#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCA10	10349	genome.wustl.edu	37	17	67181658	67181658	+	Silent	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr17:67181658C>T	ENST00000269081.4	-	21	3366	c.2457G>A	c.(2455-2457)ccG>ccA	p.P819P	ABCA10_ENST00000416101.2_3'UTR	NM_080282.3	NP_525021.3	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 10	819					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(34)|ovary(2)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	81	Breast(10;6.95e-12)					GAGGCGTCTTCGGGATTTGTT	0.373																																																	0													72.0	73.0	73.0					17																	67181658		2203	4300	6503	SO:0001819	synonymous_variant	0			AY247065	CCDS11684.1	17q24	2012-03-14			ENSG00000154263	ENSG00000154263		"""ATP binding cassette transporters / subfamily A"""	30	protein-coding gene	gene with protein product		612508				12821155, 11435397	Standard	NM_080282		Approved	EST698739	uc010dfa.1	Q8WWZ4	OTTHUMG00000164716	ENST00000269081.4:c.2457G>A	17.37:g.67181658C>T			C9JZH2|C9K035|Q6PIQ6|Q7Z2I9|Q7Z7P7|Q86TD2	Silent	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.P819	ENST00000269081.4	37	c.2457	CCDS11684.1	17																																																																																			ABCA10	-	NULL	ENSG00000154263		0.373	ABCA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA10	HGNC	protein_coding	OTTHUMT00000379881.4	-	0.00	77	0	C	NM_080282		67181658	-1	tier1	-	no_errors	ENST00000269081	ensembl	human	known	74_37	silent	12.66	138	20	SNP	0.001	T
ABCC13	150000	genome.wustl.edu	37	21	15710177	15710177	+	RNA	SNP	T	T	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr21:15710177T>C	ENST00000482980.1	+	0	3203							Q9NSE7	ABCCD_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 13, pseudogene							integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)										GGTCACTTACTTAGGGCAGAA	0.418																																					Ovarian(111;916 1572 1777 20423 38208)												0																																												0			AF418600		21q11.2	2012-03-14	2010-04-29		ENSG00000243064	ENSG00000243064		"""ATP binding cassette transporters / subfamily C"""	16022	pseudogene	pseudogene		608835	"""ATP-binding cassette, sub-family C (CFTR/MRP), member 13"""			10049586	Standard	NR_003087		Approved	PRED6, C21orf73	uc002yjr.3	Q9NSE7	OTTHUMG00000074257		21.37:g.15710177T>C			Q8N6A4|Q8N6A5	RNA	SNP	-	NULL	ENST00000482980.1	37	NULL		21																																																																																			ABCC13	-	-	ENSG00000243064		0.418	ABCC13-004	KNOWN	non_canonical_polymorphism|basic	processed_transcript	ABCC13	HGNC	pseudogene	OTTHUMT00000157809.3	-	0.00	36	0	T			15710177	+1	tier1	-	no_errors	ENST00000482980	ensembl	human	known	74_37	rna	32.65	33	16	SNP	0.266	C
ACAP1	9744	genome.wustl.edu	37	17	7245588	7245588	+	Intron	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr17:7245588G>T	ENST00000158762.3	+	4	437				ACAP1_ENST00000573893.1_3'UTR	NM_014716.3	NP_055531.1	Q15027	ACAP1_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 1						protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)	endosome (GO:0005768)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|cervix(3)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|prostate(3)|skin(1)|urinary_tract(1)	33						GCCTCTTCTTGCCTAGGAGTG	0.597																																																	0													125.0	108.0	114.0					17																	7245588		2203	4300	6503	SO:0001627	intron_variant	0			D30758	CCDS11101.1	17p13.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000072818	ENSG00000072818		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16467	protein-coding gene	gene with protein product		607763	"""centaurin, beta 1"""	CENTB1		11050434, 11062263	Standard	NM_014716		Approved	KIAA0050	uc002ggd.2	Q15027	OTTHUMG00000102199	ENST00000158762.3:c.232-6G>T	17.37:g.7245588G>T			Q53XN9	RNA	SNP	-	NULL	ENST00000158762.3	37	NULL	CCDS11101.1	17																																																																																			ACAP1	-	-	ENSG00000072818		0.597	ACAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAP1	HGNC	protein_coding	OTTHUMT00000220049.4	-	0.00	92	0	G	NM_014716		7245588	+1	tier1	-	no_errors	ENST00000573893	ensembl	human	known	74_37	rna	6.15	61	4	SNP	0.000	T
ACSM5	54988	genome.wustl.edu	37	16	20429577	20429577	+	Missense_Mutation	SNP	C	C	G			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr16:20429577C>G	ENST00000331849.4	+	3	548	c.401C>G	c.(400-402)gCt>gGt	p.A134G	ACSM5_ENST00000575584.1_Missense_Mutation_p.A134G	NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	134					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						GTCAGTGTGGCTTGCATGCGG	0.592																																																	0													51.0	43.0	46.0					16																	20429577		2203	4300	6503	SO:0001583	missense	0				CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.401C>G	16.37:g.20429577C>G	ENSP00000327916:p.Ala134Gly		Q96AV1|Q96CX8|Q9NWV3	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.A134G	ENST00000331849.4	37	c.401	CCDS10585.1	16	.	.	.	.	.	.	.	.	.	.	C	15.48	2.847424	0.51164	.	.	ENSG00000183549	ENST00000331849	T	0.63255	-0.03	4.56	4.56	0.56223	AMP-dependent synthetase/ligase (1);	0.000000	0.64402	D	0.000011	T	0.52338	0.1728	N	0.25957	0.775	0.54753	D	0.999983	P	0.36733	0.567	B	0.40825	0.341	T	0.47032	-0.9148	10	0.14656	T	0.56	-16.3832	17.2067	0.86920	0.0:1.0:0.0:0.0	.	134	Q6NUN0	ACSM5_HUMAN	G	134	ENSP00000327916:A134G	ENSP00000327916:A134G	A	+	2	0	ACSM5	20337078	0.999000	0.42202	1.000000	0.80357	0.943000	0.58893	4.609000	0.61148	2.369000	0.80426	0.650000	0.86243	GCT	ACSM5	-	pfam_AMP-dep_Synth/Lig	ENSG00000183549		0.592	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSM5	HGNC	protein_coding	OTTHUMT00000254413.1	-	0.00	52	0	C	NM_017888		20429577	+1	tier1	-	no_errors	ENST00000331849	ensembl	human	known	74_37	missense	12.50	77	11	SNP	1.000	G
ADAMTSL1	92949	genome.wustl.edu	37	9	18770777	18770777	+	Nonsense_Mutation	SNP	G	G	T	rs576805757		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr9:18770777G>T	ENST00000380548.4	+	17	2734	c.2395G>T	c.(2395-2397)Gag>Tag	p.E799*		NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	799	TSP type-1 7. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		AGACTGGACAGAGGTATGTAT	0.463																																																	0													41.0	41.0	41.0					9																	18770777		1906	4126	6032	SO:0001587	stop_gained	0			AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.2395G>T	9.37:g.18770777G>T	ENSP00000369921:p.Glu799*		A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,pfam_Immunoglobulin,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,prints_Peptidase_M12B_ADAM-TS,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.E799*	ENST00000380548.4	37	c.2395	CCDS47954.1	9	.	.	.	.	.	.	.	.	.	.	G	44	10.824876	0.99473	.	.	ENSG00000178031	ENST00000380548	.	.	.	5.19	4.27	0.50696	.	14.966700	0.04415	U	0.366688	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	.	12.0701	0.53611	0.0:0.4216:0.5784:0.0	.	.	.	.	X	799	.	ENSP00000369921:E799X	E	+	1	0	ADAMTSL1	18760777	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	5.055000	0.64282	2.446000	0.82766	0.609000	0.83330	GAG	ADAMTSL1	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000178031		0.463	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	ADAMTSL1	HGNC	protein_coding	OTTHUMT00000401206.1	-	0.00	54	0	G			18770777	+1	tier1	-	no_errors	ENST00000380548	ensembl	human	novel	74_37	nonsense	6.90	54	4	SNP	1.000	T
ADAP2	55803	genome.wustl.edu	37	17	29271984	29271984	+	Silent	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr17:29271984G>A	ENST00000330889.3	+	6	905	c.570G>A	c.(568-570)gaG>gaA	p.E190E	ADAP2_ENST00000580525.1_Silent_p.E196E	NM_018404.2	NP_060874.1	Q9NPF8	ADAP2_HUMAN	ArfGAP with dual PH domains 2	190	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				heart development (GO:0007507)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|mitochondrial envelope (GO:0005740)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein binding, bridging (GO:0030674)|zinc ion binding (GO:0008270)	p.?(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	13						TCCAGACAGAGAAGATAGGGC	0.502																																																	1	Unknown(1)	central_nervous_system(1)											98.0	92.0	94.0					17																	29271984		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ238994	CCDS11261.1	17q11.2	2013-01-10	2008-09-22	2008-09-22	ENSG00000184060	ENSG00000184060		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	16487	protein-coding gene	gene with protein product		608635	"""centaurin, alpha 2"""	CENTA2			Standard	XM_005258008		Approved		uc002hfx.3	Q9NPF8	OTTHUMG00000132868	ENST00000330889.3:c.570G>A	17.37:g.29271984G>A			Q8N4Q6|Q96SD5	Silent	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,smart_ArfGAP,smart_Pleckstrin_homology,prints_ArfGAP,pfscan_Pleckstrin_homology,pfscan_ArfGAP	p.E190	ENST00000330889.3	37	c.570	CCDS11261.1	17																																																																																			ADAP2	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000184060		0.502	ADAP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ADAP2	HGNC	protein_coding	OTTHUMT00000256346.1	-	0.00	25	0	G	NM_018404		29271984	+1	tier1	-	no_errors	ENST00000330889	ensembl	human	known	74_37	silent	55.71	31	39	SNP	1.000	A
ADAR	103	genome.wustl.edu	37	1	154558301	154558301	+	Silent	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:154558301G>A	ENST00000368474.4	-	13	3442	c.3243C>T	c.(3241-3243)tgC>tgT	p.C1081C	ADAR_ENST00000292205.5_Silent_p.C1124C|ADAR_ENST00000368471.3_Silent_p.C786C	NM_001111.4|NM_015840.3|NM_015841.3	NP_001102|NP_056655.2|NP_056656.2	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific	1081	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|miRNA loading onto RISC involved in gene silencing by miRNA (GO:0035280)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of viral genome replication (GO:0045071)|positive regulation of viral genome replication (GO:0045070)|pre-miRNA processing (GO:0031054)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(4)|prostate(2)|skin(2)	51	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		TCACACGACAGCAAATAGCAC	0.453																																																	0													117.0	103.0	108.0					1																	154558301		2203	4300	6503	SO:0001819	synonymous_variant	0			BC038227	CCDS1071.1, CCDS30879.1	1q21.3	2012-03-22			ENSG00000160710	ENSG00000160710	3.5.4.-		225	protein-coding gene	gene with protein product		146920	"""interferon-induced protein 4"""	IFI4, G1P1		7972084	Standard	NM_001111		Approved	ADAR1	uc001ffh.3	P55265	OTTHUMG00000037261	ENST00000368474.4:c.3243C>T	1.37:g.154558301G>A			B1AQQ9|B1AQR0|D3DV76|O15223|O43859|O43860|Q9BYM3|Q9BYM4	Silent	SNP	pfam_A_deamin,pfam_dsRNA_A_deaminase,pfam_dsRNA-bd_dom,smart_dsRNA_A_deaminase,smart_dsRNA-bd_dom,smart_A_deamin,pfscan_dsRNA-bd_dom,pfscan_dsRNA_A_deaminase,pfscan_A_deamin	p.C1124	ENST00000368474.4	37	c.3372	CCDS1071.1	1																																																																																			ADAR	-	pfam_A_deamin,smart_A_deamin,pfscan_A_deamin	ENSG00000160710		0.453	ADAR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ADAR	HGNC	protein_coding	OTTHUMT00000090691.2	-	0.00	69	0	G	NM_001111		154558301	-1	tier1	-	no_errors	ENST00000292205	ensembl	human	known	74_37	silent	47.22	57	51	SNP	1.000	A
ADARB2	105	genome.wustl.edu	37	10	1405543	1405543	+	Nonsense_Mutation	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr10:1405543G>A	ENST00000381312.1	-	3	1082	c.757C>T	c.(757-759)Cga>Tga	p.R253*	RP11-398B16.2_ENST00000432987.1_RNA	NM_018702.3	NP_061172.1	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2 (non-functional)	253					mRNA processing (GO:0006397)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	41		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		AGCCGCCGTCGCCCGTAGGCC	0.801																																																	0													1.0	1.0	1.0					10																	1405543		444	1166	1610	SO:0001587	stop_gained	0			AF034837	CCDS7058.1	10p15.3	2013-05-20	2013-05-20		ENSG00000185736	ENSG00000185736	3.5.-.-		227	protein-coding gene	gene with protein product	"""RED2 homolog (rat)"""	602065	"""adenosine deaminase, RNA-specific, B2 (RED2 homolog rat)"", ""adenosine deaminase, RNA-specific, B2"""			9272162, 10836796	Standard	NM_018702		Approved	RED2, hRED2, ADAR3	uc009xhq.3	Q9NS39	OTTHUMG00000017543	ENST00000381312.1:c.757C>T	10.37:g.1405543G>A	ENSP00000370713:p.Arg253*		B2RPJ5|Q5VUT6|Q5VW42	Nonsense_Mutation	SNP	pfam_A_deamin,pfam_dsRNA-bd_dom,smart_dsRNA-bd_dom,smart_A_deamin,pfscan_dsRNA-bd_dom,pfscan_A_deamin	p.R253*	ENST00000381312.1	37	c.757	CCDS7058.1	10	.	.	.	.	.	.	.	.	.	.	G	37	6.039383	0.97226	.	.	ENSG00000185736	ENST00000381312	.	.	.	5.05	3.12	0.35913	.	0.892480	0.09924	N	0.738080	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	-3.7979	13.6519	0.62316	0.0:0.0:0.7174:0.2826	.	.	.	.	X	253	.	ENSP00000370713:R253X	R	-	1	2	ADARB2	1395543	0.131000	0.22433	0.014000	0.15608	0.011000	0.07611	2.126000	0.42026	0.482000	0.27582	-0.500000	0.04577	CGA	ADARB2	-	NULL	ENSG00000185736		0.801	ADARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADARB2	HGNC	protein_coding	OTTHUMT00000046426.1		0.00	8	0	G	NM_018702		1405543	-1			no_errors	ENST00000381312	ensembl	human	known	74_37	nonsense	60.00	2	3	SNP	0.960	A
ADHFE1	137872	genome.wustl.edu	37	8	67356900	67356900	+	Silent	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr8:67356900G>T	ENST00000396623.3	+	5	301	c.270G>T	c.(268-270)gtG>gtT	p.V90V	ADHFE1_ENST00000379385.4_Silent_p.V90V|ADHFE1_ENST00000415254.1_Silent_p.V42V|ADHFE1_ENST00000496501.1_3'UTR	NM_144650.2	NP_653251.2	Q8IWW8	HOT_HUMAN	alcohol dehydrogenase, iron containing, 1	90					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|molecular hydrogen transport (GO:0015993)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	hydroxyacid-oxoacid transhydrogenase activity (GO:0047988)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	29		Lung NSC(129;0.197)	Epithelial(68;0.0321)|all cancers(69;0.0751)|BRCA - Breast invasive adenocarcinoma(89;0.0855)|OV - Ovarian serous cystadenocarcinoma(28;0.226)			TCCCTCCTGTGCAAGTAGCTA	0.413																																																	0													257.0	242.0	247.0					8																	67356900		2203	4300	6503	SO:0001819	synonymous_variant	0			AK056992	CCDS6190.2	8q12.3	2013-05-21			ENSG00000147576	ENSG00000147576	1.1.99.24	"""Alcohol dehydrogenases"""	16354	protein-coding gene	gene with protein product	"""hydroxyacid-oxoacid transhydrogenase"""	611083				12592711	Standard	NM_144650		Approved	ADHFe1, FLJ32430	uc003xwb.4	Q8IWW8	OTTHUMG00000150215	ENST00000396623.3:c.270G>T	8.37:g.67356900G>T			B4DTJ8|Q49A19|Q68CI7|Q6P2B6|Q96MF9	Silent	SNP	pfam_ADH_Fe	p.V90	ENST00000396623.3	37	c.270	CCDS6190.2	8																																																																																			ADHFE1	-	pfam_ADH_Fe	ENSG00000147576		0.413	ADHFE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADHFE1	HGNC	protein_coding	OTTHUMT00000316867.3	-	0.00	72	0	G	NM_144650		67356900	+1	tier1	-	no_errors	ENST00000396623	ensembl	human	known	74_37	silent	6.33	74	5	SNP	0.003	T
AHCTF1	25909	genome.wustl.edu	37	1	247013009	247013009	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:247013009C>T	ENST00000391829.2	-	33	6422	c.6299G>A	c.(6298-6300)cGg>cAg	p.R2100Q	AHCTF1_ENST00000326225.3_Missense_Mutation_p.R2109Q|AHCTF1_ENST00000366508.1_Missense_Mutation_p.R2135Q|AHCTF1_ENST00000470300.1_5'UTR			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	2100	Disordered. {ECO:0000250}.|Necessary for nuclear localization. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			CTTGCTAGACCGAGTCCTGCT	0.453																																					Colon(145;197 1800 4745 15099 26333)												0													153.0	130.0	138.0					1																	247013009		2203	4300	6503	SO:0001583	missense	0				CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.6299G>A	1.37:g.247013009C>T	ENSP00000375705:p.Arg2100Gln		A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Missense_Mutation	SNP	superfamily_Quinonprotein_ADH-like_supfam	p.R2109Q	ENST00000391829.2	37	c.6326		1	.	.	.	.	.	.	.	.	.	.	C	18.41	3.618830	0.66787	.	.	ENSG00000153207	ENST00000366508;ENST00000326225;ENST00000391829	T;T;T	0.47869	0.83;0.84;0.84	5.76	5.76	0.90799	.	0.000000	0.64402	D	0.000001	T	0.66636	0.2809	M	0.68952	2.095	0.35715	D	0.816713	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.994	T	0.67968	-0.5533	10	0.27082	T	0.32	-21.7075	17.1279	0.86719	0.0:1.0:0.0:0.0	.	2135;2100	Q8WYP5-2;Q8WYP5	.;ELYS_HUMAN	Q	2135;2109;2100	ENSP00000355464:R2135Q;ENSP00000355465:R2109Q;ENSP00000375705:R2100Q	ENSP00000355465:R2109Q	R	-	2	0	AHCTF1	245079632	1.000000	0.71417	0.866000	0.34008	0.015000	0.08874	4.723000	0.61965	2.718000	0.92993	0.650000	0.86243	CGG	AHCTF1	-	NULL	ENSG00000153207		0.453	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	AHCTF1	HGNC	protein_coding		-	0.00	101	0	C	NM_015446		247013009	-1	tier1	-	no_errors	ENST00000326225	ensembl	human	known	74_37	missense	27.13	136	51	SNP	0.996	T
AIG1	51390	genome.wustl.edu	37	6	143654504	143654504	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr6:143654504G>T	ENST00000275235.4	+	5	626	c.601G>T	c.(601-603)Ggg>Tgg	p.G201W	AIG1_ENST00000357847.4_Missense_Mutation_p.G201W|AIG1_ENST00000344492.5_Missense_Mutation_p.G149W			Q9NVV5	AIG1_HUMAN	androgen-induced 1	201						integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(155;2.34e-05)|GBM - Glioblastoma multiforme(68;0.0246)		CATCTTCTTTGGGTCTACAAC	0.463																																																	0													169.0	163.0	165.0					6																	143654504		2203	4300	6503	SO:0001583	missense	0			AF153605	CCDS5198.1, CCDS69216.1	6q24.1	2008-02-05			ENSG00000146416	ENSG00000146416			21607	protein-coding gene	gene with protein product		608514				11266118	Standard	NM_001286587		Approved	dJ95L4.1, AIG-1, FLJ10485	uc003qjh.3	Q9NVV5	OTTHUMG00000015721	ENST00000275235.4:c.601G>T	6.37:g.143654504G>T	ENSP00000275235:p.Gly201Trp		B4DPX2|C9J569|Q5T2H2|Q6N047|Q7Z378|Q8TB14|Q9Y3A9|Q9Y5B4	Missense_Mutation	SNP	pfam_Far-17a_AIG1	p.G201W	ENST00000275235.4	37	c.601		6	.	.	.	.	.	.	.	.	.	.	G	16.99	3.274460	0.59649	.	.	ENSG00000146416	ENST00000419072;ENST00000357847;ENST00000344492;ENST00000275235;ENST00000458219	T;T;T;T	0.30448	1.53;1.53;1.53;1.53	5.46	4.57	0.56435	.	0.895855	0.09993	N	0.729496	T	0.30978	0.0782	L	0.52573	1.65	0.80722	D	1	D;D;D	0.64830	0.993;0.993;0.994	P;P;P	0.60345	0.8;0.8;0.873	T	0.04216	-1.0968	9	.	.	.	1.1334	8.8709	0.35316	0.0745:0.0:0.7754:0.1501	.	149;201;197	Q9NVV5-3;Q9NVV5-2;E7ENG8	.;.;.	W	197;201;149;201;113	ENSP00000350509:G201W;ENSP00000340090:G149W;ENSP00000275235:G201W;ENSP00000407817:G113W	.	G	+	1	0	AIG1	143696197	0.999000	0.42202	0.983000	0.44433	0.998000	0.95712	2.399000	0.44495	1.233000	0.43693	0.650000	0.86243	GGG	AIG1	-	pfam_Far-17a_AIG1	ENSG00000146416		0.463	AIG1-005	KNOWN	basic	protein_coding	AIG1	HGNC	protein_coding	OTTHUMT00000042510.1	-	0.00	64	0	G	NM_016108		143654504	+1	tier1	-	no_errors	ENST00000275235	ensembl	human	known	74_37	missense	7.41	50	4	SNP	0.987	T
ALKBH1	8846	genome.wustl.edu	37	14	78140430	78140430	+	Nonsense_Mutation	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr14:78140430C>A	ENST00000216489.3	-	6	910	c.895G>T	c.(895-897)Gaa>Taa	p.E299*		NM_006020.2	NP_006011.2	Q13686	ALKB1_HUMAN	alkB, alkylation repair homolog 1 (E. coli)	299	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				developmental growth (GO:0048589)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA demethylation (GO:0080111)|DNA repair (GO:0006281)|in utero embryonic development (GO:0001701)|negative regulation of neuron apoptotic process (GO:0043524)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|oxidative demethylation (GO:0070989)|placenta development (GO:0001890)|RNA repair (GO:0042245)	mitochondrion (GO:0005739)|nuclear euchromatin (GO:0005719)	chemoattractant activity (GO:0042056)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)			endometrium(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	9			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		GGCAGGCCTTCCCCTTCTGGA	0.557																																																	0													66.0	62.0	64.0					14																	78140430		2203	4300	6503	SO:0001587	stop_gained	0			X91992	CCDS32127.1	14q24	2014-07-23	2006-02-09	2006-02-09	ENSG00000100601	ENSG00000100601		"""Alkylation repair homologs"""	17911	protein-coding gene	gene with protein product		605345	"""alkB, alkylation repair homolog (E. coli)"""	ALKBH		8600462	Standard	XM_005268165		Approved	hABH, alkB, ABH	uc001xuc.1	Q13686	OTTHUMG00000171542	ENST00000216489.3:c.895G>T	14.37:g.78140430C>A	ENSP00000216489:p.Glu299*		Q8TAU1|Q9ULA7	Nonsense_Mutation	SNP	tigrfam_Alkb	p.E299*	ENST00000216489.3	37	c.895	CCDS32127.1	14	.	.	.	.	.	.	.	.	.	.	C	16.52	3.145712	0.57044	.	.	ENSG00000100601	ENST00000216489	.	.	.	5.95	4.97	0.65823	.	0.658363	0.16705	N	0.202942	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.12103	T	0.63	-29.0722	7.2155	0.25957	0.0:0.8164:0.0:0.1836	.	.	.	.	X	299	.	ENSP00000216489:E299X	E	-	1	0	ALKBH1	77210183	0.000000	0.05858	0.391000	0.26233	0.781000	0.44180	1.061000	0.30542	2.824000	0.97209	0.655000	0.94253	GAA	ALKBH1	-	NULL	ENSG00000100601		0.557	ALKBH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALKBH1	HGNC	protein_coding	OTTHUMT00000414037.1		0.00	56	0	C	NM_006020		78140430	-1			no_errors	ENST00000216489	ensembl	human	known	74_37	nonsense	5.13	74	4	SNP	0.293	A
ALMS1	7840	genome.wustl.edu	37	2	73777445	73777445	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr2:73777445G>A	ENST00000264448.6	+	13	10067	c.9956G>A	c.(9955-9957)aGa>aAa	p.R3319K	ALMS1_ENST00000409009.1_Missense_Mutation_p.R3277K	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	3319					endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						CTAGGCACAAGAGATGATGAC	0.443																																																	0													110.0	102.0	104.0					2																	73777445		1922	4132	6054	SO:0001583	missense	0			AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.9956G>A	2.37:g.73777445G>A	ENSP00000264448:p.Arg3319Lys		Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	NULL	p.R3319K	ENST00000264448.6	37	c.9956	CCDS42697.1	2	.	.	.	.	.	.	.	.	.	.	G	25.3	4.619517	0.87460	.	.	ENSG00000116127	ENST00000409009;ENST00000264448	T;T	0.22336	1.96;1.96	5.83	5.83	0.93111	.	0.000000	0.53938	D	0.000050	T	0.40498	0.1119	L	0.48642	1.525	0.80722	D	1	D;D;D	0.76494	0.994;0.998;0.999	D;D;D	0.80764	0.979;0.986;0.994	T	0.05209	-1.0899	10	0.59425	D	0.04	.	15.6048	0.76658	0.0:0.0:1.0:0.0	.	3319;3277;3319	Q8TCU4-3;B8ZZJ3;Q8TCU4	.;.;ALMS1_HUMAN	K	3277;3319	ENSP00000386627:R3277K;ENSP00000264448:R3319K	ENSP00000264448:R3319K	R	+	2	0	ALMS1	73630953	0.999000	0.42202	0.703000	0.30354	0.770000	0.43624	2.373000	0.44266	2.762000	0.94881	0.655000	0.94253	AGA	ALMS1	-	NULL	ENSG00000116127		0.443	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ALMS1	HGNC	protein_coding	OTTHUMT00000327776.1	-	0.00	56	0	G	NM_015120		73777445	+1	tier1	-	no_errors	ENST00000264448	ensembl	human	known	74_37	missense	10.00	90	10	SNP	0.975	A
ALPK3	57538	genome.wustl.edu	37	15	85383828	85383828	+	Missense_Mutation	SNP	C	C	T	rs558339788		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr15:85383828C>T	ENST00000258888.5	+	5	2091	c.1924C>T	c.(1924-1926)Cgg>Tgg	p.R642W		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	642					heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CCTGAGTGTCCGGGCGCCTGG	0.647																																																	0													24.0	27.0	26.0					15																	85383828		2201	4299	6500	SO:0001583	missense	0			AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.1924C>T	15.37:g.85383828C>T	ENSP00000258888:p.Arg642Trp		Q9P2L6	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase,pfscan_Ig-like_dom	p.R642W	ENST00000258888.5	37	c.1924	CCDS10333.1	15	.	.	.	.	.	.	.	.	.	.	C	13.66	2.303336	0.40795	.	.	ENSG00000136383	ENST00000258888	T	0.62788	0.0	4.01	0.283	0.15696	.	7739.210000	0.00166	N	0.000000	T	0.50069	0.1594	L	0.29908	0.895	0.09310	N	1	P	0.48834	0.916	B	0.36666	0.23	T	0.53464	-0.8435	10	0.72032	D	0.01	-5.0309	10.0199	0.42037	0.4274:0.5726:0.0:0.0	.	642	Q96L96	ALPK3_HUMAN	W	642	ENSP00000258888:R642W	ENSP00000258888:R642W	R	+	1	2	ALPK3	83184832	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.356000	0.20181	0.028000	0.15324	-0.457000	0.05445	CGG	ALPK3	-	NULL	ENSG00000136383		0.647	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK3	HGNC	protein_coding	OTTHUMT00000308997.1	-	0.00	136	0	C	NM_020778		85383828	+1	tier1	-	no_errors	ENST00000258888	ensembl	human	known	74_37	missense	22.73	85	25	SNP	0.000	T
AMY2B	280	genome.wustl.edu	37	1	104114006	104114007	+	Intron	INS	-	-	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:104114006_104114007insA	ENST00000361355.4	+	3	570				AMY2B_ENST00000491397.1_3'UTR	NM_020978.3	NP_066188.1	P19961	AMY2B_HUMAN	amylase, alpha 2B (pancreatic)						carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|kidney(4)|large_intestine(1)|lung(30)|prostate(1)|skin(1)|urinary_tract(1)	46		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		CTGCCAGAACCAAAAAAACATT	0.312																																																	0																																										SO:0001627	intron_variant	0			M24895	CCDS782.1	1p21	2010-08-02	2006-04-27		ENSG00000240038	ENSG00000240038	3.2.1.1		478	protein-coding gene	gene with protein product		104660	"""amylase, alpha 2B; pancreatic"""	AMY2		8268204	Standard	NM_020978		Approved		uc001duq.3	P19961	OTTHUMG00000011024	ENST00000361355.4:c.-46-172->A	1.37:g.104114013_104114013dupA			B3KTI1|B3KXB7|D3DT76|Q9UBH3	RNA	INS	-	NULL	ENST00000361355.4	37	NULL	CCDS782.1	1																																																																																			AMY2B	-	-	ENSG00000240038		0.312	AMY2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMY2B	HGNC	protein_coding	OTTHUMT00000030318.1		0.00	24	0	-	NM_020978		104114007	+1	tier1		no_errors	ENST00000491397	ensembl	human	known	74_37	rna	25.00	30	10	INS	0.001:0.000	A
ANAPC5	51433	genome.wustl.edu	37	12	121775130	121775130	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr12:121775130G>T	ENST00000261819.3	-	6	844	c.723C>A	c.(721-723)aaC>aaA	p.N241K	ANAPC5_ENST00000441917.2_Missense_Mutation_p.N142K|ANAPC5_ENST00000536366.1_Missense_Mutation_p.N120K|ANAPC5_ENST00000541887.1_Missense_Mutation_p.N241K|ANAPC5_ENST00000544314.1_5'Flank|ANAPC5_ENST00000344395.4_Missense_Mutation_p.N142K	NM_016237.4	NP_057321.2	Q9UJX4	APC5_HUMAN	anaphase promoting complex subunit 5	241					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)			breast(6)|endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|prostate(1)|skin(3)	31	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TCAACAAATTGTTTAATTCCT	0.363																																																	0													102.0	105.0	104.0					12																	121775130		2203	4300	6503	SO:0001583	missense	0			AF191339	CCDS9220.1, CCDS45000.1	12q24.31	2014-08-12			ENSG00000089053	ENSG00000089053		"""Anaphase promoting complex subunits"""	15713	protein-coding gene	gene with protein product		606948				9469815	Standard	NM_016237		Approved	APC5	uc001uag.3	Q9UJX4	OTTHUMG00000169157	ENST00000261819.3:c.723C>A	12.37:g.121775130G>T	ENSP00000261819:p.Asn241Lys		E9PFB2|Q8N4H7|Q9BQD4	Missense_Mutation	SNP	smart_TPR_repeat	p.N241K	ENST00000261819.3	37	c.723	CCDS9220.1	12	.	.	.	.	.	.	.	.	.	.	G	15.86	2.959221	0.53400	.	.	ENSG00000089053	ENST00000441917;ENST00000541887;ENST00000261819;ENST00000344395;ENST00000536366;ENST00000544442	T;T;T;T;T;T	0.33865	1.39;1.39;1.39;1.39;1.39;1.39	5.64	3.79	0.43588	.	0.000000	0.85682	D	0.000000	T	0.38957	0.1060	L	0.55481	1.735	0.58432	D	0.999997	D;D	0.62365	0.978;0.991	P;P	0.49922	0.531;0.626	T	0.13361	-1.0512	10	0.27785	T	0.31	.	10.2721	0.43489	0.211:0.0:0.789:0.0	.	142;241	E9PFB2;Q9UJX4	.;APC5_HUMAN	K	142;241;241;142;120;142	ENSP00000415061:N142K;ENSP00000439875:N241K;ENSP00000261819:N241K;ENSP00000343787:N142K;ENSP00000445310:N120K;ENSP00000440800:N142K	ENSP00000261819:N241K	N	-	3	2	ANAPC5	120259513	1.000000	0.71417	1.000000	0.80357	0.840000	0.47671	1.222000	0.32515	1.523000	0.49018	0.563000	0.77884	AAC	ANAPC5	-	NULL	ENSG00000089053		0.363	ANAPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANAPC5	HGNC	protein_coding	OTTHUMT00000402582.1	-	0.00	50	0	G			121775130	-1	tier1	-	no_errors	ENST00000261819	ensembl	human	known	74_37	missense	5.26	72	4	SNP	1.000	T
ANGPT2	285	genome.wustl.edu	37	8	6372251	6372251	+	Missense_Mutation	SNP	G	G	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr8:6372251G>C	ENST00000325203.5	-	6	1453	c.979C>G	c.(979-981)Cga>Gga	p.R327G	ANGPT2_ENST00000415216.1_Missense_Mutation_p.R326G|MCPH1_ENST00000344683.5_Intron|ANGPT2_ENST00000523120.1_Missense_Mutation_p.R326G|ANGPT2_ENST00000338312.6_Missense_Mutation_p.R275G			O15123	ANGP2_HUMAN	angiopoietin 2	327	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to growth factor stimulus (GO:0071363)|germ cell development (GO:0007281)|glomerulus vasculature development (GO:0072012)|leukocyte migration (GO:0050900)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of positive chemotaxis (GO:0050928)|organ regeneration (GO:0031100)|positive regulation of angiogenesis (GO:0045766)|response to activity (GO:0014823)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|response to organic cyclic compound (GO:0014070)|response to radiation (GO:0009314)|signal transduction (GO:0007165)|Tie signaling pathway (GO:0048014)	cell projection (GO:0042995)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17		Hepatocellular(245;0.0663)		Colorectal(4;0.0142)|READ - Rectum adenocarcinoma(4;0.19)|COAD - Colon adenocarcinoma(4;0.226)		TCCTCACGTCGCTGAATAATT	0.478																																																	0													165.0	177.0	173.0					8																	6372251		2203	4300	6503	SO:0001583	missense	0			AF004327	CCDS5958.1, CCDS47761.1	8p23	2013-02-06			ENSG00000091879	ENSG00000091879		"""Fibrinogen C domain containing"""	485	protein-coding gene	gene with protein product		601922				9545648	Standard	NM_001147		Approved	Ang2	uc003wqj.4	O15123	OTTHUMG00000090365	ENST00000325203.5:c.979C>G	8.37:g.6372251G>C	ENSP00000314897:p.Arg327Gly		A0AV38|A8K205|B7ZLM7|Q9NRR7|Q9P2Y7	Missense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	p.R327G	ENST00000325203.5	37	c.979	CCDS5958.1	8	.	.	.	.	.	.	.	.	.	.	G	19.69	3.874260	0.72180	.	.	ENSG00000091879	ENST00000325203;ENST00000415216;ENST00000338312;ENST00000523120	T;T;T;T	0.78595	1.79;1.79;1.79;-1.19	5.81	3.81	0.43845	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.161185	0.52532	D	0.000067	D	0.91479	0.7310	H	0.97240	3.965	0.35253	D	0.778917	P;D;P;P	0.63880	0.661;0.993;0.814;0.952	B;D;B;P	0.66716	0.122;0.946;0.243;0.729	D	0.96661	0.9489	10	0.87932	D	0	.	14.3224	0.66496	0.0:0.0:0.7259:0.2741	.	275;326;326;327	O15123-2;E7EVQ3;O15123-3;O15123	.;.;.;ANGP2_HUMAN	G	327;326;275;326	ENSP00000314897:R327G;ENSP00000400782:R326G;ENSP00000343517:R275G;ENSP00000428023:R326G	ENSP00000314897:R327G	R	-	1	2	ANGPT2	6359659	0.996000	0.38824	1.000000	0.80357	0.997000	0.91878	2.059000	0.41384	1.433000	0.47394	0.655000	0.94253	CGA	ANGPT2	-	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	ENSG00000091879		0.478	ANGPT2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANGPT2	HGNC	protein_coding	OTTHUMT00000206737.1	-	0.00	38	0	G	NM_001147		6372251	-1	tier1	-	no_errors	ENST00000325203	ensembl	human	known	74_37	missense	23.26	33	10	SNP	0.998	C
ANKS6	203286	genome.wustl.edu	37	9	101552791	101552791	+	Silent	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr9:101552791G>T	ENST00000353234.4	-	2	504	c.457C>A	c.(457-459)Cgg>Agg	p.R153R	ANKS6_ENST00000471846.1_5'UTR|ANKS6_ENST00000540940.1_5'UTR|ANKS6_ENST00000375018.1_Silent_p.R153R|ANKS6_ENST00000375019.2_Intron			Q68DC2	ANKS6_HUMAN	ankyrin repeat and sterile alpha motif domain containing 6	153						cilium (GO:0005929)|cytoplasm (GO:0005737)				endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	21		Acute lymphoblastic leukemia(62;0.0527)				TGGCCGCCCCGAGAAGCCACA	0.632																																																	0													18.0	24.0	22.0					9																	101552791		2006	4162	6168	SO:0001819	synonymous_variant	0			AK094247	CCDS43856.1	9q31.1	2013-09-10	2006-02-17	2006-02-17	ENSG00000165138	ENSG00000165138		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	26724	protein-coding gene	gene with protein product		615370	"""sterile alpha motif domain containing 6"", ""ankyrin repeat domain 14"""	SAMD6, ANKRD14		23793029	Standard	XM_005251793		Approved	FLJ36928, NPHP16	uc004ayu.3	Q68DC2	OTTHUMG00000020347	ENST00000353234.4:c.457C>A	9.37:g.101552791G>T			A0SE62|Q5VSL0|Q5VSL2|Q5VSL3|Q5VSL4|Q68DB8|Q6P2R2|Q8N9L6|Q96D62	Silent	SNP	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_SAM_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SAM,prints_Ankyrin_rpt	p.R153	ENST00000353234.4	37	c.457	CCDS43856.1	9																																																																																			ANKS6	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000165138		0.632	ANKS6-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANKS6	HGNC	protein_coding	OTTHUMT00000277053.1		0.00	53	0	G	NM_173551		101552791	-1			no_errors	ENST00000375018	ensembl	human	known	74_37	silent	6.78	55	4	SNP	1.000	T
APBB1	322	genome.wustl.edu	37	11	6424578	6424578	+	Frame_Shift_Del	DEL	C	C	-			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr11:6424578delC	ENST00000609360.1	-	5	1110	c.1011delG	c.(1009-1011)gggfs	p.G337fs	APBB1_ENST00000608645.1_Frame_Shift_Del_p.G78fs|APBB1_ENST00000530885.1_Frame_Shift_Del_p.G117fs|APBB1_ENST00000608394.1_Frame_Shift_Del_p.G78fs|APBB1_ENST00000311051.3_Frame_Shift_Del_p.G337fs|APBB1_ENST00000608655.1_Frame_Shift_Del_p.G117fs|APBB1_ENST00000608704.1_Frame_Shift_Del_p.G78fs|APBB1_ENST00000389906.2_Frame_Shift_Del_p.G337fs|APBB1_ENST00000529519.1_5'UTR|APBB1_ENST00000299402.6_Frame_Shift_Del_p.G337fs|APBB1_ENST00000609331.1_Frame_Shift_Del_p.G102fs	NM_001164.3	NP_001155.1	O00213	APBB1_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65)	337					apoptotic process (GO:0006915)|axonogenesis (GO:0007409)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|histone H4 acetylation (GO:0043967)|negative regulation of cell growth (GO:0030308)|negative regulation of thymidylate synthase biosynthetic process (GO:0050760)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|proline-rich region binding (GO:0070064)|transcription factor binding (GO:0008134)			breast(4)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|prostate(2)|skin(1)|urinary_tract(1)	24		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;6.49e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)		AGGTCAACGTCCCCTCCTCAG	0.567																																					GBM(147;1810 2556 5672 39622)												0													70.0	67.0	68.0					11																	6424578		2201	4296	6497	SO:0001589	frameshift_variant	0			L77864	CCDS31410.1, CCDS58114.1, CCDS66015.1, CCDS66016.1, CCDS66017.1, CCDS66018.1	11p15	2008-02-01				ENSG00000166313			581	protein-coding gene	gene with protein product		602709		RIR		8955346, 8894693	Standard	NM_001164		Approved	Fe65	uc001mcy.1	O00213		ENST00000609360.1:c.1011delG	11.37:g.6424578delC	ENSP00000477213:p.Gly337fs		A1E379|A6NH82|A6NL69|B7Z1J5|B7Z1J6|B7Z2Y0|D3DQT2|Q7Z324|Q96A93|V9GYK0|V9GYT4	Frame_Shift_Del	DEL	pfam_PTB/PI_dom,pfam_WW_dom,pfam_PTB,superfamily_WW_dom,smart_WW_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom,pfscan_WW_dom	p.T338fs	ENST00000609360.1	37	c.1011		11																																																																																			APBB1	-	NULL	ENSG00000166313		0.567	APBB1-023	KNOWN	basic|appris_candidate_longest	protein_coding	APBB1	HGNC	protein_coding	OTTHUMT00000471831.1		0.00	49	0	C	NM_001164		6424578	-1	tier1		no_errors	ENST00000389906	ensembl	human	known	74_37	frame_shift_del	28.95	27	11	DEL	0.993	-
APOL1	8542	genome.wustl.edu	37	22	36661572	36661572	+	Silent	SNP	C	C	T	rs566062739		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr22:36661572C>T	ENST00000397278.3	+	6	919	c.690C>T	c.(688-690)taC>taT	p.Y230Y	APOL1_ENST00000347595.7_Silent_p.Y109Y|APOL1_ENST00000397279.4_Silent_p.Y230Y|APOL1_ENST00000319136.4_Silent_p.Y246Y|APOL1_ENST00000440669.2_3'UTR|APOL1_ENST00000422706.1_Silent_p.Y230Y|APOL1_ENST00000426053.1_Silent_p.Y212Y	NM_003661.3	NP_003652.2	O14791	APOL1_HUMAN	apolipoprotein L, 1	230					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|cholesterol metabolic process (GO:0008203)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|killing of cells of other organism (GO:0031640)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|high-density lipoprotein particle (GO:0034364)|intrinsic component of membrane (GO:0031224)|very-low-density lipoprotein particle (GO:0034361)	chloride channel activity (GO:0005254)|lipid binding (GO:0008289)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	14						CCATGGACTACGGAAAGAAGT	0.522													c|||	1	0.000199681	0.0008	0.0	5008	,	,		21672	0.0		0.0	False		,,,				2504	0.0																0													99.0	94.0	95.0					22																	36661572		2203	4300	6503	SO:0001819	synonymous_variant	0			AF019225	CCDS13925.1, CCDS13926.1, CCDS46702.1	22q13.1	2014-09-17			ENSG00000100342	ENSG00000100342		"""Apolipoproteins"""	618	protein-coding gene	gene with protein product		603743		APOL		9325276, 11374903, 16020735	Standard	NM_003661		Approved		uc011amp.2	O14791	OTTHUMG00000030427	ENST00000397278.3:c.690C>T	22.37:g.36661572C>T			A5PLQ4|B4DU12|E9PF24|O60804|Q5R3P7|Q5R3P8|Q96AB8|Q96PM4|Q9BQ03	Silent	SNP	pfam_ApoL	p.Y246	ENST00000397278.3	37	c.738	CCDS13926.1	22																																																																																			APOL1	-	pfam_ApoL	ENSG00000100342		0.522	APOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOL1	HGNC	protein_coding	OTTHUMT00000319100.4	-	0.00	62	0	C	NM_145343		36661572	+1	tier1	-	no_errors	ENST00000319136	ensembl	human	known	74_37	silent	5.80	65	4	SNP	0.000	T
AR	367	genome.wustl.edu	37	X	66766359	66766359	+	Silent	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chrX:66766359C>T	ENST00000374690.3	+	1	1895	c.1371C>T	c.(1369-1371)ggC>ggT	p.G457G	AR_ENST00000513847.1_3'UTR|AR_ENST00000396044.3_Silent_p.G457G|AR_ENST00000504326.1_Silent_p.G457G	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	455	Modulating.|Poly-Gly.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	ggggtggtggcggcggcggcg	0.746									Androgen Insensitivity Syndrome																																								0													1.0	1.0	1.0					X																	66766359		738	1695	2433	SO:0001819	synonymous_variant	0	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.1371C>T	X.37:g.66766359C>T			A2RUN2|B1AKD7|Q9UD95	Silent	SNP	pfam_Andrgn_rcpt,pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Andrgn_rcpt,prints_Znf_hrmn_rcpt	p.G457	ENST00000374690.3	37	c.1371	CCDS14387.1	X																																																																																			AR	-	NULL	ENSG00000169083		0.746	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AR	HGNC	protein_coding	OTTHUMT00000057007.1	-	0.00	26	0	C	NM_000044		66766359	+1	tier1	-	no_errors	ENST00000374690	ensembl	human	known	74_37	silent	100.00	0	6	SNP	0.062	T
ARF5	381	genome.wustl.edu	37	7	127231142	127231142	+	Splice_Site	SNP	G	G	T	rs572157049		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr7:127231142G>T	ENST00000000233.5	+	5	610	c.456G>T	c.(454-456)acG>acT	p.T152T	FSCN3_ENST00000265825.5_5'Flank|FSCN3_ENST00000420086.2_5'Flank|GCC1_ENST00000497650.1_Intron	NM_001662.3	NP_001653.1	P84085	ARF5_HUMAN	ADP-ribosylation factor 5	152					GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			cervix(2)|kidney(1)|lung(10)|ovary(1)	14						GCAGCCGCACGGTAGGGGTCC	0.577																																																	0													80.0	74.0	76.0					7																	127231142		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS34745.1	7q31.3	2008-07-18			ENSG00000004059	ENSG00000004059		"""ADP-ribosylation factors"""	658	protein-coding gene	gene with protein product		103188				1993656	Standard	NM_001662		Approved		uc003vmb.2	P84085	OTTHUMG00000023246	ENST00000000233.5:c.456+1G>T	7.37:g.127231142G>T			P26437	Silent	SNP	pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,pfam_Small_GTPase,pfam_Gtr1_RagA,pfam_Gprotein_alpha_su,pfam_MIRO-like,superfamily_P-loop_NTPase,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,smart_Small_GTPase_Rab_type,prints_Small_GTPase_ARF/SAR,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.T152	ENST00000000233.5	37	c.456	CCDS34745.1	7																																																																																			ARF5	-	pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,smart_Small_GTPase_Rab_type	ENSG00000004059		0.577	ARF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARF5	HGNC	protein_coding	OTTHUMT00000059567.2	-	0.00	59	0	G	NM_001662	Silent	127231142	+1	tier1	-	no_errors	ENST00000000233	ensembl	human	known	74_37	silent	19.44	29	7	SNP	0.988	T
ARHGEF38	54848	genome.wustl.edu	37	4	106588433	106588433	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr4:106588433G>T	ENST00000420470.2	+	12	1981	c.1837G>T	c.(1837-1839)Gaa>Taa	p.E613*	ARHGEF38_ENST00000508036.2_3'UTR	NM_001242729.1	NP_001229658.1	Q9NXL2	ARH38_HUMAN	Rho guanine nucleotide exchange factor (GEF) 38	613						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(3)	11						GGCTGTGATAGAACAGAAAGA	0.433																																																	0																																										SO:0001587	stop_gained	0			AK000191	CCDS3670.1, CCDS56338.1	4q24	2012-07-24			ENSG00000236699	ENSG00000236699		"""Rho guanine nucleotide exchange factors"""	25968	protein-coding gene	gene with protein product							Standard	NM_001242729		Approved	FLJ20184	uc003hxv.2	Q9NXL2	OTTHUMG00000154752	ENST00000420470.2:c.1837G>T	4.37:g.106588433G>T	ENSP00000416125:p.Glu613*		C9JIB4	Nonsense_Mutation	SNP	pfam_DH-domain,pfam_BAR_dom,pfam_SH3_2,pfam_SH3_domain,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_BAR_dom,smart_SH3_domain,pfscan_BAR_dom,pfscan_SH3_domain,pfscan_DH-domain	p.E613*	ENST00000420470.2	37	c.1837	CCDS56338.1	4	.	.	.	.	.	.	.	.	.	.	G	39	7.413538	0.98269	.	.	ENSG00000236699	ENST00000420470	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.2017	19.9155	0.97058	0.0:0.0:1.0:0.0	.	.	.	.	X	613	.	ENSP00000416125:E613X	E	+	1	0	ARHGEF38	106807882	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.019000	0.70818	2.699000	0.92147	0.650000	0.86243	GAA	ARHGEF38	-	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain	ENSG00000236699		0.433	ARHGEF38-001	PUTATIVE	basic|appris_principal|readthrough_transcript|exp_conf|CCDS	protein_coding	ARHGEF38	HGNC	protein_coding	OTTHUMT00000336934.3		0.00	43	0	G	NM_017700		106588433	+1			no_errors	ENST00000420470	ensembl	human	putative	74_37	nonsense	5.48	69	4	SNP	1.000	T
ARMCX4	100131755	genome.wustl.edu	37	X	100744937	100744937	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chrX:100744937G>A	ENST00000423738.3	+	2	1563	c.1361G>A	c.(1360-1362)gGc>gAc	p.G454D		NM_001256155.1	NP_001243084.1	Q5H9R4	ARMX4_HUMAN	armadillo repeat containing, X-linked 4	294						integral component of membrane (GO:0016021)				lung(1)	1						AAGAGCAGAGGCAATCCCAAT	0.532																																																	0																																										SO:0001583	missense	0			AK096955	CCDS59170.1	Xq22	2014-03-21	2009-11-26		ENSG00000196440	ENSG00000196440		"""Armadillo repeat containing"""	28615	protein-coding gene	gene with protein product			"""chromosome X open reading frame 35"", ""armadillo repeat containing, X-linked 4 pseudogene"""	CXorf35		16221301, 22569362	Standard	NR_028407		Approved	MGC40053, GASP4	uc031tkc.1	Q5H9R4	OTTHUMG00000022030	ENST00000423738.3:c.1361G>A	X.37:g.100744937G>A	ENSP00000404304:p.Gly454Asp		A8K928|B3KXA4|Q5H9K8|Q8N8D6	Missense_Mutation	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold,pfscan_Armadillo	p.G454D	ENST00000423738.3	37	c.1361	CCDS59170.1	X	.	.	.	.	.	.	.	.	.	.	.	7.073	0.568763	0.13560	.	.	ENSG00000196440	ENST00000423738	.	.	.	4.63	-2.27	0.06846	.	.	.	.	.	T	0.18341	0.0440	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.22695	-1.0209	4	.	.	.	.	1.3513	0.02173	0.3916:0.1379:0.3282:0.1424	.	.	.	.	D	558	.	.	G	+	2	0	ARMCX4	100631593	0.000000	0.05858	0.000000	0.03702	0.862000	0.49288	-0.293000	0.08320	-0.863000	0.04084	0.506000	0.49869	GGC	ARMCX4	-	NULL	ENSG00000196440		0.532	ARMCX4-010	PUTATIVE	upstream_ATG|upstream_uORF|basic|appris_principal|CCDS	protein_coding	ARMCX4	HGNC	protein_coding	OTTHUMT00000370455.2	-	0.00	50	0	G	NM_001256155		100744937	+1	tier1	-	no_errors	ENST00000423738	ensembl	human	putative	74_37	missense	8.16	45	4	SNP	0.003	A
ASAH2	56624	genome.wustl.edu	37	10	52005058	52005058	+	Missense_Mutation	SNP	A	A	G			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr10:52005058A>G	ENST00000395526.4	-	2	283	c.284T>C	c.(283-285)cTa>cCa	p.L95P	ASAH2_ENST00000447815.1_Missense_Mutation_p.L95P|ASAH2_ENST00000329428.6_Missense_Mutation_p.L76P	NM_019893.2	NP_063946.2	Q9NR71	ASAH2_HUMAN	N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2	95					apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|glycosphingolipid metabolic process (GO:0006687)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ceramidase activity (GO:0017040)			large_intestine(1)|lung(9)|urinary_tract(1)	11						GTTCTGAAATAGAGGAGACTC	0.512																																																	0													176.0	180.0	179.0					10																	52005058		2203	4300	6503	SO:0001583	missense	0			AF250847	CCDS7239.2, CCDS44398.1	10q11.23	2008-08-11			ENSG00000188611	ENSG00000188611			18860	protein-coding gene	gene with protein product		611202				10781606	Standard	NM_019893		Approved		uc001jjd.3	Q9NR71	OTTHUMG00000018223	ENST00000395526.4:c.284T>C	10.37:g.52005058A>G	ENSP00000378897:p.Leu95Pro		Q3KNU1|Q5SNT7|Q5SZP6|Q5SZP7|Q5T1D5|Q71ME6	Missense_Mutation	SNP	pfam_Ceramidase_alk	p.L95P	ENST00000395526.4	37	c.284	CCDS7239.2	10	.	.	.	.	.	.	.	.	.	.	A	9.421	1.083076	0.20309	.	.	ENSG00000188611	ENST00000395526;ENST00000447815;ENST00000329428	T;T;T	0.32023	1.48;1.47;1.47	5.31	0.253	0.15551	.	1.149980	0.06310	N	0.702538	T	0.20820	0.0501	N	0.22421	0.69	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.001	T	0.29549	-1.0008	10	0.27082	T	0.32	.	9.0457	0.36345	0.5581:0.0:0.4419:0.0	.	95;95	Q9NR71-2;Q9NR71	.;ASAH2_HUMAN	P	95;95;76	ENSP00000378897:L95P;ENSP00000388206:L95P;ENSP00000329886:L76P	ENSP00000329886:L76P	L	-	2	0	ASAH2	51675064	0.028000	0.19301	0.000000	0.03702	0.210000	0.24377	1.589000	0.36644	0.041000	0.15688	0.533000	0.62120	CTA	ASAH2	-	NULL	ENSG00000188611		0.512	ASAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASAH2	HGNC	protein_coding	OTTHUMT00000048061.3	-	0.00	95	0	A	NM_019893		52005058	-1	tier1	-	no_errors	ENST00000395526	ensembl	human	known	74_37	missense	5.19	128	7	SNP	0.000	G
ASTN1	460	genome.wustl.edu	37	1	177133539	177133539	+	Missense_Mutation	SNP	A	A	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:177133539A>C	ENST00000367654.3	-	1	485	c.274T>G	c.(274-276)Ttc>Gtc	p.F92V	ASTN1_ENST00000424564.2_Missense_Mutation_p.F92V|ASTN1_ENST00000367657.3_Missense_Mutation_p.F92V|ASTN1_ENST00000361833.2_Missense_Mutation_p.F92V|ASTN1_ENST00000281881.3_5'UTR	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	92					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						CCCAGCACGAAGTAGGGCAGC	0.697																																																	0													33.0	28.0	30.0					1																	177133539		2203	4300	6503	SO:0001583	missense	0			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.274T>G	1.37:g.177133539A>C	ENSP00000356626:p.Phe92Val		A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	superfamily_Fibronectin_type3,smart_EG-like_dom,smart_MACPF,pfscan_Fibronectin_type3	p.F92V	ENST00000367654.3	37	c.274		1	.	.	.	.	.	.	.	.	.	.	A	22.7	4.324567	0.81580	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;T;T	0.15952	2.38;2.8;2.8;2.39	3.04	3.04	0.35103	.	0.000000	0.85682	D	0.000000	T	0.29976	0.0750	L	0.44542	1.39	0.80722	D	1	D;D;D	0.61080	0.989;0.989;0.978	D;D;P	0.70487	0.969;0.969;0.649	T	0.02263	-1.1186	10	0.52906	T	0.07	-23.062	11.3054	0.49332	1.0:0.0:0.0:0.0	.	92;92;92	O14525;O14525-2;B1AJS1	ASTN1_HUMAN;.;.	V	92	ENSP00000356629:F92V;ENSP00000354536:F92V;ENSP00000356626:F92V;ENSP00000395041:F92V	ENSP00000354536:F92V	F	-	1	0	ASTN1	175400162	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.588000	0.90813	1.404000	0.46819	0.317000	0.21355	TTC	ASTN1	-	NULL	ENSG00000152092		0.697	ASTN1-201	KNOWN	basic	protein_coding	ASTN1	HGNC	protein_coding		-	0.00	83	0	A	NM_004319		177133539	-1	tier1	-	no_errors	ENST00000367654	ensembl	human	known	74_37	missense	29.21	63	26	SNP	1.000	C
ATM	472	genome.wustl.edu	37	11	108121679	108121679	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr11:108121679G>T	ENST00000452508.2	+	11	1676	c.1487G>T	c.(1486-1488)aGt>aTt	p.S496I	ATM_ENST00000278616.4_Missense_Mutation_p.S496I			Q13315	ATM_HUMAN	ATM serine/threonine kinase	496					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	CGTGGTATAAGTTCTGAGCAA	0.368			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	0													123.0	133.0	129.0					11																	108121679		2201	4298	6499	SO:0001583	missense	0	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.1487G>T	11.37:g.108121679G>T	ENSP00000388058:p.Ser496Ile		B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_TAN,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.S496I	ENST00000452508.2	37	c.1487	CCDS31669.1	11	.	.	.	.	.	.	.	.	.	.	G	25.1	4.600183	0.87055	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508	T;T;T	0.65549	-0.16;-0.16;-0.16	5.77	4.86	0.63082	Armadillo-type fold (1);	0.043398	0.85682	D	0.000000	T	0.71609	0.3360	M	0.68952	2.095	0.51482	D	0.999921	D	0.56746	0.977	P	0.54460	0.753	T	0.75736	-0.3213	10	0.72032	D	0.01	.	14.5973	0.68415	0.0694:0.0:0.9305:0.0	.	496	Q13315	ATM_HUMAN	I	496	ENSP00000435747:S496I;ENSP00000278616:S496I;ENSP00000388058:S496I	ENSP00000278616:S496I	S	+	2	0	ATM	107626889	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.267000	0.72546	1.446000	0.47643	0.561000	0.74099	AGT	ATM	-	superfamily_ARM-type_fold	ENSG00000149311		0.368	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	HGNC	protein_coding	OTTHUMT00000389938.1	-	0.00	45	0	G	NM_000051		108121679	+1	tier1	-	no_errors	ENST00000278616	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	T
ATP10B	23120	genome.wustl.edu	37	5	160047770	160047770	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr5:160047770G>T	ENST00000327245.5	-	15	2846	c.2000C>A	c.(1999-2001)tCt>tAt	p.S667Y	CTC-348L5.1_ENST00000523598.1_RNA	NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	667					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ACTGCACACAGATGCATCATC	0.587																																																	0													67.0	70.0	69.0					5																	160047770		2170	4272	6442	SO:0001583	missense	0			AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.2000C>A	5.37:g.160047770G>T	ENSP00000313600:p.Ser667Tyr		Q9H725	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.S667Y	ENST00000327245.5	37	c.2000	CCDS43394.1	5	.	.	.	.	.	.	.	.	.	.	G	1.025	-0.683508	0.03353	.	.	ENSG00000118322	ENST00000327245;ENST00000520108	D;D	0.86432	-2.12;-2.12	5.36	5.36	0.76844	HAD-like domain (1);	0.317848	0.30979	N	0.008498	T	0.81969	0.4935	N	0.25647	0.755	0.21184	N	0.999767	P;B	0.43788	0.817;0.077	B;B	0.41988	0.372;0.018	T	0.74506	-0.3643	9	.	.	.	.	18.1147	0.89549	0.0:0.0:1.0:0.0	.	275;667	Q2YDW8;O94823	.;AT10B_HUMAN	Y	667;275	ENSP00000313600:S667Y;ENSP00000431081:S275Y	.	S	-	2	0	ATP10B	159980348	1.000000	0.71417	0.536000	0.28039	0.021000	0.10359	5.996000	0.70639	2.523000	0.85059	0.655000	0.94253	TCT	ATP10B	-	superfamily_HAD-like_dom	ENSG00000118322		0.587	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10B	HGNC	protein_coding	OTTHUMT00000374127.1		0.00	35	0	G	NM_025153		160047770	-1			no_errors	ENST00000327245	ensembl	human	known	74_37	missense	6.12	46	3	SNP	0.373	T
ATP8A2	51761	genome.wustl.edu	37	13	26104741	26104741	+	Silent	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr13:26104741G>T	ENST00000381655.2	+	4	505	c.363G>T	c.(361-363)ctG>ctT	p.L121L	ATP8A2_ENST00000255283.8_Silent_p.L81L	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	81					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		ATACCACCCTGGTGCCATTGA	0.358																																																	0													87.0	75.0	79.0					13																	26104741		1816	4080	5896	SO:0001819	synonymous_variant	0			AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.363G>T	13.37:g.26104741G>T			Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Silent	SNP	pfam_ATPase_P-typ_transduc_dom_A,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.L121	ENST00000381655.2	37	c.363	CCDS41873.1	13																																																																																			ATP8A2	-	tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	ENSG00000132932		0.358	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP8A2	HGNC	protein_coding	OTTHUMT00000044236.2	-	0.00	32	0	G	NM_016529		26104741	+1	tier1	-	no_errors	ENST00000381655	ensembl	human	known	74_37	silent	8.89	41	4	SNP	1.000	T
ATRN	8455	genome.wustl.edu	37	20	3578567	3578567	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr20:3578567G>T	ENST00000262919.5	+	22	3552	c.3484G>T	c.(3484-3486)Gac>Tac	p.D1162Y	ATRN_ENST00000446916.2_Missense_Mutation_p.D1162Y	NM_139321.2	NP_647537.1	O75882	ATRN_HUMAN	attractin	1162					cerebellum development (GO:0021549)|inflammatory response (GO:0006954)|myelination (GO:0042552)|pigmentation (GO:0043473)|regulation of multicellular organism growth (GO:0040014)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			breast(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	59						TCTTCTTATTGACTATCAGTT	0.333																																																	0													161.0	152.0	155.0					20																	3578567		2203	4300	6503	SO:0001583	missense	0			AF034957	CCDS13053.1, CCDS13054.1	20p13	2008-07-02			ENSG00000088812	ENSG00000088812			885	protein-coding gene	gene with protein product	"""mahogany protein"""	603130				9736737, 8596018	Standard	NM_139321		Approved	DPPT-L, MGCA	uc002wim.2	O75882	OTTHUMG00000031746	ENST00000262919.5:c.3484G>T	20.37:g.3578567G>T	ENSP00000262919:p.Asp1162Tyr		A8KAE5|O60295|O95414|Q3MIT3|Q5TDA2|Q5TDA4|Q5VYW3|Q9NTQ3|Q9NTQ4|Q9NU01|Q9NZ57|Q9NZ58|Q9UC75|Q9UDF5	Missense_Mutation	SNP	pfam_Kelch_1,pfam_Plexin_repeat,pfam_CUB_dom,superfamily_C-type_lectin_fold,superfamily_CUB_dom,superfamily_Plexin-like_fold,smart_EG-like_dom,smart_CUB_dom,smart_Plexin-like_fold,smart_C-type_lectin,smart_EGF_laminin,pfscan_CUB_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_C-type_lectin	p.D1162Y	ENST00000262919.5	37	c.3484	CCDS13053.1	20	.	.	.	.	.	.	.	.	.	.	G	24.8	4.567741	0.86439	.	.	ENSG00000088812	ENST00000262919;ENST00000446916;ENST00000340500	T;T	0.51325	0.71;0.71	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.73233	0.3561	M	0.80332	2.49	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.977;0.999	T	0.74109	-0.3771	10	0.87932	D	0	-26.5239	20.4745	0.99168	0.0:0.0:1.0:0.0	.	1162;1162	O75882;O75882-2	ATRN_HUMAN;.	Y	1162;1162;1088	ENSP00000262919:D1162Y;ENSP00000416587:D1162Y	ENSP00000262919:D1162Y	D	+	1	0	ATRN	3526567	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.798000	0.99111	2.941000	0.99782	0.655000	0.94253	GAC	ATRN	-	NULL	ENSG00000088812		0.333	ATRN-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRN	HGNC	protein_coding	OTTHUMT00000077740.2		0.00	26	0	G	NM_139321		3578567	+1			no_errors	ENST00000262919	ensembl	human	known	74_37	missense	8.51	43	4	SNP	1.000	T
AXDND1	126859	genome.wustl.edu	37	1	179437745	179437745	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:179437745G>T	ENST00000367618.3	+	17	2353	c.1966G>T	c.(1966-1968)Gtt>Ttt	p.V656F	AXDND1_ENST00000461179.2_3'UTR|AXDND1_ENST00000457238.2_3'UTR	NM_144696.4	NP_653297.3	Q5T1B0	AXDN1_HUMAN	axonemal dynein light chain domain containing 1	656										NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(27)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	59						TACTGGTATTGTTCCACAGCA	0.343																																																	0													96.0	97.0	97.0					1																	179437745		2203	4300	6503	SO:0001583	missense	0			BX647935	CCDS30948.1	1q25.2	2011-02-18	2011-02-18	2011-02-18	ENSG00000162779	ENSG00000162779			26564	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 125"""	C1orf125		14702039	Standard	NM_144696		Approved	FLJ32940	uc001gmo.3	Q5T1B0	OTTHUMG00000035266	ENST00000367618.3:c.1966G>T	1.37:g.179437745G>T	ENSP00000356590:p.Val656Phe		Q6AWB2|Q96LJ3|Q96M01	Missense_Mutation	SNP	pfam_Axonemal_dynein_light_chain	p.V656F	ENST00000367618.3	37	c.1966	CCDS30948.1	1	.	.	.	.	.	.	.	.	.	.	G	15.71	2.914036	0.52546	.	.	ENSG00000162779	ENST00000367618;ENST00000360322;ENST00000434088	T;T	0.19105	2.17;2.18	4.42	3.48	0.39840	.	0.754534	0.12508	N	0.462759	T	0.36608	0.0973	M	0.64997	1.995	0.49051	D	0.999747	D;D	0.58268	0.965;0.982	P;P	0.58660	0.742;0.843	T	0.08249	-1.0731	10	0.52906	T	0.07	2.574	9.6875	0.40107	0.0:0.0:0.7932:0.2068	.	614;656	E9PCJ4;Q5T1B0	.;AXDN1_HUMAN	F	656;614;590	ENSP00000356590:V656F;ENSP00000391716:V590F	ENSP00000353471:V614F	V	+	1	0	AXDND1	177704368	0.096000	0.21769	0.566000	0.28421	0.012000	0.07955	1.792000	0.38754	1.407000	0.46875	0.655000	0.94253	GTT	AXDND1	-	NULL	ENSG00000162779		0.343	AXDND1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	AXDND1	HGNC	protein_coding	OTTHUMT00000085312.1	-	0.00	53	0	G	NM_144696		179437745	+1	tier1	-	no_errors	ENST00000367618	ensembl	human	known	74_37	missense	5.19	73	4	SNP	0.673	T
CMC1	152100	genome.wustl.edu	37	3	28364042	28364042	+	3'UTR	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr3:28364042G>T	ENST00000466830.1	+	0	3442				AZI2_ENST00000295748.3_5'UTR|AZI2_ENST00000479665.1_3'UTR	NM_182523.1	NP_872329.1	Q7Z7K0	COXM1_HUMAN	C-x(9)-C motif containing 1							mitochondrion (GO:0005739)	metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(3)	5						ATGAGAAATAGTTTTTGCTGC	0.343																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC052644	CCDS33722.1	3p24.1	2013-10-18	2013-10-18	2008-06-20	ENSG00000187118	ENSG00000187118			28783	protein-coding gene	gene with protein product		615166	"""chromosome 3 open reading frame 68"", ""COX assembly mitochondrial protein 1 homolog (S. cerevisiae)"""	C3orf68		18443040	Standard	NM_182523		Approved	MGC61571	uc003cea.3	Q7Z7K0	OTTHUMG00000155660	ENST00000466830.1:c.*2922G>T	3.37:g.28364042G>T			Q68DJ7	RNA	SNP	-	NULL	ENST00000466830.1	37	NULL	CCDS33722.1	3																																																																																			AZI2	-	-	ENSG00000163512		0.343	CMC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AZI2	HGNC	protein_coding	OTTHUMT00000341087.1	-	0.00	26	0	G	NM_182523		28364042	-1	tier1	-	no_errors	ENST00000295748	ensembl	human	known	74_37	rna	38.10	26	16	SNP	0.957	T
BAD	572	genome.wustl.edu	37	11	64044391	64044391	+	Intron	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr11:64044391C>A	ENST00000394532.3	-	2	458				BAD_ENST00000394531.3_Missense_Mutation_p.E104D|BAD_ENST00000309032.3_Intron|BAD_ENST00000544785.1_Intron	NM_004322.3	NP_004313.1	Q92934	BAD_HUMAN	BCL2-associated agonist of cell death						activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|ADP metabolic process (GO:0046031)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|ATP metabolic process (GO:0046034)|cellular process regulating host cell cycle in response to virus (GO:0060154)|cellular response to chromate (GO:0071247)|cellular response to hypoxia (GO:0071456)|cellular response to lipid (GO:0071396)|cellular response to mechanical stimulus (GO:0071260)|cellular response to nicotine (GO:0071316)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose catabolic process (GO:0006007)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|pore complex assembly (GO:0046931)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic process by virus (GO:0060139)|positive regulation of autophagy (GO:0010508)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of glucokinase activity (GO:0033133)|positive regulation of insulin secretion (GO:0032024)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane potential (GO:0010918)|positive regulation of neuron death (GO:1901216)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of proteolysis (GO:0045862)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of type B pancreatic cell development (GO:2000078)|regulation of mitochondrial membrane permeability (GO:0046902)|release of cytochrome c from mitochondria (GO:0001836)|response to amino acid (GO:0043200)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hydrogen peroxide (GO:0042542)|response to oleic acid (GO:0034201)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|suppression by virus of host apoptotic process (GO:0019050)|type B pancreatic cell proliferation (GO:0044342)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|lipid binding (GO:0008289)|phospholipid binding (GO:0005543)|protein kinase binding (GO:0019901)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(1)	4						GCTTTACATTCTCTGCGTGTT	0.612																																																	0													13.0	12.0	12.0					11																	64044391		873	1988	2861	SO:0001627	intron_variant	0			AF021792	CCDS8065.1	11q13.1	2014-03-07	2008-08-19		ENSG00000002330	ENSG00000002330			936	protein-coding gene	gene with protein product		603167				8929532	Standard	NM_004322		Approved	BCL2L8, BBC2	uc001nzd.3	Q92934	OTTHUMG00000134302	ENST00000394532.3:c.188-5116G>T	11.37:g.64044391C>A			O14803|Q6FH21	Missense_Mutation	SNP	pfam_Bcl-2_BAD	p.E104D	ENST00000394532.3	37	c.312	CCDS8065.1	11	.	.	.	.	.	.	.	.	.	.	C	9.047	0.991186	0.18966	.	.	ENSG00000002330	ENST00000394531	.	.	.	2.32	2.32	0.28847	.	.	.	.	.	T	0.32194	0.0821	.	.	.	0.24650	N	0.993522	B	0.31931	0.347	B	0.31751	0.135	T	0.29518	-1.0009	7	0.87932	D	0	.	8.2252	0.31564	0.0:1.0:0.0:0.0	.	104	A8MXU7	.	D	104	.	ENSP00000378039:E104D	E	-	3	2	BAD	63800967	0.001000	0.12720	0.027000	0.17364	0.324000	0.28378	0.279000	0.18771	1.619000	0.50296	0.313000	0.20887	GAG	BAD	-	NULL	ENSG00000002330		0.612	BAD-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BAD	HGNC	protein_coding	OTTHUMT00000259180.2	-	0.00	88	0	C	NM_032989		64044391	-1	tier1	-	no_errors	ENST00000394531	ensembl	human	putative	74_37	missense	33.00	67	33	SNP	0.031	A
BAG1	573	genome.wustl.edu	37	9	33256871	33256871	+	Silent	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr9:33256871G>T	ENST00000379704.2	-	5	901	c.468C>A	c.(466-468)ctC>ctA	p.L156L	BAG1_ENST00000467389.2_5'UTR|BAG1_ENST00000472232.3_Silent_p.L271L			Q99933	BAG1_HUMAN	BCL2-associated athanogene	271	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				apoptotic process (GO:0006915)|cell surface receptor signaling pathway (GO:0007166)|chaperone cofactor-dependent protein refolding (GO:0070389)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	receptor signaling protein activity (GO:0005057)			endometrium(1)|large_intestine(3)|lung(3)|ovary(1)	8			LUSC - Lung squamous cell carcinoma(29;0.00506)			CAAGTTTGCAGAGAGCTTCAG	0.438																																					GBM(77;1066 1502 5858 12192)												0													141.0	127.0	132.0					9																	33256871		2203	4300	6503	SO:0001819	synonymous_variant	0			AF022224	CCDS35004.1, CCDS55301.1	9p12	2010-12-09			ENSG00000107262	ENSG00000107262			937	protein-coding gene	gene with protein product		601497				7834747	Standard	NM_004323		Approved		uc003zsj.3	Q99933	OTTHUMG00000019766	ENST00000379704.2:c.468C>A	9.37:g.33256871G>T			O75315|Q14414|Q53H32|Q5VZE8|Q5VZE9|Q5VZF0|Q96TG2|Q9Y2V4	Silent	SNP	pfam_BAG_domain,pfam_Ubiquitin_dom,smart_Ubiquitin_dom,smart_BAG_domain,pfscan_BAG_domain,pfscan_Ubiquitin_supergroup	p.L271	ENST00000379704.2	37	c.813	CCDS55301.1	9																																																																																			BAG1	-	pfam_BAG_domain,smart_BAG_domain,pfscan_BAG_domain	ENSG00000107262		0.438	BAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAG1	HGNC	protein_coding	OTTHUMT00000052042.3	-	0.00	70	0	G	NM_004323		33256871	-1	tier1	-	no_errors	ENST00000472232	ensembl	human	known	74_37	silent	5.00	76	4	SNP	0.999	T
BAG2	9532	genome.wustl.edu	37	6	57037568	57037568	+	Missense_Mutation	SNP	T	T	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr6:57037568T>C	ENST00000370693.5	+	1	445	c.73T>C	c.(73-75)Tcc>Ccc	p.S25P	RP11-203B9.4_ENST00000586466.1_RNA|RP11-203B9.4_ENST00000586053.1_RNA|BAG2_ENST00000545080.1_5'Flank|RP11-203B9.4_ENST00000589549.1_RNA|RP11-203B9.4_ENST00000590164.1_RNA|RP11-203B9.4_ENST00000589394.1_RNA|RP11-203B9.4_ENST00000588811.1_RNA|RP11-203B9.4_ENST00000586432.1_RNA|RP11-203B9.4_ENST00000609545.1_RNA|RP11-203B9.4_ENST00000585414.1_RNA|RP11-203B9.4_ENST00000589312.1_RNA|RP11-203B9.4_ENST00000592785.1_RNA|RP11-203B9.4_ENST00000588819.1_RNA|RP11-203B9.4_ENST00000592500.1_RNA|RP11-203B9.4_ENST00000416069.2_RNA|RP11-203B9.4_ENST00000587815.1_RNA|RP11-203B9.4_ENST00000591553.1_RNA|RP11-203B9.4_ENST00000589263.1_RNA|RP11-203B9.4_ENST00000592038.1_RNA|RP11-203B9.4_ENST00000585792.1_RNA|RP11-203B9.4_ENST00000586234.1_RNA|RP11-203B9.4_ENST00000586668.1_RNA	NM_004282.3	NP_004273.1	O95816	BAG2_HUMAN	BCL2-associated athanogene 2	25					protein folding (GO:0006457)|protein metabolic process (GO:0019538)		identical protein binding (GO:0042802)			endometrium(1)|large_intestine(1)	2	Lung NSC(77;0.126)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			GGCTGACCGCTCCAGCCGCCT	0.697																																																	0													20.0	18.0	19.0					6																	57037568		2200	4296	6496	SO:0001583	missense	0			AF095192	CCDS4961.1	6p12.3-p11.2	2008-02-05			ENSG00000112208	ENSG00000112208			938	protein-coding gene	gene with protein product		603882				9873016	Standard	NM_004282		Approved		uc003pdr.3	O95816	OTTHUMG00000014919	ENST00000370693.5:c.73T>C	6.37:g.57037568T>C	ENSP00000359727:p.Ser25Pro		B4DXE2|Q08AS9|Q6FID0	Missense_Mutation	SNP	pfam_BAG_domain,smart_BAG_domain,pfscan_BAG_domain	p.S25P	ENST00000370693.5	37	c.73	CCDS4961.1	6	.	.	.	.	.	.	.	.	.	.	T	25.1	4.605081	0.87157	.	.	ENSG00000112208	ENST00000370693	.	.	.	4.89	2.49	0.30216	.	0.112007	0.64402	N	0.000006	T	0.49932	0.1586	M	0.69823	2.125	0.80722	D	1	D	0.56521	0.976	P	0.51016	0.656	T	0.53753	-0.8394	9	0.66056	D	0.02	-6.6833	8.8188	0.35011	0.0:0.1556:0.0:0.8444	.	25	O95816	BAG2_HUMAN	P	25	.	ENSP00000359727:S25P	S	+	1	0	BAG2	57145527	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	5.622000	0.67750	0.232000	0.21100	0.383000	0.25322	TCC	BAG2	-	NULL	ENSG00000112208		0.697	BAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAG2	HGNC	protein_coding	OTTHUMT00000041044.2	-	0.00	111	0	T			57037568	+1	tier1	-	no_errors	ENST00000370693	ensembl	human	known	74_37	missense	56.18	39	50	SNP	1.000	C
BANP	54971	genome.wustl.edu	37	16	88037956	88037956	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr16:88037956G>T	ENST00000393207.1	+	5	615	c.394G>T	c.(394-396)Gcc>Tcc	p.A132S	BANP_ENST00000286122.7_Missense_Mutation_p.A132S|BANP_ENST00000479780.2_Intron|BANP_ENST00000393208.2_Intron|BANP_ENST00000355163.5_Intron|BANP_ENST00000538234.1_Missense_Mutation_p.A140S|BANP_ENST00000355022.4_Intron	NM_001173543.1	NP_001167014.1	Q8N9N5	BANP_HUMAN	BTG3 associated nuclear protein	132					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|multicellular organismal development (GO:0007275)|negative regulation of protein catabolic process (GO:0042177)|protein localization to nucleus (GO:0034504)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|endometrium(2)|large_intestine(3)|lung(5)|prostate(1)	12				BRCA - Breast invasive adenocarcinoma(80;0.00551)		CGCCATTGTAGCCAAGATGGA	0.488																																																	0																																										SO:0001583	missense	0			AK094158	CCDS10966.2, CCDS42215.1, CCDS54052.1, CCDS54053.1, CCDS54054.1	16q24	2012-11-22			ENSG00000172530	ENSG00000172530		"""BEN domain containing"""	13450	protein-coding gene	gene with protein product	"""BEN domain containing 1"""	611564				10940556, 10950932	Standard	NM_017869		Approved	SMARBP1, SMAR1, FLJ20538, DKFZp761H172, FLJ10177, BEND1	uc010vow.2	Q8N9N5	OTTHUMG00000137678	ENST00000393207.1:c.394G>T	16.37:g.88037956G>T	ENSP00000376902:p.Ala132Ser		A8MU25|A8MX25|B2RCF7|B4DNJ9|F5GZM0|Q96GJ7|Q9NWY1	Missense_Mutation	SNP	pfam_BEN_domain	p.A132S	ENST00000393207.1	37	c.394	CCDS54054.1	16	.	.	.	.	.	.	.	.	.	.	G	20.4	3.979173	0.74360	.	.	ENSG00000172530	ENST00000286122;ENST00000538234;ENST00000393207	T;T;T	0.39997	1.05;1.05;1.05	5.93	5.93	0.95920	.	0.217217	0.39985	N	0.001205	T	0.24509	0.0594	N	0.14661	0.345	0.39395	D	0.966497	B;B	0.34372	0.243;0.451	B;B	0.31869	0.097;0.137	T	0.14090	-1.0485	10	0.15499	T	0.54	.	12.6066	0.56527	0.075:0.0:0.925:0.0	.	140;132	B4DE54;Q8N9N5	.;BANP_HUMAN	S	132;140;132	ENSP00000286122:A132S;ENSP00000444352:A140S;ENSP00000376902:A132S	ENSP00000286122:A132S	A	+	1	0	BANP	86595457	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.012000	0.64017	2.797000	0.96272	0.655000	0.94253	GCC	BANP	-	NULL	ENSG00000172530		0.488	BANP-002	KNOWN	basic|CCDS	protein_coding	BANP	HGNC	protein_coding	OTTHUMT00000269166.1	-	0.00	76	0	G	NM_017869		88037956	+1	tier1	-	no_errors	ENST00000286122	ensembl	human	known	74_37	missense	5.43	87	5	SNP	1.000	T
BBS7	55212	genome.wustl.edu	37	4	122756435	122756435	+	Missense_Mutation	SNP	G	G	T	rs150743868	byFrequency	TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr4:122756435G>T	ENST00000264499.4	-	14	1558	c.1375C>A	c.(1375-1377)Cgc>Agc	p.R459S	BBS7_ENST00000506636.1_Missense_Mutation_p.R459S	NM_176824.2	NP_789794.1	Q8IWZ6	BBS7_HUMAN	Bardet-Biedl syndrome 7	459					brain development (GO:0007420)|cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|digestive tract morphogenesis (GO:0048546)|eye development (GO:0001654)|fat cell differentiation (GO:0045444)|heart looping (GO:0001947)|limb development (GO:0060173)|melanosome transport (GO:0032402)|nonmotile primary cilium assembly (GO:0035058)|palate development (GO:0060021)|pigment granule aggregation in cell center (GO:0051877)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein transport (GO:0015031)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smoothened signaling pathway (GO:0007224)|visual perception (GO:0007601)	axoneme (GO:0005930)|BBSome (GO:0034464)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(2)|prostate(1)|skin(2)	30						TCAATTGAGCGAATCTGATTC	0.358									Bardet-Biedl syndrome																																								0													157.0	142.0	147.0					4																	122756435		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AF521644	CCDS3724.1, CCDS54799.1	4q27	2013-01-08			ENSG00000138686	ENSG00000138686			18758	protein-coding gene	gene with protein product		607590					Standard	NM_176824		Approved	FLJ10715, BBS2L1	uc003ied.3	Q8IWZ6	OTTHUMG00000133076	ENST00000264499.4:c.1375C>A	4.37:g.122756435G>T	ENSP00000264499:p.Arg459Ser		Q4W5P8|Q8N581|Q9NVI4	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,pirsf_Bardet-Biedl_syndrome_7_prot	p.R459S	ENST00000264499.4	37	c.1375	CCDS3724.1	4	.	.	.	.	.	.	.	.	.	.	G	22.6	4.306029	0.81247	.	.	ENSG00000138686	ENST00000264499;ENST00000506636	T;T	0.76060	-0.99;-0.99	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	D	0.88262	0.6389	M	0.88241	2.94	0.80722	D	1	D	0.71674	0.998	D	0.70935	0.971	D	0.87885	0.2680	10	0.37606	T	0.19	-9.2483	19.2795	0.94046	0.0:0.0:1.0:0.0	.	459	Q8IWZ6	BBS7_HUMAN	S	459	ENSP00000264499:R459S;ENSP00000423626:R459S	ENSP00000264499:R459S	R	-	1	0	BBS7	122975885	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.005000	0.70716	2.549000	0.85964	0.650000	0.86243	CGC	BBS7	-	pirsf_Bardet-Biedl_syndrome_7_prot	ENSG00000138686		0.358	BBS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BBS7	HGNC	protein_coding	OTTHUMT00000256716.1		0.00	53	0	G			122756435	-1			no_errors	ENST00000264499	ensembl	human	known	74_37	missense	5.26	54	3	SNP	1.000	T
