#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCA8	10351	genome.wustl.edu	37	17	66929322	66929322	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr17:66929322G>A	ENST00000269080.2	-	5	694	c.557C>T	c.(556-558)gCt>gTt	p.A186V	ABCA8_ENST00000430352.2_Missense_Mutation_p.A186V|ABCA8_ENST00000586539.1_Missense_Mutation_p.A186V	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	186					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					TATAATAGCAGCATTAATGGC	0.313																																																	0													124.0	128.0	127.0					17																	66929322		2203	4297	6500	SO:0001583	missense	0			AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.557C>T	17.37:g.66929322G>A	ENSP00000269080:p.Ala186Val		A1L3U3|C9JQE6|Q86WW0	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.A186V	ENST00000269080.2	37	c.557	CCDS11680.1	17	.	.	.	.	.	.	.	.	.	.	G	20.3	3.959765	0.74016	.	.	ENSG00000141338	ENST00000269080;ENST00000430352;ENST00000541225;ENST00000428549	D;D	0.88277	-2.36;-2.36	4.17	4.17	0.49024	.	0.000000	0.46758	D	0.000275	D	0.93854	0.8034	M	0.86651	2.83	0.39081	D	0.960916	D;D;D;D;D	0.67145	0.995;0.996;0.996;0.989;0.996	P;D;D;P;D	0.70487	0.897;0.911;0.938;0.856;0.969	D	0.93220	0.6608	10	0.29301	T	0.29	.	12.1725	0.54167	0.0:0.0:1.0:0.0	.	125;186;186;186;186	F5H6Z4;A1L3U3;B4DJ11;C9JQE6;O94911	.;.;.;.;ABCA8_HUMAN	V	186;186;125;186	ENSP00000269080:A186V;ENSP00000402814:A186V	ENSP00000269080:A186V	A	-	2	0	ABCA8	64440917	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	4.939000	0.63526	2.322000	0.78497	0.655000	0.94253	GCT	ABCA8	-	NULL	ENSG00000141338		0.313	ABCA8-001	KNOWN	basic|CCDS	protein_coding	ABCA8	HGNC	protein_coding	OTTHUMT00000450172.1		0.00	36	0	G	NM_007168		66929322	-1			no_errors	ENST00000430352	ensembl	human	known	74_37	missense	7.69	24	2	SNP	1.000	A
ACTA2	59	genome.wustl.edu	37	10	90706962	90706962	+	Intron	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr10:90706962G>C	ENST00000458208.1	-	3	733				STAMBPL1_ENST00000371927.3_Intron|ACTA2_ENST00000224784.6_Intron|ACTA2_ENST00000480297.1_Intron	NM_001141945.1	NP_001135417.1	P62736	ACTA_HUMAN	actin, alpha 2, smooth muscle, aorta						glomerular mesangial cell development (GO:0072144)|muscle contraction (GO:0006936)|regulation of blood pressure (GO:0008217)|response to virus (GO:0009615)|vascular smooth muscle contraction (GO:0014829)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|smooth muscle contractile fiber (GO:0030485)	ATP binding (GO:0005524)|protein kinase binding (GO:0019901)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|skin(1)|urinary_tract(2)	17		Colorectal(252;0.0161)		Colorectal(12;0.000123)|COAD - Colon adenocarcinoma(12;0.00018)		CTGTATCAGAGAACACAGGGA	0.458																																																	0																																										SO:0001627	intron_variant	0			X13839	CCDS7392.1	10q23.31	2014-09-17			ENSG00000107796	ENSG00000107796			130	protein-coding gene	gene with protein product		102620				2398629	Standard	NM_001141945		Approved	ACTSA	uc001kfp.3	P62736	OTTHUMG00000018700	ENST00000458208.1:c.258+52C>G	10.37:g.90706962G>C			B2R8A4|P03996|P04108|Q6FI19	RNA	SNP	-	NULL	ENST00000458208.1	37	NULL	CCDS7392.1	10																																																																																			ACTA2	-	-	ENSG00000107796		0.458	ACTA2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTA2	HGNC	protein_coding	OTTHUMT00000049264.1	-	0.00	62	0	G	NM_001613		90706962	-1	tier1	-	no_errors	ENST00000488967	ensembl	human	known	74_37	rna	32.65	33	16	SNP	0.000	C
ABCC2	1244	genome.wustl.edu	37	10	101560160	101560160	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr10:101560160C>T	ENST00000370449.4	+	9	1162	c.1049C>T	c.(1048-1050)gCa>gTa	p.A350V		NM_000392.3	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 2	350	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular chloride ion homeostasis (GO:0030644)|drug transmembrane transport (GO:0006855)|prostaglandin transport (GO:0015732)|response to arsenic-containing substance (GO:0046685)|response to estrogen (GO:0043627)|response to heat (GO:0009408)|response to methotrexate (GO:0031427)|response to oxidative stress (GO:0006979)|thyroid hormone transport (GO:0070327)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(5)|endometrium(9)|kidney(2)|large_intestine(20)|liver(1)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	67		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Aminohippurate(DB00345)|Arsenic trioxide(DB01169)|Atorvastatin(DB01076)|Canagliflozin(DB08907)|Carbamazepine(DB00564)|Carboplatin(DB00958)|Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Eprosartan(DB00876)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Ezetimibe(DB00973)|Furosemide(DB00695)|Fusidic Acid(DB02703)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Leucovorin(DB00650)|Levetiracetam(DB01202)|Lomefloxacin(DB00978)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nifedipine(DB01115)|Norgestimate(DB00957)|Ofloxacin(DB01165)|Olmesartan(DB00275)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Ritonavir(DB00503)|Saquinavir(DB01232)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Sulfasalazine(DB00795)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Tenofovir(DB00300)|Tetrahydrofolic acid(DB00116)|Ursodeoxycholic acid(DB01586)|Vasopressin(DB00067)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	ATCTCCTTTGCAAGTGACCGT	0.458																																																	0													366.0	348.0	354.0					10																	101560160		2203	4300	6503	SO:0001583	missense	0			U63970	CCDS7484.1	10q24	2012-03-14			ENSG00000023839	ENSG00000023839		"""ATP binding cassette transporters / subfamily C"""	53	protein-coding gene	gene with protein product		601107	"""canalicular multispecific organic anion transporter 1"""	CMOAT		8797578, 9284939	Standard	XM_006717630		Approved	DJS, MRP2, cMRP	uc001kqf.2	Q92887	OTTHUMG00000018895	ENST00000370449.4:c.1049C>T	10.37:g.101560160C>T	ENSP00000359478:p.Ala350Val		B2RMT8|Q14022|Q5T2B1|Q92500|Q92798|Q99663|Q9UMS2	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,tigrfam_Multidrug-R_assoc	p.A350V	ENST00000370449.4	37	c.1049	CCDS7484.1	10	.	.	.	.	.	.	.	.	.	.	C	5.677	0.309464	0.10733	.	.	ENSG00000023839	ENST00000370449	D	0.87887	-2.31	5.8	3.69	0.42338	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.357463	0.34133	N	0.004229	T	0.57007	0.2024	N	0.00811	-1.165	0.80722	D	1	B	0.02656	0.0	B	0.09377	0.004	T	0.54879	-0.8227	10	0.02654	T	1	-0.7871	4.7332	0.12975	0.0:0.5355:0.1645:0.3001	.	350	Q92887	MRP2_HUMAN	V	350	ENSP00000359478:A350V	ENSP00000359478:A350V	A	+	2	0	ABCC2	101550150	0.995000	0.38212	0.354000	0.25760	0.925000	0.55904	3.093000	0.50217	0.502000	0.28037	0.561000	0.74099	GCA	ABCC2	-	pfam_ABC_transptr_TM_dom,superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom,tigrfam_Multidrug-R_assoc	ENSG00000023839		0.458	ABCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC2	HGNC	protein_coding	OTTHUMT00000049825.1	-	0.00	46	0	C	NM_000392		101560160	+1	tier1	-	no_errors	ENST00000370449	ensembl	human	known	74_37	missense	7.14	52	4	SNP	0.970	T
ACTR5	79913	genome.wustl.edu	37	20	37383788	37383788	+	Missense_Mutation	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr20:37383788G>C	ENST00000243903.4	+	4	1001	c.964G>C	c.(964-966)Gag>Cag	p.E322Q		NM_024855.3	NP_079131.3	Q9H9F9	ARP5_HUMAN	ARP5 actin-related protein 5 homolog (yeast)	322					DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|UV-damage excision repair (GO:0070914)	cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)				kidney(2)|large_intestine(2)|liver(1)|lung(5)|skin(2)	12		Myeloproliferative disorder(115;0.00878)				GCTGGATCAGGAGCGTCTGGA	0.552																																																	0													21.0	23.0	22.0					20																	37383788		2202	4300	6502	SO:0001583	missense	0			AK022847	CCDS13308.1	20q12	2011-07-06	2001-11-28		ENSG00000101442	ENSG00000101442		"""INO80 complex subunits"""	14671	protein-coding gene	gene with protein product	"""INO80 complex subunit M"""		"""ARP5 (actin-related protein 5, yeast) homolog"""			16230350	Standard	NM_024855		Approved	FLJ12785, Arp5, INO80M	uc002xjd.2	Q9H9F9	OTTHUMG00000032456	ENST00000243903.4:c.964G>C	20.37:g.37383788G>C	ENSP00000243903:p.Glu322Gln		Q86WF7|Q8IUY5|Q8N724|Q9BRN0|Q9BVB7	Missense_Mutation	SNP	pfam_Actin-related,smart_Actin-related	p.E322Q	ENST00000243903.4	37	c.964	CCDS13308.1	20	.	.	.	.	.	.	.	.	.	.	G	23.0	4.357260	0.82243	.	.	ENSG00000101442	ENST00000243903	D	0.96232	-3.95	5.86	5.86	0.93980	.	0.046592	0.85682	D	0.000000	D	0.96781	0.8949	L	0.38649	1.16	0.51767	D	0.999936	D	0.67145	0.996	D	0.67725	0.953	D	0.95584	0.8649	10	0.30854	T	0.27	-35.7498	20.1726	0.98160	0.0:0.0:1.0:0.0	.	322	Q9H9F9	ARP5_HUMAN	Q	322	ENSP00000243903:E322Q	ENSP00000243903:E322Q	E	+	1	0	ACTR5	36817202	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	7.094000	0.76944	2.777000	0.95525	0.655000	0.94253	GAG	ACTR5	-	pfam_Actin-related,smart_Actin-related	ENSG00000101442		0.552	ACTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTR5	HGNC	protein_coding	OTTHUMT00000079205.2		0.00	66	0	G	NM_024855		37383788	+1			no_errors	ENST00000243903	ensembl	human	known	74_37	missense	14.00	43	7	SNP	1.000	C
ADAM12	8038	genome.wustl.edu	37	10	127708322	127708322	+	Missense_Mutation	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr10:127708322G>C	ENST00000368679.4	-	22	2920	c.2611C>G	c.(2611-2613)Cat>Gat	p.H871D		NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12	871					cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		GCCAAGGCATGAGTGAGCCGA	0.572																																																	0													63.0	62.0	62.0					10																	127708322		2203	4300	6503	SO:0001583	missense	0			AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.2611C>G	10.37:g.127708322G>C	ENSP00000357668:p.His871Asp		O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.H871D	ENST00000368679.4	37	c.2611	CCDS7653.1	10	.	.	.	.	.	.	.	.	.	.	G	2.652	-0.281701	0.05642	.	.	ENSG00000148848	ENST00000368679	T	0.01438	4.89	5.16	-1.95	0.07548	.	1.186530	0.06261	N	0.693860	T	0.00845	0.0028	N	0.08118	0	0.09310	N	1	B	0.12013	0.005	B	0.09377	0.004	T	0.48019	-0.9071	10	0.12430	T	0.62	.	5.7746	0.18271	0.0:0.2499:0.2858:0.4643	.	871	O43184	ADA12_HUMAN	D	871	ENSP00000357668:H871D	ENSP00000357668:H871D	H	-	1	0	ADAM12	127698312	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.324000	0.07986	-0.019000	0.14055	-0.284000	0.09977	CAT	ADAM12	-	NULL	ENSG00000148848		0.572	ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM12	HGNC	protein_coding	OTTHUMT00000050961.1	-	0.00	25	0	G			127708322	-1	tier1	-	no_errors	ENST00000368679	ensembl	human	known	74_37	missense	37.93	18	11	SNP	0.000	C
ADAM5	255926	genome.wustl.edu	37	8	39233345	39233345	+	RNA	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr8:39233345C>T	ENST00000505455.1	+	0	1043							Q6NVV9	ADAM5_HUMAN	ADAM metallopeptidase domain 5, pseudogene								metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)										CTTCTGTTTTCAAGGAAAGTG	0.363																																																	0																																												0			BC047448		8p11.23	2012-08-22	2010-03-12	2012-08-22	ENSG00000196115	ENSG00000196115		"""ADAM metallopeptidase domain containing"""	212	pseudogene	pseudogene			"""a disintegrin and metalloproteinase domain 5"""	ADAM5P		8786143, 10417343	Standard	NR_001448		Approved	tMDCII	uc003xnb.3	Q6NVV9	OTTHUMG00000154982		8.37:g.39233345C>T			A8MW71|Q4G196	RNA	SNP	-	NULL	ENST00000505455.1	37	NULL		8																																																																																			ADAM5	-	-	ENSG00000196115		0.363	ADAM5-006	KNOWN	basic	processed_transcript	ADAM5	HGNC	pseudogene	OTTHUMT00000337882.1	-	0.00	68	0	C	NR_001448		39233345	+1	tier1	-	no_errors	ENST00000359790	ensembl	human	known	74_37	rna	27.47	66	25	SNP	0.000	T
ADAMTS12	81792	genome.wustl.edu	37	5	33615933	33615933	+	Splice_Site	SNP	C	C	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr5:33615933C>A	ENST00000504830.1	-	15	2723	c.2388G>T	c.(2386-2388)caG>caT	p.Q796H	ADAMTS12_ENST00000352040.3_Splice_Site_p.Q711H|ADAMTS12_ENST00000504582.1_5'UTR	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	796	Spacer 1.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						TCTGCATTACCTGGATCCACA	0.468										HNSCC(64;0.19)																																							0													137.0	122.0	127.0					5																	33615933		2203	4300	6503	SO:0001630	splice_region_variant	0			AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.2388+1G>T	5.37:g.33615933C>A			A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.Q796H	ENST00000504830.1	37	c.2388	CCDS34140.1	5	.	.	.	.	.	.	.	.	.	.	C	24.4	4.525339	0.85600	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.53857	0.6;0.6	5.35	5.35	0.76521	ADAM-TS Spacer 1 (1);	0.107334	0.64402	D	0.000004	T	0.78773	0.4336	M	0.90542	3.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.992	T	0.82936	-0.0210	9	.	.	.	.	18.6763	0.91529	0.0:1.0:0.0:0.0	.	711;796	P58397-3;P58397	.;ATS12_HUMAN	H	796;711	ENSP00000422554:Q796H;ENSP00000344847:Q711H	.	Q	-	3	2	ADAMTS12	33651690	1.000000	0.71417	1.000000	0.80357	0.801000	0.45260	4.795000	0.62489	2.481000	0.83766	0.561000	0.74099	CAG	ADAMTS12	-	pfam_ADAM_spacer1	ENSG00000151388		0.468	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS12	HGNC	protein_coding	OTTHUMT00000367164.2		0.00	18	0	C	NM_030955	Missense_Mutation	33615933	-1			no_errors	ENST00000504830	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	A
ADAMTS3	9508	genome.wustl.edu	37	4	73181672	73181672	+	Missense_Mutation	SNP	G	G	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr4:73181672G>T	ENST00000286657.4	-	11	1538	c.1502C>A	c.(1501-1503)cCa>cAa	p.P501Q		NM_014243.2	NP_055058.2	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 3	501	Disintegrin.				collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix organization (GO:0030198)|positive regulation of vascular endothelial growth factor signaling pathway (GO:1900748)|protein processing (GO:0016485)|vascular endothelial growth factor production (GO:0010573)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(33)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	76			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CTGTTTACATGGGTCAAAGGT	0.408																																					NSCLC(168;1941 2048 2918 13048 43078)												0													89.0	83.0	85.0					4																	73181672		2203	4300	6503	SO:0001583	missense	0			AB002364	CCDS3553.1	4q21	2008-07-29	2005-08-19		ENSG00000156140	ENSG00000156140	3.4.24.-	"""ADAM metallopeptidases with thrombospondin type 1 motif"""	219	protein-coding gene	gene with protein product		605011	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 3"""			10094461	Standard	NM_014243		Approved	KIAA0366, ADAMTS-4	uc003hgk.2	O15072	OTTHUMG00000129912	ENST00000286657.4:c.1502C>A	4.37:g.73181672G>T	ENSP00000286657:p.Pro501Gln		A1L3U9|Q9BXZ8	Missense_Mutation	SNP	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B	p.P501Q	ENST00000286657.4	37	c.1502	CCDS3553.1	4	.	.	.	.	.	.	.	.	.	.	G	27.5	4.834018	0.91036	.	.	ENSG00000156140	ENST00000286657	T	0.64618	-0.11	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.74733	0.3755	L	0.42529	1.33	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.74931	-0.3496	10	0.56958	D	0.05	.	19.6668	0.95895	0.0:0.0:1.0:0.0	.	501	O15072	ATS3_HUMAN	Q	501	ENSP00000286657:P501Q	ENSP00000286657:P501Q	P	-	2	0	ADAMTS3	73400536	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.835000	0.99442	2.650000	0.89964	0.655000	0.94253	CCA	ADAMTS3	-	NULL	ENSG00000156140		0.408	ADAMTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS3	HGNC	protein_coding	OTTHUMT00000252164.2	-	0.00	44	0	G			73181672	-1	tier1	-	no_errors	ENST00000286657	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	T
ADSL	158	genome.wustl.edu	37	22	40757555	40757555	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr22:40757555G>A	ENST00000216194.7	+	9	982	c.926G>A	c.(925-927)cGc>cAc	p.R309H	ADSL_ENST00000480775.1_3'UTR|ADSL_ENST00000454266.2_Missense_Mutation_p.R323H|ADSL_ENST00000342312.6_Missense_Mutation_p.R309H	NM_000026.2	NP_000017.1	P30566	PUR8_HUMAN	adenylosuccinate lyase	309					'de novo' AMP biosynthetic process (GO:0044208)|'de novo' IMP biosynthetic process (GO:0006189)|aerobic respiration (GO:0009060)|AMP biosynthetic process (GO:0006167)|metabolic process (GO:0008152)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein tetramerization (GO:0051262)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	(S)-2-(5-amino-1-(5-phospho-D-ribosyl)imidazole-4-carboxamido)succinate AMP-lyase (fumarate-forming) activity (GO:0070626)|N6-(1,2-dicarboxyethyl)AMP AMP-lyase (fumarate-forming) activity (GO:0004018)			breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(2)|ovary(1)|prostate(1)	19						AGTCTTGCCCGCCACCTGATG	0.532																																					Colon(4;65 130 1097 1516)												0													146.0	117.0	127.0					22																	40757555		2203	4300	6503	SO:0001583	missense	0			X65867	CCDS14001.1, CCDS46714.1	22q13.1	2011-02-17			ENSG00000239900	ENSG00000239900	4.3.2.2		291	protein-coding gene	gene with protein product		608222				8404037	Standard	NM_000026		Approved		uc003ayp.4	P30566	OTTHUMG00000166425	ENST00000216194.7:c.926G>A	22.37:g.40757555G>A	ENSP00000216194:p.Arg309His		B0QY76|O75495|Q5TI34	Missense_Mutation	SNP	pfam_Fumarate_lyase_N,pfam_AdenyloSucc_lyase_C,superfamily_L-Aspartase-like,prints_Fumarate_lyase_fam,tigrfam_Pur_lyase	p.R323H	ENST00000216194.7	37	c.968	CCDS14001.1	22	.	.	.	.	.	.	.	.	.	.	G	36	5.731123	0.96856	.	.	ENSG00000239900	ENST00000216194;ENST00000454266;ENST00000537028;ENST00000342312	T;T;T	0.73897	-0.79;-0.79;-0.79	5.91	5.91	0.95273	Lyase 1, N-terminal (1);L-Aspartase-like (1);	0.000000	0.85682	D	0.000000	D	0.91965	0.7455	H	0.97758	4.07	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.93979	0.7256	10	0.87932	D	0	-17.1946	20.2985	0.98592	0.0:0.0:1.0:0.0	.	323;309;309;309	E7ERF4;P30566-2;Q71UA4;P30566	.;.;.;PUR8_HUMAN	H	309;323;129;309	ENSP00000216194:R309H;ENSP00000390107:R323H;ENSP00000341429:R309H	ENSP00000216194:R309H	R	+	2	0	ADSL	39087501	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	9.026000	0.93700	2.793000	0.96121	0.655000	0.94253	CGC	ADSL	-	pfam_Fumarate_lyase_N,superfamily_L-Aspartase-like,tigrfam_Pur_lyase	ENSG00000239900		0.532	ADSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADSL	HGNC	protein_coding	OTTHUMT00000321386.1	-	0.00	15	0	G	NM_000026		40757555	+1	tier1	-	no_errors	ENST00000454266	ensembl	human	known	74_37	missense	28.57	25	10	SNP	1.000	A
AFAP1L1	134265	genome.wustl.edu	37	5	148689634	148689635	+	Frame_Shift_Ins	INS	-	-	G	rs35622916		TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr5:148689634_148689635insG	ENST00000296721.4	+	8	961_962	c.863_864insG	c.(862-867)caggggfs	p.QG288fs	AFAP1L1_ENST00000515000.1_Frame_Shift_Ins_p.QG288fs	NM_001146337.1|NM_152406.2	NP_001139809.1|NP_689619.1	Q8TED9	AF1L1_HUMAN	actin filament associated protein 1-like 1	288	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.					cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(10)|ovary(1)|pancreas(1)|skin(2)	26			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGTTTCACCCAGGGGGCTACCG	0.629																																																	0																																										SO:0001589	frameshift_variant	0			AK094067	CCDS34274.1, CCDS54932.1	5q33.1	2013-01-10			ENSG00000157510	ENSG00000157510		"""Pleckstrin homology (PH) domain containing"""	26714	protein-coding gene	gene with protein product		614410					Standard	NM_152406		Approved	FLJ36748	uc003lqh.3	Q8TED9	OTTHUMG00000163441	ENST00000296721.4:c.868dupG	5.37:g.148689639_148689639dupG	ENSP00000296721:p.Gln288fs		Q08AN4|Q08AN5|Q8IW82|Q8N8Z5|Q8N9Q4	Frame_Shift_Ins	INS	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.A290fs	ENST00000296721.4	37	c.863_864	CCDS34274.1	5																																																																																			AFAP1L1	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000157510		0.629	AFAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFAP1L1	HGNC	protein_coding	OTTHUMT00000373443.1		0.00	50	0	-	NM_152406		148689635	+1	tier1		no_errors	ENST00000296721	ensembl	human	known	74_37	frame_shift_ins	5.56	34	2	INS	1.000:1.000	G
AFF3	3899	genome.wustl.edu	37	2	100203676	100203676	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr2:100203676C>G	ENST00000409236.2	-	14	2643	c.2531G>C	c.(2530-2532)aGa>aCa	p.R844T	AFF3_ENST00000409579.1_Missense_Mutation_p.R869T|AFF3_ENST00000356421.2_Missense_Mutation_p.R869T|AFF3_ENST00000317233.4_Missense_Mutation_p.R844T			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	844					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)			NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						GGTGGCCAGTCTTGAAGAGCT	0.473																																																	0													311.0	266.0	281.0					2																	100203676		2203	4300	6503	SO:0001583	missense	0			U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.2531G>C	2.37:g.100203676C>G	ENSP00000387207:p.Arg844Thr		B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Missense_Mutation	SNP	pfam_TF_AF4/FMR2	p.R869T	ENST00000409236.2	37	c.2606	CCDS42723.1	2	.	.	.	.	.	.	.	.	.	.	C	10.26	1.302452	0.23736	.	.	ENSG00000144218	ENST00000317233;ENST00000356421;ENST00000409579;ENST00000409236;ENST00000433370;ENST00000444786	T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09	5.92	5.92	0.95590	.	0.000000	0.50627	D	0.000112	T	0.64659	0.2618	L	0.27053	0.805	0.09310	N	0.999998	D;B;D	0.76494	0.999;0.144;0.996	D;B;P	0.72338	0.977;0.063;0.9	T	0.55630	-0.8111	10	0.15066	T	0.55	.	12.7667	0.57396	0.0:0.9252:0.0:0.0748	.	997;844;869	B7Z4I6;P51826;P51826-2	.;AFF3_HUMAN;.	T	844;869;869;844;844;997	ENSP00000317421:R844T;ENSP00000348793:R869T;ENSP00000386834:R869T;ENSP00000387207:R844T	ENSP00000317421:R844T	R	-	2	0	AFF3	99570108	0.838000	0.29461	0.012000	0.15200	0.881000	0.50899	2.505000	0.45424	2.804000	0.96469	0.655000	0.94253	AGA	AFF3	-	pfam_TF_AF4/FMR2	ENSG00000144218		0.473	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFF3	HGNC	protein_coding	OTTHUMT00000328982.3	-	0.00	118	0	C	NM_002285		100203676	-1	tier1	-	no_errors	ENST00000356421	ensembl	human	known	74_37	missense	27.87	88	34	SNP	0.053	G
AFM	173	genome.wustl.edu	37	4	74357670	74357670	+	Missense_Mutation	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr4:74357670G>C	ENST00000226355.3	+	8	1018	c.925G>C	c.(925-927)Gag>Cag	p.E309Q		NM_001133.2	NP_001124.1	P43652	AFAM_HUMAN	afamin	309	Albumin 2. {ECO:0000255|PROSITE- ProRule:PRU00769}.				vitamin transport (GO:0051180)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	vitamin E binding (GO:0008431)			breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	Breast(15;0.00102)		Epithelial(6;5.69e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|all cancers(17;0.000555)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GAAAATACCAGAGCGCGGCCA	0.353																																																	0													85.0	89.0	88.0					4																	74357670		2203	4300	6503	SO:0001583	missense	0			L32140	CCDS3557.1	4q13.3	2008-06-11			ENSG00000079557	ENSG00000079557			316	protein-coding gene	gene with protein product		104145				7517938	Standard	NM_001133		Approved	ALB2, ALBA	uc003hhb.3	P43652	OTTHUMG00000130004	ENST00000226355.3:c.925G>C	4.37:g.74357670G>C	ENSP00000226355:p.Glu309Gln		A8K3E1|Q32MR3|Q4W5C5	Missense_Mutation	SNP	pirsf_Serum_albumin/AFP,pfam_Serum_albumin_N,superfamily_Serum_albumin-like,smart_Serum_albumin_N,prints_ALB/AFP/VDB,prints_Alpha-fetoprotein	p.E309Q	ENST00000226355.3	37	c.925	CCDS3557.1	4	.	.	.	.	.	.	.	.	.	.	G	8.748	0.920495	0.17982	.	.	ENSG00000079557	ENST00000226355	T	0.77358	-1.09	5.06	3.26	0.37387	Serum albumin-like (1);Serum albumin, N-terminal (3);	0.345426	0.27768	N	0.017929	T	0.65544	0.2701	L	0.36672	1.1	0.09310	N	1	P	0.37061	0.58	B	0.37550	0.253	T	0.56786	-0.7921	10	0.39692	T	0.17	.	7.1765	0.25747	0.0939:0.1707:0.7354:0.0	.	309	P43652	AFAM_HUMAN	Q	309	ENSP00000226355:E309Q	ENSP00000226355:E309Q	E	+	1	0	AFM	74576534	0.976000	0.34144	0.066000	0.19879	0.594000	0.36715	2.535000	0.45685	1.158000	0.42547	0.449000	0.29647	GAG	AFM	-	pirsf_Serum_albumin/AFP,pfam_Serum_albumin_N,superfamily_Serum_albumin-like,smart_Serum_albumin_N	ENSG00000079557		0.353	AFM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFM	HGNC	protein_coding	OTTHUMT00000252275.2	-	0.00	29	0	G			74357670	+1	tier1	-	no_errors	ENST00000226355	ensembl	human	known	74_37	missense	51.43	17	18	SNP	0.011	C
AHCTF1	25909	genome.wustl.edu	37	1	247076573	247076573	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr1:247076573C>G	ENST00000391829.2	-	4	640	c.517G>C	c.(517-519)Gat>Cat	p.D173H	AHCTF1_ENST00000366508.1_Missense_Mutation_p.D208H|AHCTF1_ENST00000326225.3_Missense_Mutation_p.D182H			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	173	Necessary for cytoplasmic localization. {ECO:0000250}.|Seven-bladed beta propeller repeats. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			GACAAGTCATCCAAACATAGG	0.408																																					Colon(145;197 1800 4745 15099 26333)												0													76.0	71.0	73.0					1																	247076573		2203	4300	6503	SO:0001583	missense	0				CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.517G>C	1.37:g.247076573C>G	ENSP00000375705:p.Asp173His		A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Missense_Mutation	SNP	superfamily_Quinonprotein_ADH-like_supfam	p.D182H	ENST00000391829.2	37	c.544		1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.594900	0.86953	.	.	ENSG00000153207	ENST00000366508;ENST00000326225;ENST00000391829	T;T;T	0.22336	1.96;1.96;1.96	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.48750	0.1517	M	0.69823	2.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.49093	-0.8975	10	0.72032	D	0.01	-24.7628	19.169	0.93569	0.0:1.0:0.0:0.0	.	208;173	Q8WYP5-2;Q8WYP5	.;ELYS_HUMAN	H	208;182;173	ENSP00000355464:D208H;ENSP00000355465:D182H;ENSP00000375705:D173H	ENSP00000355465:D182H	D	-	1	0	AHCTF1	245143196	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.466000	0.80914	2.607000	0.88179	0.655000	0.94253	GAT	AHCTF1	-	superfamily_Quinonprotein_ADH-like_supfam	ENSG00000153207		0.408	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	AHCTF1	HGNC	protein_coding		-	0.00	91	0	C	NM_015446		247076573	-1	tier1	-	no_errors	ENST00000326225	ensembl	human	known	74_37	missense	31.76	58	27	SNP	1.000	G
AHCTF1	25909	genome.wustl.edu	37	1	247076585	247076585	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr1:247076585C>G	ENST00000391829.2	-	4	628	c.505G>C	c.(505-507)Gac>Cac	p.D169H	AHCTF1_ENST00000366508.1_Missense_Mutation_p.D204H|AHCTF1_ENST00000326225.3_Missense_Mutation_p.D178H			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	169	Necessary for cytoplasmic localization. {ECO:0000250}.|Seven-bladed beta propeller repeats. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			AAACATAGGTCAACAAGAAGG	0.438																																					Colon(145;197 1800 4745 15099 26333)												0													80.0	75.0	77.0					1																	247076585		2203	4300	6503	SO:0001583	missense	0				CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.505G>C	1.37:g.247076585C>G	ENSP00000375705:p.Asp169His		A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Missense_Mutation	SNP	superfamily_Quinonprotein_ADH-like_supfam	p.D178H	ENST00000391829.2	37	c.532		1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.274537	0.80580	.	.	ENSG00000153207	ENST00000366508;ENST00000326225;ENST00000391829	T;T;T	0.23147	1.92;1.92;1.92	5.38	4.47	0.54385	.	0.000000	0.85682	D	0.000000	T	0.50086	0.1595	M	0.69823	2.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.55250	-0.8170	10	0.87932	D	0	-16.5173	14.3804	0.66907	0.0:0.9286:0.0:0.0714	.	204;169	Q8WYP5-2;Q8WYP5	.;ELYS_HUMAN	H	204;178;169	ENSP00000355464:D204H;ENSP00000355465:D178H;ENSP00000375705:D169H	ENSP00000355465:D178H	D	-	1	0	AHCTF1	245143208	1.000000	0.71417	0.999000	0.59377	0.980000	0.70556	7.466000	0.80914	1.411000	0.46957	0.655000	0.94253	GAC	AHCTF1	-	superfamily_Quinonprotein_ADH-like_supfam	ENSG00000153207		0.438	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	AHCTF1	HGNC	protein_coding		-	0.00	87	0	C	NM_015446		247076585	-1	tier1	-	no_errors	ENST00000326225	ensembl	human	known	74_37	missense	27.03	53	20	SNP	1.000	G
AHNAK	79026	genome.wustl.edu	37	11	62295933	62295933	+	Missense_Mutation	SNP	T	T	C	rs543137707		TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr11:62295933T>C	ENST00000378024.4	-	5	6230	c.5956A>G	c.(5956-5958)Acc>Gcc	p.T1986A	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	1986					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				ATCTTGGGGGTCTTGAAGTGC	0.507													T|||	1	0.000199681	0.0008	0.0	5008	,	,		22609	0.0		0.0	False		,,,				2504	0.0																0													269.0	276.0	273.0					11																	62295933		2202	4299	6501	SO:0001583	missense	0			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.5956A>G	11.37:g.62295933T>C	ENSP00000367263:p.Thr1986Ala		A1A586	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.T1986A	ENST00000378024.4	37	c.5956	CCDS31584.1	11	.	.	.	.	.	.	.	.	.	.	t	0.001	-3.251305	0.00022	.	.	ENSG00000124942	ENST00000244934;ENST00000378024	T	0.00856	5.61	3.78	-1.22	0.09494	.	.	.	.	.	T	0.00300	0.0009	N	0.00459	-1.475	0.09310	N	1	B	0.09022	0.002	B	0.14023	0.01	T	0.42344	-0.9457	9	0.02654	T	1	.	5.0121	0.14317	0.0:0.5779:0.149:0.273	.	1986	Q09666	AHNK_HUMAN	A	75;1986	ENSP00000367263:T1986A	ENSP00000244934:T75A	T	-	1	0	AHNAK	62052509	0.873000	0.30073	0.009000	0.14445	0.052000	0.14988	0.460000	0.21924	-0.580000	0.05944	-0.802000	0.03209	ACC	AHNAK	-	NULL	ENSG00000124942		0.507	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK	HGNC	protein_coding	OTTHUMT00000395572.1		0.00	108	0	T	NM_024060		62295933	-1			no_errors	ENST00000378024	ensembl	human	known	74_37	missense	5.79	112	7	SNP	0.009	C
AKAP11	11215	genome.wustl.edu	37	13	42877567	42877567	+	Missense_Mutation	SNP	G	G	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr13:42877567G>T	ENST00000025301.2	+	8	4860	c.4685G>T	c.(4684-4686)cGa>cTa	p.R1562L		NM_016248.3	NP_057332.1	Q9UKA4	AKA11_HUMAN	A kinase (PRKA) anchor protein 11	1562					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein kinase A binding (GO:0051018)|protein phosphatase 1 binding (GO:0008157)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(2)	56		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		ACAGTGTTCCGAGTGTCTGAG	0.433																																																	0													96.0	84.0	88.0					13																	42877567		2203	4300	6503	SO:0001583	missense	0			AB014529	CCDS9383.1	13q	2012-04-17			ENSG00000023516	ENSG00000023516		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	369	protein-coding gene	gene with protein product	"""AKAP 220"", ""A-kinase anchoring protein, 220kDa"", ""protein kinase A anchoring protein 11"", ""protein phosphatase 1, regulatory subunit 44"""	604696				9734811, 8621616	Standard	NM_016248		Approved	KIAA0629, AKAP220, PRKA11, FLJ11304, DKFZp781I12161, PPP1R44	uc001uys.2	Q9UKA4	OTTHUMG00000016805	ENST00000025301.2:c.4685G>T	13.37:g.42877567G>T	ENSP00000025301:p.Arg1562Leu		O75124|Q9NUK7	Missense_Mutation	SNP	NULL	p.R1562L	ENST00000025301.2	37	c.4685	CCDS9383.1	13	.	.	.	.	.	.	.	.	.	.	G	1.301	-0.604764	0.03717	.	.	ENSG00000023516	ENST00000025301	T	0.45276	0.9	5.72	-8.74	0.00838	.	0.738559	0.13158	N	0.409280	T	0.10508	0.0257	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.13019	-1.0525	10	0.25751	T	0.34	.	3.3733	0.07228	0.3673:0.255:0.2946:0.083	.	1562	Q9UKA4	AKA11_HUMAN	L	1562	ENSP00000025301:R1562L	ENSP00000025301:R1562L	R	+	2	0	AKAP11	41775567	0.002000	0.14202	0.000000	0.03702	0.004000	0.04260	0.292000	0.19011	-1.789000	0.01264	-1.044000	0.02363	CGA	AKAP11	-	NULL	ENSG00000023516		0.433	AKAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP11	HGNC	protein_coding	OTTHUMT00000044700.2	-	0.00	27	0	G	NM_016248		42877567	+1	tier1	-	no_errors	ENST00000025301	ensembl	human	known	74_37	missense	11.54	23	3	SNP	0.000	T
AKAP13	11214	genome.wustl.edu	37	15	86122760	86122760	+	Missense_Mutation	SNP	G	G	C	rs111631396	byFrequency	TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr15:86122760G>C	ENST00000394518.2	+	7	1556	c.1461G>C	c.(1459-1461)atG>atC	p.M487I	AKAP13_ENST00000361243.2_Missense_Mutation_p.M487I|RP11-815J21.2_ENST00000561409.1_RNA	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	487					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						ATGGGCTCATGAACCCAGATG	0.498																																					Melanoma(94;603 1453 3280 32295 32951)												0													76.0	81.0	79.0					15																	86122760		2202	4299	6501	SO:0001583	missense	0			M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.1461G>C	15.37:g.86122760G>C	ENSP00000378026:p.Met487Ile		Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain	p.M487I	ENST00000394518.2	37	c.1461	CCDS32319.1	15	.	.	.	.	.	.	.	.	.	.	G	9.113	1.006990	0.19199	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540	T;T	0.09163	3.01;3.01	5.67	2.53	0.30540	.	.	.	.	.	T	0.06142	0.0159	N	0.19112	0.55	0.09310	N	0.999998	B;B	0.19817	0.023;0.039	B;B	0.15870	0.006;0.014	T	0.31336	-0.9947	9	0.37606	T	0.19	.	3.2849	0.06929	0.0927:0.1682:0.5506:0.1886	.	487;487	Q12802;Q12802-2	AKP13_HUMAN;.	I	487;487;486;486	ENSP00000354718:M487I;ENSP00000378026:M487I	ENSP00000354718:M487I	M	+	3	0	AKAP13	83923764	0.005000	0.15991	0.006000	0.13384	0.036000	0.12997	1.364000	0.34171	1.473000	0.48159	0.655000	0.94253	ATG	AKAP13	-	NULL	ENSG00000170776		0.498	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	AKAP13	HGNC	protein_coding	OTTHUMT00000417318.1	-	0.00	13	0	G	NM_007200		86122760	+1	tier1	-	no_errors	ENST00000361243	ensembl	human	known	74_37	missense	38.89	11	7	SNP	0.002	C
AKAP9	10142	genome.wustl.edu	37	7	91670145	91670145	+	Missense_Mutation	SNP	A	A	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr7:91670145A>T	ENST00000359028.2	+	19	5111	c.4886A>T	c.(4885-4887)gAg>gTg	p.E1629V	AKAP9_ENST00000358100.2_Missense_Mutation_p.E1629V|AKAP9_ENST00000356239.3_Missense_Mutation_p.E1617V			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	1629					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			CGGCAAATGGAGAGACAGCGA	0.448			T	BRAF	papillary thyroid																																			Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	0													132.0	121.0	125.0					7																	91670145		2203	4300	6503	SO:0001583	missense	0			AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.4886A>T	7.37:g.91670145A>T	ENSP00000351922:p.Glu1629Val		A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	pfam_PACT_domain,superfamily_Prefoldin,superfamily_YbaB	p.E1629V	ENST00000359028.2	37	c.4886		7	.	.	.	.	.	.	.	.	.	.	A	16.82	3.229883	0.58777	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394565	T;T;T	0.04275	3.71;3.67;3.66	5.37	5.37	0.77165	.	0.000000	0.40222	N	0.001160	T	0.21145	0.0509	M	0.74258	2.255	0.47819	D	0.999526	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.91635	0.991;0.996;0.996;0.999	T	0.00231	-1.1896	10	0.72032	D	0.01	.	14.2372	0.65934	1.0:0.0:0.0:0.0	.	1629;1617;1617;1629	Q99996;Q99996-2;Q99996-3;A4D1E4	AKAP9_HUMAN;.;.;.	V	1617;1629;1629;1629;1629	ENSP00000348573:E1617V;ENSP00000351922:E1629V;ENSP00000350813:E1629V	ENSP00000348573:E1617V	E	+	2	0	AKAP9	91508081	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	5.989000	0.70587	2.158000	0.67659	0.477000	0.44152	GAG	AKAP9	-	NULL	ENSG00000127914		0.448	AKAP9-202	KNOWN	basic	protein_coding	AKAP9	HGNC	protein_coding		-	0.00	46	0	A	NM_005751		91670145	+1	tier1	-	no_errors	ENST00000359028	ensembl	human	known	74_37	missense	21.21	26	7	SNP	1.000	T
AMER3	205147	genome.wustl.edu	37	2	131520638	131520638	+	Frame_Shift_Del	DEL	C	C	-			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr2:131520638delC	ENST00000423981.1	+	2	1103	c.993delC	c.(991-993)ggcfs	p.G331fs	AMER3_ENST00000321420.4_Frame_Shift_Del_p.G331fs	NM_001105193.1|NM_001105194.1|NM_001105195.1|NM_152698.2	NP_001098663.1|NP_001098664.1|NP_001098665.1|NP_689911.2	Q8N944	AMER3_HUMAN	APC membrane recruitment protein 3	331					Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	lipid binding (GO:0008289)										GGCTTTCAGGCCCCCAGGGGA	0.657																																																	0													35.0	41.0	39.0					2																	131520638		2203	4300	6503	SO:0001589	frameshift_variant	0			AK095696	CCDS2164.1	2q21.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000178171	ENSG00000178171		"""-"""	26771	protein-coding gene	gene with protein product			"""family with sequence similarity 123C"""	FAM123C		20843316	Standard	NM_001105195		Approved	FLJ38377	uc002trw.2	Q8N944	OTTHUMG00000131637	ENST00000423981.1:c.993delC	2.37:g.131520638delC	ENSP00000392700:p.Gly331fs		B7ZLH6	Frame_Shift_Del	DEL	pfam_Uncharacterised_FAM123	p.Q333fs	ENST00000423981.1	37	c.993	CCDS2164.1	2																																																																																			AMER3	-	pfam_Uncharacterised_FAM123	ENSG00000178171		0.657	AMER3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	AMER3	HGNC	protein_coding	OTTHUMT00000254531.3		0.00	49	0	C	NM_152698		131520638	+1	tier1		no_errors	ENST00000321420	ensembl	human	known	74_37	frame_shift_del	5.71	33	2	DEL	0.000	-
ANO5	203859	genome.wustl.edu	37	11	22281209	22281209	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr11:22281209G>A	ENST00000324559.8	+	15	1869	c.1552G>A	c.(1552-1554)Gga>Aga	p.G518R	CTD-3064C13.1_ENST00000526935.1_RNA	NM_001142649.1|NM_213599.2	NP_001136121.1|NP_998764.1	Q75V66	ANO5_HUMAN	anoctamin 5	518					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	intracellular calcium activated chloride channel activity (GO:0005229)			breast(2)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(12)|lung(36)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						ATCACTCACAGGATCATGCTT	0.383																																																	0													176.0	149.0	158.0					11																	22281209		2203	4300	6503	SO:0001583	missense	0			AL833271	CCDS31444.1	11p15.1	2014-09-17	2008-08-28	2008-08-28	ENSG00000171714	ENSG00000171714		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	27337	protein-coding gene	gene with protein product		608662	"""transmembrane protein 16E"", ""limb girdle muscular dystrophy 2L (autosomal recessive)"""	TMEM16E, LGMD2L		15067359, 20096397, 24692353	Standard	NM_213599		Approved	GDD1	uc001mqi.2	Q75V66	OTTHUMG00000166051	ENST00000324559.8:c.1552G>A	11.37:g.22281209G>A	ENSP00000315371:p.Gly518Arg			Missense_Mutation	SNP	pfam_Anoctamin	p.G518R	ENST00000324559.8	37	c.1552	CCDS31444.1	11	.	.	.	.	.	.	.	.	.	.	G	29.3	4.998547	0.93227	.	.	ENSG00000171714	ENST00000324559	T	0.63255	-0.03	5.48	5.48	0.80851	.	0.100923	0.64402	D	0.000002	T	0.81706	0.4879	M	0.85777	2.775	0.48288	D	0.999621	D	0.61080	0.989	D	0.67103	0.949	D	0.84476	0.0602	10	0.87932	D	0	.	19.3345	0.94309	0.0:0.0:1.0:0.0	.	518	Q75V66	ANO5_HUMAN	R	518	ENSP00000315371:G518R	ENSP00000315371:G518R	G	+	1	0	ANO5	22237785	1.000000	0.71417	0.981000	0.43875	0.980000	0.70556	9.855000	0.99526	2.563000	0.86464	0.591000	0.81541	GGA	ANO5	-	pfam_Anoctamin	ENSG00000171714		0.383	ANO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANO5	HGNC	protein_coding	OTTHUMT00000387615.1	-	0.00	84	0	G	NM_213599		22281209	+1	tier1	-	no_errors	ENST00000324559	ensembl	human	known	74_37	missense	21.62	56	16	SNP	1.000	A
DPH6	89978	genome.wustl.edu	37	15	35530356	35530357	+	Intron	INS	-	-	T	rs141813373		TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr15:35530356_35530357insT	ENST00000560386.1	-	4	200				ANP32AP1_ENST00000560832.1_RNA			Q7L8W6	DPH6_HUMAN	diphthamine biosynthesis 6						peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)		ATP binding (GO:0005524)|diphthine-ammonia ligase activity (GO:0017178)										CCTGAAACTTATTTTTTTTTCT	0.46																																																	0																																										SO:0001627	intron_variant	0				CCDS10043.1, CCDS45213.1	15q14	2013-06-19	2013-06-19	2013-05-02	ENSG00000134146	ENSG00000134146	6.3.1.14		30543	protein-coding gene	gene with protein product	"""diphthine--ammonia ligase"""		"""ATP binding domain 4"", ""DPH6 homolog (S. cerevisiae)"""	ATPBD4		23169644, 23468660	Standard	NM_080650		Approved	MGC14798		Q7L8W6	OTTHUMG00000129759	ENST00000560386.1:c.3239-17573->A	15.37:g.35530365_35530365dupT			B3KWG1|Q96HJ6	RNA	INS	-	NULL	ENST00000560386.1	37	NULL		15																																																																																			ANP32AP1	-	-	ENSG00000259516		0.460	DPH6-003	KNOWN	basic	processed_transcript	ANP32AP1	HGNC	protein_coding	OTTHUMT00000417824.1		0.00	22	0	-	NM_080650		35530357	+1	tier1		no_errors	ENST00000560832	ensembl	human	known	74_37	rna	12.50	14	2	INS	0.997:0.996	T
ANXA4	307	genome.wustl.edu	37	2	70033541	70033541	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr2:70033541G>A	ENST00000394295.4	+	5	465	c.217G>A	c.(217-219)Gaa>Aaa	p.E73K	ANXA4_ENST00000409920.1_Missense_Mutation_p.E73K|ANXA4_ENST00000536030.1_5'UTR	NM_001153.3	NP_001144.1	P09525	ANXA4_HUMAN	annexin A4	71					epithelial cell differentiation (GO:0030855)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of interleukin-8 secretion (GO:2000483)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|phospholipase inhibitor activity (GO:0004859)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)	11						CCTGAAGTCAGAACTGAGTGG	0.522																																																	0													163.0	127.0	139.0					2																	70033541		2203	4300	6503	SO:0001583	missense	0			M82809	CCDS1894.1	2p13.3	2008-02-05			ENSG00000196975	ENSG00000196975		"""Annexins"""	542	protein-coding gene	gene with protein product		106491		ANX4		1346776	Standard	NM_001153		Approved		uc002sfr.4	P09525	OTTHUMG00000129649	ENST00000394295.4:c.217G>A	2.37:g.70033541G>A	ENSP00000377833:p.Glu73Lys		B4DDF9|Q96F33|Q9BWK1	Missense_Mutation	SNP	pfam_Annexin_repeat,smart_Annexin_repeat,prints_Annexin,prints_AnnexinIV,prints_AnnexinV	p.E73K	ENST00000394295.4	37	c.217	CCDS1894.1	2	.	.	.	.	.	.	.	.	.	.	G	21.2	4.107199	0.77096	.	.	ENSG00000196975	ENST00000409920;ENST00000394295	T;T	0.04862	3.54;3.54	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.31949	0.0813	M	0.90145	3.09	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.998	T	0.25293	-1.0136	9	.	.	.	.	15.8659	0.79063	0.0:0.0:1.0:0.0	.	73;73	Q6P452;Q6LES2	.;.	K	73	ENSP00000386756:E73K;ENSP00000377833:E73K	.	E	+	1	0	ANXA4	69887045	1.000000	0.71417	0.965000	0.40720	0.263000	0.26337	7.725000	0.84808	2.414000	0.81942	0.555000	0.69702	GAA	ANXA4	-	pfam_Annexin_repeat,smart_Annexin_repeat,prints_Annexin	ENSG00000196975		0.522	ANXA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANXA4	HGNC	protein_coding	OTTHUMT00000251848.2	-	0.00	32	0	G	NM_001153		70033541	+1	tier1	-	no_errors	ENST00000394295	ensembl	human	known	74_37	missense	35.85	34	19	SNP	0.998	A
APAF1	317	genome.wustl.edu	37	12	99065330	99065330	+	Silent	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr12:99065330G>A	ENST00000551964.1	+	12	2362	c.1626G>A	c.(1624-1626)gaG>gaA	p.E542E	APAF1_ENST00000550527.1_Silent_p.E531E|APAF1_ENST00000549007.1_Silent_p.E542E|APAF1_ENST00000359972.2_Silent_p.E531E|APAF1_ENST00000339433.3_Silent_p.E542E|APAF1_ENST00000552268.1_Intron|APAF1_ENST00000357310.1_Silent_p.E542E|APAF1_ENST00000547045.1_Silent_p.E542E|APAF1_ENST00000333991.1_Intron	NM_181861.1	NP_863651.1	O14727	APAF_HUMAN	apoptotic peptidase activating factor 1	542					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic process (GO:0006915)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway (GO:0097193)|nervous system development (GO:0007399)|neural tube closure (GO:0001843)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|response to G1 DNA damage checkpoint signaling (GO:0072432)	apoptosome (GO:0043293)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(1)	42					Adenosine triphosphate(DB00171)	CAGTCAGTGAGAATTTTCAGG	0.388																																																	0													120.0	123.0	122.0					12																	99065330		2203	4300	6503	SO:0001819	synonymous_variant	0			AF013263	CCDS9069.1, CCDS9070.1, CCDS9071.1, CCDS55862.1, CCDS55863.1	12q23	2013-01-10	2006-10-23			ENSG00000120868		"""WD repeat domain containing"""	576	protein-coding gene	gene with protein product		602233	"""apoptotic protease activating factor"", ""apoptotic peptidase activating factor"""			9267021, 10702682	Standard	NM_181861		Approved	CED4, APAF-1	uc001tfz.3	O14727	OTTHUMG00000170214	ENST00000551964.1:c.1626G>A	12.37:g.99065330G>A			B2RMX8|O43297|Q7Z438|Q9BXZ6|Q9UBZ5|Q9UGN8|Q9UGN9|Q9UGP0|Q9UJ58|Q9UJ59|Q9UJ60|Q9UJ61|Q9UJ62|Q9UJ63|Q9UJ64|Q9UJ65|Q9UJ66|Q9UJ67|Q9UNC9	Silent	SNP	pfam_WD40_repeat,pfam_NB-ARC,pfam_CARD,superfamily_WD40_repeat_dom,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_WD40_repeat,pirsf_Apoptotic_pept-activating_1,pfscan_CARD,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Disease_R,prints_G-protein_beta_WD-40_rep	p.E542	ENST00000551964.1	37	c.1626	CCDS9069.1	12																																																																																			APAF1	-	pirsf_Apoptotic_pept-activating_1	ENSG00000120868		0.388	APAF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	APAF1	HGNC	protein_coding	OTTHUMT00000408006.1	-	0.00	88	0	G	NM_181861.1		99065330	+1	tier1	-	no_errors	ENST00000551964	ensembl	human	known	74_37	silent	15.79	64	12	SNP	1.000	A
ARHGEF18	23370	genome.wustl.edu	37	19	7505006	7505006	+	Silent	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr19:7505006C>T	ENST00000359920.6	+	1	433	c.180C>T	c.(178-180)tcC>tcT	p.S60S	ARHGEF18_ENST00000319670.9_Intron|CTD-2207O23.3_ENST00000593531.1_Intron	NM_001130955.1	NP_001124427.1	Q6ZSZ5	ARHGI_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 18	60					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transforming growth factor beta receptor signaling pathway (GO:0007179)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(2)|stomach(1)|urinary_tract(1)	23		Renal(5;0.0902)				ATGCGCACTCCAAAAGCGGGG	0.642																																																	0													21.0	24.0	23.0					19																	7505006		692	1591	2283	SO:0001819	synonymous_variant	0			AK074372	CCDS12177.1, CCDS45946.1	19p13.3	2013-01-10	2009-06-12			ENSG00000104880		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	17090	protein-coding gene	gene with protein product	"""Rho-specific guanine nucleotide exchange factor p114"""		"""rho/rac guanine nucleotide exchange factor (GEF) 18"""			9628581, 11318610	Standard	NM_015318		Approved	P114-RhoGEF, KIAA0521, MGC15913	uc002mgi.3	Q6ZSZ5		ENST00000359920.6:c.180C>T	19.37:g.7505006C>T			A8MV62|B5ME81|O60274|Q6DD92	Silent	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.S60	ENST00000359920.6	37	c.180	CCDS45946.1	19																																																																																			ARHGEF18	-	NULL	ENSG00000104880		0.642	ARHGEF18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGEF18	HGNC	protein_coding	OTTHUMT00000436340.1	-	0.00	56	0	C	NM_015318		7505006	+1	tier1	-	no_errors	ENST00000359920	ensembl	human	known	74_37	silent	32.65	33	16	SNP	0.964	T
ARHGEF38	54848	genome.wustl.edu	37	4	106576802	106576802	+	Missense_Mutation	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr4:106576802G>C	ENST00000420470.2	+	9	1300	c.1156G>C	c.(1156-1158)Gag>Cag	p.E386Q	ARHGEF38_ENST00000508036.2_3'UTR	NM_001242729.1	NP_001229658.1	Q9NXL2	ARH38_HUMAN	Rho guanine nucleotide exchange factor (GEF) 38	386	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.					cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(3)	11						GGACCTTCAGGAGATTTCATA	0.388																																																	0																																										SO:0001583	missense	0			AK000191	CCDS3670.1, CCDS56338.1	4q24	2012-07-24			ENSG00000236699	ENSG00000236699		"""Rho guanine nucleotide exchange factors"""	25968	protein-coding gene	gene with protein product							Standard	NM_001242729		Approved	FLJ20184	uc003hxv.2	Q9NXL2	OTTHUMG00000154752	ENST00000420470.2:c.1156G>C	4.37:g.106576802G>C	ENSP00000416125:p.Glu386Gln		C9JIB4	Missense_Mutation	SNP	pfam_DH-domain,pfam_BAR_dom,pfam_SH3_2,pfam_SH3_domain,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_BAR_dom,smart_SH3_domain,pfscan_BAR_dom,pfscan_SH3_domain,pfscan_DH-domain	p.E386Q	ENST00000420470.2	37	c.1156	CCDS56338.1	4	.	.	.	.	.	.	.	.	.	.	G	2.836	-0.241470	0.05906	.	.	ENSG00000236699	ENST00000420470	T	0.69040	-0.37	5.17	3.46	0.39613	.	.	.	.	.	T	0.58438	0.2122	L	0.41961	1.31	0.09310	N	1	.	.	.	.	.	.	T	0.47898	-0.9081	7	0.29301	T	0.29	-4.3801	5.9521	0.19253	0.2222:0.1375:0.6403:0.0	.	.	.	.	Q	386	ENSP00000416125:E386Q	ENSP00000416125:E386Q	E	+	1	0	ARHGEF38	106796251	0.992000	0.36948	0.053000	0.19242	0.004000	0.04260	2.381000	0.44336	0.701000	0.31803	-0.280000	0.10049	GAG	ARHGEF38	-	pfam_BAR_dom,smart_BAR_dom,pfscan_BAR_dom	ENSG00000236699		0.388	ARHGEF38-001	PUTATIVE	basic|appris_principal|readthrough_transcript|exp_conf|CCDS	protein_coding	ARHGEF38	HGNC	protein_coding	OTTHUMT00000336934.3	-	0.00	88	0	G	NM_017700		106576802	+1	tier1	-	no_errors	ENST00000420470	ensembl	human	putative	74_37	missense	30.00	63	27	SNP	0.016	C
ARID1B	57492	genome.wustl.edu	37	6	157528371	157528371	+	Silent	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr6:157528371C>T	ENST00000350026.5	+	19	6058	c.6057C>T	c.(6055-6057)tcC>tcT	p.S2019S	ARID1B_ENST00000275248.4_Silent_p.S2014S|ARID1B_ENST00000367148.1_Silent_p.S2072S|ARID1B_ENST00000346085.5_Silent_p.S2032S	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	2019					chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		CCAACATTTCCGGGCAGCTAG	0.552																																																	0													122.0	118.0	119.0					6																	157528371		2203	4296	6499	SO:0001819	synonymous_variant	0			AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.6057C>T	6.37:g.157528371C>T			Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Silent	SNP	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.S2072	ENST00000350026.5	37	c.6216	CCDS5251.2	6																																																																																			ARID1B	-	pfam_DUF3518	ENSG00000049618		0.552	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARID1B	HGNC	protein_coding	OTTHUMT00000372723.1		0.00	39	0	C	NM_020732		157528371	+1			no_errors	ENST00000367148	ensembl	human	known	74_37	silent	5.00	38	2	SNP	0.940	T
ARID5B	84159	genome.wustl.edu	37	10	63851192	63851192	+	Missense_Mutation	SNP	T	T	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr10:63851192T>G	ENST00000279873.7	+	10	2380	c.1970T>G	c.(1969-1971)tTc>tGc	p.F657C	ARID5B_ENST00000309334.5_Missense_Mutation_p.F414C	NM_032199.2	NP_115575.1	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)	657					adipose tissue development (GO:0060612)|adrenal gland development (GO:0030325)|cell development (GO:0048468)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|fat pad development (GO:0060613)|female gonad development (GO:0008585)|fibroblast migration (GO:0010761)|kidney development (GO:0001822)|liver development (GO:0001889)|male gonad development (GO:0008584)|multicellular organism growth (GO:0035264)|muscle organ morphogenesis (GO:0048644)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription regulatory region DNA binding (GO:0044212)	p.F657Y(1)		NS(1)|breast(2)|endometrium(13)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	Prostate(12;0.016)|all_hematologic(501;0.215)					TTTGACATGTTCAAAGACAAA	0.552																																																	1	Substitution - Missense(1)	endometrium(1)											66.0	57.0	60.0					10																	63851192		2203	4300	6503	SO:0001583	missense	0			M73837	CCDS31208.1, CCDS58082.1	10q11.22	2013-02-07			ENSG00000150347	ENSG00000150347		"""-"""	17362	protein-coding gene	gene with protein product		608538				11483573, 11478881	Standard	NM_032199		Approved	FLJ21150, MRF2	uc001jlt.2	Q14865	OTTHUMG00000018298	ENST00000279873.7:c.1970T>G	10.37:g.63851192T>G	ENSP00000279873:p.Phe657Cys		B4DLB3|Q05DG6|Q32Q59|Q5VST4|Q6NZ42|Q7Z3M4|Q8N421|Q9H786	Missense_Mutation	SNP	pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.F657C	ENST00000279873.7	37	c.1970	CCDS31208.1	10	.	.	.	.	.	.	.	.	.	.	T	19.84	3.902074	0.72754	.	.	ENSG00000150347	ENST00000279873;ENST00000309334	T;T	0.55930	0.51;0.49	5.87	5.87	0.94306	.	0.053570	0.85682	D	0.000000	T	0.68035	0.2957	L	0.60455	1.87	0.58432	D	0.999996	D	0.76494	0.999	D	0.64042	0.921	T	0.70981	-0.4724	10	0.87932	D	0	-19.5795	16.2674	0.82597	0.0:0.0:0.0:1.0	.	657	Q14865	ARI5B_HUMAN	C	657;414	ENSP00000279873:F657C;ENSP00000308862:F414C	ENSP00000279873:F657C	F	+	2	0	ARID5B	63521198	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.144000	0.71762	2.242000	0.73789	0.533000	0.62120	TTC	ARID5B	-	NULL	ENSG00000150347		0.552	ARID5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID5B	HGNC	protein_coding	OTTHUMT00000048233.1		0.00	22	0	T	XM_084482		63851192	+1			no_errors	ENST00000279873	ensembl	human	known	74_37	missense	6.25	30	2	SNP	1.000	G
ARL2BP	23568	genome.wustl.edu	37	16	57280047	57280047	+	Missense_Mutation	SNP	A	A	C	rs199762075		TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr16:57280047A>C	ENST00000219204.3	+	2	364	c.94A>C	c.(94-96)Atc>Ctc	p.I32L	RP11-407G23.4_ENST00000562409.1_RNA|RP11-407G23.3_ENST00000564376.1_RNA|ARL2BP_ENST00000562023.1_Missense_Mutation_p.I32L|ARL2BP_ENST00000565794.1_3'UTR	NM_012106.3	NP_036238.1	Q9Y2Y0	AR2BP_HUMAN	ADP-ribosylation factor-like 2 binding protein	32					maintenance of protein location in nucleus (GO:0051457)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of catalytic activity (GO:0050790)|regulation of RNA biosynthetic process (GO:2001141)|signal transduction (GO:0007165)	centrosome (GO:0005813)|cilium (GO:0005929)|midbody (GO:0030496)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)	small GTPase regulator activity (GO:0005083)|transcription coactivator activity (GO:0003713)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(4)|urinary_tract(1)	12						AGAGGACATTATCATGGGTAA	0.343																																																	0													258.0	259.0	259.0					16																	57280047		2198	4300	6498	SO:0001583	missense	0			AF126062	CCDS10776.1	16q13	2014-01-30			ENSG00000102931	ENSG00000102931			17146	protein-coding gene	gene with protein product	"""binder of Arl2"""	615407	"""retinitis pigmentosa 66 (autosomal recessive)"""	RP66		10488091, 18981177, 23849777	Standard	NM_012106		Approved	BART1, BART	uc002elf.1	Q9Y2Y0	OTTHUMG00000133459	ENST00000219204.3:c.94A>C	16.37:g.57280047A>C	ENSP00000219204:p.Ile32Leu		B3KQJ5|Q504R0	Missense_Mutation	SNP	pfam_ARF-like_2-bdp_dom	p.I32L	ENST00000219204.3	37	c.94	CCDS10776.1	16	.	.	.	.	.	.	.	.	.	.	A	16.91	3.254052	0.59212	.	.	ENSG00000102931	ENST00000219204	T	0.33438	1.41	5.16	5.16	0.70880	ADP-ribosylation factor-like 2-binding protein, domain (2);	0.064498	0.56097	U	0.000021	T	0.38134	0.1029	L	0.43646	1.37	0.58432	D	0.999997	B	0.27068	0.167	B	0.43728	0.429	T	0.19484	-1.0304	10	0.22109	T	0.4	-8.3026	14.9985	0.71451	1.0:0.0:0.0:0.0	.	32	Q9Y2Y0	AR2BP_HUMAN	L	32	ENSP00000219204:I32L	ENSP00000219204:I32L	I	+	1	0	ARL2BP	55837548	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	6.922000	0.75811	1.946000	0.56461	0.459000	0.35465	ATC	ARL2BP	-	pfam_ARF-like_2-bdp_dom	ENSG00000102931		0.343	ARL2BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARL2BP	HGNC	protein_coding	OTTHUMT00000257334.2	-	0.00	66	0	A	NM_012106		57280047	+1	tier1	-	no_errors	ENST00000219204	ensembl	human	known	74_37	missense	18.06	59	13	SNP	1.000	C
ARMC4	55130	genome.wustl.edu	37	10	28224072	28224072	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr10:28224072C>T	ENST00000305242.5	-	16	2454	c.2362G>A	c.(2362-2364)Gaa>Aaa	p.E788K	ARMC4_ENST00000537576.1_Missense_Mutation_p.E480K|ARMC4_ENST00000545014.1_Missense_Mutation_p.E313K	NM_018076.2	NP_060546.2	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	788					cell projection organization (GO:0030030)|cilium movement (GO:0003341)|left/right axis specification (GO:0070986)|outer dynein arm assembly (GO:0036158)|ventricular system development (GO:0021591)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(17)|liver(1)|lung(17)|ovary(5)|prostate(3)|skin(8)|stomach(2)|urinary_tract(3)	75						ACTCGGTTTTCACGTTCTTGG	0.448																																																	0													175.0	166.0	169.0					10																	28224072		2203	4300	6503	SO:0001583	missense	0			AL136859	CCDS7157.1	10p12.1-p11.23	2014-02-03			ENSG00000169126	ENSG00000169126		"""Armadillo repeat containing"""	25583	protein-coding gene	gene with protein product		615408				11230166	Standard	XM_005252485		Approved	FLJ10817, FLJ10376, DKFZP434P1735, CILD23	uc001itz.3	Q5T2S8	OTTHUMG00000017867	ENST00000305242.5:c.2362G>A	10.37:g.28224072C>T	ENSP00000306410:p.Glu788Lys		A8K906|B7Z7I1|Q9H0C0	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,superfamily_GSKIP_dom,smart_Armadillo,pfscan_Armadillo	p.E788K	ENST00000305242.5	37	c.2362	CCDS7157.1	10	.	.	.	.	.	.	.	.	.	.	C	17.40	3.380920	0.61845	.	.	ENSG00000169126	ENST00000537576;ENST00000305242;ENST00000545014	T;T;T	0.41400	1.0;1.0;1.0	5.92	5.92	0.95590	Armadillo-like helical (1);Armadillo-type fold (1);	0.379769	0.30676	N	0.009104	T	0.44095	0.1277	L	0.43923	1.385	0.80722	D	1	B;B	0.28760	0.221;0.205	B;B	0.35971	0.139;0.215	T	0.15867	-1.0422	10	0.27785	T	0.31	-38.3414	20.3206	0.98668	0.0:1.0:0.0:0.0	.	313;788	B7Z7I1;Q5T2S8	.;ARMC4_HUMAN	K	480;788;313	ENSP00000443208:E480K;ENSP00000306410:E788K;ENSP00000441076:E313K	ENSP00000306410:E788K	E	-	1	0	ARMC4	28264078	0.991000	0.36638	0.963000	0.40424	0.851000	0.48451	4.049000	0.57397	2.809000	0.96659	0.655000	0.94253	GAA	ARMC4	-	superfamily_ARM-type_fold,smart_Armadillo	ENSG00000169126		0.448	ARMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMC4	HGNC	protein_coding	OTTHUMT00000047339.1	-	0.00	70	0	C	NM_018076		28224072	-1	tier1	-	no_errors	ENST00000305242	ensembl	human	known	74_37	missense	24.19	47	15	SNP	0.989	T
ATP2C1	27032	genome.wustl.edu	37	3	130694321	130694321	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr3:130694321C>T	ENST00000510168.1	+	18	2109	c.1559C>T	c.(1558-1560)gCg>gTg	p.A520V	ATP2C1_ENST00000328560.8_Missense_Mutation_p.A520V|ATP2C1_ENST00000508532.1_Missense_Mutation_p.A520V|ATP2C1_ENST00000422190.2_Missense_Mutation_p.A520V|ATP2C1_ENST00000513801.1_Missense_Mutation_p.A504V|ATP2C1_ENST00000393221.4_Missense_Mutation_p.A554V|ATP2C1_ENST00000533801.2_Missense_Mutation_p.A515V|ATP2C1_ENST00000504381.1_Missense_Mutation_p.A465V|ATP2C1_ENST00000507488.2_Missense_Mutation_p.A504V|ATP2C1_ENST00000428331.2_Missense_Mutation_p.A520V|ATP2C1_ENST00000359644.3_Missense_Mutation_p.A520V|ATP2C1_ENST00000504948.1_Missense_Mutation_p.A504V|ATP2C1_ENST00000505330.1_Missense_Mutation_p.A504V			P98194	AT2C1_HUMAN	ATPase, Ca++ transporting, type 2C, member 1	520					actin cytoskeleton reorganization (GO:0031532)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cellular calcium ion homeostasis (GO:0006874)|cellular manganese ion homeostasis (GO:0030026)|epidermis development (GO:0008544)|Golgi calcium ion homeostasis (GO:0032468)|Golgi calcium ion transport (GO:0032472)|ion transmembrane transport (GO:0034220)|manganese ion transmembrane transport (GO:0071421)|manganese ion transport (GO:0006828)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|manganese ion binding (GO:0030145)|manganese-transporting ATPase activity (GO:0015410)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(15)|prostate(2)|skin(2)|urinary_tract(1)	39					Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	ATGGGCTCAGCGGGACTCAGA	0.473									Hailey-Hailey disease																												Esophageal Squamous(99;456 1443 27647 34099 42636)												0													93.0	82.0	86.0					3																	130694321		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	HHD, Familial Benign Chronic Pemphigus, Benign Familial Pemphigus	AF181120	CCDS33856.1, CCDS46912.1, CCDS46913.1, CCDS46914.1, CCDS56278.1, CCDS56279.1, CCDS56280.1, CCDS56281.1, CCDS75006.1	3q21.3	2012-10-22			ENSG00000017260	ENSG00000017260	3.6.3.8	"""ATPases / P-type"""	13211	protein-coding gene	gene with protein product	"""secretory pathway Ca2+/Mn2+ ATPase 1"", ""calcium-transporting ATPase type 2C member 1"""	604384	"""benign chronic pemphigus (Hailey-Hailey disease)"""	BCPM		10615129, 10767338	Standard	NM_001001485		Approved	KIAA1347, ATP2C1A, PMR1, SPCA1	uc011bli.2	P98194	OTTHUMG00000136802	ENST00000510168.1:c.1559C>T	3.37:g.130694321C>T	ENSP00000427461:p.Ala520Val		B2RAT7|B4DSW3|B7Z3X9|G3XAH8|G8JLN9|O76005|Q86V72|Q86V73|Q8N6V1|Q8NCJ7	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_PMR1,tigrfam_Cation_transp_P_typ_ATPase	p.A554V	ENST00000510168.1	37	c.1661	CCDS46914.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.67|12.67	2.007023|2.007023	0.35415|0.35415	.|.	.|.	ENSG00000017260|ENSG00000017260	ENST00000505330;ENST00000504381;ENST00000507488;ENST00000393221;ENST00000533801;ENST00000510168;ENST00000508532;ENST00000504948;ENST00000513801;ENST00000328560;ENST00000428331;ENST00000359644;ENST00000422190;ENST00000347421|ENST00000504612;ENST00000508660	D;D;D;D;D;D;D;D;D;D;D;D;D|.	0.96774|.	-4.12;-4.12;-4.12;-4.12;-4.12;-4.12;-4.12;-4.12;-4.12;-4.12;-4.12;-4.12;-4.12|.	5.77|5.77	5.77|5.77	0.91146|0.91146	ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);|.	0.051659|.	0.85682|.	D|.	0.000000|.	T|T	0.71443|0.71443	0.3340|0.3340	L|L	0.52573|0.52573	1.65|1.65	0.51012|0.51012	D|D	0.999904|0.999904	P;P;P;P;P;P;P|.	0.39131|.	0.609;0.661;0.483;0.609;0.483;0.456;0.512|.	B;B;B;B;B;B;B|.	0.36534|.	0.145;0.227;0.166;0.103;0.227;0.103;0.166|.	T|T	0.66598|0.66598	-0.5883|-0.5883	10|5	0.46703|.	T|.	0.11|.	.|.	19.9795|19.9795	0.97321|0.97321	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	554;515;554;520;554;520;520|.	G3XAH8;B4DSW3;B4E2Q0;P98194-5;B7Z3X9;P98194-2;P98194|.	.;.;.;.;.;.;AT2C1_HUMAN|.	V|W	504;465;504;554;515;520;520;504;504;520;520;520;520;519|474;95	ENSP00000423774:A504V;ENSP00000425320:A465V;ENSP00000421326:A504V;ENSP00000376914:A554V;ENSP00000432956:A515V;ENSP00000427461:A520V;ENSP00000424783:A520V;ENSP00000423330:A504V;ENSP00000422872:A504V;ENSP00000329664:A520V;ENSP00000395809:A520V;ENSP00000352665:A520V;ENSP00000402677:A520V|.	ENSP00000329664:A520V|.	A|R	+|+	2|1	0|2	ATP2C1|ATP2C1	132177011|132177011	0.997000|0.997000	0.39634|0.39634	0.990000|0.990000	0.47175|0.47175	0.317000|0.317000	0.28152|0.28152	3.474000|3.474000	0.53129|0.53129	2.720000|2.720000	0.93068|0.93068	0.650000|0.650000	0.86243|0.86243	GCG|CGG	ATP2C1	-	pfam_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_PMR1	ENSG00000017260		0.473	ATP2C1-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ATP2C1	HGNC	protein_coding	OTTHUMT00000356648.2	-	0.00	24	0	C	NM_001001486		130694321	+1	tier1	-	no_errors	ENST00000393221	ensembl	human	known	74_37	missense	13.33	26	4	SNP	1.000	T
AVL9	23080	genome.wustl.edu	37	7	32591907	32591907	+	Splice_Site	SNP	G	G	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr7:32591907G>T	ENST00000318709.4	+	6	750	c.529G>T	c.(529-531)Ggt>Tgt	p.G177C	AVL9_ENST00000404479.1_Splice_Site_p.G177C|AVL9_ENST00000409301.1_Splice_Site_p.G177C	NM_015060.1	NP_055875.1	Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)	177					cell migration (GO:0016477)	integral component of membrane (GO:0016021)|recycling endosome (GO:0055037)				endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						AGTATATCTTGGTAAGTAACT	0.318																																																	0													45.0	46.0	46.0					7																	32591907		2203	4296	6499	SO:0001630	splice_region_variant	0			D87682	CCDS34613.1	7p14.3	2013-05-01	2008-10-03	2008-10-03	ENSG00000105778	ENSG00000105778			28994	protein-coding gene	gene with protein product		612927	"""KIAA0241"""	KIAA0241		17229886, 22595670	Standard	XM_005249668		Approved		uc003tcv.1	Q8NBF6	OTTHUMG00000152929	ENST00000318709.4:c.529+1G>T	7.37:g.32591907G>T			Q92573	Missense_Mutation	SNP	pfam_ABL9/DENND6_dom,pfam_DUF2347	p.G177C	ENST00000318709.4	37	c.529	CCDS34613.1	7	.	.	.	.	.	.	.	.	.	.	G	24.6	4.550649	0.86127	.	.	ENSG00000105778	ENST00000318709;ENST00000409301;ENST00000329714;ENST00000404479;ENST00000446718	T;T;T;T	0.55234	0.53;0.53;0.53;0.53	5.41	5.41	0.78517	.	0.047144	0.85682	D	0.000000	T	0.76877	0.4049	M	0.87097	2.86	0.80722	D	1	D;D;D	0.89917	1.0;0.99;1.0	D;P;D	0.91635	0.999;0.905;0.994	T	0.79495	-0.1780	9	.	.	.	-18.1539	17.747	0.88423	0.0:0.0:1.0:0.0	.	177;177;177	Q8N6Z3;Q8NBF6-2;Q8NBF6	.;.;AVL9_HUMAN	C	177;177;177;177;108	ENSP00000315568:G177C;ENSP00000387011:G177C;ENSP00000385242:G177C;ENSP00000395134:G108C	.	G	+	1	0	AVL9	32558432	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.070000	0.71220	2.700000	0.92200	0.650000	0.86243	GGT	AVL9	-	pfam_ABL9/DENND6_dom	ENSG00000105778		0.318	AVL9-003	NOVEL	basic|appris_principal|CCDS	protein_coding	AVL9	HGNC	protein_coding	OTTHUMT00000328643.1	-	0.00	80	0	G	NM_015060	Missense_Mutation	32591907	+1	tier1	-	no_errors	ENST00000404479	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
BAI1	575	genome.wustl.edu	37	8	143546245	143546245	+	Frame_Shift_Del	DEL	C	C	-	rs569958433		TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr8:143546245delC	ENST00000517894.1	+	2	1580	c.686delC	c.(685-687)gccfs	p.A229fs	BAI1_ENST00000323289.5_Frame_Shift_Del_p.A229fs			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	229					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					ggacccctggccccccgcggg	0.736																																																	0													2.0	2.0	2.0					8																	143546245		972	2207	3179	SO:0001589	frameshift_variant	0			AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.686delC	8.37:g.143546245delC	ENSP00000430945:p.Ala229fs			Frame_Shift_Del	DEL	pfam_GPCR_2_secretin-like,pfam_Thrombospondin_1_rpt,pfam_DUF3497,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like	p.R231fs	ENST00000517894.1	37	c.686		8																																																																																			BAI1	-	NULL	ENSG00000181790		0.736	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	BAI1	HGNC	protein_coding	OTTHUMT00000379963.3		0.00	10	0	C	NM_001702		143546245	+1			no_errors	ENST00000323289	ensembl	human	known	74_37	frame_shift_del	33.33	4	2	DEL	0.000	0
BIRC6	57448	genome.wustl.edu	37	2	32693623	32693623	+	Missense_Mutation	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr2:32693623G>C	ENST00000421745.2	+	29	6033	c.5899G>C	c.(5899-5901)Gac>Cac	p.D1967H		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	1967					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					AGTTGAGGAAGACAGTAGGGT	0.418																																					Pancreas(94;175 1509 16028 18060 45422)												0													113.0	111.0	112.0					2																	32693623		2203	4300	6503	SO:0001583	missense	0			AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.5899G>C	2.37:g.32693623G>C	ENSP00000393596:p.Asp1967His		Q9ULD1	Missense_Mutation	SNP	pfam_DUF3643,pfam_UBQ-conjugat_E2,pfam_BIR,pfam_UEV_N,superfamily_UBQ-conjugating_enzyme/RWD,superfamily_Galactose-bd-like,superfamily_WD40_repeat_dom,smart_BIR,pfscan_BIR,pfscan_UBQ-conjugat_E2	p.D1967H	ENST00000421745.2	37	c.5899	CCDS33175.2	2	.	.	.	.	.	.	.	.	.	.	G	15.70	2.911003	0.52439	.	.	ENSG00000115760	ENST00000421745	T	0.75260	-0.92	5.68	5.68	0.88126	.	0.055106	0.64402	D	0.000001	D	0.82545	0.5060	L	0.42245	1.32	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.80039	-0.1549	10	0.36615	T	0.2	.	19.8568	0.96762	0.0:0.0:1.0:0.0	.	1967	Q9NR09	BIRC6_HUMAN	H	1967	ENSP00000393596:D1967H	ENSP00000393596:D1967H	D	+	1	0	BIRC6	32547127	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	9.869000	0.99810	2.691000	0.91804	0.644000	0.83932	GAC	BIRC6	-	NULL	ENSG00000115760		0.418	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BIRC6	HGNC	protein_coding	OTTHUMT00000318769.3	-	0.00	68	0	G	NM_016252		32693623	+1	tier1	-	no_errors	ENST00000421745	ensembl	human	known	74_37	missense	21.35	70	19	SNP	1.000	C
BMS1P5	399761	genome.wustl.edu	37	10	48919831	48919831	+	IGR	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr10:48919831G>A								PTPN20B (91897 upstream) : BMS1P5 (7541 downstream)																							CTCACCATCTGTTTGAGAGTT	0.348																																																	0																																										SO:0001628	intergenic_variant	0																															10.37:g.48919831G>A				RNA	SNP	-	NULL		37	NULL		10																																																																																			BMS1P5	-	-	ENSG00000204164	0	0.348					BMS1P5	HGNC			-	0.00	250	0	G			48919831	-1	tier1	-	no_errors	ENST00000436180	ensembl	human	known	74_37	rna	34.87	155	83	SNP	0.994	A
C11orf74	119710	genome.wustl.edu	37	11	36669655	36669655	+	Nonsense_Mutation	SNP	G	G	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr11:36669655G>T	ENST00000334307.5	+	5	563	c.448G>T	c.(448-450)Gaa>Taa	p.E150*	C11orf74_ENST00000534635.1_Nonsense_Mutation_p.E76*|C11orf74_ENST00000446510.2_Nonsense_Mutation_p.E150*|C11orf74_ENST00000347206.4_Nonsense_Mutation_p.E76*	NM_138787.2	NP_620142.2	Q86VG3	CK074_HUMAN	chromosome 11 open reading frame 74	150										breast(1)|kidney(1)|large_intestine(1)|lung(5)	8	all_lung(20;0.226)	all_hematologic(20;0.0118)				TCCTACCTGTGAAGTGAAGCC	0.478																																																	0													133.0	125.0	127.0					11																	36669655		2202	4298	6500	SO:0001587	stop_gained	0			AK095997, BC009561	CCDS7904.1, CCDS60762.1	11p12	2012-08-10			ENSG00000166352	ENSG00000166352			25142	protein-coding gene	gene with protein product						12477932	Standard	NM_001276722		Approved	FLJ38678, HEPIS	uc031pzr.1	Q86VG3	OTTHUMG00000166397	ENST00000334307.5:c.448G>T	11.37:g.36669655G>T	ENSP00000334848:p.Glu150*		D3DR18|Q96DD6	Nonsense_Mutation	SNP	NULL	p.E150*	ENST00000334307.5	37	c.448	CCDS7904.1	11	.	.	.	.	.	.	.	.	.	.	G	11.19	1.565288	0.27915	.	.	ENSG00000166352	ENST00000334307;ENST00000531554;ENST00000347206;ENST00000534635;ENST00000446510;ENST00000527108	.	.	.	5.65	2.72	0.32119	.	0.766537	0.12338	N	0.477739	.	.	.	.	.	.	0.58432	A	0.99999	.	.	.	.	.	.	.	.	.	.	.	.	.	-2.7177	6.1595	0.20356	0.1672:0.1522:0.6806:0.0	.	.	.	.	X	150;150;76;76;150;76	.	.	E	+	1	0	C11orf74	36626231	0.261000	0.24063	0.003000	0.11579	0.017000	0.09413	1.383000	0.34385	0.310000	0.22990	0.655000	0.94253	GAA	C11orf74	-	NULL	ENSG00000166352		0.478	C11orf74-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C11orf74	HGNC	protein_coding	OTTHUMT00000389567.1	-	0.00	50	0	G	NM_138787		36669655	+1	tier1	-	no_errors	ENST00000334307	ensembl	human	known	74_37	nonsense	5.97	63	4	SNP	0.019	T
C12orf36	283422	genome.wustl.edu	37	12	13529360	13529360	+	Splice_Site	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr12:13529360C>G	ENST00000318426.2	-	2	198		c.e2-1		C12orf36_ENST00000527705.2_5'UTR|C12orf36_ENST00000532841.1_Splice_Site|C12orf36_ENST00000531049.1_Splice_Site|C12orf36_ENST00000539026.1_Splice_Site					chromosome 12 open reading frame 36											lung(3)|skin(3)	6				BRCA - Breast invasive adenocarcinoma(232;0.198)		tattagagttctgtagagaaa	0.368																																																	0													48.0	51.0	50.0					12																	13529360		2104	4074	6178	SO:0001630	splice_region_variant	0			AK091129		12p13.1	2012-08-14			ENSG00000180861	ENSG00000180861			26598	protein-coding gene	gene with protein product							Standard	NR_036555		Approved	FLJ33810	uc001rbs.2	Q495D7	OTTHUMG00000167562	ENST00000318426.2:c.20-1G>C	12.37:g.13529360C>G				Splice_Site	SNP	-	e1-1	ENST00000318426.2	37	c.1-1		12																																																																																			C12orf36	-	-	ENSG00000180861		0.368	C12orf36-001	KNOWN	basic|appris_candidate_longest	protein_coding	C12orf36	HGNC	protein_coding	OTTHUMT00000395025.2		0.00	17	0	C	NM_182558	Intron	13529360	-1			no_errors	ENST00000318426	ensembl	human	known	74_37	splice_site	27.27	8	3	SNP	0.000	G
C12orf77	196415	genome.wustl.edu	37	12	25149214	25149214	+	Missense_Mutation	SNP	G	G	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr12:25149214G>T	ENST00000549828.1	-	2	267	c.63C>A	c.(61-63)agC>agA	p.S21R	C12orf77_ENST00000549262.1_5'UTR|C12orf77_ENST00000434912.3_5'UTR	NM_001101339.1	NP_001094809.1	C9JDV5	CL097_HUMAN	chromosome 12 open reading frame 77	21										endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	7						TTCTGGCTCTGCTGCTGGCTT	0.428																																																	0													134.0	128.0	130.0					12																	25149214		1908	4136	6044	SO:0001583	missense	0			BC046192	CCDS44846.1	12p12.1	2009-09-30			ENSG00000226397	ENSG00000226397			27282	protein-coding gene	gene with protein product						12477932	Standard	NM_001101339		Approved		uc001rgf.3	C9JDV5	OTTHUMG00000170185	ENST00000549828.1:c.63C>A	12.37:g.25149214G>T	ENSP00000447146:p.Ser21Arg			Missense_Mutation	SNP	NULL	p.S21R	ENST00000549828.1	37	c.63	CCDS44846.1	12	.	.	.	.	.	.	.	.	.	.	G	9.813	1.183587	0.21870	.	.	ENSG00000226397	ENST00000549828	T	0.54866	0.55	4.85	-3.07	0.05363	.	.	.	.	.	T	0.43166	0.1235	N	0.08118	0	0.20821	N	0.999845	D	0.59767	0.986	P	0.56865	0.808	T	0.50021	-0.8876	9	0.87932	D	0	.	10.904	0.47069	0.3276:0.0:0.6724:0.0	.	21	C9JDV5	CL097_HUMAN	R	21	ENSP00000447146:S21R	ENSP00000447146:S21R	S	-	3	2	C12orf77	25040481	0.000000	0.05858	0.000000	0.03702	0.471000	0.32888	-0.519000	0.06260	-0.672000	0.05266	0.655000	0.94253	AGC	C12orf77	-	NULL	ENSG00000226397		0.428	C12orf77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf77	HGNC	protein_coding	OTTHUMT00000407827.1	-	0.00	45	0	G	NM_001101339		25149214	-1	tier1	-	no_errors	ENST00000549828	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.000	T
