan_Znf_RanBP2	p.Y29D	ENST00000262077.2	37	c.85	CCDS4541.1	6	.	.	.	.	.	.	.	.	.	.	A	19.90	3.913488	0.72983	.	.	ENSG00000124789	ENST00000262077;ENST00000430136;ENST00000537253	T;T	0.23754	1.89;1.96	4.33	4.33	0.51752	.	0.000000	0.31784	N	0.007065	T	0.16514	0.0397	L	0.48642	1.525	0.49915	D	0.99983	P;P;P	0.51933	0.949;0.828;0.538	P;B;B	0.45946	0.498;0.077;0.077	T	0.01982	-1.1235	10	0.87932	D	0	-5.3116	10.1843	0.42988	1.0:0.0:0.0:0.0	.	29;51;29	F6QR24;Q4LE47;P49790	.;.;NU153_HUMAN	D	29;51;29	ENSP00000262077:Y29D;ENSP00000444029:Y29D	ENSP00000262077:Y29D	Y	-	1	0	NUP153	17814513	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	2.304000	0.43655	2.178000	0.69098	0.482000	0.46254	TAC	NUP153	-	NULL	ENSG00000124789		0.721	NUP153-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP153	HGNC	protein_coding	OTTHUMT00000039953.1	-	0.00	123	0	A			17706534	-1	tier1	-	no_errors	ENST00000537253	ensembl	human	known	74_37	missense	46.77	66	58	SNP	1.000	C
NYAP2	57624	genome.wustl.edu	37	2	226447460	226447460	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr2:226447460G>C	ENST00000272907.6	+	4	1740	c.1327G>C	c.(1327-1329)Ggg>Cgg	p.G443R	NYAP2_ENST00000409269.2_Intron	NM_020864.1	NP_065915.1	Q9P242	NYAP2_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2	443	Pro-rich.				neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												CGTCAGCATGGGGAGGTCCCT	0.632																																																	0													38.0	42.0	41.0					2																	226447460		2011	4184	6195	SO:0001583	missense	0			AB040919	CCDS46529.1	2q36.3	2011-11-30	2011-11-30	2011-11-30	ENSG00000144460	ENSG00000144460			29291	protein-coding gene	gene with protein product		615478	"""KIAA1486"""	KIAA1486		10819331, 21946561	Standard	NM_020864		Approved		uc002voe.2	Q9P242	OTTHUMG00000153450	ENST00000272907.6:c.1327G>C	2.37:g.226447460G>C	ENSP00000272907:p.Gly443Arg		A2RRN4|Q96NL2	Missense_Mutation	SNP	NULL	p.G443R	ENST00000272907.6	37	c.1327	CCDS46529.1	2	.	.	.	.	.	.	.	.	.	.	G	20.2	3.946694	0.73672	.	.	ENSG00000144460	ENST00000272907	T	0.35789	1.29	5.19	4.31	0.51392	.	0.000000	0.85682	D	0.000000	T	0.48390	0.1497	L	0.54323	1.7	0.80722	D	1	P	0.51653	0.947	P	0.55785	0.784	T	0.51340	-0.8718	10	0.87932	D	0	-26.4106	13.4494	0.61161	0.0752:0.0:0.9248:0.0	.	443	Q9P242	K1486_HUMAN	R	443	ENSP00000272907:G443R	ENSP00000272907:G443R	G	+	1	0	KIAA1486	226155704	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	9.476000	0.97823	1.185000	0.42971	0.563000	0.77884	GGG	NYAP2	-	NULL	ENSG00000144460		0.632	NYAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NYAP2	HGNC	protein_coding	OTTHUMT00000331258.1	-	0.00	67	0	G	NM_020864		226447460	+1	tier1	-	no_errors	ENST00000272907	ensembl	human	known	74_37	missense	44.59	41	33	SNP	1.000	C
NYNRIN	57523	genome.wustl.edu	37	14	24880348	24880348	+	Silent	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr14:24880348G>T	ENST00000382554.3	+	5	2799	c.2481G>T	c.(2479-2481)cgG>cgT	p.R827R		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	827					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						TCTGGAACCGGGGACACCGAG	0.597											OREG0022626	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													95.0	105.0	102.0					14																	24880348		2090	4227	6317	SO:0001819	synonymous_variant	0			AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.2481G>T	14.37:g.24880348G>T		774	Q6P153|Q86TR3|Q9HAC4	Silent	SNP	pfam_RNase_Zc3h12,superfamily_RNaseH-like_dom,pfscan_Integrase_cat-core	p.R827	ENST00000382554.3	37	c.2481	CCDS45090.1	14																																																																																			NYNRIN	-	pfam_RNase_Zc3h12	ENSG00000205978		0.597	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NYNRIN	HGNC	protein_coding	OTTHUMT00000412939.1	-	0.00	50	0	G			24880348	+1	tier1	-	no_errors	ENST00000382554	ensembl	human	known	74_37	silent	11.76	30	4	SNP	0.936	T
OPTN	10133	genome.wustl.edu	37	10	13164403	13164403	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr10:13164403G>C	ENST00000378748.3	+	9	1160	c.798G>C	c.(796-798)aaG>aaC	p.K266N	OPTN_ENST00000378764.2_Missense_Mutation_p.K260N|OPTN_ENST00000378757.2_Missense_Mutation_p.K266N|OPTN_ENST00000378747.3_Missense_Mutation_p.K266N|OPTN_ENST00000263036.5_Missense_Mutation_p.K266N|OPTN_ENST00000378752.3_Missense_Mutation_p.K260N	NM_001008211.1|NM_001008213.1	NP_001008212|NP_001008214	Q96CV9	OPTN_HUMAN	optineurin	266					cell death (GO:0008219)|defense response to Gram-negative bacterium (GO:0050829)|G2/M transition of mitotic cell cycle (GO:0000086)|Golgi organization (GO:0007030)|Golgi ribbon formation (GO:0090161)|Golgi to plasma membrane protein transport (GO:0043001)|macroautophagy (GO:0016236)|mitotic cell cycle (GO:0000278)|negative regulation of receptor recycling (GO:0001920)|protein targeting to Golgi (GO:0000042)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	polyubiquitin binding (GO:0031593)|protein C-terminus binding (GO:0008022)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22						ATTTTGAAAAGAAAACAAGTA	0.368																																																	0													49.0	55.0	53.0					10																	13164403		2203	4300	6503	SO:0001583	missense	0			AF420371	CCDS7094.1	10p14	2014-01-28	2003-09-08		ENSG00000123240	ENSG00000123240			17142	protein-coding gene	gene with protein product		602432	"""glaucoma 1, open angle, E (adult-onset)"""	GLC1E		11834836, 9488477	Standard	NM_001008211		Approved	FIP2, HYPL, FIP-2, TFIIIA-INTP, NRP, HIP7	uc001ilx.1	Q96CV9	OTTHUMG00000017690	ENST00000378748.3:c.798G>C	10.37:g.13164403G>C	ENSP00000368022:p.Lys266Asn		B3KP00|D3DRS4|D3DRS8|Q5T672|Q5T673|Q5T674|Q5T675|Q7LDL9|Q8N562|Q9UET9|Q9UEV4|Q9Y218	Missense_Mutation	SNP	pfam_NEMO_N	p.K266N	ENST00000378748.3	37	c.798	CCDS7094.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.03|12.03	1.816902|1.816902	0.32145|0.32145	.|.	.|.	ENSG00000123240|ENSG00000123240	ENST00000263036;ENST00000378764;ENST00000378757;ENST00000378752;ENST00000378748;ENST00000378747|ENST00000424614	D;D;D;D;D;D|.	0.87966|.	-2.31;-2.32;-2.31;-2.32;-2.31;-2.31|.	5.83|5.83	3.96|3.96	0.45880|0.45880	.|.	0.372480|.	0.36374|.	N|.	0.002623|.	T|T	0.50188|0.50188	0.1601|0.1601	L|L	0.61036|0.61036	1.89|1.89	0.30332|0.30332	N|N	0.786584|0.786584	P;P|.	0.39748|.	0.686;0.559|.	B;B|.	0.37888|.	0.26;0.133|.	T|T	0.51545|0.51545	-0.8692|-0.8692	10|5	0.45353|.	T|.	0.12|.	-24.1676|-24.1676	7.5913|7.5913	0.28023|0.28023	0.083:0.0:0.7541:0.1629|0.083:0.0:0.7541:0.1629	.|.	260;266|.	Q96CV9-2;Q96CV9|.	.;OPTN_HUMAN|.	N|T	266;260;266;260;266;266|82	ENSP00000263036:K266N;ENSP00000368040:K260N;ENSP00000368032:K266N;ENSP00000368027:K260N;ENSP00000368022:K266N;ENSP00000368021:K266N|.	ENSP00000263036:K266N|.	K|R	+|+	3|2	2|0	OPTN|OPTN	13204409|13204409	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.780000|0.780000	0.44128|0.44128	1.010000|1.010000	0.29898|0.29898	0.796000|0.796000	0.33947|0.33947	0.650000|0.650000	0.86243|0.86243	AAG|AGA	OPTN	-	NULL	ENSG00000123240		0.368	OPTN-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OPTN	HGNC	protein_coding	OTTHUMT00000046834.1	-	0.00	76	0	G	NM_021980		13164403	+1	tier1	-	no_errors	ENST00000263036	ensembl	human	known	74_37	missense	6.45	87	6	SNP	1.000	C
OVCA2	124641	genome.wustl.edu	37	17	1945944	1945944	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr17:1945944A>T	ENST00000572195.1	+	2	245	c.230A>T	c.(229-231)gAg>gTg	p.E77V	DPH1_ENST00000570477.1_3'UTR|DPH1_ENST00000263083.6_3'UTR|RP11-667K14.3_ENST00000572790.1_lincRNA|RP11-667K14.4_ENST00000572404.1_RNA	NM_080822.2	NP_543012.1	Q8WZ82	OVCA2_HUMAN	ovarian tumor suppressor candidate 2	77					metabolic process (GO:0008152)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)										TGGTTTTCAGAGCAGGAGGCC	0.617											OREG0024078	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													47.0	50.0	49.0					17																	1945944		2202	4300	6502	SO:0001583	missense	0			AF321875	CCDS11015.1	17p13.3	2012-10-08			ENSG00000262664	ENSG00000262664			24203	protein-coding gene	gene with protein product	"""candidate tumor suppressor in ovarian cancer 2"""	607896				11979432, 8616839, 16368187	Standard	NM_080822		Approved		uc002ftx.3	Q8WZ82	OTTHUMG00000132471	ENST00000572195.1:c.230A>T	17.37:g.1945944A>T	ENSP00000461388:p.Glu77Val	599	Q86XN3|Q8IW87|Q9UCX9	Missense_Mutation	SNP	pfam_Serine_hydrolase_FSH,pfam_PLipase/COase/thioEstase	p.E77V	ENST00000572195.1	37	c.230	CCDS11015.1	17	.	.	.	.	.	.	.	.	.	.	A	20.6	4.009877	0.75046	.	.	ENSG00000214014	ENST00000263084	.	.	.	5.22	5.22	0.72569	.	0.143002	0.45126	U	0.000390	T	0.47173	0.1431	M	0.63843	1.955	0.18873	N	0.999985	B	0.27286	0.174	B	0.35931	0.214	T	0.41980	-0.9478	9	0.30854	T	0.27	.	9.321	0.37964	0.9144:0.0:0.0856:0.0	.	77	Q8WZ82	OVCA2_HUMAN	V	77	.	ENSP00000263084:E77V	E	+	2	0	OVCA2	1892694	0.349000	0.24870	0.008000	0.14137	0.916000	0.54674	2.756000	0.47549	1.983000	0.57843	0.482000	0.46254	GAG	OVCA2	-	pfam_Serine_hydrolase_FSH	ENSG00000262664		0.617	OVCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OVCA2	HGNC	protein_coding	OTTHUMT00000255636.5	-	0.00	28	0	A	NM_080822		1945944	+1	tier1	-	no_errors	ENST00000572195	ensembl	human	known	74_37	missense	34.15	27	14	SNP	0.152	T
PAXBP1	94104	genome.wustl.edu	37	21	34134551	34134551	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr21:34134551G>T	ENST00000331923.4	-	4	916	c.727C>A	c.(727-729)Cct>Act	p.P243T	PAXBP1_ENST00000290178.4_Missense_Mutation_p.P243T|PAXBP1_ENST00000472588.1_5'UTR	NM_016631.3	NP_057715.2	Q9Y5B6	PAXB1_HUMAN	PAX3 and PAX7 binding protein 1	243					muscle organ development (GO:0007517)|positive regulation of histone methylation (GO:0031062)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of satellite cell proliferation (GO:0014842)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)										TTATCATGAGGAGTGAAATCT	0.423																																																	0													83.0	82.0	83.0					21																	34134551		2203	4300	6503	SO:0001583	missense	0			AF231920	CCDS13619.1, CCDS33541.1	21q22.11	2014-01-23	2013-01-08	2013-01-08	ENSG00000159086	ENSG00000159086			13579	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 105"", ""GC-rich sequence DNA-binding factor candidate"""		"""chromosome 21 open reading frame 66"", ""GC-rich sequence DNA-binding factor 1"""	C21orf66, GCFC1		11707072, 22862948	Standard	NM_016631		Approved	GCFC, fSAP105	uc002yqn.3	Q9Y5B6	OTTHUMG00000064980	ENST00000331923.4:c.727C>A	21.37:g.34134551G>T	ENSP00000328992:p.Pro243Thr		D3DSE7|Q96DU8|Q9NYQ0	Missense_Mutation	SNP	pfam_GCFC_dom	p.P243T	ENST00000331923.4	37	c.727	CCDS13619.1	21	.	.	.	.	.	.	.	.	.	.	G	21.6	4.170566	0.78452	.	.	ENSG00000159086	ENST00000331923;ENST00000290178	T;T	0.51817	1.18;0.69	5.63	5.63	0.86233	.	0.166503	0.53938	D	0.000048	T	0.67230	0.2871	M	0.84082	2.675	0.80722	D	1	D;D	0.71674	0.984;0.998	P;P	0.61658	0.77;0.892	T	0.72020	-0.4416	10	0.87932	D	0	-16.1077	12.6195	0.56595	0.0763:0.0:0.9237:0.0	.	243;243	Q9Y5B6-2;Q9Y5B6	.;GCFC1_HUMAN	T	243	ENSP00000328992:P243T;ENSP00000290178:P243T	ENSP00000290178:P243T	P	-	1	0	GCFC1	33056422	1.000000	0.71417	0.950000	0.38849	0.997000	0.91878	6.469000	0.73555	2.650000	0.89964	0.557000	0.71058	CCT	PAXBP1	-	NULL	ENSG00000159086		0.423	PAXBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAXBP1	HGNC	protein_coding	OTTHUMT00000139563.1		0.00	23	0	G	NM_013329		34134551	-1			no_errors	ENST00000331923	ensembl	human	known	74_37	missense	7.27	51	4	SNP	0.992	T
PCDHA9	9752	genome.wustl.edu	37	5	140230375	140230375	+	Silent	SNP	G	G	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr5:140230375G>A	ENST00000532602.1	+	1	3328	c.2295G>A	c.(2293-2295)caG>caA	p.Q765Q	PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA9_ENST00000378122.3_Silent_p.Q765Q|PCDHA5_ENST00000529859.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	765	5 X 4 AA repeats of P-X-X-P.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGGTAAGCAGAAGACCGACC	0.617																																					Melanoma(55;1800 1972 14909)												0													87.0	86.0	87.0					5																	140230375		2198	4274	6472	SO:0001819	synonymous_variant	0			AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.2295G>A	5.37:g.140230375G>A			O15053|Q2M3S5	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.Q765	ENST00000532602.1	37	c.2295	CCDS54920.1	5																																																																																			PCDHA9	-	NULL	ENSG00000204961		0.617	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA9	HGNC	protein_coding	OTTHUMT00000372896.2	-	0.00	81	0	G	NM_031857		140230375	+1	tier1	-	no_errors	ENST00000532602	ensembl	human	known	74_37	silent	46.67	48	42	SNP	0.240	A
PCDHB3	56132	genome.wustl.edu	37	5	140481751	140481751	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr5:140481751C>G	ENST00000231130.2	+	1	1518	c.1518C>G	c.(1516-1518)atC>atG	p.I506M	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	506	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGGTCTCCATCAACGCGGACA	0.672																																																	0													58.0	62.0	61.0					5																	140481751		2201	4296	6497	SO:0001583	missense	0			AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.1518C>G	5.37:g.140481751C>G	ENSP00000231130:p.Ile506Met		B2R8P2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.I506M	ENST00000231130.2	37	c.1518	CCDS4245.1	5	.	.	.	.	.	.	.	.	.	.	C	7.365	0.625579	0.14257	.	.	ENSG00000113205	ENST00000231130	T	0.72615	-0.67	3.92	2.02	0.26589	Cadherin (4);Cadherin-like (1);	.	.	.	.	D	0.83013	0.5162	M	0.87381	2.88	0.29010	N	0.886909	D	0.89917	1.0	D	0.97110	1.0	T	0.73569	-0.3941	9	0.87932	D	0	.	6.3104	0.21161	0.0:0.3541:0.4781:0.1678	.	506	Q9Y5E6	PCDB3_HUMAN	M	506	ENSP00000231130:I506M	ENSP00000231130:I506M	I	+	3	3	PCDHB3	140461935	0.004000	0.15560	0.747000	0.31113	0.010000	0.07245	-0.914000	0.04038	0.220000	0.20860	-0.311000	0.09066	ATC	PCDHB3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000113205		0.672	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB3	HGNC	protein_coding	OTTHUMT00000251817.2	-	0.00	257	0	C	NM_018937		140481751	+1	tier1	-	no_errors	ENST00000231130	ensembl	human	known	74_37	missense	23.29	191	58	SNP	0.969	G
PCDHGC5	56097	genome.wustl.edu	37	5	140870755	140870755	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr5:140870755G>T	ENST00000252087.1	+	1	1948	c.1948G>T	c.(1948-1950)Gac>Tac	p.D650Y	PCDHGA11_ENST00000398587.2_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGC4_ENST00000306593.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGB4_ENST00000519479.1_Intron	NM_018929.2|NM_032403.2|NM_032407.1	NP_061752.1|NP_115779.1|NP_115783.1	Q9Y5F6	PCDGM_HUMAN	protocadherin gamma subfamily C, 5	650	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(4)|lung(10)|ovary(4)|prostate(1)|urinary_tract(2)	35			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTGGTGAGGGACaatggtga	0.572																																																	0													100.0	89.0	93.0					5																	140870755		2203	4300	6503	SO:0001583	missense	0			AF152526	CCDS4263.1, CCDS75350.1	5q31	2010-01-26			ENSG00000240764	ENSG00000240764		"""Cadherins / Protocadherins : Clustered"""	8718	other	protocadherin		606306				10380929	Standard	NM_018929		Approved	PCDH-GAMMA-C5	uc003lla.2	Q9Y5F6	OTTHUMG00000129624	ENST00000252087.1:c.1948G>T	5.37:g.140870755G>T	ENSP00000252087:p.Asp650Tyr		Q9Y5C2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D650Y	ENST00000252087.1	37	c.1948	CCDS4263.1	5	.	.	.	.	.	.	.	.	.	.	G	18.06	3.539420	0.65085	.	.	ENSG00000240764	ENST00000252087	T	0.68903	-0.36	5.3	5.3	0.74995	Cadherin (4);Cadherin-like (1);	0.000000	0.56097	D	0.000033	D	0.88566	0.6471	H	0.97186	3.955	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91974	0.5589	10	0.87932	D	0	.	19.1415	0.93448	0.0:0.0:1.0:0.0	.	650;650	Q9Y5F6-2;Q9Y5F6	.;PCDGM_HUMAN	Y	650	ENSP00000252087:D650Y	ENSP00000252087:D650Y	D	+	1	0	PCDHGC5	140850939	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.610000	0.98337	2.753000	0.94483	0.655000	0.94253	GAC	PCDHGC5	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000240764		0.572	PCDHGC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGC5	HGNC	protein_coding	OTTHUMT00000251819.1	-	0.00	41	0	G	NM_018929		140870755	+1	tier1	-	no_errors	ENST00000252087	ensembl	human	known	74_37	missense	18.52	22	5	SNP	1.000	T
PCLO	27445	genome.wustl.edu	37	7	82583637	82583637	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr7:82583637G>A	ENST00000333891.9	-	5	6969	c.6632C>T	c.(6631-6633)aCa>aTa	p.T2211I	PCLO_ENST00000423517.2_Missense_Mutation_p.T2211I	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CACTGGCTCTGTATAAACTGT	0.398																																																	0													75.0	70.0	72.0					7																	82583637		1898	4132	6030	SO:0001583	missense	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.6632C>T	7.37:g.82583637G>A	ENSP00000334319:p.Thr2211Ile			Missense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.T2211I	ENST00000333891.9	37	c.6632	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	G	8.131	0.783013	0.16189	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.16897	2.31;2.31	5.77	5.77	0.91146	.	.	.	.	.	T	0.11623	0.0283	N	0.22421	0.69	0.80722	D	1	B;B	0.14438	0.01;0.01	B;B	0.12156	0.007;0.005	T	0.08617	-1.0713	9	0.87932	D	0	.	6.7449	0.23456	0.1117:0.1773:0.711:0.0	.	2211;2211	Q9Y6V0-5;Q9Y6V0-6	.;.	I	2142;2211;2211	ENSP00000334319:T2211I;ENSP00000388393:T2211I	ENSP00000334319:T2211I	T	-	2	0	PCLO	82421573	0.519000	0.26242	0.997000	0.53966	0.980000	0.70556	1.908000	0.39907	2.724000	0.93272	0.650000	0.86243	ACA	PCLO	-	NULL	ENSG00000186472		0.398	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5		0.00	18	0	G	NM_014510		82583637	-1			no_errors	ENST00000333891	ensembl	human	known	74_37	missense	5.71	33	2	SNP	0.987	A
PDZD2	23037	genome.wustl.edu	37	5	32037378	32037378	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr5:32037378G>T	ENST00000438447.1	+	7	1837	c.1449G>T	c.(1447-1449)gaG>gaT	p.E483D	PDZD2_ENST00000282493.3_Missense_Mutation_p.E483D			O15018	PDZD2_HUMAN	PDZ domain containing 2	483					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						GCGGTGCTGAGGAATCCAAGG	0.537																																																	0													80.0	77.0	78.0					5																	32037378		2203	4300	6503	SO:0001583	missense	0			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.1449G>T	5.37:g.32037378G>T	ENSP00000402033:p.Glu483Asp		Q9BXD4	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.E483D	ENST00000438447.1	37	c.1449	CCDS34137.1	5	.	.	.	.	.	.	.	.	.	.	G	14.12	2.441610	0.43326	.	.	ENSG00000133401	ENST00000438447;ENST00000282493	T;T	0.09163	3.01;3.01	5.37	2.08	0.27032	.	0.124840	0.36854	N	0.002374	T	0.05456	0.0144	N	0.14661	0.345	0.32153	N	0.584007	B;B	0.22541	0.071;0.053	B;B	0.25884	0.064;0.064	T	0.21793	-1.0235	10	0.24483	T	0.36	.	5.6481	0.17600	0.1219:0.3861:0.4919:0.0	.	309;483	B4E3P2;O15018	.;PDZD2_HUMAN	D	483	ENSP00000402033:E483D;ENSP00000282493:E483D	ENSP00000282493:E483D	E	+	3	2	PDZD2	32073135	1.000000	0.71417	0.984000	0.44739	0.391000	0.30476	1.265000	0.33027	0.740000	0.32651	-0.165000	0.13383	GAG	PDZD2	-	NULL	ENSG00000133401		0.537	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD2	HGNC	protein_coding	OTTHUMT00000366608.1		0.00	40	0	G			32037378	+1			no_errors	ENST00000282493	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.996	T
PDZD7	79955	genome.wustl.edu	37	10	102778670	102778670	+	Silent	SNP	C	C	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr10:102778670C>T	ENST00000370215.3	-	8	1458	c.1233G>A	c.(1231-1233)gcG>gcA	p.A411A		NM_024895.4	NP_079171.1	Q9H5P4	PDZD7_HUMAN	PDZ domain containing 7	411						cilium (GO:0005929)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				Epithelial(162;6.98e-09)|all cancers(201;3.55e-07)		ACTCAGAGAGCGCAGAGTCAA	0.697											OREG0020453	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													12.0	16.0	15.0					10																	102778670		2198	4294	6492	SO:0001819	synonymous_variant	0			AK026862	CCDS31269.1, CCDS73182.1	10q24.32	2006-01-24		2006-01-24	ENSG00000186862	ENSG00000186862			26257	protein-coding gene	gene with protein product		612971		PDZK7		12477932	Standard	NM_024895		Approved	FLJ23209, bA108L7.8	uc021pxc.1	Q9H5P4	OTTHUMG00000018916	ENST00000370215.3:c.1233G>A	10.37:g.102778670C>T		1369	D5FJ77|Q8N321	Silent	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.A411	ENST00000370215.3	37	c.1233	CCDS31269.1	10																																																																																			PDZD7	-	NULL	ENSG00000186862		0.697	PDZD7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD7	HGNC	protein_coding	OTTHUMT00000049883.1	-	0.00	44	0	C	NM_024895		102778670	-1	tier1	-	no_errors	ENST00000370215	ensembl	human	known	74_37	silent	22.22	28	8	SNP	0.000	T
PDZK1	5174	genome.wustl.edu	37	1	145752451	145752451	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr1:145752451G>C	ENST00000344770.2	+	4	557	c.484G>C	c.(484-486)Gat>Cat	p.D162H	PDZK1_ENST00000417171.1_Missense_Mutation_p.D162H|PDZK1_ENST00000451928.2_Intron	NM_002614.4	NP_002605.2	Q5T2W1	NHRF3_HUMAN	PDZ domain containing 1	162	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				carnitine transport (GO:0015879)|cell proliferation (GO:0008283)|drug transport (GO:0015893)|establishment of protein localization to plasma membrane (GO:0090002)|positive regulation of ion transmembrane transport (GO:0034767)|positive regulation of protein targeting to membrane (GO:0090314)|regulation of anion transport (GO:0044070)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|transporter activity (GO:0005215)			NS(1)|endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)	7	all_hematologic(18;0.00473)|Acute lymphoblastic leukemia(18;0.0786)		KIRC - Kidney renal clear cell carcinoma(6;0.0764)|Kidney(552;0.118)|Colorectal(543;0.229)			GTACATGACTGATATTACACC	0.463																																																	0													157.0	124.0	135.0					1																	145752451		2203	4300	6503	SO:0001583	missense	0			AF012281	CCDS72859.1, CCDS72860.1	1q21	2009-08-21			ENSG00000174827	ENSG00000174827			8821	protein-coding gene	gene with protein product		603831				9461128	Standard	NM_002614		Approved	PDZD1, NHERF3	uc001eoo.2	Q5T2W1	OTTHUMG00000013735	ENST00000344770.2:c.484G>C	1.37:g.145752451G>C	ENSP00000342143:p.Asp162His		B4DPB9|E7EU02|O60450|Q5T5P6|Q9BQ41	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.D162H	ENST00000344770.2	37	c.484	CCDS924.1	1	.	.	.	.	.	.	.	.	.	.	G	9.587	1.125108	0.20959	.	.	ENSG00000174827	ENST00000443667;ENST00000417171;ENST00000344770	T;T;T	0.27890	1.64;1.64;1.64	5.31	3.45	0.39498	PDZ/DHR/GLGF (4);	0.865339	0.10035	N	0.724146	T	0.29749	0.0743	L	0.52573	1.65	0.20563	N	0.999883	D	0.65815	0.995	D	0.65684	0.937	T	0.09862	-1.0655	10	0.38643	T	0.18	-5.8656	9.4201	0.38546	0.1711:0.0:0.8289:0.0	.	162	Q5T2W1	NHRF3_HUMAN	H	162	ENSP00000409291:D162H;ENSP00000394485:D162H;ENSP00000342143:D162H	ENSP00000342143:D162H	D	+	1	0	PDZK1	144463808	0.968000	0.33430	0.026000	0.17262	0.029000	0.11900	2.603000	0.46266	0.823000	0.34589	-0.218000	0.12543	GAT	PDZK1	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000174827		0.463	PDZK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZK1	HGNC	protein_coding	OTTHUMT00000038502.2	-	0.00	122	0	G	NM_002614		145752451	+1	tier1	-	no_errors	ENST00000344770	ensembl	human	known	74_37	missense	32.29	130	62	SNP	0.021	C