BCAS4	55653	genome.wustl.edu	37	20	49446909	49446909	+	Missense_Mutation	SNP	C	C	G			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr20:49446909C>G	ENST00000358791.5	+	3	446	c.346C>G	c.(346-348)Cgg>Ggg	p.R116G	BCAS4_ENST00000262591.5_Missense_Mutation_p.R116G|BCAS4_ENST00000485049.1_3'UTR|BCAS4_ENST00000609336.1_Missense_Mutation_p.R86G|BCAS4_ENST00000371608.2_Missense_Mutation_p.R116G	NM_017843.3	NP_060313.3	Q8TDM0	BCAS4_HUMAN	breast carcinoma amplified sequence 4	116						cytoplasm (GO:0005737)				large_intestine(2)|lung(2)|pancreas(1)|upper_aerodigestive_tract(1)	6						CAAAGTGGACCGGCTAGAGGT	0.502																																																	0													136.0	109.0	118.0					20																	49446909		2203	4300	6503	SO:0001583	missense	0			AK000502	CCDS13432.2, CCDS33487.1	20q13	2008-07-03			ENSG00000124243	ENSG00000124243			14367	protein-coding gene	gene with protein product		607471				12378525	Standard	NM_001010974		Approved	FLJ20495, CNOL	uc002xvq.3	Q8TDM0	OTTHUMG00000032735	ENST00000358791.5:c.346C>G	20.37:g.49446909C>G	ENSP00000351642:p.Arg116Gly		Q5TD52|Q5TD53|Q5TD54|Q5U5K7|Q5XKE8|Q8IXI7|Q8NEZ6|Q8TDL9|Q9NX13|Q9Y511	Missense_Mutation	SNP	NULL	p.R116G	ENST00000358791.5	37	c.346	CCDS33487.1	20	.	.	.	.	.	.	.	.	.	.	C	13.33	2.204441	0.38905	.	.	ENSG00000124243	ENST00000358791;ENST00000262591;ENST00000355583;ENST00000371608	T;T;T	0.48201	1.85;0.87;0.82	5.52	4.52	0.55395	.	0.616213	0.15427	N	0.262895	T	0.39517	0.1081	L	0.32530	0.975	0.24761	N	0.992925	P;P;P;P	0.47191	0.761;0.761;0.891;0.491	B;B;B;B	0.43754	0.338;0.202;0.43;0.202	T	0.31641	-0.9936	10	0.62326	D	0.03	-16.9791	9.9024	0.41355	0.2529:0.7471:0.0:0.0	.	116;116;116;116	Q8TDM0-2;Q8TDM0-3;Q8TDM0;F8WE92	.;.;BCAS4_HUMAN;.	G	116	ENSP00000351642:R116G;ENSP00000262591:R116G;ENSP00000360669:R116G	ENSP00000262591:R116G	R	+	1	2	BCAS4	48880316	0.969000	0.33509	0.970000	0.41538	0.514000	0.34195	2.360000	0.44151	2.597000	0.87782	0.655000	0.94253	CGG	BCAS4	-	NULL	ENSG00000124243		0.502	BCAS4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCAS4	HGNC	protein_coding	OTTHUMT00000079700.1	-	0.00	89	0	C	NM_017843		49446909	+1	tier1	-	no_errors	ENST00000358791	ensembl	human	known	74_37	missense	9.21	137	14	SNP	0.932	G
BEND6	221336	genome.wustl.edu	37	6	56880028	56880028	+	Silent	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr6:56880028C>A	ENST00000370746.3	+	4	665	c.396C>A	c.(394-396)ctC>ctA	p.L132L	BEND6_ENST00000370750.2_3'UTR|BEND6_ENST00000545789.1_Silent_p.L34L|BEND6_ENST00000484701.1_3'UTR	NM_152731.2	NP_689944.2	Q5SZJ8	BEND6_HUMAN	BEN domain containing 6	132					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)		RNA polymerase II transcription corepressor activity (GO:0001106)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)	17						CATCCACCCTCTGGAGAGCAA	0.473																																																	0													129.0	128.0	128.0					6																	56880028		1942	4134	6076	SO:0001819	synonymous_variant	0			AK054724	CCDS43476.1	6p12.1	2012-11-22	2008-10-03	2008-10-03	ENSG00000151917	ENSG00000151917		"""BEN domain containing"""	20871	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 65"""	C6orf65			Standard	NM_152731		Approved	FLJ30162, bA203B9.1	uc010kab.3	Q5SZJ8	OTTHUMG00000014914	ENST00000370746.3:c.396C>A	6.37:g.56880028C>A			Q4G0W8|Q8N662|Q96NS6	Silent	SNP	pfam_BEN_domain	p.L132	ENST00000370746.3	37	c.396	CCDS43476.1	6																																																																																			BEND6	-	NULL	ENSG00000151917		0.473	BEND6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	BEND6	HGNC	protein_coding	OTTHUMT00000041032.4	-	0.00	49	0	C	NM_152731		56880028	+1	tier1	-	no_errors	ENST00000370746	ensembl	human	known	74_37	silent	20.16	102	26	SNP	1.000	A
BMP15	9210	genome.wustl.edu	37	X	50659505	50659505	+	Silent	SNP	G	G	A	rs147148606	byFrequency	TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chrX:50659505G>A	ENST00000252677.3	+	2	1077	c.1077G>A	c.(1075-1077)ccG>ccA	p.P359P		NM_005448.2	NP_005439.2	O95972	BMP15_HUMAN	bone morphogenetic protein 15	359					female gamete generation (GO:0007292)|granulosa cell development (GO:0060016)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)				NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|skin(1)	26	Ovarian(276;0.236)					CCTGTGTCCCGTATAAGTATG	0.458																																																	0								G		1,3834		0,1,1631,571	89.0	81.0	84.0		1077	2.0	1.0	X	dbSNP_134	84	1,6726		0,1,2427,1871	no	coding-synonymous	BMP15	NM_005448.2		0,2,4058,2442	AA,AG,GG,G		0.0149,0.0261,0.0189		359/393	50659505	2,10560	2203	4299	6502	SO:0001819	synonymous_variant	0			AF082349	CCDS14334.1	Xp11.2	2013-02-06			ENSG00000130385	ENSG00000130385		"""Bone morphogenetic proteins"""	1068	protein-coding gene	gene with protein product		300247				9849956	Standard	NM_005448		Approved	GDF9B	uc011mnw.2	O95972	OTTHUMG00000021525	ENST00000252677.3:c.1077G>A	X.37:g.50659505G>A			Q17RM6|Q5JST1|Q9UMS1	Silent	SNP	pfam_TGF-b_C,smart_TGF-b_C,prints_Inhibin_asu	p.P359	ENST00000252677.3	37	c.1077	CCDS14334.1	X																																																																																			BMP15	-	pfam_TGF-b_C,smart_TGF-b_C	ENSG00000130385		0.458	BMP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP15	HGNC	protein_coding	OTTHUMT00000056572.1	-	0.00	24	0	G	NM_005448		50659505	+1	tier1	rs147148606	no_errors	ENST00000252677	ensembl	human	known	74_37	silent	20.59	27	7	SNP	0.959	A
BMS1	9790	genome.wustl.edu	37	10	43292424	43292424	+	Missense_Mutation	SNP	G	G	T	rs375201810		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr10:43292424G>T	ENST00000374518.5	+	10	1795	c.1732G>T	c.(1732-1734)Gat>Tat	p.D578Y		NM_014753.3	NP_055568.3	Q14692	BMS1_HUMAN	BMS1 ribosome biogenesis factor	578					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(23)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						CCCCACTTTCGATTCTGGGCA	0.468																																																	0													85.0	81.0	82.0					10																	43292424		2203	4300	6503	SO:0001583	missense	0			BC043345	CCDS7199.1	10q11.21	2013-05-01	2013-05-01	2007-03-20	ENSG00000165733	ENSG00000165733			23505	protein-coding gene	gene with protein product		611448	"""BMS1-like, ribosome assembly protein (yeast)"", ""BMS1 homolog, ribosome assembly protein (yeast)"""	BMS1L		11779832	Standard	NM_014753		Approved	KIAA0187	uc001jaj.3	Q14692	OTTHUMG00000018020	ENST00000374518.5:c.1732G>T	10.37:g.43292424G>T	ENSP00000363642:p.Asp578Tyr		Q5QPT5|Q86XJ9	Missense_Mutation	SNP	pfam_BMS1_TSR1_C,pfam_AARP2CN,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_AARP2CN	p.D578Y	ENST00000374518.5	37	c.1732	CCDS7199.1	10	.	.	.	.	.	.	.	.	.	.	g	14.86	2.661979	0.47572	.	.	ENSG00000165733	ENST00000374518	T	0.27256	1.68	4.79	4.79	0.61399	.	0.196868	0.43579	D	0.000548	T	0.43456	0.1248	L	0.36672	1.1	0.49582	D	0.999803	D	0.89917	1.0	D	0.91635	0.999	T	0.41342	-0.9514	10	0.72032	D	0.01	.	18.2534	0.90011	0.0:0.0:1.0:0.0	.	578	Q14692	BMS1_HUMAN	Y	578	ENSP00000363642:D578Y	ENSP00000363642:D578Y	D	+	1	0	BMS1	42612430	1.000000	0.71417	1.000000	0.80357	0.026000	0.11368	5.862000	0.69560	2.381000	0.81170	0.549000	0.68633	GAT	BMS1	-	superfamily_P-loop_NTPase	ENSG00000165733		0.468	BMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMS1	HGNC	protein_coding	OTTHUMT00000047690.2		0.00	55	0	G	NM_014753		43292424	+1			no_errors	ENST00000374518	ensembl	human	known	74_37	missense	6.35	59	4	SNP	1.000	T
BMPR1A	657	genome.wustl.edu	37	10	88649838	88649838	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr10:88649838G>T	ENST00000372037.3	+	4	624	c.87G>T	c.(85-87)atG>atT	p.M29I	BMPR1A_ENST00000480152.1_3'UTR|RNU1-19P_ENST00000363306.1_RNA	NM_004329.2	NP_004320.2	P36894	BMR1A_HUMAN	bone morphogenetic protein receptor, type IA	29					BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|developmental growth (GO:0048589)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic digit morphogenesis (GO:0042733)|embryonic organ development (GO:0048568)|endocardial cushion formation (GO:0003272)|heart formation (GO:0060914)|hindlimb morphogenesis (GO:0035137)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|lateral mesoderm development (GO:0048368)|lung development (GO:0030324)|mesendoderm development (GO:0048382)|mesoderm formation (GO:0001707)|Mullerian duct regression (GO:0001880)|negative regulation of neurogenesis (GO:0050768)|neural crest cell development (GO:0014032)|neural plate mediolateral regionalization (GO:0021998)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|paraxial mesoderm structural organization (GO:0048352)|pituitary gland development (GO:0021983)|positive regulation of bone mineralization (GO:0030501)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of lateral mesodermal cell fate specification (GO:0048378)|somitogenesis (GO:0001756)|stem cell maintenance (GO:0019827)|transforming growth factor beta receptor signaling pathway (GO:0007179)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|SMAD binding (GO:0046332)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|skin(1)|stomach(1)	24						TGGATAGTATGCTTCATGGCA	0.363			"""Mis, N, F"""			gastrointestinal polyps			Juvenile Polyposis;Hereditary Mixed Polyposis syndrome type 2																												Ovarian(190;603 2086 22044 30335 47971)		yes	Rec		Juvenile polyposis	10	10q22.3	657	"""bone morphogenetic protein receptor, type IA"""		E	0													101.0	96.0	98.0					10																	88649838		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	incl.: Juvenile Polyposis of the Stomach;HMPS2	BC028383	CCDS7378.1	10q22.3	2014-09-17			ENSG00000107779	ENSG00000107779		"""CD molecules"""	1076	protein-coding gene	gene with protein product		601299		ACVRLK3		8397373, 9730621	Standard	NM_004329		Approved	ALK3, CD292	uc001kdy.3	P36894	OTTHUMG00000018657	ENST00000372037.3:c.87G>T	10.37:g.88649838G>T	ENSP00000361107:p.Met29Ile		A8K6U9|Q8NEN8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_TGF_beta_rcpt_GS,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_TGF_beta_rcpt_GS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.M29I	ENST00000372037.3	37	c.87	CCDS7378.1	10	.	.	.	.	.	.	.	.	.	.	G	15.14	2.744820	0.49151	.	.	ENSG00000107779	ENST00000224764;ENST00000372037	D	0.82433	-1.61	6.01	2.97	0.34412	.	0.450080	0.28778	N	0.014172	T	0.73094	0.3543	L	0.27053	0.805	0.44181	D	0.996993	B	0.14012	0.009	B	0.14023	0.01	T	0.72214	-0.4358	10	0.62326	D	0.03	.	12.879	0.58006	0.0:0.1094:0.6649:0.2257	.	29	P36894	BMR1A_HUMAN	I	29	ENSP00000361107:M29I	ENSP00000224764:M29I	M	+	3	0	BMPR1A	88639818	1.000000	0.71417	0.999000	0.59377	0.968000	0.65278	2.480000	0.45206	1.506000	0.48736	0.650000	0.86243	ATG	BMPR1A	-	NULL	ENSG00000107779		0.363	BMPR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMPR1A	HGNC	protein_coding	OTTHUMT00000049170.3	-	0.00	51	0	G	NM_004329		88649838	+1	tier1	-	no_errors	ENST00000372037	ensembl	human	known	74_37	missense	6.10	77	5	SNP	1.000	T
BOC	91653	genome.wustl.edu	37	3	112997020	112997020	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr3:112997020G>T	ENST00000495514.1	+	10	2322	c.1618G>T	c.(1618-1620)Gac>Tac	p.D540Y	BOC_ENST00000273395.4_Missense_Mutation_p.D541Y|BOC_ENST00000355385.3_Missense_Mutation_p.D540Y|BOC_ENST00000497495.1_3'UTR			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated	540	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			CACCAGACTTGACCCCGGGAG	0.542																																																	0													146.0	135.0	139.0					3																	112997020		2203	4300	6503	SO:0001583	missense	0			AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.1618G>T	3.37:g.112997020G>T	ENSP00000418663:p.Asp540Tyr		A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.D541Y	ENST00000495514.1	37	c.1621	CCDS2971.1	3	.	.	.	.	.	.	.	.	.	.	G	21.2	4.118375	0.77323	.	.	ENSG00000144857	ENST00000495514;ENST00000273395;ENST00000355385	T;T;T	0.57273	0.41;0.41;0.41	5.8	5.8	0.92144	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.107759	0.64402	D	0.000006	T	0.64416	0.2596	L	0.50333	1.59	0.58432	D	0.99999	P;P	0.42248	0.732;0.774	P;P	0.52159	0.459;0.691	T	0.64223	-0.6458	10	0.72032	D	0.01	.	20.0466	0.97609	0.0:0.0:1.0:0.0	.	541;540	Q9BWV1-3;Q9BWV1	.;BOC_HUMAN	Y	540;541;540	ENSP00000418663:D540Y;ENSP00000273395:D541Y;ENSP00000347546:D540Y	ENSP00000273395:D541Y	D	+	1	0	BOC	114479710	1.000000	0.71417	0.967000	0.41034	0.760000	0.43138	6.938000	0.75904	2.729000	0.93468	0.563000	0.77884	GAC	BOC	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000144857		0.542	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	BOC	HGNC	protein_coding	OTTHUMT00000354485.3		0.00	61	0	G	NM_033254		112997020	+1			no_errors	ENST00000273395	ensembl	human	known	74_37	missense	5.13	74	4	SNP	1.000	T
BRD7	29117	genome.wustl.edu	37	16	50402730	50402730	+	5'UTR	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr16:50402730C>A	ENST00000394688.3	-	0	115				RP11-21B23.1_ENST00000568427.1_RNA|BRD7_ENST00000394689.2_5'Flank|BRD7_ENST00000401491.3_5'UTR			Q9NPI1	BRD7_HUMAN	bromodomain containing 7						cell cycle (GO:0007049)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|prostate(2)|urinary_tract(2)	22		all_cancers(37;0.0127)				aggcccaggccgtgcggcgcc	0.781																																																	0													10.0	10.0	10.0					16																	50402730		2101	4025	6126	SO:0001623	5_prime_UTR_variant	0			AF213969	CCDS10742.1, CCDS54007.1	16q12.1	2008-11-18	2002-01-14		ENSG00000166164	ENSG00000166164			14310	protein-coding gene	gene with protein product			"""bromodomain-containing 7"""			10526152, 18809673	Standard	NM_013263		Approved	CELTIX1, BP75	uc002ege.2	Q9NPI1	OTTHUMG00000133170	ENST00000394688.3:c.-45G>T	16.37:g.50402730C>A			Q4VC09|Q8N2L9|Q96KA4|Q9BV48|Q9UH59	RNA	SNP	-	NULL	ENST00000394688.3	37	NULL	CCDS10742.1	16																																																																																			BRD7	-	-	ENSG00000166164		0.781	BRD7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	BRD7	HGNC	protein_coding	OTTHUMT00000256874.3	-	0.00	27	0	C	NM_013263		50402730	-1	tier1	-	no_errors	ENST00000401491	ensembl	human	known	74_37	rna	13.79	25	4	SNP	0.993	A
BTK	695	genome.wustl.edu	37	X	100611043	100611043	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chrX:100611043G>T	ENST00000308731.7	-	15	1726	c.1563C>A	c.(1561-1563)gaC>gaA	p.D521E	BTK_ENST00000372880.1_Intron	NM_000061.2	NP_000052.1	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase	521	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		D -> G (in XLA). {ECO:0000269|PubMed:9445504}.|D -> H (in XLA; severe). {ECO:0000269|PubMed:8695804}.|D -> N (in XLA; severe).		adaptive immune response (GO:0002250)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|calcium-mediated signaling (GO:0019722)|cell maturation (GO:0048469)|Fc-epsilon receptor signaling pathway (GO:0038095)|histamine secretion by mast cell (GO:0002553)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell cytokine production (GO:0002721)|response to organic substance (GO:0010033)|response to reactive oxygen species (GO:0000302)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein tyrosine kinase activity (GO:0004713)			breast(4)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(25)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						GTCCCACCAGGTCTCGGTGAA	0.537									Agammaglobulinemia, X-linked																																								0													138.0	117.0	124.0					X																	100611043		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Bruton Type Agammaglobulinemia	AK057105	CCDS14482.1, CCDS76002.1, CCDS76003.1	Xq21.33-q22	2014-09-17			ENSG00000010671	ENSG00000010671	2.7.10.1	"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1133	protein-coding gene	gene with protein product		300300		AGMX1, IMD1		8380905	Standard	NM_000061		Approved	ATK, XLA, PSCTK1	uc004ehg.2	Q06187	OTTHUMG00000022022	ENST00000308731.7:c.1563C>A	X.37:g.100611043G>T	ENSP00000308176:p.Asp521Glu		B2RAW1|Q32ML5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_SH3_domain,pfam_Znf_Btk_motif,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_Znf_Btk_motif,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Znf_Btk_motif,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,prints_SH2,prints_Znf_Btk_motif	p.D521E	ENST00000308731.7	37	c.1563	CCDS14482.1	X	.	.	.	.	.	.	.	.	.	.	G	17.77	3.470102	0.63625	.	.	ENSG00000010671	ENST00000372855;ENST00000443591;ENST00000308731	D	0.96334	-3.98	5.49	1.18	0.20946	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.98874	0.9619	H	0.99609	4.655	0.80722	D	1	D;D;D;D	0.89917	0.994;0.999;1.0;0.999	D;D;D;D	0.97110	0.967;0.995;1.0;0.997	D	0.97740	1.0208	10	0.87932	D	0	.	10.956	0.47358	0.3235:0.0:0.6765:0.0	.	192;192;521;521	Q3MS94;Q3MS96;B2RAW1;Q06187	.;.;.;BTK_HUMAN	E	70;192;521	ENSP00000308176:D521E	ENSP00000308176:D521E	D	-	3	2	BTK	100497699	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	3.492000	0.53259	0.156000	0.19299	-0.191000	0.12829	GAC	BTK	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	ENSG00000010671		0.537	BTK-006	KNOWN	basic|appris_principal|CCDS	protein_coding	BTK	HGNC	protein_coding	OTTHUMT00000057532.2		0.00	44	0	G	NM_000061		100611043	-1			no_errors	ENST00000308731	ensembl	human	known	74_37	missense	5.97	62	4	SNP	1.000	T
BTN2A1	11120	genome.wustl.edu	37	6	26466201	26466201	+	Splice_Site	SNP	C	C	T	rs552017766		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr6:26466201C>T	ENST00000312541.5	+	6	1203	c.955C>T	c.(955-957)Cga>Tga	p.R319*	BTN2A1_ENST00000469185.1_Splice_Site_p.R319*|BTN2A1_ENST00000429381.1_Splice_Site_p.R319*|BTN2A1_ENST00000541522.1_Splice_Site_p.R258*	NM_007049.3|NM_078476.2	NP_008980.1|NP_510961.1	Q7KYR7	BT2A1_HUMAN	butyrophilin, subfamily 2, member A1	319	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				lipid metabolic process (GO:0006629)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)		p.R319*(1)|p.R305*(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)|skin(3)|urinary_tract(3)	27						AGAAGAATTGCGTAAGTTTAG	0.373																																																	2	Substitution - Nonsense(2)	endometrium(2)											203.0	183.0	190.0					6																	26466201		2203	4300	6503	SO:0001630	splice_region_variant	0			U90543	CCDS4613.1, CCDS47390.1, CCDS56404.1, CCDS56405.1	6p22.1	2014-01-14			ENSG00000112763	ENSG00000112763		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1136	protein-coding gene	gene with protein product		613590				9382921, 9149941	Standard	NM_007049		Approved	BT2.1, BTF1, BTN2.1	uc003nib.2	Q7KYR7	OTTHUMG00000014457	ENST00000312541.5:c.955+1C>T	6.37:g.26466201C>T			B4DLP9|E9PGR4|O00475|P78408|Q59EN4|Q7KYQ7|Q7Z386|Q96AV7|Q9NU62	Nonsense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Ig_V-set,pfam_CD80_C2-set,superfamily_ConA-like_lec_gl_sf,smart_Ig_sub,smart_Ig_V-set_subgr,smart_PRY,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Ig-like_dom	p.R319*	ENST00000312541.5	37	c.955	CCDS4613.1	6	.	.	.	.	.	.	.	.	.	.	C	18.07	3.541175	0.65085	.	.	ENSG00000112763	ENST00000312541;ENST00000541522;ENST00000429381;ENST00000265424;ENST00000469185	.	.	.	3.84	-2.23	0.06930	.	1.164090	0.06577	N	0.749545	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	.	2.4458	0.04506	0.4684:0.2767:0.1535:0.1013	.	.	.	.	X	319;258;319;305;319	.	ENSP00000265424:R305X	R	+	1	2	BTN2A1	26574180	0.092000	0.21681	0.920000	0.36463	0.027000	0.11550	-0.333000	0.07894	-0.245000	0.09625	-0.448000	0.05591	CGA	BTN2A1	-	superfamily_ConA-like_lec_gl_sf,pfscan_B30.2/SPRY	ENSG00000112763		0.373	BTN2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTN2A1	HGNC	protein_coding	OTTHUMT00000040122.2	-	0.00	81	0	C	NM_007049	Nonsense_Mutation	26466201	+1	tier1	-	no_errors	ENST00000312541	ensembl	human	known	74_37	nonsense	39.66	70	46	SNP	0.869	T
C10orf71	118461	genome.wustl.edu	37	10	50533993	50533993	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr10:50533993C>T	ENST00000374144.3	+	3	3691	c.3403C>T	c.(3403-3405)Cgg>Tgg	p.R1135W	C10orf71_ENST00000323868.4_Intron			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	1135										endometrium(1)	1						AGAAGACCTCCGGACCCTCTC	0.637																																																	0													26.0	32.0	30.0					10																	50533993		692	1591	2283	SO:0001583	missense	0			AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.3403C>T	10.37:g.50533993C>T	ENSP00000363259:p.Arg1135Trp		A0AVL8	Missense_Mutation	SNP	NULL	p.R1135W	ENST00000374144.3	37	c.3403	CCDS44387.1	10	.	.	.	.	.	.	.	.	.	.	C	16.90	3.250046	0.59212	.	.	ENSG00000177354	ENST00000374144	T	0.05319	3.46	5.35	0.364	0.16124	.	0.177419	0.26669	N	0.023117	T	0.07188	0.0182	L	0.32530	0.975	0.09310	N	0.999994	.	.	.	.	.	.	T	0.22765	-1.0207	8	0.51188	T	0.08	.	10.5223	0.44927	0.4187:0.4913:0.0:0.09	.	.	.	.	W	1135	ENSP00000363259:R1135W	ENSP00000363259:R1135W	R	+	1	2	C10orf71	50203999	0.000000	0.05858	0.024000	0.17045	0.172000	0.22775	-0.013000	0.12678	-0.156000	0.11079	0.491000	0.48974	CGG	C10orf71	-	NULL	ENSG00000177354		0.637	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C10orf71	HGNC	protein_coding	OTTHUMT00000047984.2	-	0.00	91	0	C	NM_199459		50533993	+1	tier1	-	no_errors	ENST00000374144	ensembl	human	known	74_37	missense	35.56	28	16	SNP	0.000	T
C12orf40	283461	genome.wustl.edu	37	12	40076539	40076539	+	Silent	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr12:40076539G>T	ENST00000324616.5	+	8	967	c.813G>T	c.(811-813)ggG>ggT	p.G271G	C12orf40_ENST00000405531.3_Silent_p.G271G|C12orf40_ENST00000398716.1_Silent_p.G194G	NM_001031748.2	NP_001026918.2	Q86WS4	CL040_HUMAN	chromosome 12 open reading frame 40	271										breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(6)|prostate(1)|skin(2)	38						ATATTTGGGGGAAAAATGGAA	0.353																																																	0																																										SO:0001819	synonymous_variant	0			AK097445	CCDS41770.1	12q12	2008-08-04			ENSG00000180116	ENSG00000180116			26846	protein-coding gene	gene with protein product						12477932	Standard	XM_005268806		Approved	FLJ40126	uc001rmc.3	Q86WS4	OTTHUMG00000133567	ENST00000324616.5:c.813G>T	12.37:g.40076539G>T			B7WNU1|Q8IXY6|Q8N818|V9HW02	Silent	SNP	NULL	p.G271	ENST00000324616.5	37	c.813	CCDS41770.1	12																																																																																			C12orf40	-	NULL	ENSG00000180116		0.353	C12orf40-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf40	HGNC	protein_coding	OTTHUMT00000257664.2	-	0.00	51	0	G	NM_173599		40076539	+1	tier1	-	no_errors	ENST00000324616	ensembl	human	known	74_37	silent	10.42	43	5	SNP	0.002	T
C16orf78	123970	genome.wustl.edu	37	16	49407984	49407984	+	Missense_Mutation	SNP	A	A	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr16:49407984A>C	ENST00000299191.3	+	1	251	c.134A>C	c.(133-135)aAg>aCg	p.K45T		NM_144602.2	NP_653203.1	Q8WTQ4	CP078_HUMAN	chromosome 16 open reading frame 78	45						nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|upper_aerodigestive_tract(1)	22						CAGGGGAAGAAGAAACAAGCT	0.512																																																	0													74.0	71.0	72.0					16																	49407984		2199	4300	6499	SO:0001583	missense	0			BC021181	CCDS10738.1	16q12.1	2008-02-05			ENSG00000166152	ENSG00000166152			28479	protein-coding gene	gene with protein product						12477932	Standard	NM_144602		Approved	MGC33367	uc002efr.3	Q8WTQ4	OTTHUMG00000133149	ENST00000299191.3:c.134A>C	16.37:g.49407984A>C	ENSP00000299191:p.Lys45Thr			Missense_Mutation	SNP	NULL	p.K45T	ENST00000299191.3	37	c.134	CCDS10738.1	16	.	.	.	.	.	.	.	.	.	.	A	13.99	2.401200	0.42613	.	.	ENSG00000166152	ENST00000299191	T	0.55760	0.5	3.66	1.33	0.21861	.	0.266624	0.26939	N	0.021728	T	0.51295	0.1666	L	0.34521	1.04	0.28767	N	0.900597	D	0.67145	0.996	D	0.64877	0.93	T	0.42137	-0.9469	9	.	.	.	-41.2732	4.8343	0.13456	0.7033:0.0:0.2967:0.0	.	45	Q8WTQ4	CP078_HUMAN	T	45	ENSP00000299191:K45T	.	K	+	2	0	C16orf78	47965485	0.927000	0.31430	0.863000	0.33907	0.718000	0.41266	0.442000	0.21628	0.259000	0.21709	0.459000	0.35465	AAG	C16orf78	-	NULL	ENSG00000166152		0.512	C16orf78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf78	HGNC	protein_coding	OTTHUMT00000256846.1	-	0.00	77	0	A	NM_144602		49407984	+1	tier1	-	no_errors	ENST00000299191	ensembl	human	known	74_37	missense	20.69	92	24	SNP	0.885	C
C16orf74	404550	genome.wustl.edu	37	16	85743833	85743833	+	Missense_Mutation	SNP	C	C	T	rs377716191		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr16:85743833C>T	ENST00000284245.4	-	3	292	c.109G>A	c.(109-111)Gac>Aac	p.D37N	C16orf74_ENST00000602914.1_Intron|C16orf74_ENST00000602675.1_5'UTR|C16orf74_ENST00000602719.1_Missense_Mutation_p.D37N|C16orf74_ENST00000602758.1_Intron|C16orf74_ENST00000602583.1_Missense_Mutation_p.D25N|C16orf74_ENST00000602766.1_5'UTR	NM_206967.2	NP_996850.1	Q96GX8	CP074_HUMAN	chromosome 16 open reading frame 74	37																	ATGATGATGTCGGGCACGTCC	0.662																																																	0													17.0	22.0	20.0					16																	85743833		2133	4236	6369	SO:0001583	missense	0			BC009078	CCDS45540.1	16q24.1	2014-05-28			ENSG00000154102	ENSG00000154102			23362	protein-coding gene	gene with protein product							Standard	NM_206967		Approved	MGC17624	uc002fjc.4	Q96GX8	OTTHUMG00000183875	ENST00000284245.4:c.109G>A	16.37:g.85743833C>T	ENSP00000284245:p.Asp37Asn			Missense_Mutation	SNP	NULL	p.D37N	ENST00000284245.4	37	c.109	CCDS45540.1	16	.	.	.	.	.	.	.	.	.	.	C	5.934	0.356442	0.11239	.	.	ENSG00000154102	ENST00000284245	.	.	.	4.85	-0.84	0.10755	.	0.448478	0.20948	N	0.082807	T	0.12220	0.0297	.	.	.	0.24242	N	0.995352	B	0.12630	0.006	B	0.06405	0.002	T	0.34725	-0.9817	8	0.02654	T	1	-27.196	8.0544	0.30596	0.0:0.3031:0.0:0.6969	.	37	Q96GX8	CP074_HUMAN	N	37	.	ENSP00000284245:D37N	D	-	1	0	C16orf74	84301334	0.980000	0.34600	0.996000	0.52242	0.986000	0.74619	-0.165000	0.09968	-0.129000	0.11620	0.561000	0.74099	GAC	C16orf74	-	NULL	ENSG00000154102		0.662	C16orf74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf74	HGNC	protein_coding	OTTHUMT00000467253.1	-	0.00	27	0	C	NM_206967		85743833	-1	tier1	-	no_errors	ENST00000284245	ensembl	human	known	74_37	missense	65.85	14	27	SNP	0.994	T
C1QTNF7	114905	genome.wustl.edu	37	4	15437439	15437439	+	Missense_Mutation	SNP	A	A	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr4:15437439A>C	ENST00000444304.2	+	2	398	c.72A>C	c.(70-72)aaA>aaC	p.K24N	C1QTNF7_ENST00000429690.1_Missense_Mutation_p.K24N|C1QTNF7_ENST00000295297.4_Missense_Mutation_p.K31N			Q9BXJ2	C1QT7_HUMAN	C1q and tumor necrosis factor related protein 7	24					protein homooligomerization (GO:0051260)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)				endometrium(5)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|stomach(1)	16						ATCAGTTGAAAGGAGAGAACT	0.532																																																	0													82.0	81.0	81.0					4																	15437439		2203	4300	6503	SO:0001583	missense	0			AF329839	CCDS3414.1, CCDS47025.1	4p15.3	2008-08-29			ENSG00000163145	ENSG00000163145			14342	protein-coding gene	gene with protein product							Standard	NM_001135170		Approved	CTRP7	uc003gnp.3	Q9BXJ2	OTTHUMG00000097095	ENST00000444304.2:c.72A>C	4.37:g.15437439A>C	ENSP00000388914:p.Lys24Asn		B2RBT3|J3KPW3	Missense_Mutation	SNP	pfam_C1q,pfam_Collagen,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	p.K24N	ENST00000444304.2	37	c.72	CCDS3414.1	4	.	.	.	.	.	.	.	.	.	.	A	16.63	3.177201	0.57692	.	.	ENSG00000163145	ENST00000397700;ENST00000295297;ENST00000382383;ENST00000429690;ENST00000444304	D;D;D;D;D	0.91577	-2.87;-2.55;-2.74;-2.53;-2.53	5.54	3.09	0.35607	.	0.048258	0.85682	D	0.000000	D	0.83105	0.5182	L	0.36672	1.1	0.52501	D	0.999954	B	0.34103	0.437	B	0.29862	0.108	T	0.77680	-0.2497	10	0.49607	T	0.09	.	8.0086	0.30340	0.7912:0.1371:0.0717:0.0	.	24	Q9BXJ2	C1QT7_HUMAN	N	31;31;24;24;24	ENSP00000380812:K31N;ENSP00000295297:K31N;ENSP00000371820:K24N;ENSP00000410722:K24N;ENSP00000388914:K24N	ENSP00000295297:K31N	K	+	3	2	C1QTNF7	15046537	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.378000	0.52432	0.468000	0.27243	0.533000	0.62120	AAA	C1QTNF7	-	NULL	ENSG00000163145		0.532	C1QTNF7-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	C1QTNF7	HGNC	protein_coding	OTTHUMT00000250891.2	-	0.00	38	0	A			15437439	+1	tier1	-	no_errors	ENST00000429690	ensembl	human	known	74_37	missense	15.09	45	8	SNP	1.000	C
C1orf168	199920	genome.wustl.edu	37	1	57258301	57258301	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:57258301C>T	ENST00000343433.6	-	2	265	c.185G>A	c.(184-186)cGc>cAc	p.R62H	C1orf168_ENST00000484327.1_5'UTR	NM_001004303.4	NP_001004303.3	Q5VWT5	CA168_HUMAN	chromosome 1 open reading frame 168	62										NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(13)|ovary(3)|skin(6)|stomach(1)|urinary_tract(2)	46						GTATGGTGTGCGCTGCTTGTG	0.473																																																	0													148.0	141.0	143.0					1																	57258301		2203	4300	6503	SO:0001583	missense	0			BX648439	CCDS30729.1	1p32.2	2011-02-22			ENSG00000187889	ENSG00000187889			27295	protein-coding gene	gene with protein product						14702039	Standard	NM_001004303		Approved	RP4-758N20.2, FLJ43208	uc001cym.4	Q5VWT5	OTTHUMG00000008281	ENST00000343433.6:c.185G>A	1.37:g.57258301C>T	ENSP00000345972:p.Arg62His		Q63HM3|Q6ZUY6	Missense_Mutation	SNP	superfamily_SH3_domain	p.R62H	ENST00000343433.6	37	c.185	CCDS30729.1	1	.	.	.	.	.	.	.	.	.	.	C	5.451	0.268340	0.10349	.	.	ENSG00000187889	ENST00000343433	T	0.31769	1.48	4.39	-7.27	0.01461	.	1.264140	0.05447	N	0.548664	T	0.09730	0.0239	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.16600	-1.0397	10	0.40728	T	0.16	5.9064	0.0969	0.00045	0.3085:0.2118:0.1603:0.3195	.	62;62	Q5VWT5-2;Q5VWT5	.;CA168_HUMAN	H	62	ENSP00000345972:R62H	ENSP00000345972:R62H	R	-	2	0	C1orf168	57030889	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-1.230000	0.02942	-1.640000	0.01525	-2.444000	0.00210	CGC	C1orf168	-	NULL	ENSG00000187889		0.473	C1orf168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf168	HGNC	protein_coding	OTTHUMT00000022751.2	-	0.00	45	0	C	NM_001004303		57258301	-1	tier1	-	no_errors	ENST00000343433	ensembl	human	known	74_37	missense	8.91	92	9	SNP	0.000	T
C4orf50	389197	genome.wustl.edu	37	4	5990868	5990869	+	5'Flank	INS	-	-	CT	rs143859826		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr4:5990868_5990869insCT	ENST00000324058.5	-	0	0				C4orf50_ENST00000531445.1_Frame_Shift_Ins_p.V211fs			Q6ZRC1	CD050_HUMAN	chromosome 4 open reading frame 50											breast(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(2)|skin(3)|urinary_tract(1)	15						ATTTTTGTCACCTCTCTCTCTC	0.455																																																	0																																										SO:0001631	upstream_gene_variant	0			BC140710		4p16.1	2009-04-14			ENSG00000181215	ENSG00000181215			33766	protein-coding gene	gene with protein product							Standard	XM_003119922		Approved	FLJ46481		Q6ZRC1	OTTHUMG00000149971		4.37:g.5990877_5990878dupCT	Exception_encountered			Frame_Shift_Ins	INS	NULL	p.V210fs	ENST00000324058.5	37	c.631_630		4																																																																																			C4orf50	-	NULL	ENSG00000181215		0.455	C4orf50-201	KNOWN	basic|appris_candidate	protein_coding	C4orf50	HGNC	protein_coding			0.00	52	0	0	NM_207405		5990869	-1			no_errors	ENST00000531445	ensembl	human	known	74_37	frame_shift_ins	7.23	77	6	INS	0.000:0.000	CT
C5orf47	133491	genome.wustl.edu	37	5	173428210	173428210	+	Missense_Mutation	SNP	A	A	G			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr5:173428210A>G	ENST00000340147.6	+	4	628	c.523A>G	c.(523-525)Aca>Gca	p.T175A	C5orf47_ENST00000522195.1_3'UTR	NM_001144954.1	NP_001138426.1	Q569G3	CE047_HUMAN	chromosome 5 open reading frame 47	175										kidney(1)|prostate(1)	2						CTCAAATTACACAAGATGAAT	0.308																																																	0													97.0	81.0	86.0					5																	173428210		692	1585	2277	SO:0001583	missense	0				CCDS47343.1	5q35.2	2012-02-24			ENSG00000185056	ENSG00000185056			27026	protein-coding gene	gene with protein product						12477932	Standard	NM_001144954		Approved	LOC133491	uc003mcw.4	Q569G3	OTTHUMG00000163349	ENST00000340147.6:c.523A>G	5.37:g.173428210A>G	ENSP00000340887:p.Thr175Ala		Q8IYU7	Missense_Mutation	SNP	NULL	p.T175A	ENST00000340147.6	37	c.523	CCDS47343.1	5	.	.	.	.	.	.	.	.	.	.	A	10.95	1.497088	0.26861	.	.	ENSG00000185056	ENST00000340147	.	.	.	4.6	2.0	0.26442	.	.	.	.	.	T	0.16514	0.0397	N	0.08118	0	0.09310	N	1	B	0.23650	0.089	B	0.25614	0.062	T	0.26395	-1.0104	8	0.25751	T	0.34	-0.5792	4.0983	0.10002	0.7215:0.0:0.0994:0.1792	.	175	Q569G3	CE047_HUMAN	A	175	.	ENSP00000340887:T175A	T	+	1	0	C5orf47	173360816	0.005000	0.15991	0.001000	0.08648	0.063000	0.16089	0.981000	0.29526	0.294000	0.22547	0.528000	0.53228	ACA	C5orf47	-	NULL	ENSG00000185056		0.308	C5orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5orf47	HGNC	protein_coding	OTTHUMT00000372926.1	-	0.00	47	0	A	NM_001144954		173428210	+1	tier1	-	no_errors	ENST00000340147	ensembl	human	known	74_37	missense	13.21	92	14	SNP	0.002	G
C8A	731	genome.wustl.edu	37	1	57347161	57347161	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:57347161G>T	ENST00000361249.3	+	5	604	c.508G>T	c.(508-510)Gcc>Tcc	p.A170S		NM_000562.2	NP_000553.1	P07357	CO8A_HUMAN	complement component 8, alpha polypeptide	170	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	43						TGTGTACGATGCCAGTTATTA	0.473																																																	0													170.0	172.0	172.0					1																	57347161		2203	4300	6503	SO:0001583	missense	0			M16974	CCDS606.1	1p32.2	2014-09-17			ENSG00000157131	ENSG00000157131		"""Complement system"""	1352	protein-coding gene	gene with protein product		120950					Standard	NM_000562		Approved		uc001cyo.2	P07357	OTTHUMG00000008306	ENST00000361249.3:c.508G>T	1.37:g.57347161G>T	ENSP00000354458:p.Ala170Ser		A2RUI4|A2RUI5|Q13668|Q9H130	Missense_Mutation	SNP	pfam_MACPF,pfam_LDrepeatLR_classA_rpt,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,pfscan_LDrepeatLR_classA_rpt,pfscan_Thrombospondin_1_rpt,prints_MAC_perforin	p.A170S	ENST00000361249.3	37	c.508	CCDS606.1	1	.	.	.	.	.	.	.	.	.	.	G	7.938	0.742059	0.15642	.	.	ENSG00000157131	ENST00000361249	T	0.75260	-0.92	5.56	3.62	0.41486	Membrane attack complex component/perforin (MACPF) domain (1);	0.267810	0.43747	D	0.000525	T	0.67040	0.2851	L	0.59912	1.85	0.29939	N	0.821202	B	0.24368	0.102	B	0.17433	0.018	T	0.58741	-0.7583	10	0.10902	T	0.67	-13.4206	14.458	0.67431	0.0:0.5796:0.4204:0.0	.	170	P07357	CO8A_HUMAN	S	170	ENSP00000354458:A170S	ENSP00000354458:A170S	A	+	1	0	C8A	57119749	0.858000	0.29795	0.901000	0.35422	0.155000	0.21991	3.538000	0.53597	1.331000	0.45412	0.655000	0.94253	GCC	C8A	-	NULL	ENSG00000157131		0.473	C8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C8A	HGNC	protein_coding	OTTHUMT00000022890.1	-	0.00	44	0	G	NM_000562		57347161	+1	tier1	-	no_errors	ENST00000361249	ensembl	human	known	74_37	missense	6.78	54	4	SNP	0.964	T
C8orf34	116328	genome.wustl.edu	37	8	69434158	69434158	+	Missense_Mutation	SNP	A	A	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr8:69434158A>T	ENST00000539993.1	+	6	1181	c.632A>T	c.(631-633)aAa>aTa	p.K211I	C8orf34_ENST00000337103.4_Missense_Mutation_p.K186I|C8orf34_ENST00000349492.3_3'UTR|C8orf34_ENST00000348340.2_Missense_Mutation_p.K211I|C8orf34_ENST00000518698.1_Missense_Mutation_p.K297I			Q49A92	CH034_HUMAN	chromosome 8 open reading frame 34	211										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(12)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	36			Epithelial(68;0.0117)|OV - Ovarian serous cystadenocarcinoma(28;0.0227)|all cancers(69;0.0502)			CCAAGAAGCAAAAATGACCAA	0.438																																																	0													102.0	97.0	99.0					8																	69434158		2203	4300	6503	SO:0001583	missense	0			AB056652	CCDS6203.1, CCDS6203.2	8q13	2009-10-01			ENSG00000165084	ENSG00000165084			30905	protein-coding gene	gene with protein product	"""vestibule 1"""						Standard	NM_052958		Approved	vest-1, VEST1	uc010lyz.3	Q49A92	OTTHUMG00000164438	ENST00000539993.1:c.632A>T	8.37:g.69434158A>T	ENSP00000438159:p.Lys211Ile		A8K5X1|G3XAM6|Q8N1X0|Q8N9M7|Q8ND19|Q96Q28	Missense_Mutation	SNP	superfamily_cAMP_dep_PK_reg_su_I/II_a/b	p.K297I	ENST00000539993.1	37	c.890		8	.	.	.	.	.	.	.	.	.	.	A	31	5.064306	0.93898	.	.	ENSG00000165084	ENST00000518698;ENST00000539993;ENST00000348340;ENST00000337103	T;T;T	0.55234	0.53;0.57;0.55	5.59	5.59	0.84812	.	0.092020	0.85682	D	0.000000	T	0.69851	0.3157	M	0.62723	1.935	0.41632	D	0.98902	D;D	0.89917	0.963;1.0	P;D	0.85130	0.76;0.997	T	0.70015	-0.4988	9	.	.	.	-18.0878	16.0668	0.80887	1.0:0.0:0.0:0.0	.	211;211	Q49A92;Q49A92-3	CH034_HUMAN;.	I	297;211;211;186	ENSP00000427820:K297I;ENSP00000438159:K211I;ENSP00000337174:K186I	.	K	+	2	0	C8orf34	69596712	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.918000	0.87506	2.246000	0.74042	0.533000	0.62120	AAA	C8orf34	-	NULL	ENSG00000165084		0.438	C8orf34-201	KNOWN	basic|appris_candidate	protein_coding	C8orf34	HGNC	protein_coding		-	0.00	81	0	A	NM_052958		69434158	+1	tier1	-	no_errors	ENST00000518698	ensembl	human	known	74_37	missense	29.07	61	25	SNP	1.000	T
CACNA2D4	93589	genome.wustl.edu	37	12	1965219	1965219	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr12:1965219G>T	ENST00000382722.5	-	22	2473	c.2111C>A	c.(2110-2112)gCc>gAc	p.A704D	CACNA2D4_ENST00000585708.1_Missense_Mutation_p.A640D|CACNA2D4_ENST00000588077.1_Missense_Mutation_p.A640D|CACNA2D4_ENST00000586184.1_Missense_Mutation_p.A704D|CACNA2D4_ENST00000587995.1_Missense_Mutation_p.A679D|CACNA2D4_ENST00000539048.2_5'UTR|CACNA2D4_ENST00000585732.1_Missense_Mutation_p.A565D	NM_172364.4	NP_758952.4	Q7Z3S7	CA2D4_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 4	704					calcium ion transmembrane transport (GO:0070588)|detection of light stimulus involved in visual perception (GO:0050908)	voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			endometrium(3)|kidney(2)|large_intestine(1)|liver(1)|lung(27)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	39	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		GCGGATCATGGCCTCTAGCTG	0.547																																					Colon(2;101 179 21030 23310 28141)												0													68.0	76.0	73.0					12																	1965219		2040	4192	6232	SO:0001583	missense	0			AF516695	CCDS44785.1	12p13.33	2003-03-05			ENSG00000151062	ENSG00000151062		"""Calcium channel subunits"""	20202	protein-coding gene	gene with protein product		608171				12181424	Standard	NM_172364		Approved		uc021qsx.1	Q7Z3S7	OTTHUMG00000168111	ENST00000382722.5:c.2111C>A	12.37:g.1965219G>T	ENSP00000372169:p.Ala704Asp		Q7Z3S8|Q86XZ5|Q8IZS9	Missense_Mutation	SNP	pfam_VWA_N,pfam_Cache_domain,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.A704D	ENST00000382722.5	37	c.2111	CCDS44785.1	12	.	.	.	.	.	.	.	.	.	.	G	15.87	2.962083	0.53400	.	.	ENSG00000151062	ENST00000456077;ENST00000280663;ENST00000382722	T	0.30981	1.51	4.2	4.2	0.49525	.	0.000000	0.85682	D	0.000000	T	0.56906	0.2017	M	0.84585	2.705	0.80722	D	1	D;D	0.89917	0.985;1.0	P;D	0.91635	0.882;0.999	T	0.59236	-0.7492	10	0.17369	T	0.5	.	15.6637	0.77209	0.0:0.0:1.0:0.0	.	704;704	Q7Z3S7-2;Q7Z3S7	.;CA2D4_HUMAN	D	640;704;704	ENSP00000372169:A704D	ENSP00000280663:A704D	A	-	2	0	CACNA2D4	1835480	1.000000	0.71417	0.913000	0.36048	0.153000	0.21895	9.349000	0.97066	2.065000	0.61736	0.462000	0.41574	GCC	CACNA2D4	-	NULL	ENSG00000151062		0.547	CACNA2D4-001	KNOWN	non_canonical_U12|basic|appris_candidate|CCDS	protein_coding	CACNA2D4	HGNC	protein_coding	OTTHUMT00000398230.2		0.00	96	0	G			1965219	-1			no_errors	ENST00000382722	ensembl	human	known	74_37	missense	6.10	77	5	SNP	0.998	T
CAPNS1	826	genome.wustl.edu	37	19	36633589	36633589	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr19:36633589C>A	ENST00000246533.3	+	4	877	c.279C>A	c.(277-279)aaC>aaA	p.N93K	CAPNS1_ENST00000590874.1_Intron|CAPNS1_ENST00000588815.1_Missense_Mutation_p.N93K|CAPNS1_ENST00000589146.1_Intron|AD001527.7_ENST00000604228.1_RNA|CAPNS1_ENST00000588780.1_Missense_Mutation_p.N93K|CAPNS1_ENST00000587718.1_Missense_Mutation_p.N93K	NM_001003962.1|NM_001749.2	NP_001003962.1|NP_001740.1	P04632	CPNS1_HUMAN	calpain, small subunit 1	93	EF-hand 1; atypical. {ECO:0000255|PROSITE-ProRule:PRU00448}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell proliferation (GO:0008284)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			cervix(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	5	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			TTGAGGCCAACGAGAGTGAGG	0.622																																					Esophageal Squamous(129;1541 1691 5780 18353 34150)												0													129.0	134.0	133.0					19																	36633589		2203	4300	6503	SO:0001583	missense	0			X04106	CCDS12489.1	19q13.1	2013-01-10		2001-08-10	ENSG00000126247	ENSG00000126247	3.4.22.52	"""EF-hand domain containing"""	1481	protein-coding gene	gene with protein product		114170		CAPN4		3024120, 3016651	Standard	NM_001003962		Approved	CANP, CANPS, 30K, CDPS	uc002odj.3	P04632		ENST00000246533.3:c.279C>A	19.37:g.36633589C>A	ENSP00000246533:p.Asn93Lys		A8K0P1|Q8WTX3|Q96EW0	Missense_Mutation	SNP	pfscan_EF_hand_dom	p.N93K	ENST00000246533.3	37	c.279	CCDS12489.1	19	.	.	.	.	.	.	.	.	.	.	c	13.45	2.239488	0.39598	.	.	ENSG00000126247	ENST00000246533	T	0.46819	0.86	4.73	2.3	0.28687	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.35451	0.0932	M	0.62723	1.935	0.80722	D	1	P	0.34800	0.469	B	0.21546	0.035	T	0.13229	-1.0517	10	0.48119	T	0.1	.	5.5173	0.16914	0.0:0.4571:0.0:0.5429	.	93	P04632	CPNS1_HUMAN	K	93	ENSP00000246533:N93K	ENSP00000246533:N93K	N	+	3	2	CAPNS1	41325429	0.999000	0.42202	1.000000	0.80357	0.981000	0.71138	0.554000	0.23407	0.393000	0.25203	0.655000	0.94253	AAC	CAPNS1	-	NULL	ENSG00000126247		0.622	CAPNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPNS1	HGNC	protein_coding	OTTHUMT00000457411.2	-	0.00	83	0	C			36633589	+1	tier1	-	no_errors	ENST00000588780	ensembl	human	known	74_37	missense	9.41	77	8	SNP	1.000	A
CACNG8	59283	genome.wustl.edu	37	19	54483237	54483237	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr19:54483237G>A	ENST00000270458.2	+	3	587	c.484G>A	c.(484-486)Gca>Aca	p.A162T	MIR935_ENST00000401179.1_RNA	NM_031895.5	NP_114101	Q8WXS5	CCG8_HUMAN	calcium channel, voltage-dependent, gamma subunit 8	162					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			kidney(1)|large_intestine(3)|lung(8)|urinary_tract(1)	13	all_cancers(19;0.0385)|all_epithelial(19;0.0207)|all_lung(19;0.145)|Lung NSC(19;0.168)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.162)		CATTCTGGGCGCAGGGATCCT	0.652																																																	0													35.0	35.0	35.0					19																	54483237		2202	4299	6501	SO:0001583	missense	0			AF288388	CCDS33104.1	19q13.4	2008-05-02			ENSG00000142408	ENSG00000142408		"""Calcium channel subunits"""	13628	protein-coding gene	gene with protein product		606900				11170751	Standard	NM_031895		Approved		uc002qcs.2	Q8WXS5	OTTHUMG00000064908	ENST00000270458.2:c.484G>A	19.37:g.54483237G>A	ENSP00000270458:p.Ala162Thr		Q9BXT0|Q9BY23	Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_VDCC_gsu,prints_VDCC_g8su,prints_Claudin	p.A162T	ENST00000270458.2	37	c.484	CCDS33104.1	19	.	.	.	.	.	.	.	.	.	.	.	34	5.301610	0.95601	.	.	ENSG00000142408	ENST00000270458	D	0.89617	-2.54	4.75	3.68	0.42216	.	0.081888	0.46442	U	0.000293	D	0.91570	0.7337	L	0.53780	1.695	0.29308	N	0.8681909999999999	D	0.71674	0.998	D	0.65233	0.933	D	0.93820	0.7118	9	0.87932	D	0	-2.4663	12.2439	0.54560	0.0:0.0:0.8281:0.1718	.	162	Q8WXS5	CCG8_HUMAN	T	162	ENSP00000270458:A162T	ENSP00000270458:A162T	A	+	1	0	CACNG8	59175049	1.000000	0.71417	0.639000	0.29394	0.991000	0.79684	7.435000	0.80391	1.121000	0.41925	0.531000	0.56144	GCA	CACNG8	-	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin	ENSG00000142408		0.652	CACNG8-001	KNOWN	non_ATG_start|basic|appris_principal|CCDS	protein_coding	CACNG8	HGNC	protein_coding	OTTHUMT00000139361.3	-	0.00	119	0	G			54483237	+1	tier1	-	no_errors	ENST00000270458	ensembl	human	known	74_37	missense	28.23	89	35	SNP	0.995	A
CASQ2	845	genome.wustl.edu	37	1	116268160	116268160	+	Missense_Mutation	SNP	C	C	A	rs200265771		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:116268160C>A	ENST00000261448.5	-	7	991	c.752G>T	c.(751-753)cGc>cTc	p.R251L	CASQ2_ENST00000488931.1_5'Flank|CASQ2_ENST00000456138.2_Missense_Mutation_p.R180L	NM_001232.3	NP_001223.2	O14958	CASQ2_HUMAN	calsequestrin 2 (cardiac muscle)	251					cardiac muscle contraction (GO:0060048)|cellular response to caffeine (GO:0071313)|detection of calcium ion (GO:0005513)|ion transmembrane transport (GO:0034220)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|protein polymerization (GO:0051258)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of heart rate (GO:0002027)|regulation of membrane repolarization (GO:0060306)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|sequestering of calcium ion (GO:0051208)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|junctional sarcoplasmic reticulum membrane (GO:0014701)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|protein homodimerization activity (GO:0042803)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|skin(1)	18	Lung SC(450;0.211)	all_cancers(81;1.25e-06)|all_epithelial(167;1.02e-06)|all_lung(203;8.03e-06)|Lung NSC(69;5.01e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		TGGGCGCAGGCGACGTAGAGT	0.423																																																	0													107.0	110.0	109.0					1																	116268160		2203	4300	6503	SO:0001583	missense	0			BC022288	CCDS884.1	1p13.1	2014-09-17			ENSG00000118729	ENSG00000118729		"""Protein disulfide isomerases"""	1513	protein-coding gene	gene with protein product		114251				8406504	Standard	NM_001232		Approved	PDIB2	uc001efx.4	O14958	OTTHUMG00000011970	ENST00000261448.5:c.752G>T	1.37:g.116268160C>A	ENSP00000261448:p.Arg251Leu		B2R7M6|B4DIB0|Q5T1D2|Q8TBW8	Missense_Mutation	SNP	pfam_Calsequestrin,superfamily_Thioredoxin-like_fold,prints_Calsequestrin	p.R251L	ENST00000261448.5	37	c.752	CCDS884.1	1	.	.	.	.	.	.	.	.	.	.	C	17.61	3.433261	0.62844	.	.	ENSG00000118729	ENST00000261448;ENST00000456138	T;T	0.75589	-0.95;-0.95	5.31	5.31	0.75309	Thioredoxin-like fold (2);	0.095159	0.64402	D	0.000002	T	0.56673	0.2001	N	0.22421	0.69	0.43471	D	0.995684	D;B	0.54964	0.969;0.083	P;B	0.50082	0.63;0.026	T	0.65475	-0.6159	10	0.72032	D	0.01	-6.7415	7.1055	0.25360	0.0:0.8032:0.0:0.1968	.	180;251	B4DIB0;O14958	.;CASQ2_HUMAN	L	251;180	ENSP00000261448:R251L;ENSP00000403858:R180L	ENSP00000261448:R251L	R	-	2	0	CASQ2	116069683	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.140000	0.64807	2.937000	0.99478	0.650000	0.86243	CGC	CASQ2	-	pfam_Calsequestrin,superfamily_Thioredoxin-like_fold,prints_Calsequestrin	ENSG00000118729		0.423	CASQ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASQ2	HGNC	protein_coding	OTTHUMT00000033091.1		0.00	15	0	C	NM_001232		116268160	-1			no_errors	ENST00000261448	ensembl	human	known	74_37	missense	8.00	23	2	SNP	1.000	A
CBLN4	140689	genome.wustl.edu	37	20	54579078	54579078	+	Silent	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr20:54579078C>T	ENST00000064571.2	-	1	1450	c.150G>A	c.(148-150)acG>acA	p.T50T		NM_080617.5	NP_542184.1	Q9NTU7	CBLN4_HUMAN	cerebellin 4 precursor	50					protein secretion (GO:0009306)	cell junction (GO:0030054)|extracellular space (GO:0005615)|synapse (GO:0045202)				endometrium(2)|large_intestine(1)|lung(10)|ovary(3)|pancreas(1)	17			Colorectal(105;0.202)			CCTTGGAGTCCGTGGCCGGGT	0.677																																																	0													61.0	61.0	61.0					20																	54579078		2203	4300	6503	SO:0001819	synonymous_variant	0			AY358527	CCDS13448.1	20q13	2004-08-19	2004-08-19	2004-08-19	ENSG00000054803	ENSG00000054803			16231	protein-coding gene	gene with protein product		615029	"""cerebellin precursor-like 1"""	CBLNL1			Standard	NM_080617		Approved	dJ885A10.1	uc002xxa.4	Q9NTU7	OTTHUMG00000032782	ENST00000064571.2:c.150G>A	20.37:g.54579078C>T			A8K0S5	Silent	SNP	pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	p.T50	ENST00000064571.2	37	c.150	CCDS13448.1	20																																																																																			CBLN4	-	NULL	ENSG00000054803		0.677	CBLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBLN4	HGNC	protein_coding	OTTHUMT00000079783.2	-	0.00	30	0	C	NM_080617		54579078	-1	tier1	-	no_errors	ENST00000064571	ensembl	human	known	74_37	silent	17.14	29	6	SNP	0.992	T
CCDC168	643677	genome.wustl.edu	37	13	103385504	103385504	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr13:103385504G>A	ENST00000322527.2	-	1	3655	c.3656C>T	c.(3655-3657)aCg>aTg	p.T1219M		NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168	1219																	GATAGTGTTCGTCCTGGTCTT	0.458																																																	0													282.0	215.0	235.0					13																	103385504		692	1591	2283	SO:0001583	missense	0				CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287	ENST00000322527.2:c.3656C>T	13.37:g.103385504G>A	ENSP00000320232:p.Thr1219Met		Q8N800	Missense_Mutation	SNP	NULL	p.T1219M	ENST00000322527.2	37	c.3656		13	.	.	.	.	.	.	.	.	.	.	G	4.353	0.064902	0.08388	.	.	ENSG00000175820	ENST00000322527	T	0.03717	3.83	2.9	-0.512	0.11966	.	.	.	.	.	T	0.01835	0.0058	N	0.08118	0	0.09310	N	1	B	0.12013	0.005	B	0.04013	0.001	T	0.45948	-0.9226	9	0.48119	T	0.1	.	2.067	0.03605	0.4095:0.0:0.3418:0.2487	.	1219	Q8NDH2	CC168_HUMAN	M	1219	ENSP00000320232:T1219M	ENSP00000320232:T1219M	T	-	2	0	CCDC168	102183505	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.002000	0.13061	-0.128000	0.11641	-1.141000	0.01876	ACG	CCDC168	-	NULL	ENSG00000175820		0.458	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	CCDC168	HGNC	protein_coding		-	0.00	8	0	G	NM_001146197		103385504	-1	tier1	-	no_errors	ENST00000322527	ensembl	human	known	74_37	missense	57.14	6	8	SNP	0.000	A
CCDC37	348807	genome.wustl.edu	37	3	126139071	126139071	+	Splice_Site	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr3:126139071G>A	ENST00000352312.1	+	11	1180	c.1081G>A	c.(1081-1083)Ggg>Agg	p.G361R	CCDC37_ENST00000505024.1_Splice_Site_p.G362R|CCDC37_ENST00000393425.1_Splice_Site_p.G362R	NM_182628.2	NP_872434.2	Q494V2	CCD37_HUMAN	coiled-coil domain containing 37	361										NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|skin(3)	23				GBM - Glioblastoma multiforme(114;0.166)		CGACTCCAGAGGGTGAGTGGG	0.652																																																	0													21.0	25.0	24.0					3																	126139071		2201	4295	6496	SO:0001630	splice_region_variant	0			AK097402	CCDS3037.1	3q21.2	2014-07-31			ENSG00000163885	ENSG00000163885			26842	protein-coding gene	gene with protein product						23569216	Standard	NM_182628		Approved	FLJ40083, MIA1	uc003eiu.1	Q494V2	OTTHUMG00000162691	ENST00000352312.1:c.1082+1G>A	3.37:g.126139071G>A			D3DNA8|Q494V1|Q494V4|Q8N838	Missense_Mutation	SNP	superfamily_SuperAg_toxin_C	p.G362R	ENST00000352312.1	37	c.1084	CCDS3037.1	3	.	.	.	.	.	.	.	.	.	.	G	8.771	0.925893	0.18056	.	.	ENSG00000163885	ENST00000352312;ENST00000393425;ENST00000505024	T;T;T	0.30182	1.55;1.54;1.54	3.37	-4.64	0.03349	.	2.853410	0.00721	N	0.000882	T	0.14270	0.0345	N	0.11560	0.145	0.09310	N	1	B;B	0.14438	0.01;0.006	B;B	0.11329	0.006;0.003	T	0.12967	-1.0527	10	0.15499	T	0.54	.	5.1174	0.14843	0.5031:0.3042:0.1927:0.0	.	362;361	Q494V2-2;Q494V2	.;CCD37_HUMAN	R	361;362;362	ENSP00000344749:G361R;ENSP00000377076:G362R;ENSP00000423046:G362R	ENSP00000344749:G361R	G	+	1	0	CCDC37	127621761	0.003000	0.15002	0.001000	0.08648	0.520000	0.34377	-0.682000	0.05185	-1.080000	0.03109	0.491000	0.48974	GGG	CCDC37	-	NULL	ENSG00000163885		0.652	CCDC37-001	KNOWN	basic|appris_candidate|exp_conf|CCDS	protein_coding	CCDC37	HGNC	protein_coding	OTTHUMT00000370099.4	-	0.00	62	0	G	NM_182628	Missense_Mutation	126139071	+1	tier1	-	no_errors	ENST00000393425	ensembl	human	known	74_37	missense	25.27	68	23	SNP	0.001	A
CCNF	899	genome.wustl.edu	37	16	2505474	2505474	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr16:2505474G>T	ENST00000397066.4	+	16	1882	c.1794G>T	c.(1792-1794)gaG>gaT	p.E598D	RP11-715J22.3_ENST00000561653.1_RNA|RP11-715J22.4_ENST00000566085.1_lincRNA	NM_001761.2	NP_001752.2	P41002	CCNF_HUMAN	cyclin F	598	PEST.				mitotic nuclear division (GO:0007067)|negative regulation of centrosome duplication (GO:0010826)|placenta development (GO:0001890)|protein ubiquitination (GO:0016567)|re-entry into mitotic cell cycle (GO:0000320)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	centriole (GO:0005814)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)				breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(2)|lung(5)|prostate(4)|skin(1)	20		Ovarian(90;0.17)				GCCAGGAGGAGACGCTGCTGG	0.637																																																	0													47.0	40.0	42.0					16																	2505474		2197	4299	6496	SO:0001583	missense	0			Z36714	CCDS10467.1	16p13.3	2008-02-05			ENSG00000162063	ENSG00000162063		"""F-boxes /  ""other"""""	1591	protein-coding gene	gene with protein product		600227				7896286	Standard	NM_001761		Approved	FBX1, FBXO1	uc002cqd.1	P41002	OTTHUMG00000128858	ENST00000397066.4:c.1794G>T	16.37:g.2505474G>T	ENSP00000380256:p.Glu598Asp		B2R8H3|Q96EG9	Missense_Mutation	SNP	pfam_Cyclin_N,pfam_Cyclin_C-dom,pfam_F-box_dom,superfamily_Cyclin-like,superfamily_F-box_dom,smart_F-box_dom,smart_Cyclin-like,pfscan_F-box_dom	p.E598D	ENST00000397066.4	37	c.1794	CCDS10467.1	16	.	.	.	.	.	.	.	.	.	.	G	21.3	4.123341	0.77436	.	.	ENSG00000162063	ENST00000397066;ENST00000293968	T	0.30448	1.53	5.52	1.97	0.26223	.	0.045776	0.85682	N	0.000000	T	0.43344	0.1243	L	0.59436	1.845	0.54753	D	0.999989	D	0.76494	0.999	D	0.65987	0.94	T	0.25082	-1.0142	10	0.52906	T	0.07	-26.934	7.2139	0.25949	0.2131:0.1446:0.6423:0.0	.	598	P41002	CCNF_HUMAN	D	598;513	ENSP00000380256:E598D	ENSP00000293968:E513D	E	+	3	2	CCNF	2445475	1.000000	0.71417	0.980000	0.43619	0.996000	0.88848	1.952000	0.40343	0.686000	0.31488	0.561000	0.74099	GAG	CCNF	-	NULL	ENSG00000162063		0.637	CCNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNF	HGNC	protein_coding	OTTHUMT00000250801.1	-	0.00	133	0	G	NM_001761		2505474	+1	tier1	-	no_errors	ENST00000397066	ensembl	human	known	74_37	missense	7.14	65	5	SNP	0.996	T
CCR4	1233	genome.wustl.edu	37	3	32995849	32995849	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr3:32995849G>A	ENST00000330953.5	+	2	1103	c.935G>A	c.(934-936)cGc>cAc	p.R312H		NM_005508.4	NP_005499.1	P51679	CCR4_HUMAN	chemokine (C-C motif) receptor 4	312					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuron migration (GO:0001764)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of positive chemotaxis (GO:0050927)|response to antibiotic (GO:0046677)|response to bacterium (GO:0009617)|response to radiation (GO:0009314)|tolerance induction (GO:0002507)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)			NS(1)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(3)|stomach(1)	16						GAGAAATTTCGCAAGTACATC	0.478																																																	0													64.0	68.0	67.0					3																	32995849		2203	4300	6503	SO:0001583	missense	0			X85740	CCDS2656.1	3p24-p21.3	2012-08-08			ENSG00000183813	ENSG00000183813		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1605	protein-coding gene	gene with protein product		604836				7642634, 8884276	Standard	NM_005508		Approved	CC-CKR-4, CMKBR4, CKR4, k5-5, ChemR13, CD194	uc003cfg.1	P51679	OTTHUMG00000130752	ENST00000330953.5:c.935G>A	3.37:g.32995849G>A	ENSP00000332659:p.Arg312His		Q9ULY6|Q9ULY7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CCR4,prints_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Chemokine_CXCR4,prints_ATII_rcpt,prints_Duffy_chemokine_rcpt	p.R312H	ENST00000330953.5	37	c.935	CCDS2656.1	3	.	.	.	.	.	.	.	.	.	.	G	20.9	4.068896	0.76301	.	.	ENSG00000183813	ENST00000330953	T	0.58358	0.34	5.73	5.73	0.89815	.	0.107611	0.39210	N	0.001435	T	0.71986	0.3405	M	0.84948	2.725	0.48288	D	0.999625	D	0.89917	1.0	D	0.64506	0.926	T	0.76187	-0.3051	10	0.87932	D	0	.	11.2774	0.49174	0.1148:0.0:0.8852:0.0	.	312	P51679	CCR4_HUMAN	H	312	ENSP00000332659:R312H	ENSP00000332659:R312H	R	+	2	0	CCR4	32970853	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.362000	0.59467	2.706000	0.92434	0.563000	0.77884	CGC	CCR4	-	pfam_7TM_GPCR_olfarory/Srsx,prints_GPCR_Rhodpsn,prints_Chemokine_rcpt	ENSG00000183813		0.478	CCR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCR4	HGNC	protein_coding	OTTHUMT00000253252.2	-	0.00	45	0	G			32995849	+1	tier1	-	no_errors	ENST00000330953	ensembl	human	known	74_37	missense	34.78	30	16	SNP	1.000	A
CCRL2	9034	genome.wustl.edu	37	3	46449067	46449067	+	Intron	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr3:46449067G>T	ENST00000399036.3	+	1	340				CCRL2_ENST00000400882.2_5'Flank|RP11-24F11.2_ENST00000451485.1_RNA|CCRL2_ENST00000357392.4_5'UTR|CCRL2_ENST00000400880.3_5'Flank	NM_003965.4	NP_003956.2	O00421	CCRL2_HUMAN	chemokine (C-C motif) receptor-like 2						chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	CCR chemokine receptor binding (GO:0048020)|chemokine receptor activity (GO:0004950)|chemokine receptor binding (GO:0042379)			lung(3)|ovary(1)|urinary_tract(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.00112)|KIRC - Kidney renal clear cell carcinoma(197;0.017)|Kidney(197;0.02)		TTTCACTTTTGCAAACATTTA	0.438																																																	0																																										SO:0001627	intron_variant	0			AF014958	CCDS43079.1, CCDS46814.1	3p21	2013-07-18	2013-07-18	2013-07-18	ENSG00000121797	ENSG00000121797		"""GPCR / Class A : Chemokine receptors : Atypical"""	1612	protein-coding gene	gene with protein product	"""atypical chemokine receptor 5"""	608379				9473515	Standard	NM_001130910		Approved	HCR, CRAM-B, CKRX, CRAM-A, ACKR5	uc003cpp.4	O00421	OTTHUMG00000156318	ENST00000399036.3:c.-13+74G>T	3.37:g.46449067G>T			B4DKQ8|O75307|Q4VBB0|Q6IPX0|Q7KYQ9|Q96KP5|Q9UPG0	RNA	SNP	-	NULL	ENST00000399036.3	37	NULL	CCDS43079.1	3																																																																																			CCRL2	-	-	ENSG00000121797		0.438	CCRL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CCRL2	HGNC	protein_coding	OTTHUMT00000343909.2	-	0.00	49	0	G			46449067	+1	tier1	-	no_errors	ENST00000495870	ensembl	human	putative	74_37	rna	5.26	71	4	SNP	0.999	T
CD163	9332	genome.wustl.edu	37	12	7647722	7647722	+	Nonsense_Mutation	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr12:7647722C>A	ENST00000359156.4	-	6	1577	c.1375G>T	c.(1375-1377)Gga>Tga	p.G459*	CD163_ENST00000432237.2_Nonsense_Mutation_p.G459*|CD163_ENST00000396620.3_Nonsense_Mutation_p.G459*|CD163_ENST00000541972.1_Nonsense_Mutation_p.G447*	NM_004244.5	NP_004235.4	Q86VB7	C163A_HUMAN	CD163 molecule	459	SRCR 4. {ECO:0000255|PROSITE- ProRule:PRU00196}.				acute-phase response (GO:0006953)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(6)|pancreas(2)|prostate(1)|skin(5)|urinary_tract(4)	76					WF10(DB05389)	CAGGTAAGTCCACCCCATTGC	0.413																																																	0													210.0	193.0	199.0					12																	7647722		2203	4300	6503	SO:0001587	stop_gained	0			Z22968	CCDS8578.1, CCDS53742.1	12p13	2006-03-28	2006-03-28		ENSG00000177575	ENSG00000177575		"""CD molecules"""	1631	protein-coding gene	gene with protein product		605545	"""CD163 antigen"""			10403791, 8370408	Standard	NM_004244		Approved	M130, MM130	uc001qsz.3	Q86VB7	OTTHUMG00000168353	ENST00000359156.4:c.1375G>T	12.37:g.7647722C>A	ENSP00000352071:p.Gly459*		C9JIG2|Q07898|Q07899|Q07900|Q07901|Q2VLH7	Nonsense_Mutation	SNP	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,prints_SRCR,pfscan_SRCR	p.G459*	ENST00000359156.4	37	c.1375	CCDS8578.1	12	.	.	.	.	.	.	.	.	.	.	C	36	5.862457	0.97036	.	.	ENSG00000177575	ENST00000359156;ENST00000541972;ENST00000396620;ENST00000432237	.	.	.	5.01	4.12	0.48240	.	0.464024	0.20456	N	0.091982	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15952	T	0.53	.	11.2519	0.49031	0.0:0.9092:0.0:0.0908	.	.	.	.	X	459;447;459;459	.	ENSP00000352071:G459X	G	-	1	0	CD163	7538989	0.000000	0.05858	1.000000	0.80357	0.777000	0.43975	-0.165000	0.09968	2.776000	0.95493	0.650000	0.86243	GGA	CD163	-	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR	ENSG00000177575		0.413	CD163-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD163	HGNC	protein_coding	OTTHUMT00000399396.2	-	0.00	47	0	C	NM_004244, NM_203416		7647722	-1	tier1	-	no_errors	ENST00000359156	ensembl	human	known	74_37	nonsense	5.80	65	4	SNP	0.936	A
CD1D	912	genome.wustl.edu	37	1	158152092	158152092	+	Missense_Mutation	SNP	A	A	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:158152092A>T	ENST00000368171.3	+	4	1098	c.599A>T	c.(598-600)aAg>aTg	p.K200M		NM_001766.3	NP_001757.1	P15813	CD1D_HUMAN	CD1d molecule	200	Ig-like.				antigen processing and presentation, endogenous lipid antigen via MHC class Ib (GO:0048006)|detection of bacterium (GO:0016045)|heterotypic cell-cell adhesion (GO:0034113)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of T cell proliferation (GO:0042102)|T cell selection (GO:0045058)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	beta-2-microglobulin binding (GO:0030881)|cell adhesion molecule binding (GO:0050839)|exogenous lipid antigen binding (GO:0030884)|histone binding (GO:0042393)|lipid antigen binding (GO:0030882)|receptor activity (GO:0004872)			endometrium(1)|kidney(2)|large_intestine(2)|lung(19)|ovary(1)|prostate(3)|urinary_tract(2)	30	all_hematologic(112;0.0378)					TCGGAACTGAAGAAGCAAGGT	0.532																																																	0													124.0	123.0	123.0					1																	158152092		2203	4300	6503	SO:0001583	missense	0			BC027926	CCDS1173.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158473	ENSG00000158473		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1637	protein-coding gene	gene with protein product		188410	"""CD1D antigen, d polypeptide"", ""CD1d antigen"""			2463622	Standard	NM_001766		Approved		uc001frr.3	P15813	OTTHUMG00000022436	ENST00000368171.3:c.599A>T	1.37:g.158152092A>T	ENSP00000357153:p.Lys200Met		D3DVD5|Q5W0J3|Q9UMM3|Q9Y5M4	Missense_Mutation	SNP	pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like_dom	p.K200M	ENST00000368171.3	37	c.599	CCDS1173.1	1	.	.	.	.	.	.	.	.	.	.	A	10.73	1.432235	0.25813	.	.	ENSG00000158473	ENST00000368171	T	0.06768	3.26	4.65	3.51	0.40186	Immunoglobulin-like (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	0.263100	0.27327	N	0.019870	T	0.02342	0.0072	L	0.35854	1.095	0.09310	N	0.999999	B	0.12013	0.005	B	0.06405	0.002	T	0.39121	-0.9629	10	0.87932	D	0	-21.5368	7.1515	0.25614	0.8969:0.0:0.1031:0.0	.	200	P15813	CD1D_HUMAN	M	200	ENSP00000357153:K200M	ENSP00000357153:K200M	K	+	2	0	CD1D	156418716	0.998000	0.40836	0.984000	0.44739	0.328000	0.28507	3.893000	0.56243	0.894000	0.36317	0.528000	0.53228	AAG	CD1D	-	superfamily_MHC_I/II-like_Ag-recog,pfscan_Ig-like_dom	ENSG00000158473		0.532	CD1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD1D	HGNC	protein_coding	OTTHUMT00000058340.1	-	0.00	114	0	A	NM_001766		158152092	+1	tier1	-	no_errors	ENST00000368171	ensembl	human	known	74_37	missense	28.12	92	36	SNP	0.840	T
CD1C	911	genome.wustl.edu	37	1	158261014	158261014	+	Missense_Mutation	SNP	A	A	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:158261014A>C	ENST00000368170.3	+	2	431	c.152A>C	c.(151-153)gAc>gCc	p.D51A		NM_001765.2	NP_001756.2	P29017	CD1C_HUMAN	CD1c molecule	51					antigen processing and presentation (GO:0019882)|T cell activation involved in immune response (GO:0002286)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	endogenous lipid antigen binding (GO:0030883)|exogenous lipid antigen binding (GO:0030884)|glycolipid binding (GO:0051861)|lipopeptide binding (GO:0071723)			NS(1)|endometrium(3)|large_intestine(4)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	39	all_hematologic(112;0.0378)					GGATGGCTGGACGAGTTGCAG	0.502																																																	0													106.0	92.0	97.0					1																	158261014		2203	4300	6503	SO:0001583	missense	0			M28827	CCDS1175.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158481	ENSG00000158481		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1636	protein-coding gene	gene with protein product		188340	"""CD1C antigen, c polypeptide"", ""CD1c antigen"""	CD1		2447586	Standard	NM_001765		Approved		uc001fru.3	P29017	OTTHUMG00000017514	ENST00000368170.3:c.152A>C	1.37:g.158261014A>C	ENSP00000357152:p.Asp51Ala		Q5TDJ7|Q6IAS4|Q9UMM0|Q9UN96	Missense_Mutation	SNP	pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like_dom	p.D51A	ENST00000368170.3	37	c.152	CCDS1175.1	1	.	.	.	.	.	.	.	.	.	.	-	13.99	2.400538	0.42613	.	.	ENSG00000158481	ENST00000368169;ENST00000368170	T	0.14144	2.53	3.32	0.434	0.16539	MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	0.220262	0.23149	N	0.051365	T	0.06280	0.0162	M	0.76838	2.35	0.09310	N	1	P	0.51147	0.942	B	0.40636	0.335	T	0.16867	-1.0388	10	0.72032	D	0.01	.	5.2713	0.15627	0.6288:0.0:0.3712:0.0	.	51	P29017	CD1C_HUMAN	A	51	ENSP00000357152:D51A	ENSP00000357151:D51A	D	+	2	0	CD1C	156527638	0.000000	0.05858	0.001000	0.08648	0.577000	0.36160	-1.161000	0.03144	0.060000	0.16281	0.529000	0.55759	GAC	CD1C	-	superfamily_MHC_I/II-like_Ag-recog	ENSG00000158481		0.502	CD1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD1C	HGNC	protein_coding	OTTHUMT00000046351.2	-	0.00	40	0	A	NM_001765		158261014	+1	tier1	-	no_errors	ENST00000368170	ensembl	human	known	74_37	missense	7.38	113	9	SNP	0.002	C
CDH8	1006	genome.wustl.edu	37	16	61851392	61851392	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr16:61851392C>A	ENST00000577390.1	-	7	2222	c.1268G>T	c.(1267-1269)aGt>aTt	p.S423I	CDH8_ENST00000584337.1_Missense_Mutation_p.S423I|CDH8_ENST00000299345.6_Missense_Mutation_p.S423I|CDH8_ENST00000577730.1_Missense_Mutation_p.S423I	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	423	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		CCTTATAGGACTGGAAGTGAT	0.428																																																	0													62.0	60.0	60.0					16																	61851392		2203	4300	6503	SO:0001583	missense	0			L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.1268G>T	16.37:g.61851392C>A	ENSP00000462701:p.Ser423Ile		B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S423I	ENST00000577390.1	37	c.1268	CCDS10802.1	16	.	.	.	.	.	.	.	.	.	.	C	20.5	4.005081	0.74932	.	.	ENSG00000150394	ENST00000299345	T	0.01838	4.61	6.08	6.08	0.98989	Cadherin (4);Cadherin-like (1);	0.034571	0.85682	D	0.000000	T	0.20820	0.0501	M	0.92923	3.36	0.80722	D	1	D;P	0.76494	0.999;0.797	D;P	0.77557	0.99;0.702	T	0.01071	-1.1461	10	0.87932	D	0	.	20.6634	0.99662	0.0:1.0:0.0:0.0	.	239;423	Q3LID3;P55286	.;CADH8_HUMAN	I	423	ENSP00000299345:S423I	ENSP00000299345:S423I	S	-	2	0	CDH8	60408893	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.584000	0.60971	2.894000	0.99253	0.655000	0.94253	AGT	CDH8	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000150394		0.428	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH8	HGNC	protein_coding	OTTHUMT00000268754.3	-	0.00	57	0	C	NM_001796		61851392	-1	tier1	-	no_errors	ENST00000577390	ensembl	human	known	74_37	missense	40.62	38	26	SNP	1.000	A
CDKN2A	1029	genome.wustl.edu	37	9	21971175	21971175	+	Frame_Shift_Del	DEL	C	C	-			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr9:21971175delC	ENST00000304494.5	-	2	453	c.183delG	c.(181-183)gagfs	p.E61fs	CDKN2A_ENST00000446177.1_Frame_Shift_Del_p.E61fs|CDKN2A_ENST00000498124.1_Frame_Shift_Del_p.E61fs|CDKN2A_ENST00000579122.1_Frame_Shift_Del_p.E61fs|CDKN2A_ENST00000497750.1_Frame_Shift_Del_p.E10fs|CDKN2A_ENST00000361570.3_Frame_Shift_Del_p.A120fs|CDKN2A_ENST00000578845.2_Frame_Shift_Del_p.E10fs|CDKN2A_ENST00000530628.2_Frame_Shift_Del_p.A79fs|CDKN2A_ENST00000579755.1_Frame_Shift_Del_p.A79fs|CDKN2A_ENST00000498628.2_Frame_Shift_Del_p.E10fs|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000494262.1_Frame_Shift_Del_p.E10fs|CDKN2A_ENST00000479692.2_Frame_Shift_Del_p.E10fs	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	61			EL -> DV.		cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.?(45)|p.E61fs*80(2)|p.E61fs*49(2)|p.V59fs*82(2)|p.E61fs*50(1)|p.L62fs*86(1)|p.E61fs*54(1)|p.0(1)|p.V28_V51del(1)|p.V59fs*45(1)|p.E61_L94del(1)|p.G116fs*>53(1)|p.L62del(1)|p.V59_G67del(1)|p.E61fs*55(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		GCAGCAGCAGCTCCGCCACTC	0.677		17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																																							1377	Whole gene deletion(1316)|Unknown(45)|Deletion - Frameshift(11)|Deletion - In frame(4)|Insertion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(285)|skin(174)|central_nervous_system(167)|lung(146)|urinary_tract(92)|bone(74)|soft_tissue(57)|upper_aerodigestive_tract(56)|oesophagus(54)|pleura(51)|ovary(36)|kidney(32)|pancreas(32)|breast(32)|thyroid(13)|NS(12)|biliary_tract(12)|stomach(12)|autonomic_ganglia(7)|meninges(7)|large_intestine(6)|liver(6)|salivary_gland(4)|thymus(4)|vulva(2)|endometrium(2)|prostate(2)											7.0	8.0	8.0					9																	21971175		2089	4169	6258	SO:0001589	frameshift_variant	0			L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.183delG	9.37:g.21971175delC	ENSP00000307101:p.Glu61fs		A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Frame_Shift_Del	DEL	pfam_Cyclin_kinase-Inhib_2A	p.A117fs	ENST00000304494.5	37	c.349	CCDS6510.1	9																																																																																			CDKN2A	-	NULL	ENSG00000147889		0.677	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CDKN2A	HGNC	protein_coding	OTTHUMT00000051915.1		0.00	13	0	C	NM_000077		21971175	-1	tier1		no_errors	ENST00000361570	ensembl	human	known	74_37	frame_shift_del	75.00	1	3	DEL	0.005	-
CEP78	84131	genome.wustl.edu	37	9	80858446	80858446	+	Silent	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr9:80858446C>T	ENST00000424347.2	+	5	961	c.672C>T	c.(670-672)gaC>gaT	p.D224D	CEP78_ENST00000415759.2_Silent_p.D224D|CEP78_ENST00000277082.5_Silent_p.D224D|CEP78_ENST00000376598.2_Silent_p.D224D|CEP78_ENST00000376597.4_Silent_p.D224D			Q5JTW2	CEP78_HUMAN	centrosomal protein 78kDa	224					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)				breast(1)|cervix(1)|endometrium(5)|large_intestine(7)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	21						CTGATCTTGACTGTATGGCTG	0.418																																																	0													157.0	150.0	152.0					9																	80858446		1950	4148	6098	SO:0001819	synonymous_variant	0			BC058931	CCDS47984.1, CCDS47985.1	9q21.2	2014-02-20	2005-12-01	2005-12-01	ENSG00000148019	ENSG00000148019			25740	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 81"""	C9orf81		14654843	Standard	NM_001098802		Approved	FLJ12643	uc004aky.4	Q5JTW2	OTTHUMG00000020062	ENST00000424347.2:c.672C>T	9.37:g.80858446C>T			A1A4S8|E9PHX5|Q5BJE3|Q5JTW0|Q5JTW1|Q9H9N3	Silent	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.D224	ENST00000424347.2	37	c.672		9																																																																																			CEP78	-	NULL	ENSG00000148019		0.418	CEP78-001	KNOWN	basic|appris_candidate	protein_coding	CEP78	HGNC	protein_coding	OTTHUMT00000052766.2	-	0.00	48	0	C	XM_095991		80858446	+1	tier1	-	no_errors	ENST00000376597	ensembl	human	known	74_37	silent	26.98	46	17	SNP	0.752	T
CHM	1121	genome.wustl.edu	37	X	85212893	85212893	+	Missense_Mutation	SNP	T	T	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chrX:85212893T>C	ENST00000357749.2	-	7	936	c.907A>G	c.(907-909)Atg>Gtg	p.M303V	CHM_ENST00000537751.1_Missense_Mutation_p.M155V|CHM_ENST00000467744.2_Intron	NM_000390.2	NP_000381.1	P24386	RAE1_HUMAN	choroideremia (Rab escort protein 1)	303					blood vessel development (GO:0001568)|protein geranylgeranylation (GO:0018344)|protein targeting to membrane (GO:0006612)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytosol (GO:0005829)|Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|prostate(1)	20		all_lung(315;5.41e-06)				TCATATTCCATACAAAATGTA	0.294																																																	0													46.0	45.0	46.0					X																	85212893		2201	4287	6488	SO:0001583	missense	0			X78121	CCDS14454.1, CCDS48139.1	Xq21.1-q21.3	2014-09-17			ENSG00000188419	ENSG00000188419			1940	protein-coding gene	gene with protein product		300390		TCD, DXS540		1373238	Standard	XM_006724615		Approved	REP-1	uc004eet.3	P24386	OTTHUMG00000021937	ENST00000357749.2:c.907A>G	X.37:g.85212893T>C	ENSP00000350386:p.Met303Val		A1L4D2|O43732	Missense_Mutation	SNP	pfam_GDP_dissociation_inhibitor,pirsf_Rab_geranylTrfase_A_euk,prints_Rab_escort,prints_GDP_dissociation_inhibitor	p.M303V	ENST00000357749.2	37	c.907	CCDS14454.1	X	.	.	.	.	.	.	.	.	.	.	T	1.800	-0.477246	0.04414	.	.	ENSG00000188419	ENST00000357749;ENST00000537751	D;D	0.85339	-1.97;-1.97	4.36	-0.658	0.11428	.	0.483736	0.25506	N	0.030201	T	0.55449	0.1921	N	0.02802	-0.49	0.23304	N	0.997941	B	0.02656	0.0	B	0.06405	0.002	T	0.44143	-0.9347	10	0.13470	T	0.59	-2.7113	0.8684	0.01209	0.23:0.1092:0.235:0.4258	.	303	P24386	RAE1_HUMAN	V	303;155	ENSP00000350386:M303V;ENSP00000441728:M155V	ENSP00000350386:M303V	M	-	1	0	CHM	85099549	1.000000	0.71417	0.999000	0.59377	0.929000	0.56500	0.533000	0.23082	0.056000	0.16144	0.339000	0.21740	ATG	CHM	-	pfam_GDP_dissociation_inhibitor,pirsf_Rab_geranylTrfase_A_euk,prints_Rab_escort,prints_GDP_dissociation_inhibitor	ENSG00000188419		0.294	CHM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHM	HGNC	protein_coding	OTTHUMT00000057396.3	-	0.00	48	0	T	NM_000390		85212893	-1	tier1	-	no_errors	ENST00000357749	ensembl	human	known	74_37	missense	82.50	7	33	SNP	0.991	C