C1QL3	389941	genome.wustl.edu	37	10	16562630	16562630	+	Silent	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr10:16562630G>A	ENST00000298943.3	-	1	1374	c.435C>T	c.(433-435)ttC>ttT	p.F145F		NM_001010908.1	NP_001010908.1	Q5VWW1	C1QL3_HUMAN	complement component 1, q subcomponent-like 3	145	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				regulation of synapse organization (GO:0050807)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)				breast(1)|endometrium(3)|kidney(1)|lung(4)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	13						CCACGTCGTCGAACTTGAGCA	0.627																																																	0													156.0	130.0	139.0					10																	16562630		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS31156.1	10p13	2012-03-26			ENSG00000165985	ENSG00000165985			19359	protein-coding gene	gene with protein product		615227				21378161	Standard	NM_001010908		Approved	K100, C1ql, C1QTNF13, CTRP13	uc001ioj.1	Q5VWW1	OTTHUMG00000017738	ENST00000298943.3:c.435C>T	10.37:g.16562630G>A			A0PJY4|A0PJY5	Silent	SNP	pfam_C1q,pfam_Collagen,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	p.F145	ENST00000298943.3	37	c.435	CCDS31156.1	10																																																																																			C1QL3	-	pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	ENSG00000165985		0.627	C1QL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1QL3	HGNC	protein_coding	OTTHUMT00000047003.1	-	0.00	21	0	G	XM_372305		16562630	-1	tier1	-	no_errors	ENST00000298943	ensembl	human	known	74_37	silent	24.32	28	9	SNP	1.000	A
C22orf31	25770	genome.wustl.edu	37	22	29455150	29455150	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr22:29455150C>G	ENST00000216071.4	-	3	504	c.453G>C	c.(451-453)gaG>gaC	p.E151D		NM_015370.1	NP_056185.1	O95567	CV031_HUMAN	chromosome 22 open reading frame 31	151										cervix(1)|endometrium(1)|kidney(17)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	27						TTAGTTTTTTCTCCTTTGAAC	0.478																																																	0													108.0	100.0	103.0					22																	29455150		2203	4300	6503	SO:0001583	missense	0			AL035364	CCDS13848.1	22q12.1	2006-07-05			ENSG00000100249	ENSG00000100249			26931	protein-coding gene	gene with protein product						15461802	Standard	XM_005261490		Approved	HS747E2A, bK747E2.1	uc003aej.1	O95567	OTTHUMG00000151011	ENST00000216071.4:c.453G>C	22.37:g.29455150C>G	ENSP00000216071:p.Glu151Asp		A0AV97	Missense_Mutation	SNP	NULL	p.E151D	ENST00000216071.4	37	c.453	CCDS13848.1	22	.	.	.	.	.	.	.	.	.	.	C	15.61	2.884650	0.51908	.	.	ENSG00000100249	ENST00000216071	T	0.36520	1.25	5.64	4.6	0.57074	.	0.106553	0.41938	D	0.000791	T	0.36580	0.0972	L	0.29908	0.895	0.27022	N	0.96446	P	0.49961	0.93	P	0.54372	0.75	T	0.09378	-1.0677	10	0.29301	T	0.29	-23.3709	10.7217	0.46044	0.0:0.9125:0.0:0.0875	.	151	O95567	CV031_HUMAN	D	151	ENSP00000216071:E151D	ENSP00000216071:E151D	E	-	3	2	C22orf31	27785150	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.550000	0.23345	2.937000	0.99478	0.650000	0.86243	GAG	C22orf31	-	NULL	ENSG00000100249		0.478	C22orf31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C22orf31	HGNC	protein_coding	OTTHUMT00000320952.1	-	0.00	35	0	C	NM_015370		29455150	-1	tier1	-	no_errors	ENST00000216071	ensembl	human	known	74_37	missense	22.22	42	12	SNP	1.000	G
C3P1	388503	genome.wustl.edu	37	19	10157199	10157199	+	RNA	SNP	G	G	C	rs556051721	byFrequency	TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr19:10157199G>C	ENST00000495140.1	+	0	978							Q6ZMU1	C3P1_HUMAN	complement component 3 precursor pseudogene							extracellular space (GO:0005615)	endopeptidase inhibitor activity (GO:0004866)			endometrium(4)|large_intestine(2)|lung(6)|urinary_tract(1)	13						CGGGAGGCTCGAGAGGATCAA	0.572																																																	0																																												0			AK131489		19p13.2	2009-04-08			ENSG00000167798	ENSG00000167798			34414	pseudogene	pseudogene							Standard	NR_027300		Approved	CPLP	uc010dwx.2	Q6ZMU1	OTTHUMG00000158555		19.37:g.10157199G>C				RNA	SNP	-	NULL	ENST00000495140.1	37	NULL		19																																																																																			C3P1	-	-	ENSG00000167798		0.572	C3P1-002	KNOWN	basic	processed_transcript	C3P1	HGNC	pseudogene	OTTHUMT00000351284.1	-	0.00	32	0	G	NR_027300		10157199	+1	tier1	-	no_errors	ENST00000495140	ensembl	human	known	74_37	rna	20.83	38	10	SNP	0.000	C
C5orf34	375444	genome.wustl.edu	37	5	43492341	43492341	+	Missense_Mutation	SNP	A	A	G	rs145050535		TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr5:43492341A>G	ENST00000306862.2	-	10	1931	c.1556T>C	c.(1555-1557)aTt>aCt	p.I519T	RP11-159F24.3_ENST00000505645.1_RNA	NM_198566.2	NP_940968	Q96MH7	CE034_HUMAN	chromosome 5 open reading frame 34	519										breast(2)|endometrium(2)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)|stomach(2)	21	Lung NSC(6;2.07e-05)					AGGGTGTTCAATCTGAATTAA	0.289																																																	0								A	THR/ILE	0,4406		0,0,2203	91.0	87.0	88.0		1556	2.3	0.9	5	dbSNP_134	88	1,8585	1.2+/-3.3	0,1,4292	no	missense	C5orf34	NM_198566.2	89	0,1,6495	GG,GA,AA		0.0116,0.0,0.0077	benign	519/639	43492341	1,12991	2203	4293	6496	SO:0001583	missense	0			AK056925	CCDS3946.1	5p12	2012-02-23			ENSG00000172244	ENSG00000172244			24738	protein-coding gene	gene with protein product						12477932	Standard	XM_006714473		Approved	FLJ32363	uc003jnz.2	Q96MH7	OTTHUMG00000131151	ENST00000306862.2:c.1556T>C	5.37:g.43492341A>G	ENSP00000303490:p.Ile519Thr			Missense_Mutation	SNP	NULL	p.I519T	ENST00000306862.2	37	c.1556	CCDS3946.1	5	.	.	.	.	.	.	.	.	.	.	A	7.731	0.699214	0.15106	0.0	1.16E-4	ENSG00000172244	ENST00000306862	T	0.53206	0.63	5.98	2.33	0.28932	.	0.438058	0.24907	N	0.034648	T	0.29158	0.0725	N	0.22421	0.69	0.27320	N	0.95707	B	0.14805	0.011	B	0.13407	0.009	T	0.15694	-1.0428	10	0.26408	T	0.33	-1.963	7.6583	0.28388	0.7445:0.0:0.2555:0.0	.	519	Q96MH7	CE034_HUMAN	T	519	ENSP00000303490:I519T	ENSP00000303490:I519T	I	-	2	0	C5orf34	43528098	0.982000	0.34865	0.931000	0.37212	0.392000	0.30506	2.113000	0.41902	0.167000	0.19631	-0.263000	0.10527	ATT	C5orf34	-	NULL	ENSG00000172244		0.289	C5orf34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5orf34	HGNC	protein_coding	OTTHUMT00000253843.1	-	0.00	40	0	A	NM_198566		43492341	-1	tier1	rs145050535	no_errors	ENST00000306862	ensembl	human	known	74_37	missense	26.92	38	14	SNP	0.979	G
ZBED8	63920	genome.wustl.edu	37	5	159822044	159822044	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr5:159822044C>T	ENST00000408953.3	-	2	961	c.454G>A	c.(454-456)Gaa>Aaa	p.E152K	C5orf54_ENST00000523213.1_Missense_Mutation_p.E152K	NM_022090.3	NP_071373.2														breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	12						tggctcatttcatcaattcta	0.408																																																	0													96.0	97.0	97.0					5																	159822044		2203	4300	6503	SO:0001583	missense	0																														ENST00000408953.3:c.454G>A	5.37:g.159822044C>T	ENSP00000386184:p.Glu152Lys			Missense_Mutation	SNP	superfamily_RNaseH-like_dom	p.E152K	ENST00000408953.3	37	c.454	CCDS34283.1	5	.	.	.	.	.	.	.	.	.	.	C	11.68	1.710969	0.30322	.	.	ENSG00000221886	ENST00000408953;ENST00000523213	T;T	0.14766	2.48;2.48	3.47	0.551	0.17225	.	.	.	.	.	T	0.09247	0.0228	L	0.43152	1.355	0.24335	N	0.994989	B	0.28713	0.22	B	0.26517	0.07	T	0.39187	-0.9626	9	0.16420	T	0.52	.	3.9967	0.09561	0.4189:0.4625:0.0:0.1186	.	152	Q8IZ13	CE054_HUMAN	K	152	ENSP00000386184:E152K;ENSP00000428831:E152K	ENSP00000386184:E152K	E	-	1	0	C5orf54	159754622	0.928000	0.31464	0.979000	0.43373	0.995000	0.86356	-0.172000	0.09868	0.086000	0.17137	0.655000	0.94253	GAA	C5orf54	-	NULL	ENSG00000221886		0.408	C5orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5orf54	HGNC	protein_coding	OTTHUMT00000374143.1	-	0.00	44	0	C			159822044	-1	tier1	-	no_errors	ENST00000408953	ensembl	human	known	74_37	missense	37.50	20	12	SNP	0.982	T
C9orf24	84688	genome.wustl.edu	37	9	34381385	34381385	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr9:34381385C>G	ENST00000297623.2	-	4	652	c.454G>C	c.(454-456)Gag>Cag	p.E152Q	C9orf24_ENST00000481295.1_5'Flank|C9orf24_ENST00000379127.1_Missense_Mutation_p.E17Q|C9orf24_ENST00000379124.1_Missense_Mutation_p.E17Q|C9orf24_ENST00000379126.3_Missense_Mutation_p.E17Q|C9orf24_ENST00000379133.3_Missense_Mutation_p.E17Q	NM_032596.3	NP_115985.2	Q8NCR6	SMRP1_HUMAN	chromosome 9 open reading frame 24	152					cell differentiation (GO:0030154)|cellular protein complex assembly (GO:0043623)|spermatogenesis (GO:0007283)	manchette (GO:0002177)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)	5			LUSC - Lung squamous cell carcinoma(29;0.0107)	GBM - Glioblastoma multiforme(74;0.123)		TTGAGCCGCTCCGGCCTAGGA	0.612																																																	0													146.0	129.0	135.0					9																	34381385		2203	4300	6503	SO:0001583	missense	0			BC029484	CCDS6553.1, CCDS6554.1, CCDS6555.1, CCDS59121.1	9p11.2	2013-01-11			ENSG00000164972	ENSG00000164972			19919	protein-coding gene	gene with protein product	"""ciliated bronchial epithelium 1"", ""spermatid-specific manchette-related protein 1"""					12029067	Standard	NM_147168		Approved	bA573M23.4, NYD-SP22, MGC32921, MGC33614, CBE1, SMRP1	uc003zuh.1	Q8NCR6	OTTHUMG00000000437	ENST00000297623.2:c.454G>C	9.37:g.34381385C>G	ENSP00000297623:p.Glu152Gln		Q5T598|Q5T599|Q5T5A0|Q8N9G4|Q96KD1|Q96LN1	Missense_Mutation	SNP	NULL	p.E152Q	ENST00000297623.2	37	c.454	CCDS6554.1	9	.	.	.	.	.	.	.	.	.	.	C	24.8	4.566048	0.86439	.	.	ENSG00000164972	ENST00000297623;ENST00000379126;ENST00000379133;ENST00000379127;ENST00000379124	T;T;T;T;T	0.51574	0.7;0.7;0.7;0.7;0.7	5.19	5.19	0.71726	.	0.214718	0.34460	N	0.003946	T	0.57431	0.2053	L	0.29908	0.895	0.34446	D	0.70017	D;D;D	0.76494	0.999;0.996;0.998	D;P;D	0.80764	0.964;0.858;0.994	T	0.67872	-0.5558	10	0.62326	D	0.03	-21.0114	15.7934	0.78384	0.0:1.0:0.0:0.0	.	17;152;17	Q8NCR6-2;Q8NCR6;Q8NCR6-3	.;CI024_HUMAN;.	Q	152;17;17;17;17	ENSP00000297623:E152Q;ENSP00000368421:E17Q;ENSP00000368428:E17Q;ENSP00000368422:E17Q;ENSP00000368419:E17Q	ENSP00000297623:E152Q	E	-	1	0	C9orf24	34371385	1.000000	0.71417	0.995000	0.50966	0.969000	0.65631	4.304000	0.59104	2.599000	0.87857	0.462000	0.41574	GAG	C9orf24	-	NULL	ENSG00000164972		0.612	C9orf24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf24	HGNC	protein_coding	OTTHUMT00000001098.3	-	0.00	34	0	C	NM_147169		34381385	-1	tier1	-	no_errors	ENST00000297623	ensembl	human	known	74_37	missense	40.00	9	6	SNP	0.998	G
C9orf3	84909	genome.wustl.edu	37	9	97766233	97766233	+	Intron	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr9:97766233G>C	ENST00000375315.2	+	11	1977				C9orf3_ENST00000425634.2_5'Flank|C9orf3_ENST00000297979.5_Intron|C9orf3_ENST00000433691.2_5'Flank	NM_001193329.1	NP_001180258.1	Q8N6M6	AMPO_HUMAN	chromosome 9 open reading frame 3						leukotriene biosynthetic process (GO:0019370)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(323;0.000275)		GGAATGAAGGGATAAATTCCT	0.353																																																	0																																										SO:0001627	intron_variant	0			AF043896	CCDS6713.1, CCDS55327.1, CCDS55328.1	9q22	2013-06-27			ENSG00000148120	ENSG00000148120			1361	protein-coding gene	gene with protein product	aminopeptidase O					15687497	Standard	NM_001193329		Approved	C90RF3, FLJ14675, APO, AOPEP, AP-O	uc004ava.3	Q8N6M6	OTTHUMG00000020276	ENST00000375315.2:c.1978-1207G>C	9.37:g.97766233G>C			Q5T9B1|Q5T9B3|Q5T9B4|Q8WUL6|Q96M23|Q96SS1	RNA	SNP	-	NULL	ENST00000375315.2	37	NULL	CCDS55328.1	9																																																																																			C9orf3	-	-	ENSG00000148120		0.353	C9orf3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf3	HGNC	protein_coding		-	0.00	22	0	G	NM_032823		97766233	+1	tier1	-	no_errors	ENST00000478603	ensembl	human	known	74_37	rna	34.78	15	8	SNP	0.871	C
CAMTA2	23125	genome.wustl.edu	37	17	4886089	4886089	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr17:4886089C>T	ENST00000348066.3	-	5	425	c.302G>A	c.(301-303)cGa>cAa	p.R101Q	CAMTA2_ENST00000571831.1_5'UTR|CAMTA2_ENST00000358183.4_Missense_Mutation_p.R101Q|CAMTA2_ENST00000361571.5_Missense_Mutation_p.R124Q|CAMTA2_ENST00000414043.3_Missense_Mutation_p.R124Q|CAMTA2_ENST00000381311.5_Missense_Mutation_p.R103Q|CAMTA2_ENST00000572543.1_Missense_Mutation_p.R101Q	NM_015099.3	NP_055914.2	O94983	CMTA2_HUMAN	calmodulin binding transcription activator 2	101					cardiac muscle hypertrophy in response to stress (GO:0014898)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	31						GTGGTCCTCTCGGGTGGTCTT	0.537																																																	0													138.0	116.0	124.0					17																	4886089		2203	4300	6503	SO:0001583	missense	0			AB020716	CCDS11063.1, CCDS54071.1, CCDS54072.1, CCDS54073.1	17p13.3	2004-09-01			ENSG00000108509	ENSG00000108509			18807	protein-coding gene	gene with protein product		611508				11925432	Standard	NM_015099		Approved	KIAA0909	uc010cku.2	O94983	OTTHUMG00000099417	ENST00000348066.3:c.302G>A	17.37:g.4886089C>T	ENSP00000321813:p.Arg101Gln		B9EGL0|D3DTL5|E7EWU5|Q7Z6M8|Q8N3V0|Q8NDG4|Q96G17	Missense_Mutation	SNP	pfam_CG-1_dom,pfam_IPT,pfam_IQ_motif_EF-hand-BS,superfamily_Ig_E-set,superfamily_Ankyrin_rpt-contain_dom,superfamily_P-loop_NTPase,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS	p.R124Q	ENST00000348066.3	37	c.371	CCDS11063.1	17	.	.	.	.	.	.	.	.	.	.	C	26.2	4.713610	0.89112	.	.	ENSG00000108509	ENST00000414043;ENST00000381311;ENST00000361571;ENST00000358183;ENST00000348066	T;T;T;T;T	0.52754	1.83;0.89;0.88;0.88;0.65	4.99	4.02	0.46733	CG-1 (2);	0.000000	0.64402	D	0.000001	T	0.67757	0.2927	M	0.80508	2.5	0.35111	D	0.766168	D;D;D;D	0.89917	1.0;0.999;0.999;1.0	D;D;D;D	0.85130	0.997;0.996;0.995;0.994	T	0.78643	-0.2124	10	0.87932	D	0	-5.3337	11.1169	0.48266	0.0:0.9106:0.0:0.0894	.	124;103;101;124	E7EWU5;O94983-3;O94983;O94983-4	.;.;CMTA2_HUMAN;.	Q	124;103;124;101;101	ENSP00000412886:R124Q;ENSP00000370712:R103Q;ENSP00000354828:R124Q;ENSP00000350910:R101Q;ENSP00000321813:R101Q	ENSP00000321813:R101Q	R	-	2	0	CAMTA2	4826813	0.992000	0.36948	1.000000	0.80357	0.997000	0.91878	7.319000	0.79040	1.345000	0.45676	0.655000	0.94253	CGA	CAMTA2	-	pfam_CG-1_dom	ENSG00000108509		0.537	CAMTA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAMTA2	HGNC	protein_coding	OTTHUMT00000216876.1		0.00	32	0	C	NM_015099		4886089	-1			no_errors	ENST00000414043	ensembl	human	known	74_37	missense	7.69	24	2	SNP	1.000	T
CCDC146	57639	genome.wustl.edu	37	7	76903894	76903894	+	Silent	SNP	A	A	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr7:76903894A>T	ENST00000285871.4	+	11	1492	c.1365A>T	c.(1363-1365)gtA>gtT	p.V455V	CCDC146_ENST00000431197.1_Silent_p.V169V|CCDC146_ENST00000415740.2_3'UTR	NM_020879.2	NP_065930.2	Q8IYE0	CC146_HUMAN	coiled-coil domain containing 146	455										breast(3)|central_nervous_system(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	34		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)				AAGAGCTAGTAGTCAACCTTC	0.338																																																	0													59.0	57.0	58.0					7																	76903894		2203	4300	6503	SO:0001819	synonymous_variant	0			BC029458	CCDS34671.1	7q11.23	2011-09-07			ENSG00000135205	ENSG00000135205			29296	protein-coding gene	gene with protein product						10819331	Standard	NM_020879		Approved	KIAA1505	uc003uga.3	Q8IYE0	OTTHUMG00000162595	ENST00000285871.4:c.1365A>T	7.37:g.76903894A>T			A8K8X6|Q9P223	Silent	SNP	NULL	p.V455	ENST00000285871.4	37	c.1365	CCDS34671.1	7																																																																																			CCDC146	-	NULL	ENSG00000135205		0.338	CCDC146-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC146	HGNC	protein_coding	OTTHUMT00000341449.1	-	0.00	22	0	A	NM_020879		76903894	+1	tier1	-	no_errors	ENST00000285871	ensembl	human	known	74_37	silent	48.39	16	15	SNP	0.003	T
CCDC22	28952	genome.wustl.edu	37	X	49104664	49104664	+	Missense_Mutation	SNP	T	T	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chrX:49104664T>A	ENST00000376227.3	+	10	1275	c.1105T>A	c.(1105-1107)Tgc>Agc	p.C369S		NM_014008.3	NP_054727.1	O60826	CCD22_HUMAN	coiled-coil domain containing 22	369										NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|prostate(2)|skin(1)	18						AGAGTCTGAGTGCCGGCACAG	0.647																																																	0													22.0	23.0	23.0					X																	49104664		2199	4290	6489	SO:0001583	missense	0			BC000972	CCDS14322.1	Xp11.23	2008-02-05	2005-07-24	2005-07-24	ENSG00000101997	ENSG00000101997			28909	protein-coding gene	gene with protein product		300859	"""chromosome X open reading frame 37"""	CXorf37		12477932	Standard	NM_014008		Approved	JM1	uc004dnd.2	O60826	OTTHUMG00000024141	ENST00000376227.3:c.1105T>A	X.37:g.49104664T>A	ENSP00000365401:p.Cys369Ser		A8K7G1	Missense_Mutation	SNP	pfam_DUF812	p.C369S	ENST00000376227.3	37	c.1105	CCDS14322.1	X	.	.	.	.	.	.	.	.	.	.	T	8.090	0.774354	0.16051	.	.	ENSG00000101997	ENST00000376227;ENST00000538876	.	.	.	5.13	2.75	0.32379	.	0.381500	0.27544	N	0.018891	T	0.22126	0.0533	N	0.19112	0.55	0.28484	N	0.914829	B	0.14805	0.011	B	0.15870	0.014	T	0.08785	-1.0705	9	0.18710	T	0.47	-10.9436	5.8508	0.18691	0.1362:0.0:0.2381:0.6256	.	369	O60826	CCD22_HUMAN	S	369	.	ENSP00000365401:C369S	C	+	1	0	CCDC22	48991608	0.997000	0.39634	0.993000	0.49108	0.117000	0.20001	0.323000	0.19593	1.711000	0.51337	0.381000	0.24937	TGC	CCDC22	-	pfam_DUF812	ENSG00000101997		0.647	CCDC22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC22	HGNC	protein_coding	OTTHUMT00000060822.1	-	0.00	10	0	T	NM_014008		49104664	+1	tier1	-	no_errors	ENST00000376227	ensembl	human	known	74_37	missense	45.45	5	5	SNP	0.982	A
CCPG1	9236	genome.wustl.edu	37	15	55652422	55652422	+	Missense_Mutation	SNP	C	C	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr15:55652422C>A	ENST00000310958.6	-	8	1847	c.1549G>T	c.(1549-1551)Gct>Tct	p.A517S	CCPG1_ENST00000442196.3_Missense_Mutation_p.A517S|CCPG1_ENST00000425574.3_Intron|DYX1C1-CCPG1_ENST00000565113.1_RNA|CCPG1_ENST00000569205.1_Missense_Mutation_p.A517S	NM_001204450.1|NM_001204451.1|NM_004748.4|NM_020739.3	NP_001191379.1|NP_001191380.1|NP_004739.3|NP_065790.2	Q9ULG6	CCPG1_HUMAN	cell cycle progression 1	517			A -> D (in dbSNP:rs1063563). {ECO:0000269|PubMed:9383053}.		cell cycle (GO:0007049)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001106)	integral component of membrane (GO:0016021)				autonomic_ganglia(1)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|stomach(3)	30				all cancers(107;0.0354)		TCCTTCACAGCTTCTTTAGCC	0.328																																																	0													128.0	122.0	124.0					15																	55652422		1795	4057	5852	SO:0001583	missense	0			AF212228	CCDS42039.1, CCDS55966.1, CCDS55967.1	15q21.1	2011-04-20				ENSG00000260916			24227	protein-coding gene	gene with protein product		611326				9383053, 10574462	Standard	NM_004748		Approved	KIAA1254, CPR8	uc010bfk.2	Q9ULG6		ENST00000310958.6:c.1549G>T	15.37:g.55652422C>A	ENSP00000311656:p.Ala517Ser		A0PJH3|A8K9T0|O14712|Q05DG4|Q5U5S7|Q8IYV8|Q9BY53|Q9HA17	Missense_Mutation	SNP	NULL	p.A517S	ENST00000310958.6	37	c.1549	CCDS42039.1	15	.	.	.	.	.	.	.	.	.	.	C	20.2	3.954501	0.73902	.	.	ENSG00000256061	ENST00000310958;ENST00000442196	T;T	0.37411	1.2;1.2	5.36	5.36	0.76844	.	0.156867	0.56097	D	0.000027	T	0.57213	0.2038	L	0.59436	1.845	0.58432	D	0.999998	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.997;0.998;0.997;0.997	T	0.51340	-0.8718	10	0.33940	T	0.23	.	18.0652	0.89388	0.0:1.0:0.0:0.0	.	517;517;517;373	A8K9T0;Q9ULG6-4;Q9ULG6;Q9ULG6-2	.;.;CCPG1_HUMAN;.	S	517	ENSP00000311656:A517S;ENSP00000403400:A517S	ENSP00000311656:A517S	A	-	1	0	DYX1C1	53439714	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.395000	0.79876	2.532000	0.85374	0.591000	0.81541	GCT	CCPG1	-	NULL	ENSG00000260916		0.328	CCPG1-001	KNOWN	basic|CCDS	protein_coding	CCPG1	HGNC	protein_coding	OTTHUMT00000419850.1	-	0.00	52	0	C	NM_004748		55652422	-1	tier1	-	no_errors	ENST00000310958	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	A
CCT8L2	150160	genome.wustl.edu	37	22	17072515	17072515	+	Missense_Mutation	SNP	T	T	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr22:17072515T>G	ENST00000359963.3	-	1	1185	c.926A>C	c.(925-927)aAg>aCg	p.K309T		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	309					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)			breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				GATGCCATACTTGTCCGCCAG	0.537																																																	0													193.0	169.0	177.0					22																	17072515		2203	4300	6503	SO:0001583	missense	0			AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.926A>C	22.37:g.17072515T>G	ENSP00000353048:p.Lys309Thr		A4QPH3|Q9UJS3	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom,prints_Chaperone_TCP-1	p.K309T	ENST00000359963.3	37	c.926	CCDS13738.1	22	.	.	.	.	.	.	.	.	.	.	t	6.225	0.409662	0.11812	.	.	ENSG00000198445	ENST00000359963	T	0.78924	-1.22	1.98	-0.526	0.11913	.	1.306370	0.05662	U	0.587080	D	0.83013	0.5162	M	0.67700	2.07	0.09310	N	1	P	0.49358	0.923	P	0.59012	0.85	T	0.67273	-0.5712	10	0.72032	D	0.01	-0.9121	5.1345	0.14928	0.0:0.3368:0.0:0.6632	.	309	Q96SF2	TCPQM_HUMAN	T	309	ENSP00000353048:K309T	ENSP00000353048:K309T	K	-	2	0	CCT8L2	15452515	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.193000	0.09573	-0.564000	0.06070	-1.428000	0.01097	AAG	CCT8L2	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom	ENSG00000198445		0.537	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT8L2	HGNC	protein_coding	OTTHUMT00000280580.1	-	0.00	43	0	T			17072515	-1	tier1	-	no_errors	ENST00000359963	ensembl	human	known	74_37	missense	22.54	55	16	SNP	0.000	G
CD163	9332	genome.wustl.edu	37	12	7637735	7637735	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr12:7637735C>G	ENST00000359156.4	-	11	2938	c.2736G>C	c.(2734-2736)aaG>aaC	p.K912N	CD163_ENST00000539632.1_5'UTR|CD163_ENST00000432237.2_Missense_Mutation_p.K912N|CD163_ENST00000541972.1_Missense_Mutation_p.K900N|CD163_ENST00000396620.3_Missense_Mutation_p.K945N	NM_004244.5	NP_004235.4	Q86VB7	C163A_HUMAN	CD163 molecule	912	SRCR 8. {ECO:0000255|PROSITE- ProRule:PRU00196}.				acute-phase response (GO:0006953)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(6)|pancreas(2)|prostate(1)|skin(5)|urinary_tract(4)	76					WF10(DB05389)	TGGCCAGTCTCTTCTCCCATG	0.517																																																	0													111.0	113.0	112.0					12																	7637735		2203	4300	6503	SO:0001583	missense	0			Z22968	CCDS8578.1, CCDS53742.1	12p13	2006-03-28	2006-03-28		ENSG00000177575	ENSG00000177575		"""CD molecules"""	1631	protein-coding gene	gene with protein product		605545	"""CD163 antigen"""			10403791, 8370408	Standard	NM_004244		Approved	M130, MM130	uc001qsz.3	Q86VB7	OTTHUMG00000168353	ENST00000359156.4:c.2736G>C	12.37:g.7637735C>G	ENSP00000352071:p.Lys912Asn		C9JIG2|Q07898|Q07899|Q07900|Q07901|Q2VLH7	Missense_Mutation	SNP	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,prints_SRCR,pfscan_SRCR	p.K912N	ENST00000359156.4	37	c.2736	CCDS8578.1	12	.	.	.	.	.	.	.	.	.	.	C	1.438	-0.568372	0.03910	.	.	ENSG00000177575	ENST00000359156;ENST00000541972;ENST00000396620;ENST00000432237	T;T;T;T	0.34667	1.35;1.35;1.35;1.35	5.54	2.72	0.32119	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	1.528910	0.04124	N	0.316737	T	0.28863	0.0716	L	0.38175	1.15	0.20403	N	0.999901	P;B;B	0.36837	0.571;0.062;0.379	B;B;B	0.37198	0.243;0.015;0.119	T	0.18713	-1.0328	10	0.17369	T	0.5	.	5.3529	0.16045	0.0:0.6142:0.147:0.2388	.	945;912;912	C9JHR8;Q86VB7-3;Q86VB7	.;.;C163A_HUMAN	N	912;900;945;912	ENSP00000352071:K912N;ENSP00000444071:K900N;ENSP00000379863:K945N;ENSP00000403885:K912N	ENSP00000352071:K912N	K	-	3	2	CD163	7529002	0.057000	0.20700	0.210000	0.23637	0.001000	0.01503	0.327000	0.19663	0.392000	0.25172	-0.181000	0.13052	AAG	CD163	-	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR	ENSG00000177575		0.517	CD163-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD163	HGNC	protein_coding	OTTHUMT00000399396.2	-	0.00	24	0	C	NM_004244, NM_203416		7637735	-1	tier1	-	no_errors	ENST00000359156	ensembl	human	known	74_37	missense	39.29	17	11	SNP	0.448	G
CD5L	922	genome.wustl.edu	37	1	157805731	157805731	+	Silent	SNP	G	G	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr1:157805731G>T	ENST00000368174.4	-	3	366	c.270C>A	c.(268-270)ctC>ctA	p.L90L	CD5L_ENST00000484609.1_5'Flank	NM_005894.2	NP_005885.1	O43866	CD5L_HUMAN	CD5 molecule-like	90	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	scavenger receptor activity (GO:0005044)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	52	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			CTGATTGGATGAGGACCTTTT	0.498																																																	0													246.0	251.0	249.0					1																	157805731		2203	4300	6503	SO:0001819	synonymous_variant	0			U82812	CCDS1171.1	1q21-q23	2008-02-05	2006-03-28		ENSG00000073754	ENSG00000073754			1690	protein-coding gene	gene with protein product		602592	"""apoptosis inhibitor 6"", ""CD5 antigen-like (scavenger receptor cysteine rich family)"""	API6		9045627	Standard	NM_005894		Approved	Spalpha	uc001frk.4	O43866	OTTHUMG00000022440	ENST00000368174.4:c.270C>A	1.37:g.157805731G>T			A8K7M5|Q6UX63	Silent	SNP	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR,prints_SRCR	p.L90	ENST00000368174.4	37	c.270	CCDS1171.1	1																																																																																			CD5L	-	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR	ENSG00000073754		0.498	CD5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD5L	HGNC	protein_coding	OTTHUMT00000058346.1		0.00	45	0	G	NM_005894		157805731	-1			no_errors	ENST00000368174	ensembl	human	known	74_37	silent	5.26	54	3	SNP	0.000	T
CDH4	1002	genome.wustl.edu	37	20	60470103	60470103	+	Splice_Site	SNP	G	G	T	rs143299049	byFrequency	TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr20:60470103G>T	ENST00000360469.5	+	8	1276	c.1188G>T	c.(1186-1188)acG>acT	p.T396T	CDH4_ENST00000543233.1_Splice_Site_p.T322T	NM_001794.3	NP_001785.2	P55283	CADH4_HUMAN	cadherin 4, type 1, R-cadherin (retinal)	396	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(2)|lung(25)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			CCGCCAGCACGGTGAGTCCCT	0.582																																																	0													184.0	147.0	160.0					20																	60470103		2203	4300	6503	SO:0001630	splice_region_variant	0			L34059	CCDS13488.1, CCDS58784.1	20q13.3	2010-01-26			ENSG00000179242	ENSG00000179242		"""Cadherins / Major cadherins"""	1763	protein-coding gene	gene with protein product	"""R-Cadherin"""	603006				10191097, 10516427	Standard	NM_001794		Approved		uc002ybn.2	P55283	OTTHUMG00000032890	ENST00000360469.5:c.1188+1G>T	20.37:g.60470103G>T			B3KWB8|G3V1P8|Q2M208|Q5VZ44|Q9BZ05	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Cadherin/Desmocollin	p.T396	ENST00000360469.5	37	c.1188	CCDS13488.1	20																																																																																			CDH4	-	superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin	ENSG00000179242		0.582	CDH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH4	HGNC	protein_coding	OTTHUMT00000079965.2	-	0.00	44	0	G	NM_001794	Silent	60470103	+1	tier1	-	no_errors	ENST00000360469	ensembl	human	known	74_37	silent	7.69	48	4	SNP	0.924	T
CFH	3075	genome.wustl.edu	37	1	196683032	196683032	+	Nonsense_Mutation	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr1:196683032C>T	ENST00000367429.4	+	10	1744	c.1504C>T	c.(1504-1506)Caa>Taa	p.Q502*		NM_000186.3	NP_000177.2	P08603	CFAH_HUMAN	complement factor H	502	Sushi 8. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						ATGGTCAGCTCAACCCACGTG	0.343																																																	0													86.0	82.0	84.0					1																	196683032		2203	4300	6503	SO:0001587	stop_gained	0			Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000367429.4:c.1504C>T	1.37:g.196683032C>T	ENSP00000356399:p.Gln502*		A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Nonsense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.Q502*	ENST00000367429.4	37	c.1504	CCDS1385.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.666929	0.96745	.	.	ENSG00000000971	ENST00000367429	.	.	.	5.23	5.23	0.72850	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.17369	T	0.5	.	14.2971	0.66321	0.0:1.0:0.0:0.0	.	.	.	.	X	502	.	ENSP00000356399:Q502X	Q	+	1	0	CFH	194949655	0.962000	0.33011	0.827000	0.32855	0.043000	0.13939	2.042000	0.41222	2.443000	0.82685	0.591000	0.81541	CAA	CFH	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000000971		0.343	CFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFH	HGNC	protein_coding	OTTHUMT00000086412.2	-	0.00	41	0	C	NM_000186		196683032	+1	tier1	-	no_errors	ENST00000367429	ensembl	human	known	74_37	nonsense	31.82	30	14	SNP	0.920	T
CHD7	55636	genome.wustl.edu	37	8	61743025	61743025	+	Nonsense_Mutation	SNP	G	G	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr8:61743025G>T	ENST00000423902.2	+	15	4146	c.3667G>T	c.(3667-3669)Gag>Tag	p.E1223*	CHD7_ENST00000524602.1_Intron	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	1223					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			AGCCATCCTTGAGAAGAATTT	0.393																																																	0													119.0	115.0	116.0					8																	61743025		1866	4102	5968	SO:0001587	stop_gained	0			AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.3667G>T	8.37:g.61743025G>T	ENSP00000392028:p.Glu1223*		D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Nonsense_Mutation	SNP	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.E1223*	ENST00000423902.2	37	c.3667	CCDS47865.1	8	.	.	.	.	.	.	.	.	.	.	G	47	13.349847	0.99736	.	.	ENSG00000171316	ENST00000307121;ENST00000423902	.	.	.	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-26.4739	19.6762	0.95934	0.0:0.0:1.0:0.0	.	.	.	.	X	1223	.	ENSP00000307304:E1223X	E	+	1	0	CHD7	61905579	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.729000	0.93468	0.591000	0.81541	GAG	CHD7	-	pfam_SNF2_N,superfamily_P-loop_NTPase	ENSG00000171316		0.393	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD7	HGNC	protein_coding	OTTHUMT00000383468.2	-	0.00	29	0	G	XM_098762		61743025	+1	tier1	-	no_errors	ENST00000423902	ensembl	human	known	74_37	nonsense	8.51	43	4	SNP	1.000	T
CLEC4C	170482	genome.wustl.edu	37	12	7882268	7882268	+	Missense_Mutation	SNP	T	T	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr12:7882268T>C	ENST00000542353.1	-	7	1056	c.566A>G	c.(565-567)gAa>gGa	p.E189G	CLEC4C_ENST00000354629.5_Missense_Mutation_p.E158G|CLEC4C_ENST00000540085.1_Missense_Mutation_p.E158G|CLEC4C_ENST00000360345.3_Missense_Mutation_p.E189G	NM_130441.2	NP_569708.1	Q8WTT0	CLC4C_HUMAN	C-type lectin domain family 4, member C	189	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				innate immune response (GO:0045087)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25				Kidney(36;0.0915)		GCCCCATTCTTCTGAAGAACG	0.393																																																	0													145.0	132.0	136.0					12																	7882268		2203	4300	6503	SO:0001583	missense	0			AF325460	CCDS8583.1, CCDS8584.1	12p13.2-p12.3	2008-02-05	2004-02-13	2005-02-11	ENSG00000198178	ENSG00000198178		"""C-type lectin domain containing"", ""CD molecules"""	13258	protein-coding gene	gene with protein product		606677	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 7"""	CLECSF11, CLECSF7		11031109, 11536172	Standard	NM_130441		Approved	HECL, DLEC, BDCA2, CD303	uc001qth.1	Q8WTT0	OTTHUMG00000168441	ENST00000542353.1:c.566A>G	12.37:g.7882268T>C	ENSP00000440428:p.Glu189Gly		D3DUU3|Q3T1C3|Q6UXS8|Q8WXX8	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	p.E189G	ENST00000542353.1	37	c.566	CCDS8583.1	12	.	.	.	.	.	.	.	.	.	.	T	1.427	-0.571287	0.03882	.	.	ENSG00000198178	ENST00000542353;ENST00000354629;ENST00000540085;ENST00000360345	T;T;T;T	0.18960	2.18;2.18;2.18;2.18	1.4	-2.19	0.07015	C-type lectin fold (1);C-type lectin, conserved site (1);C-type lectin-like (1);C-type lectin (3);	.	.	.	.	T	0.10981	0.0268	N	0.25286	0.73	0.09310	N	1	B;B	0.11235	0.0;0.004	B;B	0.08055	0.0;0.003	T	0.33471	-0.9867	9	0.25106	T	0.35	.	5.3682	0.16125	0.0:0.3706:0.0:0.6294	.	158;189	Q8WTT0-2;Q8WTT0	.;CLC4C_HUMAN	G	189;158;158;189	ENSP00000440428:E189G;ENSP00000346648:E158G;ENSP00000445338:E158G;ENSP00000353500:E189G	ENSP00000346648:E158G	E	-	2	0	CLEC4C	7773535	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.861000	0.04268	-0.763000	0.04658	-0.366000	0.07423	GAA	CLEC4C	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000198178		0.393	CLEC4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC4C	HGNC	protein_coding	OTTHUMT00000399750.1	-	0.00	47	0	T	NM_203503		7882268	-1	tier1	-	no_errors	ENST00000360345	ensembl	human	known	74_37	missense	14.75	52	9	SNP	0.000	C
CLRN1-AS1	116933	genome.wustl.edu	37	3	150784127	150784127	+	RNA	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr3:150784127C>G	ENST00000476886.1	+	0	296				CLRN1-AS1_ENST00000465576.1_RNA					CLRN1 antisense RNA 1																		gaagttttcactaaatattGA	0.353																																																	0																																												0					3q25.1	2012-10-12	2012-08-15	2011-04-28	ENSG00000239265	ENSG00000239265		"""Long non-coding RNAs"""	30895	non-coding RNA	RNA, long non-coding			"""clarin 1 opposite strand"", ""CLRN1 antisense RNA 1 (non-protein coding)"""	CLRN1OS		11524702	Standard	NR_024066		Approved	UCRP	uc011bny.1		OTTHUMG00000159846		3.37:g.150784127C>G				RNA	SNP	-	NULL	ENST00000476886.1	37	NULL		3																																																																																			CLRN1-AS1	-	-	ENSG00000239265		0.353	CLRN1-AS1-001	KNOWN	basic	antisense	CLRN1-AS1	HGNC	antisense	OTTHUMT00000357695.2	-	0.00	75	0	C			150784127	+1	tier1	-	no_errors	ENST00000465576	ensembl	human	known	74_37	rna	12.26	136	19	SNP	0.000	G
CNBD1	168975	genome.wustl.edu	37	8	88296977	88296977	+	Silent	SNP	G	G	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr8:88296977G>T	ENST00000518476.1	+	7	894	c.843G>T	c.(841-843)tcG>tcT	p.S281S		NM_173538.2	NP_775809.1	Q8NA66	CNBD1_HUMAN	cyclic nucleotide binding domain containing 1	281										breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(4)|urinary_tract(1)	32						AGATGTTCTCGGTGGTGACAG	0.353																																																	0													71.0	67.0	68.0					8																	88296977		1848	4085	5933	SO:0001819	synonymous_variant	0			AK093121	CCDS55259.1	8q21.3	2005-08-09				ENSG00000176571			26663	protein-coding gene	gene with protein product							Standard	NM_173538		Approved	FLJ35802	uc003ydy.2	Q8NA66		ENST00000518476.1:c.843G>T	8.37:g.88296977G>T				Silent	SNP	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,pfscan_cNMP-bd_dom	p.S281	ENST00000518476.1	37	c.843	CCDS55259.1	8																																																																																			CNBD1	-	superfamily_cNMP-bd-like	ENSG00000176571		0.353	CNBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNBD1	HGNC	protein_coding	OTTHUMT00000375113.2		0.00	17	0	G	NM_173538		88296977	+1			no_errors	ENST00000518476	ensembl	human	known	74_37	silent	7.69	24	2	SNP	0.000	T
CNOT1	23019	genome.wustl.edu	37	16	58580291	58580291	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr16:58580291C>G	ENST00000317147.5	-	29	4272	c.3940G>C	c.(3940-3942)Gag>Cag	p.E1314Q	SNORA46_ENST00000384762.1_RNA|CNOT1_ENST00000245138.4_Missense_Mutation_p.E165Q|CNOT1_ENST00000569240.1_Missense_Mutation_p.E1309Q|CNOT1_ENST00000441024.2_Missense_Mutation_p.E1314Q	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	1314	Interaction with CNOT6, CNOT6L, CNOT7 and CNOT8.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		GAGAGTTGCTCATCTAAATTC	0.428																																																	0													150.0	134.0	140.0					16																	58580291		2198	4300	6498	SO:0001583	missense	0			AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.3940G>C	16.37:g.58580291C>G	ENSP00000320949:p.Glu1314Gln		Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	pfam_CCR4-Not_Not1_C,superfamily_ARM-type_fold	p.E1314Q	ENST00000317147.5	37	c.3940	CCDS10799.1	16	.	.	.	.	.	.	.	.	.	.	C	12.90	2.075275	0.36662	.	.	ENSG00000125107	ENST00000317147;ENST00000245138;ENST00000394200;ENST00000441024	T;T	0.44482	0.94;0.92	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.50582	0.1624	N	0.24115	0.695	0.80722	D	1	B;D;B;B	0.61080	0.036;0.989;0.085;0.063	B;D;B;B	0.72982	0.021;0.979;0.017;0.023	T	0.39014	-0.9634	10	0.20046	T	0.44	.	19.1572	0.93516	0.0:1.0:0.0:0.0	.	165;1314;1314;1309	B5MDN3;A5YKK6-4;A5YKK6;A5YKK6-2	.;.;CNOT1_HUMAN;.	Q	1314;165;1309;1314	ENSP00000320949:E1314Q;ENSP00000413113:E1314Q	ENSP00000245138:E165Q	E	-	1	0	CNOT1	57137792	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.818000	0.86416	2.526000	0.85167	0.650000	0.86243	GAG	CNOT1	-	NULL	ENSG00000125107		0.428	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNOT1	HGNC	protein_coding	OTTHUMT00000257385.3	-	0.00	26	0	C	NM_016284		58580291	-1	tier1	-	no_errors	ENST00000317147	ensembl	human	known	74_37	missense	25.93	20	7	SNP	1.000	G
CNTRL	11064	genome.wustl.edu	37	9	123888025	123888025	+	Missense_Mutation	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr9:123888025G>C	ENST00000373855.1	+	14	2096	c.1836G>C	c.(1834-1836)aaG>aaC	p.K612N	CNTRL_ENST00000373847.1_Missense_Mutation_p.K60N|CNTRL_ENST00000373850.1_Missense_Mutation_p.K60N|CNTRL_ENST00000238341.5_Missense_Mutation_p.K612N			Q7Z7A1	CNTRL_HUMAN	centriolin	612					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						CCCTGAAGAAGGATTTAGAAG	0.443																																																	0													119.0	121.0	120.0					9																	123888025		2203	4300	6503	SO:0001583	missense	0			AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.1836G>C	9.37:g.123888025G>C	ENSP00000362962:p.Lys612Asn		A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Missense_Mutation	SNP	pfam_Leu-rich_rpt,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Leu-rich_rpt_typical-subtyp	p.K612N	ENST00000373855.1	37	c.1836	CCDS35118.1	9	.	.	.	.	.	.	.	.	.	.	G	16.59	3.166650	0.57476	.	.	ENSG00000119397	ENST00000373855;ENST00000238341;ENST00000454238;ENST00000373851;ENST00000373850;ENST00000373847	T;T;T;T	0.33865	1.63;1.63;1.4;1.39	5.44	2.6	0.31112	.	.	.	.	.	T	0.39358	0.1075	L	0.29908	0.895	0.32496	N	0.539563	P;D;D	0.67145	0.456;0.996;0.994	B;P;P	0.60236	0.068;0.871;0.747	T	0.43442	-0.9391	9	0.28530	T	0.3	.	10.2091	0.43131	0.2184:0.0:0.7816:0.0	.	612;612;612	B2RP65;F5GZN0;Q7Z7A1	.;.;CNTRL_HUMAN	N	612;612;612;94;60;60	ENSP00000362962:K612N;ENSP00000238341:K612N;ENSP00000362956:K60N;ENSP00000362953:K60N	ENSP00000238341:K612N	K	+	3	2	CNTRL	122927846	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	0.726000	0.25984	0.670000	0.31165	0.650000	0.86243	AAG	CNTRL	-	NULL	ENSG00000119397		0.443	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTRL	HGNC	protein_coding	OTTHUMT00000250216.1	-	0.00	34	0	G	NM_007018		123888025	+1	tier1	-	no_errors	ENST00000238341	ensembl	human	known	74_37	missense	35.29	22	12	SNP	1.000	C
COL28A1	340267	genome.wustl.edu	37	7	7412809	7412809	+	Missense_Mutation	SNP	G	G	T	rs201662547	byFrequency	TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr7:7412809G>T	ENST00000399429.3	-	32	2868	c.2728C>A	c.(2728-2730)Cgt>Agt	p.R910S		NM_001037763.2	NP_001032852.2	Q2UY09	COSA1_HUMAN	collagen, type XXVIII, alpha 1	910	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(23)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	42		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		TCTTTATCACGAGAATCTGTC	0.458																																																	0													95.0	90.0	91.0					7																	7412809		1936	4131	6067	SO:0001583	missense	0			AJ890451	CCDS43553.1	7p21.3	2013-01-16			ENSG00000215018	ENSG00000215018		"""Collagens"""	22442	protein-coding gene	gene with protein product		609996				16330543	Standard	NM_001037763		Approved		uc003src.1	Q2UY09	OTTHUMG00000150034	ENST00000399429.3:c.2728C>A	7.37:g.7412809G>T	ENSP00000382356:p.Arg910Ser		A4D101|A4D106|A4D107|A8MVR2|B9EGX9|Q2UY07|Q2UY08	Missense_Mutation	SNP	pfam_Collagen,pfam_VWF_A,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,smart_VWF_A,smart_Prot_inh_Kunz-m,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m	p.R910S	ENST00000399429.3	37	c.2728	CCDS43553.1	7	.	.	.	.	.	.	.	.	.	.	G	15.35	2.808650	0.50421	.	.	ENSG00000215018	ENST00000399429	T	0.76186	-1.0	4.09	4.09	0.47781	von Willebrand factor, type A (3);	0.095709	0.40302	U	0.001130	D	0.85141	0.5629	M	0.81942	2.565	0.43879	D	0.996498	D	0.59767	0.986	D	0.73708	0.981	T	0.83261	-0.0048	10	0.20046	T	0.44	-4.4705	16.8665	0.86030	0.0:0.0:1.0:0.0	.	910	Q2UY09	COSA1_HUMAN	S	910	ENSP00000382356:R910S	ENSP00000382356:R910S	R	-	1	0	COL28A1	7379334	0.177000	0.23109	0.425000	0.26659	0.565000	0.35776	1.429000	0.34903	2.284000	0.76573	0.655000	0.94253	CGT	COL28A1	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000215018		0.458	COL28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL28A1	HGNC	protein_coding	OTTHUMT00000315899.1		0.00	34	0	G	NM_001037763		7412809	-1			no_errors	ENST00000399429	ensembl	human	known	74_37	missense	8.70	21	2	SNP	0.927	T
COL6A5	256076	genome.wustl.edu	37	3	130119967	130119967	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr3:130119967C>G	ENST00000432398.2	+	11	4578	c.4084C>G	c.(4084-4086)Cat>Gat	p.H1362D	COL6A5_ENST00000265379.6_Missense_Mutation_p.H1362D	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	1362	Nonhelical region.|VWFA 7. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						TTACAGGACTCATCTGACTAT	0.413																																																	0													157.0	135.0	142.0					3																	130119967		692	1591	2283	SO:0001583	missense	0			AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.4084C>G	3.37:g.130119967C>G	ENSP00000390895:p.His1362Asp		A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.H1362D	ENST00000432398.2	37	c.4084		3	.	.	.	.	.	.	.	.	.	.	C	10.58	1.391153	0.25118	.	.	ENSG00000172752	ENST00000432398;ENST00000265379	T;T	0.37235	1.21;1.21	5.41	5.41	0.78517	.	.	.	.	.	T	0.35189	0.0923	L	0.36672	1.1	0.27125	N	0.96203	B	0.31705	0.336	B	0.38225	0.268	T	0.20706	-1.0267	9	0.12430	T	0.62	.	17.9731	0.89119	0.0:1.0:0.0:0.0	.	1362	A8TX70-2	.	D	1362	ENSP00000390895:H1362D;ENSP00000265379:H1362D	ENSP00000265379:H1362D	H	+	1	0	COL6A5	131602657	1.000000	0.71417	0.993000	0.49108	0.073000	0.16967	3.635000	0.54309	2.547000	0.85894	0.561000	0.74099	CAT	COL6A5	-	NULL	ENSG00000172752		0.413	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	COL6A5	HGNC	protein_coding		-	0.00	36	0	C	NM_153264		130119967	+1	tier1	-	no_errors	ENST00000265379	ensembl	human	known	74_37	missense	20.37	43	11	SNP	0.991	G
CPA1	1357	genome.wustl.edu	37	7	130025029	130025029	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr7:130025029G>A	ENST00000011292.3	+	8	980	c.830G>A	c.(829-831)gGc>gAc	p.G277D	CPA1_ENST00000484324.1_Missense_Mutation_p.G189D	NM_001868.2	NP_001859.1	P15085	CBPA1_HUMAN	carboxypeptidase A1 (pancreatic)	277					proteolysis (GO:0006508)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)	21	Melanoma(18;0.0435)					ACTTACCACGGCAAGTTTGCC	0.562																																																	0													117.0	103.0	108.0					7																	130025029		2203	4300	6503	SO:0001583	missense	0				CCDS5820.1	7q32	2012-02-10			ENSG00000091704	ENSG00000091704	3.4.17.1		2296	protein-coding gene	gene with protein product	"""pancreatic carboxypeptidase A"""	114850		CPA			Standard	NM_001868		Approved		uc003vpx.3	P15085	OTTHUMG00000157826	ENST00000011292.3:c.830G>A	7.37:g.130025029G>A	ENSP00000011292:p.Gly277Asp		A4D1M1|Q53XU0|Q9BS67|Q9UCF2	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_Prot_inh_M14A,superfamily_Prot_inh_propept,smart_Peptidase_M14,prints_Peptidase_M14	p.G277D	ENST00000011292.3	37	c.830	CCDS5820.1	7	.	.	.	.	.	.	.	.	.	.	G	24.9	4.585455	0.86748	.	.	ENSG00000091704	ENST00000011292;ENST00000476062;ENST00000484324	T;T;T	0.07114	3.22;3.22;3.22	5.63	5.63	0.86233	Peptidase M14, carboxypeptidase A (2);	0.000000	0.85682	D	0.000000	T	0.50837	0.1639	H	0.99130	4.44	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.73094	-0.4091	10	0.87932	D	0	.	18.6739	0.91521	0.0:0.0:1.0:0.0	.	277;189	P15085;C9JUF9	CBPA1_HUMAN;.	D	277;189;189	ENSP00000011292:G277D;ENSP00000419408:G189D;ENSP00000419497:G189D	ENSP00000011292:G277D	G	+	2	0	CPA1	129812265	1.000000	0.71417	0.730000	0.30809	0.642000	0.38348	9.476000	0.97823	2.660000	0.90430	0.561000	0.74099	GGC	CPA1	-	pfam_Peptidase_M14,smart_Peptidase_M14	ENSG00000091704		0.562	CPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPA1	HGNC	protein_coding	OTTHUMT00000349736.2		0.00	36	0	G	NM_001868		130025029	+1			no_errors	ENST00000011292	ensembl	human	known	74_37	missense	5.45	52	3	SNP	1.000	A
CSMD2	114784	genome.wustl.edu	37	1	34158555	34158555	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr1:34158555C>T	ENST00000373380.1	-	4	866	c.646G>A	c.(646-648)Gaa>Aaa	p.E216K	CSMD2_ENST00000373381.4_Missense_Mutation_p.E1343K|CSMD2_ENST00000373388.2_5'UTR			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1303	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GCCTCTGCTTCGATGGTCCAG	0.562																																																	0													162.0	152.0	155.0					1																	34158555		2203	4300	6503	SO:0001583	missense	0			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.646G>A	1.37:g.34158555C>T	ENSP00000362478:p.Glu216Lys		B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.E1343K	ENST00000373380.1	37	c.4027		1	.	.	.	.	.	.	.	.	.	.	C	36	5.880781	0.97062	.	.	ENSG00000121904	ENST00000373381;ENST00000373380	T;T	0.17854	2.25;2.25	5.52	5.52	0.82312	CUB (5);	0.000000	0.85682	D	0.000000	T	0.36166	0.0957	L	0.45744	1.44	0.80722	D	1	D;D;D	0.76494	0.995;0.999;0.993	P;D;D	0.67900	0.87;0.954;0.921	T	0.02075	-1.1218	10	0.56958	D	0.05	.	18.4386	0.90656	0.0:1.0:0.0:0.0	.	216;1303;1343	Q7Z408-2;Q7Z408;E7EUA6	.;CSMD2_HUMAN;.	K	1343;216	ENSP00000362479:E1343K;ENSP00000362478:E216K	ENSP00000241312:E1303K	E	-	1	0	CSMD2	33931142	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.747000	0.85070	2.597000	0.87782	0.655000	0.94253	GAA	CSMD2	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000121904		0.562	CSMD2-002	KNOWN	basic	protein_coding	CSMD2	HGNC	protein_coding	OTTHUMT00000030635.4	-	0.00	42	0	C	NM_052896		34158555	-1	tier1	-	no_errors	ENST00000373381	ensembl	human	known	74_37	missense	41.03	23	16	SNP	1.000	T
CTAGE6	340307	genome.wustl.edu	37	7	143453971	143453971	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr7:143453971C>T	ENST00000470691.2	-	1	818	c.781G>A	c.(781-783)Gat>Aat	p.D261N	RNU6-267P_ENST00000516714.1_RNA	NM_178561.4	NP_848656.2	Q86UF2	CTGE6_HUMAN	CTAGE family, member 6	261						integral component of membrane (GO:0016021)						Melanoma(164;0.0903)					TTTTCTTTATCATTCAGAACT	0.398																																																	0													2.0	1.0	1.0					7																	143453971		707	1680	2387	SO:0001583	missense	0			BC043153	CCDS64790.1	7q35	2013-05-22	2013-02-25	2013-02-25	ENSG00000271321	ENSG00000271321			28644	protein-coding gene	gene with protein product			"""CTAGE family, member 6, pseudogene"""	CTAGE6P		12477932	Standard	NM_178561		Approved	MGC41943	uc003wdk.4	Q86UF2	OTTHUMG00000157770	ENST00000470691.2:c.781G>A	7.37:g.143453971C>T	ENSP00000474388:p.Asp261Asn		A4FU29|Q3ZCM5	Missense_Mutation	SNP	superfamily_tRNA-bd_arm	p.D261N	ENST00000470691.2	37	c.781		7																																																																																			CTAGE6	-	superfamily_tRNA-bd_arm	ENSG00000271321		0.398	CTAGE6-001	KNOWN	basic|appris_principal	protein_coding	CTAGE6	HGNC	protein_coding	OTTHUMT00000349580.2	-	0.00	156	0	C	NM_178561		143453971	-1	tier1	-	no_errors	ENST00000470691	ensembl	human	known	74_37	missense	11.45	147	19	SNP	0.088	T
CYB5R3	1727	genome.wustl.edu	37	22	43027454	43027454	+	Silent	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr22:43027454G>A	ENST00000352397.5	-	3	408	c.156C>T	c.(154-156)atC>atT	p.I52I	CYB5R3_ENST00000402438.1_Silent_p.I29I|CYB5R3_ENST00000407332.1_Silent_p.I29I|CYB5R3_ENST00000396303.3_Silent_p.I29I|CYB5R3_ENST00000361740.4_Silent_p.I85I|CYB5R3_ENST00000407623.3_Silent_p.I29I	NM_000398.6	NP_000389.1	P00387	NB5R3_HUMAN	cytochrome b5 reductase 3	52	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				blood circulation (GO:0008015)|cholesterol biosynthetic process (GO:0006695)|L-ascorbic acid metabolic process (GO:0019852)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|hemoglobin complex (GO:0005833)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)|FAD binding (GO:0071949)|flavin adenine dinucleotide binding (GO:0050660)|NAD binding (GO:0051287)			kidney(2)|large_intestine(1)|lung(2)|skin(1)	6					Flavin adenine dinucleotide(DB03147)	CATGGCTGATGATCTGGAGAG	0.672																																																	0													79.0	87.0	85.0					22																	43027454		1807	3377	5184	SO:0001819	synonymous_variant	0			M16461	CCDS14040.1, CCDS33658.1, CCDS54535.1	22q13.2	2012-10-02		2005-07-13	ENSG00000100243	ENSG00000100243	1.6.2.2		2873	protein-coding gene	gene with protein product		613213	"""diaphorase (NADH) (cytochrome b-5 reductase)"""	DIA1		2479590, 3268037	Standard	NM_001129819		Approved		uc011aps.2	P00387	OTTHUMG00000150745	ENST00000352397.5:c.156C>T	22.37:g.43027454G>A			B1AHF2|B7Z7L3|O75675|Q8TDL8|Q8WTS8|Q9UEN4|Q9UEN5|Q9UL55|Q9UL56	Silent	SNP	pfam_OxRdtase_FAD-bd_dom,pfam_OxRdtase_FAD/NAD-bd,superfamily_Riboflavin_synthase-like_b-brl,prints_NADH-Cyt_B5_reductase,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase	p.I85	ENST00000352397.5	37	c.255	CCDS33658.1	22																																																																																			CYB5R3	-	pfam_OxRdtase_FAD-bd_dom,superfamily_Riboflavin_synthase-like_b-brl	ENSG00000100243		0.672	CYB5R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYB5R3	HGNC	protein_coding	OTTHUMT00000320439.1	-	0.00	41	0	G			43027454	-1	tier1	-	no_errors	ENST00000361740	ensembl	human	known	74_37	silent	24.39	62	20	SNP	0.772	A
CYTH2	9266	genome.wustl.edu	37	19	48976576	48976576	+	Silent	SNP	G	G	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr19:48976576G>T	ENST00000452733.2	+	5	851	c.375G>T	c.(373-375)gtG>gtT	p.V125V	CYTH2_ENST00000427476.1_Silent_p.V125V			Q99418	CYH2_HUMAN	cytohesin 2	125	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				actin cytoskeleton organization (GO:0030036)|endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|regulation of cell adhesion (GO:0030155)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|inositol 1,4,5 trisphosphate binding (GO:0070679)|lipid binding (GO:0008289)			endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15						ACCTGGCAGTGCTCCATGCTT	0.547																																																	0													138.0	105.0	116.0					19																	48976576		2203	4300	6503	SO:0001819	synonymous_variant	0			X99753	CCDS12722.1	19q13.32	2014-05-02	2008-08-14	2008-08-14	ENSG00000105443	ENSG00000105443		"""Pleckstrin homology (PH) domain containing"""	9502	protein-coding gene	gene with protein product		602488	"""pleckstrin homology, Sec7 and coiled/coil domains 2 (cytohesin-2)"", ""pleckstrin homology, Sec7 and coiled-coil domains 2"""	PSCD2L, PSCD2		8706128, 8945478, 20525696	Standard	NM_004228		Approved	CTS18.1, Sec7p-L, ARNO, Sec7p-like, cytohesin-2	uc002pjj.4	Q99418	OTTHUMG00000150245	ENST00000452733.2:c.375G>T	19.37:g.48976576G>T			A8K8P0|Q8IXY9|Q92958	Silent	SNP	pfam_Sec7_dom,pfam_Pleckstrin_homology,superfamily_Sec7_dom,smart_Sec7_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7_dom	p.V125	ENST00000452733.2	37	c.375	CCDS12722.1	19																																																																																			CYTH2	-	pfam_Sec7_dom,superfamily_Sec7_dom,smart_Sec7_dom,pfscan_Sec7_dom	ENSG00000105443		0.547	CYTH2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CYTH2	HGNC	protein_coding	OTTHUMT00000317060.1		0.00	38	0	G	NM_004228		48976576	+1			no_errors	ENST00000427476	ensembl	human	known	74_37	silent	13.79	25	4	SNP	1.000	T
DCAF8L2	347442	genome.wustl.edu	37	X	27765402	27765402	+	Silent	SNP	G	G	A	rs371896121		TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chrX:27765402G>A	ENST00000451261.2	+	5	789	c.390G>A	c.(388-390)gaG>gaA	p.E130E		NM_001136533.1	NP_001130005.1	P0C7V8	DC8L2_HUMAN	DDB1 and CUL4 associated factor 8-like 2	130	Glu-rich.									central_nervous_system(1)|endometrium(9)|kidney(3)|lung(7)|pancreas(1)|skin(3)	24						aggaggaagaggaggaggagg	0.562																																																	0													22.0	19.0	20.0					X																	27765402		692	1589	2281	SO:0001819	synonymous_variant	0				CCDS59162.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17		ENSG00000189186		"""WD repeat domain containing"""	31811	protein-coding gene	gene with protein product			"""WD repeat domain 42C"""	WDR42C			Standard	NM_001136533		Approved		uc011mjy.2	P0C7V8		ENST00000451261.2:c.390G>A	X.37:g.27765402G>A			B2RXH9|J3KT06	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E130	ENST00000451261.2	37	c.390	CCDS59162.1	X																																																																																			DCAF8L2	-	NULL	ENSG00000189186		0.562	DCAF8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF8L2	HGNC	protein_coding	OTTHUMT00000056143.4		0.00	8	0	G	XM_293354		27765402	+1			no_errors	ENST00000451261	ensembl	human	known	74_37	silent	33.33	10	5	SNP	0.002	A
DENND5B	160518	genome.wustl.edu	37	12	31540555	31540555	+	Silent	SNP	G	G	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr12:31540555G>T	ENST00000389082.5	-	21	4071	c.3807C>A	c.(3805-3807)atC>atA	p.I1269I	DENND5B_ENST00000306833.6_Silent_p.I1304I|DENND5B_ENST00000536562.1_Silent_p.I1304I	NM_144973.3	NP_659410.3	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	1269					positive regulation of Rab GTPase activity (GO:0032851)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						CCACTCCTTTGATGAGTGATC	0.498																																																	0													91.0	85.0	87.0					12																	31540555		1935	4143	6078	SO:0001819	synonymous_variant	0			AF086301	CCDS44857.1	12p11.21	2012-10-03			ENSG00000170456	ENSG00000170456		"""DENN/MADD domain containing"""	28338	protein-coding gene	gene with protein product						12477932	Standard	NM_144973		Approved	MGC24039	uc001rki.1	Q6ZUT9	OTTHUMG00000169034	ENST00000389082.5:c.3807C>A	12.37:g.31540555G>T			B5ME75|Q59FW8|Q68CZ7|Q6NUJ0|Q7Z3F9|Q8N973|Q8WUC8	Silent	SNP	pfam_DENN_dom,pfam_Run,pfam_uDENN_dom,pfam_dDENN_dom,pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,smart_Run,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom,pfscan_PLAT/LH2_dom,pfscan_Run	p.I1304	ENST00000389082.5	37	c.3912	CCDS44857.1	12																																																																																			DENND5B	-	NULL	ENSG00000170456		0.498	DENND5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND5B	HGNC	protein_coding	OTTHUMT00000402040.1	-	0.00	38	0	G	NM_144973		31540555	-1	tier1	-	no_errors	ENST00000306833	ensembl	human	known	74_37	silent	7.02	53	4	SNP	0.997	T
DDX51	317781	genome.wustl.edu	37	12	132626103	132626103	+	Silent	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr12:132626103G>A	ENST00000397333.3	-	7	1082	c.1044C>T	c.(1042-1044)ggC>ggT	p.G348G	NOC4L_ENST00000330579.1_5'Flank	NM_175066.3	NP_778236.2	Q8N8A6	DDX51_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 51	348	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				rRNA processing (GO:0006364)	membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			endometrium(1)|lung(5)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.241)		OV - Ovarian serous cystadenocarcinoma(86;7.59e-08)|Epithelial(86;3.62e-07)|all cancers(50;2.13e-05)		CCACCAGGCGGCCGGGGGTGG	0.642																																																	0													38.0	50.0	46.0					12																	132626103		2032	4187	6219	SO:0001819	synonymous_variant	0			BC040185	CCDS41865.1	12q24.33	2005-10-12				ENSG00000185163		"""DEAD-boxes"""	20082	protein-coding gene	gene with protein product							Standard	NM_175066		Approved		uc001ujy.4	Q8N8A6		ENST00000397333.3:c.1044C>T	12.37:g.132626103G>A			A8MPT9|Q5CZ71|Q8IXK5|Q96ED1	Silent	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.G348	ENST00000397333.3	37	c.1044	CCDS41865.1	12																																																																																			DDX51	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000185163		0.642	DDX51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX51	HGNC	protein_coding	OTTHUMT00000398978.1	-	0.00	25	0	G	NM_175066		132626103	-1	tier1	-	no_errors	ENST00000397333	ensembl	human	known	74_37	silent	10.81	33	4	SNP	1.000	A
DFNB59	494513	genome.wustl.edu	37	2	179325074	179325074	+	Splice_Site	SNP	G	G	A	rs34458034		TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr2:179325074G>A	ENST00000409117.3	+	6	1023		c.e6-1		DFNB59_ENST00000375129.4_Splice_Site	NM_001042702.3	NP_001036167.1	Q0ZLH3	PJVK_HUMAN	deafness, autosomal recessive 59						sensory perception of sound (GO:0007605)	neuronal cell body (GO:0043025)				breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.0159)|all cancers(119;0.0564)			TTTTTTTGTAGACCTTTGTGT	0.318																																																	0													72.0	66.0	68.0					2																	179325074		1815	4075	5890	SO:0001630	splice_region_variant	0			BC020859, BQ887979	CCDS42787.1	2q31.2	2011-07-01			ENSG00000204311	ENSG00000204311			29502	protein-coding gene	gene with protein product		610219				16804542	Standard	NM_001042702		Approved	pejvakin	uc002umi.4	Q0ZLH3	OTTHUMG00000154425	ENST00000409117.3:c.668-1G>A	2.37:g.179325074G>A			A0PK14|B9EJE2	Splice_Site	SNP	-	e5-1	ENST00000409117.3	37	c.668-1	CCDS42787.1	2	.	.	.	.	.	.	.	.	.	.	G	23.3	4.400528	0.83120	.	.	ENSG00000204311	ENST00000409117;ENST00000375129;ENST00000442710	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2497	0.93919	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DFNB59	179033320	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.955000	0.87856	2.647000	0.89833	0.462000	0.41574	.	DFNB59	-	-	ENSG00000204311		0.318	DFNB59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DFNB59	HGNC	protein_coding	OTTHUMT00000335160.1	-	0.00	46	0	G		Intron	179325074	+1	tier1	-	no_errors	ENST00000375129	ensembl	human	known	74_37	splice_site	34.04	31	16	SNP	1.000	A
DGKK	139189	genome.wustl.edu	37	X	50133337	50133337	+	RNA	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chrX:50133337G>C	ENST00000376025.2	-	0	1974							Q5KSL6	DGKK_HUMAN	diacylglycerol kinase, kappa						blood coagulation (GO:0007596)|diacylglycerol metabolic process (GO:0046339)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			central_nervous_system(1)|endometrium(12)|kidney(4)|large_intestine(5)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Ovarian(276;0.236)					TCAAATCGTGGTACATCCATT	0.393																																																	0													189.0	176.0	180.0					X																	50133337		1912	4114	6026			0			AB183864	CCDS75980.1	Xp11.22	2006-02-08				ENSG00000274588			32395	protein-coding gene	gene with protein product		300837				16210324	Standard	NM_001013742		Approved		uc010njr.2	Q5KSL6			X.37:g.50133337G>C			B2RP91	RNA	SNP	-	NULL	ENST00000376025.2	37	NULL		X																																																																																			DGKK	-	-	ENSG00000204466		0.393	DGKK-001	KNOWN	basic	processed_transcript	DGKK	HGNC	processed_transcript	OTTHUMT00000368187.1	-	0.00	50	0	G	NM_001013742		50133337	-1	tier1	-	no_errors	ENST00000376025	ensembl	human	known	74_37	rna	30.91	38	17	SNP	0.003	C
DPP6	1804	genome.wustl.edu	37	7	154684078	154684078	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr7:154684078C>G	ENST00000377770.3	+	26	2627	c.2486C>G	c.(2485-2487)tCc>tGc	p.S829C	DPP6_ENST00000332007.3_Missense_Mutation_p.S767C|DPP6_ENST00000404039.1_Missense_Mutation_p.S765C|DPP6_ENST00000427557.1_Missense_Mutation_p.S722C			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6	829					cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			TTTACCAGCTCCAGCCTCAAA	0.527																																					NSCLC(125;1384 1783 2490 7422 34254)												0													104.0	111.0	109.0					7																	154684078		2069	4201	6270	SO:0001583	missense	0			M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.2486C>G	7.37:g.154684078C>G	ENSP00000367001:p.Ser829Cys			Missense_Mutation	SNP	pfam_Peptidase_S9B,pfam_Peptidase_S9,pfam_PD40	p.S829C	ENST00000377770.3	37	c.2486		7	.	.	.	.	.	.	.	.	.	.	C	8.827	0.939033	0.18281	.	.	ENSG00000130226	ENST00000404039;ENST00000377770;ENST00000332007;ENST00000427557	T;T;T;T	0.32023	1.47;1.47;1.47;1.47	4.66	0.695	0.18070	Peptidase S9, prolyl oligopeptidase, catalytic domain (1);	0.972834	0.08488	N	0.938357	T	0.37679	0.1012	L	0.46157	1.445	0.09310	N	1	B;B;B;B	0.30763	0.281;0.25;0.294;0.294	P;B;B;B	0.47981	0.563;0.181;0.276;0.276	T	0.53620	-0.8413	10	0.56958	D	0.05	-2.8766	3.7489	0.08559	0.2895:0.4695:0.0:0.241	.	722;767;829;765	E9PDL2;P42658-2;P42658;E9PF59	.;.;DPP6_HUMAN;.	C	765;829;767;722	ENSP00000385578:S765C;ENSP00000367001:S829C;ENSP00000328226:S767C;ENSP00000397303:S722C	ENSP00000328226:S767C	S	+	2	0	DPP6	154315011	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.510000	0.22723	-0.175000	0.10725	-0.136000	0.14681	TCC	DPP6	-	pfam_Peptidase_S9	ENSG00000130226		0.527	DPP6-003	KNOWN	basic|appris_principal	protein_coding	DPP6	HGNC	protein_coding	OTTHUMT00000322932.1	-	0.00	60	0	C	NM_130797		154684078	+1	tier1	-	no_errors	ENST00000377770	ensembl	human	known	74_37	missense	18.28	76	17	SNP	0.001	G
DUOX2	50506	genome.wustl.edu	37	15	45399058	45399058	+	Silent	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr15:45399058G>C	ENST00000603300.1	-	15	2005	c.1803C>G	c.(1801-1803)acC>acG	p.T601T	DUOX2_ENST00000389039.6_Silent_p.T601T	NM_014080.4	NP_054799.4	Q9NRD8	DUOX2_HUMAN	dual oxidase 2	601					adenohypophysis morphogenesis (GO:0048855)|bone mineralization (GO:0030282)|cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|inner ear development (GO:0048839)|multicellular organism growth (GO:0035264)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|response to virus (GO:0009615)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|peroxidase activity (GO:0004601)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	63		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		GAGCAATGATGGTGATGGCAA	0.587																																																	0													58.0	55.0	56.0					15																	45399058		2196	4296	6492	SO:0001819	synonymous_variant	0			AF181972	CCDS10117.1	15q15.3-q21	2013-01-10			ENSG00000140279	ENSG00000140279		"""EF-hand domain containing"""	13273	protein-coding gene	gene with protein product	"""dual oxidase-like domains 2"", ""nicotinamide adenine dinucleotide phosphate oxidase"", ""flavoprotein NADPH oxidase"", ""NADPH thyroid oxidase 2"", ""NADH/NADPH thyroid oxidase p138-tox"", ""NADPH oxidase/peroxidase DUOX2"""	606759				10601291, 10806195	Standard	NM_014080		Approved	P138-TOX, P138(TOX), THOX2, LNOX2	uc010bea.3	Q9NRD8	OTTHUMG00000131355	ENST00000603300.1:c.1803C>G	15.37:g.45399058G>C			A8MQ13|D2XI64|Q9NR02|Q9UHF9	Silent	SNP	pfam_Haem_peroxidase_animal,pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_EF_hand_dom,superfamily_Haem_peroxidase,superfamily_Riboflavin_synthase-like_b-brl,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr,prints_Recoverin	p.T601	ENST00000603300.1	37	c.1803	CCDS10117.1	15																																																																																			DUOX2	-	NULL	ENSG00000140279		0.587	DUOX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DUOX2	HGNC	protein_coding		-	0.00	17	0	G	NM_014080		45399058	-1	tier1	-	no_errors	ENST00000389039	ensembl	human	known	74_37	silent	25.00	15	5	SNP	0.985	C
DUSP6	1848	genome.wustl.edu	37	12	89745616	89745616	+	Silent	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr12:89745616C>T	ENST00000279488.7	-	1	1432	c.201G>A	c.(199-201)caG>caA	p.Q67Q	DUSP6_ENST00000547140.1_5'Flank|DUSP6_ENST00000308385.6_Silent_p.Q67Q|DUSP6_ENST00000547291.1_5'Flank	NM_001946.2	NP_001937.2	Q16828	DUS6_HUMAN	dual specificity phosphatase 6	67	Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.				cell differentiation (GO:0030154)|dorsal/ventral pattern formation (GO:0009953)|inactivation of MAPK activity (GO:0000188)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of apoptotic process (GO:0043065)|regulation of endodermal cell fate specification (GO:0042663)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of heart growth (GO:0060420)|response to drug (GO:0042493)|response to nitrosative stress (GO:0051409)|response to organic cyclic compound (GO:0014070)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)			large_intestine(5)|lung(8)|skin(2)|urinary_tract(1)	16						GGTTACCCTTCTGCAGGCGCC	0.672																																					Colon(132;3456 5224)												0													17.0	16.0	16.0					12																	89745616		2184	4273	6457	SO:0001819	synonymous_variant	0			BC037236	CCDS9033.1, CCDS9034.1	12q22-q23	2011-06-09				ENSG00000139318		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3072	protein-coding gene	gene with protein product		602748				8626780, 9205128	Standard	NM_001946		Approved	MKP-3, PYST1	uc001tay.3	Q16828		ENST00000279488.7:c.201G>A	12.37:g.89745616C>T			O75109|Q53Y75|Q9BSH6	Silent	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,smart_Dual-sp_phosphatase_subgr_cat,pirsf_MKP,pfscan_Rhodanese-like_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_MKP	p.Q67	ENST00000279488.7	37	c.201	CCDS9033.1	12																																																																																			DUSP6	-	pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,pirsf_MKP,pfscan_Rhodanese-like_dom,prints_MKP	ENSG00000139318		0.672	DUSP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP6	HGNC	protein_coding	OTTHUMT00000406534.2	-	0.00	10	0	C	NM_001946, NM_022652		89745616	-1	tier1	-	no_errors	ENST00000279488	ensembl	human	known	74_37	silent	35.29	11	6	SNP	1.000	T
EIF3J	8669	genome.wustl.edu	37	15	44843706	44843706	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr15:44843706G>A	ENST00000535391.1	+	4	292	c.280G>A	c.(280-282)Gaa>Aaa	p.E94K	EIF3J_ENST00000424492.3_Intron|EIF3J_ENST00000261868.5_Missense_Mutation_p.E94K					eukaryotic translation initiation factor 3, subunit J											endometrium(1)|large_intestine(5)|liver(2)|skin(1)	9		all_cancers(109;2.81e-14)|all_epithelial(112;2.8e-12)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.0122)		all cancers(107;3.13e-20)|GBM - Glioblastoma multiforme(94;9.81e-07)|COAD - Colon adenocarcinoma(120;0.0754)|Colorectal(105;0.0758)		aaggcaagaagaaaTTAAAAA	0.294																																																	0													38.0	44.0	42.0					15																	44843706		2196	4296	6492	SO:0001583	missense	0			U97670	CCDS10111.1, CCDS61612.1, CCDS61613.1	15q21.1	2014-05-13	2007-07-27	2007-07-27	ENSG00000104131	ENSG00000104131			3270	protein-coding gene	gene with protein product		603910	"""eukaryotic translation initiation factor 3, subunit 1 alpha, 35kDa"""	EIF3S1		9822659	Standard	NM_001284335		Approved	eIF3-p35, eIF3-alpha, eIF3j	uc001ztv.3	O75822	OTTHUMG00000131158	ENST00000535391.1:c.280G>A	15.37:g.44843706G>A	ENSP00000440221:p.Glu94Lys			Missense_Mutation	SNP	pfam_eIF3j	p.E94K	ENST00000535391.1	37	c.280		15	.	.	.	.	.	.	.	.	.	.	G	17.51	3.406917	0.62399	.	.	ENSG00000104131	ENST00000261868;ENST00000535391	T;T	0.39787	1.06;1.06	5.24	5.24	0.73138	.	0.200325	0.50627	D	0.000104	T	0.51058	0.1652	L	0.38953	1.18	0.40068	D	0.975984	D;D	0.57257	0.979;0.979	D;D	0.71414	0.973;0.973	T	0.33085	-0.9882	10	0.19590	T	0.45	.	14.1991	0.65690	0.0:0.0:1.0:0.0	.	94;94	B4DUI3;O75822	.;EIF3J_HUMAN	K	94	ENSP00000261868:E94K;ENSP00000440221:E94K	ENSP00000261868:E94K	E	+	1	0	EIF3J	42630998	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.235000	0.58666	2.715000	0.92844	0.655000	0.94253	GAA	EIF3J	-	pfam_eIF3j	ENSG00000104131		0.294	EIF3J-002	NOVEL	basic|exp_conf	protein_coding	EIF3J	HGNC	protein_coding	OTTHUMT00000396804.1	-	0.00	51	0	G	NM_003758		44843706	+1	tier1	-	no_errors	ENST00000261868	ensembl	human	known	74_37	missense	35.82	43	24	SNP	1.000	A
CTC-301O7.4	0	genome.wustl.edu	37	19	49835424	49835424	+	lincRNA	SNP	A	A	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr19:49835424A>G	ENST00000358234.4	-	0	285																											tggctccaggagttccttggc	0.498																																																	0																																												0																															19.37:g.49835424A>G				RNA	SNP	-	NULL	ENST00000358234.4	37	NULL		19	.	.	.	.	.	.	.	.	.	.	A	4.373	0.068777	0.08436	.	.	ENSG00000197813	ENST00000358234	.	.	.	0.7	0.7	0.18099	.	.	.	.	.	T	0.37210	0.0995	.	.	.	.	.	.	B	0.29085	0.232	B	0.30495	0.116	T	0.48896	-0.8994	5	0.87932	D	0	.	.	.	.	.	73	Q8N843	.	P	73	.	ENSP00000350969:L73P	L	-	2	0	AC011450.1	54527236	0.004000	0.15560	0.001000	0.08648	0.014000	0.08584	1.020000	0.30027	0.544000	0.28883	0.334000	0.21626	CTC	CTC-301O7.4	-	-	ENSG00000197813		0.498	CTC-301O7.4-001	KNOWN	basic	lincRNA	ENSG00000197813	Clone_based_vega_gene	lincRNA	OTTHUMT00000467743.1		0.00	61	0	A			49835424	-1			no_errors	ENST00000358234	ensembl	human	known	74_37	rna	6.67	70	5	SNP	0.001	G
LOC101927209	101927209	genome.wustl.edu	37	1	142620925	142620925	+	lincRNA	SNP	A	A	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr1:142620925A>T	ENST00000610091.1	-	0	6558				RP11-417J8.3_ENST00000426408.1_lincRNA																							ATGTGTCTAGAGTGTTGGGCA	0.493																																																	0																																												0																															1.37:g.142620925A>T				RNA	SNP	-	NULL	ENST00000610091.1	37	NULL		1																																																																																			RP11-417J8.6	-	-	ENSG00000203849		0.493	RP11-417J8.6-001	KNOWN	basic	lincRNA	ENSG00000203849	Clone_based_vega_gene	lincRNA	OTTHUMT00000037265.2	-	0.00	98	0	A			142620925	-1	tier1	-	no_errors	ENST00000369381	ensembl	human	known	74_37	rna	18.03	50	11	SNP	0.208	T
Unknown	0	genome.wustl.edu	37	GL000212.1	64283	64283	+	IGR	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chrGL000212.1:64283G>A								None (None upstream) : None (None downstream)																							TCACTAACGCGGACGCCGCCC	0.607																																																	0																																										SO:0001628	intergenic_variant	0																															GL000212.1.37:g.64283G>A				Missense_Mutation	SNP	NULL	p.R11Q		37	c.32		GL000212.1																																																																																			AL356585.1	-	NULL	ENSG00000212857	0	0.607					ENSG00000212857	Clone_based_ensembl_gene			-	0.00	31	0	G			64283	+1	tier1	-	no_errors	ENST00000391545	ensembl	human	known	74_37	missense	33.33	22	11	SNP	NULL	A
RP11-764K9.1	0	genome.wustl.edu	37	9	68409852	68409852	+	lincRNA	SNP	C	C	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr9:68409852C>A	ENST00000417843.2	-	0	41				RNA5SP284_ENST00000384547.1_RNA																							ctctccaaggctctgtcgctg	0.632																																																	0																																												0																															9.37:g.68409852C>A				RNA	SNP	-	NULL	ENST00000417843.2	37	NULL		9																																																																																			RP11-764K9.1	-	-	ENSG00000225411		0.632	RP11-764K9.1-001	KNOWN	basic	lincRNA	ENSG00000225411	Clone_based_vega_gene	lincRNA	OTTHUMT00000129817.2	-	0.00	28	0	C			68409852	-1	tier1	-	no_errors	ENST00000417843	ensembl	human	known	74_37	rna	33.33	10	5	SNP	0.293	A
LOC730338	730338	genome.wustl.edu	37	7	46729005	46729005	+	Missense_Mutation	SNP	C	C	T	rs545168572		TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr7:46729005C>T	ENST00000451905.1	-	3	418	c.311G>A	c.(310-312)cGc>cAc	p.R104H	AC011294.3_ENST00000469937.1_5'UTR																							TCATCACCTGCGTGGCCATTG	0.413													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19296	0.0		0.0	False		,,,				2504	0.0																0																																										SO:0001583	missense	0																														ENST00000451905.1:c.311G>A	7.37:g.46729005C>T	ENSP00000398500:p.Arg104His			Missense_Mutation	SNP	NULL	p.R104H	ENST00000451905.1	37	c.311		7	.	.	.	.	.	.	.	.	.	.	C	7.989	0.752909	0.15778	.	.	ENSG00000233539	ENST00000451905	.	.	.	1.59	-1.67	0.08238	.	.	.	.	.	T	0.35422	0.0931	.	.	.	.	.	.	.	.	.	.	.	.	T	0.45011	-0.9290	4	0.87932	D	0	.	2.67	0.05064	0.2657:0.2924:0.4419:0.0	.	.	.	.	H	104	.	ENSP00000398500:R104H	R	-	2	0	AC011294.3	46695530	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.745000	0.04834	-0.362000	0.08113	-0.411000	0.06167	CGC	AC011294.3	-	NULL	ENSG00000233539		0.413	AC011294.3-003	PUTATIVE	basic|appris_principal	protein_coding	ENSG00000233539	Clone_based_vega_gene	protein_coding	OTTHUMT00000340262.1	-	0.00	57	0	C			46729005	-1	tier1	-	no_errors	ENST00000451905	ensembl	human	putative	74_37	missense	36.67	38	22	SNP	0.000	T