PLEC	5339	genome.wustl.edu	37	8	144996545	144996545	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr8:144996545C>G	ENST00000322810.4	-	32	8024	c.7855G>C	c.(7855-7857)Gag>Cag	p.E2619Q	PLEC_ENST00000354958.2_Missense_Mutation_p.E2460Q|PLEC_ENST00000398774.2_Missense_Mutation_p.E2450Q|PLEC_ENST00000357649.2_Missense_Mutation_p.E2486Q|PLEC_ENST00000527096.1_Missense_Mutation_p.E2505Q|PLEC_ENST00000356346.3_Missense_Mutation_p.E2468Q|PLEC_ENST00000345136.3_Missense_Mutation_p.E2482Q|PLEC_ENST00000354589.3_Missense_Mutation_p.E2482Q|PLEC_ENST00000436759.2_Missense_Mutation_p.E2509Q	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2619	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)	p.E2619*(1)		NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						AGCAGCTGCTCCTGCTGCACC	0.627																																																	1	Substitution - Nonsense(1)	skin(1)											29.0	34.0	33.0					8																	144996545		2018	4158	6176	SO:0001583	missense	0			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.7855G>C	8.37:g.144996545C>G	ENSP00000323856:p.Glu2619Gln		Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	pfam_Plectin_repeat,pfam_CH-domain,pfam_S10_plectin_N,superfamily_CH-domain,superfamily_Chorismate_mutase_type_II,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,pfscan_CH-domain	p.E2619Q	ENST00000322810.4	37	c.7855	CCDS43772.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	2.785|2.785	-0.252625|-0.252625	0.05829|0.05829	.|.	.|.	ENSG00000178209|ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096|ENST00000527303	T;T;T;T;T;T;T;T;T|.	0.78595|.	-1.16;-1.16;-1.19;-1.19;-1.18;-1.16;-1.16;-1.16;-1.16|.	4.39|4.39	4.39|4.39	0.52855|0.52855	.|.	0.180777|.	0.33235|.	U|.	0.005134|.	T|T	0.65365|0.65365	0.2684|0.2684	L|L	0.53249|0.53249	1.67|1.67	0.35337|0.35337	D|D	0.786104|0.786104	P;P;P;P;P;P;P;P|.	0.38597|.	0.639;0.639;0.639;0.506;0.639;0.639;0.639;0.639|.	B;B;B;B;B;B;B;B|.	0.30029|.	0.11;0.11;0.11;0.051;0.11;0.11;0.11;0.11|.	T|T	0.71862|0.71862	-0.4464|-0.4464	10|5	0.54805|.	T|.	0.06|.	.|.	16.741|16.741	0.85459|0.85459	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	2509;2468;2460;2619;2450;2482;2486;2482|.	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4|.	.;.;.;PLEC_HUMAN;.;.;.;.|.	Q|S	2482;2486;2482;2450;2619;2460;2468;2509;2505|51	ENSP00000344848:E2482Q;ENSP00000350277:E2486Q;ENSP00000346602:E2482Q;ENSP00000381756:E2450Q;ENSP00000323856:E2619Q;ENSP00000347044:E2460Q;ENSP00000348702:E2468Q;ENSP00000388180:E2509Q;ENSP00000434583:E2505Q|.	ENSP00000323856:E2619Q|.	E|R	-|-	1|3	0|2	PLEC|PLEC	145068533|145068533	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.071000|0.071000	0.16799|0.16799	4.540000|4.540000	0.60664|0.60664	2.292000|2.292000	0.77174|0.77174	0.448000|0.448000	0.29417|0.29417	GAG|AGG	PLEC	-	NULL	ENSG00000178209		0.627	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEC	HGNC	protein_coding	OTTHUMT00000383281.1	-	0.00	45	0	C	NM_000445		144996545	-1	tier1	-	no_errors	ENST00000322810	ensembl	human	known	74_37	missense	28.57	35	14	SNP	1.000	G
PLEC	5339	genome.wustl.edu	37	8	144996723	144996723	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr8:144996723C>G	ENST00000322810.4	-	31	7954	c.7785G>C	c.(7783-7785)gaG>gaC	p.E2595D	PLEC_ENST00000354958.2_Missense_Mutation_p.E2436D|PLEC_ENST00000398774.2_Missense_Mutation_p.E2426D|PLEC_ENST00000357649.2_Missense_Mutation_p.E2462D|PLEC_ENST00000527096.1_Missense_Mutation_p.E2481D|PLEC_ENST00000356346.3_Missense_Mutation_p.E2444D|PLEC_ENST00000345136.3_Missense_Mutation_p.E2458D|PLEC_ENST00000354589.3_Missense_Mutation_p.E2458D|PLEC_ENST00000436759.2_Missense_Mutation_p.E2485D	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2595	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GCTTCTCCTTCTCACGCTCCA	0.637																																																	0													37.0	41.0	40.0					8																	144996723		2118	4231	6349	SO:0001583	missense	0			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.7785G>C	8.37:g.144996723C>G	ENSP00000323856:p.Glu2595Asp		Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	pfam_Plectin_repeat,pfam_CH-domain,pfam_S10_plectin_N,superfamily_CH-domain,superfamily_Chorismate_mutase_type_II,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,pfscan_CH-domain	p.E2595D	ENST00000322810.4	37	c.7785	CCDS43772.1	8	.	.	.	.	.	.	.	.	.	.	C	15.10	2.733197	0.48939	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	D;D;D;D;D;D;D;D;D	0.91180	-2.77;-2.77;-2.8;-2.79;-2.75;-2.75;-2.74;-2.76;-2.76	4.43	4.43	0.53597	.	0.000000	0.64402	U	0.000006	D	0.92854	0.7727	L	0.48642	1.525	0.48762	D	0.999702	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.83275	0.996;0.996;0.996;0.991;0.996;0.996;0.996;0.996	D	0.90595	0.4540	10	0.20519	T	0.43	.	16.8143	0.85729	0.0:1.0:0.0:0.0	.	2485;2444;2436;2595;2426;2458;2462;2458	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	D	2458;2462;2458;2426;2595;2436;2444;2485;2481	ENSP00000344848:E2458D;ENSP00000350277:E2462D;ENSP00000346602:E2458D;ENSP00000381756:E2426D;ENSP00000323856:E2595D;ENSP00000347044:E2436D;ENSP00000348702:E2444D;ENSP00000388180:E2485D;ENSP00000434583:E2481D	ENSP00000323856:E2595D	E	-	3	2	PLEC	145068711	1.000000	0.71417	1.000000	0.80357	0.846000	0.48090	3.537000	0.53590	2.309000	0.77851	0.448000	0.29417	GAG	PLEC	-	NULL	ENSG00000178209		0.637	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEC	HGNC	protein_coding	OTTHUMT00000383281.1	-	0.00	65	0	C	NM_000445		144996723	-1	tier1	-	no_errors	ENST00000322810	ensembl	human	known	74_37	missense	28.87	69	28	SNP	1.000	G
POMZP3	22932	genome.wustl.edu	37	7	76254993	76254993	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr7:76254993G>A	ENST00000310842.4	-	3	757	c.73C>T	c.(73-75)Cag>Tag	p.Q25*	POMZP3_ENST00000275569.4_Nonsense_Mutation_p.Q25*|UPK3B_ENST00000443097.2_Intron|AC004980.7_ENST00000418663.1_RNA|UPK3B_ENST00000419923.2_Intron	NM_012230.3	NP_036362.3	Q6PJE2	POZP3_HUMAN	POM121 and ZP3 fusion	25										kidney(3)|lung(2)	5		Myeloproliferative disorder(862;0.204)				CTGATTATCTGCTCTGGTCTA	0.413																																																	0													194.0	180.0	185.0					7																	76254993		2203	4300	6503	SO:0001587	stop_gained	0			U10099	CCDS5590.1, CCDS43606.1	7q11.2	2010-06-24	2010-06-24		ENSG00000146707	ENSG00000146707			9203	protein-coding gene	gene with protein product	"""POM-ZP3 fusion protein"", ""POM121/ZP3 fusion protein"""	600587	"""POM (POM121 rat homolog) and ZP3 fusion"", ""POM (POM121 homolog, rat) and ZP3 fusion"""			7789967	Standard	NM_012230		Approved	POM-ZP3, POM121	uc003uft.3	Q6PJE2	OTTHUMG00000023514	ENST00000310842.4:c.73C>T	7.37:g.76254993G>A	ENSP00000309233:p.Gln25*		F6STJ3|Q12903|Q9BWB4	Nonsense_Mutation	SNP	pfam_ZP_dom	p.Q25*	ENST00000310842.4	37	c.73	CCDS43606.1	7	.	.	.	.	.	.	.	.	.	.	g	39	7.649029	0.98412	.	.	ENSG00000146707	ENST00000275569;ENST00000310842;ENST00000454397	.	.	.	0.694	0.694	0.18062	.	0.120055	0.56097	U	0.000036	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	4.8171	0.13372	0.0:0.0:1.0:0.0	.	.	.	.	X	25	.	ENSP00000275569:Q25X	Q	-	1	0	POMZP3	76092929	0.984000	0.35163	0.078000	0.20375	0.763000	0.43281	2.269000	0.43346	0.690000	0.31570	0.472000	0.43445	CAG	POMZP3	-	NULL	ENSG00000146707		0.413	POMZP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POMZP3	HGNC	protein_coding	OTTHUMT00000341775.1	-	0.00	95	0	G	NM_012230		76254993	-1	tier1	-	no_errors	ENST00000310842	ensembl	human	known	74_37	nonsense	29.49	107	46	SNP	0.116	A
PPARGC1A	10891	genome.wustl.edu	37	4	23816165	23816165	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr4:23816165G>T	ENST00000264867.2	-	8	1060	c.941C>A	c.(940-942)cCa>cAa	p.P314Q	PPARGC1A_ENST00000509702.1_5'UTR	NM_013261.3	NP_037393.1	Q9UBK2	PRGC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 alpha	314	Interaction with PPARG.				androgen metabolic process (GO:0008209)|androgen receptor signaling pathway (GO:0030521)|brown fat cell differentiation (GO:0050873)|cellular glucose homeostasis (GO:0001678)|cellular respiration (GO:0045333)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|cellular response to nitrite (GO:0071250)|cellular response to oxidative stress (GO:0034599)|cellular response to thyroid hormone stimulus (GO:0097067)|cellular response to tumor necrosis factor (GO:0071356)|circadian regulation of gene expression (GO:0032922)|digestion (GO:0007586)|fatty acid oxidation (GO:0019395)|flavone metabolic process (GO:0051552)|galactose metabolic process (GO:0006012)|gluconeogenesis (GO:0006094)|mitochondrion organization (GO:0007005)|mRNA processing (GO:0006397)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of receptor activity (GO:2000272)|positive regulation of ATP biosynthetic process (GO:2001171)|positive regulation of cellular respiration (GO:1901857)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of histone acetylation (GO:0035066)|positive regulation of mitochondrial DNA metabolic process (GO:1901860)|positive regulation of mitochondrion organization (GO:0010822)|positive regulation of muscle tissue development (GO:1901863)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|regulation of circadian rhythm (GO:0042752)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|response to cold (GO:0009409)|response to epinephrine (GO:0071871)|response to leucine (GO:0043201)|response to muscle activity (GO:0014850)|response to norepinephrine (GO:0071873)|response to starvation (GO:0042594)|response to statin (GO:0036273)|RNA splicing (GO:0008380)|temperature homeostasis (GO:0001659)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytosol (GO:0005829)|DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.P314Q(1)		central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|liver(1)|lung(24)|ovary(3)|skin(5)	51		Breast(46;0.0503)				CTTCAGCTTTGGAGAAGCCCT	0.438																																					Esophageal Squamous(29;694 744 13796 34866 44181)												1	Substitution - Missense(1)	endometrium(1)											95.0	101.0	99.0					4																	23816165		2203	4300	6503	SO:0001583	missense	0			AF106698	CCDS3429.1	4p15.1	2013-02-12	2006-10-17	2004-02-04	ENSG00000109819	ENSG00000109819		"""RNA binding motif (RRM) containing"""	9237	protein-coding gene	gene with protein product		604517	"""peroxisome proliferative activated receptor, gamma, coactivator 1"", ""peroxisome proliferative activated receptor, gamma, coactivator 1, alpha"""	PPARGC1		10585775	Standard	NM_013261		Approved	PGC1, PGC1A	uc003gqs.3	Q9UBK2	OTTHUMG00000097747	ENST00000264867.2:c.941C>A	4.37:g.23816165G>T	ENSP00000264867:p.Pro314Gln		B7Z406|G8DM16|I3RTT5|I3RTT6|I3RTT7|I3RTT8|I3RTT9|Q3LIG1|Q4W5M7|Q9UN32	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.P314Q	ENST00000264867.2	37	c.941	CCDS3429.1	4	.	.	.	.	.	.	.	.	.	.	G	17.27	3.348318	0.61183	.	.	ENSG00000109819	ENST00000264867	T	0.22743	1.94	6.02	6.02	0.97574	.	0.102097	0.64402	D	0.000001	T	0.42359	0.1199	L	0.49350	1.555	0.80722	D	1	D	0.69078	0.997	D	0.63597	0.916	T	0.02610	-1.1134	10	0.51188	T	0.08	-8.869	20.6202	0.99473	0.0:0.0:1.0:0.0	.	314	Q9UBK2	PRGC1_HUMAN	Q	314	ENSP00000264867:P314Q	ENSP00000264867:P314Q	P	-	2	0	PPARGC1A	23425263	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.874000	0.69652	2.876000	0.98609	0.644000	0.83932	CCA	PPARGC1A	-	NULL	ENSG00000109819		0.438	PPARGC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPARGC1A	HGNC	protein_coding	OTTHUMT00000214976.1		0.00	40	0	G	NM_013261		23816165	-1			no_errors	ENST00000264867	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	T
PRDM9	56979	genome.wustl.edu	37	5	23527626	23527626	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr5:23527626G>T	ENST00000296682.3	+	11	2611	c.2429G>T	c.(2428-2430)gGg>gTg	p.G810V		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	810					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						AGGGAGTGTGGGCGGGGCTTT	0.577										HNSCC(3;0.000094)																																							0													41.0	51.0	48.0					5																	23527626		2149	4269	6418	SO:0001583	missense	0			AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.2429G>T	5.37:g.23527626G>T	ENSP00000296682:p.Gly810Val		B4DX22|Q27Q50	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_SSXRD_motif,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.G810V	ENST00000296682.3	37	c.2429	CCDS43307.1	5	.	.	.	.	.	.	.	.	.	.	G	9.975	1.226605	0.22542	.	.	ENSG00000164256	ENST00000296682	T	0.22134	1.97	3.02	0.122	0.14702	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.47746	0.1462	M	0.91612	3.225	0.49130	D	0.999757	D	0.89917	1.0	D	0.77557	0.99	T	0.47824	-0.9087	9	0.72032	D	0.01	.	7.4492	0.27229	0.3094:0.0:0.6906:0.0	.	810	Q9NQV7	PRDM9_HUMAN	V	810	ENSP00000296682:G810V	ENSP00000296682:G810V	G	+	2	0	PRDM9	23563383	0.981000	0.34729	0.819000	0.32651	0.015000	0.08874	1.714000	0.37961	0.026000	0.15269	0.472000	0.43445	GGG	PRDM9	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000164256		0.577	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM9	HGNC	protein_coding	OTTHUMT00000366375.1	-	0.00	87	0	G	NM_020227		23527626	+1	tier1	-	no_errors	ENST00000296682	ensembl	human	known	74_37	missense	34.57	52	28	SNP	0.904	T
PRKAA1	5562	genome.wustl.edu	37	5	40775593	40775593	+	Silent	SNP	G	G	A	rs200384612		TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr5:40775593G>A	ENST00000397128.2	-	3	290	c.282C>T	c.(280-282)atC>atT	p.I94I	PRKAA1_ENST00000354209.3_Silent_p.I94I|PRKAA1_ENST00000296800.4_Silent_p.I85I	NM_006251.5|NM_206907.3	NP_006242.5|NP_996790.3	Q13131	AAPK1_HUMAN	protein kinase, AMP-activated, alpha 1 catalytic subunit	94	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|autophagy (GO:0006914)|cell cycle arrest (GO:0007050)|cellular response to ethanol (GO:0071361)|cellular response to glucose starvation (GO:0042149)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|cholesterol biosynthetic process (GO:0006695)|cold acclimation (GO:0009631)|fatty acid biosynthetic process (GO:0006633)|fatty acid homeostasis (GO:0055089)|fatty acid oxidation (GO:0019395)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glucose import in response to insulin stimulus (GO:2001274)|negative regulation of glucosylceramide biosynthetic process (GO:0046318)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of gene expression (GO:0010628)|positive regulation of glycolytic process (GO:0045821)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|regulation of energy homeostasis (GO:2000505)|regulation of transcription, DNA-templated (GO:0006355)|regulation of vesicle-mediated transport (GO:0060627)|response to activity (GO:0014823)|response to caffeine (GO:0031000)|response to camptothecin (GO:1901563)|response to gamma radiation (GO:0010332)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	AMP-activated protein kinase complex (GO:0031588)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)	[acetyl-CoA carboxylase] kinase activity (GO:0050405)|[hydroxymethylglutaryl-CoA reductase (NADPH)] kinase activity (GO:0047322)|AMP-activated protein kinase activity (GO:0004679)|ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|chromatin binding (GO:0003682)|histone serine kinase activity (GO:0035174)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|tau-protein kinase activity (GO:0050321)	p.I94I(1)		breast(1)	1					Acetylsalicylic acid(DB00945)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Phenformin(DB00914)	ATGGTGTACTGATGACCTGGT	0.338																																																	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)											114.0	100.0	105.0					5																	40775593		1845	4082	5927	SO:0001819	synonymous_variant	0				CCDS3932.2, CCDS3933.2	5p13.1	2012-10-03			ENSG00000132356	ENSG00000132356			9376	protein-coding gene	gene with protein product	"""AMPK, alpha, 1"""	602739				8557660	Standard	XM_006714481		Approved	AMPKa1	uc003jmb.3	Q13131	OTTHUMG00000162269	ENST00000397128.2:c.282C>T	5.37:g.40775593G>A			A8MTQ6|B2R7E1|O00286|Q5D0E1|Q86VS1|Q9UNQ4	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_KA1/Ssp2_C,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.I94	ENST00000397128.2	37	c.282	CCDS3932.2	5																																																																																			PRKAA1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000132356		0.338	PRKAA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKAA1	HGNC	protein_coding	OTTHUMT00000253833.2		0.00	24	0	G	NM_006251		40775593	-1			no_errors	ENST00000354209	ensembl	human	known	74_37	silent	6.82	41	3	SNP	1.000	A
PROM2	150696	genome.wustl.edu	37	2	95943752	95943752	+	Splice_Site	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr2:95943752G>T	ENST00000317620.9	+	8	1183	c.1050G>T	c.(1048-1050)gaG>gaT	p.E350D	PROM2_ENST00000317668.4_Splice_Site_p.E350D|PROM2_ENST00000403131.2_Splice_Site_p.E350D|PROM2_ENST00000542147.1_Splice_Site_p.E350D	NM_001165978.1	NP_001159450.1	Q8N271	PROM2_HUMAN	prominin 2	350					negative regulation of caveolin-mediated endocytosis (GO:2001287)|negative regulation of pinocytosis (GO:0048550)|positive regulation of cell projection organization (GO:0031346)|positive regulation of protein phosphorylation (GO:0001934)|regulation of Cdc42 GTPase activity (GO:0043088)	cell projection (GO:0042995)|cell surface (GO:0009986)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|microspike (GO:0044393)|microvillus (GO:0005902)|prominosome (GO:0071914)	cholesterol binding (GO:0015485)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	32						TGGTCCAGGAGGTGAGAGCCA	0.562																																																	0													72.0	55.0	60.0					2																	95943752		2203	4300	6503	SO:0001630	splice_region_variant	0			AF245303	CCDS2012.1	2q11.1	2008-02-05			ENSG00000155066	ENSG00000155066			20685	protein-coding gene	gene with protein product						12514187	Standard	NM_001165978		Approved		uc002sui.3	Q8N271	OTTHUMG00000130393	ENST00000317620.9:c.1050+1G>T	2.37:g.95943752G>T			A8K2V1|Q2HIX6|Q8NB84|Q8TAE2	Missense_Mutation	SNP	pfam_Prominin	p.E350D	ENST00000317620.9	37	c.1050	CCDS2012.1	2	.	.	.	.	.	.	.	.	.	.	G	19.95	3.921366	0.73213	.	.	ENSG00000155066	ENST00000403131;ENST00000317668;ENST00000317620;ENST00000542147	T;T;T;T	0.47177	0.85;0.85;0.85;0.85	5.17	5.17	0.71159	.	0.195682	0.34750	N	0.003715	T	0.45054	0.1323	M	0.70595	2.14	0.46654	D	0.99914	P	0.36354	0.549	B	0.31442	0.13	T	0.41645	-0.9497	10	0.30078	T	0.28	-28.9214	14.0525	0.64747	0.0:0.0:1.0:0.0	.	350	Q8N271	PROM2_HUMAN	D	350	ENSP00000385716:E350D;ENSP00000318520:E350D;ENSP00000318270:E350D;ENSP00000442542:E350D	ENSP00000318270:E350D	E	+	3	2	PROM2	95307479	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	4.605000	0.61119	2.703000	0.92315	0.655000	0.94253	GAG	PROM2	-	pfam_Prominin	ENSG00000155066		0.562	PROM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PROM2	HGNC	protein_coding	OTTHUMT00000252771.1		0.00	57	0	G	NM_144707	Missense_Mutation	95943752	+1			no_errors	ENST00000317620	ensembl	human	known	74_37	missense	5.56	85	5	SNP	1.000	T
PTH2	113091	genome.wustl.edu	37	19	49926533	49926533	+	Missense_Mutation	SNP	G	G	C	rs200733272|rs371950649	byFrequency	TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr19:49926533G>C	ENST00000270631.1	-	1	165	c.64C>G	c.(64-66)Ctg>Gtg	p.L22V	CTD-3148I10.1_ENST00000576655.1_5'Flank	NM_178449.3	NP_848544.1	Q96A98	TIP39_HUMAN	parathyroid hormone 2	22					neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)		p.L22V(2)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(262;0.0015)|GBM - Glioblastoma multiforme(486;0.044)|Lung(386;0.0785)|LUSC - Lung squamous cell carcinoma(496;0.0836)		GGCACCACcagcagcagcagc	0.692													g|||	17	0.00339457	0.003	0.0043	5008	,	,		11369	0.004		0.002	False		,,,				2504	0.0041																2	Substitution - Missense(2)	endometrium(2)							VAL/LEU	12,4376		0,12,2182	12.0	16.0	14.0		64	3.3	0.0	19		14	11,8561		0,11,4275	no	missense	PTH2	NM_178449.3	32	0,23,6457	CC,CG,GG		0.1283,0.2735,0.1775	possibly-damaging	22/101	49926533	23,12937	2194	4286	6480	SO:0001583	missense	0			AY037555	CCDS12763.1	19q13.33	2013-02-28				ENSG00000142538		"""Endogenous ligands"""	30828	protein-coding gene	gene with protein product	"""tuberoinfundibular 39 residues"""	608386				11861531	Standard	NM_178449		Approved	TIP39	uc002pnn.1	Q96A98		ENST00000270631.1:c.64C>G	19.37:g.49926533G>C	ENSP00000270631:p.Leu22Val		Q96DJ4	Missense_Mutation	SNP	NULL	p.L22V	ENST00000270631.1	37	c.64	CCDS12763.1	19	.	.	.	.	.	.	.	.	.	.	g	6.292	0.421904	0.11928	0.002735	0.001283	ENSG00000142538	ENST00000270631	.	.	.	4.3	3.26	0.37387	.	0.489236	0.15528	U	0.257640	T	0.26521	0.0648	L	0.27053	0.805	0.09310	N	1	P	0.46142	0.873	B	0.39419	0.299	T	0.08066	-1.0740	9	0.87932	D	0	-7.2733	12.3672	0.55234	0.0:0.1717:0.8283:0.0	.	22	Q96A98	TIP39_HUMAN	V	22	.	ENSP00000270631:L22V	L	-	1	2	PTH2	54618345	0.088000	0.21588	0.012000	0.15200	0.011000	0.07611	-0.504000	0.06375	0.947000	0.37659	-0.370000	0.07254	CTG	PTH2	-	NULL	ENSG00000142538		0.692	PTH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTH2	HGNC	protein_coding	OTTHUMT00000465366.1	-	0.00	88	0	G	NM_178449		49926533	-1	tier1	rs200733272	no_errors	ENST00000270631	ensembl	human	known	74_37	missense	5.15	91	5	SNP	0.132	C
PTPN9	5780	genome.wustl.edu	37	15	75809693	75809693	+	Silent	SNP	C	C	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr15:75809693C>T	ENST00000306726.2	-	5	947	c.435G>A	c.(433-435)caG>caA	p.Q145Q		NM_002833.2	NP_002824.1	P43378	PTN9_HUMAN	protein tyrosine phosphatase, non-receptor type 9	145	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|protein tyrosine phosphatase activity (GO:0004725)			central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GTCCATTCCTCTGAGTTTCAA	0.403																																																	0													109.0	88.0	95.0					15																	75809693		2197	4294	6491	SO:0001819	synonymous_variant	0				CCDS10280.1	15q23	2011-06-09			ENSG00000169410	ENSG00000169410		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9661	protein-coding gene	gene with protein product		600768				1557404	Standard	NM_002833		Approved	MEG2	uc002bal.3	P43378	OTTHUMG00000142838	ENST00000306726.2:c.435G>A	15.37:g.75809693C>T			Q53XR9	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_CRAL/TRIO_N_dom,smart_CRAL-TRIO_dom,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_CRAL-TRIO_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_CRAL-bd_toc_tran	p.Q145	ENST00000306726.2	37	c.435	CCDS10280.1	15																																																																																			PTPN9	-	pfam_CRAL-TRIO_dom,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	ENSG00000169410		0.403	PTPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN9	HGNC	protein_coding	OTTHUMT00000286474.1	-	0.00	42	0	C			75809693	-1	tier1	-	no_errors	ENST00000306726	ensembl	human	known	74_37	silent	46.88	34	30	SNP	1.000	T
PTPRK	5796	genome.wustl.edu	37	6	128383359	128383359	+	Intron	DEL	T	T	-	rs74921639		TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr6:128383359delT	ENST00000368215.3	-	13	2194				PTPRK_ENST00000368213.5_Intron|PTPRK_ENST00000368227.3_Intron|PTPRK_ENST00000532331.1_Intron|PTPRK_ENST00000524481.1_Intron|PTPRK_ENST00000368207.3_Intron|RP11-103C16.2_ENST00000417390.1_RNA|PTPRK_ENST00000368210.3_Intron|PTPRK_ENST00000368226.4_Intron			Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K						cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to reactive oxygen species (GO:0034614)|cellular response to UV (GO:0034644)|focal adhesion assembly (GO:0048041)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)		PTPRK/RSPO3(10)	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(14)|lung(24)|ovary(3)|pancreas(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	72				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		ttttcttttcttttttttttc	0.378																																																	0																																										SO:0001627	intron_variant	0			L77886	CCDS5137.1, CCDS47473.1, CCDS75517.1	6q22.2-q22.3	2013-02-11			ENSG00000152894	ENSG00000152894		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9674	protein-coding gene	gene with protein product		602545				9047348, 8663237	Standard	NM_002844		Approved	R-PTP-kappa	uc010kfc.3	Q15262	OTTHUMG00000015536	ENST00000368215.3:c.2194+2543A>-	6.37:g.128383359delT			B2RTQ8|B7ZMG0|Q14763|Q5TG10|Q5TG11	RNA	DEL	-	NULL	ENST00000368215.3	37	NULL		6																																																																																			PTPRK	-	-	ENSG00000152894		0.378	PTPRK-005	KNOWN	basic|appris_candidate	protein_coding	PTPRK	HGNC	protein_coding	OTTHUMT00000042163.1		0.00	18	0	T			128383359	-1	tier1		no_errors	ENST00000434424	ensembl	human	known	74_37	rna	12.50	14	2	DEL	0.036	-