CHN1	1123	genome.wustl.edu	37	2	175742705	175742705	+	Missense_Mutation	SNP	T	T	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr2:175742705T>A	ENST00000409900.3	-	6	725	c.412A>T	c.(412-414)Acg>Tcg	p.T138S	CHN1_ENST00000488080.1_Intron|CHN1_ENST00000409156.3_Missense_Mutation_p.T138S	NM_001822.5	NP_001813.1	P15882	CHIN_HUMAN	chimerin 1	138					ephrin receptor signaling pathway (GO:0048013)|motor neuron axon guidance (GO:0008045)|positive regulation of signal transduction (GO:0009967)|regulation of axonogenesis (GO:0050770)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(117;0.226)			GGGTTTATCGTCATCTTGGCA	0.428			T	TAF15	extraskeletal myxoid chondrosarcoma																																			Dom	yes		2	2q31-q32.1	1123	chimerin (chimaerin) 1		M	0													221.0	211.0	214.0					2																	175742705		1936	4148	6084	SO:0001583	missense	0				CCDS46454.1, CCDS46455.1, CCDS56147.1	2q31-q32.1	2013-02-14	2012-10-17		ENSG00000128656	ENSG00000128656		"""Rho GTPase activating proteins"", ""SH2 domain containing"""	1943	protein-coding gene	gene with protein product	"""Chimerin 1 (GTPase-activating protein, rho, 2)"", ""chimaerin 1"""	118423	"""Duane retraction syndrome 2"", ""chimerin (chimaerin) 1"""	CHN, DURS2		2299665, 15013773, 18653847	Standard	NM_001822		Approved	RhoGAP2, ARHGAP2, n-chimerin	uc002uji.3	P15882	OTTHUMG00000154225	ENST00000409900.3:c.412A>T	2.37:g.175742705T>A	ENSP00000386741:p.Thr138Ser		A8K1M6|B3KNU6|B4DV19|Q53SD6|Q53SH5|Q96FB0	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_SH2,superfamily_Rho_GTPase_activation_prot,smart_SH2,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pirsf_N-chimaerin,pfscan_SH2,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom,prints_DAG/PE-bd	p.T138S	ENST00000409900.3	37	c.412	CCDS46455.1	2	.	.	.	.	.	.	.	.	.	.	T	17.72	3.458710	0.63401	.	.	ENSG00000128656	ENST00000409900;ENST00000409156	T;T	0.62639	0.01;0.01	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.54240	0.1846	L	0.42245	1.32	0.58432	D	0.999999	P;P	0.47910	0.641;0.902	B;B	0.41466	0.19;0.358	T	0.52170	-0.8611	10	0.18276	T	0.48	.	15.0746	0.72066	0.0:0.0:0.0:1.0	.	138;138	B4DV19;P15882	.;CHIN_HUMAN	S	138	ENSP00000386741:T138S;ENSP00000386470:T138S	ENSP00000386470:T138S	T	-	1	0	CHN1	175450951	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.764000	0.85297	2.150000	0.67090	0.533000	0.62120	ACG	CHN1	-	pirsf_N-chimaerin	ENSG00000128656		0.428	CHN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHN1	HGNC	protein_coding	OTTHUMT00000334453.1	-	0.00	39	0	T	NM_001822		175742705	-1	tier1	-	no_errors	ENST00000409900	ensembl	human	known	74_37	missense	54.90	46	56	SNP	1.000	A
CHUK	1147	genome.wustl.edu	37	10	101959766	101959766	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr10:101959766G>T	ENST00000370397.7	-	16	1777	c.1691C>A	c.(1690-1692)gCc>gAc	p.A564D		NM_001278.3	NP_001269.3	O15111	IKKA_HUMAN	conserved helix-loop-helix ubiquitous kinase	564					anatomical structure morphogenesis (GO:0009653)|cellular response to tumor necrosis factor (GO:0071356)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell proliferation (GO:0033598)|morphogenesis of an epithelial sheet (GO:0002011)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|protein phosphorylation (GO:0006468)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to hydroperoxide (GO:0033194)|response to lipopolysaccharide (GO:0032496)|response to toxic substance (GO:0009636)|response to virus (GO:0009615)|Rho protein signal transduction (GO:0007266)|skeletal muscle contraction (GO:0003009)|striated muscle cell differentiation (GO:0051146)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|scaffold protein binding (GO:0097110)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(9)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)	27		Colorectal(252;0.117)		Epithelial(162;2.05e-10)|all cancers(201;1.91e-08)	Acetylcysteine(DB06151)|Aminosalicylic Acid(DB00233)|Mesalazine(DB00244)|Sulfasalazine(DB00795)	TAGATCAATGGCACGCTGTTC	0.333																																					Ovarian(159;52 1904 10536 35305 37148)												0													184.0	181.0	182.0					10																	101959766		2203	4300	6503	SO:0001583	missense	0			AF009225	CCDS7488.1	10q24-q25	2008-08-01			ENSG00000213341	ENSG00000213341			1974	protein-coding gene	gene with protein product		600664		TCF16		7558004, 16902410	Standard	XR_246062		Approved	IKK1, IKK-alpha, IkBKA, NFKBIKA, IKKA	uc001kqp.3	O15111	OTTHUMG00000018899	ENST00000370397.7:c.1691C>A	10.37:g.101959766G>T	ENSP00000359424:p.Ala564Asp		O14666|Q13132|Q5W0I4|Q92467	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_IKKbetaNEMObind,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.A564D	ENST00000370397.7	37	c.1691	CCDS7488.1	10	.	.	.	.	.	.	.	.	.	.	G	23.2	4.383669	0.82792	.	.	ENSG00000213341	ENST00000370397	T	0.25414	1.8	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.51160	0.1658	M	0.73217	2.22	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.53599	-0.8416	10	0.66056	D	0.02	-4.8528	16.1381	0.81502	0.0:0.0:1.0:0.0	.	564	O15111	IKKA_HUMAN	D	564	ENSP00000359424:A564D	ENSP00000359424:A564D	A	-	2	0	CHUK	101949756	1.000000	0.71417	0.999000	0.59377	0.889000	0.51656	6.968000	0.76086	2.413000	0.81919	0.558000	0.71614	GCC	CHUK	-	NULL	ENSG00000213341		0.333	CHUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHUK	HGNC	protein_coding	OTTHUMT00000049836.1		0.00	44	0	G	NM_001278		101959766	-1			no_errors	ENST00000370397	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	T
CLEC9A	283420	genome.wustl.edu	37	12	10218213	10218213	+	Silent	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr12:10218213G>T	ENST00000355819.1	+	9	1321	c.708G>T	c.(706-708)gcG>gcT	p.A236A		NM_207345.2	NP_997228.1	Q6UXN8	CLC9A_HUMAN	C-type lectin domain family 9, member A	236					positive regulation of cytokine secretion (GO:0050715)|receptor-mediated endocytosis (GO:0006898)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.A236A(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	22						AGAAGTATGCGTTGAGATCCT	0.438																																																	1	Substitution - coding silent(1)	large_intestine(1)											187.0	166.0	173.0					12																	10218213		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS8611.1	12p13.31	2010-04-27				ENSG00000197992		"""C-type lectin domain containing"""	26705	protein-coding gene	gene with protein product		612252					Standard	NM_207345		Approved	UNQ9341, HEEE9341	uc001qxa.3	Q6UXN8		ENST00000355819.1:c.708G>T	12.37:g.10218213G>T			B0ZBM2	Silent	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.A236	ENST00000355819.1	37	c.708	CCDS8611.1	12																																																																																			CLEC9A	-	superfamily_C-type_lectin_fold	ENSG00000197992		0.438	CLEC9A-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	CLEC9A	HGNC	protein_coding	OTTHUMT00000399564.1		0.00	30	0	G	NM_207345		10218213	+1			no_errors	ENST00000355819	ensembl	human	putative	74_37	silent	5.13	37	2	SNP	0.000	T
CLHC1	130162	genome.wustl.edu	37	2	55403045	55403045	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr2:55403045G>T	ENST00000401408.1	-	13	1987	c.1642C>A	c.(1642-1644)Cag>Aag	p.Q548K	CLHC1_ENST00000406076.1_Missense_Mutation_p.Q426K|CLHC1_ENST00000494539.1_5'UTR|CLHC1_ENST00000406437.2_Missense_Mutation_p.Q99K|CLHC1_ENST00000407122.1_Missense_Mutation_p.Q548K	NM_152385.2	NP_689598.2	Q8NHS4	CLHC1_HUMAN	clathrin heavy chain linker domain containing 1	548																	AAGCCATTCTGTGAACATATA	0.363																																																	0													119.0	114.0	115.0					2																	55403045		2203	4300	6503	SO:0001583	missense	0				CCDS33201.1, CCDS46287.1	2p16.1	2012-08-03	2012-08-03	2012-08-03	ENSG00000162994	ENSG00000162994			26453	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 63"""	C2orf63			Standard	NM_152385		Approved	FLJ31438	uc002ryi.2	Q8NHS4	OTTHUMG00000151918	ENST00000401408.1:c.1642C>A	2.37:g.55403045G>T	ENSP00000384869:p.Gln548Lys		B2RDV1|Q53R93|Q8N403	Missense_Mutation	SNP	superfamily_ARM-type_fold,pirsf_Clathrin_heavy-chain-rel	p.Q548K	ENST00000401408.1	37	c.1642	CCDS33201.1	2	.	.	.	.	.	.	.	.	.	.	G	14.77	2.633493	0.47049	.	.	ENSG00000162994	ENST00000406437;ENST00000407122;ENST00000401408;ENST00000406076	T;T;T;T	0.32515	1.45;2.21;2.21;2.21	5.91	4.99	0.66335	.	0.196908	0.35739	N	0.003008	T	0.31544	0.0800	M	0.69823	2.125	0.33312	D	0.566213	P	0.35844	0.524	B	0.31946	0.138	T	0.48258	-0.9051	10	0.37606	T	0.19	-10.8646	12.6183	0.56590	0.0:0.2516:0.7484:0.0	.	548	Q8NHS4	CB063_HUMAN	K	99;548;548;426	ENSP00000384810:Q99K;ENSP00000385778:Q548K;ENSP00000384869:Q548K;ENSP00000385512:Q426K	ENSP00000384869:Q548K	Q	-	1	0	C2orf63	55256549	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	2.817000	0.48034	2.814000	0.96858	0.650000	0.86243	CAG	CLHC1	-	pirsf_Clathrin_heavy-chain-rel	ENSG00000162994		0.363	CLHC1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CLHC1	HGNC	protein_coding	OTTHUMT00000324412.4	-	0.00	40	0	G	NM_152385		55403045	-1	tier1	-	no_errors	ENST00000401408	ensembl	human	known	74_37	missense	5.80	65	4	SNP	1.000	T
CLIP2	7461	genome.wustl.edu	37	7	73791017	73791017	+	Silent	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr7:73791017G>A	ENST00000395060.1	+	9	2286	c.2286G>A	c.(2284-2286)aaG>aaA	p.K762K	CLIP2_ENST00000361545.5_Silent_p.K727K|CLIP2_ENST00000223398.6_Silent_p.K762K			Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	762						cytoplasmic microtubule (GO:0005881)|microtubule associated complex (GO:0005875)|microtubule plus-end (GO:0035371)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|pancreas(1)|prostate(2)|skin(3)	30						CCGAGAAGAAGATGTTGGACT	0.607																																																	0													29.0	35.0	33.0					7																	73791017		2203	4300	6503	SO:0001819	synonymous_variant	0			AB006629	CCDS5569.1, CCDS5570.1	7q11.23	2008-06-12	2007-01-04	2007-01-04	ENSG00000106665	ENSG00000106665			2586	protein-coding gene	gene with protein product		603432	"""cytoplasmic linker 2"", ""Williams-Beuren syndrome chromosome region 3"""	WBSCR4, CYLN2, WBSCR3		8812460, 9799601	Standard	NM_003388		Approved	CLIP-115, KIAA0291, WSCR4, CLIP, WSCR3	uc003uam.3	Q9UDT6	OTTHUMG00000022980	ENST00000395060.1:c.2286G>A	7.37:g.73791017G>A			O14527|O43611	Silent	SNP	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,superfamily_t-SNARE,pfscan_CAP-Gly_domain	p.K762	ENST00000395060.1	37	c.2286	CCDS5569.1	7																																																																																			CLIP2	-	NULL	ENSG00000106665		0.607	CLIP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CLIP2	HGNC	protein_coding	OTTHUMT00000252556.1	-	0.00	67	0	G	NM_003388		73791017	+1	tier1	-	no_errors	ENST00000223398	ensembl	human	known	74_37	silent	22.47	69	20	SNP	1.000	A
CLPB	81570	genome.wustl.edu	37	11	72004486	72004486	+	Silent	SNP	G	G	T	rs200471243		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr11:72004486G>T	ENST00000294053.3	-	17	2222	c.2049C>A	c.(2047-2049)atC>atA	p.I683I	CLPB_ENST00000538021.1_Silent_p.I291I|CLPB_ENST00000340729.5_Silent_p.I624I|CLPB_ENST00000538039.1_Silent_p.I653I|CLPB_ENST00000543042.1_Silent_p.I482I|CLPB_ENST00000437826.2_Silent_p.I638I	NM_001258394.1|NM_030813.4	NP_001245323.1|NP_110440.1	Q9H078	CLPB_HUMAN	ClpB caseinolytic peptidase B homolog (E. coli)	683					cellular response to heat (GO:0034605)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)			endometrium(3)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	19						TGTCCTTGTCGATGATCTCCA	0.592																																																	0													134.0	104.0	114.0					11																	72004486		2200	4293	6493	SO:0001819	synonymous_variant	0			BC006404	CCDS8215.1, CCDS58152.1, CCDS58153.1, CCDS58154.1	11q13.4	2013-01-10			ENSG00000162129	ENSG00000162129		"""Ankyrin repeat domain containing"""	30664	protein-coding gene	gene with protein product	"""suppressor of potassium transport defect 3"""					11230166, 7835694	Standard	NM_030813		Approved	HSP78, SKD3, FLJ13152	uc010rqy.3	Q9H078	OTTHUMG00000167902	ENST00000294053.3:c.2049C>A	11.37:g.72004486G>T			B4DXJ7|B4DXP7|E7EWN6|F8W7P6|Q8ND11|Q9H8Y0	Silent	SNP	pfam_ATPase_AAA-2,pfam_Ankyrin_rpt,pfam_Clp_ATPase_C,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA_core,pfam_Zeta_toxin_domain,pfam_Sigma_54_int,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_AAA+_ATPase,prints_ClpA/B,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.I683	ENST00000294053.3	37	c.2049	CCDS8215.1	11																																																																																			CLPB	-	NULL	ENSG00000162129		0.592	CLPB-001	KNOWN	basic|CCDS	protein_coding	CLPB	HGNC	protein_coding	OTTHUMT00000396889.1		0.00	50	0	G	NM_030813		72004486	-1			no_errors	ENST00000294053	ensembl	human	known	74_37	silent	5.97	63	4	SNP	0.887	T
CNGA1	1259	genome.wustl.edu	37	4	47938583	47938583	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr4:47938583C>T	ENST00000514170.1	-	11	2247	c.1928G>A	c.(1927-1929)cGa>cAa	p.R643Q	CNGA1_ENST00000402813.3_Missense_Mutation_p.R712Q|CNGA1_ENST00000544810.1_Missense_Mutation_p.R643Q|CNGA1_ENST00000420489.2_Missense_Mutation_p.R643Q|CNGA1_ENST00000358519.4_Missense_Mutation_p.R643Q			P29973	CNGA1_HUMAN	cyclic nucleotide gated channel alpha 1	643					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|urinary_tract(1)	28						AGCCAAGATTCGGGCAAACCT	0.423																																																	0													132.0	126.0	128.0					4																	47938583		1884	4110	5994	SO:0001583	missense	0			M84741	CCDS43226.1, CCDS47050.1	4p12	2013-02-14				ENSG00000198515		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2148	protein-coding gene	gene with protein product		123825		CNCG1, CNCG		7683629, 16382102	Standard	NM_000087		Approved	RCNC1, RCNCa, CNG1, RP49	uc003gxu.3	P29973		ENST00000514170.1:c.1928G>A	4.37:g.47938583C>T	ENSP00000426862:p.Arg643Gln		A8K7K6|J3KPZ2|Q16279|Q16485|Q4W5E3	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.R712Q	ENST00000514170.1	37	c.2135	CCDS43226.1	4	.	.	.	.	.	.	.	.	.	.	C	22.2	4.255733	0.80135	.	.	ENSG00000198515	ENST00000402813;ENST00000514170;ENST00000544810;ENST00000358519;ENST00000420489	D;D;D;D;D	0.97066	-4.11;-4.23;-4.23;-4.23;-4.23	4.77	3.93	0.45458	.	0.053822	0.64402	N	0.000001	D	0.94961	0.8370	M	0.77712	2.385	0.54753	D	0.999988	P;P	0.38788	0.647;0.647	B;B	0.23150	0.044;0.044	D	0.93736	0.7046	10	0.52906	T	0.07	.	13.3431	0.60555	0.0:0.923:0.0:0.077	.	643;643	Q4W5E3;P29973	.;CNGA1_HUMAN	Q	712;643;643;643;643	ENSP00000384264:R712Q;ENSP00000426862:R643Q;ENSP00000443401:R643Q;ENSP00000351320:R643Q;ENSP00000389881:R643Q	ENSP00000351320:R643Q	R	-	2	0	CNGA1	47633340	0.998000	0.40836	0.992000	0.48379	0.925000	0.55904	3.826000	0.55738	1.132000	0.42129	0.491000	0.48974	CGA	CNGA1	-	NULL	ENSG00000198515		0.423	CNGA1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	CNGA1	HGNC	protein_coding	OTTHUMT00000372070.2		0.00	41	0	C	NM_000087		47938583	-1			no_errors	ENST00000402813	ensembl	human	known	74_37	missense	5.66	50	3	SNP	1.000	T
CNTLN	54875	genome.wustl.edu	37	9	17457615	17457615	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr9:17457615G>A	ENST00000380647.3	+	19	3292	c.3208G>A	c.(3208-3210)Gaa>Aaa	p.E1070K	CNTLN_ENST00000262360.5_Missense_Mutation_p.E1070K|CNTLN_ENST00000425824.1_Missense_Mutation_p.E1070K			Q9NXG0	CNTLN_HUMAN	centlein, centrosomal protein	1070					centriole-centriole cohesion (GO:0010457)|protein localization to organelle (GO:0033365)	centriole (GO:0005814)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)|protein binding, bridging (GO:0030674)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(6)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53				GBM - Glioblastoma multiforme(50;6.14e-10)		TTTGGCAGAAGAAAATTCCCA	0.363																																																	0													80.0	78.0	79.0					9																	17457615		1812	4074	5886	SO:0001583	missense	0			AK000283	CCDS43789.1, CCDS47953.1	9p22.2-p22.1	2008-11-11	2008-02-08	2008-02-08	ENSG00000044459	ENSG00000044459			23432	protein-coding gene	gene with protein product		611870	"""chromosome 9 open reading frame 101"", ""chromosome 9 open reading frame 39"""	C9orf101, C9orf39		18086554	Standard	XM_005251492		Approved	FLJ20276, bA340N12.1, OTTHUMG00000019597	uc003zmy.3	Q9NXG0	OTTHUMG00000019599	ENST00000380647.3:c.3208G>A	9.37:g.17457615G>A	ENSP00000370021:p.Glu1070Lys		A5Z2X6|Q5VYJ0|Q8N1G9|Q9HAJ5	Missense_Mutation	SNP	superfamily_Prefoldin	p.E1070K	ENST00000380647.3	37	c.3208	CCDS43789.1	9	.	.	.	.	.	.	.	.	.	.	G	11.62	1.693006	0.30052	.	.	ENSG00000044459	ENST00000380647;ENST00000425824;ENST00000262360	T;T;T	0.18960	2.18;2.18;2.44	4.31	4.31	0.51392	.	.	.	.	.	T	0.32133	0.0819	L	0.50919	1.6	0.27690	N	0.946131	D;P;P	0.56035	0.974;0.728;0.728	P;B;B	0.56216	0.794;0.297;0.297	T	0.04347	-1.0958	9	0.25106	T	0.35	.	13.006	0.58705	0.0:0.1764:0.8236:0.0	.	1070;1070;1070	Q9NXG0;C9J1F9;Q9NXG0-2	CNTLN_HUMAN;.;.	K	1070	ENSP00000370021:E1070K;ENSP00000392798:E1070K;ENSP00000262360:E1070K	ENSP00000262360:E1070K	E	+	1	0	CNTLN	17447615	0.421000	0.25465	0.994000	0.49952	0.726000	0.41606	1.438000	0.35002	2.691000	0.91804	0.585000	0.79938	GAA	CNTLN	-	NULL	ENSG00000044459		0.363	CNTLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNTLN	HGNC	protein_coding	OTTHUMT00000051793.3	-	0.00	121	0	G	NM_017738		17457615	+1	tier1	-	no_errors	ENST00000380647	ensembl	human	known	74_37	missense	25.75	124	43	SNP	0.950	A
COL11A1	1301	genome.wustl.edu	37	1	103343611	103343611	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:103343611G>T	ENST00000370096.3	-	67	5697	c.5385C>A	c.(5383-5385)ttC>ttA	p.F1795L	COL11A1_ENST00000353414.4_Missense_Mutation_p.F1756L|COL11A1_ENST00000512756.1_Missense_Mutation_p.F1679L|COL11A1_ENST00000358392.2_Missense_Mutation_p.F1807L	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1795	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.F1807F(1)		NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CTTCAAATCCGAACTTCTGAT	0.348																																																	1	Substitution - coding silent(1)	skin(1)											107.0	103.0	104.0					1																	103343611		2203	4300	6503	SO:0001583	missense	0			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.5385C>A	1.37:g.103343611G>T	ENSP00000359114:p.Phe1795Leu		B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Laminin_G,smart_Fib_collagen_C	p.F1807L	ENST00000370096.3	37	c.5421	CCDS778.1	1	.	.	.	.	.	.	.	.	.	.	g	14.52	2.559793	0.45590	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	T;T;T;T	0.76578	-1.03;-1.03;-1.03;-1.03	5.36	1.59	0.23543	Fibrillar collagen, C-terminal (4);	0.000000	0.85682	D	0.000000	T	0.72692	0.3492	M	0.89840	3.065	0.58432	D	0.999998	B;B;B;B;B	0.31968	0.129;0.106;0.3;0.349;0.106	B;B;B;B;B	0.34590	0.186;0.117;0.182;0.186;0.14	T	0.73792	-0.3871	10	0.72032	D	0.01	.	11.7623	0.51910	0.8675:0.0:0.1325:0.0	.	1679;1756;1807;1795;1015	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	L	1795;1807;1756;1015;1679	ENSP00000359114:F1795L;ENSP00000351163:F1807L;ENSP00000302551:F1756L;ENSP00000426533:F1679L	ENSP00000302551:F1756L	F	-	3	2	COL11A1	103116199	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	3.602000	0.54066	0.145000	0.18977	-1.380000	0.01176	TTC	COL11A1	-	pfam_Fib_collagen_C,smart_Fib_collagen_C	ENSG00000060718		0.348	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COL11A1	HGNC	protein_coding	OTTHUMT00000029997.1		0.00	38	0	G	NM_080630		103343611	-1			no_errors	ENST00000358392	ensembl	human	known	74_37	missense	6.12	46	3	SNP	1.000	T
COL1A2	1278	genome.wustl.edu	37	7	94052369	94052369	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr7:94052369G>A	ENST00000297268.6	+	40	2975	c.2504G>A	c.(2503-2505)gGt>gAt	p.G835D		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	835			G -> C (in OI3). {ECO:0000269|PubMed:16879195}.|G -> S (in OI1). {ECO:0000269|PubMed:8829649}.|Missing (in OI2). {ECO:0000269|PubMed:1339453}.		blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)		COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	GGAGAAGTAGGTGCAGTTGGT	0.562										HNSCC(75;0.22)																																							0													151.0	140.0	144.0					7																	94052369		2203	4300	6503	SO:0001583	missense	0			Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.2504G>A	7.37:g.94052369G>A	ENSP00000297268:p.Gly835Asp		P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fib_collagen_C	p.G835D	ENST00000297268.6	37	c.2504	CCDS34682.1	7	.	.	.	.	.	.	.	.	.	.	G	23.4	4.411054	0.83340	.	.	ENSG00000164692	ENST00000297268;ENST00000545487	D	0.99488	-6.0	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	D	0.99753	0.9901	H	0.97214	3.96	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97137	0.9822	10	0.87932	D	0	.	19.1875	0.93649	0.0:0.0:1.0:0.0	.	835	P08123	CO1A2_HUMAN	D	835;836	ENSP00000297268:G835D	ENSP00000297268:G835D	G	+	2	0	COL1A2	93890305	1.000000	0.71417	1.000000	0.80357	0.384000	0.30261	9.869000	0.99810	2.614000	0.88457	0.563000	0.77884	GGT	COL1A2	-	NULL	ENSG00000164692		0.562	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL1A2	HGNC	protein_coding	OTTHUMT00000309045.2	-	0.00	58	0	G	NM_000089		94052369	+1	tier1	-	no_errors	ENST00000297268	ensembl	human	known	74_37	missense	41.26	84	59	SNP	1.000	A
COL6A2	1292	genome.wustl.edu	37	21	47552323	47552323	+	Missense_Mutation	SNP	G	G	T	rs145959270		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr21:47552323G>T	ENST00000300527.4	+	28	3021	c.2917G>T	c.(2917-2919)Gtg>Ttg	p.V973L		NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	973	Nonhelical region.|VWFA 3. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		GGTACCCACCGTGCTGGCCTT	0.652																																																	0													71.0	61.0	64.0					21																	47552323		2202	4300	6502	SO:0001583	missense	0			M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.2917G>T	21.37:g.47552323G>T	ENSP00000300527:p.Val973Leu		Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.V973L	ENST00000300527.4	37	c.2917	CCDS13728.1	21	.	.	.	.	.	.	.	.	.	.	G	14.35	2.508554	0.44660	.	.	ENSG00000142173	ENST00000300527	D	0.86097	-2.07	4.4	4.4	0.53042	von Willebrand factor, type A (3);	0.069431	0.56097	D	0.000024	D	0.85843	0.5791	L	0.49350	1.555	0.80722	D	1	P	0.44006	0.824	P	0.50791	0.65	D	0.86586	0.1857	10	0.56958	D	0.05	-16.4704	12.1528	0.54059	0.0:0.0:0.8287:0.1713	.	973	P12110	CO6A2_HUMAN	L	973	ENSP00000300527:V973L	ENSP00000300527:V973L	V	+	1	0	COL6A2	46376751	1.000000	0.71417	0.998000	0.56505	0.321000	0.28281	7.542000	0.82095	2.001000	0.58596	0.297000	0.19635	GTG	COL6A2	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000142173		0.652	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A2	HGNC	protein_coding	OTTHUMT00000206971.1	-	0.00	40	0	G			47552323	+1	tier1	-	no_errors	ENST00000300527	ensembl	human	known	74_37	missense	46.43	15	13	SNP	0.998	T
CSMD1	64478	genome.wustl.edu	37	8	2824268	2824268	+	Splice_Site	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr8:2824268G>A	ENST00000520002.1	-	59	9482	c.8927C>T	c.(8926-8928)gCc>gTc	p.A2976V	CSMD1_ENST00000537824.1_Splice_Site_p.A2975V|CSMD1_ENST00000602557.1_Splice_Site_p.A2976V|CSMD1_ENST00000400186.3_Intron|CSMD1_ENST00000602723.1_Intron|CSMD1_ENST00000542608.1_Intron			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2976	Sushi 22. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		ACAGGACACGGCTGTTAGGCA	0.507																																																	0													46.0	47.0	47.0					8																	2824268		2065	4214	6279	SO:0001630	splice_region_variant	0					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.8927-1C>T	8.37:g.2824268G>A			Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.A2976V	ENST00000520002.1	37	c.8927		8	.	.	.	.	.	.	.	.	.	.	G	9.620	1.133684	0.21123	.	.	ENSG00000183117	ENST00000520002;ENST00000318252;ENST00000537824	T;T	0.24908	1.83;1.83	5.46	5.46	0.80206	Complement control module (2);Sushi/SCR/CCP (1);	0.000000	0.85682	D	0.000000	T	0.32496	0.0831	N	0.17901	0.54	0.80722	D	1	D;B	0.69078	0.997;0.004	D;B	0.70716	0.97;0.009	T	0.02179	-1.1200	10	0.02654	T	1	.	19.3169	0.94218	0.0:0.0:1.0:0.0	.	2976;2976	E5RIG2;Q96PZ7	.;CSMD1_HUMAN	V	2976;2837;2975	ENSP00000430733:A2976V;ENSP00000441462:A2975V	ENSP00000320445:A2837V	A	-	2	0	CSMD1	2811675	1.000000	0.71417	0.420000	0.26596	0.273000	0.26683	5.173000	0.65010	2.557000	0.86248	0.655000	0.94253	GCC	CSMD1	-	superfamily_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000183117		0.507	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	HGNC	protein_coding	OTTHUMT00000374500.2		0.00	48	0	G	NM_033225	Missense_Mutation	2824268	-1			no_errors	ENST00000520002	ensembl	human	known	74_37	missense	5.56	68	4	SNP	0.996	A
CSMD1	64478	genome.wustl.edu	37	8	2967710	2967710	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr8:2967710G>A	ENST00000520002.1	-	44	7136	c.6581C>T	c.(6580-6582)aCg>aTg	p.T2194M	CSMD1_ENST00000537824.1_Missense_Mutation_p.T2193M|CSMD1_ENST00000602557.1_Missense_Mutation_p.T2194M|CSMD1_ENST00000400186.3_Missense_Mutation_p.T2194M|CSMD1_ENST00000602723.1_Missense_Mutation_p.T2194M|CSMD1_ENST00000542608.1_Missense_Mutation_p.T2193M			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2194	CUB 13. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GACAGCTTCCGTCTGTAACAG	0.448																																																	0													98.0	97.0	97.0					8																	2967710		1958	4134	6092	SO:0001583	missense	0					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.6581C>T	8.37:g.2967710G>A	ENSP00000430733:p.Thr2194Met		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.T2194M	ENST00000520002.1	37	c.6581		8	.	.	.	.	.	.	.	.	.	.	G	15.64	2.893250	0.52121	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608	T;T;T;T	0.18960	2.18;2.18;2.18;2.18	4.96	4.96	0.65561	CUB (5);	0.000000	0.85682	D	0.000000	T	0.43634	0.1256	L	0.56199	1.76	0.80722	D	1	D;P;D	0.89917	1.0;0.911;1.0	D;P;D	0.91635	0.998;0.658;0.999	T	0.20075	-1.0286	10	0.45353	T	0.12	.	18.564	0.91111	0.0:0.0:1.0:0.0	.	2194;2194;2193	E5RIG2;Q96PZ7;F5H2I8	.;CSMD1_HUMAN;.	M	2194;2194;2055;2193;2193	ENSP00000383047:T2194M;ENSP00000430733:T2194M;ENSP00000441462:T2193M;ENSP00000446243:T2193M	ENSP00000320445:T2055M	T	-	2	0	CSMD1	2955117	1.000000	0.71417	0.946000	0.38457	0.223000	0.24884	5.911000	0.69939	2.461000	0.83175	0.453000	0.30009	ACG	CSMD1	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000183117		0.448	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	HGNC	protein_coding	OTTHUMT00000374500.2	-	0.00	55	0	G	NM_033225		2967710	-1	tier1	-	no_errors	ENST00000520002	ensembl	human	known	74_37	missense	25.64	58	20	SNP	0.995	A
CSMD3	114788	genome.wustl.edu	37	8	113299394	113299394	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr8:113299394G>T	ENST00000297405.5	-	58	9474	c.9230C>A	c.(9229-9231)aCt>aAt	p.T3077N	CSMD3_ENST00000455883.2_Missense_Mutation_p.T2908N|CSMD3_ENST00000352409.3_Missense_Mutation_p.T3007N|CSMD3_ENST00000343508.3_Missense_Mutation_p.T3037N	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	3077	Sushi 22. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T3037I(1)|p.T3077I(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ATAACGTACAGTACTTTTAGT	0.473										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							2	Substitution - Missense(2)	lung(2)											178.0	150.0	159.0					8																	113299394		2203	4300	6503	SO:0001583	missense	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.9230C>A	8.37:g.113299394G>T	ENSP00000297405:p.Thr3077Asn		Q96PZ3	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.T3077N	ENST00000297405.5	37	c.9230	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	G	11.64	1.698518	0.30142	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21;-0.21	5.36	2.5	0.30297	Complement control module (2);Sushi/SCR/CCP (3);	0.652914	0.14801	N	0.297625	T	0.60274	0.2256	M	0.65498	2.005	0.20926	N	0.999828	B;B;B	0.23316	0.035;0.083;0.074	B;B;B	0.30943	0.036;0.122;0.091	T	0.51639	-0.8680	10	0.31617	T	0.26	.	3.6034	0.08032	0.12:0.1202:0.5131:0.2466	.	2908;3077;3037	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	N	3037;3077;2347;2908;3007	ENSP00000345799:T3037N;ENSP00000297405:T3077N;ENSP00000341558:T2347N;ENSP00000412263:T2908N;ENSP00000343124:T3007N	ENSP00000297405:T3077N	T	-	2	0	CSMD3	113368570	0.565000	0.26610	0.986000	0.45419	0.993000	0.82548	0.814000	0.27239	0.728000	0.32382	0.650000	0.86243	ACT	CSMD3	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000164796		0.473	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1		0.00	26	0	G	NM_052900		113299394	-1			no_errors	ENST00000297405	ensembl	human	known	74_37	missense	6.45	29	2	SNP	0.421	T
CYP19A1	1588	genome.wustl.edu	37	15	51507369	51507369	+	Missense_Mutation	SNP	C	C	A	rs370257485		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr15:51507369C>A	ENST00000396402.1	-	8	1072	c.919G>T	c.(919-921)Gct>Tct	p.A307S	CYP19A1_ENST00000396404.4_Missense_Mutation_p.A307S|CYP19A1_ENST00000260433.2_Missense_Mutation_p.A307S|CYP19A1_ENST00000559878.1_Missense_Mutation_p.A307S|RP11-108K3.1_ENST00000559909.1_lincRNA	NM_000103.3	NP_000094.2	P11511	CP19A_HUMAN	cytochrome P450, family 19, subfamily A, polypeptide 1	307					androgen metabolic process (GO:0008209)|estrogen biosynthetic process (GO:0006703)|prostate gland growth (GO:0060736)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)	aromatase activity (GO:0070330)|electron carrier activity (GO:0009055)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)			endometrium(1)|kidney(4)|large_intestine(9)|lung(11)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	33				all cancers(107;0.000372)|GBM - Glioblastoma multiforme(94;0.0128)	Aminoglutethimide(DB00357)|Anastrozole(DB01217)|Betamethasone(DB00443)|Bifonazole(DB04794)|Buserelin(DB06719)|Carbimazole(DB00389)|Chlorphenesin(DB00856)|Clomifene(DB00882)|Clotrimazole(DB00257)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Dexamethasone(DB01234)|Diethylstilbestrol(DB00255)|Dinoprostone(DB00917)|Drostanolone(DB00858)|Econazole(DB01127)|Edetic Acid(DB00974)|Etomidate(DB00292)|Exemestane(DB00990)|Ketoconazole(DB01026)|Letrozole(DB01006)|Levomethadyl Acetate(DB01227)|Levonorgestrel(DB00367)|Mefloquine(DB00358)|Melatonin(DB01065)|Methadone(DB00333)|Methyltestosterone(DB06710)|Miconazole(DB01110)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nicotine(DB00184)|Paclitaxel(DB01229)|Raloxifene(DB00481)|Sulfathiazole(DB06147)|Tamoxifen(DB00675)|Terbinafine(DB00857)|Testolactone(DB00894)|Testosterone(DB00624)|Tioconazole(DB01007)|Trastuzumab(DB00072)	GTGTCAGGAGCTGCGATCAGC	0.398																																					Melanoma(142;1016 1807 39614 48966 51721)												0													131.0	124.0	127.0					15																	51507369		2196	4293	6489	SO:0001583	missense	0			D14473	CCDS10139.1	15q21	2009-01-26	2003-02-14	2003-02-28	ENSG00000137869	ENSG00000137869		"""Cytochrome P450s"""	2594	protein-coding gene	gene with protein product		107910	"""cytochrome P450, subfamily XIX (aromatization of androgens)"""	CYP19		8477708	Standard	NM_031226		Approved	ARO, P-450AROM, CPV1, ARO1, CYAR, aromatase	uc001zza.4	P11511	OTTHUMG00000131747	ENST00000396402.1:c.919G>T	15.37:g.51507369C>A	ENSP00000379683:p.Ala307Ser		Q16731|Q3B764|Q58FA0|Q8IYJ7	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.A307S	ENST00000396402.1	37	c.919	CCDS10139.1	15	.	.	.	.	.	.	.	.	.	.	C	29.7	5.024426	0.93518	.	.	ENSG00000137869	ENST00000396402;ENST00000260433;ENST00000396404;ENST00000420301;ENST00000439712	T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	D	0.83889	0.5352	M	0.79926	2.475	0.80722	D	1	D	0.63046	0.992	D	0.77557	0.99	D	0.84472	0.0600	10	0.72032	D	0.01	-18.3898	20.3539	0.98825	0.0:1.0:0.0:0.0	.	307	P11511	CP19A_HUMAN	S	307	ENSP00000379683:A307S;ENSP00000260433:A307S;ENSP00000379685:A307S;ENSP00000390614:A307S	ENSP00000260433:A307S	A	-	1	0	CYP19A1	49294661	1.000000	0.71417	0.504000	0.27639	0.752000	0.42762	7.480000	0.81109	2.826000	0.97356	0.655000	0.94253	GCT	CYP19A1	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV	ENSG00000137869		0.398	CYP19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP19A1	HGNC	protein_coding	OTTHUMT00000254669.1		0.00	35	0	C			51507369	-1			no_errors	ENST00000260433	ensembl	human	known	74_37	missense	6.38	44	3	SNP	1.000	A
CYP11A1	1583	genome.wustl.edu	37	15	74636231	74636231	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr15:74636231G>T	ENST00000268053.6	-	4	882	c.728C>A	c.(727-729)aCc>aAc	p.T243N	CYP11A1_ENST00000358632.4_Missense_Mutation_p.T85N|CYP11A1_ENST00000541301.1_3'UTR|CYP11A1_ENST00000419019.2_Missense_Mutation_p.T85N	NM_000781.2	NP_000772.2	P05108	CP11A_HUMAN	cytochrome P450, family 11, subfamily A, polypeptide 1	243					biphenyl metabolic process (GO:0018879)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to antibiotic (GO:0071236)|cellular response to cadmium ion (GO:0071276)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|cerebellum development (GO:0021549)|cholesterol metabolic process (GO:0008203)|dibenzo-p-dioxin metabolic process (GO:0018894)|estrogen biosynthetic process (GO:0006703)|fractalkine metabolic process (GO:0050756)|granulosa cell differentiation (GO:0060014)|hippocampus development (GO:0021766)|Leydig cell differentiation (GO:0033327)|maternal process involved in female pregnancy (GO:0060135)|mating behavior (GO:0007617)|phenol-containing compound metabolic process (GO:0018958)|phthalate metabolic process (GO:0018963)|progesterone biosynthetic process (GO:0006701)|response to alkaloid (GO:0043279)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to fungicide (GO:0060992)|response to gamma radiation (GO:0010332)|response to genistein (GO:0033595)|response to hydrogen peroxide (GO:0042542)|response to insecticide (GO:0017085)|response to L-ascorbic acid (GO:0033591)|response to salt stress (GO:0009651)|response to vitamin E (GO:0033197)|Schwann cell differentiation (GO:0014037)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|testosterone biosynthetic process (GO:0061370)|vitamin D metabolic process (GO:0042359)|xenobiotic metabolic process (GO:0006805)	mitochondrial crista (GO:0030061)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|perikaryon (GO:0043204)	cholesterol binding (GO:0015485)|cholesterol monooxygenase (side-chain-cleaving) activity (GO:0008386)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(3)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20					Aminoglutethimide(DB00357)|Cholecalciferol(DB00169)|Clomifene(DB00882)|Clotrimazole(DB00257)|Dexamethasone(DB01234)|Digitoxin(DB01396)|Digoxin(DB00390)|Dinoprostone(DB00917)|Glutethimide(DB01437)|Ketoconazole(DB01026)|Omeprazole(DB00338)|Saquinavir(DB01232)|Terbinafine(DB00857)|Testosterone(DB00624)	GGGGACGCTGGTGTGGAACAT	0.542																																					Esophageal Squamous(87;818 1337 4093 9268 37314)												0													165.0	152.0	156.0					15																	74636231		2197	4296	6493	SO:0001583	missense	0			AK056794	CCDS32291.1, CCDS45303.1	15q23-q24	2010-05-04	2003-01-14	2003-01-17	ENSG00000140459	ENSG00000140459	1.14.15.6	"""Cytochrome P450s"""	2590	protein-coding gene	gene with protein product	"""cholesterol monooxygenase (side-chain-cleaving)"""	118485	"""cytochrome P450, subfamily XIA (cholesterol side chain cleavage)"""	CYP11A			Standard	NM_000781		Approved	P450SCC	uc002axt.2	P05108	OTTHUMG00000150716	ENST00000268053.6:c.728C>A	15.37:g.74636231G>T	ENSP00000268053:p.Thr243Asn		A8K8D5|B3KPU8|G3XAD7|Q15081|Q16805|Q8N1A7	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_mitochondrial,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.T243N	ENST00000268053.6	37	c.728	CCDS32291.1	15	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.6|20.6	4.010288|4.010288	0.75046|0.75046	.|.	.|.	ENSG00000140459|ENSG00000140459	ENST00000452422|ENST00000268053;ENST00000358632;ENST00000419019;ENST00000450547	.|T;T;T	.|0.68479	.|-0.33;-0.33;-0.33	4.33|4.33	3.38|3.38	0.38709|0.38709	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.78123|0.78123	0.4234|0.4234	L|L	0.61218|0.61218	1.895|1.895	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.87578	.|0.993;0.998	T|T	0.78066|0.78066	-0.2349|-0.2349	6|10	0.02654|0.49607	T|T	1|0.09	-20.8241|-20.8241	13.6072|13.6072	0.62054|0.62054	0.0:0.1572:0.8428:0.0|0.0:0.1572:0.8428:0.0	.|.	.|213;243	.|B4DTE5;P05108	.|.;CP11A_HUMAN	T|N	9|243;85;85;155	.|ENSP00000268053:T243N;ENSP00000351455:T85N;ENSP00000405488:T85N	ENSP00000391041:P9T|ENSP00000268053:T243N	P|T	-|-	1|2	0|0	CYP11A1|CYP11A1	72423284|72423284	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.850000|0.850000	0.48378|0.48378	7.161000|7.161000	0.77505|0.77505	0.791000|0.791000	0.33826|0.33826	0.537000|0.537000	0.68136|0.68136	CCA|ACC	CYP11A1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000140459		0.542	CYP11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP11A1	HGNC	protein_coding	OTTHUMT00000319737.1	-	0.00	71	0	G			74636231	-1	tier1	-	no_errors	ENST00000268053	ensembl	human	known	74_37	missense	7.55	49	4	SNP	1.000	T
CYP4F22	126410	genome.wustl.edu	37	19	15658973	15658973	+	Silent	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr19:15658973C>A	ENST00000269703.3	+	11	1390	c.1191C>A	c.(1189-1191)cgC>cgA	p.R397R	CYP4F22_ENST00000601005.2_Silent_p.R397R	NM_173483.3	NP_775754.2	Q6NT55	CP4FN_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 22	397						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			endometrium(6)|large_intestine(9)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|soft_tissue(1)	37						AGAGCCTGCGCCAGTACCCAC	0.562																																																	0													170.0	152.0	158.0					19																	15658973		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS12331.1	19p13.12	2013-11-11			ENSG00000171954	ENSG00000171954		"""Cytochrome P450s"""	26820	protein-coding gene	gene with protein product		611495				16436457	Standard	NM_173483		Approved	FLJ39501	uc002nbh.4	Q6NT55	OTTHUMG00000182451	ENST00000269703.3:c.1191C>A	19.37:g.15658973C>A			Q8N8H4	Silent	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.R397	ENST00000269703.3	37	c.1191	CCDS12331.1	19																																																																																			CYP4F22	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450	ENSG00000171954		0.562	CYP4F22-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP4F22	HGNC	protein_coding	OTTHUMT00000461338.2	-	0.00	43	0	C	NM_173483		15658973	+1	tier1	-	no_errors	ENST00000269703	ensembl	human	known	74_37	silent	7.14	52	4	SNP	0.721	A
CYP4F35P	284233	genome.wustl.edu	37	18	14339564	14339564	+	lincRNA	SNP	C	C	T	rs567588032		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr18:14339564C>T	ENST00000582957.1	+	0	1528					NR_026756.1				cytochrome P450, family 4, subfamily F, polypeptide 35, pseudogene																		TCCTCAACCCCGGGTCTGAca	0.542													.|||	1	0.000199681	0.0008	0.0	5008	,	,		19087	0.0		0.0	False		,,,				2504	0.0																0																																												0					18p11.21	2013-11-11			ENSG00000265787	ENSG00000265787		"""Cytochrome P450s"""	39954	pseudogene	pseudogene							Standard	NR_026756		Approved	CYP4F-se8[6:7:8]	uc002ktb.3		OTTHUMG00000178670		18.37:g.14339564C>T				RNA	SNP	-	NULL	ENST00000582957.1	37	NULL		18																																																																																			CYP4F35P	-	-	ENSG00000265787		0.542	CYP4F35P-001	KNOWN	basic	lincRNA	CYP4F35P	HGNC	lincRNA	OTTHUMT00000442865.1	-	0.00	44	0	C	NR_026756		14339564	+1	tier1	-	no_errors	ENST00000582957	ensembl	human	known	74_37	rna	45.24	22	19	SNP	0.088	T
DAAM2	23500	genome.wustl.edu	37	6	39846262	39846262	+	Silent	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr6:39846262G>A	ENST00000398904.2	+	13	1625	c.1443G>A	c.(1441-1443)cgG>cgA	p.R481R	DAAM2_ENST00000274867.4_Silent_p.R481R|DAAM2_ENST00000538976.1_Silent_p.R481R			Q86T65	DAAM2_HUMAN	dishevelled associated activator of morphogenesis 2	481					actin cytoskeleton organization (GO:0030036)|determination of left/right symmetry (GO:0007368)					NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(18)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)	49	Ovarian(28;0.0355)|Colorectal(47;0.196)					AGATGATGCGGACGCTGAACA	0.582																																																	0													44.0	50.0	48.0					6																	39846262		2038	4190	6228	SO:0001819	synonymous_variant	0			AB002379	CCDS54999.1, CCDS56426.1	6p21.1	2008-07-30			ENSG00000146122	ENSG00000146122			18143	protein-coding gene	gene with protein product		606627				11779461, 12632087	Standard	NM_015345		Approved	KIAA0381	uc003oow.3	Q86T65	OTTHUMG00000014653	ENST00000398904.2:c.1443G>A	6.37:g.39846262G>A			G5EA45|Q5T4T8|Q5T4U0|Q9NQI5|Q9Y4G0	Silent	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,superfamily_ARM-type_fold,smart_FH2_Formin	p.R481	ENST00000398904.2	37	c.1443	CCDS56426.1	6																																																																																			DAAM2	-	NULL	ENSG00000146122		0.582	DAAM2-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	DAAM2	HGNC	protein_coding	OTTHUMT00000280648.1	-	0.00	61	0	G			39846262	+1	tier1	-	no_errors	ENST00000274867	ensembl	human	known	74_37	silent	17.07	68	14	SNP	1.000	A
DACT3	147906	genome.wustl.edu	37	19	47151905	47151905	+	Nonsense_Mutation	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr19:47151905C>T	ENST00000391916.2	-	4	1797	c.1724G>A	c.(1723-1725)tGg>tAg	p.W575*	DACT3_ENST00000300875.4_Nonsense_Mutation_p.W350*	NM_145056.2	NP_659493.2	Q96B18	DACT3_HUMAN	dishevelled-binding antagonist of beta-catenin 3	575					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)	delta-catenin binding (GO:0070097)|protein kinase A binding (GO:0051018)|protein kinase C binding (GO:0005080)			lung(1)	1		Ovarian(192;0.0798)|all_neural(266;0.107)		OV - Ovarian serous cystadenocarcinoma(262;0.000173)|all cancers(93;0.000464)|Epithelial(262;0.02)|GBM - Glioblastoma multiforme(486;0.0325)		CTGCTGCGGCCACACGAGGCC	0.692																																																	0													29.0	41.0	37.0					19																	47151905		2186	4257	6443	SO:0001587	stop_gained	0				CCDS12688.2, CCDS74402.1	19q13.32	2013-05-15	2013-05-15	2006-09-25	ENSG00000197380	ENSG00000197380			30745	protein-coding gene	gene with protein product		611112	"""arginine rich region 1"", ""dapper, antagonist of beta-catenin, homolog 3 (Xenopus laevis)"""	RRR1		16881060	Standard	NM_145056		Approved	MGC15476, DAPPER3	uc010ekq.3	Q96B18	OTTHUMG00000153070	ENST00000391916.2:c.1724G>A	19.37:g.47151905C>T	ENSP00000375783:p.Trp575*			Nonsense_Mutation	SNP	NULL	p.W575*	ENST00000391916.2	37	c.1724	CCDS12688.2	19	.	.	.	.	.	.	.	.	.	.	C	40	8.235001	0.98719	.	.	ENSG00000197380	ENST00000391916;ENST00000300875	.	.	.	3.11	3.11	0.35812	.	0.000000	0.40728	U	0.001037	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.2012	12.0067	0.53263	0.0:1.0:0.0:0.0	.	.	.	.	X	575;350	.	ENSP00000300875:W350X	W	-	2	0	DACT3	51843745	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	6.835000	0.75344	1.710000	0.51325	0.289000	0.19496	TGG	DACT3	-	NULL	ENSG00000197380		0.692	DACT3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	DACT3	HGNC	protein_coding	OTTHUMT00000334090.1	-	0.00	20	0	C	NM_145056		47151905	-1	tier1	-	no_errors	ENST00000391916	ensembl	human	known	74_37	nonsense	72.73	6	16	SNP	1.000	T
DBF4	10926	genome.wustl.edu	37	7	87507388	87507389	+	Frame_Shift_Ins	INS	-	-	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr7:87507388_87507389insA	ENST00000265728.1	+	2	571_572	c.67_68insA	c.(67-69)gaafs	p.E23fs	SLC25A40_ENST00000341119.5_5'Flank	NM_006716.3	NP_006707.1	Q9UBU7	DBF4A_HUMAN	DBF4 zinc finger	23					DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of catalytic activity (GO:0043085)	nucleoplasm (GO:0005654)	enzyme activator activity (GO:0008047)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|skin(3)	28	Esophageal squamous(14;0.00202)	Breast(660;0.0334)				AGTCAAAAATGAAAAAAACAGA	0.302																																																	0																																										SO:0001589	frameshift_variant	0			AF160876	CCDS5611.1	7q21.3	2014-02-17	2014-02-17		ENSG00000006634	ENSG00000006634		"""Zinc fingers, DBF-type"""	17364	protein-coding gene	gene with protein product	"""activator of S phase kinase"", ""chiffon homolog (Drosophila)"", ""zinc finger, DBF-type containing 1"", ""DBF4 zinc finger A"""	604281	"""DBF4 homolog (S. cerevisiae)"""			10373557, 10517317	Standard	NM_006716		Approved	ASK, chif, ZDBF1, DBF4A	uc003ujf.1	Q9UBU7	OTTHUMG00000131034	ENST00000265728.1:c.74dupA	7.37:g.87507395_87507395dupA	ENSP00000265728:p.Glu23fs		A4D1D8|A8K954|O75226|Q75MS6|Q75N01|Q9Y2M6	Frame_Shift_Ins	INS	pfam_Znf_DBF,superfamily_BRCT_dom,smart_Znf_DBF	p.N25fs	ENST00000265728.1	37	c.67_68	CCDS5611.1	7																																																																																			DBF4	-	NULL	ENSG00000006634		0.302	DBF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DBF4	HGNC	protein_coding	OTTHUMT00000253678.1		0.00	165	0	-	NM_006716		87507389	+1	tier1		no_errors	ENST00000265728	ensembl	human	known	74_37	frame_shift_ins	40.09	139	93	INS	1.000:1.000	A
DCBLD1	285761	genome.wustl.edu	37	6	117859897	117859897	+	Missense_Mutation	SNP	T	T	G			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr6:117859897T>G	ENST00000338728.5	+	8	995	c.875T>G	c.(874-876)cTt>cGt	p.L292R	DCBLD1_ENST00000368503.4_Intron|DCBLD1_ENST00000296955.8_Missense_Mutation_p.L292R|GOPC_ENST00000467125.1_Intron			Q8N8Z6	DCBD1_HUMAN	discoidin, CUB and LCCL domain containing 1	292	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(15)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	26		all_cancers(87;0.171)		GBM - Glioblastoma multiforme(226;0.0447)|OV - Ovarian serous cystadenocarcinoma(136;0.0921)|all cancers(137;0.125)		CAAGCCCGACTTCAGGACCAA	0.517																																																	0													59.0	56.0	57.0					6																	117859897		2203	4300	6503	SO:0001583	missense	0			AK055462	CCDS34522.1	6q22.31	2003-06-20			ENSG00000164465	ENSG00000164465			21479	protein-coding gene	gene with protein product							Standard	NM_173674		Approved	MGC46341, dJ94G16.1	uc003pxs.3	Q8N8Z6	OTTHUMG00000015455	ENST00000338728.5:c.875T>G	6.37:g.117859897T>G	ENSP00000342422:p.Leu292Arg		Q5H992|Q8IYK5|Q8N7L9|Q96NH2	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_LCCL,pfam_CUB_dom,superfamily_Galactose-bd-like,superfamily_LCCL,superfamily_CUB_dom,smart_CUB_dom,smart_LCCL,smart_Coagulation_fac_5/8-C_type_dom,pfscan_CUB_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_LCCL	p.L292R	ENST00000338728.5	37	c.875		6	.	.	.	.	.	.	.	.	.	.	T	16.93	3.257342	0.59321	.	.	ENSG00000164465	ENST00000296955;ENST00000338728	D;D	0.98701	-5.08;-5.08	4.17	1.63	0.23807	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.424932	0.23340	N	0.049258	D	0.98298	0.9436	H	0.96805	3.885	0.80722	D	1	P;B	0.35600	0.511;0.413	B;B	0.43225	0.412;0.219	D	0.97556	1.0095	10	0.87932	D	0	-6.0862	7.2645	0.26222	0.144:0.0:0.1507:0.7053	.	292;292	Q8N8Z6-2;Q8N8Z6	.;DCBD1_HUMAN	R	292	ENSP00000296955:L292R;ENSP00000342422:L292R	ENSP00000296955:L292R	L	+	2	0	DCBLD1	117966590	0.997000	0.39634	0.933000	0.37362	0.915000	0.54546	2.604000	0.46274	0.145000	0.18977	0.379000	0.24179	CTT	DCBLD1	-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	ENSG00000164465		0.517	DCBLD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	DCBLD1	HGNC	protein_coding	OTTHUMT00000041979.2	-	0.00	41	0	T	NM_173674		117859897	+1	tier1	-	no_errors	ENST00000338728	ensembl	human	known	74_37	missense	7.69	60	5	SNP	0.951	G
DCHS1	8642	genome.wustl.edu	37	11	6651816	6651816	+	Silent	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr11:6651816G>A	ENST00000299441.3	-	10	4620	c.4209C>T	c.(4207-4209)cgC>cgT	p.R1403R	RP11-732A19.6_ENST00000526633.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	1403	Cadherin 13. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCGTAAGCGCGCGCCACGGCG	0.726																																																	0													2.0	3.0	3.0					11																	6651816		1390	3110	4500	SO:0001819	synonymous_variant	0			AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.4209C>T	11.37:g.6651816G>A			O15098	Silent	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R1403	ENST00000299441.3	37	c.4209	CCDS7771.1	11																																																																																			DCHS1	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000166341		0.726	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS1	HGNC	protein_coding	OTTHUMT00000257258.1		0.00	13	0	G	NM_003737		6651816	-1			no_errors	ENST00000299441	ensembl	human	known	74_37	silent	50.00	3	3	SNP	1.000	A
DCT	1638	genome.wustl.edu	37	13	95092239	95092239	+	Silent	SNP	A	A	G			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr13:95092239A>G	ENST00000377028.5	-	8	1886	c.1473T>C	c.(1471-1473)gcT>gcC	p.A491A	DCT_ENST00000446125.1_Silent_p.A524A	NM_001922.3	NP_001913.2	P40126	TYRP2_HUMAN	dopachrome tautomerase	491					cell development (GO:0048468)|developmental pigmentation (GO:0048066)|epidermis development (GO:0008544)|melanin biosynthetic process from tyrosine (GO:0006583)|positive regulation of neuroblast proliferation (GO:0002052)|ventricular zone neuroblast division (GO:0021847)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)	copper ion binding (GO:0005507)|dopachrome isomerase activity (GO:0004167)|oxidoreductase activity (GO:0016491)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	50	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)		ATTGAAGAAAAGCCAACAGCA	0.438																																																	0													102.0	102.0	102.0					13																	95092239		2203	4300	6503	SO:0001819	synonymous_variant	0			D17547	CCDS9470.1, CCDS45060.1	13q32	2012-09-28	2012-09-28		ENSG00000080166	ENSG00000080166	5.3.3.12		2709	protein-coding gene	gene with protein product	"""dopachrome delta-isomerase"""	191275	"""tyrosine-related protein 2"""	TYRP2		8306979	Standard	NM_001922		Approved		uc010afh.3	P40126	OTTHUMG00000017206	ENST00000377028.5:c.1473T>C	13.37:g.95092239A>G			Q09GT4	Silent	SNP	pfam_Tyrosinase,superfamily_Unchr_di-copper_centre,prints_Tyrosinase	p.A524	ENST00000377028.5	37	c.1572	CCDS9470.1	13																																																																																			DCT	-	NULL	ENSG00000080166		0.438	DCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCT	HGNC	protein_coding	OTTHUMT00000045461.3	-	0.00	34	0	A			95092239	-1	tier1	-	no_errors	ENST00000446125	ensembl	human	known	74_37	silent	58.49	22	31	SNP	0.003	G
DDX3Y	8653	genome.wustl.edu	37	Y	15021383	15021383	+	Intron	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chrY:15021383G>T	ENST00000336079.3	+	3	257				DDX3Y_ENST00000360160.4_Intron	NM_001122665.1|NM_004660.3	NP_001116137.1|NP_004651.2	O15523	DDX3Y_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 3, Y-linked							cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)|RNA binding (GO:0003723)			kidney(1)|liver(2)|lung(1)|upper_aerodigestive_tract(1)	5						AGGGAAGAAAGTAACTTTAGG	0.388																																																	0													37.0	34.0	35.0					Y																	15021383		176	791	967	SO:0001627	intron_variant	0			AF000984	CCDS14782.1	Yq11	2013-07-16	2013-07-16	2003-06-20	ENSG00000067048	ENSG00000067048		"""DEAD-boxes"""	2699	protein-coding gene	gene with protein product		400010	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide, Y chromosome"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked"""	DBY		9381176	Standard	NM_004660		Approved		uc004fsv.2	O15523	OTTHUMG00000036324	ENST00000336079.3:c.151+65G>T	Y.37:g.15021383G>T			B4DK29|B4DXX7|Q8IYV7	RNA	SNP	-	NULL	ENST00000336079.3	37	NULL	CCDS14782.1	Y																																																																																			DDX3Y	-	-	ENSG00000067048		0.388	DDX3Y-003	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX3Y	HGNC	protein_coding	OTTHUMT00000088407.1	-	0.00	36	0	G	NM_004660		15021383	+1	tier1	-	no_errors	ENST00000493363	ensembl	human	known	74_37	rna	8.89	41	4	SNP	0.000	T
DDX60	55601	genome.wustl.edu	37	4	169201719	169201719	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr4:169201719G>T	ENST00000393743.3	-	14	2036	c.1745C>A	c.(1744-1746)gCt>gAt	p.A582D		NM_017631.5	NP_060101.3	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	582					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|urinary_tract(4)	63		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		ATTCTCTCTAGCAATTATTTC	0.348																																																	0													46.0	48.0	47.0					4																	169201719		2203	4300	6503	SO:0001583	missense	0			AK001649	CCDS34097.1	4q32.3	2010-02-17			ENSG00000137628	ENSG00000137628			25942	protein-coding gene	gene with protein product		613974				12477932	Standard	NM_017631		Approved	FLJ20035	uc003irp.3	Q8IY21	OTTHUMG00000161350	ENST00000393743.3:c.1745C>A	4.37:g.169201719G>T	ENSP00000377344:p.Ala582Asp		Q6PK35|Q9NVE3	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.A582D	ENST00000393743.3	37	c.1745	CCDS34097.1	4	.	.	.	.	.	.	.	.	.	.	G	5.953	0.359785	0.11296	.	.	ENSG00000137628	ENST00000393743	T	0.19394	2.15	5.58	1.34	0.21922	.	1.297200	0.04861	N	0.444220	T	0.15869	0.0382	L	0.40543	1.245	0.09310	N	1	B	0.28552	0.215	B	0.25291	0.059	T	0.28996	-1.0026	10	0.12103	T	0.63	.	5.7016	0.17885	0.3564:0.0:0.511:0.1327	.	582	Q8IY21	DDX60_HUMAN	D	582	ENSP00000377344:A582D	ENSP00000377344:A582D	A	-	2	0	DDX60	169438294	0.000000	0.05858	0.003000	0.11579	0.117000	0.20001	-0.112000	0.10791	0.306000	0.22856	0.563000	0.77884	GCT	DDX60	-	NULL	ENSG00000137628		0.348	DDX60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX60	HGNC	protein_coding	OTTHUMT00000364622.1		0.00	34	0	G	NM_017631		169201719	-1			no_errors	ENST00000393743	ensembl	human	known	74_37	missense	7.14	65	5	SNP	0.000	T
DENND4C	55667	genome.wustl.edu	37	9	19346068	19346068	+	Silent	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr9:19346068C>A	ENST00000380432.2	+	18	2479	c.2446C>A	c.(2446-2448)Cga>Aga	p.R816R	DENND4C_ENST00000434457.2_Silent_p.R1101R|DENND4C_ENST00000602925.1_Silent_p.R1052R			Q5VZ89	DEN4C_HUMAN	DENN/MADD domain containing 4C	816					cellular response to insulin stimulus (GO:0032869)|positive regulation of Rab GTPase activity (GO:0032851)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)	cytosol (GO:0005829)|insulin-responsive compartment (GO:0032593)|plasma membrane (GO:0005886)|retromer complex (GO:0030904)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(8)|kidney(1)|large_intestine(7)|liver(2)|lung(13)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						TTCTGAAAGTCGAGCAGGAAT	0.403																																																	0													141.0	135.0	137.0					9																	19346068		2203	4300	6503	SO:0001819	synonymous_variant	0			AK000693	CCDS6491.2, CCDS6491.3	9p22.1	2012-10-03	2006-01-27	2006-01-27	ENSG00000137145	ENSG00000137145		"""DENN/MADD domain containing"""	26079	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 55B"", ""chromosome 9 open reading frame 55"""	C9orf55B, C9orf55		12906859	Standard	NM_017925		Approved	FLJ20686, bA513M16.3	uc031tcw.1	Q5VZ89	OTTHUMG00000019627	ENST00000380432.2:c.2446C>A	9.37:g.19346068C>A			A2A3R1|A2A3R2|A2A3R3|A2A3R9|Q6AI48|Q6ZUB3|Q8NCY7|Q9H6N4|Q9NUT1|Q9NWA5|Q9NWT3	Silent	SNP	pfam_DENN_dom,pfam_dDENN_dom,pfam_uDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.R1052	ENST00000380432.2	37	c.3154		9																																																																																			DENND4C	-	NULL	ENSG00000137145		0.403	DENND4C-201	KNOWN	basic	protein_coding	DENND4C	HGNC	protein_coding		-	0.00	67	0	C	NM_017925		19346068	+1	tier1	-	no_errors	ENST00000602925	ensembl	human	known	74_37	silent	5.33	71	4	SNP	1.000	A
DIAPH3	81624	genome.wustl.edu	37	13	60435609	60435609	+	Missense_Mutation	SNP	C	C	T	rs74451107		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr13:60435609C>T	ENST00000400324.4	-	22	2889	c.2669G>A	c.(2668-2670)tGt>tAt	p.C890Y	DIAPH3_ENST00000400319.1_Missense_Mutation_p.C820Y|DIAPH3_ENST00000400320.1_Missense_Mutation_p.C844Y|DIAPH3_ENST00000377908.2_Missense_Mutation_p.C879Y|DIAPH3_ENST00000465066.1_5'UTR|DIAPH3_ENST00000267215.4_Missense_Mutation_p.C890Y|DIAPH3_ENST00000400330.1_Missense_Mutation_p.C890Y	NM_001042517.1|NM_001258366.1	NP_001035982.1|NP_001245295.1	Q9NSV4	DIAP3_HUMAN	diaphanous-related formin 3	890	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|liver(1)|lung(20)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		CTTCTCTTCACATATTTCTAC	0.358																																																	0													148.0	136.0	140.0					13																	60435609		1831	4083	5914	SO:0001583	missense	0			AL137718	CCDS41898.1, CCDS58294.1, CCDS58295.1, CCDS58296.1, CCDS58297.1, CCDS73579.1, CCDS73580.1	13q21.2	2013-05-24	2013-05-24		ENSG00000139734	ENSG00000139734			15480	protein-coding gene	gene with protein product		614567	"""diaphanous (Drosophila, homolog) 3"", ""auditory neuropathy, autosomal dominant 1"", ""diaphanous homolog 3 (Drosophila)"""	AUNA1		14767582, 20624953	Standard	NM_030932		Approved	DRF3, FLJ34705, AN, NSDAN	uc001vht.4	Q9NSV4	OTTHUMG00000017004	ENST00000400324.4:c.2669G>A	13.37:g.60435609C>T	ENSP00000383178:p.Cys890Tyr		A2A3B8|A2A3B9|A2A3C0|Q18P99|Q18PA0|Q18PA1|Q2KPB6|Q3ZK23|Q5JTP8|Q5T2S7|Q5XKF6|Q6MZF0|Q6NUP0|Q86VS4|Q8NAV4	Missense_Mutation	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,pfam_Drf_DAD,superfamily_ARM-type_fold,smart_FH2_Formin	p.C890Y	ENST00000400324.4	37	c.2669	CCDS41898.1	13	.	.	.	.	.	.	.	.	.	.	C	23.2	4.388048	0.82902	.	.	ENSG00000139734	ENST00000400324;ENST00000400330;ENST00000400327;ENST00000413168;ENST00000400329;ENST00000377908;ENST00000400319;ENST00000400320;ENST00000267215;ENST00000267214;ENST00000453990	T;T;T;T;T;T	0.16324	2.35;2.35;2.35;2.35;2.35;2.35	5.38	5.38	0.77491	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.85682	D	0.000000	T	0.43545	0.1252	M	0.67625	2.065	0.52501	D	0.999957	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.987;0.996;1.0	T	0.33394	-0.9870	10	0.87932	D	0	.	19.1314	0.93408	0.0:1.0:0.0:0.0	.	627;627;890	Q9NSV4-2;Q9NSV4-1;Q9NSV4	.;.;DIAP3_HUMAN	Y	890;890;879;844;820;879;820;844;890;627;890	ENSP00000383178:C890Y;ENSP00000383184:C890Y;ENSP00000367141:C879Y;ENSP00000383173:C820Y;ENSP00000383174:C844Y;ENSP00000267215:C890Y	ENSP00000267214:C627Y	C	-	2	0	DIAPH3	59333610	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	7.487000	0.81328	2.536000	0.85505	0.561000	0.74099	TGT	DIAPH3	-	pfam_FH2_Formin,smart_FH2_Formin	ENSG00000139734		0.358	DIAPH3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIAPH3	HGNC	protein_coding	OTTHUMT00000045166.3	-	0.00	50	0	C	NM_001042517		60435609	-1	tier1	-	no_errors	ENST00000400324	ensembl	human	known	74_37	missense	18.03	100	22	SNP	1.000	T
DIP2B	57609	genome.wustl.edu	37	12	51089677	51089677	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr12:51089677G>T	ENST00000301180.5	+	16	1894	c.1860G>T	c.(1858-1860)atG>atT	p.M620I		NM_173602.2	NP_775873.2	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B (Drosophila)	620						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(15)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	60						GGGCTATGATGGCACATCGGG	0.418																																																	0													207.0	179.0	188.0					12																	51089677		2203	4300	6503	SO:0001583	missense	0			AB040896	CCDS31799.1	12q13.12	2012-10-02	2006-01-13		ENSG00000066084	ENSG00000066084			29284	protein-coding gene	gene with protein product		611379					Standard	XM_005269044		Approved	KIAA1463, FLJ34278	uc001rwv.3	Q9P265	OTTHUMG00000169475	ENST00000301180.5:c.1860G>T	12.37:g.51089677G>T	ENSP00000301180:p.Met620Ile		Q6B011|Q8N1L5|Q8NB38	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.M620I	ENST00000301180.5	37	c.1860	CCDS31799.1	12	.	.	.	.	.	.	.	.	.	.	G	16.99	3.274883	0.59649	.	.	ENSG00000066084	ENST00000301180	T	0.36878	1.23	4.96	4.96	0.65561	AMP-dependent synthetase/ligase (1);	0.038653	0.85682	D	0.000000	T	0.22360	0.0539	N	0.16478	0.41	0.58432	D	0.999999	B	0.06786	0.001	B	0.09377	0.004	T	0.05289	-1.0894	10	0.26408	T	0.33	-23.8608	11.8113	0.52183	0.0799:0.0:0.9201:0.0	.	620	Q9P265	DIP2B_HUMAN	I	620	ENSP00000301180:M620I	ENSP00000301180:M620I	M	+	3	0	DIP2B	49375944	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.826000	0.86716	2.582000	0.87167	0.555000	0.69702	ATG	DIP2B	-	pfam_AMP-dep_Synth/Lig	ENSG00000066084		0.418	DIP2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DIP2B	HGNC	protein_coding	OTTHUMT00000404243.1		0.00	46	0	G	NM_173602		51089677	+1			no_errors	ENST00000301180	ensembl	human	known	74_37	missense	6.45	58	4	SNP	1.000	T
DLEU2	8847	genome.wustl.edu	37	13	50623719	50623719	+	RNA	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr13:50623719C>T	ENST00000607334.1	-	0	0				MIR16-1_ENST00000385271.1_RNA	NR_029485.1				deleted in lymphocytic leukemia 2 (non-protein coding)																		TTGATCTTTACCTTGGTAAAA	0.274																																																	0																																												0			Y15228		13q14	2014-07-18	2008-08-13		ENSG00000231607	ENSG00000231607		"""-"""	13748	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 22"", ""long intergenic non-protein coding RNA 22"", ""mir-15a-16-1 cluster host gene (non-protein coding)"""	605766	"""ret finger protein 2 opposite strand"", ""deleted in lymphocytic leukemia, 2"""	DLB2, BCMSUN, RFP2OS		9395242, 11072235	Standard	NR_002612		Approved	LEU2, TRIM13OS, NCRNA00022, LINC00022, MIR15AHG	uc001vdo.1		OTTHUMG00000016927		13.37:g.50623719C>T				Splice_Site	SNP	-	NULL	ENST00000607334.1	37	c.NULL		13																																																																																			DLEU2	-	-	ENSG00000231607		0.274	DLEU2-202	KNOWN	basic	miRNA	DLEU2	HGNC	processed_transcript		-	0.00	23	0	C	NR_002612		50623719	-1	tier1	-	no_errors	ENST00000235290	ensembl	human	known	74_37	splice_site	72.31	18	47	SNP	1.000	T
DLGAP1	9229	genome.wustl.edu	37	18	3597090	3597090	+	Intron	DEL	T	T	-			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr18:3597090delT	ENST00000315677.3	-	8	2187				DLGAP1_ENST00000400147.2_Intron|DLGAP1-AS1_ENST00000573355.1_RNA|DLGAP1_ENST00000400149.3_Intron|DLGAP1-AS1_ENST00000317114.1_RNA|DLGAP1_ENST00000400150.3_Intron|DLGAP1_ENST00000581527.1_Intron|DLGAP1_ENST00000534970.1_Intron|DLGAP1_ENST00000584874.1_Intron|DLGAP1-AS1_ENST00000575606.1_RNA|DLGAP1_ENST00000400155.1_Intron|DLGAP1_ENST00000581699.1_Intron|DLGAP1_ENST00000539435.1_Intron|DLGAP1_ENST00000400145.2_Intron|DLGAP1-AS1_ENST00000574411.1_RNA|DLGAP1-AS1_ENST00000576606.1_RNA|DLGAP1-AS1_ENST00000577995.1_RNA|DLGAP1_ENST00000515196.2_Intron	NM_004746.3	NP_004737.2	O14490	DLGP1_HUMAN	discs, large (Drosophila) homolog-associated protein 1						synaptic transmission (GO:0007268)	cell junction (GO:0030054)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)				breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	56		Colorectal(8;0.0257)				CTCGTTACTCTTTTTTTTTTC	0.448																																																	0													108.0	111.0	110.0					18																	3597090		1844	4103	5947	SO:0001627	intron_variant	0			AB000277	CCDS11836.1, CCDS42406.1, CCDS56049.1, CCDS56050.1, CCDS56051.1, CCDS56052.1, CCDS56053.1, CCDS74191.1	18p11.3	2008-07-28	2001-11-28		ENSG00000170579	ENSG00000170579			2905	protein-coding gene	gene with protein product		605445	"""discs, large (Drosophila) homolog-associated protein 1"""			9024696, 9286858	Standard	NM_004746		Approved	GKAP, SAPAP1, DAP-1	uc002kmf.3	O14490	OTTHUMG00000131537	ENST00000315677.3:c.1592-14844A>-	18.37:g.3597090delT			A8MWN8|B2RMU8|B7WPA1|B7Z2H2|B7Z2I2|B7Z9Y4|O14489|P78335	RNA	DEL	-	NULL	ENST00000315677.3	37	NULL	CCDS11836.1	18																																																																																			DLGAP1-AS1	-	-	ENSG00000177337		0.448	DLGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP1-AS1	HGNC	protein_coding	OTTHUMT00000254394.4		0.00	47	0	T			3597090	+1	tier1		no_errors	ENST00000317114	ensembl	human	known	74_37	rna	9.38	29	3	DEL	0.002	-
DMBT1	1755	genome.wustl.edu	37	10	124396670	124396670	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr10:124396670C>A	ENST00000338354.3	+	51	6503	c.6397C>A	c.(6397-6399)Caa>Aaa	p.Q2133K	DMBT1_ENST00000368955.3_Missense_Mutation_p.Q2123K|DMBT1_ENST00000359586.6_Missense_Mutation_p.Q853K|DMBT1_ENST00000368956.2_Missense_Mutation_p.Q1505K|DMBT1_ENST00000368909.3_Missense_Mutation_p.Q2133K|DMBT1_ENST00000330163.4_Missense_Mutation_p.Q1505K|DMBT1_ENST00000344338.3_Missense_Mutation_p.Q2123K			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	2133	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				AAATCACATGCAAGCCAGTGT	0.532																																					Ovarian(182;93 2026 18125 22222 38972)												0													116.0	116.0	116.0					10																	124396670		2037	4192	6229	SO:0001583	missense	0				CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.6397C>A	10.37:g.124396670C>A	ENSP00000342210:p.Gln2133Lys		A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	pfam_SRCR,pfam_CUB_dom,pfam_ZP_dom,superfamily_Srcr_rcpt-rel,superfamily_CUB_dom,smart_Srcr_rcpt-rel,smart_CUB_dom,smart_ZP_dom,pfscan_CUB_dom,pfscan_SRCR,pfscan_ZP_dom,prints_SRCR	p.Q2133K	ENST00000338354.3	37	c.6397		10	.	.	.	.	.	.	.	.	.	.	C	1.574	-0.533395	0.04082	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000327438;ENST00000344338;ENST00000339712;ENST00000330163;ENST00000368909;ENST00000368955;ENST00000368956;ENST00000344467;ENST00000359586	D;D;D;D;D;D;D	0.81579	-1.51;-1.51;-1.51;-1.51;-1.51;-1.51;-1.51	5.29	2.01	0.26516	Zona pellucida sperm-binding protein (3);	0.760645	0.10333	U	0.687300	T	0.75347	0.3837	L	0.52759	1.655	0.25576	N	0.986847	B;B;B;B;B;B;P	0.34462	0.035;0.016;0.4;0.4;0.4;0.4;0.454	B;B;B;B;B;B;B	0.34931	0.038;0.004;0.121;0.121;0.121;0.121;0.192	T	0.61758	-0.6997	10	0.35671	T	0.21	.	11.414	0.49941	0.126:0.5416:0.3324:0.0	.	853;2113;1382;2262;1505;2123;2133	F8WEF7;Q9UGM3-5;Q9UGM3-8;Q9UGM3-6;Q9UGM3-2;Q9UGM3-3;Q9UGM3	.;.;.;.;.;.;DMBT1_HUMAN	K	2133;2262;2133;2133;2133;2132;1505;2123;1505;1505;2133;2123;1505;279;853	ENSP00000342210:Q2133K;ENSP00000343175:Q2123K;ENSP00000327747:Q1505K;ENSP00000357905:Q2133K;ENSP00000357951:Q2123K;ENSP00000357952:Q1505K;ENSP00000352593:Q853K	ENSP00000331522:Q1505K	Q	+	1	0	DMBT1	124386660	0.477000	0.25909	0.984000	0.44739	0.317000	0.28152	0.598000	0.24074	0.601000	0.29879	-0.165000	0.13383	CAA	DMBT1	-	pfam_ZP_dom,smart_ZP_dom,pfscan_ZP_dom	ENSG00000187908		0.532	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	DMBT1	HGNC	protein_coding	OTTHUMT00000050792.2	-	0.00	56	0	C	NM_004406		124396670	+1	tier1	-	no_errors	ENST00000338354	ensembl	human	known	74_37	missense	6.49	72	5	SNP	0.636	A
DNAH1	25981	genome.wustl.edu	37	3	52406928	52406928	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr3:52406928G>T	ENST00000420323.2	+	44	7105	c.6844G>T	c.(6844-6846)Gga>Tga	p.G2282*		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	2282	AAA 3. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GGGTGTGTTTGGACCACCTCT	0.622																																																	0													80.0	84.0	83.0					3																	52406928		1997	4153	6150	SO:0001587	stop_gained	0			U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.6844G>T	3.37:g.52406928G>T	ENSP00000401514:p.Gly2282*		B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Nonsense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase	p.G2282*	ENST00000420323.2	37	c.6844	CCDS46842.1	3	.	.	.	.	.	.	.	.	.	.	G	50	16.348637	0.99861	.	.	ENSG00000114841	ENST00000420323	.	.	.	4.98	4.98	0.66077	.	0.000000	0.49916	D	0.000135	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.4445	0.90678	0.0:0.0:1.0:0.0	.	.	.	.	X	2282	.	ENSP00000401514:G2282X	G	+	1	0	DNAH1	52381968	1.000000	0.71417	0.964000	0.40570	0.963000	0.63663	9.169000	0.94788	2.604000	0.88044	0.655000	0.94253	GGA	DNAH1	-	superfamily_P-loop_NTPase	ENSG00000114841		0.622	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH1	HGNC	protein_coding	OTTHUMT00000350816.1	-	0.00	62	0	G	NM_015512		52406928	+1	tier1	-	no_errors	ENST00000420323	ensembl	human	known	74_37	nonsense	7.14	52	4	SNP	1.000	T
DNAH3	55567	genome.wustl.edu	37	16	21098317	21098317	+	Silent	SNP	C	C	A	rs376345259		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr16:21098317C>A	ENST00000261383.3	-	19	2729	c.2730G>T	c.(2728-2730)acG>acT	p.T910T	DNAH3_ENST00000415178.1_Silent_p.T910T	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	910	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		TCAGTTTATACGTTGTCCTCC	0.463																																																	0													242.0	217.0	225.0					16																	21098317		2201	4300	6501	SO:0001819	synonymous_variant	0			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.2730G>T	16.37:g.21098317C>A			O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_AAA+_ATPase	p.T910	ENST00000261383.3	37	c.2730	CCDS10594.1	16																																																																																			DNAH3	-	pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase	ENSG00000158486		0.463	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	HGNC	protein_coding	OTTHUMT00000207361.1	-	0.00	43	0	C	NM_017539		21098317	-1	tier1	-	no_errors	ENST00000261383	ensembl	human	known	74_37	silent	39.58	58	38	SNP	0.806	A
DNAJC1	64215	genome.wustl.edu	37	10	22208783	22208783	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr10:22208783C>T	ENST00000376980.3	-	5	903	c.613G>A	c.(613-615)Ggt>Agt	p.G205S		NM_022365.3	NP_071760.2	Q96KC8	DNJC1_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 1	205					negative regulation of proteolysis (GO:0045861)|positive regulation of ATPase activity (GO:0032781)|protein folding (GO:0006457)|regulation of protein secretion (GO:0050708)|regulation of translation (GO:0006417)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(2)|lung(13)|skin(2)|upper_aerodigestive_tract(2)	21		Breast(68;0.00869)|Prostate(175;0.0181)|Lung SC(717;0.0262)				TCTGAAGCACCGAGTTTTGAT	0.289																																																	0													140.0	145.0	143.0					10																	22208783		2202	4297	6499	SO:0001583	missense	0			AK026062	CCDS7136.1	10p11.23	2011-09-02			ENSG00000136770	ENSG00000136770		"""Heat shock proteins / DNAJ (HSP40)"""	20090	protein-coding gene	gene with protein product		611207					Standard	NM_022365		Approved	DNAJL1, ERdj1, MTJ1	uc001irc.3	Q96KC8	OTTHUMG00000017800	ENST00000376980.3:c.613G>A	10.37:g.22208783C>T	ENSP00000366179:p.Gly205Ser		B0YIZ8|Q5VX89|Q9H6B8	Missense_Mutation	SNP	pfam_DnaJ_domain,pfam_SANT/Myb,superfamily_DnaJ_domain,superfamily_Homeodomain-like,smart_DnaJ_domain,smart_SANT/Myb,pfscan_Myb-like_dom,pfscan_DnaJ_domain,prints_DnaJ_domain	p.G205S	ENST00000376980.3	37	c.613	CCDS7136.1	10	.	.	.	.	.	.	.	.	.	.	C	9.846	1.192440	0.21954	.	.	ENSG00000136770	ENST00000376980	T	0.39997	1.05	5.91	2.65	0.31530	.	0.651159	0.17323	N	0.178409	T	0.21186	0.0510	N	0.25647	0.755	0.58432	D	0.999998	P	0.45986	0.87	B	0.30716	0.119	T	0.06516	-1.0822	10	0.09843	T	0.71	-2.8678	12.1983	0.54311	0.0:0.7848:0.0:0.2152	.	205	Q96KC8	DNJC1_HUMAN	S	205	ENSP00000366179:G205S	ENSP00000366179:G205S	G	-	1	0	DNAJC1	22248789	0.997000	0.39634	0.989000	0.46669	0.977000	0.68977	1.066000	0.30604	0.846000	0.35142	0.650000	0.86243	GGT	DNAJC1	-	NULL	ENSG00000136770		0.289	DNAJC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC1	HGNC	protein_coding	OTTHUMT00000047149.1	-	0.00	23	0	C	NM_022365		22208783	-1	tier1	-	no_errors	ENST00000376980	ensembl	human	known	74_37	missense	64.44	15	29	SNP	0.933	T
DNAJC13	23317	genome.wustl.edu	37	3	132221270	132221270	+	Silent	SNP	A	A	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr3:132221270A>T	ENST00000260818.6	+	40	4922	c.4674A>T	c.(4672-4674)ctA>ctT	p.L1558L		NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	1558					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						ACTACACACTAGAAGAGAGTG	0.368																																																	0													123.0	118.0	119.0					3																	132221270		2203	4300	6503	SO:0001819	synonymous_variant	0			AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.4674A>T	3.37:g.132221270A>T			Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Silent	SNP	pfam_DnaJ_domain,superfamily_ARM-type_fold,superfamily_GYF,smart_DnaJ_domain,pfscan_DnaJ_domain	p.L1558	ENST00000260818.6	37	c.4674	CCDS33857.1	3																																																																																			DNAJC13	-	superfamily_ARM-type_fold	ENSG00000138246		0.368	DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC13	HGNC	protein_coding	OTTHUMT00000356807.2	-	0.00	52	0	A	NM_015268		132221270	+1	tier1	-	no_errors	ENST00000260818	ensembl	human	known	74_37	silent	6.40	117	8	SNP	1.000	T