PCDHB17	54661	genome.wustl.edu	37	5	140536041	140536041	+	Silent	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr5:140536041G>A	ENST00000539533.1	+	1	465	c.465G>A	c.(463-465)ttG>ttA	p.L155L						protocadherin beta 17 pseudogene																		CATTTCCTTTGAAAATAGCTC	0.438																																																	0																																										SO:0001819	synonymous_variant	0			AF152527		5q31	2010-01-26				ENSG00000255622		"""Cadherins / Protocadherins : Clustered"""	14547	pseudogene	pseudogene						10380929	Standard	NR_001280		Approved	PCDH-psi1	uc003lis.3			ENST00000539533.1:c.465G>A	5.37:g.140536041G>A				Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L155	ENST00000539533.1	37	c.465		5																																																																																			PCDHB17	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000255622		0.438	PCDHB17-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000255622	Uniprot_gn	protein_coding		-	0.00	29	0	G			140536041	+1	tier1	-	no_errors	ENST00000539533	ensembl	human	known	74_37	silent	41.67	14	10	SNP	0.938	A
CHMP1B	57132	genome.wustl.edu	37	18	11852303	11852303	+	3'UTR	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr18:11852303G>C	ENST00000526991.2	+	0	909				GNAL_ENST00000334049.6_Intron|GNAL_ENST00000423027.3_Intron|GNAL_ENST00000269162.5_Intron|RP11-78A19.3_ENST00000586474.1_RNA|GNAL_ENST00000535121.1_Intron	NM_020412.4	NP_065145.2	Q7LBR1	CHM1B_HUMAN	charged multivesicular body protein 1B						cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|protein transport (GO:0015031)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein domain specific binding (GO:0019904)			endometrium(1)|lung(1)|urinary_tract(1)	3						GGATTCTAAAGTTCTGTATAG	0.378																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF306520	CCDS54180.1	18p11.21	2011-09-21	2011-09-21		ENSG00000255112	ENSG00000255112		"""Charged multivesicular body proteins"""	24287	protein-coding gene	gene with protein product		606486	"""chromatin modifying protein 1B"""			15537668	Standard	NM_020412		Approved	CHMP1.5, C18orf2, Vps46B	uc002kqe.3	Q7LBR1	OTTHUMG00000165820	ENST00000526991.2:c.*193G>C	18.37:g.11852303G>C			Q96E89|Q9HD41	RNA	SNP	-	NULL	ENST00000526991.2	37	NULL	CCDS54180.1	18																																																																																			RP11-78A19.3	-	-	ENSG00000267165		0.378	CHMP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000267165	Clone_based_vega_gene	protein_coding	OTTHUMT00000386375.2	-	0.00	33	0	G	NM_020412		11852303	-1	tier1	-	no_errors	ENST00000586474	ensembl	human	known	74_37	rna	65.62	11	21	SNP	0.002	C
ZNF551	90233	genome.wustl.edu	37	19	58204033	58204033	+	IGR	DEL	A	A	-	rs76200340		TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr19:58204033delA	ENST00000282296.5	+	0	4564				AC004017.1_ENST00000597520.1_Frame_Shift_Del_p.F32fs|AC003006.7_ENST00000599221.1_Intron|AC003006.7_ENST00000594684.1_Intron|ZNF551_ENST00000596085.1_Intron			Q7Z340	ZN551_HUMAN	zinc finger protein 551						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)	15		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		actccgtctcaaaaaaaaaaa	0.512																																																	0																																										SO:0001628	intergenic_variant	0			BX538151	CCDS12959.1, CCDS12959.2	19q13.43	2013-09-20			ENSG00000204519	ENSG00000204519		"""Zinc fingers, C2H2-type"", ""-"""	25108	protein-coding gene	gene with protein product							Standard	NM_138347		Approved	DKFZp686H1038	uc002qpw.5	Q7Z340	OTTHUMG00000183470		19.37:g.58204033delA			B4DU22|P17034|Q8N246|Q9BRY1	Frame_Shift_Del	DEL	NULL	p.F32fs	ENST00000282296.5	37	c.96	CCDS12959.2	19																																																																																			AC004017.1	-	NULL	ENSG00000268948		0.512	ZNF551-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000268948	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000466803.2		0.00	16	0	A	NM_138347		58204033	-1	tier1		no_errors	ENST00000597520	ensembl	human	novel	74_37	frame_shift_del	9.09	20	2	DEL	0.045	-
MRPS22	56945	genome.wustl.edu	37	3	139068148	139068149	+	Intron	INS	-	-	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr3:139068148_139068149insT	ENST00000495075.1	+	6	936				MRPS22_ENST00000465056.1_Intron|MRPS22_ENST00000478464.1_Intron|RP11-219D15.3_ENST00000608472.1_RNA|MRPS22_ENST00000310776.4_Intron			P82650	RT22_HUMAN	mitochondrial ribosomal protein S22							mitochondrial ribosome (GO:0005761)|mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)	structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	12						TTGGCATGTGCTTTTTTTTTTT	0.351																																																	0																																										SO:0001627	intron_variant	0			AF226045	CCDS3107.1	3q23	2012-09-13			ENSG00000175110	ENSG00000175110		"""Mitochondrial ribosomal proteins / small subunits"""	14508	protein-coding gene	gene with protein product		605810				11175783	Standard	NM_020191		Approved	MRP-S22, GK002, C3orf5, GIBT	uc003etb.3	P82650	OTTHUMG00000159910	ENST00000495075.1:c.505-872->T	3.37:g.139068159_139068159dupT			Q9H3I1	RNA	INS	-	NULL	ENST00000495075.1	37	NULL	CCDS3107.1	3																																																																																			RP11-219D15.3	-	-	ENSG00000272656		0.351	MRPS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000272656	Clone_based_vega_gene	protein_coding	OTTHUMT00000358120.1		0.00	47	0	-	NM_020191		139068149	-1	tier1		no_errors	ENST00000608472	ensembl	human	known	74_37	rna	7.50	74	6	INS	0.000:0.000	T
EPS8	2059	genome.wustl.edu	37	12	15811043	15811043	+	Silent	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr12:15811043C>T	ENST00000281172.5	-	12	1507	c.1071G>A	c.(1069-1071)ttG>ttA	p.L357L	EPS8_ENST00000543612.1_Silent_p.L357L|EPS8_ENST00000540613.1_Silent_p.L97L|EPS8_ENST00000542903.1_Silent_p.L97L|EPS8_ENST00000543523.1_Silent_p.L357L	NM_004447.5	NP_004438.3	Q12929	EPS8_HUMAN	epidermal growth factor receptor pathway substrate 8	357					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|actin filament bundle assembly (GO:0051017)|actin polymerization-dependent cell motility (GO:0070358)|adult locomotory behavior (GO:0008344)|barbed-end actin filament capping (GO:0051016)|behavioral response to ethanol (GO:0048149)|cell proliferation (GO:0008283)|dendritic cell migration (GO:0036336)|epidermal growth factor receptor signaling pathway (GO:0007173)|exit from mitosis (GO:0010458)|positive regulation of signal transduction (GO:0009967)|Rac protein signal transduction (GO:0016601)|regulation of actin filament length (GO:0030832)|regulation of cell shape (GO:0008360)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|ruffle membrane (GO:0032587)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actin binding (GO:0003779)|Rac GTPase binding (GO:0048365)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33		all_epithelial(100;1.87e-05)|Breast(259;0.000286)|Hepatocellular(102;0.244)		BRCA - Breast invasive adenocarcinoma(232;4.29e-05)|GBM - Glioblastoma multiforme(207;0.0264)		AAAAGTGAACCAAATCTGCAG	0.343																																																	0													74.0	74.0	74.0					12																	15811043		2203	4300	6503	SO:0001819	synonymous_variant	0			U12535	CCDS31753.1	12p12.3	2008-05-02				ENSG00000151491			3420	protein-coding gene	gene with protein product		600206				8084614	Standard	NM_004447		Approved		uc001rdb.3	Q12929		ENST00000281172.5:c.1071G>A	12.37:g.15811043C>T			A6NMC3|A8K6W2|A8KA66|B4DX66|Q8N6J0	Silent	SNP	pfam_PTB,pfam_SH3_domain,pfam_PTB/PI_dom,pfam_SH3_2,superfamily_SH3_domain,superfamily_SAM/pointed,smart_PTB/PI_dom,smart_SH3_domain,pfscan_SH3_domain	p.L357	ENST00000281172.5	37	c.1071	CCDS31753.1	12																																																																																			EPS8	-	NULL	ENSG00000151491		0.343	EPS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPS8	HGNC	protein_coding	OTTHUMT00000401093.1	-	0.00	49	0	C			15811043	-1	tier1	-	no_errors	ENST00000281172	ensembl	human	known	74_37	silent	28.95	27	11	SNP	1.000	T
EXD2	55218	genome.wustl.edu	37	14	69707767	69707767	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr14:69707767C>G	ENST00000409018.3	+	9	1944	c.1816C>G	c.(1816-1818)Cag>Gag	p.Q606E	EXD2_ENST00000409242.1_Missense_Mutation_p.Q481E|EXD2_ENST00000409675.1_Missense_Mutation_p.Q481E|EXD2_ENST00000409949.1_Missense_Mutation_p.Q481E|EXD2_ENST00000492815.1_3'UTR|EXD2_ENST00000312994.5_Missense_Mutation_p.Q606E|EXD2_ENST00000409014.1_Missense_Mutation_p.Q481E|RP11-363J20.2_ENST00000556316.1_lincRNA|EXD2_ENST00000449989.1_Missense_Mutation_p.Q481E	NM_001193361.1	NP_001180290.1	Q9NVH0	EXD2_HUMAN	exonuclease 3'-5' domain containing 2	606							3'-5' exonuclease activity (GO:0008408)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(7)|prostate(1)|urinary_tract(1)	14						CCACAACCATCAGAAGCTGCT	0.587																																																	0													53.0	49.0	50.0					14																	69707767		2203	4300	6503	SO:0001583	missense	0			AK001600	CCDS9793.1, CCDS53902.1	14q24.1	2009-02-24	2009-02-24	2009-02-24	ENSG00000081177	ENSG00000081177			20217	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 114"", ""exonuclease 3'-5' domain-like 2"""	C14orf114, EXDL2			Standard	NM_018199		Approved	FLJ10738	uc001xkv.3	Q9NVH0	OTTHUMG00000154496	ENST00000409018.3:c.1816C>G	14.37:g.69707767C>G	ENSP00000387331:p.Gln606Glu		B4DIH6|G5E947|Q6AWB6|Q8N3D3	Missense_Mutation	SNP	pfam_3'-5'_exonuclease_dom,superfamily_RNaseH-like_dom,smart_3'-5'_exonuclease_dom	p.Q606E	ENST00000409018.3	37	c.1816	CCDS53902.1	14	.	.	.	.	.	.	.	.	.	.	C	5.213	0.224851	0.09916	.	.	ENSG00000081177	ENST00000409018;ENST00000409014;ENST00000409675;ENST00000409949;ENST00000409242;ENST00000312994;ENST00000449989	T;T;T;T;T;T;T	0.61274	0.52;0.12;0.12;0.12;0.12;0.52;0.12	6.17	5.26	0.73747	.	0.493620	0.26507	N	0.023987	T	0.25082	0.0609	N	0.01874	-0.695	0.25967	N	0.982549	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.06405	0.002;0.001;0.001	T	0.16660	-1.0395	10	0.02654	T	1	-9.0233	10.4199	0.44344	0.2089:0.5269:0.2642:0.0	.	606;481;481	G5E947;B3KP95;Q9NVH0	.;.;EXD2_HUMAN	E	606;481;481;481;481;606;481	ENSP00000387331:Q606E;ENSP00000386915:Q481E;ENSP00000386762:Q481E;ENSP00000386632:Q481E;ENSP00000386839:Q481E;ENSP00000313140:Q606E;ENSP00000392177:Q481E	ENSP00000313140:Q606E	Q	+	1	0	EXD2	68777520	0.996000	0.38824	1.000000	0.80357	0.919000	0.55068	1.008000	0.29872	2.941000	0.99782	0.655000	0.94253	CAG	EXD2	-	NULL	ENSG00000081177		0.587	EXD2-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	EXD2	HGNC	protein_coding	OTTHUMT00000335504.1	-	0.00	17	0	C			69707767	+1	tier1	-	no_errors	ENST00000312994	ensembl	human	known	74_37	missense	31.03	20	9	SNP	0.997	G
EXD2	55218	genome.wustl.edu	37	14	69707805	69707805	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr14:69707805C>G	ENST00000409018.3	+	9	1982	c.1854C>G	c.(1852-1854)atC>atG	p.I618M	EXD2_ENST00000409242.1_Missense_Mutation_p.I493M|EXD2_ENST00000409675.1_Missense_Mutation_p.I493M|EXD2_ENST00000409949.1_Missense_Mutation_p.I493M|EXD2_ENST00000492815.1_3'UTR|EXD2_ENST00000312994.5_Missense_Mutation_p.I618M|EXD2_ENST00000409014.1_Missense_Mutation_p.I493M|RP11-363J20.2_ENST00000556316.1_lincRNA|EXD2_ENST00000449989.1_Missense_Mutation_p.I493M	NM_001193361.1	NP_001180290.1	Q9NVH0	EXD2_HUMAN	exonuclease 3'-5' domain containing 2	618							3'-5' exonuclease activity (GO:0008408)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(7)|prostate(1)|urinary_tract(1)	14						ATCTTCCCATCCAGCTGTCTT	0.517																																																	0													45.0	40.0	42.0					14																	69707805		2203	4300	6503	SO:0001583	missense	0			AK001600	CCDS9793.1, CCDS53902.1	14q24.1	2009-02-24	2009-02-24	2009-02-24	ENSG00000081177	ENSG00000081177			20217	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 114"", ""exonuclease 3'-5' domain-like 2"""	C14orf114, EXDL2			Standard	NM_018199		Approved	FLJ10738	uc001xkv.3	Q9NVH0	OTTHUMG00000154496	ENST00000409018.3:c.1854C>G	14.37:g.69707805C>G	ENSP00000387331:p.Ile618Met		B4DIH6|G5E947|Q6AWB6|Q8N3D3	Missense_Mutation	SNP	pfam_3'-5'_exonuclease_dom,superfamily_RNaseH-like_dom,smart_3'-5'_exonuclease_dom	p.I618M	ENST00000409018.3	37	c.1854	CCDS53902.1	14	.	.	.	.	.	.	.	.	.	.	C	11.94	1.787561	0.31593	.	.	ENSG00000081177	ENST00000409018;ENST00000409014;ENST00000409675;ENST00000409949;ENST00000409242;ENST00000312994;ENST00000449989	T;T;T;T;T;T;T	0.67345	0.08;-0.26;-0.26;-0.26;-0.26;0.08;-0.26	6.08	4.12	0.48240	.	0.296907	0.42420	D	0.000716	T	0.61652	0.2364	L	0.51422	1.61	0.44834	D	0.997847	B;B;B	0.23806	0.091;0.055;0.055	B;B;B	0.26094	0.066;0.018;0.018	T	0.64118	-0.6482	10	0.87932	D	0	-5.3346	12.6718	0.56872	0.0:0.6966:0.2376:0.0658	.	618;493;493	G5E947;B3KP95;Q9NVH0	.;.;EXD2_HUMAN	M	618;493;493;493;493;618;493	ENSP00000387331:I618M;ENSP00000386915:I493M;ENSP00000386762:I493M;ENSP00000386632:I493M;ENSP00000386839:I493M;ENSP00000313140:I618M;ENSP00000392177:I493M	ENSP00000313140:I618M	I	+	3	3	EXD2	68777558	0.780000	0.28664	1.000000	0.80357	0.649000	0.38597	0.086000	0.14935	1.546000	0.49388	0.655000	0.94253	ATC	EXD2	-	NULL	ENSG00000081177		0.517	EXD2-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	EXD2	HGNC	protein_coding	OTTHUMT00000335504.1		0.00	16	0	C			69707805	+1			no_errors	ENST00000312994	ensembl	human	known	74_37	missense	33.33	16	8	SNP	0.925	G
F10	2159	genome.wustl.edu	37	13	113803401	113803401	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr13:113803401G>A	ENST00000375559.3	+	8	1075	c.1037G>A	c.(1036-1038)cGt>cAt	p.R346H	F10_ENST00000409306.1_3'UTR|F10_ENST00000375551.3_3'UTR	NM_000504.3	NP_000495.1	P00742	FA10_HUMAN	coagulation factor X	346	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|blood coagulation, intrinsic pathway (GO:0007597)|cellular protein metabolic process (GO:0044267)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of cell migration (GO:0030335)|positive regulation of protein kinase B signaling (GO:0051897)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|intrinsic component of external side of plasma membrane (GO:0031233)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phospholipid binding (GO:0005543)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(4)|lung(10)|pancreas(1)|stomach(1)	18	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.113)|all_lung(25;0.0364)|all_epithelial(44;0.0373)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0805)|Epithelial(84;0.231)		Antihemophilic Factor(DB00025)|Apixaban(DB06605)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Enoxaparin(DB01225)|Fondaparinux sodium(DB00569)|Heparin(DB01109)|Menadione(DB00170)|Rivaroxaban(DB06228)	CTCCCCGAGCGTGACTGGGCC	0.642																																																	0													86.0	71.0	76.0					13																	113803401		2203	4300	6503	SO:0001583	missense	0				CCDS9530.1	13q34	2012-10-02			ENSG00000126218	ENSG00000126218	3.4.21.6		3528	protein-coding gene	gene with protein product		613872					Standard	XM_005268298		Approved		uc001vsx.3	P00742	OTTHUMG00000017374	ENST00000375559.3:c.1037G>A	13.37:g.113803401G>A	ENSP00000364709:p.Arg346His		Q14340	Missense_Mutation	SNP	pirsf_Pept_S1A_FX,pfam_Peptidase_S1,pfam_GLA_domain,pfam_EG-like_dom,superfamily_Trypsin-like_Pept_dom,superfamily_GLA_domain,smart_GLA_domain,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Peptidase_S1,prints_Peptidase_S1A,prints_GLA_domain,pfscan_EG-like_dom,pfscan_GLA_domain,pfscan_Peptidase_S1	p.R346H	ENST00000375559.3	37	c.1037	CCDS9530.1	13	.	.	.	.	.	.	.	.	.	.	G	8.920	0.960766	0.18583	.	.	ENSG00000126218	ENST00000375559	D	0.93076	-3.16	5.11	3.95	0.45737	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.422310	0.24145	N	0.041130	D	0.89904	0.6850	L	0.55103	1.725	0.09310	N	1	P	0.48764	0.915	B	0.41894	0.369	T	0.83310	-0.0023	10	0.56958	D	0.05	.	7.3273	0.26563	0.6148:0.3028:0.0825:0.0	.	346	P00742	FA10_HUMAN	H	346	ENSP00000364709:R346H	ENSP00000364709:R346H	R	+	2	0	F10	112851402	0.000000	0.05858	0.895000	0.35142	0.002000	0.02628	-0.021000	0.12504	0.804000	0.34136	-0.379000	0.06801	CGT	F10	-	pirsf_Pept_S1A_FX,pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000126218		0.642	F10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F10	HGNC	protein_coding	OTTHUMT00000045841.3	-	0.00	17	0	G			113803401	+1	tier1	-	no_errors	ENST00000375559	ensembl	human	known	74_37	missense	52.27	21	23	SNP	0.000	A
FAM120C	54954	genome.wustl.edu	37	X	54143073	54143073	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chrX:54143073C>T	ENST00000375180.2	-	10	2273	c.2217G>A	c.(2215-2217)atG>atA	p.M739I	FAM120C_ENST00000328235.4_Missense_Mutation_p.M739I	NM_017848.4	NP_060318.3	Q9NX05	F120C_HUMAN	family with sequence similarity 120C	739							poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						GGAAGGCCCGCATCCTTCTGT	0.537																																																	0													159.0	115.0	130.0					X																	54143073		2203	4300	6503	SO:0001583	missense	0			AY150025	CCDS14356.1, CCDS55421.1, CCDS75987.1	Xp11.22	2011-04-13	2006-07-04	2006-07-04	ENSG00000184083	ENSG00000184083			16949	protein-coding gene	gene with protein product		300741	"""chromosome X open reading frame 17"""	CXorf17		14585507	Standard	XM_006724589		Approved	ORF34, FLJ20506	uc004dsz.4	Q9NX05	OTTHUMG00000021625	ENST00000375180.2:c.2217G>A	X.37:g.54143073C>T	ENSP00000364324:p.Met739Ile		B2RMT7	Missense_Mutation	SNP	NULL	p.M739I	ENST00000375180.2	37	c.2217	CCDS14356.1	X	.	.	.	.	.	.	.	.	.	.	C	21.2	4.117160	0.77323	.	.	ENSG00000184083	ENST00000375180;ENST00000328235	T;T	0.44083	0.93;0.93	4.4	4.4	0.53042	.	0.051200	0.85682	D	0.000000	T	0.47948	0.1473	L	0.46157	1.445	0.80722	D	1	P;P	0.44877	0.845;0.845	P;P	0.49708	0.62;0.503	T	0.51671	-0.8676	10	0.59425	D	0.04	-8.1766	15.2369	0.73438	0.0:1.0:0.0:0.0	.	739;739	F8W881;Q9NX05	.;F120C_HUMAN	I	739	ENSP00000364324:M739I;ENSP00000329896:M739I	ENSP00000329896:M739I	M	-	3	0	FAM120C	54159798	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.784000	0.55416	1.911000	0.55334	0.594000	0.82650	ATG	FAM120C	-	NULL	ENSG00000184083		0.537	FAM120C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM120C	HGNC	protein_coding	OTTHUMT00000056795.2	-	0.00	31	0	C	NM_017848		54143073	-1	tier1	-	no_errors	ENST00000375180	ensembl	human	known	74_37	missense	38.46	32	20	SNP	1.000	T
FAM219B	57184	genome.wustl.edu	37	15	75198649	75198649	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr15:75198649G>A	ENST00000357635.5	-	2	592	c.272C>T	c.(271-273)tCg>tTg	p.S91L	FAM219B_ENST00000563119.1_Missense_Mutation_p.S91L|FAM219B_ENST00000563706.1_5'Flank|FAM219B_ENST00000457294.2_Missense_Mutation_p.S91L|FAM219B_ENST00000565772.1_Missense_Mutation_p.S5L	NM_020447.3	NP_065180.1	Q5XKK7	F219B_HUMAN	family with sequence similarity 219, member B	91																	GCGGTTCGGCGAGGCCCCCAG	0.622																																																	0													29.0	28.0	28.0					15																	75198649		2197	4295	6492	SO:0001583	missense	0			AK000005	CCDS32295.1	15q23	2012-03-06	2012-03-06	2012-03-06	ENSG00000178761	ENSG00000178761			24695	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 17"""	C15orf17		11214971	Standard	NM_020447		Approved	FLJ00005	uc002azh.4	Q5XKK7	OTTHUMG00000172715	ENST00000357635.5:c.272C>T	15.37:g.75198649G>A	ENSP00000350260:p.Ser91Leu		A8K4Q5|B4DK57|Q9NXY0	Missense_Mutation	SNP	NULL	p.S91L	ENST00000357635.5	37	c.272	CCDS32295.1	15	.	.	.	.	.	.	.	.	.	.	G	14.08	2.430130	0.43122	.	.	ENSG00000178761	ENST00000357635;ENST00000457294	.	.	.	5.35	4.38	0.52667	.	1.628090	0.03488	N	0.216183	T	0.29256	0.0728	N	0.12182	0.205	0.09310	N	1	B;B	0.12630	0.006;0.0	B;B	0.06405	0.002;0.001	T	0.18777	-1.0326	9	0.33141	T	0.24	-0.0472	8.2556	0.31754	0.1252:0.0:0.8748:0.0	.	91;91	D3DW69;Q5XKK7	.;CO017_HUMAN	L	91	.	ENSP00000350260:S91L	S	-	2	0	C15orf17	72985702	0.050000	0.20438	0.124000	0.21820	0.964000	0.63967	1.787000	0.38704	1.099000	0.41499	0.555000	0.69702	TCG	FAM219B	-	NULL	ENSG00000178761		0.622	FAM219B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM219B	HGNC	protein_coding	OTTHUMT00000420165.1	-	0.00	72	0	G	NM_020447		75198649	-1	tier1	-	no_errors	ENST00000357635	ensembl	human	known	74_37	missense	20.55	58	15	SNP	0.111	A
FANCB	2187	genome.wustl.edu	37	X	14883004	14883004	+	Missense_Mutation	SNP	G	G	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chrX:14883004G>T	ENST00000324138.3	-	2	782	c.629C>A	c.(628-630)aCc>aAc	p.T210N	FANCB_ENST00000398334.1_Missense_Mutation_p.T210N	NM_152633.2	NP_689846.1	Q8NB91	FANCB_HUMAN	Fanconi anemia, complementation group B	210					DNA repair (GO:0006281)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	24	Hepatocellular(33;0.183)					ACAAAATTTGGTATTCCAAAT	0.318								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																																								0													75.0	79.0	78.0					X																	14883004		2203	4299	6502	SO:0001583	missense	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AK091383	CCDS14161.1	Xp22.2	2014-09-17			ENSG00000181544	ENSG00000181544		"""Fanconi anemia, complementation groups"""	3583	protein-coding gene	gene with protein product		300515				9382107, 15502827	Standard	NM_152633		Approved	FAB, FLJ34064, FAAP95	uc004cwh.1	Q8NB91	OTTHUMG00000021168	ENST00000324138.3:c.629C>A	X.37:g.14883004G>T	ENSP00000326819:p.Thr210Asn		B2RMZ4|Q7Z2U2|Q86XG1	Missense_Mutation	SNP	NULL	p.T210N	ENST00000324138.3	37	c.629	CCDS14161.1	X	.	.	.	.	.	.	.	.	.	.	G	13.67	2.305166	0.40795	.	.	ENSG00000181544	ENST00000324138;ENST00000398334;ENST00000452869	T;T;T	0.03413	3.94;3.94;3.94	5.56	4.68	0.58851	.	0.636534	0.16407	N	0.215771	T	0.15349	0.0370	M	0.64997	1.995	0.09310	N	0.999999	D	0.76494	0.999	D	0.67382	0.951	T	0.02933	-1.1092	10	0.72032	D	0.01	-1.1897	14.9995	0.71462	0.0:0.2795:0.7205:0.0	.	210	Q8NB91	FANCB_HUMAN	N	210	ENSP00000326819:T210N;ENSP00000381378:T210N;ENSP00000397849:T210N	ENSP00000326819:T210N	T	-	2	0	FANCB	14792925	0.954000	0.32549	0.012000	0.15200	0.551000	0.35334	2.125000	0.42016	1.201000	0.43203	0.600000	0.82982	ACC	FANCB	-	NULL	ENSG00000181544		0.318	FANCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCB	HGNC	protein_coding	OTTHUMT00000055835.1	-	0.00	41	0	G	NM_152633		14883004	-1	tier1	-	no_errors	ENST00000324138	ensembl	human	known	74_37	missense	8.16	45	4	SNP	0.304	T
FAT4	79633	genome.wustl.edu	37	4	126336956	126336956	+	Missense_Mutation	SNP	C	C	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr4:126336956C>A	ENST00000394329.3	+	5	6851	c.6838C>A	c.(6838-6840)Ctt>Att	p.L2280I	FAT4_ENST00000335110.5_Missense_Mutation_p.L578I	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	2280	Cadherin 22. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						CAGAACAATTCTTCAGGTCAG	0.358																																																	0													33.0	34.0	33.0					4																	126336956		2200	4298	6498	SO:0001583	missense	0			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.6838C>A	4.37:g.126336956C>A	ENSP00000377862:p.Leu2280Ile		A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.L2280I	ENST00000394329.3	37	c.6838	CCDS3732.3	4	.	.	.	.	.	.	.	.	.	.	C	17.76	3.468264	0.63625	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.01745	4.66;4.66	5.29	5.29	0.74685	Cadherin (3);Cadherin-like (1);	0.000000	0.31450	U	0.007626	T	0.07728	0.0194	L	0.51853	1.615	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.85130	0.995;0.997	T	0.53739	-0.8396	10	0.20519	T	0.43	.	18.9676	0.92702	0.0:1.0:0.0:0.0	.	578;2280	Q6V0I7-2;Q6V0I7	.;FAT4_HUMAN	I	2280;578	ENSP00000377862:L2280I;ENSP00000335169:L578I	ENSP00000335169:L578I	L	+	1	0	FAT4	126556406	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	4.442000	0.59988	2.473000	0.83533	0.563000	0.77884	CTT	FAT4	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000196159		0.358	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	HGNC	protein_coding	OTTHUMT00000256765.2		0.00	26	0	C	NM_024582		126336956	+1			no_errors	ENST00000394329	ensembl	human	known	74_37	missense	27.27	24	9	SNP	1.000	A
FBXL16	146330	genome.wustl.edu	37	16	746901	746901	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr16:746901C>T	ENST00000397621.1	-	2	836	c.505G>A	c.(505-507)Gag>Aag	p.E169K	FBXL16_ENST00000562563.1_5'Flank|FBXL16_ENST00000324361.5_Missense_Mutation_p.E169K|FBXL16_ENST00000562585.1_5'Flank	NM_153350.3	NP_699181.2	Q8N461	FXL16_HUMAN	F-box and leucine-rich repeat protein 16	169										endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(3)|ovary(1)	10		Hepatocellular(780;0.0218)				CAGAAGCCCTCGAAGCCTCTG	0.587																																																	0													83.0	73.0	77.0					16																	746901		2200	4299	6499	SO:0001583	missense	0			BC036680	CCDS10421.1	16p13.3	2011-06-09	2004-06-15	2004-06-16	ENSG00000127585	ENSG00000127585		"""F-boxes / Leucine-rich repeats"""	14150	protein-coding gene	gene with protein product		609082	"""chromosome 16 open reading frame 22"""	C16orf22		11157797	Standard	NM_153350		Approved	MGC33974, Fbl16	uc021taa.1	Q8N461	OTTHUMG00000090420	ENST00000397621.1:c.505G>A	16.37:g.746901C>T	ENSP00000380746:p.Glu169Lys		B3KR59|D3DU60|Q2MHR2|Q96S14|Q9UJI0	Missense_Mutation	SNP	superfamily_F-box_dom,smart_Leu-rich_rpt_Cys-con_subtyp	p.E169K	ENST00000397621.1	37	c.505	CCDS10421.1	16	.	.	.	.	.	.	.	.	.	.	c	12.80	2.045205	0.36085	.	.	ENSG00000127585	ENST00000397621;ENST00000324361	T;T	0.22134	1.97;1.97	4.16	4.16	0.48862	F-box domain, Skp2-like (1);	0.209202	0.41605	D	0.000845	T	0.10423	0.0255	N	0.19112	0.55	0.43512	D	0.995778	P	0.39181	0.663	B	0.28011	0.085	T	0.10314	-1.0635	10	0.07175	T	0.84	.	15.4489	0.75257	0.0:1.0:0.0:0.0	.	169	Q8N461	FXL16_HUMAN	K	169	ENSP00000380746:E169K;ENSP00000318674:E169K	ENSP00000318674:E169K	E	-	1	0	FBXL16	686902	1.000000	0.71417	0.969000	0.41365	0.719000	0.41307	6.032000	0.70918	1.879000	0.54435	0.313000	0.20887	GAG	FBXL16	-	superfamily_F-box_dom	ENSG00000127585		0.587	FBXL16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL16	HGNC	protein_coding	OTTHUMT00000206851.2	-	0.00	25	0	C	NM_153350		746901	-1	tier1	-	no_errors	ENST00000324361	ensembl	human	known	74_37	missense	46.15	14	12	SNP	1.000	T
FBXL4	26235	genome.wustl.edu	37	6	99347302	99347302	+	Missense_Mutation	SNP	A	A	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr6:99347302A>T	ENST00000369244.2	-	7	1587	c.1159T>A	c.(1159-1161)Ttt>Att	p.F387I	FBXL4_ENST00000229971.1_Missense_Mutation_p.F387I	NM_001278716.1	NP_001265645.1	Q9UKA2	FBXL4_HUMAN	F-box and leucine-rich repeat protein 4	387					ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(4)|prostate(3)|skin(2)	18		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0413)		TCATTAAGAAAGTGGCTGCAA	0.368																																																	0													91.0	85.0	87.0					6																	99347302		2203	4300	6503	SO:0001583	missense	0			AF176699	CCDS5041.1	6q16.1-q16.3	2011-06-09			ENSG00000112234	ENSG00000112234		"""F-boxes / Leucine-rich repeats"""	13601	protein-coding gene	gene with protein product		605654				10531035	Standard	NM_012160		Approved	FBL4, FBL5	uc003ppf.1	Q9UKA2	OTTHUMG00000015259	ENST00000369244.2:c.1159T>A	6.37:g.99347302A>T	ENSP00000358247:p.Phe387Ile		B2R7Q5|E1P530|O95919|Q5BJH0|Q9UJU0	Missense_Mutation	SNP	pfam_F-box_dom,superfamily_F-box_dom,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_F-box_dom	p.F387I	ENST00000369244.2	37	c.1159	CCDS5041.1	6	.	.	.	.	.	.	.	.	.	.	A	24.3	4.511135	0.85389	.	.	ENSG00000112234	ENST00000369244;ENST00000229971	T;T	0.14766	2.48;2.48	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.08891	0.0220	L	0.49513	1.565	0.80722	D	1	P	0.52842	0.956	P	0.47299	0.543	T	0.20438	-1.0275	10	0.22706	T	0.39	.	11.5959	0.50972	0.8512:0.1488:0.0:0.0	.	387	Q9UKA2	FBXL4_HUMAN	I	387	ENSP00000358247:F387I;ENSP00000229971:F387I	ENSP00000229971:F387I	F	-	1	0	FBXL4	99454023	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.963000	0.76055	2.094000	0.63399	0.460000	0.39030	TTT	FBXL4	-	NULL	ENSG00000112234		0.368	FBXL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL4	HGNC	protein_coding	OTTHUMT00000041587.2	-	0.00	22	0	A			99347302	-1	tier1	-	no_errors	ENST00000229971	ensembl	human	known	74_37	missense	25.00	18	6	SNP	1.000	T
FBXO3	26273	genome.wustl.edu	37	11	33770429	33770429	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr11:33770429C>T	ENST00000265651.3	-	9	960	c.942G>A	c.(940-942)atG>atA	p.M314I	FBXO3_ENST00000534136.1_Missense_Mutation_p.M314I|FBXO3_ENST00000448981.2_Missense_Mutation_p.M314I|FBXO3_ENST00000531080.1_Start_Codon_SNP_p.M1I|FBXO3_ENST00000530401.1_Missense_Mutation_p.M309I|FBXO3_ENST00000526785.1_Missense_Mutation_p.M201I|FBXO3_ENST00000532057.1_Start_Codon_SNP_p.M1I	NM_012175.3	NP_036307.2	Q9UK99	FBX3_HUMAN	F-box protein 3	314	ApaG. {ECO:0000255|PROSITE- ProRule:PRU00412}.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|pancreas(1)|stomach(1)	13		Lung NSC(402;0.0804)		BRCA - Breast invasive adenocarcinoma(625;0.00315)|Lung(977;0.00488)|LUSC - Lung squamous cell carcinoma(625;0.008)		CATCTTTTGACATTTCAATCC	0.423																																																	0													86.0	81.0	83.0					11																	33770429		2202	4298	6500	SO:0001583	missense	0			AK001943	CCDS7887.1, CCDS44566.1	11p13	2006-07-07	2004-06-15		ENSG00000110429	ENSG00000110429		"""F-boxes /  ""other"""""	13582	protein-coding gene	gene with protein product		609089	"""F-box only protein 3"""			10531037	Standard	NM_033406		Approved	FBX3, FBA	uc001muz.3	Q9UK99	OTTHUMG00000166244	ENST00000265651.3:c.942G>A	11.37:g.33770429C>T	ENSP00000265651:p.Met314Ile		B3KY16|D3DR05|Q86X90|Q9H0V2|Q9NUX2	Missense_Mutation	SNP	pfam_ApaG_domain,pfam_F-box_dom,superfamily_ApaG_domain,superfamily_F-box_dom,smart_F-box_dom,smart_SMI1/KNR4_like_dom,pfscan_ApaG_domain,pfscan_F-box_dom	p.M314I	ENST00000265651.3	37	c.942	CCDS7887.1	11	.	.	.	.	.	.	.	.	.	.	C	27.6	4.843070	0.91197	.	.	ENSG00000110429	ENST00000526785;ENST00000265651;ENST00000530401;ENST00000531080;ENST00000532057;ENST00000534136;ENST00000448981	T;T;T;T;T	0.47869	0.83;0.84;0.86;0.86;0.87	5.46	5.46	0.80206	ApaG domain (4);	0.000000	0.85682	D	0.000000	T	0.67961	0.2949	M	0.71581	2.175	0.80722	D	1	D;D;D	0.69078	0.993;0.993;0.997	D;D;D	0.67725	0.91;0.91;0.953	T	0.66308	-0.5956	10	0.40728	T	0.16	-18.995	19.2889	0.94090	0.0:1.0:0.0:0.0	.	309;314;314	Q9UK99-3;Q9UK99-2;Q9UK99	.;.;FBX3_HUMAN	I	201;314;309;1;1;314;314	ENSP00000435680:M201I;ENSP00000265651:M314I;ENSP00000433781:M309I;ENSP00000431745:M314I;ENSP00000408836:M314I	ENSP00000265651:M314I	M	-	3	0	FBXO3	33727005	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.294000	0.78760	2.586000	0.87340	0.491000	0.48974	ATG	FBXO3	-	pfam_ApaG_domain,superfamily_ApaG_domain,pfscan_ApaG_domain	ENSG00000110429		0.423	FBXO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO3	HGNC	protein_coding	OTTHUMT00000388665.1	-	0.00	63	0	C	NM_012175		33770429	-1	tier1	-	no_errors	ENST00000265651	ensembl	human	known	74_37	missense	27.91	62	24	SNP	1.000	T
FBXW8	26259	genome.wustl.edu	37	12	117402587	117402587	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr12:117402587G>A	ENST00000309909.5	+	5	845	c.763G>A	c.(763-765)Gag>Aag	p.E255K	FBXW8_ENST00000455858.2_Missense_Mutation_p.E189K			Q8N3Y1	FBXW8_HUMAN	F-box and WD repeat domain containing 8	255					cell proliferation (GO:0008283)|Golgi organization (GO:0007030)|labyrinthine layer blood vessel development (GO:0060716)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|spongiotrophoblast layer development (GO:0060712)	Cul7-RING ubiquitin ligase complex (GO:0031467)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|SCF ubiquitin ligase complex (GO:0019005)				endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	22	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0353)		CGAGGAGGATGAGCCTGGAAT	0.522																																																	0													181.0	157.0	165.0					12																	117402587		2203	4300	6503	SO:0001583	missense	0			AF176707	CCDS9182.1, CCDS44988.1	12q24.23	2013-01-09	2007-02-08	2003-06-13				"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13597	protein-coding gene	gene with protein product		609073	"""F-box only protein 29"", ""F-box and WD-40 domain protein 8"""	FBXO29		10531035, 10531037	Standard	NM_012174		Approved	FBX29, FBW6, FBW8	uc001twg.1	Q8N3Y1	OTTHUMG00000169329	ENST00000309909.5:c.763G>A	12.37:g.117402587G>A	ENSP00000310686:p.Glu255Lys		Q9UK95	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_F-box_dom,superfamily_Quinonprotein_ADH-like_supfam,superfamily_F-box_dom,smart_F-box_dom,smart_WD40_repeat,pfscan_F-box_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E255K	ENST00000309909.5	37	c.763	CCDS9182.1	12	.	.	.	.	.	.	.	.	.	.	G	19.54	3.846186	0.71603	.	.	ENSG00000174989	ENST00000309909;ENST00000455858;ENST00000505227	T;T	0.04360	3.64;3.64	5.28	5.28	0.74379	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40-repeat-containing domain (1);	0.444418	0.24431	N	0.038582	T	0.05502	0.0145	N	0.22421	0.69	0.36337	D	0.859231	P;P	0.44429	0.835;0.804	B;B	0.42386	0.283;0.386	T	0.54262	-0.8320	10	0.15952	T	0.53	-16.4563	19.469	0.94954	0.0:0.0:1.0:0.0	.	255;189	Q8N3Y1;Q8N3Y1-2	FBXW8_HUMAN;.	K	255;189;189	ENSP00000310686:E255K;ENSP00000389144:E189K	ENSP00000310686:E255K	E	+	1	0	FBXW8	115886970	1.000000	0.71417	0.999000	0.59377	0.917000	0.54804	6.860000	0.75473	2.906000	0.99361	0.655000	0.94253	GAG	FBXW8	-	superfamily_Quinonprotein_ADH-like_supfam,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000174989		0.522	FBXW8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW8	HGNC	protein_coding	OTTHUMT00000403561.1	-	0.00	67	0	G	NM_012174		117402587	+1	tier1	-	no_errors	ENST00000309909	ensembl	human	known	74_37	missense	7.46	62	5	SNP	1.000	A
FCN3	8547	genome.wustl.edu	37	1	27695957	27695957	+	Missense_Mutation	SNP	T	T	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr1:27695957T>C	ENST00000270879.4	-	8	675	c.670A>G	c.(670-672)Agc>Ggc	p.S224G	MAP3K6_ENST00000374040.3_5'Flank|MAP3K6_ENST00000493901.1_5'Flank|FCN3_ENST00000354982.2_Missense_Mutation_p.S213G|MAP3K6_ENST00000357582.2_5'Flank	NM_003665.2	NP_003656.2	O75636	FCN3_HUMAN	ficolin (collagen/fibrinogen domain containing) 3	224	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)	blood microparticle (GO:0072562)|collagen trimer (GO:0005581)|extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)	p.S224G(1)		endometrium(2)|kidney(2)|large_intestine(1)|lung(1)|urinary_tract(1)	7		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;1.42e-27)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00128)|KIRC - Kidney renal clear cell carcinoma(1967;0.00155)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		CTGTGGAGGCTCAGGGAATCC	0.562																																																	1	Substitution - Missense(1)	large_intestine(1)											65.0	62.0	63.0					1																	27695957		2203	4300	6503	SO:0001583	missense	0			D88587	CCDS300.1, CCDS301.1	1p36.11	2014-09-17	2013-09-12		ENSG00000142748	ENSG00000142748		"""Fibrinogen C domain containing"""	3625	protein-coding gene	gene with protein product	"""Hakata antigen"""	604973	"""ficolin (collagen/fibrinogen domain-containing) 3 (Hakata antigen)"""			9694814, 10330454	Standard	NM_003665		Approved	FCNH, HAKA1	uc001boa.3	O75636	OTTHUMG00000005722	ENST00000270879.4:c.670A>G	1.37:g.27695957T>C	ENSP00000270879:p.Ser224Gly		Q6IBJ5|Q8WW86	Missense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C_dom,pfam_Collagen,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	p.S224G	ENST00000270879.4	37	c.670	CCDS300.1	1	.	.	.	.	.	.	.	.	.	.	T	13.62	2.290831	0.40494	.	.	ENSG00000142748	ENST00000270879;ENST00000354982	T;T	0.77489	-1.1;-1.1	5.0	5.0	0.66597	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.352632	0.22824	N	0.055188	T	0.72391	0.3454	L	0.42686	1.345	0.80722	D	1	B;B	0.20671	0.047;0.047	B;B	0.28305	0.035;0.088	T	0.70226	-0.4930	10	0.49607	T	0.09	.	12.7131	0.57100	0.0:0.0:0.0:1.0	.	213;224	Q6UXM4;O75636	.;FCN3_HUMAN	G	224;213	ENSP00000270879:S224G;ENSP00000347077:S213G	ENSP00000270879:S224G	S	-	1	0	FCN3	27568544	0.002000	0.14202	0.985000	0.45067	0.279000	0.26890	0.107000	0.15375	2.102000	0.63906	0.459000	0.35465	AGC	FCN3	-	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	ENSG00000142748		0.562	FCN3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCN3	HGNC	protein_coding	OTTHUMT00000015667.1		0.00	19	0	T			27695957	-1			no_errors	ENST00000270879	ensembl	human	known	74_37	missense	10.53	17	2	SNP	0.981	C
FGF13	2258	genome.wustl.edu	37	X	137717719	137717719	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chrX:137717719C>T	ENST00000315930.6	-	4	1161	c.500G>A	c.(499-501)cGa>cAa	p.R167Q	FGF13_ENST00000305414.4_Missense_Mutation_p.R114Q|FGF13_ENST00000370603.3_Missense_Mutation_p.R177Q|FGF13_ENST00000441825.2_Missense_Mutation_p.R148Q|FGF13_ENST00000541469.1_Missense_Mutation_p.R121Q	NM_004114.3	NP_004105.1	Q92913	FGF13_HUMAN	fibroblast growth factor 13	167	Mediates interaction with sodium channels.				cell-cell signaling (GO:0007267)|cerebral cortex cell migration (GO:0021795)|establishment of neuroblast polarity (GO:0045200)|hippocampus development (GO:0021766)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|microtubule polymerization (GO:0046785)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of microtubule depolymerization (GO:0007026)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|positive regulation of protein kinase activity (GO:0045860)|protein localization to plasma membrane (GO:0072659)|signal transduction (GO:0007165)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular region (GO:0005576)|filopodium (GO:0030175)|growth cone (GO:0030426)|intercalated disc (GO:0014704)|microtubule (GO:0005874)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-tubulin binding (GO:0048487)|growth factor activity (GO:0008083)|ion channel binding (GO:0044325)|microtubule binding (GO:0008017)|protein kinase activator activity (GO:0030295)|sodium channel regulator activity (GO:0017080)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)	24	Acute lymphoblastic leukemia(192;0.000127)					ATACCACCCTCGGCCTGACTG	0.418																																																	0													177.0	149.0	159.0					X																	137717719		2203	4300	6503	SO:0001583	missense	0			BC034340	CCDS14664.1, CCDS14665.1, CCDS55511.1	Xq26.3	2008-02-05			ENSG00000129682	ENSG00000129682			3670	protein-coding gene	gene with protein product	"""fibroblast growth factor homologous factor 2"""	300070				8790420	Standard	NM_033642		Approved	FHF2, FGF2	uc011mwj.2	Q92913	OTTHUMG00000022532	ENST00000315930.6:c.500G>A	X.37:g.137717719C>T	ENSP00000322390:p.Arg167Gln		B1AK18|B7Z4M7|B7Z8N0|D3DWH4|O95830|Q9NZH9|Q9NZI0	Missense_Mutation	SNP	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam,prints_IL-1_fam/FGF_fam,prints_Fibroblast_GF_fam	p.R177Q	ENST00000315930.6	37	c.530	CCDS14665.1	X	.	.	.	.	.	.	.	.	.	.	C	36	5.776286	0.96922	.	.	ENSG00000129682	ENST00000315930;ENST00000305414;ENST00000441825;ENST00000370603;ENST00000541469;ENST00000436198;ENST00000455663	D;D;D;D;D;D;D	0.82711	-1.64;-1.64;-1.64;-1.64;-1.64;-1.64;-1.64	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.92120	0.7502	M	0.82630	2.6	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.997;0.997;0.994	D	0.92617	0.6104	10	0.87932	D	0	.	18.5888	0.91200	0.0:1.0:0.0:0.0	.	121;177;114;167	B7Z8N0;B7Z4M7;Q92913-2;Q92913	.;.;.;FGF13_HUMAN	Q	167;114;148;177;121;177;183	ENSP00000322390:R167Q;ENSP00000303391:R114Q;ENSP00000409276:R148Q;ENSP00000359635:R177Q;ENSP00000437903:R121Q;ENSP00000396198:R177Q;ENSP00000406916:R183Q	ENSP00000303391:R114Q	R	-	2	0	FGF13	137545385	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.618000	0.88619	0.600000	0.82982	CGA	FGF13	-	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam	ENSG00000129682		0.418	FGF13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF13	HGNC	protein_coding	OTTHUMT00000058534.2	-	0.00	60	0	C	NM_004114		137717719	-1	tier1	-	no_errors	ENST00000370603	ensembl	human	known	74_37	missense	18.75	78	18	SNP	1.000	T
FKBP9	11328	genome.wustl.edu	37	7	33014253	33014253	+	Silent	SNP	T	T	C	rs200712661		TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr7:33014253T>C	ENST00000242209.4	+	2	415	c.246T>C	c.(244-246)aaT>aaC	p.N82N	AVL9_ENST00000404479.1_Intron|FKBP9_ENST00000538443.1_Intron|FKBP9_ENST00000538336.1_Silent_p.N135N	NM_001284343.1|NM_007270.3	NP_001271272.1|NP_009201.2	O95302	FKBP9_HUMAN	FK506 binding protein 9, 63 kDa	82	PPIase FKBP-type 1. {ECO:0000255|PROSITE- ProRule:PRU00277}.				chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			central_nervous_system(13)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	39			GBM - Glioblastoma multiforme(11;0.0156)			CCACTTTCAATGTGTTTGTGG	0.453																																																	0													146.0	145.0	146.0					7																	33014253		2203	4300	6503	SO:0001819	synonymous_variant	0			AF089745	CCDS5439.1, CCDS64622.1, CCDS64623.1	7p11.1	2013-01-10	2002-08-29		ENSG00000122642	ENSG00000122642		"""EF-hand domain containing"""	3725	protein-coding gene	gene with protein product			"""FK506-binding protein 9 (63 kD)"""			12036304	Standard	NM_007270		Approved	FKBP60, FKBP63	uc003tdh.3	O95302	OTTHUMG00000097847	ENST00000242209.4:c.246T>C	7.37:g.33014253T>C			B3KY35|B7Z1G9|B7Z6H3|Q2M2A1|Q3MIR7|Q6IN76|Q6P2N1|Q96EX5|Q96IJ9	Silent	SNP	pfam_PPIase_FKBP_dom,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_PPIase_FKBP_dom	p.N135	ENST00000242209.4	37	c.405	CCDS5439.1	7																																																																																			FKBP9	-	pfam_PPIase_FKBP_dom,pfscan_PPIase_FKBP_dom	ENSG00000122642		0.453	FKBP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP9	HGNC	protein_coding	OTTHUMT00000215137.1		0.00	103	0	T	NM_007270		33014253	+1			no_errors	ENST00000538336	ensembl	human	known	74_37	silent	6.10	77	5	SNP	0.990	C
FLNA	2316	genome.wustl.edu	37	X	153581174	153581174	+	Silent	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chrX:153581174G>A	ENST00000369850.3	-	39	6581	c.6345C>T	c.(6343-6345)atC>atT	p.I2115I	FLNA_ENST00000344736.4_Silent_p.I2075I|FLNA_ENST00000369856.3_Silent_p.I248I|FLNA_ENST00000422373.1_Silent_p.I2107I|FLNA_ENST00000498491.1_5'Flank|FLNA_ENST00000360319.4_Silent_p.I2107I	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	2115					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TGATGTTGATGATGTAGTTGC	0.607																																																	0													111.0	112.0	112.0					X																	153581174		2161	4236	6397	SO:0001819	synonymous_variant	0			X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.6345C>T	X.37:g.153581174G>A			E9KL45|Q5HY53|Q5HY55|Q8NF52	Silent	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.I2115	ENST00000369850.3	37	c.6345	CCDS48194.1	X																																																																																			FLNA	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000196924		0.607	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNA	HGNC	protein_coding	OTTHUMT00000058942.3	-	0.00	23	0	G			153581174	-1	tier1	-	no_errors	ENST00000369850	ensembl	human	known	74_37	silent	44.44	20	16	SNP	0.996	A
FMO3	2328	genome.wustl.edu	37	1	171083374	171083374	+	Missense_Mutation	SNP	T	T	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr1:171083374T>C	ENST00000367755.4	+	7	1166	c.1055T>C	c.(1054-1056)tTa>tCa	p.L352S	FMO3_ENST00000392085.2_Missense_Mutation_p.L352S|FMO3_ENST00000542847.1_Missense_Mutation_p.L332S|FMO3_ENST00000538429.1_Missense_Mutation_p.L289S	NM_001002294.2	NP_001002294.1	P31513	FMO3_HUMAN	flavin containing monooxygenase 3	352					drug metabolic process (GO:0017144)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	amino acid binding (GO:0016597)|flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)|trimethylamine monooxygenase activity (GO:0034899)			endometrium(1)|kidney(1)|large_intestine(12)|lung(12)|skin(1)|stomach(2)|urinary_tract(2)	31	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Almotriptan(DB00918)|Cimetidine(DB00501)|Clozapine(DB00363)|Dapsone(DB00250)|Dasatinib(DB01254)|Olanzapine(DB00334)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	GAGATCATTTTATTTAAAGGA	0.433																																																	0													93.0	92.0	92.0					1																	171083374		2203	4300	6503	SO:0001583	missense	0			BC032016	CCDS1292.1	1q24.3	2013-10-01			ENSG00000007933	ENSG00000007933	2.6.1.16		3771	protein-coding gene	gene with protein product		136132				8486388, 9417913	Standard	NM_001002294		Approved		uc001ghh.3	P31513	OTTHUMG00000035505	ENST00000367755.4:c.1055T>C	1.37:g.171083374T>C	ENSP00000356729:p.Leu352Ser		B2R816|Q14854|Q8N5N5	Missense_Mutation	SNP	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase,prints_Flavin_mOase_3,prints_Flavin_mOase_1,prints_Flavin_mOase_2	p.L352S	ENST00000367755.4	37	c.1055	CCDS1292.1	1	.	.	.	.	.	.	.	.	.	.	T	16.01	3.002690	0.54254	.	.	ENSG00000007933	ENST00000367755;ENST00000392085;ENST00000542847;ENST00000538429	T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14	4.92	4.92	0.64577	.	0.000000	0.85682	D	0.000000	D	0.84897	0.5574	H	0.98612	4.28	0.58432	D	0.999996	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.997;0.998	D	0.90847	0.4728	10	0.87932	D	0	-16.1019	14.5384	0.67976	0.0:0.0:0.0:1.0	.	289;332;352	F5H261;F5GZZ8;P31513	.;.;FMO3_HUMAN	S	352;352;332;289	ENSP00000356729:L352S;ENSP00000375935:L352S;ENSP00000444073:L332S;ENSP00000439500:L289S	ENSP00000356729:L352S	L	+	2	0	FMO3	169349998	1.000000	0.71417	1.000000	0.80357	0.229000	0.25112	7.411000	0.80078	1.952000	0.56665	0.528000	0.53228	TTA	FMO3	-	pfam_Flavin_mOase-like,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase_3,prints_Flavin_mOase_2	ENSG00000007933		0.433	FMO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMO3	HGNC	protein_coding	OTTHUMT00000086219.1		0.00	41	0	T	NM_006894		171083374	+1			no_errors	ENST00000367755	ensembl	human	known	74_37	missense	6.67	28	2	SNP	0.997	C
FOCAD	54914	genome.wustl.edu	37	9	20951037	20951037	+	Missense_Mutation	SNP	G	G	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr9:20951037G>T	ENST00000380249.1	+	36	4355	c.3991G>T	c.(3991-3993)Gtc>Ttc	p.V1331F	FOCAD_ENST00000605086.1_Missense_Mutation_p.V767F|FOCAD_ENST00000338382.6_Missense_Mutation_p.V1331F	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin	1331						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)											GTCAAATGCAGTCTGGCTTCT	0.403																																																	0													247.0	229.0	236.0					9																	20951037		2203	4300	6503	SO:0001583	missense	0			AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.3991G>T	9.37:g.20951037G>T	ENSP00000369599:p.Val1331Phe		D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Missense_Mutation	SNP	pfam_DUF3028,pfam_DUF3730,superfamily_ARM-type_fold	p.V1331F	ENST00000380249.1	37	c.3991	CCDS34993.1	9	.	.	.	.	.	.	.	.	.	.	G	12.59	1.983761	0.35036	.	.	ENSG00000188352	ENST00000380249;ENST00000338382	T;T	0.21932	1.98;1.98	5.87	-0.757	0.11054	Armadillo-type fold (1);	0.217143	0.46442	D	0.000290	T	0.11410	0.0278	N	0.22421	0.69	0.09310	N	1	B	0.18610	0.029	B	0.21546	0.035	T	0.16778	-1.0391	10	0.56958	D	0.05	-25.2342	5.4145	0.16365	0.307:0.0:0.5179:0.1751	.	1331	Q5VW36	K1797_HUMAN	F	1331	ENSP00000369599:V1331F;ENSP00000344307:V1331F	ENSP00000344307:V1331F	V	+	1	0	KIAA1797	20941037	0.976000	0.34144	0.510000	0.27712	0.901000	0.52897	0.794000	0.26958	-0.077000	0.12752	-1.144000	0.01866	GTC	FOCAD	-	pfam_DUF3028,superfamily_ARM-type_fold	ENSG00000188352		0.403	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOCAD	HGNC	protein_coding	OTTHUMT00000143442.1	-	0.00	86	0	G	NM_017794		20951037	+1	tier1	-	no_errors	ENST00000338382	ensembl	human	known	74_37	missense	5.80	65	4	SNP	0.224	T
GABRA6	2559	genome.wustl.edu	37	5	161117302	161117302	+	Missense_Mutation	SNP	C	C	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr5:161117302C>A	ENST00000274545.5	+	7	1202	c.769C>A	c.(769-771)Ctt>Att	p.L257I	RP11-348M17.2_ENST00000521984.1_RNA|GABRA6_ENST00000523217.1_Missense_Mutation_p.L247I			Q16445	GBRA6_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 6	257					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|liver(2)|lung(22)|ovary(7)|skin(6)|urinary_tract(2)	57	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	GACAGTCATTCTTTCCCAGGT	0.398										TCGA Ovarian(5;0.080)																																							0													171.0	157.0	162.0					5																	161117302		2203	4300	6503	SO:0001583	missense	0				CCDS4356.1	5q34	2012-06-22			ENSG00000145863	ENSG00000145863		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4080	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 6"""	137143				8020978	Standard	NM_000811		Approved		uc003lyu.2	Q16445	OTTHUMG00000130351	ENST00000274545.5:c.769C>A	5.37:g.161117302C>A	ENSP00000274545:p.Leu257Ile		A8K096|Q4VAV2	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAAa_rcpt,prints_GABAA_rcpt,prints_GABBAa6_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.L257I	ENST00000274545.5	37	c.769	CCDS4356.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.6|20.6	4.018384|4.018384	0.75275|0.75275	.|.	.|.	ENSG00000145863|ENSG00000145863	ENST00000520000|ENST00000274545;ENST00000523217;ENST00000523691	.|D;D;D	.|0.92858	.|-3.12;-3.12;-3.12	5.31|5.31	5.31|5.31	0.75309|0.75309	.|Neurotransmitter-gated ion-channel transmembrane domain (2);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.95188|0.95188	0.8440|0.8440	L|L	0.52823|0.52823	1.66|1.66	0.49213|0.49213	D|D	0.999767|0.999767	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	D|D	0.95564|0.95564	0.8632|0.8632	5|10	.|0.87932	.|D	.|0	.|.	18.9873|18.9873	0.92777|0.92777	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|257	.|Q16445	.|GBRA6_HUMAN	L|I	196|257;247;177	.|ENSP00000274545:L257I;ENSP00000430527:L247I;ENSP00000427989:L177I	.|ENSP00000274545:L257I	F|L	+|+	3|1	2|0	GABRA6|GABRA6	161049880|161049880	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	4.825000|4.825000	0.62708|0.62708	2.491000|2.491000	0.84063|0.84063	0.655000|0.655000	0.94253|0.94253	TTC|CTT	GABRA6	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,tigrfam_Neur_channel	ENSG00000145863		0.398	GABRA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRA6	HGNC	protein_coding	OTTHUMT00000252707.2	-	0.00	43	0	C			161117302	+1	tier1	-	no_errors	ENST00000274545	ensembl	human	known	74_37	missense	62.79	16	27	SNP	1.000	A
GOLGA8I	283796	genome.wustl.edu	37	15	23263636	23263636	+	Silent	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr15:23263636C>T	ENST00000450802.3	+	14	1343	c.1245C>T	c.(1243-1245)gcC>gcT	p.A415A	RN7SL495P_ENST00000461817.2_RNA|AC091565.1_ENST00000459619.1_RNA	NM_001282468.1|NM_001282472.1|NM_001282484.1|NM_001282490.1|NM_001282493.1|NM_001282494.1	NP_001269397.1|NP_001269401.1|NP_001269413.1|NP_001269419.1|NP_001269422.1|NP_001269423.1	A6NC78	GOG8I_HUMAN	golgin A8 family, member I	415						Golgi apparatus (GO:0005794)|membrane (GO:0016020)											AGCTAACAGCCCAGCTGAGCC	0.617																																																	0																																										SO:0001819	synonymous_variant	0			AK093104		15q11.2	2013-01-17	2012-10-05	2012-10-05	ENSG00000153666	ENSG00000277561			26660	other	unknown	"""FLJ35785"""		"""golgi autoantigen, golgin subfamily a, 9 pseudogene"", ""golgin A9, pseudogene"", ""golgin A8 family, member I, pseudogene"""	GOLGA9P, GOLGA8IP			Standard	NR_024074		Approved	FLJ35785	uc001yvh.1	A6NC78	OTTHUMG00000129149	ENST00000450802.3:c.1245C>T	15.37:g.23263636C>T				Silent	SNP	NULL	p.A415	ENST00000450802.3	37	c.1245		15																																																																																			GOLGA8I	-	NULL	ENSG00000153666		0.617	GOLGA8I-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	GOLGA8I	HGNC	protein_coding	OTTHUMT00000251213.2	-	0.00	188	0	C	NR_024074		23263636	+1	tier1	-	no_errors	ENST00000450802	ensembl	human	known	74_37	silent	48.67	58	55	SNP	0.989	T
GPATCH11	253635	genome.wustl.edu	37	2	37311692	37311692	+	5'UTR	DEL	G	G	-			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr2:37311692delG	ENST00000608836.1	+	0	99				GPATCH11_ENST00000281932.5_5'UTR|HEATR5B_ENST00000354531.2_5'Flank|HEATR5B_ENST00000233099.5_5'Flank|GPATCH11_ENST00000409774.1_Frame_Shift_Del_p.R11fs	NM_174931.2	NP_777591.3	Q8N954	GPT11_HUMAN	G patch domain containing 11								nucleic acid binding (GO:0003676)										GCGCTGAACCGGGGCGAGCAG	0.612																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AK095667	CCDS1785.2, CCDS62891.1, CCDS1785.3	2p22.2	2013-11-05	2013-01-28	2013-01-28	ENSG00000152133	ENSG00000152133		"""G patch domain containing"""	26768	protein-coding gene	gene with protein product	"""centromere protein Y"""		"""coiled-coil domain containing 75"""	CCDC75			Standard	NM_001278505		Approved	FLJ38348, CENPY, CENP-Y	uc010ezz.3	Q8N954	OTTHUMG00000128469	ENST00000608836.1:c.-47G>-	2.37:g.37311692delG			A8K0D9|B7Z2G4|B8ZZ44	Frame_Shift_Del	DEL	pfam_G_patch_dom,smart_G_patch_dom,pfscan_G_patch_dom	p.G12fs	ENST00000608836.1	37	c.32	CCDS1785.2	2																																																																																			GPATCH11	-	NULL	ENSG00000152133		0.612	GPATCH11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GPATCH11	HGNC	protein_coding			0.00	17	0	G	NM_174931		37311692	+1	tier1		no_errors	ENST00000409774	ensembl	human	known	74_37	frame_shift_del	8.00	23	2	DEL	0.000	-
GPR112	139378	genome.wustl.edu	37	X	135432293	135432293	+	Missense_Mutation	SNP	G	G	T	rs150281542		TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chrX:135432293G>T	ENST00000394143.1	+	6	6719	c.6428G>T	c.(6427-6429)gGt>gTt	p.G2143V	GPR112_ENST00000370652.1_Missense_Mutation_p.G2143V|GPR112_ENST00000412101.1_Missense_Mutation_p.G1938V|GPR112_ENST00000287534.4_Missense_Mutation_p.G2080V|GPR112_ENST00000394141.1_Missense_Mutation_p.G1938V	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	2143					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					CTATCTGTTGGTGCCATGCCT	0.453													g|||	2	0.000529801	0.0008	0.0014	3775	,	,		17100	0.0		0.0	False		,,,				2504	0.0																0									VAL/GLY	2,3833		0,2,1630,571	164.0	119.0	134.0		6428	2.5	0.0	X	dbSNP_134	134	0,6728		0,0,2428,1872	no	missense	GPR112	NM_153834.3	109	0,2,4058,2443	TT,TG,GG,G		0.0,0.0522,0.0189	possibly-damaging	2143/3081	135432293	2,10561	2203	4300	6503	SO:0001583	missense	0			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.6428G>T	X.37:g.135432293G>T	ENSP00000377699:p.Gly2143Val		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.G2143V	ENST00000394143.1	37	c.6428	CCDS35409.1	X	.	.	.	.	.	.	.	.	.	.	g	9.837	1.189996	0.21954	5.22E-4	0.0	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.53640	1.25;1.25;1.2;0.61;1.2	3.52	2.55	0.30701	.	.	.	.	.	T	0.45935	0.1367	L	0.27053	0.805	0.09310	N	1	D;P;D	0.67145	0.996;0.944;0.964	P;P;P	0.62740	0.906;0.624;0.706	T	0.25467	-1.0131	9	0.17369	T	0.5	.	7.3118	0.26479	0.0:0.2687:0.7313:0.0	.	2080;1938;2143	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	V	2143;2143;1938;2080;1938	ENSP00000377699:G2143V;ENSP00000359686:G2143V;ENSP00000416526:G1938V;ENSP00000287534:G2080V;ENSP00000377697:G1938V	ENSP00000287534:G2080V	G	+	2	0	GPR112	135259959	0.038000	0.19896	0.005000	0.12908	0.090000	0.18270	1.289000	0.33307	1.759000	0.51996	0.509000	0.49947	GGT	GPR112	-	NULL	ENSG00000156920		0.453	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR112	HGNC	protein_coding	OTTHUMT00000286639.1	-	0.00	48	0	G			135432293	+1	tier1	rs150281542	no_errors	ENST00000370652	ensembl	human	known	74_37	missense	20.00	24	6	SNP	0.009	T
GRB10	2887	genome.wustl.edu	37	7	50686896	50686896	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr7:50686896C>T	ENST00000401949.1	-	9	1217	c.748G>A	c.(748-750)Gca>Aca	p.A250T	GRB10_ENST00000439599.1_Missense_Mutation_p.A244T|GRB10_ENST00000407526.1_Missense_Mutation_p.A192T|GRB10_ENST00000398812.2_Missense_Mutation_p.A250T|GRB10_ENST00000402578.1_Missense_Mutation_p.A192T|GRB10_ENST00000335866.3_Missense_Mutation_p.A192T|GRB10_ENST00000398810.2_Missense_Mutation_p.A192T|GRB10_ENST00000403097.1_Missense_Mutation_p.A244T|GRB10_ENST00000402497.1_Missense_Mutation_p.A192T|GRB10_ENST00000357271.5_Missense_Mutation_p.A250T|GRB10_ENST00000406641.1_Missense_Mutation_p.A192T			Q13322	GRB10_HUMAN	growth factor receptor-bound protein 10	250	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of phosphorylation (GO:0042326)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of phosphorylation (GO:0042327)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|response to insulin (GO:0032868)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(19)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	41	Glioma(55;0.08)|all_neural(89;0.245)					TCGTATTTTGCGTAATTCTTC	0.443									Russell-Silver syndrome																																								0													104.0	103.0	104.0					7																	50686896		1895	4120	6015	SO:0001583	missense	0	Familial Cancer Database	Silver-Russell Dwarfism, Silver-Russell syndrome, SRS, Russel-Silver Dwarfism		CCDS43582.1, CCDS43583.1, CCDS47586.1	7p12.2	2013-02-14			ENSG00000106070	ENSG00000106070		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4564	protein-coding gene	gene with protein product		601523					Standard	NM_005311		Approved		uc003tpi.2	Q13322	OTTHUMG00000150622	ENST00000401949.1:c.748G>A	7.37:g.50686896C>T	ENSP00000385770:p.Ala250Thr		A4D258|A7VJ95|A8K0E6|D3DVM9|O00427|O00701|O75222|Q92606|Q92907|Q92948	Missense_Mutation	SNP	pfam_BPS-dom,pfam_SH2,pfam_Ras-assoc,pfam_Pleckstrin_homology,smart_Ras-assoc,smart_Pleckstrin_homology,smart_SH2,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SH2,prints_SH2	p.A250T	ENST00000401949.1	37	c.748	CCDS43582.1	7	.	.	.	.	.	.	.	.	.	.	C	21.1	4.096212	0.76870	.	.	ENSG00000106070	ENST00000398812;ENST00000439599;ENST00000335866;ENST00000398810;ENST00000402578;ENST00000403097;ENST00000406641;ENST00000357271;ENST00000407526;ENST00000401949;ENST00000402497;ENST00000428711	T;T;T;T;T;T;T;T;T;T;T;T	0.75154	-0.91;-0.91;-0.91;-0.91;-0.91;-0.91;-0.91;-0.91;-0.91;-0.91;-0.91;-0.91	5.77	5.77	0.91146	Ras-association (2);	0.047801	0.85682	D	0.000000	D	0.87916	0.6298	M	0.82323	2.585	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.997	D;D;P	0.77004	0.93;0.989;0.875	D	0.88028	0.2773	10	0.56958	D	0.05	-14.1157	19.9837	0.97340	0.0:1.0:0.0:0.0	.	244;250;250	Q13322-4;Q13322-2;Q13322	.;.;GRB10_HUMAN	T	250;244;192;192;192;244;192;250;192;250;192;66	ENSP00000381793:A250T;ENSP00000406716:A244T;ENSP00000338543:A192T;ENSP00000381790:A192T;ENSP00000385189:A192T;ENSP00000385544:A244T;ENSP00000385366:A192T;ENSP00000349818:A250T;ENSP00000385046:A192T;ENSP00000385770:A250T;ENSP00000385748:A192T;ENSP00000410920:A66T	ENSP00000338543:A192T	A	-	1	0	GRB10	50654390	1.000000	0.71417	0.988000	0.46212	0.110000	0.19582	7.818000	0.86416	2.723000	0.93209	0.655000	0.94253	GCA	GRB10	-	smart_Ras-assoc,pfscan_Ras-assoc	ENSG00000106070		0.443	GRB10-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GRB10	HGNC	protein_coding	OTTHUMT00000319157.1		0.00	47	0	C			50686896	-1			no_errors	ENST00000398812	ensembl	human	known	74_37	missense	6.25	30	2	SNP	1.000	T
GSDMC	56169	genome.wustl.edu	37	8	130772830	130772830	+	Missense_Mutation	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr8:130772830G>C	ENST00000276708.4	-	6	1563	c.682C>G	c.(682-684)Ctc>Gtc	p.L228V		NM_031415.2	NP_113603.1	Q9BYG8	GSDMC_HUMAN	gasdermin C	228						cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)				autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|pancreas(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	26						TCTGAGATGAGAATGGCTGAA	0.398																																																	0													103.0	102.0	102.0					8																	130772830		2203	4300	6503	SO:0001583	missense	0			AB042405	CCDS6360.1	8q24.21	2014-05-14	2008-07-31	2008-07-31	ENSG00000147697	ENSG00000147697			7151	protein-coding gene	gene with protein product		608384	"""melanoma-derived leucine zipper, extra-nuclear factor"""	MLZE		17350798	Standard	NM_031415		Approved		uc003ysr.3	Q9BYG8	OTTHUMG00000164851	ENST00000276708.4:c.682C>G	8.37:g.130772830G>C	ENSP00000276708:p.Leu228Val		Q5XKF3|Q6P494	Missense_Mutation	SNP	pfam_Gasdermin	p.L228V	ENST00000276708.4	37	c.682	CCDS6360.1	8	.	.	.	.	.	.	.	.	.	.	G	3.743	-0.053274	0.07362	.	.	ENSG00000147697	ENST00000276708	T	0.25414	1.8	3.66	2.79	0.32731	.	1.507810	0.04295	N	0.346300	T	0.25306	0.0615	L	0.46157	1.445	0.09310	N	1	B	0.25772	0.134	B	0.20767	0.031	T	0.23261	-1.0193	10	0.51188	T	0.08	.	7.1708	0.25717	0.1233:0.0:0.8767:0.0	.	228	Q9BYG8	GSDMC_HUMAN	V	228	ENSP00000276708:L228V	ENSP00000276708:L228V	L	-	1	0	GSDMC	130842012	0.007000	0.16637	0.005000	0.12908	0.002000	0.02628	0.851000	0.27751	1.125000	0.41998	0.585000	0.79938	CTC	GSDMC	-	pfam_Gasdermin	ENSG00000147697		0.398	GSDMC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSDMC	HGNC	protein_coding	OTTHUMT00000380586.1	-	0.00	96	0	G			130772830	-1	tier1	-	no_errors	ENST00000276708	ensembl	human	known	74_37	missense	34.04	62	32	SNP	0.006	C
HIVEP3	59269	genome.wustl.edu	37	1	41979259	41979259	+	Missense_Mutation	SNP	G	G	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr1:41979259G>T	ENST00000372583.1	-	8	6518	c.5633C>A	c.(5632-5634)tCc>tAc	p.S1878Y	HIVEP3_ENST00000247584.5_Missense_Mutation_p.S1878Y|HIVEP3_ENST00000460604.1_5'UTR|HIVEP3_ENST00000429157.2_Missense_Mutation_p.S1878Y|HIVEP3_ENST00000372584.1_Missense_Mutation_p.S1878Y	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	1878					positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				CGCCTCTGAGGATGGTCTGGA	0.652																																																	0													36.0	42.0	40.0					1																	41979259		2203	4300	6503	SO:0001583	missense	0			AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.5633C>A	1.37:g.41979259G>T	ENSP00000361664:p.Ser1878Tyr		A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S1878Y	ENST00000372583.1	37	c.5633	CCDS463.1	1	.	.	.	.	.	.	.	.	.	.	G	14.35	2.509733	0.44660	.	.	ENSG00000127124	ENST00000372584;ENST00000372583;ENST00000247584;ENST00000429157	T;T;T;T	0.07800	3.17;3.16;3.16;3.17	5.52	2.61	0.31194	.	0.807366	0.10767	N	0.636505	T	0.06735	0.0172	N	0.19112	0.55	0.09310	N	1	B;B	0.28998	0.23;0.148	B;B	0.33521	0.165;0.08	T	0.40850	-0.9541	10	0.49607	T	0.09	-3.8841	7.069	0.25167	0.2074:0.133:0.6596:0.0	.	1878;1878	Q5T1R4-2;Q5T1R4	.;ZEP3_HUMAN	Y	1878	ENSP00000361665:S1878Y;ENSP00000361664:S1878Y;ENSP00000247584:S1878Y;ENSP00000410828:S1878Y	ENSP00000247584:S1878Y	S	-	2	0	HIVEP3	41751846	0.368000	0.25031	0.019000	0.16419	0.867000	0.49689	1.829000	0.39121	0.676000	0.31285	0.655000	0.94253	TCC	HIVEP3	-	NULL	ENSG00000127124		0.652	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HIVEP3	HGNC	protein_coding	OTTHUMT00000016978.1	-	0.00	42	0	G	NM_024503		41979259	-1	tier1	-	no_errors	ENST00000247584	ensembl	human	known	74_37	missense	10.26	35	4	SNP	0.005	T
HOOK2	29911	genome.wustl.edu	37	19	12876825	12876825	+	Silent	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr19:12876825C>G	ENST00000397668.3	-	16	1588	c.1515G>C	c.(1513-1515)ctG>ctC	p.L505L	HOOK2_ENST00000589965.1_Intron|HOOK2_ENST00000264827.5_Silent_p.L505L	NM_013312.2	NP_037444.2	Q96ED9	HOOK2_HUMAN	hook microtubule-tethering protein 2	505	Sufficient for interaction with microtubules.				early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	centrosome (GO:0005813)|FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)	p.L505L(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(5)|skin(1)	20						GCTGCTGGTTCAGCCTGCGAG	0.672											OREG0025273	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - coding silent(1)	breast(1)											40.0	47.0	44.0					19																	12876825		1983	4156	6139	SO:0001819	synonymous_variant	0			AF044924	CCDS42507.1, CCDS42508.1	19p13.2	2013-08-21	2013-08-21						19885	protein-coding gene	gene with protein product		607824	"""hook homolog 2 (Drosophila)"""			9927460	Standard	NM_013312		Approved	HK2	uc002muy.2	Q96ED9		ENST00000397668.3:c.1515G>C	19.37:g.12876825C>G		683	O60562	Silent	SNP	pfam_Hook-related_fam,superfamily_UBA-like	p.L505	ENST00000397668.3	37	c.1515	CCDS42508.1	19																																																																																			HOOK2	-	pfam_Hook-related_fam,superfamily_UBA-like	ENSG00000095066		0.672	HOOK2-002	KNOWN	basic|CCDS	protein_coding	HOOK2	HGNC	protein_coding	OTTHUMT00000451008.1		0.00	35	0	C	NM_013312		12876825	-1			no_errors	ENST00000397668	ensembl	human	known	74_37	silent	6.25	30	2	SNP	1.000	G
HUWE1	10075	genome.wustl.edu	37	X	53575129	53575129	+	Missense_Mutation	SNP	T	T	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chrX:53575129T>C	ENST00000342160.3	-	67	10598	c.10141A>G	c.(10141-10143)Agc>Ggc	p.S3381G	HUWE1_ENST00000474288.1_5'Flank|HUWE1_ENST00000262854.6_Missense_Mutation_p.S3381G			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	3381					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						ATGCCACTGCTGGAGGACTGT	0.517																																																	0													63.0	43.0	50.0					X																	53575129		2203	4300	6503	SO:0001583	missense	0			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.10141A>G	X.37:g.53575129T>C	ENSP00000340648:p.Ser3381Gly		O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	pfam_E3_Ub_ligase_DUF913,pfam_HECT,pfam_E3_Ub_ligase_DUF908,pfam_WWE-dom,pfam_UBA/Ts_N,superfamily_HECT,superfamily_UBA-like,superfamily_ARM-type_fold,smart_UBA/transl_elong_EF1B_N_euk,smart_HECT,pfscan_HECT,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_WWE-dom	p.S3381G	ENST00000342160.3	37	c.10141	CCDS35301.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	4.839|4.839	0.156032|0.156032	0.09236|0.09236	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000427052;ENST00000426907|ENST00000342160;ENST00000262854	.|T;T	.|0.39592	.|1.07;1.07	5.75|5.75	4.58|4.58	0.56647|0.56647	.|.	.|1.198660	.|0.05797	.|N	.|0.611488	T|T	0.40015|0.40015	0.1100|0.1100	L|L	0.44542|0.44542	1.39|1.39	0.24403|0.24403	N|N	0.994698|0.994698	.|B;B	.|0.13594	.|0.008;0.0	.|B;B	.|0.14578	.|0.011;0.0	T|T	0.33266|0.33266	-0.9875|-0.9875	5|10	.|0.44086	.|T	.|0.13	.|.	9.9805|9.9805	0.41811|0.41811	0.0:0.0816:0.0:0.9184|0.0:0.0816:0.0:0.9184	.|.	.|3381;3365	.|Q7Z6Z7;Q7Z6Z7-2	.|HUWE1_HUMAN;.	R|G	2414;218|3381	.|ENSP00000340648:S3381G;ENSP00000262854:S3381G	.|ENSP00000262854:S3381G	Q|S	-|-	2|1	0|0	HUWE1|HUWE1	53591854|53591854	0.976000|0.976000	0.34144|0.34144	0.866000|0.866000	0.34008|0.34008	0.666000|0.666000	0.39218|0.39218	1.743000|1.743000	0.38258|0.38258	0.811000|0.811000	0.34303|0.34303	0.430000|0.430000	0.28490|0.28490	CAG|AGC	HUWE1	-	NULL	ENSG00000086758		0.517	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	HGNC	protein_coding	OTTHUMT00000056766.1	-	0.00	50	0	T	XM_497119		53575129	-1	tier1	-	no_errors	ENST00000262854	ensembl	human	known	74_37	missense	20.00	24	6	SNP	0.415	C
IBSP	3381	genome.wustl.edu	37	4	88732910	88732910	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr4:88732910G>A	ENST00000226284.5	+	7	869	c.802G>A	c.(802-804)Gcc>Acc	p.A268T		NM_004967.3	NP_004958.2	P21815	SIAL_HUMAN	integrin-binding sialoprotein	268			A -> V (in dbSNP:rs1054628). {ECO:0000269|PubMed:2404984}.		biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|cellular response to growth factor stimulus (GO:0071363)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|membrane-bounded vesicle (GO:0031988)				breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(10)	21		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000333)|COAD - Colon adenocarcinoma(81;0.154)		ATACACGGGCGCCAATGAATA	0.468																																																	0													66.0	61.0	63.0					4																	88732910		2203	4300	6503	SO:0001583	missense	0				CCDS3624.1	4q21.1	2008-07-28	2008-07-28		ENSG00000029559	ENSG00000029559			5341	protein-coding gene	gene with protein product	"""bone sialoprotein"", ""bone sialoprotein II"""	147563				8406493	Standard	NM_004967		Approved	BSP, SP-II, BSP-II	uc003hqx.4	P21815	OTTHUMG00000130600	ENST00000226284.5:c.802G>A	4.37:g.88732910G>A	ENSP00000226284:p.Ala268Thr			Missense_Mutation	SNP	pfam_BSP_II	p.A268T	ENST00000226284.5	37	c.802	CCDS3624.1	4	.	.	.	.	.	.	.	.	.	.	G	1.378	-0.584140	0.03827	.	.	ENSG00000029559	ENST00000226284	T	0.12879	2.64	5.36	4.1	0.47936	.	0.644144	0.15037	N	0.284091	T	0.03136	0.0092	N	0.00521	-1.4	0.21290	N	0.999732	B	0.02656	0.0	B	0.01281	0.0	T	0.40251	-0.9573	10	0.06365	T	0.9	.	7.9599	0.30066	0.8322:0.0:0.1678:0.0	.	268	P21815	SIAL_HUMAN	T	268	ENSP00000226284:A268T	ENSP00000226284:A268T	A	+	1	0	IBSP	88951934	0.020000	0.18652	0.979000	0.43373	0.596000	0.36781	0.561000	0.23515	0.866000	0.35629	-0.423000	0.05987	GCC	IBSP	-	pfam_BSP_II	ENSG00000029559		0.468	IBSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IBSP	HGNC	protein_coding	OTTHUMT00000253050.2	-	0.00	9	0	G			88732910	+1	tier1	-	no_errors	ENST00000226284	ensembl	human	known	74_37	missense	30.77	9	4	SNP	0.878	A
IBTK	25998	genome.wustl.edu	37	6	82924304	82924304	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr6:82924304C>T	ENST00000306270.7	-	12	2393	c.1844G>A	c.(1843-1845)tGc>tAc	p.C615Y	IBTK_ENST00000503631.1_Intron|IBTK_ENST00000510291.1_Missense_Mutation_p.C615Y	NM_015525.2	NP_056340.2	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton agammaglobulinemia tyrosine kinase	615	BTB 1. {ECO:0000255|PROSITE- ProRule:PRU00037}.				negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein tyrosine kinase activity (GO:0061099)|release of sequestered calcium ion into cytosol (GO:0051209)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine kinase inhibitor activity (GO:0030292)			central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(10)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	54		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		AAAGAGATGGCACCCTGCAGA	0.338																																																	0													46.0	45.0	46.0					6																	82924304		2203	4300	6503	SO:0001583	missense	0			AF235049	CCDS34490.1, CCDS75486.1	6q14.3	2013-01-10	2003-10-06	2003-10-08	ENSG00000005700	ENSG00000005700		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	17853	protein-coding gene	gene with protein product		606457	"""Bruton agammaglobulinemia tyrosine kinase inhibitor"""	BTKI		11577348	Standard	XM_006715453		Approved	DKFZP564B116, BTBD26	uc003pjl.1	Q9P2D0	OTTHUMG00000015102	ENST00000306270.7:c.1844G>A	6.37:g.82924304C>T	ENSP00000305721:p.Cys615Tyr		Q2QKU2|Q2QKU3|Q2QKU4|Q5TFD7|Q5TFD9|Q8IUQ9|Q8IUY7|Q8TAI4|Q9HBI8|Q9Y3T8	Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_BTB_POZ,pfam_Ankyrin_rpt,superfamily_RCC1/BLIP-II,superfamily_BTB/POZ_fold,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_BTB/POZ-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BTB/POZ-like,pfscan_Reg_chr_condens	p.C615Y	ENST00000306270.7	37	c.1844	CCDS34490.1	6	.	.	.	.	.	.	.	.	.	.	C	21.8	4.196910	0.79015	.	.	ENSG00000005700	ENST00000306270;ENST00000510291	T;T	0.24350	1.86;1.86	5.71	5.71	0.89125	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.041945	0.85682	D	0.000000	T	0.37598	0.1009	M	0.77103	2.36	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.998	D;D;D	0.72075	0.976;0.957;0.976	T	0.39901	-0.9591	10	0.02654	T	1	-5.9165	19.8632	0.96793	0.0:1.0:0.0:0.0	.	615;615;615	E7EPI0;Q9P2D0-2;Q9P2D0	.;.;IBTK_HUMAN	Y	615	ENSP00000305721:C615Y;ENSP00000426405:C615Y	ENSP00000305721:C615Y	C	-	2	0	IBTK	82981023	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.487000	0.81328	2.699000	0.92147	0.655000	0.94253	TGC	IBTK	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	ENSG00000005700		0.338	IBTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IBTK	HGNC	protein_coding	OTTHUMT00000041337.2		0.00	60	0	C	NM_015525		82924304	-1			no_errors	ENST00000306270	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	T
IFIT3	3437	genome.wustl.edu	37	10	91099326	91099326	+	Missense_Mutation	SNP	A	A	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr10:91099326A>G	ENST00000371818.4	+	2	1094	c.914A>G	c.(913-915)gAg>gGg	p.E305G	LIPA_ENST00000487618.1_Intron|IFIT3_ENST00000371811.4_Missense_Mutation_p.E305G|LIPA_ENST00000371837.1_Intron	NM_001549.4	NP_001540.2	O14879	IFIT3_HUMAN	interferon-induced protein with tetratricopeptide repeats 3	305					cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	identical protein binding (GO:0042802)			breast(1)|central_nervous_system(3)|endometrium(1)|large_intestine(4)|lung(3)|skin(2)|urinary_tract(1)	15						GGAAATAAAGAGATGATTGAA	0.418																																																	0													81.0	73.0	76.0					10																	91099326		2203	4300	6503	SO:0001583	missense	0			U52513	CCDS7402.1, CCDS31241.1	10q23.31	2014-05-22	2004-07-16	2004-07-16	ENSG00000119917	ENSG00000119917		"""Tetratricopeptide (TTC) repeat domain containing"""	5411	protein-coding gene	gene with protein product		604650	"""interferon-induced protein with tetratricopeptide repeats 4"""	IFIT4		9828129, 9391139	Standard	NM_001031683		Approved	ISG60, RIG-G, CIG-49, IFI60, GARG-49, IRG2	uc001kgg.3	O14879	OTTHUMG00000018708	ENST00000371818.4:c.914A>G	10.37:g.91099326A>G	ENSP00000360883:p.Glu305Gly		Q99634|Q9BSK7	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E305G	ENST00000371818.4	37	c.914	CCDS7402.1	10	.	.	.	.	.	.	.	.	.	.	A	16.37	3.103413	0.56291	.	.	ENSG00000119917	ENST00000371818;ENST00000371811;ENST00000543062	T;T	0.14391	2.51;2.51	4.28	4.28	0.50868	Tetratricopeptide-like helical (1);	0.650217	0.13988	N	0.349033	T	0.25938	0.0632	M	0.71206	2.165	0.09310	N	1	P	0.40066	0.701	P	0.49637	0.617	T	0.08848	-1.0702	10	0.72032	D	0.01	-2.7629	8.291	0.31958	0.9102:0.0:0.0898:0.0	.	305	O14879	IFIT3_HUMAN	G	305;305;126	ENSP00000360883:E305G;ENSP00000360876:E305G	ENSP00000360876:E305G	E	+	2	0	IFIT3	91089306	0.868000	0.29978	0.069000	0.20011	0.276000	0.26787	2.400000	0.44504	2.167000	0.68274	0.529000	0.55759	GAG	IFIT3	-	NULL	ENSG00000119917		0.418	IFIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFIT3	HGNC	protein_coding	OTTHUMT00000049294.1	-	0.00	16	0	A	NM_001549		91099326	+1	tier1	-	no_errors	ENST00000371811	ensembl	human	known	74_37	missense	45.83	13	11	SNP	0.031	G