RAPGEF5	9771	genome.wustl.edu	37	7	22233043	22233043	+	Silent	SNP	C	C	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr7:22233043C>T	ENST00000401957.2	-	1	484	c.237G>A	c.(235-237)aaG>aaA	p.K79K	RAPGEF5_ENST00000344041.6_Silent_p.K229K|RAPGEF5_ENST00000405243.1_3'UTR|RAPGEF5_ENST00000475788.1_5'UTR			Q92565	RPGF5_HUMAN	Rap guanine nucleotide exchange factor (GEF) 5	79	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				nervous system development (GO:0007399)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|small GTPase mediated signal transduction (GO:0007264)	nucleus (GO:0005634)	GTP-dependent protein binding (GO:0030742)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(2)|ovary(1)	6						GCTCCAAAATCTTCTCCGGGG	0.522																																																	0													71.0	71.0	71.0					7																	22233043		1906	4129	6035	SO:0001819	synonymous_variant	0			D87467	CCDS55093.1	7p15.3	2004-03-01			ENSG00000136237	ENSG00000136237			16862	protein-coding gene	gene with protein product	"""M-Ras-regulated GEF"""	609527				9039502, 10486569	Standard	NM_012294		Approved	KIAA0277, GFR, MR-GEF	uc003svg.3	Q92565	OTTHUMG00000152525	ENST00000401957.2:c.237G>A	7.37:g.22233043C>T			A4D140|Q8IXU5	Silent	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.K229	ENST00000401957.2	37	c.687		7																																																																																			RAPGEF5	-	pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,pfscan_Ras-like_Gua-exchang_fac_N	ENSG00000136237		0.522	RAPGEF5-001	KNOWN	basic	protein_coding	RAPGEF5	HGNC	protein_coding	OTTHUMT00000326590.2	-	0.00	31	0	C	NM_012294		22233043	-1	tier1	-	no_errors	ENST00000344041	ensembl	human	known	74_37	silent	32.43	24	12	SNP	1.000	T
REPS2	9185	genome.wustl.edu	37	X	17165604	17165605	+	Stop_Codon_Ins	INS	-	-	C			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chrX:17165604_17165605insC	ENST00000357277.3	+	0	2154_2155				REPS2_ENST00000469714.1_3'UTR|REPS2_ENST00000303843.7_Stop_Codon_Ins|REPS2_ENST00000380064.4_Stop_Codon_Ins	NM_001080975.1|NM_004726.2	NP_001074444.1|NP_004717.2	Q8NFH8	REPS2_HUMAN	RALBP1 associated Eps domain containing 2						epidermal growth factor receptor signaling pathway (GO:0007173)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(2)|skin(3)|urinary_tract(1)	17	Hepatocellular(33;0.183)					CTGTGTTGTGACCCCCCCATGG	0.416																																																	0																																										SO:0001567	stop_retained_variant	0			AF010233	CCDS14180.2, CCDS43919.1	Xp22.2	2013-01-10			ENSG00000169891	ENSG00000169891		"""EF-hand domain containing"""	9963	protein-coding gene	gene with protein product		300317				9422736, 9928989	Standard	NM_001080975		Approved	POB1	uc004cxv.1	Q8NFH8	OTTHUMG00000021199	ENST00000357277.3:c.1987dupC	X.37:g.17165611_17165611dupC			A6PWZ6|O43428|Q5JNZ8|Q8NFI5	Frame_Shift_Ins	INS	smart_EPS15_homology,pfscan_EF_hand_dom,pfscan_EPS15_homology	p.*661fs	ENST00000357277.3	37	c.1983_1984	CCDS14180.2	X																																																																																			REPS2	-	NULL	ENSG00000169891		0.416	REPS2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	REPS2	HGNC	protein_coding	OTTHUMT00000316778.1		0.00	23	0	-	NM_004726		17165605	+1	tier1		no_errors	ENST00000357277	ensembl	human	known	74_37	frame_shift_ins	60.42	19	29	INS	1.000:0.910	C
RFX3	5991	genome.wustl.edu	37	9	3293163	3293163	+	Missense_Mutation	SNP	G	G	T	rs374803532		TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr9:3293163G>T	ENST00000382004.3	-	7	956	c.645C>A	c.(643-645)caC>caA	p.H215Q	RFX3_ENST00000358730.2_Missense_Mutation_p.H215Q|RFX3_ENST00000302303.1_Missense_Mutation_p.H215Q	NM_001282116.1|NM_134428.1	NP_001269045.1|NP_602304.1	P48380	RFX3_HUMAN	regulatory factor X, 3 (influences HLA class II expression)	215					cell maturation (GO:0048469)|cilium assembly (GO:0042384)|cilium-dependent cell motility (GO:0060285)|endocrine pancreas development (GO:0031018)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type B pancreatic cell development (GO:2000078)|regulation of insulin secretion (GO:0050796)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell maturation (GO:0072560)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(11)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(50;0.00124)|Lung(2;0.0337)		GGTCCAGTTTGTGTTCCTGAC	0.453																																																	0													126.0	116.0	119.0					9																	3293163		2203	4300	6503	SO:0001583	missense	0			AI811824	CCDS6449.1, CCDS6450.1, CCDS75809.1	9p24.2	2008-02-05			ENSG00000080298	ENSG00000080298			9984	protein-coding gene	gene with protein product		601337				8289803	Standard	XM_005251534		Approved		uc003zhr.3	P48380	OTTHUMG00000019456	ENST00000382004.3:c.645C>A	9.37:g.3293163G>T	ENSP00000371434:p.His215Gln		A8K0H5|D3DRH8|D3DRH9|Q5JTL7|Q5JTL8|Q6NW13|Q8WTU4|Q95HL5|Q95HL6	Missense_Mutation	SNP	pfam_RFX1_trans_act,pfam_DNA-bd_RFX	p.H215Q	ENST00000382004.3	37	c.645	CCDS6449.1	9	.	.	.	.	.	.	.	.	.	.	G	11.36	1.615058	0.28712	.	.	ENSG00000080298	ENST00000382004;ENST00000381992;ENST00000358730;ENST00000302303;ENST00000457373	D;D;D;D	0.82255	-1.59;-1.59;-1.59;-1.59	5.71	4.81	0.61882	Winged helix-turn-helix transcription repressor DNA-binding (1);DNA-binding RFX (1);	0.045999	0.85682	D	0.000000	T	0.75162	0.3812	L	0.43646	1.37	0.80722	D	1	B;B;B;B	0.27416	0.009;0.178;0.014;0.009	B;B;B;B	0.24155	0.01;0.051;0.03;0.021	T	0.69698	-0.5075	10	0.23302	T	0.38	-13.8005	11.6099	0.51053	0.1424:0.0:0.8576:0.0	.	190;215;215;215	B1ANP5;P48380-3;P48380-2;P48380	.;.;.;RFX3_HUMAN	Q	215;190;215;215;190	ENSP00000371434:H215Q;ENSP00000351574:H215Q;ENSP00000303847:H215Q;ENSP00000405664:H190Q	ENSP00000303847:H215Q	H	-	3	2	RFX3	3283163	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.054000	0.64275	1.415000	0.47037	0.585000	0.79938	CAC	RFX3	-	pfam_DNA-bd_RFX	ENSG00000080298		0.453	RFX3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX3	HGNC	protein_coding	OTTHUMT00000051545.1	-	0.00	87	0	G	NM_002919		3293163	-1	tier1	-	no_errors	ENST00000382004	ensembl	human	known	74_37	missense	5.13	74	4	SNP	1.000	T
RFX7	64864	genome.wustl.edu	37	15	56386365	56386365	+	Silent	SNP	A	A	G			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr15:56386365A>G	ENST00000559447.2	-	9	3541	c.3270T>C	c.(3268-3270)aaT>aaC	p.N1090N	RFX7_ENST00000422057.1_Silent_p.N1090N|RFX7_ENST00000423270.1_Silent_p.N1187N|RFX7_ENST00000317318.6_Silent_p.N1187N			Q2KHR2	RFX7_HUMAN	regulatory factor X, 7	1090					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						ATCGTGGGATATTAGATACTG	0.473																																																	0													108.0	110.0	109.0					15																	56386365		1970	4157	6127	SO:0001819	synonymous_variant	0					15q21.3	2008-08-04	2008-08-04	2008-08-04		ENSG00000181827			25777	protein-coding gene	gene with protein product		612660	"""regulatory factor X domain containing 2"""	RFXDC2			Standard	NM_022841		Approved	FLJ12994	uc010bfn.3	Q2KHR2		ENST00000559447.2:c.3270T>C	15.37:g.56386365A>G			Q6ZRR1|Q6ZTY6|Q8N3J0|Q9H7A9|Q9H956	Silent	SNP	pfam_DNA-bd_RFX	p.N1187	ENST00000559447.2	37	c.3561		15																																																																																			RFX7	-	NULL	ENSG00000181827		0.473	RFX7-001	KNOWN	non_canonical_U12|basic	protein_coding	RFX7	HGNC	protein_coding	OTTHUMT00000418841.3	-	0.00	22	0	A	NM_022841		56386365	-1	tier1	-	no_errors	ENST00000423270	ensembl	human	known	74_37	silent	60.00	12	18	SNP	1.000	G
RMND1	55005	genome.wustl.edu	37	6	151766902	151766902	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr6:151766902T>C	ENST00000367303.4	-	2	167	c.45A>G	c.(43-45)atA>atG	p.I15M	RMND1_ENST00000336451.3_5'Flank|RMND1_ENST00000491268.1_5'UTR	NM_017909.2	NP_060379.2	Q9NWS8	RMND1_HUMAN	required for meiotic nuclear division 1 homolog (S. cerevisiae)	15					translation (GO:0006412)	mitochondrion (GO:0005739)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.146)	OV - Ovarian serous cystadenocarcinoma(155;6.8e-11)		CTTTTGATAATATATGATGAG	0.378																																																	0													39.0	35.0	37.0					6																	151766902		2203	4300	6503	SO:0001583	missense	0			AK000634	CCDS5232.1, CCDS75539.1	6q25.1	2008-02-05	2006-11-24	2006-11-24	ENSG00000155906	ENSG00000155906			21176	protein-coding gene	gene with protein product		614917	"""chromosome 6 open reading frame 96"""	C6orf96			Standard	NM_001271937		Approved	bA351K16.3, FLJ20627, RMD1	uc003qoi.3	Q9NWS8	OTTHUMG00000015837	ENST00000367303.4:c.45A>G	6.37:g.151766902T>C	ENSP00000356272:p.Ile15Met		A8K8H4|Q0VDG6|Q5SZ48|Q5SZ83|Q6NSC5|Q96EN7	Missense_Mutation	SNP	pfam_DUF155	p.I15M	ENST00000367303.4	37	c.45	CCDS5232.1	6	.	.	.	.	.	.	.	.	.	.	T	11.90	1.775354	0.31411	.	.	ENSG00000155906	ENST00000367303	T	0.49139	0.79	5.57	1.81	0.25067	.	1.003620	0.08025	N	0.992596	T	0.23688	0.0573	L	0.29908	0.895	0.19945	N	0.999949	P;B	0.48016	0.904;0.435	P;B	0.48921	0.595;0.127	T	0.14309	-1.0477	10	0.59425	D	0.04	-4.3317	5.5816	0.17252	0.6782:0.0:0.1:0.2218	.	15;15	Q9NWS8-3;Q9NWS8	.;RMND1_HUMAN	M	15	ENSP00000356272:I15M	ENSP00000356272:I15M	I	-	3	3	RMND1	151808595	0.163000	0.22920	0.007000	0.13788	0.025000	0.11179	0.356000	0.20181	0.069000	0.16605	0.460000	0.39030	ATA	RMND1	-	NULL	ENSG00000155906		0.378	RMND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RMND1	HGNC	protein_coding	OTTHUMT00000042718.2	-	0.00	21	0	T	NM_017909		151766902	-1	tier1	-	no_errors	ENST00000367303	ensembl	human	known	74_37	missense	15.91	37	7	SNP	0.106	C
RNF111	54778	genome.wustl.edu	37	15	59373162	59373162	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr15:59373162A>G	ENST00000557998.1	+	8	2263	c.1976A>G	c.(1975-1977)cAt>cGt	p.H659R	RNF111_ENST00000561186.1_Missense_Mutation_p.H659R|RNF111_ENST00000348370.4_Missense_Mutation_p.H659R|RNF111_ENST00000559209.1_Missense_Mutation_p.H659R|RNF111_ENST00000434298.1_Missense_Mutation_p.H659R	NM_001270530.1	NP_001257459.1	Q6ZNA4	RN111_HUMAN	ring finger protein 111	659	Pro-rich.				gene expression (GO:0010467)|pattern specification process (GO:0007389)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein polyubiquitination (GO:0000209)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ligase activity (GO:0016874)|SUMO polymer binding (GO:0032184)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35				all cancers(107;0.194)		CCACTTCATCATCAAGCTTCT	0.438																																					NSCLC(72;983 1365 10746 34387 47081)												0													150.0	139.0	142.0					15																	59373162		2192	4291	6483	SO:0001583	missense	0			AL157474	CCDS10169.1, CCDS58365.1, CCDS58366.1	15q21	2013-01-09			ENSG00000157450	ENSG00000157450		"""RING-type (C3HC4) zinc fingers"""	17384	protein-coding gene	gene with protein product		605840				11298452	Standard	NM_017610		Approved	ARK, Arkadia, FLJ38008, DKFZP761D081	uc002aft.4	Q6ZNA4	OTTHUMG00000132716	ENST00000557998.1:c.1976A>G	15.37:g.59373162A>G	ENSP00000452732:p.His659Arg		C9JUS4|H0YN55|Q6P9A4|Q6ZMU2|Q7L428|Q7Z346|Q8N1P9|Q8WUA3|Q9NSR1	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.H659R	ENST00000557998.1	37	c.1976	CCDS58366.1	15	.	.	.	.	.	.	.	.	.	.	A	16.95	3.263678	0.59431	.	.	ENSG00000157450	ENST00000348370;ENST00000434298	T;T	0.17528	2.27;2.28	5.74	4.6	0.57074	.	0.052325	0.64402	D	0.000001	T	0.32763	0.0840	L	0.44542	1.39	0.58432	D	0.999997	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.85130	0.997;0.991;0.996	T	0.02326	-1.1176	10	0.62326	D	0.03	-12.7287	12.1443	0.54014	0.8715:0.0:0.0:0.1285	.	659;659;659	Q6ZNA4-3;Q6ZNA4;Q6ZNA4-2	.;RN111_HUMAN;.	R	659	ENSP00000288199:H659R;ENSP00000393641:H659R	ENSP00000288199:H659R	H	+	2	0	RNF111	57160454	1.000000	0.71417	1.000000	0.80357	0.480000	0.33159	8.730000	0.91510	0.988000	0.38734	-0.468000	0.05107	CAT	RNF111	-	NULL	ENSG00000157450		0.438	RNF111-003	KNOWN	basic|CCDS	protein_coding	RNF111	HGNC	protein_coding	OTTHUMT00000416012.1	-	0.00	45	0	A	NM_017610		59373162	+1	tier1	-	no_errors	ENST00000434298	ensembl	human	known	74_37	missense	38.00	30	19	SNP	1.000	G
RPF1	80135	genome.wustl.edu	37	1	84961936	84961936	+	Silent	SNP	C	C	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr1:84961936C>T	ENST00000370654.5	+	8	906	c.891C>T	c.(889-891)ttC>ttT	p.F297F	GNG5_ENST00000487806.1_5'Flank	NM_025065.6	NP_079341.2	Q9H9Y2	RPF1_HUMAN	ribosome production factor 1 homolog (S. cerevisiae)	297	Brix. {ECO:0000255|PROSITE- ProRule:PRU00034}.				rRNA processing (GO:0006364)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)			breast(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(2)|prostate(1)	14						GATACATATTCAGGAGTGAAA	0.318																																																	0													67.0	71.0	69.0					1																	84961936		2203	4300	6503	SO:0001819	synonymous_variant	0			AF322053	CCDS695.1	1p22.3	2009-09-25	2009-09-25	2009-09-25	ENSG00000117133	ENSG00000117133			30350	protein-coding gene	gene with protein product	"""RNA processing factor 1"", ""ribosome production factor 1"""		"""brix domain containing 5"""	BXDC5		11864606	Standard	NM_025065		Approved		uc001djv.4	Q9H9Y2	OTTHUMG00000009857	ENST00000370654.5:c.891C>T	1.37:g.84961936C>T			Q5VSK7|Q6AHX1|Q8WXZ8	Silent	SNP	pfam_Brix,superfamily_Anticodon-bd,smart_Brix,pfscan_Brix	p.F297	ENST00000370654.5	37	c.891	CCDS695.1	1																																																																																			RPF1	-	pfam_Brix,superfamily_Anticodon-bd,smart_Brix,pfscan_Brix	ENSG00000117133		0.318	RPF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPF1	HGNC	protein_coding	OTTHUMT00000027238.1	-	0.00	14	0	C	NM_025065		84961936	+1	tier1	-	no_errors	ENST00000370654	ensembl	human	known	74_37	silent	63.41	15	26	SNP	1.000	T
RPL23AP53	644128	genome.wustl.edu	37	8	163319	163319	+	RNA	SNP	C	C	G			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr8:163319C>G	ENST00000606975.1	-	0	602									ribosomal protein L23a pseudogene 53																		GCCTTGTTCTCTTTATCAGGA	0.443																																																	0																																												0					8p23.3	2014-06-17			ENSG00000223508	ENSG00000223508			35921	pseudogene	pseudogene						19123937	Standard	NR_003572		Approved		uc010lrb.4				8.37:g.163319C>G				RNA	SNP	-	NULL	ENST00000606975.1	37	NULL		8																																																																																			RPL23AP53	-	-	ENSG00000223508		0.443	RPL23AP53-002	KNOWN	basic	processed_transcript	RPL23AP53	HGNC	pseudogene	OTTHUMT00000470409.1	-	0.00	50	0	C	NR_003572		163319	-1	tier1	-	no_errors	ENST00000606975	ensembl	human	known	74_37	rna	17.65	56	12	SNP	0.793	G
RUSC2	9853	genome.wustl.edu	37	9	35561273	35561273	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr9:35561273G>C	ENST00000455600.1	+	12	5014	c.4445G>C	c.(4444-4446)gGa>gCa	p.G1482A	FAM166B_ENST00000492890.1_5'Flank	NM_001135999.1	NP_001129471	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2	1482	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.					cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)	Rab GTPase binding (GO:0017137)			NS(1)|breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(4)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)			CGAGCTGGAGGAGACTGGCTG	0.652																																																	0													49.0	60.0	56.0					9																	35561273		2203	4300	6503	SO:0001583	missense	0			AB002373	CCDS35008.1	9p13.2	2003-12-02			ENSG00000198853	ENSG00000198853			23625	protein-coding gene	gene with protein product		611053				9205841	Standard	NM_001135999		Approved	KIAA0375	uc003zww.3	Q8N2Y8	OTTHUMG00000019861	ENST00000455600.1:c.4445G>C	9.37:g.35561273G>C	ENSP00000393922:p.Gly1482Ala		A2RU62|A7E2A9|O15080|Q5W134|Q641Q6|Q6P1W7	Missense_Mutation	SNP	pfam_Run,pfam_SH3_2,superfamily_SH3_domain,smart_Run,smart_SH3_domain,pfscan_Run,pfscan_SH3_domain	p.G1482A	ENST00000455600.1	37	c.4445	CCDS35008.1	9	.	.	.	.	.	.	.	.	.	.	G	8.571	0.879952	0.17467	.	.	ENSG00000198853	ENST00000361226;ENST00000455600	T;T	0.09073	3.02;3.02	5.39	3.5	0.40072	Src homology-3 domain (3);Variant SH3 (1);	0.609127	0.18004	N	0.154808	T	0.06600	0.0169	L	0.35542	1.07	0.24585	N	0.993855	B	0.06786	0.001	B	0.12156	0.007	T	0.32745	-0.9895	10	0.23302	T	0.38	-0.0062	8.5492	0.33440	0.0819:0.1553:0.7628:0.0	.	1482	Q8N2Y8	RUSC2_HUMAN	A	1482	ENSP00000355177:G1482A;ENSP00000393922:G1482A	ENSP00000355177:G1482A	G	+	2	0	RUSC2	35551273	0.637000	0.27216	0.909000	0.35828	0.971000	0.66376	2.115000	0.41921	1.386000	0.46466	0.650000	0.86243	GGA	RUSC2	-	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000198853		0.652	RUSC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	RUSC2	HGNC	protein_coding	OTTHUMT00000052309.1	-	0.00	57	0	G	XM_048462		35561273	+1	tier1	-	no_errors	ENST00000361226	ensembl	human	known	74_37	missense	64.58	17	31	SNP	0.413	C
SEC16B	89866	genome.wustl.edu	37	1	177913774	177913774	+	Silent	SNP	A	A	C			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr1:177913774A>C	ENST00000308284.6	-	15	1892	c.1803T>G	c.(1801-1803)acT>acG	p.T601T	RP4-798P15.3_ENST00000354921.3_RNA	NM_033127.2	NP_149118.2	Q96JE7	SC16B_HUMAN	SEC16 homolog B (S. cerevisiae)	601					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|peroxisome fission (GO:0016559)|peroxisome organization (GO:0007031)|positive regulation of gene expression (GO:0010628)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endoplasmic reticulum (GO:0070972)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)				central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)|stomach(1)	35						GGATTGCCTCAGTTGTTGCAA	0.473																																																	0													134.0	137.0	136.0					1																	177913774		1890	4112	6002	SO:0001819	synonymous_variant	0			AK090411	CCDS44281.1	1q25.2	2012-10-08	2007-06-20	2007-06-20	ENSG00000120341	ENSG00000120341			30301	protein-coding gene	gene with protein product	"""regucalcin gene promotor region related protein"""	612855	"""leucine zipper transcription regulator 2"""	LZTR2		11572484, 11605020	Standard	NM_033127		Approved	RGPR, PGPR-p117	uc001gli.1	Q96JE7	OTTHUMG00000167206	ENST00000308284.6:c.1803T>G	1.37:g.177913774A>C			A3EYF1|Q5HYF6|Q8N7D6|Q96GX6	Silent	SNP	NULL	p.T601	ENST00000308284.6	37	c.1803	CCDS44281.1	1																																																																																			SEC16B	-	NULL	ENSG00000120341		0.473	SEC16B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC16B	HGNC	protein_coding	OTTHUMT00000084773.16	-	0.00	44	0	A	NM_033127		177913774	-1	tier1	-	no_errors	ENST00000308284	ensembl	human	known	74_37	silent	17.53	80	17	SNP	0.042	C
SEC31A	22872	genome.wustl.edu	37	4	83799895	83799895	+	Silent	SNP	C	C	G			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr4:83799895C>G	ENST00000395310.2	-	4	572	c.390G>C	c.(388-390)gtG>gtC	p.V130V	SEC31A_ENST00000448323.1_Silent_p.V130V|SEC31A_ENST00000513858.1_Silent_p.V130V|SEC31A_ENST00000508502.1_Silent_p.V130V|SEC31A_ENST00000326950.5_Silent_p.V130V|SEC31A_ENST00000509142.1_Silent_p.V130V|SEC31A_ENST00000508479.1_Silent_p.V130V|SEC31A_ENST00000443462.2_Silent_p.V125V|SEC31A_ENST00000348405.4_Silent_p.V130V|SEC31A_ENST00000436790.2_5'UTR|SEC31A_ENST00000505984.1_Silent_p.V130V|SEC31A_ENST00000505472.1_Silent_p.V130V|SEC31A_ENST00000432794.1_Silent_p.V130V|SEC31A_ENST00000311785.7_Silent_p.V130V|SEC31A_ENST00000355196.2_Silent_p.V130V|SEC31A_ENST00000500777.2_Silent_p.V130V	NM_001077207.2|NM_001077208.2|NM_014933.3	NP_001070675.1|NP_001070676.1|NP_055748.2	O94979	SC31A_HUMAN	SEC31 homolog A (S. cerevisiae)	130					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)|response to calcium ion (GO:0051592)	COPII vesicle coat (GO:0030127)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle (GO:0030134)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|vesicle coat (GO:0030120)	calcium-dependent protein binding (GO:0048306)		SEC31A/ALK(3)|SEC31A/JAK2(4)	breast(1)	1		Hepatocellular(203;0.114)				GGAAAATGTTCACATCCAAGG	0.363																																																	0													89.0	90.0	89.0					4																	83799895		2203	4300	6503	SO:0001819	synonymous_variant	0			AB018358	CCDS3596.1, CCDS3597.1, CCDS43244.1, CCDS47088.1, CCDS54773.1, CCDS75155.1, CCDS75156.1	4q21.3	2013-01-10	2006-10-05	2006-09-07	ENSG00000138674	ENSG00000138674		"""WD repeat domain containing"""	17052	protein-coding gene	gene with protein product		610257	"""SEC31-like 1 (S. cerevisiae)"", ""Sec31 homolog A (S. cerevisiae)"""	SEC31L1		10048485, 10788476	Standard	NM_001077206		Approved	KIAA0905, ABP125, ABP130	uc003hnh.3	O94979	OTTHUMG00000130297	ENST00000395310.2:c.390G>C	4.37:g.83799895C>G			B4DIW6|B7ZKZ7|B7ZL00|H7C2W3|Q17RR5|Q5H9P6|Q5XG74|Q659G7|Q6ZU90|Q7LCX9|Q86TJ0|Q8IZH4|Q9P048|Q9P0A6|Q9UM05|Q9UM06	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V130	ENST00000395310.2	37	c.390	CCDS3596.1	4																																																																																			SEC31A	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000138674		0.363	SEC31A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEC31A	HGNC	protein_coding	OTTHUMT00000252640.1	-	0.00	19	0	C	NM_016211		83799895	-1	tier1	-	no_errors	ENST00000432794	ensembl	human	known	74_37	silent	57.45	20	27	SNP	0.999	G
SGK2	10110	genome.wustl.edu	37	20	42195101	42195101	+	Missense_Mutation	SNP	C	C	T	rs369635262		TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr20:42195101C>T	ENST00000341458.4	+	1	365	c.146C>T	c.(145-147)cCt>cTt	p.P49L	SGK2_ENST00000426287.1_Intron|SGK2_ENST00000373077.1_Intron|SGK2_ENST00000373092.3_Intron|SGK2_ENST00000373100.1_Intron|SGK2_ENST00000423407.3_Intron	NM_016276.3	NP_057360.2	Q9HBY8	SGK2_HUMAN	serum/glucocorticoid regulated kinase 2	49					intracellular signal transduction (GO:0035556)|ion transmembrane transport (GO:0034220)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|response to oxidative stress (GO:0006979)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|sodium channel regulator activity (GO:0017080)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(11)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			CTGCTCCTCCCTGTCCCCCCA	0.607																																																	0													104.0	104.0	104.0					20																	42195101		2203	4300	6503	SO:0001583	missense	0			AF169034	CCDS13320.1, CCDS13321.1	20q13.2	2008-07-04			ENSG00000101049	ENSG00000101049			13900	protein-coding gene	gene with protein product		607589				10548550	Standard	NM_016276		Approved		uc002xkv.3	Q9HBY8	OTTHUMG00000033054	ENST00000341458.4:c.146C>T	20.37:g.42195101C>T	ENSP00000340608:p.Pro49Leu		Q52PK5|Q5H8Y6|Q5H8Z1|Q5TZR3|Q9UKG6	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_dom	p.P49L	ENST00000341458.4	37	c.146	CCDS13320.1	20	.	.	.	.	.	.	.	.	.	.	C	8.020	0.759506	0.15846	.	.	ENSG00000101049	ENST00000341458	T	0.72051	-0.62	3.35	1.29	0.21616	.	1.878420	0.03258	U	0.182867	T	0.46034	0.1372	N	0.03608	-0.345	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.33085	-0.9882	10	0.25106	T	0.35	.	4.1494	0.10230	0.0:0.6036:0.0:0.3964	.	49	Q9HBY8	SGK2_HUMAN	L	49	ENSP00000340608:P49L	ENSP00000340608:P49L	P	+	2	0	SGK2	41628515	0.023000	0.18921	0.077000	0.20336	0.582000	0.36321	1.691000	0.37721	0.352000	0.24053	0.561000	0.74099	CCT	SGK2	-	NULL	ENSG00000101049		0.607	SGK2-002	KNOWN	basic|CCDS	protein_coding	SGK2	HGNC	protein_coding	OTTHUMT00000080383.1	-	0.00	57	0	C			42195101	+1	tier1	-	no_errors	ENST00000341458	ensembl	human	known	74_37	missense	11.54	92	12	SNP	0.102	T