DNAJC2	27000	genome.wustl.edu	37	7	102964049	102964051	+	In_Frame_Del	DEL	CTG	CTG	-	rs369683489		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	CTG	CTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr7:102964049_102964051delCTG	ENST00000379263.3	-	7	963_965	c.713_715delCAG	c.(712-717)gcagaa>gaa	p.A238del	PMPCB_ENST00000420236.2_Intron|DNAJC2_ENST00000249270.7_In_Frame_Del_p.A238del	NM_014377.1	NP_055192.1	Q99543	DNJC2_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 2	238	ZRF1-UBD.				'de novo' cotranslational protein folding (GO:0051083)|chromatin modification (GO:0016568)|DNA replication (GO:0006260)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA biosynthetic process (GO:2000279)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone binding (GO:0042393)|Hsp70 protein binding (GO:0030544)|poly(A) RNA binding (GO:0044822)|ubiquitin binding (GO:0043130)			endometrium(1)|kidney(9)|large_intestine(6)|lung(4)|ovary(1)	21						ACATACCATTCTGCTTTTTCTTT	0.256																																																	0																																										SO:0001651	inframe_deletion	0			X98260	CCDS43628.1, CCDS47679.1	7q22-q32	2011-09-02	2008-07-01	2008-07-01	ENSG00000105821	ENSG00000105821		"""Heat shock proteins / DNAJ (HSP40)"""	13192	protein-coding gene	gene with protein product		605502	"""zuotin related factor 1"""	ZRF1		8885239	Standard	NM_001129887		Approved	MPP11, MPHOSPH11, ZUO1, zuotin	uc003vbo.3	Q99543	OTTHUMG00000157202	ENST00000379263.3:c.713_715delCAG	7.37:g.102964049_102964051delCTG	ENSP00000368565:p.Ala238del		A4VCI0|Q9BVX1	In_Frame_Del	DEL	pfam_SANT/Myb,pfam_DnaJ_domain,superfamily_DnaJ_domain,superfamily_Homeodomain-like,smart_DnaJ_domain,smart_SANT/Myb,pfscan_Myb-like_dom,pfscan_DnaJ_domain	p.A238in_frame_del	ENST00000379263.3	37	c.715_713	CCDS43628.1	7																																																																																			DNAJC2	-	NULL	ENSG00000105821		0.256	DNAJC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC2	HGNC	protein_coding	OTTHUMT00000347891.1		0.00	50	0	CTG			102964051	-1	tier1		no_errors	ENST00000379263	ensembl	human	known	74_37	in_frame_del	32.99	65	32	DEL	1.000:0.998:1.000	-
DNAJC2	27000	genome.wustl.edu	37	7	102964051	102964052	+	Missense_Mutation	DNP	GC	GC	TT			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G|C	G|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr7:102964051_102964052GC>TT	ENST00000379263.3	-	7	962_963	c.712_713GC>AA	c.(712-714)GCa>AAa	p.A238K	PMPCB_ENST00000420236.2_Intron|DNAJC2_ENST00000249270.7_Missense_Mutation_p.A238K	NM_014377.1	NP_055192.1	Q99543	DNJC2_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 2	238	ZRF1-UBD.				'de novo' cotranslational protein folding (GO:0051083)|chromatin modification (GO:0016568)|DNA replication (GO:0006260)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA biosynthetic process (GO:2000279)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone binding (GO:0042393)|Hsp70 protein binding (GO:0030544)|poly(A) RNA binding (GO:0044822)|ubiquitin binding (GO:0043130)			endometrium(1)|kidney(9)|large_intestine(6)|lung(4)|ovary(1)	21						ATACCATTCTGCTTTTTCTTTT	0.257																																																	0																																										SO:0001583	missense	0			X98260	CCDS43628.1, CCDS47679.1	7q22-q32	2011-09-02	2008-07-01	2008-07-01	ENSG00000105821	ENSG00000105821		"""Heat shock proteins / DNAJ (HSP40)"""	13192	protein-coding gene	gene with protein product		605502	"""zuotin related factor 1"""	ZRF1		8885239	Standard	NM_001129887		Approved	MPP11, MPHOSPH11, ZUO1, zuotin	uc003vbo.3	Q99543	OTTHUMG00000157202	ENST00000379263.3:c.712_713delinsTT	7.37:g.102964051_102964052delinsTT	ENSP00000368565:p.Ala238Lys		A4VCI0|Q9BVX1	Missense_Mutation	SNP	pfam_SANT/Myb,pfam_DnaJ_domain,superfamily_DnaJ_domain,superfamily_Homeodomain-like,smart_DnaJ_domain,smart_SANT/Myb,pfscan_Myb-like_dom,pfscan_DnaJ_domain	p.A238E|p.A238T	ENST00000379263.3	37	c.713|c.712	CCDS43628.1	7																																																																																			DNAJC2	-	NULL	ENSG00000105821		0.257	DNAJC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC2	HGNC	protein_coding	OTTHUMT00000347891.1		0.00	48	0	G|C			102964051|102964052	-1			no_errors	ENST00000379263	ensembl	human	known	74_37	missense	18.18|9.18	54|89	12|9	SNP	1.000	T
DNHD1	144132	genome.wustl.edu	37	11	6565398	6565398	+	Missense_Mutation	SNP	T	T	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr11:6565398T>C	ENST00000527990.2	+	17	3676	c.3676T>C	c.(3676-3678)Tcc>Ccc	p.S1226P	DNHD1_ENST00000254579.6_Missense_Mutation_p.S1226P			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	1226					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		TCAGGTGTTGTCCAAGATCTT	0.507																																																	0													97.0	85.0	89.0					11																	6565398		692	1591	2283	SO:0001583	missense	0			AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.3676T>C	11.37:g.6565398T>C	ENSP00000436180:p.Ser1226Pro		Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom,superfamily_P-loop_NTPase,superfamily_t-SNARE	p.S1226P	ENST00000527990.2	37	c.3676	CCDS44532.1	11	.	.	.	.	.	.	.	.	.	.	T	11.23	1.578528	0.28180	.	.	ENSG00000179532	ENST00000254579;ENST00000527990	T;T	0.62498	0.02;0.02	5.23	1.67	0.24075	Dynein heavy chain, domain-2 (1);	.	.	.	.	T	0.36110	0.0955	N	0.08118	0	0.21675	N	0.999595	B	0.28998	0.23	B	0.32090	0.14	T	0.22765	-1.0207	9	0.23302	T	0.38	.	3.4922	0.07642	0.0:0.2152:0.2004:0.5844	.	1226	Q96M86	DNHD1_HUMAN	P	1226	ENSP00000254579:S1226P;ENSP00000436180:S1226P	ENSP00000254579:S1226P	S	+	1	0	DNHD1	6521974	0.589000	0.26807	0.977000	0.42913	0.763000	0.43281	0.146000	0.16180	0.488000	0.27723	-0.291000	0.09656	TCC	DNHD1	-	pfam_Dynein_heavy_dom-2	ENSG00000179532		0.507	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	DNHD1	HGNC	protein_coding	OTTHUMT00000384673.2		0.00	39	0	T	NM_144666		6565398	+1			no_errors	ENST00000254579	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.971	C
DPPA3P2	400206	genome.wustl.edu	37	14	36840721	36840721	+	RNA	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr14:36840721G>A	ENST00000557188.1	+	0	352									developmental pluripotency associated 3 pseudogene 2																		AATCTCCTCCGAGACGTTGAT	0.493																																																	0																																												0					14q13.3	2012-07-04			ENSG00000188831	ENSG00000188831			20417	pseudogene	pseudogene							Standard	NG_023379		Approved	STELLAR			OTTHUMG00000170728		14.37:g.36840721G>A				RNA	SNP	-	NULL	ENST00000557188.1	37	NULL		14																																																																																			DPPA3P2	-	-	ENSG00000188831		0.493	DPPA3P2-002	KNOWN	basic	processed_transcript	DPPA3P2	HGNC	pseudogene	OTTHUMT00000410122.1	-	0.00	54	0	G			36840721	+1	tier1	-	no_errors	ENST00000557188	ensembl	human	known	74_37	rna	51.19	41	43	SNP	0.005	A
DPY19L2P2	349152	genome.wustl.edu	37	7	102912317	102912318	+	RNA	INS	-	-	T	rs199625775		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr7:102912317_102912318insT	ENST00000312132.4	-	0	2263							Q6ZN68	D19P2_HUMAN	DPY19L2 pseudogene 2							integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)										AATAAAGTCCCTTTTTTAAAAA	0.277																																																	0																																												0			AL834175		7q22.1	2013-09-12	2013-09-12		ENSG00000170629	ENSG00000170629			21764	pseudogene	pseudogene			"""dpy-19-like 2 pseudogene 2 (C. elegans)"""				Standard	NR_027768		Approved	DKFZp434E092, FLJ36166	uc003vbh.4	Q6ZN68	OTTHUMG00000157200		7.37:g.102912323_102912323dupT			Q8N9V4|Q8ND62	Splice_Site	INS	-	NULL	ENST00000312132.4	37	c.NULL		7																																																																																			DPY19L2P2	-	-	ENSG00000170629		0.277	DPY19L2P2-002	KNOWN	basic	processed_transcript	DPY19L2P2	HGNC	pseudogene	OTTHUMT00000347877.1		0.00	132	0	-	NM_182634		102912318	-1	tier1		no_errors	ENST00000312132	ensembl	human	known	74_37	splice_site_ins	10.40	224	26	INS	1.000:1.000	T
DUSP13	51207	genome.wustl.edu	37	10	76863737	76863737	+	Missense_Mutation	SNP	C	C	T	rs576003204		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr10:76863737C>T	ENST00000491677.2	-	4	748	c.206G>A	c.(205-207)cGt>cAt	p.R69H	DUSP13_ENST00000607131.1_Missense_Mutation_p.R33H|DUSP13_ENST00000607009.1_Intron|DUSP13_ENST00000372702.3_3'UTR|DUSP13_ENST00000372700.3_Intron	NM_001007271.1	NP_001007272.1	Q9UII6	DS13B_HUMAN	dual specificity phosphatase 13	172					meiotic nuclear division (GO:0007126)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)		protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	8	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					GCCGACCCCACGCTGGGCTTC	0.652													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19622	0.0		0.0	False		,,,				2504	0.0				NSCLC(174;1655 2059 12324 40663 42963)												0													34.0	35.0	35.0					10																	76863737		2196	4297	6493	SO:0001583	missense	0			AB027004	CCDS7346.1, CCDS31224.1, CCDS53542.1	10q23.1	2013-10-25			ENSG00000079393	ENSG00000079393		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	19681	protein-coding gene	gene with protein product		613191				10585869	Standard	XM_005269883		Approved	BEDP, TMDP, FLJ32450, DUSP13A, DUSP13B	uc001jwu.3	Q6B8I1	OTTHUMG00000018516	ENST00000491677.2:c.206G>A	10.37:g.76863737C>T	ENSP00000436312:p.Arg69His		A8K776|A8K782|B3KPY1|B3KXT0|B4DUK0|Q5JSC6|Q6IAR0|Q96GC2	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_Atypical_DUSP,prints_Atypical_DUSP_famA	p.R69H	ENST00000491677.2	37	c.206		10	.	.	.	.	.	.	.	.	.	.	C	9.760	1.169866	0.21621	.	.	ENSG00000079393	ENST00000491677;ENST00000372698	T	0.04275	3.66	4.0	-0.0252	0.13936	.	2.957090	0.01171	N	0.006873	T	0.03053	0.0090	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41288	-0.9517	10	0.18276	T	0.48	.	6.652	0.22967	0.0:0.575:0.0:0.425	.	69	F2Z2C4	.	H	69;33	ENSP00000436312:R69H	ENSP00000361783:R33H	R	-	2	0	DUSP13	76533743	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.676000	0.05221	-0.089000	0.12484	-0.742000	0.03525	CGT	DUSP13	-	NULL	ENSG00000079393		0.652	DUSP13-201	KNOWN	basic|appris_candidate_longest	protein_coding	DUSP13	HGNC	protein_coding		-	0.00	113	0	C			76863737	-1	tier1	-	no_errors	ENST00000491677	ensembl	human	known	74_37	missense	29.55	62	26	SNP	0.000	T
DUSP7	1849	genome.wustl.edu	37	3	52088231	52088231	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr3:52088231G>T	ENST00000495880.1	-	2	860	c.677C>A	c.(676-678)cCc>cAc	p.P226H	DUSP7_ENST00000296483.6_Missense_Mutation_p.P175H			Q16829	DUS7_HUMAN	dual specificity phosphatase 7	226	Ser-rich.				inactivation of MAPK activity (GO:0000188)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of MAP kinase activity (GO:0043407)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)	17				BRCA - Breast invasive adenocarcinoma(193;5.14e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GGCACTGCTGGGCAGCTCTCG	0.677																																																	0													109.0	100.0	103.0					3																	52088231		2203	4300	6503	SO:0001583	missense	0			X93921	CCDS33766.1, CCDS33766.2	3p21	2011-06-09			ENSG00000164086	ENSG00000164086		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3073	protein-coding gene	gene with protein product		602749				8626780, 9205128	Standard	NM_001947		Approved	MKP-X, PYST2	uc003dct.3	Q16829	OTTHUMG00000157819	ENST00000495880.1:c.677C>A	3.37:g.52088231G>T	ENSP00000417183:p.Pro226His		Q2M3J7|Q8NFJ0	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,smart_Dual-sp_phosphatase_subgr_cat,pirsf_MKP,prints_MKP,pfscan_Rhodanese-like_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.P175H	ENST00000495880.1	37	c.524	CCDS33766.2	3	.	.	.	.	.	.	.	.	.	.	G	18.47	3.630095	0.67015	.	.	ENSG00000164086	ENST00000495880;ENST00000296483;ENST00000469623	T;T;T	0.10477	4.2;4.23;2.87	5.53	4.63	0.57726	.	0.000000	0.85682	D	0.000000	T	0.16214	0.0390	L	0.53249	1.67	0.80722	D	1	B;B	0.24092	0.052;0.097	B;B	0.33254	0.093;0.16	T	0.02333	-1.1175	10	0.56958	D	0.05	.	15.1308	0.72520	0.0:0.0:0.8572:0.1428	.	175;226	Q16829-2;Q16829	.;DUS7_HUMAN	H	226;175;159	ENSP00000417183:P226H;ENSP00000296483:P175H;ENSP00000418566:P159H	ENSP00000296483:P175H	P	-	2	0	DUSP7	52063271	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	9.391000	0.97249	1.279000	0.44446	0.549000	0.68633	CCC	DUSP7	-	pirsf_MKP	ENSG00000164086		0.677	DUSP7-001	NOVEL	basic|CCDS	protein_coding	DUSP7	HGNC	protein_coding	OTTHUMT00000349697.1		0.00	55	0	G	NM_001947		52088231	-1			no_errors	ENST00000296483	ensembl	human	known	74_37	missense	6.45	29	2	SNP	1.000	T
DYSF	8291	genome.wustl.edu	37	2	71797921	71797921	+	Intron	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr2:71797921C>T	ENST00000258104.3	+	29	3451				DYSF_ENST00000394120.2_Intron|DYSF_ENST00000409582.3_Intron|DYSF_ENST00000409744.1_Intron|DYSF_ENST00000409651.1_Intron|DYSF_ENST00000410041.1_Intron|DYSF_ENST00000429174.2_Intron|DYSF_ENST00000409762.1_Intron|DYSF_ENST00000413539.2_Intron|DYSF_ENST00000410020.3_Intron|DYSF_ENST00000409366.1_Intron	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin						plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						CACAGGTGGCCAGTAGGCACA	0.592																																																	0													67.0	58.0	61.0					2																	71797921		2201	4295	6496	SO:0001627	intron_variant	0			AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.3174+50C>T	2.37:g.71797921C>T			A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	RNA	SNP	-	NULL	ENST00000258104.3	37	NULL	CCDS1918.1	2																																																																																			DYSF	-	-	ENSG00000135636		0.592	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DYSF	HGNC	protein_coding	OTTHUMT00000251970.3	-	0.00	44	0	C	NM_003494		71797921	+1	tier1	-	no_errors	ENST00000461565	ensembl	human	known	74_37	rna	44.64	31	25	SNP	0.002	T
ECEL1	9427	genome.wustl.edu	37	2	233347591	233347591	+	Missense_Mutation	SNP	T	T	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr2:233347591T>C	ENST00000304546.1	-	10	1865	c.1655A>G	c.(1654-1656)aAg>aGg	p.K552R	ECEL1_ENST00000409941.1_Missense_Mutation_p.K552R	NM_004826.2	NP_004817.2	O95672	ECEL1_HUMAN	endothelin converting enzyme-like 1	552					neuropeptide signaling pathway (GO:0007218)|respiratory system process (GO:0003016)	integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000771)|Lung(119;0.00213)|LUSC - Lung squamous cell carcinoma(224;0.00746)		CCGAATCTTCTTAACTGAGAG	0.572																																																	0													163.0	163.0	163.0					2																	233347591		2203	4300	6503	SO:0001583	missense	0			Y16187	CCDS2493.1	2q37.1	2010-09-29			ENSG00000171551	ENSG00000171551			3147	protein-coding gene	gene with protein product	"""damage induced neuronal endopeptidase"""	605896				9931490, 11352565	Standard	NM_004826		Approved	XCE, DINE	uc002vsv.2	O95672	OTTHUMG00000133262	ENST00000304546.1:c.1655A>G	2.37:g.233347591T>C	ENSP00000302051:p.Lys552Arg		Q45UD9|Q53RF9|Q6UW86|Q86TH4|Q9NY95	Missense_Mutation	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,prints_Peptidase_M13_C	p.K552R	ENST00000304546.1	37	c.1655	CCDS2493.1	2	.	.	.	.	.	.	.	.	.	.	T	15.27	2.784882	0.49997	.	.	ENSG00000171551	ENST00000304546;ENST00000409941	D;D	0.81996	-1.56;-1.56	5.25	5.25	0.73442	.	0.053197	0.64402	D	0.000001	T	0.72708	0.3494	L	0.29908	0.895	0.53688	D	0.999979	B;B	0.17465	0.012;0.022	B;B	0.17433	0.013;0.018	T	0.67684	-0.5607	10	0.33940	T	0.23	-0.149	9.6616	0.39958	0.0:0.078:0.0:0.922	.	552;552	O95672-2;O95672	.;ECEL1_HUMAN	R	552	ENSP00000302051:K552R;ENSP00000386333:K552R	ENSP00000302051:K552R	K	-	2	0	ECEL1	233055835	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	3.434000	0.52841	1.981000	0.57761	0.533000	0.62120	AAG	ECEL1	-	NULL	ENSG00000171551		0.572	ECEL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ECEL1	HGNC	protein_coding	OTTHUMT00000257039.2	-	0.00	90	0	T	NM_004826		233347591	-1	tier1	-	no_errors	ENST00000304546	ensembl	human	known	74_37	missense	17.72	65	14	SNP	1.000	C
EFNA3	1944	genome.wustl.edu	37	1	155059036	155059036	+	3'UTR	DEL	G	G	-	rs538270136		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:155059036delG	ENST00000368408.3	+	0	804				EFNA3_ENST00000556931.1_3'UTR|EFNA3_ENST00000418360.2_3'UTR|EFNA3_ENST00000505139.1_3'UTR|EFNA3_ENST00000498667.1_3'UTR	NM_004952.4	NP_004943.1	P52797	EFNA3_HUMAN	ephrin-A3						axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)|ephrin receptor signaling pathway (GO:0048013)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)|transmembrane-ephrin receptor activity (GO:0005005)			breast(1)|central_nervous_system(1)|large_intestine(1)|lung(2)	5	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		all cancers(21;5.67e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000284)|LUSC - Lung squamous cell carcinoma(543;0.193)			CCCCTCCCCTGGGGGGGGAGA	0.652											OREG0013850	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0										1745,11,111,2395		332,1,60,1020,1,0,8,6,39,664	43.0	49.0	47.0			-3.2	0.0	1	dbSNP_132	49	694,30,50,7476		22,0,7,643,0,0,30,4,35,3384	no	utr-3	EFNA3	NM_004952.4		354,1,67,1663,1,0,38,10,74,4048	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		9.3818,43.8057,21.1077			155059036	2439,41,161,9871	2203	4299	6502	SO:0001624	3_prime_UTR_variant	0			BC017722	CCDS1090.1	1q21-q22	2011-03-09			ENSG00000143590	ENSG00000143590		"""Ephrins"""	3223	protein-coding gene	gene with protein product		601381		EPLG3		8660976	Standard	NM_004952		Approved	LERK3, Ehk1-L	uc001fhf.3	P52797	OTTHUMG00000035313	ENST00000368408.3:c.*17G>-	1.37:g.155059036delG		220	B7ZAD3|D3DV85|Q0VGC9|Q5SR70	RNA	DEL	-	NULL	ENST00000368408.3	37	NULL	CCDS1090.1	1																																																																																			EFNA3	-	-	ENSG00000143590		0.652	EFNA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EFNA3	HGNC	protein_coding	OTTHUMT00000085429.1		0.00	86	0	G	NM_004952		155059036	+1	tier1		no_errors	ENST00000470294	ensembl	human	known	74_37	rna	18.60	105	24	DEL	0.000	-
EGFR	1956	genome.wustl.edu	37	7	55233043	55233043	+	Missense_Mutation	SNP	G	G	A	rs139236063		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr7:55233043G>A	ENST00000275493.2	+	15	1970	c.1793G>A	c.(1792-1794)gGa>gAa	p.G598E	EGFR_ENST00000342916.3_Missense_Mutation_p.G598E|EGFR_ENST00000454757.2_Missense_Mutation_p.G545E|EGFR_ENST00000442591.1_Missense_Mutation_p.G598E|EGFR_ENST00000344576.2_Missense_Mutation_p.G598E|EGFR_ENST00000455089.1_Missense_Mutation_p.G553E	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	598					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.G598V(15)		NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	TGCCCGGCAGGAGTCATGGGA	0.567		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																													yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	15	Substitution - Missense(15)	central_nervous_system(15)											96.0	84.0	88.0					7																	55233043		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.1793G>A	7.37:g.55233043G>A	ENSP00000275493:p.Gly598Glu		O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.G598E	ENST00000275493.2	37	c.1793	CCDS5514.1	7	.	.	.	.	.	.	.	.	.	.	G	28.2	4.899687	0.91962	.	.	ENSG00000146648	ENST00000455089;ENST00000342916;ENST00000395504;ENST00000344576;ENST00000275493;ENST00000442591;ENST00000454757;ENST00000533450	T;T;T;T;T;T	0.38560	1.13;1.13;1.13;1.13;1.13;1.13	5.87	5.87	0.94306	Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	T	0.70334	0.3212	M	0.85197	2.74	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.87578	0.941;0.954;0.991;0.998	T	0.73936	-0.3825	10	0.87932	D	0	.	18.7698	0.91887	0.0:0.0:1.0:0.0	.	553;598;598;598	Q504U8;P00533;P00533-3;P00533-4	.;EGFR_HUMAN;.;.	E	553;598;468;598;598;598;545;392	ENSP00000415559:G553E;ENSP00000342376:G598E;ENSP00000345973:G598E;ENSP00000275493:G598E;ENSP00000410031:G598E;ENSP00000395243:G545E	ENSP00000275493:G598E	G	+	2	0	EGFR	55200537	1.000000	0.71417	0.454000	0.27019	0.665000	0.39181	7.905000	0.87416	2.785000	0.95823	0.655000	0.94253	GGA	EGFR	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat	ENSG00000146648		0.567	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EGFR	HGNC	protein_coding	OTTHUMT00000251456.2	-	0.00	46	0	G	NM_005228		55233043	+1	tier1	-	no_errors	ENST00000275493	ensembl	human	known	74_37	missense	39.06	39	25	SNP	1.000	A
EIF2AK3	9451	genome.wustl.edu	37	2	88874663	88874663	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr2:88874663C>T	ENST00000303236.3	-	13	2639	c.2338G>A	c.(2338-2340)Gat>Aat	p.D780N	AC104134.2_ENST00000413234.1_RNA|EIF2AK3_ENST00000470706.1_Intron|EIF2AK3_ENST00000419748.1_Missense_Mutation_p.D629N	NM_004836.5	NP_004827.4	Q9NZJ5	E2AK3_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 3	780	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|bone mineralization (GO:0030282)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|chondrocyte development (GO:0002063)|endocrine pancreas development (GO:0031018)|endoplasmic reticulum organization (GO:0007029)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|fat cell differentiation (GO:0045444)|insulin secretion (GO:0030073)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|lactation (GO:0007595)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|negative regulation of myelination (GO:0031642)|negative regulation of translation (GO:0017148)|negative regulation of translational initiation in response to stress (GO:0032057)|ossification (GO:0001503)|positive regulation of protein binding (GO:0032092)|positive regulation of signal transduction (GO:0009967)|protein autophosphorylation (GO:0046777)|protein homooligomerization (GO:0051260)|protein phosphorylation (GO:0006468)|regulation of fatty acid metabolic process (GO:0019217)|response to endoplasmic reticulum stress (GO:0034976)|skeletal system development (GO:0001501)|SREBP signaling pathway (GO:0032933)|translation (GO:0006412)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activity (GO:0004674)			ovary(3)	3						TGCCCCTCATCATTGCCATCC	0.473																																					GBM(138;671 1851 16235 39058 45249)												0													312.0	308.0	309.0					2																	88874663		2203	4300	6503	SO:0001583	missense	0			AF110146	CCDS33241.1	2p12	2008-05-21			ENSG00000172071	ENSG00000172071			3255	protein-coding gene	gene with protein product		604032				10026192, 10575235	Standard	NM_004836		Approved	PEK, PERK	uc002stc.4	Q9NZJ5	OTTHUMG00000155046	ENST00000303236.3:c.2338G>A	2.37:g.88874663C>T	ENSP00000307235:p.Asp780Asn		A0AVH1|A0AVH2|B2RCU9|O95846|Q53QY0|Q53SB1	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Quinonprotein_ADH-like_supfam,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.D780N	ENST00000303236.3	37	c.2338	CCDS33241.1	2	.	.	.	.	.	.	.	.	.	.	C	13.20	2.167243	0.38315	.	.	ENSG00000172071	ENST00000419748;ENST00000303236;ENST00000535951;ENST00000415570	T;T;T	0.74526	-0.73;-0.67;-0.85	6.06	5.19	0.71726	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.288248	0.42682	D	0.000667	T	0.64549	0.2608	L	0.41492	1.28	0.43069	D	0.994707	B	0.06786	0.001	B	0.06405	0.002	T	0.60979	-0.7155	10	0.40728	T	0.16	-4.4928	10.1086	0.42548	0.0:0.7914:0.1382:0.0704	.	780	Q9NZJ5	E2AK3_HUMAN	N	629;780;629;659	ENSP00000408325:D629N;ENSP00000307235:D780N;ENSP00000412076:D659N	ENSP00000307235:D780N	D	-	1	0	EIF2AK3	88655778	0.028000	0.19301	0.427000	0.26684	0.974000	0.67602	2.015000	0.40961	1.588000	0.49971	-0.127000	0.14921	GAT	EIF2AK3	-	superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000172071		0.473	EIF2AK3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	EIF2AK3	HGNC	protein_coding	OTTHUMT00000338233.2		0.00	26	0	C	NM_004836		88874663	-1			no_errors	ENST00000303236	ensembl	human	known	74_37	missense	5.13	37	2	SNP	0.862	T
EIF3H	8667	genome.wustl.edu	37	8	117668098	117668098	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr8:117668098C>T	ENST00000276682.4	-	7	1512	c.746G>A	c.(745-747)aGc>aAc	p.S249N	EIF3H_ENST00000521861.1_Missense_Mutation_p.S235N					eukaryotic translation initiation factor 3, subunit H									p.S235I(1)		large_intestine(2)|lung(10)|skin(1)	13	all_cancers(13;3.98e-22)|Lung NSC(37;0.000183)|Ovarian(258;0.0172)					CACTTACCTGCTGGCAAGGCT	0.373																																																	1	Substitution - Missense(1)	lung(1)											96.0	85.0	89.0					8																	117668098		2203	4300	6503	SO:0001583	missense	0			U54559	CCDS6319.1	8q24.11	2007-07-27	2007-07-27	2007-07-27	ENSG00000147677	ENSG00000147677			3273	protein-coding gene	gene with protein product		603912	"""eukaryotic translation initiation factor 3, subunit 3 gamma, 40kDa"""	EIF3S3		9341143	Standard	NM_003756		Approved	eIF3-gamma, eIF3-p40, eIF3h	uc003yoa.3	O15372	OTTHUMG00000164919	ENST00000276682.4:c.746G>A	8.37:g.117668098C>T	ENSP00000276682:p.Ser249Asn			Missense_Mutation	SNP	pfam_JAB_MPN_dom,smart_JAB_MPN_dom	p.S235N	ENST00000276682.4	37	c.704		8	.	.	.	.	.	.	.	.	.	.	C	27.6	4.848777	0.91277	.	.	ENSG00000147677	ENST00000521861;ENST00000276682;ENST00000518949	T;T	0.45668	0.89;0.89	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.40145	0.1105	L	0.46157	1.445	0.80722	D	1	P;P	0.48764	0.915;0.842	B;B	0.36922	0.236;0.236	T	0.41233	-0.9520	10	0.72032	D	0.01	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	249;235	B3KS98;O15372	.;EIF3H_HUMAN	N	235;249;203	ENSP00000429931:S235N;ENSP00000276682:S249N	ENSP00000276682:S249N	S	-	2	0	EIF3H	117737279	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.771000	0.85420	2.937000	0.99478	0.650000	0.86243	AGC	EIF3H	-	NULL	ENSG00000147677		0.373	EIF3H-003	PUTATIVE	basic|exp_conf	protein_coding	EIF3H	HGNC	protein_coding	OTTHUMT00000380913.1		0.00	27	0	C	NM_003756		117668098	-1			no_errors	ENST00000521861	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	T
ELAVL4	1996	genome.wustl.edu	37	1	50663196	50663197	+	Intron	INS	-	-	T	rs575024053		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:50663196_50663197insT	ENST00000371823.4	+	6	997				ELAVL4_ENST00000371821.1_Intron|ELAVL4_ENST00000371819.1_Intron|ELAVL4_ENST00000357083.4_Intron|ELAVL4_ENST00000371827.1_Intron|ELAVL4_ENST00000371824.1_Intron|ELAVL4_ENST00000448907.2_Intron	NM_001144774.1|NM_021952.3	NP_001138246.1|NP_068771.2	P26378	ELAV4_HUMAN	ELAV like neuron-specific RNA binding protein 4						mRNA processing (GO:0006397)|RNA processing (GO:0006396)		AU-rich element binding (GO:0017091)|mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	32						TGGGGCTAGAATTTTTTTTTTT	0.351																																																	0																																										SO:0001627	intron_variant	0			AY033998	CCDS553.1, CCDS44138.1, CCDS44139.1, CCDS44140.1, CCDS53315.1, CCDS72788.1	1p34	2013-10-03	2013-10-03		ENSG00000162374	ENSG00000162374		"""RNA binding motif (RRM) containing"""	3315	protein-coding gene	gene with protein product	"""Hu antigen D"""	168360	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D)"", ""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4"""	HUD		8222755	Standard	XM_005270581		Approved	PNEM	uc001csb.2	P26378	OTTHUMG00000007877	ENST00000371823.4:c.773+57->T	1.37:g.50663207_50663207dupT			B1APY6|B1APY7|B7Z4G7|Q8IYD4|Q96J74|Q96J75|Q9UD24	RNA	INS	-	NULL	ENST00000371823.4	37	NULL	CCDS553.1	1																																																																																			ELAVL4	-	-	ENSG00000162374		0.351	ELAVL4-004	KNOWN	basic|CCDS	protein_coding	ELAVL4	HGNC	protein_coding	OTTHUMT00000021712.1		0.00	24	0	-	NM_021952		50663197	+1	tier1		no_errors	ENST00000474675	ensembl	human	known	74_37	rna	15.15	28	5	INS	1.000:1.000	T
ELMSAN1	91748	genome.wustl.edu	37	14	74203747	74203747	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr14:74203747G>A	ENST00000286523.5	-	3	2485	c.1703C>T	c.(1702-1704)aCc>aTc	p.T568I	ELMSAN1_ENST00000394071.2_Missense_Mutation_p.T568I|ELMSAN1_ENST00000486739.1_5'Flank	NM_194278.3	NP_919254.2	Q6PJG2	EMSA1_HUMAN	ELM2 and Myb/SANT-like domain containing 1	568					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)										CCGCCTGCGGGTGACGATGAC	0.622																																																	0													82.0	71.0	75.0					14																	74203747		2203	4300	6503	SO:0001583	missense	0			BF971739	CCDS9819.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000156030	ENSG00000156030			19853	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 117"", ""chromosome 14 open reading frame 43"""	C14orf117, C14orf43			Standard	NM_194278		Approved	LSR68	uc001xou.3	Q6PJG2	OTTHUMG00000150359	ENST00000286523.5:c.1703C>T	14.37:g.74203747G>A	ENSP00000286523:p.Thr568Ile		Q6PK13|Q6PK59|Q6ZS23	Missense_Mutation	SNP	pfam_ELM2_dom,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_ELM2_dom	p.T568I	ENST00000286523.5	37	c.1703	CCDS9819.1	14	.	.	.	.	.	.	.	.	.	.	G	28.1	4.888233	0.91814	.	.	ENSG00000156030	ENST00000394071;ENST00000286523;ENST00000423556;ENST00000435371	T;T;T;T	0.16897	2.32;2.32;2.32;2.31	5.24	5.24	0.73138	.	0.000000	0.64402	D	0.000001	T	0.30823	0.0777	L	0.29908	0.895	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.71870	0.975;0.975	T	0.01729	-1.1286	10	0.59425	D	0.04	-27.6493	17.1775	0.86845	0.0:0.0:1.0:0.0	.	568;568	A0PJD3;Q6PJG2	.;CN043_HUMAN	I	568	ENSP00000377634:T568I;ENSP00000286523:T568I;ENSP00000407767:T568I;ENSP00000402380:T568I	ENSP00000286523:T568I	T	-	2	0	C14orf43	73273500	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.890000	0.92477	2.732000	0.93576	0.655000	0.94253	ACC	ELMSAN1	-	NULL	ENSG00000156030		0.622	ELMSAN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ELMSAN1	HGNC	protein_coding	OTTHUMT00000317793.1	-	0.00	105	0	G	NM_194278		74203747	-1	tier1	-	no_errors	ENST00000286523	ensembl	human	known	74_37	missense	12.50	105	15	SNP	1.000	A
EMC2	9694	genome.wustl.edu	37	8	109491236	109491236	+	Splice_Site	SNP	C	C	G			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr8:109491236C>G	ENST00000220853.3	+	10	739	c.704C>G	c.(703-705)tCg>tGg	p.S235W	EMC2_ENST00000520294.1_3'UTR	NM_014673.3	NP_055488.1	Q15006	EMC2_HUMAN	ER membrane protein complex subunit 2	235						cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|ER membrane protein complex (GO:0072546)|mitochondrion (GO:0005739)|nucleus (GO:0005634)											TGTTTTTAGTCGGCAAGTCAT	0.323																																																	0													79.0	74.0	75.0					8																	109491236		2203	4300	6503	SO:0001630	splice_region_variant	0			BC021667	CCDS6309.1	8q23.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000104412	ENSG00000104412			28963	protein-coding gene	gene with protein product		607722	"""tetratricopeptide repeat domain 35"""	KIAA0103, TTC35		7788527, 22119785	Standard	NM_014673		Approved		uc003ymw.1	Q15006	OTTHUMG00000164873	ENST00000220853.3:c.703-1C>G	8.37:g.109491236C>G			Q8WUE1	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.S235W	ENST00000220853.3	37	c.704	CCDS6309.1	8	.	.	.	.	.	.	.	.	.	.	C	22.0	4.225044	0.79576	.	.	ENSG00000104412	ENST00000220853	T	0.76839	-1.05	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	D	0.87022	0.6074	M	0.66939	2.045	0.80722	D	1	D	0.76494	0.999	D	0.65773	0.938	D	0.86685	0.1919	10	0.54805	T	0.06	-9.2818	19.8297	0.96630	0.0:1.0:0.0:0.0	.	235	Q15006	TTC35_HUMAN	W	235	ENSP00000220853:S235W	ENSP00000220853:S235W	S	+	2	0	TTC35	109560412	1.000000	0.71417	0.987000	0.45799	0.816000	0.46133	7.412000	0.80091	2.697000	0.92050	0.557000	0.71058	TCG	EMC2	-	NULL	ENSG00000104412		0.323	EMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMC2	HGNC	protein_coding	OTTHUMT00000380717.1	-	0.00	22	0	C	NM_014673	Missense_Mutation	109491236	+1	tier1	-	no_errors	ENST00000220853	ensembl	human	known	74_37	missense	47.83	12	11	SNP	1.000	G
ENPP5	59084	genome.wustl.edu	37	6	46135472	46135472	+	Silent	SNP	T	T	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr6:46135472T>C	ENST00000371383.2	-	3	788	c.528A>G	c.(526-528)tcA>tcG	p.S176S	ENPP5_ENST00000492313.1_5'Flank|ENPP5_ENST00000230565.3_Silent_p.S176S					ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative)											endometrium(3)|kidney(1)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	12						TGGGCTCTTTTGACGTAAACC	0.418																																																	0													74.0	80.0	78.0					6																	46135472		2203	4300	6503	SO:0001819	synonymous_variant	0			AL035701	CCDS4915.1	6p21.1-p11.2	2010-06-24	2010-06-24		ENSG00000112796	ENSG00000112796			13717	protein-coding gene	gene with protein product						11027689	Standard	XM_005249259		Approved		uc003oxz.1	Q9UJA9	OTTHUMG00000014781	ENST00000371383.2:c.528A>G	6.37:g.46135472T>C				Silent	SNP	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.S176	ENST00000371383.2	37	c.528	CCDS4915.1	6																																																																																			ENPP5	-	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	ENSG00000112796		0.418	ENPP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP5	HGNC	protein_coding	OTTHUMT00000040779.2	-	0.00	23	0	T			46135472	-1	tier1	-	no_errors	ENST00000230565	ensembl	human	known	74_37	silent	24.07	41	13	SNP	0.839	C
AC109351.1	0	genome.wustl.edu	37	4	29751861	29751861	+	RNA	DEL	A	A	-	rs113375137	byFrequency	TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr4:29751861delA	ENST00000390756.1	+	0	44																											CTTGAGAAGGAAAAAAAAAAT	0.308													|||unknown(HR)	243	0.0485224	0.0961	0.0375	5008	,	,		17644	0.0069		0.0596	False		,,,				2504	0.0235																0																																												0																															4.37:g.29751861delA				RNA	DEL	-	NULL	ENST00000390756.1	37	NULL		4																																																																																			AC109351.1	-	-	ENSG00000212045		0.308	AC109351.1-201	NOVEL	basic	miRNA	ENSG00000212045	Clone_based_ensembl_gene	miRNA			0.00	47	0	A			29751861	+1	tier1		no_errors	ENST00000390756	ensembl	human	novel	74_37	rna	12.12	58	8	DEL	1.000	-
AC099552.4	0	genome.wustl.edu	37	7	154988978	154988978	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr7:154988978G>T	ENST00000404289.1	-	2	274	c.139C>A	c.(139-141)Cta>Ata	p.L47I																								ttactttttagagggctcagg	0.473																																																	0																																										SO:0001583	missense	0																														ENST00000404289.1:c.139C>A	7.37:g.154988978G>T	ENSP00000386035:p.Leu47Ile			Missense_Mutation	SNP	NULL	p.L47I	ENST00000404289.1	37	c.139		7	.	.	.	.	.	.	.	.	.	.	G	2.451	-0.326401	0.05350	.	.	ENSG00000217825	ENST00000404289	.	.	.	0.149	0.149	0.14863	.	.	.	.	.	T	0.53077	0.1774	.	.	.	.	.	.	.	.	.	.	.	.	T	0.62358	-0.6871	3	0.87932	D	0	.	.	.	.	.	.	.	.	I	47	.	ENSP00000386035:L47I	L	-	1	2	AC099552.4	154619911	0.111000	0.22076	0.173000	0.22940	0.173000	0.22820	0.251000	0.18257	0.192000	0.20272	0.195000	0.17529	CTA	AC099552.4	-	NULL	ENSG00000217825		0.473	AC099552.4-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	ENSG00000217825	Clone_based_vega_gene	protein_coding	OTTHUMT00000322236.1	-	0.00	82	0	G			154988978	-1	tier1	-	no_errors	ENST00000404289	ensembl	human	putative	74_37	missense	6.06	62	4	SNP	0.200	T
LOC102723968	102723968	genome.wustl.edu	37	13	64413248	64413248	+	lincRNA	SNP	A	A	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr13:64413248A>T	ENST00000607822.1	-	0	2113				RP11-394A14.4_ENST00000606894.1_lincRNA																							tccaagaagaaagctcaaatc	0.532																																																	0																																												0																															13.37:g.64413248A>T				RNA	SNP	-	NULL	ENST00000607822.1	37	NULL		13																																																																																			RP11-394A14.2	-	-	ENSG00000219926		0.532	RP11-394A14.2-002	KNOWN	basic	lincRNA	ENSG00000219926	Clone_based_vega_gene	lincRNA	OTTHUMT00000471084.1	-	0.00	129	0	A			64413248	-1	tier1	-	no_errors	ENST00000606050	ensembl	human	known	74_37	rna	7.92	93	8	SNP	0.040	T
BCL6	604	genome.wustl.edu	37	3	187463074	187463075	+	Intron	INS	-	-	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr3:187463074_187463075insA	ENST00000406870.2	-	1	318				BCL6_ENST00000496823.1_Intron|RP11-211G3.2_ENST00000450760.1_lincRNA	NM_001706.4	NP_001697.2	P41182	BCL6_HUMAN	B-cell CLL/lymphoma 6						actin cytoskeleton organization (GO:0030036)|B cell differentiation (GO:0030183)|cell morphogenesis (GO:0000902)|cellular response to DNA damage stimulus (GO:0006974)|erythrocyte development (GO:0048821)|germinal center formation (GO:0002467)|inflammatory response (GO:0006954)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of mast cell cytokine production (GO:0032764)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cellular component movement (GO:0051272)|protein import into nucleus, translocation (GO:0000060)|regulation of germinal center formation (GO:0002634)|regulation of immune response (GO:0050776)|regulation of inflammatory response (GO:0050727)|regulation of memory T cell differentiation (GO:0043380)|regulation of Rho GTPase activity (GO:0032319)|Rho protein signal transduction (GO:0007266)|spermatogenesis (GO:0007283)|type 2 immune response (GO:0042092)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(9)|lung(10)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	40	all_cancers(143;9.45e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0141)		GGCAAGAGCGGAAAAAAAAAGA	0.441			"""T, Mis"""	"""IG loci, ZNFN1A1, LCP1, PIM1, TFRC, CIITA, NACA, HSPCB, HSPCA, HIST1H4I, IL21R,  POU2AF1, ARHH, EIF4A2, SFRS3"""	"""NHL, CLL"""																																			Dom	yes		3	3q27	604	B-cell CLL/lymphoma 6		L	0																																										SO:0001627	intron_variant	0				CCDS3289.1, CCDS46975.1	3q27	2013-01-09	2008-08-01		ENSG00000113916	ENSG00000113916		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1001	protein-coding gene	gene with protein product		109565	"""zinc finger protein 51"""	ZNF51			Standard	NM_001130845		Approved	ZBTB27, LAZ3, BCL5, BCL6A	uc003frq.2	P41182	OTTHUMG00000156441	ENST00000406870.2:c.48+122->T	3.37:g.187463083_187463083dupA			A7E241|B8PSA7|D3DNV5	RNA	INS	-	NULL	ENST00000406870.2	37	NULL	CCDS3289.1	3																																																																																			RP11-211G3.2	-	-	ENSG00000223401		0.441	BCL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000223401	Clone_based_vega_gene	protein_coding	OTTHUMT00000344202.1		0.00	90	0	-	NM_138931		187463075	+1	tier1		no_errors	ENST00000450760	ensembl	human	known	74_37	rna	8.06	57	5	INS	0.969:0.026	A
LHX8	431707	genome.wustl.edu	37	1	75596421	75596421	+	Intron	SNP	A	A	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:75596421A>C	ENST00000294638.5	+	2	682				RP11-510C10.3_ENST00000427892.1_RNA|RP11-510C10.2_ENST00000446238.1_RNA	NM_001001933.1	NP_001001933.1	Q68G74	LHX8_HUMAN	LIM homeobox 8						female gonad development (GO:0008585)|forebrain neuron development (GO:0021884)|learning or memory (GO:0007611)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	female germ cell nucleus (GO:0001674)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(18)|ovary(3)|urinary_tract(1)	30						GAGCAGGGTAAGTTTGTGGAA	0.448																																																	0													131.0	139.0	136.0					1																	75596421		2203	4300	6503	SO:0001627	intron_variant	0			AB050476	CCDS30756.1, CCDS58008.1	1p31.1	2011-06-20			ENSG00000162624	ENSG00000162624		"""Homeoboxes / LIM class"""	28838	protein-coding gene	gene with protein product		604425				9598319	Standard	NM_001256114		Approved	Lhx7	uc031pmx.1	Q68G74	OTTHUMG00000009692	ENST00000294638.5:c.18+4A>C	1.37:g.75596421A>C			E9PGE3	RNA	SNP	-	NULL	ENST00000294638.5	37	NULL	CCDS30756.1	1																																																																																			RP11-510C10.3	-	-	ENSG00000224149		0.448	LHX8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000224149	Clone_based_vega_gene	protein_coding	OTTHUMT00000026700.1	-	0.00	124	0	A	NM_001001933		75596421	-1	tier1	-	no_errors	ENST00000427892	ensembl	human	known	74_37	rna	25.52	108	37	SNP	0.000	C
RP11-423O2.5	0	genome.wustl.edu	37	1	142803930	142803930	+	lincRNA	SNP	A	A	G	rs74792472		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:142803930A>G	ENST00000423385.1	-	0	1035																											AATTTGATTAACTTCTAAATT	0.328																																																	0																																												0																															1.37:g.142803930A>G				RNA	SNP	-	NULL	ENST00000423385.1	37	NULL		1																																																																																			RP11-423O2.5	-	-	ENSG00000234978		0.328	RP11-423O2.5-001	KNOWN	basic	lincRNA	ENSG00000234978	Clone_based_vega_gene	lincRNA	OTTHUMT00000193203.1	-	0.00	41	0	A			142803930	-1	tier1	rs74792472	no_errors	ENST00000423385	ensembl	human	known	74_37	rna	10.00	36	4	SNP	0.001	G
BX088651.1	0	genome.wustl.edu	37	9	44403205	44403205	+	5'Flank	SNP	T	T	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr9:44403205T>C	ENST00000540551.1	-	0	0				RP11-475I24.3_ENST00000435586.1_lincRNA																							GCCCATTTTCTCACTTCCTGT	0.363																																																	0																																										SO:0001631	upstream_gene_variant	0																															9.37:g.44403205T>C	Exception_encountered			RNA	SNP	-	NULL	ENST00000540551.1	37	NULL		9																																																																																			RP11-475I24.3	-	-	ENSG00000237357		0.363	BX088651.1-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000237357	Clone_based_vega_gene	protein_coding		-	0.00	40	0	T			44403205	+1	tier1	-	no_errors	ENST00000425309	ensembl	human	known	74_37	rna	17.95	32	7	SNP	0.355	C
SOX11	6664	genome.wustl.edu	37	2	5836388	5836388	+	3'UTR	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr2:5836388C>T	ENST00000322002.3	+	0	3590				AC010729.1_ENST00000455579.2_RNA	NM_003108.3	NP_003099.1	P35716	SOX11_HUMAN	SRY (sex determining region Y)-box 11						cardiac ventricle formation (GO:0003211)|closure of optic fissure (GO:0061386)|cornea development in camera-type eye (GO:0061303)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|eyelid development in camera-type eye (GO:0061029)|glial cell development (GO:0021782)|glial cell proliferation (GO:0014009)|hard palate development (GO:0060022)|kidney development (GO:0001822)|lens morphogenesis in camera-type eye (GO:0002089)|limb bud formation (GO:0060174)|lung morphogenesis (GO:0060425)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of lymphocyte proliferation (GO:0050672)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|neural crest cell development (GO:0014032)|neural tube formation (GO:0001841)|neuroepithelial cell differentiation (GO:0060563)|neuron differentiation (GO:0030182)|noradrenergic neuron differentiation (GO:0003357)|oligodendrocyte development (GO:0014003)|outflow tract morphogenesis (GO:0003151)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of hippo signaling (GO:0035332)|positive regulation of hormone secretion (GO:0046887)|positive regulation of lens epithelial cell proliferation (GO:2001111)|positive regulation of neurogenesis (GO:0050769)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of ossification (GO:0045778)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|signal transduction involved in cell cycle checkpoint (GO:0072395)|skeletal muscle cell differentiation (GO:0035914)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)|somite development (GO:0061053)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|translation (GO:0006412)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|translation factor activity, nucleic acid binding (GO:0008135)			central_nervous_system(5)|cervix(1)|endometrium(1)|liver(1)|lung(4)|stomach(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			OV - Ovarian serous cystadenocarcinoma(76;0.132)		TGACCTCTAGCGGTGAAGGGG	0.552																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS1654.1	2p25	2008-05-21			ENSG00000176887	ENSG00000176887		"""SRY (sex determining region Y)-boxes"""	11191	protein-coding gene	gene with protein product	"""SRY-related HMG-box gene 11"""	600898				8666406, 12637543	Standard	NM_003108		Approved		uc002qyj.3	P35716	OTTHUMG00000090333	ENST00000322002.3:c.*2209C>T	2.37:g.5836388C>T			Q4ZFV8	RNA	SNP	-	NULL	ENST00000322002.3	37	NULL	CCDS1654.1	2																																																																																			AC010729.1	-	-	ENSG00000242540		0.552	SOX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000242540	Clone_based_vega_gene	protein_coding	OTTHUMT00000206698.1	-	0.00	199	0	C	NM_003108		5836388	+1	tier1	-	no_errors	ENST00000455579	ensembl	human	known	74_37	rna	51.14	86	90	SNP	0.004	T
ST5	6764	genome.wustl.edu	37	11	8715405	8715405	+	3'UTR	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr11:8715405G>A	ENST00000534127.1	-	0	4037				ST5_ENST00000526757.1_3'UTR|ST5_ENST00000313726.6_3'UTR|RPL27A_ENST00000531102.1_Intron|ST5_ENST00000357665.1_3'UTR|ST5_ENST00000530991.1_3'UTR|RP11-152H18.3_ENST00000529883.1_RNA|ST5_ENST00000526099.1_3'UTR	NM_005418.3	NP_005409.3	P78524	ST5_HUMAN	suppression of tumorigenicity 5						positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(13)|liver(1)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	39				Epithelial(150;2.63e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0352)		CGGCCCCTTGGGAATATACAA	0.443																																																	0																																										SO:0001624	3_prime_UTR_variant	0			U15131	CCDS7791.1, CCDS7792.1	11p15	2012-10-04				ENSG00000166444		"""DENN/MADD domain containing"""	11350	protein-coding gene	gene with protein product	"""DENN/MADD domain containing 2B"""	140750				1390339	Standard	NM_005418		Approved	HTS1, DENND2B, p126	uc001mgt.3	P78524		ENST00000534127.1:c.*238C>T	11.37:g.8715405G>A			B2R6X7|B3KXQ6|P78523|Q16492|Q7KYY2|Q7KZ12|Q8NE12|Q9BQQ6	RNA	SNP	-	NULL	ENST00000534127.1	37	NULL	CCDS7791.1	11																																																																																			RP11-152H18.3	-	-	ENSG00000254665		0.443	ST5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000254665	Clone_based_vega_gene	protein_coding	OTTHUMT00000386518.1	-	0.00	70	0	G	NM_005418		8715405	+1	tier1	-	no_errors	ENST00000529883	ensembl	human	known	74_37	rna	30.00	55	24	SNP	1.000	A
RP11-480G7.1	0	genome.wustl.edu	37	16	46737582	46737583	+	lincRNA	INS	-	-	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr16:46737582_46737583insA	ENST00000562218.1	-	0	354_355																											CCTCAAATTTCAAAAAAAGGAT	0.381																																																	0																																												0																															16.37:g.46737589_46737589dupA				RNA	INS	-	NULL	ENST00000562218.1	37	NULL		16																																																																																			RP11-480G7.1	-	-	ENSG00000261788		0.381	RP11-480G7.1-001	KNOWN	basic	lincRNA	ENSG00000261788	Clone_based_vega_gene	lincRNA	OTTHUMT00000430609.1		0.00	30	0	-			46737583	-1	tier1		no_errors	ENST00000562218	ensembl	human	known	74_37	rna	26.67	22	8	INS	0.083:0.072	A
CTC-444N24.8	0	genome.wustl.edu	37	19	57773715	57773716	+	lincRNA	INS	-	-	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr19:57773715_57773716insA	ENST00000600047.1	+	0	994_995																											CCATTGTAACCAAGAAAAAAAA	0.317																																																	0																																												0																															19.37:g.57773717_57773717dupA				RNA	INS	-	NULL	ENST00000600047.1	37	NULL		19																																																																																			CTC-444N24.8	-	-	ENSG00000268713		0.317	CTC-444N24.8-001	KNOWN	basic	lincRNA	ENSG00000268713	Clone_based_vega_gene	lincRNA	OTTHUMT00000465723.1		0.00	63	0	0			57773716	+1			no_errors	ENST00000600047	ensembl	human	known	74_37	rna	5.22	127	7	INS	0.000:0.001	A
GET4	51608	genome.wustl.edu	37	7	925793	925793	+	Intron	SNP	T	T	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr7:925793T>C	ENST00000265857.3	+	2	328				GET4_ENST00000407192.1_Intron|RP11-449P15.2_ENST00000609998.1_RNA	NM_015949.2	NP_057033.2	Q7L5D6	GET4_HUMAN	golgi to ER traffic protein 4 homolog (S. cerevisiae)						tail-anchored membrane protein insertion into ER membrane (GO:0071816)|transport (GO:0006810)	BAT3 complex (GO:0071818)|cytosol (GO:0005829)				breast(1)|large_intestine(1)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						TGCTTCCTCCTGCATCCCTTT	0.637																																																	0													88.0	67.0	74.0					7																	925793		2202	4298	6500	SO:0001627	intron_variant	0			AK023560	CCDS5317.1	7p22.3	2010-08-05	2010-03-24	2010-03-24	ENSG00000239857	ENSG00000239857			21690	protein-coding gene	gene with protein product	"""CGI-20 protein"", ""conserved edge protein"", ""transmembrane domain recognition complex, 35kDa"""	612056	"""chromosome 7 open reading frame 20"""	C7orf20		10810093, 20106980, 20676083	Standard	NM_015949		Approved	CGI-20, H_NH1244M04.5, CEE, TRC35	uc003sjl.1	Q7L5D6	OTTHUMG00000112459	ENST00000265857.3:c.234+22T>C	7.37:g.925793T>C			A4D2Q1|B3KNC7|Q9UFC9|Q9Y309	RNA	SNP	-	NULL	ENST00000265857.3	37	NULL	CCDS5317.1	7																																																																																			RP11-449P15.2	-	-	ENSG00000273151		0.637	GET4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000273151	Clone_based_vega_gene	protein_coding	OTTHUMT00000231930.1	-	0.00	66	0	T	NM_015949		925793	-1	tier1	-	no_errors	ENST00000609998	ensembl	human	known	74_37	rna	6.12	137	9	SNP	0.000	C
EP400	57634	genome.wustl.edu	37	12	132512805	132512805	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr12:132512805G>T	ENST00000333577.4	+	28	5570	c.5461G>T	c.(5461-5463)Gga>Tga	p.G1821*	EP400_ENST00000389561.2_Nonsense_Mutation_p.G1785*|EP400_ENST00000330386.6_Nonsense_Mutation_p.G1704*|EP400_ENST00000389562.2_Nonsense_Mutation_p.G1784*|EP400_ENST00000332482.4_Nonsense_Mutation_p.G1748*|SNORA49_ENST00000386157.1_RNA			Q96L91	EP400_HUMAN	E1A binding protein p400	1821					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		TTGTCGGTGTGGAGAGTCTCT	0.567																																																	0													184.0	159.0	168.0					12																	132512805		2203	4300	6503	SO:0001587	stop_gained	0			U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.5461G>T	12.37:g.132512805G>T	ENSP00000333602:p.Gly1821*		O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Nonsense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase/SANT-assoc_DNA-bd,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Homeodomain-like,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Myb-like_dom,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.G1821*	ENST00000333577.4	37	c.5461		12	.	.	.	.	.	.	.	.	.	.	G	44	10.558655	0.99427	.	.	ENSG00000183495	ENST00000333577;ENST00000389561;ENST00000389562;ENST00000332482;ENST00000330386;ENST00000541296;ENST00000542457	.	.	.	5.97	0.419	0.16438	.	1.436090	0.04193	N	0.328659	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	.	7.3877	0.26893	0.2805:0.5653:0.0844:0.0697	.	.	.	.	X	1821;1785;1784;1748;1704;1785;1704	.	ENSP00000330620:G1704X	G	+	1	0	EP400	131078758	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.291000	0.18994	-0.140000	0.11394	-0.802000	0.03209	GGA	EP400	-	NULL	ENSG00000183495		0.567	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	EP400	HGNC	protein_coding			0.00	124	0	G	NM_015409		132512805	+1			no_errors	ENST00000333577	ensembl	human	known	74_37	nonsense	5.43	87	5	SNP	0.000	T
EPHA8	2046	genome.wustl.edu	37	1	22902916	22902916	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:22902916C>A	ENST00000166244.3	+	3	438	c.366C>A	c.(364-366)ttC>ttA	p.F122L	EPHA8_ENST00000538803.1_Missense_Mutation_p.F122L|EPHA8_ENST00000374644.4_Missense_Mutation_p.F122L	NM_020526.3	NP_065387.1	P29322	EPHA8_HUMAN	EPH receptor A8	122	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|ephrin receptor signaling pathway (GO:0048013)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell adhesion mediated by integrin (GO:0033628)|substrate-dependent cell migration (GO:0006929)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(6)|lung(22)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		AGGAGACCTTCAACCTCTACT	0.607																																																	0													61.0	58.0	59.0					1																	22902916		2203	4300	6503	SO:0001583	missense	0			BC038796	CCDS225.1, CCDS30626.1	1p36.12	2013-02-11	2004-10-28		ENSG00000070886	ENSG00000070886	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3391	protein-coding gene	gene with protein product		176945	"""EphA8"""	EEK		1648701	Standard	NM_001006943		Approved	Hek3	uc001bfx.1	P29322	OTTHUMG00000002892	ENST00000166244.3:c.366C>A	1.37:g.22902916C>A	ENSP00000166244:p.Phe122Leu		Q6IN80|Q8IUX6|Q9NUA9|Q9P269	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.F122L	ENST00000166244.3	37	c.366	CCDS225.1	1	.	.	.	.	.	.	.	.	.	.	C	19.52	3.843252	0.71488	.	.	ENSG00000070886	ENST00000166244;ENST00000374644;ENST00000538803	T;T;T	0.12569	2.67;2.67;2.67	4.29	2.41	0.29592	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	T	0.34745	0.0908	M	0.84156	2.68	0.53005	D	0.999961	D;D	0.89917	0.999;1.0	D;D	0.91635	0.992;0.999	T	0.04593	-1.0940	10	0.87932	D	0	.	6.9888	0.24743	0.0:0.7095:0.0:0.2905	.	122;122	P29322;P29322-2	EPHA8_HUMAN;.	L	122	ENSP00000166244:F122L;ENSP00000363775:F122L;ENSP00000440274:F122L	ENSP00000166244:F122L	F	+	3	2	EPHA8	22775503	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.623000	0.46435	0.448000	0.26722	0.442000	0.29010	TTC	EPHA8	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ephrin_rcpt_lig-bd_dom,superfamily_Galactose-bd-like,smart_Ephrin_rcpt_lig-bd_dom	ENSG00000070886		0.607	EPHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA8	HGNC	protein_coding	OTTHUMT00000008085.1		0.00	60	0	C	NM_020526		22902916	+1			no_errors	ENST00000166244	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	A
EPPK1	83481	genome.wustl.edu	37	8	144942890	144942890	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr8:144942890G>A	ENST00000525985.1	-	2	4603	c.4532C>T	c.(4531-4533)gCt>gTt	p.A1511V				P58107	EPIPL_HUMAN	epiplakin 1	1511						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCTCTCTGCAGCCTCGACCAG	0.682																																																	0													11.0	13.0	13.0					8																	144942890		2072	4201	6273	SO:0001583	missense	0			AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.4532C>T	8.37:g.144942890G>A	ENSP00000436337:p.Ala1511Val		Q76E58|Q9NSU9	Missense_Mutation	SNP	pfam_Plectin_repeat,smart_Plectin_repeat	p.A1511V	ENST00000525985.1	37	c.4532		8	.	.	.	.	.	.	.	.	.	.	G	2.768	-0.256413	0.05829	.	.	ENSG00000227184	ENST00000525985	T	0.67865	-0.29	4.54	-1.47	0.08772	.	.	.	.	.	T	0.55065	0.1897	L	0.34521	1.04	0.09310	N	1	B	0.24721	0.11	B	0.27887	0.084	T	0.41556	-0.9502	9	0.30078	T	0.28	.	14.8305	0.70146	0.0:0.0:0.3355:0.6645	.	1511	E9PPU0	.	V	1511	ENSP00000436337:A1511V	ENSP00000436337:A1511V	A	-	2	0	EPPK1	145014878	0.004000	0.15560	0.000000	0.03702	0.005000	0.04900	0.771000	0.26633	-0.368000	0.08040	-1.378000	0.01179	GCT	EPPK1	-	NULL	ENSG00000227184		0.682	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	EPPK1	HGNC	protein_coding	OTTHUMT00000382675.1	-	0.00	20	0	G	NM_031308		144942890	-1	tier1	-	no_errors	ENST00000525985	ensembl	human	known	74_37	missense	23.53	26	8	SNP	0.000	A
EPS8L3	79574	genome.wustl.edu	37	1	110299762	110299762	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:110299762C>T	ENST00000361965.4	-	12	1101	c.995G>A	c.(994-996)gGc>gAc	p.G332D	EPS8L3_ENST00000361852.4_Missense_Mutation_p.G332D|RP4-735C1.4_ENST00000431955.1_RNA|EPS8L3_ENST00000494151.1_5'Flank|EPS8L3_ENST00000369805.3_Missense_Mutation_p.G333D	NM_133181.3	NP_573444.2	Q8TE67	ES8L3_HUMAN	EPS8-like 3	332						cytoplasm (GO:0005737)				breast(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	32		all_epithelial(167;1.95e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)		Lung(183;0.0245)|Colorectal(144;0.0365)|all cancers(265;0.103)|Epithelial(280;0.109)|LUSC - Lung squamous cell carcinoma(189;0.137)|COAD - Colon adenocarcinoma(174;0.141)		GGCTGCTAGGCCAGCCTCAGG	0.592																																																	0													63.0	55.0	58.0					1																	110299762		2203	4300	6503	SO:0001583	missense	0			AK025175	CCDS813.1, CCDS814.1, CCDS815.1	1p13.2	2008-02-05			ENSG00000198758	ENSG00000198758			21297	protein-coding gene	gene with protein product		614989				12620401	Standard	NM_139053		Approved	FLJ21522, MGC16817	uc001dyq.2	Q8TE67	OTTHUMG00000011651	ENST00000361965.4:c.995G>A	1.37:g.110299762C>T	ENSP00000355255:p.Gly332Asp		A8K833|Q5T8Q6|Q5T8Q7|Q5T8Q8|Q96E47|Q9H719	Missense_Mutation	SNP	pfam_PTB,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_SAM/pointed,smart_SH3_domain,pfscan_SH3_domain	p.G333D	ENST00000361965.4	37	c.998	CCDS814.1	1	.	.	.	.	.	.	.	.	.	.	C	6.008	0.369891	0.11352	.	.	ENSG00000198758	ENST00000361852;ENST00000369805;ENST00000361965	T;T;T	0.12147	2.71;2.71;2.71	5.44	-6.76	0.01732	.	0.918119	0.09416	N	0.805110	T	0.01287	0.0042	N	0.04880	-0.145	0.09310	N	1	B;B;B;B	0.11235	0.0;0.002;0.0;0.004	B;B;B;B	0.09377	0.002;0.004;0.003;0.004	T	0.47711	-0.9096	10	0.05436	T	0.98	-0.0237	15.6673	0.77238	0.0:0.1738:0.0:0.8262	.	332;332;332;333	A8K2J6;Q8TE67-2;Q8TE67;Q8TE67-3	.;.;ES8L3_HUMAN;.	D	332;333;332	ENSP00000354551:G332D;ENSP00000358820:G333D;ENSP00000355255:G332D	ENSP00000354551:G332D	G	-	2	0	EPS8L3	110101285	0.000000	0.05858	0.000000	0.03702	0.484000	0.33280	-2.147000	0.01293	-1.368000	0.02149	0.585000	0.79938	GGC	EPS8L3	-	NULL	ENSG00000198758		0.592	EPS8L3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	EPS8L3	HGNC	protein_coding	OTTHUMT00000032234.1	-	0.00	36	0	C	NM_024526		110299762	-1	tier1	-	no_errors	ENST00000369805	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.000	T
ERBB4	2066	genome.wustl.edu	37	2	212812173	212812173	+	Nonsense_Mutation	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr2:212812173C>A	ENST00000342788.4	-	3	713	c.403G>T	c.(403-405)Gga>Tga	p.G135*	ERBB4_ENST00000402597.1_Nonsense_Mutation_p.G135*|ERBB4_ENST00000484474.1_5'UTR|ERBB4_ENST00000436443.1_Nonsense_Mutation_p.G135*	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	135					cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	TTCTTTAATCCAAGTTCTTGA	0.323										TSP Lung(8;0.080)																																							0													113.0	110.0	111.0					2																	212812173		2202	4300	6502	SO:0001587	stop_gained	0			L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.403G>T	2.37:g.212812173C>A	ENSP00000342235:p.Gly135*		B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Nonsense_Mutation	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.G135*	ENST00000342788.4	37	c.403	CCDS2394.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	37|37	6.621559|6.621559	0.97714|0.97714	.|.	.|.	ENSG00000178568|ENSG00000178568	ENST00000342788;ENST00000436443;ENST00000402597;ENST00000435846|ENST00000260943	.|D	.|0.91521	.|-2.86	5.54|5.54	5.54|5.54	0.83059|0.83059	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|D	.|0.95357	.|0.8493	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|D	.|0.95571	.|0.8638	.|5	0.06757|0.87932	T|D	0.87|0	.|.	19.4961|19.4961	0.95073|0.95073	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|F	135;135;135;76|134	.|ENSP00000260943:L134F	ENSP00000342235:G135X|ENSP00000260943:L134F	G|L	-|-	1|3	0|2	ERBB4|ERBB4	212520418|212520418	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	5.999000|5.999000	0.70665|0.70665	2.601000|2.601000	0.87937|0.87937	0.557000|0.557000	0.71058|0.71058	GGA|TTG	ERBB4	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_EGF_rcpt_L	ENSG00000178568		0.323	ERBB4-001	KNOWN	basic|CCDS	protein_coding	ERBB4	HGNC	protein_coding	OTTHUMT00000256597.1		0.00	35	0	C	NM_001042599		212812173	-1			no_errors	ENST00000342788	ensembl	human	known	74_37	nonsense	7.69	48	4	SNP	1.000	A
ERC2	26059	genome.wustl.edu	37	3	56026194	56026194	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr3:56026194G>T	ENST00000288221.6	-	11	2401	c.2146C>A	c.(2146-2148)Cgc>Agc	p.R716S		NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2	716						cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)				breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		CACTCGTCGCGGTAGTAAGAC	0.473																																																	0													192.0	187.0	189.0					3																	56026194		1911	4126	6037	SO:0001583	missense	0			AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.2146C>A	3.37:g.56026194G>T	ENSP00000288221:p.Arg716Ser		Q2T9F6|Q86TK4	Missense_Mutation	SNP	pfam_CAZ_cplx_RIM-bd_prot,superfamily_Prefoldin	p.R716S	ENST00000288221.6	37	c.2146	CCDS46851.1	3	.	.	.	.	.	.	.	.	.	.	G	14.99	2.699414	0.48307	.	.	ENSG00000187672	ENST00000288221	T	0.43688	0.94	5.69	5.69	0.88448	.	0.049024	0.85682	D	0.000000	T	0.42404	0.1201	M	0.70275	2.135	0.40723	D	0.982676	P	0.34815	0.47	B	0.30646	0.118	T	0.48625	-0.9019	10	0.66056	D	0.02	-8.2645	12.8431	0.57815	0.0:0.0:0.7287:0.2713	.	716	O15083	ERC2_HUMAN	S	716	ENSP00000288221:R716S	ENSP00000288221:R716S	R	-	1	0	ERC2	56001234	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	4.782000	0.62396	2.699000	0.92147	0.591000	0.81541	CGC	ERC2	-	pfam_CAZ_cplx_RIM-bd_prot	ENSG00000187672		0.473	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERC2	HGNC	protein_coding	OTTHUMT00000350884.2	-	0.00	40	0	G	NM_015576		56026194	-1	tier1	-	no_errors	ENST00000288221	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
ERCC6L2	375748	genome.wustl.edu	37	9	98729016	98729016	+	3'UTR	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr9:98729016C>A	ENST00000288985.7	+	0	2458				ERCC6L2_ENST00000466840.1_3'UTR|ERCC6L2_ENST00000437817.1_3'UTR	NM_001010895.2	NP_001010895.1	Q5T890	ER6L2_HUMAN	excision repair cross-complementation group 6-like 2						DNA repair (GO:0006281)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)										TCTTCTCTGACCTTTTCAATA	0.363																																																	0													63.0	61.0	61.0					9																	98729016		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			BC022957	CCDS35072.1	9q22.32	2014-03-07	2014-03-07	2012-03-30	ENSG00000182150	ENSG00000182150			26922	protein-coding gene	gene with protein product		615667	"""chromosome 9 open reading frame 102"", ""excision repair cross-complementing rodent repair deficiency, complementation group 6-like 2"""	C9orf102			Standard	NM_001010895		Approved	FLJ37706, RAD26L	uc004avt.4	Q5T890	OTTHUMG00000020289	ENST00000288985.7:c.*14C>A	9.37:g.98729016C>A			A4D997|B2RTP8|Q49AM9|Q5T892|Q8N663|Q8N9D0|Q9NPM7	RNA	SNP	-	NULL	ENST00000288985.7	37	NULL	CCDS35072.1	9																																																																																			ERCC6L2	-	-	ENSG00000182150		0.363	ERCC6L2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ERCC6L2	HGNC	protein_coding	OTTHUMT00000053247.2	-	0.00	40	0	C	NM_001010895		98729016	+1	tier1	-	no_errors	ENST00000466840	ensembl	human	known	74_37	rna	45.71	19	16	SNP	0.000	A
ERVV-1	147664	genome.wustl.edu	37	19	53518336	53518336	+	Silent	SNP	G	G	A	rs139323953	byFrequency	TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr19:53518336G>A	ENST00000602168.1	+	1	1163	c.993G>A	c.(991-993)gcG>gcA	p.A331A	CTD-2620I22.3_ENST00000596769.1_lincRNA	NM_152473.2	NP_689686.2	B6SEH8	ERVV1_HUMAN	endogenous retrovirus group V, member 1	331						integral component of membrane (GO:0016021)											ggatgggtgcggccataggaa	0.502													N|||	242	0.0483227	0.0129	0.1412	5008	,	,		16328	0.0099		0.0586	False		,,,				2504	0.0593																0																																										SO:0001819	synonymous_variant	0			AK056776, BC104018, BC104019	CCDS59419.1	19q13.41	2014-05-02			ENSG00000269526	ENSG00000269526			26501	other	endogenous retrovirus						18826608, 21542922	Standard	NM_152473		Approved	FLJ32214, HERV-V1, ENVV1	uc002qap.3	B6SEH8	OTTHUMG00000182942	ENST00000602168.1:c.993G>A	19.37:g.53518336G>A				Silent	SNP	pfam_TLV/ENV_coat_polyprotein	p.A331	ENST00000602168.1	37	c.993	CCDS59419.1	19																																																																																			ERVV-1	-	pfam_TLV/ENV_coat_polyprotein	ENSG00000269526		0.502	ERVV-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERVV-1	HGNC	protein_coding	OTTHUMT00000464402.1	-	0.00	60	0	G	NM_152473		53518336	+1	tier1	rs139323953	no_errors	ENST00000602168	ensembl	human	known	74_37	silent	14.53	99	17	SNP	0.001	A
EVI5	7813	genome.wustl.edu	37	1	93101861	93101861	+	Frame_Shift_Del	DEL	A	A	-			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:93101861delA	ENST00000370331.1	-	12	1386	c.1377delT	c.(1375-1377)tttfs	p.F459fs	EVI5_ENST00000543509.1_Frame_Shift_Del_p.F470fs|EVI5_ENST00000540033.1_Frame_Shift_Del_p.F459fs|EVI5_ENST00000491940.1_5'UTR	NM_005665.4	NP_005656.4	O60447	EVI5_HUMAN	ecotropic viral integration site 5	459	Dimerization.|Interaction with alpha-tubulin, gamma- tubulin, BIRC5 and FBXO5.|Targeting to the centrosomes.				cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|retrograde transport, endosome to Golgi (GO:0042147)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|skin(1)	38		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)		GCTGTAGCACAAAATCTTCGT	0.368																																																	0													135.0	121.0	126.0					1																	93101861		2203	4300	6503	SO:0001589	frameshift_variant	0			AF008915	CCDS30774.1	1p22	2013-07-09			ENSG00000067208	ENSG00000067208			3501	protein-coding gene	gene with protein product	"""neuroblastoma stage 4S gene"""	602942				9618176	Standard	XM_005271180		Approved	NB4S	uc001dox.3	O60447	OTTHUMG00000010895	ENST00000370331.1:c.1377delT	1.37:g.93101861delA	ENSP00000359356:p.Phe459fs		A6NKX8|B9A6J0|Q9H1Y9	Frame_Shift_Del	DEL	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.F470fs	ENST00000370331.1	37	c.1410	CCDS30774.1	1																																																																																			EVI5	-	NULL	ENSG00000067208		0.368	EVI5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVI5	HGNC	protein_coding	OTTHUMT00000030047.1		0.00	79	0	A	NM_005665		93101861	-1	tier1		no_errors	ENST00000543509	ensembl	human	known	74_37	frame_shift_del	18.75	65	15	DEL	1.000	-
EXOC4	60412	genome.wustl.edu	37	7	133314798	133314798	+	Splice_Site	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr7:133314798G>A	ENST00000253861.4	+	10	1447	c.1418G>A	c.(1417-1419)gGg>gAg	p.G473E	EXOC4_ENST00000545148.1_Splice_Site_p.G83E|EXOC4_ENST00000460346.1_3'UTR|EXOC4_ENST00000539845.1_Splice_Site_p.G372E	NM_021807.3	NP_068579.3	Q96A65	EXOC4_HUMAN	exocyst complex component 4	473					cellular protein metabolic process (GO:0044267)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)			NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(16)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	50		Esophageal squamous(399;0.129)				CTTCTGAAAGGGGGTCCTGAT	0.358																																																	0													91.0	91.0	91.0					7																	133314798		2203	4300	6503	SO:0001630	splice_region_variant	0			AL831989	CCDS5829.1, CCDS43648.1	7q31	2013-01-22	2005-11-01	2005-11-01	ENSG00000131558	ENSG00000131558			30389	protein-coding gene	gene with protein product		608185	"""SEC8-like 1 (S. cerevisiae)"""	SEC8L1		11214970, 12687004	Standard	XM_005250523		Approved	KIAA1699, MGC27170, SEC8, Sec8p	uc003vrk.3	Q96A65	OTTHUMG00000155259	ENST00000253861.4:c.1418-1G>A	7.37:g.133314798G>A			E9PED2|Q541U8|Q9C0G4|Q9H9K0|Q9P102	Missense_Mutation	SNP	pfam_Sec8_exocyst	p.G473E	ENST00000253861.4	37	c.1418	CCDS5829.1	7	.	.	.	.	.	.	.	.	.	.	G	22.1	4.239222	0.79800	.	.	ENSG00000131558	ENST00000253861;ENST00000546185;ENST00000539845;ENST00000545148	.	.	.	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.73040	0.3536	L	0.36672	1.1	0.80722	D	1	B;D;D	0.89917	0.376;0.999;1.0	B;D;D	0.83275	0.058;0.973;0.996	T	0.68055	-0.5510	8	.	.	.	.	20.1519	0.98089	0.0:0.0:1.0:0.0	.	5;83;473	B7Z689;F5GZT1;Q96A65	.;.;EXOC4_HUMAN	E	473;92;372;83	.	.	G	+	2	0	EXOC4	132965338	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.004000	0.93583	2.861000	0.98227	0.655000	0.94253	GGG	EXOC4	-	NULL	ENSG00000131558		0.358	EXOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC4	HGNC	protein_coding	OTTHUMT00000339182.1	-	0.00	29	0	G	NM_021807	Missense_Mutation	133314798	+1	tier1	-	no_errors	ENST00000253861	ensembl	human	known	74_37	missense	29.09	39	16	SNP	1.000	A
EYS	346007	genome.wustl.edu	37	6	66005740	66005741	+	Intron	INS	-	-	AA	rs374955689|rs567365942|rs35045551|rs397797960|rs74667330|rs398110200	byFrequency	TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr6:66005740_66005741insAA	ENST00000370621.3	-	12	2550				EYS_ENST00000503581.1_Intron|EYS_ENST00000370616.2_Intron			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)						detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						AATTTATCAGGAAAAAAAAAAC	0.302																																																	0																																										SO:0001627	intron_variant	0				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.2023+14->TT	6.37:g.66005749_66005750dupAA			A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	RNA	INS	-	NULL	ENST00000370621.3	37	NULL		6																																																																																			EYS	-	-	ENSG00000188107		0.302	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3		0.00	14	0	-	XM_294050		66005741	-1	tier1		no_errors	ENST00000370615	ensembl	human	putative	74_37	rna	12.12	29	4	INS	0.032:0.122	AA
FAM13C	220965	genome.wustl.edu	37	10	61012606	61012606	+	Missense_Mutation	SNP	T	T	G			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr10:61012606T>G	ENST00000373868.2	-	12	1572	c.1485A>C	c.(1483-1485)gaA>gaC	p.E495D	FAM13C_ENST00000468840.2_Missense_Mutation_p.E412D|FAM13C_ENST00000442566.3_Missense_Mutation_p.E516D|FAM13C_ENST00000277705.6_Missense_Mutation_p.E515D|FAM13C_ENST00000373867.3_Missense_Mutation_p.E411D|FAM13C_ENST00000419214.2_Missense_Mutation_p.E397D|FAM13C_ENST00000435852.2_Missense_Mutation_p.E495D	NM_198215.3	NP_937858.2	Q8NE31	FA13C_HUMAN	family with sequence similarity 13, member C	495										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						GTGGTTTTACTTCTTTCTTTT	0.453																																																	0													171.0	150.0	157.0					10																	61012606		2203	4300	6503	SO:0001583	missense	0			U79304	CCDS31207.1, CCDS44406.1, CCDS7255.1, CCDS53538.1	10q21	2009-09-15	2009-01-20	2009-01-20	ENSG00000148541	ENSG00000148541			19371	protein-coding gene	gene with protein product			"""family with sequence similarity 13, member C1"""	FAM13C1			Standard	NM_001001971		Approved		uc001jkn.3	Q8NE31	OTTHUMG00000018277	ENST00000373868.2:c.1485A>C	10.37:g.61012606T>G	ENSP00000362975:p.Glu495Asp		B7ZB77|Q5T631|Q6P2M3|Q99787	Missense_Mutation	SNP	NULL	p.E495D	ENST00000373868.2	37	c.1485	CCDS7255.1	10	.	.	.	.	.	.	.	.	.	.	T	14.70	2.612502	0.46631	.	.	ENSG00000148541	ENST00000373867;ENST00000373868;ENST00000442566;ENST00000277705;ENST00000419214;ENST00000468840;ENST00000435852	T;T;T;T;T	0.46819	0.88;0.89;0.86;0.88;0.86	5.72	3.34	0.38264	.	0.171243	0.38605	N	0.001636	T	0.50086	0.1595	L	0.60455	1.87	0.21861	N	0.999503	D;B;P;D	0.57899	0.981;0.134;0.955;0.981	P;B;P;P	0.54889	0.763;0.027;0.636;0.604	T	0.36359	-0.9751	10	0.36615	T	0.2	-21.0341	5.1247	0.14878	0.2988:0.0793:0.0:0.6219	.	495;411;397;495	B7Z2K3;B7ZB77;Q8NE31-3;Q8NE31	.;.;.;FA13C_HUMAN	D	411;495;516;515;397;412;495	ENSP00000362975:E495D;ENSP00000395661:E516D;ENSP00000277705:E515D;ENSP00000391993:E397D;ENSP00000392302:E495D	ENSP00000277705:E515D	E	-	3	2	FAM13C	60682612	0.998000	0.40836	0.952000	0.39060	0.994000	0.84299	0.849000	0.27723	1.083000	0.41159	0.533000	0.62120	GAA	FAM13C	-	NULL	ENSG00000148541		0.453	FAM13C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM13C	HGNC	protein_coding	OTTHUMT00000048162.2	-	0.00	70	0	T			61012606	-1	tier1	-	no_errors	ENST00000373868	ensembl	human	known	74_37	missense	9.64	75	8	SNP	0.439	G