IKBIP	121457	genome.wustl.edu	37	12	99020063	99020063	+	Intron	SNP	G	G	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr12:99020063G>T	ENST00000342502.2	-	2	709				IKBIP_ENST00000299157.4_Missense_Mutation_p.S260Y|IKBIP_ENST00000420861.1_Intron|IKBIP_ENST00000393042.3_Intron	NM_201612.2	NP_963906.1	Q70UQ0	IKIP_HUMAN	IKBKB interacting protein						response to X-ray (GO:0010165)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|kidney(1)|large_intestine(1)|lung(1)|prostate(2)	6						TTCGTAGTCGGAAAGTTTATT	0.418																																																	0													131.0	129.0	130.0					12																	99020063		2203	4300	6503	SO:0001627	intron_variant	0			AJ539425	CCDS9067.1, CCDS9068.1, CCDS41822.1	12q23.1	2010-02-17			ENSG00000166130	ENSG00000166130			26430	protein-coding gene	gene with protein product	"""I kappa B kinase interacting protein"""	609861				15389287	Standard	NM_153687		Approved	FLJ31051, IKIP	uc001tfx.4	Q70UQ0	OTTHUMG00000170213	ENST00000342502.2:c.297+8010C>A	12.37:g.99020063G>T			Q6ZWH4|Q70UP9|Q86V91|Q96ND2	Missense_Mutation	SNP	NULL	p.S260Y	ENST00000342502.2	37	c.779	CCDS9067.1	12	.	.	.	.	.	.	.	.	.	.	G	18.26	3.584696	0.65992	.	.	ENSG00000166130	ENST00000299157	T	0.47869	0.83	5.53	5.53	0.82687	.	1.060040	0.07180	N	0.853912	T	0.65112	0.2660	.	.	.	0.80722	D	1	D	0.59767	0.986	P	0.54100	0.742	T	0.59621	-0.7420	9	0.46703	T	0.11	-4.5578	19.4344	0.94785	0.0:0.0:1.0:0.0	.	260	Q70UQ0-4	.	Y	260	ENSP00000299157:S260Y	ENSP00000299157:S260Y	S	-	2	0	IKBIP	97544194	0.981000	0.34729	0.944000	0.38274	0.862000	0.49288	5.077000	0.64419	2.592000	0.87571	0.650000	0.86243	TCC	IKBIP	-	NULL	ENSG00000166130		0.418	IKBIP-003	KNOWN	basic|CCDS	protein_coding	IKBIP	HGNC	protein_coding	OTTHUMT00000408003.2	-	0.00	30	0	G	NM_153687		99020063	-1	tier1	-	no_errors	ENST00000299157	ensembl	human	known	74_37	missense	13.04	20	3	SNP	0.666	T
IKBKAP	8518	genome.wustl.edu	37	9	111659447	111659447	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr9:111659447C>G	ENST00000374647.5	-	23	2789	c.2482G>C	c.(2482-2484)Gag>Cag	p.E828Q	IKBKAP_ENST00000537196.1_Missense_Mutation_p.E479Q	NM_003640.3	NP_003631.2	O95163	ELP1_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein	828					chromatin organization (GO:0006325)|immune response (GO:0006955)|positive regulation of cell migration (GO:0030335)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|nucleolus (GO:0005730)|transcription elongation factor complex (GO:0008023)	phosphorylase kinase regulator activity (GO:0008607)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						TTTATGCTCTCCATGACTGCT	0.473																																																	0													218.0	177.0	191.0					9																	111659447		2203	4300	6503	SO:0001583	missense	0			AF044195	CCDS6773.1	9q31	2014-09-17	2003-12-02		ENSG00000070061	ENSG00000070061		"""Elongator acetyltransferase complex subunits"""	5959	protein-coding gene	gene with protein product	"""elongator acetyltransferase complex subunit 1"""	603722	"""dysautonomia (Riley-Day syndrome, hereditary sensory autonomic neuropathy type III)"""	DYS		9751059, 11179008	Standard	NM_003640		Approved	IKAP, TOT1, ELP1, IKI3	uc004bdm.4	O95163	OTTHUMG00000020465	ENST00000374647.5:c.2482G>C	9.37:g.111659447C>G	ENSP00000363779:p.Glu828Gln		Q5JSV2|Q9H327|Q9UG87	Missense_Mutation	SNP	pfam_IKI3,superfamily_ARM-type_fold,superfamily_UBA-like,pirsf_IKI3	p.E828Q	ENST00000374647.5	37	c.2482	CCDS6773.1	9	.	.	.	.	.	.	.	.	.	.	C	14.97	2.695590	0.48202	.	.	ENSG00000070061	ENST00000374647;ENST00000537196	T;T	0.29917	1.55;1.55	5.35	4.39	0.52855	.	0.110120	0.64402	D	0.000009	T	0.28466	0.0704	L	0.33753	1.03	0.38324	D	0.943605	P	0.42908	0.793	P	0.46452	0.517	T	0.03017	-1.1082	10	0.16896	T	0.51	-22.7329	13.5597	0.61782	0.0:0.8026:0.1974:0.0	.	828	O95163	ELP1_HUMAN	Q	828;479	ENSP00000363779:E828Q;ENSP00000439367:E479Q	ENSP00000363779:E828Q	E	-	1	0	IKBKAP	110699268	1.000000	0.71417	1.000000	0.80357	0.673000	0.39480	4.438000	0.59961	2.660000	0.90430	0.467000	0.42956	GAG	IKBKAP	-	pfam_IKI3,pirsf_IKI3	ENSG00000070061		0.473	IKBKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IKBKAP	HGNC	protein_coding	OTTHUMT00000053574.1	-	0.00	46	0	C			111659447	-1	tier1	-	no_errors	ENST00000374647	ensembl	human	known	74_37	missense	26.79	41	15	SNP	1.000	G
IKBKAP	8518	genome.wustl.edu	37	9	111670649	111670649	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr9:111670649C>G	ENST00000374647.5	-	13	1703	c.1396G>C	c.(1396-1398)Gga>Cga	p.G466R	IKBKAP_ENST00000537196.1_Missense_Mutation_p.G117R	NM_003640.3	NP_003631.2	O95163	ELP1_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein	466					chromatin organization (GO:0006325)|immune response (GO:0006955)|positive regulation of cell migration (GO:0030335)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|nucleolus (GO:0005730)|transcription elongation factor complex (GO:0008023)	phosphorylase kinase regulator activity (GO:0008607)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						CCCACAGCTCCCAGTTTCACT	0.383																																																	0													71.0	71.0	71.0					9																	111670649		2203	4300	6503	SO:0001583	missense	0			AF044195	CCDS6773.1	9q31	2014-09-17	2003-12-02		ENSG00000070061	ENSG00000070061		"""Elongator acetyltransferase complex subunits"""	5959	protein-coding gene	gene with protein product	"""elongator acetyltransferase complex subunit 1"""	603722	"""dysautonomia (Riley-Day syndrome, hereditary sensory autonomic neuropathy type III)"""	DYS		9751059, 11179008	Standard	NM_003640		Approved	IKAP, TOT1, ELP1, IKI3	uc004bdm.4	O95163	OTTHUMG00000020465	ENST00000374647.5:c.1396G>C	9.37:g.111670649C>G	ENSP00000363779:p.Gly466Arg		Q5JSV2|Q9H327|Q9UG87	Missense_Mutation	SNP	pfam_IKI3,superfamily_ARM-type_fold,superfamily_UBA-like,pirsf_IKI3	p.G466R	ENST00000374647.5	37	c.1396	CCDS6773.1	9	.	.	.	.	.	.	.	.	.	.	C	22.1	4.238962	0.79800	.	.	ENSG00000070061	ENST00000374647;ENST00000537196	T;T	0.26810	2.1;1.71	5.56	5.56	0.83823	.	0.241812	0.42420	D	0.000711	T	0.30070	0.0753	M	0.70595	2.14	0.39036	D	0.960048	B	0.31209	0.313	B	0.30105	0.111	T	0.12091	-1.0561	10	0.16896	T	0.51	-17.9115	17.0215	0.86435	0.0:1.0:0.0:0.0	.	466	O95163	ELP1_HUMAN	R	466;117	ENSP00000363779:G466R;ENSP00000439367:G117R	ENSP00000363779:G466R	G	-	1	0	IKBKAP	110710470	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.327000	0.65881	2.605000	0.88082	0.655000	0.94253	GGA	IKBKAP	-	pfam_IKI3,pirsf_IKI3	ENSG00000070061		0.383	IKBKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IKBKAP	HGNC	protein_coding	OTTHUMT00000053574.1	-	0.00	37	0	C			111670649	-1	tier1	-	no_errors	ENST00000374647	ensembl	human	known	74_37	missense	67.50	13	27	SNP	1.000	G
IL1R1	3554	genome.wustl.edu	37	2	102781461	102781461	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr2:102781461G>A	ENST00000410023.1	+	4	607	c.289G>A	c.(289-291)Gtg>Atg	p.V97M	IL1R1_ENST00000233946.3_Missense_Mutation_p.V97M|IL1R1_ENST00000409329.1_Missense_Mutation_p.V97M|IL1R1_ENST00000424272.1_Missense_Mutation_p.V97M|IL1R1_ENST00000409288.1_Missense_Mutation_p.V97M|IL1R1_ENST00000409929.1_Missense_Mutation_p.V97M|IL1R1_ENST00000409589.1_Missense_Mutation_p.V97M			P14778	IL1R1_HUMAN	interleukin 1 receptor, type I	97	Ig-like C2-type 1.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|interleukin-1-mediated signaling pathway (GO:0070498)|regulation of inflammatory response (GO:0050727)|response to interleukin-1 (GO:0070555)	cell surface (GO:0009986)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type I, activating receptor activity (GO:0004909)|platelet-derived growth factor receptor binding (GO:0005161)|signal transducer activity (GO:0004871)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|prostate(2)|skin(3)	19					Anakinra(DB00026)	TTACTATTGCGTGGTAAGGTA	0.373																																																	0													102.0	93.0	96.0					2																	102781461		2203	4300	6503	SO:0001583	missense	0			M27492	CCDS2055.1, CCDS74547.1	2q12	2013-01-29			ENSG00000115594	ENSG00000115594		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5993	protein-coding gene	gene with protein product		147810		IL1R, IL1RA		1833184, 10191101	Standard	XM_005263929		Approved	D2S1473, CD121A	uc002tbr.3	P14778	OTTHUMG00000130783	ENST00000410023.1:c.289G>A	2.37:g.102781461G>A	ENSP00000386380:p.Val97Met		Q587I7	Missense_Mutation	SNP	pfam_TIR_dom,pfam_Ig_I-set,superfamily_TIR_dom,smart_Ig_sub,smart_TIR_dom,pfscan_TIR_dom,pfscan_Ig-like_dom,prints_IL-1_rcpt_I-typ,prints_IL-1_rcpt_I/II-typ	p.V97M	ENST00000410023.1	37	c.289	CCDS2055.1	2	.	.	.	.	.	.	.	.	.	.	G	12.66	2.004920	0.35415	.	.	ENSG00000115594	ENST00000409929;ENST00000424272;ENST00000409589;ENST00000409329;ENST00000450319;ENST00000442590;ENST00000409288;ENST00000410023;ENST00000233946;ENST00000430171	T;T;T;T;T;T;T;T;T;T	0.68765	-0.35;-0.35;0.35;-0.35;-0.35;0.35;-0.35;-0.35;-0.35;0.35	5.63	-2.16	0.07080	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.973700	0.01746	N	0.029656	T	0.72439	0.3460	L	0.47016	1.485	0.09310	N	1	D;D;D	0.89917	1.0;0.998;1.0	D;P;P	0.67725	0.953;0.749;0.84	T	0.58244	-0.7670	9	.	.	.	.	3.8982	0.09149	0.2871:0.0:0.3591:0.3538	.	97;97;97	B8ZZW4;P14778;B8ZZ73	.;IL1R1_HUMAN;.	M	97	ENSP00000386776:V97M;ENSP00000415366:V97M;ENSP00000386555:V97M;ENSP00000387131:V97M;ENSP00000411627:V97M;ENSP00000393296:V97M;ENSP00000386478:V97M;ENSP00000386380:V97M;ENSP00000233946:V97M;ENSP00000408101:V97M	.	V	+	1	0	IL1R1	102147893	0.000000	0.05858	0.000000	0.03702	0.184000	0.23303	-0.916000	0.04029	-0.676000	0.05238	0.655000	0.94253	GTG	IL1R1	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom,prints_IL-1_rcpt_I/II-typ	ENSG00000115594		0.373	IL1R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1R1	HGNC	protein_coding	OTTHUMT00000253299.1	-	0.00	84	0	G			102781461	+1	tier1	-	no_errors	ENST00000233946	ensembl	human	known	74_37	missense	30.00	56	24	SNP	0.003	A
INPP4B	8821	genome.wustl.edu	37	4	143159120	143159120	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr4:143159120C>T	ENST00000513000.1	-	13	1166	c.733G>A	c.(733-735)Gac>Aac	p.D245N	INPP4B_ENST00000509777.1_Missense_Mutation_p.D245N|INPP4B_ENST00000308502.4_Missense_Mutation_p.D245N|INPP4B_ENST00000262992.4_Missense_Mutation_p.D245N|INPP4B_ENST00000508116.1_Missense_Mutation_p.D245N	NM_003866.2	NP_003857.2	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II, 105kDa	245					cellular calcium ion homeostasis (GO:0006874)|inositol phosphate metabolic process (GO:0043647)|negative regulation of osteoclast differentiation (GO:0045671)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of bone remodeling (GO:0046850)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of protein kinase B signaling (GO:0051896)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	lipid binding (GO:0008289)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)|phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(29)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58	all_hematologic(180;0.158)					CACTTATTGTCAGATGTGGGA	0.328																																																	0													47.0	46.0	46.0					4																	143159120		2201	4298	6499	SO:0001583	missense	0			U96922	CCDS3757.1	4q31.1	2008-02-05	2002-08-29			ENSG00000109452			6075	protein-coding gene	gene with protein product		607494	"""inositol polyphosphate-4-phosphatase, type II, 105kD"""			9295334	Standard	NM_003866		Approved		uc003iiw.4	O15327		ENST00000513000.1:c.733G>A	4.37:g.143159120C>T	ENSP00000425487:p.Asp245Asn		Q2TAI2|Q5XLE7|Q6IN59|Q6PJB4	Missense_Mutation	SNP	superfamily_C2_dom	p.D245N	ENST00000513000.1	37	c.733	CCDS3757.1	4	.	.	.	.	.	.	.	.	.	.	C	19.38	3.815670	0.70912	.	.	ENSG00000109452	ENST00000513000;ENST00000262992;ENST00000308502;ENST00000543161;ENST00000508116;ENST00000509777;ENST00000511838;ENST00000542702;ENST00000510812;ENST00000514525	T;T;T;T;T;T;T;T	0.39406	1.08;1.08;1.08;1.08;1.08;1.08;1.08;1.08	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.43500	0.1250	L	0.53249	1.67	0.80722	D	1	B;B	0.33288	0.031;0.406	B;B	0.36504	0.016;0.226	T	0.21759	-1.0236	10	0.15952	T	0.53	.	19.7273	0.96170	0.0:1.0:0.0:0.0	.	116;245	B7Z6T2;O15327	.;INP4B_HUMAN	N	245;245;245;116;245;245;60;60;245;116	ENSP00000425487:D245N;ENSP00000262992:D245N;ENSP00000308441:D245N;ENSP00000423954:D245N;ENSP00000422793:D245N;ENSP00000426207:D60N;ENSP00000427250:D245N;ENSP00000421065:D116N	ENSP00000262992:D245N	D	-	1	0	INPP4B	143378570	1.000000	0.71417	1.000000	0.80357	0.778000	0.44026	7.251000	0.78297	2.718000	0.92993	0.655000	0.94253	GAC	INPP4B	-	NULL	ENSG00000109452		0.328	INPP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INPP4B	HGNC	protein_coding	OTTHUMT00000364587.1	-	0.00	45	0	C	NM_003866		143159120	-1	tier1	-	no_errors	ENST00000509777	ensembl	human	known	74_37	missense	42.86	32	24	SNP	1.000	T
ITCH	83737	genome.wustl.edu	37	20	33049899	33049899	+	Splice_Site	SNP	C	C	T	rs372589721		TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr20:33049899C>T	ENST00000262650.6	+	15	1556	c.1420C>T	c.(1420-1422)Caa>Taa	p.Q474*	ITCH_ENST00000483727.1_3'UTR|ITCH_ENST00000535650.1_Splice_Site_p.Q323*|ITCH_ENST00000374864.4_Splice_Site_p.Q433*			Q96J02	ITCH_HUMAN	itchy E3 ubiquitin protein ligase	474					apoptotic process (GO:0006915)|defense response to virus (GO:0051607)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of defense response to virus (GO:0050687)|negative regulation of JNK cascade (GO:0046329)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|protein K29-linked ubiquitination (GO:0035519)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of cell growth (GO:0001558)|regulation of protein deubiquitination (GO:0090085)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	CXCR chemokine receptor binding (GO:0045236)|ligase activity (GO:0016874)|ribonucleoprotein complex binding (GO:0043021)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(9)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(13)|skin(1)|upper_aerodigestive_tract(1)	36						GTTTCGTAGTCAATTAAATGA	0.338																																																	0													73.0	74.0	74.0					20																	33049899		2203	4300	6503	SO:0001630	splice_region_variant	0			AF095745	CCDS13234.1, CCDS58768.1, CCDS58769.1	20q11.22	2014-09-17	2012-02-23		ENSG00000078747	ENSG00000078747			13890	protein-coding gene	gene with protein product		606409	"""itchy (mouse homolog) E3 ubiquitin protein ligase"", ""itchy E3 ubiquitin protein ligase homolog (mouse)"""			11318614	Standard	NM_001257137		Approved	AIP4	uc010geu.2	Q96J02	OTTHUMG00000032300	ENST00000262650.6:c.1419-1C>T	20.37:g.33049899C>T			A6NEW4|B4E234|E1P5P3|F5H217|O43584|Q5QP37|Q5TEL0|Q96F66|Q9BY75|Q9H451|Q9H4U5	Nonsense_Mutation	SNP	pfam_HECT,pfam_WW_dom,pfam_C2_dom,superfamily_HECT,superfamily_C2_dom,superfamily_WW_dom,smart_C2_dom,smart_WW_dom,smart_HECT,pfscan_HECT,pfscan_C2_dom,pfscan_WW_dom	p.Q474*	ENST00000262650.6	37	c.1420	CCDS58768.1	20	.	.	.	.	.	.	.	.	.	.	C	38	7.259659	0.98171	.	.	ENSG00000078747	ENST00000374864;ENST00000535650;ENST00000262650	.	.	.	5.7	5.7	0.88788	.	0.321128	0.33040	N	0.005348	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	.	19.4391	0.94811	0.0:1.0:0.0:0.0	.	.	.	.	X	433;323;474	.	ENSP00000262650:Q474X	Q	+	1	0	ITCH	32513560	0.997000	0.39634	1.000000	0.80357	0.942000	0.58702	3.220000	0.51207	2.690000	0.91761	0.650000	0.86243	CAA	ITCH	-	NULL	ENSG00000078747		0.338	ITCH-002	KNOWN	basic|CCDS	protein_coding	ITCH	HGNC	protein_coding	OTTHUMT00000078783.2	-	0.00	67	0	C		Nonsense_Mutation	33049899	+1	tier1	-	no_errors	ENST00000262650	ensembl	human	known	74_37	nonsense	8.64	74	7	SNP	1.000	T
JAKMIP2	9832	genome.wustl.edu	37	5	147011063	147011064	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	TC	TC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr5:147011063_147011064delTC	ENST00000265272.5	-	14	2254_2255	c.1787_1788delGA	c.(1786-1788)agafs	p.R597fs	JAKMIP2_ENST00000333010.6_Frame_Shift_Del_p.R555fs|JAKMIP2_ENST00000507386.1_Frame_Shift_Del_p.R576fs	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2	597						Golgi apparatus (GO:0005794)		p.E595fs*17(1)		NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGGGGATCGTCTCTCTCTCTC	0.371																																																	1	Deletion - Frameshift(1)	breast(1)																																								SO:0001589	frameshift_variant	0			AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.1787_1788delGA	5.37:g.147011073_147011074delTC	ENSP00000265272:p.Arg597fs		A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Frame_Shift_Del	DEL	NULL	p.R596fs	ENST00000265272.5	37	c.1788_1787	CCDS4285.1	5																																																																																			JAKMIP2	-	NULL	ENSG00000176049		0.371	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JAKMIP2	HGNC	protein_coding	OTTHUMT00000251941.1		0.00	36	0	TC	NM_014790		147011064	-1	tier1		no_errors	ENST00000265272	ensembl	human	known	74_37	frame_shift_del	8.00	23	2	DEL	1.000:1.000	-
KCNU1	157855	genome.wustl.edu	37	8	36788577	36788577	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr8:36788577G>A	ENST00000399881.3	+	25	2882	c.2845G>A	c.(2845-2847)Gat>Aat	p.D949N	KCNU1_ENST00000518904.1_3'UTR	NM_001031836.2	NP_001027006.2	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	949					multicellular organism reproduction (GO:0032504)|potassium ion transmembrane transport (GO:0071805)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	large conductance calcium-activated potassium channel activity (GO:0060072)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(31)|ovary(1)|urinary_tract(1)	57				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		TGGTGTGGCAGATAGCTGCAC	0.443																																																	0													127.0	122.0	123.0					8																	36788577		1930	4142	6072	SO:0001583	missense	0			BC028701	CCDS55220.1	8p11.2	2012-07-05				ENSG00000215262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18867	protein-coding gene	gene with protein product		615215				16382103	Standard	NM_001031836		Approved	KCa5.1, Slo3, KCNMC1, Kcnma3	uc010lvw.3	A8MYU2		ENST00000399881.3:c.2845G>A	8.37:g.36788577G>A	ENSP00000382770:p.Asp949Asn			Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_2pore_dom_K_chnl_dom,prints_K_chnl_Ca-activ_BK_asu	p.D949N	ENST00000399881.3	37	c.2845	CCDS55220.1	8	.	.	.	.	.	.	.	.	.	.	G	11.36	1.616724	0.28801	.	.	ENSG00000215262	ENST00000399881	T	0.30981	1.51	5.41	-1.82	0.07857	.	3.026090	0.02524	U	0.092907	T	0.26448	0.0646	L	0.44542	1.39	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.19451	-1.0305	10	0.44086	T	0.13	-2.9268	6.1612	0.20366	0.4453:0.1313:0.4234:0.0	.	949	A8MYU2	KCNU1_HUMAN	N	949	ENSP00000382770:D949N	ENSP00000382770:D949N	D	+	1	0	KCNU1	36907735	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.126000	0.10563	-0.809000	0.04381	0.650000	0.86243	GAT	KCNU1	-	NULL	ENSG00000215262		0.443	KCNU1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	KCNU1	HGNC	protein_coding	OTTHUMT00000376631.1		0.00	73	0	G	NM_001031836		36788577	+1			no_errors	ENST00000399881	ensembl	human	known	74_37	missense	5.26	54	3	SNP	0.000	A
KCTD15	79047	genome.wustl.edu	37	19	34304803	34304803	+	3'UTR	SNP	C	C	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr19:34304803C>A	ENST00000430256.3	+	0	2210				KCTD15_ENST00000284006.6_3'UTR|KCTD15_ENST00000592363.1_3'UTR			Q96SI1	KCD15_HUMAN	potassium channel tetramerization domain containing 15						multicellular organismal development (GO:0007275)|protein homooligomerization (GO:0051260)					endometrium(1)|lung(2)|pancreas(1)|urinary_tract(1)	5	Esophageal squamous(110;0.162)					CGTTGTTACACTAGCCTGCCG	0.562																																					Melanoma(36;646 1094 5145 14504 45302)|GBM(25;193 541 1518 14388 52178)												0																																										SO:0001624	3_prime_UTR_variant	0			AK025590	CCDS12434.1, CCDS46039.1	19q13.12	2013-06-20	2013-06-20			ENSG00000153885			23297	protein-coding gene	gene with protein product		615240	"""potassium channel tetramerisation domain containing 15"""			12477932	Standard	NM_024076		Approved	MGC25497	uc002nuw.4	Q96SI1		ENST00000430256.3:c.*950C>A	19.37:g.34304803C>A			A8K600|Q9BVI6	RNA	SNP	-	NULL	ENST00000430256.3	37	NULL	CCDS46039.1	19																																																																																			KCTD15	-	-	ENSG00000153885		0.562	KCTD15-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KCTD15	HGNC	protein_coding	OTTHUMT00000451462.2	-	0.00	20	0	C	NM_024076		34304803	+1	tier1	-	no_errors	ENST00000592363	ensembl	human	putative	74_37	rna	34.78	15	8	SNP	0.018	A
KDM5C	8242	genome.wustl.edu	37	X	53246370	53246370	+	Silent	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chrX:53246370G>A	ENST00000375401.3	-	5	1144	c.612C>T	c.(610-612)tcC>tcT	p.S204S	KDM5C_ENST00000404049.3_Silent_p.S203S|KDM5C_ENST00000375379.3_Silent_p.S204S|KDM5C_ENST00000375383.3_Silent_p.S163S|KDM5C_ENST00000452825.3_Silent_p.S137S|KDM5C-IT1_ENST00000412242.1_RNA	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	204					histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						TGTTGAACTTGGAAGGCTGCA	0.537			"""N, F, S"""		clear cell renal carcinoma																																			Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	0													148.0	104.0	119.0					X																	53246370		2203	4300	6503	SO:0001819	synonymous_variant	0			Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.612C>T	X.37:g.53246370G>A			B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Silent	SNP	pfam_Lys_sp_deMease_like_dom,pfam_JmjC_dom,pfam_ARID/BRIGHT_DNA-bd,pfam_Znf_C5HC2,pfam_Znf_PHD-finger,pfam_TF_JmjN,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_Znf_PHD,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_ARID/BRIGHT_DNA-bd	p.S204	ENST00000375401.3	37	c.612	CCDS14351.1	X																																																																																			KDM5C	-	NULL	ENSG00000126012		0.537	KDM5C-005	KNOWN	basic|CCDS	protein_coding	KDM5C	HGNC	protein_coding	OTTHUMT00000056737.2	-	0.00	52	0	G	NM_004187		53246370	-1	tier1	-	no_errors	ENST00000375401	ensembl	human	known	74_37	silent	20.00	48	12	SNP	1.000	A
CEP162	22832	genome.wustl.edu	37	6	84925088	84925088	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr6:84925088C>G	ENST00000403245.3	-	5	529	c.415G>C	c.(415-417)Gag>Cag	p.E139Q	KIAA1009_ENST00000257766.4_Missense_Mutation_p.E63Q	NM_014895.2	NP_055710.2														breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	43		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)		BRCA - Breast invasive adenocarcinoma(397;0.089)		AAGCCTTTCTCAAGCCTGGCA	0.358																																																	0													108.0	101.0	103.0					6																	84925088		2203	4299	6502	SO:0001583	missense	0																														ENST00000403245.3:c.415G>C	6.37:g.84925088C>G	ENSP00000385215:p.Glu139Gln			Missense_Mutation	SNP	NULL	p.E139Q	ENST00000403245.3	37	c.415	CCDS34494.2	6	.	.	.	.	.	.	.	.	.	.	C	13.46	2.242449	0.39598	.	.	ENSG00000135315	ENST00000257766;ENST00000403245	T;T	0.15718	2.4;2.4	5.46	4.53	0.55603	.	0.184871	0.37483	N	0.002061	T	0.19366	0.0465	L	0.50333	1.59	0.30224	N	0.796533	P;D	0.56521	0.897;0.976	B;P	0.56474	0.357;0.799	T	0.00455	-1.1729	10	0.45353	T	0.12	-16.4423	16.0206	0.80486	0.0:0.8656:0.1344:0.0	.	139;139	Q5TB80;C9JFM9	QN1_HUMAN;.	Q	63;139	ENSP00000257766:E63Q;ENSP00000385215:E139Q	ENSP00000257766:E63Q	E	-	1	0	KIAA1009	84981807	1.000000	0.71417	1.000000	0.80357	0.210000	0.24377	3.977000	0.56874	2.706000	0.92434	0.591000	0.81541	GAG	KIAA1009	-	NULL	ENSG00000135315		0.358	KIAA1009-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIAA1009	HGNC	protein_coding	OTTHUMT00000317315.1	-	0.00	38	0	C			84925088	-1	tier1	-	no_errors	ENST00000403245	ensembl	human	known	74_37	missense	27.66	33	13	SNP	1.000	G
KIAA2013	90231	genome.wustl.edu	37	1	11982770	11982770	+	Frame_Shift_Del	DEL	G	G	-			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr1:11982770delG	ENST00000376572.3	-	2	1995	c.1810delC	c.(1810-1812)ctcfs	p.L604fs	KIAA2013_ENST00000376576.3_Frame_Shift_Del_p.L604fs	NM_138346.2	NP_612355.1	Q8IYS2	K2013_HUMAN	KIAA2013	604						integral component of membrane (GO:0016021)|membrane (GO:0016020)				endometrium(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	7	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00149)|all_lung(284;0.00189)|Breast(348;0.00586)|Colorectal(325;0.0062)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0556)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		AGGTGGAAGAGGGTGATTAGG	0.597																																																	0													38.0	37.0	37.0					1																	11982770		2203	4300	6503	SO:0001589	frameshift_variant	0			AB095933	CCDS141.1	1p36.22	2011-02-09			ENSG00000116685	ENSG00000116685			28513	protein-coding gene	gene with protein product						12477932	Standard	NM_138346		Approved	MGC33867, RP5-1077B9.1	uc001atk.3	Q8IYS2	OTTHUMG00000002391	ENST00000376572.3:c.1810delC	1.37:g.11982770delG	ENSP00000365756:p.Leu604fs		Q5JXC1|Q8IVF8|Q8NDI7|Q9BSY1	Frame_Shift_Del	DEL	pfam_DUF2152	p.L604fs	ENST00000376572.3	37	c.1810	CCDS141.1	1																																																																																			KIAA2013	-	pfam_DUF2152	ENSG00000116685		0.597	KIAA2013-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA2013	HGNC	protein_coding	OTTHUMT00000006858.1		0.00	24	0	G	NM_138346		11982770	-1	tier1		no_errors	ENST00000376576	ensembl	human	known	74_37	frame_shift_del	40.00	15	10	DEL	1.000	-
KIF13B	23303	genome.wustl.edu	37	8	28997678	28997678	+	Nonsense_Mutation	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr8:28997678G>A	ENST00000524189.1	-	21	2553	c.2515C>T	c.(2515-2517)Cga>Tga	p.R839*	CTD-2647L4.1_ENST00000523661.1_RNA|CTD-2647L4.1_ENST00000517632.1_RNA|RN7SL781P_ENST00000582428.1_RNA	NM_015254.3	NP_056069.2	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	839					metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein targeting (GO:0006605)|regulation of axonogenesis (GO:0050770)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	axon (GO:0030424)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)			endometrium(6)|kidney(1)|lung(20)|urinary_tract(1)	28		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		CCACTGAGTCGCATCACCTCC	0.552																																																	0													58.0	60.0	59.0					8																	28997678		2185	4285	6470	SO:0001587	stop_gained	0			AB014539	CCDS55217.1	8p21	2008-07-30				ENSG00000197892		"""Kinesins"""	14405	protein-coding gene	gene with protein product		607350				9734811, 10859302, 16864656	Standard	NM_015254		Approved	GAKIN, KIAA0639	uc003xhh.4	Q9NQT8		ENST00000524189.1:c.2515C>T	8.37:g.28997678G>A	ENSP00000427900:p.Arg839*		B4DGY5|B5MC45|F8VPJ2|O75134|Q9BYJ6	Nonsense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_CAP-Gly_domain,pfam_KIF1B,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_CAP-Gly_domain,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,pfscan_CAP-Gly_domain,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R839*	ENST00000524189.1	37	c.2515	CCDS55217.1	8	.	.	.	.	.	.	.	.	.	.	G	36	5.767530	0.96914	.	.	ENSG00000197892	ENST00000524189	.	.	.	4.8	2.9	0.33743	.	0.128286	0.49305	D	0.000141	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.1725	0.59606	0.0:0.0:0.7087:0.2913	.	.	.	.	X	839	.	ENSP00000427900:R839X	R	-	1	2	KIF13B	29053597	1.000000	0.71417	0.955000	0.39395	0.036000	0.12997	1.131000	0.31406	0.551000	0.29008	0.655000	0.94253	CGA	KIF13B	-	NULL	ENSG00000197892		0.552	KIF13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF13B	HGNC	protein_coding	OTTHUMT00000376878.1	-	0.00	24	0	G			28997678	-1	tier1	-	no_errors	ENST00000524189	ensembl	human	known	74_37	nonsense	42.86	8	6	SNP	0.917	A
KIF5B	3799	genome.wustl.edu	37	10	32311947	32311947	+	Silent	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr10:32311947G>A	ENST00000302418.4	-	16	2200	c.1743C>T	c.(1741-1743)ggC>ggT	p.G581G	KIF5B_ENST00000493889.1_5'Flank	NM_004521.2	NP_004512.1	P33176	KINH_HUMAN	kinesin family member 5B	581					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cellular protein metabolic process (GO:0044267)|cytoplasm organization (GO:0007028)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|regulation of membrane potential (GO:0042391)|stress granule disassembly (GO:0035617)|vesicle transport along microtubule (GO:0047496)	ciliary rootlet (GO:0035253)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule organizing center (GO:0005815)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|vesicle (GO:0031982)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)		KIF5B/ALK(8)|KIF5B/RET(79)	NS(2)|breast(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)	35		Prostate(175;0.0137)				CATCTATCATGCCAGTTCCCT	0.348			T	"""RET, ALK"""	NSCLC																																			Dom	yes		10	10p11.22	3799	kinesin family member 5B		E	0													98.0	87.0	90.0					10																	32311947		2203	4300	6503	SO:0001819	synonymous_variant	0			X65873	CCDS7171.1	10p11.22	2007-02-13			ENSG00000170759	ENSG00000170759		"""Kinesins"""	6324	protein-coding gene	gene with protein product		602809		KNS1		1607388	Standard	NM_004521		Approved	KNS	uc001iwe.4	P33176	OTTHUMG00000017913	ENST00000302418.4:c.1743C>T	10.37:g.32311947G>A			A0AVB2|Q5VZ85	Silent	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.G581	ENST00000302418.4	37	c.1743	CCDS7171.1	10																																																																																			KIF5B	-	superfamily_P-loop_NTPase	ENSG00000170759		0.348	KIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF5B	HGNC	protein_coding	OTTHUMT00000047467.1	-	0.00	58	0	G	NM_004521		32311947	-1	tier1	-	no_errors	ENST00000302418	ensembl	human	known	74_37	silent	29.63	38	16	SNP	1.000	A
KLF8	11279	genome.wustl.edu	37	X	56295889	56295889	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chrX:56295889C>T	ENST00000468660.1	+	4	1013	c.725C>T	c.(724-726)tCa>tTa	p.S242L	KLF8_ENST00000374928.3_Missense_Mutation_p.S242L	NM_007250.4	NP_009181.2	O95600	KLF8_HUMAN	Kruppel-like factor 8	242					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(4)|large_intestine(6)|lung(5)|ovary(1)	16						AGTGGATCCTCAGCCTTGCAG	0.458																																																	0													145.0	114.0	124.0					X																	56295889		2203	4300	6503	SO:0001583	missense	0			U28282	CCDS14373.1, CCDS55428.1	Xp11.21	2013-01-08			ENSG00000102349	ENSG00000102349		"""Zinc fingers, C2H2-type"", ""Kruppel-like transcription factors"""	6351	protein-coding gene	gene with protein product		300286					Standard	NM_007250		Approved	BKLF3, ZNF741, DXS741	uc004dur.3	O95600	OTTHUMG00000021666	ENST00000468660.1:c.725C>T	X.37:g.56295889C>T	ENSP00000417303:p.Ser242Leu		B4DJN3|E7EQQ8|L0R3U8|L0R4U2|Q2M246|Q59GV5|Q5HYQ5|Q5JXP7|Q6MZJ7|Q9UGC4	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S242L	ENST00000468660.1	37	c.725	CCDS14373.1	X	.	.	.	.	.	.	.	.	.	.	C	15.87	2.960178	0.53400	.	.	ENSG00000102349	ENST00000374928;ENST00000468660	T	0.06849	3.25	4.13	3.26	0.37387	.	0.234982	0.29100	N	0.013148	T	0.09512	0.0234	L	0.56769	1.78	0.32442	N	0.546637	B;B	0.10296	0.003;0.001	B;B	0.09377	0.004;0.0	T	0.03112	-1.1071	10	0.72032	D	0.01	.	7.5902	0.28017	0.0:0.8707:0.0:0.1293	.	242;242	E7EQQ8;O95600	.;KLF8_HUMAN	L	242	ENSP00000417303:S242L	ENSP00000364063:S242L	S	+	2	0	KLF8	56312614	0.255000	0.24002	0.746000	0.31095	0.944000	0.59088	2.894000	0.48640	0.847000	0.35167	0.600000	0.82982	TCA	KLF8	-	NULL	ENSG00000102349		0.458	KLF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF8	HGNC	protein_coding	OTTHUMT00000056887.2	-	0.00	73	0	C	NM_007250		56295889	+1	tier1	-	no_errors	ENST00000468660	ensembl	human	known	74_37	missense	22.22	56	16	SNP	0.998	T
KMT2A	4297	genome.wustl.edu	37	11	118374498	118374498	+	Frame_Shift_Del	DEL	T	T	-			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr11:118374498delT	ENST00000389506.5	+	27	7882	c.7882delT	c.(7882-7884)tttfs	p.F2629fs	KMT2A_ENST00000354520.4_Frame_Shift_Del_p.F2591fs|KMT2A_ENST00000534358.1_Frame_Shift_Del_p.F2632fs			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	2629					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										TTCTAACATGTTTTTTGGGCT	0.498																																																	0													76.0	66.0	69.0					11																	118374498		2200	4296	6496	SO:0001589	frameshift_variant	0			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.7882delT	11.37:g.118374498delT	ENSP00000374157:p.Phe2629fs		E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Frame_Shift_Del	DEL	pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_Bromodomain,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pirsf_MeTrfase_trithorax,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC,pfscan_Bromodomain	p.F2629fs	ENST00000389506.5	37	c.7882	CCDS31686.1	11																																																																																			KMT2A	-	pirsf_MeTrfase_trithorax	ENSG00000118058		0.498	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2A	HGNC	protein_coding	OTTHUMT00000399085.2		0.00	31	0	T	NM_005933		118374498	+1	tier1		no_errors	ENST00000389506	ensembl	human	known	74_37	frame_shift_del	9.09	20	2	DEL	1.000	-
KRTAP10-3	386682	genome.wustl.edu	37	21	45978578	45978578	+	Silent	SNP	G	G	T	rs201902293	byFrequency	TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr21:45978578G>T	ENST00000391620.1	-	1	65	c.21C>A	c.(19-21)tcC>tcA	p.S7S	TSPEAR_ENST00000323084.4_Intron|TSPEAR_ENST00000397916.1_Intron	NM_198696.2	NP_941969.2	P60369	KR103_HUMAN	keratin associated protein 10-3	7						keratin filament (GO:0045095)				kidney(1)|lung(4)|prostate(1)|skin(1)	7						TGGAGCAGACGGACATGGTAG	0.662																																																	0													67.0	65.0	66.0					21																	45978578		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ566383	CCDS42956.1	21q22.3	2007-10-05			ENSG00000212935	ENSG00000212935		"""Keratin associated proteins"""	22968	protein-coding gene	gene with protein product				KRTAP18-3			Standard	NM_198696		Approved	KAP10.3, KAP18.3	uc002zfj.1	P60369	OTTHUMG00000057628	ENST00000391620.1:c.21C>A	21.37:g.45978578G>T			A3KN67|Q70LJ4	Silent	SNP	NULL	p.S7	ENST00000391620.1	37	c.21	CCDS42956.1	21																																																																																			KRTAP10-3	-	NULL	ENSG00000212935		0.662	KRTAP10-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-3	HGNC	protein_coding	OTTHUMT00000128031.1	-	0.00	99	0	G			45978578	-1	tier1	-	no_errors	ENST00000391620	ensembl	human	known	74_37	silent	6.67	56	4	SNP	0.800	T
LARGE	9215	genome.wustl.edu	37	22	33673135	33673135	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr22:33673135C>G	ENST00000354992.2	-	15	2555	c.1984G>C	c.(1984-1986)Gtt>Ctt	p.V662L	LARGE_ENST00000402320.1_Missense_Mutation_p.V610L|LARGE_ENST00000452586.2_Missense_Mutation_p.V461L|LARGE_ENST00000397394.2_Missense_Mutation_p.V662L|LARGE_ENST00000437602.2_Missense_Mutation_p.V613L|LARGE_ENST00000337431.2_Missense_Mutation_p.V610L	NM_004737.4	NP_004728.1	O95461	LARGE_HUMAN	like-glycosyltransferase	662					glycoprotein biosynthetic process (GO:0009101)|glycosphingolipid biosynthetic process (GO:0006688)|muscle cell cellular homeostasis (GO:0046716)|N-acetylglucosamine metabolic process (GO:0006044)|protein glycosylation (GO:0006486)	integral component of Golgi membrane (GO:0030173)	acetylglucosaminyltransferase activity (GO:0008375)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(1;0.219)				CGTCTCACAACAACATACGGC	0.572																																					Colon(70;397 1175 4573 19089 45288)												0													101.0	86.0	91.0					22																	33673135		2203	4300	6503	SO:0001583	missense	0			AJ007583	CCDS13912.1	22q12.3	2013-02-22			ENSG00000133424	ENSG00000133424		"""Glycosyltransferase family 8 domain containing"""	6511	protein-coding gene	gene with protein product		603590				9892679, 10591208, 12966029	Standard	NM_004737		Approved	KIAA0609	uc003ane.4	O95461	OTTHUMG00000150914	ENST00000354992.2:c.1984G>C	22.37:g.33673135C>G	ENSP00000347088:p.Val662Leu		B0QXZ7|O60348|Q17R80|Q9UGD1|Q9UGE7|Q9UGG3|Q9UGZ8|Q9UH22	Missense_Mutation	SNP	pfam_Glyco_trans_8	p.V662L	ENST00000354992.2	37	c.1984	CCDS13912.1	22	.	.	.	.	.	.	.	.	.	.	C	15.44	2.835043	0.50951	.	.	ENSG00000133424	ENST00000354992;ENST00000337431;ENST00000397394;ENST00000402320;ENST00000452586;ENST00000437602	T;T;T;T;T;T	0.27402	1.67;1.67;1.67;1.67;1.67;1.67	5.5	5.5	0.81552	.	0.047153	0.85682	D	0.000000	T	0.43919	0.1269	L	0.53617	1.68	0.58432	D	0.99999	B;B;B;B	0.32876	0.388;0.006;0.337;0.388	B;B;B;B	0.44044	0.439;0.086;0.312;0.323	T	0.28618	-1.0038	10	0.51188	T	0.08	-9.0773	19.7664	0.96346	0.0:1.0:0.0:0.0	.	613;461;610;662	B7Z2I9;E9PH73;O95461-2;O95461	.;.;.;LARGE_HUMAN	L	662;610;662;610;461;613	ENSP00000347088:V662L;ENSP00000336636:V610L;ENSP00000380549:V662L;ENSP00000385223:V610L;ENSP00000407917:V461L;ENSP00000388544:V613L	ENSP00000336636:V610L	V	-	1	0	LARGE	32003135	0.974000	0.33945	0.203000	0.23512	0.864000	0.49448	2.320000	0.43797	2.735000	0.93741	0.655000	0.94253	GTT	LARGE	-	NULL	ENSG00000133424		0.572	LARGE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LARGE	HGNC	protein_coding	OTTHUMT00000320515.2	-	0.00	26	0	C	NM_133642		33673135	-1	tier1	-	no_errors	ENST00000354992	ensembl	human	known	74_37	missense	12.77	41	6	SNP	0.968	G
LDB2	9079	genome.wustl.edu	37	4	16900009	16900009	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr4:16900009C>G	ENST00000304523.5	-	1	423	c.100G>C	c.(100-102)Gag>Cag	p.E34Q	LDB2_ENST00000441778.2_Missense_Mutation_p.E34Q|LDB2_ENST00000502640.1_Missense_Mutation_p.E34Q|LDB2_ENST00000515064.1_Missense_Mutation_p.E34Q	NM_001290.3	NP_001281.1	O43679	LDB2_HUMAN	LIM domain binding 2	34					epithelial structure maintenance (GO:0010669)|hair follicle development (GO:0001942)|positive regulation of cellular component biogenesis (GO:0044089)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|somatic stem cell maintenance (GO:0035019)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	LIM domain binding (GO:0030274)|transcription cofactor activity (GO:0003712)	p.E34K(2)		breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(23)|urinary_tract(1)	33						TTGTTCATCTCATAGATTCGG	0.453																																																	2	Substitution - Missense(2)	urinary_tract(2)											202.0	179.0	187.0					4																	16900009		2203	4300	6503	SO:0001583	missense	0			AF068651	CCDS3420.1, CCDS47031.1	4p16	2008-08-01			ENSG00000169744	ENSG00000169744			6533	protein-coding gene	gene with protein product		603450				9853615, 9880598, 10861853	Standard	NM_001290		Approved	CLIM1, LDB1	uc003goz.3	O43679	OTTHUMG00000048212	ENST00000304523.5:c.100G>C	4.37:g.16900009C>G	ENSP00000306772:p.Glu34Gln		O60619|O75480	Missense_Mutation	SNP	NULL	p.E34Q	ENST00000304523.5	37	c.100	CCDS3420.1	4	.	.	.	.	.	.	.	.	.	.	C	22.4	4.291507	0.80914	.	.	ENSG00000169744	ENST00000515064;ENST00000441778;ENST00000304523;ENST00000502640;ENST00000506732	.	.	.	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.76772	0.4034	M	0.64630	1.985	0.80722	D	1	D;P;D;D	0.76494	0.976;0.882;0.985;0.999	P;P;P;D	0.91635	0.817;0.612;0.891;0.999	T	0.75806	-0.3188	9	0.38643	T	0.18	-13.2447	17.3952	0.87443	0.0:1.0:0.0:0.0	.	34;34;34;34	E9PFI4;G5E9Y7;O43679-2;O43679	.;.;.;LDB2_HUMAN	Q	34;34;34;34;10	.	ENSP00000306772:E34Q	E	-	1	0	LDB2	16509107	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.349000	0.79376	2.325000	0.78763	0.460000	0.39030	GAG	LDB2	-	NULL	ENSG00000169744		0.453	LDB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LDB2	HGNC	protein_coding	OTTHUMT00000250321.2	-	0.00	59	0	C			16900009	-1	tier1	-	no_errors	ENST00000304523	ensembl	human	known	74_37	missense	16.67	45	9	SNP	1.000	G
LILRA4	23547	genome.wustl.edu	37	19	54848413	54848413	+	Splice_Site	SNP	T	T	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr19:54848413T>G	ENST00000291759.4	-	6	1010	c.954A>C	c.(952-954)ggA>ggC	p.G318G	AC008984.2_ENST00000507363.1_RNA	NM_012276.3	NP_036408.3	P59901	LIRA4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 4	318					immune system process (GO:0002376)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(13)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	32	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0565)		CAGAGATCTGTCCTGGAGAAA	0.607																																																	0													43.0	45.0	45.0					19																	54848413		2203	4300	6503	SO:0001630	splice_region_variant	0			AF041261	CCDS12890.1	19q13.4	2013-01-11			ENSG00000239961	ENSG00000239961		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15503	protein-coding gene	gene with protein product		607517				10941842	Standard	NM_012276		Approved	ILT7, CD85g	uc002qfj.3	P59901	OTTHUMG00000065355	ENST00000291759.4:c.953-1A>C	19.37:g.54848413T>G			Q32MC4	Silent	SNP	smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt,pfscan_Ig-like_dom	p.G318	ENST00000291759.4	37	c.954	CCDS12890.1	19																																																																																			LILRA4	-	pirsf_A1B_glyco/leuk_Ig-like_rcpt	ENSG00000239961		0.607	LILRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LILRA4	HGNC	protein_coding	OTTHUMT00000140229.2	-	0.00	49	0	T	NM_012276	Silent	54848413	-1	tier1	-	no_errors	ENST00000291759	ensembl	human	known	74_37	silent	28.99	49	20	SNP	0.008	G
LINC00324	284029	genome.wustl.edu	37	17	8125983	8125983	+	lincRNA	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr17:8125983C>G	ENST00000315707.3	-	0	841				RP11-849F2.8_ENST00000602405.1_lincRNA	NR_026951.1				long intergenic non-protein coding RNA 324																		GGGCGTGCCTCGTCTCTTCCT	0.547																																																	0																																												0			AK092109		17p13.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000178977	ENSG00000178977		"""Long non-coding RNAs"""	26628	non-coding RNA	RNA, long non-coding			"""chromosome 17 open reading frame 44"", ""non-protein coding RNA 324"""	C17orf44, NCRNA00324			Standard	NR_026951		Approved	FLJ34790, MGC104931	uc002gkp.4		OTTHUMG00000132866		17.37:g.8125983C>G				RNA	SNP	-	NULL	ENST00000315707.3	37	NULL		17																																																																																			LINC00324	-	-	ENSG00000178977		0.547	LINC00324-001	KNOWN	basic	lincRNA	LINC00324	HGNC	lincRNA	OTTHUMT00000256341.1	-	0.00	22	0	C			8125983	-1	tier1	-	no_errors	ENST00000315707	ensembl	human	known	74_37	rna	68.75	5	11	SNP	0.000	G
LOC101930127	101930127	genome.wustl.edu	37	11	134704	134704	+	RNA	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr11:134704G>A	ENST00000527297.1	+	0	235																											CGTAGGGTATGGGCCTAAATA	0.577																																																	0																																												0																															11.37:g.134704G>A				RNA	SNP	-	NULL	ENST00000527297.1	37	NULL		11																																																																																			LINC01001	-	-	ENSG00000230724		0.577	RP11-304M2.3-001	KNOWN	basic	antisense	LINC01001	HGNC	antisense	OTTHUMT00000384758.1	-	0.00	12	0	G			134704	-1	tier1	-	no_errors	ENST00000527683	ensembl	human	known	74_37	rna	60.00	2	3	SNP	0.141	A
LINC01020	340094	genome.wustl.edu	37	5	5059708	5059708	+	lincRNA	SNP	A	A	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr5:5059708A>C	ENST00000508201.1	+	0	656									long intergenic non-protein coding RNA 1020																		AAGATCCTTCATCTTCAAGAA	0.363																																																	0																																												0					5p15.32	2013-07-26			ENSG00000215231	ENSG00000215231		"""Long non-coding RNAs"""	27968	non-coding RNA	RNA, long non-coding						12477932	Standard	NR_026994		Approved				OTTHUMG00000161653		5.37:g.5059708A>C				RNA	SNP	-	NULL	ENST00000508201.1	37	NULL		5																																																																																			LINC01020	-	-	ENSG00000215231		0.363	LINC01020-001	KNOWN	basic	lincRNA	LINC01020	HGNC	lincRNA	OTTHUMT00000365595.1	-	0.00	45	0	A			5059708	+1	tier1	-	no_errors	ENST00000508201	ensembl	human	known	74_37	rna	28.85	37	15	SNP	0.000	C
LOC643201	643201	genome.wustl.edu	37	5	175574547	175574547	+	lincRNA	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr5:175574547G>C	ENST00000515403.1	-	0	2654				RP11-826N14.4_ENST00000510029.1_lincRNA	NR_036494.1																						CATACCTGAAGAGCCGAGTTC	0.308																																																	0																																												0																															5.37:g.175574547G>C				RNA	SNP	-	NULL	ENST00000515403.1	37	NULL		5																																																																																			RP11-844P9.2	-	-	ENSG00000248596		0.308	RP11-844P9.2-001	KNOWN	basic	lincRNA	LOC643201	Clone_based_vega_gene	lincRNA	OTTHUMT00000371986.1		0.00	17	0	G			175574547	-1			no_errors	ENST00000513919	ensembl	human	known	74_37	rna	18.18	9	2	SNP	0.281	C
LPAL2	80350	genome.wustl.edu	37	6	160908400	160908400	+	RNA	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr6:160908400C>T	ENST00000335388.5	-	0	572					NR_028092.1		Q16609	LPAL2_HUMAN	lipoprotein, Lp(a)-like 2, pseudogene							extracellular region (GO:0005576)				large_intestine(1)|lung(4)	5		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.214)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)		ACTTTGGGATCCGTTGTATAA	0.498																																																	0													82.0	70.0	74.0					6																	160908400		692	1591	2283			0			U19517		6q26-q27	2010-10-27	2010-10-27	2004-02-18	ENSG00000213071	ENSG00000213071			21210	pseudogene	pseudogene		611682	"""apolipoprotein A-like"", ""lipoprotein, Lp(a)-like 2"""	APOAL		7749817, 7679504	Standard	NR_028092		Approved	APOARGC	uc011efy.2	Q16609	OTTHUMG00000015952		6.37:g.160908400C>T			E1P5B4	RNA	SNP	-	NULL	ENST00000335388.5	37	NULL		6																																																																																			LPAL2	-	-	ENSG00000213071		0.498	LPAL2-003	KNOWN	basic	processed_transcript	LPAL2	HGNC	pseudogene	OTTHUMT00000042950.1	-	0.00	59	0	C	NM_024492		160908400	-1	tier1	-	no_errors	ENST00000335388	ensembl	human	known	74_37	rna	32.14	38	18	SNP	0.465	T
LRRC34	151827	genome.wustl.edu	37	3	169526492	169526492	+	Missense_Mutation	SNP	A	A	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr3:169526492A>G	ENST00000316515.7	-	2	418	c.142T>C	c.(142-144)Tgt>Cgt	p.C48R	LRRC34_ENST00000522526.2_Missense_Mutation_p.C61R|LRRC34_ENST00000446859.1_Missense_Mutation_p.C61R|LRRC34_ENST00000524327.1_5'Flank|LRRC34_ENST00000522830.1_5'UTR	NM_153353.4	NP_699184.2	Q8IZ02	LRC34_HUMAN	leucine rich repeat containing 34	48										breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(2)	10	all_cancers(22;4.12e-22)|all_epithelial(15;7.54e-27)|all_lung(20;1.63e-16)|Lung NSC(18;6.92e-16)|Ovarian(172;0.000223)|Breast(254;0.197)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00676)			TTTTCCATACACAGATTAGAA	0.289																																																	0													36.0	38.0	37.0					3																	169526492		2188	4279	6467	SO:0001583	missense	0			AK095125	CCDS3208.1, CCDS3208.2, CCDS54672.1	3q26.2	2014-03-18			ENSG00000171757	ENSG00000171757			28408	protein-coding gene	gene with protein product						12477932	Standard	NM_153353		Approved	MGC27085	uc003ffy.3	Q8IZ02	OTTHUMG00000164419	ENST00000316515.7:c.142T>C	3.37:g.169526492A>G	ENSP00000326150:p.Cys48Arg		B4DEJ7|E9PBH2|G5E9T7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_RNase_inh_sub-typ	p.C61R	ENST00000316515.7	37	c.181		3	.	.	.	.	.	.	.	.	.	.	A	17.31	3.358049	0.61403	.	.	ENSG00000171757	ENST00000446859;ENST00000316515;ENST00000522526	T;T;T	0.66099	-0.0;-0.19;0.11	5.01	5.01	0.66863	.	0.041945	0.85682	D	0.000000	T	0.75532	0.3862	M	0.68593	2.085	0.58432	D	0.99999	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.91635	0.915;0.999;0.998	T	0.78018	-0.2368	10	0.87932	D	0	-16.2512	11.2927	0.49261	1.0:0.0:0.0:0.0	.	48;61;48	B4DHF2;G5E9T7;Q8IZ02	.;.;LRC34_HUMAN	R	61;48;61	ENSP00000414635:C61R;ENSP00000326150:C48R;ENSP00000429278:C61R	ENSP00000326150:C48R	C	-	1	0	LRRC34	171009186	0.776000	0.28616	0.351000	0.25721	0.337000	0.28794	3.864000	0.56024	2.234000	0.73211	0.459000	0.35465	TGT	LRRC34	-	NULL	ENSG00000171757		0.289	LRRC34-201	KNOWN	basic	protein_coding	LRRC34	HGNC	protein_coding		-	0.00	52	0	A	NM_153353		169526492	-1	tier1	-	no_errors	ENST00000446859	ensembl	human	known	74_37	missense	20.24	67	17	SNP	0.400	G
LRRC37A6P	387646	genome.wustl.edu	37	10	27536913	27536913	+	lincRNA	SNP	T	T	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr10:27536913T>C	ENST00000574842.1	+	0	255				LRRC37A6P_ENST00000284414.4_RNA																							AGGGGCTCTTTGTATTGTTAT	0.353																																																	0																																												0																															10.37:g.27536913T>C				RNA	SNP	-	NULL	ENST00000574842.1	37	NULL		10																																																																																			LRRC37A6P	-	-	ENSG00000230445		0.353	RP11-85G18.6-001	KNOWN	basic	lincRNA	LRRC37A6P	HGNC	lincRNA	OTTHUMT00000436904.1	-	0.00	45	0	T			27536913	-1	tier1	-	no_errors	ENST00000284414	ensembl	human	known	74_37	rna	33.93	37	19	SNP	0.002	C
LRRIQ3	127255	genome.wustl.edu	37	1	74621391	74621391	+	Intron	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr1:74621391C>G	ENST00000395089.1	-	3	707				LRRIQ3_ENST00000370909.2_Intron|LRRIQ3_ENST00000468759.1_Intron|LRRIQ3_ENST00000354431.4_Intron			A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3											NS(2)|breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(13)|liver(1)|lung(27)|ovary(3)|prostate(1)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(5)	73						TTTCAATATTCAAATGGTAAA	0.274																																																	0													35.0	33.0	34.0					1																	74621391		1775	4018	5793	SO:0001627	intron_variant	0			BX647210	CCDS41350.1	1p31.1	2008-06-12	2008-06-12	2008-06-12	ENSG00000162620	ENSG00000162620			28318	protein-coding gene	gene with protein product			"""leucine rich repeat containing 44"""	LRRC44		12477932	Standard	NM_001105659		Approved	MGC22773	uc001dfy.4	A6PVS8	OTTHUMG00000009508	ENST00000395089.1:c.707+25G>C	1.37:g.74621391C>G			A6PVS9|Q6P5P7|Q6ZMV4|Q8WUE0	RNA	SNP	-	NULL	ENST00000395089.1	37	NULL	CCDS41350.1	1																																																																																			LRRIQ3	-	-	ENSG00000162620		0.274	LRRIQ3-008	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRIQ3	HGNC	protein_coding	OTTHUMT00000316539.1	-	0.00	135	0	C	NM_145258		74621391	-1	tier1	-	no_errors	ENST00000495179	ensembl	human	putative	74_37	rna	26.98	92	34	SNP	0.000	G
LRRTM2	26045	genome.wustl.edu	37	5	138208713	138208713	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr5:138208713C>G	ENST00000274711.6	-	2	1915	c.1537G>C	c.(1537-1539)Gaa>Caa	p.E513Q	LRRTM2_ENST00000523537.1_5'Flank|LRRTM2_ENST00000518785.1_3'UTR|CTNNA1_ENST00000520400.1_Intron|CTNNA1_ENST00000518825.1_Intron|CTNNA1_ENST00000302763.7_Intron|CTNNA1_ENST00000355078.5_Intron|CTNNA1_ENST00000540387.1_5'Flank|LRRTM2_ENST00000521094.2_Missense_Mutation_p.E74Q	NM_015564.2	NP_056379.1	O43300	LRRT2_HUMAN	leucine rich repeat transmembrane neuronal 2	513					long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|synapse organization (GO:0050808)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(1)|urinary_tract(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			ACTTCACATTCTTTGTATGGC	0.363																																																	0													146.0	139.0	142.0					5																	138208713		1871	4116	5987	SO:0001583	missense	0			AB007876	CCDS47272.1	5q31	2008-02-05				ENSG00000146006			19409	protein-coding gene	gene with protein product		610868				12676565	Standard	NM_015564		Approved	KIAA0416	uc011cyz.1	O43300		ENST00000274711.6:c.1537G>C	5.37:g.138208713C>G	ENSP00000274711:p.Glu513Gln		A0AVL3|A8K4U9|B7ZLN8|Q7L770	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.E513Q	ENST00000274711.6	37	c.1537	CCDS47272.1	5	.	.	.	.	.	.	.	.	.	.	C	17.39	3.377914	0.61735	.	.	ENSG00000146006	ENST00000521094;ENST00000274711	T	0.65549	-0.16	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.71978	0.3404	L	0.29908	0.895	0.58432	D	0.999999	D;D	0.76494	0.98;0.999	D;D	0.80764	0.968;0.994	T	0.74231	-0.3732	10	0.87932	D	0	.	19.6362	0.95735	0.0:1.0:0.0:0.0	.	379;513	B7Z4G4;O43300	.;LRRT2_HUMAN	Q	74;513	ENSP00000274711:E513Q	ENSP00000274711:E513Q	E	-	1	0	LRRTM2	138236612	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.739000	0.93911	0.655000	0.94253	GAA	LRRTM2	-	NULL	ENSG00000146006		0.363	LRRTM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRTM2	HGNC	protein_coding	OTTHUMT00000374043.2	-	0.00	87	0	C			138208713	-1	tier1	-	no_errors	ENST00000274711	ensembl	human	known	74_37	missense	37.68	43	26	SNP	1.000	G
MAGEC3	139081	genome.wustl.edu	37	X	140985178	140985178	+	Missense_Mutation	SNP	A	A	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chrX:140985178A>T	ENST00000298296.1	+	7	1634	c.1634A>T	c.(1633-1635)aAg>aTg	p.K545M	MAGEC3_ENST00000536088.1_Missense_Mutation_p.K247M|MAGEC3_ENST00000443323.2_Missense_Mutation_p.K167M|MAGEC3_ENST00000409007.1_Missense_Mutation_p.K247M|MAGEC3_ENST00000544766.1_Missense_Mutation_p.K247M	NM_138702.1	NP_619647.1	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3	545	MAGE 2. {ECO:0000255|PROSITE- ProRule:PRU00127}.									NS(2)|breast(3)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|liver(1)|lung(32)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(2)	69	Acute lymphoblastic leukemia(192;6.56e-05)					GGCATGCCCAAGAACTGTCTC	0.493																																																	0													138.0	123.0	128.0					X																	140985178		2203	4300	6503	SO:0001583	missense	0			AF490508	CCDS14676.1, CCDS14677.1	Xq27.2	2009-03-25			ENSG00000165509	ENSG00000165509			23798	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 2"""	300469				10861452	Standard	NM_138702		Approved	HCA2, MAGE-C3, CT7.2	uc011mwp.2	Q8TD91	OTTHUMG00000022570	ENST00000298296.1:c.1634A>T	X.37:g.140985178A>T	ENSP00000298296:p.Lys545Met		Q3SYA7|Q5JZ43|Q9BZ80	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.K545M	ENST00000298296.1	37	c.1634	CCDS14676.1	X	.	.	.	.	.	.	.	.	.	.	a	11.43	1.635055	0.29068	.	.	ENSG00000165509	ENST00000298296;ENST00000536088;ENST00000443323;ENST00000544766;ENST00000409007	T;T;T;T;T	0.06294	3.32;3.32;3.32;3.32;3.32	1.25	0.0225	0.14133	.	.	.	.	.	T	0.19565	0.0470	M	0.80183	2.485	0.09310	N	1	D;D	0.76494	0.969;0.999	P;D	0.87578	0.881;0.998	T	0.10590	-1.0623	9	0.87932	D	0	.	2.8813	0.05648	0.683:0.0:0.317:0.0	.	545;247	Q8TD91;Q3SYA7	MAGC3_HUMAN;.	M	545;247;167;247;247	ENSP00000298296:K545M;ENSP00000441107:K247M;ENSP00000438254:K167M;ENSP00000440444:K247M;ENSP00000386566:K247M	ENSP00000298296:K545M	K	+	2	0	MAGEC3	140812844	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	0.364000	0.20325	-0.054000	0.13266	0.235000	0.17854	AAG	MAGEC3	-	pfam_MAGE,pfscan_MAGE	ENSG00000165509		0.493	MAGEC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC3	HGNC	protein_coding	OTTHUMT00000058606.1	-	0.00	53	0	A	NM_138702		140985178	+1	tier1	-	no_errors	ENST00000298296	ensembl	human	known	74_37	missense	28.38	53	21	SNP	0.000	T
MAGI3	260425	genome.wustl.edu	37	1	113933837	113933837	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr1:113933837C>G	ENST00000307546.9	+	1	257	c.182C>G	c.(181-183)tCg>tGg	p.S61W	MAGI3_ENST00000369611.4_Missense_Mutation_p.S61W|MAGI3_ENST00000369615.1_Missense_Mutation_p.S61W|MAGI3_ENST00000369617.4_Missense_Mutation_p.S61W|MAGI3_ENST00000486456.1_3'UTR	NM_001142782.1	NP_001136254.1	Q5TCQ9	MAGI3_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 3	61	Interaction with ADRB1 and TGFA. {ECO:0000250}.|PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|nucleotide phosphorylation (GO:0046939)|positive regulation of JUN kinase activity (GO:0043507)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	41	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGCGTCGTCTCGGGCAAGGCG	0.721																																																	0													10.0	10.0	10.0					1																	113933837		2128	4211	6339	SO:0001583	missense	0			AF213259	CCDS860.1, CCDS44196.1	1p12-p11.2	2008-02-05			ENSG00000081026	ENSG00000081026			29647	protein-coding gene	gene with protein product		615943				10997877, 10748157	Standard	NM_152900		Approved	MAGI-3	uc001edk.3	Q5TCQ9	OTTHUMG00000011737	ENST00000307546.9:c.182C>G	1.37:g.113933837C>G	ENSP00000304604:p.Ser61Trp		Q5TCQ8|Q5TCR0|Q9H2V6|Q9H5Y8|Q9HBC4|Q9HCD8	Missense_Mutation	SNP	pfam_PDZ,pfam_WW_dom,pfam_GK/Ca_channel_bsu,superfamily_PDZ,superfamily_P-loop_NTPase,superfamily_WW_dom,smart_PDZ,smart_GK/Ca_channel_bsu,smart_WW_dom,pfscan_PDZ,pfscan_WW_dom,pfscan_Guanylate_kin-like	p.S61W	ENST00000307546.9	37	c.182	CCDS44196.1	1	.	.	.	.	.	.	.	.	.	.	C	18.40	3.616324	0.66672	.	.	ENSG00000081026	ENST00000369617;ENST00000307546;ENST00000369615;ENST00000369611	T;T;T;T	0.18657	2.39;2.2;2.39;2.39	3.98	3.98	0.46160	.	0.250565	0.26567	N	0.023651	T	0.28333	0.0700	L	0.52011	1.625	0.43803	D	0.996357	D;D;D	0.76494	0.999;0.991;0.999	D;P;D	0.70935	0.965;0.876;0.971	T	0.04976	-1.0914	10	0.87932	D	0	-12.1269	12.8531	0.57869	0.0:1.0:0.0:0.0	.	61;61;61	Q5TCQ9-4;Q5TCQ9-3;Q5TCQ9-2	.;.;.	W	61	ENSP00000358630:S61W;ENSP00000304604:S61W;ENSP00000358628:S61W;ENSP00000358624:S61W	ENSP00000304604:S61W	S	+	2	0	MAGI3	113735360	0.998000	0.40836	0.997000	0.53966	0.981000	0.71138	2.885000	0.48570	1.767000	0.52121	0.456000	0.33151	TCG	MAGI3	-	superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000081026		0.721	MAGI3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	MAGI3	HGNC	protein_coding	OTTHUMT00000032429.1	-	0.00	30	0	C	NM_152900		113933837	+1	tier1	-	no_errors	ENST00000369611	ensembl	human	known	74_37	missense	31.03	20	9	SNP	0.984	G
MAML3	55534	genome.wustl.edu	37	4	140811293	140811293	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr4:140811293G>A	ENST00000509479.2	-	2	2153	c.1297C>T	c.(1297-1299)Cgg>Tgg	p.R433W	MAML3_ENST00000327122.5_Missense_Mutation_p.R277W|MAML3_ENST00000398940.1_5'Flank	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					TTTCCAGGCCGAGGTGGAGCT	0.597																																																	0													84.0	82.0	82.0					4																	140811293		2089	4223	6312	SO:0001583	missense	0			AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.1297C>T	4.37:g.140811293G>A	ENSP00000421180:p.Arg433Trp			Missense_Mutation	SNP	pfam_Neuroggenic_mastermind-like_N	p.R433W	ENST00000509479.2	37	c.1297	CCDS54805.1	4	.	.	.	.	.	.	.	.	.	.	G	14.89	2.669635	0.47677	.	.	ENSG00000196782	ENST00000509479;ENST00000327122	T	0.27402	1.67	5.83	1.58	0.23477	.	0.000000	0.85682	D	0.000000	T	0.51244	0.1663	L	0.60455	1.87	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.57568	-0.7789	10	0.72032	D	0.01	.	16.943	0.86223	0.0:0.0:0.4744:0.5256	.	433	Q96JK9	MAML3_HUMAN	W	433;277	ENSP00000421180:R433W	ENSP00000313316:R277W	R	-	1	2	MAML3	141030743	0.995000	0.38212	0.831000	0.32960	0.932000	0.56968	2.367000	0.44213	0.329000	0.23460	-0.188000	0.12872	CGG	MAML3	-	NULL	ENSG00000196782		0.597	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAML3	HGNC	protein_coding	OTTHUMT00000364934.2	-	0.00	33	0	G			140811293	-1	tier1	-	no_errors	ENST00000509479	ensembl	human	known	74_37	missense	16.13	26	5	SNP	0.317	A
MAN1B1	11253	genome.wustl.edu	37	9	140002044	140002044	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr9:140002044G>A	ENST00000371589.4	+	12	1899	c.1826G>A	c.(1825-1827)cGc>cAc	p.R609H	MAN1B1_ENST00000540391.1_3'UTR|MAN1B1_ENST00000474902.1_Missense_Mutation_p.R312H	NM_016219.4	NP_057303.2	Q9UKM7	MA1B1_HUMAN	mannosidase, alpha, class 1B, member 1	609					cellular protein metabolic process (GO:0044267)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum quality control compartment (GO:0044322)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			autonomic_ganglia(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(2)	14	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;3.08e-05)|Epithelial(140;0.000513)		TACCTGTACCGCGTCACAGGG	0.647																																																	0													110.0	100.0	103.0					9																	140002044		2203	4300	6503	SO:0001583	missense	0			AF145732	CCDS7029.1	9q34.3	2014-05-27			ENSG00000177239	ENSG00000177239			6823	protein-coding gene	gene with protein product	"""endoplasmic reticulum alpha-mannosidase 1"", ""alpha 1,2-mannosidase"", ""endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase 1"", ""ER alpha 1,2-mannosidase"", ""Man9GlcNAc2-specific processing alpha-mannosidase"""	604346				10409699, 10521544	Standard	NM_016219		Approved	MANA-ER, MRT15	uc004cld.3	Q9UKM7	OTTHUMG00000020978	ENST00000371589.4:c.1826G>A	9.37:g.140002044G>A	ENSP00000360645:p.Arg609His		Q5VSG3|Q9BRS9|Q9Y5K7	Missense_Mutation	SNP	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47,prints_Glyco_hydro_47	p.R609H	ENST00000371589.4	37	c.1826	CCDS7029.1	9	.	.	.	.	.	.	.	.	.	.	G	26.6	4.750328	0.89753	.	.	ENSG00000177239	ENST00000371589;ENST00000474902	D;D	0.89681	-2.55;-2.55	5.19	5.19	0.71726	.	.	.	.	.	D	0.95166	0.8433	M	0.87038	2.855	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.996	D;D;P	0.97110	1.0;0.998;0.9	D	0.95466	0.8547	8	.	.	.	.	17.684	0.88251	0.0:0.0:1.0:0.0	.	496;282;609	B4DPS9;B3KXZ1;Q9UKM7	.;.;MA1B1_HUMAN	H	609;312	ENSP00000360645:R609H;ENSP00000447256:R312H	.	R	+	2	0	MAN1B1	139121865	1.000000	0.71417	0.949000	0.38748	0.718000	0.41266	9.109000	0.94291	2.443000	0.82685	0.561000	0.74099	CGC	MAN1B1	-	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47,prints_Glyco_hydro_47	ENSG00000177239		0.647	MAN1B1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN1B1	HGNC	protein_coding	OTTHUMT00000055294.2	-	0.00	29	0	G	NM_016219		140002044	+1	tier1	-	no_errors	ENST00000371589	ensembl	human	known	74_37	missense	14.29	24	4	SNP	1.000	A
MAP3K15	389840	genome.wustl.edu	37	X	19391656	19391656	+	Silent	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chrX:19391656G>C	ENST00000338883.4	-	21	2930	c.2931C>G	c.(2929-2931)ctC>ctG	p.L977L	MAP3K15_ENST00000518578.1_5'UTR|MAP3K15_ENST00000359173.3_Silent_p.L412L|MAP3K15_ENST00000469203.2_Silent_p.L809L	NM_001001671.3	NP_001001671.3	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase 15	977							ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			NS(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(13)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	Hepatocellular(33;0.183)					GGGTGTACCTGAGGAGGTGGC	0.667																																																	0													30.0	25.0	27.0					X																	19391656		2125	4165	6290	SO:0001819	synonymous_variant	0			AK131412		Xp22.12	2011-06-09			ENSG00000180815	ENSG00000180815		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	31689	protein-coding gene	gene with protein product		300820					Standard	NM_001001671		Approved	bA723P2.3, FLJ16518	uc022btq.1	Q6ZN16	OTTHUMG00000022724	ENST00000338883.4:c.2931C>G	X.37:g.19391656G>C			A2AI49|A2AI50|A6NJ61|Q5JPR4|Q6ZMV3	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_SAM/pointed,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.L977	ENST00000338883.4	37	c.2931		X																																																																																			MAP3K15	-	NULL	ENSG00000180815		0.667	MAP3K15-201	KNOWN	basic|appris_principal	protein_coding	MAP3K15	HGNC	protein_coding		-	0.00	62	0	G	NM_001001671		19391656	-1	tier1	-	no_errors	ENST00000338883	ensembl	human	known	74_37	silent	40.00	51	34	SNP	0.561	C
MAP3K15	389840	genome.wustl.edu	37	X	19418722	19418722	+	Missense_Mutation	SNP	T	T	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chrX:19418722T>A	ENST00000338883.4	-	14	1903	c.1904A>T	c.(1903-1905)gAg>gTg	p.E635V	MAP3K15_ENST00000518578.1_5'UTR|MAP3K15_ENST00000359173.3_Missense_Mutation_p.E70V|MAP3K15_ENST00000469203.2_Missense_Mutation_p.E467V	NM_001001671.3	NP_001001671.3	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase 15	635							ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			NS(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(13)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	Hepatocellular(33;0.183)					GGTCTCTCCCTCCAGCTCCAC	0.443																																																	0													389.0	329.0	349.0					X																	19418722		2203	4300	6503	SO:0001583	missense	0			AK131412		Xp22.12	2011-06-09			ENSG00000180815	ENSG00000180815		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	31689	protein-coding gene	gene with protein product		300820					Standard	NM_001001671		Approved	bA723P2.3, FLJ16518	uc022btq.1	Q6ZN16	OTTHUMG00000022724	ENST00000338883.4:c.1904A>T	X.37:g.19418722T>A	ENSP00000345629:p.Glu635Val		A2AI49|A2AI50|A6NJ61|Q5JPR4|Q6ZMV3	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_SAM/pointed,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.E635V	ENST00000338883.4	37	c.1904		X	.	.	.	.	.	.	.	.	.	.	T	19.50	3.840130	0.71488	.	.	ENSG00000180815	ENST00000338883;ENST00000359173;ENST00000469203	T;T;T	0.74209	-0.79;-0.82;-0.78	5.13	5.13	0.70059	.	0.051244	0.85682	D	0.000000	D	0.83783	0.5329	M	0.69248	2.105	0.54753	D	0.999985	D;D	0.89917	0.997;1.0	D;D	0.69142	0.962;0.931	D	0.85520	0.1203	10	0.66056	D	0.02	.	14.1158	0.65151	0.0:0.0:0.0:1.0	.	110;635	Q6ZN16-3;Q6ZN16	.;M3K15_HUMAN	V	635;70;467	ENSP00000345629:E635V;ENSP00000352093:E70V;ENSP00000428356:E467V	ENSP00000345629:E635V	E	-	2	0	MAP3K15	19328643	1.000000	0.71417	0.961000	0.40146	0.603000	0.37013	5.553000	0.67287	1.711000	0.51337	0.483000	0.47432	GAG	MAP3K15	-	NULL	ENSG00000180815		0.443	MAP3K15-201	KNOWN	basic|appris_principal	protein_coding	MAP3K15	HGNC	protein_coding		-	0.00	87	0	T	NM_001001671		19418722	-1	tier1	-	no_errors	ENST00000338883	ensembl	human	known	74_37	missense	35.00	52	28	SNP	1.000	A
LONRF1	91694	genome.wustl.edu	37	8	12584775	12584775	+	Intron	DEL	T	T	-	rs573549519	byFrequency	TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr8:12584775delT	ENST00000398246.3	-	11	2080				MIR3926-2_ENST00000578598.1_RNA|LONRF1_ENST00000525024.1_Intron|LONRF1_ENST00000533751.1_Intron	NM_152271.3	NP_689484.3	Q17RB8	LONF1_HUMAN	LON peptidase N-terminal domain and ring finger 1								ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(4)|ovary(1)|upper_aerodigestive_tract(2)	19				READ - Rectum adenocarcinoma(644;0.236)		GCAGAGACGCTTTTAAAGTCT	0.368																																																	0																																										SO:0001627	intron_variant	0			AK074329	CCDS5987.2	8p23.1	2013-01-09			ENSG00000154359	ENSG00000154359		"""RING-type (C3HC4) zinc fingers"""	26302	protein-coding gene	gene with protein product						18253036	Standard	XM_005273685		Approved	FLJ23749, RNF191	uc003wwd.1	Q17RB8	OTTHUMG00000165475	ENST00000398246.3:c.2011-1387A>-	8.37:g.12584775delT			B4DM29|B4DU84|Q8TEA0|Q9BSV1	RNA	DEL	-	NULL	ENST00000398246.3	37	NULL	CCDS5987.2	8																																																																																			MIR3926-2	-	-	ENSG00000266206		0.368	LONRF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR3926-2	HGNC	protein_coding	OTTHUMT00000251693.2		0.00	25	0	T	NM_152271		12584775	-1	tier1		no_errors	ENST00000578598	ensembl	human	known	74_37	rna	11.76	15	2	DEL	0.074	-
MLLT3	4300	genome.wustl.edu	37	9	20414280	20414280	+	Silent	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr9:20414280G>A	ENST00000380338.4	-	5	850	c.564C>T	c.(562-564)agC>agT	p.S188S	MLLT3_ENST00000475957.1_5'UTR|MLLT3_ENST00000429426.2_Silent_p.S185S|MLLT3_ENST00000355930.6_5'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	188	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)		p.S188S(1)		central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		TGGTActactgctgctgctgc	0.502			T	MLL	ALL																																			Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	1	Substitution - coding silent(1)	large_intestine(1)											77.0	84.0	82.0					9																	20414280		2203	4300	6503	SO:0001819	synonymous_variant	0			L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.564C>T	9.37:g.20414280G>A			B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	pfam_YEATS,pfscan_YEATS	p.S188	ENST00000380338.4	37	c.564	CCDS6494.1	9																																																																																			MLLT3	-	NULL	ENSG00000171843		0.502	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLLT3	HGNC	protein_coding	OTTHUMT00000051872.1		0.00	31	0	G	NM_004529		20414280	-1			no_errors	ENST00000380338	ensembl	human	known	74_37	silent	7.69	24	2	SNP	1.000	A
MORC2	22880	genome.wustl.edu	37	22	31330084	31330084	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr22:31330084C>G	ENST00000397641.3	-	20	2696	c.2288G>C	c.(2287-2289)aGa>aCa	p.R763T	MORC2_ENST00000215862.4_Missense_Mutation_p.R701T|MORC2_ENST00000469915.1_5'Flank|MORC2-AS1_ENST00000441558.1_RNA			Q9Y6X9	MORC2_HUMAN	MORC family CW-type zinc finger 2	763						cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	21						CACAACAAATCTGCCCCGCTT	0.552																																																	0													218.0	171.0	187.0					22																	31330084		2203	4300	6503	SO:0001583	missense	0			AB020659	CCDS33636.1	22q12.2	2005-06-15	2005-06-15	2005-06-15	ENSG00000133422	ENSG00000133422			23573	protein-coding gene	gene with protein product			"""zinc finger, CW-type with coiled-coil domain 1"", ""zinc finger, CW type with coiled-coil domain 1"""	ZCWCC1		14607086	Standard	XM_005261391		Approved	ZCW3, KIAA0852, AC004542.C22.1	uc003aje.1	Q9Y6X9	OTTHUMG00000151193	ENST00000397641.3:c.2288G>C	22.37:g.31330084C>G	ENSP00000380763:p.Arg763Thr		B2RNB1|Q9UF28|Q9Y6V2	Missense_Mutation	SNP	pfam_Znf_CW,pfam_HATPase_ATP-bd,superfamily_HATPase_ATP-bd,superfamily_Carb-bd_dom,pfscan_Znf_CW	p.R763T	ENST00000397641.3	37	c.2288		22	.	.	.	.	.	.	.	.	.	.	C	14.70	2.613132	0.46631	.	.	ENSG00000133422	ENST00000397641;ENST00000215862	T;T	0.12255	2.7;2.7	5.95	3.84	0.44239	.	0.363117	0.30667	N	0.009134	T	0.08447	0.0210	N	0.24115	0.695	0.80722	D	1	B	0.11235	0.004	B	0.13407	0.009	T	0.27640	-1.0068	10	0.21014	T	0.42	.	7.7515	0.28901	0.0:0.2333:0.0:0.7667	.	763	Q9Y6X9	MORC2_HUMAN	T	763;701	ENSP00000380763:R763T;ENSP00000215862:R701T	ENSP00000215862:R701T	R	-	2	0	MORC2	29660084	0.972000	0.33761	0.978000	0.43139	0.939000	0.58152	1.584000	0.36589	0.512000	0.28257	-0.302000	0.09304	AGA	MORC2	-	NULL	ENSG00000133422		0.552	MORC2-001	KNOWN	basic|appris_principal	protein_coding	MORC2	HGNC	protein_coding	OTTHUMT00000321710.2	-	0.00	61	0	C	NM_014941		31330084	-1	tier1	-	no_errors	ENST00000397641	ensembl	human	known	74_37	missense	19.39	79	19	SNP	0.850	G
MROH2B	133558	genome.wustl.edu	37	5	41009477	41009477	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr5:41009477C>G	ENST00000399564.4	-	32	3775	c.3325G>C	c.(3325-3327)Gaa>Caa	p.E1109Q	MROH2B_ENST00000506092.2_Missense_Mutation_p.E664Q	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	1109																	GCTGGCTTTTCAGCCAGCGCC	0.498																																																	0													91.0	95.0	94.0					5																	41009477		1852	4104	5956	SO:0001583	missense	0				CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.3325G>C	5.37:g.41009477C>G	ENSP00000382476:p.Glu1109Gln		Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.E1109Q	ENST00000399564.4	37	c.3325	CCDS47202.1	5	.	.	.	.	.	.	.	.	.	.	C	5.952	0.359715	0.11239	.	.	ENSG00000171495	ENST00000506092;ENST00000296803;ENST00000399564	T;T	0.04156	3.69;3.69	6.06	3.23	0.37069	Armadillo-type fold (1);	0.188110	0.37761	N	0.001941	T	0.04092	0.0114	L	0.39898	1.24	0.27480	N	0.952591	B	0.25955	0.138	B	0.21917	0.037	T	0.39643	-0.9604	10	0.13853	T	0.58	.	8.5709	0.33569	0.0:0.633:0.2888:0.0783	.	1109	Q7Z745	HTRB2_HUMAN	Q	664;814;1109	ENSP00000441504:E664Q;ENSP00000382476:E1109Q	ENSP00000296803:E814Q	E	-	1	0	HEATR7B2	41045234	1.000000	0.71417	0.999000	0.59377	0.239000	0.25481	2.152000	0.42272	0.890000	0.36211	-0.175000	0.13238	GAA	MROH2B	-	superfamily_ARM-type_fold	ENSG00000171495		0.498	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MROH2B	HGNC	protein_coding	OTTHUMT00000367558.2	-	0.00	24	0	C	NM_173489		41009477	-1	tier1	-	no_errors	ENST00000399564	ensembl	human	known	74_37	missense	14.29	60	10	SNP	0.998	G
MRPL1	65008	genome.wustl.edu	37	4	78830473	78830473	+	Missense_Mutation	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr4:78830473G>C	ENST00000315567.8	+	7	1053	c.724G>C	c.(724-726)Gaa>Caa	p.E242Q		NM_020236.3	NP_064621.3	Q9BYD6	RM01_HUMAN	mitochondrial ribosomal protein L1	242					translation (GO:0006412)	large ribosomal subunit (GO:0015934)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)	17						AAATGGACATGAAATTAAGGT	0.313																																																	0													85.0	94.0	91.0					4																	78830473		2203	4296	6499	SO:0001583	missense	0			AB049474	CCDS3583.2	4q21.1	2012-09-13			ENSG00000169288	ENSG00000169288		"""Mitochondrial ribosomal proteins / large subunits"""	14275	protein-coding gene	gene with protein product		611821					Standard	NM_020236		Approved	BM022	uc003hku.2	Q9BYD6	OTTHUMG00000130200	ENST00000315567.8:c.724G>C	4.37:g.78830473G>C	ENSP00000315017:p.Glu242Gln		A6NG03|Q4W5B8|Q6IAG4|Q96BW3|Q9H793|Q9NRL5	Missense_Mutation	SNP	pfam_Ribosomal_L1/biogenesis,superfamily_Ribosomal_L1-like,tigrfam_Ribosomal_L1_mit	p.E242Q	ENST00000315567.8	37	c.724	CCDS3583.2	4	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	20.2|20.2|20.2	3.955896|3.955896|3.955896	0.73902|0.73902|0.73902	.|.|.	.|.|.	ENSG00000169288|ENSG00000169288|ENSG00000169288	ENST00000315567;ENST00000538314|ENST00000504901|ENST00000502384	T|.|.	0.40225|.|.	1.04|.|.	5.56|5.56|5.56	5.56|5.56|5.56	0.83823|0.83823|0.83823	Ribosomal protein L1, superfamily (1);|.|.	0.000000|.|.	0.85682|.|.	D|.|.	0.000000|.|.	T|T|.	0.75989|0.75989|.	0.3925|0.3925|.	M|M|M	0.79475|0.79475|0.79475	2.455|2.455|2.455	0.48511|0.48511|0.48511	D|D|D	0.999665|0.999665|0.999665	P;P|.|.	0.47409|.|.	0.895;0.895|.|.	P;P|.|.	0.51918|.|.	0.684;0.684|.|.	T|T|.	0.76468|0.76468|.	-0.2948|-0.2948|.	10|5|.	0.48119|.|.	T|.|.	0.1|.|.	-25.9137|-25.9137|-25.9137	15.0262|15.0262|15.0262	0.71671|0.71671|0.71671	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	220;242|.|.	A0PJ79;Q9BYD6|.|.	.;RM01_HUMAN|.|.	Q|I|S	242;220|35|195	ENSP00000315017:E242Q|.|.	ENSP00000315017:E242Q|.|.	E|M|X	+|+|+	1|3|2	0|0|2	MRPL1|MRPL1|MRPL1	79049497|79049497|79049497	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.742000|0.742000|0.742000	0.42306|0.42306|0.42306	4.981000|4.981000|4.981000	0.63819|0.63819|0.63819	2.632000|2.632000|2.632000	0.89209|0.89209|0.89209	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	GAA|ATG|TGA	MRPL1	-	pfam_Ribosomal_L1/biogenesis,superfamily_Ribosomal_L1-like	ENSG00000169288		0.313	MRPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL1	HGNC	protein_coding	OTTHUMT00000252518.3	-	0.00	41	0	G	NM_020236		78830473	+1	tier1	-	no_errors	ENST00000315567	ensembl	human	known	74_37	missense	12.90	27	4	SNP	1.000	C