SIX4	51804	genome.wustl.edu	37	14	61180669	61180669	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr14:61180669C>A	ENST00000216513.4	-	3	1861	c.1802G>T	c.(1801-1803)gGg>gTg	p.G601V		NM_017420.4	NP_059116.3	Q9UIU6	SIX4_HUMAN	SIX homeobox 4	601					anatomical structure morphogenesis (GO:0009653)|embryonic cranial skeleton morphogenesis (GO:0048701)|generation of neurons (GO:0048699)|inner ear morphogenesis (GO:0042472)|metanephric mesenchyme development (GO:0072075)|myoblast migration (GO:0051451)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of ureteric bud formation (GO:0072107)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of protein localization (GO:0032880)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|skeletal muscle tissue development (GO:0007519)|thymus development (GO:0048538)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(1)|large_intestine(11)|liver(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28				OV - Ovarian serous cystadenocarcinoma(108;0.0275)		CAGGCCACTCCCCGAGATGTT	0.443																																																	0													69.0	67.0	68.0					14																	61180669		2203	4300	6503	SO:0001583	missense	0			AB024687	CCDS9749.2	14q23.1	2012-10-02	2007-07-13		ENSG00000100625	ENSG00000100625		"""Homeoboxes / SINE class"""	10890	protein-coding gene	gene with protein product		606342	"""sine oculis homeobox (Drosophila) homolog 4"", ""sine oculis homeobox homolog 4 (Drosophila)"""			10512683, 10640827	Standard	NM_017420		Approved	AREC3	uc001xfc.3	Q9UIU6	OTTHUMG00000028996	ENST00000216513.4:c.1802G>T	14.37:g.61180669C>A	ENSP00000216513:p.Gly601Val		Q4QQH5|Q4V764	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.G601V	ENST00000216513.4	37	c.1802	CCDS9749.2	14	.	.	.	.	.	.	.	.	.	.	C	15.42	2.827713	0.50845	.	.	ENSG00000100625	ENST00000216513;ENST00000554079	D;T	0.91577	-2.87;0.75	5.44	5.44	0.79542	.	0.487205	0.22022	N	0.065713	D	0.85305	0.5666	N	0.08118	0	0.80722	D	1	P	0.47106	0.89	P	0.48114	0.567	D	0.85229	0.1031	10	0.28530	T	0.3	.	17.4595	0.87616	0.0:1.0:0.0:0.0	.	601	Q9UIU6	SIX4_HUMAN	V	601;274	ENSP00000216513:G601V;ENSP00000451537:G274V	ENSP00000216513:G601V	G	-	2	0	SIX4	60250422	0.872000	0.30054	0.991000	0.47740	0.842000	0.47809	1.826000	0.39092	2.560000	0.86352	0.655000	0.94253	GGG	SIX4	-	NULL	ENSG00000100625		0.443	SIX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIX4	HGNC	protein_coding	OTTHUMT00000072397.2	-	0.00	44	0	C			61180669	-1	tier1	-	no_errors	ENST00000216513	ensembl	human	known	74_37	missense	36.21	37	21	SNP	0.336	A
SKIDA1	387640	genome.wustl.edu	37	10	21805483	21805484	+	In_Frame_Ins	INS	-	-	TCT			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr10:21805483_21805484insTCT	ENST00000449193.2	-	4	3520_3521	c.1268_1269insAGA	c.(1267-1269)gag>gaAGAg	p.423_423E>EE	SKIDA1_ENST00000444772.3_In_Frame_Ins_p.344_344E>EE|SKIDA1_ENST00000487107.1_5'Flank	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	342						nucleus (GO:0005634)											cctcctcttcctcctcctcctc	0.629																																																	0																																										SO:0001652	inframe_insertion	0			AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1268_1269insAGA	10.37:g.21805483_21805484insTCT	ENSP00000410041:p.Glu428dup		B1ANA5|Q6ZMX4|Q8N3C3	In_Frame_Ins	INS	pfam_Transform_Ski,superfamily_DNA-bd_dom_put	p.427in_frame_insE	ENST00000449193.2	37	c.1269_1268	CCDS44363.1	10																																																																																			SKIDA1	-	NULL	ENSG00000180592		0.629	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKIDA1	HGNC	protein_coding	OTTHUMT00000286950.2		0.00	46	0	-	NM_207371		21805484	-1	tier1		no_errors	ENST00000449193	ensembl	human	known	74_37	in_frame_ins	9.26	49	5	INS	0.410:0.996	TCT
SLC2A6	11182	genome.wustl.edu	37	9	136337224	136337224	+	Silent	SNP	G	G	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr9:136337224G>A	ENST00000371899.4	-	10	1520	c.1443C>T	c.(1441-1443)tgC>tgT	p.C481C	SLC2A6_ENST00000371897.4_Silent_p.C419C|SLC2A6_ENST00000485978.1_5'UTR	NM_017585.3	NP_060055.2	Q9UGQ3	GTR6_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 6	481					glucose transport (GO:0015758)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)			cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(3)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(145;8.47e-08)|Epithelial(140;9.37e-07)|all cancers(34;1.03e-05)		CGGGCACACAGCAGCCTGTGA	0.637																																																	0													95.0	92.0	93.0					9																	136337224		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ011372	CCDS6975.1, CCDS48052.1	9q34	2013-05-22			ENSG00000160326	ENSG00000160326		"""Solute carriers"""	11011	protein-coding gene	gene with protein product		606813				10970791	Standard	NM_001145099		Approved	GLUT9, GLUT6, HSA011372	uc004cee.3	Q9UGQ3	OTTHUMG00000020874	ENST00000371899.4:c.1443C>T	9.37:g.136337224G>A			A6NNU6|Q5SXD7|Q8NCC2	Silent	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,prints_Sugar/inositol_transpt,tigrfam_Sugar/inositol_transpt	p.C481	ENST00000371899.4	37	c.1443	CCDS6975.1	9																																																																																			SLC2A6	-	pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	ENSG00000160326		0.637	SLC2A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A6	HGNC	protein_coding	OTTHUMT00000054909.1		0.00	76	0	G	NM_017585		136337224	-1			no_errors	ENST00000371899	ensembl	human	known	74_37	silent	7.02	53	4	SNP	0.998	A
SLITRK4	139065	genome.wustl.edu	37	X	142718078	142718078	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chrX:142718078C>G	ENST00000381779.4	-	2	1072	c.847G>C	c.(847-849)Ggc>Cgc	p.G283R	SLITRK4_ENST00000356928.1_Missense_Mutation_p.G283R|SLITRK4_ENST00000338017.4_Missense_Mutation_p.G283R	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	283						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					GTGGTGTAGCCATTTTCCAGC	0.448																																																	0													138.0	120.0	126.0					X																	142718078		2203	4300	6503	SO:0001583	missense	0			BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.847G>C	X.37:g.142718078C>G	ENSP00000371198:p.Gly283Arg		Q5JXG3|Q8TCM8|Q96DL3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.G283R	ENST00000381779.4	37	c.847	CCDS14679.1	X	.	.	.	.	.	.	.	.	.	.	C	7.324	0.617458	0.14129	.	.	ENSG00000179542	ENST00000381779;ENST00000356928;ENST00000338017	T;T;T	0.44083	0.93;0.93;0.93	5.88	4.12	0.48240	.	0.262685	0.36303	N	0.002675	T	0.23611	0.0571	N	0.14661	0.345	0.44275	D	0.99713	B	0.09022	0.002	B	0.12156	0.007	T	0.04767	-1.0928	10	0.23302	T	0.38	-2.0458	8.3754	0.32440	0.0:0.7524:0.0:0.2476	.	283	Q8IW52	SLIK4_HUMAN	R	283	ENSP00000371198:G283R;ENSP00000349400:G283R;ENSP00000336627:G283R	ENSP00000336627:G283R	G	-	1	0	SLITRK4	142545744	0.987000	0.35691	1.000000	0.80357	0.945000	0.59286	1.492000	0.35594	0.627000	0.30340	0.600000	0.82982	GGC	SLITRK4	-	NULL	ENSG00000179542		0.448	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK4	HGNC	protein_coding	OTTHUMT00000058617.1	-	0.00	35	0	C	NM_173078		142718078	-1	tier1	-	no_errors	ENST00000338017	ensembl	human	known	74_37	missense	37.08	55	33	SNP	0.998	G
SLITRK5	26050	genome.wustl.edu	37	13	88327729	88327729	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr13:88327729C>T	ENST00000325089.6	+	2	305	c.86C>T	c.(85-87)gCt>gTt	p.A29V	SLITRK5_ENST00000400028.3_Intron	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	29					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					CTAGCGTTTGCTGTAACATCT	0.453																																																	0													150.0	128.0	136.0					13																	88327729		2203	4300	6503	SO:0001583	missense	0			AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.86C>T	13.37:g.88327729C>T	ENSP00000366283:p.Ala29Val		B3KNB8|B4DSH5|Q5VT81	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.A29V	ENST00000325089.6	37	c.86	CCDS9465.1	13	.	.	.	.	.	.	.	.	.	.	C	12.15	1.851510	0.32699	.	.	ENSG00000165300	ENST00000325089	T	0.57752	0.38	5.94	5.94	0.96194	.	0.194815	0.40728	N	0.001035	T	0.39600	0.1084	N	0.20685	0.6	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.16778	-1.0391	9	.	.	.	-1.9664	17.8571	0.88767	0.0:1.0:0.0:0.0	.	29	O94991	SLIK5_HUMAN	V	29	ENSP00000366283:A29V	.	A	+	2	0	SLITRK5	87125730	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.564000	0.67359	2.826000	0.97356	0.561000	0.74099	GCT	SLITRK5	-	NULL	ENSG00000165300		0.453	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK5	HGNC	protein_coding	OTTHUMT00000045416.3	-	0.00	35	0	C			88327729	+1	tier1	-	no_errors	ENST00000325089	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	T
SMC1B	27127	genome.wustl.edu	37	22	45802661	45802661	+	Silent	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr22:45802661G>T	ENST00000357450.4	-	3	383	c.384C>A	c.(382-384)gtC>gtA	p.V128V	SMC1B_ENST00000404354.3_Silent_p.V128V	NM_148674.3	NP_683515.3	Q8NDV3	SMC1B_HUMAN	structural maintenance of chromosomes 1B	128					meiotic nuclear division (GO:0007126)|sister chromatid cohesion (GO:0007062)	chromosome, centromeric region (GO:0000775)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		TTTGTGCTTTGACTATTATGC	0.303																																																	0													82.0	78.0	79.0					22																	45802661		1815	4067	5882	SO:0001819	synonymous_variant	0			AJ504806	CCDS43027.1, CCDS74876.1	22q13	2006-07-06	2006-07-06	2006-07-06	ENSG00000077935	ENSG00000077935		"""Structural maintenance of chromosomes proteins"""	11112	protein-coding gene	gene with protein product		608685	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 2 (yeast)"""	SMC1L2		10591208, 11564881	Standard	XM_005261566		Approved	bK268H5	uc003bgc.3	Q8NDV3	OTTHUMG00000151334	ENST00000357450.4:c.384C>A	22.37:g.45802661G>T			A0AV46|B0QY23|B0QY24|Q5TIC3|Q6ZUF9|Q9Y3G5	Silent	SNP	pfam_RecF/RecN/SMC_N,pfam_SMC_hinge,superfamily_P-loop_NTPase,superfamily_SMC_hinge,superfamily_t-SNARE,smart_SMC_hinge	p.V128	ENST00000357450.4	37	c.384	CCDS43027.1	22																																																																																			SMC1B	-	pfam_RecF/RecN/SMC_N,superfamily_P-loop_NTPase	ENSG00000077935		0.303	SMC1B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC1B	HGNC	protein_coding	OTTHUMT00000322256.2		0.00	45	0	G	NM_148674		45802661	-1			no_errors	ENST00000357450	ensembl	human	known	74_37	silent	5.21	91	5	SNP	0.969	T
SP2	6668	genome.wustl.edu	37	17	46005104	46005104	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr17:46005104G>A	ENST00000376741.4	+	7	1893	c.1756G>A	c.(1756-1758)Gag>Aag	p.E586K	AC003665.1_ENST00000585280.1_RNA|RP11-6N17.3_ENST00000584276.1_RNA|AC003665.1_ENST00000411573.2_RNA|AC003665.1_ENST00000433001.1_RNA|AC003665.1_ENST00000451140.2_RNA	NM_003110.5	NP_003101.3	Q02086	SP2_HUMAN	Sp2 transcription factor	586					cardiovascular system development (GO:0072358)|embryonic organ development (GO:0048568)|fibroblast proliferation (GO:0048144)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	13						CAAACGCTTCGAGTGCGCCCA	0.582																																																	0													80.0	63.0	69.0					17																	46005104		2202	4299	6501	SO:0001583	missense	0				CCDS11521.2	17q21.3-q22	2013-01-08			ENSG00000167182	ENSG00000167182		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11207	protein-coding gene	gene with protein product		601801				1341900, 9730617	Standard	NM_003110		Approved	KIAA0048	uc002imk.3	Q02086	OTTHUMG00000150196	ENST00000376741.4:c.1756G>A	17.37:g.46005104G>A	ENSP00000365931:p.Glu586Lys		A6NK74	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E586K	ENST00000376741.4	37	c.1756	CCDS11521.2	17	.	.	.	.	.	.	.	.	.	.	G	16.55	3.153566	0.57259	.	.	ENSG00000167182	ENST00000376741	T	0.19250	2.16	4.42	3.45	0.39498	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.111629	0.64402	D	0.000014	T	0.12305	0.0299	N	0.04162	-0.26	0.80722	D	1	D	0.55800	0.973	P	0.49887	0.625	T	0.08953	-1.0697	10	0.09843	T	0.71	.	12.1845	0.54229	0.0867:0.0:0.9133:0.0	.	586	Q02086	SP2_HUMAN	K	586	ENSP00000365931:E586K	ENSP00000365931:E586K	E	+	1	0	SP2	43360103	1.000000	0.71417	0.940000	0.37924	0.803000	0.45373	7.416000	0.80143	1.454000	0.47793	0.462000	0.41574	GAG	SP2	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000167182		0.582	SP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SP2	HGNC	protein_coding	OTTHUMT00000316777.1	-	0.00	32	0	G	NM_003110		46005104	+1	tier1	-	no_errors	ENST00000376741	ensembl	human	known	74_37	missense	23.08	30	9	SNP	1.000	A
SPATA7	55812	genome.wustl.edu	37	14	88859798	88859798	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr14:88859798G>A	ENST00000393545.4	+	3	445	c.156G>A	c.(154-156)atG>atA	p.M52I	SPATA7_ENST00000554102.1_3'UTR|SPATA7_ENST00000356583.5_Intron|SPATA7_ENST00000045347.7_Missense_Mutation_p.M52I|SPATA7_ENST00000556553.1_Intron	NM_018418.4	NP_060888.2	Q9P0W8	SPAT7_HUMAN	spermatogenesis associated 7	52					response to stimulus (GO:0050896)|visual perception (GO:0007601)					cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)	18						AGAATCACATGGCTGTTCACT	0.333																																																	0													30.0	28.0	29.0					14																	88859798		2203	4299	6502	SO:0001583	missense	0			AF144487	CCDS9883.1, CCDS32132.1	14q31.3	2011-02-17				ENSG00000042317			20423	protein-coding gene	gene with protein product		609868	"""Leber congenital amaurosis 3"""	LCA3		9799089, 19268277	Standard	NM_018418		Approved	HSD3	uc001xwq.3	Q9P0W8		ENST00000393545.4:c.156G>A	14.37:g.88859798G>A	ENSP00000377176:p.Met52Ile		Q5BKY5|Q8WX30|Q96HF3|Q9H0X0|Q9P0W7	Missense_Mutation	SNP	NULL	p.M52I	ENST00000393545.4	37	c.156	CCDS9883.1	14	.	.	.	.	.	.	.	.	.	.	G	23.3	4.398848	0.83120	.	.	ENSG00000042317	ENST00000393545;ENST00000045347	T;T	0.25414	1.8;1.8	5.63	5.63	0.86233	.	0.053662	0.64402	D	0.000003	T	0.52597	0.1744	M	0.73598	2.24	0.80722	D	1	D	0.67145	0.996	D	0.78314	0.991	T	0.52298	-0.8594	10	0.66056	D	0.02	-19.4443	16.967	0.86288	0.0:0.0:1.0:0.0	.	52	Q9P0W8	SPAT7_HUMAN	I	52	ENSP00000377176:M52I;ENSP00000045347:M52I	ENSP00000045347:M52I	M	+	3	0	SPATA7	87929551	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.150000	0.58098	2.814000	0.96858	0.591000	0.81541	ATG	SPATA7	-	NULL	ENSG00000042317		0.333	SPATA7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPATA7	HGNC	protein_coding	OTTHUMT00000410172.1	-	0.00	58	0	G			88859798	+1	tier1	-	no_errors	ENST00000393545	ensembl	human	known	74_37	missense	17.31	43	9	SNP	1.000	A
SPG11	80208	genome.wustl.edu	37	15	44881455	44881455	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr15:44881455G>C	ENST00000261866.7	-	28	4917	c.4901C>G	c.(4900-4902)tCt>tGt	p.S1634C	SPG11_ENST00000535302.2_Missense_Mutation_p.S1634C|SPG11_ENST00000427534.2_Missense_Mutation_p.S1634C|SPG11_ENST00000558253.1_5'UTR|SPG11_ENST00000558319.1_Missense_Mutation_p.S1634C	NM_025137.3	NP_079413.3	Q96JI7	SPTCS_HUMAN	spastic paraplegia 11 (autosomal recessive)	1634					cell death (GO:0008219)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	72		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		CTTACCATCAGAGAAGAGATG	0.378																																																	0													70.0	68.0	69.0					15																	44881455		2198	4298	6496	SO:0001583	missense	0				CCDS10112.1, CCDS53939.1	15q13-q15	2007-11-13			ENSG00000104133	ENSG00000104133			11226	protein-coding gene	gene with protein product	"""spatacsin"""	610844	"""KIAA1840"""	KIAA1840		10408536, 17322883	Standard	NM_001160227		Approved	FLJ21439	uc001ztx.3	Q96JI7	OTTHUMG00000131199	ENST00000261866.7:c.4901C>G	15.37:g.44881455G>C	ENSP00000261866:p.Ser1634Cys		A8KAX9|B9EK60|F5H3N6|Q4VC11|Q58G86|Q69YG6|Q6NW01|Q8N270|Q8TBU9|Q9H734	Missense_Mutation	SNP	NULL	p.S1634C	ENST00000261866.7	37	c.4901	CCDS10112.1	15	.	.	.	.	.	.	.	.	.	.	G	15.70	2.910610	0.52439	.	.	ENSG00000104133	ENST00000261866;ENST00000535302;ENST00000427534	T;T;T	0.79033	-1.23;-0.98;-0.97	5.53	2.56	0.30785	.	0.709345	0.13510	N	0.382588	T	0.81950	0.4931	M	0.62723	1.935	0.80722	D	1	D;D;D	0.71674	0.998;0.997;0.998	P;P;P	0.60682	0.878;0.846;0.878	T	0.76852	-0.2806	10	0.52906	T	0.07	.	6.8017	0.23754	0.1515:0.2748:0.5737:0.0	.	1634;1634;1634	C4B7M2;F5H3N6;Q96JI7	.;.;SPTCS_HUMAN	C	1634	ENSP00000261866:S1634C;ENSP00000445278:S1634C;ENSP00000396110:S1634C	ENSP00000261866:S1634C	S	-	2	0	SPG11	42668747	0.981000	0.34729	0.993000	0.49108	0.969000	0.65631	1.790000	0.38734	0.258000	0.21686	0.655000	0.94253	TCT	SPG11	-	NULL	ENSG00000104133		0.378	SPG11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPG11	HGNC	protein_coding	OTTHUMT00000253927.1	-	0.00	36	0	G			44881455	-1	tier1	-	no_errors	ENST00000261866	ensembl	human	known	74_37	missense	32.14	38	18	SNP	0.996	C
SPOCD1	90853	genome.wustl.edu	37	1	32266183	32266183	+	Silent	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr1:32266183G>T	ENST00000360482.2	-	4	1590	c.1461C>A	c.(1459-1461)gcC>gcA	p.A487A	SPOCD1_ENST00000257100.3_5'UTR|SPOCD1_ENST00000373648.2_Intron|SPOCD1_ENST00000533231.1_Silent_p.A487A	NM_144569.4	NP_653170.3	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1	487					negative regulation of phosphatase activity (GO:0010923)|transcription, DNA-templated (GO:0006351)					NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(1)|lung(7)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	37		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)		CGTGGCTGATGGCCCCCAGGA	0.657																																																	0													17.0	16.0	17.0					1																	32266183		2202	4300	6502	SO:0001819	synonymous_variant	0			AK058077	CCDS347.1, CCDS60066.1, CCDS72748.1	1p35.1	2014-06-13			ENSG00000134668	ENSG00000134668			26338	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 146"""					12477932	Standard	NM_144569		Approved	FLJ25348, PPP1R146	uc001bts.1	Q6ZMY3	OTTHUMG00000003879	ENST00000360482.2:c.1461C>A	1.37:g.32266183G>T			Q24JU3|Q6PI90|Q8N869|Q8N8U0|Q8NBC6|Q96LN6	Silent	SNP	pfam_TFIIS_cen_dom,pfam_SPOC_C,superfamily_TFIIS_cen_dom,smart_TFS2M	p.A487	ENST00000360482.2	37	c.1461	CCDS347.1	1																																																																																			SPOCD1	-	NULL	ENSG00000134668		0.657	SPOCD1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPOCD1	HGNC	protein_coding	OTTHUMT00000381912.1		0.00	76	0	G	NM_144569		32266183	-1			no_errors	ENST00000360482	ensembl	human	known	74_37	silent	5.21	91	5	SNP	0.220	T
SPTA1	6708	genome.wustl.edu	37	1	158606438	158606438	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr1:158606438G>A	ENST00000368147.4	-	37	5483	c.5303C>T	c.(5302-5304)gCc>gTc	p.A1768V		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1768					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TACCTGGATGGCAGGCTCATG	0.478																																																	0													90.0	90.0	90.0					1																	158606438		1875	4101	5976	SO:0001583	missense	0			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.5303C>T	1.37:g.158606438G>A	ENSP00000357129:p.Ala1768Val		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_hand_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.A1768V	ENST00000368147.4	37	c.5303	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	G	18.02	3.529085	0.64860	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.50548	0.74;0.74	5.27	4.36	0.52297	.	.	.	.	.	T	0.28665	0.0710	L	0.41356	1.27	0.42385	D	0.992505	B	0.29835	0.258	B	0.40165	0.321	T	0.12451	-1.0547	9	0.26408	T	0.33	.	11.2964	0.49280	0.0846:0.0:0.9154:0.0	.	1768	P02549	SPTA1_HUMAN	V	1768	ENSP00000357130:A1768V;ENSP00000357129:A1768V	ENSP00000357129:A1768V	A	-	2	0	SPTA1	156873062	1.000000	0.71417	0.998000	0.56505	0.899000	0.52679	6.838000	0.75359	1.465000	0.48006	0.655000	0.94253	GCC	SPTA1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000163554		0.478	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3		0.00	36	0	G	NM_003126		158606438	-1			no_errors	ENST00000368147	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	A
SRRM5	100170229	genome.wustl.edu	37	19	44116308	44116308	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr19:44116308T>C	ENST00000607544.1	+	3	357	c.35T>C	c.(34-36)aTg>aCg	p.M12T	SRRM5_ENST00000526798.1_Missense_Mutation_p.M27T|SRRM5_ENST00000417606.1_Missense_Mutation_p.M12T|ZNF428_ENST00000300811.3_Intron			B3KS81	SRRM5_HUMAN	serine/arginine repetitive matrix 5	12	Ser-rich.									endometrium(11)|kidney(2)|skin(1)|stomach(1)	15						AAGCCCAGTATGTCTCTGGCA	0.537																																																	0													243.0	219.0	226.0					19																	44116308		692	1591	2283	SO:0001583	missense	0			AK297891	CCDS46095.1	19q13.31	2013-09-20			ENSG00000226763	ENSG00000226763			37248	protein-coding gene	gene with protein product							Standard	NM_001145641		Approved		uc010xwr.2	B3KS81	OTTHUMG00000165480	ENST00000607544.1:c.35T>C	19.37:g.44116308T>C	ENSP00000476253:p.Met12Thr		B4DNF0	Missense_Mutation	SNP	NULL	p.M27T	ENST00000607544.1	37	c.80	CCDS46095.1	19	.	.	.	.	.	.	.	.	.	.	T	0.828	-0.746229	0.03065	.	.	ENSG00000226763	ENST00000526798;ENST00000417606	.	.	.	4.21	-4.94	0.03057	.	.	.	.	.	T	0.21962	0.0529	N	0.19112	0.55	0.18873	N	0.999983	B	0.17038	0.02	B	0.14023	0.01	T	0.24225	-1.0166	8	0.87932	D	0	.	3.8428	0.08922	0.3538:0.237:0.0:0.4092	.	12	B3KS81	SRRM5_HUMAN	T	27;12	.	ENSP00000414512:M12T	M	+	2	0	SRRM5	48808148	0.022000	0.18835	0.002000	0.10522	0.024000	0.10985	-0.295000	0.08298	-0.979000	0.03529	0.533000	0.62120	ATG	SRRM5	-	NULL	ENSG00000226763		0.537	SRRM5-001	KNOWN	alternative_5_UTR|upstream_ATG|basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	SRRM5	HGNC	protein_coding	OTTHUMT00000384398.2	-	0.00	83	0	T	NM_001145641		44116308	+1	tier1	-	no_errors	ENST00000526798	ensembl	human	known	74_37	missense	37.97	49	30	SNP	0.063	C
SSPO	23145	genome.wustl.edu	37	7	149486300	149486300	+	RNA	SNP	G	G	T	rs540269082		TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr7:149486300G>T	ENST00000378016.2	+	0	4276							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			TTGCAGCTCCGGCCACTGCCT	0.667																																																	0													20.0	25.0	23.0					7																	149486300		2166	4261	6427			0			AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149486300G>T			Q76B61	RNA	SNP	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			SSPO	-	-	ENSG00000197558		0.667	SSPO-202	KNOWN	basic	processed_transcript	SSPO	HGNC	processed_transcript		-	0.00	40	0	G			149486300	+1	tier1	-	no_errors	ENST00000262089	ensembl	human	known	74_37	rna	35.85	34	19	SNP	0.826	T
STAB1	23166	genome.wustl.edu	37	3	52551624	52551624	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr3:52551624T>C	ENST00000321725.6	+	44	4698	c.4622T>C	c.(4621-4623)cTg>cCg	p.L1541P		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	1541	EGF-like 13. {ECO:0000255|PROSITE- ProRule:PRU00076, ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		TGCGAGCTCCTGGACCCCTGC	0.627																																																	0													50.0	50.0	50.0					3																	52551624		2203	4300	6503	SO:0001583	missense	0			AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.4622T>C	3.37:g.52551624T>C	ENSP00000312946:p.Leu1541Pro		A7E297|Q8IUH0|Q8IUH1|Q93072	Missense_Mutation	SNP	pfam_FAS1_domain,pfam_Link,superfamily_C-type_lectin_fold,superfamily_FAS1_domain,smart_EG-like_dom,smart_EGF_laminin,smart_FAS1_domain,smart_EGF-like_Ca-bd_dom,smart_Link,pfscan_EG-like_dom,pfscan_FAS1_domain,pfscan_Link	p.L1541P	ENST00000321725.6	37	c.4622	CCDS33768.1	3	.	.	.	.	.	.	.	.	.	.	T	20.2	3.946656	0.73672	.	.	ENSG00000010327	ENST00000321725	D	0.85556	-2.0	4.28	4.28	0.50868	Epidermal growth factor-like, type 3 (1);	0.473941	0.20544	N	0.090253	D	0.86789	0.6017	L	0.55481	1.735	0.80722	D	1	D	0.59357	0.985	P	0.54460	0.753	D	0.87657	0.2532	10	0.87932	D	0	.	11.194	0.48703	0.0:0.0:0.0:1.0	.	1541	Q9NY15	STAB1_HUMAN	P	1541	ENSP00000312946:L1541P	ENSP00000312946:L1541P	L	+	2	0	STAB1	52526664	0.978000	0.34361	0.999000	0.59377	0.770000	0.43624	1.702000	0.37836	1.929000	0.55896	0.533000	0.62120	CTG	STAB1	-	pfscan_EG-like_dom	ENSG00000010327		0.627	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAB1	HGNC	protein_coding	OTTHUMT00000351380.2	-	0.00	74	0	T	NM_015136		52551624	+1	tier1	-	no_errors	ENST00000321725	ensembl	human	known	74_37	missense	6.15	61	4	SNP	0.996	C