FAM167B	84734	genome.wustl.edu	37	1	32713121	32713121	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:32713121G>T	ENST00000373582.3	+	1	288	c.99G>T	c.(97-99)aaG>aaT	p.K33N		NM_032648.2	NP_116037.2	Q9BTA0	F167B_HUMAN	family with sequence similarity 167, member B	33										endometrium(1)|large_intestine(1)|lung(1)|ovary(2)	5						TGACAGCCAAGCTGCAGCTGC	0.637																																																	0													42.0	53.0	49.0					1																	32713121		2026	4185	6211	SO:0001583	missense	0			BC004269	CCDS358.2	1p35.1	2010-08-27	2008-06-11	2008-06-11	ENSG00000183615	ENSG00000183615			28133	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 90"""	C1orf90		12477932	Standard	NM_032648		Approved	MGC10820	uc001buw.3	Q9BTA0	OTTHUMG00000007462	ENST00000373582.3:c.99G>T	1.37:g.32713121G>T	ENSP00000362684:p.Lys33Asn		Q5TDH6	Missense_Mutation	SNP	pfam_FAM167	p.K33N	ENST00000373582.3	37	c.99	CCDS358.2	1	.	.	.	.	.	.	.	.	.	.	g	16.56	3.157150	0.57259	.	.	ENSG00000183615	ENST00000373582	T	0.46451	0.87	5.51	3.6	0.41247	.	0.070442	0.53938	U	0.000042	T	0.51822	0.1697	M	0.72118	2.19	0.43238	D	0.995143	D	0.71674	0.998	P	0.53954	0.738	T	0.57219	-0.7849	10	0.87932	D	0	10.7384	9.4709	0.38842	0.2763:0.0:0.7237:0.0	.	33	Q9BTA0	F167B_HUMAN	N	33	ENSP00000362684:K33N	ENSP00000362684:K33N	K	+	3	2	FAM167B	32485708	1.000000	0.71417	1.000000	0.80357	0.659000	0.38960	2.580000	0.46068	1.477000	0.48234	-0.258000	0.10820	AAG	FAM167B	-	NULL	ENSG00000183615		0.637	FAM167B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM167B	HGNC	protein_coding	OTTHUMT00000019615.2	-	0.00	74	0	G	NM_032648		32713121	+1	tier1	-	no_errors	ENST00000373582	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	T
FAM46A	55603	genome.wustl.edu	37	6	82459466	82459466	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr6:82459466C>A	ENST00000320172.6	-	3	1589	c.1275G>T	c.(1273-1275)caG>caT	p.Q425H	FAM46A_ENST00000369756.3_Missense_Mutation_p.Q506H|FAM46A_ENST00000369754.3_Missense_Mutation_p.Q444H	NM_017633.2	NP_060103.2	Q96IP4	FA46A_HUMAN	family with sequence similarity 46, member A	425					regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)		poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	12		all_cancers(76;6.74e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000282)|all_epithelial(107;0.0104)		BRCA - Breast invasive adenocarcinoma(397;0.0428)		TGAATACTGGCTGAACCTGTG	0.438																																																	0													145.0	129.0	135.0					6																	82459466		2203	4300	6503	SO:0001583	missense	0			AF350451	CCDS34489.1	6q14	2008-07-03	2004-08-19	2004-08-26	ENSG00000112773	ENSG00000112773			18345	protein-coding gene	gene with protein product		611357	"""chromosome 6 open reading frame 37"""	C6orf37		12054608, 17803723	Standard	NM_017633		Approved	FLJ20037	uc003pjg.3	Q96IP4	OTTHUMG00000015097	ENST00000320172.6:c.1275G>T	6.37:g.82459466C>A	ENSP00000318298:p.Gln425His		A8K7U4|Q5TF86|Q8NFZ9|Q9BW32|Q9NXV5	Missense_Mutation	SNP	pfam_DUF1693	p.Q444H	ENST00000320172.6	37	c.1332	CCDS34489.1	6	.	.	.	.	.	.	.	.	.	.	C	16.11	3.030344	0.54790	.	.	ENSG00000112773	ENST00000369754;ENST00000320172;ENST00000369756	T;T;T	0.24908	1.83;1.84;1.83	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.31136	0.0787	L	0.52364	1.645	0.80722	D	1	D;D	0.64830	0.99;0.994	D;D	0.78314	0.979;0.991	T	0.02307	-1.1179	10	0.15499	T	0.54	-17.187	13.9957	0.64397	0.0:0.9315:0.0:0.0685	.	425;444	Q96IP4;Q96IP4-2	FA46A_HUMAN;.	H	444;425;506	ENSP00000358769:Q444H;ENSP00000318298:Q425H;ENSP00000358771:Q506H	ENSP00000318298:Q425H	Q	-	3	2	FAM46A	82516185	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.835000	0.55805	2.941000	0.99782	0.655000	0.94253	CAG	FAM46A	-	NULL	ENSG00000112773		0.438	FAM46A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM46A	HGNC	protein_coding	OTTHUMT00000041331.1		0.00	84	0	C			82459466	-1			no_errors	ENST00000369754	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	A
FAT4	79633	genome.wustl.edu	37	4	126241321	126241321	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr4:126241321G>T	ENST00000394329.3	+	1	3768	c.3755G>T	c.(3754-3756)gGa>gTa	p.G1252V		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	1252	Cadherin 12. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G1252E(2)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						ATAATAAAAGGAAATGAAGAA	0.363																																																	2	Substitution - Missense(2)	skin(2)											57.0	55.0	55.0					4																	126241321		1845	4105	5950	SO:0001583	missense	0			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.3755G>T	4.37:g.126241321G>T	ENSP00000377862:p.Gly1252Val		A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.G1252V	ENST00000394329.3	37	c.3755	CCDS3732.3	4	.	.	.	.	.	.	.	.	.	.	G	17.56	3.419435	0.62622	.	.	ENSG00000196159	ENST00000394329	T	0.67171	-0.25	4.81	4.81	0.61882	Cadherin (4);Cadherin-like (1);	0.000000	0.33610	U	0.004730	D	0.83445	0.5256	M	0.83953	2.67	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86277	0.1665	10	0.87932	D	0	.	18.0596	0.89373	0.0:0.0:1.0:0.0	.	1252	Q6V0I7	FAT4_HUMAN	V	1252	ENSP00000377862:G1252V	ENSP00000377862:G1252V	G	+	2	0	FAT4	126460771	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.454000	0.97621	2.503000	0.84419	0.561000	0.74099	GGA	FAT4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000196159		0.363	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	HGNC	protein_coding	OTTHUMT00000256765.2		0.00	46	0	G	NM_024582		126241321	+1			no_errors	ENST00000394329	ensembl	human	known	74_37	missense	5.17	55	3	SNP	1.000	T
FAT4	79633	genome.wustl.edu	37	4	126402848	126402848	+	Silent	SNP	C	C	T	rs558612271		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr4:126402848C>T	ENST00000394329.3	+	15	12784	c.12771C>T	c.(12769-12771)ggC>ggT	p.G4257G	FAT4_ENST00000335110.5_Silent_p.G2498G	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	4257	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						GCGAGAATGGCGTTTTAATCC	0.433																																																	0													105.0	99.0	101.0					4																	126402848		2203	4300	6503	SO:0001819	synonymous_variant	0			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.12771C>T	4.37:g.126402848C>T			A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.G4257	ENST00000394329.3	37	c.12771	CCDS3732.3	4																																																																																			FAT4	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	ENSG00000196159		0.433	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	HGNC	protein_coding	OTTHUMT00000256765.2	-	0.00	50	0	C	NM_024582		126402848	+1	tier1	-	no_errors	ENST00000394329	ensembl	human	known	74_37	silent	49.37	40	39	SNP	0.976	T
FAT1	2195	genome.wustl.edu	37	4	187510244	187510244	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr4:187510244G>T	ENST00000441802.2	-	27	13478	c.13269C>A	c.(13267-13269)gaC>gaA	p.D4423E		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	4423					actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						CAGGGTAATAGTCCGTATCGA	0.532										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)												0													229.0	229.0	229.0					4																	187510244		2026	4185	6211	SO:0001583	missense	0			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.13269C>A	4.37:g.187510244G>T	ENSP00000406229:p.Asp4423Glu			Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.D4423E	ENST00000441802.2	37	c.13269	CCDS47177.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.79|16.79	3.221286|3.221286	0.58560|0.58560	.|.	.|.	ENSG00000083857|ENSG00000083857	ENST00000441802;ENST00000260147;ENST00000509927|ENST00000512772;ENST00000507105	T;T|.	0.49432|.	0.78;0.78|.	5.37|5.37	4.53|4.53	0.55603|0.55603	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.73218|0.73218	0.3559|0.3559	M|M	0.80422|0.80422	2.495|2.495	0.58432|0.58432	D|D	0.999992|0.999992	D|.	0.89917|.	1.0|.	D|.	0.83275|.	0.996|.	T|T	0.74645|0.74645	-0.3596|-0.3596	10|5	0.39692|.	T|.	0.17|.	.|.	10.6382|10.6382	0.45577|0.45577	0.1461:0.0:0.8539:0.0|0.1461:0.0:0.8539:0.0	.|.	4423|.	Q14517|.	FAT1_HUMAN|.	E|I	4423;4425;113|203;191	ENSP00000406229:D4423E;ENSP00000420869:D113E|.	ENSP00000260147:D4425E|.	D|L	-|-	3|1	2|2	FAT1|FAT1	187747238|187747238	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.384000|0.384000	0.30261|0.30261	3.167000|3.167000	0.50793|0.50793	1.505000|1.505000	0.48720|0.48720	0.455000|0.455000	0.32223|0.32223	GAC|CTA	FAT1	-	NULL	ENSG00000083857		0.532	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT1	HGNC	protein_coding	OTTHUMT00000360209.3	-	0.00	58	0	G	NM_005245		187510244	-1	tier1	-	no_errors	ENST00000441802	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	T
FBN2	2201	genome.wustl.edu	37	5	127595289	127595289	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr5:127595289C>T	ENST00000508053.1	-	71	9571	c.8597G>A	c.(8596-8598)gGc>gAc	p.G2866D	FBN2_ENST00000262464.4_Missense_Mutation_p.G2866D			P35556	FBN2_HUMAN	fibrillin 2	2866					anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TGTGTATGTGCCGGGCATGAG	0.502																																																	0													234.0	208.0	217.0					5																	127595289		2203	4300	6503	SO:0001583	missense	0			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.8597G>A	5.37:g.127595289C>T	ENSP00000424571:p.Gly2866Asp		B4DU01|Q59ES6	Missense_Mutation	SNP	pirsf_FBN,pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Cadherin-like,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.G2866D	ENST00000508053.1	37	c.8597	CCDS34222.1	5	.	.	.	.	.	.	.	.	.	.	C	11.39	1.625387	0.28889	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	T;T	0.61158	0.13;0.13	5.49	4.63	0.57726	.	0.000000	0.64402	D	0.000005	T	0.56790	0.2009	M	0.63843	1.955	0.49798	D	0.999828	P	0.37500	0.597	B	0.37650	0.255	T	0.61710	-0.7007	10	0.54805	T	0.06	.	14.3998	0.67034	0.0:0.9296:0.0:0.0704	.	2866	P35556	FBN2_HUMAN	D	2866	ENSP00000262464:G2866D;ENSP00000424571:G2866D	ENSP00000262464:G2866D	G	-	2	0	FBN2	127623188	1.000000	0.71417	0.493000	0.27502	0.003000	0.03518	5.762000	0.68809	1.565000	0.49641	-0.229000	0.12294	GGC	FBN2	-	pirsf_FBN,superfamily_Cadherin-like	ENSG00000138829		0.502	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN2	HGNC	protein_coding	OTTHUMT00000371618.2		0.00	50	0	C	NM_001999		127595289	-1			no_errors	ENST00000262464	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.999	T
FBN3	84467	genome.wustl.edu	37	19	8152011	8152011	+	Missense_Mutation	SNP	A	A	G			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr19:8152011A>G	ENST00000600128.1	-	54	7118	c.6704T>C	c.(6703-6705)gTc>gCc	p.V2235A	FBN3_ENST00000601739.1_Missense_Mutation_p.V2235A|FBN3_ENST00000270509.2_Missense_Mutation_p.V2235A			Q75N90	FBN3_HUMAN	fibrillin 3	2235	EGF-like 36; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						TGGGGGACAGACGCACGCGAA	0.627																																																	0													84.0	75.0	78.0					19																	8152011		2203	4300	6503	SO:0001583	missense	0				CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.6704T>C	19.37:g.8152011A>G	ENSP00000470498:p.Val2235Ala		Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,pfam_EG-like_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pirsf_FBN,pfscan_EG-like_dom	p.V2235A	ENST00000600128.1	37	c.6704	CCDS12196.1	19	.	.	.	.	.	.	.	.	.	.	A	13.51	2.260039	0.39995	.	.	ENSG00000142449	ENST00000270509;ENST00000341066	D	0.92446	-3.04	3.71	3.71	0.42584	EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.124305	0.52532	U	0.000074	D	0.85283	0.5661	N	0.05351	-0.065	0.41168	D	0.986146	P;B	0.38300	0.626;0.051	B;B	0.43508	0.422;0.01	D	0.86018	0.1505	10	0.46703	T	0.11	.	12.7178	0.57125	1.0:0.0:0.0:0.0	.	2235;341	Q75N90;Q6ZNB8	FBN3_HUMAN;.	A	2235;341	ENSP00000270509:V2235A	ENSP00000270509:V2235A	V	-	2	0	FBN3	8058011	1.000000	0.71417	0.748000	0.31131	0.076000	0.17211	6.868000	0.75516	1.462000	0.47948	0.334000	0.21626	GTC	FBN3	-	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_FBN,pfscan_EG-like_dom	ENSG00000142449		0.627	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN3	HGNC	protein_coding	OTTHUMT00000461428.2	-	0.00	42	0	A	NM_032447		8152011	-1	tier1	-	no_errors	ENST00000270509	ensembl	human	known	74_37	missense	26.32	28	10	SNP	1.000	G
FBXL4	26235	genome.wustl.edu	37	6	99353423	99353423	+	Missense_Mutation	SNP	A	A	G			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr6:99353423A>G	ENST00000369244.2	-	6	1410	c.982T>C	c.(982-984)Tac>Cac	p.Y328H	FBXL4_ENST00000229971.1_Missense_Mutation_p.Y328H	NM_001278716.1	NP_001265645.1	Q9UKA2	FBXL4_HUMAN	F-box and leucine-rich repeat protein 4	328	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(4)|prostate(3)|skin(2)	18		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0413)		TTTGCCCAGTATGGTTGCAGA	0.448																																																	0													193.0	172.0	179.0					6																	99353423		2203	4300	6503	SO:0001583	missense	0			AF176699	CCDS5041.1	6q16.1-q16.3	2011-06-09			ENSG00000112234	ENSG00000112234		"""F-boxes / Leucine-rich repeats"""	13601	protein-coding gene	gene with protein product		605654				10531035	Standard	NM_012160		Approved	FBL4, FBL5	uc003ppf.1	Q9UKA2	OTTHUMG00000015259	ENST00000369244.2:c.982T>C	6.37:g.99353423A>G	ENSP00000358247:p.Tyr328His		B2R7Q5|E1P530|O95919|Q5BJH0|Q9UJU0	Missense_Mutation	SNP	pfam_F-box_dom,superfamily_F-box_dom,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_F-box_dom	p.Y328H	ENST00000369244.2	37	c.982	CCDS5041.1	6	.	.	.	.	.	.	.	.	.	.	A	23.5	4.422987	0.83559	.	.	ENSG00000112234	ENST00000369244;ENST00000229971	T;T	0.55760	0.5;0.5	5.43	5.43	0.79202	F-box domain, cyclin-like (1);F-box domain, Skp2-like (1);	0.000000	0.85682	D	0.000000	T	0.67757	0.2927	M	0.82716	2.605	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	T	0.72659	-0.4226	10	0.52906	T	0.07	.	14.043	0.64689	1.0:0.0:0.0:0.0	.	328	Q9UKA2	FBXL4_HUMAN	H	328	ENSP00000358247:Y328H;ENSP00000229971:Y328H	ENSP00000229971:Y328H	Y	-	1	0	FBXL4	99460144	1.000000	0.71417	0.977000	0.42913	0.961000	0.63080	8.962000	0.93254	2.056000	0.61249	0.482000	0.46254	TAC	FBXL4	-	superfamily_F-box_dom,pfscan_F-box_dom	ENSG00000112234		0.448	FBXL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL4	HGNC	protein_coding	OTTHUMT00000041587.2	-	0.00	46	0	A			99353423	-1	tier1	-	no_errors	ENST00000229971	ensembl	human	known	74_37	missense	34.92	41	22	SNP	0.999	G
FLG	2312	genome.wustl.edu	37	1	152276671	152276671	+	Missense_Mutation	SNP	C	C	T	rs7518080	byFrequency	TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:152276671C>T	ENST00000368799.1	-	3	10726	c.10691G>A	c.(10690-10692)cGt>cAt	p.R3564H	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3564	Ser-rich.		R -> H (in dbSNP:rs7518080).		establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGCAGATCCACGATGGTTTCT	0.567									Ichthyosis				c|||	1284	0.25639	0.2685	0.2608	5008	,	,		18674	0.38		0.0875	False		,,,				2504	0.2832																0													154.0	193.0	180.0					1																	152276671		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.10691G>A	1.37:g.152276671C>T	ENSP00000357789:p.Arg3564His		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.R3564H	ENST00000368799.1	37	c.10691	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	c	3.366	-0.129501	0.06753	.	.	ENSG00000143631	ENST00000368799	T	0.00816	5.66	2.89	-5.77	0.02369	.	.	.	.	.	T	0.00109	0.0003	N	0.01742	-0.745	0.09310	N	1	B	0.20459	0.045	B	0.08055	0.003	T	0.34527	-0.9825	9	0.09843	T	0.71	.	4.6793	0.12727	0.0:0.3492:0.341:0.3098	rs7518080;rs56813207	3564	P20930	FILA_HUMAN	H	3564	ENSP00000357789:R3564H	ENSP00000357789:R3564H	R	-	2	0	FLG	150543295	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.306000	0.02735	-1.611000	0.01581	-2.444000	0.00210	CGT	FLG	-	NULL	ENSG00000143631		0.567	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	-	0.00	110	0	C	NM_002016		152276671	-1	tier1	rs7518080	no_errors	ENST00000368799	ensembl	human	known	74_37	missense	10.85	230	28	SNP	0.000	T
FOLR4	390243	genome.wustl.edu	37	11	94039705	94039705	+	Nonsense_Mutation	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr11:94039705C>A	ENST00000440961.2	+	2	209	c.165C>A	c.(163-165)tgC>tgA	p.C55*		NM_001199206.1	NP_001186135.1	A6ND01	JUNO_HUMAN	folate receptor 4, delta (putative)	55					cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14						ACAATGCCTGCTGCACCCTCA	0.552																																																	0													205.0	203.0	203.0					11																	94039705		2068	4202	6270	SO:0001587	stop_gained	0					11q14	2014-07-23	2012-12-07		ENSG00000183560	ENSG00000183560			32565	protein-coding gene	gene with protein product		615737	"""folate receptor 4 (delta) homolog (mouse)"""			11111049, 24739963	Standard	NM_001199206		Approved	Folbp3, JUNO	uc021qou.1	A6ND01		ENST00000440961.2:c.165C>A	11.37:g.94039705C>A	ENSP00000416935:p.Cys55*			Nonsense_Mutation	SNP	pfam_Folate_rcpt-like	p.C55*	ENST00000440961.2	37	c.165		11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.9|21.9	4.217886|4.217886	0.79352|0.79352	.|.	.|.	ENSG00000183560|ENSG00000183560	ENST00000328458|ENST00000440961	.|.	.|.	.|.	4.75|4.75	3.84|3.84	0.44239|0.44239	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.53753|.	0.1816|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.64202|.	-0.6463|.	3|.	.|.	.|.	.|.	-6.1828|-6.1828	10.7748|10.7748	0.46343|0.46343	0.0:0.9071:0.0:0.0929|0.0:0.9071:0.0:0.0929	.|.	.|.	.|.	.|.	D|X	49|55	.|.	.|.	A|C	+|+	2|3	0|2	FOLR4|FOLR4	93679353|93679353	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.824000|0.824000	0.46624|0.46624	1.849000|1.849000	0.39318|0.39318	1.368000|1.368000	0.46115|0.46115	0.561000|0.561000	0.74099|0.74099	GCT|TGC	FOLR4	-	pfam_Folate_rcpt-like	ENSG00000183560		0.552	FOLR4-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	FOLR4	HGNC	protein_coding	OTTHUMT00000396420.1	-	0.00	18	0	C	NM_001080486		94039705	+1	tier1	-	no_errors	ENST00000440961	ensembl	human	novel	74_37	nonsense	42.86	8	6	SNP	1.000	A
FOS	2353	genome.wustl.edu	37	14	75748089	75748089	+	Missense_Mutation	SNP	T	T	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr14:75748089T>C	ENST00000303562.4	+	4	1314	c.1105T>C	c.(1105-1107)Tct>Cct	p.S369P	FOS_ENST00000555347.1_Missense_Mutation_p.S221P|FOS_ENST00000535987.1_Missense_Mutation_p.S333P|FOS_ENST00000555686.1_Missense_Mutation_p.S255P	NM_005252.3	NP_005243.1	P01100	FOS_HUMAN	FBJ murine osteosarcoma viral oncogene homolog	369					aging (GO:0007568)|cellular response to calcium ion (GO:0071277)|cellular response to extracellular stimulus (GO:0031668)|cellular response to hormone stimulus (GO:0032870)|cellular response to reactive oxygen species (GO:0034614)|conditioned taste aversion (GO:0001661)|DNA methylation (GO:0006306)|Fc-epsilon receptor signaling pathway (GO:0038095)|female pregnancy (GO:0007565)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nervous system development (GO:0007399)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to cold (GO:0009409)|response to corticosterone (GO:0051412)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to gravity (GO:0009629)|response to light stimulus (GO:0009416)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to toxic substance (GO:0009636)|skeletal muscle cell differentiation (GO:0035914)|sleep (GO:0030431)|SMAD protein signal transduction (GO:0060395)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	double-stranded DNA binding (GO:0003690)|R-SMAD binding (GO:0070412)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|large_intestine(1)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		all_lung(585;0.0138)|all_epithelial(191;0.0263)|all_neural(303;0.112)		BRCA - Breast invasive adenocarcinoma(234;0.0117)	Nadroparin(DB08813)|Pseudoephedrine(DB00852)	TGAGCCTTCCTCTGACTCGCT	0.642																																																	0													35.0	36.0	35.0					14																	75748089		2202	4300	6502	SO:0001583	missense	0			K00650	CCDS9841.1	14q24.3	2013-01-10	2009-07-23			ENSG00000170345		"""basic leucine zipper proteins"""	3796	protein-coding gene	gene with protein product		164810	"""v-fos FBJ murine osteosarcoma viral oncogene homolog"""			16123044, 16055710, 15926923	Standard	NM_005252		Approved	c-fos, AP-1	uc001xrn.3	P01100		ENST00000303562.4:c.1105T>C	14.37:g.75748089T>C	ENSP00000306245:p.Ser369Pro		A8K4E2|B4DQ65|P18849	Missense_Mutation	SNP	pfam_bZIP,superfamily_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_Fos	p.S369P	ENST00000303562.4	37	c.1105	CCDS9841.1	14	.	.	.	.	.	.	.	.	.	.	T	17.00	3.276102	0.59649	.	.	ENSG00000170345	ENST00000303562;ENST00000535987;ENST00000555686;ENST00000555347	T;T;T	0.70749	0.16;0.56;-0.51	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	D	0.82660	0.5085	M	0.69248	2.105	0.58432	D	0.999999	P;D	0.71674	0.518;0.998	B;D	0.75484	0.204;0.986	D	0.84672	0.0712	10	0.87932	D	0	-26.0367	15.5464	0.76104	0.0:0.0:0.0:1.0	.	333;369	B4DQ65;P01100	.;FOS_HUMAN	P	369;333;255;221	ENSP00000306245:S369P;ENSP00000442268:S333P;ENSP00000452590:S255P	ENSP00000306245:S369P	S	+	1	0	FOS	74817842	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.066000	0.64351	2.155000	0.67459	0.533000	0.62120	TCT	FOS	-	NULL	ENSG00000170345		0.642	FOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOS	HGNC	protein_coding	OTTHUMT00000415044.1	-	0.00	47	0	T	NM_005252		75748089	+1	tier1	-	no_errors	ENST00000303562	ensembl	human	known	74_37	missense	67.65	11	23	SNP	1.000	C
FRG1B	284802	genome.wustl.edu	37	20	29631557	29631557	+	Missense_Mutation	SNP	A	A	G	rs11525721		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr20:29631557A>G	ENST00000278882.3	+	7	733	c.353A>G	c.(352-354)aAa>aGa	p.K118R	FRG1B_ENST00000358464.4_Missense_Mutation_p.K118R			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	118								p.K118R(2)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TGTGCTGAAAAAGAAACCAAG	0.333																																																	2	Substitution - Missense(2)	endometrium(2)																																								SO:0001583	missense	0					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.353A>G	20.37:g.29631557A>G	ENSP00000278882:p.Lys118Arg		C4AME5	Missense_Mutation	SNP	pfam_FRG1,superfamily_Actin_cross-linking	p.K118R	ENST00000278882.3	37	c.353		20	.	.	.	.	.	.	.	.	.	.	a	0.014	-1.602257	0.00849	.	.	ENSG00000149531	ENST00000278882;ENST00000358464	.	.	.	2.03	1.07	0.20283	.	0.100689	0.64402	N	0.000003	T	0.12475	0.0303	.	.	.	0.22378	N	0.999156	B	0.02656	0.0	B	0.01281	0.0	T	0.34079	-0.9843	8	0.02654	T	1	.	7.0418	0.25025	0.1556:0.0:0.8444:0.0	rs11525721	118	Q9BZ01	FRG1B_HUMAN	R	118	.	ENSP00000278882:K118R	K	+	2	0	FRG1B	28245218	1.000000	0.71417	0.998000	0.56505	0.630000	0.37929	4.500000	0.60387	0.419000	0.25927	-0.343000	0.07986	AAA	FRG1B	-	pfam_FRG1	ENSG00000149531		0.333	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FRG1B	HGNC	protein_coding	OTTHUMT00000078494.2		0.00	33	0	A	NR_003579		29631557	+1			no_errors	ENST00000278882	ensembl	human	known	74_37	missense	6.98	40	3	SNP	1.000	G
FRMPD3	84443	genome.wustl.edu	37	X	106845185	106845185	+	Silent	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chrX:106845185C>A	ENST00000276185.4	+	16	4015	c.4015C>A	c.(4015-4017)Cgg>Agg	p.R1339R				Q5JV73	FRPD3_HUMAN	FERM and PDZ domain containing 3	1339						cytoskeleton (GO:0005856)				breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(16)|ovary(2)|urinary_tract(1)	28						GCGCATCTGCCGGGGGGGCCG	0.706																																																	0													22.0	25.0	24.0					X																	106845185		876	1990	2866	SO:0001819	synonymous_variant	0			AB058720	CCDS76006.1	Xq22	2008-02-05			ENSG00000147234	ENSG00000147234			29382	protein-coding gene	gene with protein product						11347906	Standard	NM_032428		Approved	RP5-1070B1.1, KIAA1817		Q5JV73	OTTHUMG00000022165	ENST00000276185.4:c.4015C>A	X.37:g.106845185C>A			Q96JK8	Silent	SNP	pfam_FERM_central,pfam_PDZ,superfamily_FERM_central,superfamily_PDZ,smart_PDZ,smart_Band_41_domain,pfscan_FERM_domain,pfscan_PDZ	p.R1339	ENST00000276185.4	37	c.4015		X																																																																																			FRMPD3	-	NULL	ENSG00000147234		0.706	FRMPD3-201	KNOWN	basic|appris_principal	protein_coding	FRMPD3	HGNC	protein_coding		-	0.00	42	0	C	XM_042978		106845185	+1	tier1	-	no_errors	ENST00000276185	ensembl	human	known	74_37	silent	72.73	6	16	SNP	0.983	A
FZD2	2535	genome.wustl.edu	37	17	42636566	42636566	+	Missense_Mutation	SNP	A	A	G			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr17:42636566A>G	ENST00000315323.3	+	1	1642	c.1510A>G	c.(1510-1512)Atc>Gtc	p.I504V		NM_001466.3	NP_001457.1	Q14332	FZD2_HUMAN	frizzled class receptor 2	504					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cell-cell signaling (GO:0007267)|cochlea morphogenesis (GO:0090103)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hard palate development (GO:0060022)|inner ear receptor cell development (GO:0060119)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|neuron differentiation (GO:0030182)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of cGMP metabolic process (GO:0030825)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|sensory perception of smell (GO:0007608)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(8)	33		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		GAGCCTGGCCATCCCGTGCCC	0.627																																																	0													45.0	41.0	42.0					17																	42636566		2203	4300	6503	SO:0001583	missense	0			L37882	CCDS11484.1	17q21.1	2014-01-29	2014-01-29			ENSG00000180340		"""GPCR / Class F : Frizzled receptors"""	4040	protein-coding gene	gene with protein product		600667	"""frizzled (Drosophila) homolog 2"", ""frizzled homolog 2 (Drosophila)"", ""frizzled 2, seven transmembrane spanning receptor"", ""frizzled family receptor 2"""			7558010, 9813155	Standard	NM_001466		Approved		uc002igx.2	Q14332		ENST00000315323.3:c.1510A>G	17.37:g.42636566A>G	ENSP00000323901:p.Ile504Val		Q0VG82	Missense_Mutation	SNP	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.I504V	ENST00000315323.3	37	c.1510	CCDS11484.1	17	.	.	.	.	.	.	.	.	.	.	a	2.451	-0.326393	0.05350	.	.	ENSG00000180340	ENST00000541149;ENST00000315323	D	0.82711	-1.64	5.0	5.0	0.66597	GPCR, family 2-like (1);	0.000000	0.85682	D	0.000000	T	0.68035	0.2957	N	0.16233	0.39	0.50171	D	0.999854	B	0.06786	0.001	B	0.15484	0.013	T	0.62872	-0.6762	10	0.05351	T	0.99	.	14.4343	0.67270	1.0:0.0:0.0:0.0	.	504	Q14332	FZD2_HUMAN	V	580;504	ENSP00000323901:I504V	ENSP00000323901:I504V	I	+	1	0	FZD2	39992092	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.485000	0.45250	1.885000	0.54596	0.454000	0.30748	ATC	FZD2	-	pfam_Frizzled,pfscan_GPCR_2-like	ENSG00000180340		0.627	FZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD2	HGNC	protein_coding	OTTHUMT00000457806.1	-	0.00	92	0	A	NM_001466		42636566	+1	tier1	-	no_errors	ENST00000315323	ensembl	human	known	74_37	missense	9.20	79	8	SNP	1.000	G
GABBR2	9568	genome.wustl.edu	37	9	101056109	101056109	+	Missense_Mutation	SNP	C	C	T	rs368856308		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr9:101056109C>T	ENST00000259455.2	-	18	3077	c.2618G>A	c.(2617-2619)cGa>cAa	p.R873Q		NM_005458.7	NP_005449.5	O75899	GABR2_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 2	873					G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled GABA receptor activity (GO:0004965)		NOTCH1_ENST00000277541/GABBR2(2)	breast(4)|endometrium(4)|large_intestine(12)|lung(21)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	49		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)	TTTGCATGTTCGAGAGGGCTC	0.398													C|||	1	0.000199681	0.0	0.0	5008	,	,		19417	0.001		0.0	False		,,,				2504	0.0																0													240.0	234.0	236.0					9																	101056109		2203	4300	6503	SO:0001583	missense	0			AF069755	CCDS6736.1	9q22.1-q22.3	2012-08-29	2006-02-16	2006-02-16	ENSG00000136928	ENSG00000136928		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4507	protein-coding gene	gene with protein product		607340	"""G protein-coupled receptor 51"""	GPR51		10087195	Standard	NM_005458		Approved	HG20, GABABR2, GPRC3B	uc004ays.3	O75899	OTTHUMG00000020345	ENST00000259455.2:c.2618G>A	9.37:g.101056109C>T	ENSP00000259455:p.Arg873Gln		O75974|O75975|Q5VXZ2|Q8WX04|Q9P1R2|Q9UNR1|Q9UNS9	Missense_Mutation	SNP	pfam_GPCR_3_C,pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,prints_GPCR_3_GABA_rcpt_B2,prints_GPCR_3_GABA_rcpt_B,prints_GPCR_3_GABA_rcpt_B1,prints_GPCR_3,pfscan_GPCR_3_C	p.R873Q	ENST00000259455.2	37	c.2618	CCDS6736.1	9	.	.	.	.	.	.	.	.	.	.	C	18.82	3.704803	0.68615	.	.	ENSG00000136928	ENST00000259455	T	0.80393	-1.37	5.1	5.1	0.69264	.	0.053754	0.64402	D	0.000001	T	0.59335	0.2186	N	0.14661	0.345	0.45025	D	0.99804	P	0.39782	0.688	B	0.25884	0.064	T	0.65573	-0.6135	10	0.54805	T	0.06	-10.0223	9.4348	0.38632	0.0:0.9058:0.0:0.0942	.	873	O75899	GABR2_HUMAN	Q	873	ENSP00000259455:R873Q	ENSP00000259455:R873Q	R	-	2	0	GABBR2	100095930	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	5.469000	0.66749	2.641000	0.89580	0.650000	0.86243	CGA	GABBR2	-	NULL	ENSG00000136928		0.398	GABBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABBR2	HGNC	protein_coding	OTTHUMT00000053373.1	-	0.00	69	0	C			101056109	-1	tier1	-	no_errors	ENST00000259455	ensembl	human	known	74_37	missense	79.12	19	72	SNP	0.997	T
GCNT3	9245	genome.wustl.edu	37	15	59911753	59911753	+	Nonstop_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr15:59911753G>T	ENST00000396065.1	+	3	1764	c.1316G>T	c.(1315-1317)tGa>tTa	p.*439L	GCNT3_ENST00000560585.1_Nonstop_Mutation_p.*439L	NM_004751.2	NP_004742.1	O95395	GCNT3_HUMAN	glucosaminyl (N-acetyl) transferase 3, mucin type	0					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|immunoglobulin production in mucosal tissue (GO:0002426)|intestinal absorption (GO:0050892)|kidney morphogenesis (GO:0060993)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|tissue morphogenesis (GO:0048729)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylgalactosaminyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0047225)|beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0003829)|N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)			central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						ACTGAACTTTGAGACACACTA	0.478																																																	0													135.0	139.0	138.0					15																	59911753		2190	4290	6480	SO:0001578	stop_lost	0			AF102542	CCDS10172.1	15q22	2013-02-25			ENSG00000140297	ENSG00000140297	2.4.1.102, 2.4.1.150	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	4205	protein-coding gene	gene with protein product		606836				9915862, 9988682	Standard	NM_004751		Approved	C2GnT-M, C2/4GnT, C2GnT2	uc002age.3	O95395	OTTHUMG00000132726	ENST00000396065.1:c.1316G>T	15.37:g.59911753G>T	ENSP00000379377:p.*439Leuext*4			Nonstop_Mutation	SNP	pfam_Glyco_trans_14	p.*439L	ENST00000396065.1	37	c.1316	CCDS10172.1	15	.	.	.	.	.	.	.	.	.	.	G	3.540	-0.093817	0.07053	.	.	ENSG00000140297	ENST00000396065	.	.	.	5.22	4.3	0.51218	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.7391	0.34547	0.075:0.0:0.7734:0.1515	.	.	.	.	L	439	.	.	X	+	2	2	GCNT3	57699045	1.000000	0.71417	0.998000	0.56505	0.099000	0.18886	2.621000	0.46418	1.175000	0.42826	0.655000	0.94253	TGA	GCNT3	-	NULL	ENSG00000140297		0.478	GCNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCNT3	HGNC	protein_coding	OTTHUMT00000256068.1	-	0.00	48	0	G	NM_004751		59911753	+1	tier1	-	no_errors	ENST00000396065	ensembl	human	known	74_37	nonstop	5.19	72	4	SNP	1.000	T
GIGYF1	64599	genome.wustl.edu	37	7	100284957	100284957	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr7:100284957G>T	ENST00000275732.5	-	5	1655	c.446C>A	c.(445-447)cCc>cAc	p.P149H	GIGYF1_ENST00000471340.2_Intron	NM_022574.4	NP_072096.2	O75420	PERQ1_HUMAN	GRB10 interacting GYF protein 1	149					insulin-like growth factor receptor signaling pathway (GO:0048009)					central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					GATTTCCCGGGGGCTTCGTCC	0.657																																																	0													65.0	72.0	69.0					7																	100284957		2203	4300	6503	SO:0001583	missense	0			AF053356	CCDS34708.1	7q22	2008-02-11	2008-02-11	2008-02-11	ENSG00000146830	ENSG00000146830			9126	protein-coding gene	gene with protein product	"""GYF domain containing 1"""	612064	"""PERQ amino acid rich, with GYF domain 1"""	PERQ1		9799793, 12771153	Standard	NM_022574		Approved	GYF1	uc003uwg.1	O75420	OTTHUMG00000157036	ENST00000275732.5:c.446C>A	7.37:g.100284957G>T	ENSP00000275732:p.Pro149His		Q6Y7W7|Q8WZ38	Missense_Mutation	SNP	pfam_GYF,superfamily_GYF,smart_GYF,pfscan_GYF	p.P149H	ENST00000275732.5	37	c.446	CCDS34708.1	7	.	.	.	.	.	.	.	.	.	.	.	22.0	4.233210	0.79688	.	.	ENSG00000146830	ENST00000275732	D	0.82803	-1.65	5.21	5.21	0.72293	.	0.160696	0.44097	D	0.000495	T	0.76564	0.4005	N	0.14661	0.345	0.35429	D	0.793865	D	0.64830	0.994	P	0.51355	0.667	T	0.81583	-0.0866	10	0.39692	T	0.17	-14.4957	12.0782	0.53655	0.0:0.1734:0.8265:0.0	.	149	O75420	PERQ1_HUMAN	H	149	ENSP00000275732:P149H	ENSP00000275732:P149H	P	-	2	0	GIGYF1	100122893	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	2.666000	0.46799	2.415000	0.81967	0.563000	0.77884	CCC	GIGYF1	-	NULL	ENSG00000146830		0.657	GIGYF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIGYF1	HGNC	protein_coding	OTTHUMT00000347205.2		0.00	45	0	G	NM_022574		100284957	-1			no_errors	ENST00000275732	ensembl	human	known	74_37	missense	6.45	58	4	SNP	1.000	T
GOLGA6L7P	728310	genome.wustl.edu	37	15	29090312	29090312	+	RNA	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr15:29090312G>A	ENST00000569815.1	-	0	950					NR_047567.1				golgin A6 family-like 7, pseudogene																		acacacacacgtacaTGTGtt	0.398																																																	0																																												0			AK302238		15q13.1	2012-10-05	2011-04-15	2010-04-20	ENSG00000261649	ENSG00000261649			37442	pseudogene	pseudogene			"""golgi autoantigen, golgin subfamily a, 6-like 7 (pseudogene)"""	GOLGA6L7			Standard	NR_047567		Approved		uc010uar.2		OTTHUMG00000176345		15.37:g.29090312G>A				RNA	SNP	-	NULL	ENST00000569815.1	37	NULL		15																																																																																			GOLGA6L7P	-	-	ENSG00000261649		0.398	GOLGA6L7P-002	PUTATIVE	basic	processed_transcript	GOLGA6L7P	HGNC	pseudogene	OTTHUMT00000431796.1		0.00	9	0	G	XR_078490		29090312	-1			no_errors	ENST00000569815	ensembl	human	putative	74_37	rna	17.65	14	3	SNP	0.005	A
GORASP1	64689	genome.wustl.edu	37	3	39141811	39141811	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr3:39141811C>A	ENST00000319283.3	-	6	1571	c.750G>T	c.(748-750)caG>caT	p.Q250H	GORASP1_ENST00000422110.2_Missense_Mutation_p.Q95H|GORASP1_ENST00000476334.1_5'Flank|GORASP1_ENST00000479927.1_Missense_Mutation_p.Q155H	NM_031899.2	NP_114105.1	Q9BQQ3	GORS1_HUMAN	golgi reassembly stacking protein 1, 65kDa	250	Pro-rich.				Golgi organization (GO:0007030)|mitotic cell cycle (GO:0000278)|negative regulation of dendrite morphogenesis (GO:0050774)|protein transport (GO:0015031)	Golgi membrane (GO:0000139)				central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(1)|ovary(3)|urinary_tract(1)	14				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)		TGTAGTCACTCTGCCTGGAAC	0.592																																																	0													53.0	57.0	55.0					3																	39141811		2203	4300	6503	SO:0001583	missense	0			AJ409349	CCDS2681.1, CCDS63596.1, CCDS63597.1	3p22-p21.33	2008-04-23	2002-08-29	2002-05-24	ENSG00000114745	ENSG00000114745			16769	protein-coding gene	gene with protein product		606867	"""golgi phosphoprotein 5"""	GOLPH5			Standard	NM_001278789		Approved	GRASP65, P65, FLJ23443	uc003ciw.1	Q9BQQ3	OTTHUMG00000131292	ENST00000319283.3:c.750G>T	3.37:g.39141811C>A	ENSP00000313869:p.Gln250His		B3KWC8|Q3SYG7|Q8N272|Q96H42	Missense_Mutation	SNP	pfam_GRASP55/65_PDZ,superfamily_PDZ	p.Q250H	ENST00000319283.3	37	c.750	CCDS2681.1	3	.	.	.	.	.	.	.	.	.	.	C	5.566	0.289348	0.10513	.	.	ENSG00000114745	ENST00000319283;ENST00000422110;ENST00000479927	T;T;T	0.48522	0.84;0.82;0.81	4.56	3.67	0.42095	.	0.833030	0.10800	N	0.632816	T	0.53270	0.1786	M	0.67953	2.075	0.33906	D	0.639101	B;P;B	0.52061	0.001;0.95;0.003	B;P;B	0.50708	0.002;0.648;0.002	T	0.62029	-0.6940	10	0.44086	T	0.13	-14.0726	7.5951	0.28044	0.0:0.8871:0.0:0.1129	.	155;95;250	B4E1H8;B3KPY8;Q9BQQ3	.;.;GORS1_HUMAN	H	250;95;155	ENSP00000313869:Q250H;ENSP00000395709:Q95H;ENSP00000419123:Q155H	ENSP00000313869:Q250H	Q	-	3	2	GORASP1	39116815	0.209000	0.23505	1.000000	0.80357	0.215000	0.24574	0.422000	0.21296	2.469000	0.83416	0.591000	0.81541	CAG	GORASP1	-	pfam_GRASP55/65_PDZ	ENSG00000114745		0.592	GORASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GORASP1	HGNC	protein_coding	OTTHUMT00000254060.1	-	0.00	60	0	C			39141811	-1	tier1	-	no_errors	ENST00000319283	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.996	A
GPAT2	150763	genome.wustl.edu	37	2	96691728	96691728	+	Silent	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr2:96691728G>A	ENST00000434632.1	-	13	1647	c.1188C>T	c.(1186-1188)ggC>ggT	p.G396G	GPAT2_ENST00000377137.3_Silent_p.G396G|GPAT2_ENST00000359548.4_Silent_p.G396G|GPAT2_ENST00000453542.1_Silent_p.G325G			Q6NUI2	GPAT2_HUMAN	glycerol-3-phosphate acyltransferase 2, mitochondrial	396					CDP-diacylglycerol biosynthetic process (GO:0016024)|glycerol-3-phosphate metabolic process (GO:0006072)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			NS(1)|breast(1)|cervix(1)|endometrium(4)|large_intestine(1)|lung(5)|skin(3)	16						TCTGTCTGCCGCCCCAGCAGC	0.632																																																	0													27.0	28.0	28.0					2																	96691728		1955	4142	6097	SO:0001819	synonymous_variant	0			BC042847	CCDS42714.1	2q11.2	2010-05-04			ENSG00000186281	ENSG00000186281			27168	protein-coding gene	gene with protein product	"""cancer/testis antigen 123"""					12477932	Standard	NM_207328		Approved	CT123	uc010yuf.1	Q6NUI2	OTTHUMG00000155208	ENST00000434632.1:c.1188C>T	2.37:g.96691728G>A			Q6P2E4|Q6ZNI3|Q6ZNI5|Q6ZWJ4	Silent	SNP	smart_Plipid/glycerol_acylTrfase	p.G396	ENST00000434632.1	37	c.1188	CCDS42714.1	2																																																																																			GPAT2	-	NULL	ENSG00000186281		0.632	GPAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPAT2	HGNC	protein_coding	OTTHUMT00000338786.1	-	0.00	97	0	G	NM_207328		96691728	-1	tier1	-	no_errors	ENST00000359548	ensembl	human	known	74_37	silent	16.98	88	18	SNP	0.063	A
GPR45	11250	genome.wustl.edu	37	2	105858480	105858480	+	Silent	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr2:105858480C>A	ENST00000258456.1	+	1	281	c.165C>A	c.(163-165)gtC>gtA	p.V55V		NM_007227.3	NP_009158.3	Q9Y5Y3	GPR45_HUMAN	G protein-coupled receptor 45	55						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	28						ACACTGTGGTCTGCATCATCG	0.622																																																	0													144.0	126.0	132.0					2																	105858480		2203	4300	6503	SO:0001819	synonymous_variant	0			AF118266	CCDS2066.1	2q11.1-q12	2012-08-21			ENSG00000135973	ENSG00000135973		"""GPCR / Class A : Orphans"""	4503	protein-coding gene	gene with protein product		604838				10036181	Standard	NM_007227		Approved	PSP24, PSP24A	uc002tco.1	Q9Y5Y3	OTTHUMG00000130805	ENST00000258456.1:c.165C>A	2.37:g.105858480C>A			Q6NWS4|Q6NXU6	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.V55	ENST00000258456.1	37	c.165	CCDS2066.1	2																																																																																			GPR45	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000135973		0.622	GPR45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR45	HGNC	protein_coding	OTTHUMT00000253348.1	-	0.00	64	0	C	NM_007227		105858480	+1	tier1	-	no_errors	ENST00000258456	ensembl	human	known	74_37	silent	7.27	51	4	SNP	1.000	A
GPR39	2863	genome.wustl.edu	37	2	133402990	133402990	+	Silent	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr2:133402990G>A	ENST00000329321.3	+	2	1642	c.1173G>A	c.(1171-1173)ccG>ccA	p.P391P	LYPD1_ENST00000397463.2_3'UTR|GPR39_ENST00000470071.1_3'UTR	NM_001508.2	NP_001499.1	O43194	GPR39_HUMAN	G protein-coupled receptor 39	391					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TGCAGCGCCCGTTGCTCTTCG	0.622																																																	0													42.0	44.0	44.0					2																	133402990		2203	4300	6503	SO:0001819	synonymous_variant	0			AF034633	CCDS2170.1	2q21-q22	2012-08-21			ENSG00000183840	ENSG00000183840		"""GPCR / Class A : Orphans"""	4496	protein-coding gene	gene with protein product		602886				9441746	Standard	NM_001508		Approved		uc002ttl.3	O43194	OTTHUMG00000131679	ENST00000329321.3:c.1173G>A	2.37:g.133402990G>A			B2RC12|B6V9G4|Q08AS2|Q53R01	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.P391	ENST00000329321.3	37	c.1173	CCDS2170.1	2																																																																																			GPR39	-	NULL	ENSG00000183840		0.622	GPR39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR39	HGNC	protein_coding	OTTHUMT00000254582.1	-	0.00	62	0	G			133402990	+1	tier1	-	no_errors	ENST00000329321	ensembl	human	known	74_37	silent	29.41	36	15	SNP	0.001	A
GPRC5A	9052	genome.wustl.edu	37	12	13061546	13061546	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr12:13061546G>T	ENST00000014914.5	+	2	1253	c.363G>T	c.(361-363)aaG>aaT	p.K121N	GPRC5A_ENST00000542056.1_Intron	NM_003979.3	NP_003970.1	Q8NFJ5	RAI3_HUMAN	G protein-coupled receptor, class C, group 5, member A	121					signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	18		Prostate(47;0.141)		BRCA - Breast invasive adenocarcinoma(232;0.0708)	Tretinoin(DB00755)	GTCTGACCAAGCTCGTCCGGG	0.562																																																	0													151.0	150.0	150.0					12																	13061546		2203	4300	6503	SO:0001583	missense	0			AF095448	CCDS8657.1	12p13-p12.3	2014-01-30	2014-01-30	2005-05-03		ENSG00000013588		"""GPCR / Class C : Orphans"""	9836	protein-coding gene	gene with protein product		604138	"""retinoic acid induced 3"", ""G protein-coupled receptor, family C, group 5, member A"""	RAI3, GPCR5A		9857033	Standard	NM_003979		Approved	RAIG1	uc001rba.3	Q8NFJ5		ENST00000014914.5:c.363G>T	12.37:g.13061546G>T	ENSP00000014914:p.Lys121Asn		B3KV45|O95357	Missense_Mutation	SNP	pfam_GPCR_3_C	p.K121N	ENST00000014914.5	37	c.363	CCDS8657.1	12	.	.	.	.	.	.	.	.	.	.	G	12.48	1.949821	0.34377	.	.	ENSG00000013588	ENST00000014914;ENST00000534831	D;D	0.87887	-2.31;-2.31	5.63	4.68	0.58851	GPCR, family 3, C-terminal (1);	0.662303	0.15566	N	0.255700	D	0.87997	0.6319	M	0.68952	2.095	0.24562	N	0.993966	P;P	0.50369	0.81;0.934	B;P	0.50537	0.361;0.643	T	0.80146	-0.1504	10	0.33141	T	0.24	-3.1414	9.9359	0.41550	0.081:0.1425:0.7766:0.0	.	121;121	Q8NFJ5;A8K556	RAI3_HUMAN;.	N	121	ENSP00000014914:K121N;ENSP00000441627:K121N	ENSP00000014914:K121N	K	+	3	2	GPRC5A	12952813	0.964000	0.33143	0.876000	0.34364	0.014000	0.08584	1.660000	0.37397	2.659000	0.90383	0.561000	0.74099	AAG	GPRC5A	-	pfam_GPCR_3_C	ENSG00000013588		0.562	GPRC5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRC5A	HGNC	protein_coding	OTTHUMT00000400682.1		0.00	70	0	G			13061546	+1			no_errors	ENST00000014914	ensembl	human	known	74_37	missense	5.19	73	4	SNP	0.899	T
GRIN2A	2903	genome.wustl.edu	37	16	9857432	9857432	+	Silent	SNP	A	A	G			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr16:9857432A>G	ENST00000396573.2	-	14	4278	c.3969T>C	c.(3967-3969)aaT>aaC	p.N1323N	GRIN2A_ENST00000535259.1_Intron|GRIN2A_ENST00000404927.2_Intron|GRIN2A_ENST00000396575.2_Silent_p.N1323N|GRIN2A_ENST00000562109.1_Intron|GRIN2A_ENST00000330684.3_Silent_p.N1323N	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	1323					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TGCCGTAAAAATTTCCCTCCA	0.522																																																	0													88.0	92.0	90.0					16																	9857432		2197	4300	6497	SO:0001819	synonymous_variant	0				CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.3969T>C	16.37:g.9857432A>G			O00669|Q17RZ6	Silent	SNP	pfam_NMDAR2_C,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.N1323	ENST00000396573.2	37	c.3969	CCDS10539.1	16																																																																																			GRIN2A	-	pfam_NMDAR2_C	ENSG00000183454		0.522	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2A	HGNC	protein_coding	OTTHUMT00000251930.3	-	0.00	59	0	A			9857432	-1	tier1	-	no_errors	ENST00000330684	ensembl	human	known	74_37	silent	59.51	83	122	SNP	0.004	G
GRM1	2911	genome.wustl.edu	37	6	146720166	146720166	+	Missense_Mutation	SNP	T	T	G			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr6:146720166T>G	ENST00000282753.1	+	7	2226	c.1991T>G	c.(1990-1992)gTt>gGt	p.V664G	GRM1_ENST00000355289.4_Missense_Mutation_p.V664G|GRM1_ENST00000492807.2_Missense_Mutation_p.V664G|GRM1_ENST00000392299.2_Missense_Mutation_p.V664G|GRM1_ENST00000361719.2_Missense_Mutation_p.V664G|GRM1_ENST00000507907.1_Missense_Mutation_p.V664G			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	664					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		CGCCTCTTGGTTGGCCTCTCC	0.517																																																	0													328.0	302.0	311.0					6																	146720166		2203	4300	6503	SO:0001583	missense	0			U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.1991T>G	6.37:g.146720166T>G	ENSP00000282753:p.Val664Gly		B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_Metabotropic_Glu_rcpt_Homer-bd,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3_mtglu_rcpt_1,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_5	p.V664G	ENST00000282753.1	37	c.1991	CCDS5209.1	6	.	.	.	.	.	.	.	.	.	.	T	18.89	3.719118	0.68844	.	.	ENSG00000152822	ENST00000361719;ENST00000392299;ENST00000492807;ENST00000282753;ENST00000355289;ENST00000507907	D;D;D;D;D;D	0.88509	-2.39;-2.39;-2.39;-2.39;-2.39;-2.39	5.51	4.34	0.51931	GPCR, family 3, C-terminal (2);	0.053373	0.85682	D	0.000000	D	0.88994	0.6589	L	0.42245	1.32	0.80722	D	1	D;D;D	0.89917	0.973;1.0;0.973	P;D;P	0.91635	0.69;0.999;0.786	D	0.90134	0.4208	10	0.87932	D	0	.	11.2249	0.48877	0.0:0.0722:0.0:0.9278	.	664;664;664	F8W805;Q13255;Q13255-2	.;GRM1_HUMAN;.	G	664	ENSP00000354896:V664G;ENSP00000376119:V664G;ENSP00000424095:V664G;ENSP00000282753:V664G;ENSP00000347437:V664G;ENSP00000425599:V664G	ENSP00000282753:V664G	V	+	2	0	GRM1	146761859	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	8.040000	0.89188	0.931000	0.37242	0.477000	0.44152	GTT	GRM1	-	pfam_GPCR_3_C,pfscan_GPCR_3_C,prints_GPCR_3_mtglu_rcpt	ENSG00000152822		0.517	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM1	HGNC	protein_coding	OTTHUMT00000042574.1	-	0.00	42	0	T	NM_000838		146720166	+1	tier1	-	no_errors	ENST00000282753	ensembl	human	known	74_37	missense	41.46	24	17	SNP	1.000	G
GRPEL2	134266	genome.wustl.edu	37	5	148725272	148725272	+	Intron	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr5:148725272C>A	ENST00000329271.3	+	1	187				GRPEL2_ENST00000513661.1_Intron|GRPEL2-AS1_ENST00000521295.1_RNA|GRPEL2_ENST00000416916.2_Intron|GRPEL2_ENST00000507562.1_3'UTR	NM_152407.3	NP_689620.2	Q8TAA5	GRPE2_HUMAN	GrpE-like 2, mitochondrial (E. coli)						cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane (GO:0005743)	adenyl-nucleotide exchange factor activity (GO:0000774)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGAGAGCTATCTGAGCGTAGG	0.627																																																	0																																										SO:0001627	intron_variant	0			AL832325	CCDS4295.1	5q33.1	2008-02-05			ENSG00000164284	ENSG00000164284			21060	protein-coding gene	gene with protein product							Standard	NM_152407		Approved	DKFZp451C205, Mt-GrpE#2, FLJ23713	uc003lqj.3	Q8TAA5	OTTHUMG00000130048	ENST00000329271.3:c.77+93C>A	5.37:g.148725272C>A			B4DFA6|Q49AJ6	RNA	SNP	-	NULL	ENST00000329271.3	37	NULL	CCDS4295.1	5																																																																																			GRPEL2	-	-	ENSG00000164284		0.627	GRPEL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRPEL2	HGNC	protein_coding	OTTHUMT00000252327.1	-	0.00	52	0	C	NM_152407		148725272	+1	tier1	-	no_errors	ENST00000507562	ensembl	human	known	74_37	rna	8.70	42	4	SNP	0.000	A
GSTCD	79807	genome.wustl.edu	37	4	106763267	106763267	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr4:106763267C>T	ENST00000515279.1	+	11	1961	c.1741C>T	c.(1741-1743)Ctc>Ttc	p.L581F	GSTCD_ENST00000394728.3_Missense_Mutation_p.L581F|GSTCD_ENST00000515255.1_3'UTR|GSTCD_ENST00000360505.5_Missense_Mutation_p.L581F|GSTCD_ENST00000394730.3_Missense_Mutation_p.L494F			Q8NEC7	GSTCD_HUMAN	glutathione S-transferase, C-terminal domain containing	581						extracellular vesicular exosome (GO:0070062)				breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|skin(1)	14		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.15e-07)|READ - Rectum adenocarcinoma(30;0.139)		AGCTGTCCAGCTCCCACCCCA	0.408																																																	0													116.0	108.0	110.0					4																	106763267		1905	4134	6039	SO:0001583	missense	0			BC032942	CCDS3672.2, CCDS43257.1	4q24	2008-02-05	2006-05-09		ENSG00000138780	ENSG00000138780			25806	protein-coding gene	gene with protein product		615912	"""Glutathione S-transferase, C-terminal domain containing"""			12477932	Standard	NM_001031720		Approved	FLJ13273	uc003hxz.4	Q8NEC7	OTTHUMG00000131211	ENST00000515279.1:c.1741C>T	4.37:g.106763267C>T	ENSP00000422354:p.Leu581Phe		A8K8J0|A8MVD3|H9KV97|Q9H8S3	Missense_Mutation	SNP	pfam_rRNA_ssu_MeTfrase_G,pfam_Small_mtfrase_dom,superfamily_Glutathione-S-Trfase_C-like	p.L581F	ENST00000515279.1	37	c.1741	CCDS43257.1	4	.	.	.	.	.	.	.	.	.	.	C	16.32	3.091284	0.55968	.	.	ENSG00000138780	ENST00000394730;ENST00000515279;ENST00000360505;ENST00000394728	.	.	.	5.27	4.4	0.53042	.	0.139850	0.45606	D	0.000342	T	0.46132	0.1377	L	0.50919	1.6	0.52501	D	0.999956	P;B	0.49862	0.929;0.024	B;B	0.43103	0.408;0.013	T	0.42292	-0.9460	9	0.45353	T	0.12	-2.0712	8.4964	0.33130	0.1544:0.7691:0.0:0.0765	.	581;204	Q8NEC7;B7Z8J7	GSTCD_HUMAN;.	F	494;581;581;581	.	ENSP00000353695:L581F	L	+	1	0	GSTCD	106982716	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.642000	0.54367	1.147000	0.42369	0.591000	0.81541	CTC	GSTCD	-	NULL	ENSG00000138780		0.408	GSTCD-006	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	GSTCD	HGNC	protein_coding	OTTHUMT00000363981.1	-	0.00	32	0	C	NM_024751		106763267	+1	tier1	-	no_errors	ENST00000360505	ensembl	human	known	74_37	missense	37.74	33	20	SNP	1.000	T
HABP2	3026	genome.wustl.edu	37	10	115340369	115340369	+	Silent	SNP	C	C	T	rs142304622		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr10:115340369C>T	ENST00000351270.3	+	8	852	c.756C>T	c.(754-756)gaC>gaT	p.D252D	HABP2_ENST00000542051.1_Silent_p.D226D|HABP2_ENST00000541666.1_Silent_p.D252D	NM_004132.3	NP_004123.1	Q14520	HABP2_HUMAN	hyaluronan binding protein 2	252	Kringle. {ECO:0000255|PROSITE- ProRule:PRU00121}.				cell adhesion (GO:0007155)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	glycosaminoglycan binding (GO:0005539)|serine-type endopeptidase activity (GO:0004252)			breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(8)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	23		Colorectal(252;0.0233)|Breast(234;0.0672)		Epithelial(162;0.00319)|all cancers(201;0.0112)	Hyaluronan(DB08818)	CAGATGCGGACGAAAAGCCCT	0.428													C|||	1	0.000199681	0.0	0.0	5008	,	,		19063	0.0		0.0	False		,,,				2504	0.001																0								C	,	3,4403	6.2+/-15.9	0,3,2200	94.0	95.0	95.0		678,756	1.6	0.9	10	dbSNP_134	95	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	HABP2	NM_001177660.1,NM_004132.3	,	0,3,6500	TT,TC,CC		0.0,0.0681,0.0231	,	226/535,252/561	115340369	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS7577.1, CCDS53579.1	10q25.3	2008-08-01	2001-11-28		ENSG00000148702	ENSG00000148702			4798	protein-coding gene	gene with protein product	"""plasma hyaluronan binding protein"", ""factor VII activating protein"""	603924	"""hyaluronan-binding protein 2"""			8827452, 12437095	Standard	NM_004132		Approved	HABP, PHBP, HGFAL, FSAP	uc001lai.4	Q14520	OTTHUMG00000019073	ENST00000351270.3:c.756C>T	10.37:g.115340369C>T			A8K467|B7Z8U5|F5H5M6|O00663	Silent	SNP	pfam_Peptidase_S1,pfam_Kringle,pfam_EG-like_dom,superfamily_Trypsin-like_Pept_dom,superfamily_Kringle-like,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Kringle,smart_Peptidase_S1,pfscan_EG-like_dom,pfscan_Kringle,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.D252	ENST00000351270.3	37	c.756	CCDS7577.1	10																																																																																			HABP2	-	pfam_Kringle,superfamily_Kringle-like,smart_Kringle,pfscan_Kringle	ENSG00000148702		0.428	HABP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HABP2	HGNC	protein_coding	OTTHUMT00000050428.1	-	0.00	72	0	C	NM_004132		115340369	+1	tier1	rs142304622	no_errors	ENST00000351270	ensembl	human	known	74_37	silent	47.54	32	29	SNP	0.841	T
HAS1	3036	genome.wustl.edu	37	19	52222984	52222984	+	Silent	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr19:52222984G>A	ENST00000222115.1	-	2	211	c.177C>T	c.(175-177)taC>taT	p.Y59Y	HAS1_ENST00000540069.2_Silent_p.Y58Y|HAS1_ENST00000601714.1_Silent_p.Y66Y|HAS1_ENST00000594621.1_5'Flank	NM_001523.2	NP_001514.2	Q92839	HYAS1_HUMAN	hyaluronan synthase 1	59					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|negative regulation of fibroblast migration (GO:0010764)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronan synthase activity (GO:0050501)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	40		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00102)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		GGAAGGCCCCGTAGAGGCCGA	0.731																																					NSCLC(132;636 2450 45807 47979)												0													4.0	5.0	5.0					19																	52222984		2068	4125	6193	SO:0001819	synonymous_variant	0			U59269	CCDS12838.1, CCDS74436.1	19q13.3-q13.4	2013-02-22			ENSG00000105509	ENSG00000105509	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4818	protein-coding gene	gene with protein product		601463		HAS		9169154	Standard	XM_005258834		Approved		uc002pxo.1	Q92839		ENST00000222115.1:c.177C>T	19.37:g.52222984G>A			Q14470|Q9NS49	Silent	SNP	pfam_Chitin_synth_fng,pfam_Glyco_trans_2	p.Y66	ENST00000222115.1	37	c.198	CCDS12838.1	19																																																																																			HAS1	-	NULL	ENSG00000105509		0.731	HAS1-005	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	HAS1	HGNC	protein_coding	OTTHUMT00000466953.1	-	0.00	10	0	G	NM_001523		52222984	-1	tier1	-	no_errors	ENST00000601714	ensembl	human	known	74_37	silent	33.33	12	6	SNP	0.998	A
HCFC2	29915	genome.wustl.edu	37	12	104492126	104492126	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr12:104492126G>T	ENST00000229330.4	+	13	1850	c.1746G>T	c.(1744-1746)gaG>gaT	p.E582D	HCFC2_ENST00000550335.1_3'UTR	NM_013320.2	NP_037452.1	Q9Y5Z7	HCFC2_HUMAN	host cell factor C2	582					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	35						ATTAGAAAGAGACTCCTTCAA	0.338																																					Esophageal Squamous(184;1814 2036 4771 6974 15702)												0													34.0	38.0	37.0					12																	104492126		2203	4300	6503	SO:0001583	missense	0			AF117210	CCDS9097.1	12q23.3	2011-03-30			ENSG00000111727	ENSG00000111727			24972	protein-coding gene	gene with protein product		607926				10196288	Standard	NM_013320		Approved	HCF-2	uc001tkj.4	Q9Y5Z7	OTTHUMG00000170175	ENST00000229330.4:c.1746G>T	12.37:g.104492126G>T	ENSP00000229330:p.Glu582Asp		B2R8Q5|C0H5X3	Missense_Mutation	SNP	pfam_Kelch_1,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.E582D	ENST00000229330.4	37	c.1746	CCDS9097.1	12	.	.	.	.	.	.	.	.	.	.	G	5.151	0.213372	0.09757	.	.	ENSG00000111727	ENST00000229330	T	0.01804	4.63	5.68	0.0568	0.14321	Fibronectin, type III (3);	0.347447	0.28327	N	0.015756	T	0.00815	0.0027	N	0.04636	-0.2	0.31938	N	0.61129	B	0.02656	0.0	B	0.04013	0.001	T	0.40478	-0.9561	10	0.23302	T	0.38	-16.9573	4.1665	0.10308	0.463:0.0:0.3665:0.1705	.	582	Q9Y5Z7	HCFC2_HUMAN	D	582	ENSP00000229330:E582D	ENSP00000229330:E582D	E	+	3	2	HCFC2	103016256	0.494000	0.26043	0.996000	0.52242	0.987000	0.75469	0.171000	0.16685	0.309000	0.22966	0.650000	0.86243	GAG	HCFC2	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3	ENSG00000111727		0.338	HCFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCFC2	HGNC	protein_coding	OTTHUMT00000407780.1	-	0.00	91	0	G	NM_013320		104492126	+1	tier1	-	no_errors	ENST00000229330	ensembl	human	known	74_37	missense	6.61	226	16	SNP	0.465	T
HCN3	57657	genome.wustl.edu	37	1	155257872	155257872	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:155257872G>T	ENST00000368358.3	+	8	1951	c.1943G>T	c.(1942-1944)cGc>cTc	p.R648L	HCN3_ENST00000496230.1_3'UTR	NM_020897.2	NP_065948.1	Q9P1Z3	HCN3_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 3	648					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			TCTGCTTGGCGCTCAGCAGGC	0.697																																																	0													30.0	29.0	29.0					1																	155257872		2203	4300	6503	SO:0001583	missense	0			AB040968	CCDS1108.1	1q21.2	2011-07-05			ENSG00000143630	ENSG00000143630		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	19183	protein-coding gene	gene with protein product		609973				16382102	Standard	NM_020897		Approved	KIAA1535	uc001fjz.2	Q9P1Z3	OTTHUMG00000035872	ENST00000368358.3:c.1943G>T	1.37:g.155257872G>T	ENSP00000357342:p.Arg648Leu		D3DV90|Q4VX12|Q8N6W6|Q9BWQ2	Missense_Mutation	SNP	pfam_Ion_trans_N,pfam_Ion_trans_dom,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG	p.R648L	ENST00000368358.3	37	c.1943	CCDS1108.1	1	.	.	.	.	.	.	.	.	.	.	G	8.402	0.842173	0.16963	.	.	ENSG00000143630	ENST00000368358	D	0.98105	-4.72	4.91	2.94	0.34122	.	0.301944	0.22829	N	0.055126	D	0.87386	0.6164	N	0.08118	0	0.32507	N	0.538066	B;B	0.18166	0.026;0.001	B;B	0.15484	0.013;0.001	T	0.77811	-0.2449	10	0.36615	T	0.2	.	11.7302	0.51732	0.0:0.0:0.6795:0.3205	.	343;648	B7Z5R8;Q9P1Z3	.;HCN3_HUMAN	L	648	ENSP00000357342:R648L	ENSP00000357342:R648L	R	+	2	0	HCN3	153524496	0.979000	0.34478	0.946000	0.38457	0.905000	0.53344	0.887000	0.28254	0.704000	0.31869	0.557000	0.71058	CGC	HCN3	-	NULL	ENSG00000143630		0.697	HCN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCN3	HGNC	protein_coding	OTTHUMT00000087388.1		0.00	47	0	G	NM_020897		155257872	+1			no_errors	ENST00000368358	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	T
HECTD4	283450	genome.wustl.edu	37	12	112631334	112631334	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr12:112631334G>T	ENST00000430131.2	-	56	8773	c.7628C>A	c.(7627-7629)aCc>aAc	p.T2543N	HECTD4_ENST00000550722.1_Missense_Mutation_p.T2819N|HECTD4_ENST00000377560.5_Missense_Mutation_p.T2793N			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	2543					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										CTGGTGCAGGGTCCGGGTGAT	0.552																																																	0													57.0	62.0	60.0					12																	112631334		2025	4184	6209	SO:0001583	missense	0			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.7628C>A	12.37:g.112631334G>T	ENSP00000404379:p.Thr2543Asn		L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,superfamily_ConA-like_lec_gl_sf,smart_HECT,pfscan_HECT	p.T2793N	ENST00000430131.2	37	c.8378		12	.	.	.	.	.	.	.	.	.	.	G	21.4	4.145999	0.77888	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	T;T;T	0.48836	0.8;0.81;0.8	5.38	5.38	0.77491	.	.	.	.	.	T	0.33147	0.0853	N	0.08118	0	0.49130	D	0.999754	B	0.24186	0.099	B	0.19391	0.025	T	0.21008	-1.0258	9	0.72032	D	0.01	.	19.1362	0.93429	0.0:0.0:1.0:0.0	.	2543	Q9Y4D8	K0614_HUMAN	N	2793;2543;2819	ENSP00000366783:T2793N;ENSP00000404379:T2543N;ENSP00000449784:T2819N	ENSP00000366783:T2793N	T	-	2	0	C12orf51	111115717	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.577000	0.82486	2.515000	0.84797	0.591000	0.81541	ACC	HECTD4	-	NULL	ENSG00000173064		0.552	HECTD4-202	KNOWN	basic	protein_coding	HECTD4	HGNC	protein_coding			0.00	68	0	G	NM_173813		112631334	-1			no_errors	ENST00000377560	ensembl	human	known	74_37	missense	5.19	73	4	SNP	1.000	T
HECTD4	283450	genome.wustl.edu	37	12	112685929	112685929	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr12:112685929G>A	ENST00000430131.2	-	26	4069	c.2924C>T	c.(2923-2925)gCc>gTc	p.A975V	HECTD4_ENST00000550722.1_Missense_Mutation_p.A1251V|HECTD4_ENST00000377560.5_Missense_Mutation_p.A1225V			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	975					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										CCCCTGCATGGCATCATCAAC	0.328																																																	0													106.0	97.0	100.0					12																	112685929		1887	4129	6016	SO:0001583	missense	0			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.2924C>T	12.37:g.112685929G>A	ENSP00000404379:p.Ala975Val		L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,superfamily_ConA-like_lec_gl_sf,smart_HECT,pfscan_HECT	p.A1225V	ENST00000430131.2	37	c.3674		12	.	.	.	.	.	.	.	.	.	.	G	22.2	4.252633	0.80135	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	T;T;T	0.46451	0.87;0.87;0.88	5.79	5.79	0.91817	.	.	.	.	.	T	0.31231	0.0790	N	0.14661	0.345	0.58432	D	0.999994	P	0.37525	0.598	B	0.34824	0.19	T	0.16719	-1.0393	9	0.56958	D	0.05	.	20.0341	0.97551	0.0:0.0:1.0:0.0	.	975	Q9Y4D8	K0614_HUMAN	V	1225;975;1251	ENSP00000366783:A1225V;ENSP00000404379:A975V;ENSP00000449784:A1251V	ENSP00000366783:A1225V	A	-	2	0	C12orf51	111170312	1.000000	0.71417	0.996000	0.52242	0.855000	0.48748	9.154000	0.94694	2.753000	0.94483	0.555000	0.69702	GCC	HECTD4	-	NULL	ENSG00000173064		0.328	HECTD4-202	KNOWN	basic	protein_coding	HECTD4	HGNC	protein_coding			0.00	28	0	G	NM_173813		112685929	-1			no_errors	ENST00000377560	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	A
HERC2P3	283755	genome.wustl.edu	37	15	20588458	20588458	+	RNA	SNP	G	G	C	rs2291971	byFrequency	TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr15:20588458G>C	ENST00000428453.1	-	0	4292							Q9BVR0	HRC23_HUMAN	hect domain and RLD 2 pseudogene 3								metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(1)|lung(14)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	35						TGCTGGCCATGACTGCAGTGC	0.458																																																	0																																												0			AF041081		15q11.2	2010-08-02			ENSG00000180229	ENSG00000180229			4871	pseudogene	pseudogene						9730612	Standard	NR_036432		Approved	D15F37S4, LOC283755	uc001ytg.3	Q9BVR0	OTTHUMG00000157175		15.37:g.20588458G>C				RNA	SNP	-	NULL	ENST00000428453.1	37	NULL		15																																																																																			HERC2P3	-	-	ENSG00000180229		0.458	HERC2P3-014	KNOWN	basic	processed_transcript	HERC2P3	HGNC	pseudogene	OTTHUMT00000347772.2	-	0.00	11	0	G	NG_008269		20588458	-1	tier1	rs2291971	no_errors	ENST00000428453	ensembl	human	known	74_37	rna	62.50	6	10	SNP	0.002	C
HERC2	8924	genome.wustl.edu	37	15	28431882	28431882	+	Missense_Mutation	SNP	T	T	G			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr15:28431882T>G	ENST00000261609.7	-	56	8774	c.8666A>C	c.(8665-8667)gAa>gCa	p.E2889A		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TATAGCAATTTCAATATACCT	0.433																																																	0													64.0	58.0	60.0					15																	28431882		2203	4300	6503	SO:0001583	missense	0			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.8666A>C	15.37:g.28431882T>G	ENSP00000261609:p.Glu2889Ala			Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_CPH_domain,pfam_Mib_Herc2,pfam_Cyt_B5-like_heme/steroid-bd,pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_RCC1/BLIP-II,superfamily_HECT,superfamily_Galactose-bd-like,superfamily_Cyt_B5-like_heme/steroid-bd,superfamily_UBA-like,superfamily_CUB_dom,smart_Beta-propeller_rpt_TECPR,smart_Znf_ZZ,smart_HECT,pfscan_HECT,pfscan_Znf_ZZ,pfscan_Reg_chr_condens,pfscan_Cyt_B5-like_heme/steroid-bd,prints_Reg_chr_condens	p.E2889A	ENST00000261609.7	37	c.8666	CCDS10021.1	15	.	.	.	.	.	.	.	.	.	.	T	24.1	4.497275	0.85069	.	.	ENSG00000128731	ENST00000261609	T	0.65732	-0.17	5.0	5.0	0.66597	Anaphase-promoting complex, subunit 10/DOC domain (1);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	T	0.80265	0.4591	M	0.83774	2.66	0.80722	D	1	D	0.69078	0.997	D	0.79108	0.992	D	0.83861	0.0268	10	0.87932	D	0	.	15.0231	0.71647	0.0:0.0:0.0:1.0	.	2889	O95714	HERC2_HUMAN	A	2889	ENSP00000261609:E2889A	ENSP00000261609:E2889A	E	-	2	0	HERC2	26105477	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.997000	0.88414	2.000000	0.58554	0.528000	0.53228	GAA	HERC2	-	superfamily_Galactose-bd-like	ENSG00000128731		0.433	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC2	HGNC	protein_coding	OTTHUMT00000251358.2	-	0.00	50	0	T	NM_004667		28431882	-1	tier1	-	no_errors	ENST00000261609	ensembl	human	known	74_37	missense	40.00	21	14	SNP	1.000	G
HFE2	148738	genome.wustl.edu	37	1	145416451	145416451	+	Nonsense_Mutation	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:145416451C>T	ENST00000336751.5	+	4	1034	c.796C>T	c.(796-798)Caa>Taa	p.Q266*	HFE2_ENST00000357836.5_Nonsense_Mutation_p.Q153*|HFE2_ENST00000497365.1_Nonsense_Mutation_p.Q40*|HFE2_ENST00000475797.1_Nonsense_Mutation_p.Q40*	NM_213653.3	NP_998818.1	Q6ZVN8	RGMC_HUMAN	hemochromatosis type 2 (juvenile)	266					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|iron ion homeostasis (GO:0055072)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)	14	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TTTGTCGATTCAAACTGCTAA	0.493																																																	0													109.0	111.0	110.0					1																	145416451		2203	4300	6503	SO:0001587	stop_gained	0			AY372521	CCDS72877.1, CCDS72878.1, CCDS72879.1	1q21.2	2014-06-26			ENSG00000168509	ENSG00000168509			4887	protein-coding gene	gene with protein product	"""repulsive guidance molecule c"""	608374				10205270, 14647275	Standard	NM_213653		Approved	JH, HFE2A, RGMC, HJV, hemojuvelin, haemojuvelin	uc001eni.2	Q6ZVN8	OTTHUMG00000013748	ENST00000336751.5:c.796C>T	1.37:g.145416451C>T	ENSP00000337014:p.Gln266*		B1ALI7|Q2PQ63|Q6IMF6|Q8NAH2|Q8WVJ5	Nonsense_Mutation	SNP	pfam_RGM_N,pfam_RGM_C	p.Q266*	ENST00000336751.5	37	c.796	CCDS910.1	1	.	.	.	.	.	.	.	.	.	.	C	31	5.060569	0.93846	.	.	ENSG00000168509	ENST00000357836;ENST00000336751;ENST00000497365;ENST00000475797	.	.	.	5.18	0.95	0.19572	.	0.823806	0.11045	N	0.605648	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	-20.1646	3.2518	0.06818	0.2944:0.3394:0.2859:0.0803	.	.	.	.	X	153;266;40;40	.	ENSP00000337014:Q266X	Q	+	1	0	HFE2	144127808	0.014000	0.17966	0.863000	0.33907	0.994000	0.84299	0.248000	0.18198	0.018000	0.15052	0.655000	0.94253	CAA	HFE2	-	pfam_RGM_C	ENSG00000168509		0.493	HFE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HFE2	HGNC	protein_coding	OTTHUMT00000038527.1	-	0.00	160	0	C	NM_145277		145416451	+1	tier1	-	no_errors	ENST00000336751	ensembl	human	known	74_37	nonsense	33.48	151	76	SNP	0.043	T
HMCN1	83872	genome.wustl.edu	37	1	186017922	186017922	+	Silent	SNP	A	A	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:186017922A>T	ENST00000271588.4	+	42	6757	c.6528A>T	c.(6526-6528)gcA>gcT	p.A2176A	HMCN1_ENST00000367492.2_Silent_p.A2176A	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	2176	Ig-like C2-type 19.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CTTGTGAAGCAACAAATGTTG	0.363																																																	0													100.0	101.0	101.0					1																	186017922		2203	4300	6503	SO:0001819	synonymous_variant	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.6528A>T	1.37:g.186017922A>T			A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd_dom,pfam_Thrombospondin_1_rpt,superfamily_GFP,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.A2176	ENST00000271588.4	37	c.6528	CCDS30956.1	1																																																																																			HMCN1	-	pfam_Ig_I-set,smart_Ig_V-set_subgr,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000143341		0.363	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	-	0.00	40	0	A	NM_031935		186017922	+1	tier1	-	no_errors	ENST00000271588	ensembl	human	known	74_37	silent	21.31	48	13	SNP	0.957	T
HNF4A	3172	genome.wustl.edu	37	20	43047127	43047127	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr20:43047127G>T	ENST00000316099.4	+	6	800	c.711G>T	c.(709-711)atG>atT	p.M237I	HNF4A_ENST00000457232.1_Missense_Mutation_p.M215I|HNF4A_ENST00000415691.2_Missense_Mutation_p.M237I|HNF4A_ENST00000443598.2_Missense_Mutation_p.M237I|HNF4A_ENST00000609795.1_Missense_Mutation_p.M215I|HNF4A_ENST00000316673.4_Missense_Mutation_p.M215I	NM_000457.4|NM_001258355.1|NM_178849.2	NP_000448.3|NP_001245284.1|NP_849180.1	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4, alpha	237					blood coagulation (GO:0007596)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|ornithine metabolic process (GO:0006591)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gastrulation (GO:0010470)|regulation of growth hormone receptor signaling pathway (GO:0060398)|regulation of insulin secretion (GO:0050796)|regulation of lipid metabolic process (GO:0019216)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|sex differentiation (GO:0007548)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|fatty acid binding (GO:0005504)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	34		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			AGAGATCCATGGTGTTCAAGG	0.612																																					Colon(79;2 1269 8820 14841 52347)												0													115.0	101.0	106.0					20																	43047127		2203	4300	6503	SO:0001583	missense	0			X76930	CCDS13330.1, CCDS13331.1, CCDS42876.1, CCDS46604.1, CCDS46605.1, CCDS68131.1, CCDS74728.1	20q13.12	2014-09-17			ENSG00000101076	ENSG00000101076		"""Nuclear hormone receptors"""	5024	protein-coding gene	gene with protein product		600281		TCF14, MODY, MODY1		7926813, 9048927	Standard	NM_001030003		Approved	NR2A1, HNF4	uc010zwo.1	P41235	OTTHUMG00000032531	ENST00000316099.4:c.711G>T	20.37:g.43047127G>T	ENSP00000312987:p.Met237Ile		A5JW41|B2RPP8|O00659|O00723|Q14540|Q5QPB8|Q6B4V5|Q6B4V6|Q6B4V7|Q92653|Q92654|Q92655|Q99864|Q9NQH0	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_COUP_TF,prints_Retinoid-X_rcpt/HNF4	p.M237I	ENST00000316099.4	37	c.711	CCDS13330.1	20	.	.	.	.	.	.	.	.	.	.	G	13.58	2.278976	0.40294	.	.	ENSG00000101076	ENST00000316673;ENST00000457232;ENST00000316099;ENST00000443598;ENST00000338692;ENST00000415691	D;D;D;D;D	0.96491	-4.03;-4.03;-4.03;-4.03;-4.03	5.33	5.33	0.75918	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.94019	0.8084	L	0.48260	1.515	0.80722	D	1	B;B;B;B;B;B;B	0.26483	0.049;0.002;0.002;0.15;0.049;0.04;0.043	B;B;B;B;B;B;B	0.25140	0.058;0.04;0.04;0.058;0.058;0.034;0.031	D	0.91868	0.5505	10	0.16896	T	0.51	.	19.006	0.92851	0.0:0.0:1.0:0.0	.	230;237;237;237;215;215;215	Q5QPB7;P41235;F1D8S2;P41235-3;F1D8T0;P41235-6;P41235-7	.;HNF4A_HUMAN;.;.;.;.;.	I	215;215;237;237;267;237	ENSP00000315180:M215I;ENSP00000396216:M215I;ENSP00000312987:M237I;ENSP00000410911:M237I;ENSP00000412111:M237I	ENSP00000312987:M237I	M	+	3	0	HNF4A	42480541	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.995000	0.88328	2.481000	0.83766	0.462000	0.41574	ATG	HNF4A	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core	ENSG00000101076		0.612	HNF4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HNF4A	HGNC	protein_coding	OTTHUMT00000079363.3	-	0.00	26	0	G			43047127	+1	tier1	-	no_errors	ENST00000316099	ensembl	human	known	74_37	missense	12.90	27	4	SNP	1.000	T