MT-ND2	4536	genome.wustl.edu	37	M	2101	2101	+	5'Flank	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chrM:2101C>T	ENST00000361453.3	+	0	0				MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TI_ENST00000387365.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						TAACTGTTAGTCCAAAGAGGA	0.393																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.2101C>T	Exception_encountered		Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	-	NULL	ENST00000361453.3	37	NULL		MT																																																																																			MT-RNR2	-	-	ENSG00000210082		0.393	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR2	HGNC	protein_coding		-	0.00	31	0	C	YP_003024027		2101	+1	tier1	-	no_errors	ENST00000387347	ensembl	human	known	74_37	rna	28.57	10	4	SNP	NULL	T
MT-CO2	4513	genome.wustl.edu	37	M	7814	7814	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chrM:7814G>A	ENST00000361739.1	+	1	229	c.229G>A	c.(229-231)Gcc>Acc	p.A77T	MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-ATP8_ENST00000361851.1_5'Flank|MT-CO3_ENST00000362079.2_5'Flank|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-TA_ENST00000387392.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA			P00403	COX2_HUMAN	mitochondrially encoded cytochrome c oxidase II	77					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|respiratory chain complex IV (GO:0045277)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)			endometrium(5)|kidney(8)|lung(2)|pancreas(3)|prostate(1)	19						TAGTCCTCATCGCCCTCCCAT	0.468																																																	0																																										SO:0001583	missense	0					mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198712	ENSG00000198712		"""Mitochondrial respiratory chain complex / Complex IV"""	7421	protein-coding gene	gene with protein product		516040	"""cytochrome c oxidase II"""	MTCO2		1712754, 1989603	Standard			Approved	COX2, CO2		P00403		ENST00000361739.1:c.229G>A	M.37:g.7814G>A	ENSP00000354876:p.Ala77Thr		Q37526	Missense_Mutation	SNP	pfam_Cyt_c_oxidase_su2_C,pfam_Cyt_c_oxidase_su2_TM_dom,superfamily_Cupredoxin,superfamily_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_C,tigrfam_Cyt_c_oxidase_su2	p.A77T	ENST00000361739.1	37	c.229		MT																																																																																			MT-CO2	-	pfam_Cyt_c_oxidase_su2_TM_dom,superfamily_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_TM_dom,tigrfam_Cyt_c_oxidase_su2	ENSG00000198712		0.468	MT-CO2-201	KNOWN	basic|appris_principal	protein_coding	MT-CO2	HGNC	protein_coding		-	0.00	956	0	G	YP_003024029		7814	+1	tier1	-	no_errors	ENST00000361739	ensembl	human	known	74_37	missense	5.67	466	28	SNP	NULL	A
MUC4	4585	genome.wustl.edu	37	3	195506955	195506955	+	Silent	SNP	T	T	C	rs201420433		TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr3:195506955T>C	ENST00000463781.3	-	2	11955	c.11496A>G	c.(11494-11496)tcA>tcG	p.S3832S	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Silent_p.S3832S|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CTGTGGATGCTGAGGAAGCGT	0.582																																																	0													6.0	6.0	6.0					3																	195506955		399	1159	1558	SO:0001819	synonymous_variant	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11496A>G	3.37:g.195506955T>C			O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.S3832	ENST00000463781.3	37	c.11496	CCDS54700.1	3																																																																																			MUC4	-	NULL	ENSG00000145113		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6		0.00	67	0	T	NM_018406		195506955	-1			no_errors	ENST00000463781	ensembl	human	known	74_37	silent	5.56	102	6	SNP	0.019	C
MYLK3	91807	genome.wustl.edu	37	16	46782047	46782047	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr16:46782047G>A	ENST00000394809.4	-	1	174	c.59C>T	c.(58-60)aCc>aTc	p.T20I	MYLK3_ENST00000536476.1_Intron	NM_182493.2	NP_872299.2	Q32MK0	MYLK3_HUMAN	myosin light chain kinase 3	20					cardiac myofibril assembly (GO:0055003)|cellular response to interleukin-1 (GO:0071347)|positive regulation of sarcomere organization (GO:0060298)|protein phosphorylation (GO:0006468)|regulation of vascular permeability involved in acute inflammatory response (GO:0002528)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(3)|prostate(3)|skin(5)|stomach(3)	37		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				TGTTAAGCAGGTCTTGCCCAA	0.557																																																	0													73.0	75.0	74.0					16																	46782047		2203	4298	6501	SO:0001583	missense	0			AJ247087	CCDS10723.2	16q11.2	2008-10-23			ENSG00000140795	ENSG00000140795			29826	protein-coding gene	gene with protein product	"""MLC kinase"""	612147				17885681	Standard	NM_182493		Approved	caMLCK, MLCK	uc002eei.4	Q32MK0	OTTHUMG00000132543	ENST00000394809.4:c.59C>T	16.37:g.46782047G>A	ENSP00000378288:p.Thr20Ile		B5BUL9|B7Z5U8|Q32MK1|Q96DV1	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.T20I	ENST00000394809.4	37	c.59	CCDS10723.2	16	.	.	.	.	.	.	.	.	.	.	G	8.431	0.848578	0.17034	.	.	ENSG00000140795	ENST00000394809	T	0.69806	-0.43	5.42	2.11	0.27256	.	.	.	.	.	T	0.40979	0.1139	N	0.08118	0	0.18873	N	0.999984	B	0.10296	0.003	B	0.09377	0.004	T	0.27262	-1.0079	9	0.54805	T	0.06	.	2.7525	0.05285	0.1669:0.1094:0.5082:0.2154	.	20	Q32MK0	MYLK3_HUMAN	I	20	ENSP00000378288:T20I	ENSP00000378288:T20I	T	-	2	0	MYLK3	45339548	0.053000	0.20554	0.989000	0.46669	0.197000	0.23852	0.258000	0.18387	0.668000	0.31126	0.491000	0.48974	ACC	MYLK3	-	NULL	ENSG00000140795		0.557	MYLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYLK3	HGNC	protein_coding	OTTHUMT00000255743.2	-	0.00	47	0	G	NM_182493		46782047	-1	tier1	-	no_errors	ENST00000394809	ensembl	human	known	74_37	missense	23.08	30	9	SNP	0.206	A
MYO15B	80022	genome.wustl.edu	37	17	73612645	73612645	+	3'UTR	SNP	A	A	G	rs201496149		TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr17:73612645A>G	ENST00000578382.2	+	0	6034					NR_003587.2		Q96JP2	MY15B_HUMAN	myosin XVB pseudogene							cytoplasm (GO:0005737)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)										AGAAGCCATGAAGCAAGGTGG	0.642																																																	0																																										SO:0001624	3_prime_UTR_variant	0					17q25.1	2014-07-16			ENSG00000266714	ENSG00000266714		"""Myosins / Myosin superfamily : Class XV"""	14083	pseudogene	pseudogene						11294886	Standard	NR_003587		Approved	MYO15BP	uc002jon.1	Q96JP2	OTTHUMG00000179794	ENST00000578382.2:c.*6031A>G	17.37:g.73612645A>G				RNA	SNP	-	NULL	ENST00000578382.2	37	NULL		17																																																																																			MYO15B	-	-	ENSG00000266714		0.642	MYO15B-001	KNOWN	sequence_error|basic	processed_transcript	MYO15B	HGNC	protein_coding	OTTHUMT00000448172.2		0.00	60	0	A	NR_003587		73612645	+1			no_errors	ENST00000578382	ensembl	human	known	74_37	rna	9.09	50	5	SNP	0.001	G
MYO7B	4648	genome.wustl.edu	37	2	128324310	128324310	+	Missense_Mutation	SNP	T	T	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr2:128324310T>G	ENST00000409816.2	+	4	410	c.378T>G	c.(376-378)caT>caG	p.H126Q	MYO7B_ENST00000428314.1_Missense_Mutation_p.H126Q|MYO7B_ENST00000389524.4_Missense_Mutation_p.H126Q			Q6PIF6	MYO7B_HUMAN	myosin VIIB	126	Myosin motor.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		ACAGCCGCCATATGGGCGAGC	0.582																																																	0													37.0	42.0	40.0					2																	128324310		2038	4189	6227	SO:0001583	missense	0				CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.378T>G	2.37:g.128324310T>G	ENSP00000386461:p.His126Gln		Q14786|Q8TEE1	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,pfam_SH3_2,superfamily_P-loop_NTPase,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_Band_41_domain,smart_SH3_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_SH3_domain,prints_Myosin_head_motor_dom	p.H126Q	ENST00000409816.2	37	c.378	CCDS46405.1	2	.	.	.	.	.	.	.	.	.	.	T	7.794	0.712093	0.15306	.	.	ENSG00000169994	ENST00000389524;ENST00000428314;ENST00000409816	D;D;D	0.86865	-2.18;-2.18;-2.18	5.55	-11.1	0.00147	Myosin head, motor domain (2);	0.151373	0.41823	N	0.000801	T	0.65270	0.2675	N	0.20328	0.56	0.09310	N	1	B	0.32128	0.357	B	0.24006	0.05	T	0.54833	-0.8234	10	0.33940	T	0.23	.	7.9176	0.29827	0.0619:0.1857:0.1778:0.5746	.	126	Q6PIF6	MYO7B_HUMAN	Q	126	ENSP00000374175:H126Q;ENSP00000415090:H126Q;ENSP00000386461:H126Q	ENSP00000374175:H126Q	H	+	3	2	MYO7B	128040780	0.000000	0.05858	0.000000	0.03702	0.078000	0.17371	-2.723000	0.00810	-2.624000	0.00438	-2.167000	0.00324	CAT	MYO7B	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000169994		0.582	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYO7B	HGNC	protein_coding	OTTHUMT00000331124.3	-	0.00	22	0	T	XM_291001		128324310	+1	tier1	-	no_errors	ENST00000389524	ensembl	human	known	74_37	missense	38.10	13	8	SNP	0.000	G
NDUFB2	4708	genome.wustl.edu	37	7	140395555	140395556	+	5'Flank	DEL	TT	TT	-	rs373239942|rs538494031	byFrequency	TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	TT	TT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr7:140395555_140395556delTT	ENST00000476279.1	+	0	0				NDUFB2_ENST00000476470.1_5'Flank|NDUFB2_ENST00000204307.5_5'Flank|NDUFB2_ENST00000471136.1_5'Flank|NDUFB2_ENST00000465506.1_5'Flank|NDUFB2_ENST00000482954.1_Intron|NDUFB2_ENST00000461457.1_5'Flank|NDUFB2_ENST00000247866.4_5'Flank|NDUFB2_ENST00000460088.1_5'Flank|ADCK2_ENST00000476491.1_Intron|NDUFB2_ENST00000472695.1_5'Flank|NDUFB2-AS1_ENST00000465466.1_RNA			O95178	NDUB2_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2, 8kDa						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|stomach(1)	10	Melanoma(164;0.00956)					TTAATTTCTCTTTTTTTTTTTT	0.485																																																	0																																										SO:0001631	upstream_gene_variant	0			AF050639	CCDS5862.1	7q34	2011-07-04	2002-08-29		ENSG00000090266	ENSG00000090266		"""Mitochondrial respiratory chain complex / Complex I"""	7697	protein-coding gene	gene with protein product	"""NADH-ubiquinone oxidoreductase AGGG subunit"", ""complex I AGGG subunit"""	603838	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2 (8kD, AGGG)"""			9763677, 9878551	Standard	NM_004546		Approved	AGGG, CI-AGGG	uc003vwa.3	O95178	OTTHUMG00000157424		7.37:g.140395565_140395566delTT	Exception_encountered		Q6FGI6	RNA	DEL	-	NULL	ENST00000476279.1	37	NULL	CCDS5862.1	7																																																																																			NDUFB2-AS1	-	-	ENSG00000240889		0.485	NDUFB2-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	NDUFB2-AS1	HGNC	protein_coding	OTTHUMT00000348784.1		0.00	42	0	TT	NM_004546		140395556	-1	tier1		no_errors	ENST00000465466	ensembl	human	known	74_37	rna	10.64	42	5	DEL	0.000:0.000	-
NEK10	152110	genome.wustl.edu	37	3	27183038	27183038	+	Missense_Mutation	SNP	G	G	A	rs370226106		TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr3:27183038G>A	ENST00000429845.2	-	34	3438	c.3076C>T	c.(3076-3078)Cgt>Tgt	p.R1026C	NEK10_ENST00000383770.3_Missense_Mutation_p.R281C|NEK10_ENST00000498182.1_5'UTR|NEK10_ENST00000295720.6_Missense_Mutation_p.R338C|NEK10_ENST00000383771.4_Missense_Mutation_p.R328C			Q6ZWH5	NEK10_HUMAN	NIMA-related kinase 10	1026					positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein autophosphorylation (GO:0031954)|protein phosphorylation (GO:0006468)|regulation of cell cycle G2/M phase transition (GO:1902749)|regulation of ERK1 and ERK2 cascade (GO:0070372)	protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						CTGATCTGACGCACTTTCCTC	0.358																																																	0								G		0,4406		0,0,2203	144.0	142.0	143.0			5.0	0.8	3		143	1,8599	1.2+/-3.3	0,1,4299	no	intergenic				0,1,6502	AA,AG,GG		0.0116,0.0,0.0077			27183038	1,13005	2203	4300	6503	SO:0001583	missense	0			AK123061, AK057247	CCDS46781.1	3p24.1	2012-11-15	2012-11-15		ENSG00000163491	ENSG00000163491			18592	protein-coding gene	gene with protein product			"""NIMA (never in mitosis gene a)- related kinase 10"""			15289607	Standard	NM_199347		Approved	FLJ32685	uc003cdt.2	Q6ZWH5	OTTHUMG00000130571	ENST00000429845.2:c.3076C>T	3.37:g.27183038G>A	ENSP00000395849:p.Arg1026Cys		A8MWG1|B9ZVR0|Q45VJ4|Q6ZR11|Q7Z671|Q86XB1|Q96MB3	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,pfscan_Prot_kinase_dom	p.R328C	ENST00000429845.2	37	c.982		3	.	.	.	.	.	.	.	.	.	.	G	21.4	4.141594	0.77775	0.0	1.16E-4	ENSG00000163491	ENST00000295720;ENST00000383771;ENST00000383770	T;T;T	0.35421	1.31;1.37;1.84	5.89	5.01	0.66863	.	.	.	.	.	T	0.62901	0.2466	.	.	.	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.69172	-0.5215	8	0.87932	D	0	.	15.3523	0.74399	0.0:0.0:0.8597:0.1403	.	338;281	Q6ZWH5-5;Q6ZWH5-7	.;.	C	338;328;281	ENSP00000295720:R338C;ENSP00000373281:R328C;ENSP00000373280:R281C	ENSP00000295720:R338C	R	-	1	0	NEK10	27158042	0.997000	0.39634	0.766000	0.31476	0.991000	0.79684	2.767000	0.47637	1.465000	0.48006	0.655000	0.94253	CGT	NEK10	-	NULL	ENSG00000163491		0.358	NEK10-016	NOVEL	basic|appris_principal	protein_coding	NEK10	HGNC	protein_coding	OTTHUMT00000438156.1	-	0.00	27	0	G	NM_152534		27183038	-1	tier1	-	no_errors	ENST00000383771	ensembl	human	known	74_37	missense	10.81	33	4	SNP	0.970	A
NID2	22795	genome.wustl.edu	37	14	52505686	52505686	+	Missense_Mutation	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr14:52505686G>C	ENST00000216286.5	-	9	2035	c.2036C>G	c.(2035-2037)tCt>tGt	p.S679C	NID2_ENST00000541773.1_Missense_Mutation_p.S626C	NM_007361.3	NP_031387.3	Q14112	NID2_HUMAN	nidogen 2 (osteonidogen)	679	Nidogen G2 beta-barrel. {ECO:0000255|PROSITE-ProRule:PRU00348}.				basement membrane organization (GO:0071711)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)			NS(1)|breast(5)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(40)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	87	Breast(41;0.0639)|all_epithelial(31;0.123)					GGAACTTGTAGAGGTCACAGC	0.403																																																	0													89.0	82.0	84.0					14																	52505686		2203	4300	6503	SO:0001583	missense	0			AB009799	CCDS9706.1	14q22.1	2008-05-14			ENSG00000087303	ENSG00000087303			13389	protein-coding gene	gene with protein product		605399				9733643	Standard	NM_007361		Approved		uc001wzo.3	Q14112	OTTHUMG00000140298	ENST00000216286.5:c.2036C>G	14.37:g.52505686G>C	ENSP00000216286:p.Ser679Cys		A8K6I7|B4DU19|O43710	Missense_Mutation	SNP	pfam_G2_nidogen/fibulin_G2F,pfam_LDLR_classB_rpt,pfam_Nidogen_extracell_dom,pfam_Thyroglobulin_1,pfam_EGF-like_Ca-bd_dom,superfamily_GFP,superfamily_Thyroglobulin_1,smart_Nidogen_extracell_dom,smart_EG-like_dom,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_Thyroglobulin_1,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDLR_classB_rpt,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thyroglobulin_1	p.S679C	ENST00000216286.5	37	c.2036	CCDS9706.1	14	.	.	.	.	.	.	.	.	.	.	G	15.32	2.797509	0.50208	.	.	ENSG00000087303	ENST00000216286;ENST00000316204;ENST00000541773;ENST00000395707	T;T	0.32272	1.46;1.46	6.17	5.29	0.74685	G2 nidogen/fibulin G2F (3);Green fluorescent protein-like (1);	0.145674	0.64402	D	0.000004	T	0.55321	0.1913	M	0.87456	2.885	0.43095	D	0.994776	P;P;D;P	0.53885	0.496;0.635;0.963;0.937	B;B;P;P	0.57679	0.429;0.19;0.55;0.825	T	0.61277	-0.7095	10	0.36615	T	0.2	.	15.0305	0.71701	0.068:0.0:0.932:0.0	.	273;626;681;679	E7EPP3;Q14112-2;Q5CZI2;Q14112	.;.;.;NID2_HUMAN	C	679;273;626;681	ENSP00000216286:S679C;ENSP00000443730:S626C	ENSP00000216286:S679C	S	-	2	0	NID2	51575436	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	6.082000	0.71318	1.631000	0.50456	0.655000	0.94253	TCT	NID2	-	pfam_G2_nidogen/fibulin_G2F,superfamily_GFP,smart_G2_nidogen/fibulin_G2F,pfscan_G2_nidogen/fibulin_G2F	ENSG00000087303		0.403	NID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NID2	HGNC	protein_coding	OTTHUMT00000276888.1	-	0.00	37	0	G			52505686	-1	tier1	-	no_errors	ENST00000216286	ensembl	human	known	74_37	missense	23.68	29	9	SNP	1.000	C
NLRC4	58484	genome.wustl.edu	37	2	32476497	32476497	+	Missense_Mutation	SNP	G	G	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr2:32476497G>T	ENST00000404025.2	-	5	924	c.436C>A	c.(436-438)Cat>Aat	p.H146N	NLRC4_ENST00000342905.6_Intron|NLRC4_ENST00000360906.5_Missense_Mutation_p.H146N|NLRC4_ENST00000402280.1_Missense_Mutation_p.H146N			Q9NPP4	NLRC4_HUMAN	NLR family, CARD domain containing 4	146	Nucleotide-binding domain (NBD). {ECO:0000250}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of innate immune response (GO:0002218)|defense response to bacterium (GO:0042742)|detection of bacterium (GO:0016045)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of apoptotic process (GO:0043065)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein homooligomerization (GO:0051260)|pyroptosis (GO:0070269)	cytosol (GO:0005829)|intracellular (GO:0005622)|IPAF inflammasome complex (GO:0072557)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(1)|ovary(3)|skin(2)|stomach(2)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					ACGCGGTGATGGTGTTGGTCC	0.488																																																	0													68.0	64.0	65.0					2																	32476497		2203	4300	6503	SO:0001583	missense	0			AF376061	CCDS33174.1	2p22-p21	2008-08-27	2006-12-08	2006-12-08	ENSG00000091106	ENSG00000091106		"""Nucleotide-binding domain and leucine rich repeat containing"""	16412	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 4"", ""NOD-like receptor C4"""	606831	"""caspase recruitment domain family, member 12"""	CARD12		11374873	Standard	NM_021209		Approved	CLAN1, ipaf, CLANA, CLANB, CLANC, CLAND, CLR2.1, CLAN	uc021vfq.1	Q9NPP4	OTTHUMG00000152107	ENST00000404025.2:c.436C>A	2.37:g.32476497G>T	ENSP00000385090:p.His146Asn		A8K9F8|B2RBQ3|B3KTF0|D6W580|Q96J81|Q96J82|Q96J83	Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,pfscan_NACHT_NTPase,pfscan_CARD	p.H146N	ENST00000404025.2	37	c.436	CCDS33174.1	2	.	.	.	.	.	.	.	.	.	.	G	0.026	-1.368365	0.01225	.	.	ENSG00000091106	ENST00000360906;ENST00000402280;ENST00000404025	T;T;T	0.20598	2.06;2.06;2.06	3.46	3.46	0.39613	.	0.126842	0.32687	N	0.005771	T	0.10680	0.0261	N	0.17082	0.46	0.29704	N	0.839939	B	0.11235	0.004	B	0.06405	0.002	T	0.15867	-1.0422	9	0.08599	T	0.76	-9.9917	10.2511	0.43370	0.0:0.0:0.8012:0.1988	.	146	Q9NPP4	NLRC4_HUMAN	N	146	ENSP00000354159:H146N;ENSP00000385428:H146N;ENSP00000385090:H146N	ENSP00000354159:H146N	H	-	1	0	NLRC4	32330001	0.968000	0.33430	0.679000	0.29978	0.545000	0.35147	2.483000	0.45233	1.939000	0.56221	0.543000	0.68304	CAT	NLRC4	-	superfamily_P-loop_NTPase	ENSG00000091106		0.488	NLRC4-001	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	NLRC4	HGNC	protein_coding	OTTHUMT00000325222.2	-	0.00	17	0	G	NM_021209		32476497	-1	tier1	-	no_errors	ENST00000360906	ensembl	human	known	74_37	missense	32.35	23	11	SNP	0.030	T
NOTUM	147111	genome.wustl.edu	37	17	79915689	79915689	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr17:79915689C>T	ENST00000409678.3	-	6	1071	c.688G>A	c.(688-690)Ggg>Agg	p.G230R		NM_178493.5	NP_848588.3	Q6P988	NOTUM_HUMAN	notum pectinacetylesterase homolog (Drosophila)	230						extracellular region (GO:0005576)	hydrolase activity (GO:0016787)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	15	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			CACCTGCTCCCGGCCAGCAGC	0.682																																																	0													16.0	16.0	16.0					17																	79915689		2192	4289	6481	SO:0001583	missense	0			BC060882	CCDS32771.2	17q25.3	2008-02-05			ENSG00000185269	ENSG00000185269			27106	protein-coding gene	gene with protein product		609847					Standard	NM_178493		Approved		uc010wvg.2	Q6P988	OTTHUMG00000154416	ENST00000409678.3:c.688G>A	17.37:g.79915689C>T	ENSP00000387310:p.Gly230Arg		Q8N410|Q8NI82	Missense_Mutation	SNP	pfam_NOTUM	p.G230R	ENST00000409678.3	37	c.688	CCDS32771.2	17	.	.	.	.	.	.	.	.	.	.	C	27.2	4.812203	0.90707	.	.	ENSG00000185269	ENST00000409678;ENST00000425009	.	.	.	4.33	4.33	0.51752	.	0.000000	0.85682	D	0.000000	D	0.85805	0.5782	M	0.92649	3.33	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90138	0.4211	9	0.87932	D	0	.	16.8011	0.85614	0.0:1.0:0.0:0.0	.	230	Q6P988	NOTUM_HUMAN	R	230	.	ENSP00000387310:G230R	G	-	1	0	NOTUM	77508979	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.152000	0.77419	1.952000	0.56665	0.491000	0.48974	GGG	NOTUM	-	pfam_NOTUM	ENSG00000185269		0.682	NOTUM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTUM	HGNC	protein_coding	OTTHUMT00000335123.2	-	0.00	67	0	C	NM_178493		79915689	-1	tier1	-	no_errors	ENST00000409678	ensembl	human	known	74_37	missense	53.45	27	31	SNP	1.000	T
NOX1	27035	genome.wustl.edu	37	X	100105308	100105308	+	Missense_Mutation	SNP	C	C	T	rs372154041		TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chrX:100105308C>T	ENST00000372966.3	-	9	1170	c.965G>A	c.(964-966)gGg>gAg	p.G322E	NOX1_ENST00000372960.4_Missense_Mutation_p.G285E|NOX1_ENST00000217885.5_Missense_Mutation_p.G322E|NOX1_ENST00000372964.1_Intron	NM_007052.4|NM_013955.2	NP_008983.2|NP_039249.1	Q9Y5S8	NOX1_HUMAN	NADPH oxidase 1	322	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				angiogenesis (GO:0001525)|cell migration (GO:0016477)|cellular response to hyperoxia (GO:0071455)|cellular stress response to acidic pH (GO:1990451)|extracellular matrix organization (GO:0030198)|hydrogen peroxide metabolic process (GO:0042743)|inflammatory response (GO:0006954)|intracellular pH elevation (GO:0051454)|NADP metabolic process (GO:0006739)|oxidation-reduction process (GO:0055114)|oxygen metabolic process (GO:0072592)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of JNK cascade (GO:0046330)|positive regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902177)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation vascular endothelial growth factor production (GO:0010575)|proton transport (GO:0015992)|regulation of blood pressure (GO:0008217)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|respiratory burst (GO:0045730)|signal transduction (GO:0007165)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|early endosome (GO:0005769)|integral component of membrane (GO:0016021)|invadopodium membrane (GO:0071438)|NADPH oxidase complex (GO:0043020)	metal ion binding (GO:0046872)|NADP binding (GO:0050661)|Rac GTPase binding (GO:0048365)|superoxide-generating NADPH oxidase activity (GO:0016175)|voltage-gated proton channel activity (GO:0030171)			cervix(1)|lung(3)|ovary(1)|skin(2)	7						GATATACTGCCCCACTTCCAT	0.433																																																	0													52.0	46.0	48.0					X																	100105308		2203	4300	6503	SO:0001583	missense	0			AF127763	CCDS14474.1, CCDS14475.1, CCDS65298.1	Xq22	2008-08-01			ENSG00000007952	ENSG00000007952			7889	protein-coding gene	gene with protein product	"""mitogenic oxidase (pyridine nucleotide-dependent superoxide-generating)"", ""NADPH oxidase homolog-1"", ""NADPH oxidase 1 variant NOH-1L"""	300225				10485709, 10615049	Standard	NM_007052		Approved	NOH1, NOH-1, MOX1, GP91-2	uc004egj.3	Q9Y5S8	OTTHUMG00000022007	ENST00000372966.3:c.965G>A	X.37:g.100105308C>T	ENSP00000362057:p.Gly322Glu		A8K836|O95691|Q2PP02	Missense_Mutation	SNP	pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_OxRdtase_FAD-bd_dom,superfamily_Riboflavin_synthase-like_b-brl,prints_Cyt_b245_heavy_chain	p.G322E	ENST00000372966.3	37	c.965	CCDS14474.1	X	.	.	.	.	.	.	.	.	.	.	C	17.31	3.358406	0.61403	.	.	ENSG00000007952	ENST00000372966;ENST00000217885;ENST00000372960;ENST00000372957	T;T;T	0.75154	-0.91;-0.91;-0.91	3.87	3.87	0.44632	Riboflavin synthase-like beta-barrel (1);FAD-binding 8 (1);Ferredoxin reductase-type FAD-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.90535	0.7034	H	0.97564	4.03	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.93738	0.7047	10	0.87932	D	0	-8.7647	14.1697	0.65500	0.0:1.0:0.0:0.0	.	285;322;322	A6NGA6;Q9Y5S8-3;Q9Y5S8	.;.;NOX1_HUMAN	E	322;322;285;11	ENSP00000362057:G322E;ENSP00000217885:G322E;ENSP00000362051:G285E	ENSP00000217885:G322E	G	-	2	0	NOX1	99991964	1.000000	0.71417	0.981000	0.43875	0.770000	0.43624	5.108000	0.64609	1.767000	0.52121	0.422000	0.28245	GGG	NOX1	-	pfam_FAD-bd_8,pfam_OxRdtase_FAD-bd_dom,superfamily_Riboflavin_synthase-like_b-brl	ENSG00000007952		0.433	NOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOX1	HGNC	protein_coding	OTTHUMT00000057495.1	-	0.00	40	0	C	NM_007052		100105308	-1	tier1	-	no_errors	ENST00000372966	ensembl	human	known	74_37	missense	27.91	31	12	SNP	1.000	T
NUDT4	11163	genome.wustl.edu	37	12	93772141	93772141	+	Missense_Mutation	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr12:93772141G>C	ENST00000415493.2	+	1	470	c.43G>C	c.(43-45)Gag>Cag	p.E15Q	RP11-486A14.2_ENST00000548890.1_RNA|NUDT4_ENST00000549992.1_5'Flank|NUDT4_ENST00000548662.1_5'Flank|RP11-486A14.2_ENST00000552835.1_RNA|NUDT4_ENST00000337179.5_Missense_Mutation_p.E15Q|RP11-486A14.2_ENST00000549806.1_RNA|NUDT4_ENST00000547014.1_5'Flank	NM_019094.4	NP_061967.3	Q9NZJ9	NUDT4_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 4	15					calcium-mediated signaling (GO:0019722)|cyclic nucleotide metabolic process (GO:0009187)|cyclic-nucleotide-mediated signaling (GO:0019935)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|regulation of RNA export from nucleus (GO:0046831)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|intracellular (GO:0005622)	diphosphoinositol-polyphosphate diphosphatase activity (GO:0008486)|inositol diphosphate tetrakisphosphate diphosphatase activity (GO:0052840)|inositol-1,5-bisdiphosphate-2,3,4,6-tetrakisphosphate 1-diphosphatase activity (GO:0052846)|inositol-1,5-bisdiphosphate-2,3,4,6-tetrakisphosphate 5-diphosphatase activity (GO:0052847)|inositol-1-diphosphate-2,3,4,5,6-pentakisphosphate diphosphatase activity (GO:0052843)|inositol-3,5-bisdiphosphate-2,3,4,6-tetrakisphosphate 5-diphosphatase activity (GO:0052848)|inositol-3-diphosphate-1,2,4,5,6-pentakisphosphate diphosphatase activity (GO:0052844)|inositol-5-diphosphate-1,2,3,4,6-pentakisphosphate diphosphatase activity (GO:0052845)|metal ion binding (GO:0046872)|snoRNA binding (GO:0030515)			endometrium(2)|kidney(1)|lung(2)	5						CTACGACCGCGAGGGCTTCAA	0.736																																																	0													9.0	11.0	10.0					12																	93772141		2149	4224	6373	SO:0001583	missense	0			AF067803	CCDS9044.1, CCDS44952.1, CCDS73504.1	12q21	2008-09-04			ENSG00000173598	ENSG00000173598		"""Nudix motif containing"""	8051	protein-coding gene	gene with protein product	"""diphosphoinositol polyphosphate phosphohydrolase type 2"""	609229				10777568, 11376937	Standard	XM_005268595		Approved	DIPP2, HDCMB47P, KIAA0487, DIPP2alpha, DIPP2beta	uc001tcm.3	Q9NZJ9	OTTHUMG00000170155	ENST00000415493.2:c.43G>C	12.37:g.93772141G>C	ENSP00000406612:p.Glu15Gln		B7Z916|Q4AEJ6|Q53EZ2|Q68DD7|Q9NPC5|Q9NS30|Q9NZK0|Q9NZK1	Missense_Mutation	SNP	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like	p.E15Q	ENST00000415493.2	37	c.43	CCDS44952.1	12	.	.	.	.	.	.	.	.	.	.	G	34	5.294439	0.95546	.	.	ENSG00000173598	ENST00000337179;ENST00000415493	T;T	0.42513	0.97;0.97	4.68	3.79	0.43588	NUDIX hydrolase domain-like (1);	0.051036	0.85682	D	0.000000	T	0.49949	0.1587	L	0.50333	1.59	0.80722	D	1	D;D	0.65815	0.995;0.991	P;P	0.56751	0.805;0.772	T	0.42344	-0.9457	10	0.34782	T	0.22	-10.2023	12.4227	0.55529	0.0829:0.0:0.9171:0.0	.	15;15	Q9NZJ9-2;Q9NZJ9	.;NUDT4_HUMAN	Q	15	ENSP00000338352:E15Q;ENSP00000406612:E15Q	ENSP00000338352:E15Q	E	+	1	0	NUDT4	92296272	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	8.975000	0.93437	0.965000	0.38133	0.585000	0.79938	GAG	NUDT4	-	superfamily_NUDIX_hydrolase_dom-like	ENSG00000173598		0.736	NUDT4-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	NUDT4	HGNC	protein_coding	OTTHUMT00000407702.1		0.00	89	0	G	NM_019094		93772141	+1			no_errors	ENST00000337179	ensembl	human	known	74_37	missense	5.98	110	7	SNP	1.000	C
NUTM2B	729262	genome.wustl.edu	37	10	81466039	81466039	+	Silent	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr10:81466039G>A	ENST00000429828.1	+	2	1007	c.624G>A	c.(622-624)agG>agA	p.R208R	RP11-119F19.2_ENST00000601369.1_RNA|NUTM2B_ENST00000448135.1_Silent_p.R208R|RP11-119F19.2_ENST00000596088.1_RNA|RP11-119F19.2_ENST00000600376.1_RNA|NUTM2B_ENST00000372321.1_Silent_p.R141R	NM_001278495.1	NP_001265424.1	A6NNL0	NTM2B_HUMAN	NUT family member 2B	208																	TCCAGATGAGGACAGAGGTGG	0.652																																																	0																																										SO:0001819	synonymous_variant	0				CCDS60574.1	10q22.3	2014-08-13	2013-03-14	2013-03-14	ENSG00000188199	ENSG00000188199			23445	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member B"""	FAM22B			Standard	NM_001278495		Approved	bA119F19.1		A6NNL0	OTTHUMG00000018572	ENST00000429828.1:c.624G>A	10.37:g.81466039G>A			A6NM73	Silent	SNP	NULL	p.R208	ENST00000429828.1	37	c.624		10																																																																																			NUTM2B	-	NULL	ENSG00000188199		0.652	NUTM2B-201	KNOWN	basic|appris_principal	protein_coding	NUTM2B	HGNC	protein_coding		-	0.00	61	0	G	NG_012780		81466039	+1	tier1	-	no_errors	ENST00000429828	ensembl	human	known	74_37	silent	20.34	47	12	SNP	0.001	A
NUTM2F	54754	genome.wustl.edu	37	9	97081163	97081163	+	Missense_Mutation	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr9:97081163G>C	ENST00000253262.4	-	7	1875	c.1855C>G	c.(1855-1857)Cct>Gct	p.P619A	NUTM2F_ENST00000335456.7_Intron|NUTM2F_ENST00000341207.4_Missense_Mutation_p.P604A	NM_017561.1	NP_060031.1	A1L443	NTM2F_HUMAN	NUT family member 2F	619																	TCCTTGACAGGAGACTCTCCA	0.642																																																	0													7.0	6.0	6.0					9																	97081163		1727	3842	5569	SO:0001583	missense	0				CCDS47994.1	9q22.32	2013-05-02	2013-03-14	2013-05-02	ENSG00000130950	ENSG00000130950			23450	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member F"""	FAM22F			Standard	NM_017561		Approved	DKFZp434I1117		A1L443	OTTHUMG00000020260	ENST00000253262.4:c.1855C>G	9.37:g.97081163G>C	ENSP00000253262:p.Pro619Ala		B6ZDF0|Q5SR58|Q5SR59|Q9UFB1	Missense_Mutation	SNP	NULL	p.P619A	ENST00000253262.4	37	c.1855	CCDS47994.1	9	.	.	.	.	.	.	.	.	.	.	G	6.689	0.495821	0.12762	.	.	ENSG00000130950	ENST00000253262;ENST00000341207;ENST00000375347	T;T	0.11930	2.74;2.73	1.52	1.52	0.23074	Nuclear Testis protein, C-terminal (1);	0.883949	0.09565	N	0.784994	T	0.13415	0.0325	L	0.55213	1.73	0.09310	N	1	B	0.34329	0.449	B	0.36567	0.228	T	0.28839	-1.0031	10	0.21540	T	0.41	.	6.5199	0.22269	0.0:0.0:1.0:0.0	.	619	A1L443	FA22F_HUMAN	A	619;604;453	ENSP00000253262:P619A;ENSP00000343865:P604A	ENSP00000253262:P619A	P	-	1	0	FAM22F	96120984	0.101000	0.21875	0.010000	0.14722	0.029000	0.11900	1.588000	0.36633	1.188000	0.43014	0.456000	0.33151	CCT	NUTM2F	-	NULL	ENSG00000130950		0.642	NUTM2F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NUTM2F	HGNC	protein_coding	OTTHUMT00000053173.2	-	0.00	33	0	G	NM_017561		97081163	-1	tier1	-	no_errors	ENST00000253262	ensembl	human	known	74_37	missense	25.00	21	7	SNP	0.010	C
OOEP	441161	genome.wustl.edu	37	6	74079456	74079456	+	Silent	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr6:74079456G>A	ENST00000370359.5	-	1	59	c.60C>T	c.(58-60)tcC>tcT	p.S20S	OOEP_ENST00000370363.1_Intron|OOEP-AS1_ENST00000445350.2_RNA	NM_001080507.2	NP_001073976.1	A6NGQ2	OOEP_HUMAN	oocyte expressed protein	20					cellular protein complex assembly (GO:0043623)|embryo implantation (GO:0007566)|embryonic pattern specification (GO:0009880)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|protein phosphorylation (GO:0006468)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|protein complex (GO:0043234)	RNA binding (GO:0003723)			large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	8						GCTGCTCCAGGGAGTGGGCCG	0.642																																																	0													53.0	64.0	60.0					6																	74079456		2134	4258	6392	SO:0001819	synonymous_variant	0			BC024931	CCDS47451.1	6q13	2012-02-22	2012-02-22	2007-11-13	ENSG00000203907	ENSG00000203907			21382	protein-coding gene	gene with protein product	"""KH homology domain containing 2"""	611689	"""chromosome 6 open reading frame 156"", ""oocyte expressed protein homolog (dog)"""	C6orf156		17913455	Standard	NM_001080507		Approved	Em:AC019205.2, KHDC2	uc003pgu.4	A6NGQ2	OTTHUMG00000150057	ENST00000370359.5:c.60C>T	6.37:g.74079456G>A			A6NIN5|A9UIB7	Silent	SNP	NULL	p.S20	ENST00000370359.5	37	c.60	CCDS47451.1	6																																																																																			OOEP	-	NULL	ENSG00000203907		0.642	OOEP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	OOEP	HGNC	protein_coding	OTTHUMT00000108414.2	-	0.00	38	0	G	NM_001080507		74079456	-1	tier1	-	no_errors	ENST00000370359	ensembl	human	known	74_37	silent	10.00	36	4	SNP	0.001	A
OR2G2	81470	genome.wustl.edu	37	1	247752347	247752347	+	Nonsense_Mutation	SNP	T	T	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr1:247752347T>A	ENST00000320065.1	+	1	686	c.686T>A	c.(685-687)tTg>tAg	p.L229*	RP11-978I15.10_ENST00000435333.1_RNA|RP11-978I15.10_ENST00000446347.1_RNA	NM_001001915.1	NP_001001915.1	Q8NGZ5	OR2G2_HUMAN	olfactory receptor, family 2, subfamily G, member 2	229						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(4)|large_intestine(3)|lung(30)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			CACGCAGTGTTGAGGATTAAG	0.473																																																	0													154.0	145.0	148.0					1																	247752347		2203	4300	6503	SO:0001587	stop_gained	0			BK004472	CCDS31092.1	1q44	2012-08-09	2008-05-23		ENSG00000177489	ENSG00000177489		"""GPCR / Class A : Olfactory receptors"""	15007	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily G, member 2"", ""olfactory receptor, family 2, subfamily G, member 2 pseudogene"""				Standard	NM_001001915		Approved		uc010pyy.2	Q8NGZ5	OTTHUMG00000040575	ENST00000320065.1:c.686T>A	1.37:g.247752347T>A	ENSP00000326349:p.Leu229*		Q5JQT2|Q6IEZ0	Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L229*	ENST00000320065.1	37	c.686	CCDS31092.1	1	.	.	.	.	.	.	.	.	.	.	T	13.07	2.126836	0.37533	.	.	ENSG00000177489	ENST00000320065	.	.	.	4.29	4.29	0.51040	.	0.000000	0.29884	U	0.010954	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.4683	0.50252	0.0:0.0:0.0:1.0	.	.	.	.	X	229	.	ENSP00000326349:L229X	L	+	2	0	OR2G2	245818970	0.003000	0.15002	0.021000	0.16686	0.043000	0.13939	1.462000	0.35266	1.789000	0.52484	0.481000	0.45027	TTG	OR2G2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000177489		0.473	OR2G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2G2	HGNC	protein_coding	OTTHUMT00000097623.1	-	0.00	67	0	T			247752347	+1	tier1	-	no_errors	ENST00000320065	ensembl	human	known	74_37	nonsense	5.56	68	4	SNP	0.035	A
OR2L13	284521	genome.wustl.edu	37	1	248262873	248262873	+	Missense_Mutation	SNP	T	T	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr1:248262873T>C	ENST00000358120.2	+	2	341	c.196T>C	c.(196-198)Tcc>Ccc	p.S66P	OR2L13_ENST00000366478.2_Missense_Mutation_p.S66P			Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L, member 13	66						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(32)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	59	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			CAGCCAGCTCTCCCTTATGGA	0.542																																																	0													239.0	217.0	225.0					1																	248262873		2203	4300	6503	SO:0001583	missense	0			BC028158	CCDS1637.1	1q44	2012-08-09			ENSG00000196071	ENSG00000196071		"""GPCR / Class A : Olfactory receptors"""	19578	protein-coding gene	gene with protein product				OR2L14			Standard	NM_175911		Approved		uc001ids.3	Q8N349	OTTHUMG00000040446	ENST00000358120.2:c.196T>C	1.37:g.248262873T>C	ENSP00000350836:p.Ser66Pro		Q5VUR5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S66P	ENST00000358120.2	37	c.196	CCDS1637.1	1	.	.	.	.	.	.	.	.	.	.	T	17.03	3.284644	0.59867	.	.	ENSG00000196071	ENST00000366478;ENST00000358120	T;T	0.12361	2.69;2.69	4.07	2.86	0.33363	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43260	D	0.000586	T	0.46698	0.1406	H	0.95850	3.73	0.24208	N	0.995481	D	0.76494	0.999	D	0.80764	0.994	T	0.46555	-0.9183	10	0.87932	D	0	.	10.5578	0.45127	0.0:0.0:0.2867:0.7133	.	66	Q8N349	OR2LD_HUMAN	P	66	ENSP00000355434:S66P;ENSP00000350836:S66P	ENSP00000350836:S66P	S	+	1	0	OR2L13	246329496	0.010000	0.17322	1.000000	0.80357	0.991000	0.79684	0.011000	0.13264	1.688000	0.51068	0.528000	0.53228	TCC	OR2L13	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000196071		0.542	OR2L13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2L13	HGNC	protein_coding	OTTHUMT00000097342.1	-	0.00	55	0	T	NM_175911		248262873	+1	tier1	-	no_errors	ENST00000358120	ensembl	human	known	74_37	missense	30.77	45	20	SNP	0.775	C
OR4A15	81328	genome.wustl.edu	37	11	55135647	55135647	+	Silent	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr11:55135647C>T	ENST00000314706.3	+	1	288	c.288C>T	c.(286-288)ttC>ttT	p.F96F		NM_001005275.1	NP_001005275.1	Q8NGL6	O4A15_HUMAN	olfactory receptor, family 4, subfamily A, member 15	96						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(48)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	71						CTTTATCATTCATAGATACCG	0.433																																																	0													120.0	118.0	119.0					11																	55135647		2201	4296	6497	SO:0001819	synonymous_variant	0			AB065776	CCDS31500.1	11q11	2012-08-09			ENSG00000181958	ENSG00000181958		"""GPCR / Class A : Olfactory receptors"""	15152	protein-coding gene	gene with protein product							Standard	NM_001005275		Approved		uc010rif.2	Q8NGL6	OTTHUMG00000166711	ENST00000314706.3:c.288C>T	11.37:g.55135647C>T			Q6IFL4|Q96R65	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F96	ENST00000314706.3	37	c.288	CCDS31500.1	11																																																																																			OR4A15	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000181958		0.433	OR4A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A15	HGNC	protein_coding	OTTHUMT00000391161.1	-	0.00	79	0	C	NM_001005275		55135647	+1	tier1	-	no_errors	ENST00000314706	ensembl	human	known	74_37	silent	24.62	49	16	SNP	0.000	T
OR51Q1	390061	genome.wustl.edu	37	11	5443799	5443799	+	Missense_Mutation	SNP	C	C	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr11:5443799C>A	ENST00000300778.4	+	1	459	c.369C>A	c.(367-369)gaC>gaA	p.D123E	HBG2_ENST00000380259.2_Intron|HBG2_ENST00000380252.1_Intron|AC104389.28_ENST00000415970.1_RNA|HBE1_ENST00000380237.1_Intron	NM_001004757.2	NP_001004757.1	Q8NH59	O51Q1_HUMAN	olfactory receptor, family 51, subfamily Q, member 1 (gene/pseudogene)	123						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(2)|large_intestine(3)|liver(2)|lung(21)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	37		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;2.18e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGTCCGTTGACTGCTATGTGG	0.483																																																	0													233.0	197.0	209.0					11																	5443799		2201	4297	6498	SO:0001583	missense	0			AB065531	CCDS31381.1	11p15.4	2013-10-10	2013-10-10		ENSG00000167360	ENSG00000167360		"""GPCR / Class A : Olfactory receptors"""	14851	protein-coding gene	gene with protein product			"""olfactory receptor, family 51, subfamily Q, member 1"""				Standard	NM_001004757		Approved		uc010qzd.2	Q8NH59	OTTHUMG00000066896	ENST00000300778.4:c.369C>A	11.37:g.5443799C>A	ENSP00000300778:p.Asp123Glu		B2RNN1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.D123E	ENST00000300778.4	37	c.369	CCDS31381.1	11	.	.	.	.	.	.	.	.	.	.	C	16.85	3.235833	0.58886	.	.	ENSG00000167360	ENST00000300778	T	0.51817	0.69	5.0	0.559	0.17272	GPCR, rhodopsin-like superfamily (1);	0.191912	0.36066	N	0.002803	T	0.79028	0.4377	H	0.99391	4.545	0.37976	D	0.933441	D	0.89917	1.0	D	0.83275	0.996	T	0.83196	-0.0081	10	0.87932	D	0	.	9.9109	0.41406	0.0:0.6409:0.0:0.3591	.	123	Q8NH59	O51Q1_HUMAN	E	123	ENSP00000300778:D123E	ENSP00000300778:D123E	D	+	3	2	OR51Q1	5400375	0.999000	0.42202	1.000000	0.80357	0.715000	0.41141	1.024000	0.30077	0.271000	0.22005	0.380000	0.24917	GAC	OR51Q1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000167360		0.483	OR51Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51Q1	HGNC	protein_coding	OTTHUMT00000143373.1	-	0.00	32	0	C	NM_001004757		5443799	+1	tier1	-	no_errors	ENST00000300778	ensembl	human	known	74_37	missense	20.00	16	4	SNP	1.000	A
OR5B2	390190	genome.wustl.edu	37	11	58190052	58190052	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr11:58190052G>A	ENST00000302581.2	-	1	734	c.683C>T	c.(682-684)tCa>tTa	p.S228L		NM_001005566.2	NP_001005566.1	Q96R09	OR5B2_HUMAN	olfactory receptor, family 5, subfamily B, member 2	228						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|large_intestine(2)|lung(19)|ovary(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				TCCCTTAGCTGAATGCATCTT	0.403																																																	0													97.0	91.0	93.0					11																	58190052		2201	4295	6496	SO:0001583	missense	0			AB065852	CCDS31550.1	11q12.1	2012-08-09			ENSG00000172365	ENSG00000172365		"""GPCR / Class A : Olfactory receptors"""	8323	protein-coding gene	gene with protein product							Standard	NM_001005566		Approved	OST073	uc010rkg.2	Q96R09	OTTHUMG00000167517	ENST00000302581.2:c.683C>T	11.37:g.58190052G>A	ENSP00000303076:p.Ser228Leu		B2RNJ6|B9EGY7|Q6IEV7|Q8NGF5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S228L	ENST00000302581.2	37	c.683	CCDS31550.1	11	.	.	.	.	.	.	.	.	.	.	G	11.36	1.615324	0.28801	.	.	ENSG00000172365	ENST00000302581	T	0.00330	8.08	3.73	3.73	0.42828	GPCR, rhodopsin-like superfamily (1);	0.000000	0.29783	U	0.011205	T	0.00695	0.0023	M	0.93106	3.38	0.09310	N	1	P	0.40731	0.728	P	0.46850	0.529	T	0.06127	-1.0844	10	0.87932	D	0	-5.607	14.5682	0.68194	0.0:0.0:1.0:0.0	.	228	Q96R09	OR5B2_HUMAN	L	228	ENSP00000303076:S228L	ENSP00000303076:S228L	S	-	2	0	OR5B2	57946628	0.004000	0.15560	0.071000	0.20095	0.010000	0.07245	1.263000	0.33004	2.098000	0.63641	0.585000	0.79938	TCA	OR5B2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000172365		0.403	OR5B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5B2	HGNC	protein_coding	OTTHUMT00000394887.2	-	0.00	50	0	G	NM_001005566		58190052	-1	tier1	-	no_errors	ENST00000302581	ensembl	human	known	74_37	missense	38.33	36	23	SNP	0.003	A
OR4D6	219983	genome.wustl.edu	37	11	59224784	59224784	+	Silent	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr11:59224784G>A	ENST00000300127.2	+	1	374	c.351G>A	c.(349-351)gtG>gtA	p.V117V		NM_001004708.1	NP_001004708.1	Q8NGJ1	OR4D6_HUMAN	olfactory receptor, family 4, subfamily D, member 6	117						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	34						TCCTCTCTGTGATGGCCTATG	0.478																																																	0													203.0	196.0	199.0					11																	59224784		2201	4295	6496	SO:0001819	synonymous_variant	0			AB065803	CCDS31562.1	11q12.1	2012-08-09			ENSG00000166884	ENSG00000166884		"""GPCR / Class A : Olfactory receptors"""	15175	protein-coding gene	gene with protein product							Standard	NM_001004708		Approved		uc010rku.2	Q8NGJ1	OTTHUMG00000167340	ENST00000300127.2:c.351G>A	11.37:g.59224784G>A			B2RNP7|Q6IFF5|Q96R74	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V117	ENST00000300127.2	37	c.351	CCDS31562.1	11																																																																																			OR4D6	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000166884		0.478	OR4D6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4D6	HGNC	protein_coding	OTTHUMT00000394234.1	-	0.00	20	0	G	NM_001004708		59224784	+1	tier1	-	no_errors	ENST00000300127	ensembl	human	known	74_37	silent	15.38	33	6	SNP	0.967	A
OR5V1	81696	genome.wustl.edu	37	6	29323469	29323469	+	Silent	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr6:29323469G>A	ENST00000377154.1	-	4	803	c.504C>T	c.(502-504)ttC>ttT	p.F168F	OR5V1_ENST00000543825.1_Silent_p.F168F			Q9UGF6	OR5V1_HUMAN	olfactory receptor, family 5, subfamily V, member 1	168						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(3)|large_intestine(3)|liver(1)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						TGTTGCCACAGAAGGGCAGGC	0.458																																					Ovarian(32;43 883 21137 32120 42650)												0													90.0	86.0	88.0					6																	29323469		2203	4299	6502	SO:0001819	synonymous_variant	0				CCDS4657.1	6p22.1	2013-09-23				ENSG00000243729		"""GPCR / Class A : Olfactory receptors"""	13972	protein-coding gene	gene with protein product							Standard	NM_030876		Approved	hs6M1-21	uc011dlo.2	Q9UGF6		ENST00000377154.1:c.504C>T	6.37:g.29323469G>A			A2BDZ0|B0S860|Q5SQI9|Q6NTB5|Q8IVL3	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F168	ENST00000377154.1	37	c.504	CCDS4657.1	6																																																																																			OR5V1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000243729		0.458	OR5V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5V1	HGNC	protein_coding	OTTHUMT00000076398.3	-	0.00	15	0	G			29323469	-1	tier1	-	no_errors	ENST00000377154	ensembl	human	known	74_37	silent	77.78	8	28	SNP	0.996	A
OSBP2	23762	genome.wustl.edu	37	22	31218649	31218649	+	Intron	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr22:31218649C>T	ENST00000332585.6	+	3	957				OSBP2_ENST00000403222.3_Intron|OSBP2_ENST00000382310.3_Intron|OSBP2_ENST00000437268.2_Missense_Mutation_p.S11F|OSBP2_ENST00000401475.1_Intron|OSBP2_ENST00000407373.1_Intron|OSBP2_ENST00000446658.2_Intron	NM_001282739.1|NM_001282740.1|NM_001282741.1|NM_001282742.1|NM_030758.3	NP_001269668.1|NP_001269669.1|NP_001269670.1|NP_001269671.1|NP_110385.1	Q969R2	OSBP2_HUMAN	oxysterol binding protein 2						lipid transport (GO:0006869)	membrane (GO:0016020)	cholesterol binding (GO:0015485)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(6)|ovary(1)|skin(3)|urinary_tract(1)	19						GACACGGCCTCCGTGCGCTCC	0.687																																																	0																																										SO:0001627	intron_variant	0				CCDS43002.1, CCDS63448.1, CCDS63449.1, CCDS63450.1, CCDS63451.1	22q12.2	2013-01-10			ENSG00000184792	ENSG00000184792		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	8504	protein-coding gene	gene with protein product		606729		OSBPL1		10591208, 11278871, 11802775	Standard	NM_001282738		Approved	KIAA1664, ORP-4, ORP4	uc003aiy.1	Q969R2	OTTHUMG00000151153	ENST00000332585.6:c.854-47767C>T	22.37:g.31218649C>T			B0QYG1|B4DK24|B4DKE4|B4DTR3|F5H2A3|O60396|Q0VF99|Q8NA37|Q9BY96|Q9BZF0	Missense_Mutation	SNP	pfam_Oxysterol-bd,superfamily_DNA-bd_dom_put	p.S11F	ENST00000332585.6	37	c.32	CCDS43002.1	22	.	.	.	.	.	.	.	.	.	.	C	13.54	2.267973	0.40095	.	.	ENSG00000184792	ENST00000437268	T	0.44482	0.92	4.62	4.62	0.57501	.	.	.	.	.	T	0.65647	0.2711	.	.	.	0.80722	D	1	D	0.69078	0.997	D	0.78314	0.991	T	0.71170	-0.4671	8	0.66056	D	0.02	.	16.2369	0.82380	0.0:1.0:0.0:0.0	.	11	F5H2A3	.	F	11	ENSP00000389200:S11F	ENSP00000389200:S11F	S	+	2	0	OSBP2	29548649	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.197000	0.65141	2.127000	0.65507	0.655000	0.94253	TCC	OSBP2	-	NULL	ENSG00000184792		0.687	OSBP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OSBP2	HGNC	protein_coding	OTTHUMT00000321547.2	-	0.00	55	0	C	NM_030758		31218649	+1	tier1	-	no_errors	ENST00000437268	ensembl	human	known	74_37	missense	57.45	20	27	SNP	1.000	T
OTUD6B	51633	genome.wustl.edu	37	8	92086058	92086058	+	Splice_Site	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr8:92086058G>C	ENST00000285420.4	+	3	423		c.e3-1		OTUD6B_ENST00000404789.3_Splice_Site	NM_016023.3	NP_057107.3	Q8N6M0	OTU6B_HUMAN	OTU domain containing 6B								cysteine-type peptidase activity (GO:0008234)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)	11			BRCA - Breast invasive adenocarcinoma(11;0.0187)			GTTTCCTTCAGATAGATTCTG	0.333																																																	0													94.0	83.0	87.0					8																	92086058		2202	4298	6500	SO:0001630	splice_region_variant	0				CCDS6253.2, CCDS69513.1	8q21.3	2013-01-21			ENSG00000155100	ENSG00000155100		"""OTU domain containing"""	24281	protein-coding gene	gene with protein product		612021					Standard	NM_016023		Approved	CGI-77, DUBA5	uc003yeu.4	Q8N6M0	OTTHUMG00000150758	ENST00000285420.4:c.325-1G>C	8.37:g.92086058G>C			A8K6I1|B4DEY0|Q9NTA4|Q9Y387	Splice_Site	SNP	-	e3-1	ENST00000285420.4	37	c.325-1	CCDS6253.2	8	.	.	.	.	.	.	.	.	.	.	G	21.4	4.137998	0.77775	.	.	ENSG00000155100	ENST00000285420	.	.	.	6.17	6.17	0.99709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0599	0.93085	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	OTUD6B	92155234	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.271000	0.72569	2.941000	0.99782	0.655000	0.94253	.	OTUD6B	-	-	ENSG00000155100		0.333	OTUD6B-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	OTUD6B	HGNC	protein_coding	OTTHUMT00000319968.1	-	0.00	32	0	G	NM_016023	Intron	92086058	+1	tier1	-	no_errors	ENST00000285420	ensembl	human	known	74_37	splice_site	41.94	18	13	SNP	1.000	C
P2RY12	64805	genome.wustl.edu	37	3	151056001	151056001	+	Silent	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr3:151056001G>C	ENST00000302632.3	-	3	932	c.633C>G	c.(631-633)ctC>ctG	p.L211L	MED12L_ENST00000491549.1_Intron|MED12L_ENST00000474524.1_Intron|MED12L_ENST00000273432.4_Intron	NM_022788.4|NM_176876.2	NP_073625.1|NP_795345.1	Q9H244	P2Y12_HUMAN	purinergic receptor P2Y, G-protein coupled, 12	211					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell projection organization (GO:0030030)|G-protein coupled purinergic nucleotide receptor signaling pathway (GO:0035589)|G-protein coupled receptor signaling pathway (GO:0007186)|hemostasis (GO:0007599)|negative regulation of cell differentiation (GO:0045596)|negative regulation of norepinephrine secretion (GO:0010700)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of GTPase activity (GO:0043547)|positive regulation of ion transport (GO:0043270)|potassium ion transmembrane transport (GO:0071805)|protein kinase B signaling (GO:0043491)|regulation of calcium ion transport (GO:0051924)	basal plasma membrane (GO:0009925)|caveola (GO:0005901)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	ADP receptor activity (GO:0001621)|G-protein coupled adenosine receptor activity (GO:0001609)|guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)	17			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)		Clopidogrel(DB00758)|Epoprostenol(DB01240)|Prasugrel(DB06209)|Ticagrelor(DB08816)|Ticlopidine(DB00208)|Treprostinil(DB00374)	CTTTTGTAATGAGTGTATAAC	0.348																																																	0													69.0	71.0	70.0					3																	151056001		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ320495	CCDS3159.1	3q24-q25	2014-09-17			ENSG00000169313	ENSG00000169313		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	18124	protein-coding gene	gene with protein product		600515				11502873, 11104774	Standard	NM_022788		Approved	P2Y12, SP1999, HORK3	uc003eyw.1	Q9H244	OTTHUMG00000159863	ENST00000302632.3:c.633C>G	3.37:g.151056001G>C			D3DNJ5|Q546J7	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_P2Y12_rcpt,prints_GPCR_Rhodpsn,prints_P2Y13_rcpt,prints_P2Y14_rcpt	p.L211	ENST00000302632.3	37	c.633	CCDS3159.1	3																																																																																			P2RY12	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000169313		0.348	P2RY12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RY12	HGNC	protein_coding	OTTHUMT00000357796.1	-	0.00	74	0	G			151056001	-1	tier1	-	no_errors	ENST00000302632	ensembl	human	known	74_37	silent	47.01	62	55	SNP	0.932	C
PACS2	23241	genome.wustl.edu	37	14	105849685	105849685	+	Intron	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr14:105849685C>T	ENST00000325438.8	+	16	2117				PACS2_ENST00000458164.2_Intron|PACS2_ENST00000430725.2_Intron|PACS2_ENST00000551743.1_Silent_p.L49L|PACS2_ENST00000447393.1_Intron|PACS2_ENST00000547217.1_Intron			Q86VP3	PACS2_HUMAN	phosphofurin acidic cluster sorting protein 2						apoptotic process (GO:0006915)|autophagic vacuole assembly (GO:0000045)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to plasma membrane (GO:0072661)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)				endometrium(2)|kidney(2)|lung(7)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	21		all_cancers(154;0.0351)|all_epithelial(191;0.153)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)|Epithelial(46;0.036)	Epithelial(152;0.138)		CCACCTGCCTCTGGATTGCAG	0.657																																																	0													59.0	62.0	61.0					14																	105849685		2203	4300	6503	SO:0001627	intron_variant	0			AB011174	CCDS32168.1, CCDS45178.1, CCDS45178.2, CCDS58339.1	14q32	2005-02-15	2005-02-15	2005-02-15		ENSG00000179364			23794	protein-coding gene	gene with protein product		610423	"""phosphofurin acidic cluster sorting protein 1-like"""	PACS1L		15692567	Standard	NM_001100913		Approved	KIAA0602	uc001yqu.3	Q86VP3	OTTHUMG00000170450	ENST00000325438.8:c.1614-11C>T	14.37:g.105849685C>T			A2VDJ9|G8JLK3|O60342|Q6P191|Q96FL7	Silent	SNP	pfam_Phosphofurin_acidic_CS-1	p.L49	ENST00000325438.8	37	c.145	CCDS32168.1	14																																																																																			PACS2	-	NULL	ENSG00000179364		0.657	PACS2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PACS2	HGNC	protein_coding	OTTHUMT00000409209.1	-	0.00	32	0	C	XM_377355		105849685	+1	tier1	-	no_errors	ENST00000551743	ensembl	human	putative	74_37	silent	18.52	22	5	SNP	0.000	T
PCDHA3	56145	genome.wustl.edu	37	5	140181759	140181759	+	Missense_Mutation	SNP	G	G	T	rs148196865		TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr5:140181759G>T	ENST00000522353.2	+	1	977	c.977G>T	c.(976-978)gGa>gTa	p.G326V	PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000532566.2_Missense_Mutation_p.G326V|PCDHA2_ENST00000520672.2_Intron	NM_018906.2	NP_061729.1	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3	326	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.G326E(1)		NS(1)|breast(1)|endometrium(16)|kidney(3)|large_intestine(19)|lung(36)|ovary(7)|prostate(8)|skin(3)|stomach(1)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACGGATAAAGGAAATCCCCCA	0.378																																																	1	Substitution - Missense(1)	skin(1)											166.0	165.0	165.0					5																	140181759		2203	4300	6503	SO:0001583	missense	0			AF152481	CCDS54915.1	5q31	2010-11-26				ENSG00000255408		"""Cadherins / Protocadherins : Clustered"""	8669	other	complex locus constituent	"""KIAA0345-like 11"""	606309				10380929	Standard	NM_018906		Approved	PCDH-ALPHA3		Q9Y5H8		ENST00000522353.2:c.977G>T	5.37:g.140181759G>T	ENSP00000429808:p.Gly326Val		O75286	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.G326V	ENST00000522353.2	37	c.977	CCDS54915.1	5	.	.	.	.	.	.	.	.	.	.	g	15.89	2.965274	0.53507	.	.	ENSG00000255408	ENST00000522353;ENST00000532566	T;T	0.68181	-0.31;-0.31	4.79	4.79	0.61399	Cadherin (4);Cadherin-like (1);	0.000000	0.40728	U	0.001031	D	0.88262	0.6389	H	0.97186	3.955	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.92507	0.6013	10	0.87932	D	0	.	18.1862	0.89793	0.0:0.0:1.0:0.0	.	326;326	Q9Y5H8-2;Q9Y5H8	.;PCDA3_HUMAN	V	326	ENSP00000429808:G326V;ENSP00000434086:G326V	ENSP00000429808:G326V	G	+	2	0	PCDHA3	140161943	1.000000	0.71417	0.991000	0.47740	0.919000	0.55068	6.167000	0.71902	2.378000	0.81104	0.467000	0.42956	GGA	PCDHA3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000255408		0.378	PCDHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA3	HGNC	protein_coding	OTTHUMT00000372848.2		0.00	37	0	G	NM_018906		140181759	+1			no_errors	ENST00000522353	ensembl	human	known	74_37	missense	8.70	21	2	SNP	0.995	T
PCDHA7	56141	genome.wustl.edu	37	5	140215524	140215524	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr5:140215524C>T	ENST00000525929.1	+	1	1556	c.1556C>T	c.(1555-1557)gCg>gTg	p.A519V	PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA7_ENST00000378125.3_Missense_Mutation_p.A519V|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA3_ENST00000522353.2_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	519	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAGGTGTACGCGCTGCAGCCG	0.682																																					NSCLC(160;258 2013 5070 22440 28951)												0													69.0	76.0	73.0					5																	140215524		2201	4287	6488	SO:0001583	missense	0			AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.1556C>T	5.37:g.140215524C>T	ENSP00000436426:p.Ala519Val		O75282	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A519V	ENST00000525929.1	37	c.1556	CCDS54918.1	5	.	.	.	.	.	.	.	.	.	.	C	14.69	2.609889	0.46527	.	.	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.43294	0.95;0.95	4.01	3.14	0.36123	Cadherin (5);Cadherin-like (1);	0.000000	0.31519	U	0.007514	T	0.41305	0.1153	L	0.35723	1.085	0.23838	N	0.996707	P;P	0.50156	0.932;0.802	P;P	0.50825	0.572;0.651	T	0.22800	-1.0206	10	0.62326	D	0.03	.	10.4793	0.44684	0.0:0.8329:0.0:0.1671	.	519;519	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	V	519	ENSP00000436426:A519V;ENSP00000367365:A519V	ENSP00000367365:A519V	A	+	2	0	PCDHA7	140195708	0.000000	0.05858	0.999000	0.59377	0.462000	0.32619	0.371000	0.20450	0.822000	0.34565	-0.665000	0.03846	GCG	PCDHA7	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	ENSG00000204963		0.682	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA7	HGNC	protein_coding	OTTHUMT00000372887.2	-	0.00	139	0	C	NM_018910		140215524	+1	tier1	-	no_errors	ENST00000525929	ensembl	human	known	74_37	missense	54.95	41	50	SNP	0.683	T
PCDHGC3	5098	genome.wustl.edu	37	5	140857757	140857757	+	Frame_Shift_Del	DEL	T	T	-			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr5:140857757delT	ENST00000308177.3	+	1	2178	c.2074delT	c.(2074-2076)tttfs	p.F692fs	PCDHGA8_ENST00000398604.2_Intron|RN7SL68P_ENST00000488078.2_RNA|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_002588.2|NM_032402.1	NP_002579.2|NP_115778.1	Q9UN70	PCDGK_HUMAN	protocadherin gamma subfamily C, 3	692					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(2)|urinary_tract(1)	29			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAATCTCACCTTTTATCTACT	0.488											OREG0016865	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													138.0	173.0	161.0					5																	140857757		2203	4300	6503	SO:0001589	frameshift_variant	0			AF152337	CCDS4261.1, CCDS75347.1, CCDS75348.1	5q31	2010-01-26			ENSG00000240184	ENSG00000240184		"""Cadherins / Protocadherins : Clustered"""	8716	other	protocadherin	"""cadherin-like 2"", ""protocadherin 2"", ""protocadherin 43"""	603627		PCDH2		9360932, 8508762	Standard	NM_032402		Approved	PC-43, PC43, PCDH-GAMMA-C3		Q9UN70	OTTHUMG00000129613	ENST00000308177.3:c.2074delT	5.37:g.140857757delT	ENSP00000312070:p.Phe692fs	1659	O60622|Q08192|Q9Y5C4	Frame_Shift_Del	DEL	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Y693fs	ENST00000308177.3	37	c.2074	CCDS4261.1	5																																																																																			PCDHGC3	-	NULL	ENSG00000240184		0.488	PCDHGC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGC3	HGNC	protein_coding	OTTHUMT00000251808.2		0.00	30	0	T	NM_002588		140857757	+1	tier1		no_errors	ENST00000308177	ensembl	human	known	74_37	frame_shift_del	8.70	21	2	DEL	1.000	-
DHRS7	51635	genome.wustl.edu	37	14	60635504	60635504	+	Intron	SNP	C	C	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr14:60635504C>A	ENST00000216500.5	-	1	160				DHRS7_ENST00000536410.2_Intron|PCNXL4_ENST00000553898.1_3'UTR|PCNXL4_ENST00000406949.1_3'UTR			Q9Y394	DHRS7_HUMAN	dehydrogenase/reductase (SDR family) member 7							membrane (GO:0016020)	oxidoreductase activity (GO:0016491)			endometrium(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	5				OV - Ovarian serous cystadenocarcinoma(108;0.121)		AAATCATACTCCATCCCATTG	0.383																																																	0													4.0	3.0	3.0					14																	60635504		812	1854	2666	SO:0001627	intron_variant	0			AF151844	CCDS9743.1	14q23.1	2011-09-20			ENSG00000100612	ENSG00000100612		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	21524	protein-coding gene	gene with protein product	"""retinal short-chain dehydrogenase/reductase 4"", ""short chain dehydrogenase/reductase family 34C, member 1"""	612833				10800688, 10810093, 19027726	Standard	NM_016029		Approved	retDSR4, SDR34C1	uc001xes.3	Q9Y394	OTTHUMG00000140331	ENST00000216500.5:c.295+910G>T	14.37:g.60635504C>A			B2R896|Q9UKU2	RNA	SNP	-	NULL	ENST00000216500.5	37	NULL	CCDS9743.1	14																																																																																			PCNXL4	-	-	ENSG00000126773		0.383	DHRS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNXL4	HGNC	protein_coding	OTTHUMT00000276947.2	-	0.00	45	0	C	NM_016029		60635504	+1	tier1	-	no_errors	ENST00000553898	ensembl	human	putative	74_37	rna	6.78	55	4	SNP	0.147	A
PDE4C	5143	genome.wustl.edu	37	19	18322726	18322726	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr19:18322726G>A	ENST00000355502.3	-	18	2505	c.1634C>T	c.(1633-1635)gCt>gTt	p.A545V	PDE4C_ENST00000594465.3_Missense_Mutation_p.A545V|PDE4C_ENST00000597297.1_Missense_Mutation_p.A315V|PDE4C_ENST00000598111.2_Missense_Mutation_p.A260V|PDE4C_ENST00000539010.1_Missense_Mutation_p.A314V|AC068499.10_ENST00000594805.3_RNA|AC068499.10_ENST00000599416.2_RNA|PDE4C_ENST00000594617.3_Missense_Mutation_p.A545V|PDE4C_ENST00000262805.12_Missense_Mutation_p.A513V|PDE4C_ENST00000447275.3_Missense_Mutation_p.A439V			Q08493	PDE4C_HUMAN	phosphodiesterase 4C, cAMP-specific	545					cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular space (GO:0005615)|primary cilium (GO:0072372)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	33					Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	GCTCAGATCAGCACAGTGCAC	0.642																																																	0													80.0	62.0	68.0					19																	18322726		2203	4300	6503	SO:0001583	missense	0				CCDS12373.1, CCDS42523.1, CCDS46016.1	19p13.11	2010-06-24	2010-06-24			ENSG00000105650	3.1.4.17	"""Phosphodiesterases"""	8782	protein-coding gene	gene with protein product	"""phosphodiesterase E1 dunce homolog (Drosophila)"""	600128	"""phosphodiesterase 4C, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E1)"""	DPDE1			Standard	NM_001098818		Approved		uc002nik.4	Q08493		ENST00000355502.3:c.1634C>T	19.37:g.18322726G>A	ENSP00000347689:p.Ala545Val		B3KTC4|Q9UN44|Q9UN45|Q9UN46|Q9UPJ6	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	p.A545V	ENST00000355502.3	37	c.1634	CCDS12373.1	19	.	.	.	.	.	.	.	.	.	.	G	18.40	3.616631	0.66672	.	.	ENSG00000105650	ENST00000536045;ENST00000355502;ENST00000536507;ENST00000262805;ENST00000447275;ENST00000545961;ENST00000336173;ENST00000539010;ENST00000543547	T;T;T;T	0.80480	-1.38;-1.38;-1.38;-1.38	4.64	4.64	0.57946	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.000000	0.85682	D	0.000000	D	0.92941	0.7754	H	0.96916	3.905	0.46279	D	0.998965	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.998;0.997;0.999	D	0.95217	0.8330	10	0.87932	D	0	.	15.0054	0.71507	0.0:0.0:1.0:0.0	.	545;513;351;260	Q08493;Q08493-3;O43850;O76104	PDE4C_HUMAN;.;.;.	V	624;545;533;513;439;351;259;314;654	ENSP00000347689:A545V;ENSP00000262805:A513V;ENSP00000402091:A439V;ENSP00000439470:A314V	ENSP00000262805:A513V	A	-	2	0	PDE4C	18183726	1.000000	0.71417	0.340000	0.25575	0.083000	0.17756	9.377000	0.97184	2.137000	0.66172	0.561000	0.74099	GCT	PDE4C	-	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	ENSG00000105650		0.642	PDE4C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDE4C	HGNC	protein_coding	OTTHUMT00000466295.1		0.00	18	0	G			18322726	-1			no_errors	ENST00000355502	ensembl	human	known	74_37	missense	5.88	32	2	SNP	0.995	A
PDE6A	5145	genome.wustl.edu	37	5	149245776	149245776	+	Missense_Mutation	SNP	A	A	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr5:149245776A>G	ENST00000255266.5	-	20	2434	c.2315T>C	c.(2314-2316)cTt>cCt	p.L772P		NM_000440.2	NP_000431.2	P16499	PDE6A_HUMAN	phosphodiesterase 6A, cGMP-specific, rod, alpha	772					cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)	p.L772H(1)		breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	44			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Caffeine(DB00201)	GCCGACTTGAAGCTTAGGGAG	0.463																																																	1	Substitution - Missense(1)	lung(1)											176.0	161.0	166.0					5																	149245776		2203	4300	6503	SO:0001583	missense	0				CCDS4299.1	5q31.2-q34	2013-02-14			ENSG00000132915	ENSG00000132915	3.1.4.17	"""Phosphodiesterases"""	8785	protein-coding gene	gene with protein product		180071		PDEA		2155175	Standard	NM_000440		Approved	RP43	uc003lrg.4	P16499	OTTHUMG00000130047	ENST00000255266.5:c.2315T>C	5.37:g.149245776A>G	ENSP00000255266:p.Leu772Pro		Q0P638	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.L772P	ENST00000255266.5	37	c.2315	CCDS4299.1	5	.	.	.	.	.	.	.	.	.	.	A	18.07	3.542575	0.65198	.	.	ENSG00000132915	ENST00000255266	T	0.78595	-1.19	5.22	5.22	0.72569	5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.069182	0.64402	D	0.000014	D	0.82990	0.5157	M	0.85197	2.74	0.80722	D	1	B	0.30664	0.289	B	0.40477	0.33	T	0.83131	-0.0113	10	0.48119	T	0.1	.	13.053	0.58964	1.0:0.0:0.0:0.0	.	772	P16499	PDE6A_HUMAN	P	772	ENSP00000255266:L772P	ENSP00000255266:L772P	L	-	2	0	PDE6A	149225969	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.526000	0.90588	1.969000	0.57287	0.379000	0.24179	CTT	PDE6A	-	pfam_PDEase_catalytic_dom	ENSG00000132915		0.463	PDE6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE6A	HGNC	protein_coding	OTTHUMT00000252326.2		0.00	65	0	A			149245776	-1			no_errors	ENST00000255266	ensembl	human	known	74_37	missense	6.67	28	2	SNP	1.000	G
PDS5A	23244	genome.wustl.edu	37	4	39911951	39911951	+	Missense_Mutation	SNP	C	C	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr4:39911951C>A	ENST00000303538.8	-	10	1539	c.1000G>T	c.(1000-1002)Gat>Tat	p.D334Y	PDS5A_ENST00000503396.1_Missense_Mutation_p.D334Y	NM_001100399.1	NP_001093869.1			PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae)											breast(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(9)|lung(14)|prostate(3)|skin(1)|urinary_tract(1)	39						ACATGAATATCATTAAATCTA	0.333																																																	0													54.0	50.0	52.0					4																	39911951		1819	4088	5907	SO:0001583	missense	0			AF294791	CCDS47045.1, CCDS54759.1	4p14	2007-06-20			ENSG00000121892	ENSG00000121892			29088	protein-coding gene	gene with protein product		613200				11076961, 15855230	Standard	NM_001100399		Approved	KIAA0648, PIG54, SCC-112	uc003guv.4	Q29RF7	OTTHUMG00000160582	ENST00000303538.8:c.1000G>T	4.37:g.39911951C>A	ENSP00000303427:p.Asp334Tyr			Missense_Mutation	SNP	superfamily_ARM-type_fold	p.D334Y	ENST00000303538.8	37	c.1000	CCDS47045.1	4	.	.	.	.	.	.	.	.	.	.	C	25.1	4.608310	0.87258	.	.	ENSG00000121892	ENST00000303538;ENST00000503396	T;T	0.73258	-0.69;-0.73	5.06	5.06	0.68205	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.85141	0.5629	M	0.81942	2.565	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85834	0.1393	9	.	.	.	-12.8905	18.7958	0.91993	0.0:1.0:0.0:0.0	.	334;334	Q29RF7-3;Q29RF7	.;PDS5A_HUMAN	Y	334	ENSP00000303427:D334Y;ENSP00000426749:D334Y	.	D	-	1	0	PDS5A	39588346	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.718000	0.84743	2.520000	0.84964	0.650000	0.86243	GAT	PDS5A	-	superfamily_ARM-type_fold	ENSG00000121892		0.333	PDS5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDS5A	HGNC	protein_coding	OTTHUMT00000361287.1		0.00	25	0	C	NM_015200		39911951	-1			no_errors	ENST00000303538	ensembl	human	known	74_37	missense	8.33	22	2	SNP	1.000	A
PEX2	5828	genome.wustl.edu	37	8	77895531	77895531	+	Nonsense_Mutation	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr8:77895531G>C	ENST00000419564.2	-	4	1348	c.884C>G	c.(883-885)tCa>tGa	p.S295*	PEX2_ENST00000357039.4_Nonsense_Mutation_p.S295*|PEX2_ENST00000522527.1_Nonsense_Mutation_p.S295*|PEX2_ENST00000520103.1_Nonsense_Mutation_p.S295*	NM_001172087.1	NP_001165558.1	P28328	PEX2_HUMAN	peroxisomal biogenesis factor 2	295					bile acid biosynthetic process (GO:0006699)|cholesterol homeostasis (GO:0042632)|fatty acid beta-oxidation (GO:0006635)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|peroxisome organization (GO:0007031)|protein destabilization (GO:0031648)|protein import into peroxisome matrix (GO:0016558)|regulation of cholesterol biosynthetic process (GO:0045540)|very long-chain fatty acid metabolic process (GO:0000038)	Cdc73/Paf1 complex (GO:0016593)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	14						CTCGATTCCTGATTTCAGTGG	0.353																																																	0													99.0	101.0	100.0					8																	77895531		2203	4300	6503	SO:0001587	stop_gained	0			M86852	CCDS6221.1	8q21.11	2010-02-09	2010-01-25	2010-01-25		ENSG00000164751		"""RING-type (C3HC4) zinc fingers"""	9717	protein-coding gene	gene with protein product	"""Zellweger syndrome"", ""peroxin 2"""	170993	"""peroxisomal membrane protein 3 (35kD, Zellweger syndrome)"", ""peroxisomal membrane protein 3, 35kDa"""	PXMP3		1546315, 8858157	Standard	NM_000318		Approved	PMP35, PAF-1, RNF72, ZWS3	uc022awf.1	P28328		ENST00000419564.2:c.884C>G	8.37:g.77895531G>C	ENSP00000400984:p.Ser295*		Q567S6|Q9BW41	Nonsense_Mutation	SNP	pfam_Pex_N,smart_Znf_RING,pfscan_Znf_RING	p.S295*	ENST00000419564.2	37	c.884	CCDS6221.1	8	.	.	.	.	.	.	.	.	.	.	G	39	7.682377	0.98431	.	.	ENSG00000164751	ENST00000357039;ENST00000419564;ENST00000520103;ENST00000522527	.	.	.	5.35	4.49	0.54785	.	0.529631	0.20641	N	0.088411	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	-16.1962	5.1766	0.15139	0.1651:0.0:0.627:0.2079	.	.	.	.	X	295	.	ENSP00000349543:S295X	S	-	2	0	PEX2	78058086	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.002000	0.63952	1.507000	0.48752	0.557000	0.71058	TCA	PEX2	-	NULL	ENSG00000164751		0.353	PEX2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX2	HGNC	protein_coding	OTTHUMT00000379122.1	-	0.00	53	0	G	NM_000318		77895531	-1	tier1	-	no_errors	ENST00000357039	ensembl	human	known	74_37	nonsense	25.00	30	10	SNP	0.989	C
PF4V1	5197	genome.wustl.edu	37	4	74719096	74719096	+	Missense_Mutation	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr4:74719096G>C	ENST00000226524.3	+	1	191	c.17G>C	c.(16-18)aGg>aCg	p.R6T		NM_002620.2	NP_002611.1	P10720	PF4V_HUMAN	platelet factor 4 variant 1	6					cell chemotaxis (GO:0060326)|immune response (GO:0006955)	extracellular space (GO:0005615)	heparin binding (GO:0008201)			endometrium(1)|liver(2)	3	Breast(15;0.00102)		all cancers(17;0.00176)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)			TCCGCAGCCAGGTCCCGCCTC	0.642																																																	0													27.0	27.0	27.0					4																	74719096		2203	4299	6502	SO:0001583	missense	0			M26167	CCDS3561.1	4q12-q21	2008-08-15			ENSG00000109272	ENSG00000109272			8862	protein-coding gene	gene with protein product		173461				2725510	Standard	NM_002620		Approved	SCYB4V1, CXCL4V1, CXCL4L1	uc003hhg.1	P10720	OTTHUMG00000130177	ENST00000226524.3:c.17G>C	4.37:g.74719096G>C	ENSP00000226524:p.Arg6Thr		A1L4S0	Missense_Mutation	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom,prints_Chemokine_CXC	p.R6T	ENST00000226524.3	37	c.17	CCDS3561.1	4	.	.	.	.	.	.	.	.	.	.	G	8.410	0.844058	0.16963	.	.	ENSG00000109272	ENST00000226524	.	.	.	3.47	-3.68	0.04463	.	164.923000	0.00166	N	0.000000	T	0.16342	0.0393	N	0.08118	0	0.09310	N	1	B	0.11235	0.004	B	0.12156	0.007	T	0.06625	-1.0816	9	0.21014	T	0.42	.	2.2832	0.04120	0.1023:0.2429:0.1821:0.4727	.	6	P10720	PF4V_HUMAN	T	6	.	ENSP00000226524:R6T	R	+	2	0	PF4V1	74937960	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.074000	0.14662	-0.971000	0.03564	-0.972000	0.02603	AGG	PF4V1	-	NULL	ENSG00000109272		0.642	PF4V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PF4V1	HGNC	protein_coding	OTTHUMT00000252495.1	-	0.00	39	0	G			74719096	+1	tier1	-	no_errors	ENST00000226524	ensembl	human	known	74_37	missense	10.42	43	5	SNP	0.000	C