STARD9	57519	genome.wustl.edu	37	15	42977858	42977858	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr15:42977858C>A	ENST00000290607.7	+	23	4139	c.4082C>A	c.(4081-4083)cCt>cAt	p.P1361H		NM_020759.2	NP_065810.2	Q9P2P6	STAR9_HUMAN	StAR-related lipid transfer (START) domain containing 9	1361					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spindle assembly (GO:0051225)	centriole (GO:0005814)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|lipid binding (GO:0008289)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						TGTCCAAGTCCTGATATGCAG	0.493																																																	0													48.0	38.0	41.0					15																	42977858		692	1590	2282	SO:0001583	missense	0			AB037721	CCDS53935.1	15q15.2	2013-10-16	2007-08-16		ENSG00000159433	ENSG00000159433		"""StAR-related lipid transfer (START) domain containing"""	19162	protein-coding gene	gene with protein product		614642	"""START domain containing 9"""			10718198	Standard	NM_020759		Approved	KIAA1300	uc010udj.2	Q9P2P6	OTTHUMG00000175799	ENST00000290607.7:c.4082C>A	15.37:g.42977858C>A	ENSP00000290607:p.Pro1361His		Q68DG2|Q6AI01|Q6ZWK0|Q9UF70	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_START_lipid-bd_dom,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,pfscan_START_lipid-bd_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.P1361H	ENST00000290607.7	37	c.4082	CCDS53935.1	15	.	.	.	.	.	.	.	.	.	.	C	15.46	2.839370	0.51057	.	.	ENSG00000159433	ENST00000290607	T	0.65178	-0.14	5.43	3.28	0.37604	.	0.334445	0.20252	U	0.096057	T	0.59445	0.2194	L	0.52573	1.65	0.09310	N	1	.	.	.	.	.	.	T	0.55166	-0.8183	8	0.87932	D	0	-8.7316	5.7988	0.18401	0.1888:0.675:0.0:0.1362	.	.	.	.	H	1361	ENSP00000290607:P1361H	ENSP00000290607:P1361H	P	+	2	0	STARD9	40765150	0.753000	0.28349	0.985000	0.45067	0.641000	0.38312	1.580000	0.36547	2.538000	0.85594	0.563000	0.77884	CCT	STARD9	-	NULL	ENSG00000159433		0.493	STARD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD9	HGNC	protein_coding	OTTHUMT00000431094.1		0.00	65	0	C			42977858	+1			no_errors	ENST00000290607	ensembl	human	known	74_37	missense	6.45	58	4	SNP	0.006	A
STIP1	10963	genome.wustl.edu	37	11	63953435	63953435	+	5'Flank	SNP	A	A	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr11:63953435A>T	ENST00000305218.4	+	0	0				STIP1_ENST00000538945.1_5'Flank|STIP1_ENST00000358794.5_Missense_Mutation_p.S47C|STIP1_ENST00000543847.1_5'Flank	NM_006819.2	NP_006810.1	P31948	STIP1_HUMAN	stress-induced phosphoprotein 1						response to stress (GO:0006950)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(4)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(1)|skin(1)	27						CCATTCGTGGAGCCTGAGATG	0.587																																																	0																																										SO:0001631	upstream_gene_variant	0			BC039299	CCDS8058.1, CCDS60827.1, CCDS60828.1	11q13	2014-01-13	2014-01-13		ENSG00000168439	ENSG00000168439		"""Tetratricopeptide (TTC) repeat domain containing"""	11387	protein-coding gene	gene with protein product	"""Hsp70/Hsp90-organizing protein"""	605063	"""stress-induced-phosphoprotein 1"""			1569099	Standard	NM_006819		Approved	HOP, STI1	uc001nyk.1	P31948	OTTHUMG00000167789		11.37:g.63953435A>T	Exception_encountered		B4DM70|F5H0T1|G3XAD8|Q3ZCU9|Q5TZU9	Missense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,smart_STI1_HS-bd,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.S47C	ENST00000305218.4	37	c.139	CCDS8058.1	11	.	.	.	.	.	.	.	.	.	.	A	11.89	1.773886	0.31411	.	.	ENSG00000168439	ENST00000358794	T	0.15487	2.42	4.01	2.85	0.33270	.	3.466780	0.00691	N	0.000726	T	0.20414	0.0491	.	.	.	0.18873	N	0.999984	.	.	.	.	.	.	T	0.26643	-1.0097	7	0.87932	D	0	.	6.4356	0.21821	0.8875:0.0:0.1125:0.0	.	.	.	.	C	47	ENSP00000351646:S47C	ENSP00000351646:S47C	S	+	1	0	STIP1	63710011	0.000000	0.05858	0.001000	0.08648	0.046000	0.14306	0.666000	0.25097	0.855000	0.35359	0.402000	0.26972	AGC	STIP1	-	NULL	ENSG00000168439		0.587	STIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STIP1	HGNC	protein_coding	OTTHUMT00000396289.2	-	0.00	53	0	A	NM_006819		63953435	+1	tier1	-	no_errors	ENST00000358794	ensembl	human	putative	74_37	missense	40.58	41	28	SNP	0.001	T
SUCLG1	8802	genome.wustl.edu	37	2	84650856	84650857	+	3'UTR	INS	-	-	T	rs527774382	byFrequency	TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr2:84650856_84650857insT	ENST00000393868.2	-	0	1264_1265				SUCLG1_ENST00000491123.1_5'UTR	NM_003849.3	NP_003840.2	P53597	SUCA_HUMAN	succinate-CoA ligase, alpha subunit						cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|succinyl-CoA metabolic process (GO:0006104)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|succinate-CoA ligase complex (GDP-forming) (GO:0045244)	ATP citrate synthase activity (GO:0003878)|cofactor binding (GO:0048037)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|poly(A) RNA binding (GO:0044822)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)|succinate-CoA ligase (GDP-forming) activity (GO:0004776)			kidney(4)|large_intestine(4)|lung(2)	10					Succinic acid(DB00139)	AGTTTTAGGAATTTTTTTTTTC	0.381																																					Ovarian(48;203 1101 37206 40305 50790)												0																																										SO:0001624	3_prime_UTR_variant	0			Z68204	CCDS1967.2	2p11.3	2008-02-05	2008-01-08		ENSG00000163541	ENSG00000163541	6.2.1.4		11449	protein-coding gene	gene with protein product		611224	"""succinate-CoA ligase, GDP-forming, alpha subunit"""			9128182	Standard	NM_003849		Approved		uc002son.3	P53597	OTTHUMG00000130023	ENST00000393868.2:c.*14->A	2.37:g.84650866_84650866dupT			Q9BWB0|Q9UNP6	RNA	INS	-	NULL	ENST00000393868.2	37	NULL	CCDS1967.2	2																																																																																			SUCLG1	-	-	ENSG00000163541		0.381	SUCLG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUCLG1	HGNC	protein_coding	OTTHUMT00000252298.2		0.00	28	0	-	NM_003849		84650857	-1	tier1		no_errors	ENST00000491123	ensembl	human	known	74_37	rna	10.34	26	3	INS	0.000:0.001	T
STK11IP	114790	genome.wustl.edu	37	2	220480764	220480764	+	Splice_Site	SNP	A	A	G			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr2:220480764A>G	ENST00000456909.1	+	25	3207		c.e25-1		STK11IP_ENST00000295641.10_Splice_Site			Q8N1F8	S11IP_HUMAN	serine/threonine kinase 11 interacting protein						protein localization (GO:0008104)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)	protein kinase binding (GO:0019901)			breast(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	23		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCGGTCTGCCAGGTGTCCCGG	0.617																																																	0													52.0	57.0	56.0					2																	220480764		2053	4197	6250	SO:0001630	splice_region_variant	0			AF450267	CCDS46521.1	2q35	2008-06-03			ENSG00000144589	ENSG00000144589			19184	protein-coding gene	gene with protein product	"""LKB1 interacting protein"""	607172				11741830	Standard	NM_052902		Approved	LIP1, KIAA1898, LKB1IP, STK11IP1	uc002vml.3	Q8N1F8	OTTHUMG00000059239	ENST00000456909.1:c.3118-1A>G	2.37:g.220480764A>G			Q8NAW9|Q8WXE4|Q96CN3|Q96PY9	Splice_Site	SNP	-	e24-2	ENST00000456909.1	37	c.3118-2		2	.	.	.	.	.	.	.	.	.	.	A	15.85	2.956193	0.53293	.	.	ENSG00000144589	ENST00000456909;ENST00000295641	.	.	.	4.51	4.51	0.55191	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.1567	0.42827	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	STK11IP	220189008	0.998000	0.40836	1.000000	0.80357	0.783000	0.44284	4.792000	0.62467	1.908000	0.55244	0.533000	0.62120	.	STK11IP	-	-	ENSG00000144589		0.617	STK11IP-001	NOVEL	basic|appris_principal	protein_coding	STK11IP	HGNC	protein_coding	OTTHUMT00000131432.1	-	0.00	26	0	A	NM_052902	Intron	220480764	+1	tier1	-	no_errors	ENST00000456909	ensembl	human	novel	74_37	splice_site	55.00	9	11	SNP	0.997	G
PHKG1	5260	genome.wustl.edu	37	7	56145799	56145799	+	IGR	SNP	A	A	G			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr7:56145799A>G	ENST00000297373.2	-	0	1431				SUMF2_ENST00000275607.9_Missense_Mutation_p.K111R|SUMF2_ENST00000413756.1_Missense_Mutation_p.K199R|SUMF2_ENST00000395436.2_Missense_Mutation_p.K203R|SUMF2_ENST00000342190.6_Missense_Mutation_p.K218R|SUMF2_ENST00000434526.2_Missense_Mutation_p.K218R|SUMF2_ENST00000437307.2_Missense_Mutation_p.K130R|SUMF2_ENST00000395435.2_Missense_Mutation_p.K134R	NM_001258460.1|NM_006213.4	NP_001245389.1|NP_006204.1	Q16816	PHKG1_HUMAN	phosphorylase kinase, gamma 1 (muscle)						carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)	ATP binding (GO:0005524)|phosphorylase kinase activity (GO:0004689)|tau-protein kinase activity (GO:0050321)			endometrium(1)|large_intestine(1)|lung(5)	7	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			CATCAGGGAAAGTTCCCCAAG	0.522																																					Melanoma(184;580 2064 5329 24177 35303)												0													125.0	109.0	115.0					7																	56145799		2203	4300	6503	SO:0001628	intergenic_variant	0			X80590	CCDS5525.1, CCDS59057.1	7p11.2	2009-07-10			ENSG00000164776	ENSG00000164776	2.7.11.19		8930	protein-coding gene	gene with protein product		172470		PHKG		8530014	Standard	NM_001258459		Approved		uc011kdb.2	Q16816	OTTHUMG00000023869		7.37:g.56145799A>G			B7Z1D0|F5H2S1|Q75LP5	Missense_Mutation	SNP	pfam_FGE_dom,superfamily_C-type_lectin_fold	p.K218R	ENST00000297373.2	37	c.653	CCDS5525.1	7	.	.	.	.	.	.	.	.	.	.	A	2.318	-0.356382	0.05138	.	.	ENSG00000129103	ENST00000395436;ENST00000434526;ENST00000275607;ENST00000395435;ENST00000413952;ENST00000342190;ENST00000437307;ENST00000413756;ENST00000451338	D;D;D;D;D;D;D;D;D	0.94687	-3.49;-3.49;-3.49;-3.49;-3.49;-3.49;-3.49;-3.49;-3.49	5.32	-1.59	0.08453	C-type lectin fold (1);Formylglycine-generating sulphatase enzyme domain (2);	1.032470	0.07601	N	0.923713	D	0.85940	0.5814	N	0.17082	0.46	0.09310	N	1	B;B;B;B;B	0.19331	0.035;0.008;0.0;0.001;0.016	B;B;B;B;B	0.15484	0.013;0.006;0.001;0.004;0.012	T	0.72204	-0.4361	10	0.12766	T	0.61	-17.1671	7.0417	0.25023	0.5196:0.3432:0.1371:0.0	.	115;203;221;199;218	Q8NBJ7-5;A8MXB9;E7EMF9;Q8NBJ7;F8WA42	.;.;.;SUMF2_HUMAN;.	R	203;218;111;134;221;218;130;199;216	ENSP00000378824:K203R;ENSP00000400922:K218R;ENSP00000275607:K111R;ENSP00000378823:K134R;ENSP00000414434:K221R;ENSP00000341938:K218R;ENSP00000415989:K130R;ENSP00000406445:K199R;ENSP00000410796:K216R	ENSP00000275607:K111R	K	+	2	0	SUMF2	56113293	0.000000	0.05858	0.282000	0.24776	0.065000	0.16274	0.162000	0.16501	-0.476000	0.06842	-1.431000	0.01090	AAG	SUMF2	-	pfam_FGE_dom,superfamily_C-type_lectin_fold	ENSG00000129103		0.522	PHKG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUMF2	HGNC	protein_coding	OTTHUMT00000251587.1	-	0.00	44	0	A	NM_006213		56145799	+1	tier1	-	no_errors	ENST00000342190	ensembl	human	known	74_37	missense	37.50	35	21	SNP	0.001	G
SUN2	25777	genome.wustl.edu	37	22	39138309	39138310	+	Frame_Shift_Ins	INS	-	-	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr22:39138309_39138310insA	ENST00000405510.1	-	10	1422_1423	c.1064_1065insT	c.(1063-1065)atcfs	p.I355fs	RP3-508I15.21_ENST00000609212.1_RNA|RP3-508I15.22_ENST00000607991.1_RNA|SUN2_ENST00000216064.4_Frame_Shift_Ins_p.I355fs|SUN2_ENST00000405018.1_Frame_Shift_Ins_p.I376fs|SUN2_ENST00000406622.1_Frame_Shift_Ins_p.I355fs|SUN2_ENST00000411587.2_Frame_Shift_Ins_p.I344fs|RP3-508I15.14_ENST00000416406.1_RNA	NM_001199580.1	NP_001186509.1	Q9UH99	SUN2_HUMAN	Sad1 and UNC84 domain containing 2	355					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|mitotic spindle organization (GO:0007052)|nuclear envelope organization (GO:0006998)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)	condensed nuclear chromosome (GO:0000794)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nuclear inner membrane (GO:0005637)|nuclear membrane (GO:0031965)|SUN-KASH complex (GO:0034993)	identical protein binding (GO:0042802)|lamin binding (GO:0005521)|microtubule binding (GO:0008017)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|skin(2)|stomach(1)	15						CTCCTACCTGGATGCGAGCAGC	0.604																																																	0																																										SO:0001589	frameshift_variant	0			AF202723	CCDS13978.1, CCDS56231.1	22q12-q13	2010-05-18	2010-05-18	2010-01-27	ENSG00000100242	ENSG00000100242			14210	protein-coding gene	gene with protein product		613569	"""unc-84 homolog B (C. elegans)"""	UNC84B		10508607, 10375507	Standard	NM_015374		Approved		uc010gxq.2	Q9UH99	OTTHUMG00000151031	ENST00000405510.1:c.1065dupT	22.37:g.39138310_39138310dupA	ENSP00000385740:p.Ile355fs		B0QY62|O75156|Q2NKN8|Q2T9F7|Q504T5|Q6B4H1|Q7Z3E3	Frame_Shift_Ins	INS	pfam_Sad1_UNC_C,superfamily_Galactose-bd-like	p.Q356fs	ENST00000405510.1	37	c.1065_1064	CCDS13978.1	22																																																																																			SUN2	-	NULL	ENSG00000100242		0.604	SUN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUN2	HGNC	protein_coding	OTTHUMT00000321057.1		0.00	25	0	-	XM_039332		39138310	-1	tier1		no_errors	ENST00000216064	ensembl	human	known	74_37	frame_shift_ins	70.37	8	19	INS	0.974:0.944	A
TAF1B	9014	genome.wustl.edu	37	2	10073979	10073979	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr2:10073979C>G	ENST00000263663.5	+	15	1821	c.1633C>G	c.(1633-1635)Ctc>Gtc	p.L545V	RP11-95D17.1_ENST00000602458.1_lincRNA|TAF1B_ENST00000396242.3_Missense_Mutation_p.L290V	NM_005680.2	NP_005671	Q53T94	TAF1B_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa	545					gene expression (GO:0010467)|RNA polymerase I transcriptional preinitiation complex assembly at the promoter for the nuclear large rRNA transcript (GO:0001189)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RNA polymerase I core factor complex (GO:0070860)	metal ion binding (GO:0046872)|RNA polymerase I CORE element sequence-specific DNA binding (GO:0001164)|RNA polymerase I CORE element sequence-specific DNA binding transcription factor recruiting transcription factor activity (GO:0001187)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TBP-class protein binding (GO:0017025)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	14	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					TATACTAAATCTCTTCTCCTT	0.313																																																	0													66.0	72.0	70.0					2																	10073979		2202	4299	6501	SO:0001583	missense	0			L39061	CCDS33143.1	2p25	2008-06-02	2002-08-29		ENSG00000115750	ENSG00000115750			11533	protein-coding gene	gene with protein product		604904	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kD"""			7801123	Standard	NM_005680		Approved	TAFI63, SL1, RAF1B, RAFI63	uc002qzz.3	Q53T94	OTTHUMG00000151673	ENST00000263663.5:c.1633C>G	2.37:g.10073979C>G	ENSP00000263663:p.Leu545Val		B4DI42|F8WD72|Q15574|Q8WVC3	Missense_Mutation	SNP	pfam_TF_Rrn7	p.L545V	ENST00000263663.5	37	c.1633	CCDS33143.1	2	.	.	.	.	.	.	.	.	.	.	C	14.07	2.424257	0.43020	.	.	ENSG00000115750	ENST00000263663;ENST00000396242	T;T	0.45668	0.89;0.89	5.64	1.39	0.22231	.	0.117742	0.56097	D	0.000026	T	0.28863	0.0716	M	0.65498	2.005	0.33581	D	0.599869	P	0.48294	0.908	B	0.34489	0.184	T	0.42413	-0.9453	9	.	.	.	-3.5715	3.2253	0.06730	0.3173:0.4505:0.1449:0.0873	.	545	Q53T94	TAF1B_HUMAN	V	545;290	ENSP00000263663:L545V;ENSP00000379542:L290V	.	L	+	1	0	TAF1B	9991430	0.992000	0.36948	0.969000	0.41365	0.994000	0.84299	1.212000	0.32394	0.691000	0.31592	0.462000	0.41574	CTC	TAF1B	-	NULL	ENSG00000115750		0.313	TAF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1B	HGNC	protein_coding	OTTHUMT00000323426.2	-	0.00	37	0	C	NM_005680		10073979	+1	tier1	-	no_errors	ENST00000263663	ensembl	human	known	74_37	missense	14.71	58	10	SNP	0.986	G
TDRD1	56165	genome.wustl.edu	37	10	115981169	115981169	+	Missense_Mutation	SNP	A	A	G	rs376481564		TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr10:115981169A>G	ENST00000369280.1	+	20	3284	c.2824A>G	c.(2824-2826)Ata>Gta	p.I942V	TDRD1_ENST00000369282.1_Missense_Mutation_p.I942V|TDRD1_ENST00000251864.2_Missense_Mutation_p.I942V|TDRD1_ENST00000369281.2_Missense_Mutation_p.I828V|TDRD1_ENST00000422662.1_Missense_Mutation_p.I546V			Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	942					DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ cell development (GO:0007281)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)	metal ion binding (GO:0046872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(5)	48		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		GGATAAAACTATACAAGCAAA	0.363																																																	0								A	VAL/ILE	0,4406		0,0,2203	101.0	103.0	102.0		2824	-0.6	0.3	10		102	2,8598	2.2+/-6.3	0,2,4298	no	missense	TDRD1	NM_198795.1	29	0,2,6501	GG,GA,AA		0.0233,0.0,0.0154	benign	942/1190	115981169	2,13004	2203	4300	6503	SO:0001583	missense	0			AF285606	CCDS7588.1	10q26.11	2013-01-23			ENSG00000095627	ENSG00000095627		"""Tudor domain containing"""	11712	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.1"""	605796				11279525	Standard	NM_198795		Approved	CT41.1	uc001lbg.1	Q9BXT4	OTTHUMG00000019083	ENST00000369280.1:c.2824A>G	10.37:g.115981169A>G	ENSP00000358286:p.Ile942Val		A6NEN3|A6NMN2|B3KVI4|B4E2L5|D3DRC2|Q4G0Y8|Q6P518|Q9H7B3	Missense_Mutation	SNP	pfam_Tudor,pfam_Znf_MYND,smart_Tudor,pfscan_Tudor,pfscan_Znf_MYND	p.I942V	ENST00000369280.1	37	c.2824		10	.	.	.	.	.	.	.	.	.	.	A	0.005	-2.166245	0.00318	0.0	2.33E-4	ENSG00000095627	ENST00000369282;ENST00000251864;ENST00000369281;ENST00000422662;ENST00000369280	T;T;T;T;T	0.09538	2.97;2.97;2.97;2.97;2.97	5.92	-0.586	0.11694	Maternal tudor protein (1);	0.798511	0.11928	N	0.515947	T	0.02193	0.0068	N	0.01242	-0.935	0.09310	N	0.999999	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.08055	0.003;0.003;0.002;0.002;0.001	T	0.42582	-0.9443	10	0.02654	T	1	-6.0444	2.1893	0.03894	0.3505:0.1144:0.4178:0.1173	.	546;942;828;942;828	Q9BXT4-4;Q9BXT4;B7WPM2;Q9BXT4-3;Q9BXT4-2	.;TDRD1_HUMAN;.;.;.	V	942;942;828;546;942	ENSP00000358288:I942V;ENSP00000251864:I942V;ENSP00000358287:I828V;ENSP00000402794:I546V;ENSP00000358286:I942V	ENSP00000251864:I942V	I	+	1	0	TDRD1	115971159	0.000000	0.05858	0.308000	0.25141	0.056000	0.15407	-0.598000	0.05706	-0.135000	0.11495	-0.137000	0.14449	ATA	TDRD1	-	pfam_Tudor	ENSG00000095627		0.363	TDRD1-001	KNOWN	basic	protein_coding	TDRD1	HGNC	protein_coding	OTTHUMT00000050457.2	-	0.00	28	0	A			115981169	+1	tier1	-	no_errors	ENST00000251864	ensembl	human	known	74_37	missense	29.51	43	18	SNP	0.287	G
TECPR2	9895	genome.wustl.edu	37	14	102963419	102963419	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr14:102963419A>G	ENST00000359520.7	+	18	4119	c.3893A>G	c.(3892-3894)gAg>gGg	p.E1298G		NM_014844.3	NP_055659.2	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2	1298					autophagy (GO:0006914)|cell death (GO:0008219)					breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(21)|ovary(2)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	50						GGGATCACCGAGGAGATGCCT	0.672																																																	0													92.0	79.0	83.0					14																	102963419		2203	4300	6503	SO:0001583	missense	0			AB019441	CCDS32162.1, CCDS58337.1	14q32.33	2009-02-27	2009-02-27	2009-02-27		ENSG00000196663			19957	protein-coding gene	gene with protein product		615000	"""KIAA0329"""	KIAA0329		9205841	Standard	NM_014844		Approved		uc001ylw.2	O15040		ENST00000359520.7:c.3893A>G	14.37:g.102963419A>G	ENSP00000352510:p.Glu1298Gly		A5PKY3|A6NFY9|A7E2X3|H0YMM9|Q9UEG6	Missense_Mutation	SNP	pfam_Beta-propeller_rpt_TECPR,superfamily_WD40_repeat_dom,superfamily_RCC1/BLIP-II,smart_WD40_repeat,smart_Beta-propeller_rpt_TECPR	p.E1298G	ENST00000359520.7	37	c.3893	CCDS32162.1	14	.	.	.	.	.	.	.	.	.	.	A	29.0	4.965514	0.92855	.	.	ENSG00000196663	ENST00000359520	T	0.15952	2.38	5.71	5.71	0.89125	.	0.052728	0.85682	D	0.000000	T	0.35624	0.0938	L	0.51422	1.61	0.80722	D	1	P;D	0.67145	0.892;0.996	P;D	0.68765	0.575;0.96	T	0.04191	-1.0970	10	0.62326	D	0.03	.	14.8057	0.69952	1.0:0.0:0.0:0.0	.	481;1298	B4DSD3;O15040	.;TCPR2_HUMAN	G	1298	ENSP00000352510:E1298G	ENSP00000352510:E1298G	E	+	2	0	TECPR2	102033172	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	8.656000	0.91102	2.180000	0.69256	0.379000	0.24179	GAG	TECPR2	-	pfam_Beta-propeller_rpt_TECPR	ENSG00000196663		0.672	TECPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TECPR2	HGNC	protein_coding	OTTHUMT00000415056.2	-	0.00	80	0	A	NM_014844		102963419	+1	tier1	-	no_errors	ENST00000359520	ensembl	human	known	74_37	missense	47.87	49	45	SNP	1.000	G
TENM4	26011	genome.wustl.edu	37	11	78381002	78381002	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr11:78381002T>C	ENST00000278550.7	-	32	6850	c.6388A>G	c.(6388-6390)Att>Gtt	p.I2130V		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	2130					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										ATCTGGTTAATGTCATAGTAA	0.463																																																	0													65.0	63.0	64.0					11																	78381002		2107	4227	6334	SO:0001583	missense	0			AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.6388A>G	11.37:g.78381002T>C	ENSP00000278550:p.Ile2130Val		A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,pfam_YD,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.I2130V	ENST00000278550.7	37	c.6388	CCDS44688.1	11	.	.	.	.	.	.	.	.	.	.	T	17.19	3.327114	0.60743	.	.	ENSG00000149256	ENST00000278550;ENST00000530738	D;T	0.89415	-2.51;0.97	4.69	4.69	0.59074	.	0.000000	0.85682	D	0.000000	D	0.92844	0.7724	M	0.71581	2.175	0.58432	D	0.999994	P	0.48640	0.913	P	0.61592	0.891	D	0.92611	0.6099	9	.	.	.	.	14.6241	0.68608	0.0:0.0:0.0:1.0	.	2130	Q6N022	TEN4_HUMAN	V	2130;594	ENSP00000278550:I2130V;ENSP00000431711:I594V	.	I	-	1	0	ODZ4	78058650	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.825000	0.86693	2.100000	0.63781	0.533000	0.62120	ATT	TENM4	-	NULL	ENSG00000149256		0.463	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM4	HGNC	protein_coding	OTTHUMT00000391406.2	-	0.00	37	0	T			78381002	-1	tier1	-	no_errors	ENST00000278550	ensembl	human	known	74_37	missense	48.00	13	12	SNP	1.000	C
TGDS	23483	genome.wustl.edu	37	13	95248249	95248249	+	Intron	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr13:95248249G>T	ENST00000261296.5	-	1	207				TGDS_ENST00000498294.1_5'UTR	NM_014305.2	NP_055120.1	O95455	TGDS_HUMAN	TDP-glucose 4,6-dehydratase						nucleotide-sugar metabolic process (GO:0009225)		coenzyme binding (GO:0050662)|dTDP-glucose 4,6-dehydratase activity (GO:0008460)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	8	all_neural(89;0.0684)|Medulloblastoma(90;0.163)					CAGAGCTGCGGGAAAAGGTAG	0.572																																																	0													11.0	19.0	17.0					13																	95248249		691	1591	2282	SO:0001627	intron_variant	0			AF048686	CCDS9471.1	13q32.1	2012-02-22			ENSG00000088451	ENSG00000088451	4.2.1.46	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	20324	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 2E, member 1"""					19027726	Standard	NM_014305		Approved	TDPGD, SDR2E1	uc001vlw.3	O95455	OTTHUMG00000046308	ENST00000261296.5:c.86+55C>A	13.37:g.95248249G>T			Q05DQ3|Q2TU31|Q5T3Z2|Q9H1T9	RNA	SNP	-	NULL	ENST00000261296.5	37	NULL	CCDS9471.1	13																																																																																			TGDS	-	-	ENSG00000088451		0.572	TGDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGDS	HGNC	protein_coding	OTTHUMT00000106904.2	-	0.00	109	0	G	NM_014305		95248249	-1	tier1	-	no_errors	ENST00000498294	ensembl	human	known	74_37	rna	5.97	62	4	SNP	0.026	T