HPGDS	27306	genome.wustl.edu	37	4	95220738	95220738	+	Missense_Mutation	SNP	G	G	A	rs377587381		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr4:95220738G>A	ENST00000295256.5	-	6	583	c.493C>T	c.(493-495)Cct>Tct	p.P165S		NM_014485.2	NP_055300.1	O60760	HPGDS_HUMAN	hematopoietic prostaglandin D synthase	165	GST C-terminal.				arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|glutathione derivative biosynthetic process (GO:1901687)|locomotory behavior (GO:0007626)|prostaglandin metabolic process (GO:0006693)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	calcium ion binding (GO:0005509)|glutathione transferase activity (GO:0004364)|magnesium ion binding (GO:0000287)|prostaglandin-D synthase activity (GO:0004667)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|lung(3)|ovary(1)|urinary_tract(1)	7					Glutathione(DB00143)	AACAGGTCAGGCTTAAAGACC	0.438																																					Colon(86;1802 1843 17863 46794)												0													123.0	116.0	119.0					4																	95220738		2203	4300	6503	SO:0001583	missense	0			D82073	CCDS3640.1	4q22.2	2012-06-21			ENSG00000163106	ENSG00000163106		"""Glutathione S-transferases / Soluble"""	17890	protein-coding gene	gene with protein product	"""glutathione S-transferase sigma"""	602598				9323136, 9353279, 11672424	Standard	XM_005262932		Approved	GSTS, PGDS, H-PGDS, PGD2, GSTS1-1	uc003hte.1	O60760	OTTHUMG00000130974	ENST00000295256.5:c.493C>T	4.37:g.95220738G>A	ENSP00000295256:p.Pro165Ser		Q6FHT9	Missense_Mutation	SNP	pfam_Glutathione_S-Trfase_N,pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold	p.P165S	ENST00000295256.5	37	c.493	CCDS3640.1	4	.	.	.	.	.	.	.	.	.	.	G	7.475	0.647452	0.14516	.	.	ENSG00000163106	ENST00000295256	T	0.02121	4.44	5.73	4.0	0.46444	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);Glutathione S-transferase, C-terminal (1);	0.452187	0.22413	N	0.060391	T	0.02230	0.0069	L	0.28400	0.85	0.38431	D	0.946454	B	0.11235	0.004	B	0.17098	0.017	T	0.52335	-0.8589	10	0.33940	T	0.23	.	8.9634	0.35860	0.139:0.1227:0.7382:0.0	.	165	O60760	HPGDS_HUMAN	S	165	ENSP00000295256:P165S	ENSP00000295256:P165S	P	-	1	0	HPGDS	95439761	0.998000	0.40836	0.731000	0.30826	0.036000	0.12997	0.816000	0.27267	0.760000	0.33108	0.655000	0.94253	CCT	HPGDS	-	pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like	ENSG00000163106		0.438	HPGDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPGDS	HGNC	protein_coding	OTTHUMT00000253587.1	-	0.00	69	0	G	NM_014485		95220738	-1	tier1	-	no_errors	ENST00000295256	ensembl	human	known	74_37	missense	13.40	84	13	SNP	0.844	A
HTR7	3363	genome.wustl.edu	37	10	92502287	92502288	+	Splice_Site	INS	-	-	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr10:92502287_92502288insA	ENST00000336152.3	-	4	1420		c.e4-2		HTR7_ENST00000371721.3_Splice_Site|HTR7_ENST00000371719.2_Splice_Site|HTR7_ENST00000277874.6_Splice_Site	NM_019859.3	NP_062873.1	P34969	5HT7R_HUMAN	5-hydroxytryptamine (serotonin) receptor 7, adenylate cyclase-coupled						blood circulation (GO:0008015)|circadian rhythm (GO:0007623)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|serotonin receptor signaling pathway (GO:0007210)|smooth muscle contraction (GO:0006939)|synaptic transmission (GO:0007268)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30					Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Dopamine(DB00988)|Eletriptan(DB00216)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Iloperidone(DB04946)|Imipramine(DB00458)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Methysergide(DB00247)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Quetiapine(DB01224)|Ziprasidone(DB00246)	GCATTTTGTCTAAAAAAAAGAG	0.307																																																	0																																										SO:0001630	splice_region_variant	0			BC047526	CCDS7408.1, CCDS7409.1, CCDS7410.1	10q21-q24	2012-08-08	2012-02-03		ENSG00000148680	ENSG00000148680		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5302	protein-coding gene	gene with protein product		182137	"""5-hydroxytryptamine (serotonin) receptor 7 (adenylate cyclase-coupled)"""			8226867	Standard	NM_000872		Approved	5-HT7	uc001kha.3	P34969	OTTHUMG00000018732	ENST00000336152.3:c.1394-2->T	10.37:g.92502295_92502295dupA			B5BUP6|P78336|P78372|P78516|Q5VX01|Q5VX02|Q5VX03	Splice_Site	INS	-	e4-2	ENST00000336152.3	37	c.1394-3_1394-2	CCDS7408.1	10																																																																																			HTR7	-	-	ENSG00000148680		0.307	HTR7-001	KNOWN	basic|CCDS	protein_coding	HTR7	HGNC	protein_coding	OTTHUMT00000049343.1		0.00	18	0	-	NM_000872	Intron	92502288	-1	tier1		no_errors	ENST00000336152	ensembl	human	known	74_37	splice_site_ins	9.09	20	2	INS	0.999:0.019	A
HUWE1	10075	genome.wustl.edu	37	X	53600757	53600757	+	Missense_Mutation	SNP	T	T	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chrX:53600757T>A	ENST00000342160.3	-	46	6722	c.6265A>T	c.(6265-6267)Att>Ttt	p.I2089F	HUWE1_ENST00000262854.6_Missense_Mutation_p.I2089F			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	2089					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						TAGTTGGCAATCAGGGTAGCA	0.443																																																	0													206.0	153.0	171.0					X																	53600757		2203	4300	6503	SO:0001583	missense	0			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.6265A>T	X.37:g.53600757T>A	ENSP00000340648:p.Ile2089Phe		O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	pfam_E3_Ub_ligase_DUF913,pfam_HECT,pfam_E3_Ub_ligase_DUF908,pfam_WWE-dom,pfam_UBA/Ts_N,superfamily_HECT,superfamily_UBA-like,superfamily_ARM-type_fold,smart_UBA/transl_elong_EF1B_N_euk,smart_HECT,pfscan_HECT,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_WWE-dom	p.I2089F	ENST00000342160.3	37	c.6265	CCDS35301.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	21.0|21.0	4.080728|4.080728	0.76528|0.76528	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000427052|ENST00000342160;ENST00000262854	.|T;T	.|0.50548	.|0.74;0.74	5.89|5.89	5.89|5.89	0.94794|0.94794	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.59756|0.59756	0.2217|0.2217	L|L	0.46157|0.46157	1.445|1.445	0.80722|0.80722	D|D	1|1	.|P;D	.|0.69078	.|0.932;0.997	.|P;D	.|0.78314	.|0.888;0.991	T|T	0.54918|0.54918	-0.8221|-0.8221	5|10	.|0.20046	.|T	.|0.44	.|.	14.1263|14.1263	0.65222|0.65222	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|2089;2089	.|Q7Z6Z7;Q7Z6Z7-2	.|HUWE1_HUMAN;.	V|F	1122|2089	.|ENSP00000340648:I2089F;ENSP00000262854:I2089F	.|ENSP00000262854:I2089F	D|I	-|-	2|1	0|0	HUWE1|HUWE1	53617482|53617482	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	7.639000|7.639000	0.83342|0.83342	1.981000|1.981000	0.57761|0.57761	0.441000|0.441000	0.28932|0.28932	GAT|ATT	HUWE1	-	NULL	ENSG00000086758		0.443	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	HGNC	protein_coding	OTTHUMT00000056766.1	-	0.00	64	0	T	XM_497119		53600757	-1	tier1	-	no_errors	ENST00000262854	ensembl	human	known	74_37	missense	37.70	38	23	SNP	1.000	A
ICMT	23463	genome.wustl.edu	37	1	6291979	6291979	+	Missense_Mutation	SNP	A	A	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:6291979A>C	ENST00000343813.5	-	4	683	c.655T>G	c.(655-657)Tgg>Ggg	p.W219G		NM_012405.3	NP_036537.1	O60725	ICMT_HUMAN	isoprenylcysteine carboxyl methyltransferase	219					C-terminal protein methylation (GO:0006481)|cellular protein modification process (GO:0006464)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|multicellular organism growth (GO:0035264)|positive regulation of cell proliferation (GO:0008284)|protein targeting to membrane (GO:0006612)|regulation of Ras protein signal transduction (GO:0046578)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	cAMP response element binding protein binding (GO:0008140)|protein C-terminal carboxyl O-methyltransferase activity (GO:0003880)|protein C-terminal S-isoprenylcysteine carboxyl O-methyltransferase activity (GO:0004671)			NS(1)|endometrium(2)	3	Ovarian(185;0.0634)	all_cancers(23;5.85e-39)|all_epithelial(116;2.4e-22)|all_lung(118;2.65e-08)|Lung NSC(185;6.45e-07)|all_neural(13;3.18e-06)|all_hematologic(16;8.99e-06)|Acute lymphoblastic leukemia(12;0.000365)|Breast(487;0.000688)|Renal(390;0.0007)|Colorectal(325;0.00104)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)|Medulloblastoma(700;0.211)		Epithelial(90;5.52e-38)|GBM - Glioblastoma multiforme(13;6.51e-32)|OV - Ovarian serous cystadenocarcinoma(86;3.03e-19)|Colorectal(212;7.08e-08)|COAD - Colon adenocarcinoma(227;8.35e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(365;0.00109)|STAD - Stomach adenocarcinoma(132;0.00313)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.182)		CCAATACTCCAGTAAAACCAC	0.363																																																	0													98.0	92.0	94.0					1																	6291979		2202	4300	6502	SO:0001583	missense	0			AF064084	CCDS61.1	1p36	2010-04-29			ENSG00000116237	ENSG00000116237	2.1.1.100		5350	protein-coding gene	gene with protein product	"""protein-S-isoprenylcysteine O-methyltransferase"""	605851				9614111, 10441503	Standard	XM_005263437		Approved	PCCMT, HSTE14, PPMT	uc001amk.3	O60725	OTTHUMG00000001254	ENST00000343813.5:c.655T>G	1.37:g.6291979A>C	ENSP00000343552:p.Trp219Gly		Q6FHT0	Missense_Mutation	SNP	pfam_ICMT_MeTrfase	p.W219G	ENST00000343813.5	37	c.655	CCDS61.1	1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.076594	0.76415	.	.	ENSG00000116237	ENST00000343813;ENST00000535068	.	.	.	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	D	0.85741	0.5767	M	0.92459	3.31	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.88774	0.3266	9	0.62326	D	0.03	.	15.5459	0.76101	1.0:0.0:0.0:0.0	.	219	O60725	ICMT_HUMAN	G	219;123	.	ENSP00000343552:W219G	W	-	1	0	ICMT	6214566	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.737000	0.91562	2.263000	0.75096	0.533000	0.62120	TGG	ICMT	-	pfam_ICMT_MeTrfase	ENSG00000116237		0.363	ICMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ICMT	HGNC	protein_coding	OTTHUMT00000003681.1	-	0.00	188	0	A	NM_012405		6291979	-1	tier1	-	no_errors	ENST00000343813	ensembl	human	known	74_37	missense	16.75	174	35	SNP	1.000	C
IDH3B	3420	genome.wustl.edu	37	20	2639430	2639430	+	Silent	SNP	A	A	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr20:2639430A>C	ENST00000380843.4	-	12	1155	c.1125T>G	c.(1123-1125)tcT>tcG	p.S375S	IDH3B_ENST00000380851.5_Intron|IDH3B_ENST00000488299.1_5'UTR|SNORD86_ENST00000391196.1_RNA|SNORD56_ENST00000413522.1_RNA|SNORD57_ENST00000448188.1_RNA	NM_006899.3	NP_008830.2	O43837	IDH3B_HUMAN	isocitrate dehydrogenase 3 (NAD+) beta	375					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|isocitrate metabolic process (GO:0006102)|NADH metabolic process (GO:0006734)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|isocitrate dehydrogenase (NAD+) activity (GO:0004449)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)			breast(1)|endometrium(3)|kidney(2)|lung(7)|prostate(1)	14						GACCGATGACAGACTTGATGA	0.567																																																	0													172.0	150.0	158.0					20																	2639430		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS13031.1, CCDS13032.1, CCDS74696.1	20p13	2013-02-14			ENSG00000101365	ENSG00000101365	1.1.1.41		5385	protein-coding gene	gene with protein product		604526				10575215	Standard	NM_006899		Approved	RP46	uc002wgp.4	O43837	OTTHUMG00000031699	ENST00000380843.4:c.1125T>G	20.37:g.2639430A>C			B2RDR1|D3DVX2|D3DVX3|O95106|Q5JXS8|Q9NQ06|Q9NQ07|Q9NUZ0|Q9UEX0|Q9UG99	Silent	SNP	pfam_IsoPropMal-DH-like_dom,tigrfam_Isocitrate_DH_NAD	p.S375	ENST00000380843.4	37	c.1125	CCDS13032.1	20																																																																																			IDH3B	-	pfam_IsoPropMal-DH-like_dom,tigrfam_Isocitrate_DH_NAD	ENSG00000101365		0.567	IDH3B-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IDH3B	HGNC	protein_coding	OTTHUMT00000077613.1	-	0.00	94	0	A			2639430	-1	tier1	-	no_errors	ENST00000380843	ensembl	human	known	74_37	silent	35.29	44	24	SNP	0.994	C
IFFO2	126917	genome.wustl.edu	37	1	19236843	19236843	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:19236843C>T	ENST00000455833.2	-	8	1794	c.1441G>A	c.(1441-1443)Gca>Aca	p.A481T	RP13-279N23.2_ENST00000494072.3_Missense_Mutation_p.R259H	NM_001136265.1	NP_001129737.1	Q5TF58	IFFO2_HUMAN	intermediate filament family orphan 2	481						intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)	2						TACCTGTCTGCGGAGCCTTTG	0.592																																																	0													92.0	95.0	94.0					1																	19236843		692	1591	2283	SO:0001583	missense	0			AK024480, AL080251	CCDS44076.1	1p36.13	2013-10-11			ENSG00000169991	ENSG00000169991		"""Intermediate filament family orphans"""	27006	protein-coding gene	gene with protein product						14702039	Standard	NM_001136265		Approved		uc001bbd.2	Q5TF58	OTTHUMG00000002499	ENST00000455833.2:c.1441G>A	1.37:g.19236843C>T	ENSP00000387941:p.Ala481Thr		Q9H7K0	Missense_Mutation	SNP	pfam_IF	p.A481T	ENST00000455833.2	37	c.1441	CCDS44076.1	1	.	.	.	.	.	.	.	.	.	.	C	18.82	3.705011	0.68615	.	.	ENSG00000169991	ENST00000304963;ENST00000455833;ENST00000355609	D;T	0.88664	-2.41;2.56	4.6	4.6	0.57074	Filament (1);	0.111194	0.64402	D	0.000011	D	0.88647	0.6493	N	0.22421	0.69	0.40350	D	0.979127	D	0.76494	0.999	P	0.59288	0.855	D	0.89127	0.3507	10	0.42905	T	0.14	.	16.5257	0.84330	0.0:1.0:0.0:0.0	.	481	Q5TF58	IFFO2_HUMAN	T	425;481;52	ENSP00000387941:A481T;ENSP00000347820:A52T	ENSP00000305144:A425T	A	-	1	0	IFFO2	19109430	0.853000	0.29707	0.457000	0.27056	0.631000	0.37964	4.473000	0.60196	2.555000	0.86185	0.655000	0.94253	GCA	IFFO2	-	pfam_IF	ENSG00000169991		0.592	IFFO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFFO2	HGNC	protein_coding	OTTHUMT00000007099.2	-	0.00	109	0	C	NM_001136265		19236843	-1	tier1	-	no_errors	ENST00000455833	ensembl	human	known	74_37	missense	5.04	113	6	SNP	0.835	T
IFI27L2	83982	genome.wustl.edu	37	14	94594153	94594153	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr14:94594153C>T	ENST00000238609.3	-	4	475	c.376G>A	c.(376-378)Gag>Aag	p.E126K	IFI27L2_ENST00000556727.1_Missense_Mutation_p.E101K	NM_032036.2	NP_114425.1	Q9H2X8	I27L2_HUMAN	interferon, alpha-inducible protein 27-like 2	126						integral component of membrane (GO:0016021)				breast(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	8						TCATGTTTCTCTGACTTGAGT	0.488																																																	0													219.0	206.0	210.0					14																	94594153		2203	4300	6503	SO:0001583	missense	0			AF208232	CCDS9920.1	14q32.13	2008-10-08	2008-10-08	2008-10-08		ENSG00000119632			19753	protein-coding gene	gene with protein product		611319	"""family with sequence similarity 14, member A"""	FAM14A			Standard	NM_032036		Approved	TLH29	uc001ycq.3	Q9H2X8		ENST00000238609.3:c.376G>A	14.37:g.94594153C>T	ENSP00000238609:p.Glu126Lys		Q8TBD7|Q9NYL0	Missense_Mutation	SNP	pfam_IFI6/IFI27	p.E126K	ENST00000238609.3	37	c.376	CCDS9920.1	14	.	.	.	.	.	.	.	.	.	.	C	18.97	3.734912	0.69189	.	.	ENSG00000119632	ENST00000238609;ENST00000556727	T;T	0.37411	1.2;1.21	4.1	4.1	0.47936	.	.	.	.	.	T	0.32585	0.0834	L	0.29908	0.895	0.22666	N	0.99888	P	0.40970	0.734	B	0.42798	0.398	T	0.20706	-1.0267	9	0.87932	D	0	.	12.5672	0.56316	0.0:1.0:0.0:0.0	.	126	Q9H2X8	I27L2_HUMAN	K	126;101	ENSP00000238609:E126K;ENSP00000451717:E101K	ENSP00000238609:E126K	E	-	1	0	IFI27L2	93663906	0.077000	0.21312	0.266000	0.24541	0.028000	0.11728	-0.456000	0.06754	2.211000	0.71520	0.563000	0.77884	GAG	IFI27L2	-	NULL	ENSG00000119632		0.488	IFI27L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFI27L2	HGNC	protein_coding	OTTHUMT00000412935.1	-	0.00	115	0	C	NM_032036		94594153	-1	tier1	-	no_errors	ENST00000238609	ensembl	human	known	74_37	missense	26.23	90	32	SNP	0.726	T
IFT140	9742	genome.wustl.edu	37	16	1574888	1574888	+	Missense_Mutation	SNP	A	A	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr16:1574888A>C	ENST00000426508.2	-	23	3257	c.2894T>G	c.(2893-2895)cTg>cGg	p.L965R	IFT140_ENST00000361339.5_Missense_Mutation_p.L159R	NM_014714.3	NP_055529.2	Q96RY7	IF140_HUMAN	intraflagellar transport 140	965					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)|protein localization to cilium (GO:0061512)|regulation of cilium assembly (GO:1902017)|renal system development (GO:0072001)|retina development in camera-type eye (GO:0060041)|skeletal system morphogenesis (GO:0048705)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)|photoreceptor connecting cilium (GO:0032391)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(12)|lung(10)|ovary(5)|pancreas(1)|prostate(4)|skin(4)|stomach(2)|urinary_tract(1)	53		Hepatocellular(780;0.219)				CTGGCTCTCCAGGTACTGCGC	0.697																																																	0													35.0	44.0	41.0					16																	1574888		2199	4300	6499	SO:0001583	missense	0			AB011162	CCDS10439.1	16p13.3	2014-07-03	2014-07-03	2005-11-02	ENSG00000187535	ENSG00000187535		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29077	protein-coding gene	gene with protein product		614620	"""WD and tetratricopeptide repeats 2"", ""intraflagellar transport 140 homolog (Chlamydomonas)"""	WDTC2		9628581	Standard	NM_014714		Approved	gs114, KIAA0590	uc002cmb.3	Q96RY7	OTTHUMG00000128585	ENST00000426508.2:c.2894T>G	16.37:g.1574888A>C	ENSP00000406012:p.Leu965Arg		A2A2A8|D3DU75|O60332|Q9UG52	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L965R	ENST00000426508.2	37	c.2894	CCDS10439.1	16	.	.	.	.	.	.	.	.	.	.	A	26.2	4.716988	0.89205	.	.	ENSG00000187535	ENST00000397417;ENST00000361339;ENST00000426508	T;T	0.79141	-1.24;-1.24	5.53	5.53	0.82687	.	0.000000	0.64402	D	0.000004	D	0.87541	0.6203	M	0.79475	2.455	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.70716	0.934;0.97	D	0.88252	0.2917	10	0.51188	T	0.08	.	15.66	0.77178	1.0:0.0:0.0:0.0	.	965;652	Q96RY7;B4DR58	IF140_HUMAN;.	R	965;159;965	ENSP00000354895:L159R;ENSP00000406012:L965R	ENSP00000354895:L159R	L	-	2	0	IFT140	1514889	1.000000	0.71417	1.000000	0.80357	0.814000	0.46013	9.262000	0.95591	2.108000	0.64289	0.533000	0.62120	CTG	IFT140	-	NULL	ENSG00000187535		0.697	IFT140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT140	HGNC	protein_coding	OTTHUMT00000250438.2	-	0.00	197	0	A	NM_014714		1574888	-1	tier1	-	no_errors	ENST00000426508	ensembl	human	known	74_37	missense	11.22	87	11	SNP	1.000	C
IGF2R	3482	genome.wustl.edu	37	6	160494982	160494982	+	Missense_Mutation	SNP	A	A	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr6:160494982A>T	ENST00000356956.1	+	35	5289	c.5141A>T	c.(5140-5142)aAa>aTa	p.K1714I		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	1714					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	GCTGTGTGCAAAGTTCCTATT	0.463																																																	0													68.0	62.0	64.0					6																	160494982		2203	4300	6503	SO:0001583	missense	0			J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.5141A>T	6.37:g.160494982A>T	ENSP00000349437:p.Lys1714Ile		Q7Z7G9|Q96PT5	Missense_Mutation	SNP	pfam_CIMR,pfam_FN_type2_col-bd,superfamily_Man6P_isomerase_rcpt-bd_dom,superfamily_Kringle-like,smart_FN_type2_col-bd,pfscan_FN_type2_col-bd	p.K1714I	ENST00000356956.1	37	c.5141	CCDS5273.1	6	.	.	.	.	.	.	.	.	.	.	A	19.69	3.874913	0.72180	.	.	ENSG00000197081	ENST00000356956	T	0.11277	2.79	5.58	5.58	0.84498	Mannose-6-phosphate receptor, binding (1);	0.109134	0.64402	D	0.000015	T	0.12433	0.0302	L	0.52364	1.645	0.43740	D	0.996236	B	0.31435	0.323	P	0.50617	0.646	T	0.08868	-1.0701	10	0.42905	T	0.14	-7.1058	9.3957	0.38401	0.7307:0.0:0.0:0.2693	.	1714	P11717	MPRI_HUMAN	I	1714	ENSP00000349437:K1714I	ENSP00000349437:K1714I	K	+	2	0	IGF2R	160414972	1.000000	0.71417	0.971000	0.41717	0.755000	0.42902	5.257000	0.65473	2.135000	0.66039	0.533000	0.62120	AAA	IGF2R	-	pfam_CIMR,superfamily_Man6P_isomerase_rcpt-bd_dom	ENSG00000197081		0.463	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGF2R	HGNC	protein_coding	OTTHUMT00000042931.1	-	0.00	83	0	A	NM_000876		160494982	+1	tier1	-	no_errors	ENST00000356956	ensembl	human	known	74_37	missense	20.65	73	19	SNP	1.000	T
IL4R	3566	genome.wustl.edu	37	16	27374546	27374546	+	Missense_Mutation	SNP	A	A	G			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr16:27374546A>G	ENST00000395762.2	+	11	2132	c.1873A>G	c.(1873-1875)Agc>Ggc	p.S625G	IL4R_ENST00000380922.3_Missense_Mutation_p.S610G|IL4R_ENST00000543915.2_Missense_Mutation_p.S625G|IL4R_ENST00000170630.2_Missense_Mutation_p.S625G	NM_000418.3	NP_000409.1	P24394	IL4RA_HUMAN	interleukin 4 receptor	625	Required for IL4-induced gene expression.				defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|ovulation (GO:0030728)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|production of molecular mediator involved in inflammatory response (GO:0002532)|regulation of cell proliferation (GO:0042127)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	interleukin-4 receptor activity (GO:0004913)|receptor signaling protein activity (GO:0005057)			breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	33						GTTTGGGGCTAGCAGTGGGGA	0.602																																																	0													53.0	52.0	53.0					16																	27374546		2197	4300	6497	SO:0001583	missense	0			X52425	CCDS10629.1, CCDS58441.1	16p12.1-p11.2	2008-05-14			ENSG00000077238	ENSG00000077238		"""Interleukins and interleukin receptors"", ""CD molecules"""	6015	protein-coding gene	gene with protein product		147781				1679753	Standard	NM_000418		Approved	CD124	uc010bxy.4	P24394	OTTHUMG00000097015	ENST00000395762.2:c.1873A>G	16.37:g.27374546A>G	ENSP00000379111:p.Ser625Gly		B4E076|B9EKU8|H3BSY5|Q96P01|Q9H181|Q9H182|Q9H183|Q9H184|Q9H185|Q9H186|Q9H187|Q9H188	Missense_Mutation	SNP	pfam_IL-4_rcpt-alpha_N,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.S625G	ENST00000395762.2	37	c.1873	CCDS10629.1	16	.	.	.	.	.	.	.	.	.	.	A	6.984	0.551694	0.13374	.	.	ENSG00000077238	ENST00000395762;ENST00000543915;ENST00000380922;ENST00000170630	T;T;T;T	0.10668	2.85;2.85;2.85;2.85	4.98	0.648	0.17801	.	1.748270	0.03138	N	0.166146	T	0.08714	0.0216	N	0.20401	0.57	0.09310	N	1	B;B;B	0.10296	0.003;0.002;0.002	B;B;B	0.10450	0.005;0.003;0.003	T	0.35895	-0.9770	10	0.42905	T	0.14	-13.6551	7.3058	0.26447	0.3829:0.0:0.6171:0.0	.	610;625;625	B4E076;B9EGC0;P24394	.;.;IL4RA_HUMAN	G	625;625;610;625	ENSP00000379111:S625G;ENSP00000441667:S625G;ENSP00000370309:S610G;ENSP00000170630:S625G	ENSP00000170630:S625G	S	+	1	0	IL4R	27282047	0.001000	0.12720	0.500000	0.27589	0.205000	0.24178	-0.219000	0.09228	0.145000	0.18977	0.459000	0.35465	AGC	IL4R	-	NULL	ENSG00000077238		0.602	IL4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL4R	HGNC	protein_coding	OTTHUMT00000214104.4	-	0.00	87	0	A			27374546	+1	tier1	-	no_errors	ENST00000170630	ensembl	human	known	74_37	missense	6.93	214	16	SNP	0.067	G
IL7R	3575	genome.wustl.edu	37	5	35876108	35876108	+	Silent	SNP	T	T	G			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr5:35876108T>G	ENST00000303115.3	+	8	1029	c.900T>G	c.(898-900)ccT>ccG	p.P300P	IL7R_ENST00000343305.4_3'UTR	NM_002185.3	NP_002176.2	P16871	IL7RA_HUMAN	interleukin 7 receptor	300					B cell proliferation (GO:0042100)|cell growth (GO:0016049)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|homeostasis of number of cells (GO:0048872)|immune response (GO:0006955)|immunoglobulin production (GO:0002377)|interleukin-7-mediated signaling pathway (GO:0038111)|lymph node development (GO:0048535)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|positive regulation of gene expression (GO:0010628)|positive regulation of T cell differentiation in thymus (GO:0033089)|regulation of cell size (GO:0008361)|regulation of DNA recombination (GO:0000018)|signal transduction (GO:0007165)|T cell differentiation (GO:0030217)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|interleukin-7 receptor activity (GO:0004917)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(78)|kidney(2)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|skin(5)|stomach(3)	126	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			GTTTCAATCCTGAAAGTTTCC	0.418			"""Mis, O"""		"""ALL, ETP ALL"""		Severe combined immune deficiency																																	Dom	yes		5	5p13	146661	interleukin 7 receptor	yes	L	0													86.0	82.0	83.0					5																	35876108		2203	4300	6503	SO:0001819	synonymous_variant	0			M29696	CCDS3911.1	5p13	2014-09-17			ENSG00000168685	ENSG00000168685		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6024	protein-coding gene	gene with protein product		146661				2317865	Standard	NM_002185		Approved	CD127	uc003jjs.4	P16871	OTTHUMG00000090791	ENST00000303115.3:c.900T>G	5.37:g.35876108T>G			B2RCS6|B4DVT1|Q05CU8|Q6NSP4|Q6NWM0|Q6NWM1|Q6NWM2|Q6NWM3|Q6SV45|Q9UPC1	Silent	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3	p.P300	ENST00000303115.3	37	c.900	CCDS3911.1	5																																																																																			IL7R	-	NULL	ENSG00000168685		0.418	IL7R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL7R	HGNC	protein_coding	OTTHUMT00000207577.2	-	0.00	41	0	T			35876108	+1	tier1	-	no_errors	ENST00000303115	ensembl	human	known	74_37	silent	84.44	7	38	SNP	0.871	G
QRICH1	54870	genome.wustl.edu	37	3	49065934	49065934	+	IGR	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr3:49065934G>T	ENST00000395443.2	-	0	3549				IMPDH2_ENST00000326739.4_Missense_Mutation_p.T60N|RP13-131K19.6_ENST00000607245.1_RNA	NM_198880.1	NP_942581.1	Q2TAL8	QRIC1_HUMAN	glutamine-rich 1							nucleus (GO:0005634)				breast(2)|endometrium(5)|large_intestine(8)|lung(8)|ovary(1)|skin(1)	25				BRCA - Breast invasive adenocarcinoma(193;8.88e-05)|Kidney(197;0.00239)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		GGTCTTAAGAGTGATTTTCTT	0.552																																																	0													73.0	72.0	72.0					3																	49065934		2203	4300	6503	SO:0001628	intergenic_variant	0				CCDS2787.1	3p21.31	2011-06-03			ENSG00000198218	ENSG00000198218			24713	protein-coding gene	gene with protein product						12477932	Standard	NM_017730		Approved	FLJ20259	uc003cvv.3	Q2TAL8	OTTHUMG00000156772		3.37:g.49065934G>T			Q4G0F7|Q7L621|Q8TEA5	Missense_Mutation	SNP	pfam_IMP_DH_GMPRt,pfam_CBS_dom,pfam_2Npropane_dOase,pfam_FMN-dep_DH,pfam_NanE,smart_CBS_dom,pirsf_IMP_DH,tigrfam_IMP_DH	p.T60N	ENST00000395443.2	37	c.179	CCDS2787.1	3	.	.	.	.	.	.	.	.	.	.	G	22.1	4.246870	0.80024	.	.	ENSG00000178035	ENST00000537036;ENST00000326739;ENST00000442157	T;T	0.78481	-1.18;-1.18	5.82	5.82	0.92795	Aldolase-type TIM barrel (1);IMP dehydrogenase/GMP reductase (1);	0.000000	0.85682	D	0.000000	T	0.73869	0.3642	L	0.43152	1.355	0.80722	D	1	B	0.11235	0.004	B	0.22386	0.039	T	0.66200	-0.5983	9	.	.	.	-20.7334	20.1054	0.97890	0.0:0.0:1.0:0.0	.	60	P12268	IMDH2_HUMAN	N	60	ENSP00000321584:T60N;ENSP00000403502:T60N	.	T	-	2	0	IMPDH2	49040938	1.000000	0.71417	0.990000	0.47175	0.974000	0.67602	9.712000	0.98738	2.757000	0.94681	0.655000	0.94253	ACT	IMPDH2	-	pfam_IMP_DH_GMPRt,pfam_2Npropane_dOase,pirsf_IMP_DH,tigrfam_IMP_DH	ENSG00000178035		0.552	QRICH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IMPDH2	HGNC	protein_coding	OTTHUMT00000345669.1	-	0.00	69	0	G	NM_017730		49065934	-1	tier1	-	no_errors	ENST00000326739	ensembl	human	known	74_37	missense	6.15	61	4	SNP	1.000	T
IPO4	79711	genome.wustl.edu	37	14	24657939	24657939	+	Nonsense_Mutation	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr14:24657939C>A	ENST00000354464.6	-	1	231	c.55G>T	c.(55-57)Gag>Tag	p.E19*	RP11-468E2.2_ENST00000561419.1_3'UTR	NM_024658.3	NP_078934.3	Q8TEX9	IPO4_HUMAN	importin 4	19					DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|stomach(2)|urinary_tract(1)	33				GBM - Glioblastoma multiforme(265;0.0087)		CGGATGCGCTCGGTGTCCGGT	0.687																																																	0													8.0	11.0	10.0					14																	24657939		1955	4114	6069	SO:0001587	stop_gained	0			AF411122	CCDS9616.1	14q11.2	2003-03-10			ENSG00000196497	ENSG00000196497		"""Importins"""	19426	protein-coding gene	gene with protein product						11823430	Standard	NR_051979		Approved	Imp4, FLJ23338	uc001wmv.1	Q8TEX9	OTTHUMG00000028801	ENST00000354464.6:c.55G>T	14.37:g.24657939C>A	ENSP00000346453:p.Glu19*		B2RN95|Q2NL96|Q86TZ9|Q8NCG8|Q96SJ3|Q9BTI4|Q9H5L0	Nonsense_Mutation	SNP	pfam_HEAT,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_HEAT_type_2,pfscan_Importin-beta_N	p.E19*	ENST00000354464.6	37	c.55	CCDS9616.1	14	.	.	.	.	.	.	.	.	.	.	C	38	6.646056	0.97730	.	.	ENSG00000196497	ENST00000354464	.	.	.	6.08	3.08	0.35506	.	0.303702	0.32015	N	0.006703	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.17369	T	0.5	-4.5519	7.662	0.28409	0.0:0.5997:0.3167:0.0836	.	.	.	.	X	19	.	ENSP00000346453:E19X	E	-	1	0	IPO4	23727779	0.489000	0.26004	1.000000	0.80357	0.979000	0.70002	1.887000	0.39698	0.876000	0.35872	0.655000	0.94253	GAG	IPO4	-	superfamily_ARM-type_fold	ENSG00000196497		0.687	IPO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO4	HGNC	protein_coding	OTTHUMT00000071931.4	-	0.00	76	0	C	NM_024658		24657939	-1	tier1	-	no_errors	ENST00000354464	ensembl	human	known	74_37	nonsense	6.86	95	7	SNP	0.997	A
ITGAM	3684	genome.wustl.edu	37	16	31309066	31309066	+	Splice_Site	SNP	A	A	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr16:31309066A>T	ENST00000287497.8	+	14	1573	c.1498A>T	c.(1498-1500)Agg>Tgg	p.R500W	ITGAM_ENST00000544665.3_Missense_Mutation_p.R501W			P11215	ITAM_HUMAN	integrin, alpha M (complement component 3 receptor 3 subunit)	500					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular extravasation (GO:0045123)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|microglia development (GO:0014005)|neutrophil chemotaxis (GO:0030593)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)			endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(1)|prostate(4)|skin(1)	56						TGTTTAGCAGAGGGCTCGGTG	0.657																																																	0													64.0	66.0	66.0					16																	31309066		2164	4274	6438	SO:0001630	splice_region_variant	0			J03925	CCDS45470.1, CCDS54004.1	16p11.2	2010-03-23	2006-02-10			ENSG00000169896		"""CD molecules"", ""Complement system"", ""Integrins"""	6149	protein-coding gene	gene with protein product		120980	"""integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide)"""	CR3A, CD11B			Standard	NM_001145808		Approved	MAC-1, CD11b	uc002ebr.3	P11215		ENST00000287497.8:c.1498-1A>T	16.37:g.31309066A>T			Q4VAK0|Q4VAK1|Q4VAK2	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.R501W	ENST00000287497.8	37	c.1501	CCDS45470.1	16	.	.	.	.	.	.	.	.	.	.	A	8.373	0.835829	0.16820	.	.	ENSG00000169896	ENST00000544665;ENST00000287497	T;T	0.26810	2.76;1.71	4.0	0.0916	0.14469	.	.	.	.	.	T	0.22205	0.0535	L	0.58101	1.795	0.09310	N	1	B;B	0.25351	0.124;0.124	B;B	0.24269	0.052;0.052	T	0.25082	-1.0142	9	0.49607	T	0.09	.	5.0971	0.14739	0.4896:0.4042:0.1062:0.0	.	500;500	Q4VAK1;P11215	.;ITAM_HUMAN	W	501;500	ENSP00000441691:R501W;ENSP00000287497:R500W	ENSP00000287497:R500W	R	+	1	2	ITGAM	31216567	0.433000	0.25562	0.172000	0.22920	0.427000	0.31564	0.229000	0.17833	-0.111000	0.12001	0.533000	0.62120	AGG	ITGAM	-	smart_Int_alpha_beta-p	ENSG00000169896		0.657	ITGAM-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGAM	HGNC	protein_coding	OTTHUMT00000432816.1	-	0.00	110	0	A	NM_000632	Missense_Mutation	31309066	+1	tier1	-	no_errors	ENST00000544665	ensembl	human	known	74_37	missense	7.75	369	31	SNP	0.091	T
ITPKB	3707	genome.wustl.edu	37	1	226923281	226923281	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:226923281G>T	ENST00000272117.3	-	1	1878	c.1879C>A	c.(1879-1881)Ctg>Atg	p.L627M	ITPKB_ENST00000429204.1_Missense_Mutation_p.L627M|ITPKB_ENST00000366784.1_Missense_Mutation_p.L627M			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	627					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				TTGGGGTCCAGGGTGCGCTCA	0.562																																					Colon(84;110 1851 5306 33547)												0													132.0	123.0	126.0					1																	226923281		2203	4300	6503	SO:0001583	missense	0			AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.1879C>A	1.37:g.226923281G>T	ENSP00000272117:p.Leu627Met		Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	Missense_Mutation	SNP	pfam_IPK	p.L627M	ENST00000272117.3	37	c.1879	CCDS1555.1	1	.	.	.	.	.	.	.	.	.	.	G	19.14	3.770748	0.69992	.	.	ENSG00000143772	ENST00000272117;ENST00000429204;ENST00000366784	T;T;T	0.33654	1.76;1.76;1.4	5.77	2.44	0.29823	.	0.324112	0.28964	N	0.013580	T	0.41236	0.1150	L	0.27053	0.805	0.25314	N	0.989175	D	0.76494	0.999	D	0.68192	0.956	T	0.13602	-1.0503	10	0.49607	T	0.09	-8.9213	9.9268	0.41496	0.315:0.0:0.685:0.0	.	627	P27987	IP3KB_HUMAN	M	627	ENSP00000272117:L627M;ENSP00000411152:L627M;ENSP00000355748:L627M	ENSP00000272117:L627M	L	-	1	2	ITPKB	224989904	0.997000	0.39634	1.000000	0.80357	0.997000	0.91878	0.419000	0.21247	0.912000	0.36772	0.655000	0.94253	CTG	ITPKB	-	NULL	ENSG00000143772		0.562	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPKB	HGNC	protein_coding	OTTHUMT00000091632.1	-	0.00	58	0	G	NM_002221		226923281	-1	tier1	-	no_errors	ENST00000272117	ensembl	human	known	74_37	missense	5.88	64	4	SNP	0.996	T
IWS1	55677	genome.wustl.edu	37	2	128261067	128261067	+	Silent	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr2:128261067G>A	ENST00000295321.4	-	4	1564	c.1305C>T	c.(1303-1305)acC>acT	p.T435T	IWS1_ENST00000455721.2_Silent_p.T442T|IWS1_ENST00000486662.1_5'Flank|AC010976.2_ENST00000599001.1_RNA	NM_017969.2	NP_060439.2	Q96ST2	IWS1_HUMAN	IWS1 homolog (S. cerevisiae)	435	Glu-rich.				mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of histone H3-K36 trimethylation (GO:2001253)|regulation of histone H4 acetylation (GO:0090239)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(2)|kidney(6)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0735)		CAGATGCTATGGTCTTCTCTC	0.428																																																	0													160.0	142.0	148.0					2																	128261067		2203	4300	6503	SO:0001819	synonymous_variant	0			AK000868	CCDS2146.1	2q14.3	2006-03-17			ENSG00000163166	ENSG00000163166			25467	protein-coding gene	gene with protein product							Standard	NM_017969		Approved	DKFZp761G0123, FLJ10006, FLJ14655, FLJ32319	uc002ton.2	Q96ST2	OTTHUMG00000131527	ENST00000295321.4:c.1305C>T	2.37:g.128261067G>A			Q2TB65|Q6P157|Q8N3E8|Q96MI7|Q9NV97|Q9NWH8	Silent	SNP	pfam_TFIIS_N,superfamily_TFIIS_N	p.T435	ENST00000295321.4	37	c.1305	CCDS2146.1	2																																																																																			IWS1	-	NULL	ENSG00000163166		0.428	IWS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IWS1	HGNC	protein_coding	OTTHUMT00000254384.2	-	0.00	27	0	G	NM_017969		128261067	-1	tier1	-	no_errors	ENST00000295321	ensembl	human	known	74_37	silent	11.11	32	4	SNP	0.009	A
JAK2	3717	genome.wustl.edu	37	9	5069023	5069023	+	Splice_Site	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr9:5069023G>T	ENST00000381652.3	+	11	1822	c.1328G>T	c.(1327-1329)cGa>cTa	p.R443L	JAK2_ENST00000544510.1_Splice_Site_p.R294L|JAK2_ENST00000539801.1_Splice_Site_p.R443L	NM_004972.3	NP_004963.1	O60674	JAK2_HUMAN	Janus kinase 2	443	SH2; atypical. {ECO:0000255|PROSITE- ProRule:PRU00191}.	Breakpoint for translocation to form PCM1-JAK2 fusion protein.			actin filament polymerization (GO:0030041)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon regeneration (GO:0031103)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular component movement (GO:0006928)|cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone receptor signaling pathway (GO:0060396)|histone H3-Y41 phosphorylation (GO:0035409)|hormone-mediated signaling pathway (GO:0009755)|host programmed cell death induced by symbiont (GO:0034050)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-12-mediated signaling pathway (GO:0035722)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|mammary gland epithelium development (GO:0061180)|mesoderm development (GO:0007498)|mineralocorticoid receptor signaling pathway (GO:0031959)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of DNA binding (GO:0043392)|negative regulation of heart contraction (GO:0045822)|negative regulation of neuron apoptotic process (GO:0043524)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell activation (GO:0050867)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA binding (GO:0043388)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|positive regulation of inflammatory response (GO:0050729)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to antibiotic (GO:0046677)|response to hydroperoxide (GO:0033194)|response to interleukin-12 (GO:0070671)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|tyrosine phosphorylation of STAT protein (GO:0007260)|tyrosine phosphorylation of Stat1 protein (GO:0042508)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome lumen (GO:0031904)|membrane raft (GO:0045121)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|heme binding (GO:0020037)|histone binding (GO:0042393)|histone kinase activity (H3-Y41 specific) (GO:0035401)|interleukin-12 receptor binding (GO:0005143)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)		BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)|ETV6/JAK2(11)|PCM1/JAK2(30)|PAX5/JAK2(18)	breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(32944)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(4)|skin(2)|urinary_tract(1)	32998	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	CTTATACAGCGAGAAAATGTC	0.328		1	"""T, Mis, O"""	"""ETV6, PCM1, BCR"""	"""ALL, AML, MPD,  CML"""				Polycythemia Vera, Familial																															Dom	yes		9	9p24	3717	Janus kinase 2		L	0													54.0	60.0	58.0					9																	5069023		2203	4299	6502	SO:0001630	splice_region_variant	0	Familial Cancer Database			CCDS6457.1	9p24	2014-09-17	2009-04-23		ENSG00000096968	ENSG00000096968	2.7.10.1	"""SH2 domain containing"""	6192	protein-coding gene	gene with protein product		147796				1848670	Standard	NM_004972		Approved	JTK10	uc003ziw.3	O60674	OTTHUMG00000019490	ENST00000381652.3:c.1327-1G>T	9.37:g.5069023G>T			O14636|O75297	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,superfamily_Kinase-like_dom,superfamily_FERM_central,smart_Band_41_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_FERM_domain,pfscan_SH2,pfscan_Prot_kinase_dom,prints_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Tyr_kinase_non-rcpt_Jak2,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R443L	ENST00000381652.3	37	c.1328	CCDS6457.1	9	.	.	.	.	.	.	.	.	.	.	G	11.57	1.678745	0.29783	.	.	ENSG00000096968	ENST00000539801;ENST00000381652;ENST00000544510	T;T;T	0.26373	1.74;1.74;1.74	5.02	3.19	0.36642	SH2 motif (4);	0.488046	0.20689	N	0.087500	T	0.17492	0.0420	N	0.25647	0.755	0.39592	D	0.969607	B	0.23442	0.085	B	0.26614	0.071	T	0.06972	-1.0797	10	0.30078	T	0.28	-2.4355	9.5014	0.39019	0.2283:0.0:0.7717:0.0	.	443	O60674	JAK2_HUMAN	L	443;443;294	ENSP00000440387:R443L;ENSP00000371067:R443L;ENSP00000443103:R294L	ENSP00000371067:R443L	R	+	2	0	JAK2	5059023	1.000000	0.71417	0.992000	0.48379	0.969000	0.65631	2.765000	0.47621	0.521000	0.28445	0.591000	0.81541	CGA	JAK2	-	pfam_SH2,smart_SH2,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_SH2	ENSG00000096968		0.328	JAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JAK2	HGNC	protein_coding	OTTHUMT00000051609.1	-	0.00	56	0	G		Missense_Mutation	5069023	+1	tier1	-	no_errors	ENST00000381652	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.984	T
JMJD1C	221037	genome.wustl.edu	37	10	64967532	64967532	+	Silent	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr10:64967532C>T	ENST00000399262.2	-	10	4115	c.3897G>A	c.(3895-3897)caG>caA	p.Q1299Q	JMJD1C_ENST00000402544.1_Silent_p.Q1080Q|JMJD1C_ENST00000399251.1_Silent_p.Q1080Q|JMJD1C_ENST00000542921.1_Silent_p.Q1117Q	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	1299					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					CCATAGCAGCCTGTAACTTTC	0.418																																																	0													121.0	119.0	120.0					10																	64967532		1920	4124	6044	SO:0001819	synonymous_variant	0			L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.3897G>A	10.37:g.64967532C>T			A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Silent	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.Q1299	ENST00000399262.2	37	c.3897	CCDS41532.1	10																																																																																			JMJD1C	-	NULL	ENSG00000171988		0.418	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	JMJD1C	HGNC	protein_coding	OTTHUMT00000048249.2	-	0.00	29	0	C	NM_004241		64967532	-1	tier1	-	no_errors	ENST00000399262	ensembl	human	known	74_37	silent	20.00	48	12	SNP	0.941	T
KCNAB2	8514	genome.wustl.edu	37	1	6111615	6111615	+	Intron	SNP	A	A	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:6111615A>T	ENST00000164247.1	+	3	683				KCNAB2_ENST00000378092.1_Intron|KCNAB2_ENST00000602612.1_Intron|KCNAB2_ENST00000378111.1_Intron|KCNAB2_ENST00000378087.3_Intron|KCNAB2_ENST00000458166.2_Intron|KCNAB2_ENST00000352527.1_Intron|KCNAB2_ENST00000341524.1_Intron|KCNAB2_ENST00000378097.1_Intron|KCNAB2_ENST00000378083.3_Missense_Mutation_p.S7C	NM_001199860.1	NP_001186789.1	Q13303	KCAB2_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 2						hematopoietic progenitor cell differentiation (GO:0002244)|protein heterooligomerization (GO:0051291)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			large_intestine(1)|lung(4)|skin(3)	8	Ovarian(185;0.0634)	all_cancers(23;5.85e-39)|all_epithelial(116;4.88e-22)|all_lung(118;4.21e-08)|Lung NSC(185;9.77e-07)|all_hematologic(16;2.78e-06)|all_neural(13;3.18e-06)|Acute lymphoblastic leukemia(12;0.000272)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00106)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)		Epithelial(90;6.9e-37)|GBM - Glioblastoma multiforme(13;8.8e-31)|OV - Ovarian serous cystadenocarcinoma(86;1.45e-19)|Colorectal(212;2.46e-07)|COAD - Colon adenocarcinoma(227;2.07e-05)|Kidney(185;7.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00131)|BRCA - Breast invasive adenocarcinoma(365;0.00133)|STAD - Stomach adenocarcinoma(132;0.00391)|READ - Rectum adenocarcinoma(331;0.0649)		CATGACGTACAGCGAGAGTCT	0.652																																																	0																																										SO:0001627	intron_variant	0			U33429	CCDS55.1, CCDS56.1, CCDS55570.1, CCDS55571.1	1p36.3	2008-02-05			ENSG00000069424	ENSG00000069424		"""Potassium channels"", ""Aldo-keto reductases"""	6229	protein-coding gene	gene with protein product		601142				8838324	Standard	NM_003636		Approved	AKR6A5, KCNA2B, HKvbeta2.1, HKvbeta2.2	uc001aly.2	Q13303	OTTHUMG00000000795	ENST00000164247.1:c.119+9683A>T	1.37:g.6111615A>T			A0AVM9|A8K1A4|B0AZR7|O43659|Q5TG82|Q5TG83|Q6ZNE4|Q99411	Missense_Mutation	SNP	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_K_chnl_volt-dep_bsu_KCNAB1,prints_K_chnl_volt-dep_bsu_KCNAB2,prints_K_chnl_volt-dep_bsu_KCNAB-rel,prints_K_chnl_volt-dep_bsu_KCNAB3,tigrfam_K_chnl_volt-dep_bsu_KCNAB	p.S7C	ENST00000164247.1	37	c.19	CCDS55.1	1	.	.	.	.	.	.	.	.	.	.	A	28.0	4.882349	0.91740	.	.	ENSG00000069424	ENST00000378083	T	0.06608	3.28	5.26	5.26	0.73747	.	0.597834	0.19529	N	0.112100	T	0.25232	0.0613	.	.	.	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	T	0.00611	-1.1645	9	0.72032	D	0.01	-0.2171	14.3616	0.66776	1.0:0.0:0.0:0.0	.	7	Q13303-3	.	C	7	ENSP00000367323:S7C	ENSP00000367323:S7C	S	+	1	0	KCNAB2	6034202	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	8.539000	0.90637	1.994000	0.58287	0.374000	0.22700	AGC	KCNAB2	-	NULL	ENSG00000069424		0.652	KCNAB2-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	KCNAB2	HGNC	protein_coding	OTTHUMT00000002114.3	-	0.00	32	0	A	NM_172130		6111615	+1	tier1	-	no_errors	ENST00000378083	ensembl	human	known	74_37	missense	60.00	18	27	SNP	1.000	T
KCNMA1	3778	genome.wustl.edu	37	10	78799285	78799285	+	Splice_Site	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr10:78799285C>T	ENST00000286628.8	-	15	1859		c.e15+1		KCNMA1_ENST00000404857.1_Splice_Site|KCNMA1_ENST00000372443.1_Splice_Site|KCNMA1_ENST00000372440.1_Splice_Site|KCNMA1_ENST00000406533.3_Splice_Site|KCNMA1_ENST00000286627.5_Splice_Site|KCNMA1_ENST00000354353.5_Splice_Site|KCNMA1_ENST00000404771.3_Splice_Site	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1						blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	AGGTCACTTACTCACAAACAG	0.473																																																	0													192.0	162.0	172.0					10																	78799285		2203	4300	6503	SO:0001630	splice_region_variant	0			U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.1859+1G>A	10.37:g.78799285C>T			F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Splice_Site	SNP	-	e15+1	ENST00000286628.8	37	c.1859+1		10	.	.	.	.	.	.	.	.	.	.	C	28.6	4.931646	0.92389	.	.	ENSG00000156113	ENST00000372421;ENST00000372440;ENST00000372403;ENST00000372408;ENST00000372437;ENST00000457953;ENST00000404771;ENST00000372443;ENST00000434208;ENST00000286627;ENST00000286628;ENST00000406533;ENST00000354353;ENST00000404857;ENST00000412708;ENST00000450795;ENST00000428546	.	.	.	5.72	5.72	0.89469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8759	0.96870	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KCNMA1	78469291	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.653000	0.83643	2.704000	0.92352	0.585000	0.79938	.	KCNMA1	-	-	ENSG00000156113		0.473	KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	KCNMA1	HGNC	protein_coding	OTTHUMT00000048885.3	-	0.00	36	0	C	NM_002247	Intron	78799285	-1	tier1	-	no_errors	ENST00000406533	ensembl	human	known	74_37	splice_site	30.77	36	16	SNP	1.000	T
KCNN3	3782	genome.wustl.edu	37	1	154842330	154842331	+	In_Frame_Ins	INS	-	-	TGC			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:154842330_154842331insTGC	ENST00000271915.4	-	1	425_426	c.110_111insGCA	c.(109-111)caa>caGCAa	p.37_37Q>QQ	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	37	Gln-rich.				potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	gctgctgctgttgctgctgctg	0.673																																																	0																																										SO:0001652	inframe_insertion	0			AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.108_110dupGCA	1.37:g.154842337_154842339dupTGC	ENSP00000271915:p.Gln41dup		B1ANX0|O43517|Q86VF9|Q8WXG7	In_Frame_Ins	INS	pfam_K_chnl_Ca-activ_SK,pfam_CaM-bd_dom,pfam_2pore_dom_K_chnl_dom,superfamily_CaM-bd_dom,prints_K_chnl_Ca-activ_SK	p.41in_frame_insQ	ENST00000271915.4	37	c.111_110	CCDS30880.1	1																																																																																			KCNN3	-	NULL	ENSG00000143603		0.673	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	KCNN3	HGNC	protein_coding	OTTHUMT00000090688.3		0.00	139	0	-	NM_002249		154842331	-1	tier1		no_errors	ENST00000271915	ensembl	human	novel	74_37	in_frame_ins	14.97	125	22	INS	0.893:0.882	TGC
KCNQ1DN	55539	genome.wustl.edu	37	11	2892082	2892082	+	RNA	SNP	C	C	T	rs564048538		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr11:2892082C>T	ENST00000441418.2	+	0	820					NR_024627.1		Q9H478	KCQ1D_HUMAN	KCNQ1 downstream neighbor (non-protein coding)																		CTACTTTAAACGGCCAGCCTC	0.602																																																	0													92.0	92.0	92.0					11																	2892082		692	1591	2283			0			AB039920		11p15.5	2012-10-16	2011-08-30		ENSG00000237941	ENSG00000237941		"""Long non-coding RNAs"""	13335	non-coding RNA	RNA, long non-coding		610980	"""KCNQ1 downstream neighbor"""			11056398, 11063728, 22067257	Standard	NR_024627		Approved	BWRT, HSA404617	uc021pwt.1	Q9H478	OTTHUMG00000009942		11.37:g.2892082C>T				RNA	SNP	-	NULL	ENST00000441418.2	37	NULL		11																																																																																			KCNQ1DN	-	-	ENSG00000237941		0.602	KCNQ1DN-001	KNOWN	basic	antisense	KCNQ1DN	HGNC	antisense	OTTHUMT00000027530.3	-	0.00	129	0	C	NR_024627		2892082	+1	tier1	-	no_errors	ENST00000441418	ensembl	human	known	74_37	rna	43.31	72	55	SNP	0.002	T
KCNU1	157855	genome.wustl.edu	37	8	36767014	36767014	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr8:36767014G>T	ENST00000399881.3	+	21	2329	c.2292G>T	c.(2290-2292)tgG>tgT	p.W764C		NM_001031836.2	NP_001027006.2	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	764					multicellular organism reproduction (GO:0032504)|potassium ion transmembrane transport (GO:0071805)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	large conductance calcium-activated potassium channel activity (GO:0060072)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(31)|ovary(1)|urinary_tract(1)	57				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		AGAGAGAATGGCGATTTCTCT	0.378																																																	0													129.0	129.0	129.0					8																	36767014		1852	4084	5936	SO:0001583	missense	0			BC028701	CCDS55220.1	8p11.2	2012-07-05				ENSG00000215262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18867	protein-coding gene	gene with protein product		615215				16382103	Standard	NM_001031836		Approved	KCa5.1, Slo3, KCNMC1, Kcnma3	uc010lvw.3	A8MYU2		ENST00000399881.3:c.2292G>T	8.37:g.36767014G>T	ENSP00000382770:p.Trp764Cys			Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_2pore_dom_K_chnl_dom,prints_K_chnl_Ca-activ_BK_asu	p.W764C	ENST00000399881.3	37	c.2292	CCDS55220.1	8	.	.	.	.	.	.	.	.	.	.	G	17.01	3.279021	0.59758	.	.	ENSG00000215262	ENST00000399881	T	0.54071	0.59	5.8	5.8	0.92144	.	0.000000	0.36591	U	0.002516	T	0.75882	0.3910	M	0.83384	2.64	0.80722	D	1	D	0.89917	1.0	D	0.69307	0.963	T	0.78476	-0.2189	10	0.87932	D	0	-2.7834	19.6593	0.95859	0.0:0.0:1.0:0.0	.	764	A8MYU2	KCNU1_HUMAN	C	764	ENSP00000382770:W764C	ENSP00000382770:W764C	W	+	3	0	KCNU1	36886172	1.000000	0.71417	1.000000	0.80357	0.262000	0.26303	9.094000	0.94168	2.745000	0.94114	0.655000	0.94253	TGG	KCNU1	-	NULL	ENSG00000215262		0.378	KCNU1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	KCNU1	HGNC	protein_coding	OTTHUMT00000376631.1	-	0.00	36	0	G	NM_001031836		36767014	+1	tier1	-	no_errors	ENST00000399881	ensembl	human	known	74_37	missense	5.80	65	4	SNP	1.000	T
KHDC1	80759	genome.wustl.edu	37	6	74001721	74001721	+	Splice_Site	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr6:74001721C>T	ENST00000370384.3	-	2	706	c.206G>A	c.(205-207)aGg>aAg	p.R69K	KHDC1_ENST00000484801.1_5'UTR|RP11-398K22.12_ENST00000441363.1_RNA|RP11-398K22.12_ENST00000421315.1_RNA	NM_001251874.1	NP_001238803.1	Q4VXA5	KHDC1_HUMAN	KH homology domain containing 1	69						integral component of membrane (GO:0016021)	RNA binding (GO:0003723)			large_intestine(1)|lung(4)|skin(1)	6						CATCACGCACCTTTTGGATCG	0.388																																																	0																																										SO:0001630	splice_region_variant	0				CCDS43480.1, CCDS59027.1	6q13	2014-05-15	2007-11-13	2007-11-13	ENSG00000135314	ENSG00000135314			21366	protein-coding gene	gene with protein product		611688	"""chromosome 6 open reading frame 148"""	C6orf148		17913455	Standard	NM_030568		Approved	MGC10818, bA257K9.4, NDG1	uc003pgn.4	Q4VXA5	OTTHUMG00000015030	ENST00000370384.3:c.206+1G>A	6.37:g.74001721C>T			Q5JSQ7|Q8WTV2|Q96NQ5	Missense_Mutation	SNP	NULL	p.R69K	ENST00000370384.3	37	c.206	CCDS59027.1	6	.	.	.	.	.	.	.	.	.	.	C	7.625	0.677728	0.14841	.	.	ENSG00000135314	ENST00000370384	T	0.37915	1.17	3.53	2.22	0.28083	.	.	.	.	.	T	0.07458	0.0188	.	.	.	0.24684	N	0.99335	B	0.02656	0.0	B	0.01281	0.0	T	0.38265	-0.9669	7	.	.	.	.	7.0098	0.24855	0.0:0.1193:0.0:0.8807	.	69	Q4VXA5	KHDC1_HUMAN	K	69	ENSP00000359411:R69K	.	R	-	2	0	KHDC1	74058442	1.000000	0.71417	0.011000	0.14972	0.019000	0.09904	3.554000	0.53720	0.526000	0.28541	-0.311000	0.09066	AGG	KHDC1	-	NULL	ENSG00000135314		0.388	KHDC1-005	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	KHDC1	HGNC	protein_coding	OTTHUMT00000148103.2		0.00	91	0	C	NM_030568	Missense_Mutation	74001721	-1			no_errors	ENST00000370384	ensembl	human	putative	74_37	missense	7.05	145	11	SNP	0.999	T
KHDC1	80759	genome.wustl.edu	37	6	74001756	74001756	+	Silent	SNP	G	G	A	rs533695732	byFrequency	TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr6:74001756G>A	ENST00000370384.3	-	2	671	c.171C>T	c.(169-171)aaC>aaT	p.N57N	KHDC1_ENST00000484801.1_5'UTR|RP11-398K22.12_ENST00000441363.1_RNA|RP11-398K22.12_ENST00000421315.1_RNA	NM_001251874.1	NP_001238803.1	Q4VXA5	KHDC1_HUMAN	KH homology domain containing 1	57						integral component of membrane (GO:0016021)	RNA binding (GO:0003723)			large_intestine(1)|lung(4)|skin(1)	6						CGCTCCTTGAGTTTCTCTCTG	0.418													G|||	6	0.00119808	0.0045	0.0	5008	,	,		17781	0.0		0.0	False		,,,				2504	0.0																0																																										SO:0001819	synonymous_variant	0				CCDS43480.1, CCDS59027.1	6q13	2014-05-15	2007-11-13	2007-11-13	ENSG00000135314	ENSG00000135314			21366	protein-coding gene	gene with protein product		611688	"""chromosome 6 open reading frame 148"""	C6orf148		17913455	Standard	NM_030568		Approved	MGC10818, bA257K9.4, NDG1	uc003pgn.4	Q4VXA5	OTTHUMG00000015030	ENST00000370384.3:c.171C>T	6.37:g.74001756G>A			Q5JSQ7|Q8WTV2|Q96NQ5	Silent	SNP	NULL	p.N57	ENST00000370384.3	37	c.171	CCDS59027.1	6																																																																																			KHDC1	-	NULL	ENSG00000135314		0.418	KHDC1-005	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	KHDC1	HGNC	protein_coding	OTTHUMT00000148103.2		0.00	92	0	G	NM_030568		74001756	-1			no_errors	ENST00000370384	ensembl	human	putative	74_37	silent	7.36	151	12	SNP	0.608	A
KIAA0825	285600	genome.wustl.edu	37	5	93753085	93753085	+	Splice_Site	SNP	T	T	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr5:93753085T>A	ENST00000312498.7	-	15	2754	c.2498A>T	c.(2497-2499)aAa>aTa	p.K833I	KIAA0825_ENST00000427991.2_Intron|KIAA0825_ENST00000513200.3_Intron			Q8IV33	K0825_HUMAN	KIAA0825	833										breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(1)|pancreas(1)|prostate(1)|skin(1)	13						AAAGGTACGTTCTTGAAAGGA	0.333																																																	0													126.0	101.0	109.0					5																	93753085		692	1591	2283	SO:0001630	splice_region_variant	0			BX648338	CCDS4070.1	5q15	2011-02-23	2011-02-23	2011-02-23	ENSG00000185261	ENSG00000185261			28532	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 36"""	C5orf36		12477932	Standard	NM_173665		Approved	DKFZp686F0372, MGC34713	uc011cuk.2	Q8IV33	OTTHUMG00000131331	ENST00000312498.7:c.2498-1A>T	5.37:g.93753085T>A			O94914|Q6ZNN2	Missense_Mutation	SNP	NULL	p.K833I	ENST00000312498.7	37	c.2498		5	.	.	.	.	.	.	.	.	.	.	T	10.04	1.241939	0.22796	.	.	ENSG00000185261	ENST00000312498	T	0.40756	1.02	4.61	3.42	0.39159	.	0.364828	0.22440	U	0.060036	T	0.34571	0.0902	.	.	.	0.19575	N	0.999968	.	.	.	.	.	.	T	0.15752	-1.0426	7	0.26408	T	0.33	.	9.161	0.37023	0.0:0.0:0.1842:0.8158	.	.	.	.	I	833	ENSP00000312205:K833I	ENSP00000312205:K833I	K	-	2	0	KIAA0825	93778841	0.544000	0.26441	0.121000	0.21740	0.128000	0.20619	0.514000	0.22786	0.600000	0.29862	0.455000	0.32223	AAA	KIAA0825	-	NULL	ENSG00000185261		0.333	KIAA0825-201	KNOWN	basic	protein_coding	KIAA0825	HGNC	protein_coding		-	0.00	33	0	T	NM_173665	Missense_Mutation	93753085	-1	tier1	-	no_errors	ENST00000312498	ensembl	human	known	74_37	missense	38.10	26	16	SNP	0.449	A
KIAA1549L	25758	genome.wustl.edu	37	11	33667346	33667346	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr11:33667346C>T	ENST00000321505.4	+	16	4813	c.4633C>T	c.(4633-4635)Cca>Tca	p.P1545S	KIAA1549L_ENST00000389726.3_Missense_Mutation_p.P1551S			Q6ZVL6	K154L_HUMAN	KIAA1549-like	1545						integral component of membrane (GO:0016021)											GAGCTCCCAGCCATCCATCGA	0.622																																																	0													54.0	63.0	60.0					11																	33667346		2159	4244	6403	SO:0001583	missense	0			U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.4633C>T	11.37:g.33667346C>T	ENSP00000315295:p.Pro1545Ser		B0QYU0	Missense_Mutation	SNP	NULL	p.P1551S	ENST00000321505.4	37	c.4651	CCDS44565.2	11	.	.	.	.	.	.	.	.	.	.	C	29.9	5.043400	0.93685	.	.	ENSG00000110427	ENST00000321505;ENST00000389726;ENST00000536568	.	.	.	5.72	5.72	0.89469	.	0.000000	0.64402	D	0.000004	D	0.82848	0.5126	M	0.73962	2.25	0.58432	D	0.999992	D	0.89917	1.0	D	0.97110	1.0	D	0.83927	0.0304	9	0.87932	D	0	-19.7632	19.8929	0.96937	0.0:1.0:0.0:0.0	.	1551	E9PAT2	.	S	1545;1551;1384	.	ENSP00000315295:P1545S	P	+	1	0	C11orf41	33623922	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.466000	0.80914	2.702000	0.92279	0.462000	0.41574	CCA	KIAA1549L	-	NULL	ENSG00000110427		0.622	KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA1549L	HGNC	protein_coding	OTTHUMT00000317998.1	-	0.00	114	0	C	NM_012194		33667346	+1	tier1	-	no_errors	ENST00000389726	ensembl	human	known	74_37	missense	17.65	70	15	SNP	1.000	T
KIAA2022	340533	genome.wustl.edu	37	X	73962149	73962149	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chrX:73962149G>T	ENST00000055682.6	-	3	2854	c.2243C>A	c.(2242-2244)cCt>cAt	p.P748H		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	748					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						TTCCAAGAGAGGGCTCATTTG	0.373																																																	0													72.0	71.0	71.0					X																	73962149		2203	4300	6503	SO:0001583	missense	0				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.2243C>A	X.37:g.73962149G>T	ENSP00000055682:p.Pro748His		A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	NULL	p.P748H	ENST00000055682.6	37	c.2243	CCDS35337.1	X	.	.	.	.	.	.	.	.	.	.	G	13.69	2.312572	0.40895	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.33654	1.4;1.4	5.73	5.73	0.89815	.	0.489617	0.24031	N	0.042190	T	0.38081	0.1027	L	0.47716	1.5	0.39940	D	0.974398	B	0.17667	0.023	B	0.18561	0.022	T	0.21518	-1.0243	10	0.72032	D	0.01	-4.4293	18.9182	0.92515	0.0:0.0:1.0:0.0	.	748	Q5QGS0	K2022_HUMAN	H	748	ENSP00000362567:P748H;ENSP00000055682:P748H	ENSP00000055682:P748H	P	-	2	0	KIAA2022	73878874	1.000000	0.71417	0.997000	0.53966	0.535000	0.34838	3.619000	0.54196	2.415000	0.81967	0.600000	0.82982	CCT	KIAA2022	-	NULL	ENSG00000050030		0.373	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA2022	HGNC	protein_coding	OTTHUMT00000057270.2		0.00	37	0	G	NM_001008537		73962149	-1			no_errors	ENST00000055682	ensembl	human	known	74_37	missense	7.14	39	3	SNP	1.000	T
KIF26B	55083	genome.wustl.edu	37	1	245809487	245809487	+	Missense_Mutation	SNP	A	A	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:245809487A>C	ENST00000407071.2	+	10	2603	c.2163A>C	c.(2161-2163)aaA>aaC	p.K721N	KIF26B_ENST00000366518.4_Missense_Mutation_p.K340N	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	721	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			CTCTTAGCAAAAATCGAGAAG	0.502																																																	0													70.0	73.0	72.0					1																	245809487		2045	4197	6242	SO:0001583	missense	0			AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.2163A>C	1.37:g.245809487A>C	ENSP00000385545:p.Lys721Asn		Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.K721N	ENST00000407071.2	37	c.2163	CCDS44342.1	1	.	.	.	.	.	.	.	.	.	.	A	15.89	2.967861	0.53507	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	T;T	0.75260	-0.92;-0.92	5.52	-1.08	0.09936	Kinesin, motor domain (5);	.	.	.	.	T	0.80518	0.4638	M	0.81802	2.56	0.42107	D	0.991364	P;P	0.37548	0.587;0.599	P;P	0.49361	0.608;0.57	T	0.79657	-0.1712	9	0.72032	D	0.01	.	11.7116	0.51628	0.5294:0.0:0.4706:0.0	.	340;721	B7WPD9;Q2KJY2	.;KI26B_HUMAN	N	721;340;337	ENSP00000385545:K721N;ENSP00000355475:K340N	ENSP00000355475:K340N	K	+	3	2	KIF26B	243876110	1.000000	0.71417	0.974000	0.42286	0.994000	0.84299	0.948000	0.29096	-0.472000	0.06881	0.454000	0.30748	AAA	KIF26B	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	ENSG00000162849		0.502	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF26B	HGNC	protein_coding	OTTHUMT00000381037.1		0.00	41	0	A	XM_371354		245809487	+1			no_errors	ENST00000407071	ensembl	human	known	74_37	missense	9.59	66	7	SNP	0.968	C
KLHL32	114792	genome.wustl.edu	37	6	97561851	97561851	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr6:97561851C>A	ENST00000369261.4	+	7	1183	c.820C>A	c.(820-822)Cag>Aag	p.Q274K	KLHL32_ENST00000536676.1_Missense_Mutation_p.Q238K|KLHL32_ENST00000544166.1_Intron|KLHL32_ENST00000539200.1_Missense_Mutation_p.Q205K	NM_052904.3	NP_443136.2	Q96NJ5	KLH32_HUMAN	kelch-like family member 32	274										breast(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(13)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		all_cancers(76;1.19e-06)|Acute lymphoblastic leukemia(125;5.83e-10)|all_hematologic(75;3.67e-07)|all_epithelial(107;0.00778)|Colorectal(196;0.122)		BRCA - Breast invasive adenocarcinoma(108;0.0558)		CATCTATGCACAGCCTGTCTG	0.537																																																	0													103.0	86.0	92.0					6																	97561851		2203	4300	6503	SO:0001583	missense	0			AB067487	CCDS5038.1, CCDS69154.1, CCDS69155.1, CCDS75495.1	6q16.3	2013-02-22	2013-02-22	2007-01-09	ENSG00000186231	ENSG00000186231		"""Kelch-like"", ""BTB/POZ domain containing"""	21221	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 5"", ""KIAA1900"", ""kelch-like 32 (Drosophila)"""	BKLHD5, KIAA1900			Standard	NM_052904		Approved		uc010kcm.1	Q96NJ5	OTTHUMG00000015247	ENST00000369261.4:c.820C>A	6.37:g.97561851C>A	ENSP00000358265:p.Gln274Lys		B7Z346|B7Z4E2|E1P528|Q5THT0|Q96PY7	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.Q274K	ENST00000369261.4	37	c.820	CCDS5038.1	6	.	.	.	.	.	.	.	.	.	.	C	16.54	3.151307	0.57151	.	.	ENSG00000186231	ENST00000369261;ENST00000536676;ENST00000539200	T;T;T	0.74526	-0.79;-0.83;-0.85	5.19	4.32	0.51571	.	0.000000	0.85682	D	0.000000	T	0.72653	0.3487	M	0.67700	2.07	0.80722	D	1	P;B;D;P	0.62365	0.948;0.255;0.991;0.495	P;B;P;B	0.52514	0.598;0.104;0.701;0.098	T	0.76105	-0.3081	10	0.52906	T	0.07	.	13.7698	0.63018	0.0:0.9262:0.0:0.0738	.	205;238;274;274	B7Z4E2;B7Z346;Q96NJ5;Q6IQ08	.;.;KLH32_HUMAN;.	K	274;238;205	ENSP00000358265:Q274K;ENSP00000440382:Q238K;ENSP00000441527:Q205K	ENSP00000358265:Q274K	Q	+	1	0	KLHL32	97668572	1.000000	0.71417	0.979000	0.43373	0.803000	0.45373	7.294000	0.78760	1.406000	0.46857	0.591000	0.81541	CAG	KLHL32	-	pirsf_Kelch-like_gigaxonin	ENSG00000186231		0.537	KLHL32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL32	HGNC	protein_coding	OTTHUMT00000041570.1		0.00	42	0	C	NM_052904		97561851	+1			no_errors	ENST00000369261	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	A
KMT2D	8085	genome.wustl.edu	37	12	49433544	49433544	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr12:49433544G>A	ENST00000301067.7	-	31	8008	c.8009C>T	c.(8008-8010)tCc>tTc	p.S2670F	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	2670					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										GCTAAGGCCGGACATGCCTGG	0.577																																																	0													38.0	42.0	41.0					12																	49433544		2008	4163	6171	SO:0001583	missense	0			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.8009C>T	12.37:g.49433544G>A	ENSP00000301067:p.Ser2670Phe		O14687	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.S2670F	ENST00000301067.7	37	c.8009	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	G	6.767	0.510343	0.12883	.	.	ENSG00000167548	ENST00000301067	T	0.79653	-1.29	5.6	5.6	0.85130	.	0.204859	0.24856	N	0.035059	T	0.68732	0.3033	N	0.14661	0.345	0.23784	N	0.996858	B	0.33448	0.412	B	0.34722	0.188	T	0.67063	-0.5765	10	0.87932	D	0	.	13.5629	0.61799	0.0:0.2607:0.7393:0.0	.	2670	O14686	MLL2_HUMAN	F	2670	ENSP00000301067:S2670F	ENSP00000301067:S2670F	S	-	2	0	MLL2	47719811	1.000000	0.71417	0.992000	0.48379	0.878000	0.50629	3.256000	0.51492	2.805000	0.96524	0.655000	0.94253	TCC	KMT2D	-	NULL	ENSG00000167548		0.577	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2D	HGNC	protein_coding	OTTHUMT00000390183.2	-	0.00	68	0	G			49433544	-1	tier1	-	no_errors	ENST00000301067	ensembl	human	known	74_37	missense	35.90	25	14	SNP	0.919	A
LARGE	9215	genome.wustl.edu	37	22	33712229	33712229	+	Silent	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr22:33712229C>T	ENST00000354992.2	-	12	1864	c.1293G>A	c.(1291-1293)caG>caA	p.Q431Q	LARGE_ENST00000437602.2_Silent_p.Q431Q|LARGE_ENST00000452586.2_Silent_p.Q230Q|LARGE_ENST00000337431.2_Silent_p.Q379Q|LARGE_ENST00000397394.2_Silent_p.Q431Q|LARGE_ENST00000402320.1_Silent_p.Q379Q	NM_004737.4	NP_004728.1	O95461	LARGE_HUMAN	like-glycosyltransferase	431					glycoprotein biosynthetic process (GO:0009101)|glycosphingolipid biosynthetic process (GO:0006688)|muscle cell cellular homeostasis (GO:0046716)|N-acetylglucosamine metabolic process (GO:0006044)|protein glycosylation (GO:0006486)	integral component of Golgi membrane (GO:0030173)	acetylglucosaminyltransferase activity (GO:0008375)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(1;0.219)				ACAGCTGCTTCTGGAGCTGCA	0.607																																					Colon(70;397 1175 4573 19089 45288)												0													83.0	68.0	73.0					22																	33712229		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ007583	CCDS13912.1	22q12.3	2013-02-22			ENSG00000133424	ENSG00000133424		"""Glycosyltransferase family 8 domain containing"""	6511	protein-coding gene	gene with protein product		603590				9892679, 10591208, 12966029	Standard	NM_004737		Approved	KIAA0609	uc003ane.4	O95461	OTTHUMG00000150914	ENST00000354992.2:c.1293G>A	22.37:g.33712229C>T			B0QXZ7|O60348|Q17R80|Q9UGD1|Q9UGE7|Q9UGG3|Q9UGZ8|Q9UH22	Silent	SNP	pfam_Glyco_trans_8	p.Q431	ENST00000354992.2	37	c.1293	CCDS13912.1	22																																																																																			LARGE	-	NULL	ENSG00000133424		0.607	LARGE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LARGE	HGNC	protein_coding	OTTHUMT00000320515.2	-	0.00	30	0	C	NM_133642		33712229	-1	tier1	-	no_errors	ENST00000354992	ensembl	human	known	74_37	silent	41.30	27	19	SNP	1.000	T
LATS2	26524	genome.wustl.edu	37	13	21562256	21562256	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr13:21562256C>A	ENST00000382592.4	-	4	2068	c.1663G>T	c.(1663-1665)Gac>Tac	p.D555Y	LATS2_ENST00000472754.1_5'Flank|LATS2_ENST00000542899.1_Missense_Mutation_p.D555Y	NM_014572.2	NP_055387.2			large tumor suppressor kinase 2											breast(4)|central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(2)	45		all_cancers(29;4.74e-22)|all_epithelial(30;1.45e-18)|all_lung(29;4.69e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000781)|Epithelial(112;0.00144)|OV - Ovarian serous cystadenocarcinoma(117;0.0183)|Lung(94;0.0375)|LUSC - Lung squamous cell carcinoma(192;0.104)		CGGCTCTTGTCGCCGCCCTCG	0.622																																																	0													106.0	106.0	106.0					13																	21562256		2203	4300	6503	SO:0001583	missense	0			AB028019	CCDS9294.1	13q11-q12	2013-04-25	2013-04-25		ENSG00000150457	ENSG00000150457			6515	protein-coding gene	gene with protein product		604861	"""LATS (large tumor suppressor, Drosophila) homolog 2"", ""LATS, large tumor suppressor, homolog 2 (Drosophila)"""			10673337	Standard	NM_014572		Approved		uc001unr.4	Q9NRM7	OTTHUMG00000016531	ENST00000382592.4:c.1663G>T	13.37:g.21562256C>A	ENSP00000372035:p.Asp555Tyr			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom	p.D555Y	ENST00000382592.4	37	c.1663	CCDS9294.1	13	.	.	.	.	.	.	.	.	.	.	C	10.69	1.422066	0.25639	.	.	ENSG00000150457	ENST00000382592;ENST00000542899	T;T	0.60040	0.22;0.22	4.2	2.44	0.29823	.	1.491440	0.03667	N	0.243440	T	0.45796	0.1360	N	0.08118	0	0.20196	N	0.999923	D	0.57257	0.979	P	0.49477	0.612	T	0.39396	-0.9616	10	0.42905	T	0.14	.	5.8524	0.18699	0.0:0.6586:0.1689:0.1725	.	555	Q9NRM7	LATS2_HUMAN	Y	555	ENSP00000372035:D555Y;ENSP00000441817:D555Y	ENSP00000372035:D555Y	D	-	1	0	LATS2	20460256	0.434000	0.25570	0.002000	0.10522	0.055000	0.15305	1.268000	0.33062	0.419000	0.25927	0.478000	0.44815	GAC	LATS2	-	NULL	ENSG00000150457		0.622	LATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LATS2	HGNC	protein_coding	OTTHUMT00000044102.1	-	0.00	130	0	C			21562256	-1	tier1	-	no_errors	ENST00000382592	ensembl	human	known	74_37	missense	32.14	57	27	SNP	0.432	A
LGALS4	3960	genome.wustl.edu	37	19	39303571	39303571	+	5'UTR	SNP	G	G	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr19:39303571G>C	ENST00000307751.4	-	0	433				LGALS4_ENST00000597803.1_5'UTR	NM_006149.3	NP_006140.1	P56470	LEG4_HUMAN	lectin, galactoside-binding, soluble, 4						cell adhesion (GO:0007155)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			NS(1)|endometrium(3)|large_intestine(2)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	17	all_cancers(60;1.02e-05)|Ovarian(47;0.0454)		Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)			AAGAGCTGCAGGAGTGGGAGA	0.647																																																	0													48.0	50.0	50.0					19																	39303571		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0				CCDS12521.1	19q13.2	2014-03-19	2008-07-25		ENSG00000171747	ENSG00000171747		"""Lectins, galactoside-binding"""	6565	protein-coding gene	gene with protein product	"""galectin 4"""	602518				8063692	Standard	NM_006149		Approved	GAL4	uc002ojg.3	P56470	OTTHUMG00000182608	ENST00000307751.4:c.-45C>G	19.37:g.39303571G>C				RNA	SNP	-	NULL	ENST00000307751.4	37	NULL	CCDS12521.1	19																																																																																			LGALS4	-	-	ENSG00000171747		0.647	LGALS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGALS4	HGNC	protein_coding	OTTHUMT00000462641.1	-	0.00	66	0	G	NM_006149		39303571	-1	tier1	-	no_errors	ENST00000597803	ensembl	human	known	74_37	rna	7.69	96	8	SNP	0.014	C
LHX8	431707	genome.wustl.edu	37	1	75602808	75602808	+	Silent	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:75602808C>T	ENST00000294638.5	+	4	793	c.129C>T	c.(127-129)gaC>gaT	p.D43D	LHX8_ENST00000559413.1_3'UTR|LHX8_ENST00000356261.3_Silent_p.D33D	NM_001001933.1	NP_001001933.1	Q68G74	LHX8_HUMAN	LIM homeobox 8	43					female gonad development (GO:0008585)|forebrain neuron development (GO:0021884)|learning or memory (GO:0007611)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	female germ cell nucleus (GO:0001674)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(18)|ovary(3)|urinary_tract(1)	30						GAGCGGGGGACGAGGACTCGT	0.711																																																	0													25.0	28.0	27.0					1																	75602808		2202	4298	6500	SO:0001819	synonymous_variant	0			AB050476	CCDS30756.1, CCDS58008.1	1p31.1	2011-06-20			ENSG00000162624	ENSG00000162624		"""Homeoboxes / LIM class"""	28838	protein-coding gene	gene with protein product		604425				9598319	Standard	NM_001256114		Approved	Lhx7	uc031pmx.1	Q68G74	OTTHUMG00000009692	ENST00000294638.5:c.129C>T	1.37:g.75602808C>T			E9PGE3	Silent	SNP	pfam_Znf_LIM,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Znf_LIM,smart_Homeobox_dom,pfscan_Znf_LIM,pfscan_Homeobox_dom	p.D43	ENST00000294638.5	37	c.129	CCDS30756.1	1																																																																																			LHX8	-	NULL	ENSG00000162624		0.711	LHX8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LHX8	HGNC	protein_coding	OTTHUMT00000026700.1	-	0.00	28	0	C	NM_001001933		75602808	+1	tier1	-	no_errors	ENST00000294638	ensembl	human	known	74_37	silent	25.64	28	10	SNP	1.000	T
LINC00618	145249	genome.wustl.edu	37	14	97411731	97411731	+	lincRNA	DEL	A	A	-	rs567114812	byFrequency	TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr14:97411731delA	ENST00000435624.1	+	0	448				AL133168.3_ENST00000557090.1_RNA					long intergenic non-protein coding RNA 618																		TAGGTAAATGAAAAAAAAAAG	0.368																																																	0																																												0			AA055628		14q32.2	2012-10-12	2012-07-05	2012-07-05	ENSG00000225163	ENSG00000225163		"""Long non-coding RNAs"""	20110	non-coding RNA	RNA, long non-coding			"""chromosome 14 open reading frame 63"""	C14orf63			Standard	NR_104113		Approved				OTTHUMG00000171460		14.37:g.97411731delA				RNA	DEL	-	NULL	ENST00000435624.1	37	NULL		14																																																																																			LINC00618	-	-	ENSG00000225163		0.368	LINC00618-001	KNOWN	basic	lincRNA	LINC00618	HGNC	lincRNA	OTTHUMT00000072303.1		0.00	26	0	A			97411731	+1	tier1		no_errors	ENST00000435624	ensembl	human	known	74_37	rna	34.62	17	9	DEL	0.009	-
LMBR1L	55716	genome.wustl.edu	37	12	49494393	49494393	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr12:49494393G>T	ENST00000267102.8	-	14	1461	c.1119C>A	c.(1117-1119)agC>agA	p.S373R	LMBR1L_ENST00000395141.4_Missense_Mutation_p.S368R|LMBR1L_ENST00000547382.1_Missense_Mutation_p.S353R	NM_018113.2	NP_060583.2	Q6UX01	LMBRL_HUMAN	limb development membrane protein 1-like	373					endocytosis (GO:0006897)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						AGAGTGGAGAGCTATAGAAGC	0.552																																																	0													49.0	45.0	47.0					12																	49494393		2203	4300	6503	SO:0001583	missense	0			AB033000	CCDS8780.2, CCDS73466.1	12q13.12	2013-08-05	2013-08-05		ENSG00000139636	ENSG00000139636			18268	protein-coding gene	gene with protein product		610007	"""limb region 1 homolog (mouse)-like"""			10574461, 11287427	Standard	XM_005269022		Approved	FLJ10494, KIAA1174	uc001rth.4	Q6UX01	OTTHUMG00000150511	ENST00000267102.8:c.1119C>A	12.37:g.49494393G>T	ENSP00000267102:p.Ser373Arg		Q969J4|Q96BY8|Q96HN8|Q9NT09|Q9NVE1|Q9NVU9|Q9ULP6	Missense_Mutation	SNP	pfam_LMBR1-like_membr_prot,prints_Lipcalin_1_rcpt	p.S373R	ENST00000267102.8	37	c.1119	CCDS8780.2	12	.	.	.	.	.	.	.	.	.	.	G	22.3	4.278104	0.80692	.	.	ENSG00000139636	ENST00000267102;ENST00000547382;ENST00000547698;ENST00000395141;ENST00000552449	T;T;T;T;T	0.31247	1.5;1.5;1.5;1.5;1.5	5.54	2.77	0.32553	LMBR1-like membrane protein (1);	0.111038	0.85682	D	0.000000	T	0.44871	0.1314	M	0.73217	2.22	0.51767	D	0.999938	D;D;P	0.61080	0.983;0.989;0.741	P;P;P	0.58172	0.644;0.834;0.477	T	0.37361	-0.9709	10	0.87932	D	0	0.1718	8.2024	0.31432	0.3111:0.0:0.6889:0.0	.	353;373;368	Q6UX01-3;Q6UX01;Q6UX01-4	.;LMBRL_HUMAN;.	R	373;353;63;368;89	ENSP00000267102:S373R;ENSP00000447329:S353R;ENSP00000448821:S63R;ENSP00000378573:S368R;ENSP00000450362:S89R	ENSP00000267102:S373R	S	-	3	2	LMBR1L	47780660	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.175000	0.31944	0.460000	0.27045	0.650000	0.86243	AGC	LMBR1L	-	pfam_LMBR1-like_membr_prot,prints_Lipcalin_1_rcpt	ENSG00000139636		0.552	LMBR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMBR1L	HGNC	protein_coding	OTTHUMT00000318696.1	-	0.00	67	0	G	NM_018113		49494393	-1	tier1	-	no_errors	ENST00000267102	ensembl	human	known	74_37	missense	6.02	78	5	SNP	1.000	T