PFKFB2	5208	genome.wustl.edu	37	1	207243747	207243747	+	Silent	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr1:207243747G>A	ENST00000367080.3	+	12	1339	c.1215G>A	c.(1213-1215)aaG>aaA	p.K405K	PFKFB2_ENST00000545806.1_Silent_p.K372K|PFKFB2_ENST00000473310.1_Intron|PFKFB2_ENST00000367079.2_Silent_p.K405K|PFKFB2_ENST00000411990.2_Silent_p.K307K|PFKFB2_ENST00000541914.1_Silent_p.K219K	NM_006212.2	NP_006203.2	O60825	F262_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2	405	Fructose-2,6-bisphosphatase.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose catabolic process (GO:0006007)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|lactate metabolic process (GO:0006089)|positive regulation of glucokinase activity (GO:0033133)|positive regulation of insulin secretion (GO:0032024)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)|protein kinase binding (GO:0019901)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	20	Prostate(682;0.19)					TCTTGGATAAGGGCGCAGGTG	0.607																																																	0													58.0	43.0	48.0					1																	207243747		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS31003.1, CCDS31004.1	1q31-q32.2	2012-07-13			ENSG00000123836	ENSG00000123836	2.7.1.105, 3.1.3.46		8873	protein-coding gene	gene with protein product		171835					Standard	XM_005273162		Approved		uc001hfg.3	O60825	OTTHUMG00000036033	ENST00000367080.3:c.1215G>A	1.37:g.207243747G>A			O60824|Q5VVQ3|Q5VVQ4|Q9H3P1	Silent	SNP	pfam_6Phosfructo_kin,pfam_His_Pase_superF_clade-1,pfam_Chromatin_KTI12,superfamily_P-loop_NTPase,smart_His_Pase_superF_clade-1,pirsf_Bifunct_6PFK/fruc_bisP_Ptase,prints_6Pfruct_kin	p.K405	ENST00000367080.3	37	c.1215	CCDS31004.1	1																																																																																			PFKFB2	-	pirsf_Bifunct_6PFK/fruc_bisP_Ptase	ENSG00000123836		0.607	PFKFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PFKFB2	HGNC	protein_coding	OTTHUMT00000087838.1	-	0.00	58	0	G			207243747	+1	tier1	-	no_errors	ENST00000367080	ensembl	human	known	74_37	silent	16.28	36	7	SNP	0.999	A
PGRMC2	10424	genome.wustl.edu	37	4	129193573	129193573	+	Nonsense_Mutation	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr4:129193573G>C	ENST00000296425.5	-	2	538	c.518C>G	c.(517-519)tCa>tGa	p.S173*	PGRMC2_ENST00000512483.1_5'UTR|PGRMC2_ENST00000520121.1_Nonsense_Mutation_p.S197*|PGRMC2_ENST00000394276.3_5'UTR|PGRMC2_ENST00000503588.1_Nonsense_Mutation_p.S41*|PGRMC2_ENST00000503872.1_5'UTR			O15173	PGRC2_HUMAN	progesterone receptor membrane component 2	173	Cytochrome b5 heme-binding.				steroid hormone mediated signaling pathway (GO:0043401)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	heme binding (GO:0020037)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)										ATTCAAATCTGAGAGATCATC	0.373																																					Colon(78;371 1268 8296 41305 53030)												0													70.0	69.0	69.0					4																	129193573		2203	4300	6503	SO:0001587	stop_gained	0				CCDS3739.1, CCDS3739.2	4q26	2008-08-29			ENSG00000164040	ENSG00000164040			16089	protein-coding gene	gene with protein product		607735				9705155	Standard	NM_006320		Approved	PMBP, DG6	uc003igg.3	O15173	OTTHUMG00000133342	ENST00000296425.5:c.518C>G	4.37:g.129193573G>C	ENSP00000296425:p.Ser173*		Q569H1	Nonsense_Mutation	SNP	pfam_Cyt_B5-like_heme/steroid-bd,superfamily_Cyt_B5-like_heme/steroid-bd	p.S197*	ENST00000296425.5	37	c.590		4	.	.	.	.	.	.	.	.	.	.	G	46	12.692435	0.99689	.	.	ENSG00000164040	ENST00000296425;ENST00000520121	.	.	.	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-4.0154	18.3941	0.90493	0.0:0.0:1.0:0.0	.	.	.	.	X	173;197	.	ENSP00000296425:S173X	S	-	2	0	PGRMC2	129413023	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.901000	0.92560	2.578000	0.87016	0.555000	0.69702	TCA	PGRMC2	-	pfam_Cyt_B5-like_heme/steroid-bd,superfamily_Cyt_B5-like_heme/steroid-bd	ENSG00000164040		0.373	PGRMC2-007	KNOWN	basic|appris_principal	protein_coding	PGRMC2	HGNC	protein_coding	OTTHUMT00000470697.1	-	0.00	24	0	G			129193573	-1	tier1	-	no_errors	ENST00000520121	ensembl	human	known	74_37	nonsense	27.78	13	5	SNP	1.000	C
PHC2	1912	genome.wustl.edu	37	1	33838009	33838009	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr1:33838009C>T	ENST00000257118.5	-	2	267	c.214G>A	c.(214-216)Gct>Act	p.A72T	PHC2_ENST00000419414.2_Missense_Mutation_p.A72T|PHC2_ENST00000431992.1_Missense_Mutation_p.A72T|PHC2_ENST00000373416.1_5'UTR	NM_198040.2	NP_932157.1	Q8IXK0	PHC2_HUMAN	polyhomeotic homolog 2 (Drosophila)	72	Gln-rich.				multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				AGGTACTGAGCGGCCGTGCTG	0.662																																																	0													25.0	26.0	25.0					1																	33838009		2203	4300	6503	SO:0001583	missense	0			AJ419231	CCDS378.1, CCDS379.1	1p34.3	2013-01-10	2006-09-12	2002-11-15	ENSG00000134686	ENSG00000134686		"""Sterile alpha motif (SAM) domain containing"""	3183	protein-coding gene	gene with protein product		602979	"""early development regulator 2 (homolog of polyhomeotic 2)"", ""polyhomeotic-like 2 (Drosophila)"""	EDR2		9121482, 12384788	Standard	NM_198040		Approved	HPH2	uc001bxg.1	Q8IXK0	OTTHUMG00000004133	ENST00000257118.5:c.214G>A	1.37:g.33838009C>T	ENSP00000257118:p.Ala72Thr		A1L4Q1|A8KA40|D3DPR2|Q2TAL3|Q5T0C1|Q6NUJ6|Q6ZQR1|Q8N306|Q8TAG8|Q96BL4|Q9Y4Y7	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM,pfscan_Znf_FCS	p.A72T	ENST00000257118.5	37	c.214	CCDS378.1	1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.466438	0.84425	.	.	ENSG00000134686	ENST00000431992;ENST00000257118;ENST00000419414	T;T;T	0.74842	-0.29;-0.88;-0.42	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	D	0.86134	0.5860	M	0.79123	2.44	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.999;0.996;0.99	D	0.88060	0.2793	10	0.87932	D	0	-12.1186	15.8807	0.79201	0.0:1.0:0.0:0.0	.	72;72;72	A8KA40;B7ZLY0;Q8IXK0	.;.;PHC2_HUMAN	T	72	ENSP00000389436:A72T;ENSP00000257118:A72T;ENSP00000391440:A72T	ENSP00000257118:A72T	A	-	1	0	PHC2	33610596	1.000000	0.71417	0.066000	0.19879	0.390000	0.30446	7.621000	0.83083	2.326000	0.78906	0.655000	0.94253	GCT	PHC2	-	NULL	ENSG00000134686		0.662	PHC2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PHC2	HGNC	protein_coding	OTTHUMT00000011895.1		0.00	62	0	C	NM_198040		33838009	-1			no_errors	ENST00000419414	ensembl	human	known	74_37	missense	5.06	75	4	SNP	0.996	T
PHIP	55023	genome.wustl.edu	37	6	79668285	79668285	+	Missense_Mutation	SNP	T	T	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr6:79668285T>C	ENST00000275034.4	-	32	3856	c.3689A>G	c.(3688-3690)tAt>tGt	p.Y1230C	AL356776.1_ENST00000516160.2_RNA|PHIP_ENST00000479165.1_5'UTR	NM_017934.5	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	1230	Bromo 1. {ECO:0000255|PROSITE- ProRule:PRU00035}.				cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(10)|kidney(4)|large_intestine(20)|lung(20)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	68		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		ATGCTCTATATATCGAACTTC	0.308																																																	0													58.0	56.0	57.0					6																	79668285		2203	4299	6502	SO:0001583	missense	0			AF310250	CCDS4987.1	6q14	2013-01-09			ENSG00000146247	ENSG00000146247		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	15673	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 14"""	612870		WDR11		11018022	Standard	NM_017934		Approved	ndrp, FLJ20705, DCAF14, BRWD2	uc003pir.3	Q8WWQ0	OTTHUMG00000015071	ENST00000275034.4:c.3689A>G	6.37:g.79668285T>C	ENSP00000275034:p.Tyr1230Cys		A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_Quinonprotein_ADH-like_supfam,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Bromodomain	p.Y1230C	ENST00000275034.4	37	c.3689	CCDS4987.1	6	.	.	.	.	.	.	.	.	.	.	T	22.7	4.323622	0.81580	.	.	ENSG00000146247	ENST00000275034	T	0.18960	2.18	5.9	5.9	0.94986	Bromodomain (5);	0.000000	0.64402	D	0.000002	T	0.44850	0.1313	M	0.86651	2.83	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.52313	-0.8592	9	.	.	.	-16.8485	15.5056	0.75739	0.0:0.0:0.0:1.0	.	1230;1230	A7J992;Q8WWQ0	.;PHIP_HUMAN	C	1230	ENSP00000275034:Y1230C	.	Y	-	2	0	PHIP	79725004	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	8.017000	0.88712	2.254000	0.74563	0.460000	0.39030	TAT	PHIP	-	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain	ENSG00000146247		0.308	PHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHIP	HGNC	protein_coding	OTTHUMT00000041297.2	-	0.00	70	0	T			79668285	-1	tier1	-	no_errors	ENST00000275034	ensembl	human	known	74_37	missense	28.38	53	21	SNP	1.000	C
PIGG	54872	genome.wustl.edu	37	4	517563	517563	+	Missense_Mutation	SNP	G	G	C	rs114931121	byFrequency	TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr4:517563G>C	ENST00000453061.2	+	9	2036	c.1930G>C	c.(1930-1932)Gaa>Caa	p.E644Q	PIGG_ENST00000383028.4_Missense_Mutation_p.E511Q|PIGG_ENST00000296306.7_3'UTR|PIGG_ENST00000504346.1_Missense_Mutation_p.E555Q|PIGG_ENST00000310340.5_Missense_Mutation_p.E636Q	NM_001127178.1	NP_001120650.1	Q5H8A4	PIGG_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class G	644					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	CP2 mannose-ethanolamine phosphotransferase activity (GO:0051267)|phosphotransferase activity, for other substituted phosphate groups (GO:0016780)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	39						CTCTACCTCCGAAGTGCTCAG	0.637																																																	0													42.0	40.0	41.0					4																	517563		2203	4299	6502	SO:0001583	missense	0				CCDS3336.1, CCDS46992.1, CCDS75080.1, CCDS75081.1, CCDS75082.1, CCDS75083.1	4p16.3	2013-02-26	2006-06-28		ENSG00000174227	ENSG00000174227		"""Phosphatidylinositol glycan anchor biosynthesis"""	25985	protein-coding gene	gene with protein product			"""phosphatidylinositol glycan, class G"""			15632136	Standard	XM_005272287		Approved	FLJ20265, GPI7, LAS21	uc003gak.4	Q5H8A4	OTTHUMG00000112457	ENST00000453061.2:c.1930G>C	4.37:g.517563G>C	ENSP00000415203:p.Glu644Gln		B4DKC7|Q2TAK5|Q6UX31|Q7L5Y4|Q8N866|Q8NCC9|Q96SY9|Q9BVT7|Q9NXG5	Missense_Mutation	SNP	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.E644Q	ENST00000453061.2	37	c.1930	CCDS46992.1	4	.	.	.	.	.	.	.	.	.	.	G	7.833	0.720312	0.15372	.	.	ENSG00000174227	ENST00000310340;ENST00000453061;ENST00000504346;ENST00000383028	T;T;T;T	0.10860	3.15;3.16;2.83;2.83	5.55	0.868	0.19090	.	1.906990	0.02650	N	0.106292	T	0.09512	0.0234	L	0.33485	1.01	0.09310	N	1	B;B;B	0.22541	0.071;0.006;0.011	B;B;B	0.19946	0.027;0.011;0.025	T	0.38067	-0.9678	10	0.13108	T	0.6	-0.0566	7.8552	0.29478	0.1994:0.3197:0.4808:0.0	.	511;644;636	Q5H8A4-3;Q5H8A4;Q5H8A4-2	.;PIGG_HUMAN;.	Q	636;644;555;511	ENSP00000311750:E636Q;ENSP00000415203:E644Q;ENSP00000424800:E555Q;ENSP00000372494:E511Q	ENSP00000311750:E636Q	E	+	1	0	PIGG	507563	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.109000	0.15417	-0.314000	0.08716	-2.172000	0.00323	GAA	PIGG	-	NULL	ENSG00000174227		0.637	PIGG-001	KNOWN	basic|CCDS	protein_coding	PIGG	HGNC	protein_coding	OTTHUMT00000357494.1	-	0.00	22	0	G	NM_017733		517563	+1	tier1	-	no_errors	ENST00000453061	ensembl	human	known	74_37	missense	40.00	18	12	SNP	0.000	C
PKD1L1	168507	genome.wustl.edu	37	7	47933653	47933653	+	Missense_Mutation	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr7:47933653G>C	ENST00000289672.2	-	15	2325	c.2275C>G	c.(2275-2277)Cag>Gag	p.Q759E		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	759	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						CCTTCAATCTGAACCTGCAGG	0.552																																																	0													74.0	58.0	64.0					7																	47933653		2203	4300	6503	SO:0001583	missense	0			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.2275C>G	7.37:g.47933653G>C	ENSP00000289672:p.Gln759Glu		Q6UWK1	Missense_Mutation	SNP	pfam_PKD/REJ-like,pfam_PKD1_2_channel,pfam_PKD_dom,pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,superfamily_PKD_dom,smart_PKD/Chitinase_dom,smart_PLAT/LH2_dom,pfscan_PKD_dom,pfscan_PLAT/LH2_dom,pfscan_REJ-like	p.Q759E	ENST00000289672.2	37	c.2275	CCDS34633.1	7	.	.	.	.	.	.	.	.	.	.	g	14.20	2.463856	0.43736	.	.	ENSG00000158683	ENST00000289672	T	0.68903	-0.36	5.23	4.26	0.50523	Egg jelly receptor, REJ-like (1);PKD/REJ-like protein (1);	0.000000	0.48286	D	0.000183	T	0.76948	0.4059	M	0.61703	1.905	0.27330	N	0.956799	D	0.76494	0.999	D	0.70227	0.968	T	0.68078	-0.5504	10	0.30854	T	0.27	-12.6629	14.146	0.65351	0.0:0.0:0.8395:0.1604	.	759	Q8TDX9	PK1L1_HUMAN	E	759	ENSP00000289672:Q759E	ENSP00000289672:Q759E	Q	-	1	0	PKD1L1	47900178	1.000000	0.71417	0.834000	0.33040	0.271000	0.26615	4.424000	0.59868	2.462000	0.83206	0.543000	0.68304	CAG	PKD1L1	-	pfam_PKD/REJ-like,pfscan_REJ-like	ENSG00000158683		0.552	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD1L1	HGNC	protein_coding	OTTHUMT00000340974.1	-	0.00	16	0	G	NM_138295		47933653	-1	tier1	-	no_errors	ENST00000289672	ensembl	human	known	74_37	missense	45.45	6	5	SNP	0.998	C
PKHD1	5314	genome.wustl.edu	37	6	51483924	51483924	+	Silent	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr6:51483924G>A	ENST00000371117.3	-	67	12455	c.12180C>T	c.(12178-12180)ttC>ttT	p.F4060F	RP3-335N17.2_ENST00000454361.1_RNA|RP3-335N17.2_ENST00000589278.2_RNA|RP3-335N17.2_ENST00000587000.1_RNA	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	4060					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					AATGAAGGCAGAATGCCTCAG	0.537																																																	0													61.0	63.0	62.0					6																	51483924		2203	4300	6503	SO:0001819	synonymous_variant	0			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.12180C>T	6.37:g.51483924G>A			Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Silent	SNP	pfam_IPT,pfam_G8_domain,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,smart_IPT,smart_PbH1	p.F4060	ENST00000371117.3	37	c.12180	CCDS4935.1	6																																																																																			PKHD1	-	NULL	ENSG00000170927		0.537	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKHD1	HGNC	protein_coding	OTTHUMT00000040893.1	-	0.00	33	0	G	NM_138694		51483924	-1	tier1	-	no_errors	ENST00000371117	ensembl	human	known	74_37	silent	26.32	28	10	SNP	0.000	A
PKHD1L1	93035	genome.wustl.edu	37	8	110410724	110410724	+	Missense_Mutation	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr8:110410724G>C	ENST00000378402.5	+	12	1063	c.959G>C	c.(958-960)aGt>aCt	p.S320T		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	320	IPT/TIG 3.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			ACAGAAAATAGTATATGTTGC	0.353										HNSCC(38;0.096)																																							0													86.0	76.0	79.0					8																	110410724		1821	4074	5895	SO:0001583	missense	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.959G>C	8.37:g.110410724G>C	ENSP00000367655:p.Ser320Thr		Q567P2|Q9UF27	Missense_Mutation	SNP	pfam_IPT,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT,smart_PA14,smart_PbH1	p.S320T	ENST00000378402.5	37	c.959	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.446537	0.00178	.	.	ENSG00000205038	ENST00000378402	T	0.76316	-1.01	5.71	1.17	0.20885	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.403834	0.27280	N	0.020094	T	0.54967	0.1891	N	0.11845	0.185	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.32824	-0.9892	10	0.10902	T	0.67	.	10.7677	0.46303	0.0823:0.5137:0.404:0.0	.	320	Q86WI1	PKHL1_HUMAN	T	320	ENSP00000367655:S320T	ENSP00000367655:S320T	S	+	2	0	PKHD1L1	110479900	0.000000	0.05858	0.031000	0.17742	0.051000	0.14879	-0.956000	0.03865	0.300000	0.22699	0.563000	0.77884	AGT	PKHD1L1	-	pfam_IPT,superfamily_Ig_E-set,smart_IPT	ENSG00000205038		0.353	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	-	0.00	53	0	G	NM_177531		110410724	+1	tier1	-	no_errors	ENST00000378402	ensembl	human	known	74_37	missense	26.15	48	17	SNP	0.001	C
PLCXD3	345557	genome.wustl.edu	37	5	41510617	41510617	+	Silent	SNP	A	A	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr5:41510617A>T	ENST00000377801.3	-	1	86	c.12T>A	c.(10-12)tcT>tcA	p.S4S	PLCXD3_ENST00000328457.3_Silent_p.S4S			Q63HM9	PLCX3_HUMAN	phosphatidylinositol-specific phospholipase C, X domain containing 3	4					lipid catabolic process (GO:0016042)		phosphoric diester hydrolase activity (GO:0008081)|signal transducer activity (GO:0004871)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						TTTTCCCCTGAGACGAGGCCA	0.612																																																	0													45.0	38.0	40.0					5																	41510617		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS34150.1	5p13.1	2004-09-09			ENSG00000182836	ENSG00000182836			31822	protein-coding gene	gene with protein product							Standard	NM_001005473		Approved		uc003jmm.1	Q63HM9	OTTHUMG00000162076	ENST00000377801.3:c.12T>A	5.37:g.41510617A>T			A6NL04	Silent	SNP	pfam_PLipase_C_PInositol-sp_X_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_PInositol-sp_X_dom	p.S4	ENST00000377801.3	37	c.12	CCDS34150.1	5																																																																																			PLCXD3	-	NULL	ENSG00000182836		0.612	PLCXD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCXD3	HGNC	protein_coding	OTTHUMT00000367109.1	-	0.00	15	0	A	XM_293875		41510617	-1	tier1	-	no_errors	ENST00000328457	ensembl	human	known	74_37	silent	27.27	32	12	SNP	1.000	T
PLD2	5338	genome.wustl.edu	37	17	4721813	4721813	+	Silent	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr17:4721813C>T	ENST00000263088.6	+	20	2165	c.2034C>T	c.(2032-2034)taC>taT	p.Y678Y	PLD2_ENST00000572940.1_Silent_p.Y678Y	NM_001243108.1|NM_002663.4	NP_001230037.1|NP_002654.3	O14939	PLD2_HUMAN	phospholipase D2	678	Catalytic.				cytoskeleton organization (GO:0007010)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G-protein coupled receptor internalization (GO:0002031)|glycerophospholipid biosynthetic process (GO:0046474)|innate immune response (GO:0045087)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	brush border membrane (GO:0031526)|endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)			autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)	31					Choline(DB00122)	ACCGAGTCTACGTGCTTTTGC	0.607																																																	0													115.0	114.0	115.0					17																	4721813		2203	4300	6503	SO:0001819	synonymous_variant	0			AF035483	CCDS11057.1, CCDS58507.1	17p13.3	2008-04-14			ENSG00000129219	ENSG00000129219	3.1.4.4		9068	protein-coding gene	gene with protein product	"""choline phosphatase 2"""	602384				9858823, 9582313	Standard	NM_002663		Approved		uc002fzc.3	O14939	OTTHUMG00000090779	ENST00000263088.6:c.2034C>T	17.37:g.4721813C>T			I3L2C9|O43540|O43579|O43580|Q6PGR0|Q96BY3	Silent	SNP	pfam_Phox,pfam_PLipase_D/transphosphatidylase,superfamily_Phox,smart_Phox,smart_Pleckstrin_homology,smart_PLipase_D/transphosphatidylase,pirsf_PLipase_D_euk,pfscan_Phox,pfscan_PLipase_D/transphosphatidylase	p.Y678	ENST00000263088.6	37	c.2034	CCDS11057.1	17																																																																																			PLD2	-	pirsf_PLipase_D_euk	ENSG00000129219		0.607	PLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLD2	HGNC	protein_coding	OTTHUMT00000207561.3		0.00	24	0	C	NM_002663		4721813	+1			no_errors	ENST00000263088	ensembl	human	known	74_37	silent	17.65	14	3	SNP	0.995	T
PLEKHH2	130271	genome.wustl.edu	37	2	43927283	43927283	+	Missense_Mutation	SNP	G	G	A	rs146556619		TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr2:43927283G>A	ENST00000282406.4	+	8	1296	c.1186G>A	c.(1186-1188)Gat>Aat	p.D396N		NM_172069.3	NP_742066.2	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2	396					negative regulation of actin filament depolymerization (GO:0030835)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	actin binding (GO:0003779)	p.D396N(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(24)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	56		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				CCAGAGACTCGATTATTCATC	0.393																																																	1	Substitution - Missense(1)	pancreas(1)											70.0	67.0	68.0					2																	43927283		2203	4300	6503	SO:0001583	missense	0			AB095948	CCDS1812.1	2p22	2013-01-10			ENSG00000152527	ENSG00000152527		"""Pleckstrin homology (PH) domain containing"""	30506	protein-coding gene	gene with protein product		612723					Standard	NM_172069		Approved	KIAA2028, PLEKHH1L	uc010yny.2	Q8IVE3	OTTHUMG00000128657	ENST00000282406.4:c.1186G>A	2.37:g.43927283G>A	ENSP00000282406:p.Asp396Asn		Q5JPJ6|Q6P4Q1|Q8N3Q3	Missense_Mutation	SNP	pfam_Pleckstrin_homology,pfam_MyTH4_dom,pfam_FERM_central,superfamily_FERM_central,smart_Pleckstrin_homology,smart_MyTH4_dom,smart_Band_41_domain,pfscan_FERM_domain,pfscan_MyTH4_dom,pfscan_Pleckstrin_homology	p.D396N	ENST00000282406.4	37	c.1186	CCDS1812.1	2	.	.	.	.	.	.	.	.	.	.	G	26.6	4.757236	0.89843	.	.	ENSG00000152527	ENST00000282406	T	0.76839	-1.05	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	D	0.83986	0.5373	L	0.36672	1.1	0.80722	D	1	D;D	0.89917	1.0;1.0	P;D	0.97110	0.9;1.0	T	0.81782	-0.0775	10	0.36615	T	0.2	-9.8304	20.0655	0.97703	0.0:0.0:1.0:0.0	.	396;396	Q8IVE3;Q8IVE3-3	PKHH2_HUMAN;.	N	396	ENSP00000282406:D396N	ENSP00000282406:D396N	D	+	1	0	PLEKHH2	43780787	1.000000	0.71417	0.998000	0.56505	0.816000	0.46133	6.060000	0.71141	2.753000	0.94483	0.563000	0.77884	GAT	PLEKHH2	-	NULL	ENSG00000152527		0.393	PLEKHH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHH2	HGNC	protein_coding	OTTHUMT00000250537.1		0.00	24	0	G	NM_172069		43927283	+1			no_errors	ENST00000282406	ensembl	human	known	74_37	missense	10.00	18	2	SNP	1.000	A
Unknown	0	genome.wustl.edu	37	20	21106771	21106771	+	IGR	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr20:21106771C>T								LINC00237 (24571 upstream) : RNA5SP477 (12825 downstream)																							GCCGGACCCTCGCATCGGCCG	0.716																																																	0													4.0	6.0	5.0					20																	21106771		1809	3810	5619	SO:0001628	intergenic_variant	0																															20.37:g.21106771C>T				RNA	SNP	-	NULL		37	NULL		20																																																																																			PLK1S1	-	-	ENSG00000088970	0	0.716					PLK1S1	HGNC			-	0.00	18	0	C			21106771	+1	tier1	-	no_errors	ENST00000246027	ensembl	human	known	74_37	rna	27.27	16	6	SNP	0.000	T
PLS1	5357	genome.wustl.edu	37	3	142383112	142383112	+	Silent	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr3:142383112G>A	ENST00000337777.3	+	2	246	c.33G>A	c.(31-33)gaG>gaA	p.E11E	PLS1_ENST00000497002.1_Silent_p.E11E|PLS1_ENST00000457734.2_Silent_p.E11E	NM_002670.2	NP_002661.2	Q14651	PLSI_HUMAN	plastin 1	11	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	27						TTTCTCGGGAGGAGCTTGAAG	0.338																																																	0													85.0	87.0	86.0					3																	142383112		2203	4300	6503	SO:0001819	synonymous_variant	0			L20826	CCDS3125.1	3q23	2013-01-10	2010-02-10		ENSG00000120756	ENSG00000120756		"""EF-hand domain containing"""	9090	protein-coding gene	gene with protein product		602734	"""plastin 1 (I isoform)"""			8139549	Standard	NM_002670		Approved	I-plastin, Plastin-1	uc003euz.3	Q14651	OTTHUMG00000159292	ENST00000337777.3:c.33G>A	3.37:g.142383112G>A			A8K2Q1|D3DNG3|Q8NEG6	Silent	SNP	pfam_CH-domain,pfam_EF_hand_dom,superfamily_CH-domain,smart_EF_hand_dom,smart_CH-domain,pfscan_CH-domain,pfscan_EF_hand_dom	p.E11	ENST00000337777.3	37	c.33	CCDS3125.1	3																																																																																			PLS1	-	pfscan_EF_hand_dom	ENSG00000120756		0.338	PLS1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PLS1	HGNC	protein_coding	OTTHUMT00000354435.1	-	0.00	50	0	G	NM_002670		142383112	+1	tier1	-	no_errors	ENST00000337777	ensembl	human	known	74_37	silent	13.54	82	13	SNP	1.000	A
PLXNA3	55558	genome.wustl.edu	37	X	153695951	153695951	+	Missense_Mutation	SNP	G	G	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chrX:153695951G>T	ENST00000369682.3	+	20	3680	c.3505G>T	c.(3505-3507)Ggc>Tgc	p.G1169C		NM_017514.3	NP_059984.3	P51805	PLXA3_HUMAN	plexin A3	1169	IPT/TIG 4.				axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|hippocampus development (GO:0021766)|multicellular organismal development (GO:0007275)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|positive regulation of cytoskeleton organization (GO:0051495)|pyramidal neuron development (GO:0021860)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|trigeminal nerve structural organization (GO:0021637)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	48	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GCTGATAGGAGGCCAGCCGTG	0.632																																																	0													29.0	24.0	26.0					X																	153695951		2193	4294	6487	SO:0001583	missense	0			X74609	CCDS14752.1	Xq28	2008-02-05			ENSG00000130827	ENSG00000130827		"""Plexins"""	9101	protein-coding gene	gene with protein product		300022		PLXN4		8248200, 8733135	Standard	NM_017514		Approved	SEX, XAP-6, 6.3, Plxn3	uc004flm.3	P51805	OTTHUMG00000033290	ENST00000369682.3:c.3505G>T	X.37:g.153695951G>T	ENSP00000358696:p.Gly1169Cys		Q5HY36	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semap_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.G1169C	ENST00000369682.3	37	c.3505	CCDS14752.1	X	.	.	.	.	.	.	.	.	.	.	G	14.89	2.670828	0.47781	.	.	ENSG00000130827	ENST00000369682	T	0.80304	-1.36	5.37	4.49	0.54785	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.353879	0.30134	N	0.010331	D	0.83344	0.5234	L	0.42245	1.32	0.45837	D	0.998707	P	0.51537	0.946	P	0.61275	0.886	D	0.83996	0.0340	10	0.59425	D	0.04	.	11.7395	0.51784	0.0898:0.0:0.9102:0.0	.	1169	P51805	PLXA3_HUMAN	C	1169	ENSP00000358696:G1169C	ENSP00000358696:G1169C	G	+	1	0	PLXNA3	153349145	1.000000	0.71417	0.813000	0.32504	0.217000	0.24651	6.507000	0.73717	2.385000	0.81259	0.529000	0.55759	GGC	PLXNA3	-	pfam_IPT,superfamily_Ig_E-set,smart_IPT	ENSG00000130827		0.632	PLXNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA3	HGNC	protein_coding	OTTHUMT00000081634.1	-	0.00	35	0	G	NM_017514		153695951	+1	tier1	-	no_errors	ENST00000369682	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	T
PLXNA3	55558	genome.wustl.edu	37	X	153698330	153698330	+	Silent	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chrX:153698330C>T	ENST00000369682.3	+	29	4981	c.4806C>T	c.(4804-4806)ctC>ctT	p.L1602L	PLXNA3_ENST00000493546.1_3'UTR	NM_017514.3	NP_059984.3	P51805	PLXA3_HUMAN	plexin A3	1602					axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|hippocampus development (GO:0021766)|multicellular organismal development (GO:0007275)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|positive regulation of cytoskeleton organization (GO:0051495)|pyramidal neuron development (GO:0021860)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|trigeminal nerve structural organization (GO:0021637)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	48	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AGAGCTTGCTCCGCACGGCCA	0.622																																																	0													67.0	57.0	60.0					X																	153698330		2203	4300	6503	SO:0001819	synonymous_variant	0			X74609	CCDS14752.1	Xq28	2008-02-05			ENSG00000130827	ENSG00000130827		"""Plexins"""	9101	protein-coding gene	gene with protein product		300022		PLXN4		8248200, 8733135	Standard	NM_017514		Approved	SEX, XAP-6, 6.3, Plxn3	uc004flm.3	P51805	OTTHUMG00000033290	ENST00000369682.3:c.4806C>T	X.37:g.153698330C>T			Q5HY36	Silent	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semap_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.L1602	ENST00000369682.3	37	c.4806	CCDS14752.1	X																																																																																			PLXNA3	-	pfam_Plexin_cytoplasmic_RasGAP_dom,superfamily_Rho_GTPase_activation_prot	ENSG00000130827		0.622	PLXNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA3	HGNC	protein_coding	OTTHUMT00000081634.1	-	0.00	19	0	C	NM_017514		153698330	+1	tier1	-	no_errors	ENST00000369682	ensembl	human	known	74_37	silent	47.37	10	9	SNP	0.944	T
POTEB2	100287399	genome.wustl.edu	37	15	21063520	21063520	+	Silent	SNP	G	G	A	rs549164573	byFrequency	TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr15:21063520G>A	ENST00000454856.4	-	4	758	c.726C>T	c.(724-726)ggC>ggT	p.G242G	RNU6-749P_ENST00000459351.1_RNA	NM_001277303.1	NP_001264232.1	H3BUK9	POTB2_HUMAN	POTE ankyrin domain family, member B2	242																	GTTCATGTACGCCAAGCAAAA	0.294													G|||	55	0.0109824	0.028	0.0043	5008	,	,		17448	0.0		0.0129	False		,,,				2504	0.002																0													4.0	4.0	4.0					15																	21063520		859	1678	2537	SO:0001819	synonymous_variant	0				CCDS59248.1	15q11.2	2014-01-29			ENSG00000230031	ENSG00000230031		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	48327	protein-coding gene	gene with protein product							Standard	NM_001277303		Approved			H3BUK9	OTTHUMG00000185829	ENST00000454856.4:c.726C>T	15.37:g.21063520G>A				Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.G242	ENST00000454856.4	37	c.726	CCDS59248.1	15																																																																																			POTEB2	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000230031		0.294	POTEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEB2	HGNC	protein_coding	OTTHUMT00000471435.1	-	0.00	8	0	G			21063520	-1	tier1	-	no_errors	ENST00000454856	ensembl	human	known	74_37	silent	50.00	3	3	SNP	0.066	A
PPM1B	5495	genome.wustl.edu	37	2	44396133	44396133	+	5'UTR	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr2:44396133C>T	ENST00000282412.4	+	0	118				PPM1B_ENST00000409432.3_5'UTR|PPM1B_ENST00000378540.4_3'UTR|PPM1B_ENST00000345249.4_5'UTR|RP11-559M23.1_ENST00000609837.1_RNA|PPM1B_ENST00000409895.4_5'UTR|PPM1B_ENST00000378551.2_5'UTR	NM_002706.4	NP_002697.1	O75688	PPM1B_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1B						cytokine-mediated signaling pathway (GO:0019221)|N-terminal protein myristoylation (GO:0006499)|negative regulation of defense response to virus (GO:0050687)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)	cytosol (GO:0005829)|membrane (GO:0016020)	magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)			kidney(4)|large_intestine(3)|lung(7)|skin(2)	16		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CTCTGATTCTCAGGGTTCGGT	0.657																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AJ005801	CCDS1816.1, CCDS1817.1, CCDS1818.1, CCDS46271.1	2p22.1	2012-04-17	2010-03-05		ENSG00000138032	ENSG00000138032	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9276	protein-coding gene	gene with protein product	"""protein phosphatase 2C, beta isoform"""	603770	"""protein phosphatase 1B (formerly 2C), magnesium-dependent, beta isoform"""			9684878	Standard	NM_002706		Approved	PPC2BETAX, PP2CB, PP2CBETA	uc002rtt.3	O75688	OTTHUMG00000128757	ENST00000282412.4:c.-295C>T	2.37:g.44396133C>T			Q461Q2|Q4J6C1|Q4J6C2|Q658R4|Q96ER6|Q9HAY8	RNA	SNP	-	NULL	ENST00000282412.4	37	NULL	CCDS1817.1	2																																																																																			PPM1B	-	-	ENSG00000138032		0.657	PPM1B-001	KNOWN	basic|CCDS	protein_coding	PPM1B	HGNC	protein_coding	OTTHUMT00000250672.1	-	0.00	121	0	C	NM_002706		44396133	+1	tier1	-	no_errors	ENST00000378540	ensembl	human	known	74_37	rna	28.86	106	43	SNP	0.901	T
PRIM1	5557	genome.wustl.edu	37	12	57139922	57139922	+	Missense_Mutation	SNP	C	C	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr12:57139922C>A	ENST00000338193.6	-	5	522	c.486G>T	c.(484-486)agG>agT	p.R162S	PRIM1_ENST00000552408.1_5'Flank	NM_000946.2	NP_000937.1	P49642	PRI1_HUMAN	primase, DNA, polypeptide 1 (49kDa)	162					DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			kidney(1)|lung(6)|prostate(1)	8						GAACACCTCTCCTTCCAGAAT	0.368																																																	0													107.0	97.0	100.0					12																	57139922		1841	4092	5933	SO:0001583	missense	0			BC005266	CCDS44926.1	12q13.3	2007-06-19	2007-06-19			ENSG00000198056			9369	protein-coding gene	gene with protein product		176635				8530050	Standard	NM_000946		Approved		uc001smd.3	P49642	OTTHUMG00000170034	ENST00000338193.6:c.486G>T	12.37:g.57139922C>A	ENSP00000350491:p.Arg162Ser			Missense_Mutation	SNP	pfam_DNA_primase_S,tigrfam_DNA_primase_ssu_euk/arc	p.R162S	ENST00000338193.6	37	c.486	CCDS44926.1	12	.	.	.	.	.	.	.	.	.	.	C	20.4	3.979318	0.74360	.	.	ENSG00000198056	ENST00000537418;ENST00000338193;ENST00000550770	T;T	0.47869	0.83;0.83	5.0	2.13	0.27403	.	0.000000	0.85682	D	0.000000	T	0.69459	0.3113	M	0.90425	3.115	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	T	0.70684	-0.4804	10	0.54805	T	0.06	-9.9863	8.9255	0.35637	0.0:0.6784:0.0:0.3216	.	162	P49642	PRI1_HUMAN	S	163;162;165	ENSP00000350491:R162S;ENSP00000450185:R165S	ENSP00000350491:R162S	R	-	3	2	PRIM1	55426189	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.454000	0.44979	0.640000	0.30582	0.456000	0.33151	AGG	PRIM1	-	pfam_DNA_primase_S,tigrfam_DNA_primase_ssu_euk/arc	ENSG00000198056		0.368	PRIM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRIM1	HGNC	protein_coding	OTTHUMT00000406956.1	-	0.00	32	0	C	NM_000946		57139922	-1	tier1	-	no_errors	ENST00000338193	ensembl	human	known	74_37	missense	12.12	29	4	SNP	1.000	A
ZNF512B	57473	genome.wustl.edu	37	20	62654208	62654208	+	Intron	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr20:62654208C>T	ENST00000450537.1	-	1	56				PRPF6_ENST00000535781.1_Silent_p.Y582Y|ZNF512B_ENST00000217130.3_Intron			Q96KM6	Z512B_HUMAN	zinc finger protein 512B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					GCGCCGCGTACTTCGAGAAGA	0.572																																																	0													109.0	92.0	98.0					20																	62654208		2203	4300	6503	SO:0001627	intron_variant	0			AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.4+25849G>A	20.37:g.62654208C>T			Q08AK9|Q9ULM4	Silent	SNP	pfam_PRP1_N,smart_HAT,smart_TPR_repeat,pfscan_TPR-contain_dom	p.Y582	ENST00000450537.1	37	c.1746	CCDS13548.1	20																																																																																			PRPF6	-	smart_HAT	ENSG00000101161		0.572	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF6	HGNC	protein_coding	OTTHUMT00000080246.1	-	0.00	73	0	C	NM_020713		62654208	+1	tier1	-	no_errors	ENST00000266079	ensembl	human	known	74_37	silent	6.25	60	4	SNP	1.000	T
PTAR1	375743	genome.wustl.edu	37	9	72374807	72374807	+	Silent	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr9:72374807C>G	ENST00000340434.4	-	1	51	c.48G>C	c.(46-48)gtG>gtC	p.V16V	PTAR1_ENST00000377200.5_Silent_p.V16V|PTAR1_ENST00000472967.2_Silent_p.V16V	NM_001099666.1	NP_001093136.1	Q7Z6K3	PTAR1_HUMAN	protein prenyltransferase alpha subunit repeat containing 1	16					protein prenylation (GO:0018342)		protein prenyltransferase activity (GO:0008318)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)	5						TGATGTCCTTCACAACCCGCT	0.731																																																	0													15.0	18.0	17.0					9																	72374807		2027	4142	6169	SO:0001819	synonymous_variant	0			BC053622	CCDS47978.1	9q21.13	2008-10-01			ENSG00000188647	ENSG00000188647		"""Prenyltransferase alpha subunit repeat containing"""	30449	protein-coding gene	gene with protein product						12477932	Standard	NM_001099666		Approved		uc004ahj.4	Q7Z6K3	OTTHUMG00000019982	ENST00000340434.4:c.48G>C	9.37:g.72374807C>G			Q5T7V5|Q5T7V6	Silent	SNP	pfam_Prenyl_trans_a,pfscan_Prenyl_trans_a	p.V16	ENST00000340434.4	37	c.48	CCDS47978.1	9																																																																																			PTAR1	-	NULL	ENSG00000188647		0.731	PTAR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTAR1	HGNC	protein_coding	OTTHUMT00000052582.4	-	0.00	85	0	C	NM_001099666		72374807	-1	tier1	-	no_errors	ENST00000340434	ensembl	human	known	74_37	silent	28.26	66	26	SNP	1.000	G
PXMP2	5827	genome.wustl.edu	37	12	133272599	133272599	+	Silent	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr12:133272599C>T	ENST00000317479.3	+	3	431	c.366C>T	c.(364-366)ctC>ctT	p.L122L	PXMP2_ENST00000428960.2_Silent_p.L29L|PXMP2_ENST00000545677.1_Intron|PXMP2_ENST00000539093.1_Intron|PXMP2_ENST00000543589.1_Intron|RP13-672B3.2_ENST00000537262.1_Intron	NM_018663.1	NP_061133.1	Q9NR77	PXMP2_HUMAN	peroxisomal membrane protein 2, 22kDa	122						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|protein complex (GO:0043234)		p.L122L(1)		large_intestine(1)|liver(2)|lung(1)	4	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.86e-08)|Epithelial(86;2.47e-07)|all cancers(50;6.85e-06)		CGGCCTTCCTCATGTTGTTCT	0.532																																																	1	Substitution - coding silent(1)	lung(1)											90.0	87.0	88.0					12																	133272599		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS9279.1	12q24	2010-08-18	2002-08-29		ENSG00000176894	ENSG00000176894			9716	protein-coding gene	gene with protein product			"""peroxisomal membrane protein 2 (22kD)"""			11590176	Standard	NM_018663		Approved	PMP22	uc001ukt.3	Q9NR77	OTTHUMG00000168019	ENST00000317479.3:c.366C>T	12.37:g.133272599C>T				Silent	SNP	pfam_Mpv17_PMP22	p.L122	ENST00000317479.3	37	c.366	CCDS9279.1	12																																																																																			PXMP2	-	NULL	ENSG00000176894		0.532	PXMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PXMP2	HGNC	protein_coding	OTTHUMT00000397553.1	-	0.00	55	0	C	NM_018663		133272599	+1	tier1	-	no_errors	ENST00000317479	ensembl	human	known	74_37	silent	23.08	40	12	SNP	0.901	T
RBMXL2	27288	genome.wustl.edu	37	11	7111257	7111257	+	Silent	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr11:7111257C>T	ENST00000306904.5	+	1	1093	c.906C>T	c.(904-906)taC>taT	p.Y302Y		NM_014469.4	NP_055284.3	O75526	RMXL2_HUMAN	RNA binding motif protein, X-linked-like 2	302	Arg/Gly/Pro-rich.					nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15				Epithelial(150;5.14e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CGCCATCTTACGGAGGAGGAG	0.662																																																	0													17.0	20.0	19.0					11																	7111257		2195	4290	6485	SO:0001819	synonymous_variant	0			AF069682	CCDS7777.1	11p15	2013-07-16				ENSG00000170748		"""RNA binding motif (RRM) containing"""	17886	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G T"""	605444				10958650	Standard	NM_014469		Approved	HNRNPG-T, HNRPGT	uc001mfc.2	O75526		ENST00000306904.5:c.906C>T	11.37:g.7111257C>T			Q6PEZ2|Q9NQU0	Silent	SNP	pfam_RRM_dom,pfam_RBM1CTR,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	p.Y302	ENST00000306904.5	37	c.906	CCDS7777.1	11																																																																																			RBMXL2	-	NULL	ENSG00000170748		0.662	RBMXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL2	HGNC	protein_coding	OTTHUMT00000384552.1	-	0.00	23	0	C	NM_014469		7111257	+1	tier1	-	no_errors	ENST00000306904	ensembl	human	known	74_37	silent	17.14	29	6	SNP	1.000	T
RCL1	10171	genome.wustl.edu	37	9	4793197	4793197	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr9:4793197C>T	ENST00000381750.4	+	1	329	c.106C>T	c.(106-108)Cgg>Tgg	p.R36W	RCL1_ENST00000381732.3_Missense_Mutation_p.R36W	NM_005772.3	NP_005763.3	Q9Y2P8	RCL1_HUMAN	RNA terminal phosphate cyclase-like 1	36					ribosome biogenesis (GO:0042254)|RNA processing (GO:0006396)	nucleolus (GO:0005730)	catalytic activity (GO:0003824)			breast(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	9	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0206)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0244)		CCGAAAGATTCGGGCCAGAGA	0.677																																																	0													27.0	24.0	25.0					9																	4793197		2202	4299	6501	SO:0001583	missense	0			AJ276894	CCDS6456.1, CCDS69565.1, CCDS75810.1	9p24.1-p23	2008-02-05			ENSG00000120158	ENSG00000120158			17687	protein-coding gene	gene with protein product		611405					Standard	NM_001286701		Approved	RPCL1, RNAC	uc003zis.2	Q9Y2P8	OTTHUMG00000019474	ENST00000381750.4:c.106C>T	9.37:g.4793197C>T	ENSP00000371169:p.Arg36Trp		D3DRI2|Q5VYW9|Q5VZU1|Q9H9D0|Q9NY00|Q9P044	Missense_Mutation	SNP	pfam_RNA3'_phos_cyclase_dom,pfam_RNA3'-term_phos_cycl_insert,superfamily_RNA3'P_cycl/enolpyr_Trfase_a/b,pirsf_RNA3'_term_phos_cyc,tigrfam_RNA3'_term_phos_cyc_type_2	p.R36W	ENST00000381750.4	37	c.106	CCDS6456.1	9	.	.	.	.	.	.	.	.	.	.	C	35	5.493237	0.96339	.	.	ENSG00000120158	ENST00000381750;ENST00000381732	.	.	.	5.61	5.61	0.85477	-terminal phosphate cyclase-like, eukaryotic (2);-terminal phosphate cyclase domain (2);RNA 3&apos (6);-terminal phosphate cyclase/enolpyruvate transferase, alpha/beta (1);-terminal phosphate cyclase (1);	0.052700	0.85682	D	0.000000	D	0.87845	0.6280	H	0.95504	3.68	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	D	0.91006	0.4846	9	0.87932	D	0	-14.216	19.2541	0.93938	0.0:1.0:0.0:0.0	.	36	Q9Y2P8	RCL1_HUMAN	W	36	.	ENSP00000371151:R36W	R	+	1	2	RCL1	4783197	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	2.814000	0.48010	2.661000	0.90470	0.650000	0.86243	CGG	RCL1	-	pfam_RNA3'_phos_cyclase_dom,superfamily_RNA3'P_cycl/enolpyr_Trfase_a/b,pirsf_RNA3'_term_phos_cyc,tigrfam_RNA3'_term_phos_cyc_type_2	ENSG00000120158		0.677	RCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RCL1	HGNC	protein_coding	OTTHUMT00000051587.1	-	0.00	72	0	C	NM_005772		4793197	+1	tier1	-	no_errors	ENST00000381750	ensembl	human	known	74_37	missense	39.53	26	17	SNP	1.000	T
RCN1	5954	genome.wustl.edu	37	11	32120056	32120056	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr11:32120056G>A	ENST00000054950.3	+	3	902	c.609G>A	c.(607-609)atG>atA	p.M203I	RCN1_ENST00000532942.1_Missense_Mutation_p.M152I|RP1-65P5.3_ENST00000533009.1_RNA	NM_002901.2	NP_002892.1	Q15293	RCN1_HUMAN	reticulocalbin 1, EF-hand calcium binding domain	203	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				camera-type eye development (GO:0043010)|in utero embryonic development (GO:0001701)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)	calcium ion binding (GO:0005509)			breast(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(6)	17	Lung SC(675;0.225)					TTGAACATATGAAGGAAATTG	0.458																																																	0													71.0	69.0	70.0					11																	32120056		2202	4299	6501	SO:0001583	missense	0			D42073	CCDS7876.1	11p13	2013-01-10			ENSG00000049449	ENSG00000049449		"""EF-hand domain containing"""	9934	protein-coding gene	gene with protein product	"""proliferation-inducing gene 20"""	602735		RCN		9192846, 8586628	Standard	NM_002901		Approved	Rcal, PIG20, FLJ37041	uc010reb.2	Q15293		ENST00000054950.3:c.609G>A	11.37:g.32120056G>A	ENSP00000054950:p.Met203Ile		B7Z1M1|D3DR00	Missense_Mutation	SNP	smart_EF_hand_dom,pfscan_EF_hand_dom	p.M203I	ENST00000054950.3	37	c.609	CCDS7876.1	11	.	.	.	.	.	.	.	.	.	.	g	27.8	4.860796	0.91433	.	.	ENSG00000049449	ENST00000530348;ENST00000532942;ENST00000054950	T;T;T	0.70986	0.31;-0.53;3.22	5.32	5.32	0.75619	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.83087	0.5178	M	0.62154	1.92	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.91635	0.994;0.999	D	0.84119	0.0405	10	0.62326	D	0.03	-41.2073	18.9947	0.92807	0.0:0.0:1.0:0.0	.	203;152	Q15293;B7Z1M1	RCN1_HUMAN;.	I	37;152;203	ENSP00000436482:M37I;ENSP00000436422:M152I;ENSP00000054950:M203I	ENSP00000054950:M203I	M	+	3	0	RCN1	32076632	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	9.869000	0.99810	2.499000	0.84300	0.491000	0.48974	ATG	RCN1	-	pfscan_EF_hand_dom	ENSG00000049449		0.458	RCN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RCN1	HGNC	protein_coding	OTTHUMT00000388510.1		0.00	24	0	G	NM_002901		32120056	+1			no_errors	ENST00000054950	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	A
RET	5979	genome.wustl.edu	37	10	43600603	43600603	+	Missense_Mutation	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr10:43600603G>C	ENST00000355710.3	+	4	1061	c.829G>C	c.(829-831)Gac>Cac	p.D277H	RET_ENST00000340058.5_Missense_Mutation_p.D277H	NM_020975.4	NP_066124.1	P07949	RET_HUMAN	ret proto-oncogene	277					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to retinoic acid (GO:0071300)|embryonic epithelial tube formation (GO:0001838)|enteric nervous system development (GO:0048484)|homophilic cell adhesion (GO:0007156)|innervation (GO:0060384)|lymphocyte migration into lymphoid organs (GO:0097021)|MAPK cascade (GO:0000165)|membrane protein proteolysis (GO:0033619)|neural crest cell migration (GO:0001755)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch morphogenesis (GO:0061146)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration (GO:0030335)|positive regulation of cell size (GO:0045793)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior midgut development (GO:0007497)|protein phosphorylation (GO:0006468)|regulation of axonogenesis (GO:0050770)|regulation of cell adhesion (GO:0030155)|response to drug (GO:0042493)|response to pain (GO:0048265)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ureter maturation (GO:0035799)|ureteric bud development (GO:0001657)	endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		CCDC6/RET(4)|KIF5B/RET(79)	NS(2)|adrenal_gland(26)|breast(5)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|lung(27)|ovary(5)|prostate(3)|skin(1)|thyroid(504)|upper_aerodigestive_tract(1)|urinary_tract(1)	607		Ovarian(717;0.0423)			Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	CGCGGGCGTCGACACCGCCAG	0.687		1	"""T, Mis, N, F"""	"""H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma"""	Hirschsprung disease		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma																												Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)		yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	10	10q11.2	5979	ret proto-oncogene	yes	"""E, O"""	0													39.0	35.0	36.0					10																	43600603		2201	4300	6501	SO:0001583	missense	0	Familial Cancer Database	MEN2B, Wagenmann-Froboese s.;MEN2A, Sipple disease, incl MEN2C;FMTC	BC004257	CCDS7200.1, CCDS53525.1	10q11.2	2014-09-17	2007-02-16		ENSG00000165731	ENSG00000165731		"""Cadherins / Cadherin-related"""	9967	protein-coding gene	gene with protein product	"""cadherin-related family member 16"""	164761	"""multiple endocrine neoplasia and medullary thyroid carcinoma 1"", ""Hirschsprung disease 1"""	HSCR1, MEN2A, MTC1, MEN2B		2687772, 1611909	Standard	NM_020975		Approved	PTC, CDHF12, RET51, CDHR16	uc001jal.3	P07949	OTTHUMG00000018024	ENST00000355710.3:c.829G>C	10.37:g.43600603G>C	ENSP00000347942:p.Asp277His		A8K6Z2|Q15250|Q9BTB0|Q9H4A2	Missense_Mutation	SNP	pirsf_Tyr_kinase_Ret_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Cadherin,superfamily_Kinase-like_dom,superfamily_Cadherin-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Cadherin	p.D277H	ENST00000355710.3	37	c.829	CCDS7200.1	10	.	.	.	.	.	.	.	.	.	.	g	22.2	4.264638	0.80358	.	.	ENSG00000165731	ENST00000355710;ENST00000340058;ENST00000535749	T;T	0.79749	-1.17;-1.3	4.73	3.74	0.42951	.	0.186902	0.56097	D	0.000028	D	0.84266	0.5434	L	0.55481	1.735	0.47659	D	0.999487	D;D;D	0.67145	0.996;0.996;0.987	P;P;D	0.64410	0.843;0.898;0.925	D	0.83764	0.0216	10	0.49607	T	0.09	.	10.5417	0.45037	0.1535:0.0:0.8465:0.0	.	23;277;277	B4DGX8;P07949;P07949-2	.;RET_HUMAN;.	H	277	ENSP00000347942:D277H;ENSP00000344798:D277H	ENSP00000344798:D277H	D	+	1	0	RET	42920609	1.000000	0.71417	0.932000	0.37286	0.989000	0.77384	3.191000	0.50981	2.450000	0.82876	0.556000	0.70494	GAC	RET	-	pirsf_Tyr_kinase_Ret_rcpt,superfamily_Cadherin-like	ENSG00000165731		0.687	RET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RET	HGNC	protein_coding	OTTHUMT00000047694.2	-	0.00	47	0	G	NM_020975		43600603	+1	tier1	-	no_errors	ENST00000355710	ensembl	human	known	74_37	missense	43.75	44	35	SNP	0.982	C
RFWD3	55159	genome.wustl.edu	37	16	74662409	74662409	+	Frame_Shift_Del	DEL	C	C	-			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr16:74662409delC	ENST00000361070.4	-	11	2007	c.1910delG	c.(1909-1911)ggcfs	p.G637fs	RFWD3_ENST00000571750.1_Frame_Shift_Del_p.G637fs	NM_018124.3	NP_060594.3	Q6PCD5	RFWD3_HUMAN	ring finger and WD repeat domain 3	637					DNA repair (GO:0006281)|mitotic G1 DNA damage checkpoint (GO:0031571)|protein ubiquitination (GO:0016567)|regulation of DNA damage checkpoint (GO:2000001)|response to ionizing radiation (GO:0010212)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|MDM2/MDM4 family protein binding (GO:0097371)|p53 binding (GO:0002039)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	26						GTCTATGCAGCCCCCTGGCTC	0.537																																																	0													106.0	105.0	105.0					16																	74662409		2198	4300	6498	SO:0001589	frameshift_variant	0			AK001382	CCDS32486.1	16q22.3	2013-01-09						"""WD repeat domain containing"", ""RING-type (C3HC4) zinc fingers"""	25539	protein-coding gene	gene with protein product		614151				21504906	Standard	XM_005256021		Approved	FLJ10520, RNF201	uc002fda.3	Q6PCD5		ENST00000361070.4:c.1910delG	16.37:g.74662409delC	ENSP00000354361:p.Gly637fs		A8K585|B2RE35|D3DUJ8|Q5XKR3|Q9H9Q3|Q9NVT4	Frame_Shift_Del	DEL	pfam_WD40_repeat,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_WD40_repeat,pfscan_Znf_RING	p.G637fs	ENST00000361070.4	37	c.1910	CCDS32486.1	16																																																																																			RFWD3	-	NULL	ENSG00000168411		0.537	RFWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFWD3	HGNC	protein_coding	OTTHUMT00000436506.2		0.00	29	0	C	NM_018124		74662409	-1	tier1		no_errors	ENST00000361070	ensembl	human	known	74_37	frame_shift_del	7.41	25	2	DEL	1.000	-
RFX7	64864	genome.wustl.edu	37	15	56390515	56390515	+	Missense_Mutation	SNP	G	G	C	rs377452165		TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr15:56390515G>C	ENST00000559447.2	-	8	851	c.580C>G	c.(580-582)Cag>Gag	p.Q194E	RFX7_ENST00000422057.1_Missense_Mutation_p.Q194E|RFX7_ENST00000423270.1_Missense_Mutation_p.Q291E|RFX7_ENST00000317318.6_Missense_Mutation_p.Q291E			Q2KHR2	RFX7_HUMAN	regulatory factor X, 7	194					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						ACCTGAGGCTGAAAGGAATTA	0.403																																																	0													58.0	54.0	55.0					15																	56390515		1841	4084	5925	SO:0001583	missense	0					15q21.3	2008-08-04	2008-08-04	2008-08-04		ENSG00000181827			25777	protein-coding gene	gene with protein product		612660	"""regulatory factor X domain containing 2"""	RFXDC2			Standard	NM_022841		Approved	FLJ12994	uc010bfn.3	Q2KHR2		ENST00000559447.2:c.580C>G	15.37:g.56390515G>C	ENSP00000453281:p.Gln194Glu		Q6ZRR1|Q6ZTY6|Q8N3J0|Q9H7A9|Q9H956	Missense_Mutation	SNP	pfam_DNA-bd_RFX	p.Q291E	ENST00000559447.2	37	c.871		15	.	.	.	.	.	.	.	.	.	.	G	21.2	4.120238	0.77323	.	.	ENSG00000181827	ENST00000422057;ENST00000317318;ENST00000423270	T;T;T	0.54279	0.59;0.58;0.59	5.84	5.84	0.93424	.	0.080187	0.52532	D	0.000062	T	0.41743	0.1172	N	0.19112	0.55	0.58432	D	0.999999	P;P	0.41313	0.745;0.745	B;B	0.37480	0.251;0.251	T	0.39643	-0.9604	10	0.49607	T	0.09	-7.095	19.1188	0.93353	0.0:0.0:1.0:0.0	.	194;194	Q2KHR2;C9JU50	RFX7_HUMAN;.	E	194;291;291	ENSP00000387504:Q194E;ENSP00000313299:Q291E;ENSP00000397644:Q291E	ENSP00000313299:Q291E	Q	-	1	0	RFX7	54177807	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.751000	0.94390	0.655000	0.94253	CAG	RFX7	-	NULL	ENSG00000181827		0.403	RFX7-001	KNOWN	non_canonical_U12|basic	protein_coding	RFX7	HGNC	protein_coding	OTTHUMT00000418841.3	-	0.00	49	0	G	NM_022841		56390515	-1	tier1	-	no_errors	ENST00000423270	ensembl	human	known	74_37	missense	27.50	29	11	SNP	1.000	C
RFX7	64864	genome.wustl.edu	37	15	56436654	56436654	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr15:56436654C>G	ENST00000423270.1	-	3	222	c.223G>C	c.(223-225)Gag>Cag	p.E75Q	RFX7_ENST00000559447.2_5'UTR|RFX7_ENST00000422057.1_5'UTR|RFX7_ENST00000317318.6_Missense_Mutation_p.E75Q	NM_022841.5	NP_073752.5	Q2KHR2	RFX7_HUMAN	regulatory factor X, 7	0					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						TAGAGTTTCTCTAGGTCTGTA	0.328																																																	0													102.0	101.0	101.0					15																	56436654		1822	4068	5890	SO:0001583	missense	0					15q21.3	2008-08-04	2008-08-04	2008-08-04		ENSG00000181827			25777	protein-coding gene	gene with protein product		612660	"""regulatory factor X domain containing 2"""	RFXDC2			Standard	NM_022841		Approved	FLJ12994	uc010bfn.3	Q2KHR2		ENST00000423270.1:c.223G>C	15.37:g.56436654C>G	ENSP00000397644:p.Glu75Gln		Q6ZRR1|Q6ZTY6|Q8N3J0|Q9H7A9|Q9H956	Missense_Mutation	SNP	pfam_DNA-bd_RFX	p.E75Q	ENST00000423270.1	37	c.223		15	.	.	.	.	.	.	.	.	.	.	C	19.19	3.779599	0.70107	.	.	ENSG00000181827	ENST00000317318;ENST00000423270	T;T	0.59906	0.23;0.23	5.41	5.41	0.78517	.	.	.	.	.	T	0.71796	0.3382	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.73157	-0.4071	6	0.52906	T	0.07	.	16.6865	0.85310	0.0:1.0:0.0:0.0	.	.	.	.	Q	75	ENSP00000313299:E75Q;ENSP00000397644:E75Q	ENSP00000313299:E75Q	E	-	1	0	RFX7	54223946	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.325000	0.65869	2.524000	0.85096	0.563000	0.77884	GAG	RFX7	-	NULL	ENSG00000181827		0.328	RFX7-203	KNOWN	basic|appris_principal	protein_coding	RFX7	HGNC	protein_coding		-	0.00	27	0	C	NM_022841		56436654	-1	tier1	-	no_errors	ENST00000423270	ensembl	human	known	74_37	missense	17.07	34	7	SNP	1.000	G
RIF1	55183	genome.wustl.edu	37	2	152320541	152320541	+	Frame_Shift_Del	DEL	A	A	-			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr2:152320541delA	ENST00000243326.5	+	29	4990	c.4507delA	c.(4507-4509)aaafs	p.K1505fs	RIF1_ENST00000453091.2_Frame_Shift_Del_p.K1505fs|RIF1_ENST00000430328.2_Frame_Shift_Del_p.K1505fs|RIF1_ENST00000428287.2_Frame_Shift_Del_p.K1505fs|RIF1_ENST00000444746.2_Frame_Shift_Del_p.K1505fs			Q9Y581	INSL6_HUMAN	replication timing regulatory factor 1	0					fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)	p.K1505fs*18(1)		NS(2)|breast(8)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(19)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	97				BRCA - Breast invasive adenocarcinoma(221;0.0429)		TGAACAAAATAAAAAAAAGGC	0.408																																																	1	Deletion - Frameshift(1)	lung(1)											58.0	64.0	62.0					2																	152320541		2199	4294	6493	SO:0001589	frameshift_variant	0			AK022932	CCDS2194.1, CCDS54406.1	2q23.3	2014-06-02	2014-06-02		ENSG00000080345	ENSG00000080345			23207	protein-coding gene	gene with protein product		608952	"""RAP1 interacting factor homolog (yeast)"""			15342490, 15042697, 22850674	Standard	NM_018151		Approved	FLJ12870, FLJ10599	uc002txm.3	Q5UIP0	OTTHUMG00000131886	ENST00000243326.5:c.4507delA	2.37:g.152320541delA	ENSP00000243326:p.Lys1505fs		A0AVS0|Q9NS16	Frame_Shift_Del	DEL	pfam_Rif1_N,superfamily_ARM-type_fold	p.K1505fs	ENST00000243326.5	37	c.4507	CCDS2194.1	2																																																																																			RIF1	-	NULL	ENSG00000080345		0.408	RIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RIF1	HGNC	protein_coding	OTTHUMT00000254836.3		0.00	15	0	A			152320541	+1	tier1		no_errors	ENST00000243326	ensembl	human	known	74_37	frame_shift_del	10.53	17	2	DEL	0.001	-
RIMS2	9699	genome.wustl.edu	37	8	104898029	104898029	+	Missense_Mutation	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr8:104898029G>C	ENST00000436393.2	+	2	777	c.536G>C	c.(535-537)aGa>aCa	p.R179T	RIMS2_ENST00000406091.3_Missense_Mutation_p.R401T|RIMS2_ENST00000522174.1_3'UTR|RIMS2_ENST00000507740.1_Missense_Mutation_p.R209T|RIMS2_ENST00000262231.10_Missense_Mutation_p.R209T			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	432	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TCAGAACGTAGAGCTGCCATG	0.433										HNSCC(12;0.0054)																																							0													72.0	69.0	70.0					8																	104898029		1922	4130	6052	SO:0001583	missense	0			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.536G>C	8.37:g.104898029G>C	ENSP00000390665:p.Arg179Thr		B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ,pfscan_Znf_FYVE-typ,pfscan_Znf_FYVE-rel	p.R401T	ENST00000436393.2	37	c.1202		8	.	.	.	.	.	.	.	.	.	.	G	18.82	3.705203	0.68615	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998;ENST00000515551;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393	T;T;T;T;T;T;T	0.39406	1.08;1.08;1.08;1.08;1.08;1.08;1.08	5.52	4.64	0.57946	.	.	.	.	.	T	0.56543	0.1992	L	0.48642	1.525	0.80722	D	1	P;D;P;P;D	0.69078	0.951;0.983;0.947;0.951;0.997	P;D;P;P;D	0.65773	0.497;0.938;0.835;0.721;0.925	T	0.59721	-0.7401	9	0.62326	D	0.03	.	15.7455	0.77936	0.0:0.0:0.8622:0.1378	.	432;179;209;209;401	Q9UQ26;D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	RIMS2_HUMAN;.;.;.;.	T	401;432;401;432;209;209;209;209;179	ENSP00000427018:R401T;ENSP00000384892:R401T;ENSP00000425205:R209T;ENSP00000262231:R209T;ENSP00000423559:R209T;ENSP00000386228:R209T;ENSP00000390665:R179T	ENSP00000262231:R209T	R	+	2	0	RIMS2	104967205	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.176000	0.77643	1.312000	0.45043	0.467000	0.42956	AGA	RIMS2	-	NULL	ENSG00000176406		0.433	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	RIMS2	HGNC	protein_coding	OTTHUMT00000367217.1	-	0.00	43	0	G	NM_001100117		104898029	+1	tier1	-	no_errors	ENST00000406091	ensembl	human	known	74_37	missense	30.77	18	8	SNP	1.000	C
RIPK4	54101	genome.wustl.edu	37	21	43165934	43165935	+	Frame_Shift_Ins	INS	-	-	G	rs144324321		TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr21:43165934_43165935insG	ENST00000352483.2	-	7	1128_1129	c.1064_1065insC	c.(1063-1065)ccgfs	p.P355fs	RIPK4_ENST00000332512.3_Frame_Shift_Ins_p.P307fs|RIPK4_ENST00000544709.1_Frame_Shift_Ins_p.P244fs|RIPK4_ENST00000542057.1_Frame_Shift_Ins_p.P244fs			P57078	RIPK4_HUMAN	receptor-interacting serine-threonine kinase 4	355					morphogenesis of an epithelium (GO:0002009)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						TCCTGGGCTCCGGGGGGCTTTT	0.535																																																	0																																										SO:0001589	frameshift_variant	0			AJ278016	CCDS13675.1	21q22.3	2013-01-10	2004-07-06	2004-07-06	ENSG00000183421	ENSG00000183421		"""Ankyrin repeat domain containing"""	496	protein-coding gene	gene with protein product	"""protein kinase C-associated kinase"", ""PKC-delta-interacting protein kinase"""	605706	"""ankyrin repeat domain 3"""	ANKRD3		10830953	Standard	NM_020639		Approved	DIK, ANKK2, RIP4, PKK	uc002yzn.1	P57078	OTTHUMG00000086770	ENST00000352483.2:c.1065dupC	21.37:g.43165940_43165940dupG	ENSP00000330161:p.Pro355fs		Q96KH0	Frame_Shift_Ins	INS	pfam_Ankyrin_rpt,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom,prints_Ankyrin_rpt,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E356fs	ENST00000352483.2	37	c.1065_1064		21																																																																																			RIPK4	-	NULL	ENSG00000183421		0.535	RIPK4-201	KNOWN	basic	protein_coding	RIPK4	HGNC	protein_coding			0.00	60	0	-	NM_020639		43165935	-1	tier1		no_errors	ENST00000352483	ensembl	human	known	74_37	frame_shift_ins	27.03	27	10	INS	0.000:0.000	G
RNF115	27246	genome.wustl.edu	37	1	145682022	145682022	+	Splice_Site	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr1:145682022G>A	ENST00000369291.5	+	5	632		c.e5-1			NM_014455.2	NP_055270.1			ring finger protein 115											breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	13						TTCTGTAACAGAATACTACAA	0.353																																																	0													169.0	164.0	166.0					1																	145682022		2203	4300	6503	SO:0001630	splice_region_variant	0			AF419857	CCDS72863.1	1q12	2013-01-09	2008-06-16	2008-06-16	ENSG00000121848	ENSG00000265491		"""RING-type (C3HC4) zinc fingers"""	18154	protein-coding gene	gene with protein product			"""zinc finger protein 364"""	ZNF364			Standard	NM_014455		Approved	CL469780	uc001eoj.3	Q9Y4L5	OTTHUMG00000013758	ENST00000369291.5:c.429-1G>A	1.37:g.145682022G>A				Splice_Site	SNP	-	e5-1	ENST00000369291.5	37	c.429-1	CCDS922.1	1	.	.	.	.	.	.	.	.	.	.	G	15.01	2.705400	0.48412	.	.	ENSG00000121848	ENST00000369291	.	.	.	4.82	4.82	0.62117	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4405	0.75178	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RNF115	144393379	1.000000	0.71417	1.000000	0.80357	0.431000	0.31685	6.920000	0.75799	2.500000	0.84329	0.655000	0.94253	.	RNF115	-	-	ENSG00000121848		0.353	RNF115-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF115	HGNC	protein_coding	OTTHUMT00000038554.2	-	0.00	64	0	G	NM_014455	Intron	145682022	+1	tier1	-	no_errors	ENST00000369291	ensembl	human	known	74_37	splice_site	26.23	44	16	SNP	1.000	A
RNF144A	9781	genome.wustl.edu	37	2	7160801	7160801	+	Missense_Mutation	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr2:7160801G>C	ENST00000320892.6	+	6	941	c.499G>C	c.(499-501)Ggg>Cgg	p.G167R	RNF144A_ENST00000467276.1_3'UTR	NM_014746.3	NP_055561.2	P50876	R144A_HUMAN	ring finger protein 144A	167					protein ubiquitination (GO:0016567)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.G167R(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|prostate(1)	25	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;0.226)		OV - Ovarian serous cystadenocarcinoma(76;0.195)		CTTCCTCCCCGGGGAGACCAG	0.587																																																	1	Substitution - Missense(1)	breast(1)											64.0	68.0	66.0					2																	7160801		2203	4300	6503	SO:0001583	missense	0			D79983	CCDS1657.1	2p25.2	2008-02-05	2007-08-20	2007-08-20	ENSG00000151692	ENSG00000151692		"""RING-type (C3HC4) zinc fingers"""	20457	protein-coding gene	gene with protein product			"""ring finger protein 144"""	RNF144		8724849, 10431818	Standard	NM_014746		Approved	UBCE7IP4, KIAA0161	uc002qys.3	P50876	OTTHUMG00000090353	ENST00000320892.6:c.499G>C	2.37:g.7160801G>C	ENSP00000321330:p.Gly167Arg		D6W4Y6|Q585H5	Missense_Mutation	SNP	pfam_Znf_C6HC,smart_Znf_C6HC,pfscan_Znf_RING	p.G167R	ENST00000320892.6	37	c.499	CCDS1657.1	2	.	.	.	.	.	.	.	.	.	.	G	26.4	4.737452	0.89482	.	.	ENSG00000151692	ENST00000320892;ENST00000427092	T	0.22743	1.94	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.42854	0.1221	L	0.49778	1.585	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.03576	-1.1023	10	0.33940	T	0.23	.	19.5896	0.95503	0.0:0.0:1.0:0.0	.	167	P50876	R144A_HUMAN	R	167	ENSP00000321330:G167R	ENSP00000321330:G167R	G	+	1	0	RNF144A	7078252	1.000000	0.71417	0.974000	0.42286	0.875000	0.50365	9.222000	0.95196	2.706000	0.92434	0.561000	0.74099	GGG	RNF144A	-	NULL	ENSG00000151692		0.587	RNF144A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF144A	HGNC	protein_coding	OTTHUMT00000206725.2		0.00	29	0	G	NM_014746		7160801	+1			no_errors	ENST00000320892	ensembl	human	known	74_37	missense	9.09	30	3	SNP	1.000	C
RPE65	6121	genome.wustl.edu	37	1	68914383	68914383	+	Silent	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr1:68914383C>T	ENST00000262340.5	-	2	71	c.18G>A	c.(16-18)gaG>gaA	p.E6E		NM_000329.2	NP_000320.1	Q16518	RPE65_HUMAN	retinal pigment epithelium-specific protein 65kDa	6					cellular response to electrical stimulus (GO:0071257)|detection of light stimulus involved in visual perception (GO:0050908)|insulin receptor signaling pathway (GO:0008286)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin gene expression (GO:0007468)|retina homeostasis (GO:0001895)|retina morphogenesis in camera-type eye (GO:0060042)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|visual perception (GO:0007601)|vitamin A metabolic process (GO:0006776)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	all-trans-retinyl-ester hydrolase, 11-cis retinol forming activity (GO:0052885)|all-trans-retinyl-palmitate hydrolase, 11-cis retinol forming activity (GO:0052884)|metal ion binding (GO:0046872)|retinal isomerase activity (GO:0004744)			central_nervous_system(1)|kidney(3)|large_intestine(12)|lung(15)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	35						CAGCAGGATGCTCAACCCTGA	0.517																																																	0													90.0	79.0	83.0					1																	68914383		2203	4300	6503	SO:0001819	synonymous_variant	0			U18991	CCDS643.1	1p31	2014-05-13	2002-08-29		ENSG00000116745	ENSG00000116745	3.1.1.64		10294	protein-coding gene	gene with protein product	"""retinol isomerase"", ""all-trans-retinyl-palmitate hydrolase"", ""retinoid isomerohydrolase"", ""BCO family, member 3"""	180069	"""retinal pigment epithelium-specific protein (65kD)"""	RP20		8340400	Standard	XM_006710811		Approved	LCA2, rd12, BCO3	uc001dei.1	Q16518	OTTHUMG00000009208	ENST00000262340.5:c.18G>A	1.37:g.68914383C>T			A8K1L0|Q5T9U3	Silent	SNP	pfam_Carotenoid_Oase	p.E6	ENST00000262340.5	37	c.18	CCDS643.1	1																																																																																			RPE65	-	NULL	ENSG00000116745		0.517	RPE65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPE65	HGNC	protein_coding	OTTHUMT00000025509.1		0.00	28	0	C	NM_000329		68914383	-1			no_errors	ENST00000262340	ensembl	human	known	74_37	silent	6.25	45	3	SNP	0.999	T
RTCB	51493	genome.wustl.edu	37	22	32802744	32802744	+	Missense_Mutation	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr22:32802744G>C	ENST00000216038.5	-	4	343	c.245C>G	c.(244-246)tCt>tGt	p.S82C	RTCB_ENST00000476619.1_5'UTR|RTCB_ENST00000451746.2_Missense_Mutation_p.S82C	NM_014306.4	NP_055121.1			RNA 2',3'-cyclic phosphate and 5'-OH ligase																		AAGCCCAATAGATCGCTGAAA	0.453																																																	0													114.0	110.0	111.0					22																	32802744		2203	4300	6503	SO:0001583	missense	0			BC016707	CCDS13905.1	22q12.3	2013-05-22	2013-05-22	2013-05-22	ENSG00000100220	ENSG00000100220	6.5.1.3		26935	protein-coding gene	gene with protein product	"""focal adhesion-associated protein"""	613901	"""chromosome 22 open reading frame 28"""	C22orf28		11042152, 21209330, 21311021	Standard	NM_014306		Approved	HSPC117, FAAP		Q9Y3I0	OTTHUMG00000030300	ENST00000216038.5:c.245C>G	22.37:g.32802744G>C	ENSP00000216038:p.Ser82Cys			Missense_Mutation	SNP	pfam_RtcB,superfamily_RtcB	p.S82C	ENST00000216038.5	37	c.245	CCDS13905.1	22	.	.	.	.	.	.	.	.	.	.	G	27.1	4.801757	0.90538	.	.	ENSG00000100220	ENST00000216038;ENST00000451746	T;T	0.32023	1.47;1.47	5.75	5.75	0.90469	.	0.099034	0.64402	D	0.000001	T	0.66626	0.2808	M	0.91818	3.245	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.73733	-0.3890	10	0.87932	D	0	-16.465	19.9439	0.97175	0.0:0.0:1.0:0.0	.	82	Q9Y3I0	RTCB_HUMAN	C	82	ENSP00000216038:S82C;ENSP00000413466:S82C	ENSP00000216038:S82C	S	-	2	0	C22orf28	31132744	1.000000	0.71417	0.998000	0.56505	0.962000	0.63368	9.738000	0.98835	2.706000	0.92434	0.561000	0.74099	TCT	RTCB	-	pfam_RtcB,superfamily_RtcB	ENSG00000100220		0.453	RTCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTCB	HGNC	protein_coding	OTTHUMT00000075188.3	-	0.00	21	0	G	NM_014306		32802744	-1	tier1	-	no_errors	ENST00000216038	ensembl	human	known	74_37	missense	30.43	16	7	SNP	1.000	C
RUNDC3A	10900	genome.wustl.edu	37	17	42392345	42392345	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr17:42392345C>G	ENST00000426726.3	+	6	871	c.597C>G	c.(595-597)atC>atG	p.I199M	RUNDC3A_ENST00000590941.1_Missense_Mutation_p.I194M|RUNDC3A_ENST00000225441.7_Missense_Mutation_p.I199M|AC003102.3_ENST00000588097.1_RNA	NM_001144825.1	NP_001138297.1	Q59EK9	RUN3A_HUMAN	RUN domain containing 3A	199	Interaction with RAP2A. {ECO:0000250}.				positive regulation of cGMP biosynthetic process (GO:0030828)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanylate cyclase activator activity (GO:0030250)|small GTPase regulator activity (GO:0005083)			large_intestine(1)|lung(1)|ovary(2)	4		Prostate(33;0.0233)		BRCA - Breast invasive adenocarcinoma(366;0.189)		CCGTGGTCATCGATTACACGC	0.647																																					Pancreas(82;1061 1416 11136 20771 23901)												0													70.0	76.0	74.0					17																	42392345		1960	4137	6097	SO:0001583	missense	0			AF055026	CCDS45698.1, CCDS45699.1, CCDS59294.1	17q21.31	2008-02-05			ENSG00000108309	ENSG00000108309			16984	protein-coding gene	gene with protein product		605448				9523700	Standard	NM_006695		Approved	RPIP8, RAP2IP	uc002igl.4	Q59EK9	OTTHUMG00000169259	ENST00000426726.3:c.597C>G	17.37:g.42392345C>G	ENSP00000410862:p.Ile199Met		B2R974|O15483|O60651|Q7Z3S2|Q9UF50	Missense_Mutation	SNP	pfam_Run,smart_Run,pfscan_Run	p.I199M	ENST00000426726.3	37	c.597	CCDS45698.1	17	.	.	.	.	.	.	.	.	.	.	c	17.20	3.329454	0.60743	.	.	ENSG00000108309	ENST00000426726;ENST00000225441	T;T	0.47869	1.29;0.83	4.19	0.828	0.18841	.	0.053835	0.64402	D	0.000001	T	0.52757	0.1754	M	0.63843	1.955	0.58432	D	0.99999	P;D;D;D	0.55385	0.882;0.971;0.971;0.971	P;P;P;P	0.60473	0.557;0.875;0.875;0.875	T	0.52465	-0.8572	10	0.87932	D	0	-20.7891	2.4457	0.04506	0.4025:0.3192:0.0:0.2783	.	199;199;194;199	Q59EK9;Q59EK9-4;Q59EK9-2;Q59EK9-3	RUN3A_HUMAN;.;.;.	M	199	ENSP00000410862:I199M;ENSP00000225441:I199M	ENSP00000225441:I199M	I	+	3	3	RUNDC3A	39747871	0.464000	0.25807	1.000000	0.80357	0.930000	0.56654	-0.323000	0.07997	0.411000	0.25702	0.407000	0.27541	ATC	RUNDC3A	-	NULL	ENSG00000108309		0.647	RUNDC3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RUNDC3A	HGNC	protein_coding	OTTHUMT00000403173.2	-	0.00	42	0	C	NM_006695		42392345	+1	tier1	-	no_errors	ENST00000426726	ensembl	human	known	74_37	missense	26.47	49	18	SNP	0.998	G
SCAF1	58506	genome.wustl.edu	37	19	50157957	50157957	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr19:50157957C>G	ENST00000360565.3	+	9	3572	c.3448C>G	c.(3448-3450)Cct>Gct	p.P1150A		NM_021228.2	NP_067051.2	Q9H7N4	SFR19_HUMAN	SR-related CTD-associated factor 1	1150					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	20		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.196)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00113)|GBM - Glioblastoma multiforme(134;0.0204)		GACCCCAGCTCCTGTGCCCAC	0.657																																																	0													108.0	91.0	97.0					19																	50157957		2203	4300	6503	SO:0001583	missense	0			AK024444	CCDS33074.1	19q13.3-q13.4	2011-01-10			ENSG00000126461	ENSG00000126461			30403	protein-coding gene	gene with protein product						11461075	Standard	NM_021228		Approved	SR-A1, FLJ00034	uc002poq.3	Q9H7N4		ENST00000360565.3:c.3448C>G	19.37:g.50157957C>G	ENSP00000353769:p.Pro1150Ala		Q7Z5V7|Q8WVA1|Q9NR59	Missense_Mutation	SNP	NULL	p.P1150A	ENST00000360565.3	37	c.3448	CCDS33074.1	19	.	.	.	.	.	.	.	.	.	.	c	11.83	1.755613	0.31046	.	.	ENSG00000126461	ENST00000360565	T	0.33865	1.39	5.22	5.22	0.72569	.	0.092923	0.41001	D	0.000965	T	0.22244	0.0536	N	0.24115	0.695	0.43593	D	0.995947	P	0.46859	0.885	B	0.39805	0.31	T	0.01977	-1.1236	10	0.59425	D	0.04	-14.143	6.7086	0.23264	0.1775:0.7352:0.0:0.0873	.	1150	Q9H7N4	SFR19_HUMAN	A	1150	ENSP00000353769:P1150A	ENSP00000353769:P1150A	P	+	1	0	SCAF1	54849769	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.674000	0.46867	2.716000	0.92895	0.651000	0.88453	CCT	SCAF1	-	NULL	ENSG00000126461		0.657	SCAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAF1	HGNC	protein_coding	OTTHUMT00000465764.1		0.00	41	0	C	NM_021228		50157957	+1			no_errors	ENST00000360565	ensembl	human	known	74_37	missense	11.11	24	3	SNP	0.998	G
SCUBE1	80274	genome.wustl.edu	37	22	43616536	43616536	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr22:43616536C>T	ENST00000360835.4	-	14	1733	c.1607G>A	c.(1606-1608)cGt>cAt	p.R536H		NM_173050.3	NP_766638.2	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1	536					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|post-embryonic development (GO:0009791)|protein homooligomerization (GO:0051260)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)	p.R536H(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(4)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_neural(38;0.0414)|Ovarian(80;0.07)				CTTGCGGCCACGGCGCCTCTT	0.577																																																	1	Substitution - Missense(1)	kidney(1)											138.0	113.0	121.0					22																	43616536		2203	4300	6503	SO:0001583	missense	0				CCDS14048.1	22q13	2008-07-01			ENSG00000159307	ENSG00000159307			13441	protein-coding gene	gene with protein product		611746				11087664	Standard	NM_173050		Approved		uc003bdt.2	Q8IWY4	OTTHUMG00000150679	ENST00000360835.4:c.1607G>A	22.37:g.43616536C>T	ENSP00000354080:p.Arg536His		Q5R336	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_EG-like_dom,pfam_CUB_dom,superfamily_CUB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_CUB_dom,pfscan_CUB_dom,pfscan_EG-like_dom	p.R536H	ENST00000360835.4	37	c.1607	CCDS14048.1	22	.	.	.	.	.	.	.	.	.	.	C	27.0	4.787905	0.90367	.	.	ENSG00000159307	ENST00000360835;ENST00000381243	D	0.86030	-2.06	4.87	4.87	0.63330	.	0.000000	0.85682	D	0.000000	D	0.83524	0.5273	L	0.59436	1.845	0.80722	D	1	B	0.18863	0.031	B	0.16722	0.016	T	0.79657	-0.1712	10	0.36615	T	0.2	.	18.202	0.89842	0.0:1.0:0.0:0.0	.	536	Q8IWY4	SCUB1_HUMAN	H	536;166	ENSP00000354080:R536H	ENSP00000354080:R536H	R	-	2	0	SCUBE1	41946480	0.999000	0.42202	1.000000	0.80357	0.999000	0.98932	5.544000	0.67231	2.518000	0.84900	0.655000	0.94253	CGT	SCUBE1	-	NULL	ENSG00000159307		0.577	SCUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCUBE1	HGNC	protein_coding	OTTHUMT00000319582.3	-	0.00	68	0	C	NM_173050		43616536	-1	tier1	-	no_errors	ENST00000360835	ensembl	human	known	74_37	missense	29.47	67	28	SNP	1.000	T