TFDP1	7027	genome.wustl.edu	37	13	114294708	114294708	+	3'UTR	SNP	G	G	C			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr13:114294708G>C	ENST00000375370.5	+	0	1571				TFDP1_ENST00000538138.1_3'UTR	NM_007111.4	NP_009042.1	Q14186	TFDP1_HUMAN	transcription factor Dp-1						anoikis (GO:0043276)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|epidermis development (GO:0008544)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|Notch signaling pathway (GO:0007219)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA biosynthetic process (GO:2000278)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(10)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	26	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.132)|all_epithelial(44;0.0731)|all_lung(25;0.149)|Breast(118;0.153)	all cancers(43;0.0576)			ATTGAATTTAGATATGCACCT	0.388										TSP Lung(29;0.18)																																							0																																										SO:0001624	3_prime_UTR_variant	0			BC011685	CCDS9538.1	13q34	2008-07-18			ENSG00000198176	ENSG00000198176			11749	protein-coding gene	gene with protein product		189902				8413592, 9027491	Standard	NM_007111		Approved	Dp-1, DRTF1, DP1	uc001vtw.3	Q14186	OTTHUMG00000017388	ENST00000375370.5:c.*126G>C	13.37:g.114294708G>C			B4DLQ9|Q5JSB4|Q8IZL5	RNA	SNP	-	NULL	ENST00000375370.5	37	NULL	CCDS9538.1	13																																																																																			TFDP1	-	-	ENSG00000198176		0.388	TFDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFDP1	HGNC	protein_coding	OTTHUMT00000045918.3	-	0.00	11	0	G	NM_007111		114294708	+1	tier1	-	no_errors	ENST00000494812	ensembl	human	known	74_37	rna	60.00	4	6	SNP	0.024	C
TGM3	7053	genome.wustl.edu	37	20	2312957	2312957	+	Splice_Site	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr20:2312957G>T	ENST00000381458.5	+	10	1705		c.e10+1			NM_003245.3	NP_003236.3	Q08188	TGM3_HUMAN	transglutaminase 3						cell envelope organization (GO:0043163)|cellular protein modification process (GO:0006464)|hair follicle morphogenesis (GO:0031069)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein tetramerization (GO:0051262)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	calcium ion binding (GO:0005509)|catalytic activity (GO:0003824)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)|transferase activity, transferring acyl groups (GO:0016746)			breast(3)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(11)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	39					L-Glutamine(DB00130)	CCTGAGGAAGGTAACGCATCC	0.562																																																	0													85.0	66.0	73.0					20																	2312957		2203	4300	6503	SO:0001630	splice_region_variant	0			L10386	CCDS33435.1	20q11.2	2013-05-02	2013-05-02		ENSG00000125780	ENSG00000125780	2.3.2.13	"""Transglutaminases"""	11779	protein-coding gene	gene with protein product	"""E polypeptide, protein-glutamine-gamma-glutamyltransferase"""	600238	"""transglutaminase 3 (E polypeptide, protein-glutamine-gamma-glutamyltransferase)"""			7851911, 9452468	Standard	NM_003245		Approved	TGE	uc002wfx.4	Q08188	OTTHUMG00000031690	ENST00000381458.5:c.1642+1G>T	20.37:g.2312957G>T			A8K5N6|B2RCR6|D3DVX1|O95933|Q32ML9|Q32MM0	Splice_Site	SNP	-	e10+1	ENST00000381458.5	37	c.1642+1	CCDS33435.1	20	.	.	.	.	.	.	.	.	.	.	G	13.82	2.350911	0.41599	.	.	ENSG00000125780	ENST00000381458	.	.	.	5.08	5.08	0.68730	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0023	0.80306	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TGM3	2260957	1.000000	0.71417	1.000000	0.80357	0.327000	0.28475	5.804000	0.69135	2.640000	0.89533	0.655000	0.94253	.	TGM3	-	-	ENSG00000125780		0.562	TGM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM3	HGNC	protein_coding	OTTHUMT00000077579.2		0.00	17	0	G	NM_003245	Intron	2312957	+1			no_errors	ENST00000381458	ensembl	human	known	74_37	splice_site	8.57	32	3	SNP	1.000	T
THBS2	7058	genome.wustl.edu	37	6	169637866	169637866	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr6:169637866G>C	ENST00000366787.3	-	9	1403	c.1154C>G	c.(1153-1155)tCt>tGt	p.S385C	XXyac-YX65C7_A.2_ENST00000444188.1_RNA	NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	385	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		TGCCCACGGAGACCAGCCCTC	0.657																																					Esophageal Squamous(91;219 1934 18562 44706)												0													74.0	57.0	63.0					6																	169637866		2203	4299	6502	SO:0001583	missense	0				CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.1154C>G	6.37:g.169637866G>C	ENSP00000355751:p.Ser385Cys		A6H8N1|A7E232|Q5RI52	Missense_Mutation	SNP	pfam_Thrombospondin_C,pfam_Thrombospondin_1_rpt,pfam_VWF_C,pfam_Thrombospondin_3-like_rpt,pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Thrombospondin_1_rpt,smart_Laminin_G,smart_VWF_C,smart_Thrombospondin_1_rpt,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Thrombospondin_1_rpt,pfscan_VWF_C	p.S385C	ENST00000366787.3	37	c.1154	CCDS34574.1	6	.	.	.	.	.	.	.	.	.	.	g	20.9	4.068782	0.76301	.	.	ENSG00000186340	ENST00000366787	T	0.61274	0.12	4.75	4.75	0.60458	.	0.000000	0.39687	U	0.001291	T	0.73776	0.3630	H	0.98407	4.225	0.52501	D	0.999957	P	0.35844	0.524	B	0.42112	0.376	T	0.83239	-0.0059	10	0.87932	D	0	-32.2284	17.77	0.88489	0.0:0.0:1.0:0.0	.	385	P35442	TSP2_HUMAN	C	385	ENSP00000355751:S385C	ENSP00000355751:S385C	S	-	2	0	THBS2	169379791	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	9.193000	0.94954	2.181000	0.69327	0.552000	0.68991	TCT	THBS2	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000186340		0.657	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THBS2	HGNC	protein_coding	OTTHUMT00000105439.1	-	0.00	85	0	G	NM_003247		169637866	-1	tier1	-	no_errors	ENST00000366787	ensembl	human	known	74_37	missense	15.85	69	13	SNP	1.000	C
TMBIM4	51643	genome.wustl.edu	37	12	66539653	66539653	+	Silent	SNP	T	T	C			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr12:66539653T>C	ENST00000358230.3	-	5	552	c.432A>G	c.(430-432)caA>caG	p.Q144Q	TMBIM4_ENST00000544599.1_5'UTR|TMBIM4_ENST00000398033.4_Silent_p.Q144Q|TMBIM4_ENST00000286424.7_Silent_p.Q191Q|TMBIM4_ENST00000539652.1_Silent_p.Q144Q|TMBIM4_ENST00000542724.1_Silent_p.Q113Q|TMBIM4_ENST00000556010.1_Silent_p.Q144Q	NM_016056.2	NP_057140.2	Q9HC24	LFG4_HUMAN	transmembrane BAX inhibitor motif containing 4	144					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|regulation of calcium-mediated signaling (GO:0050848)	Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(4)|ovary(1)|prostate(2)	9				GBM - Glioblastoma multiforme(28;0.0745)		CCTTCTTAGATTGTAGAGTAT	0.289																																																	0													67.0	65.0	65.0					12																	66539653		1799	4060	5859	SO:0001819	synonymous_variant	0			AF113127	CCDS41805.1, CCDS61187.1, CCDS73493.1	12q14.3	2014-05-09			ENSG00000155957	ENSG00000155957			24257	protein-coding gene	gene with protein product						11042152, 10810093	Standard	NM_001282609		Approved	CGI-119, S1R, ZPRO, LFG4, GAAP	uc001stc.3	Q9HC24	OTTHUMG00000168973	ENST00000358230.3:c.432A>G	12.37:g.66539653T>C			Q542Z6|Q9UHY5|Q9Y3C2	Silent	SNP	pfam_Bax_inhibitor_1-related	p.Q144	ENST00000358230.3	37	c.432	CCDS41805.1	12																																																																																			TMBIM4	-	pfam_Bax_inhibitor_1-related	ENSG00000155957		0.289	TMBIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMBIM4	HGNC	protein_coding	OTTHUMT00000401832.2	-	0.00	53	0	T	NM_016056		66539653	-1	tier1	-	no_errors	ENST00000358230	ensembl	human	known	74_37	silent	24.78	83	28	SNP	1.000	C
TP53	7157	genome.wustl.edu	37	17	7578239	7578239	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr17:7578239C>A	ENST00000269305.4	-	6	799	c.610G>T	c.(610-612)Gag>Tag	p.E204*	TP53_ENST00000445888.2_Nonsense_Mutation_p.E204*|TP53_ENST00000455263.2_Nonsense_Mutation_p.E204*|TP53_ENST00000359597.4_Nonsense_Mutation_p.E204*|TP53_ENST00000413465.2_Nonsense_Mutation_p.E204*|TP53_ENST00000420246.2_Nonsense_Mutation_p.E204*|TP53_ENST00000574684.1_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	204	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		E -> A (in sporadic cancers; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> Q (in a sporadic cancer; somatic mutation).|E -> V (in a sporadic cancer; somatic mutation).|VE -> LV (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E204*(33)|p.0?(8)|p.?(5)|p.E72*(3)|p.E111*(3)|p.E204K(2)|p.E204fs*43(2)|p.E204Q(1)|p.E204fs*4(1)|p.V203_E204>V*(1)|p.V203_E204>LV(1)|p.E204fs*39(1)|p.G199fs*42(1)|p.E204_N210delEYLDDRN(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCCAAATACTCCACACGCAAA	0.542		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	63	Substitution - Nonsense(39)|Whole gene deletion(8)|Deletion - Frameshift(5)|Unknown(5)|Substitution - Missense(3)|Complex - compound substitution(2)|Deletion - In frame(1)	lung(15)|haematopoietic_and_lymphoid_tissue(7)|large_intestine(6)|upper_aerodigestive_tract(5)|biliary_tract(5)|NS(5)|breast(4)|bone(4)|oesophagus(3)|ovary(3)|central_nervous_system(2)|stomach(1)|liver(1)|urinary_tract(1)|pancreas(1)											133.0	118.0	123.0					17																	7578239		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.610G>T	17.37:g.7578239C>A	ENSP00000269305:p.Glu204*		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.E204*	ENST00000269305.4	37	c.610	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	14.28	2.489037	0.44249	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.41	-0.604	0.11626	.	0.445020	0.26082	N	0.026458	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	-5.2849	1.4244	0.02320	0.133:0.2829:0.3261:0.258	.	.	.	.	X	204;204;204;204;204;204;193;111;72;111;72	.	ENSP00000269305:E204X	E	-	1	0	TP53	7518964	0.600000	0.26899	0.018000	0.16275	0.030000	0.12068	0.945000	0.29056	-0.004000	0.14419	0.655000	0.94253	GAG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	65	0	C	NM_000546		7578239	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	nonsense	67.21	20	41	SNP	0.045	A
TMEM97	27346	genome.wustl.edu	37	17	26652649	26652649	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr17:26652649A>G	ENST00000226230.6	+	2	392	c.247A>G	c.(247-249)Att>Gtt	p.I83V	TMEM97_ENST00000582113.1_Missense_Mutation_p.I83V|TMEM97_ENST00000336687.6_5'UTR|TMEM97_ENST00000583381.1_5'UTR	NM_014573.2	NP_055388.2	Q5BJF2	TMM97_HUMAN	transmembrane protein 97	83					cholesterol homeostasis (GO:0042632)|regulation of cell growth (GO:0001558)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)				endometrium(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	6	all_lung(13;0.000238)|Lung NSC(42;0.000789)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)		TTTCTTTCCCATTGCAACGTA	0.448																																																	0													137.0	130.0	133.0					17																	26652649		1922	4152	6074	SO:0001583	missense	0			BC091504	CCDS11226.2	17q11.2	2014-01-28			ENSG00000109084	ENSG00000109084			28106	protein-coding gene	gene with protein product		612912				7694637, 15375745	Standard	NM_014573		Approved	MAC30	uc002hat.3	Q5BJF2	OTTHUMG00000132497	ENST00000226230.6:c.247A>G	17.37:g.26652649A>G	ENSP00000226230:p.Ile83Val		B4DS02|Q07823	Missense_Mutation	SNP	pfam_Transmembrane_6/97,pirsf_Transmembrane_6/97	p.I83V	ENST00000226230.6	37	c.247	CCDS11226.2	17	.	.	.	.	.	.	.	.	.	.	A	2.873	-0.233648	0.05983	.	.	ENSG00000109084	ENST00000226230	.	.	.	5.91	-11.8	0.00035	.	0.631167	0.17495	N	0.172205	T	0.16642	0.0400	N	0.04686	-0.185	0.58432	D	0.999991	B	0.11235	0.004	B	0.10450	0.005	T	0.49643	-0.8918	9	0.05351	T	0.99	1.2551	8.5498	0.33444	0.2039:0.0:0.263:0.5331	.	83	Q5BJF2	TMM97_HUMAN	V	83	.	ENSP00000226230:I83V	I	+	1	0	TMEM97	23676776	0.000000	0.05858	0.000000	0.03702	0.917000	0.54804	-3.022000	0.00642	-3.066000	0.00255	-1.407000	0.01130	ATT	TMEM97	-	pfam_Transmembrane_6/97,pirsf_Transmembrane_6/97	ENSG00000109084		0.448	TMEM97-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM97	HGNC	protein_coding	OTTHUMT00000255675.2	-	0.00	61	0	A	NM_014573		26652649	+1	tier1	-	no_errors	ENST00000226230	ensembl	human	known	74_37	missense	10.71	75	9	SNP	0.004	G
TPTE2	93492	genome.wustl.edu	37	13	20025336	20025336	+	Silent	SNP	A	A	G	rs545861513	byFrequency	TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr13:20025336A>G	ENST00000400230.2	-	11	815	c.771T>C	c.(769-771)caT>caC	p.H257H	TPTE2_ENST00000255310.6_Silent_p.H180H|TPTE2_ENST00000390680.2_Silent_p.H180H|TPTE2_ENST00000457266.2_Silent_p.H146H|TPTE2_ENST00000382977.4_Silent_p.H257H|TPTE2_ENST00000382975.4_Silent_p.H217H|TPTE2_ENST00000382978.1_Silent_p.H217H|TPTE2_ENST00000400103.2_Silent_p.H146H			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	257	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		AGTGGTTTCGATGTTTCTTAT	0.358													a|||	6	0.00119808	0.003	0.0014	5008	,	,		20859	0.0		0.001	False		,,,				2504	0.0																0													132.0	116.0	122.0					13																	20025336		2203	4299	6502	SO:0001819	synonymous_variant	0			AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.771T>C	13.37:g.20025336A>G			A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Silent	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_Ion_trans_dom,pfam_Dual-sp_phosphatase_cat-dom,superfamily_C2_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.H257	ENST00000400230.2	37	c.771	CCDS45014.1	13																																																																																			TPTE2	-	pfscan_Phosphatase_tensin-typ	ENSG00000132958		0.358	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	TPTE2	HGNC	protein_coding			0.00	58	0	A	NM_199254		20025336	-1			no_errors	ENST00000382977	ensembl	human	known	74_37	silent	7.84	47	4	SNP	0.040	G
TTC16	158248	genome.wustl.edu	37	9	130493299	130493299	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr9:130493299C>G	ENST00000373289.3	+	14	2317	c.2237C>G	c.(2236-2238)tCc>tGc	p.S746C	TTC16_ENST00000489226.1_3'UTR|TOR2A_ENST00000472723.1_5'Flank	NM_144965.1	NP_659402.1	Q8NEE8	TTC16_HUMAN	tetratricopeptide repeat domain 16	746										central_nervous_system(2)|endometrium(3)|lung(7)|ovary(3)|pancreas(2)|prostate(4)|skin(1)	22						AGGCAGAGCTCCAGCGAGATT	0.657																																																	0													37.0	35.0	36.0					9																	130493299		2201	4296	6497	SO:0001583	missense	0			AK057342	CCDS6875.1	9q34.13	2013-01-10			ENSG00000167094	ENSG00000167094		"""Tetratricopeptide (TTC) repeat domain containing"""	26536	protein-coding gene	gene with protein product						12477932	Standard	NM_144965		Approved	FLJ32780	uc004brq.1	Q8NEE8	OTTHUMG00000020711	ENST00000373289.3:c.2237C>G	9.37:g.130493299C>G	ENSP00000362386:p.Ser746Cys		B4DYG4|B5ME24|Q5JU66|Q96M72	Missense_Mutation	SNP	pfam_TPR_2,pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.S746C	ENST00000373289.3	37	c.2237	CCDS6875.1	9	.	.	.	.	.	.	.	.	.	.	C	16.45	3.125956	0.56721	.	.	ENSG00000167094	ENST00000373289	T	0.19938	2.11	4.51	4.51	0.55191	.	2.008310	0.02133	N	0.056557	T	0.38692	0.1050	M	0.62723	1.935	0.80722	D	1	D;D	0.59357	0.985;0.985	P;P	0.49999	0.628;0.628	T	0.29058	-1.0024	10	0.66056	D	0.02	-2.8466	13.0255	0.58812	0.0:1.0:0.0:0.0	.	733;746	B4DZ42;Q8NEE8	.;TTC16_HUMAN	C	746	ENSP00000362386:S746C	ENSP00000362386:S746C	S	+	2	0	TTC16	129533120	0.130000	0.22417	0.012000	0.15200	0.002000	0.02628	2.141000	0.42168	2.793000	0.96121	0.561000	0.74099	TCC	TTC16	-	NULL	ENSG00000167094		0.657	TTC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC16	HGNC	protein_coding	OTTHUMT00000054224.1		0.00	95	0	C	NM_144965		130493299	+1			no_errors	ENST00000373289	ensembl	human	known	74_37	missense	5.17	55	3	SNP	0.019	G
CFAP46	54777	genome.wustl.edu	37	10	134751079	134751079	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr10:134751079A>G	ENST00000368586.5	-	6	737	c.637T>C	c.(637-639)Tac>Cac	p.Y213H	TTC40_ENST00000368582.2_Missense_Mutation_p.Y213H|TTC40_ENST00000368585.3_Missense_Mutation_p.Y213H	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						ATCTGCCGGTATTTCTGTGGC	0.433																																																	0													70.0	74.0	73.0					10																	134751079		2203	4300	6503	SO:0001583	missense	0																														ENST00000368586.5:c.637T>C	10.37:g.134751079A>G	ENSP00000357575:p.Tyr213His			Missense_Mutation	SNP	NULL	p.Y213H	ENST00000368586.5	37	c.637	CCDS58101.1	10	.	.	.	.	.	.	.	.	.	.	A	17.27	3.347098	0.61183	.	.	ENSG00000171811	ENST00000368586;ENST00000368582;ENST00000368585	D;D;D	0.82711	-1.64;-1.64;-1.64	4.68	4.68	0.58851	.	0.355542	0.22940	N	0.053793	D	0.90123	0.6914	M	0.73598	2.24	0.09310	N	0.999998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.995	D	0.83471	0.0059	10	0.87932	D	0	.	13.4017	0.60887	1.0:0.0:0.0:0.0	.	213;213	Q5SR76-2;Q5SR76-1	.;.	H	213	ENSP00000357575:Y213H;ENSP00000357571:Y213H;ENSP00000357574:Y213H	ENSP00000357571:Y213H	Y	-	1	0	C10orf93	134601069	0.583000	0.26757	0.008000	0.14137	0.005000	0.04900	3.415000	0.52700	1.864000	0.54056	0.528000	0.53228	TAC	TTC40	-	NULL	ENSG00000171811		0.433	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TTC40	HGNC	protein_coding	OTTHUMT00000051095.3	-	0.00	34	0	A			134751079	-1	tier1	-	no_errors	ENST00000368582	ensembl	human	known	74_37	missense	18.18	36	8	SNP	0.202	G
TTN	7273	genome.wustl.edu	37	2	179648828	179648828	+	Missense_Mutation	SNP	C	C	T	rs376922544		TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr2:179648828C>T	ENST00000591111.1	-	16	2968	c.2744G>A	c.(2743-2745)cGc>cAc	p.R915H	TTN_ENST00000342992.6_Missense_Mutation_p.R915H|TTN_ENST00000360870.5_Missense_Mutation_p.R915H|TTN_ENST00000359218.5_Missense_Mutation_p.R869H|TTN_ENST00000460472.2_Missense_Mutation_p.R869H|TTN_ENST00000342175.6_Missense_Mutation_p.R869H|TTN_ENST00000589042.1_Missense_Mutation_p.R915H			Q8WZ42	TITIN_HUMAN	titin	33951					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TACTTCAAAGCGCTCTTCACG	0.547																																																	0								C	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	141.0	115.0	124.0		2606,2606,2744,2744,2606	-5.7	0.0	2		124	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense	TTN	NM_133437.3,NM_133432.3,NM_133379.3,NM_133378.4,NM_003319.4	29,29,29,29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign,benign,benign	869/27119,869/27052,915/5605,915/33424,869/26927	179648828	1,13005	2203	4300	6503	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.2744G>A	2.37:g.179648828C>T	ENSP00000465570:p.Arg915His		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.R915H	ENST00000591111.1	37	c.2744		2	.	.	.	.	.	.	.	.	.	.	C	11.20	1.569294	0.28003	0.0	1.16E-4	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.62498	0.02;0.26;0.24;0.23;0.38	5.52	-5.66	0.02451	Ribonuclease H-like (1);	.	.	.	.	T	0.40979	0.1139	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.10296	0.0;0.0;0.0;0.0;0.003	B;B;B;B;B	0.06405	0.0;0.0;0.0;0.0;0.002	T	0.24870	-1.0148	9	0.87932	D	0	.	16.113	0.81275	0.0:0.3114:0.0:0.6886	.	869;869;869;915;915	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	H	915;869;869;869;869;915	ENSP00000343764:R915H;ENSP00000434586:R869H;ENSP00000340554:R869H;ENSP00000352154:R869H;ENSP00000354117:R915H	ENSP00000340554:R869H	R	-	2	0	TTN	179357073	0.000000	0.05858	0.035000	0.18076	0.043000	0.13939	-0.116000	0.10724	-0.956000	0.03631	-1.743000	0.00684	CGC	TTN	-	superfamily_RNaseH-like_dom	ENSG00000155657		0.547	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	38	0	C	NM_133378		179648828	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	19.64	45	11	SNP	0.001	T
TTYH2	94015	genome.wustl.edu	37	17	72227120	72227120	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr17:72227120C>G	ENST00000269346.4	+	3	470	c.396C>G	c.(394-396)ttC>ttG	p.F132L	TTYH2_ENST00000529107.1_Missense_Mutation_p.F111L	NM_032646.5	NP_116035.5	Q9BSA4	TTYH2_HUMAN	tweety family member 2	132						chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(14)|ovary(3)|pancreas(1)|stomach(3)|upper_aerodigestive_tract(1)	36						ACCACACCTTCTCTGGGATCG	0.602																																																	0													178.0	137.0	151.0					17																	72227120		2203	4300	6503	SO:0001583	missense	0				CCDS32717.1, CCDS45770.1	17q25.1	2013-09-02	2013-09-02		ENSG00000141540	ENSG00000141540			13877	protein-coding gene	gene with protein product		608855	"""tweety (Drosophila) homolog 2"", ""tweety homolog 2 (Drosophila)"""			11597145	Standard	XM_005257824		Approved	C17orf29	uc002jkc.3	Q9BSA4	OTTHUMG00000166018	ENST00000269346.4:c.396C>G	17.37:g.72227120C>G	ENSP00000269346:p.Phe132Leu		B3KX97|Q3B7H8|Q3B7R9|Q6AWB4|Q8NBB7|Q96PK1	Missense_Mutation	SNP	pfam_Tweety	p.F132L	ENST00000269346.4	37	c.396	CCDS32717.1	17	.	.	.	.	.	.	.	.	.	.	C	6.762	0.509488	0.12883	.	.	ENSG00000141540	ENST00000269346;ENST00000529107	T;T	0.08008	3.14;3.14	5.35	4.39	0.52855	.	0.138233	0.52532	N	0.000061	T	0.02848	0.0085	N	0.02985	-0.445	0.80722	D	1	B;B	0.12013	0.005;0.001	B;B	0.14023	0.01;0.004	T	0.32052	-0.9921	10	0.02654	T	1	-30.2244	8.6598	0.34086	0.0:0.7652:0.1526:0.0822	.	111;132	B4DKD1;Q9BSA4	.;TTYH2_HUMAN	L	132;111	ENSP00000269346:F132L;ENSP00000433089:F111L	ENSP00000269346:F132L	F	+	3	2	TTYH2	69738715	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.312000	0.43726	1.256000	0.44068	0.655000	0.94253	TTC	TTYH2	-	pfam_Tweety	ENSG00000141540		0.602	TTYH2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	TTYH2	HGNC	protein_coding	OTTHUMT00000387459.1		0.00	43	0	C			72227120	+1			no_errors	ENST00000269346	ensembl	human	known	74_37	missense	7.32	38	3	SNP	1.000	G
UBAP2	55833	genome.wustl.edu	37	9	33941666	33941666	+	Nonsense_Mutation	SNP	G	G	C	rs552066686	byFrequency	TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr9:33941666G>C	ENST00000379238.1	-	16	2027	c.1910C>G	c.(1909-1911)tCa>tGa	p.S637*	UBAP2_ENST00000449054.1_Nonsense_Mutation_p.S637*|UBAP2_ENST00000379239.4_Nonsense_Mutation_p.S370*|UBAP2_ENST00000539807.1_Nonsense_Mutation_p.S392*|UBAP2_ENST00000379225.1_Nonsense_Mutation_p.S270*|UBAP2_ENST00000360802.1_Nonsense_Mutation_p.S637*|UBAP2_ENST00000418786.2_Nonsense_Mutation_p.S584*					ubiquitin associated protein 2											endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(13)|ovary(3)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(29;0.00575)	GBM - Glioblastoma multiforme(74;0.168)		TCCTGGAGCTGACTCTGATGA	0.398																																																	0													91.0	87.0	88.0					9																	33941666		2203	4300	6503	SO:0001587	stop_gained	0			AB040924	CCDS6547.1, CCDS75828.1	9p11.2	2008-02-05			ENSG00000137073	ENSG00000137073			14185	protein-coding gene	gene with protein product						8871400	Standard	NM_018449		Approved	KIAA1491, bA176F3.5, FLJ22435	uc003ztq.1	Q5T6F2	OTTHUMG00000000427	ENST00000379238.1:c.1910C>G	9.37:g.33941666G>C	ENSP00000368540:p.Ser637*			Nonsense_Mutation	SNP	pfam_DUF3697_Uba2,pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk	p.S637*	ENST00000379238.1	37	c.1910	CCDS6547.1	9	.	.	.	.	.	.	.	.	.	.	G	43	9.872389	0.99284	.	.	ENSG00000137073	ENST00000379238;ENST00000449054;ENST00000360802;ENST00000431417;ENST00000379239;ENST00000539807;ENST00000418786;ENST00000379225	.	.	.	6.03	5.1	0.69264	.	0.777035	0.12129	N	0.496960	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	0.1224	10.1918	0.43030	0.1566:0.0:0.8434:0.0	.	.	.	.	X	637;637;637;546;370;392;584;270	.	ENSP00000354039:S637X	S	-	2	0	UBAP2	33931666	0.093000	0.21703	0.013000	0.15412	0.974000	0.67602	2.448000	0.44926	1.474000	0.48178	0.655000	0.94253	TCA	UBAP2	-	NULL	ENSG00000137073		0.398	UBAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBAP2	HGNC	protein_coding	OTTHUMT00000001071.1	-	0.00	23	0	G	NM_018449		33941666	-1	tier1	-	no_errors	ENST00000360802	ensembl	human	known	74_37	nonsense	47.73	23	21	SNP	0.028	C
TUBBP5	643224	genome.wustl.edu	37	9	141069223	141069223	+	RNA	SNP	T	T	C			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr9:141069223T>C	ENST00000503395.1	+	0	922									tubulin, beta pseudogene 5																		actaaagacgtgggaggaagt	0.512																																																	0																																												0			AF355123		9q34.3	2012-03-06	2005-11-15		ENSG00000159247	ENSG00000159247			23674	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 5"""			11731935	Standard	NR_027156		Approved		uc010ncq.3		OTTHUMG00000021001		9.37:g.141069223T>C				RNA	SNP	-	NULL	ENST00000503395.1	37	NULL		9																																																																																			TUBBP5	-	-	ENSG00000159247		0.512	TUBBP5-003	KNOWN	basic	processed_transcript	TUBBP5	HGNC	pseudogene	OTTHUMT00000373087.1	-	0.00	42	0	T	NR_027156		141069223	+1	tier1	-	no_errors	ENST00000503395	ensembl	human	known	74_37	rna	17.24	24	5	SNP	0.013	C