LOC100129434	100129434	genome.wustl.edu	37	2	56403059	56403059	+	RNA	SNP	A	A	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr2:56403059A>C	ENST00000596663.1	-	0	684				AC007743.1_ENST00000447423.2_RNA|AC007743.1_ENST00000432793.1_RNA|RP11-482H16.1_ENST00000607540.1_RNA|RP11-481J13.1_ENST00000606639.1_lincRNA																							CACTGGGACAAGCAGAAGCTG	0.478																																																	0																																												0																															2.37:g.56403059A>C				RNA	SNP	-	NULL	ENST00000596663.1	37	NULL		2																																																																																			AC007743.1	-	-	ENSG00000233251		0.478	AC007743.1-005	KNOWN	basic	antisense	LOC100129434	Clone_based_vega_gene	antisense	OTTHUMT00000470756.1	-	0.00	16	0	A			56403059	-1	tier1	-	no_errors	ENST00000432793	ensembl	human	known	74_37	rna	36.36	21	12	SNP	0.000	C
LINC01410	103352539	genome.wustl.edu	37	9	66466216	66466216	+	lincRNA	SNP	C	C	T	rs112543984		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr9:66466216C>T	ENST00000424345.1	+	0	849																											gtgactctctcctagcggaga	0.443																																																	0																																												0																															9.37:g.66466216C>T				RNA	SNP	-	NULL	ENST00000424345.1	37	NULL		9																																																																																			RP11-262H14.1	-	-	ENSG00000238113		0.443	RP11-262H14.1-001	KNOWN	basic	lincRNA	LOC100996870	Clone_based_vega_gene	lincRNA	OTTHUMT00000128851.1	-	0.00	8	0	C			66466216	+1	tier1	rs112543984	no_errors	ENST00000424345	ensembl	human	known	74_37	rna	50.00	7	7	SNP	0.068	T
AP3B2	8120	genome.wustl.edu	37	15	83360866	83360866	+	Intron	SNP	G	G	A	rs567744729		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr15:83360866G>A	ENST00000261722.3	-	2	321				RP11-752G15.3_ENST00000560650.1_RNA|AP3B2_ENST00000535348.1_Intron|AP3B2_ENST00000561455.1_Intron|AP3B2_ENST00000535359.1_Intron|AP3B2_ENST00000542200.1_Intron	NM_004644.3	NP_004635.2	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2 subunit						anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)|post-Golgi vesicle-mediated transport (GO:0006892)	AP-3 adaptor complex (GO:0030123)|COPI-coated vesicle (GO:0030137)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(4)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(2)	41			BRCA - Breast invasive adenocarcinoma(143;0.229)			CCCCGACTTCGTAAGTCCTGG	0.532													G|||	1	0.000199681	0.0	0.0	5008	,	,		16143	0.0		0.0	False		,,,				2504	0.001																0																																										SO:0001627	intron_variant	0			U37673	CCDS45331.1, CCDS61736.1, CCDS61737.1	15q	2008-07-07			ENSG00000103723	ENSG00000103723			567	protein-coding gene	gene with protein product		602166				7671305, 1851215	Standard	NM_004644		Approved	NAPTB	uc010uoh.2	Q13367	OTTHUMG00000168009	ENST00000261722.3:c.114-2661C>T	15.37:g.83360866G>A			A4Z4T7|B7ZKR7|B7ZKS0|O14808|Q52LY8	RNA	SNP	-	NULL	ENST00000261722.3	37	NULL	CCDS45331.1	15																																																																																			RP11-752G15.3	-	-	ENSG00000259462		0.532	AP3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC283692	Clone_based_vega_gene	protein_coding	OTTHUMT00000397463.1	-	0.00	92	0	G			83360866	+1	tier1	-	no_errors	ENST00000560650	ensembl	human	known	74_37	rna	28.89	64	26	SNP	0.000	A
GOLGA2P7	388152	genome.wustl.edu	37	15	84868719	84868719	+	RNA	SNP	G	G	T	rs200105620		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr15:84868719G>T	ENST00000559668.1	-	0	3596					NR_049748.1																						GGGGGGGGGGGGGGGAGGGGT	0.706																																																	0																																												0																															15.37:g.84868719G>T				RNA	SNP	-	NULL	ENST00000559668.1	37	NULL		15																																																																																			AC103965.1	-	-	ENSG00000225151		0.706	AC103965.1-008	KNOWN	basic	processed_transcript	LOC101929847	Clone_based_vega_gene	pseudogene	OTTHUMT00000418802.1		0.00	54	0	G			84868719	-1			no_errors	ENST00000316967	ensembl	human	known	74_37	rna	8.11	33	3	SNP	0.305	T
LRP1B	53353	genome.wustl.edu	37	2	141819787	141819787	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr2:141819787C>T	ENST00000389484.3	-	8	2040	c.1069G>A	c.(1069-1071)Gat>Aat	p.D357N		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	357					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TTCATCCCATCCATGTCACAT	0.433										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												0													145.0	127.0	133.0					2																	141819787		2203	4300	6503	SO:0001583	missense	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.1069G>A	2.37:g.141819787C>T	ENSP00000374135:p.Asp357Asn		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.D357N	ENST00000389484.3	37	c.1069	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	C	28.1	4.888547	0.91814	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.95001	-3.58	5.63	5.63	0.86233	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	D	0.97331	0.9127	M	0.78285	2.405	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.97382	0.9983	10	0.72032	D	0.01	.	20.0401	0.97581	0.0:1.0:0.0:0.0	.	357	Q9NZR2	LRP1B_HUMAN	N	357;295	ENSP00000374135:D357N	ENSP00000374135:D357N	D	-	1	0	LRP1B	141536257	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.729000	0.84864	2.805000	0.96524	0.655000	0.94253	GAT	LRP1B	-	superfamily_Growth_fac_rcpt_N_dom,smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt	ENSG00000168702		0.433	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2		0.00	8	0	C	NM_018557		141819787	-1			no_errors	ENST00000389484	ensembl	human	known	74_37	missense	50.00	2	2	SNP	1.000	T
LRRC4B	94030	genome.wustl.edu	37	19	51021420	51021420	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr19:51021420G>A	ENST00000599957.1	-	3	1747	c.1550C>T	c.(1549-1551)aCg>aTg	p.T517M	LRRC4B_ENST00000389201.3_Missense_Mutation_p.T517M			Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B	517	Gly-rich.				positive regulation of synapse assembly (GO:0051965)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(1)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	30		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		ACCGTCTGTCGTGGGCCCTGG	0.736																																																	0													8.0	10.0	9.0					19																	51021420		1794	3958	5752	SO:0001583	missense	0			BC032460	CCDS42595.1	19q13.33	2014-01-30	2004-06-14	2004-06-16	ENSG00000131409	ENSG00000131409		"""Immunoglobulin superfamily / I-set domain containing"", ""Endogenous ligands"""	25042	protein-coding gene	gene with protein product	"""netrin-G3 ligand"""		"""leucine-rich repeats and immunoglobulin-like domains 4"""	LRIG4		11441184	Standard	NM_001080457		Approved	DKFZp761A179, HSM	uc002pss.3	Q9NT99		ENST00000599957.1:c.1550C>T	19.37:g.51021420G>A	ENSP00000471502:p.Thr517Met		Q3ZCQ4|Q58F20	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.T517M	ENST00000599957.1	37	c.1550	CCDS42595.1	19	.	.	.	.	.	.	.	.	.	.	G	13.52	2.262446	0.39995	.	.	ENSG00000131409	ENST00000389201	T	0.64260	-0.09	3.05	3.05	0.35203	.	0.166419	0.38605	U	0.001628	T	0.68467	0.3004	L	0.54323	1.7	0.32456	N	0.544812	D	0.89917	1.0	D	0.66602	0.945	T	0.72714	-0.4210	10	0.49607	T	0.09	.	7.548	0.27778	0.0:0.0:0.7445:0.2555	.	517	Q9NT99	LRC4B_HUMAN	M	517	ENSP00000373853:T517M	ENSP00000373853:T517M	T	-	2	0	LRRC4B	55713232	0.998000	0.40836	0.996000	0.52242	0.507000	0.33981	2.555000	0.45854	1.705000	0.51264	0.462000	0.41574	ACG	LRRC4B	-	NULL	ENSG00000131409		0.736	LRRC4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC4B	HGNC	protein_coding	OTTHUMT00000464907.1	-	0.00	24	0	G	NM_001080457		51021420	-1	tier1	-	no_errors	ENST00000389201	ensembl	human	known	74_37	missense	43.33	17	13	SNP	1.000	A
LRRC6	23639	genome.wustl.edu	37	8	133584607	133584607	+	Missense_Mutation	SNP	T	T	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr8:133584607T>C	ENST00000519595.1	-	12	1446	c.1348A>G	c.(1348-1350)Agt>Ggt	p.S450G	LRRC6_ENST00000518642.1_3'UTR|LRRC6_ENST00000250173.1_Missense_Mutation_p.S450G			Q86X45	TILB_HUMAN	leucine rich repeat containing 6	450					cilium movement (GO:0003341)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|inner dynein arm assembly (GO:0036159)|male gonad development (GO:0008584)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)|reproductive system development (GO:0061458)|sperm motility (GO:0030317)	cilium (GO:0005929)|cytoplasm (GO:0005737)				breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|urinary_tract(2)	34	Ovarian(258;0.00352)|Esophageal squamous(12;0.00507)|all_neural(3;0.0052)|Medulloblastoma(3;0.0922)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			TCTTCCTCACTTGGTATAATT	0.473																																																	0													316.0	286.0	296.0					8																	133584607		2203	4300	6503	SO:0001583	missense	0			U60666	CCDS6365.1	8q24	2013-02-22			ENSG00000129295	ENSG00000129295			16725	protein-coding gene	gene with protein product	"""leucine rich testes protein"""	614930				10775177, 23122586	Standard	NM_012472		Approved	TSLRP, LRTP, CILD19	uc003ytk.4	Q86X45	OTTHUMG00000164646	ENST00000519595.1:c.1348A>G	8.37:g.133584607T>C	ENSP00000429791:p.Ser450Gly		Q13648|Q4G183	Missense_Mutation	SNP	superfamily_HSP20-like_chaperone,smart_U2A'_phosphoprotein32A_C,pfscan_CS_dom	p.S450G	ENST00000519595.1	37	c.1348		8	.	.	.	.	.	.	.	.	.	.	T	1.863	-0.462147	0.04508	.	.	ENSG00000129295	ENST00000519595;ENST00000522789;ENST00000250173	T;T;T	0.50813	0.73;0.88;0.73	5.49	-0.37	0.12530	.	1.378510	0.04331	N	0.352286	T	0.30634	0.0771	L	0.29908	0.895	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.09975	-1.0650	10	0.22706	T	0.39	-0.076	1.2006	0.01884	0.3776:0.0928:0.1428:0.3868	.	450	Q86X45	LRRC6_HUMAN	G	450;190;450	ENSP00000429791:S450G;ENSP00000428015:S190G;ENSP00000250173:S450G	ENSP00000250173:S450G	S	-	1	0	LRRC6	133653789	0.000000	0.05858	0.000000	0.03702	0.062000	0.15995	-0.426000	0.07008	0.032000	0.15435	-0.290000	0.09829	AGT	LRRC6	-	NULL	ENSG00000129295		0.473	LRRC6-001	KNOWN	basic|appris_principal	protein_coding	LRRC6	HGNC	protein_coding	OTTHUMT00000379578.1	-	0.00	48	0	T	NM_012472		133584607	-1	tier1	-	no_errors	ENST00000250173	ensembl	human	known	74_37	missense	13.25	72	11	SNP	0.000	C
LRRK2	120892	genome.wustl.edu	37	12	40643716	40643716	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr12:40643716G>T	ENST00000298910.7	+	8	985	c.927G>T	c.(925-927)caG>caT	p.Q309H	LRRK2_ENST00000343742.2_Missense_Mutation_p.Q309H	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	309					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				CAGCATTGCAGATCTCAGCGC	0.403																																																	0													89.0	82.0	84.0					12																	40643716		2203	4300	6503	SO:0001583	missense	0			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.927G>T	12.37:g.40643716G>T	ENSP00000298910:p.Gln309His		A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIRO-like,pfam_Small_GTPase,pfam_Leu-rich_rpt,pfam_Small_GTPase_ARF/SAR,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Small_GTPase_Rab_type,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,prints_Small_GTPase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,tigrfam_Small_GTP-bd_dom	p.Q309H	ENST00000298910.7	37	c.927	CCDS31774.1	12	.	.	.	.	.	.	.	.	.	.	G	11.13	1.547253	0.27652	.	.	ENSG00000188906	ENST00000416796;ENST00000343742;ENST00000298910	T;T;T	0.67171	-0.25;1.27;1.27	5.56	-2.33	0.06724	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.74114	0.3674	L	0.56769	1.78	0.27931	N	0.937888	D	0.89917	1.0	D	0.87578	0.998	T	0.70655	-0.4812	10	0.72032	D	0.01	.	11.7269	0.51714	0.5424:0.0:0.4576:0.0	.	309	Q5S007	LRRK2_HUMAN	H	193;309;309	ENSP00000398726:Q193H;ENSP00000341930:Q309H;ENSP00000298910:Q309H	ENSP00000298910:Q309H	Q	+	3	2	LRRK2	38929983	0.383000	0.25156	0.008000	0.14137	0.089000	0.18198	-0.236000	0.09003	-0.858000	0.04110	-1.031000	0.02408	CAG	LRRK2	-	superfamily_ARM-type_fold	ENSG00000188906		0.403	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	HGNC	protein_coding	OTTHUMT00000277179.1		0.00	32	0	G	XM_058513		40643716	+1			no_errors	ENST00000298910	ensembl	human	known	74_37	missense	7.41	25	2	SNP	0.176	T
MACC1	346389	genome.wustl.edu	37	7	20199215	20199215	+	Missense_Mutation	SNP	G	G	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr7:20199215G>C	ENST00000400331.5	-	5	1077	c.769C>G	c.(769-771)Ccg>Gcg	p.P257A	MACC1_ENST00000589011.1_Missense_Mutation_p.P257A|MACC1_ENST00000332878.4_Missense_Mutation_p.P257A	NM_182762.3	NP_877439.3	Q6ZN28	MACC1_HUMAN	metastasis associated in colon cancer 1	257					positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(15)|lung(12)|ovary(2)|prostate(1)|skin(3)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(1)	39						ATGTGTGGCGGATCAAGGAAA	0.473																																																	0													100.0	95.0	97.0					7																	20199215		2203	4300	6503	SO:0001583	missense	0				CCDS5369.1	7p15.3	2008-10-14			ENSG00000183742	ENSG00000183742			30215	protein-coding gene	gene with protein product		612646					Standard	NM_182762		Approved	7A5, SH3BP4L	uc003sus.4	Q6ZN28	OTTHUMG00000128415	ENST00000400331.5:c.769C>G	7.37:g.20199215G>C	ENSP00000383185:p.Pro257Ala		A8MUS5|B2RNR9|Q6ZQN8|Q7Z5A5	Missense_Mutation	SNP	pfam_SH3_2,superfamily_DEATH-like_dom	p.P257A	ENST00000400331.5	37	c.769	CCDS5369.1	7	.	.	.	.	.	.	.	.	.	.	G	9.578	1.122761	0.20877	.	.	ENSG00000183742	ENST00000400331;ENST00000332878	T;T	0.11930	2.73;2.73	5.47	4.53	0.55603	.	0.048745	0.85682	D	0.000000	T	0.13670	0.0331	L	0.52573	1.65	0.80722	D	1	B	0.29508	0.246	B	0.28305	0.088	T	0.02596	-1.1136	10	0.59425	D	0.04	-17.0994	10.1226	0.42630	0.0742:0.1389:0.7869:0.0	.	257	Q6ZN28	MACC1_HUMAN	A	257	ENSP00000383185:P257A;ENSP00000328410:P257A	ENSP00000328410:P257A	P	-	1	0	MACC1	20165740	1.000000	0.71417	0.986000	0.45419	0.439000	0.31926	6.714000	0.74692	2.569000	0.86673	0.585000	0.79938	CCG	MACC1	-	NULL	ENSG00000183742		0.473	MACC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MACC1	HGNC	protein_coding	OTTHUMT00000250202.5	-	0.00	34	0	G	NM_182762		20199215	-1	tier1	-	no_errors	ENST00000332878	ensembl	human	known	74_37	missense	26.98	46	17	SNP	1.000	C
MACF1	23499	genome.wustl.edu	37	1	39800561	39800561	+	Silent	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:39800561C>T	ENST00000372915.3	+	36	8403	c.8316C>T	c.(8314-8316)agC>agT	p.S2772S	MACF1_ENST00000361689.2_Intron|MACF1_ENST00000545844.1_Intron|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000289893.4_Silent_p.S1207S|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000476350.1_Intron|MACF1_ENST00000567887.1_Silent_p.S2804S|MACF1_ENST00000564288.1_Silent_p.S2767S			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	2772					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CAGAGTTCAGCGATCACAGGG	0.373																																																	0													76.0	76.0	76.0					1																	39800561		2203	4300	6503	SO:0001819	synonymous_variant	0			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.8316C>T	1.37:g.39800561C>T			B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Silent	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_RNaseH-like_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.S2804	ENST00000372915.3	37	c.8412		1																																																																																			MACF1	-	superfamily_RNaseH-like_dom	ENSG00000127603		0.373	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	-	0.00	52	0	C	NM_033044		39800561	+1	tier1	-	no_errors	ENST00000567887	ensembl	human	putative	74_37	silent	39.33	54	35	SNP	0.011	T
MAEL	84944	genome.wustl.edu	37	1	166990945	166990945	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:166990945C>A	ENST00000367872.4	+	12	1402	c.1158C>A	c.(1156-1158)agC>agA	p.S386R	MAEL_ENST00000367870.2_Missense_Mutation_p.S355R|MAEL_ENST00000491055.1_3'UTR	NM_032858.1	NP_116247.1	Q96JY0	MAEL_HUMAN	maelstrom spermatogenic transposon silencer	386					cell differentiation (GO:0030154)|cell morphogenesis (GO:0000902)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|piRNA metabolic process (GO:0034587)|regulation of organ growth (GO:0046620)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	autosome (GO:0030849)|chromatin (GO:0000785)|chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|P granule (GO:0043186)|perinuclear region of cytoplasm (GO:0048471)|piP-body (GO:0071547)|XY body (GO:0001741)	DNA binding (GO:0003677)			breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(12)|skin(4)	28						GCCAAAACAGCAGCGTTCGGG	0.383																																																	0													86.0	85.0	85.0					1																	166990945		2203	4300	6503	SO:0001583	missense	0			AK027810, DQ076156	CCDS1257.1, CCDS65712.1, CCDS72975.1	1q24.1	2013-10-11	2012-12-18		ENSG00000143194	ENSG00000143194			25929	protein-coding gene	gene with protein product	"""cancer/testis antigen 128"", ""spermatogenesis associated 35"""	611368	"""maelstrom homolog (Drosophila)"""			19693694, 18694567	Standard	NM_001286378		Approved	FLJ14904, CT128, SPATA35	uc001gdy.1	Q96JY0	OTTHUMG00000034432	ENST00000367872.4:c.1158C>A	1.37:g.166990945C>A	ENSP00000356846:p.Ser386Arg		B4DY43|E9JVC3|Q49AP9|Q5VZP8|Q9UIW6	Missense_Mutation	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,superfamily_CH-domain	p.S386R	ENST00000367872.4	37	c.1158	CCDS1257.1	1	.	.	.	.	.	.	.	.	.	.	C	14.14	2.447546	0.43429	.	.	ENSG00000143194	ENST00000367872;ENST00000367870;ENST00000537744	T;T	0.54866	0.55;0.59	5.38	3.53	0.40419	.	0.075030	0.56097	D	0.000025	T	0.19525	0.0469	L	0.27053	0.805	0.32492	N	0.540094	P;P	0.38250	0.624;0.624	B;B	0.34590	0.186;0.186	T	0.07065	-1.0792	10	0.87932	D	0	.	7.8084	0.29217	0.0:0.8171:0.0:0.1829	.	355;386	E9JVC3;Q96JY0	.;MAEL_HUMAN	R	386;355;108	ENSP00000356846:S386R;ENSP00000356844:S355R	ENSP00000356844:S355R	S	+	3	2	MAEL	165257569	0.953000	0.32496	0.994000	0.49952	0.994000	0.84299	0.704000	0.25661	0.844000	0.35094	0.655000	0.94253	AGC	MAEL	-	NULL	ENSG00000143194		0.383	MAEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAEL	HGNC	protein_coding	OTTHUMT00000083239.1	-	0.00	54	0	C	NM_032858		166990945	+1	tier1	-	no_errors	ENST00000367872	ensembl	human	known	74_37	missense	17.02	78	16	SNP	0.986	A
MAF	4094	genome.wustl.edu	37	16	79632734	79632734	+	Missense_Mutation	SNP	A	A	G			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr16:79632734A>G	ENST00000393350.1	-	1	1877	c.1066T>C	c.(1066-1068)Ttc>Ctc	p.F356L	MAF_ENST00000326043.4_Missense_Mutation_p.F356L|MAF_ENST00000569649.1_Missense_Mutation_p.F356L	NM_001031804.2	NP_001026974.1	O75444	MAF_HUMAN	v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog	356	Represses ARE-mediated transcription.				cell development (GO:0048468)|cytokine production (GO:0001816)|inner ear development (GO:0048839)|lens fiber cell differentiation (GO:0070306)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of chondrocyte differentiation (GO:0032330)|transcription from RNA polymerase II promoter (GO:0006366)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)	10		all_epithelial(2;0.139)|Lung NSC(2;0.186)|Melanoma(2;0.211)		UCEC - Uterine corpus endometrioid carcinoma (2;0.0178)		TTTTCTCGGAAGCCGCTGCTC	0.582			T	IGH@	MM																																			Dom	yes		16	16q22-q23	4094	v-maf musculoaponeurotic fibrosarcoma oncogene homolog		L	0													62.0	62.0	62.0					16																	79632734		2198	4300	6498	SO:0001583	missense	0				CCDS10928.1, CCDS42198.1	16q22-q23	2013-07-09	2013-07-09		ENSG00000178573	ENSG00000178573			6776	protein-coding gene	gene with protein product		177075				14998484	Standard	NM_005360		Approved	c-MAF	uc002ffm.3	O75444	OTTHUMG00000137621	ENST00000393350.1:c.1066T>C	16.37:g.79632734A>G	ENSP00000377019:p.Phe356Leu		Q66I47|Q9UP93	Missense_Mutation	SNP	pfam_bZIP_Maf,pfam_Maf_TF_N,superfamily_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.F356L	ENST00000393350.1	37	c.1066	CCDS42198.1	16	.	.	.	.	.	.	.	.	.	.	A	21.4	4.142764	0.77888	.	.	ENSG00000178573	ENST00000326043;ENST00000393350	D;D	0.97480	-4.4;-4.36	4.27	4.27	0.50696	.	0.270692	0.42548	D	0.000692	D	0.96620	0.8897	M	0.74881	2.28	0.39901	D	0.973904	B;B	0.33826	0.069;0.427	B;B	0.42916	0.076;0.402	D	0.95966	0.8966	10	0.22109	T	0.4	-12.4494	13.6754	0.62451	1.0:0.0:0.0:0.0	.	356;356	O75444;O75444-1	MAF_HUMAN;.	L	356	ENSP00000327048:F356L;ENSP00000377019:F356L	ENSP00000327048:F356L	F	-	1	0	MAF	78190235	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.200000	0.77838	1.693000	0.51124	0.448000	0.29417	TTC	MAF	-	NULL	ENSG00000178573		0.582	MAF-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAF	HGNC	protein_coding	OTTHUMT00000317037.1	-	0.00	132	0	A			79632734	-1	tier1	-	no_errors	ENST00000326043	ensembl	human	known	74_37	missense	30.70	79	35	SNP	1.000	G
MAGEB10	139422	genome.wustl.edu	37	X	27839520	27839520	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chrX:27839520G>T	ENST00000356790.2	+	3	342	c.97G>T	c.(97-99)Gaa>Taa	p.E33*		NM_182506.3	NP_872312.2	Q96LZ2	MAGBA_HUMAN	melanoma antigen family B, 10	33										NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	26						GGACATTTTAGAAGAGGAGGA	0.517																																																	0													55.0	53.0	54.0					X																	27839520		2202	4300	6502	SO:0001587	stop_gained	0				CCDS35221.1	Xp21.3	2008-02-05			ENSG00000177689	ENSG00000177689			25377	protein-coding gene	gene with protein product		300761				11454705	Standard	NM_182506		Approved	FLJ32965	uc004dbw.3	Q96LZ2	OTTHUMG00000046084	ENST00000356790.2:c.97G>T	X.37:g.27839520G>T	ENSP00000368304:p.Glu33*		Q494Y6|Q494Y7|Q9BZ78	Nonsense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.E33*	ENST00000356790.2	37	c.97	CCDS35221.1	X	.	.	.	.	.	.	.	.	.	.	G	14.85	2.658338	0.47467	.	.	ENSG00000177689	ENST00000356790	.	.	.	1.94	0.845	0.18950	.	1.353090	0.05243	U	0.512536	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	4.9256	0.13892	0.0:0.0:0.5354:0.4646	.	.	.	.	X	33	.	ENSP00000368304:E33X	E	+	1	0	MAGEB10	27749441	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.249000	0.08842	0.151000	0.19162	0.422000	0.28245	GAA	MAGEB10	-	pfam_Melanoma_ass_antigen_N	ENSG00000177689		0.517	MAGEB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB10	HGNC	protein_coding	OTTHUMT00000106216.1	-	0.00	47	0	G	NM_182506		27839520	+1	tier1	-	no_errors	ENST00000356790	ensembl	human	known	74_37	nonsense	6.67	56	4	SNP	0.000	T
MAGI1	9223	genome.wustl.edu	37	3	65425633	65425633	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr3:65425633C>A	ENST00000497477.2	-	9	1190	c.1191G>T	c.(1189-1191)aaG>aaT	p.K397N	MAGI1_ENST00000330909.8_Missense_Mutation_p.K397N|MAGI1_ENST00000483466.1_Missense_Mutation_p.K397N|MAGI1_ENST00000470990.1_5'UTR|MAGI1_ENST00000402939.2_Missense_Mutation_p.K397N			Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 1	397					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|neuron death (GO:0070997)|protein complex assembly (GO:0006461)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	alpha-actinin binding (GO:0051393)|ATP binding (GO:0005524)|protein C-terminus binding (GO:0008022)	p.K397K(2)		breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|liver(1)|lung(21)|pancreas(1)|skin(5)	51		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		CAAGCTGCTTCTTCCGTTTGG	0.517											OREG0015658	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					2	Substitution - coding silent(2)	lung(2)											145.0	119.0	128.0					3																	65425633		2203	4300	6503	SO:0001583	missense	0			AB010894	CCDS33780.1, CCDS33781.1, CCDS2904.1	3p14.1	2009-10-06	2005-05-10	2005-05-10	ENSG00000151276	ENSG00000151276			946	protein-coding gene	gene with protein product		602625	"""BAI1-associated protein 1"""	BAIAP1		9647739, 9225980	Standard	XM_005265563		Approved	BAP1, MAGI-1, TNRC19, AIP3, WWP3	uc003dmn.3	Q96QZ7	OTTHUMG00000157554	ENST00000497477.2:c.1191G>T	3.37:g.65425633C>A	ENSP00000424369:p.Lys397Asn	1084	A8K188|O00309|O43863|O75085|Q96QZ8|Q96QZ9	Missense_Mutation	SNP	pfam_PDZ,pfam_WW_dom,pfam_GK/Ca_channel_bsu,superfamily_PDZ,superfamily_P-loop_NTPase,superfamily_WW_dom,smart_PDZ,smart_GK/Ca_channel_bsu,smart_WW_dom,pfscan_PDZ,pfscan_WW_dom,pfscan_Guanylate_kin-like	p.K397N	ENST00000497477.2	37	c.1191		3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.0|22.0	4.232251|4.232251	0.79688|0.79688	.|.	.|.	ENSG00000151276|ENSG00000151276	ENST00000402939;ENST00000330909;ENST00000422949;ENST00000463103;ENST00000483466;ENST00000497477;ENST00000472257;ENST00000479287|ENST00000460329	T;T;T;T;T;T;T|.	0.79141|.	-0.04;-1.24;-1.24;-1.24;-1.24;-1.24;2.25|.	5.86|5.86	4.99|4.99	0.66335|0.66335	.|.	0.304838|.	0.35067|.	N|.	0.003472|.	T|T	0.69486|0.69486	0.3116|0.3116	L|L	0.59436|0.59436	1.845|1.845	0.58432|0.58432	D|D	0.999999|0.999999	D;D;P;P;B|.	0.57899|.	0.981;0.981;0.835;0.929;0.317|.	P;P;P;P;B|.	0.53490|.	0.681;0.727;0.549;0.681;0.187|.	T|T	0.68277|0.68277	-0.5451|-0.5451	10|5	0.45353|.	T|.	0.12|.	-28.091|-28.091	14.7788|14.7788	0.69749|0.69749	0.0:0.9312:0.0:0.0688|0.0:0.9312:0.0:0.0688	.|.	397;397;397;397;397|.	Q96QZ7-6;Q96QZ7-4;Q96QZ7-3;Q96QZ7-2;Q96QZ7-5|.	.;.;.;.;.|.	N|I	397;397;293;272;397;397;183;147|278	ENSP00000385450:K397N;ENSP00000331157:K397N;ENSP00000418177:K272N;ENSP00000420323:K397N;ENSP00000424369:K397N;ENSP00000420796:K183N;ENSP00000418044:K147N|.	ENSP00000331157:K397N|.	K|R	-|-	3|2	2|0	MAGI1|MAGI1	65400673|65400673	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	1.445000|1.445000	0.35079|0.35079	1.490000|1.490000	0.48466|0.48466	0.650000|0.650000	0.86243|0.86243	AAG|AGA	MAGI1	-	NULL	ENSG00000151276		0.517	MAGI1-007	NOVEL	basic|exp_conf	protein_coding	MAGI1	HGNC	protein_coding	OTTHUMT00000349132.2		0.00	27	0	C	NM_004742		65425633	-1			no_errors	ENST00000402939	ensembl	human	known	74_37	missense	8.00	23	2	SNP	1.000	A
MAN2B2	23324	genome.wustl.edu	37	4	6596273	6596273	+	Nonsense_Mutation	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr4:6596273C>T	ENST00000285599.3	+	7	907	c.871C>T	c.(871-873)Cag>Tag	p.Q291*	MAN2B2_ENST00000504248.1_Intron	NM_015274.1	NP_056089.1	Q9Y2E5	MA2B2_HUMAN	mannosidase, alpha, class 2B, member 2	291					mannose metabolic process (GO:0006013)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			breast(2)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	30						ATGTGACAAGCAGTTCTTCAA	0.632																																																	0													121.0	94.0	103.0					4																	6596273		2203	4300	6503	SO:0001587	stop_gained	0			BC033307	CCDS33951.1	4p16.2	2005-11-09			ENSG00000013288	ENSG00000013288			29623	protein-coding gene	gene with protein product	"""core-specific lysosomal alpha-1,6-Mannosidase"""					10231032, 16115860	Standard	XR_241647		Approved	KIAA0935	uc003gjf.1	Q9Y2E5	OTTHUMG00000160073	ENST00000285599.3:c.871C>T	4.37:g.6596273C>T	ENSP00000285599:p.Gln291*		Q66MP2|Q86T67	Nonsense_Mutation	SNP	pfam_Glyco_hydro_38_N,pfam_Glyco_hydro_38_C,pfam_Glyco_hydro_38_cen_dom,superfamily_Gal_mutarotase_SF_dom,superfamily_Glyco_hydro/deAcase_b/a-brl,smart_Glyco_hydro_38_cen_dom	p.Q291*	ENST00000285599.3	37	c.871	CCDS33951.1	4	.	.	.	.	.	.	.	.	.	.	C	37	6.437057	0.97568	.	.	ENSG00000013288	ENST00000285599	.	.	.	4.1	4.1	0.47936	.	0.125214	0.56097	D	0.000036	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	-17.7441	15.342	0.74306	0.0:1.0:0.0:0.0	.	.	.	.	X	291	.	ENSP00000285599:Q291X	Q	+	1	0	MAN2B2	6647174	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	4.816000	0.62642	1.836000	0.53414	0.442000	0.29010	CAG	MAN2B2	-	pfam_Glyco_hydro_38_N,superfamily_Glyco_hydro/deAcase_b/a-brl	ENSG00000013288		0.632	MAN2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN2B2	HGNC	protein_coding	OTTHUMT00000359106.2	-	0.00	47	0	C	NM_015274		6596273	+1	tier1	-	no_errors	ENST00000285599	ensembl	human	known	74_37	nonsense	5.80	65	4	SNP	1.000	T
MANSC4	100287284	genome.wustl.edu	37	12	27916260	27916260	+	Missense_Mutation	SNP	C	C	G			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr12:27916260C>G	ENST00000381273.3	-	3	433	c.434G>C	c.(433-435)aGa>aCa	p.R145T		NM_001146221.1	NP_001139693.1	A6NHS7	MANS4_HUMAN	MANSC domain containing 4	145						integral component of membrane (GO:0016021)				kidney(1)	1						TCTGTCCCATCTATTGGATGA	0.378																																																	0													165.0	135.0	144.0					12																	27916260		692	1591	2283	SO:0001583	missense	0				CCDS53770.1	12p11.22	2011-05-05			ENSG00000205693	ENSG00000205693			40023	protein-coding gene	gene with protein product							Standard	NM_001146221		Approved		uc010sjs.1	A6NHS7	OTTHUMG00000169216	ENST00000381273.3:c.434G>C	12.37:g.27916260C>G	ENSP00000370673:p.Arg145Thr			Missense_Mutation	SNP	pfam_MANSC_N,smart_MANSC_N,pfscan_MANSC	p.R145T	ENST00000381273.3	37	c.434	CCDS53770.1	12	.	.	.	.	.	.	.	.	.	.	C	4.552	0.102459	0.08731	.	.	ENSG00000205693	ENST00000381273	T	0.43294	0.95	5.31	1.33	0.21861	.	0.640411	0.14530	N	0.313887	T	0.15219	0.0367	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.21280	-1.0250	10	0.18276	T	0.48	-0.7617	3.1838	0.06593	0.1403:0.5267:0.1968:0.1363	.	145	A6NHS7	MANS4_HUMAN	T	145	ENSP00000370673:R145T	ENSP00000370673:R145T	R	-	2	0	MANSC4	27807527	0.000000	0.05858	0.000000	0.03702	0.284000	0.27059	-0.680000	0.05197	0.200000	0.20447	0.563000	0.77884	AGA	MANSC4	-	NULL	ENSG00000205693		0.378	MANSC4-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	MANSC4	HGNC	protein_coding	OTTHUMT00000402902.1		0.00	66	0	C			27916260	-1			no_errors	ENST00000381273	ensembl	human	novel	74_37	missense	7.69	120	10	SNP	0.000	G
MAP2	4133	genome.wustl.edu	37	2	210559473	210559473	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr2:210559473C>T	ENST00000360351.4	+	7	3085	c.2579C>T	c.(2578-2580)aCg>aTg	p.T860M	MAP2_ENST00000199940.6_Intron|MAP2_ENST00000361559.4_Intron|MAP2_ENST00000447185.1_Missense_Mutation_p.T856M|MAP2_ENST00000392194.1_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	860					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	ATTGTAAAAACGGACAGTCAG	0.483																																					Pancreas(27;423 979 28787 29963)												0													84.0	78.0	80.0					2																	210559473		2203	4300	6503	SO:0001583	missense	0				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.2579C>T	2.37:g.210559473C>T	ENSP00000353508:p.Thr860Met		Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	pfam_MAP2_projctn,pfam_MAP_tubulin-bd_rpt	p.T860M	ENST00000360351.4	37	c.2579	CCDS2384.1	2	.	.	.	.	.	.	.	.	.	.	C	10.57	1.387435	0.25031	.	.	ENSG00000078018	ENST00000360351;ENST00000447185	T;T	0.18960	2.18;2.18	5.8	3.91	0.45181	MAP2/Tau projection (1);	0.464648	0.20454	N	0.092038	T	0.25938	0.0632	L	0.40543	1.245	0.22446	N	0.9991	D;D	0.56287	0.969;0.975	P;P	0.51895	0.555;0.683	T	0.04481	-1.0948	10	0.62326	D	0.03	-7.4309	10.572	0.45206	0.1329:0.7983:0.0:0.0688	.	856;860	P11137-3;P11137	.;MAP2_HUMAN	M	860;856	ENSP00000353508:T860M;ENSP00000392164:T856M	ENSP00000353508:T860M	T	+	2	0	MAP2	210267718	0.961000	0.32948	0.884000	0.34674	0.104000	0.19210	2.354000	0.44098	1.469000	0.48083	-0.145000	0.13849	ACG	MAP2	-	pfam_MAP2_projctn	ENSG00000078018		0.483	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP2	HGNC	protein_coding	OTTHUMT00000256521.2	-	0.00	25	0	C	NM_001039538		210559473	+1	tier1	-	no_errors	ENST00000360351	ensembl	human	known	74_37	missense	29.82	40	17	SNP	0.735	T
MAP2	4133	genome.wustl.edu	37	2	210588377	210588377	+	Intron	SNP	A	A	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr2:210588377A>C	ENST00000360351.4	+	13	5579				RNA5SP118_ENST00000410385.1_RNA|MAP2_ENST00000199940.6_Missense_Mutation_p.K412T|MAP2_ENST00000361559.4_Intron|MAP2_ENST00000447185.1_Intron|MAP2_ENST00000392194.1_Intron|MAP2_ENST00000475600.1_3'UTR	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2						axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	TGTGGTTCCAAGGATAACATC	0.443																																					Pancreas(27;423 979 28787 29963)												0													100.0	98.0	98.0					2																	210588377		2203	4300	6503	SO:0001627	intron_variant	0				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.5074-2056A>C	2.37:g.210588377A>C			Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	pfam_MAP_tubulin-bd_rpt	p.K412T	ENST00000360351.4	37	c.1235	CCDS2384.1	2	.	.	.	.	.	.	.	.	.	.	A	13.98	2.399275	0.42512	.	.	ENSG00000078018	ENST00000199940	D	0.93366	-3.21	5.65	5.65	0.86999	.	.	.	.	.	D	0.92554	0.7635	L	0.52364	1.645	0.80722	D	1	P	0.41569	0.755	P	0.50896	0.653	D	0.89650	0.3869	9	0.17369	T	0.5	.	10.5518	0.45092	0.9188:0.0:0.0812:0.0	.	412	Q8IUX2	.	T	412	ENSP00000199940:K412T	ENSP00000199940:K412T	K	+	2	0	MAP2	210296622	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.682000	0.54656	2.144000	0.66660	0.533000	0.62120	AAG	MAP2	-	pfam_MAP_tubulin-bd_rpt	ENSG00000078018		0.443	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP2	HGNC	protein_coding	OTTHUMT00000256521.2	-	0.00	54	0	A	NM_001039538		210588377	+1	tier1	-	no_errors	ENST00000199940	ensembl	human	known	74_37	missense	25.61	61	21	SNP	1.000	C
MAP3K7	6885	genome.wustl.edu	37	6	91266319	91266319	+	Silent	SNP	T	T	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr6:91266319T>A	ENST00000369329.3	-	6	668	c.507A>T	c.(505-507)acA>acT	p.T169T	MAP3K7_ENST00000369325.3_Silent_p.T169T|MAP3K7_ENST00000369332.3_Silent_p.T169T|MAP3K7_ENST00000369327.3_Silent_p.T169T	NM_145331.2	NP_663304.1	O43318	M3K7_HUMAN	mitogen-activated protein kinase kinase kinase 7	169	Interaction with MAPK8IP1. {ECO:0000250}.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|Fc-epsilon receptor signaling pathway (GO:0038095)|histone H3 acetylation (GO:0043966)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of ripoptosome assembly involved in necroptotic process (GO:1902443)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|regulation of reactive oxygen species metabolic process (GO:2000377)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase activity (GO:0004708)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)			endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	28		all_cancers(76;6.4e-08)|Acute lymphoblastic leukemia(125;1.43e-09)|Prostate(29;9.32e-09)|all_hematologic(105;3.69e-06)|all_epithelial(107;0.000187)|Ovarian(999;0.0164)		OV - Ovarian serous cystadenocarcinoma(136;2.05e-11)|all cancers(137;3.25e-11)|GBM - Glioblastoma multiforme(226;0.0416)|BRCA - Breast invasive adenocarcinoma(108;0.0429)		TTTTTAGAACTGTCCCCCCTG	0.378																																																	0													99.0	93.0	95.0					6																	91266319		2203	4300	6503	SO:0001819	synonymous_variant	0			AB009356	CCDS5027.1, CCDS5028.1, CCDS5029.1, CCDS5030.1	6q15	2011-06-09			ENSG00000135341	ENSG00000135341		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6859	protein-coding gene	gene with protein product		602614		TAK1		9466656	Standard	NM_003188		Approved	MEKK7	uc003pnz.2	O43318	OTTHUMG00000015217	ENST00000369329.3:c.507A>T	6.37:g.91266319T>A			B2RE27|E1P523|O43317|O43319|Q5TDN2|Q5TDN3|Q5TDT7|Q9NTR3|Q9NZ70	Silent	SNP	pirsf_MAPKKK7,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.T169	ENST00000369329.3	37	c.507	CCDS5028.1	6																																																																																			MAP3K7	-	pirsf_MAPKKK7,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000135341		0.378	MAP3K7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP3K7	HGNC	protein_coding	OTTHUMT00000041530.1	-	0.00	108	0	T	NM_145331		91266319	-1	tier1	-	no_errors	ENST00000369329	ensembl	human	known	74_37	silent	30.25	83	36	SNP	0.995	A
MGA	23269	genome.wustl.edu	37	15	41988910	41988910	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr15:41988910G>T	ENST00000570161.1	+	2	1702	c.1702G>T	c.(1702-1704)Gat>Tat	p.D568Y	MGA_ENST00000545763.1_Missense_Mutation_p.D568Y|MGA_ENST00000219905.7_Missense_Mutation_p.D568Y|MGA_ENST00000389936.4_Missense_Mutation_p.D568Y|MGA_ENST00000566586.1_Missense_Mutation_p.D568Y			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0	Maltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	AATACTCGACGATTCAAAGGA	0.413																																																	0													58.0	52.0	54.0					15																	41988910		1875	4112	5987	SO:0001583	missense	0			AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.1702G>T	15.37:g.41988910G>T	ENSP00000457035:p.Asp568Tyr		Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	pfam_TF_T-box,pfam_bHLH_dom,superfamily_p53-like_TF_DNA-bd,superfamily_bHLH_dom,smart_TF_T-box,smart_bHLH_dom,pfscan_bHLH_dom,pfscan_TF_T-box,prints_TF_T-box	p.D568Y	ENST00000570161.1	37	c.1702	CCDS55959.1	15	.	.	.	.	.	.	.	.	.	.	G	4.672	0.124964	0.08931	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	D;D;D	0.83837	-1.77;-1.77;-1.76	5.44	0.681	0.17986	.	2.269950	0.01184	N	0.007170	T	0.75547	0.3864	N	0.14661	0.345	0.09310	N	1	P;P	0.39940	0.696;0.64	B;B	0.42245	0.381;0.15	T	0.67612	-0.5626	10	0.72032	D	0.01	.	9.106	0.36698	0.7031:0.0:0.2969:0.0	.	568;568	F5H7K2;E7ENI0	.;.	Y	568	ENSP00000219905:D568Y;ENSP00000374586:D568Y;ENSP00000442467:D568Y	ENSP00000219905:D568Y	D	+	1	0	MGA	39776202	0.178000	0.23122	0.445000	0.26908	0.010000	0.07245	1.313000	0.33585	0.388000	0.25054	-0.487000	0.04747	GAT	MGA	-	NULL	ENSG00000174197		0.413	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MGA	HGNC	protein_coding	OTTHUMT00000420229.1	-	0.00	59	0	G	NM_001164273.1		41988910	+1	tier1	-	no_errors	ENST00000219905	ensembl	human	known	74_37	missense	5.06	74	4	SNP	0.001	T
MIR200A	406983	genome.wustl.edu	37	1	1103288	1103288	+	lincRNA	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:1103288C>T	ENST00000606993.1	+	0	0				MIR429_ENST00000362106.1_RNA|MIR200A_ENST00000384875.1_RNA|MIR200B_ENST00000384997.1_RNA																							GATTTCCCAGCTTGACTCTAA	0.642																																																	0													39.0	39.0	39.0					1																	1103288		1564	3579	5143			0																															1.37:g.1103288C>T				RNA	SNP	-	NULL	ENST00000606993.1	37	NULL		1																																																																																			MIR200A	-	-	ENSG00000207607		0.642	RP11-465B22.8-001	KNOWN	basic	lincRNA	MIR200A	HGNC	lincRNA	OTTHUMT00000470776.1	-	0.00	220	0	C			1103288	+1	tier1	-	no_errors	ENST00000384875	ensembl	human	known	74_37	rna	66.16	66	131	SNP	0.320	T
MIR495	574453	genome.wustl.edu	37	14	101500143	101500143	+	RNA	SNP	A	A	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr14:101500143A>C	ENST00000385010.1	+	0	52				MIR543_ENST00000390751.1_RNA	NR_030175.1				microRNA 495																		ATGTGACGAAACAAACATGGT	0.507																																																	0													70.0	65.0	66.0					14																	101500143		1567	3582	5149			0					14q32.31	2011-09-12		2008-12-18	ENSG00000207743	ENSG00000207743		"""ncRNAs / Micro RNAs"""	32085	non-coding RNA	RNA, micro		615149		MIRN495			Standard	NR_030175		Approved	hsa-mir-495	uc021scu.1				14.37:g.101500143A>C				RNA	SNP	-	NULL	ENST00000385010.1	37	NULL		14																																																																																			MIR495	-	-	ENSG00000207743		0.507	MIR495-201	KNOWN	basic	miRNA	MIR495	HGNC	miRNA		-	0.00	30	0	A	NR_030175		101500143	+1	tier1	-	no_errors	ENST00000385010	ensembl	human	known	74_37	rna	54.29	16	19	SNP	1.000	C
MLEC	9761	genome.wustl.edu	37	12	121125148	121125150	+	In_Frame_Del	DEL	CTG	CTG	-			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	CTG	CTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr12:121125148_121125150delCTG	ENST00000228506.3	+	1	477_479	c.49_51delCTG	c.(49-51)ctgdel	p.L22del	MLEC_ENST00000412616.2_In_Frame_Del_p.L22del	NM_014730.2	NP_055545.1	Q14165	MLEC_HUMAN	malectin	22					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|enzyme binding (GO:0019899)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)	16						gctcctgcgactgctgctgctgc	0.783																																																	0										47,1473		16,15,729						-1.8	1.0			2	80,3128		23,34,1547	no	coding	MLEC	NM_014730.2		39,49,2276	A1A1,A1R,RR		2.4938,3.0921,2.6861				127,4601				SO:0001651	inframe_deletion	0			BC000371	CCDS9206.1	12q24.31	2013-03-06	2008-11-05	2008-11-05	ENSG00000110917	ENSG00000110917			28973	protein-coding gene	gene with protein product	"""oligosaccharyltransferase complex subunit (non-catalytic)"""	613802	"""KIAA0152"""	KIAA0152		18524852	Standard	NM_014730		Approved		uc001tyy.1	Q14165	OTTHUMG00000169187	ENST00000228506.3:c.49_51delCTG	12.37:g.121125157_121125159delCTG	ENSP00000228506:p.Leu22del			In_Frame_Del	DEL	pfam_Malectin	p.L20in_frame_del	ENST00000228506.3	37	c.49_51	CCDS9206.1	12																																																																																			MLEC	-	NULL	ENSG00000110917		0.783	MLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLEC	HGNC	protein_coding	OTTHUMT00000402781.2		0.00	26	0	CTG	NM_014730		121125150	+1	tier1		no_errors	ENST00000228506	ensembl	human	known	74_37	in_frame_del	13.79	25	4	DEL	1.000:1.000:1.000	-
MMP26	56547	genome.wustl.edu	37	11	5010967	5010967	+	Silent	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr11:5010967G>T	ENST00000380390.1	+	3	405	c.189G>T	c.(187-189)cgG>cgT	p.R63R	MMP26_ENST00000300762.1_Silent_p.R63R|MMP26_ENST00000477339.1_3'UTR			Q9NRE1	MMP26_HUMAN	matrix metallopeptidase 26	63					collagen catabolic process (GO:0030574)|proteolysis (GO:0006508)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(11)|pancreas(1)|skin(3)|stomach(1)	22		Medulloblastoma(188;0.0025)|Breast(177;0.0204)|all_neural(188;0.0227)		Epithelial(150;1.33e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0287)|LUSC - Lung squamous cell carcinoma(625;0.191)	Marimastat(DB00786)	AATTCCATCGGAATGGGACAG	0.522																																																	0													81.0	64.0	69.0					11																	5010967		2201	4298	6499	SO:0001819	synonymous_variant	0			AF230354	CCDS7752.1	11p15	2008-07-18	2005-08-08		ENSG00000167346	ENSG00000167346	3.4.24.1		14249	protein-coding gene	gene with protein product	"""matrilysin 2"""	605470	"""matrix metalloproteinase 26"""			10801841, 10824119	Standard	NM_021801		Approved	endometase, MGC126590, MGC126592	uc001lzv.3	Q9NRE1	OTTHUMG00000066442	ENST00000380390.1:c.189G>T	11.37:g.5010967G>T			Q3MJ78|Q9GZS2|Q9NR87	Silent	SNP	pfam_Pept_M10_metallopeptidase,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,prints_Pept_M10A	p.R63	ENST00000380390.1	37	c.189	CCDS7752.1	11																																																																																			MMP26	-	superfamily_Peptidoglycan-bd-like	ENSG00000167346		0.522	MMP26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP26	HGNC	protein_coding	OTTHUMT00000142058.3		0.00	13	0	G	NM_021801		5010967	+1			no_errors	ENST00000300762	ensembl	human	known	74_37	silent	5.56	34	2	SNP	0.000	T
MNDA	4332	genome.wustl.edu	37	1	158815572	158815572	+	Silent	SNP	T	T	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:158815572T>C	ENST00000368141.4	+	5	1027	c.766T>C	c.(766-768)Ttg>Ctg	p.L256L		NM_002432.1	NP_002423.1	P41218	MNDA_HUMAN	myeloid cell nuclear differentiation antigen	256	HIN-200. {ECO:0000255|PROSITE- ProRule:PRU00106}.				B cell receptor signaling pathway (GO:0050853)|cellular defense response (GO:0006968)|cellular response to DNA damage stimulus (GO:0006974)|negative regulation of B cell proliferation (GO:0030889)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.L256L(1)		NS(2)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(1)|lung(26)|ovary(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	all_hematologic(112;0.0378)					CGACATCAACTTGAAAGAGAA	0.363																																																	1	Substitution - coding silent(1)	lung(1)											85.0	87.0	87.0					1																	158815572		2203	4300	6503	SO:0001819	synonymous_variant	0			BC032319	CCDS1177.1	1q22	2008-02-05			ENSG00000163563	ENSG00000163563			7183	protein-coding gene	gene with protein product		159553				1644857, 7512843	Standard	NM_002432		Approved	PYHIN3	uc001fsz.1	P41218	OTTHUMG00000022776	ENST00000368141.4:c.766T>C	1.37:g.158815572T>C				Silent	SNP	pfam_HIN200/IF120x,pfam_DAPIN,pfscan_DAPIN,pfscan_HIN200/IF120x	p.L256	ENST00000368141.4	37	c.766	CCDS1177.1	1																																																																																			MNDA	-	pfam_HIN200/IF120x,pfscan_HIN200/IF120x	ENSG00000163563		0.363	MNDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MNDA	HGNC	protein_coding	OTTHUMT00000059069.1	-	0.00	66	0	T	NM_002432		158815572	+1	tier1	-	no_errors	ENST00000368141	ensembl	human	known	74_37	silent	25.00	72	24	SNP	0.058	C
MPP2	4355	genome.wustl.edu	37	17	41981824	41981824	+	Missense_Mutation	SNP	G	G	A	rs146765164	byFrequency	TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr17:41981824G>A	ENST00000461854.1	-	2	90	c.5C>T	c.(4-6)cCg>cTg	p.P2L	MPP2_ENST00000536246.1_5'Flank|MPP2_ENST00000520305.1_5'UTR|MPP2_ENST00000523501.1_Intron|MPP2_ENST00000518766.1_Missense_Mutation_p.P47L|MPP2_ENST00000269095.4_Missense_Mutation_p.P2L|MPP2_ENST00000473246.1_5'Flank			Q14168	MPP2_HUMAN	membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)	2					nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)	p.P2L(1)		breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|liver(1)|lung(4)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)	29		Breast(137;0.00314)		BRCA - Breast invasive adenocarcinoma(366;0.12)		GGCGGCAACCGGCATGGTGAA	0.557																																																	1	Substitution - Missense(1)	large_intestine(1)											114.0	97.0	102.0					17																	41981824		2203	4300	6503	SO:0001583	missense	0				CCDS11471.1, CCDS62206.1, CCDS62207.1, CCDS62208.1, CCDS62209.1, CCDS62210.1	17q12-q21	2008-07-18			ENSG00000108852	ENSG00000108852			7220	protein-coding gene	gene with protein product	"""MAGUK p55 subfamily member 2"", ""discs large, homolog 2"""	600723		DLG2		7590743	Standard	NM_001278370		Approved	DKFZp761D0712	uc002ieo.1	Q14168	OTTHUMG00000133840	ENST00000461854.1:c.5C>T	17.37:g.41981824G>A	ENSP00000428286:p.Pro2Leu		B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Missense_Mutation	SNP	pfam_GK/Ca_channel_bsu,pfam_L27_C,pfam_SH3_2,pfam_PDZ,pfam_SH3_domain,superfamily_P-loop_NTPase,superfamily_SH3_domain,superfamily_PDZ,smart_L27,smart_PDZ,smart_SH3_domain,smart_GK/Ca_channel_bsu,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin-like	p.P2L	ENST00000461854.1	37	c.5		17	.	.	.	.	.	.	.	.	.	.	G	16.22	3.062694	0.55432	.	.	ENSG00000108852	ENST00000269095;ENST00000461854;ENST00000518766;ENST00000520406;ENST00000523934;ENST00000520241;ENST00000521178;ENST00000522172;ENST00000518478	T;T;T;T;T;T;T	0.52057	3.09;2.67;3.05;0.72;0.72;0.68;0.71	4.9	4.9	0.64082	.	.	.	.	.	T	0.31979	0.0814	N	0.19112	0.55	0.80722	D	1	B	0.30211	0.273	B	0.14578	0.011	T	0.25082	-1.0142	9	0.87932	D	0	.	13.438	0.61094	0.0:0.0:1.0:0.0	.	47	E7EV80	.	L	2;2;47;2;2;2;2;2;2	ENSP00000269095:P2L;ENSP00000428286:P2L;ENSP00000428182:P47L;ENSP00000428354:P2L;ENSP00000430797:P2L;ENSP00000428938:P2L;ENSP00000430443:P2L	ENSP00000269095:P2L	P	-	2	0	MPP2	39337350	0.999000	0.42202	0.987000	0.45799	0.901000	0.52897	4.597000	0.61062	2.539000	0.85634	0.561000	0.74099	CCG	MPP2	-	NULL	ENSG00000108852		0.557	MPP2-003	KNOWN	non_canonical_polymorphism|basic	protein_coding	MPP2	HGNC	protein_coding	OTTHUMT00000258388.2	-	0.00	93	0	G	NM_005374		41981824	-1	tier1	-	no_errors	ENST00000461854	ensembl	human	known	74_37	missense	23.94	107	34	SNP	0.988	A
MRGPRX3	117195	genome.wustl.edu	37	11	18159055	18159055	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr11:18159055G>T	ENST00000396275.2	+	3	667	c.306G>T	c.(304-306)atG>atT	p.M102I		NM_054031.3	NP_473372.3	Q96LB0	MRGX3_HUMAN	MAS-related GPR, member X3	102						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27						GTCCTGTGATGACCTTTCCCT	0.567																																																	0													121.0	116.0	118.0					11																	18159055		2200	4293	6493	SO:0001583	missense	0				CCDS7830.1	11p15.1	2013-10-10			ENSG00000179826	ENSG00000179826		"""GPCR / Class A : Orphans"""	17980	protein-coding gene	gene with protein product		607229				11551509	Standard	NM_054031		Approved	MRGX3	uc001mnu.3	Q96LB0	OTTHUMG00000166435	ENST00000396275.2:c.306G>T	11.37:g.18159055G>T	ENSP00000379571:p.Met102Ile		B0M0L1|Q8TDE0|Q8TDE1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.M102I	ENST00000396275.2	37	c.306	CCDS7830.1	11	.	.	.	.	.	.	.	.	.	.	G	3.507	-0.100532	0.06967	.	.	ENSG00000179826	ENST00000396275;ENST00000531264	T;T	0.71222	-0.55;-0.55	1.46	-2.93	0.05598	GPCR, rhodopsin-like superfamily (1);	4.791810	0.00357	N	0.000030	T	0.60958	0.2309	L	0.49778	1.585	0.09310	N	1	B	0.12013	0.005	B	0.19666	0.026	T	0.19160	-1.0314	10	0.25106	T	0.35	.	3.1558	0.06504	0.3013:0.0:0.4916:0.2071	.	102	Q96LB0	MRGX3_HUMAN	I	102	ENSP00000379571:M102I;ENSP00000436242:M102I	ENSP00000379571:M102I	M	+	3	0	MRGPRX3	18115631	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-4.719000	0.00194	-0.891000	0.03940	0.430000	0.28490	ATG	MRGPRX3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000179826		0.567	MRGPRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRGPRX3	HGNC	protein_coding	OTTHUMT00000389767.1	-	0.00	41	0	G	NM_054031		18159055	+1	tier1	-	no_errors	ENST00000396275	ensembl	human	known	74_37	missense	7.27	51	4	SNP	0.025	T
MRPL55	128308	genome.wustl.edu	37	1	228294529	228294529	+	Missense_Mutation	SNP	C	C	T	rs375373877		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:228294529C>T	ENST00000411464.2	-	5	1112	c.319G>A	c.(319-321)Gag>Aag	p.E107K	MRPL55_ENST00000348259.5_Missense_Mutation_p.E107K|MRPL55_ENST00000336520.3_Missense_Mutation_p.E107K|C1orf35_ENST00000472617.1_5'Flank|MRPL55_ENST00000366731.5_Missense_Mutation_p.E143K|MRPL55_ENST00000366747.3_Missense_Mutation_p.E107K|MRPL55_ENST00000366741.1_Missense_Mutation_p.E107K|MRPL55_ENST00000295008.4_Missense_Mutation_p.E107K|MRPL55_ENST00000336300.5_Missense_Mutation_p.E107K|MRPL55_ENST00000430433.1_Missense_Mutation_p.E143K|MRPL55_ENST00000366742.1_Missense_Mutation_p.E107K|MRPL55_ENST00000366735.1_Missense_Mutation_p.E107K|MRPL55_ENST00000366740.1_Missense_Mutation_p.E107K|MRPL55_ENST00000366739.1_Missense_Mutation_p.E107K|MRPL55_ENST00000366736.1_Missense_Mutation_p.E107K|MRPL55_ENST00000465397.1_5'UTR|MRPL55_ENST00000366733.1_Missense_Mutation_p.E107K|MRPL55_ENST00000366744.1_Missense_Mutation_p.E107K|MRPL55_ENST00000391867.3_Missense_Mutation_p.E107K|MRPL55_ENST00000366732.1_Missense_Mutation_p.E104K|MRPL55_ENST00000366746.3_Missense_Mutation_p.E107K|MRPL55_ENST00000366734.1_Missense_Mutation_p.E107K|MRPL55_ENST00000366738.1_Missense_Mutation_p.E143K			Q7Z7F7	RM55_HUMAN	mitochondrial ribosomal protein L55	107					translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)	structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|lung(4)	5		Prostate(94;0.0405)				AGCTCCTGCTCGTACTCCTTC	0.612																																																	0								C	LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU	2,4404	4.2+/-10.8	0,2,2201	135.0	108.0	117.0		319,319,319,319,427,319,319,319	-0.9	0.0	1		117	0,8600		0,0,4300	no	missense,missense,missense,missense,missense,missense,missense,missense	MRPL55	NM_181441.2,NM_181454.2,NM_181455.2,NM_181456.2,NM_181462.2,NM_181463.2,NM_181464.2,NM_181465.2	56,56,56,56,56,56,56,56	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	benign,benign,benign,benign,benign,benign,benign,benign	107/129,107/129,107/129,107/129,143/165,107/129,107/129,107/129	228294529	2,13004	2203	4300	6503	SO:0001583	missense	0			AK056987	CCDS1567.1, CCDS44325.1	1q42.13	2012-09-13			ENSG00000162910	ENSG00000162910		"""Mitochondrial ribosomal proteins / large subunits"""	16686	protein-coding gene	gene with protein product		611859					Standard	NM_181463		Approved		uc001hrz.4	Q7Z7F7	OTTHUMG00000037965	ENST00000411464.2:c.319G>A	1.37:g.228294529C>T	ENSP00000401737:p.Glu107Lys		Q5TBY3|Q5TBY6|Q6UWI8	Missense_Mutation	SNP	pfam_Ribosomal_L55_mit	p.E143K	ENST00000411464.2	37	c.427	CCDS1567.1	1	.	.	.	.	.	.	.	.	.	.	C	9.179	1.022991	0.19433	4.54E-4	0.0	ENSG00000162910	ENST00000366732;ENST00000366733;ENST00000366734;ENST00000366735;ENST00000366736;ENST00000366738;ENST00000366741;ENST00000366740;ENST00000366739;ENST00000366742;ENST00000366744;ENST00000348259;ENST00000366747;ENST00000366746;ENST00000295008;ENST00000336520;ENST00000336300;ENST00000430433;ENST00000391867;ENST00000366731;ENST00000411464	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.31247	1.5;1.5;1.5;1.5;1.5;1.5;1.5;1.5;1.5;1.5;1.5;1.5;1.5;1.5;1.5;1.5;1.5;1.5;1.5;1.5;1.5	3.11	-0.931	0.10438	.	0.555880	0.16922	N	0.194035	T	0.15349	0.0370	L	0.28274	0.84	0.09310	N	1	B;B	0.27971	0.196;0.018	B;B	0.17098	0.017;0.012	T	0.13469	-1.0508	10	0.32370	T	0.25	-8.6794	5.6851	0.17799	0.0:0.5818:0.194:0.2241	.	143;107	Q7Z7F7-2;Q7Z7F7	.;RM55_HUMAN	K	104;107;107;107;107;143;107;107;107;107;107;107;107;107;107;107;107;143;107;143;107	ENSP00000355693:E104K;ENSP00000355694:E107K;ENSP00000355695:E107K;ENSP00000355696:E107K;ENSP00000355697:E107K;ENSP00000355699:E143K;ENSP00000355702:E107K;ENSP00000355701:E107K;ENSP00000355700:E107K;ENSP00000355703:E107K;ENSP00000355705:E107K;ENSP00000338189:E107K;ENSP00000355708:E107K;ENSP00000355707:E107K;ENSP00000295008:E107K;ENSP00000337342:E107K;ENSP00000337361:E107K;ENSP00000403614:E143K;ENSP00000375740:E107K;ENSP00000355692:E143K;ENSP00000401737:E107K	ENSP00000295008:E107K	E	-	1	0	MRPL55	226361152	0.004000	0.15560	0.000000	0.03702	0.002000	0.02628	-0.144000	0.10280	-0.122000	0.11766	-1.077000	0.02231	GAG	MRPL55	-	pfam_Ribosomal_L55_mit	ENSG00000162910		0.612	MRPL55-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MRPL55	HGNC	protein_coding	OTTHUMT00000092808.1	-	0.00	77	0	C	XM_059233		228294529	-1	tier1	-	no_errors	ENST00000366731	ensembl	human	known	74_37	missense	51.47	33	35	SNP	0.000	T
MRPS33	51650	genome.wustl.edu	37	7	140710420	140710420	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr7:140710420G>A	ENST00000393008.3	-	2	169	c.14C>T	c.(13-15)tCa>tTa	p.S5L	MRPS33_ENST00000467334.1_Intron|MRPS33_ENST00000496958.1_Missense_Mutation_p.S5L|MRPS33_ENST00000472343.1_5'Flank|MRPS33_ENST00000469351.1_Missense_Mutation_p.S5L|MRPS33_ENST00000324787.5_Missense_Mutation_p.S5L	NM_016071.3	NP_057155.1	Q9Y291	RT33_HUMAN	mitochondrial ribosomal protein S33	5					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)	structural constituent of ribosome (GO:0003735)			breast(2)|endometrium(1)|kidney(1)	4	Melanoma(164;0.00956)					GGCATATTCTGAAAGGGAGGA	0.413																																																	0													103.0	102.0	102.0					7																	140710420		2203	4300	6503	SO:0001583	missense	0			AF078858	CCDS5864.1	7q34	2012-09-13			ENSG00000090263	ENSG00000090263		"""Mitochondrial ribosomal proteins / small subunits"""	16634	protein-coding gene	gene with protein product		611993				11279123, 10810093	Standard	NM_016071		Approved	CGI-139	uc003vwe.4	Q9Y291	OTTHUMG00000157456	ENST00000393008.3:c.14C>T	7.37:g.140710420G>A	ENSP00000376732:p.Ser5Leu			Missense_Mutation	SNP	pfam_Ribosomal_S27/S33_mit	p.S5L	ENST00000393008.3	37	c.14	CCDS5864.1	7	.	.	.	.	.	.	.	.	.	.	G	35	5.425882	0.96131	.	.	ENSG00000090263	ENST00000544013;ENST00000393008;ENST00000324787;ENST00000496958;ENST00000469351	.	.	.	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	D	0.84579	0.5503	M	0.85710	2.77	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.86476	0.1788	9	0.87932	D	0	-12.4406	19.5988	0.95551	0.0:0.0:1.0:0.0	.	5	Q9Y291	RT33_HUMAN	L	5	.	ENSP00000320567:S5L	S	-	2	0	MRPS33	140356889	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.187000	0.94912	2.708000	0.92522	0.591000	0.81541	TCA	MRPS33	-	NULL	ENSG00000090263		0.413	MRPS33-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MRPS33	HGNC	protein_coding	OTTHUMT00000348878.1	-	0.00	84	0	G	NM_053035		140710420	-1	tier1	-	no_errors	ENST00000324787	ensembl	human	known	74_37	missense	25.81	46	16	SNP	1.000	A
MUC16	94025	genome.wustl.edu	37	19	9059054	9059054	+	Silent	SNP	A	A	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr19:9059054A>C	ENST00000397910.4	-	3	28595	c.28392T>G	c.(28390-28392)acT>acG	p.T9464T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9466	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGAAAAGAGAAGTGACAGGGA	0.483																																																	0													109.0	107.0	108.0					19																	9059054		2006	4187	6193	SO:0001819	synonymous_variant	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.28392T>G	19.37:g.9059054A>C			Q6ZQW5|Q96RK2	Silent	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.T9464	ENST00000397910.4	37	c.28392	CCDS54212.1	19																																																																																			MUC16	-	NULL	ENSG00000181143		0.483	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	60	0	A	NM_024690		9059054	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	silent	40.32	74	50	SNP	0.000	C
MUC6	4588	genome.wustl.edu	37	11	1016777	1016777	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr11:1016777G>T	ENST00000421673.2	-	31	6074	c.6024C>A	c.(6022-6024)caC>caA	p.H2008Q		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	2008	Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AAGGTGGAACGTGAGTGGGAA	0.537																																																	0													1121.0	1075.0	1090.0					11																	1016777		2203	4299	6502	SO:0001583	missense	0			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.6024C>A	11.37:g.1016777G>T	ENSP00000406861:p.His2008Gln		O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C	p.H2008Q	ENST00000421673.2	37	c.6024	CCDS44513.1	11	.	.	.	.	.	.	.	.	.	.	G	8.054	0.766569	0.15983	.	.	ENSG00000184956	ENST00000421673	T	0.16897	2.31	3.08	-6.16	0.02098	.	.	.	.	.	T	0.09468	0.0233	L	0.42245	1.32	0.09310	N	1	B	0.23128	0.08	B	0.15052	0.012	T	0.12293	-1.0553	9	0.25751	T	0.34	.	0.5755	0.00702	0.2498:0.3003:0.1474:0.3026	.	2008	Q6W4X9	MUC6_HUMAN	Q	2008	ENSP00000406861:H2008Q	ENSP00000406861:H2008Q	H	-	3	2	MUC6	1006777	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.326000	0.07965	-4.640000	0.00038	0.306000	0.20318	CAC	MUC6	-	NULL	ENSG00000184956		0.537	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC6	HGNC	protein_coding	OTTHUMT00000382120.2	-	0.00	745	0	G	XM_290540		1016777	-1	tier1	-	no_errors	ENST00000421673	ensembl	human	known	74_37	missense	6.54	527	38	SNP	0.000	T
MUC5B	727897	genome.wustl.edu	37	11	1270633	1270633	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr11:1270633C>T	ENST00000529681.1	+	31	12581	c.12523C>T	c.(12523-12525)Cgt>Tgt	p.R4175C	MUC5B_ENST00000447027.1_Missense_Mutation_p.R4178C|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	4175	7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCTCGAGTGCCGTGCCCAGGC	0.692																																																	0													30.0	39.0	36.0					11																	1270633		1865	4078	5943	SO:0001583	missense	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.12523C>T	11.37:g.1270633C>T	ENSP00000436812:p.Arg4175Cys		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.R4178C	ENST00000529681.1	37	c.12532	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	c	8.168	0.791011	0.16258	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.22134	1.97;1.97	3.69	2.75	0.32379	.	.	.	.	.	T	0.51924	0.1703	M	0.91140	3.18	0.22968	N	0.998494	D;D	0.89917	1.0;1.0	D;D	0.72075	0.976;0.976	T	0.44498	-0.9324	9	0.87932	D	0	.	10.9048	0.47073	0.3386:0.6614:0.0:0.0	.	4648;4178	A7Y9J9;E9PBJ0	.;.	C	4175;4178;4119;4025	ENSP00000436812:R4175C;ENSP00000415793:R4178C	ENSP00000343037:R4119C	R	+	1	0	MUC5B	1227209	0.000000	0.05858	0.044000	0.18714	0.027000	0.11550	-0.201000	0.09464	0.669000	0.31146	0.393000	0.25936	CGT	MUC5B	-	NULL	ENSG00000117983		0.692	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	-	0.00	209	0	C	XM_001126093		1270633	+1	tier1	-	no_errors	ENST00000447027	ensembl	human	known	74_37	missense	83.10	24	118	SNP	0.623	T
MYCBP2	23077	genome.wustl.edu	37	13	77663012	77663012	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr13:77663012C>A	ENST00000544440.2	-	61	10583	c.10566G>T	c.(10564-10566)atG>atT	p.M3522I	MYCBP2-AS1_ENST00000450627.2_RNA|MYCBP2_ENST00000357337.6_Missense_Mutation_p.M3522I|MYCBP2-AS1_ENST00000422231.2_RNA|MYCBP2-AS1_ENST00000593933.1_RNA|MYCBP2_ENST00000407578.2_Missense_Mutation_p.M3560I|MYCBP2-AS1_ENST00000448470.2_RNA					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		GGGCCTGTTTCATTGCTATTT	0.368																																																	0													97.0	97.0	97.0					13																	77663012		2203	4300	6503	SO:0001583	missense	0			AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.10566G>T	13.37:g.77663012C>A	ENSP00000444596:p.Met3522Ile			Missense_Mutation	SNP	pfam_PHR,pfam_Reg_chr_condens,pfam_Filamin/ABP280_repeat-like,superfamily_RCC1/BLIP-II,superfamily_Galactose-bd-like,superfamily_Ig_E-set,superfamily_ARM-type_fold,smart_Znf_RING,pfscan_Filamin/ABP280_repeat-like,pfscan_Znf_RING,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.M3560I	ENST00000544440.2	37	c.10680		13	.	.	.	.	.	.	.	.	.	.	C	20.4	3.987958	0.74589	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	T;T;T	0.36157	1.28;1.27;1.28	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.44498	0.1296	L	0.41492	1.28	0.80722	D	1	P	0.35872	0.525	P	0.45428	0.48	T	0.38436	-0.9661	10	0.72032	D	0.01	.	19.6914	0.96002	0.0:1.0:0.0:0.0	.	3522	O75592	MYCB2_HUMAN	I	3522;3560;3522	ENSP00000349892:M3522I;ENSP00000384288:M3560I;ENSP00000444596:M3522I	ENSP00000349892:M3522I	M	-	3	0	MYCBP2	76561013	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.809000	0.86057	2.644000	0.89710	0.563000	0.77884	ATG	MYCBP2	-	superfamily_ARM-type_fold	ENSG00000005810		0.368	MYCBP2-001	KNOWN	basic	protein_coding	MYCBP2	HGNC	protein_coding	OTTHUMT00000045326.1	-	0.00	39	0	C	NM_015057		77663012	-1	tier1	-	no_errors	ENST00000407578	ensembl	human	known	74_37	missense	9.68	28	3	SNP	1.000	A
MYL3	4634	genome.wustl.edu	37	3	46904847	46904847	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr3:46904847C>A	ENST00000395869.1	-	1	85	c.34G>T	c.(34-36)Gat>Tat	p.D12Y	MYL3_ENST00000292327.4_Missense_Mutation_p.D12Y			P08590	MYL3_HUMAN	myosin, light chain 3, alkali; ventricular, skeletal, slow	12					cardiac muscle contraction (GO:0060048)|muscle filament sliding (GO:0030049)|positive regulation of ATPase activity (GO:0032781)|regulation of striated muscle contraction (GO:0006942)|regulation of the force of heart contraction (GO:0002026)|skeletal muscle tissue development (GO:0007519)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	A band (GO:0031672)|cytosol (GO:0005829)|I band (GO:0031674)|muscle myosin complex (GO:0005859)|sarcomere (GO:0030017)	actin monomer binding (GO:0003785)|calcium ion binding (GO:0005509)|motor activity (GO:0003774)|myosin II heavy chain binding (GO:0032038)|structural constituent of muscle (GO:0008307)			breast(1)|lung(2)	3				BRCA - Breast invasive adenocarcinoma(193;0.00116)|KIRC - Kidney renal clear cell carcinoma(197;0.00557)|Kidney(197;0.0063)		GCCTTGGCATCATCCTTCTTG	0.592																																					Melanoma(166;130 1949 2249 18977 46142)												0													70.0	72.0	71.0					3																	46904847		2203	4300	6503	SO:0001583	missense	0				CCDS2746.1	3p	2014-09-17	2006-09-29		ENSG00000160808	ENSG00000160808		"""Myosins / Light chain"", ""EF-hand domain containing"""	7584	protein-coding gene	gene with protein product		160790	"""myosin, light polypeptide 3, alkali; ventricular, skeletal, slow"""			1479618, 2784124	Standard	NM_000258		Approved	CMH8, VLC1, MLC1V, MLC1SB	uc003cql.1	P08590	OTTHUMG00000133516	ENST00000395869.1:c.34G>T	3.37:g.46904847C>A	ENSP00000379210:p.Asp12Tyr		B2R534|Q9NRS8	Missense_Mutation	SNP	pfscan_EF_hand_dom	p.D12Y	ENST00000395869.1	37	c.34	CCDS2746.1	3	.	.	.	.	.	.	.	.	.	.	C	12.62	1.992957	0.35131	.	.	ENSG00000160808	ENST00000395869;ENST00000292327;ENST00000431168	D;D	0.84589	-1.87;-1.87	4.78	3.9	0.45041	.	2.132630	0.02133	N	0.056562	T	0.80325	0.4602	L	0.34521	1.04	0.09310	N	1	P	0.34546	0.456	B	0.27380	0.079	T	0.68780	-0.5318	10	0.59425	D	0.04	-3.8835	11.255	0.49048	0.0:0.91:0.0:0.09	.	12	P08590	MYL3_HUMAN	Y	12	ENSP00000379210:D12Y;ENSP00000292327:D12Y	ENSP00000292327:D12Y	D	-	1	0	MYL3	46879851	0.994000	0.37717	0.071000	0.20095	0.949000	0.60115	4.226000	0.58606	1.364000	0.46038	0.561000	0.74099	GAT	MYL3	-	NULL	ENSG00000160808		0.592	MYL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MYL3	HGNC	protein_coding	OTTHUMT00000259165.2	-	0.00	103	0	C	NM_000258		46904847	-1	tier1	-	no_errors	ENST00000292327	ensembl	human	known	74_37	missense	5.15	92	5	SNP	0.084	A
MYH15	22989	genome.wustl.edu	37	3	108127151	108127151	+	Silent	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr3:108127151G>T	ENST00000273353.3	-	33	4712	c.4656C>A	c.(4654-4656)gtC>gtA	p.V1552V		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	1552						cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						GTGTCACCTGGACTTCTGTCT	0.403																																																	0													234.0	218.0	223.0					3																	108127151		1890	4127	6017	SO:0001819	synonymous_variant	0			AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.4656C>A	3.37:g.108127151G>T				Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_Lambda_DNA-bd_dom,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	p.V1552	ENST00000273353.3	37	c.4656	CCDS43127.1	3																																																																																			MYH15	-	pfam_Myosin_tail	ENSG00000144821		0.403	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH15	HGNC	protein_coding	OTTHUMT00000353935.1	-	0.00	31	0	G	XM_036988		108127151	-1	tier1	-	no_errors	ENST00000273353	ensembl	human	known	74_37	silent	6.25	60	4	SNP	0.625	T
MYLK	4638	genome.wustl.edu	37	3	123368043	123368044	+	Splice_Site	INS	-	-	G	rs41431347|rs200371896	byFrequency	TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr3:123368043_123368044insG	ENST00000475616.1	-	22	4288		c.e22-2		MYLK_ENST00000354792.5_Splice_Site|MYLK_ENST00000359169.1_Splice_Site|MYLK_ENST00000360772.3_Splice_Site|MYLK_ENST00000360304.3_Splice_Site|MYLK_ENST00000346322.5_Splice_Site			Q15746	MYLK_HUMAN	myosin light chain kinase						actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		CCTTCGGCTCTGGGGGGGGCAC	0.624													?|GGGGGGGG|GGGGGGGGG|unsure	129	0.0257588	0.034	0.0303	5008	,	,		18148	0.0089		0.0348	False		,,,				2504	0.0194																0																																										SO:0001630	splice_region_variant	0			X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.4289-2->C	3.37:g.123368051_123368051dupG			B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Splice_Site	INS	-	e22-2	ENST00000475616.1	37	c.4289-3_4289-2	CCDS46896.1	3																																																																																			MYLK	-	-	ENSG00000065534		0.624	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYLK	HGNC	protein_coding	OTTHUMT00000356464.1		0.00	57	0	0	NM_053025	Intron	123368044	-1			no_errors	ENST00000360304	ensembl	human	known	74_37	splice_site_ins	7.14	78	6	INS	0.975:0.100	G
MYO18B	84700	genome.wustl.edu	37	22	26231269	26231269	+	Silent	SNP	T	T	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr22:26231269T>C	ENST00000407587.2	+	17	3239	c.3070T>C	c.(3070-3072)Tta>Cta	p.L1024L	MYO18B_ENST00000536101.1_Silent_p.L1023L|MYO18B_ENST00000335473.7_Silent_p.L1023L			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1023	Myosin motor.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						GCAGGTCCGCTTACCAGCTGG	0.572																																																	0													37.0	39.0	38.0					22																	26231269		1897	4123	6020	SO:0001819	synonymous_variant	0			AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.3070T>C	22.37:g.26231269T>C			B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Silent	SNP	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,superfamily_tRNA-bd_arm,superfamily_Ribosomal_zn-bd,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.L1023	ENST00000407587.2	37	c.3067		22																																																																																			MYO18B	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000133454		0.572	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	MYO18B	HGNC	protein_coding	OTTHUMT00000400691.1	-	0.00	53	0	T	NM_032608		26231269	+1	tier1	-	no_errors	ENST00000335473	ensembl	human	known	74_37	silent	66.67	26	52	SNP	0.003	C
MYO1A	4640	genome.wustl.edu	37	12	57432204	57432204	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr12:57432204G>T	ENST00000442789.2	-	18	2039	c.1752C>A	c.(1750-1752)aaC>aaA	p.N584K	MYO1A_ENST00000300119.3_Missense_Mutation_p.N584K|MYO1A_ENST00000544473.1_Missense_Mutation_p.N422K|MYO1A_ENST00000476795.1_5'Flank	NM_001256041.1	NP_001242970.1	Q9UBC5	MYO1A_HUMAN	myosin IA	584	Actin-binding. {ECO:0000255}.|Myosin motor.				microvillus assembly (GO:0030033)|sensory perception of sound (GO:0007605)|vesicle localization (GO:0051648)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|brush border (GO:0005903)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|lateral plasma membrane (GO:0016328)|microvillus (GO:0005902)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(7)|urinary_tract(3)	50						ACCTGATGTAGTTGGGGCTCT	0.547																																																	0													51.0	47.0	48.0					12																	57432204		2203	4300	6503	SO:0001583	missense	0			L29137	CCDS8929.1	12q13-q15	2011-09-27			ENSG00000166866	ENSG00000166866		"""Myosins / Myosin superfamily : Class I"""	7595	protein-coding gene	gene with protein product		601478		MYHL, DFNA48		8884266, 12736868	Standard	NM_001256041		Approved		uc009zpd.3	Q9UBC5	OTTHUMG00000149899	ENST00000442789.2:c.1752C>A	12.37:g.57432204G>T	ENSP00000393392:p.Asn584Lys		Q9UQD7	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.N584K	ENST00000442789.2	37	c.1752	CCDS8929.1	12	.	.	.	.	.	.	.	.	.	.	G	19.13	3.767321	0.69878	.	.	ENSG00000166866	ENST00000300119;ENST00000442789;ENST00000544473	T;T;T	0.71341	-0.56;-0.56;-0.56	4.94	3.11	0.35812	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.83128	0.5187	M	0.84511	2.7	0.46499	D	0.999073	D	0.89917	1.0	D	0.87578	0.998	T	0.82504	-0.0424	10	0.52906	T	0.07	.	9.8519	0.41061	0.1714:0.0:0.8286:0.0	.	584	Q9UBC5	MYO1A_HUMAN	K	584;584;422	ENSP00000300119:N584K;ENSP00000393392:N584K;ENSP00000440514:N422K	ENSP00000300119:N584K	N	-	3	2	MYO1A	55718471	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.581000	0.53914	0.621000	0.30232	0.561000	0.74099	AAC	MYO1A	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000166866		0.547	MYO1A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MYO1A	HGNC	protein_coding	OTTHUMT00000313833.2		0.00	52	0	G	NM_005379		57432204	-1			no_errors	ENST00000300119	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	T