SEMA6D	80031	genome.wustl.edu	37	15	48053870	48053870	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr15:48053870G>A	ENST00000316364.5	+	7	899	c.460G>A	c.(460-462)Gaa>Aaa	p.E154K	SEMA6D_ENST00000389433.2_Missense_Mutation_p.E154K|SEMA6D_ENST00000389428.3_Missense_Mutation_p.E154K|SEMA6D_ENST00000355997.3_Missense_Mutation_p.E154K|SEMA6D_ENST00000558014.1_Missense_Mutation_p.E154K|SEMA6D_ENST00000558816.1_Missense_Mutation_p.E154K|SEMA6D_ENST00000389432.2_Missense_Mutation_p.E154K|SEMA6D_ENST00000354744.4_Missense_Mutation_p.E154K|SEMA6D_ENST00000358066.4_Missense_Mutation_p.E154K|SEMA6D_ENST00000537942.1_Missense_Mutation_p.E154K|SEMA6D_ENST00000389425.3_Missense_Mutation_p.E154K|SEMA6D_ENST00000536845.2_Missense_Mutation_p.E154K	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	154	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		GAGTACCTTAGAATATGATGG	0.378																																																	0													115.0	120.0	118.0					15																	48053870		2198	4297	6495	SO:0001583	missense	0			AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.460G>A	15.37:g.48053870G>A	ENSP00000324857:p.Glu154Lys		A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Missense_Mutation	SNP	pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,pfscan_Semap_dom	p.E154K	ENST00000316364.5	37	c.460	CCDS32225.1	15	.	.	.	.	.	.	.	.	.	.	G	19.64	3.866101	0.71949	.	.	ENSG00000137872	ENST00000537942;ENST00000536845;ENST00000316364;ENST00000389433;ENST00000389432;ENST00000354744;ENST00000358066;ENST00000389428;ENST00000355997;ENST00000389425	T;T;T;T;T;T;T;T;T;T	0.10288	2.89;2.89;2.89;2.89;2.89;2.89;2.89;2.89;2.89;2.89	5.85	5.85	0.93711	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.044381	0.85682	D	0.000000	T	0.22003	0.0530	L	0.56199	1.76	0.80722	D	1	P;P;P;B;B	0.35844	0.524;0.496;0.524;0.397;0.396	B;B;B;P;B	0.45449	0.277;0.307;0.277;0.481;0.176	T	0.00282	-1.1850	10	0.39692	T	0.17	.	20.1634	0.98142	0.0:0.0:1.0:0.0	.	154;154;154;154;154	Q8NFY4-3;A6NM95;Q8NFY4-4;Q8NFY4;Q8NFY4-2	.;.;.;SEM6D_HUMAN;.	K	154	ENSP00000442040:E154K;ENSP00000446152:E154K;ENSP00000324857:E154K;ENSP00000374084:E154K;ENSP00000374083:E154K;ENSP00000346786:E154K;ENSP00000350770:E154K;ENSP00000374079:E154K;ENSP00000348276:E154K;ENSP00000374076:E154K	ENSP00000324857:E154K	E	+	1	0	SEMA6D	45841162	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.476000	0.97823	2.773000	0.95371	0.655000	0.94253	GAA	SEMA6D	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000137872		0.378	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SEMA6D	HGNC	protein_coding	OTTHUMT00000416868.1	-	0.00	43	0	G	NM_024966		48053870	+1	tier1	-	no_errors	ENST00000316364	ensembl	human	known	74_37	missense	29.17	34	14	SNP	1.000	A
SEPT9	10801	genome.wustl.edu	37	17	75471827	75471827	+	Intron	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr17:75471827G>A	ENST00000427177.1	+	4	847				SEPT9_ENST00000427674.2_Intron|SEPT9_ENST00000541152.2_Intron|SEPT9_ENST00000592420.1_Intron|SEPT9_ENST00000329047.8_Intron|SEPT9_ENST00000588690.1_Intron|SEPT9_ENST00000449803.2_Intron|SEPT9_ENST00000590294.1_Intron|SEPT9_ENST00000431235.2_Intron|SEPT9_ENST00000423034.2_Intron|SEPT9_ENST00000585930.1_Intron|SEPT9_ENST00000592481.1_Intron|SEPT9_ENST00000592951.1_Intron|SEPT9_ENST00000590917.1_Intron|RP11-75C10.9_ENST00000591110.1_RNA|SEPT9_ENST00000591088.1_Intron|SEPT9_ENST00000591198.1_Intron|SEPT9_ENST00000427180.1_Missense_Mutation_p.R76Q	NM_001113491.1	NP_001106963.1	Q9UHD8	SEPT9_HUMAN	septin 9						cell cycle (GO:0007049)|cell division (GO:0051301)|GTP catabolic process (GO:0006184)|protein heterooligomerization (GO:0051291)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|stress fiber (GO:0001725)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			autonomic_ganglia(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|prostate(2)	16			BRCA - Breast invasive adenocarcinoma(99;0.153)			TGTAGATGCCGGCAGCTTTCT	0.657																																																	0													40.0	42.0	41.0					17																	75471827		1568	3581	5149	SO:0001627	intron_variant	0			AB023208	CCDS45790.1, CCDS45791.1, CCDS45792.1, CCDS45793.1, CCDS45794.1, CCDS45795.1, CCDS74166.1	17q25.3	2014-09-17	2005-01-11	2005-01-12	ENSG00000184640	ENSG00000184640		"""Septins"""	7323	protein-coding gene	gene with protein product	"""Ov/Br septin"""	604061	"""MLL septin-like fusion"""	MSF		10339604, 10485469	Standard	NM_006640		Approved	MSF1, KIAA0991, PNUTL4, AF17q25, SeptD1	uc002jts.4	Q9UHD8		ENST00000427177.1:c.722-6399G>A	17.37:g.75471827G>A			A8K2V3|B3KPM0|B4DTL9|B4E0N2|B4E274|B7Z654|Q96QF3|Q96QF4|Q96QF5|Q9HA04|Q9UG40|Q9Y5W4	Missense_Mutation	SNP	pfam_Cell_div_GTP-bd,pfam_Ribosome_biogen_GTPase_RsgA,pfam_AIG1,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase	p.R76Q	ENST00000427177.1	37	c.227	CCDS45790.1	17	.	.	.	.	.	.	.	.	.	.	G	9.459	1.092523	0.20471	.	.	ENSG00000184640	ENST00000427180	T	0.53206	0.63	1.29	-2.58	0.06228	.	.	.	.	.	T	0.24005	0.0581	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.15464	-1.0436	8	0.23891	T	0.37	.	0.2429	0.00194	0.3259:0.2025:0.2682:0.2034	.	76	Q9UHD8-8	.	Q	76	ENSP00000415624:R76Q	ENSP00000415624:R76Q	R	+	2	0	SEPT9	72983422	0.000000	0.05858	0.000000	0.03702	0.061000	0.15899	-1.739000	0.01840	-1.772000	0.01292	-0.717000	0.03617	CGG	SEPT9	-	NULL	ENSG00000184640		0.657	SEPT9-001	KNOWN	basic|CCDS	protein_coding	SEPT9	HGNC	protein_coding	OTTHUMT00000436304.2	-	0.00	27	0	G	NM_006640		75471827	+1	tier1	-	no_errors	ENST00000427180	ensembl	human	known	74_37	missense	61.11	7	11	SNP	0.000	A
SFMBT2	57713	genome.wustl.edu	37	10	7326113	7326113	+	Splice_Site	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr10:7326113C>T	ENST00000361972.4	-	6	616		c.e6-1		SFMBT2_ENST00000397167.1_Splice_Site	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2						negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)			NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						CTCGCAGAGGCTGTTTAAACA	0.378																																																	0													60.0	60.0	60.0					10																	7326113		2202	4297	6499	SO:0001630	splice_region_variant	0			AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.526-1G>A	10.37:g.7326113C>T			A7MD09|Q9HCF5	Splice_Site	SNP	-	e5-1	ENST00000361972.4	37	c.526-1	CCDS31138.1	10	.	.	.	.	.	.	.	.	.	.	c	19.79	3.893328	0.72524	.	.	ENSG00000198879	ENST00000361972;ENST00000397167	.	.	.	4.45	4.45	0.53987	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.4436	0.87572	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SFMBT2	7366119	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.421000	0.73353	2.195000	0.70347	0.431000	0.28591	.	SFMBT2	-	-	ENSG00000198879		0.378	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFMBT2	HGNC	protein_coding	OTTHUMT00000046673.1		0.00	41	0	C	NM_001029880	Intron	7326113	-1			no_errors	ENST00000361972	ensembl	human	known	74_37	splice_site	9.38	29	3	SNP	1.000	T
SGTB	54557	genome.wustl.edu	37	5	65004336	65004336	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr5:65004336G>A	ENST00000381007.4	-	4	489	c.254C>T	c.(253-255)gCt>gTt	p.A85V		NM_019072.2	NP_061945.1	Q96EQ0	SGTB_HUMAN	small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta	85										large_intestine(3)|lung(3)|skin(3)	9		Lung NSC(167;3.24e-06)|Prostate(74;0.0138)|Ovarian(174;0.0545)|Breast(144;0.174)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0657)|Lung(70;0.00487)		TAATTGGTCAGCTTTTCCCAC	0.333																																																	0													117.0	115.0	116.0					5																	65004336		2203	4300	6503	SO:0001583	missense	0			AK096321	CCDS3988.1	5q12.3	2013-01-10			ENSG00000197860	ENSG00000197860		"""Tetratricopeptide (TTC) repeat domain containing"""	23567	protein-coding gene	gene with protein product						12477932	Standard	XM_005248548		Approved	Sgt2, FLJ39002	uc003jud.3	Q96EQ0	OTTHUMG00000097801	ENST00000381007.4:c.254C>T	5.37:g.65004336G>A	ENSP00000370395:p.Ala85Val			Missense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.A85V	ENST00000381007.4	37	c.254	CCDS3988.1	5	.	.	.	.	.	.	.	.	.	.	G	28.8	4.951783	0.92660	.	.	ENSG00000197860	ENST00000381007;ENST00000506816	T;T	0.75260	-0.92;-0.92	5.17	5.17	0.71159	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	.	.	.	.	D	0.85864	0.5796	M	0.74647	2.275	0.80722	D	1	D	0.64830	0.994	D	0.71870	0.975	D	0.87222	0.2254	9	0.72032	D	0.01	-1.8753	17.8631	0.88787	0.0:0.0:1.0:0.0	.	85	Q96EQ0	SGTB_HUMAN	V	85	ENSP00000370395:A85V;ENSP00000421447:A85V	ENSP00000370395:A85V	A	-	2	0	SGTB	65040092	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.754000	0.85163	2.592000	0.87571	0.558000	0.71614	GCT	SGTB	-	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000197860		0.333	SGTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGTB	HGNC	protein_coding	OTTHUMT00000215057.2	-	0.00	72	0	G	NM_019072		65004336	-1	tier1	-	no_errors	ENST00000381007	ensembl	human	known	74_37	missense	10.81	33	4	SNP	1.000	A
SH2D5	400745	genome.wustl.edu	37	1	21050598	21050598	+	Silent	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr1:21050598C>T	ENST00000444387.2	-	7	1174	c.777G>A	c.(775-777)ctG>ctA	p.L259L	SH2D5_ENST00000375031.1_Silent_p.L175L|SH2D5_ENST00000460804.1_5'UTR	NM_001103161.1	NP_001096631.1	Q6ZV89	SH2D5_HUMAN	SH2 domain containing 5	259										lung(4)|prostate(1)|upper_aerodigestive_tract(1)	6		Colorectal(325;3.46e-05)|all_lung(284;5.32e-05)|Lung NSC(340;5.51e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.17e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000142)|GBM - Glioblastoma multiforme(114;0.000465)|Kidney(64;0.000476)|STAD - Stomach adenocarcinoma(196;0.00303)|KIRC - Kidney renal clear cell carcinoma(64;0.00634)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		CCGACAGCTGCAGCTGGGTCT	0.662																																																	0													35.0	44.0	41.0					1																	21050598		2123	4207	6330	SO:0001819	synonymous_variant	0			AK124869, AK123236	CCDS41280.1, CCDS44080.1	1p36.12	2008-02-05			ENSG00000189410	ENSG00000189410			28819	protein-coding gene	gene with protein product							Standard	NM_001103161		Approved		uc009vpy.1	Q6ZV89	OTTHUMG00000002620	ENST00000444387.2:c.777G>A	1.37:g.21050598C>T			B7Z3W3|Q5SSJ2	Silent	SNP	pfam_PTB/PI_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom,pfscan_SH2	p.L259	ENST00000444387.2	37	c.777	CCDS44080.1	1																																																																																			SH2D5	-	NULL	ENSG00000189410		0.662	SH2D5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SH2D5	HGNC	protein_coding	OTTHUMT00000007455.2	-	0.00	16	0	C	XM_375698		21050598	-1	tier1	-	no_errors	ENST00000444387	ensembl	human	known	74_37	silent	25.93	20	7	SNP	1.000	T
SLC16A1	6566	genome.wustl.edu	37	1	113460327	113460327	+	Missense_Mutation	SNP	A	A	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr1:113460327A>G	ENST00000538576.1	-	4	1532	c.701T>C	c.(700-702)aTt>aCt	p.I234T	SLC16A1_ENST00000369626.3_Missense_Mutation_p.I234T|SLC16A1_ENST00000433570.4_Missense_Mutation_p.I234T	NM_001166496.1	NP_001159968.1	P53985	MOT1_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 1	234					behavioral response to nutrient (GO:0051780)|blood coagulation (GO:0007596)|cellular metabolic process (GO:0044237)|cellular response to organic cyclic compound (GO:0071407)|centrosome organization (GO:0051297)|glucose homeostasis (GO:0042593)|leukocyte migration (GO:0050900)|lipid metabolic process (GO:0006629)|mevalonate transport (GO:0015728)|monocarboxylic acid transport (GO:0015718)|plasma membrane lactate transport (GO:0035879)|pyruvate metabolic process (GO:0006090)|regulation of insulin secretion (GO:0050796)|response to food (GO:0032094)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	mevalonate transmembrane transporter activity (GO:0015130)|monocarboxylic acid transmembrane transporter activity (GO:0008028)|organic cyclic compound binding (GO:0097159)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(8)|skin(1)|urinary_tract(1)	20	Lung SC(450;0.246)	all_cancers(81;7.6e-08)|all_epithelial(167;3.82e-07)|all_lung(203;3.07e-05)|Lung NSC(69;5.51e-05)|Prostate(1639;0.00232)		Epithelial(280;7.31e-13)|all cancers(265;5.1e-10)|Kidney(133;5.29e-07)|KIRC - Kidney renal clear cell carcinoma(1967;8.63e-06)|OV - Ovarian serous cystadenocarcinoma(397;1.48e-05)|BRCA - Breast invasive adenocarcinoma(282;0.003)|LUSC - Lung squamous cell carcinoma(189;0.008)|Lung(183;0.00948)|Colorectal(144;0.0325)|COAD - Colon adenocarcinoma(174;0.0643)	Acetic acid(DB03166)|Aminohippurate(DB00345)|Ampicillin(DB00415)|Foscarnet(DB00529)|Gamma Hydroxybutyric Acid(DB01440)|Methotrexate(DB00563)|Nateglinide(DB00731)|Niacin(DB00627)|Niflumic Acid(DB04552)|Pravastatin(DB00175)|Probenecid(DB01032)|Pyruvic acid(DB00119)|Salicylic acid(DB00936)|Valproic Acid(DB00313)	GTGTCTTCCAATAAGATCTGT	0.408																																																	0													106.0	105.0	106.0					1																	113460327		2203	4300	6503	SO:0001583	missense	0			BC026317	CCDS858.1	1p12	2013-07-18	2013-07-18		ENSG00000155380	ENSG00000155380		"""Solute carriers"""	10922	protein-coding gene	gene with protein product		600682	"""solute carrier family 16 (monocarboxylic acid transporters), member 1"", ""solute carrier family 16, member 1 (monocarboxylic acid transporter 1)"""			8124722, 7835905	Standard	NM_003051		Approved	MCT, MCT1	uc001ecy.3	P53985	OTTHUMG00000012129	ENST00000538576.1:c.701T>C	1.37:g.113460327A>G	ENSP00000441065:p.Ile234Thr		Q49A45|Q5T8R6|Q9NSJ9	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Monocarb_transpt	p.I234T	ENST00000538576.1	37	c.701	CCDS858.1	1	.	.	.	.	.	.	.	.	.	.	A	0.867	-0.733328	0.03135	.	.	ENSG00000155380	ENST00000369626;ENST00000538576;ENST00000458229;ENST00000433570;ENST00000443580	T;T;T;T;T	0.25912	1.92;1.92;2.26;1.93;1.77	5.73	4.58	0.56647	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.170899	0.50627	D	0.000102	T	0.09992	0.0245	L	0.36672	1.1	0.41580	D	0.988739	B;B	0.23806	0.091;0.053	B;B	0.33121	0.158;0.102	T	0.07947	-1.0746	10	0.14252	T	0.57	.	12.0464	0.53483	0.8705:0.0:0.0:0.1295	.	234;234	Q49A45;P53985	.;MOT1_HUMAN	T	234	ENSP00000358640:I234T;ENSP00000441065:I234T;ENSP00000416167:I234T;ENSP00000445061:I234T;ENSP00000399104:I234T	ENSP00000358640:I234T	I	-	2	0	SLC16A1	113261850	0.997000	0.39634	0.931000	0.37212	0.070000	0.16714	4.128000	0.57951	1.065000	0.40693	0.455000	0.32223	ATT	SLC16A1	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Monocarb_transpt	ENSG00000155380		0.408	SLC16A1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC16A1	HGNC	protein_coding	OTTHUMT00000033539.1	-	0.00	62	0	A	NM_003051		113460327	-1	tier1	-	no_errors	ENST00000369626	ensembl	human	known	74_37	missense	32.76	39	19	SNP	0.998	G
SLC1A5	6510	genome.wustl.edu	37	19	47278877	47278877	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr19:47278877G>A	ENST00000542575.2	-	8	2144	c.1516C>T	c.(1516-1518)Ccc>Tcc	p.P506S	FKRP_ENST00000600646.1_Intron|SLC1A5_ENST00000594991.1_Missense_Mutation_p.P330S|SLC1A5_ENST00000412532.2_Missense_Mutation_p.P278S|SLC1A5_ENST00000434726.2_Missense_Mutation_p.P304S	NM_005628.2	NP_005619.1	Q15758	AAAT_HUMAN	solute carrier family 1 (neutral amino acid transporter), member 5	506					amino acid transport (GO:0006865)|extracellular amino acid transport (GO:0006860)|glutamine transport (GO:0006868)|ion transport (GO:0006811)|neutral amino acid transport (GO:0015804)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-glutamine transmembrane transporter activity (GO:0015186)|L-serine transmembrane transporter activity (GO:0015194)|neutral amino acid transmembrane transporter activity (GO:0015175)|receptor activity (GO:0004872)|sodium:dicarboxylate symporter activity (GO:0017153)|virus receptor activity (GO:0001618)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(2)|stomach(1)	13		all_epithelial(76;0.00314)|Ovarian(192;0.0798)|all_neural(266;0.107)		OV - Ovarian serous cystadenocarcinoma(262;0.000338)|all cancers(93;0.000882)|Epithelial(262;0.0211)|GBM - Glioblastoma multiforme(486;0.0341)	L-Asparagine(DB00174)|L-Glutamine(DB00130)	GGATCCAGGGGCAGCTCACTC	0.592																																																	0													154.0	147.0	149.0					19																	47278877		2203	4300	6503	SO:0001583	missense	0			U53347	CCDS12692.1, CCDS46125.1, CCDS46126.1	19q13.32	2013-07-15			ENSG00000105281	ENSG00000105281		"""Solute carriers"""	10943	protein-coding gene	gene with protein product		109190		RDRC, M7V1		8702519, 10051606	Standard	NM_005628		Approved	AAAT, ASCT2	uc002pfs.3	Q15758	OTTHUMG00000183434	ENST00000542575.2:c.1516C>T	19.37:g.47278877G>A	ENSP00000444408:p.Pro506Ser		A8K9H5|B4DR77|B4DWS4|B7ZB81|D0EYG6|E9PC01|O95720|Q96RL9|Q9BWQ3|Q9UNP2	Missense_Mutation	SNP	pfam_Na-dicarboxylate_symporter,prints_Na-dicarboxylate_symporter	p.P506S	ENST00000542575.2	37	c.1516	CCDS12692.1	19	.	.	.	.	.	.	.	.	.	.	-	10.20	1.284895	0.23392	.	.	ENSG00000105281	ENST00000542575;ENST00000434726;ENST00000412532;ENST00000306894	T;T;T	0.62498	0.84;0.02;0.03	4.88	0.174	0.15040	.	0.616112	0.14575	N	0.311214	T	0.35770	0.0943	N	0.10874	0.06	0.09310	N	1	B;B;B	0.16166	0.016;0.003;0.003	B;B;B	0.14578	0.011;0.003;0.003	T	0.20706	-1.0267	10	0.11485	T	0.65	-16.5459	9.3812	0.38316	0.374:0.0:0.626:0.0	.	304;506;506	E9PC01;Q15758;Q71UA6	.;AAAT_HUMAN;.	S	506;304;278;513	ENSP00000444408:P506S;ENSP00000406532:P304S;ENSP00000397924:P278S	ENSP00000303623:P513S	P	-	1	0	SLC1A5	51970717	0.000000	0.05858	0.003000	0.11579	0.173000	0.22820	0.554000	0.23407	0.257000	0.21650	0.550000	0.68814	CCC	SLC1A5	-	NULL	ENSG00000105281		0.592	SLC1A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC1A5	HGNC	protein_coding	OTTHUMT00000466630.1	-	0.00	32	0	G			47278877	-1	tier1	-	no_errors	ENST00000542575	ensembl	human	known	74_37	missense	35.56	29	16	SNP	0.010	A
SLC38A3	10991	genome.wustl.edu	37	3	50255369	50255369	+	RNA	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr3:50255369C>G	ENST00000420502.1	+	0	1029									solute carrier family 38, member 3											breast(1)|cervix(1)|endometrium(1)|lung(3)	6				BRCA - Breast invasive adenocarcinoma(193;0.000275)|KIRC - Kidney renal clear cell carcinoma(197;0.00548)|Kidney(197;0.00615)		CCATCCCCATCATGGCCTTCG	0.612																																																	0													73.0	80.0	77.0					3																	50255369		2155	4276	6431			0			U49082	CCDS74940.1	3p21.3	2013-05-22			ENSG00000188338	ENSG00000188338		"""Solute carriers"""	18044	protein-coding gene	gene with protein product		604437				10619430, 10823827	Standard	XM_006712954		Approved	G17, SN1	uc003cyn.4	Q99624	OTTHUMG00000156764		3.37:g.50255369C>G				RNA	SNP	-	NULL	ENST00000420502.1	37	NULL		3																																																																																			SLC38A3	-	-	ENSG00000188338		0.612	SLC38A3-001	KNOWN	sequence_error|basic	processed_transcript	SLC38A3	HGNC	processed_transcript	OTTHUMT00000345635.2	-	0.00	33	0	C	NM_006841		50255369	+1	tier1	-	no_errors	ENST00000414604	ensembl	human	known	74_37	rna	56.25	7	9	SNP	1.000	G
SLC45A1	50651	genome.wustl.edu	37	1	8395601	8395601	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr1:8395601C>G	ENST00000471889.1	+	6	1933	c.1548C>G	c.(1546-1548)atC>atG	p.I516M	SLC45A1_ENST00000377479.2_Missense_Mutation_p.I550M|SLC45A1_ENST00000481265.1_3'UTR|SLC45A1_ENST00000289877.8_Missense_Mutation_p.I516M			Q9Y2W3	S45A1_HUMAN	solute carrier family 45, member 1	516					carbohydrate transport (GO:0008643)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(2)	33	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;1.22e-15)|all_lung(118;0.000147)|Lung NSC(185;0.000251)|Renal(390;0.000469)|Colorectal(325;0.00578)|Breast(348;0.00686)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;3.95e-66)|GBM - Glioblastoma multiforme(8;5.93e-33)|Colorectal(212;2.86e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		GCTCCACCATCTGCAACATGC	0.652																																																	0													78.0	78.0	78.0					1																	8395601		2203	4300	6503	SO:0001583	missense	0			AF118274	CCDS30577.1	1p36.23	2014-01-28	2005-10-04	2005-10-04	ENSG00000162426	ENSG00000162426		"""Solute carriers"""	17939	protein-coding gene	gene with protein product	"""H+/sugar symporter"""	605763	"""deleted in neuroblastoma 5"""	DNB5		10729226	Standard	XM_005263467		Approved		uc001apb.3	Q9Y2W3	OTTHUMG00000000503	ENST00000471889.1:c.1548C>G	1.37:g.8395601C>G	ENSP00000418096:p.Ile516Met		Q5VY46|Q5VY49	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.I550M	ENST00000471889.1	37	c.1650	CCDS30577.1	1	.	.	.	.	.	.	.	.	.	.	C	15.26	2.781693	0.49891	.	.	ENSG00000162426	ENST00000471889;ENST00000377479;ENST00000289877	D;D;D	0.90676	-2.71;-2.71;-2.71	5.09	4.18	0.49190	.	0.000000	0.85682	D	0.000000	D	0.92430	0.7597	L	0.55834	1.745	0.58432	D	0.999999	D	0.89917	1.0	D	0.85130	0.997	D	0.89360	0.3667	10	0.11485	T	0.65	-42.4257	12.5402	0.56165	0.0:0.919:0.0:0.081	.	516	Q9Y2W3	S45A1_HUMAN	M	516;550;516	ENSP00000418096:I516M;ENSP00000366699:I550M;ENSP00000289877:I516M	ENSP00000289877:I516M	I	+	3	3	SLC45A1	8318188	1.000000	0.71417	1.000000	0.80357	0.820000	0.46376	5.441000	0.66569	1.131000	0.42111	0.561000	0.74099	ATC	SLC45A1	-	NULL	ENSG00000162426		0.652	SLC45A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC45A1	HGNC	protein_coding	OTTHUMT00000001245.5	-	0.00	31	0	C			8395601	+1	tier1	-	no_errors	ENST00000377479	ensembl	human	known	74_37	missense	25.45	41	14	SNP	1.000	G
SMAD4	4089	genome.wustl.edu	37	18	48604764	48604764	+	Nonsense_Mutation	SNP	T	T	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr18:48604764T>G	ENST00000342988.3	+	12	2124	c.1586T>G	c.(1585-1587)tTa>tGa	p.L529*	SMAD4_ENST00000588745.1_Nonsense_Mutation_p.L433*|SMAD4_ENST00000586253.1_3'UTR|SMAD4_ENST00000398417.2_Nonsense_Mutation_p.L529*	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	529	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(2)|p.L529fs*7(1)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		GAAATTCACTTACACCGGGCC	0.498																																																	39	Whole gene deletion(36)|Unknown(2)|Deletion - Frameshift(1)	pancreas(27)|large_intestine(3)|breast(3)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)											87.0	86.0	87.0					18																	48604764		2203	4300	6503	SO:0001587	stop_gained	0			U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1586T>G	18.37:g.48604764T>G	ENSP00000341551:p.Leu529*		A8K405	Nonsense_Mutation	SNP	pfam_SMAD_dom_Dwarfin-type,pfam_MAD_homology1_Dwarfin-type,superfamily_SMAD_FHA_domain,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,smart_SMAD_dom_Dwarfin-type,pfscan_MAD_homology_MH1,pfscan_SMAD_dom_Dwarfin-type	p.L529*	ENST00000342988.3	37	c.1586	CCDS11950.1	18	.	.	.	.	.	.	.	.	.	.	T	42	9.299913	0.99130	.	.	ENSG00000141646	ENST00000342988;ENST00000398417	.	.	.	6.07	6.07	0.98685	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.6232	0.76824	0.0:0.0:0.0:1.0	.	.	.	.	X	529	.	ENSP00000341551:L529X	L	+	2	0	SMAD4	46858762	1.000000	0.71417	0.944000	0.38274	0.994000	0.84299	7.856000	0.86956	2.326000	0.78906	0.533000	0.62120	TTA	SMAD4	-	pfam_SMAD_dom_Dwarfin-type,superfamily_SMAD_FHA_domain,smart_SMAD_dom_Dwarfin-type,pfscan_SMAD_dom_Dwarfin-type	ENSG00000141646		0.498	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SMAD4	HGNC	protein_coding	OTTHUMT00000255993.3	-	0.00	53	0	T	NM_005359		48604764	+1	tier1	-	no_errors	ENST00000342988	ensembl	human	known	74_37	nonsense	38.46	24	15	SNP	1.000	G
SMYD2	56950	genome.wustl.edu	37	1	214504371	214504371	+	Missense_Mutation	SNP	C	C	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr1:214504371C>A	ENST00000366957.5	+	9	917	c.895C>A	c.(895-897)Cgc>Agc	p.R299S	SMYD2_ENST00000415093.2_Intron|SMYD2_ENST00000491455.1_3'UTR	NM_020197.2	NP_064582.2	Q9NRG4	SMYD2_HUMAN	SET and MYND domain containing 2	299					negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)|regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043516)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	histone methyltransferase activity (H3-K36 specific) (GO:0046975)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|RNA polymerase II core binding (GO:0000993)			breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(81;0.0122)|all cancers(67;0.0209)|GBM - Glioblastoma multiforme(131;0.106)|Epithelial(68;0.144)		CAGATATGCACGCAACGTCAT	0.507																																																	0													133.0	130.0	131.0					1																	214504371		2203	4300	6503	SO:0001583	missense	0			AF226053	CCDS31022.1	1q32.3	2011-07-01			ENSG00000143499	ENSG00000143499		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	20982	protein-coding gene	gene with protein product		610663					Standard	NM_020197		Approved	HSKM-B, ZMYND14, KMT3C	uc021pix.1	Q9NRG4	OTTHUMG00000037066	ENST00000366957.5:c.895C>A	1.37:g.214504371C>A	ENSP00000355924:p.Arg299Ser		B2R9P9|I6L9H7|Q4V765|Q5VSH9|Q96AI4	Missense_Mutation	SNP	pfam_SET_dom,pfam_Znf_MYND,smart_SET_dom,pfscan_SET_dom,pfscan_Znf_MYND	p.R299S	ENST00000366957.5	37	c.895	CCDS31022.1	1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.597319	0.87055	.	.	ENSG00000143499	ENST00000366957;ENST00000416415	T	0.17054	2.3	5.84	5.84	0.93424	.	0.350346	0.32687	N	0.005768	T	0.17280	0.0415	M	0.65975	2.015	0.80722	D	1	B;B	0.30851	0.226;0.297	B;B	0.26310	0.068;0.022	T	0.03086	-1.1074	10	0.08381	T	0.77	-11.4125	12.8981	0.58111	0.2028:0.7972:0.0:0.0	.	299;283	Q9NRG4;Q05C86	SMYD2_HUMAN;.	S	299;18	ENSP00000355924:R299S	ENSP00000355924:R299S	R	+	1	0	SMYD2	212570994	0.995000	0.38212	0.997000	0.53966	0.997000	0.91878	3.253000	0.51469	2.760000	0.94817	0.655000	0.94253	CGC	SMYD2	-	NULL	ENSG00000143499		0.507	SMYD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMYD2	HGNC	protein_coding	OTTHUMT00000089998.1		0.00	29	0	C	NM_020197		214504371	+1			no_errors	ENST00000366957	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	A
SNTB1	6641	genome.wustl.edu	37	8	121706059	121706059	+	Missense_Mutation	SNP	G	G	C	rs373190531		TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr8:121706059G>C	ENST00000395601.3	-	3	1075	c.661C>G	c.(661-663)Cgg>Ggg	p.R221G	SNTB1_ENST00000519177.1_5'UTR|SNTB1_ENST00000517992.1_Missense_Mutation_p.R221G	NM_021021.3	NP_066301.1	Q13884	SNTB1_HUMAN	syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1)	221	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				muscle contraction (GO:0006936)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|focal adhesion (GO:0005925)|protein complex (GO:0043234)|synapse (GO:0045202)				NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|prostate(2)|skin(6)	24	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		STAD - Stomach adenocarcinoma(47;0.00503)			CCCCCTAACCGAGGGGATTCA	0.562																																																	0													93.0	93.0	93.0					8																	121706059		2203	4300	6503	SO:0001583	missense	0			AF028828	CCDS6334.1	8q23-q24	2013-01-10	2002-08-29		ENSG00000172164	ENSG00000172164		"""Pleckstrin homology (PH) domain containing"""	11168	protein-coding gene	gene with protein product	"""tax interaction protein 43"""	600026	"""syntrophin, beta 1 (dystrophin-associated protein A1, 59kD, basic component 1)"""	SNT2B1		8183929, 9482110	Standard	NM_021021		Approved	59-DAP, A1B, BSYN2, TIP-43, SNT2	uc010mdg.3	Q13884	OTTHUMG00000165041	ENST00000395601.3:c.661C>G	8.37:g.121706059G>C	ENSP00000378965:p.Arg221Gly		A8K9E0|O14912|Q4KMG8	Missense_Mutation	SNP	pfam_PDZ,pfam_Pleckstrin_homology,superfamily_PDZ,smart_Pleckstrin_homology,smart_PDZ,pfscan_PDZ,pfscan_Pleckstrin_homology	p.R221G	ENST00000395601.3	37	c.661	CCDS6334.1	8	.	.	.	.	.	.	.	.	.	.	G	13.33	2.205474	0.39003	.	.	ENSG00000172164	ENST00000395601;ENST00000517992	T;T	0.54479	0.57;0.57	5.96	4.09	0.47781	Pleckstrin homology domain (2);	0.163403	0.56097	D	0.000030	T	0.46483	0.1395	L	0.59436	1.845	0.58432	D	0.999995	B;P	0.35272	0.035;0.493	B;B	0.31290	0.019;0.127	T	0.31613	-0.9937	10	0.18276	T	0.48	.	14.9914	0.71390	0.0:0.0:0.7324:0.2676	.	221;221	Q13884;Q13884-2	SNTB1_HUMAN;.	G	221	ENSP00000378965:R221G;ENSP00000431124:R221G	ENSP00000378965:R221G	R	-	1	2	SNTB1	121775240	0.999000	0.42202	0.115000	0.21578	0.030000	0.12068	4.102000	0.57776	0.757000	0.33036	0.655000	0.94253	CGG	SNTB1	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000172164		0.562	SNTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNTB1	HGNC	protein_coding	OTTHUMT00000381535.1		0.00	61	0	G	NM_021021		121706059	-1			no_errors	ENST00000395601	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.771	C
SOS1	6654	genome.wustl.edu	37	2	39237798	39237798	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr2:39237798C>G	ENST00000426016.1	-	16	2523	c.2437G>C	c.(2437-2439)Gac>Cac	p.D813H	SOS1_ENST00000395038.2_Missense_Mutation_p.D813H|SOS1_ENST00000402219.2_Missense_Mutation_p.D813H			Q07889	SOS1_HUMAN	son of sevenless homolog 1 (Drosophila)	813	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|Ras protein signal transduction (GO:0007265)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	DNA binding (GO:0003677)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(29)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	75		all_hematologic(82;0.21)				ATTTCTTTGTCTTCTTTTGTC	0.333									Noonan syndrome																																								0													131.0	125.0	127.0					2																	39237798		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	L13857	CCDS1802.1	2p21	2014-09-17	2002-11-05		ENSG00000115904	ENSG00000115904		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11187	protein-coding gene	gene with protein product		182530	"""gingival fibromatosis, hereditary, 1"""	GINGF		8276400, 10995566	Standard	NM_005633		Approved	HGF, GF1	uc002rrk.4	Q07889	OTTHUMG00000102109	ENST00000426016.1:c.2437G>C	2.37:g.39237798C>G	ENSP00000387784:p.Asp813His		A8K2G3|B4DXG2	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Histone_core_D,superfamily_Ras_GEF_dom,superfamily_Histone-fold,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_Pleckstrin_homology,pfscan_DH-domain,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.D813H	ENST00000426016.1	37	c.2437	CCDS1802.1	2	.	.	.	.	.	.	.	.	.	.	C	27.4	4.828490	0.90955	.	.	ENSG00000115904	ENST00000426016;ENST00000402219;ENST00000543698;ENST00000395038;ENST00000263879	T;T;T	0.33654	1.4;1.4;1.4	5.61	5.61	0.85477	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.117157	0.64402	D	0.000017	T	0.65375	0.2685	M	0.80332	2.49	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.68903	-0.5286	10	0.87932	D	0	.	19.6879	0.95987	0.0:1.0:0.0:0.0	.	813	Q07889	SOS1_HUMAN	H	813;813;545;813;813	ENSP00000387784:D813H;ENSP00000384675:D813H;ENSP00000378479:D813H	ENSP00000263879:D813H	D	-	1	0	SOS1	39091302	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.707000	0.84623	2.629000	0.89072	0.549000	0.68633	GAC	SOS1	-	pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25	ENSG00000115904		0.333	SOS1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	SOS1	HGNC	protein_coding	OTTHUMT00000219948.3	-	0.00	116	0	C	NM_005633		39237798	-1	tier1	-	no_errors	ENST00000402219	ensembl	human	known	74_37	missense	16.81	94	19	SNP	1.000	G
SOX13	9580	genome.wustl.edu	37	1	204091377	204091377	+	Frame_Shift_Del	DEL	C	C	-			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr1:204091377delC	ENST00000367204.1	+	9	983	c.874delC	c.(874-876)cccfs	p.P292fs		NM_005686.2	NP_005677.2	Q9UN79	SOX13_HUMAN	SRY (sex determining region Y)-box 13	292	Pro-rich.				anatomical structure morphogenesis (GO:0009653)|regulation of gamma-delta T cell differentiation (GO:0045586)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(2)|prostate(2)	13	all_cancers(21;0.0754)|Breast(84;0.116)|all_epithelial(62;0.189)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)			GCCCTCCCAGCCCCTGAACCT	0.637																																																	0													12.0	17.0	15.0					1																	204091377		2017	4176	6193	SO:0001589	frameshift_variant	0				CCDS44299.1	1q32	2008-07-18			ENSG00000143842	ENSG00000143842		"""SRY (sex determining region Y)-boxes"""	11192	protein-coding gene	gene with protein product	"""islet cell antibody 12"", ""SRY-related HMG-box gene 13"", ""type 1 diabetes autoantigen"", ""SRY-box 13"""	604748				10198172	Standard	NM_005686		Approved	Sox-13, ICA12, MGC117216	uc001ham.3	Q9UN79	OTTHUMG00000036050	ENST00000367204.1:c.874delC	1.37:g.204091377delC	ENSP00000356172:p.Pro292fs		B4E2B0|O95275|O95826|Q3KQV7|Q5SXX1|Q9UHW7	Frame_Shift_Del	DEL	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.L293fs	ENST00000367204.1	37	c.874	CCDS44299.1	1																																																																																			SOX13	-	NULL	ENSG00000143842		0.637	SOX13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX13	HGNC	protein_coding	OTTHUMT00000087881.2		0.00	37	0	C	NM_005686		204091377	+1	tier1		no_errors	ENST00000367204	ensembl	human	known	74_37	frame_shift_del	5.71	33	2	DEL	1.000	-
SPAG17	200162	genome.wustl.edu	37	1	118596717	118596717	+	Splice_Site	SNP	C	C	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr1:118596717C>A	ENST00000336338.5	-	20	2788		c.e20-1			NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17							cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		CCTTTGTTACCTATAATCAGA	0.328																																																	0													34.0	35.0	35.0					1																	118596717		2195	4294	6489	SO:0001630	splice_region_variant	0				CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.2723-1G>T	1.37:g.118596717C>A			Q8NAZ1|Q9NT21	Splice_Site	SNP	-	e20-1	ENST00000336338.5	37	c.2723-1	CCDS899.1	1	.	.	.	.	.	.	.	.	.	.	C	10.65	1.409479	0.25378	.	.	ENSG00000155761	ENST00000336338	.	.	.	5.65	5.65	0.86999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.093	0.72211	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SPAG17	118398240	0.769000	0.28531	0.815000	0.32552	0.137000	0.21094	3.347000	0.52200	2.941000	0.99782	0.655000	0.94253	.	SPAG17	-	-	ENSG00000155761		0.328	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG17	HGNC	protein_coding	OTTHUMT00000033723.1	-	0.00	56	0	C	NM_206996	Intron	118596717	-1	tier1	-	no_errors	ENST00000336338	ensembl	human	known	74_37	splice_site	7.84	47	4	SNP	0.527	A
SPEF1	25876	genome.wustl.edu	37	20	3758928	3758928	+	Silent	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr20:3758928G>C	ENST00000379756.3	-	7	802	c.642C>G	c.(640-642)ctC>ctG	p.L214L	SPEF1_ENST00000463490.1_5'UTR	NM_015417.4	NP_056232.2	Q9Y4P9	SPEF1_HUMAN	sperm flagellar 1	214						axoneme (GO:0005930)|cytoskeleton (GO:0005856)|motile cilium (GO:0031514)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	8						TCTTGAGCTGGAGCAGGTGCT	0.711																																																	0													20.0	22.0	21.0					20																	3758928		1877	4093	5970	SO:0001819	synonymous_variant	0			AL080154	CCDS13063.2	20p13	2013-09-23	2007-08-20	2007-08-20	ENSG00000101222	ENSG00000101222			15874	protein-coding gene	gene with protein product		610674	"""chromosome 20 open reading frame 28"""	C20orf28		15979255	Standard	NM_015417		Approved	DKFZP434I114, SPEF1A	uc002wjj.3	Q9Y4P9	OTTHUMG00000031756	ENST00000379756.3:c.642C>G	20.37:g.3758928G>C			A5YM71|D3DVY0|Q5JX78	Silent	SNP	pfam_DUF1042,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_CH-domain	p.L214	ENST00000379756.3	37	c.642	CCDS13063.2	20																																																																																			SPEF1	-	NULL	ENSG00000101222		0.711	SPEF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEF1	HGNC	protein_coding	OTTHUMT00000077760.2	-	0.00	48	0	G			3758928	-1	tier1	-	no_errors	ENST00000379756	ensembl	human	known	74_37	silent	38.46	16	10	SNP	0.982	C
SPEN	23013	genome.wustl.edu	37	1	16263967	16263967	+	Missense_Mutation	SNP	T	T	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr1:16263967T>C	ENST00000375759.3	+	12	10540	c.10336T>C	c.(10336-10338)Tct>Cct	p.S3446P		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	3446	Pro-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		CCTTCCAGTCTCTCTTCCCAC	0.577																																																	0													87.0	79.0	81.0					1																	16263967		2203	4300	6503	SO:0001583	missense	0				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.10336T>C	1.37:g.16263967T>C	ENSP00000364912:p.Ser3446Pro		Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	pfam_RRM_dom,pfam_SPOC_C,superfamily_SPOC_like_C_dom,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.S3446P	ENST00000375759.3	37	c.10336	CCDS164.1	1	.	.	.	.	.	.	.	.	.	.	T	6.856	0.527276	0.13066	.	.	ENSG00000065526	ENST00000375759	T	0.07908	3.15	5.23	4.32	0.51571	.	.	.	.	.	T	0.02494	0.0076	N	0.00926	-1.1	0.22479	N	0.999069	B	0.02656	0.0	B	0.01281	0.0	T	0.35674	-0.9779	9	0.02654	T	1	-9.4211	10.649	0.45636	0.0:0.8513:0.0:0.1487	.	3446	Q96T58	MINT_HUMAN	P	3446	ENSP00000364912:S3446P	ENSP00000364912:S3446P	S	+	1	0	SPEN	16136554	0.397000	0.25270	0.890000	0.34922	0.338000	0.28826	1.080000	0.30779	1.318000	0.45170	-0.146000	0.13790	TCT	SPEN	-	NULL	ENSG00000065526		0.577	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEN	HGNC	protein_coding	OTTHUMT00000025993.1		0.00	33	0	T	NM_015001		16263967	+1			no_errors	ENST00000375759	ensembl	human	known	74_37	missense	6.52	43	3	SNP	0.992	C
SPRTN	83932	genome.wustl.edu	37	1	231489015	231489015	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr1:231489015C>G	ENST00000295050.7	+	5	1714	c.1378C>G	c.(1378-1380)Cag>Gag	p.Q460E		NM_001010984.2|NM_032018.5	NP_001010984.1|NP_114407.3	Q9H040	SPRTN_HUMAN	SprT-like N-terminal domain	460					cellular response to DNA damage stimulus (GO:0006974)|positive regulation of protein ubiquitination (GO:0031398)|response to UV (GO:0009411)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|K63-linked polyubiquitin binding (GO:0070530)|metal ion binding (GO:0046872)|ubiquitin binding (GO:0043130)										CCCAGTTTGTCAGAATGAAGT	0.403																																																	0													55.0	52.0	53.0					1																	231489015		2203	4300	6503	SO:0001583	missense	0			AL512744	CCDS1594.1, CCDS31054.1, CCDS58066.1	1q42.12-q43	2013-01-30	2012-06-18	2012-06-18	ENSG00000010072	ENSG00000010072			25356	protein-coding gene	gene with protein product	"""SprT-like domain at the N terminus"", ""DNA damage-targeting VCP (p97) adaptor"""		"""chromosome 1 open reading frame 124"""	C1orf124		22681887	Standard	NM_032018		Approved	DKFZP547N043, Spartan, DVC1	uc001hur.4	Q9H040	OTTHUMG00000038022	ENST00000295050.7:c.1378C>G	1.37:g.231489015C>G	ENSP00000295050:p.Gln460Glu		B1AKT0|B5MEF7|Q5TE78|Q6UWW6|Q96BC5|Q96KA0	Missense_Mutation	SNP	pfam_SprT-like_domain,smart_SprT-like_domain,smart_Znf_Rad18_put	p.Q460E	ENST00000295050.7	37	c.1378	CCDS1594.1	1	.	.	.	.	.	.	.	.	.	.	C	9.486	1.099414	0.20552	.	.	ENSG00000010072	ENST00000295050	T	0.46063	0.88	6.04	4.16	0.48862	Zinc finger, Rad18-type putative (1);	0.548610	0.20540	N	0.090321	T	0.34629	0.0904	M	0.64997	1.995	0.80722	D	1	B	0.21381	0.055	B	0.16289	0.015	T	0.17471	-1.0368	10	0.02654	T	1	-3.5527	11.3359	0.49503	0.0:0.5863:0.3497:0.064	.	460	Q9H040	CA124_HUMAN	E	460	ENSP00000295050:Q460E	ENSP00000295050:Q460E	Q	+	1	0	C1orf124	229555638	1.000000	0.71417	0.492000	0.27490	0.143000	0.21401	2.710000	0.47169	0.878000	0.35920	-0.189000	0.12847	CAG	SPRTN	-	smart_Znf_Rad18_put	ENSG00000010072		0.403	SPRTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRTN	HGNC	protein_coding	OTTHUMT00000092858.1	-	0.00	32	0	C	NM_032018		231489015	+1	tier1	-	no_errors	ENST00000295050	ensembl	human	known	74_37	missense	41.03	23	16	SNP	0.940	G
SRRM2	23524	genome.wustl.edu	37	16	2814594	2814594	+	Missense_Mutation	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr16:2814594G>C	ENST00000301740.8	+	11	4614	c.4065G>C	c.(4063-4065)ttG>ttC	p.L1355F		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1355	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						AAGAAGATTTGAATGGACCGT	0.413																																																	0													103.0	110.0	108.0					16																	2814594		2198	4300	6498	SO:0001583	missense	0			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.4065G>C	16.37:g.2814594G>C	ENSP00000301740:p.Leu1355Phe		A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	pfam_mRNA_splic_Cwf21	p.L1355F	ENST00000301740.8	37	c.4065	CCDS32373.1	16	.	.	.	.	.	.	.	.	.	.	G	12.21	1.870314	0.33069	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933	T	0.39592	1.07	6.11	3.99	0.46301	.	0.251862	0.28527	N	0.015033	T	0.37489	0.1005	L	0.47716	1.5	0.28517	N	0.913278	P	0.44877	0.845	P	0.45037	0.467	T	0.38735	-0.9647	10	0.72032	D	0.01	-0.8815	6.0146	0.19594	0.2472:0.0:0.7528:0.0	.	1355	Q9UQ35	SRRM2_HUMAN	F	1355;1355;607	ENSP00000301740:L1355F	ENSP00000301740:L1355F	L	+	3	2	SRRM2	2754595	0.999000	0.42202	1.000000	0.80357	0.996000	0.88848	1.006000	0.29847	1.597000	0.50072	0.655000	0.94253	TTG	SRRM2	-	NULL	ENSG00000167978		0.413	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM2	HGNC	protein_coding	OTTHUMT00000436411.1	-	0.00	45	0	G			2814594	+1	tier1	-	no_errors	ENST00000301740	ensembl	human	known	74_37	missense	47.62	22	20	SNP	0.990	C
STK35	140901	genome.wustl.edu	37	20	2097509	2097509	+	Missense_Mutation	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr20:2097509G>C	ENST00000381482.3	+	3	1361	c.1090G>C	c.(1090-1092)Gac>Cac	p.D364H	STK35_ENST00000246032.3_Missense_Mutation_p.D231H|STK35_ENST00000400064.3_Intron			Q8TDR2	STK35_HUMAN	serine/threonine kinase 35	364	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(2)|liver(2)|lung(6)|ovary(1)|prostate(2)	13						CCTGAAGCCAGACAACATCCT	0.557																																																	0													85.0	80.0	82.0					20																	2097509		2203	4300	6503	SO:0001583	missense	0			AL359916	CCDS13024.1, CCDS13024.2	20p13	2008-07-02			ENSG00000125834	ENSG00000125834			16254	protein-coding gene	gene with protein product	"""CLP-36 interacting kinase"""	609370				11973348	Standard	NM_080836		Approved	bA550O8.2, CLIK1	uc002wfw.4	Q8TDR2	OTTHUMG00000031688	ENST00000381482.3:c.1090G>C	20.37:g.2097509G>C	ENSP00000370891:p.Asp364His		B2RBM3|C7ENV8|Q2NKW6|Q5T3R1|Q5T3R2|Q96AB4|Q9BZ06	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.D364H	ENST00000381482.3	37	c.1090	CCDS13024.2	20	.	.	.	.	.	.	.	.	.	.	G	21.9	4.219783	0.79464	.	.	ENSG00000125834	ENST00000381482;ENST00000246032	D;D	0.93859	-3.3;-3.3	5.5	5.5	0.81552	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.94735	0.8301	L	0.37850	1.14	0.80722	D	1	D	0.69078	0.997	D	0.72075	0.976	D	0.95019	0.8159	10	0.87932	D	0	-24.5144	16.94	0.86215	0.0:0.0:1.0:0.0	.	364	Q8TDR2	STK35_HUMAN	H	364;231	ENSP00000370891:D364H;ENSP00000246032:D231H	ENSP00000246032:D231H	D	+	1	0	STK35	2045509	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.657000	0.98554	2.861000	0.98227	0.655000	0.94253	GAC	STK35	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000125834		0.557	STK35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK35	HGNC	protein_coding	OTTHUMT00000077574.3		0.00	18	0	G	NM_080836		2097509	+1			no_errors	ENST00000381482	ensembl	human	known	74_37	missense	21.43	11	3	SNP	1.000	C
STT3B	201595	genome.wustl.edu	37	3	31677544	31677544	+	Missense_Mutation	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr3:31677544G>C	ENST00000295770.2	+	16	2678	c.2469G>C	c.(2467-2469)aaG>aaC	p.K823N		NM_178862.1	NP_849193.1	Q8TCJ2	STT3B_HUMAN	STT3B, subunit of the oligosaccharyltransferase complex (catalytic)	823					co-translational protein modification (GO:0043686)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glycoprotein catabolic process (GO:0006516)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|response to unfolded protein (GO:0006986)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)			autonomic_ganglia(1)|biliary_tract(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	19						AAATATCTAAGAAGACTGTTT	0.363																																																	0													95.0	99.0	98.0					3																	31677544		2203	4300	6503	SO:0001583	missense	0			AK027789	CCDS2650.1	3p24.1	2013-03-06	2013-03-06		ENSG00000163527	ENSG00000163527	2.4.99.18		30611	protein-coding gene	gene with protein product	"""source of immunodominant MHC associated peptides"", ""dolichyl-diphosphooligosaccharide protein glycotransferase"""	608605	"""STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae)"""			12887896, 12439619	Standard	XM_006713017		Approved	SIMP, FLJ90106, STT3-B	uc011axe.2	Q8TCJ2	OTTHUMG00000130673	ENST00000295770.2:c.2469G>C	3.37:g.31677544G>C	ENSP00000295770:p.Lys823Asn		Q96JZ4|Q96KY7	Missense_Mutation	SNP	pfam_Oligo_trans_STT3	p.K823N	ENST00000295770.2	37	c.2469	CCDS2650.1	3	.	.	.	.	.	.	.	.	.	.	G	14.97	2.694458	0.48202	.	.	ENSG00000163527	ENST00000295770	.	.	.	5.24	5.24	0.73138	.	0.099263	0.64402	D	0.000001	T	0.53286	0.1787	N	0.22421	0.69	0.80722	D	1	B	0.24823	0.112	B	0.25140	0.058	T	0.52953	-0.8506	9	0.66056	D	0.02	-13.1559	19.7143	0.96108	0.0:0.0:1.0:0.0	.	823	Q8TCJ2	STT3B_HUMAN	N	823	.	ENSP00000295770:K823N	K	+	3	2	STT3B	31652548	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.593000	0.74100	2.831000	0.97527	0.650000	0.86243	AAG	STT3B	-	NULL	ENSG00000163527		0.363	STT3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STT3B	HGNC	protein_coding	OTTHUMT00000253166.2	-	0.00	65	0	G	NM_178862		31677544	+1	tier1	-	no_errors	ENST00000295770	ensembl	human	known	74_37	missense	9.52	55	6	SNP	1.000	C
SUCNR1	56670	genome.wustl.edu	37	3	151598485	151598485	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr3:151598485C>G	ENST00000362032.5	+	3	259	c.154C>G	c.(154-156)Ctg>Gtg	p.L52V	RP11-454C18.2_ENST00000475855.1_RNA|RP11-454C18.2_ENST00000483843.2_RNA	NM_033050.4	NP_149039.2	Q9BXA5	SUCR1_HUMAN	succinate receptor 1	52						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	14			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)		Succinic acid(DB00139)	CATCTTCTCTCTGAAGAACTG	0.428																																																	0													177.0	186.0	183.0					3																	151598485		2203	4300	6503	SO:0001583	missense	0			AF348078	CCDS3162.1	3q25.1	2012-08-21	2004-07-08	2004-07-09	ENSG00000198829	ENSG00000198829		"""GPCR / Class A : Orphans"""	4542	protein-coding gene	gene with protein product		606381	"""G protein-coupled receptor 91"""	GPR91		11273702, 15141213, 17192395	Standard	NM_033050		Approved		uc003ezf.2	Q9BXA5	OTTHUMG00000159880	ENST00000362032.5:c.154C>G	3.37:g.151598485C>G	ENSP00000355156:p.Leu52Val		A8K305|Q8TDQ8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.L52V	ENST00000362032.5	37	c.154	CCDS3162.1	3	.	.	.	.	.	.	.	.	.	.	C	13.32	2.202659	0.38905	.	.	ENSG00000198829	ENST00000362032	T	0.37235	1.21	5.27	0.9	0.19278	GPCR, rhodopsin-like superfamily (1);	0.085531	0.47852	D	0.000204	T	0.35653	0.0939	L	0.54965	1.715	0.27400	N	0.954875	P	0.49090	0.919	P	0.49421	0.61	T	0.26503	-1.0101	10	0.19590	T	0.45	.	9.1203	0.36784	0.5046:0.4273:0.0:0.0682	.	52	Q9BXA5	SUCR1_HUMAN	V	52	ENSP00000355156:L52V	ENSP00000355156:L52V	L	+	1	2	SUCNR1	153081175	0.178000	0.23122	0.996000	0.52242	0.460000	0.32559	0.391000	0.20784	0.242000	0.21303	0.655000	0.94253	CTG	SUCNR1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000198829		0.428	SUCNR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUCNR1	HGNC	protein_coding	OTTHUMT00000357897.2	-	0.00	56	0	C	NM_033050		151598485	+1	tier1	-	no_errors	ENST00000362032	ensembl	human	known	74_37	missense	17.43	90	19	SNP	0.987	G
SYNE2	23224	genome.wustl.edu	37	14	64518452	64518452	+	Missense_Mutation	SNP	G	G	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr14:64518452G>T	ENST00000344113.4	+	48	8033	c.7821G>T	c.(7819-7821)tgG>tgT	p.W2607C	SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000554584.1_Missense_Mutation_p.W2640C|SYNE2_ENST00000358025.3_Missense_Mutation_p.W2607C	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	2607					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AACATGGTTGGGAACAAGTGG	0.378																																																	0													101.0	96.0	98.0					14																	64518452		1886	4116	6002	SO:0001583	missense	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.7821G>T	14.37:g.64518452G>T	ENSP00000341781:p.Trp2607Cys		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.W2607C	ENST00000344113.4	37	c.7821	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	G	2.915	-0.224466	0.06061	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.70399	0.74;0.74;-0.48	5.91	4.08	0.47627	.	0.116329	0.39909	N	0.001228	T	0.58680	0.2139	L	0.34521	1.04	0.80722	D	1	B;B	0.32382	0.252;0.368	B;B	0.32677	0.071;0.15	T	0.59048	-0.7527	10	0.87932	D	0	.	9.5038	0.39033	0.0709:0.0:0.7867:0.1424	.	2607;2607	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	C	2607;2607;2640;2640	ENSP00000350719:W2607C;ENSP00000341781:W2607C;ENSP00000452570:W2640C	ENSP00000261678:W2640C	W	+	3	0	SYNE2	63588205	1.000000	0.71417	0.479000	0.27329	0.381000	0.30169	2.910000	0.48766	0.827000	0.34685	0.655000	0.94253	TGG	SYNE2	-	NULL	ENSG00000054654		0.378	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	-	0.00	35	0	G	NM_182914		64518452	+1	tier1	-	no_errors	ENST00000358025	ensembl	human	known	74_37	missense	25.00	30	10	SNP	1.000	T
SYNJ2	8871	genome.wustl.edu	37	6	158492679	158492679	+	Silent	SNP	G	G	A	rs374135325		TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr6:158492679G>A	ENST00000355585.4	+	15	2061	c.1986G>A	c.(1984-1986)gcG>gcA	p.A662A	SYNJ2_ENST00000367121.3_Silent_p.A662A|SYNJ2_ENST00000367122.2_Silent_p.A662A	NM_001178088.1|NM_003898.3	NP_001171559.1|NP_003889.1	O15056	SYNJ2_HUMAN	synaptojanin 2	662					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			biliary_tract(1)|endometrium(9)|kidney(3)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)		GGGGCAAGGCGGGGAACAAGG	0.617													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19100	0.0		0.0	False		,,,				2504	0.0																0								G	,	1,4405	2.1+/-5.4	0,1,2202	79.0	77.0	77.0		1275,1986	-12.1	0.3	6		77	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	SYNJ2	NM_001178088.1,NM_003898.3	,	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	,	425/1260,662/1497	158492679	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0			AB002346	CCDS5254.1	6q25.3	2008-05-15			ENSG00000078269	ENSG00000078269			11504	protein-coding gene	gene with protein product		609410					Standard	NM_003898		Approved	INPP5H	uc003qqx.2	O15056	OTTHUMG00000015904	ENST00000355585.4:c.1986G>A	6.37:g.158492679G>A			Q5TA13|Q5TA16|Q5TA19|Q86XK0|Q8IZA8|Q9H226	Silent	SNP	pfam_Syja_N,pfam_DUF1866,pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc,pfscan_RRM_dom,pfscan_Syja_N	p.A662	ENST00000355585.4	37	c.1986	CCDS5254.1	6																																																																																			SYNJ2	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc	ENSG00000078269		0.617	SYNJ2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNJ2	HGNC	protein_coding	OTTHUMT00000042858.2	-	0.00	8	0	G			158492679	+1	tier1	-	no_errors	ENST00000355585	ensembl	human	known	74_37	silent	50.00	10	10	SNP	1.000	A
TACO1	51204	genome.wustl.edu	37	17	61681893	61681893	+	Splice_Site	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr17:61681893G>A	ENST00000258975.6	+	2	492		c.e2-1			NM_016360.3	NP_057444.2	Q9BSH4	TACO1_HUMAN	translational activator of mitochondrially encoded cytochrome c oxidase I						regulation of translation (GO:0006417)	mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(2)|endometrium(1)|lung(1)	4						TTAAATCTCAGAAGGAGGCCC	0.453																																																	0													117.0	112.0	113.0					17																	61681893		2203	4300	6503	SO:0001630	splice_region_variant	0			BC005049	CCDS11640.1	17q23.3	2009-06-26	2009-06-26	2009-06-26		ENSG00000136463			24316	protein-coding gene	gene with protein product		612958	"""coiled-coil domain containing 44"""	CCDC44		19503089	Standard	NM_016360		Approved		uc002jbd.3	Q9BSH4		ENST00000258975.6:c.281-1G>A	17.37:g.61681893G>A			B2RD21|Q8N3N6|Q9UI60	Splice_Site	SNP	-	e2-1	ENST00000258975.6	37	c.281-1	CCDS11640.1	17	.	.	.	.	.	.	.	.	.	.	G	18.91	3.724324	0.68959	.	.	ENSG00000136463	ENST00000258975	.	.	.	5.57	5.57	0.84162	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.0322	0.86464	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TACO1	59035625	1.000000	0.71417	1.000000	0.80357	0.733000	0.41908	7.882000	0.87258	2.626000	0.88956	0.603000	0.83216	.	TACO1	-	-	ENSG00000136463		0.453	TACO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TACO1	HGNC	protein_coding	OTTHUMT00000443862.1	-	0.00	22	0	G	NM_016360	Intron	61681893	+1	tier1	-	no_errors	ENST00000258975	ensembl	human	known	74_37	splice_site	39.29	17	11	SNP	1.000	A
TACO1	51204	genome.wustl.edu	37	17	61683700	61683700	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr17:61683700G>A	ENST00000258975.6	+	3	627	c.415G>A	c.(415-417)Gag>Aag	p.E139K		NM_016360.3	NP_057444.2	Q9BSH4	TACO1_HUMAN	translational activator of mitochondrially encoded cytochrome c oxidase I	139					regulation of translation (GO:0006417)	mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(2)|endometrium(1)|lung(1)	4						TTTGCTGTATGAGGGTCGAGG	0.448																																																	0													185.0	171.0	176.0					17																	61683700		2203	4300	6503	SO:0001583	missense	0			BC005049	CCDS11640.1	17q23.3	2009-06-26	2009-06-26	2009-06-26		ENSG00000136463			24316	protein-coding gene	gene with protein product		612958	"""coiled-coil domain containing 44"""	CCDC44		19503089	Standard	NM_016360		Approved		uc002jbd.3	Q9BSH4		ENST00000258975.6:c.415G>A	17.37:g.61683700G>A	ENSP00000258975:p.Glu139Lys		B2RD21|Q8N3N6|Q9UI60	Missense_Mutation	SNP	pfam_Transcrip_reg_TACO1-like	p.E139K	ENST00000258975.6	37	c.415	CCDS11640.1	17	.	.	.	.	.	.	.	.	.	.	G	21.1	4.093480	0.76756	.	.	ENSG00000136463	ENST00000258975	T	0.65916	-0.18	5.82	5.82	0.92795	.	0.096084	0.64402	D	0.000001	D	0.85923	0.5810	H	0.95884	3.735	0.50632	D	0.999884	D	0.76494	0.999	D	0.73708	0.981	D	0.89846	0.4006	10	0.87932	D	0	-9.5597	17.5894	0.87991	0.0:0.0:1.0:0.0	.	139	Q9BSH4	TACO1_HUMAN	K	139	ENSP00000258975:E139K	ENSP00000258975:E139K	E	+	1	0	TACO1	59037432	1.000000	0.71417	0.985000	0.45067	0.069000	0.16628	6.567000	0.73983	2.746000	0.94184	0.650000	0.86243	GAG	TACO1	-	pfam_Transcrip_reg_TACO1-like	ENSG00000136463		0.448	TACO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TACO1	HGNC	protein_coding	OTTHUMT00000443862.1	-	0.00	69	0	G	NM_016360		61683700	+1	tier1	-	no_errors	ENST00000258975	ensembl	human	known	74_37	missense	40.32	37	25	SNP	1.000	A
TANGO6	79613	genome.wustl.edu	37	16	68893888	68893888	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr16:68893888C>G	ENST00000261778.1	+	2	208	c.196C>G	c.(196-198)Cag>Gag	p.Q66E		NM_024562.1	NP_078838.1	Q9C0B7	TNG6_HUMAN	transport and golgi organization 6 homolog (Drosophila)	66						integral component of membrane (GO:0016021)											GAAGGATCCTCAGTGGAAGAA	0.423																																																	0													72.0	69.0	70.0					16																	68893888		1873	4102	5975	SO:0001583	missense	0				CCDS45516.1	16q22.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000103047	ENSG00000103047			25749	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 7"""	TMCO7		11214970	Standard	NM_024562		Approved	FLJ12688, KIAA1746	uc002ewi.4	Q9C0B7	OTTHUMG00000176743	ENST00000261778.1:c.196C>G	16.37:g.68893888C>G	ENSP00000261778:p.Gln66Glu		Q569F9|Q9H9K1	Missense_Mutation	SNP	pfam_DUF2435,pfam_DUF2411,superfamily_ARM-type_fold	p.Q66E	ENST00000261778.1	37	c.196	CCDS45516.1	16	.	.	.	.	.	.	.	.	.	.	C	1.832	-0.469605	0.04445	.	.	ENSG00000103047	ENST00000261778	.	.	.	5.41	4.43	0.53597	.	.	.	.	.	T	0.22936	0.0554	N	0.12182	0.205	0.22317	N	0.999201	B	0.02656	0.0	B	0.04013	0.001	T	0.05131	-1.0904	8	0.02654	T	1	-0.1042	13.7514	0.62910	0.0:0.7136:0.2863:0.0	.	66	Q9C0B7	TMCO7_HUMAN	E	66	.	ENSP00000261778:Q66E	Q	+	1	0	TMCO7	67451389	0.005000	0.15991	0.999000	0.59377	0.993000	0.82548	0.425000	0.21346	2.548000	0.85928	0.561000	0.74099	CAG	TANGO6	-	NULL	ENSG00000103047		0.423	TANGO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TANGO6	HGNC	protein_coding	OTTHUMT00000433471.2	-	0.00	55	0	C	XM_928235.2		68893888	+1	tier1	-	no_errors	ENST00000261778	ensembl	human	known	74_37	missense	27.78	39	15	SNP	0.940	G
TAS2R10	50839	genome.wustl.edu	37	12	10978643	10978644	+	Frame_Shift_Ins	INS	-	-	AT			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr12:10978643_10978644insAT	ENST00000240619.2	-	1	313_314	c.225_226insAT	c.(223-228)tatgccfs	p.A76fs		NM_023921.1	NP_076410.1	Q9NYW0	T2R10_HUMAN	taste receptor, type 2, member 10	76					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			breast(1)|central_nervous_system(1)|large_intestine(7)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17						TTACCGGAGGCATATATATTTG	0.342																																																	0																																										SO:0001589	frameshift_variant	0			AF227136	CCDS8634.1	12p13	2012-08-22			ENSG00000121318	ENSG00000121318		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14918	protein-coding gene	gene with protein product		604791				10761934, 10766242	Standard	NM_023921		Approved	T2R10, TRB2	uc001qyy.1	Q9NYW0	OTTHUMG00000168508	ENST00000240619.2:c.224_225dupAT	12.37:g.10978650_10978651dupAT	ENSP00000240619:p.Ala76fs		Q3MIM9|Q6NTD9	Frame_Shift_Ins	INS	pfam_TAS2_rcpt	p.A75fs	ENST00000240619.2	37	c.226_225	CCDS8634.1	12																																																																																			TAS2R10	-	pfam_TAS2_rcpt	ENSG00000121318		0.342	TAS2R10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R10	HGNC	protein_coding	OTTHUMT00000399934.1		0.00	17	0	-			10978644	-1	tier1		no_errors	ENST00000240619	ensembl	human	known	74_37	frame_shift_ins	14.81	23	4	INS	0.000:0.000	AT
TENM4	26011	genome.wustl.edu	37	11	78565338	78565338	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr11:78565338C>G	ENST00000278550.7	-	12	1954	c.1492G>C	c.(1492-1494)Gat>Cat	p.D498H		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	498					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										CTCCTGCCATCCAGCAGCTCC	0.617																																																	0													9.0	11.0	10.0					11																	78565338		692	1591	2283	SO:0001583	missense	0			AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.1492G>C	11.37:g.78565338C>G	ENSP00000278550:p.Asp498His		A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,pfam_YD,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.D498H	ENST00000278550.7	37	c.1492	CCDS44688.1	11	.	.	.	.	.	.	.	.	.	.	C	27.5	4.835491	0.91117	.	.	ENSG00000149256	ENST00000278550	T	0.36157	1.27	5.07	5.07	0.68467	.	0.119565	0.56097	D	0.000036	T	0.59918	0.2229	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.58272	-0.7665	9	.	.	.	.	18.6486	0.91421	0.0:1.0:0.0:0.0	.	498	Q6N022	TEN4_HUMAN	H	498	ENSP00000278550:D498H	.	D	-	1	0	ODZ4	78242986	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.651000	0.83577	2.631000	0.89168	0.561000	0.74099	GAT	TENM4	-	NULL	ENSG00000149256		0.617	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM4	HGNC	protein_coding	OTTHUMT00000391406.2	-	0.00	15	0	C			78565338	-1	tier1	-	no_errors	ENST00000278550	ensembl	human	known	74_37	missense	23.53	13	4	SNP	1.000	G
TFAP2B	7021	genome.wustl.edu	37	6	50803869	50803869	+	Missense_Mutation	SNP	G	G	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr6:50803869G>T	ENST00000393655.3	+	4	866	c.697G>T	c.(697-699)Gtc>Ttc	p.V233F	TFAP2B_ENST00000263046.4_Missense_Mutation_p.V242F	NM_003221.3	NP_003212.2	Q92481	AP2B_HUMAN	transcription factor AP-2 beta (activating enhancer binding protein 2 beta)	233					aorta morphogenesis (GO:0035909)|calcium ion homeostasis (GO:0055074)|cellular ammonia homeostasis (GO:0097275)|cellular creatinine homeostasis (GO:0097276)|cellular urea homeostasis (GO:0097277)|collecting duct development (GO:0072044)|distal tubule development (GO:0072017)|ductus arteriosus closure (GO:0097070)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|hindlimb morphogenesis (GO:0035137)|kidney development (GO:0001822)|magnesium ion homeostasis (GO:0010960)|metanephric nephron development (GO:0072210)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphate ion homeostasis (GO:0055062)|positive regulation of cell proliferation (GO:0008284)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of urine volume (GO:0035810)|potassium ion homeostasis (GO:0055075)|regulation of BMP signaling pathway (GO:0030510)|regulation of cell differentiation (GO:0045595)|regulation of insulin secretion (GO:0050796)|regulation of transcription, DNA-templated (GO:0006355)|renal water homeostasis (GO:0003091)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|retina layer formation (GO:0010842)|skin development (GO:0043588)|sodium ion homeostasis (GO:0055078)|sympathetic nervous system development (GO:0048485)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|DNA binding (GO:0003677)|enhancer sequence-specific DNA binding (GO:0001158)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.V233F(1)		NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)	40	Lung NSC(77;0.156)					GTTTTGCTCCGTCCCAGGCCG	0.512																																					Pancreas(116;1373 2332 5475 10752)												1	Substitution - Missense(1)	lung(1)											92.0	92.0	92.0					6																	50803869		2203	4300	6503	SO:0001583	missense	0			X95694	CCDS4934.2	6p12	2008-02-05	2001-11-28		ENSG00000008196	ENSG00000008196			11743	protein-coding gene	gene with protein product		601601	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)"""			7555706, 8661133	Standard	NM_003221		Approved	AP2-B	uc003pag.3	Q92481	OTTHUMG00000014836	ENST00000393655.3:c.697G>T	6.37:g.50803869G>T	ENSP00000377265:p.Val233Phe		Q5JYX6|Q9NQ63|Q9NU99|Q9UJI7|Q9Y214|Q9Y3K3	Missense_Mutation	SNP	pfam_TF_AP2_C,prints_TF_AP2_beta,prints_TF_AP2_C	p.V242F	ENST00000393655.3	37	c.724	CCDS4934.2	6	.	.	.	.	.	.	.	.	.	.	G	13.82	2.351246	0.41700	.	.	ENSG00000008196	ENST00000393655;ENST00000263046	D;D	0.98762	-5.12;-5.12	5.34	5.34	0.76211	Transcription factor AP-2, C-terminal (1);	0.183899	0.47093	D	0.000248	D	0.98950	0.9643	M	0.82193	2.58	0.80722	D	1	P	0.49783	0.928	P	0.57425	0.82	D	0.99866	1.1090	10	0.87932	D	0	-16.8707	19.0331	0.92965	0.0:0.0:1.0:0.0	.	233	Q92481	AP2B_HUMAN	F	233;242	ENSP00000377265:V233F;ENSP00000263046:V242F	ENSP00000263046:V242F	V	+	1	0	TFAP2B	50911828	1.000000	0.71417	0.501000	0.27601	0.033000	0.12548	9.869000	0.99810	2.503000	0.84419	0.650000	0.86243	GTC	TFAP2B	-	pfam_TF_AP2_C	ENSG00000008196		0.512	TFAP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFAP2B	HGNC	protein_coding	OTTHUMT00000040886.3		0.00	45	0	G	NM_003221		50803869	+1			no_errors	ENST00000263046	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.997	T
TMBIM4	51643	genome.wustl.edu	37	12	66546114	66546114	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr12:66546114C>G	ENST00000358230.3	-	3	369	c.249G>C	c.(247-249)ttG>ttC	p.L83F	TMBIM4_ENST00000539652.1_Missense_Mutation_p.L83F|TMBIM4_ENST00000544599.1_5'UTR|TMBIM4_ENST00000398033.4_Missense_Mutation_p.L83F|TMBIM4_ENST00000556010.1_Missense_Mutation_p.L83F|TMBIM4_ENST00000286424.7_Missense_Mutation_p.L130F|TMBIM4_ENST00000542724.1_Missense_Mutation_p.L52F	NM_016056.2	NP_057140.2	Q9HC24	LFG4_HUMAN	transmembrane BAX inhibitor motif containing 4	83					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|regulation of calcium-mediated signaling (GO:0050848)	Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(4)|ovary(1)|prostate(2)	9				GBM - Glioblastoma multiforme(28;0.0745)		ACGCAAAAATCAAACCCAGAG	0.343																																																	0													93.0	90.0	91.0					12																	66546114		1832	4078	5910	SO:0001583	missense	0			AF113127	CCDS41805.1, CCDS61187.1, CCDS73493.1	12q14.3	2014-05-09			ENSG00000155957	ENSG00000155957			24257	protein-coding gene	gene with protein product						11042152, 10810093	Standard	NM_001282609		Approved	CGI-119, S1R, ZPRO, LFG4, GAAP	uc001stc.3	Q9HC24	OTTHUMG00000168973	ENST00000358230.3:c.249G>C	12.37:g.66546114C>G	ENSP00000350965:p.Leu83Phe		Q542Z6|Q9UHY5|Q9Y3C2	Missense_Mutation	SNP	pfam_Bax_inhibitor_1-related	p.L83F	ENST00000358230.3	37	c.249	CCDS41805.1	12	.	.	.	.	.	.	.	.	.	.	C	0.037	-1.304044	0.01353	.	.	ENSG00000155957	ENST00000556010;ENST00000358230;ENST00000426857;ENST00000286424;ENST00000398033;ENST00000539043;ENST00000539427;ENST00000542724	T;T;T;T;T	0.52057	0.68;0.68;0.68;0.68;0.68	5.87	-0.711	0.11230	.	0.985279	0.08303	N	0.966526	T	0.38852	0.1056	L	0.48362	1.52	0.20074	N	0.999931	B;B;B;B;B	0.22604	0.063;0.003;0.063;0.072;0.003	B;B;B;B;B	0.30716	0.119;0.017;0.076;0.066;0.042	T	0.38542	-0.9656	9	.	.	.	-0.1529	5.3006	0.15776	0.1146:0.3116:0.4457:0.1282	.	83;130;83;52;83	E7EWY5;G3XAA5;E7EQ00;G3V1M2;Q9HC24	.;.;.;.;TMBI4_HUMAN	F	83;83;83;130;83;83;129;52	ENSP00000451688:L83F;ENSP00000350965:L83F;ENSP00000286424:L130F;ENSP00000381114:L83F;ENSP00000441291:L52F	.	L	-	3	2	TMBIM4	64832381	0.075000	0.21258	0.068000	0.19968	0.154000	0.21943	-0.421000	0.07053	-0.429000	0.07329	-0.282000	0.10007	TTG	TMBIM4	-	pfam_Bax_inhibitor_1-related	ENSG00000155957		0.343	TMBIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMBIM4	HGNC	protein_coding	OTTHUMT00000401832.2	-	0.00	24	0	C	NM_016056		66546114	-1	tier1	-	no_errors	ENST00000358230	ensembl	human	known	74_37	missense	31.58	13	6	SNP	0.102	G
TMEM11	8834	genome.wustl.edu	37	17	21102020	21102020	+	Missense_Mutation	SNP	G	G	C	rs376181647		TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr17:21102020G>C	ENST00000317635.5	-	2	667	c.196C>G	c.(196-198)Cgc>Ggc	p.R66G	TMEM11_ENST00000584432.1_5'UTR	NM_003876.2	NP_003867.1	P17152	TMM11_HUMAN	transmembrane protein 11	66					mitochondrion organization (GO:0007005)	integral component of mitochondrial inner membrane (GO:0031305)|integral component of plasma membrane (GO:0005887)				endometrium(1)|large_intestine(1)|lung(2)|prostate(1)	5						TCGCCAATGCGAGTGGGCTCA	0.607																																																	0													76.0	59.0	65.0					17																	21102020		2203	4300	6503	SO:0001583	missense	0			BC002819	CCDS11216.1	17p11.1	2011-08-12	2005-09-08	2005-09-08		ENSG00000178307			16823	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 35"""	C17orf35		2110658, 21274005	Standard	NM_003876		Approved	PMI, PM1	uc002gyp.2	P17152		ENST00000317635.5:c.196C>G	17.37:g.21102020G>C	ENSP00000319992:p.Arg66Gly		Q53YB2	Missense_Mutation	SNP	NULL	p.R66G	ENST00000317635.5	37	c.196	CCDS11216.1	17	.	.	.	.	.	.	.	.	.	.	G	16.23	3.063731	0.55432	.	.	ENSG00000178307	ENST00000317635	.	.	.	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.57651	0.2068	M	0.65975	2.015	0.80722	D	1	P	0.42161	0.772	B	0.34301	0.179	T	0.65319	-0.6197	9	0.72032	D	0.01	-34.6428	20.0263	0.97523	0.0:0.0:1.0:0.0	.	66	P17152	TMM11_HUMAN	G	66	.	ENSP00000319992:R66G	R	-	1	0	TMEM11	21042612	1.000000	0.71417	0.970000	0.41538	0.403000	0.30841	9.305000	0.96197	2.735000	0.93741	0.655000	0.94253	CGC	TMEM11	-	NULL	ENSG00000178307		0.607	TMEM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM11	HGNC	protein_coding	OTTHUMT00000444150.2	-	0.00	53	0	G	NM_003876		21102020	-1	tier1	-	no_errors	ENST00000317635	ensembl	human	known	74_37	missense	45.24	23	19	SNP	1.000	C
TMEM175	84286	genome.wustl.edu	37	4	941566	941566	+	Silent	SNP	A	A	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr4:941566A>G	ENST00000264771.4	+	2	224	c.39A>G	c.(37-39)acA>acG	p.T13T	TMEM175_ENST00000508204.1_Intron|TMEM175_ENST00000515740.1_Intron	NM_032326.2	NP_115702.1	Q9BSA9	TM175_HUMAN	transmembrane protein 175	13						integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)				NS(1)|endometrium(1)|large_intestine(2)|lung(6)|pancreas(1)|upper_aerodigestive_tract(3)	14			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			CACTGGATACACCGGGGGACT	0.672																																																	0													29.0	33.0	32.0					4																	941566		2203	4300	6503	SO:0001819	synonymous_variant	0			BC005158	CCDS3341.1, CCDS75087.1, CCDS75088.1	4p16.3	2008-02-05			ENSG00000127419	ENSG00000127419			28709	protein-coding gene	gene with protein product						12477932	Standard	XM_005272301		Approved	MGC4618	uc003gbq.3	Q9BSA9	OTTHUMG00000118996	ENST00000264771.4:c.39A>G	4.37:g.941566A>G			D3DVN4|Q8ND13	Silent	SNP	pfam_DUF1211_TMEM175	p.T13	ENST00000264771.4	37	c.39	CCDS3341.1	4																																																																																			TMEM175	-	NULL	ENSG00000127419		0.672	TMEM175-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM175	HGNC	protein_coding	OTTHUMT00000239193.2	-	0.00	61	0	A	NM_032326		941566	+1	tier1	rs144663311	no_errors	ENST00000264771	ensembl	human	known	74_37	silent	30.91	38	17	SNP	0.000	G
TNFRSF19	55504	genome.wustl.edu	37	13	24200845	24200845	+	Splice_Site	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr13:24200845G>C	ENST00000382258.4	+	5	563		c.e5-1		TNFRSF19_ENST00000403372.2_Splice_Site|TNFRSF19_ENST00000248484.4_Splice_Site|TNFRSF19_ENST00000382263.3_Splice_Site	NM_018647.3	NP_061117.2	Q9NS68	TNR19_HUMAN	tumor necrosis factor receptor superfamily, member 19						apoptotic process (GO:0006915)|hair follicle development (GO:0001942)|JNK cascade (GO:0007254)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	integral component of membrane (GO:0016021)	tumor necrosis factor-activated receptor activity (GO:0005031)	p.?(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(4)|liver(2)|lung(5)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	22		all_cancers(29;3.4e-22)|all_epithelial(30;8.75e-19)|all_lung(29;5.09e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00193)|Epithelial(112;0.0137)|OV - Ovarian serous cystadenocarcinoma(117;0.0465)|GBM - Glioblastoma multiforme(144;0.184)|Lung(94;0.19)		TTCTCTTCTAGATTTTATAGG	0.428																																																	1	Unknown(1)	lung(1)											96.0	90.0	92.0					13																	24200845		2203	4300	6503	SO:0001630	splice_region_variant	0			AB040434	CCDS9301.1, CCDS9302.1, CCDS55893.1	13q12.11-q12.3	2008-07-18			ENSG00000127863	ENSG00000127863		"""Tumor necrosis factor receptor superfamily"""	11915	protein-coding gene	gene with protein product	"""toxicity and JNK inducer"""	606122				10764796, 10809768	Standard	NM_018647		Approved	TAJ-alpha, TROY, TAJ, TRADE	uc001uov.2	Q9NS68	OTTHUMG00000016568	ENST00000382258.4:c.360-1G>C	13.37:g.24200845G>C			A8KA09|A8KA26|B1AM40|B1AM41|B4E2I6|Q9BXZ9|Q9BY00|Q9NZV2	Splice_Site	SNP	-	e4-1	ENST00000382258.4	37	c.360-1	CCDS9302.1	13	.	.	.	.	.	.	.	.	.	.	G	12.12	1.843805	0.32606	.	.	ENSG00000127863	ENST00000248484;ENST00000382258;ENST00000382263	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0446	0.93015	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TNFRSF19	23098845	1.000000	0.71417	0.991000	0.47740	0.051000	0.14879	8.083000	0.89515	2.608000	0.88229	0.585000	0.79938	.	TNFRSF19	-	-	ENSG00000127863		0.428	TNFRSF19-001	KNOWN	basic|CCDS	protein_coding	TNFRSF19	HGNC	protein_coding	OTTHUMT00000044156.2	-	0.00	25	0	G	NM_018647	Intron	24200845	+1	tier1	-	no_errors	ENST00000382258	ensembl	human	known	74_37	splice_site	27.27	8	3	SNP	1.000	C
TMEM255B	348013	genome.wustl.edu	37	13	114498174	114498174	+	Silent	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr13:114498174C>T	ENST00000375353.3	+	4	333	c.306C>T	c.(304-306)tgC>tgT	p.C102C		NM_182614.2	NP_872420.1	Q8WV15	T255B_HUMAN	transmembrane protein 255B	102						integral component of membrane (GO:0016021)											CCTTCTGCTGCGCCATCGTGG	0.552																																																	0													111.0	90.0	97.0					13																	114498174		2203	4300	6503	SO:0001819	synonymous_variant	0			BC018995	CCDS45071.1	13q34	2012-11-30	2012-11-30	2012-11-30	ENSG00000184497	ENSG00000184497			28297	protein-coding gene	gene with protein product			"""family with sequence similarity 70, member B"""	FAM70B		12477932	Standard	NM_182614		Approved	MGC20579	uc001vuh.3	Q8WV15	OTTHUMG00000017398	ENST00000375353.3:c.306C>T	13.37:g.114498174C>T				Silent	SNP	NULL	p.C102	ENST00000375353.3	37	c.306	CCDS45071.1	13																																																																																			TMEM255B	-	NULL	ENSG00000184497		0.552	TMEM255B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM255B	HGNC	protein_coding	OTTHUMT00000045953.4		0.00	28	0	C	NM_182614		114498174	+1			no_errors	ENST00000375353	ensembl	human	known	74_37	silent	5.41	70	4	SNP	0.999	T
TP53	7157	genome.wustl.edu	37	17	7577121	7577121	+	Missense_Mutation	SNP	G	G	A	rs121913343		TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr17:7577121G>A	ENST00000269305.4	-	8	1006	c.817C>T	c.(817-819)Cgt>Tgt	p.R273C	TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.R273C|TP53_ENST00000359597.4_Missense_Mutation_p.R273C|TP53_ENST00000455263.2_Missense_Mutation_p.R273C|TP53_ENST00000445888.2_Missense_Mutation_p.R273C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273C(481)|p.R273S(16)|p.R273G(9)|p.0?(8)|p.?(2)|p.R273fs*72(2)|p.R273fs*33(2)|p.R273fs*32(2)|p.V272>?(2)|p.F270fs*72(1)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCACAAACACGCACCTCAAAG	0.542	R273C(8MGBA_CENTRAL_NERVOUS_SYSTEM)|R273C(BL70_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(EFO27_OVARY)|R273C(KARPAS299_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(MFE319_ENDOMETRIUM)|R273C(NCIH1048_LUNG)|R273C(PANC0213_PANCREAS)|R273C(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(RDES_BONE)|R273C(RH30_SOFT_TISSUE)|R273C(RPMI8402_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SH10TC_STOMACH)|R273C(SJRH30_SOFT_TISSUE)|R273C(SUDHL4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SW1710_URINARY_TRACT)|R273C(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273C(TT2609C02_THYROID)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	533	Substitution - Missense(506)|Whole gene deletion(8)|Deletion - Frameshift(8)|Deletion - In frame(5)|Insertion - Frameshift(2)|Unknown(2)|Complex(2)	central_nervous_system(117)|large_intestine(108)|ovary(32)|haematopoietic_and_lymphoid_tissue(31)|upper_aerodigestive_tract(30)|stomach(25)|urinary_tract(23)|lung(21)|breast(21)|liver(20)|endometrium(17)|oesophagus(17)|bone(16)|pancreas(15)|prostate(8)|skin(7)|cervix(6)|biliary_tract(6)|kidney(3)|thyroid(3)|vulva(2)|genital_tract(1)|penis(1)|adrenal_gland(1)|salivary_gland(1)|small_intestine(1)	GRCh37	CM010471|CM010473|CM951233	TP53	M	rs121913343						65.0	56.0	59.0					17																	7577121		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.817C>T	17.37:g.7577121G>A	ENSP00000269305:p.Arg273Cys		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R273C	ENST00000269305.4	37	c.817	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	17.48	3.400216	0.62177	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.92	3.95	0.45737	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99851	0.9931	M	0.90759	3.145	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.998;0.999;0.996	D	0.96877	0.9643	10	0.87932	D	0	-11.9995	11.2235	0.48869	0.0895:0.0:0.9105:0.0	.	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	C	273;273;273;273;273;262;141	ENSP00000352610:R273C;ENSP00000269305:R273C;ENSP00000398846:R273C;ENSP00000391127:R273C;ENSP00000391478:R273C;ENSP00000425104:R141C	ENSP00000269305:R273C	R	-	1	0	TP53	7517846	1.000000	0.71417	0.066000	0.19879	0.723000	0.41478	4.540000	0.60664	1.299000	0.44798	0.462000	0.41574	CGT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	34	0	G	NM_000546		7577121	-1	tier1	rs121913343	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	87.50	1	7	SNP	0.830	A