UBE2K	3093	genome.wustl.edu	37	4	39776500	39776500	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr4:39776500C>G	ENST00000261427.5	+	5	630	c.346C>G	c.(346-348)Cta>Gta	p.L116V	UBE2K_ENST00000445950.2_Missense_Mutation_p.L116V|UBE2K_ENST00000503368.1_Missense_Mutation_p.L65V|UBE2K_ENST00000438068.2_3'UTR|UBE2K_ENST00000295963.6_Intron	NM_001111112.1|NM_005339.4	NP_001104582.1|NP_005330.1	P61086	UBE2K_HUMAN	ubiquitin-conjugating enzyme E2K	116					intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|protein K48-linked ubiquitination (GO:0070936)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)			large_intestine(1)|lung(1)|ovary(2)	4						ATTGCAAGCACTATTGGCAGC	0.433																																					NSCLC(101;689 1592 16105 29682 31745)												0													61.0	62.0	61.0					4																	39776500		2203	4300	6503	SO:0001583	missense	0			U58522	CCDS33976.1, CCDS47043.1, CCDS47044.1	4p14	2011-05-19	2011-05-19	2007-12-04	ENSG00000078140	ENSG00000078140		"""Ubiquitin-conjugating enzymes E2"""	4914	protein-coding gene	gene with protein product		602846	"""huntingtin interacting protein 2"", ""ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast)"""	HIP2		8702625, 17873885	Standard	NM_005339		Approved	HYPG, UBC1	uc003guu.4	P61086	OTTHUMG00000160543	ENST00000261427.5:c.346C>G	4.37:g.39776500C>G	ENSP00000261427:p.Leu116Val		A6NJC1|A8K5Y9|B2RDF8|C9JGP1|O54806|P27924|Q16721|Q9CVV9|Q9Y2D3	Missense_Mutation	SNP	pfam_UBQ-conjugat_E2,pfam_UBA/Ts_N,superfamily_UBQ-conjugating_enzyme/RWD,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_UBQ-conjugat_E2	p.L116V	ENST00000261427.5	37	c.346	CCDS33976.1	4	.	.	.	.	.	.	.	.	.	.	C	15.26	2.781634	0.49891	.	.	ENSG00000078140	ENST00000261427;ENST00000503368;ENST00000445950	T;T;T	0.58940	0.3;0.3;0.3	5.55	2.41	0.29592	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.065348	0.64402	D	0.000013	T	0.79137	0.4395	H	0.96080	3.765	0.80722	D	1	B;B;D	0.55172	0.089;0.325;0.97	B;B;D	0.66196	0.285;0.238;0.942	T	0.80195	-0.1483	10	0.87932	D	0	-15.3765	7.4903	0.27458	0.0:0.6325:0.0:0.3675	.	116;65;116	P61086;P61086-2;C9JGP1	UBE2K_HUMAN;.;.	V	116;65;116	ENSP00000261427:L116V;ENSP00000421203:L65V;ENSP00000390483:L116V	ENSP00000261427:L116V	L	+	1	2	UBE2K	39452895	0.648000	0.27313	0.077000	0.20336	0.954000	0.61252	0.997000	0.29731	0.828000	0.34709	0.585000	0.79938	CTA	UBE2K	-	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	ENSG00000078140		0.433	UBE2K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2K	HGNC	protein_coding	OTTHUMT00000361061.1	-	0.00	16	0	C	NM_005339		39776500	+1	tier1	-	no_errors	ENST00000261427	ensembl	human	known	74_37	missense	81.25	3	13	SNP	0.828	G
UBTD1	80019	genome.wustl.edu	37	10	99330073	99330073	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr10:99330073G>T	ENST00000370664.3	+	3	813	c.477G>T	c.(475-477)aaG>aaT	p.K159N	ANKRD2_ENST00000298808.5_5'Flank|ANKRD2_ENST00000455090.1_5'Flank|ANKRD2_ENST00000370655.1_5'Flank|ANKRD2_ENST00000307518.5_5'Flank	NM_024954.3	NP_079230.1	Q9HAC8	UBTD1_HUMAN	ubiquitin domain containing 1	159	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.									central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(1)|skin(1)	7		Colorectal(252;0.162)		Epithelial(162;3.04e-10)|all cancers(201;2.86e-08)		CCACGGGCAAGGACGTGAGGC	0.692																																					Pancreas(100;169 2668 32720)												0													44.0	43.0	43.0					10																	99330073		2203	4299	6502	SO:0001583	missense	0			BC007331	CCDS7465.1	10q24.2	2005-09-22			ENSG00000165886	ENSG00000165886			25683	protein-coding gene	gene with protein product						12477932	Standard	NM_024954		Approved	FLJ11807	uc001knv.1	Q9HAC8	OTTHUMG00000018856	ENST00000370664.3:c.477G>T	10.37:g.99330073G>T	ENSP00000359698:p.Lys159Asn		D3DR57|Q53HI3	Missense_Mutation	SNP	pfam_Ubiquitin_dom,pfam_Rad60/SUMO_like,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup,prints_Ubiquitin	p.K159N	ENST00000370664.3	37	c.477	CCDS7465.1	10	.	.	.	.	.	.	.	.	.	.	G	11.46	1.644763	0.29246	.	.	ENSG00000165886	ENST00000370664	T	0.76709	-1.04	5.34	3.51	0.40186	Ubiquitin supergroup (1);Ubiquitin (2);	0.093523	0.64402	D	0.000001	D	0.83871	0.5348	M	0.66378	2.025	0.50171	D	0.999859	D	0.63046	0.992	D	0.65140	0.932	T	0.81890	-0.0725	10	0.36615	T	0.2	-39.6175	11.6907	0.51514	0.145:0.0:0.855:0.0	.	159	Q9HAC8	UBTD1_HUMAN	N	159	ENSP00000359698:K159N	ENSP00000359698:K159N	K	+	3	2	UBTD1	99320063	1.000000	0.71417	1.000000	0.80357	0.128000	0.20619	3.382000	0.52463	0.777000	0.33496	-0.136000	0.14681	AAG	UBTD1	-	pfam_Ubiquitin_dom,pfam_Rad60/SUMO_like,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup,prints_Ubiquitin	ENSG00000165886		0.692	UBTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBTD1	HGNC	protein_coding	OTTHUMT00000049701.1		0.00	64	0	G	NM_024954		99330073	+1			no_errors	ENST00000370664	ensembl	human	known	74_37	missense	5.36	53	3	SNP	1.000	T
UNG	7374	genome.wustl.edu	37	12	109547654	109547654	+	Silent	SNP	G	G	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr12:109547654G>A	ENST00000242576.2	+	7	928	c.822G>A	c.(820-822)caG>caA	p.Q274Q	RP11-968O1.5_ENST00000541704.2_RNA|UNG_ENST00000336865.2_Silent_p.Q265Q	NM_080911.2	NP_550433.1			uracil-DNA glycosylase											central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)	9						ATGTACTACAGACGGCTCATC	0.413								Base excision repair (BER), DNA glycosylases	Immune Deficiency with Hyper-IgM																																								0													132.0	131.0	131.0					12																	109547654		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	Hypogammaglobulinemia with Hyper-IgM, HIGM type I-V, XLHIGM	A64377	CCDS9124.1, CCDS9125.1	12q23-q24.1	2014-09-17			ENSG00000076248	ENSG00000076248	3.2.2.27		12572	protein-coding gene	gene with protein product	"""uracil-DNA glycosylase 1, uracil-DNA glycosylase 2"""	191525		DGU		1923798, 17101234	Standard	NM_080911		Approved	UDG, UNG1, UNG2, HIGM4	uc001tnz.2	P13051	OTTHUMG00000169247	ENST00000242576.2:c.822G>A	12.37:g.109547654G>A				Silent	SNP	pfam_Uracil-DNA_glycosylase-like,superfamily_Uracil-DNA_glycosylase-like,tigrfam_Ura_DNA_glycsylse	p.Q274	ENST00000242576.2	37	c.822	CCDS9124.1	12	.	.	.	.	.	.	.	.	.	.	G	15.11	2.736024	0.49045	.	.	ENSG00000076248	ENST00000542183	.	.	.	5.82	4.93	0.64822	.	.	.	.	.	T	0.67429	0.2892	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.70666	-0.4809	5	0.87932	D	0	-35.0822	10.1796	0.42959	0.1501:0.0:0.8499:0.0	.	.	.	.	K	28	.	ENSP00000438623:R28K	R	+	2	0	UNG	108032037	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	4.442000	0.59988	1.473000	0.48159	0.561000	0.74099	AGA	UNG	-	pfam_Uracil-DNA_glycosylase-like,superfamily_Uracil-DNA_glycosylase-like,tigrfam_Ura_DNA_glycsylse	ENSG00000076248		0.413	UNG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UNG	HGNC	protein_coding	OTTHUMT00000403067.1	-	0.00	80	0	G	NM_080911		109547654	+1	tier1	-	no_errors	ENST00000242576	ensembl	human	known	74_37	silent	33.07	85	42	SNP	1.000	A
USP7	7874	genome.wustl.edu	37	16	8997253	8997253	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr16:8997253C>T	ENST00000344836.4	-	16	1909	c.1711G>A	c.(1711-1713)Gca>Aca	p.A571T	USP7_ENST00000535863.1_Missense_Mutation_p.A472T|USP7_ENST00000381886.4_Missense_Mutation_p.A555T	NM_003470.2	NP_003461.2	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7 (herpes virus-associated)	571					maintenance of DNA methylation (GO:0010216)|multicellular organismal development (GO:0007275)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|protein deubiquitination (GO:0016579)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|transcription-coupled nucleotide-excision repair (GO:0006283)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|p53 binding (GO:0002039)|protein C-terminus binding (GO:0008022)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(13)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	48						TGGTCCTCTGCGACTATCTGA	0.388																																																	0													95.0	85.0	89.0					16																	8997253		2197	4300	6497	SO:0001583	missense	0			Z72499	CCDS32385.1, CCDS66941.1	16p13.3	2008-04-11	2005-08-08			ENSG00000187555		"""Ubiquitin-specific peptidases"""	12630	protein-coding gene	gene with protein product		602519	"""ubiquitin specific protease 7 (herpes virus-associated)"""	HAUSP		12838346, 9925944	Standard	NM_003470		Approved		uc002czl.2	Q93009		ENST00000344836.4:c.1711G>A	16.37:g.8997253C>T	ENSP00000343535:p.Ala571Thr		A6NMY8|B7Z815|H0Y3G8	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfam_MATH,pfam_USP7_ICP0-binding_dom,superfamily_TRAF-like,smart_MATH,pfscan_MATH,pfscan_Peptidase_C19/C67	p.A571T	ENST00000344836.4	37	c.1711	CCDS32385.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.58|12.58	1.980423|1.980423	0.34942|0.34942	.|.	.|.	ENSG00000187555|ENSG00000187555	ENST00000344836;ENST00000381886;ENST00000535863;ENST00000544549|ENST00000542333	T;T|T	0.04862|0.07908	3.57;3.54|3.15	5.05|5.05	3.85|3.85	0.44370|0.44370	.|.	0.203480|.	0.50627|.	D|.	0.000101|.	T|T	0.02012|0.02012	0.0063|0.0063	N|N	0.00128|0.00128	-2.045|-2.045	0.42336|0.42336	D|D	0.992316|0.992316	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.01281|.	0.0;0.0|.	T|T	0.46428|0.46428	-0.9192|-0.9192	10|7	0.02654|0.87932	T|D	1|0	.|.	8.2562|8.2562	0.31758|0.31758	0.0:0.8068:0.0:0.1932|0.0:0.8068:0.0:0.1932	.|.	571;555|.	Q93009;B7Z815|.	UBP7_HUMAN;.|.	T|H	571;579;472;472|499	ENSP00000343535:A571T;ENSP00000443646:A472T|ENSP00000439272:R499H	ENSP00000343535:A571T|ENSP00000439272:R499H	A|R	-|-	1|2	0|0	USP7|USP7	8904754|8904754	0.998000|0.998000	0.40836|0.40836	0.960000|0.960000	0.40013|0.40013	0.627000|0.627000	0.37826|0.37826	3.332000|3.332000	0.52083|0.52083	2.500000|2.500000	0.84329|0.84329	0.455000|0.455000	0.32223|0.32223	GCA|CGC	USP7	-	NULL	ENSG00000187555		0.388	USP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP7	HGNC	protein_coding	OTTHUMT00000434268.2		0.00	26	0	C			8997253	-1			no_errors	ENST00000344836	ensembl	human	known	74_37	missense	5.41	35	2	SNP	0.981	T
VWF	7450	genome.wustl.edu	37	12	6161849	6161849	+	Silent	SNP	G	G	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr12:6161849G>T	ENST00000261405.5	-	16	2300	c.2046C>A	c.(2044-2046)gcC>gcA	p.A682A		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	682	TIL 2.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	CCTCCAGGCAGGCCTCATTGC	0.622																																																	0													60.0	57.0	58.0					12																	6161849		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.2046C>A	12.37:g.6161849G>T			Q8TCE8|Q99806	Silent	SNP	pirsf_VWF,pfam_VWF_type-D,pfam_VWF_A,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_VWF_A,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_A,pfscan_VWF_C	p.A682	ENST00000261405.5	37	c.2046	CCDS8539.1	12																																																																																			VWF	-	pirsf_VWF,pfam_TIL_dom,superfamily_TIL_dom	ENSG00000110799		0.622	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VWF	HGNC	protein_coding	OTTHUMT00000399020.1		0.00	61	0	G	NM_000552		6161849	-1			no_errors	ENST00000261405	ensembl	human	known	74_37	silent	7.81	59	5	SNP	0.984	T
WASH6P	653440	genome.wustl.edu	37	X	155252248	155252248	+	RNA	SNP	C	C	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chrX:155252248C>T	ENST00000461007.1	+	0	1256				AJ271736.10_ENST00000285718.7_RNA			Q9NQA3	WASH6_HUMAN	WAS protein family homolog 6 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										TGGGGTGGCTCGGCTCGGGAG	0.682																																																	0																																												0			AI042587		Xq28 and Yq12	2014-08-28	2008-01-16	2008-01-16	ENSG00000182484	ENSG00000182484		"""Pseudoautosomal regions / PAR2"", ""WAS protein homologs"""	31685	pseudogene	pseudogene			"""family with sequence similarity 39, member A"", ""chromosomes X and Y open reading frame 1"""	FAM39A, CXYorf1		10655549, 12566406, 18159949	Standard	NG_008380		Approved			Q9NQA3	OTTHUMG00000022677		X.37:g.155252248C>T			A6NGF1|Q8N305	RNA	SNP	-	NULL	ENST00000461007.1	37	NULL		X																																																																																			WASH6P	-	-	ENSG00000182484		0.682	WASH6P-016	KNOWN	basic	processed_transcript	WASH6P	HGNC	pseudogene	OTTHUMT00000058840.1	-	0.00	30	0	C	NG_008380		155252248	+1	tier1	-	no_errors	ENST00000340131	ensembl	human	known	74_37	rna	19.35	25	6	SNP	0.567	T
WSCD1	23302	genome.wustl.edu	37	17	5991412	5991412	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr17:5991412C>T	ENST00000574946.1	+	3	920	c.530C>T	c.(529-531)gCg>gTg	p.A177V	WSCD1_ENST00000574232.1_Missense_Mutation_p.A177V|WSCD1_ENST00000539421.1_Missense_Mutation_p.A177V|WSCD1_ENST00000317744.5_Missense_Mutation_p.A177V|WSCD1_ENST00000573634.1_Missense_Mutation_p.A61V			Q658N2	WSCD1_HUMAN	WSC domain containing 1	177	WSC 1. {ECO:0000255|PROSITE- ProRule:PRU00558}.					integral component of membrane (GO:0016021)	sulfotransferase activity (GO:0008146)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)	35						TGCCAGGATGCGTGTGCTGAG	0.527																																																	0													131.0	110.0	117.0					17																	5991412		2203	4300	6503	SO:0001583	missense	0				CCDS32538.1	17p13.2	2008-02-05				ENSG00000179314			29060	protein-coding gene	gene with protein product							Standard	XM_005256572		Approved	KIAA0523	uc002gcn.3	Q658N2		ENST00000574946.1:c.530C>T	17.37:g.5991412C>T	ENSP00000460825:p.Ala177Val		A8K0N8|D3DTM3|O60276|Q96G45	Missense_Mutation	SNP	pfam_WSC_carb-bd,pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase,smart_WSC_carb-bd_subgr,pfscan_WSC_carb-bd	p.A177V	ENST00000574946.1	37	c.530	CCDS32538.1	17	.	.	.	.	.	.	.	.	.	.	C	23.3	4.402169	0.83230	.	.	ENSG00000179314	ENST00000317744;ENST00000539421	T;T	0.54675	0.56;0.56	5.83	5.83	0.93111	Carbohydrate-binding WSC (2);Carbohydrate-binding WSC, subgroup (1);	0.058194	0.64402	D	0.000002	T	0.63546	0.2520	M	0.72576	2.205	0.44337	D	0.997222	D	0.67145	0.996	P	0.53490	0.727	T	0.58261	-0.7667	10	0.16896	T	0.51	-24.9071	17.61	0.88050	0.0:1.0:0.0:0.0	.	177	Q658N2	WSCD1_HUMAN	V	177	ENSP00000323087:A177V;ENSP00000446032:A177V	ENSP00000323087:A177V	A	+	2	0	WSCD1	5932136	0.997000	0.39634	0.184000	0.23157	0.778000	0.44026	3.808000	0.55598	2.756000	0.94617	0.655000	0.94253	GCG	WSCD1	-	pfam_WSC_carb-bd,smart_WSC_carb-bd_subgr,pfscan_WSC_carb-bd	ENSG00000179314		0.527	WSCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WSCD1	HGNC	protein_coding	OTTHUMT00000438965.4	-	0.00	58	0	C	NM_015253		5991412	+1	tier1	-	no_errors	ENST00000317744	ensembl	human	known	74_37	missense	5.48	69	4	SNP	0.832	T
XDH	7498	genome.wustl.edu	37	2	31571772	31571772	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr2:31571772A>G	ENST00000379416.3	-	27	3092	c.3044T>C	c.(3043-3045)cTg>cCg	p.L1015P		NM_000379.3	NP_000370.2	P47989	XDH_HUMAN	xanthine dehydrogenase	1015					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|lactation (GO:0007595)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of gene expression (GO:0010629)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|negative regulation of vasculogenesis (GO:2001213)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)|xanthine catabolic process (GO:0009115)	cytosol (GO:0005829)|extracellular space (GO:0005615)|peroxisome (GO:0005777)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|protein homodimerization activity (GO:0042803)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)|xanthine oxidase activity (GO:0004855)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(31)|ovary(1)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(1)	74	Acute lymphoblastic leukemia(172;0.155)				Aldesleukin(DB00041)|Allopurinol(DB00437)|Azathioprine(DB00993)|Carboplatin(DB00958)|Carvedilol(DB01136)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|L-Carnitine(DB00583)|Menadione(DB00170)|Mercaptopurine(DB01033)|Nitrofural(DB00336)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Spermine(DB00127)|Trifluoperazine(DB00831)	TACCTGATTCAGAAAAGGAAC	0.388																																					Colon(66;682 1445 30109 40147)												0													92.0	92.0	92.0					2																	31571772		2203	4300	6503	SO:0001583	missense	0			D11456	CCDS1775.1	2p23.1	2009-07-10	2003-03-20		ENSG00000158125	ENSG00000158125	1.17.1.4		12805	protein-coding gene	gene with protein product		607633	"""xanthene dehydrogenase"""			8224915	Standard	NM_000379		Approved	XOR, XO	uc002rnv.1	P47989	OTTHUMG00000099385	ENST00000379416.3:c.3044T>C	2.37:g.31571772A>G	ENSP00000368727:p.Leu1015Pro		Q16681|Q16712|Q4PJ16	Missense_Mutation	SNP	pfam_AldOxase/xan_DH_Mopterin-bd,pfam_Mopterin_DH_FAD-bd,pfam_Ald_Oxase/Xan_DH_a/b,pfam_2Fe-2S-bd,pfam_CO_DH_flav_C,pfam_2Fe-2S_ferredoxin-type,superfamily_AldOxase/xan_DH_Mopterin-bd,superfamily_FAD-bd_2,superfamily_Ald_Oxase/Xan_DH_a/b,superfamily_2Fe-2S-bd,superfamily_CO_DH_flav_C,superfamily_2Fe-2S_ferredoxin-type,pirsf_Ald_Oxase/xanthine_DH,pfscan_2Fe-2S_ferredoxin-type,tigrfam_Xanthine_DH_ssu	p.L1015P	ENST00000379416.3	37	c.3044	CCDS1775.1	2	.	.	.	.	.	.	.	.	.	.	A	23.4	4.406476	0.83230	.	.	ENSG00000158125	ENST00000379416	T	0.43294	0.95	5.85	5.85	0.93711	Aldehyde oxidase/xanthine dehydrogenase, molybdopterin binding (3);	0.000000	0.85682	D	0.000000	T	0.70945	0.3282	M	0.90650	3.135	0.80722	D	1	D	0.67145	0.996	D	0.74674	0.984	T	0.77696	-0.2491	10	0.72032	D	0.01	.	15.9218	0.79583	1.0:0.0:0.0:0.0	.	1015	P47989	XDH_HUMAN	P	1015	ENSP00000368727:L1015P	ENSP00000368727:L1015P	L	-	2	0	XDH	31425276	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	8.763000	0.91715	2.237000	0.73441	0.459000	0.35465	CTG	XDH	-	pfam_AldOxase/xan_DH_Mopterin-bd,superfamily_AldOxase/xan_DH_Mopterin-bd,pirsf_Ald_Oxase/xanthine_DH	ENSG00000158125		0.388	XDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XDH	HGNC	protein_coding	OTTHUMT00000216840.1		0.00	29	0	A	NM_000379		31571772	-1			no_errors	ENST00000379416	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	G
XPC	7508	genome.wustl.edu	37	3	14219966	14219968	+	Splice_Site	DEL	CCT	CCT	-	rs72561774	byFrequency	TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	CCT	CCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr3:14219966_14219968delCCT	ENST00000285021.7	-	1	315_317	c.101_103delAGG	c.(100-105)gaggat>gat	p.E34del	XPC_ENST00000449060.2_Splice_Site_p.E34del|LSM3_ENST00000306024.3_5'UTR	NM_001145769.1|NM_004628.4	NP_001139241.1|NP_004619.3	Q01831	XPC_HUMAN	xeroderma pigmentosum, complementation group C	34	Glu-rich (acidic).|Poly-Glu.				DNA repair (GO:0006281)|intra-S DNA damage checkpoint (GO:0031573)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage recognition (GO:0000715)|nucleotide-excision repair, DNA damage removal (GO:0000718)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to drug (GO:0042493)|response to UV-B (GO:0010224)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|XPC complex (GO:0071942)	bubble DNA binding (GO:0000405)|damaged DNA binding (GO:0003684)|heteroduplex DNA loop binding (GO:0000404)|single-stranded DNA binding (GO:0003697)	p.E34delE(1)		NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TCGCTCTCACCCTCCTCCTCCTC	0.734			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																														yes	Rec		Xeroderma pigmentosum (C)	3	3p25	7508	"""xeroderma pigmentosum, complementation group C"""		E	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)							,	315,1,3348		29,0,257,0,1,1545					,	5.2	1.0			23	706,1,7113		33,0,640,0,1,3236	no	codingComplex-near-splice,codingComplex-near-splice	XPC	NM_004628.4,NM_001145769.1	,	62,0,897,0,2,4781	A1A1,A1A2,A1R,A2A2,A2R,RR		9.0409,8.6245,8.908	,	,		1021,2,10461				SO:0001630	splice_region_variant	0	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV		CCDS46763.1	3p25.1	2014-09-17			ENSG00000154767	ENSG00000154767			12816	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group C protein"""	613208				1522891	Standard	NM_004628		Approved	XPCC, RAD4	uc011ave.2	Q01831	OTTHUMG00000155526	ENST00000285021.7:c.103+1AGG>-	3.37:g.14219975_14219977delCCT			B4DIP3|E9PB96|E9PH69|Q53GT7|Q96AX0	In_Frame_Del	DEL	pfam_Rad4/PNGase_transGLS-fold,pfam_Rad4_beta-hairpin_dom3,pfam_Rad4_beta-hairpin_dom2,pfam_Rad4_beta-hairpin_dom1,tigrfam_DNA_repair_Rad4_subgr	p.E34in_frame_del	ENST00000285021.7	37	c.103_101	CCDS46763.1	3																																																																																			XPC	-	NULL	ENSG00000154767		0.734	XPC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	XPC	HGNC	protein_coding	OTTHUMT00000340517.3		0.00	24	0	CCT	NM_004628	In_Frame_Del	14219968	-1	tier1		no_errors	ENST00000285021	ensembl	human	known	74_37	in_frame_del	14.29	24	4	DEL	0.927:0.902:0.864	-
YEATS2	55689	genome.wustl.edu	37	3	183525736	183525737	+	Intron	INS	-	-	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr3:183525736_183525737insT	ENST00000305135.5	+	29	4206				YEATS2-AS1_ENST00000609195.1_RNA|YEATS2-AS1_ENST00000609871.1_RNA|YEATS2-AS1_ENST00000425008.3_RNA	NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2						chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			ATCGCTTTGCATGTCAGGGAGG	0.46																																																	0																																										SO:0001627	intron_variant	0			AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.4012-81->T	3.37:g.183525737_183525737dupT			A7E2B9|D3DNS9|Q641P6|Q9NW96	RNA	INS	-	NULL	ENST00000305135.5	37	NULL	CCDS43175.1	3																																																																																			YEATS2-AS1	-	-	ENSG00000233885		0.460	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YEATS2-AS1	HGNC	protein_coding	OTTHUMT00000346507.2		0.00	27	0	-	NM_018023		183525737	-1	tier1		no_errors	ENST00000425008	ensembl	human	known	74_37	rna	23.08	30	9	INS	0.000:0.003	T
YLPM1	56252	genome.wustl.edu	37	14	75276398	75276398	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr14:75276398G>A	ENST00000552421.1	+	6	2843	c.2719G>A	c.(2719-2721)Gtt>Att	p.V907I	YLPM1_ENST00000325680.7_Missense_Mutation_p.V1613I|YLPM1_ENST00000238571.3_Missense_Mutation_p.V1418I			P49750	YLPM1_HUMAN	YLP motif containing 1	1418	Arg-rich.				regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		ACCCCCACCTGTTCACTCTTC	0.498																																																	0													86.0	85.0	86.0					14																	75276398		1970	4159	6129	SO:0001583	missense	0			AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000552421.1:c.2719G>A	14.37:g.75276398G>A	ENSP00000447921:p.Val907Ile		P49752|Q96I64|Q9P1V7	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.V1613I	ENST00000552421.1	37	c.4837		14	.	.	.	.	.	.	.	.	.	.	G	10.16	1.273137	0.23221	.	.	ENSG00000119596	ENST00000552421;ENST00000325680;ENST00000238571;ENST00000423680;ENST00000547879	.	.	.	5.22	1.77	0.24775	.	0.676165	0.13260	N	0.401321	T	0.29684	0.0741	N	0.14661	0.345	0.33232	D	0.556073	B;B	0.24576	0.106;0.0	B;B	0.32289	0.143;0.002	T	0.37619	-0.9698	9	0.18276	T	0.48	-1.2348	8.9099	0.35546	0.306:0.0:0.694:0.0	.	1418;1613	P49750-3;P49750-4	.;.	I	907;1613;1418;1326;22	.	ENSP00000238571:V1418I	V	+	1	0	YLPM1	74346151	0.132000	0.22450	1.000000	0.80357	0.998000	0.95712	0.006000	0.13152	0.519000	0.28406	0.591000	0.81541	GTT	YLPM1	-	NULL	ENSG00000119596		0.498	YLPM1-008	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	YLPM1	HGNC	protein_coding	OTTHUMT00000404450.1		0.00	43	0	G	NM_019589		75276398	+1			no_errors	ENST00000325680	ensembl	human	known	74_37	missense	6.15	61	4	SNP	0.997	A