TRAF3IP2	10758	genome.wustl.edu	37	6	111901440	111901440	+	Missense_Mutation	SNP	C	C	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr6:111901440C>A	ENST00000340026.6	-	4	1603	c.1009G>T	c.(1009-1011)Gca>Tca	p.A337S	TRAF3IP2_ENST00000368761.5_Missense_Mutation_p.A328S|TRAF3IP2-AS1_ENST00000442928.2_RNA|TRAF3IP2-AS1_ENST00000532353.1_RNA|TRAF3IP2-AS1_ENST00000607066.1_RNA|TRAF3IP2_ENST00000359831.4_Missense_Mutation_p.A328S|TRAF3IP2_ENST00000392556.4_5'UTR			O43734	CIKS_HUMAN	TRAF3 interacting protein 2	337					B cell apoptotic process (GO:0001783)|humoral immune response (GO:0006959)|immunoglobulin secretion (GO:0048305)|intracellular signal transduction (GO:0035556)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)			p.A337T(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|urinary_tract(1)	18		all_cancers(87;7.87e-06)|Acute lymphoblastic leukemia(125;3.61e-09)|all_hematologic(75;2.63e-07)|all_epithelial(87;0.0024)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.033)|all cancers(137;0.0412)|Epithelial(106;0.0732)		TCTCTCTGTGCGGGCCTCTCT	0.567																																																	1	Substitution - Missense(1)	endometrium(1)											41.0	44.0	43.0					6																	111901440		2203	4300	6503	SO:0001583	missense	0			AF136405	CCDS5093.1, CCDS55049.1, CCDS55050.1	6q21	2008-09-05	2002-06-20	2005-04-13	ENSG00000056972	ENSG00000056972			1343	protein-coding gene	gene with protein product		607043	"""chromosome 6 open reading frame 5"", ""chromosome 6 open reading frame 2"""	C6orf4, C6orf5, C6orf6, C6orf2		10962033, 10962024	Standard	NR_028338		Approved	DKFZP586G0522, ACT1, CIKS	uc003pvf.4	O43734	OTTHUMG00000015379	ENST00000340026.6:c.1009G>T	6.37:g.111901440C>A	ENSP00000345984:p.Ala337Ser		B2RAY9|E1P555|Q5R3A3|Q7Z6Q1|Q7Z6Q2|Q7Z6Q3|Q9H5W2|Q9H6Y3|Q9NS14|Q9UG72	Missense_Mutation	SNP	pfam_SEFIR	p.A337S	ENST00000340026.6	37	c.1009		6	.	.	.	.	.	.	.	.	.	.	C	8.945	0.966804	0.18659	.	.	ENSG00000056972	ENST00000392555;ENST00000368761;ENST00000340026;ENST00000359831	T;T;T	0.32988	1.43;1.43;1.43	5.99	1.06	0.20224	.	0.880155	0.09896	N	0.741638	T	0.10680	0.0261	L	0.53249	1.67	0.09310	N	0.999998	P;P;P	0.44044	0.732;0.825;0.732	B;B;B	0.41466	0.195;0.358;0.195	T	0.21484	-1.0244	10	0.21014	T	0.42	4.2744	5.1738	0.15124	0.0:0.415:0.2711:0.3139	.	337;328;328	O43734;O43734-2;Q7Z6Q1	CIKS_HUMAN;.;.	S	337;328;337;328	ENSP00000357750:A328S;ENSP00000345984:A337S;ENSP00000352889:A328S	ENSP00000345984:A337S	A	-	1	0	TRAF3IP2	112008133	0.000000	0.05858	0.001000	0.08648	0.119000	0.20118	-0.468000	0.06656	-0.095000	0.12351	-0.345000	0.07892	GCA	TRAF3IP2	-	NULL	ENSG00000056972		0.567	TRAF3IP2-001	KNOWN	basic	protein_coding	TRAF3IP2	HGNC	protein_coding	OTTHUMT00000041841.2		0.00	18	0	C			111901440	-1			no_errors	ENST00000340026	ensembl	human	known	74_37	missense	11.11	16	2	SNP	0.000	A
TRIM36	55521	genome.wustl.edu	37	5	114499263	114499263	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr5:114499263G>A	ENST00000282369.3	-	2	371	c.250C>T	c.(250-252)Cgg>Tgg	p.R84W	TRIM36_ENST00000515104.1_5'UTR|TRIM36_ENST00000513154.1_Missense_Mutation_p.R72W|TRIM36_ENST00000514154.1_Intron	NM_018700.3	NP_061170.2	Q9NQ86	TRI36_HUMAN	tripartite motif containing 36	84					acrosome reaction (GO:0007340)|regulation of cell cycle (GO:0051726)	acrosomal vesicle (GO:0001669)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R84W(1)		breast(3)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	37		all_cancers(142;0.00133)|all_epithelial(76;2.41e-05)|Prostate(80;0.00955)|Ovarian(225;0.0443)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;3.62e-08)|Epithelial(69;7.69e-08)|all cancers(49;9.33e-06)		GAGGGGAGCCGAAGTCGAGGA	0.443																																																	1	Substitution - Missense(1)	skin(1)											130.0	123.0	125.0					5																	114499263		2202	4300	6502	SO:0001583	missense	0			AJ272269	CCDS4115.1, CCDS34211.1, CCDS34212.1, CCDS75287.1	5q22	2013-02-11	2011-01-25		ENSG00000152503	ENSG00000152503		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	16280	protein-coding gene	gene with protein product	"""zinc-binding protein Rbcc728"", ""tripartite motif protein 36"", ""RING finger protein 98"""	609317	"""tripartite motif-containing 36"""			11331580	Standard	XM_005272031		Approved	RBCC728, RNF98, HAPRIN	uc003kqs.3	Q9NQ86	OTTHUMG00000128892	ENST00000282369.3:c.250C>T	5.37:g.114499263G>A	ENSP00000282369:p.Arg84Trp		A1L3Z1|A6NDD0|B7Z3V4|B7ZAV7|E9PFI8|Q0P5Z9	Missense_Mutation	SNP	pfam_Znf_B-box,pfam_Fibronectin_type3,pfam_SPRY_rcpt,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Znf_RING,smart_Znf_B-box,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.R84W	ENST00000282369.3	37	c.250	CCDS4115.1	5	.	.	.	.	.	.	.	.	.	.	G	15.55	2.867347	0.51588	.	.	ENSG00000152503	ENST00000282369;ENST00000513154;ENST00000508894	T;T;T	0.56776	0.44;0.56;0.75	5.31	5.31	0.75309	Zinc finger, RING-type (2);	1.449480	0.04013	N	0.298579	T	0.75759	0.3893	M	0.65498	2.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.58918	-0.7551	10	0.87932	D	0	.	15.3487	0.74363	0.0:0.0:0.8599:0.1401	.	72;84	E9PFI8;Q9NQ86	.;TRI36_HUMAN	W	84;72;72	ENSP00000282369:R84W;ENSP00000423934:R72W;ENSP00000424743:R72W	ENSP00000282369:R84W	R	-	1	2	TRIM36	114527162	1.000000	0.71417	0.493000	0.27502	0.997000	0.91878	3.656000	0.54467	2.468000	0.83385	0.655000	0.94253	CGG	TRIM36	-	smart_Znf_RING,pfscan_Znf_RING	ENSG00000152503		0.443	TRIM36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM36	HGNC	protein_coding	OTTHUMT00000250854.2		0.00	45	0	G	NM_018700		114499263	-1			no_errors	ENST00000282369	ensembl	human	known	74_37	missense	5.71	33	2	SNP	0.992	A
TRIM52	84851	genome.wustl.edu	37	5	180687602	180687602	+	Silent	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr5:180687602C>T	ENST00000327767.4	-	1	517	c.213G>A	c.(211-213)gcG>gcA	p.A71A	CTC-338M12.4_ENST00000511331.1_RNA|TRIM52_ENST00000514805.1_5'UTR|TRIM52-AS1_ENST00000509252.1_RNA|TRIM52-AS1_ENST00000514146.1_RNA|TRIM52-AS1_ENST00000507434.1_RNA	NM_032765.2	NP_116154.1	Q96A61	TRI52_HUMAN	tripartite motif containing 52	71	Glu-rich.				positive regulation of NF-kappaB transcription factor activity (GO:0051092)	intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(3)|skin(1)|stomach(1)	8	all_cancers(89;8.79e-06)|all_epithelial(37;1.13e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0654)	all_cancers(40;0.0106)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.0588)|all_lung(500;0.149)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.232)		TGGCCCCCACCGCTtcctcgt	0.567																																																	0													150.0	112.0	125.0					5																	180687602		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS4467.1	5q35.3	2013-01-09	2011-01-25		ENSG00000183718	ENSG00000183718		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19024	protein-coding gene	gene with protein product			"""tripartite motif-containing 52"""				Standard	NM_032765		Approved	RNF102	uc003mnp.3	Q96A61	OTTHUMG00000130964	ENST00000327767.4:c.213G>A	5.37:g.180687602C>T				Silent	SNP	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_Znf_B-box,pfscan_Znf_B-box,pfscan_Znf_RING	p.A71	ENST00000327767.4	37	c.213	CCDS4467.1	5																																																																																			TRIM52	-	smart_Znf_RING	ENSG00000183718		0.567	TRIM52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM52	HGNC	protein_coding	OTTHUMT00000253572.3	-	0.00	23	0	C	NM_032765		180687602	-1	tier1	-	no_errors	ENST00000327767	ensembl	human	known	74_37	silent	50.00	9	9	SNP	0.002	T
TRIM34	53840	genome.wustl.edu	37	11	5655908	5655908	+	Silent	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr11:5655908G>A	ENST00000514226.1	+	4	904	c.567G>A	c.(565-567)caG>caA	p.Q189Q	TRIM6-TRIM34_ENST00000457787.2_Silent_p.Q189Q|TRIM34_ENST00000429814.2_Silent_p.Q189Q|HBG2_ENST00000380259.2_Intron|TRIM6-TRIM34_ENST00000354852.5_Silent_p.Q543Q	NM_001003827.1	NP_001003827.1	Q9BYJ4	TRI34_HUMAN	tripartite motif containing 34	189					positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein trimerization (GO:0070206)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	17		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;5.72e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AATTTGATCAGCTTAGAAGCA	0.423																																																	0													67.0	63.0	64.0					11																	5655908		2201	4297	6498	SO:0001819	synonymous_variant	0			AB039902	CCDS31391.1	11p15	2013-01-09	2011-01-25	2001-11-23		ENSG00000258659		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10063	protein-coding gene	gene with protein product		605684	"""tripartite motif-containing 34"""	RNF21			Standard	NM_130390		Approved			Q9BYJ4	OTTHUMG00000066892	ENST00000514226.1:c.567G>A	11.37:g.5655908G>A			D3DQS7|Q9C016|Q9HCR0|Q9HCR1|Q9HCR2	Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.Q543	ENST00000514226.1	37	c.1629	CCDS31391.1	11																																																																																			TRIM6-TRIM34	-	NULL	ENSG00000258588		0.423	TRIM34-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TRIM6-TRIM34	HGNC	protein_coding	OTTHUMT00000143357.2	-	0.00	20	0	G	NM_001003827		5655908	+1	tier1	-	no_errors	ENST00000354852	ensembl	human	known	74_37	silent	36.84	12	7	SNP	0.003	A
TRPV6	55503	genome.wustl.edu	37	7	142574200	142574200	+	Silent	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr7:142574200G>A	ENST00000359396.3	-	6	968	c.723C>T	c.(721-723)ctC>ctT	p.L241L	RP11-114L10.2_ENST00000438839.1_RNA	NM_018646.3	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel, subfamily V, member 6	241					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|regulation of calcium ion-dependent exocytosis (GO:0017158)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)			breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	42	Melanoma(164;0.059)					TGAAAGGGGTGAGACCCTGGT	0.572																																																	0													118.0	104.0	109.0					7																	142574200		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ277909	CCDS5874.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000165125	ENSG00000165125		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	14006	protein-coding gene	gene with protein product		606680	"""epithelial calcium channel 2"""	ECAC2		11097838, 11549322, 16382100, 16717058	Standard	NM_018646		Approved	CaT1	uc003wbx.2	Q9H1D0	OTTHUMG00000157158	ENST00000359396.3:c.723C>T	7.37:g.142574200G>A			A4D2I8|Q8TDL3|Q8WXR8|Q96LC5|Q9H1D1|Q9H296	Silent	SNP	pfam_Ankyrin_rpt,pfam_Ion_trans_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPV5/TRPV6,prints_TRPV6_channel,prints_Ankyrin_rpt,tigrfam_TRP_channel	p.L241	ENST00000359396.3	37	c.723	CCDS5874.1	7																																																																																			TRPV6	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,tigrfam_TRP_channel	ENSG00000165125		0.572	TRPV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPV6	HGNC	protein_coding	OTTHUMT00000347662.1	-	0.00	98	0	G	NM_014274		142574200	-1	tier1	-	no_errors	ENST00000359396	ensembl	human	known	74_37	silent	26.61	78	29	SNP	1.000	A
CFAP46	54777	genome.wustl.edu	37	10	134672745	134672745	+	Silent	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr10:134672745C>G	ENST00000368586.5	-	38	5305	c.5205G>C	c.(5203-5205)ctG>ctC	p.L1735L	TTC40_ENST00000263170.5_5'Flank	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						CCCGCAGGCTCAGGCACCTGA	0.617																																																	0																																										SO:0001819	synonymous_variant	0																														ENST00000368586.5:c.5205G>C	10.37:g.134672745C>G				Silent	SNP	NULL	p.L1735	ENST00000368586.5	37	c.5205	CCDS58101.1	10																																																																																			TTC40	-	NULL	ENSG00000171811		0.617	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TTC40	HGNC	protein_coding	OTTHUMT00000051095.3	-	0.00	24	0	C			134672745	-1	tier1	-	no_errors	ENST00000368586	ensembl	human	putative	74_37	silent	50.00	6	6	SNP	0.066	G
TTN	7273	genome.wustl.edu	37	2	179397665	179397665	+	Missense_Mutation	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr2:179397665G>C	ENST00000591111.1	-	308	98978	c.98754C>G	c.(98752-98754)atC>atG	p.I32918M	TTN_ENST00000359218.5_Missense_Mutation_p.I25619M|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.I25494M|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000589355.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.I25686M|TTN_ENST00000342992.6_Missense_Mutation_p.I31991M|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.I34559M|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000592689.1_RNA			Q8WZ42	TITIN_HUMAN	titin	32918					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CGAACTGCTTGATGCGTTGGT	0.438																																																	0													131.0	132.0	132.0					2																	179397665		2054	4202	6256	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.98754C>G	2.37:g.179397665G>C	ENSP00000465570:p.Ile32918Met		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.I31991M	ENST00000591111.1	37	c.95973		2	.	.	.	.	.	.	.	.	.	.	G	11.01	1.514124	0.27123	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.70164	-0.46;-0.24;-0.26;-0.27	5.94	-8.0	0.01126	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.63546	0.2520	N	0.19112	0.55	0.38327	D	0.943693	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.80764	0.994;0.994;0.994;0.994	T	0.74343	-0.3696	9	0.87932	D	0	.	12.0388	0.53442	0.386:0.0:0.5294:0.0845	.	25494;25619;25686;32918	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	M	31991;25494;25686;25619;25491	ENSP00000343764:I31991M;ENSP00000434586:I25494M;ENSP00000340554:I25686M;ENSP00000352154:I25619M	ENSP00000340554:I25686M	I	-	3	3	TTN	179105911	0.526000	0.26298	0.897000	0.35233	0.634000	0.38068	-0.110000	0.10824	-1.004000	0.03421	-0.367000	0.07326	ATC	TTN	-	superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom	ENSG00000155657		0.438	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	37	0	G	NM_133378		179397665	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	29.03	22	9	SNP	0.851	C
TTN	7273	genome.wustl.edu	37	2	179441051	179441051	+	Missense_Mutation	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr2:179441051G>A	ENST00000591111.1	-	276	65109	c.64885C>T	c.(64885-64887)Ctt>Ttt	p.L21629F	TTN_ENST00000359218.5_Missense_Mutation_p.L14330F|TTN_ENST00000460472.2_Missense_Mutation_p.L14205F|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592600.1_RNA|RP11-171I2.2_ENST00000603521.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000585451.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.L14397F|TTN_ENST00000342992.6_Missense_Mutation_p.L20702F|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.L23270F|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000592689.1_RNA			Q8WZ42	TITIN_HUMAN	titin	21629	Fibronectin type-III 57. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTGATTTCAAGTCCACCATCA	0.473																																																	0													67.0	64.0	65.0					2																	179441051		1924	4135	6059	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.64885C>T	2.37:g.179441051G>A	ENSP00000465570:p.Leu21629Phe		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.L20702F	ENST00000591111.1	37	c.62104		2	.	.	.	.	.	.	.	.	.	.	G	10.86	1.469569	0.26423	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57273	0.41;0.41;0.41;0.41	5.87	4.99	0.66335	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.69450	0.3112	M	0.64997	1.995	0.49798	D	0.999828	D;D;D;D	0.69078	0.997;0.997;0.997;0.994	D;D;D;D	0.68039	0.955;0.955;0.955;0.936	T	0.73672	-0.3909	9	0.87932	D	0	.	16.605	0.84826	0.0:0.0:0.8691:0.1309	.	14205;14330;14397;21629	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	F	20702;14205;14397;14330;14203	ENSP00000343764:L20702F;ENSP00000434586:L14205F;ENSP00000340554:L14397F;ENSP00000352154:L14330F	ENSP00000340554:L14397F	L	-	1	0	TTN	179149297	1.000000	0.71417	0.998000	0.56505	0.611000	0.37282	5.729000	0.68538	1.467000	0.48044	0.655000	0.94253	CTT	TTN	-	pfam_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.473	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1		0.00	11	0	G	NM_133378		179441051	-1			no_errors	ENST00000342992	ensembl	human	known	74_37	missense	30.00	7	3	SNP	1.000	A
TUBBP5	643224	genome.wustl.edu	37	9	141070915	141070915	+	RNA	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr9:141070915C>T	ENST00000503395.1	+	0	1690									tubulin, beta pseudogene 5									p.T178T(1)									TGTCAGACACCGTGGTGGAGC	0.522																																																	1	Substitution - coding silent(1)	prostate(1)																																										0			AF355123		9q34.3	2012-03-06	2005-11-15		ENSG00000159247	ENSG00000159247			23674	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 5"""			11731935	Standard	NR_027156		Approved		uc010ncq.3		OTTHUMG00000021001		9.37:g.141070915C>T				RNA	SNP	-	NULL	ENST00000503395.1	37	NULL		9																																																																																			TUBBP5	-	-	ENSG00000159247		0.522	TUBBP5-003	KNOWN	basic	processed_transcript	TUBBP5	HGNC	pseudogene	OTTHUMT00000373087.1		0.00	75	0	C	NR_027156		141070915	+1			no_errors	ENST00000290377	ensembl	human	known	74_37	rna	8.33	22	2	SNP	0.991	T
UBA1	7317	genome.wustl.edu	37	X	47074032	47074032	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chrX:47074032C>G	ENST00000335972.6	+	25	3220	c.3037C>G	c.(3037-3039)Cag>Gag	p.Q1013E	UBA1_ENST00000377351.4_Missense_Mutation_p.Q1013E|UBA1_ENST00000377269.3_Missense_Mutation_p.Q461E	NM_003334.3	NP_003325.2	P22314	UBA1_HUMAN	ubiquitin-like modifier activating enzyme 1	1013					cell death (GO:0008219)|cellular response to DNA damage stimulus (GO:0006974)|modification-dependent protein catabolic process (GO:0019941)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						ACGGTTGGATCAGCCGTGAGT	0.572																																																	0													68.0	44.0	52.0					X																	47074032		2203	4300	6503	SO:0001583	missense	0			AF258566	CCDS14275.1	Xp11.23	2014-08-13	2007-11-30	2007-11-30	ENSG00000130985	ENSG00000130985	6.3.2.19	"""Ubiquitin-like modifier activating enzymes"""	12469	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog (yeast)"", ""POC20 centriolar protein homolog (Chlamydomonas)"""	314370	"""ubiquitin-activating enzyme E1 (A1S9T and BN75 temperature sensitivity complementing)"", ""ubiquitin-activating enzyme E1"""	A1S9T, GXP1, UBE1		1845793	Standard	NM_153280		Approved	UBE1X, POC20, CFAP124	uc004dhj.4	P22314	OTTHUMG00000021436	ENST00000335972.6:c.3037C>G	X.37:g.47074032C>G	ENSP00000338413:p.Gln1013Glu		Q5JRR8|Q96E13	Missense_Mutation	SNP	pfam_ThiF_NAD_FAD-bd,pfam_Ub-activating_enz_e1_C,pfam_UBact_repeat,pfam_Ubiquitin-activating_enzyme,superfamily_Molybdenum_cofac_synth_MoeB,prints_UBQ/SUMO-activ_enz_E1-like,tigrfam_UBQ-activ_enz_E1	p.Q1013E	ENST00000335972.6	37	c.3037	CCDS14275.1	X	.	.	.	.	.	.	.	.	.	.	c	16.87	3.241646	0.58995	.	.	ENSG00000130985	ENST00000377351;ENST00000335972;ENST00000377269	T;T;T	0.42131	0.98;0.98;1.56	5.38	5.38	0.77491	Ubiquitin-activating enzyme e1, C-terminal (1);	0.066513	0.64402	D	0.000008	T	0.50188	0.1601	M	0.70595	2.14	0.43263	D	0.995201	B;B	0.26672	0.156;0.053	B;B	0.36030	0.216;0.079	T	0.47071	-0.9145	10	0.33940	T	0.23	-17.3894	17.1756	0.86841	0.0:1.0:0.0:0.0	.	461;1013	Q5JRR6;P22314	.;UBA1_HUMAN	E	1013;1013;461	ENSP00000366568:Q1013E;ENSP00000338413:Q1013E;ENSP00000366481:Q461E	ENSP00000338413:Q1013E	Q	+	1	0	UBA1	46958976	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.364000	0.59479	2.409000	0.81822	0.525000	0.51046	CAG	UBA1	-	pfam_Ub-activating_enz_e1_C,tigrfam_UBQ-activ_enz_E1	ENSG00000130985		0.572	UBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBA1	HGNC	protein_coding	OTTHUMT00000056389.1	-	0.00	29	0	C	NM_003334		47074032	+1	tier1	-	no_errors	ENST00000335972	ensembl	human	known	74_37	missense	28.57	30	12	SNP	1.000	G
ULK4P3	89837	genome.wustl.edu	37	15	30395997	30395997	+	RNA	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr15:30395997G>C	ENST00000568486.1	+	0	63					NR_026859.1				ULK4 pseudogene 3																		CGGCGGCGGGGAGAGGTGGAG	0.731																																																	0																																												0			BC023564		15q13.2	2014-03-20	2013-09-12	2011-11-25	ENSG00000178081	ENSG00000178081			15777	pseudogene	pseudogene			"""family with sequence similarity 7, member A3"", ""unc-51-like kinase 4 (C. elegans) pseudogene 3"""	FAM7A3		11829490	Standard	NR_026859		Approved	D-X	uc001zdk.3		OTTHUMG00000175637		15.37:g.30395997G>C				RNA	SNP	-	NULL	ENST00000568486.1	37	NULL		15																																																																																			ULK4P3	-	-	ENSG00000178081		0.731	ULK4P3-002	PUTATIVE	basic	processed_transcript	ULK4P3	HGNC	pseudogene	OTTHUMT00000430688.1		0.00	134	0	G			30395997	+1			no_errors	ENST00000565158	ensembl	human	putative	74_37	rna	8.89	82	8	SNP	0.008	C
UROD	7389	genome.wustl.edu	37	1	45479618	45479618	+	Nonsense_Mutation	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr1:45479618C>G	ENST00000246337.4	+	6	631	c.512C>G	c.(511-513)tCa>tGa	p.S171*	HECTD3_ENST00000372172.4_5'Flank|UROD_ENST00000494399.1_3'UTR	NM_000374.4	NP_000365.3	P06132	DCUP_HUMAN	uroporphyrinogen decarboxylase	171					heme biosynthetic process (GO:0006783)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	uroporphyrinogen decarboxylase activity (GO:0004853)			endometrium(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	4	Acute lymphoblastic leukemia(166;0.155)					GGTGGTGGCTCAAGCACCATG	0.532									Porphyria Cutanea Tarda, Type II																																								0													149.0	138.0	141.0					1																	45479618		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	PCT-II	BC001778	CCDS518.1	1p34	2012-10-02			ENSG00000126088	ENSG00000126088	4.1.1.37		12591	protein-coding gene	gene with protein product		613521				3015909, 3460962	Standard	NM_000374		Approved		uc001cna.2	P06132	OTTHUMG00000008949	ENST00000246337.4:c.512C>G	1.37:g.45479618C>G	ENSP00000246337:p.Ser171*		A8K762|Q16863|Q16883|Q53YB8|Q53ZP6|Q6IB28|Q9BUZ0	Nonsense_Mutation	SNP	pfam_Uroporphyrinogen_deCOase,tigrfam_Uroporphyrinogen_deCO2ase_HemE	p.S171*	ENST00000246337.4	37	c.512	CCDS518.1	1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.973564	0.74246	.	.	ENSG00000126088	ENST00000246337;ENST00000434478;ENST00000372135	.	.	.	5.78	4.85	0.62838	.	0.115930	0.64402	D	0.000010	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-50.735	15.9639	0.79952	0.1359:0.8641:0.0:0.0	.	.	.	.	X	171;150;150	.	ENSP00000246337:S171X	S	+	2	0	UROD	45252205	1.000000	0.71417	0.987000	0.45799	0.987000	0.75469	7.211000	0.77933	1.382000	0.46385	0.655000	0.94253	TCA	UROD	-	pfam_Uroporphyrinogen_deCOase,tigrfam_Uroporphyrinogen_deCO2ase_HemE	ENSG00000126088		0.532	UROD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UROD	HGNC	protein_coding	OTTHUMT00000024803.1	-	0.00	25	0	C	NM_000374		45479618	+1	tier1	-	no_errors	ENST00000246337	ensembl	human	known	74_37	nonsense	28.00	18	7	SNP	1.000	G
USP32P2	220594	genome.wustl.edu	37	17	18415379	18415382	+	RNA	DEL	TATT	TATT	-	rs547797129	byFrequency	TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	TATT	TATT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr17:18415379_18415382delTATT	ENST00000425211.1	-	0	3887_3890				USP32P2_ENST00000412260.1_RNA																							CAGTCTTGAATATTTAGAGGAAAA	0.221																																																	0																																												0																															17.37:g.18415379_18415382delTATT				RNA	DEL	-	NULL	ENST00000425211.1	37	NULL		17																																																																																			USP32P2	-	-	ENSG00000233327		0.221	CTD-2303H24.2-001	KNOWN	basic|readthrough_transcript	processed_transcript	USP32P2	HGNC	processed_transcript	OTTHUMT00000473021.1		0.00	44	0	TATT			18415382	-1	tier1		no_errors	ENST00000412260	ensembl	human	known	74_37	rna	12.50	28	4	DEL	0.702:0.636:0.550:0.518	-
USP32P2	220594	genome.wustl.edu	37	17	18415388	18415388	+	RNA	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr17:18415388G>A	ENST00000425211.1	-	0	3881				USP32P2_ENST00000412260.1_RNA																							ATATTTAGAGGAAAAAATGAA	0.229																																																	0																																												0																															17.37:g.18415388G>A				RNA	SNP	-	NULL	ENST00000425211.1	37	NULL		17																																																																																			USP32P2	-	-	ENSG00000233327		0.229	CTD-2303H24.2-001	KNOWN	basic|readthrough_transcript	processed_transcript	USP32P2	HGNC	processed_transcript	OTTHUMT00000473021.1	-	0.00	42	0	G			18415388	-1	tier1	-	no_errors	ENST00000412260	ensembl	human	known	74_37	rna	13.33	26	4	SNP	0.462	A
VANGL1	81839	genome.wustl.edu	37	1	116206829	116206829	+	Missense_Mutation	SNP	C	C	T	rs201630629		TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr1:116206829C>T	ENST00000355485.2	+	4	1023	c.752C>T	c.(751-753)aCg>aTg	p.T251M	VANGL1_ENST00000369510.4_Missense_Mutation_p.T249M|VANGL1_ENST00000369509.1_Missense_Mutation_p.T251M|VANGL1_ENST00000310260.3_Missense_Mutation_p.T251M	NM_001172411.1|NM_138959.2	NP_001165882.1|NP_620409.1	Q8TAA9	VANG1_HUMAN	VANGL planar cell polarity protein 1	251			T -> M. {ECO:0000269|PubMed:19319979}.		multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)		p.T251M(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|liver(2)|lung(13)|urinary_tract(1)	27	Lung SC(450;0.211)	all_cancers(81;1.24e-06)|all_epithelial(167;1.02e-06)|all_lung(203;7.95e-06)|Lung NSC(69;4.97e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		CCCATGTTCACGCTGCAGGTG	0.587																																																	1	Substitution - Missense(1)	endometrium(1)											65.0	61.0	62.0					1																	116206829		2203	4300	6503	SO:0001583	missense	0			AB075805	CCDS883.1, CCDS53350.1	1p13.1	2013-03-05	2013-03-05		ENSG00000173218	ENSG00000173218			15512	protein-coding gene	gene with protein product		610132	"""vang (van gogh, Drosophila)-like 1, vang, van gogh-like 1 (Drosophila)"", ""vang-like 1 (van gogh, Drosophila)"""			11956595, 12011995	Standard	NM_001172411		Approved	STB2	uc001efv.1	Q8TAA9	OTTHUMG00000011971	ENST00000355485.2:c.752C>T	1.37:g.116206829C>T	ENSP00000347672:p.Thr251Met		Q5T1D3|Q5T1D4|Q86WG8|Q8N559	Missense_Mutation	SNP	pfam_Strabismus,pirsf_Strabismus	p.T251M	ENST00000355485.2	37	c.752	CCDS883.1	1	.	.	.	.	.	.	.	.	.	.	C	19.16	3.774538	0.70107	.	.	ENSG00000173218	ENST00000355485;ENST00000369510;ENST00000310260;ENST00000369509	T;T;T;T	0.80653	-1.4;-1.4;-1.4;-1.4	5.73	5.73	0.89815	.	0.160562	0.56097	D	0.000022	D	0.82412	0.5031	L	0.56769	1.78	0.42422	D	0.992642	D;D	0.58620	0.979;0.983	P;P	0.54210	0.629;0.745	T	0.79783	-0.1658	10	0.38643	T	0.18	-26.386	20.2921	0.98543	0.0:1.0:0.0:0.0	.	249;251	Q8TAA9-2;Q8TAA9	.;VANG1_HUMAN	M	251;249;251;251	ENSP00000347672:T251M;ENSP00000358523:T249M;ENSP00000310800:T251M;ENSP00000358522:T251M	ENSP00000310800:T251M	T	+	2	0	VANGL1	116008352	0.991000	0.36638	1.000000	0.80357	0.998000	0.95712	2.984000	0.49353	2.879000	0.98667	0.650000	0.86243	ACG	VANGL1	-	pfam_Strabismus,pirsf_Strabismus	ENSG00000173218		0.587	VANGL1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VANGL1	HGNC	protein_coding	OTTHUMT00000033096.1		0.00	37	0	C			116206829	+1			no_errors	ENST00000310260	ensembl	human	known	74_37	missense	6.06	31	2	SNP	1.000	T
VMP1	81671	genome.wustl.edu	37	17	57915485	57915485	+	Intron	DEL	C	C	-			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr17:57915485delC	ENST00000262291.4	+	11	1284				VMP1_ENST00000588617.1_3'UTR|VMP1_ENST00000539763.1_Intron|VMP1_ENST00000545362.1_Intron|VMP1_ENST00000537567.1_Intron|VMP1_ENST00000536180.1_Intron	NM_030938.3	NP_112200.2	Q96GC9	VMP1_HUMAN	vacuole membrane protein 1						autophagy (GO:0006914)|cell junction assembly (GO:0034329)|embryo implantation (GO:0007566)|regulation of autophagy (GO:0010506)|single organismal cell-cell adhesion (GO:0016337)	autophagic vacuole membrane (GO:0000421)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|pre-autophagosomal structure (GO:0000407)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|skin(2)	16						ttttttttAACTAAAAAGGGG	0.348																																																	0																																										SO:0001627	intron_variant	0				CCDS11619.1	17q23.1	2014-05-20	2011-03-02	2011-03-02	ENSG00000062716	ENSG00000062716			29559	protein-coding gene	gene with protein product	"""ectopic P-granules autophagy protein 3 homolog (C. elegans)"", ""transport and golgi organization 5 homolog (Drosophila)"""	611753	"""transmembrane protein 49"""	TMEM49		11230166, 11785947	Standard	NM_030938		Approved	EPG3, TANGO5	uc002ixu.4	Q96GC9	OTTHUMG00000179882	ENST00000262291.4:c.975-171C>-	17.37:g.57915485delC			B4DVV9|Q9H0P4|Q9P089	RNA	DEL	-	NULL	ENST00000262291.4	37	NULL	CCDS11619.1	17																																																																																			VMP1	-	-	ENSG00000062716		0.348	VMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VMP1	HGNC	protein_coding	OTTHUMT00000448793.1		0.00	26	0	C	NM_030938		57915485	+1	tier1		no_errors	ENST00000588617	ensembl	human	known	74_37	rna	14.29	18	3	DEL	0.001	-
VNN3	55350	genome.wustl.edu	37	6	133045810	133045810	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr6:133045810C>T	ENST00000207771.3	-	6	1207	c.1135G>A	c.(1135-1137)Gac>Aac	p.D379N	VNN3_ENST00000367927.5_3'UTR|VNN3_ENST00000425515.2_3'UTR|VNN3_ENST00000519686.2_3'UTR|VNN3_ENST00000509351.1_3'UTR|VNN3_ENST00000275223.3_3'UTR|VNN3_ENST00000423615.2_3'UTR|VNN3_ENST00000392393.3_3'UTR|VNN3_ENST00000417437.2_3'UTR|VNN3_ENST00000414302.2_3'UTR|VNN3_ENST00000427187.2_3'UTR			Q9NY84	VNN3_HUMAN	vanin 3	380					nitrogen compound metabolic process (GO:0006807)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	pantetheine hydrolase activity (GO:0017159)			cervix(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	8	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00242)|GBM - Glioblastoma multiforme(226;0.0168)		TAGATCTCGTCTGTTCGCTTC	0.393																																																	0													33.0	31.0	32.0					6																	133045810		876	1991	2867	SO:0001583	missense	0			AJ238982		6q23.2	2014-04-09	2010-11-15	2010-11-15	ENSG00000093134	ENSG00000093134	3.5.1.92	"""Vanins"""	16431	other	unknown		606592				10501839, 19932582, 19322213	Standard	NR_028290		Approved	HSA238982	uc010kfs.3	Q9NY84	OTTHUMG00000015589	ENST00000207771.3:c.1135G>A	6.37:g.133045810C>T	ENSP00000440594:p.Asp379Asn		B2DFY0|B2DFY1|B2DFY3|B2DFY5|B2DFY6|B2DFY7|B2DFY8|Q3SX90|Q9BQY2	Missense_Mutation	SNP	pfam_C-N_Hydrolase,superfamily_C-N_Hydrolase,pirsf_Biotinidase_euk,pfscan_C-N_Hydrolase	p.D379N	ENST00000207771.3	37	c.1135		6	.	.	.	.	.	.	.	.	.	.	C	13.07	2.126414	0.37533	.	.	ENSG00000093134	ENST00000207771	D	0.87412	-2.25	4.88	4.01	0.46588	.	0.000000	0.64402	U	0.000005	T	0.67785	0.2930	.	.	.	0.80722	D	1	B	0.18166	0.026	B	0.21151	0.033	T	0.63475	-0.6629	9	0.16896	T	0.51	-33.246	13.7079	0.62651	0.0:0.9242:0.0:0.0758	.	380	Q9NY84	VNN3_HUMAN	N	379	ENSP00000440594:D379N	ENSP00000440594:D379N	D	-	1	0	VNN3	133087503	0.969000	0.33509	0.013000	0.15412	0.107000	0.19398	2.379000	0.44318	1.185000	0.42971	0.585000	0.79938	GAC	VNN3	-	pirsf_Biotinidase_euk	ENSG00000093134		0.393	VNN3-201	KNOWN	basic|appris_principal	protein_coding	VNN3	HGNC	protein_coding		-	0.00	68	0	C	NR_028290		133045810	-1	tier1	-	no_errors	ENST00000207771	ensembl	human	known	74_37	missense	32.00	34	16	SNP	0.969	T
VWA8	23078	genome.wustl.edu	37	13	42277462	42277462	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr13:42277462C>G	ENST00000379310.3	-	27	3270	c.3202G>C	c.(3202-3204)Gaa>Caa	p.E1068Q		NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8	1068						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.E1068K(1)									TGATGAGTTTCCACTGGACAC	0.368																																																	1	Substitution - Missense(1)	skin(1)											114.0	107.0	109.0					13																	42277462		1849	4105	5954	SO:0001583	missense	0			AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.3202G>C	13.37:g.42277462C>G	ENSP00000368612:p.Glu1068Gln		O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	Missense_Mutation	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_VWF_A,superfamily_P-loop_NTPase,smart_AAA+_ATPase,smart_VWF_A,pfscan_VWF_A	p.E1068Q	ENST00000379310.3	37	c.3202	CCDS41881.1	13	.	.	.	.	.	.	.	.	.	.	C	14.91	2.677889	0.47886	.	.	ENSG00000102763	ENST00000251030;ENST00000379310	T	0.11277	2.79	5.55	5.55	0.83447	.	0.055071	0.64402	D	0.000001	T	0.14917	0.0360	L	0.54323	1.7	0.80722	D	1	B	0.19445	0.036	B	0.17098	0.017	T	0.04811	-1.0925	10	0.28530	T	0.3	.	19.8667	0.96806	0.0:1.0:0.0:0.0	.	1068	A3KMH1	K0564_HUMAN	Q	972;1068	ENSP00000368612:E1068Q	ENSP00000251030:E972Q	E	-	1	0	KIAA0564	41175462	1.000000	0.71417	1.000000	0.80357	0.755000	0.42902	3.824000	0.55723	2.773000	0.95371	0.655000	0.94253	GAA	VWA8	-	NULL	ENSG00000102763		0.368	VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA8	HGNC	protein_coding	OTTHUMT00000354828.2		0.00	47	0	C	NM_015058		42277462	-1			no_errors	ENST00000379310	ensembl	human	known	74_37	missense	6.25	30	2	SNP	1.000	G
VWA8	23078	genome.wustl.edu	37	13	42439942	42439942	+	Missense_Mutation	SNP	C	C	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr13:42439942C>A	ENST00000379310.3	-	12	1423	c.1355G>T	c.(1354-1356)gGa>gTa	p.G452V	VWA8_ENST00000281496.6_Missense_Mutation_p.G452V	NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8	452						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)										CACTGTTTTTCCACAACCCTA	0.373																																																	0													132.0	123.0	126.0					13																	42439942		2203	4300	6503	SO:0001583	missense	0			AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.1355G>T	13.37:g.42439942C>A	ENSP00000368612:p.Gly452Val		O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	Missense_Mutation	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_VWF_A,superfamily_P-loop_NTPase,smart_AAA+_ATPase,smart_VWF_A,pfscan_VWF_A	p.G452V	ENST00000379310.3	37	c.1355	CCDS41881.1	13	.	.	.	.	.	.	.	.	.	.	C	25.0	4.595034	0.86953	.	.	ENSG00000102763	ENST00000251030;ENST00000379310;ENST00000281496;ENST00000398857	D;D	0.92099	-2.97;-2.97	5.3	5.3	0.74995	ATPase, AAA+ type, core (1);ATPase, dynein-related, AAA domain (1);	0.000000	0.64402	D	0.000001	D	0.97676	0.9238	H	0.96720	3.87	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98763	1.0725	10	0.87932	D	0	.	19.3149	0.94208	0.0:1.0:0.0:0.0	.	452	A3KMH1	K0564_HUMAN	V	356;452;452;452	ENSP00000368612:G452V;ENSP00000281496:G452V	ENSP00000251030:G356V	G	-	2	0	KIAA0564	41337942	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.125000	0.77193	2.631000	0.89168	0.563000	0.77884	GGA	VWA8	-	pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	ENSG00000102763		0.373	VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA8	HGNC	protein_coding	OTTHUMT00000354828.2	-	0.00	82	0	C	NM_015058		42439942	-1	tier1	-	no_errors	ENST00000379310	ensembl	human	known	74_37	missense	35.14	24	13	SNP	1.000	A
WDR27	253769	genome.wustl.edu	37	6	169857518	169857518	+	3'UTR	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr6:169857518G>A	ENST00000448612.1	-	0	2966				WDR27_ENST00000333572.6_3'UTR|WDR27_ENST00000423258.1_3'UTR	NM_182552.4	NP_872358.4	A2RRH5	WDR27_HUMAN	WD repeat domain 27							nucleus (GO:0005634)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)|skin(1)	12		Breast(66;1.53e-05)|Ovarian(120;0.216)		OV - Ovarian serous cystadenocarcinoma(33;6.48e-20)|BRCA - Breast invasive adenocarcinoma(81;3.56e-07)|GBM - Glioblastoma multiforme(31;0.00168)		CTCTGACATGGCACACACAGA	0.468																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK131435	CCDS47520.1, CCDS47520.2, CCDS56459.1	6q27	2013-01-09	2003-06-18		ENSG00000184465	ENSG00000184465		"""WD repeat domain containing"""	21248	protein-coding gene	gene with protein product							Standard	NM_182552		Approved	MGC43690	uc003qwx.3	A2RRH5	OTTHUMG00000016061	ENST00000448612.1:c.*169C>T	6.37:g.169857518G>A			A5PLM8|C9JGV0|Q5T066	RNA	SNP	-	NULL	ENST00000448612.1	37	NULL	CCDS47520.2	6																																																																																			WDR27	-	-	ENSG00000184465		0.468	WDR27-010	KNOWN	basic|CCDS	protein_coding	WDR27	HGNC	protein_coding	OTTHUMT00000407334.1	-	0.00	9	0	G	NM_182552		169857518	-1	tier1	-	no_errors	ENST00000479310	ensembl	human	known	74_37	rna	45.45	6	5	SNP	0.000	A
WNK2	65268	genome.wustl.edu	37	9	95997225	95997225	+	Missense_Mutation	SNP	A	A	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr9:95997225A>G	ENST00000297954.4	+	4	1211	c.1211A>G	c.(1210-1212)cAg>cGg	p.Q404R	WNK2_ENST00000427277.2_Missense_Mutation_p.Q16R|WNK2_ENST00000349097.3_Missense_Mutation_p.Q16R|WNK2_ENST00000395477.2_Missense_Mutation_p.Q404R|WNK2_ENST00000395475.2_Missense_Mutation_p.Q390R|WNK2_ENST00000356055.3_5'UTR	NM_001282394.1	NP_001269323.1	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	404	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(11)|kidney(4)|large_intestine(5)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)	54						AATGCGGCCCAGATCTACCGC	0.587																																																	0													97.0	74.0	82.0					9																	95997225		2203	4300	6503	SO:0001583	missense	0			AJ242724	CCDS75858.1	9q22.3	2008-02-05	2003-06-23	2005-01-22	ENSG00000165238	ENSG00000165238			14542	protein-coding gene	gene with protein product		606249	"""serologically defined colon cancer antigen 43"""	SDCCAG43, PRKWNK2		9610721, 11571656	Standard	NM_006648		Approved	NY-CO-43, KIAA1760	uc004atj.3	Q9Y3S1	OTTHUMG00000020247	ENST00000297954.4:c.1211A>G	9.37:g.95997225A>G	ENSP00000297954:p.Gln404Arg		Q5VWF1|Q5VWF2|Q8IY36|Q9C0A3|Q9H3P4	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.Q404R	ENST00000297954.4	37	c.1211		9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.57|19.57	3.851579|3.851579	0.71719|0.71719	.|.	.|.	ENSG00000165238|ENSG00000165238	ENST00000448039;ENST00000297954;ENST00000395477;ENST00000395475;ENST00000349097;ENST00000427277|ENST00000432730	T;T;T;T;T;T|.	0.26067|.	1.76;1.76;1.76;1.76;1.76;1.76|.	4.84|4.84	4.84|4.84	0.62591|0.62591	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.61689|0.61689	0.2367|0.2367	L|L	0.46741|0.46741	1.465|1.465	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.76494|.	0.999;0.996;0.999;0.999;0.999|.	D;D;D;D;D|.	0.87578|.	0.997;0.993;0.994;0.997;0.998|.	T|T	0.59690|0.59690	-0.7407|-0.7407	10|5	0.87932|.	D|.	0|.	.|.	14.714|14.714	0.69254|0.69254	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	404;404;7;404;404|.	Q9Y3S1-2;Q9Y3S1-4;A6PVR4;F8W9F9;Q9Y3S1|.	.;.;.;.;WNK2_HUMAN|.	R|G	404;404;404;390;16;16|400	ENSP00000412465:Q404R;ENSP00000297954:Q404R;ENSP00000378860:Q404R;ENSP00000378858:Q390R;ENSP00000297876:Q16R;ENSP00000411181:Q16R|.	ENSP00000297954:Q404R|.	Q|R	+|+	2|1	0|2	WNK2|WNK2	95037046|95037046	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.938000|0.938000	0.57974|0.57974	8.942000|8.942000	0.92970|0.92970	1.924000|1.924000	0.55735|0.55735	0.533000|0.533000	0.62120|0.62120	CAG|AGA	WNK2	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000165238		0.587	WNK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	WNK2	HGNC	protein_coding	OTTHUMT00000317359.1	-	0.00	54	0	A	NM_006648		95997225	+1	tier1	-	no_errors	ENST00000297954	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	G
XPC	7508	genome.wustl.edu	37	3	14219966	14219968	+	Splice_Site	DEL	CCT	CCT	-	rs72561774	byFrequency	TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	CCT	CCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr3:14219966_14219968delCCT	ENST00000285021.7	-	1	315_317	c.101_103delAGG	c.(100-105)gaggat>gat	p.E34del	LSM3_ENST00000306024.3_5'UTR|XPC_ENST00000449060.2_Splice_Site_p.E34del	NM_001145769.1|NM_004628.4	NP_001139241.1|NP_004619.3	Q01831	XPC_HUMAN	xeroderma pigmentosum, complementation group C	34	Glu-rich (acidic).|Poly-Glu.				DNA repair (GO:0006281)|intra-S DNA damage checkpoint (GO:0031573)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage recognition (GO:0000715)|nucleotide-excision repair, DNA damage removal (GO:0000718)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to drug (GO:0042493)|response to UV-B (GO:0010224)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|XPC complex (GO:0071942)	bubble DNA binding (GO:0000405)|damaged DNA binding (GO:0003684)|heteroduplex DNA loop binding (GO:0000404)|single-stranded DNA binding (GO:0003697)	p.E34delE(1)		NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TCGCTCTCACCCTCCTCCTCCTC	0.734			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																														yes	Rec		Xeroderma pigmentosum (C)	3	3p25	7508	"""xeroderma pigmentosum, complementation group C"""		E	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)							,	315,1,3348		29,0,257,0,1,1545					,	5.2	1.0			23	706,1,7113		33,0,640,0,1,3236	no	codingComplex-near-splice,codingComplex-near-splice	XPC	NM_004628.4,NM_001145769.1	,	62,0,897,0,2,4781	A1A1,A1A2,A1R,A2A2,A2R,RR		9.0409,8.6245,8.908	,	,		1021,2,10461				SO:0001630	splice_region_variant	0	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV		CCDS46763.1	3p25.1	2014-09-17			ENSG00000154767	ENSG00000154767			12816	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group C protein"""	613208				1522891	Standard	NM_004628		Approved	XPCC, RAD4	uc011ave.2	Q01831	OTTHUMG00000155526	ENST00000285021.7:c.103+1AGG>-	3.37:g.14219975_14219977delCCT			B4DIP3|E9PB96|E9PH69|Q53GT7|Q96AX0	In_Frame_Del	DEL	pfam_Rad4/PNGase_transGLS-fold,pfam_Rad4_beta-hairpin_dom3,pfam_Rad4_beta-hairpin_dom2,pfam_Rad4_beta-hairpin_dom1,tigrfam_DNA_repair_Rad4_subgr	p.E34in_frame_del	ENST00000285021.7	37	c.103_101	CCDS46763.1	3																																																																																			XPC	-	NULL	ENSG00000154767		0.734	XPC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	XPC	HGNC	protein_coding	OTTHUMT00000340517.3		0.00	14	0	CCT	NM_004628	In_Frame_Del	14219968	-1	tier1		no_errors	ENST00000285021	ensembl	human	known	74_37	in_frame_del	19.05	17	4	DEL	0.927:0.902:0.864	-
XPO4	64328	genome.wustl.edu	37	13	21417979	21417979	+	Nonsense_Mutation	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr13:21417979G>C	ENST00000255305.6	-	5	574	c.503C>G	c.(502-504)tCa>tGa	p.S168*	XPO4_ENST00000400602.2_Nonsense_Mutation_p.S168*			Q9C0E2	XPO4_HUMAN	exportin 4	168					positive regulation of protein export from nucleus (GO:0046827)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(10)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	41		all_cancers(29;5.05e-24)|all_epithelial(30;5.56e-20)|all_lung(29;2.38e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000521)|Epithelial(112;0.000892)|OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Lung(94;0.0189)|LUSC - Lung squamous cell carcinoma(192;0.0548)		ACTTGAACTTGAAAATTCACT	0.343																																																	0													113.0	100.0	104.0					13																	21417979		1841	4083	5924	SO:0001587	stop_gained	0			AB051508	CCDS41872.1	13q11	2011-04-13			ENSG00000132953	ENSG00000132953		"""Exportins"""	17796	protein-coding gene	gene with protein product		611449				11214970, 10944119	Standard	NM_022459		Approved	FLJ13046, KIAA1721	uc001unq.4	Q9C0E2	OTTHUMG00000016528	ENST00000255305.6:c.503C>G	13.37:g.21417979G>C	ENSP00000255305:p.Ser168*		Q5VUZ5|Q8N3V6|Q9H934	Nonsense_Mutation	SNP	superfamily_ARM-type_fold	p.S168*	ENST00000255305.6	37	c.503	CCDS41872.1	13	.	.	.	.	.	.	.	.	.	.	G	37	6.152294	0.97329	.	.	ENSG00000132953	ENST00000400602;ENST00000456108;ENST00000255305	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	0.1194	20.8794	0.99867	0.0:0.0:1.0:0.0	.	.	.	.	X	168;38;168	.	ENSP00000255305:S168X	S	-	2	0	XPO4	20315979	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.941000	0.99782	0.655000	0.94253	TCA	XPO4	-	superfamily_ARM-type_fold	ENSG00000132953		0.343	XPO4-001	KNOWN	non_canonical_conserved|non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	XPO4	HGNC	protein_coding	OTTHUMT00000044096.1	-	0.00	32	0	G	NM_022459		21417979	-1	tier1	-	no_errors	ENST00000255305	ensembl	human	known	74_37	nonsense	21.05	15	4	SNP	1.000	C
XXYLT1	152002	genome.wustl.edu	37	3	194842910	194842910	+	Intron	SNP	C	C	T	rs576093979		TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr3:194842910C>T	ENST00000310380.6	-	3	894				XXYLT1_ENST00000437101.1_Intron|XXYLT1_ENST00000355729.4_Intron|XXYLT1_ENST00000356740.5_Missense_Mutation_p.M4I|XXYLT1_ENST00000429994.1_Intron	NM_152531.4	NP_689744.3	Q8NBI6	XXLT1_HUMAN	xyloside xylosyltransferase 1							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring pentosyl groups (GO:0016763)										tcaggacactcatcccattca	0.507													C|||	1	0.000199681	0.0	0.0	5008	,	,		19709	0.0		0.0	False		,,,				2504	0.001																0																																										SO:0001627	intron_variant	0			AK075551	CCDS43188.1	3q29	2013-02-22	2011-10-19	2011-10-19	ENSG00000173950	ENSG00000173950		"""Glycosyltransferase family 8 domain containing"""	26639	protein-coding gene	gene with protein product		614552	"""chromosome 3 open reading frame 21"""	C3orf21		22117070	Standard	NM_152531		Approved	FLJ35155	uc003fum.4	Q8NBI6	OTTHUMG00000155915	ENST00000310380.6:c.785+34267G>A	3.37:g.194842910C>T			D3DNW5|Q8NAL3|Q8WV03|Q96ME0	Missense_Mutation	SNP	pfam_Glyco_trans_8	p.M4I	ENST00000310380.6	37	c.12	CCDS43188.1	3	.	.	.	.	.	.	.	.	.	.	C	0.184	-1.059908	0.01950	.	.	ENSG00000173950	ENST00000356740	.	.	.	0.801	-1.6	0.08426	.	.	.	.	.	T	0.26048	0.0635	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.21449	-1.0245	7	0.62326	D	0.03	.	2.3747	0.04339	0.3548:0.352:0.2932:0.0	.	4	Q8NBI6-3	.	I	4	.	ENSP00000349179:M4I	M	-	3	0	C3orf21	196324199	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.426000	0.07008	-0.854000	0.04131	-0.410000	0.06199	ATG	XXYLT1	-	NULL	ENSG00000173950		0.507	XXYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XXYLT1	HGNC	protein_coding	OTTHUMT00000342290.1	-	0.00	34	0	C	NM_152531		194842910	-1	tier1	-	no_errors	ENST00000356740	ensembl	human	known	74_37	missense	24.53	40	13	SNP	0.000	T
XYLT1	64131	genome.wustl.edu	37	16	17353166	17353166	+	Missense_Mutation	SNP	C	C	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr16:17353166C>G	ENST00000261381.6	-	3	676	c.592G>C	c.(592-594)Gaa>Caa	p.E198Q		NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	198					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						TCCTGCTGTTCCAGCTTCCTT	0.567																																																	0													129.0	134.0	132.0					16																	17353166		2197	4300	6497	SO:0001583	missense	0			AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.592G>C	16.37:g.17353166C>G	ENSP00000261381:p.Glu198Gln		Q9H1B6	Missense_Mutation	SNP	pfam_XylT,pfam_Glyco_trans_14	p.E198Q	ENST00000261381.6	37	c.592	CCDS10569.1	16	.	.	.	.	.	.	.	.	.	.	C	12.74	2.027449	0.35797	.	.	ENSG00000103489	ENST00000261381	T	0.04758	3.56	5.43	5.43	0.79202	.	0.604908	0.18726	N	0.132865	T	0.06462	0.0166	L	0.44542	1.39	0.27693	N	0.946033	B	0.14012	0.009	B	0.09377	0.004	T	0.32375	-0.9909	10	0.14656	T	0.56	-5.2805	18.2463	0.89986	0.0:1.0:0.0:0.0	.	198	Q86Y38	XYLT1_HUMAN	Q	198	ENSP00000261381:E198Q	ENSP00000261381:E198Q	E	-	1	0	XYLT1	17260667	1.000000	0.71417	0.911000	0.35937	0.991000	0.79684	3.498000	0.53302	2.547000	0.85894	0.655000	0.94253	GAA	XYLT1	-	NULL	ENSG00000103489		0.567	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XYLT1	HGNC	protein_coding	OTTHUMT00000252241.2		0.00	22	0	C	NM_022166		17353166	-1			no_errors	ENST00000261381	ensembl	human	known	74_37	missense	20.83	19	5	SNP	0.997	G
YWHAB	7529	genome.wustl.edu	37	20	43535146	43535146	+	3'UTR	SNP	A	A	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr20:43535146A>G	ENST00000372839.3	+	0	1082				YWHAB_ENST00000479421.1_3'UTR|YWHAB_ENST00000353703.4_3'UTR	NM_003404.3	NP_003395.1	P31946	1433B_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta						activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cytoplasmic sequestering of protein (GO:0051220)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|hippo signaling (GO:0035329)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway (GO:0097193)|MAPK cascade (GO:0000165)|membrane organization (GO:0061024)|mRNA metabolic process (GO:0016071)|negative regulation of protein dephosphorylation (GO:0035308)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of catalytic activity (GO:0043085)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein heterooligomerization (GO:0051291)|protein targeting (GO:0006605)|Ras protein signal transduction (GO:0007265)|RNA metabolic process (GO:0016070)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|transcriptional repressor complex (GO:0017053)	enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|phosphoprotein binding (GO:0051219)|phosphoserine binding (GO:0050815)|protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(1)|kidney(5)|large_intestine(2)|lung(2)|ovary(1)|urinary_tract(1)	12		Myeloproliferative disorder(115;0.0122)				CTTGTGCGATaaaaaaaaaaa	0.403																																																	0													45.0	52.0	50.0					20																	43535146		692	1591	2283	SO:0001624	3_prime_UTR_variant	0			X57346	CCDS13339.1	20q13.1	2013-12-03	2013-12-03		ENSG00000166913	ENSG00000166913			12849	protein-coding gene	gene with protein product	"""14-3-3 beta"", ""14-3-3 alpha"""	601289	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, alpha polypeptide"", ""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide"""	YWHAA		8617504, 7890696	Standard	NM_003404		Approved		uc002xmu.3	P31946	OTTHUMG00000032549	ENST00000372839.3:c.*67A>G	20.37:g.43535146A>G			A8K9K2|E1P616	RNA	SNP	-	NULL	ENST00000372839.3	37	NULL	CCDS13339.1	20																																																																																			YWHAB	-	-	ENSG00000166913		0.403	YWHAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YWHAB	HGNC	protein_coding	OTTHUMT00000079386.3	-	0.00	50	0	A	NM_003404		43535146	+1	tier1	-	no_errors	ENST00000479421	ensembl	human	known	74_37	rna	18.97	47	11	SNP	0.952	G
ZC3H10	84872	genome.wustl.edu	37	12	56514530	56514530	+	Missense_Mutation	SNP	G	G	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr12:56514530G>T	ENST00000257940.2	+	3	460	c.184G>T	c.(184-186)Gac>Tac	p.D62Y	RP11-603J24.6_ENST00000550840.1_RNA|RP11-603J24.5_ENST00000549438.1_RNA|RP11-603J24.5_ENST00000550947.1_RNA	NM_032786.1	NP_116175.1	Q96K80	ZC3HA_HUMAN	zinc finger CCCH-type containing 10	62							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(4)|large_intestine(1)|lung(2)|prostate(2)|skin(1)	11			OV - Ovarian serous cystadenocarcinoma(18;0.12)			TCGCCACCCAGACATGAGCGA	0.552																																																	0													131.0	111.0	118.0					12																	56514530		2203	4300	6503	SO:0001583	missense	0			BC018708	CCDS8903.1	12q13.2	2012-07-05	2005-06-02	2005-06-02		ENSG00000135482		"""Zinc fingers, CCCH-type domain containing"""	25893	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 10"""	ZC3HDC10		12477932	Standard	NM_032786		Approved	FLJ14451	uc001sjp.1	Q96K80		ENST00000257940.2:c.184G>T	12.37:g.56514530G>T	ENSP00000257940:p.Asp62Tyr			Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.D62Y	ENST00000257940.2	37	c.184	CCDS8903.1	12	.	.	.	.	.	.	.	.	.	.	G	18.79	3.699467	0.68501	.	.	ENSG00000135482	ENST00000257940;ENST00000552345;ENST00000546903	.	.	.	5.04	5.04	0.67666	Zinc finger, CCCH-type (2);	0.000000	0.85682	D	0.000000	T	0.67776	0.2929	L	0.48642	1.525	0.80722	D	1	D	0.67145	0.996	P	0.59546	0.859	T	0.70303	-0.4909	9	0.87932	D	0	-8.794	17.6965	0.88282	0.0:0.0:1.0:0.0	.	62	Q96K80	ZC3HA_HUMAN	Y	62	.	ENSP00000257940:D62Y	D	+	1	0	ZC3H10	54800797	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.949000	0.93012	2.793000	0.96121	0.655000	0.94253	GAC	ZC3H10	-	smart_Znf_CCCH	ENSG00000135482		0.552	ZC3H10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H10	HGNC	protein_coding	OTTHUMT00000407826.1	-	0.00	39	0	G	NM_032786		56514530	+1	tier1	-	no_errors	ENST00000257940	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	T
ZBTB39	9880	genome.wustl.edu	37	12	57398627	57398627	+	Silent	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr12:57398627G>C	ENST00000300101.2	-	2	160	c.75C>G	c.(73-75)ctC>ctG	p.L25L		NM_014830.2	NP_055645.1	O15060	ZBT39_HUMAN	zinc finger and BTB domain containing 39	25					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|liver(1)|lung(3)|prostate(1)	16						TGGTCTCTGAGAGCCGGCACT	0.562																																																	0													112.0	108.0	110.0					12																	57398627		2203	4300	6503	SO:0001819	synonymous_variant	0			AB002350	CCDS31839.1	12q13.3	2013-01-09				ENSG00000166860		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	29014	protein-coding gene	gene with protein product						9205841	Standard	NM_014830		Approved	KIAA0352, ZNF922	uc001sml.2	O15060		ENST00000300101.2:c.75C>G	12.37:g.57398627G>C			A7MD38|Q9UD98	Silent	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.L25	ENST00000300101.2	37	c.75	CCDS31839.1	12																																																																																			ZBTB39	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold	ENSG00000166860		0.562	ZBTB39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB39	HGNC	protein_coding	OTTHUMT00000411214.1	-	0.00	71	0	G	NM_014830		57398627	-1	tier1	-	no_errors	ENST00000300101	ensembl	human	known	74_37	silent	22.58	72	21	SNP	1.000	C
ZFAND6	54469	genome.wustl.edu	37	15	80423675	80423675	+	Intron	SNP	T	T	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr15:80423675T>G	ENST00000261749.6	+	6	900				ZFAND6_ENST00000558688.1_Missense_Mutation_p.F173C|ZFAND6_ENST00000559157.1_Intron|ZFAND6_ENST00000559775.1_Intron|ZFAND6_ENST00000558087.1_Intron|ZFAND6_ENST00000561060.1_Intron|ZFAND6_ENST00000559835.1_Intron|ZFAND6_ENST00000558494.1_Intron	NM_001242913.1|NM_001242914.1|NM_019006.3	NP_001229842.1|NP_001229843.1|NP_061879.2	Q6FIF0	ZFAN6_HUMAN	zinc finger, AN1-type domain 6						apoptotic process (GO:0006915)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of apoptotic process (GO:0043066)|protein targeting to peroxisome (GO:0006625)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)	cytoplasm (GO:0005737)	DNA binding (GO:0003677)|polyubiquitin binding (GO:0031593)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)	11						AAAATGATGTTTTATAATAAT	0.313																																																	0													36.0	35.0	36.0					15																	80423675		2202	4299	6501	SO:0001627	intron_variant	0			BC005283	CCDS10313.1, CCDS58395.1	15q24.3	2013-01-09	2006-07-07	2006-07-07	ENSG00000086666	ENSG00000086666		"""Zinc fingers, AN1-type domain containing"""	30164	protein-coding gene	gene with protein product	"""protein associated with PRK1"""	610183	"""zinc finger, A20 domain containing 3"""	ZA20D3		11054541	Standard	NM_019006		Approved	ZFAND5B, AWP1	uc002bff.2	Q6FIF0	OTTHUMG00000144169	ENST00000261749.6:c.478+40T>G	15.37:g.80423675T>G			D3DW92|D3DW94|O95792|Q9BQF7|Q9GZY3	Missense_Mutation	SNP	pfam_Znf_A20,smart_Znf_A20,pfscan_Znf_A20	p.F173C	ENST00000261749.6	37	c.518	CCDS10313.1	15																																																																																			ZFAND6	-	NULL	ENSG00000086666		0.313	ZFAND6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFAND6	HGNC	protein_coding	OTTHUMT00000291368.1	-	0.00	19	0	T	NM_019006		80423675	+1	tier1	-	no_errors	ENST00000558688	ensembl	human	putative	74_37	missense	15.79	16	3	SNP	0.000	G
MOG	4340	genome.wustl.edu	37	6	29640996	29640996	+	IGR	SNP	G	G	A			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr6:29640996G>A	ENST00000376917.3	+	0	2160				ZFP57_ENST00000376881.3_Missense_Mutation_p.P278S|ZFP57_ENST00000376883.1_Missense_Mutation_p.P278S|ZFP57_ENST00000488757.1_Missense_Mutation_p.P298S	NM_002433.4|NM_206809.3	NP_002424.3|NP_996532.2	Q16653	MOG_HUMAN	myelin oligodendrocyte glycoprotein						cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|positive regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034126)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)|skin(2)	19						TGGGTGCCTGGAATCCTCAAA	0.562																																																	0													149.0	156.0	154.0					6																	29640996		1238	2543	3781	SO:0001628	intergenic_variant	0				CCDS4667.1, CCDS34366.1, CCDS34367.1, CCDS34368.1, CCDS34369.1, CCDS34370.1, CCDS47394.1, CCDS47395.1, CCDS47395.2, CCDS54977.1	6p22.1	2014-01-16			ENSG00000204655	ENSG00000204655		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	7197	protein-coding gene	gene with protein product		159465					Standard	NM_002433		Approved	BTN6, BTNL11	uc003nne.3	Q16653	OTTHUMG00000031099		6.37:g.29640996G>A			A6NDR4|A6NNJ9|A8MY31|B0UZR9|E9PGF0|F8W9D5|O00713|O00714|O00715|Q13054|Q13055|Q14855|Q29ZN8|Q56UY0|Q5JNX7|Q5JNY1|Q5JNY2|Q5JNY4|Q5SSB5|Q5SSB6|Q5STL9|Q5STM0|Q5STM1|Q5STM2|Q5STM5|Q5SUK5|Q5SUK7|Q5SUK8|Q5SUK9|Q5SUL0|Q5SUL1|Q8IYG5|Q92891|Q92892|Q92893|Q92894|Q92895|Q93053|Q96KU9|Q96KV0|Q96KV1|Q99605	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P298S	ENST00000376917.3	37	c.892	CCDS34370.1	6	.	.	.	.	.	.	.	.	.	.	G	13.06	2.123368	0.37436	.	.	ENSG00000204644	ENST00000488757;ENST00000376881;ENST00000376883	T;T;T	0.05996	3.36;3.59;3.59	4.17	2.29	0.28610	.	0.682915	0.12326	N	0.478793	T	0.02119	0.0066	L	0.34521	1.04	0.09310	N	1	B;B	0.25312	0.123;0.123	B;B	0.24974	0.057;0.057	T	0.42515	-0.9447	10	0.46703	T	0.11	0.4077	12.1816	0.54216	0.0:0.3308:0.6691:0.0	.	298;278	Q9NU63-3;Q9NU63-2	.;.	S	298;278;278	ENSP00000418259:P298S;ENSP00000366078:P278S;ENSP00000366080:P278S	ENSP00000366078:P278S	P	-	1	0	ZFP57	29748975	0.000000	0.05858	0.001000	0.08648	0.411000	0.31082	0.338000	0.19858	0.645000	0.30675	0.563000	0.77884	CCA	ZFP57	-	NULL	ENSG00000204644		0.562	MOG-001	KNOWN	basic|CCDS	protein_coding	ZFP57	HGNC	protein_coding	OTTHUMT00000076160.3	-	0.00	113	0	G	NM_002433		29640996	-1	tier1	-	no_errors	ENST00000488757	ensembl	human	known	74_37	missense	23.62	97	30	SNP	0.007	A
ZNF132	7691	genome.wustl.edu	37	19	58946575	58946575	+	Missense_Mutation	SNP	G	G	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr19:58946575G>T	ENST00000254166.3	-	3	636	c.236C>A	c.(235-237)tCt>tAt	p.S79Y		NM_003433.3	NP_003424.3	P52740	ZN132_HUMAN	zinc finger protein 132	79	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(1)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0171)|Lung(386;0.182)		TCCATGCCAAGAACCTGAAAG	0.453																																																	0													58.0	61.0	60.0					19																	58946575		2203	4299	6502	SO:0001583	missense	0			U09411	CCDS12980.1	19q13.4	2013-01-08	2006-06-13			ENSG00000131849		"""Zinc fingers, C2H2-type"", ""-"""	12916	protein-coding gene	gene with protein product		604074	"""zinc finger protein 132 (clone pHZ-12)"""			7557990	Standard	NM_003433		Approved	pHZ-12	uc002qst.4	P52740		ENST00000254166.3:c.236C>A	19.37:g.58946575G>T	ENSP00000254166:p.Ser79Tyr		Q32MI9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S79Y	ENST00000254166.3	37	c.236	CCDS12980.1	19	.	.	.	.	.	.	.	.	.	.	C	0	-2.821074	0.00072	.	.	ENSG00000131849	ENST00000254166	T	0.00737	5.76	3.12	1.96	0.26148	Krueppel-associated box (3);	.	.	.	.	T	0.00328	0.0010	N	0.01464	-0.85	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44283	-0.9338	9	0.02654	T	1	.	2.7579	0.05298	0.0:0.4661:0.2761:0.2579	.	79	P52740	ZN132_HUMAN	Y	79	ENSP00000254166:S79Y	ENSP00000254166:S79Y	S	-	2	0	ZNF132	63638387	0.062000	0.20869	0.118000	0.21660	0.047000	0.14425	-0.147000	0.10234	0.062000	0.16340	-0.120000	0.15030	TCT	ZNF132	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000131849		0.453	ZNF132-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF132	HGNC	protein_coding	OTTHUMT00000467035.1		0.00	31	0	G	NM_003433		58946575	-1			no_errors	ENST00000254166	ensembl	human	known	74_37	missense	12.00	22	3	SNP	0.041	T
ZNF195	7748	genome.wustl.edu	37	11	3380466	3380466	+	Nonsense_Mutation	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr11:3380466G>C	ENST00000399602.4	-	6	1898	c.1772C>G	c.(1771-1773)tCa>tGa	p.S591*	ZNF195_ENST00000528796.1_Intron|ZNF195_ENST00000343338.7_Nonsense_Mutation_p.S523*|ZNF195_ENST00000429541.2_Nonsense_Mutation_p.S523*|ZNF195_ENST00000005082.9_Nonsense_Mutation_p.S568*|ZNF195_ENST00000526601.1_Nonsense_Mutation_p.S572*|ZNF195_ENST00000354599.6_Nonsense_Mutation_p.S519*	NM_001130520.2	NP_001123992.1	O14628	ZN195_HUMAN	zinc finger protein 195	591					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)	17		Medulloblastoma(188;0.00106)|Breast(177;0.00328)|all_neural(188;0.00681)|Ovarian(85;0.00965)		BRCA - Breast invasive adenocarcinoma(625;0.0361)|LUSC - Lung squamous cell carcinoma(625;0.2)		AATAAGGTTTGAGGACTGGGT	0.408																																																	0													92.0	95.0	94.0					11																	3380466		2055	4220	6275	SO:0001587	stop_gained	0				CCDS41604.1, CCDS44521.1, CCDS44522.1, CCDS55736.1, CCDS55737.1, CCDS58111.1	11p15.5	2013-01-08			ENSG00000005801	ENSG00000005801		"""Zinc fingers, C2H2-type"", ""-"""	12986	protein-coding gene	gene with protein product		602187				9344677	Standard	NM_001130520		Approved		uc001lxt.3	O14628	OTTHUMG00000011694	ENST00000399602.4:c.1772C>G	11.37:g.3380466G>C	ENSP00000382511:p.Ser591*		A8K234|B3KTK2|B4DEL0|C9JLY9|L7MNK2|Q0VAJ6|Q658N8|Q6ZNA9	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S591*	ENST00000399602.4	37	c.1772	CCDS44522.1	11	.	.	.	.	.	.	.	.	.	.	g	19.56	3.850732	0.71719	.	.	ENSG00000005801	ENST00000354599;ENST00000399602;ENST00000343338;ENST00000429541;ENST00000005082;ENST00000526601	.	.	.	1.27	1.27	0.21489	.	.	.	.	.	.	.	.	.	.	.	0.54753	D	0.999989	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	5.7885	0.18347	0.0:0.0:1.0:0.0	.	.	.	.	X	519;591;523;523;568;572	.	ENSP00000005082:S568X	S	-	2	0	ZNF195	3337042	0.000000	0.05858	0.002000	0.10522	0.196000	0.23810	-0.006000	0.12833	0.638000	0.30545	0.305000	0.20034	TCA	ZNF195	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000005801		0.408	ZNF195-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF195	HGNC	protein_coding	OTTHUMT00000032321.2	-	0.00	52	0	G			3380466	-1	tier1	-	no_errors	ENST00000399602	ensembl	human	known	74_37	nonsense	34.00	33	17	SNP	0.003	C
ZNF280A	129025	genome.wustl.edu	37	22	22869365	22869365	+	Missense_Mutation	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr22:22869365G>C	ENST00000302097.3	-	2	842	c.590C>G	c.(589-591)cCt>cGt	p.P197R	snoU13_ENST00000459485.1_RNA	NM_080740.3	NP_542778.1	P59817	Z280A_HUMAN	zinc finger protein 280A	197					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	18	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		CATATCTGAAGGGACCACAGC	0.433																																																	0													127.0	117.0	120.0					22																	22869365		2203	4300	6503	SO:0001583	missense	0			D87009	CCDS13800.1	22q11.21	2007-09-20	2007-09-20	2007-09-20	ENSG00000169548	ENSG00000169548			18597	protein-coding gene	gene with protein product			"""zinc finger protein 280"", ""suppressor of hairy wing homolog 1 (Drosophila)"""	ZNF280, SUHW1		9074928	Standard	NM_080740		Approved	3'OY11.1, ZNF636	uc002zwe.3	P59817	OTTHUMG00000030545	ENST00000302097.3:c.590C>G	22.37:g.22869365G>C	ENSP00000302855:p.Pro197Arg			Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P197R	ENST00000302097.3	37	c.590	CCDS13800.1	22	.	.	.	.	.	.	.	.	.	.	G	13.42	2.230970	0.39399	.	.	ENSG00000169548	ENST00000302097	T	0.25250	1.81	3.57	-4.65	0.03339	.	.	.	.	.	T	0.23451	0.0567	L	0.49126	1.545	0.09310	N	1	P	0.48911	0.917	P	0.49887	0.625	T	0.12400	-1.0549	9	0.59425	D	0.04	0.49	1.1739	0.01831	0.4323:0.1528:0.2597:0.1552	.	197	P59817	Z280A_HUMAN	R	197	ENSP00000302855:P197R	ENSP00000302855:P197R	P	-	2	0	ZNF280A	21199365	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-0.046000	0.11983	-0.852000	0.04141	-0.137000	0.14449	CCT	ZNF280A	-	NULL	ENSG00000169548		0.433	ZNF280A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF280A	HGNC	protein_coding	OTTHUMT00000075433.3	-	0.00	40	0	G	NM_080740		22869365	-1	tier1	-	no_errors	ENST00000302097	ensembl	human	known	74_37	missense	9.26	49	5	SNP	0.000	C
ZNF318	24149	genome.wustl.edu	37	6	43307265	43307265	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr6:43307265C>T	ENST00000361428.2	-	10	4548	c.4471G>A	c.(4471-4473)Gtg>Atg	p.V1491M	ZNF318_ENST00000318149.3_Intron	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	1491	Pro-rich.				meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			TTAGGACCCACGAAGCCAGGG	0.522																																																	0													71.0	65.0	67.0					6																	43307265		2203	4300	6503	SO:0001583	missense	0			AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.4471G>A	6.37:g.43307265C>T	ENSP00000354964:p.Val1491Met		O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Missense_Mutation	SNP	smart_Znf_U1	p.V1491M	ENST00000361428.2	37	c.4471	CCDS4895.2	6	.	.	.	.	.	.	.	.	.	.	C	3.389	-0.124640	0.06795	.	.	ENSG00000171467	ENST00000361428	T	0.12147	2.71	5.14	1.15	0.20763	.	1.046160	0.07584	N	0.920834	T	0.02047	0.0064	N	0.14661	0.345	0.22851	N	0.998656	B	0.18968	0.032	B	0.09377	0.004	T	0.46775	-0.9167	10	0.33141	T	0.24	0.0079	3.9703	0.09451	0.091:0.405:0.3595:0.1444	.	1491	Q5VUA4	ZN318_HUMAN	M	1491	ENSP00000354964:V1491M	ENSP00000354964:V1491M	V	-	1	0	ZNF318	43415243	0.129000	0.22400	0.991000	0.47740	0.849000	0.48306	0.082000	0.14847	0.299000	0.22661	-1.114000	0.02060	GTG	ZNF318	-	NULL	ENSG00000171467		0.522	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF318	HGNC	protein_coding	OTTHUMT00000040601.2	-	0.00	50	0	C	NM_014345		43307265	-1	tier1	-	no_errors	ENST00000361428	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.345	T
ZNF678	339500	genome.wustl.edu	37	1	227842420	227842420	+	Nonsense_Mutation	SNP	G	G	T	rs368224195		TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr1:227842420G>T	ENST00000343776.5	+	4	814	c.469G>T	c.(469-471)Gaa>Taa	p.E157*	ZNF678_ENST00000608949.1_Intron|ZNF678_ENST00000397097.3_Nonsense_Mutation_p.E212*	NM_178549.3	NP_848644.2	Q5SXM1	ZN678_HUMAN	zinc finger protein 678	157					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(7)|pancreas(1)|prostate(1)	24		Prostate(94;0.0885)				CAAATGTGACGAATGTGGCAA	0.343																																																	0													63.0	74.0	71.0					1																	227842420		2201	4299	6500	SO:0001587	stop_gained	0			BC042500		1q42.13	2013-01-08			ENSG00000181450	ENSG00000181450		"""Zinc fingers, C2H2-type"", ""-"""	28652	protein-coding gene	gene with protein product	"""hypothetical protein MGC42493"""					12477932	Standard	NM_178549		Approved	MGC42493	uc021pjy.1	Q5SXM1	OTTHUMG00000037700	ENST00000343776.5:c.469G>T	1.37:g.227842420G>T	ENSP00000344828:p.Glu157*		Q8IVQ9	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E212*	ENST00000343776.5	37	c.634		1	.	.	.	.	.	.	.	.	.	.	G	10.28	1.305681	0.23736	.	.	ENSG00000181450	ENST00000343776;ENST00000397097;ENST00000440339	.	.	.	1.34	1.34	0.21922	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	8.5465	0.33424	0.0:0.0:1.0:0.0	.	.	.	.	X	157;212;212	.	ENSP00000344828:E157X	E	+	1	0	ZNF678	225909043	0.000000	0.05858	0.010000	0.14722	0.009000	0.06853	0.243000	0.18106	0.596000	0.29794	0.603000	0.83216	GAA	ZNF678	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000181450		0.343	ZNF678-001	KNOWN	basic	protein_coding	ZNF678	HGNC	protein_coding	OTTHUMT00000091976.2	-	0.00	9	0	G	NM_178549		227842420	+1	tier1	-	no_errors	ENST00000397097	ensembl	human	known	74_37	nonsense	40.00	12	8	SNP	0.306	T
ZNF702P	79986	genome.wustl.edu	37	19	53472838	53472838	+	RNA	SNP	A	A	G			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr19:53472838A>G	ENST00000600068.1	-	0	489				ZNF702P_ENST00000270443.4_RNA																							GAAATTGAAAACTTTGTCACA	0.348																																																	0																																												0																															19.37:g.53472838A>G				RNA	SNP	-	NULL	ENST00000600068.1	37	NULL		19																																																																																			ZNF702P	-	-	ENSG00000242779		0.348	CTD-2620I22.1-001	KNOWN	basic|readthrough_transcript	processed_transcript	ZNF702P	HGNC	processed_transcript	OTTHUMT00000463881.1	-	0.00	34	0	A			53472838	-1	tier1	-	no_errors	ENST00000270443	ensembl	human	known	74_37	rna	25.71	26	9	SNP	0.001	G
ZNF721	170960	genome.wustl.edu	37	4	438198	438198	+	Missense_Mutation	SNP	C	C	T			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr4:438198C>T	ENST00000338977.5	-	2	70	c.22G>A	c.(22-24)Gac>Aac	p.D8N	ZNF721_ENST00000507078.1_Intron|ZNF721_ENST00000511833.2_Missense_Mutation_p.D20N|ABCA11P_ENST00000451020.2_RNA|ZNF721_ENST00000506646.1_Missense_Mutation_p.D52N			Q8TF20	ZN721_HUMAN	zinc finger protein 721	8					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(15)|lung(6)|ovary(1)|skin(1)|stomach(5)|urinary_tract(1)	33						GGCAAAAAGTCTTGGGTGAAA	0.328																																																	0													38.0	41.0	40.0					4																	438198		2104	4258	6362	SO:0001583	missense	0			AK092362	CCDS46991.1	4p16.3	2013-01-08			ENSG00000182903	ENSG00000182903		"""Zinc fingers, C2H2-type"", ""-"""	29425	protein-coding gene	gene with protein product						11853319	Standard	NM_133474		Approved	KIAA1982	uc003gag.4	Q8TF20		ENST00000338977.5:c.22G>A	4.37:g.438198C>T	ENSP00000340524:p.Asp8Asn		Q69YG7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D20N	ENST00000338977.5	37	c.58		4	.	.	.	.	.	.	.	.	.	.	C	8.446	0.852036	0.17034	.	.	ENSG00000182903	ENST00000506646;ENST00000338977;ENST00000511833;ENST00000505900	T;T;T;T	0.07567	5.35;3.18;3.24;6.0	0.579	-0.723	0.11181	.	.	.	.	.	T	0.07548	0.0190	M	0.67700	2.07	0.09310	N	1	P;P;P;P	0.39424	0.462;0.544;0.544;0.673	B;B;B;B	0.28916	0.08;0.044;0.044;0.096	T	0.19647	-1.0299	8	0.72032	D	0.01	.	.	.	.	.	52;8;20;20	B4E159;Q8TF20;D9N162;Q8TF20-2	.;ZN721_HUMAN;.;.	N	52;8;20;52	ENSP00000423586:D52N;ENSP00000340524:D8N;ENSP00000428878:D20N;ENSP00000421325:D52N	ENSP00000340524:D8N	D	-	1	0	ZNF721	428198	0.000000	0.05858	0.006000	0.13384	0.137000	0.21094	-2.765000	0.00783	-0.344000	0.08338	0.195000	0.17529	GAC	ZNF721	-	NULL	ENSG00000182903		0.328	ZNF721-001	KNOWN	basic|appris_candidate	protein_coding	ZNF721	HGNC	protein_coding	OTTHUMT00000357939.1	-	0.00	42	0	C	NM_133474		438198	-1	tier1	-	no_errors	ENST00000511833	ensembl	human	known	74_37	missense	33.96	35	18	SNP	0.049	T
ZNF844	284391	genome.wustl.edu	37	19	12186303	12186303	+	Missense_Mutation	SNP	G	G	C			TCGA-Q9-A6FU-01A-11D-A31U-09	TCGA-Q9-A6FU-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e76b7ff1-70d7-46fb-82ad-e5b852bf6d83	50f9a9ff-a202-4715-b353-26da91902aca	g.chr19:12186303G>C	ENST00000439326.3	+	4	543	c.368G>C	c.(367-369)aGa>aCa	p.R123T	ZNF844_ENST00000441304.2_3'UTR	NM_001136501.1	NP_001129973.1	Q08AG5	ZN844_HUMAN	zinc finger protein 844	123					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(1)|prostate(1)	10						AGGCACATTAGAGCTGACACT	0.443																																																	0													97.0	83.0	87.0					19																	12186303		692	1591	2283	SO:0001583	missense	0			AL832297	CCDS45985.1	19p13.2	2013-01-08			ENSG00000223547	ENSG00000223547		"""Zinc fingers, C2H2-type"", ""-"""	25932	protein-coding gene	gene with protein product							Standard	NM_001136501		Approved	FLJ14959	uc002mtb.2	Q08AG5	OTTHUMG00000156405	ENST00000439326.3:c.368G>C	19.37:g.12186303G>C	ENSP00000392024:p.Arg123Thr		Q5JPI8	Missense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R123T	ENST00000439326.3	37	c.368	CCDS45985.1	19	.	.	.	.	.	.	.	.	.	.	G	13.91	2.379391	0.42207	.	.	ENSG00000223547	ENST00000439326;ENST00000541708;ENST00000535505	T	0.18657	2.2	2.73	-5.45	0.02616	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	.	.	.	.	T	0.19886	0.0478	M	0.82517	2.595	0.19945	N	0.999944	B	0.26081	0.141	B	0.19666	0.026	T	0.35325	-0.9793	9	0.59425	D	0.04	.	1.681	0.02832	0.1939:0.2918:0.3653:0.149	.	123	Q08AG5	ZN844_HUMAN	T	123	ENSP00000392024:R123T	ENSP00000392024:R123T	R	+	2	0	ZNF844	12047303	0.006000	0.16342	0.000000	0.03702	0.009000	0.06853	-1.189000	0.03061	-1.370000	0.02144	-0.426000	0.05927	AGA	ZNF844	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000223547		0.443	ZNF844-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF844	HGNC	protein_coding	OTTHUMT00000344086.2	-	0.00	36	0	G			12186303	+1	tier1	-	no_errors	ENST00000439326	ensembl	human	known	74_37	missense	41.51	31	22	SNP	0.033	C