ZC3H7B	23264	genome.wustl.edu	37	22	41739432	41739432	+	Silent	SNP	C	C	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr22:41739432C>A	ENST00000352645.4	+	13	1568	c.1311C>A	c.(1309-1311)ggC>ggA	p.G437G	ZC3H7B_ENST00000351589.4_Silent_p.G437G	NM_017590.4	NP_060060.3	Q9UGR2	Z3H7B_HUMAN	zinc finger CCCH-type containing 7B	453					viral process (GO:0016032)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	38						CCCGGGCTGGCGACTACACCT	0.632																																																	0													57.0	59.0	58.0					22																	41739432		2203	4299	6502	SO:0001819	synonymous_variant	0				CCDS14013.1	22q13.2	2013-01-10		2005-08-09	ENSG00000100403	ENSG00000100403		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30869	protein-coding gene	gene with protein product						10470851, 11230166	Standard	NM_017590		Approved	RoXaN, FLJ13787, DKFZp434K0920, KIAA1031	uc003azw.4	Q9UGR2	OTTHUMG00000150969	ENST00000352645.4:c.1311C>A	22.37:g.41739432C>A			A7YY88|B2RCA4|Q5TFX9|Q8TBT9|Q9H8B6|Q9UGQ9|Q9UGR0|Q9UGR1|Q9UK03|Q9UPW9	Silent	SNP	pfam_Znf_CCCH,pfam_TPR_1,smart_TPR_repeat,smart_Znf_CCCH,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.G437	ENST00000352645.4	37	c.1311	CCDS14013.1	22																																																																																			ZC3H7B	-	NULL	ENSG00000100403		0.632	ZC3H7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H7B	HGNC	protein_coding	OTTHUMT00000320696.1		0.00	70	0	C	NM_017590		41739432	+1			no_errors	ENST00000351589	ensembl	human	known	74_37	silent	5.33	70	4	SNP	0.525	A
ZFYVE26	23503	genome.wustl.edu	37	14	68236404	68236404	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr14:68236404C>T	ENST00000347230.4	-	29	5666	c.5528G>A	c.(5527-5529)tGc>tAc	p.C1843Y	ZFYVE26_ENST00000555452.1_Missense_Mutation_p.C1843Y	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	1843					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		GCAGGAGCTGCACACTAGCCG	0.517																																																	0													89.0	79.0	83.0					14																	68236404		2203	4300	6503	SO:0001583	missense	0			AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.5528G>A	14.37:g.68236404C>T	ENSP00000251119:p.Cys1843Tyr		B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	p.C1843Y	ENST00000347230.4	37	c.5528	CCDS9788.1	14	.	.	.	.	.	.	.	.	.	.	C	28.3	4.907670	0.92107	.	.	ENSG00000072121	ENST00000347230;ENST00000411699;ENST00000555452	D;D	0.93076	-3.16;-3.16	5.69	5.69	0.88448	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, FYVE-type (2);Zinc finger, FYVE-related (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	D	0.98254	0.9422	H	0.97983	4.12	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.99198	1.0872	10	0.87932	D	0	-5.8668	19.801	0.96507	0.0:1.0:0.0:0.0	.	1843;1843	G3V2D8;Q68DK2	.;ZFY26_HUMAN	Y	1843;1822;1843	ENSP00000251119:C1843Y;ENSP00000450603:C1843Y	ENSP00000251119:C1843Y	C	-	2	0	ZFYVE26	67306157	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.818000	0.86416	2.685000	0.91497	0.555000	0.69702	TGC	ZFYVE26	-	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	ENSG00000072121		0.517	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFYVE26	HGNC	protein_coding	OTTHUMT00000412736.2	-	0.00	48	0	C	NM_015346		68236404	-1	tier1	-	no_errors	ENST00000347230	ensembl	human	known	74_37	missense	48.98	25	24	SNP	1.000	T
ZNF208	7757	genome.wustl.edu	37	19	22154522	22154522	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr19:22154522C>T	ENST00000397126.4	-	4	3462	c.3314G>A	c.(3313-3315)aGa>aAa	p.R1105K	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	1105					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.R977I(2)|p.R1105I(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				AGTATGAATTCTCTTATGTTC	0.393																																																	3	Substitution - Missense(3)	large_intestine(3)											65.0	68.0	67.0					19																	22154522		2086	4239	6325	SO:0001583	missense	0			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.3314G>A	19.37:g.22154522C>T	ENSP00000380315:p.Arg1105Lys			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R1105K	ENST00000397126.4	37	c.3314	CCDS54240.1	19	.	.	.	.	.	.	.	.	.	.	C	7.902	0.734632	0.15574	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.02197	4.4	2.59	1.06	0.20224	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02649	0.0080	.	.	.	0.09310	N	1	B	0.29627	0.252	B	0.34590	0.186	T	0.45411	-0.9263	8	0.45353	T	0.12	.	9.2481	0.37539	0.0:0.8399:0.0:0.16	.	977	O43345	ZN208_HUMAN	K	1105;977	ENSP00000380315:R1105K	ENSP00000380315:R1105K	R	-	2	0	ZNF208	21946362	0.000000	0.05858	0.003000	0.11579	0.124000	0.20399	-0.834000	0.04391	1.029000	0.39812	0.297000	0.19635	AGA	ZNF208	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000160321		0.393	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	HGNC	protein_coding	OTTHUMT00000464302.1		0.00	43	0	C	NM_007153		22154522	-1			no_errors	ENST00000397126	ensembl	human	novel	74_37	missense	5.33	71	4	SNP	0.000	T
ZNF223	7766	genome.wustl.edu	37	19	44571272	44571272	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr19:44571272G>C	ENST00000434772.3	+	5	1546	c.1291G>C	c.(1291-1293)Gag>Cag	p.E431Q	ZNF223_ENST00000591793.1_Missense_Mutation_p.E541Q	NM_013361.4	NP_037493.3	Q9UK11	ZN223_HUMAN	zinc finger protein 223	431					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18		Prostate(69;0.0352)				ATTCAAATGTGAGGATTGTGG	0.413																																																	0													106.0	107.0	107.0					19																	44571272		2203	4300	6503	SO:0001583	missense	0			AF187989	CCDS12635.1	19q13.2	2013-01-08				ENSG00000178386		"""Zinc fingers, C2H2-type"", ""-"""	13016	protein-coding gene	gene with protein product							Standard	XM_006723365		Approved		uc002oyf.1	Q9UK11		ENST00000434772.3:c.1291G>C	19.37:g.44571272G>C	ENSP00000401947:p.Glu431Gln		Q15736|Q8TBJ3|Q9HCA9	Missense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E541Q	ENST00000434772.3	37	c.1621	CCDS12635.1	19	.	.	.	.	.	.	.	.	.	.	G	12.87	2.067941	0.36470	.	.	ENSG00000178386	ENST00000434772	T	0.11604	2.76	2.46	0.107	0.14544	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.17577	0.0422	L	0.45352	1.415	0.09310	N	1	D	0.71674	0.998	D	0.69824	0.966	T	0.15263	-1.0443	9	0.49607	T	0.09	.	2.5191	0.04675	0.2816:0.0:0.3609:0.3574	.	431	Q9UK11	ZN223_HUMAN	Q	431	ENSP00000401947:E431Q	ENSP00000401947:E431Q	E	+	1	0	ZNF223	49263112	0.000000	0.05858	0.185000	0.23176	0.293000	0.27360	-1.339000	0.02652	0.316000	0.23135	0.313000	0.20887	GAG	ZNF223	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000267022		0.413	ZNF223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF223	Uniprot_gn	protein_coding	OTTHUMT00000460469.2	-	0.00	19	0	G			44571272	+1	tier1	-	no_errors	ENST00000591793	ensembl	human	known	74_37	missense	36.96	29	17	SNP	0.011	C
ZNF252P	286101	genome.wustl.edu	37	8	146203408	146203408	+	RNA	SNP	C	C	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr8:146203408C>A	ENST00000426361.2	-	0	776					NR_023392.1				zinc finger protein 252, pseudogene											endometrium(1)	1						GTAAGTTTTTCCACACCCAGT	0.423																																																	0																																												0			BC019922		8q24.3	2012-10-05	2012-04-19	2012-04-19	ENSG00000196922	ENSG00000196922			13046	pseudogene	pseudogene			"""zinc finger protein 252"""	ZNF252			Standard	NR_023392		Approved		uc011llo.2		OTTHUMG00000165201		8.37:g.146203408C>A				RNA	SNP	-	NULL	ENST00000426361.2	37	NULL		8	.	.	.	.	.	.	.	.	.	.	C	15.13	2.741674	0.49151	.	.	ENSG00000196922	ENST00000426361;ENST00000544285;ENST00000355436	.	.	.	2.65	2.65	0.31530	.	.	.	.	.	T	0.59972	0.2233	.	.	.	0.24345	N	0.994942	D	0.58268	0.982	P	0.52672	0.706	T	0.74293	-0.3712	6	0.87932	D	0	.	12.4424	0.55631	0.0:1.0:0.0:0.0	.	189	E9PMP9	.	V	189;189;168	.	ENSP00000347611:G168V	G	-	2	0	ZNF252	146174212	0.006000	0.16342	0.005000	0.12908	0.003000	0.03518	-0.035000	0.12205	1.479000	0.48272	0.514000	0.50259	GGA	ZNF252P	-	-	ENSG00000196922		0.423	ZNF252P-008	KNOWN	basic|exp_conf	processed_transcript	ZNF252P	HGNC	pseudogene	OTTHUMT00000451422.1	-	0.00	62	0	C	NR_023392		146203408	-1	tier1	-	no_errors	ENST00000426361	ensembl	human	known	74_37	rna	25.43	129	44	SNP	0.986	A
ZNF341	84905	genome.wustl.edu	37	20	32376685	32376685	+	Silent	SNP	A	A	G			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr20:32376685A>G	ENST00000375200.1	+	13	2234	c.1869A>G	c.(1867-1869)aaA>aaG	p.K623K	RP4-553F4.6_ENST00000423074.1_RNA|RP4-553F4.6_ENST00000443171.1_RNA|ZNF341_ENST00000342427.2_Silent_p.K616K|RP4-553F4.6_ENST00000439444.1_RNA	NM_001282933.1	NP_001269862.1	Q9BYN7	ZN341_HUMAN	zinc finger protein 341	623					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	31						AGCCCTACAAATGCTCAGTGT	0.567																																																	0													101.0	83.0	89.0					20																	32376685		2203	4300	6503	SO:0001819	synonymous_variant	0			AK027550	CCDS13227.1, CCDS74719.1	20q11.22	2013-01-08			ENSG00000131061	ENSG00000131061		"""Zinc fingers, C2H2-type"""	15992	protein-coding gene	gene with protein product							Standard	NM_001282933		Approved	dJ553F4.3	uc002wzx.3	Q9BYN7	OTTHUMG00000032275	ENST00000375200.1:c.1869A>G	20.37:g.32376685A>G			A2RUF4|B2RXE5|B7ZM09|Q5JXM8|Q96ST5	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.N591S	ENST00000375200.1	37	c.1772		20																																																																																			ZNF341	-	NULL	ENSG00000131061		0.567	ZNF341-201	KNOWN	basic	protein_coding	ZNF341	HGNC	protein_coding		-	0.00	32	0	A			32376685	+1	tier1	-	no_errors	ENST00000483118	ensembl	human	known	74_37	missense	34.33	44	23	SNP	0.996	G
ZNF385B	151126	genome.wustl.edu	37	2	180306890	180306890	+	3'UTR	SNP	G	G	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr2:180306890G>A	ENST00000410066.1	-	0	3106				ZNF385B_ENST00000466398.1_5'UTR|ZNF385B_ENST00000409343.1_3'UTR|ZNF385B_ENST00000336917.5_3'UTR	NM_152520.4	NP_689733.3	Q569K4	Z385B_HUMAN	zinc finger protein 385B						intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|p53 binding (GO:0002039)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	26			Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)			AGAAAGGGGGGCATGGGAGCA	0.373																																					Colon(155;204 2491 32774 51842)												0																																										SO:0001624	3_prime_UTR_variant	0			AK057999	CCDS33339.1, CCDS46463.1, CCDS46464.1	2q31.3-q32.1	2012-10-05	2007-12-06	2007-12-06	ENSG00000144331	ENSG00000144331			26332	protein-coding gene	gene with protein product		612344	"""zinc finger protein 533"""	ZNF533		12477932	Standard	NM_152520		Approved	FLJ25270	uc002unn.4	Q569K4	OTTHUMG00000154559	ENST00000410066.1:c.*1087C>T	2.37:g.180306890G>A			Q49A04|Q6ZMZ7|Q8IY01|Q8N8H2|Q96DK4	RNA	SNP	-	NULL	ENST00000410066.1	37	NULL	CCDS33339.1	2																																																																																			ZNF385B	-	-	ENSG00000144331		0.373	ZNF385B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF385B	HGNC	protein_coding	OTTHUMT00000335972.1	-	0.00	31	0	G	NM_152520		180306890	-1	tier1	-	no_errors	ENST00000466398	ensembl	human	known	74_37	rna	41.11	52	37	SNP	0.006	A
ZNF446	55663	genome.wustl.edu	37	19	58991834	58991834	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr19:58991834T>A	ENST00000594369.1	+	7	1475	c.1094T>A	c.(1093-1095)cTa>cAa	p.L365Q	ZNF446_ENST00000335841.4_Nonstop_Mutation_p.*337K|ZNF446_ENST00000596341.1_Missense_Mutation_p.L314Q	NM_017908.2	NP_060378.1	Q9NWS9	ZN446_HUMAN	zinc finger protein 446	365					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	extracellular space (GO:0005615)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	8		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		TCCCCGGGGCTAGCCACCGGG	0.652																																																	0													27.0	28.0	28.0					19																	58991834		2203	4299	6502	SO:0001583	missense	0				CCDS12982.1	19q13.43	2013-01-09				ENSG00000083838		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	21036	protein-coding gene	gene with protein product							Standard	NM_017908		Approved	ZKSCAN20, FLJ20626, ZSCAN52	uc002qsz.3	Q9NWS9		ENST00000594369.1:c.1094T>A	19.37:g.58991834T>A	ENSP00000472802:p.Leu365Gln			Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.L365Q	ENST00000594369.1	37	c.1094	CCDS12982.1	19	.	.	.	.	.	.	.	.	.	.	T	12.68	2.011642	0.35511	.	.	ENSG00000083838	ENST00000335841;ENST00000540481;ENST00000391694	.	.	.	2.08	-2.87	0.05700	.	.	.	.	.	T	0.19406	0.0466	L	0.28740	0.885	0.09310	N	1	B	0.17465	0.022	B	0.11329	0.006	T	0.26052	-1.0114	8	0.51188	T	0.08	1.4023	0.0955	0.00043	0.2405:0.2368:0.2428:0.2799	.	365	Q9NWS9	ZN446_HUMAN	Q	365;365;262	.	ENSP00000336565:L365Q	L	+	2	0	ZNF446	63683646	0.287000	0.24315	0.000000	0.03702	0.002000	0.02628	-0.375000	0.07475	-0.735000	0.04837	0.454000	0.30748	CTA	ZNF446	-	NULL	ENSG00000083838		0.652	ZNF446-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF446	HGNC	protein_coding	OTTHUMT00000467052.1		0.00	58	0	T	NM_017908		58991834	+1			no_errors	ENST00000594369	ensembl	human	known	74_37	missense	5.00	76	4	SNP	0.001	A
ZNF518A	9849	genome.wustl.edu	37	10	97920573	97920573	+	RNA	SNP	G	G	A	rs374825340		TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr10:97920573G>A	ENST00000534948.1	+	0	5349							Q6AHZ1	Z518A_HUMAN	zinc finger protein 518A						transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|urinary_tract(2)	24		Colorectal(252;0.0815)		Epithelial(162;4.23e-08)|all cancers(201;1.85e-06)		AATTACCTTAGAAGAAAACAA	0.343																																																	0													14.0	14.0	14.0					10																	97920573		1825	4064	5889			0			AB002333	CCDS73170.1	10q23.33	2012-08-08	2007-12-07	2007-12-07	ENSG00000177853	ENSG00000177853		"""Zinc fingers, C2H2-type"""	29009	protein-coding gene	gene with protein product			"""zinc finger protein 518"""	ZNF518		9205841	Standard	NM_014803		Approved	KIAA0335	uc001klp.3	Q6AHZ1	OTTHUMG00000018828		10.37:g.97920573G>A			A0PJI5|O15044|Q32MP4	RNA	SNP	-	NULL	ENST00000534948.1	37	NULL		10																																																																																			ZNF518A	-	-	ENSG00000177853		0.343	ZNF518A-202	KNOWN	basic	processed_transcript	ZNF518A	HGNC	processed_transcript		-	0.00	21	0	G	NM_014803		97920573	+1	tier1	-	no_errors	ENST00000534948	ensembl	human	known	74_37	rna	30.00	27	12	SNP	0.017	A
ZNF729	100287226	genome.wustl.edu	37	19	22499217	22499217	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr19:22499217G>C	ENST00000601693.1	+	4	3116	c.2998G>C	c.(2998-3000)Gat>Cat	p.D1000H	ZNF729_ENST00000357491.6_Missense_Mutation_p.D972H			A6NN14	ZN729_HUMAN	zinc finger protein 729	1000					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|lung(32)|ovary(3)	41						ATGTGGCAAAGATTTTAACAA	0.353																																																	0																																										SO:0001583	missense	0				CCDS59368.1	19p12	2014-02-14			ENSG00000196350	ENSG00000196350		"""Zinc fingers, C2H2-type"", ""-"""	32464	protein-coding gene	gene with protein product							Standard	NM_001242680		Approved		uc021urs.1	A6NN14	OTTHUMG00000182938	ENST00000601693.1:c.2998G>C	19.37:g.22499217G>C	ENSP00000469582:p.Asp1000His		M0QY45	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D1000H	ENST00000601693.1	37	c.2998	CCDS59368.1	19	.	.	.	.	.	.	.	.	.	.	.	6.112	0.388994	0.11581	.	.	ENSG00000196350	ENST00000357491	T	0.35973	1.28	0.898	0.898	0.19264	.	.	.	.	.	T	0.27098	0.0664	L	0.35414	1.06	.	.	.	.	.	.	.	.	.	T	0.36432	-0.9748	6	0.87932	D	0	.	1.8154	0.03099	0.2474:0.0:0.4307:0.3219	.	.	.	.	H	972	ENSP00000350085:D972H	ENSP00000350085:D972H	D	+	1	0	ZNF729	22291057	0.000000	0.05858	0.003000	0.11579	0.003000	0.03518	-3.480000	0.00457	0.284000	0.22305	0.289000	0.19496	GAT	ZNF729	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196350		0.353	ZNF729-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF729	HGNC	protein_coding	OTTHUMT00000464396.1	-	0.00	21	0	G	XM_496301		22499217	+1	tier1	-	no_errors	ENST00000601693	ensembl	human	novel	74_37	missense	40.62	38	26	SNP	0.008	C
ZNF730	100129543	genome.wustl.edu	37	19	23328256	23328256	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr19:23328256T>C	ENST00000597761.2	+	4	609	c.410T>C	c.(409-411)tTg>tCg	p.L137S		NM_001277403.1	NP_001264332.1	Q6ZMV8	ZN730_HUMAN	zinc finger protein 730	137					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(7)|pancreas(1)|stomach(2)|urinary_tract(1)	16						AACCAGTGTTTGACAACTTCC	0.294																																																	0																																										SO:0001583	missense	0			AK131472	CCDS59371.1	19p12	2013-01-08			ENSG00000183850	ENSG00000183850		"""Zinc fingers, C2H2-type"", ""-"""	32470	protein-coding gene	gene with protein product							Standard	NM_001277403		Approved		uc031rkc.1	Q6ZMV8		ENST00000597761.2:c.410T>C	19.37:g.23328256T>C	ENSP00000472959:p.Leu137Ser			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L137S	ENST00000597761.2	37	c.410	CCDS59371.1	19	.	.	.	.	.	.	.	.	.	.	t	4.661	0.122927	0.08931	.	.	ENSG00000183850	ENST00000327867	.	.	.	1.13	-1.27	0.09347	.	.	.	.	.	T	0.40815	0.1132	M	0.69463	2.115	0.09310	N	1	.	.	.	.	.	.	T	0.38628	-0.9652	6	0.37606	T	0.19	.	3.7188	0.08448	0.0:0.0:0.3958:0.6042	.	.	.	.	S	137	.	ENSP00000329365:L137S	L	+	2	0	ZNF730	23120096	0.000000	0.05858	0.003000	0.11579	0.071000	0.16799	-0.548000	0.06048	-0.522000	0.06417	0.255000	0.18592	TTG	ZNF730	-	NULL	ENSG00000183850		0.294	ZNF730-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF730	HGNC	protein_coding	OTTHUMT00000465737.2	-	0.00	43	0	T	XM_001719792		23328256	+1	tier1	-	no_errors	ENST00000597761	ensembl	human	known	74_37	missense	28.40	57	23	SNP	0.024	C
ZNF568	374900	genome.wustl.edu	37	19	37416130	37416130	+	Silent	SNP	C	C	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr19:37416130C>T	ENST00000333987.7	+	4	611	c.105C>T	c.(103-105)tcC>tcT	p.S35S	ZNF568_ENST00000427117.1_Silent_p.S35S|ZNF568_ENST00000415168.1_Intron|ZNF568_ENST00000455427.2_5'UTR	NM_001204835.1|NM_198539.3	NP_001191764.1|NP_940941.2	Q3ZCX4	ZN568_HUMAN	zinc finger protein 568	35					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(9)|ovary(1)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CTGCCCTTTCCGAGGAAGAAG	0.413																																																	0													142.0	127.0	132.0					19																	37416130		1877	4109	5986	SO:0001819	synonymous_variant	0			BX640681	CCDS42558.1, CCDS56092.1, CCDS56093.1, CCDS74351.1	19q13.12	2013-09-20			ENSG00000198453	ENSG00000198453		"""Zinc fingers, C2H2-type"", ""-"""	25392	protein-coding gene	gene with protein product							Standard	NM_198539		Approved	DKFZp686B0797	uc002ofc.3	Q3ZCX4	OTTHUMG00000048160	ENST00000333987.7:c.105C>T	19.37:g.37416130C>T			B4DS92|E7ER33|Q6N060|Q8NA64	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S35	ENST00000333987.7	37	c.105	CCDS42558.1	19																																																																																			ZNF568	-	NULL	ENSG00000198453		0.413	ZNF568-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF568	HGNC	protein_coding	OTTHUMT00000109572.2	-	0.00	57	0	C	NM_198539		37416130	+1	tier1	-	no_errors	ENST00000333987	ensembl	human	known	74_37	silent	37.38	66	40	SNP	0.000	T
ZNF831	128611	genome.wustl.edu	37	20	57766387	57766387	+	Missense_Mutation	SNP	G	G	A	rs371038563		TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr20:57766387G>A	ENST00000371030.2	+	1	313	c.313G>A	c.(313-315)Gtg>Atg	p.V105M		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	105	Pro-rich.						metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					CCCCACCCAGGTGGGGAAGCC	0.711													.|||	1	0.000199681	0.0008	0.0	5008	,	,		16388	0.0		0.0	False		,,,				2504	0.0																0								G	MET/VAL	0,3972		0,0,1986	8.0	11.0	10.0		313	-3.2	0.0	20		10	1,8249		0,1,4124	no	missense	ZNF831	NM_178457.1	21	0,1,6110	AA,AG,GG		0.0121,0.0,0.0082	benign	105/1678	57766387	1,12221	1986	4125	6111	SO:0001583	missense	0			AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.313G>A	20.37:g.57766387G>A	ENSP00000360069:p.Val105Met		Q5TDR4|Q8TCP0	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V105M	ENST00000371030.2	37	c.313	CCDS42894.1	20	.	.	.	.	.	.	.	.	.	.	G	10.27	1.304562	0.23736	0.0	1.21E-4	ENSG00000124203	ENST00000371030	T	0.05513	3.43	5.48	-3.22	0.05125	.	.	.	.	.	T	0.03739	0.0106	N	0.24115	0.695	0.09310	N	1	B	0.26318	0.146	B	0.21360	0.034	T	0.42582	-0.9443	9	0.40728	T	0.16	-1.6366	5.5636	0.17158	0.1404:0.5349:0.1605:0.1642	.	105	Q5JPB2	ZN831_HUMAN	M	105	ENSP00000360069:V105M	ENSP00000360069:V105M	V	+	1	0	ZNF831	57199782	0.000000	0.05858	0.000000	0.03702	0.812000	0.45895	-0.151000	0.10175	-0.204000	0.10235	0.561000	0.74099	GTG	ZNF831	-	NULL	ENSG00000124203		0.711	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF831	HGNC	protein_coding	OTTHUMT00000079916.2	-	0.00	8	0	G	NM_178457		57766387	+1	tier1	-	no_errors	ENST00000371030	ensembl	human	novel	74_37	missense	41.67	14	10	SNP	0.000	A
ZNF99	7652	genome.wustl.edu	37	19	22941667	22941667	+	Silent	SNP	T	T	C	rs199672066		TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr19:22941667T>C	ENST00000596209.1	-	4	1134	c.1044A>G	c.(1042-1044)aaA>aaG	p.K348K	ZNF99_ENST00000397104.3_Silent_p.K257K	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	348					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				GGCTAAAAGCTTTGCCACATT	0.373																																																	0													53.0	56.0	55.0					19																	22941667		1993	4204	6197	SO:0001819	synonymous_variant	0			BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.1044A>G	19.37:g.22941667T>C			M0R335	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K257	ENST00000596209.1	37	c.771	CCDS59369.1	19																																																																																			ZNF99	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000213973		0.373	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	ZNF99	HGNC	protein_coding	OTTHUMT00000464591.1	-	0.00	42	0	T	XM_065124		22941667	-1	tier1	rs199672066	no_errors	ENST00000397104	ensembl	human	known	74_37	silent	7.84	94	8	SNP	0.014	C
ZSCAN23	222696	genome.wustl.edu	37	6	28402571	28402571	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A9FO-01A-11D-A387-09	TCGA-LN-A9FO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5368be89-2d00-4206-a8d3-b96639295db4	e1e94442-c85e-4d32-9f22-9a1c2bf12624	g.chr6:28402571C>T	ENST00000289788.4	-	4	986	c.841G>A	c.(841-843)Gag>Aag	p.E281K	ZSCAN23_ENST00000486481.1_5'Flank	NM_001012455.1	NP_001012458.1	Q3MJ62	ZSC23_HUMAN	zinc finger and SCAN domain containing 23	281					transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|prostate(1)|stomach(2)	4						CGCCCACACTCATCACATTCA	0.512																																																	0													82.0	74.0	76.0					6																	28402571		692	1591	2283	SO:0001583	missense	0			AK092117	CCDS47393.1	6p21.33	2013-01-08	2007-02-20	2007-02-20	ENSG00000187987	ENSG00000187987		"""-"", ""Zinc fingers, C2H2-type"""	21193	protein-coding gene	gene with protein product			"""zinc finger protein 453"", ""zinc finger protein 390"""	ZNF453, ZNF390			Standard	NM_001012455		Approved	dJ29K1.3.1	uc003nli.4	Q3MJ62	OTTHUMG00000016346	ENST00000289788.4:c.841G>A	6.37:g.28402571C>T	ENSP00000289788:p.Glu281Lys		Q96KV9	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.E281K	ENST00000289788.4	37	c.841	CCDS47393.1	6	.	.	.	.	.	.	.	.	.	.	C	20.2	3.942880	0.73672	.	.	ENSG00000187987	ENST00000289788	T	0.07327	3.2	4.17	4.17	0.49024	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.196393	0.26149	N	0.026044	T	0.05181	0.0138	L	0.39566	1.225	0.21416	N	0.999694	P	0.40909	0.732	P	0.44359	0.447	T	0.12553	-1.0543	10	0.54805	T	0.06	.	14.0077	0.64475	0.0:1.0:0.0:0.0	.	281	Q3MJ62	ZSC23_HUMAN	K	281	ENSP00000289788:E281K	ENSP00000289788:E281K	E	-	1	0	ZSCAN23	28510550	0.042000	0.20092	0.875000	0.34327	0.966000	0.64601	1.839000	0.39220	2.127000	0.65507	0.650000	0.86243	GAG	ZSCAN23	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000187987		0.512	ZSCAN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN23	HGNC	protein_coding	OTTHUMT00000043751.2	-	0.00	50	0	C	XM_167147		28402571	-1	tier1	-	no_errors	ENST00000289788	ensembl	human	known	74_37	missense	47.06	36	32	SNP	0.655	T