MYOC	4653	genome.wustl.edu	37	1	171605844	171605844	+	Nonsense_Mutation	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:171605844C>A	ENST00000037502.6	-	3	807	c.736G>T	c.(736-738)Gga>Tga	p.G246*		NM_000261.1	NP_000252.1	Q99972	MYOC_HUMAN	myocilin, trabecular meshwork inducible glucocorticoid response	246	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.		G -> R (in GLC1A). {ECO:0000269|PubMed:9328473}.		bone development (GO:0060348)|clustering of voltage-gated sodium channels (GO:0045162)|ERBB2-ERBB3 signaling pathway (GO:0038133)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neuron projection development (GO:0031175)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|osteoblast differentiation (GO:0001649)|positive regulation of cell migration (GO:0030335)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of MAPK cascade (GO:0043408)|skeletal muscle hypertrophy (GO:0014734)	cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|node of Ranvier (GO:0033268)|proteinaceous extracellular matrix (GO:0005578)	fibronectin binding (GO:0001968)|frizzled binding (GO:0005109)|myosin light chain binding (GO:0032027)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|prostate(1)|urinary_tract(2)	28	all_cancers(6;5.47e-10)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					ACTAGTTCTCCACATCCTGGT	0.473																																																	0			GRCh37	CM971019	MYOC	M							69.0	73.0	72.0					1																	171605844		2203	4300	6503	SO:0001587	stop_gained	0			BC029261	CCDS1297.1	1q23-q24	2008-02-05			ENSG00000034971	ENSG00000034971			7610	protein-coding gene	gene with protein product		601652		GLC1A		9169133, 9005853	Standard	NM_000261		Approved	TIGR, JOAG1	uc001ghu.3	Q99972	OTTHUMG00000034789	ENST00000037502.6:c.736G>T	1.37:g.171605844C>A	ENSP00000037502:p.Gly246*		B2RD84|O00620|Q7Z6Q9	Nonsense_Mutation	SNP	pfam_Olfac-like,smart_Olfac-like,pfscan_Olfac-like	p.G246*	ENST00000037502.6	37	c.736	CCDS1297.1	1	.	.	.	.	.	.	.	.	.	.	C	18.15	3.560297	0.65538	.	.	ENSG00000034971	ENST00000037502;ENST00000357746;ENST00000536591;ENST00000537133	.	.	.	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.5426	0.91035	0.0:1.0:0.0:0.0	.	.	.	.	X	246;199;179;246	.	ENSP00000037502:G246X	G	-	1	0	MYOC	169872467	1.000000	0.71417	0.499000	0.27577	0.187000	0.23431	7.410000	0.80065	2.719000	0.93026	0.555000	0.69702	GGA	MYOC	-	smart_Olfac-like,pfscan_Olfac-like	ENSG00000034971		0.473	MYOC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOC	HGNC	protein_coding	OTTHUMT00000084178.2		0.00	42	0	C	NM_000261		171605844	-1			no_errors	ENST00000037502	ensembl	human	known	74_37	nonsense	5.56	68	4	SNP	1.000	A
MYRF	745	genome.wustl.edu	37	11	61541595	61541595	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr11:61541595G>T	ENST00000278836.5	+	8	1368	c.1272G>T	c.(1270-1272)aaG>aaT	p.K424N	MYRF_ENST00000265460.5_Missense_Mutation_p.K415N|TMEM258_ENST00000535042.1_5'UTR|MYRF_ENST00000327797.1_Missense_Mutation_p.K51N	NM_001127392.1	NP_001120864.1	Q9Y2G1	MRF_HUMAN	myelin regulatory factor	424					central nervous system myelin maintenance (GO:0032286)|central nervous system myelination (GO:0022010)|oligodendrocyte development (GO:0014003)|oligodendrocyte differentiation (GO:0048709)|positive regulation of myelination (GO:0031643)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)										AGGGCCTCAAGCCCCTCGACT	0.592																																																	0													49.0	43.0	45.0					11																	61541595		2202	4299	6501	SO:0001583	missense	0				CCDS31579.1, CCDS44622.1	11q12-q13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000124920	ENSG00000124920			1181	protein-coding gene	gene with protein product	"""myelin gene regulatory factor"""	608329	"""chromosome 11 open reading frame 9"""	C11orf9		10828591, 12384578	Standard	NM_001127392		Approved	Ndt80, pqn-47, MRF	uc001nsc.1	Q9Y2G1	OTTHUMG00000168161	ENST00000278836.5:c.1272G>T	11.37:g.61541595G>T	ENSP00000278836:p.Lys424Asn		O43582|Q9P1Q6	Missense_Mutation	SNP	pfam_NDT80_DNA-bd_dom,superfamily_p53-like_TF_DNA-bd	p.K424N	ENST00000278836.5	37	c.1272	CCDS44622.1	11	.	.	.	.	.	.	.	.	.	.	G	22.5	4.294625	0.81025	.	.	ENSG00000124920	ENST00000278836;ENST00000265460;ENST00000327797	T;T;T	0.48201	1.34;1.35;0.82	4.52	4.52	0.55395	NDT80 DNA-binding domain (2);p53-like transcription factor, DNA-binding (1);	0.249286	0.41294	D	0.000904	T	0.53254	0.1785	L	0.58669	1.825	0.52501	D	0.99995	B;B	0.33777	0.216;0.425	B;B	0.43950	0.437;0.324	T	0.57528	-0.7796	10	0.59425	D	0.04	-20.1586	13.2364	0.59971	0.0799:0.0:0.9201:0.0	.	415;424	Q9Y2G1-2;Q9Y2G1	.;MRF_HUMAN	N	424;415;51	ENSP00000278836:K424N;ENSP00000265460:K415N;ENSP00000333261:K51N	ENSP00000265460:K415N	K	+	3	2	C11orf9	61298171	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.058000	0.57463	2.527000	0.85204	0.462000	0.41574	AAG	MYRF	-	pfam_NDT80_DNA-bd_dom,superfamily_p53-like_TF_DNA-bd	ENSG00000124920		0.592	MYRF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYRF	HGNC	protein_coding	OTTHUMT00000398519.2	-	0.00	76	0	G	NM_013279		61541595	+1	tier1	-	no_errors	ENST00000278836	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	T
N4BP1	9683	genome.wustl.edu	37	16	48595560	48595560	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr16:48595560C>T	ENST00000262384.3	-	2	1230	c.994G>A	c.(994-996)Gaa>Aaa	p.E332K	RP11-44I10.3_ENST00000563994.1_RNA	NM_153029.3	NP_694574.3	O75113	N4BP1_HUMAN	NEDD4 binding protein 1	332					cellular response to UV (GO:0034644)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein ubiquitination (GO:0031397)	nucleolus (GO:0005730)|PML body (GO:0016605)				breast(3)|kidney(2)|lung(11)|urinary_tract(1)	17		all_cancers(37;0.179)|all_lung(18;0.11)				CTTAAATTTTCAGAATCAGCA	0.363																																																	0													66.0	66.0	66.0					16																	48595560		1808	4068	5876	SO:0001583	missense	0			AK026937	CCDS45479.1	16q12.1	2008-01-18				ENSG00000102921			29850	protein-coding gene	gene with protein product						9734811, 11717310	Standard	NM_153029		Approved		uc002efp.3	O75113		ENST00000262384.3:c.994G>A	16.37:g.48595560C>T	ENSP00000262384:p.Glu332Lys		A7MD49|Q2YDX1	Missense_Mutation	SNP	pfam_RNase_Zc3h12	p.E332K	ENST00000262384.3	37	c.994	CCDS45479.1	16	.	.	.	.	.	.	.	.	.	.	C	13.82	2.350731	0.41599	.	.	ENSG00000102921	ENST00000262384	T	0.49139	0.79	5.97	4.0	0.46444	.	0.656314	0.16165	N	0.226565	T	0.34308	0.0893	L	0.27053	0.805	0.26429	N	0.975976	B	0.26876	0.162	B	0.17979	0.02	T	0.24261	-1.0165	10	0.48119	T	0.1	-8.3763	12.3663	0.55230	0.0:0.8604:0.0:0.1396	.	332	O75113	N4BP1_HUMAN	K	332	ENSP00000262384:E332K	ENSP00000262384:E332K	E	-	1	0	N4BP1	47153061	0.683000	0.27633	0.023000	0.16930	0.744000	0.42396	1.231000	0.32624	1.508000	0.48769	0.655000	0.94253	GAA	N4BP1	-	NULL	ENSG00000102921		0.363	N4BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	N4BP1	HGNC	protein_coding	OTTHUMT00000429920.1	-	0.00	21	0	C	NM_014664		48595560	-1	tier1	-	no_errors	ENST00000262384	ensembl	human	known	74_37	missense	36.36	21	12	SNP	0.718	T
NBPF1	55672	genome.wustl.edu	37	1	16921146	16921146	+	5'UTR	SNP	T	T	C	rs1759165	byFrequency	TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:16921146T>C	ENST00000430580.2	-	0	511					NM_017940.3	NP_060410.2	Q3BBV0	NBPF1_HUMAN	neuroblastoma breakpoint family, member 1							cytoplasm (GO:0005737)									UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TCGGGCTCCTTCCAAGGCTCC	0.527																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AB051480		1p36.13	2013-01-30			ENSG00000219481	ENSG00000219481		"""neuroblastoma breakpoint family"""	26088	protein-coding gene	gene with protein product		610501				11214970, 16079250	Standard	NM_017940		Approved	FLJ20719, KIAA1693	uc001ayw.4	Q3BBV0	OTTHUMG00000002487	ENST00000430580.2:c.-377A>G	1.37:g.16921146T>C			Q8N4E8|Q9C0H0	RNA	SNP	-	NULL	ENST00000430580.2	37	NULL		1																																																																																			NBPF1	-	-	ENSG00000219481		0.527	NBPF1-005	NOVEL	upstream_uORF|basic|appris_principal	protein_coding	NBPF1	HGNC	protein_coding	OTTHUMT00000106436.3	-	0.00	8	0	T	NM_017940		16921146	-1	tier1	rs1759165	no_errors	ENST00000420513	ensembl	human	known	74_37	rna	20.00	16	4	SNP	0.001	C
NCKAP5	344148	genome.wustl.edu	37	2	133554203	133554203	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr2:133554203G>T	ENST00000409261.1	-	12	1280	c.907C>A	c.(907-909)Cac>Aac	p.H303N	NCKAP5_ENST00000317721.6_Missense_Mutation_p.H303N|NCKAP5_ENST00000405974.3_Missense_Mutation_p.H303N|NCKAP5_ENST00000409213.1_Missense_Mutation_p.H303N	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	303										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						AAACTCACGTGCACCTCAGCA	0.438																																																	0													71.0	71.0	71.0					2																	133554203		1950	4147	6097	SO:0001583	missense	0			AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.907C>A	2.37:g.133554203G>T	ENSP00000387128:p.His303Asn		B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	NULL	p.H303N	ENST00000409261.1	37	c.907	CCDS46418.1	2	.	.	.	.	.	.	.	.	.	.	G	12.63	1.997085	0.35226	.	.	ENSG00000176771	ENST00000409261;ENST00000409213;ENST00000317721;ENST00000405974;ENST00000537661	T;T;T;T	0.43688	2.93;0.94;2.93;0.94	5.35	4.47	0.54385	.	0.529195	0.13743	U	0.365838	T	0.45478	0.1344	N	0.19112	0.55	0.09310	N	1	P;D	0.63880	0.867;0.993	B;P	0.59424	0.439;0.857	T	0.35822	-0.9773	10	0.59425	D	0.04	.	12.7616	0.57367	0.0755:0.0:0.9245:0.0	.	303;303	O14513-2;O14513	.;NCKP5_HUMAN	N	303	ENSP00000387128:H303N;ENSP00000386952:H303N;ENSP00000380603:H303N;ENSP00000385692:H303N	ENSP00000380603:H303N	H	-	1	0	NCKAP5	133270673	0.943000	0.32029	0.048000	0.18961	0.992000	0.81027	4.742000	0.62103	1.632000	0.50472	0.655000	0.94253	CAC	NCKAP5	-	NULL	ENSG00000176771		0.438	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCKAP5	HGNC	protein_coding	OTTHUMT00000331663.1	-	0.00	32	0	G	NM_207481		133554203	-1	tier1	-	no_errors	ENST00000317721	ensembl	human	known	74_37	missense	8.00	46	4	SNP	0.073	T
NDUFA1	4694	genome.wustl.edu	37	X	119005968	119005968	+	Missense_Mutation	SNP	G	G	T	rs1801316	byFrequency	TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chrX:119005968G>T	ENST00000371437.4	+	1	519	c.94G>T	c.(94-96)Ggg>Tgg	p.G32W	RNF113A_ENST00000371442.2_5'Flank	NM_004541.3	NP_004532.1	O15239	NDUA1_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa	32			G -> R (in dbSNP:rs1801316).		cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)	p.G32R(1)		endometrium(1)|kidney(1)|large_intestine(2)|stomach(1)	5						GTTCACTAACGGGGGCAAGGT	0.617																																																	1	Substitution - Missense(1)	large_intestine(1)											106.0	92.0	96.0					X																	119005968		2203	4300	6503	SO:0001583	missense	0				CCDS14590.1	Xq24	2011-07-04	2002-08-29		ENSG00000125356	ENSG00000125356		"""Mitochondrial respiratory chain complex / Complex I"""	7683	protein-coding gene	gene with protein product	"""NADH:ubiquinone oxidoreductase (complex 1)"", ""type I dehydrogenase"", ""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1 (7.5kD, MWFE)"", ""complex I MWFE subunit"""	300078	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1 (7.5kD, MWFE)"""			8938439	Standard	NM_004541		Approved	MWFE, CI-MWFE	uc004esc.4	O15239	OTTHUMG00000022287	ENST00000371437.4:c.94G>T	X.37:g.119005968G>T	ENSP00000360492:p.Gly32Trp			Missense_Mutation	SNP	pirsf_NADH_Ub_cplx-1_asu_su-1	p.G32W	ENST00000371437.4	37	c.94	CCDS14590.1	X	.	.	.	.	.	.	.	.	.	.	G	14.62	2.590818	0.46214	.	.	ENSG00000125356	ENST00000371437	T	0.78126	-1.15	5.55	3.79	0.43588	.	0.098623	0.64402	D	0.000001	D	0.86326	0.5906	.	.	.	0.52501	D	0.999953	D	0.89917	1.0	D	0.83275	0.996	D	0.85251	0.1044	9	0.87932	D	0	-14.0394	8.269	0.31833	0.1835:0.0:0.8165:0.0	.	32	O15239	NDUA1_HUMAN	W	32	ENSP00000360492:G32W	ENSP00000360492:G32W	G	+	1	0	NDUFA1	118889996	1.000000	0.71417	0.831000	0.32960	0.084000	0.17831	3.706000	0.54830	0.536000	0.28733	0.600000	0.82982	GGG	NDUFA1	-	pirsf_NADH_Ub_cplx-1_asu_su-1	ENSG00000125356		0.617	NDUFA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFA1	HGNC	protein_coding	OTTHUMT00000058080.1	-	0.00	61	0	G	NM_004541		119005968	+1	tier1	-	no_errors	ENST00000371437	ensembl	human	known	74_37	missense	7.41	50	4	SNP	0.907	T
NEU2	4759	genome.wustl.edu	37	2	233899463	233899463	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr2:233899463C>A	ENST00000233840.3	+	2	839	c.839C>A	c.(838-840)cCc>cAc	p.P280H		NM_005383.2	NP_005374.2	Q9Y3R4	NEUR2_HUMAN	sialidase 2 (cytosolic sialidase)	280					ganglioside catabolic process (GO:0006689)|glycosphingolipid metabolic process (GO:0006687)|oligosaccharide catabolic process (GO:0009313)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	exo-alpha-(2->3)-sialidase activity (GO:0052794)|exo-alpha-(2->6)-sialidase activity (GO:0052795)|exo-alpha-(2->8)-sialidase activity (GO:0052796)			endometrium(3)|large_intestine(2)|lung(10)|skin(2)|urinary_tract(1)	18		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0271)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0839)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000311)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)|GBM - Glioblastoma multiforme(43;0.0488)	Oseltamivir(DB00198)|Zanamivir(DB00558)	ATCAGCTTCCCCAGCCCCCGC	0.672																																																	0													19.0	23.0	22.0					2																	233899463		2201	4295	6496	SO:0001583	missense	0			Y16535	CCDS2501.1	2q37	2008-05-27			ENSG00000115488	ENSG00000115488			7759	protein-coding gene	gene with protein product	"""N-acetyl-alpha-neuraminidase 2"""	605528				10191093, 14613940	Standard	NM_005383		Approved	SIAL2	uc010zmn.2	Q9Y3R4	OTTHUMG00000133274	ENST00000233840.3:c.839C>A	2.37:g.233899463C>A	ENSP00000233840:p.Pro280His		Q3KNW4|Q6NTB4	Missense_Mutation	SNP	superfamily_Sialidases	p.P280H	ENST00000233840.3	37	c.839	CCDS2501.1	2	.	.	.	.	.	.	.	.	.	.	C	11.45	1.643049	0.29246	.	.	ENSG00000115488	ENST00000233840	D	0.90732	-2.72	4.06	3.14	0.36123	Neuraminidase (2);	0.198149	0.36034	N	0.002829	D	0.89255	0.6663	L	0.56769	1.78	0.34328	D	0.68734	B	0.26775	0.159	B	0.37989	0.262	D	0.89115	0.3499	10	0.38643	T	0.18	-31.1754	10.6289	0.45523	0.201:0.799:0.0:0.0	.	280	Q9Y3R4	NEUR2_HUMAN	H	280	ENSP00000233840:P280H	ENSP00000233840:P280H	P	+	2	0	NEU2	233607707	0.415000	0.25416	0.870000	0.34147	0.476000	0.33039	1.969000	0.40510	0.980000	0.38523	0.655000	0.94253	CCC	NEU2	-	superfamily_Sialidases	ENSG00000115488		0.672	NEU2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEU2	HGNC	protein_coding	OTTHUMT00000257053.2		0.00	64	0	C	NM_005383		233899463	+1			no_errors	ENST00000233840	ensembl	human	known	74_37	missense	8.00	69	6	SNP	0.996	A
NFAT5	10725	genome.wustl.edu	37	16	69727099	69727099	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr16:69727099C>T	ENST00000354436.2	+	12	3635	c.3317C>T	c.(3316-3318)aCa>aTa	p.T1106I	NFAT5_ENST00000349945.1_Missense_Mutation_p.T1030I|NFAT5_ENST00000566899.1_Missense_Mutation_p.T1030I|NFAT5_ENST00000393742.2_Missense_Mutation_p.T1030I|NFAT5_ENST00000567239.1_Missense_Mutation_p.T1123I|NFAT5_ENST00000432919.1_Missense_Mutation_p.T1124I	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive	1106					cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						CAGACTTCTACAACCTCCTCT	0.453																																																	0													101.0	102.0	102.0					16																	69727099		2198	4300	6498	SO:0001583	missense	0			AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.3317C>T	16.37:g.69727099C>T	ENSP00000346420:p.Thr1106Ile		A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	Missense_Mutation	SNP	pfam_RHD,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT,pfscan_RHD,prints_NFAT	p.T1124I	ENST00000354436.2	37	c.3371	CCDS10881.1	16	.	.	.	.	.	.	.	.	.	.	C	13.47	2.246173	0.39697	.	.	ENSG00000102908	ENST00000432919;ENST00000426654;ENST00000349945;ENST00000354436;ENST00000393742	T;T;T;T	0.52295	0.69;0.67;0.67;0.67	5.83	5.83	0.93111	.	0.130161	0.52532	D	0.000066	T	0.43055	0.1230	L	0.43152	1.355	0.48901	D	0.999727	P;B;B	0.35433	0.501;0.18;0.281	B;B;B	0.29942	0.109;0.076;0.076	T	0.30446	-0.9978	10	0.41790	T	0.15	-3.1267	20.1162	0.97934	0.0:1.0:0.0:0.0	.	1123;1106;1124	A2RRB4;O94916;E9PHR7	.;NFAT5_HUMAN;.	I	1124;1123;1030;1106;1030	ENSP00000396538:T1124I;ENSP00000338806:T1030I;ENSP00000346420:T1106I;ENSP00000377343:T1030I	ENSP00000338806:T1030I	T	+	2	0	NFAT5	68284600	0.997000	0.39634	0.995000	0.50966	0.987000	0.75469	5.359000	0.66074	2.756000	0.94617	0.655000	0.94253	ACA	NFAT5	-	NULL	ENSG00000102908		0.453	NFAT5-001	KNOWN	basic|CCDS	protein_coding	NFAT5	HGNC	protein_coding	OTTHUMT00000268952.2	-	0.00	47	0	C	NM_138714		69727099	+1	tier1	-	no_errors	ENST00000432919	ensembl	human	known	74_37	missense	5.88	64	4	SNP	0.989	T
NLGN4X	57502	genome.wustl.edu	37	X	6069501	6069501	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chrX:6069501G>A	ENST00000381095.3	-	2	634	c.7C>T	c.(7-9)Cgg>Tgg	p.R3W	NLGN4X_ENST00000469740.1_5'UTR|NLGN4X_ENST00000381092.1_Missense_Mutation_p.R3W|NLGN4X_ENST00000275857.6_Missense_Mutation_p.R3W|NLGN4X_ENST00000538097.1_Missense_Mutation_p.R3W|NLGN4X_ENST00000381093.2_Missense_Mutation_p.R3W	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	3					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)			breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						CCCTGGGGCCGTGACATGGTT	0.532													G|||	1	0.000264901	0.0	0.0	3775	,	,		14236	0.001		0.0	False		,,,				2504	0.0																0													74.0	53.0	60.0					X																	6069501		2203	4300	6503	SO:0001583	missense	0			AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.7C>T	X.37:g.6069501G>A	ENSP00000370485:p.Arg3Trp		Q6UX10|Q9ULG0	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Neuroligin	p.R3W	ENST00000381095.3	37	c.7	CCDS14126.1	X	.	.	.	.	.	.	.	.	.	.	G	6.620	0.482807	0.12581	.	.	ENSG00000146938	ENST00000381095;ENST00000381093;ENST00000275857;ENST00000381092;ENST00000538097	T;T;T;T;T	0.67345	-0.26;-0.25;-0.26;-0.26;-0.26	4.07	2.89	0.33648	.	.	.	.	.	T	0.38799	0.1054	N	0.08118	0	0.29310	N	0.868061	P;B;B	0.41159	0.74;0.0;0.0	B;B;B	0.26969	0.075;0.0;0.001	T	0.23332	-1.0191	9	0.56958	D	0.05	.	9.2914	0.37789	0.0:0.0:0.2027:0.7973	.	3;3;3	A6NMU8;Q8N0W4;Q8N0W4-2	.;NLGNX_HUMAN;.	W	3	ENSP00000370485:R3W;ENSP00000370483:R3W;ENSP00000275857:R3W;ENSP00000370482:R3W;ENSP00000439203:R3W	ENSP00000275857:R3W	R	-	1	2	NLGN4X	6079501	0.979000	0.34478	0.193000	0.23327	0.244000	0.25665	0.986000	0.29590	0.343000	0.23821	-0.371000	0.07208	CGG	NLGN4X	-	NULL	ENSG00000146938		0.532	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	NLGN4X	HGNC	protein_coding	OTTHUMT00000055673.1	-	0.00	34	0	G	NM_020742		6069501	-1	tier1	-	no_errors	ENST00000381093	ensembl	human	known	74_37	missense	74.51	13	38	SNP	0.967	A
NOS2	4843	genome.wustl.edu	37	17	26093544	26093544	+	Silent	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr17:26093544C>T	ENST00000313735.6	-	19	2471	c.2238G>A	c.(2236-2238)ccG>ccA	p.P746P		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	746	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	ACCTGGATGTCGGACTTTGTA	0.483																																																	0													298.0	260.0	273.0					17																	26093544		2203	4300	6503	SO:0001819	synonymous_variant	0			U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.2238G>A	17.37:g.26093544C>T			A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Silent	SNP	pfam_NO_synthase_oxygenase_dom,pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,superfamily_NO_synthase_oxygenase_dom,superfamily_Riboflavin_synthase-like_b-brl,pirsf_NOS_euk,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.P746	ENST00000313735.6	37	c.2238	CCDS11223.1	17																																																																																			NOS2	-	pfam_FAD-binding_1,superfamily_Riboflavin_synthase-like_b-brl,pirsf_NOS_euk	ENSG00000007171		0.483	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOS2	HGNC	protein_coding	OTTHUMT00000255597.1	-	0.00	75	0	C	NM_000625		26093544	-1	tier1	-	no_errors	ENST00000313735	ensembl	human	known	74_37	silent	30.93	67	30	SNP	0.000	T
NPFFR1	64106	genome.wustl.edu	37	10	72020484	72020484	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr10:72020484C>T	ENST00000277942.6	-	3	333	c.334G>A	c.(334-336)Gac>Aac	p.D112N		NM_022146.4	NP_071429.1	Q9GZQ6	NPFF1_HUMAN	neuropeptide FF receptor 1	112					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)			endometrium(2)|lung(1)	3						GTGGCATTGTCGAAGGGCCAC	0.577																																																	0													40.0	45.0	44.0					10																	72020484		2035	4190	6225	SO:0001583	missense	0			AB040104	CCDS53539.1	10q21-q22	2012-08-10	2006-02-15	2006-02-15	ENSG00000148734	ENSG00000148734		"""GPCR / Class A :  Neuropeptide receptors : FF/AF"", ""GPCR / Class A : RF amide peptide receptors"""	17425	protein-coding gene	gene with protein product	"""neuropeptide FF 1"""	607448	"""G protein-coupled receptor 147"""	GPR147		11024015	Standard	NM_022146		Approved	OT7T022, NPFF1R1	uc021psj.1	Q9GZQ6	OTTHUMG00000018404	ENST00000277942.6:c.334G>A	10.37:g.72020484C>T	ENSP00000277942:p.Asp112Asn		A2RRF0|Q8NGR0|Q96RN3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_NPFF_rcpt_1,prints_NPFF_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt	p.D112N	ENST00000277942.6	37	c.334	CCDS53539.1	10	.	.	.	.	.	.	.	.	.	.	C	26.5	4.747740	0.89663	.	.	ENSG00000148734	ENST00000449957;ENST00000277942	T;T	0.36340	1.26;1.26	4.39	4.39	0.52855	GPCR, rhodopsin-like superfamily (1);	0.301220	0.36066	N	0.002818	T	0.42921	0.1224	L	0.37800	1.135	0.53688	D	0.99997	D	0.64830	0.994	P	0.53954	0.738	T	0.43360	-0.9396	10	0.72032	D	0.01	.	16.0624	0.80847	0.0:1.0:0.0:0.0	.	112	Q9GZQ6	NPFF1_HUMAN	N	110;112	ENSP00000401171:D110N;ENSP00000277942:D112N	ENSP00000277942:D112N	D	-	1	0	NPFFR1	71690490	0.992000	0.36948	0.998000	0.56505	0.994000	0.84299	2.387000	0.44389	2.415000	0.81967	0.563000	0.77884	GAC	NPFFR1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_NPY_rcpt	ENSG00000148734		0.577	NPFFR1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	NPFFR1	HGNC	protein_coding	OTTHUMT00000048504.2	-	0.00	35	0	C	NM_022146		72020484	-1	tier1	-	no_errors	ENST00000277942	ensembl	human	novel	74_37	missense	25.81	23	8	SNP	1.000	T
NPHS1	4868	genome.wustl.edu	37	19	36330497	36330497	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr19:36330497G>A	ENST00000378910.5	-	21	2827	c.2828C>T	c.(2827-2829)cCt>cTt	p.P943L	NPHS1_ENST00000353632.6_Missense_Mutation_p.P943L	NM_004646.3	NP_004637.1	O60500	NPHN_HUMAN	nephrosis 1, congenital, Finnish type (nephrin)	943	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|excretion (GO:0007588)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell development (GO:0072015)|JNK cascade (GO:0007254)|myoblast fusion (GO:0007520)|positive regulation of actin filament polymerization (GO:0030838)|regulation of excretion (GO:0044062)|skeletal muscle tissue development (GO:0007519)	cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)	myosin binding (GO:0017022)			NS(2)|breast(1)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(1)|lung(26)|ovary(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TCCTGATGGAGGGTCAGGGCG	0.517																																																	0													49.0	51.0	51.0					19																	36330497		2203	4300	6503	SO:0001583	missense	0				CCDS32996.1	19q12-q13.1	2014-09-17				ENSG00000161270		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7908	protein-coding gene	gene with protein product		602716				9915943, 9660941	Standard	NM_004646		Approved	CNF, NPHN	uc002oby.3	O60500		ENST00000378910.5:c.2828C>T	19.37:g.36330497G>A	ENSP00000368190:p.Pro943Leu		A6NDH2|C3RX61	Missense_Mutation	SNP	pfam_CD80_C2-set,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.P943L	ENST00000378910.5	37	c.2828	CCDS32996.1	19	.	.	.	.	.	.	.	.	.	.	G	17.69	3.452836	0.63290	.	.	ENSG00000161270	ENST00000378910;ENST00000353632	T;T	0.59772	0.24;0.24	5.3	5.3	0.74995	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.77032	0.4071	M	0.83852	2.665	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.75605	-0.3260	10	0.28530	T	0.3	-17.0301	16.4567	0.84019	0.0:0.0:1.0:0.0	.	943	O60500	NPHN_HUMAN	L	943	ENSP00000368190:P943L;ENSP00000343634:P943L	ENSP00000343634:P943L	P	-	2	0	NPHS1	41022337	1.000000	0.71417	0.958000	0.39756	0.363000	0.29612	7.308000	0.78929	2.496000	0.84212	0.585000	0.79938	CCT	NPHS1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000161270		0.517	NPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPHS1	HGNC	protein_coding	OTTHUMT00000452553.1	-	0.00	106	0	G			36330497	-1	tier1	-	no_errors	ENST00000378910	ensembl	human	known	74_37	missense	8.39	142	13	SNP	1.000	A
NRXN1	9378	genome.wustl.edu	37	2	50149314	50149314	+	Missense_Mutation	SNP	G	G	A	rs201871400		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr2:50149314G>A	ENST00000406316.2	-	22	5678	c.4202C>T	c.(4201-4203)aCg>aTg	p.T1401M	NRXN1_ENST00000406859.3_Missense_Mutation_p.T1401M|NRXN1_ENST00000342183.5_Missense_Mutation_p.T366M|NRXN1_ENST00000401710.1_Missense_Mutation_p.T419M|NRXN1_ENST00000401669.2_Missense_Mutation_p.T1431M|NRXN1_ENST00000402717.3_Missense_Mutation_p.T1423M|NRXN1_ENST00000405472.3_Missense_Mutation_p.T1423M|NRXN1_ENST00000404971.1_Missense_Mutation_p.T1471M	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	1401					adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			GACCATACCCGTGGTGCTGCT	0.547																																																	0													88.0	73.0	78.0					2																	50149314		2203	4300	6503	SO:0001583	missense	0			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.4202C>T	2.37:g.50149314G>A	ENSP00000384311:p.Thr1401Met		A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_EG-like_dom,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Laminin_G	p.T1423M	ENST00000406316.2	37	c.4268	CCDS54360.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.4|21.4	4.148121|4.148121	0.78001|0.78001	.|.	.|.	ENSG00000179915|ENSG00000179915	ENST00000412315|ENST00000342183;ENST00000536347;ENST00000401710;ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	.|T;T;T;T;T;T;T;T	.|0.73047	.|0.8;2.02;-0.0;-0.02;-0.71;-0.59;-0.3;-0.15	5.97|5.97	5.97|5.97	0.96955|0.96955	.|.	.|0.000000	.|0.51477	.|U	.|0.000081	D|D	0.85062|0.85062	0.5611|0.5611	M|M	0.76574|0.76574	2.34|2.34	0.53688|0.53688	D|D	0.999971|0.999971	.|D;D;D;D;D;D	.|0.89917	.|0.999;0.994;1.0;1.0;1.0;0.998	.|P;P;D;D;D;D	.|0.78314	.|0.872;0.63;0.991;0.966;0.973;0.985	D|D	0.85357|0.85357	0.1105|0.1105	5|10	.|0.87932	.|D	.|0	.|.	20.4238|20.4238	0.99064|0.99064	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|66;1471;366;1401;1420;63	.|B4DIT5;Q9ULB1-3;P58400;F8WB18;A7E294;Q5HYI0	.|.;.;NRX1B_HUMAN;.;.;.	W|M	134|366;320;419;1471;1401;1423;1431;1472;1423;1401	.|ENSP00000341184:T366M;ENSP00000385580:T419M;ENSP00000385142:T1471M;ENSP00000384311:T1401M;ENSP00000434015:T1423M;ENSP00000385017:T1431M;ENSP00000385434:T1423M;ENSP00000385681:T1401M	.|ENSP00000341184:T366M	R|T	-|-	1|2	2|0	NRXN1|NRXN1	50002818|50002818	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.961000|0.961000	0.63080|0.63080	9.869000|9.869000	0.99810|0.99810	2.828000|2.828000	0.97474|0.97474	0.655000|0.655000	0.94253|0.94253	CGG|ACG	NRXN1	-	NULL	ENSG00000179915		0.547	NRXN1-001	KNOWN	basic|CCDS	protein_coding	NRXN1	HGNC	protein_coding	OTTHUMT00000325291.2	-	0.00	41	0	G			50149314	-1	tier1	rs201871400	no_errors	ENST00000402717	ensembl	human	known	74_37	missense	29.27	58	24	SNP	1.000	A
NSUN7	79730	genome.wustl.edu	37	4	40809088	40809088	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr4:40809088C>A	ENST00000381782.2	+	11	1906	c.1411C>A	c.(1411-1413)Cct>Act	p.P471T	NSUN7_ENST00000316607.5_Intron	NM_024677.4	NP_078953	Q8NE18	NSUN7_HUMAN	NOP2/Sun domain family, member 7	471							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|cervix(1)|large_intestine(1)|lung(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	12						GCTTAGTCCTCCTGTTCTTCC	0.368																																																	0													160.0	131.0	140.0					4																	40809088		692	1591	2283	SO:0001583	missense	0			BC036568	CCDS3461.2	4p14	2013-10-11	2009-11-23		ENSG00000179299	ENSG00000179299		"""NOP2/Sun domain containing"""	25857	protein-coding gene	gene with protein product			"""NOL1/NOP2/Sun domain family, member 7"""			17442852	Standard	NM_024677		Approved	FLJ14001	uc003gvj.4	Q8NE18	OTTHUMG00000128597	ENST00000381782.2:c.1411C>A	4.37:g.40809088C>A	ENSP00000371201:p.Pro471Thr		C9JI19|Q8N9K8|Q9H815	Missense_Mutation	SNP	pfam_Fmu/NOL1/Nop2p	p.P471T	ENST00000381782.2	37	c.1411	CCDS3461.2	4	.	.	.	.	.	.	.	.	.	.	C	14.12	2.441572	0.43326	.	.	ENSG00000179299	ENST00000381782	T	0.52295	0.67	5.73	5.73	0.89815	.	0.226577	0.43260	D	0.000582	T	0.67021	0.2849	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.71184	0.972	T	0.68296	-0.5446	10	0.59425	D	0.04	-14.9194	15.0253	0.71667	0.0:0.9299:0.0:0.0701	.	471	Q8NE18	NSUN7_HUMAN	T	471	ENSP00000371201:P471T	ENSP00000371201:P471T	P	+	1	0	NSUN7	40503845	1.000000	0.71417	1.000000	0.80357	0.031000	0.12232	2.805000	0.47939	2.692000	0.91855	0.591000	0.81541	CCT	NSUN7	-	NULL	ENSG00000179299		0.368	NSUN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSUN7	HGNC	protein_coding	OTTHUMT00000250454.2		0.00	41	0	C	NM_024677		40809088	+1			no_errors	ENST00000381782	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	A
NTSR2	23620	genome.wustl.edu	37	2	11810004	11810006	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	CAG	CAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr2:11810004_11810006delCAG	ENST00000306928.5	-	1	284_286	c.250_252delCTG	c.(250-252)ctgdel	p.L84del		NM_012344.3	NP_036476	O95665	NTR2_HUMAN	neurotensin receptor 2	84					cell surface receptor signaling pathway (GO:0007166)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of membrane potential (GO:0042391)|sensory perception (GO:0007600)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled neurotensin receptor activity (GO:0016492)|G-protein coupled receptor activity (GO:0004930)			breast(1)|large_intestine(7)|lung(7)|prostate(1)|urinary_tract(1)	17	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.129)|OV - Ovarian serous cystadenocarcinoma(76;0.24)	Levocabastine(DB01106)	GCACGCCGACCAGCAGCAGCAGC	0.719																																																	0										77,3647		3,71,1788						0.2	0.8			7	168,7346		5,158,3594	no	coding	NTSR2	NM_012344.3		8,229,5382	A1A1,A1R,RR		2.2358,2.0677,2.1801				245,10993				SO:0001651	inframe_deletion	0			Y10148	CCDS1681.1	2p25.1	2012-08-08			ENSG00000169006	ENSG00000169006		"""GPCR / Class A : Neurotensin receptors"""	8040	protein-coding gene	gene with protein product		605538				8647296, 9851594	Standard	NM_012344		Approved	NTR2	uc002rbq.4	O95665	OTTHUMG00000119083	ENST00000306928.5:c.250_252delCTG	2.37:g.11810013_11810015delCAG	ENSP00000303686:p.Leu84del		Q53QQ5|Q57Z87|Q8IY58|Q8TBH6	In_Frame_Del	DEL	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_NT2_rcpt,prints_NT_rcpt,prints_GPCR_Rhodpsn	p.L84in_frame_del	ENST00000306928.5	37	c.252_250	CCDS1681.1	2																																																																																			NTSR2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000169006		0.719	NTSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTSR2	HGNC	protein_coding	OTTHUMT00000239297.1		0.00	42	0	CAG			11810006	-1	tier1		no_errors	ENST00000306928	ensembl	human	known	74_37	in_frame_del	9.09	40	4	DEL	0.976:0.984:0.971	-
OCA2	4948	genome.wustl.edu	37	15	28234767	28234767	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr15:28234767G>T	ENST00000354638.3	-	11	1317	c.1162C>A	c.(1162-1164)Ctg>Atg	p.L388M	OCA2_ENST00000353809.5_Missense_Mutation_p.L364M|OCA2_ENST00000382996.2_Missense_Mutation_p.L388M	NM_000275.2	NP_000266.2	Q04671	P_HUMAN	oculocutaneous albinism II	388					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|spermatid development (GO:0007286)|tyrosine transport (GO:0015828)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome membrane (GO:0033162)	L-tyrosine transmembrane transporter activity (GO:0005302)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(48)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		AGCAGGGCCAGCGTCTCAAAA	0.582									Oculocutaneous Albinism																																								0													117.0	97.0	104.0					15																	28234767		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database			CCDS10020.1, CCDS73701.1	15q12	2013-01-08	2008-01-30		ENSG00000104044	ENSG00000104044			8101	protein-coding gene	gene with protein product	"""melanocyte-specific transporter protein"""	611409	"""oculocutaneous albinism II (pink-eye dilution (murine) homolog)"", ""eye color 3 (brown)"", ""eye color 2 (central brown)"", ""oculocutaneous albinism II (pink-eye dilution homolog, mouse)"""	D15S12, P, EYCL3, EYCL2			Standard	NM_000275		Approved	BEY2, EYCL, BEY, BEY1	uc001zbh.4	Q04671	OTTHUMG00000128871	ENST00000354638.3:c.1162C>A	15.37:g.28234767G>T	ENSP00000346659:p.Leu388Met		Q15211|Q15212|Q96EN1|Q9UMI5	Missense_Mutation	SNP	pfam_Cit_transptr-like_dom,pfam_Na/sul_symport,pfam_Arsenical_pump_ArsB,tigrfam_Arsenical_pump_ArsB	p.L388M	ENST00000354638.3	37	c.1162	CCDS10020.1	15	.	.	.	.	.	.	.	.	.	.	G	18.31	3.596827	0.66332	.	.	ENSG00000104044	ENST00000354638;ENST00000353809;ENST00000382996	D;D;D	0.92911	-3.13;-3.13;-3.13	4.99	3.07	0.35406	Divalent ion symporter (1);	0.000000	0.64402	D	0.000001	D	0.93838	0.8029	L	0.60904	1.88	0.43569	D	0.995897	D;D	0.89917	0.999;1.0	D;D	0.80764	0.989;0.994	D	0.92366	0.5901	10	0.54805	T	0.06	-14.1099	9.2798	0.37722	0.2521:0.0:0.7479:0.0	.	364;388	Q04671-2;Q04671	.;P_HUMAN	M	388;364;388	ENSP00000346659:L388M;ENSP00000261276:L364M;ENSP00000372457:L388M	ENSP00000261276:L364M	L	-	1	2	OCA2	25908362	1.000000	0.71417	0.974000	0.42286	0.994000	0.84299	3.223000	0.51231	0.642000	0.30620	0.655000	0.94253	CTG	OCA2	-	pfam_Cit_transptr-like_dom,pfam_Na/sul_symport,pfam_Arsenical_pump_ArsB,tigrfam_Arsenical_pump_ArsB	ENSG00000104044		0.582	OCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OCA2	HGNC	protein_coding	OTTHUMT00000250823.1	-	0.00	60	0	G	NM_000275		28234767	-1	tier1	-	no_errors	ENST00000354638	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.983	T
OGFOD3	79701	genome.wustl.edu	37	17	80361875	80361875	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr17:80361875G>A	ENST00000313056.5	-	7	788	c.637C>T	c.(637-639)Cgc>Tgc	p.R213C	RP13-20L14.4_ENST00000579188.1_RNA|OGFOD3_ENST00000329197.5_Missense_Mutation_p.R213C	NM_024648.2|NM_175902.4	NP_078924.1|NP_787098.3	Q6PK18	OGFD3_HUMAN	2-oxoglutarate and iron-dependent oxygenase domain containing 3	213	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)										CTGTTTATGCGGGAGAAGAAG	0.642																																																	0													108.0	81.0	90.0					17																	80361875		2203	4300	6503	SO:0001583	missense	0			BC023602	CCDS11811.1, CCDS11812.1	17q25.3	2012-10-23	2012-10-23	2012-10-23	ENSG00000181396	ENSG00000181396			26174	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 101"""	C17orf101		12477932	Standard	NM_175902		Approved	FLJ22222	uc002keu.2	Q6PK18		ENST00000313056.5:c.637C>T	17.37:g.80361875G>A	ENSP00000320116:p.Arg213Cys		C9JDC8|Q8IZ37|Q9H6J2	Missense_Mutation	SNP	smart_Pro_4_hyd_alph	p.R213C	ENST00000313056.5	37	c.637	CCDS11811.1	17	.	.	.	.	.	.	.	.	.	.	G	18.79	3.699230	0.68501	.	.	ENSG00000181396	ENST00000313056;ENST00000329197	T;T	0.47177	1.46;0.85	5.25	5.25	0.73442	Oxoglutarate/iron-dependent oxygenase (1);Prolyl 4-hydroxylase, alpha subunit (1);	0.000000	0.85682	D	0.000000	T	0.72503	0.3468	M	0.88105	2.93	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.78054	-0.2354	10	0.87932	D	0	-24.4987	13.3177	0.60417	0.0:0.0:0.8413:0.1586	.	213;213	Q6PK18;Q6PK18-2	CQ101_HUMAN;.	C	213	ENSP00000320116:R213C;ENSP00000330075:R213C	ENSP00000320116:R213C	R	-	1	0	C17orf101	77955164	1.000000	0.71417	0.996000	0.52242	0.725000	0.41563	3.894000	0.56250	2.439000	0.82584	0.655000	0.94253	CGC	OGFOD3	-	smart_Pro_4_hyd_alph	ENSG00000181396		0.642	OGFOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OGFOD3	HGNC	protein_coding	OTTHUMT00000442895.1	-	0.00	65	0	G	NM_175902		80361875	-1	tier1	-	no_errors	ENST00000329197	ensembl	human	known	74_37	missense	24.24	50	16	SNP	0.992	A
OMD	4958	genome.wustl.edu	37	9	95177560	95177560	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr9:95177560G>T	ENST00000375550.4	-	3	1415	c.1140C>A	c.(1138-1140)ttC>ttA	p.F380L	CENPP_ENST00000375587.3_Intron	NM_005014.2	NP_005005.1	Q99983	OMD_HUMAN	osteomodulin	380					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(3)|skin(2)	16						GAAATCTCCTGAAAACTTGTG	0.408			T	USP6	aneurysmal bone cysts																																			Dom	yes		9	9q22.31	4958	osteomodulin		M	0													219.0	202.0	208.0					9																	95177560		2203	4300	6503	SO:0001583	missense	0			AB000114	CCDS6696.1	9q22.31	2008-02-05			ENSG00000127083	ENSG00000127083		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	8134	protein-coding gene	gene with protein product	"""osteoadherin proteoglycan"""						Standard	NM_005014		Approved	osteoadherin, SLRR2C	uc004asd.4	Q99983	OTTHUMG00000020225	ENST00000375550.4:c.1140C>A	9.37:g.95177560G>T	ENSP00000364700:p.Phe380Leu		Q5TBF4	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp	p.F380L	ENST00000375550.4	37	c.1140	CCDS6696.1	9	.	.	.	.	.	.	.	.	.	.	G	14.39	2.520688	0.44866	.	.	ENSG00000127083	ENST00000375550	T	0.33654	1.4	5.44	1.5	0.22942	.	0.076211	0.53938	D	0.000048	T	0.29524	0.0736	M	0.63428	1.95	0.30777	N	0.742437	B	0.22346	0.068	B	0.17979	0.02	T	0.17379	-1.0371	10	0.33940	T	0.23	-9.2033	5.9621	0.19305	0.3141:0.0:0.5583:0.1276	.	380	Q99983	OMD_HUMAN	L	380	ENSP00000364700:F380L	ENSP00000364700:F380L	F	-	3	2	OMD	94217381	0.035000	0.19736	0.863000	0.33907	0.904000	0.53231	0.045000	0.14013	0.348000	0.23949	0.555000	0.69702	TTC	OMD	-	NULL	ENSG00000127083		0.408	OMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OMD	HGNC	protein_coding	OTTHUMT00000053090.1	-	0.00	48	0	G	NM_005014		95177560	-1	tier1	-	no_errors	ENST00000375550	ensembl	human	known	74_37	missense	5.00	76	4	SNP	0.916	T
OR10K2	391107	genome.wustl.edu	37	1	158390251	158390251	+	Frame_Shift_Del	DEL	T	T	-			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:158390251delT	ENST00000314902.2	-	1	405	c.406delA	c.(406-408)atgfs	p.M136fs		NM_001004476.1	NP_001004476.1	Q6IF99	O10K2_HUMAN	olfactory receptor, family 10, subfamily K, member 2	136						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(19)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_hematologic(112;0.0378)					CCATGTCCCATTAGCACTGAG	0.502																																																	0													183.0	175.0	178.0					1																	158390251		2203	4300	6503	SO:0001589	frameshift_variant	0			AB065642	CCDS30896.1	1q23.1	2012-08-09			ENSG00000180708	ENSG00000180708		"""GPCR / Class A : Olfactory receptors"""	14826	protein-coding gene	gene with protein product							Standard	NM_001004476		Approved		uc010pii.2	Q6IF99	OTTHUMG00000019638	ENST00000314902.2:c.406delA	1.37:g.158390251delT	ENSP00000324251:p.Met136fs			Frame_Shift_Del	DEL	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.M136fs	ENST00000314902.2	37	c.406	CCDS30896.1	1																																																																																			OR10K2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000180708		0.502	OR10K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10K2	HGNC	protein_coding	OTTHUMT00000051854.1		0.00	26	0	T	NM_001004476		158390251	-1	tier1		no_errors	ENST00000314902	ensembl	human	known	74_37	frame_shift_del	5.00	38	2	DEL	0.981	-
OR4A5	81318	genome.wustl.edu	37	11	51411994	51411994	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr11:51411994C>A	ENST00000319760.6	-	1	454	c.402G>T	c.(400-402)atG>atT	p.M134I		NM_001005272.3	NP_001005272.3	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A, member 5	134						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(28)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	49		all_lung(304;0.236)				CCTGTCGATTCATGATGGTCA	0.478																																																	0													78.0	73.0	75.0					11																	51411994		2201	4293	6494	SO:0001583	missense	0			AB065506	CCDS73289.1	11p11.12	2012-08-09			ENSG00000221840	ENSG00000221840		"""GPCR / Class A : Olfactory receptors"""	15162	protein-coding gene	gene with protein product							Standard	NM_001005272		Approved		uc001nhi.2	Q8NH83	OTTHUMG00000166764	ENST00000319760.6:c.402G>T	11.37:g.51411994C>A	ENSP00000367664:p.Met134Ile		Q6IF84	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.M134I	ENST00000319760.6	37	c.402	CCDS31497.1	11	.	.	.	.	.	.	.	.	.	.	.	9.109	1.005998	0.19199	.	.	ENSG00000221840	ENST00000319760	T	0.00848	5.62	1.93	1.93	0.25924	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000020	T	0.01940	0.0061	M	0.83692	2.655	0.28158	N	0.929112	B	0.24132	0.098	B	0.26614	0.071	T	0.10474	-1.0628	10	0.72032	D	0.01	.	9.9079	0.41388	0.0:1.0:0.0:0.0	.	134	Q8NH83	OR4A5_HUMAN	I	134	ENSP00000367664:M134I	ENSP00000367664:M134I	M	-	3	0	OR4A5	51268570	0.981000	0.34729	0.909000	0.35828	0.394000	0.30568	2.687000	0.46976	1.394000	0.46624	0.162000	0.16502	ATG	OR4A5	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000221840		0.478	OR4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A5	HGNC	protein_coding	OTTHUMT00000391399.1		0.00	33	0	C	NM_001005272		51411994	-1			no_errors	ENST00000319760	ensembl	human	known	74_37	missense	6.67	42	3	SNP	0.993	A
OR52E2	119678	genome.wustl.edu	37	11	5080587	5080587	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr11:5080587G>T	ENST00000321522.2	-	1	270	c.271C>A	c.(271-273)Ctc>Atc	p.L91I		NM_001005164.2	NP_001005164.2	Q8NGJ4	O52E2_HUMAN	olfactory receptor, family 52, subfamily E, member 2	91						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.N90_L91>KI(1)|p.L91I(1)		endometrium(2)|lung(13)|ovary(2)|skin(3)	20		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.03e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.191)		ATCCCTCTGAGGTTGATCCAG	0.488																																																	2	Substitution - Missense(1)|Complex - compound substitution(1)	lung(2)											83.0	77.0	79.0					11																	5080587		2201	4298	6499	SO:0001583	missense	0			AB065800	CCDS31371.1	11p15.4	2012-08-09			ENSG00000176787	ENSG00000176787		"""GPCR / Class A : Olfactory receptors"""	14769	protein-coding gene	gene with protein product							Standard	NM_001005164		Approved		uc010qyw.2	Q8NGJ4	OTTHUMG00000066608	ENST00000321522.2:c.271C>A	11.37:g.5080587G>T	ENSP00000322088:p.Leu91Ile			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.L91I	ENST00000321522.2	37	c.271	CCDS31371.1	11	.	.	.	.	.	.	.	.	.	.	G	1.246	-0.620019	0.03636	.	.	ENSG00000176787	ENST00000321522	T	0.03035	4.07	3.77	0.815	0.18763	GPCR, rhodopsin-like superfamily (1);	0.786555	0.10841	N	0.628273	T	0.04182	0.0116	L	0.46567	1.45	0.09310	N	1	B	0.20671	0.047	B	0.16289	0.015	T	0.39683	-0.9602	10	0.34782	T	0.22	.	8.0404	0.30519	0.3727:0.0:0.6273:0.0	.	91	Q8NGJ4	O52E2_HUMAN	I	91	ENSP00000322088:L91I	ENSP00000322088:L91I	L	-	1	0	OR52E2	5037163	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	-0.739000	0.04866	0.200000	0.20447	-0.141000	0.14075	CTC	OR52E2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000176787		0.488	OR52E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52E2	HGNC	protein_coding	OTTHUMT00000142815.1		0.00	32	0	G	NM_001005164		5080587	-1			no_errors	ENST00000321522	ensembl	human	known	74_37	missense	8.57	32	3	SNP	0.000	T
OR52A5	390054	genome.wustl.edu	37	11	5153446	5153446	+	Silent	SNP	A	A	G			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr11:5153446A>G	ENST00000307388.1	-	1	426	c.427T>C	c.(427-429)Tta>Cta	p.L143L		NM_001005160.2	NP_001005160.1	Q9H2C5	O52A5_HUMAN	olfactory receptor, family 52, subfamily A, member 5	143					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(18)|skin(3)	35		Medulloblastoma(188;0.0049)|all_neural(188;0.0442)|Breast(177;0.0675)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.2)		ATATGAGTTAAGAACTGCTGG	0.478																																																	0													72.0	65.0	67.0					11																	5153446		2201	4298	6499	SO:0001819	synonymous_variant	0			BK004433	CCDS31373.1	11p15.4	2012-08-09			ENSG00000171944	ENSG00000171944		"""GPCR / Class A : Olfactory receptors"""	19580	protein-coding gene	gene with protein product							Standard	NM_001005160		Approved		uc010qyx.2	Q9H2C5	OTTHUMG00000066616	ENST00000307388.1:c.427T>C	11.37:g.5153446A>G				Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L143	ENST00000307388.1	37	c.427	CCDS31373.1	11																																																																																			OR52A5	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000171944		0.478	OR52A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52A5	HGNC	protein_coding	OTTHUMT00000142823.1	-	0.00	58	0	A	NM_001005160		5153446	-1	tier1	-	no_errors	ENST00000307388	ensembl	human	known	74_37	silent	81.00	19	81	SNP	0.000	G
OR51I1	390063	genome.wustl.edu	37	11	5462646	5462646	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr11:5462646G>T	ENST00000380211.1	-	1	98	c.99C>A	c.(97-99)ttC>ttA	p.F33L	AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380252.1_Intron|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380259.2_Intron	NM_001005288.2	NP_001005288.1	Q9H343	O51I1_HUMAN	olfactory receptor, family 51, subfamily I, member 1	33					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F33L(1)		central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	30		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGAGGATGCAGAAAATCAGGG	0.527																																																	1	Substitution - Missense(1)	lung(1)											112.0	109.0	110.0					11																	5462646		2201	4297	6498	SO:0001583	missense	0			BK004429	CCDS31382.1	11p15.4	2012-08-09			ENSG00000167359	ENSG00000167359		"""GPCR / Class A : Olfactory receptors"""	15200	protein-coding gene	gene with protein product							Standard	NM_001005288		Approved		uc010qze.2	Q9H343	OTTHUMG00000066908	ENST00000380211.1:c.99C>A	11.37:g.5462646G>T	ENSP00000369559:p.Phe33Leu		B9EKW2|Q6IF33	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F33L	ENST00000380211.1	37	c.99	CCDS31382.1	11	.	.	.	.	.	.	.	.	.	.	G	12.73	2.024405	0.35701	.	.	ENSG00000167359	ENST00000317283;ENST00000321307;ENST00000380211	T	0.03982	3.74	5.9	4.96	0.65561	.	0.000000	0.56097	D	0.000025	T	0.04048	0.0113	N	0.20574	0.59	0.35648	D	0.811567	B	0.13145	0.007	B	0.10450	0.005	T	0.40079	-0.9582	10	0.17832	T	0.49	.	14.0849	0.64949	0.0:0.1507:0.8493:0.0	.	33	Q9H343	O51I1_HUMAN	L	18;30;33	ENSP00000369559:F33L	ENSP00000348350:F18L	F	-	3	2	OR51I1	5419222	0.904000	0.30761	1.000000	0.80357	0.979000	0.70002	1.499000	0.35671	1.497000	0.48584	0.644000	0.83932	TTC	OR51I1	-	prints_GPCR_Rhodpsn	ENSG00000167359		0.527	OR51I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51I1	HGNC	protein_coding	OTTHUMT00000143399.1		0.00	20	0	G	NM_001005288		5462646	-1			no_errors	ENST00000380211	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	T
OR4C11	219429	genome.wustl.edu	37	11	55371506	55371506	+	Missense_Mutation	SNP	A	A	G			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr11:55371506A>G	ENST00000302231.4	-	1	368	c.344T>C	c.(343-345)cTc>cCc	p.L115P		NM_001004700.2	NP_001004700.2	Q6IEV9	OR4CB_HUMAN	olfactory receptor, family 4, subfamily C, member 11	115						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(1)|large_intestine(5)|lung(23)|ovary(1)|prostate(1)|skin(1)	33						AACAGCCATGAGAATGAGGAC	0.443																																																	0													98.0	82.0	88.0					11																	55371506		2179	4009	6188	SO:0001583	missense	0			AB065774	CCDS31503.1	11q11	2012-08-09		2004-03-10	ENSG00000172188	ENSG00000172188		"""GPCR / Class A : Olfactory receptors"""	15167	protein-coding gene	gene with protein product				OR4C11P			Standard	NM_001004700		Approved		uc010rii.2	Q6IEV9	OTTHUMG00000165290	ENST00000302231.4:c.344T>C	11.37:g.55371506A>G	ENSP00000306651:p.Leu115Pro		B9EIL4|Q8NGL8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L115P	ENST00000302231.4	37	c.344	CCDS31503.1	11	.	.	.	.	.	.	.	.	.	.	A	11.93	1.786071	0.31593	.	.	ENSG00000172188	ENST00000302231	T	0.03358	3.96	4.34	4.34	0.51931	GPCR, rhodopsin-like superfamily (1);	0.362916	0.18940	U	0.126961	T	0.09642	0.0237	M	0.70903	2.155	0.48236	D	0.999615	D	0.59767	0.986	P	0.53313	0.723	T	0.01084	-1.1457	10	0.87932	D	0	.	6.6259	0.22828	0.8931:0.0:0.1069:0.0	.	115	Q6IEV9	OR4CB_HUMAN	P	115	ENSP00000306651:L115P	ENSP00000306651:L115P	L	-	2	0	OR4C11	55128082	0.000000	0.05858	0.981000	0.43875	0.154000	0.21943	0.415000	0.21181	1.962000	0.57031	0.391000	0.25812	CTC	OR4C11	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000172188		0.443	OR4C11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C11	HGNC	protein_coding	OTTHUMT00000383268.1	-	0.00	25	0	A	NM_001004700		55371506	-1	tier1	-	no_errors	ENST00000302231	ensembl	human	known	74_37	missense	42.11	22	16	SNP	0.867	G
OR8H3	390152	genome.wustl.edu	37	11	55890377	55890377	+	Missense_Mutation	SNP	T	T	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr11:55890377T>A	ENST00000313472.3	+	1	529	c.529T>A	c.(529-531)Ttt>Att	p.F177I		NM_001005201.1	NP_001005201.1	Q8N146	OR8H3_HUMAN	olfactory receptor, family 8, subfamily H, member 3	177						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(30)|ovary(2)|prostate(1)|skin(3)|stomach(1)	42	Esophageal squamous(21;0.00693)					AATTCATCACTTTTTCTGTGA	0.428																																																	0													246.0	222.0	230.0					11																	55890377		2201	4296	6497	SO:0001583	missense	0			AB065840	CCDS31519.1	11q11	2012-08-09			ENSG00000181761	ENSG00000181761		"""GPCR / Class A : Olfactory receptors"""	15309	protein-coding gene	gene with protein product							Standard	NM_001005201		Approved		uc001nii.1	Q8N146	OTTHUMG00000166833	ENST00000313472.3:c.529T>A	11.37:g.55890377T>A	ENSP00000323928:p.Phe177Ile		Q6IFB7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F177I	ENST00000313472.3	37	c.529	CCDS31519.1	11	.	.	.	.	.	.	.	.	.	.	T	15.97	2.989133	0.53934	.	.	ENSG00000181761	ENST00000313472	T	0.00350	7.98	3.62	3.62	0.41486	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000046	T	0.00724	0.0024	M	0.80982	2.52	0.29009	N	0.887012	D	0.63046	0.992	D	0.67900	0.954	T	0.18053	-1.0349	10	0.87932	D	0	.	11.7455	0.51817	0.0:0.0:0.0:1.0	.	177	Q8N146	OR8H3_HUMAN	I	177	ENSP00000323928:F177I	ENSP00000323928:F177I	F	+	1	0	OR8H3	55646953	0.002000	0.14202	0.958000	0.39756	0.395000	0.30598	0.937000	0.28951	1.415000	0.47037	0.145000	0.16022	TTT	OR8H3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000181761		0.428	OR8H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8H3	HGNC	protein_coding	OTTHUMT00000391541.1	-	0.00	23	0	T	NM_001005201		55890377	+1	tier1	-	no_errors	ENST00000313472	ensembl	human	known	74_37	missense	80.00	6	24	SNP	0.995	A
OR5A2	219981	genome.wustl.edu	37	11	59189513	59189513	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr11:59189513G>T	ENST00000302040.4	-	1	936	c.914C>A	c.(913-915)gCc>gAc	p.A305D		NM_001001954.1	NP_001001954.1	Q8NGI9	OR5A2_HUMAN	olfactory receptor, family 5, subfamily A, member 2	305						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|liver(1)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	21						CCTTTCCATGGCTTTCCTCAT	0.448																																																	0													83.0	82.0	83.0					11																	59189513		2201	4295	6496	SO:0001583	missense	0			AB065805	CCDS31560.1	11q12.1	2012-08-09			ENSG00000172324	ENSG00000172324		"""GPCR / Class A : Olfactory receptors"""	15249	protein-coding gene	gene with protein product							Standard	NM_001001954		Approved		uc010rkt.2	Q8NGI9	OTTHUMG00000167419	ENST00000302040.4:c.914C>A	11.37:g.59189513G>T	ENSP00000303834:p.Ala305Asp		B9EH21|Q6IFF4|Q96RB0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A305D	ENST00000302040.4	37	c.914	CCDS31560.1	11	.	.	.	.	.	.	.	.	.	.	G	14.89	2.671122	0.47781	.	.	ENSG00000172324	ENST00000302040	T	0.38077	1.16	5.46	-9.97	0.00440	.	0.589703	0.12541	U	0.459898	T	0.13200	0.0320	N	0.08118	0	0.09310	N	1	P	0.37038	0.579	B	0.33750	0.169	T	0.36407	-0.9749	10	0.66056	D	0.02	.	9.9216	0.41468	0.2998:0.1236:0.5766:0.0	.	305	Q8NGI9	OR5A2_HUMAN	D	305	ENSP00000303834:A305D	ENSP00000303834:A305D	A	-	2	0	OR5A2	58946089	0.001000	0.12720	0.000000	0.03702	0.406000	0.30931	0.070000	0.14573	-2.064000	0.00888	0.655000	0.94253	GCC	OR5A2	-	NULL	ENSG00000172324		0.448	OR5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5A2	HGNC	protein_coding	OTTHUMT00000394552.1	-	0.00	50	0	G	NM_001001954		59189513	-1	tier1	-	no_errors	ENST00000302040	ensembl	human	known	74_37	missense	8.93	51	5	SNP	0.000	T
ORMDL3	94103	genome.wustl.edu	37	17	38080379	38080379	+	Silent	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr17:38080379G>A	ENST00000394169.1	-	4	1572	c.78C>T	c.(76-78)taC>taT	p.Y26Y	ORMDL3_ENST00000304046.2_Silent_p.Y26Y|ORMDL3_ENST00000584220.1_Silent_p.Y26Y|ORMDL3_ENST00000579695.1_Silent_p.Y26Y|ORMDL3_ENST00000582052.1_5'Flank			Q8N138	ORML3_HUMAN	ORMDL sphingolipid biosynthesis regulator 3	26					ceramide metabolic process (GO:0006672)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|SPOTS complex (GO:0035339)				endometrium(3)|kidney(1)|lung(1)	5	Colorectal(19;0.000442)		Lung(15;0.0234)			TGGCCAGCACGTAGGAGAGCC	0.592																																																	0													209.0	156.0	174.0					17																	38080379		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS11355.1	17q12	2014-06-16	2014-06-16		ENSG00000172057	ENSG00000172057			16038	protein-coding gene	gene with protein product		610075	"""ORM1 (S. cerevisiae)-like 3"", ""ORM1-like 3 (S. cerevisiae)"""			23066021	Standard	NM_139280		Approved		uc002htj.2	Q8N138	OTTHUMG00000133249	ENST00000394169.1:c.78C>T	17.37:g.38080379G>A			B3KS83|Q6UY83	Silent	SNP	pfam_ORMDL,pirsf_ORMDL	p.Y26	ENST00000394169.1	37	c.78	CCDS11355.1	17																																																																																			ORMDL3	-	pfam_ORMDL,pirsf_ORMDL	ENSG00000172057		0.592	ORMDL3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ORMDL3	HGNC	protein_coding	OTTHUMT00000257003.1	-	0.00	64	0	G	NM_139280		38080379	-1	tier1	-	no_errors	ENST00000304046	ensembl	human	known	74_37	silent	31.65	54	25	SNP	0.997	A
OTOGL	283310	genome.wustl.edu	37	12	80645477	80645477	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr12:80645477G>T	ENST00000547103.1	+	11	1036	c.1030G>T	c.(1030-1032)Gat>Tat	p.D344Y	OTOGL_ENST00000458043.2_Missense_Mutation_p.D344Y			Q3ZCN5	OTOGL_HUMAN	otogelin-like	344					L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						TTCTAGAACTGATGATGATGA	0.448																																																	0													76.0	69.0	71.0					12																	80645477		1938	4140	6078	SO:0001583	missense	0			AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.1030G>T	12.37:g.80645477G>T	ENSP00000447211:p.Asp344Tyr		F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_AbfB,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C	p.D344Y	ENST00000547103.1	37	c.1030		12	.	.	.	.	.	.	.	.	.	.	G	11.98	1.801748	0.31869	.	.	ENSG00000165899	ENST00000547103;ENST00000458043	T;T	0.77229	-1.08;-1.08	5.8	2.47	0.30058	.	.	.	.	.	D	0.83547	0.5278	M	0.77616	2.38	0.45822	D	0.998697	.	.	.	.	.	.	D	0.83643	0.0151	7	0.52906	T	0.07	.	11.8747	0.52539	0.0711:0.2424:0.6866:0.0	.	.	.	.	Y	344	ENSP00000447211:D344Y;ENSP00000400895:D344Y	ENSP00000400895:D344Y	D	+	1	0	OTOGL	79169608	1.000000	0.71417	0.999000	0.59377	0.486000	0.33341	3.717000	0.54911	0.768000	0.33290	0.655000	0.94253	GAT	OTOGL	-	pfam_Unchr_dom_Cys-rich,smart_Unchr_dom_Cys-rich	ENSG00000165899		0.448	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	OTOGL	HGNC	protein_coding	OTTHUMT00000407438.1		0.00	35	0	G	NM_173591		80645477	+1			no_errors	ENST00000458043	ensembl	human	known	74_37	missense	8.00	45	4	SNP	1.000	T
OXNAD1	92106	genome.wustl.edu	37	3	16327858	16327858	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr3:16327858G>T	ENST00000285083.5	+	5	658	c.193G>T	c.(193-195)Gca>Tca	p.A65S	OXNAD1_ENST00000435829.2_Missense_Mutation_p.A83S|OXNAD1_ENST00000544043.1_Missense_Mutation_p.A83S|OXNAD1_ENST00000605932.1_Missense_Mutation_p.A65S|OXNAD1_ENST00000606098.1_Missense_Mutation_p.A65S	NM_138381.3	NP_612390.1	Q96HP4	OXND1_HUMAN	oxidoreductase NAD-binding domain containing 1	65	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.					mitochondrion (GO:0005739)	oxidoreductase activity (GO:0016491)			endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|skin(2)	13						GATTGTGTCAGCAGCTAAGGT	0.478																																																	0													181.0	155.0	164.0					3																	16327858		2203	4300	6503	SO:0001583	missense	0			AL832787	CCDS2630.1	3p25-p24	2010-03-19			ENSG00000154814	ENSG00000154814			25128	protein-coding gene	gene with protein product						12477932	Standard	NM_138381		Approved	MGC15763	uc003caw.3	Q96HP4	OTTHUMG00000129867	ENST00000285083.5:c.193G>T	3.37:g.16327858G>T	ENSP00000285083:p.Ala65Ser		Q2HYC7|Q59FA4	Missense_Mutation	SNP	pfam_OxRdtase_FAD/NAD-bd,pfam_Fe_red_NAD-bd_6,superfamily_Riboflavin_synthase-like_b-brl,prints_Phe_hydroxylase,prints_NADH-Cyt_B5_reductase	p.A83S	ENST00000285083.5	37	c.247	CCDS2630.1	3	.	.	.	.	.	.	.	.	.	.	G	11.48	1.650328	0.29336	.	.	ENSG00000154814	ENST00000285083;ENST00000435829;ENST00000544043	T;T;T	0.21932	2.28;1.98;2.26	5.26	-5.07	0.02938	Riboflavin synthase-like beta-barrel (1);Ferredoxin reductase-type FAD-binding domain (1);	0.397887	0.30109	N	0.010392	T	0.05868	0.0153	N	0.05230	-0.09	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.001	T	0.38585	-0.9654	10	0.07990	T	0.79	-11.3596	6.8275	0.23891	0.2433:0.5565:0.1196:0.0805	.	83;65	F5H620;Q96HP4	.;OXND1_HUMAN	S	65;65;83	ENSP00000285083:A65S;ENSP00000389872:A65S;ENSP00000437967:A83S	ENSP00000285083:A65S	A	+	1	0	OXNAD1	16302862	0.000000	0.05858	0.000000	0.03702	0.823000	0.46562	0.094000	0.15107	-0.473000	0.06871	0.655000	0.94253	GCA	OXNAD1	-	superfamily_Riboflavin_synthase-like_b-brl	ENSG00000154814		0.478	OXNAD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OXNAD1	HGNC	protein_coding	OTTHUMT00000252109.1		0.00	34	0	G	NM_138381		16327858	+1			no_errors	ENST00000544043	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.001	T
P2RX1	5023	genome.wustl.edu	37	17	3807317	3807317	+	Splice_Site	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr17:3807317G>T	ENST00000225538.3	-	5	703	c.429C>A	c.(427-429)ggC>ggA	p.G143G		NM_002558.2	NP_002549.1	P51575	P2RX1_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 1	143					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ceramide biosynthetic process (GO:0046513)|insemination (GO:0007320)|ion transport (GO:0006811)|neuronal action potential (GO:0019228)|platelet activation (GO:0030168)|positive regulation of ion transport (GO:0043270)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of vascular smooth muscle contraction (GO:0003056)|response to ATP (GO:0033198)|serotonin secretion by platelet (GO:0002554)|signal transduction (GO:0007165)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|vasoconstriction (GO:0042310)	external side of cell outer membrane (GO:0031240)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|drug binding (GO:0008144)|extracellular ATP-gated cation channel activity (GO:0004931)|purinergic nucleotide receptor activity (GO:0001614)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(2)	13				LUAD - Lung adenocarcinoma(2;1.9e-05)|Lung(3;0.0173)		CCGTGCGGATGCCTGGAGCCA	0.617																																																	0													78.0	61.0	67.0					17																	3807317		2203	4300	6503	SO:0001630	splice_region_variant	0			X83688	CCDS11040.1	17p13.3	2012-01-17				ENSG00000108405		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8533	protein-coding gene	gene with protein product		600845				8834001	Standard	NM_002558		Approved	P2X1	uc002fww.3	P51575		ENST00000225538.3:c.428-1C>A	17.37:g.3807317G>T			Q9UK84	Silent	SNP	pfam_P2X_purnocptor,prints_P2X1_purnocptor,prints_P2X_purnocptor,tigrfam_P2X_purnocptor	p.G143	ENST00000225538.3	37	c.429	CCDS11040.1	17																																																																																			P2RX1	-	pfam_P2X_purnocptor,prints_P2X1_purnocptor,tigrfam_P2X_purnocptor	ENSG00000108405		0.617	P2RX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RX1	HGNC	protein_coding	OTTHUMT00000438391.1	-	0.00	57	0	G	NM_002558	Silent	3807317	-1	tier1	-	no_errors	ENST00000225538	ensembl	human	known	74_37	silent	10.87	41	5	SNP	0.995	T
PALD1	27143	genome.wustl.edu	37	10	72298676	72298676	+	Missense_Mutation	SNP	C	C	T	rs141292267	byFrequency	TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr10:72298676C>T	ENST00000263563.6	+	13	1749	c.1481C>T	c.(1480-1482)gCg>gTg	p.A494V		NM_014431.2	NP_055246.2	Q9ULE6	PALD_HUMAN	phosphatase domain containing, paladin 1	494						cytosol (GO:0005829)											TCCCCGGACGCGCTCAGCACT	0.682																																																	0								C	VAL/ALA	0,4406		0,0,2203	58.0	63.0	61.0		1481	4.0	0.1	10	dbSNP_134	61	2,8598	2.2+/-6.3	0,2,4298	yes	missense	KIAA1274	NM_014431.2	64	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign	494/857	72298676	2,13004	2203	4300	6503	SO:0001583	missense	0			AB033100	CCDS31215.1	10q22.2	2012-07-17	2012-07-17	2012-07-17	ENSG00000107719	ENSG00000107719			23530	protein-coding gene	gene with protein product		614656	"""paladin"", ""KIAA1274"""	PALD, KIAA1274			Standard	NM_014431		Approved		uc001jrd.4	Q9ULE6	OTTHUMG00000018411	ENST00000263563.6:c.1481C>T	10.37:g.72298676C>T	ENSP00000263563:p.Ala494Val		B2RMS1|B9EGC6|Q5JTK7|Q5JTK8	Missense_Mutation	SNP	smart_Tyr_Pase_cat	p.A494V	ENST00000263563.6	37	c.1481	CCDS31215.1	10	.	.	.	.	.	.	.	.	.	.	c	1.251	-0.618649	0.03663	0.0	2.33E-4	ENSG00000107719	ENST00000263563;ENST00000373214	T	0.28255	1.62	5.01	3.98	0.46160	.	0.056377	0.64402	D	0.000001	T	0.10895	0.0266	N	0.11560	0.145	0.33411	D	0.578633	B	0.18461	0.028	B	0.12156	0.007	T	0.29027	-1.0025	10	0.02654	T	1	-20.0994	3.4805	0.07601	0.0:0.6141:0.0:0.3859	.	494	Q9ULE6	PALD_HUMAN	V	494	ENSP00000263563:A494V	ENSP00000263563:A494V	A	+	2	0	KIAA1274	71968682	0.995000	0.38212	0.055000	0.19348	0.060000	0.15804	2.820000	0.48057	2.318000	0.78349	0.542000	0.68232	GCG	PALD1	-	NULL	ENSG00000107719		0.682	PALD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PALD1	HGNC	protein_coding	OTTHUMT00000048515.2	-	0.00	64	0	C	NM_014431		72298676	+1	tier1	rs141292267	no_errors	ENST00000263563	ensembl	human	known	74_37	missense	16.95	49	10	SNP	0.989	T
PCDH10	57575	genome.wustl.edu	37	4	134073782	134073782	+	Silent	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr4:134073782C>T	ENST00000264360.5	+	1	3313	c.2487C>T	c.(2485-2487)tcC>tcT	p.S829S		NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	829					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		CCCCTGAGTCCGCCAAGACCG	0.612																																																	0													86.0	76.0	80.0					4																	134073782		2203	4300	6503	SO:0001819	synonymous_variant	0			AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.2487C>T	4.37:g.134073782C>T			Q4W5F6|Q96SF0	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S829	ENST00000264360.5	37	c.2487	CCDS34063.1	4																																																																																			PCDH10	-	NULL	ENSG00000138650		0.612	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PCDH10	HGNC	protein_coding	OTTHUMT00000364457.2	-	0.00	88	0	C	NM_032961		134073782	+1	tier1	-	no_errors	ENST00000264360	ensembl	human	known	74_37	silent	38.46	32	20	SNP	1.000	T
PCDH10	57575	genome.wustl.edu	37	4	134073920	134073920	+	Silent	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr4:134073920C>A	ENST00000264360.5	+	1	3451	c.2625C>A	c.(2623-2625)tcC>tcA	p.S875S		NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	875					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		GCATTTTGTCCAACGAGGTAA	0.552																																																	0													79.0	78.0	79.0					4																	134073920		2203	4300	6503	SO:0001819	synonymous_variant	0			AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.2625C>A	4.37:g.134073920C>A			Q4W5F6|Q96SF0	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S875	ENST00000264360.5	37	c.2625	CCDS34063.1	4																																																																																			PCDH10	-	NULL	ENSG00000138650		0.552	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PCDH10	HGNC	protein_coding	OTTHUMT00000364457.2		0.00	69	0	C	NM_032961		134073920	+1			no_errors	ENST00000264360	ensembl	human	known	74_37	silent	6.67	28	2	SNP	1.000	A
PCDH15	65217	genome.wustl.edu	37	10	56423985	56423985	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr10:56423985G>T	ENST00000320301.6	-	2	432	c.38C>A	c.(37-39)tCa>tAa	p.S13*	PCDH15_ENST00000395445.1_Nonsense_Mutation_p.S13*|PCDH15_ENST00000395433.1_Nonsense_Mutation_p.S13*|PCDH15_ENST00000395430.1_Nonsense_Mutation_p.S13*|PCDH15_ENST00000361849.3_Nonsense_Mutation_p.S13*|PCDH15_ENST00000437009.1_Nonsense_Mutation_p.S13*|PCDH15_ENST00000395432.2_Nonsense_Mutation_p.S13*|PCDH15_ENST00000395442.1_Nonsense_Mutation_p.S13*|PCDH15_ENST00000373955.1_Nonsense_Mutation_p.S13*|PCDH15_ENST00000373957.3_Nonsense_Mutation_p.S13*|PCDH15_ENST00000409834.1_5'UTR|PCDH15_ENST00000414778.1_Nonsense_Mutation_p.S13*|PCDH15_ENST00000395440.1_Nonsense_Mutation_p.S13*|PCDH15_ENST00000395438.1_Nonsense_Mutation_p.S13*|PCDH15_ENST00000395446.1_Nonsense_Mutation_p.S13*|PCDH15_ENST00000373965.2_Nonsense_Mutation_p.S13*	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	13					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				GATGATCCCTGAAGCTAAACA	0.398										HNSCC(58;0.16)																																							0													85.0	76.0	79.0					10																	56423985		2203	4300	6503	SO:0001587	stop_gained	0			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.38C>A	10.37:g.56423985G>T	ENSP00000322604:p.Ser13*		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Nonsense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S13*	ENST00000320301.6	37	c.38	CCDS7248.1	10	.	.	.	.	.	.	.	.	.	.	G	37	6.327478	0.97476	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000395445;ENST00000395446;ENST00000395442;ENST00000395440;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000373957;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009;ENST00000373955;ENST00000458638	.	.	.	5.8	-0.00993	0.13998	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.5102	0.07705	0.4844:0.0:0.3243:0.1913	.	.	.	.	X	13	.	ENSP00000322604:S13X	S	-	2	0	PCDH15	56093991	0.047000	0.20315	0.002000	0.10522	0.672000	0.39443	1.327000	0.33746	0.080000	0.16959	0.491000	0.48974	TCA	PCDH15	-	NULL	ENSG00000150275		0.398	PCDH15-001	KNOWN	basic|CCDS	protein_coding	PCDH15	HGNC	protein_coding	OTTHUMT00000048121.2	-	0.00	43	0	G	NM_033056		56423985	-1	tier1	-	no_errors	ENST00000320301	ensembl	human	known	74_37	nonsense	12.12	29	4	SNP	0.002	T
PCDHB16	57717	genome.wustl.edu	37	5	140562945	140562945	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr5:140562945G>A	ENST00000361016.2	+	1	1966	c.811G>A	c.(811-813)Ggc>Agc	p.G271S		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	271	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G271S(1)		breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGATTTAGACGGCGGAGCCAA	0.488																																																	1	Substitution - Missense(1)	lung(1)											62.0	64.0	64.0					5																	140562945		2203	4300	6503	SO:0001583	missense	0			AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.811G>A	5.37:g.140562945G>A	ENSP00000354293:p.Gly271Ser		B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G271S	ENST00000361016.2	37	c.811	CCDS4251.1	5	.	.	.	.	.	.	.	.	.	.	g	4.620	0.115281	0.08831	.	.	ENSG00000196963	ENST00000361016	T	0.01145	5.27	4.75	-0.71	0.11234	Cadherin (5);Cadherin-like (1);	0.940200	0.08702	N	0.906228	T	0.00356	0.0011	N	0.00159	-1.955	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44298	-0.9337	10	0.14252	T	0.57	.	4.6413	0.12550	0.3263:0.0:0.4028:0.2709	.	271	Q9NRJ7	PCDBG_HUMAN	S	271	ENSP00000354293:G271S	ENSP00000354293:G271S	G	+	1	0	PCDHB16	140543129	0.000000	0.05858	0.003000	0.11579	0.676000	0.39594	0.473000	0.22132	-0.409000	0.07553	-0.383000	0.06682	GGC	PCDHB16	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000196963		0.488	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB16	HGNC	protein_coding	OTTHUMT00000251800.1	-	0.00	68	0	G	NM_020957		140562945	+1	tier1	-	no_errors	ENST00000361016	ensembl	human	known	74_37	missense	86.96	9	60	SNP	0.157	A
PCDHGA2	56113	genome.wustl.edu	37	5	140720764	140720764	+	Silent	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr5:140720764C>T	ENST00000394576.2	+	1	2226	c.2226C>T	c.(2224-2226)ggC>ggT	p.G742G	PCDHGA3_ENST00000253812.6_5'Flank|PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	742					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACTTTGTGGGCGTGGACGGGG	0.627																																																	0													74.0	78.0	77.0					5																	140720764		2203	4300	6503	SO:0001819	synonymous_variant	0			AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.2226C>T	5.37:g.140720764C>T			Q52LL6|Q9Y5D5	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G742	ENST00000394576.2	37	c.2226	CCDS47289.1	5																																																																																			PCDHGA2	-	NULL	ENSG00000081853		0.627	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA2	HGNC	protein_coding	OTTHUMT00000374738.1	-	0.00	203	0	C	NM_018915		140720764	+1	tier1	-	no_errors	ENST00000394576	ensembl	human	known	74_37	silent	13.10	126	19	SNP	0.111	T
PCDHGB4	8641	genome.wustl.edu	37	5	140768647	140768647	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr5:140768647C>T	ENST00000519479.1	+	1	1196	c.1196C>T	c.(1195-1197)aCg>aTg	p.T399M	PCDHGA7_ENST00000518325.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA6_ENST00000517434.1_Intron	NM_003736.2|NM_018925.2|NM_032098.1	NP_003727.1|NP_061748.1|NP_115269.1	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4	399	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(2)	37			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCAAGAAACACGTATAAATTA	0.433																																																	0													125.0	126.0	126.0					5																	140768647		1907	4129	6036	SO:0001583	missense	0			AF152520	CCDS54928.1, CCDS75337.1	5q31	2010-01-26				ENSG00000253953		"""Cadherins / Protocadherins : Clustered"""	8711	other	protocadherin	"""fibroblast cadherin FIB2"", ""cadherin 20"""	603058				10380929	Standard	NM_003736		Approved	FIB2, CDH20, PCDH-GAMMA-B4		Q9UN71		ENST00000519479.1:c.1196C>T	5.37:g.140768647C>T	ENSP00000428288:p.Thr399Met		O15099|Q2M267|Q9UN64	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T399M	ENST00000519479.1	37	c.1196	CCDS54928.1	5	.	.	.	.	.	.	.	.	.	.	.	15.32	2.797342	0.50208	.	.	ENSG00000253953	ENST00000519479	T	0.01767	4.65	5.18	1.04	0.20106	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.02649	0.0080	L	0.35288	1.05	0.09310	N	1	P;P	0.52463	0.889;0.953	P;P	0.51487	0.541;0.671	T	0.49103	-0.8974	9	0.87932	D	0	.	4.7398	0.13007	0.4434:0.393:0.0:0.1637	.	399;399	Q9UN71-2;Q9UN71	.;PCDGG_HUMAN	M	399	ENSP00000428288:T399M	ENSP00000428288:T399M	T	+	2	0	PCDHGB4	140748831	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.349000	0.20055	0.639000	0.30564	0.655000	0.94253	ACG	PCDHGB4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000253953		0.433	PCDHGB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB4	HGNC	protein_coding	OTTHUMT00000374745.1	-	0.00	87	0	C	NM_003736		140768647	+1	tier1	-	no_errors	ENST00000519479	ensembl	human	known	74_37	missense	37.70	38	23	SNP	0.000	T
PCDHGA8	9708	genome.wustl.edu	37	5	140773787	140773787	+	Silent	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr5:140773787C>A	ENST00000398604.2	+	1	1407	c.1407C>A	c.(1405-1407)gcC>gcA	p.A469A	PCDHGA7_ENST00000518325.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA6_ENST00000517434.1_Intron	NM_032088.1	NP_114477.1	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8	469	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(6)|kidney(6)|large_intestine(6)|lung(30)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGAGAGGAGCCTCCATCTTTT	0.562																																																	0													60.0	63.0	62.0					5																	140773787		2084	4222	6306	SO:0001819	synonymous_variant	0			AF152515	CCDS47291.1, CCDS75338.1	5q31	2010-01-26			ENSG00000253767	ENSG00000253767		"""Cadherins / Protocadherins : Clustered"""	8706	other	protocadherin		606295				10380929	Standard	NM_014004		Approved	KIAA0327, PCDH-GAMMA-A8		Q9Y5G5	OTTHUMG00000164053	ENST00000398604.2:c.1407C>A	5.37:g.140773787C>A			A7MCZ4|O15039	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A469	ENST00000398604.2	37	c.1407	CCDS47291.1	5																																																																																			PCDHGA8	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000253767		0.562	PCDHGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA8	HGNC	protein_coding	OTTHUMT00000376972.1	-	0.00	112	0	C	NM_032088		140773787	+1	tier1	-	no_errors	ENST00000398604	ensembl	human	known	74_37	silent	39.53	52	34	SNP	0.801	A
PCED1B	91523	genome.wustl.edu	37	12	47630009	47630009	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr12:47630009G>A	ENST00000546455.1	+	4	1894	c.1163G>A	c.(1162-1164)cGt>cAt	p.R388H	RP11-493L12.3_ENST00000547748.1_RNA|PCED1B_ENST00000432328.1_Missense_Mutation_p.R388H			Q96HM7	PED1B_HUMAN	PC-esterase domain containing 1B	388	Pro-rich.						hydrolase activity (GO:0016787)										CCCACACCCCGTTATCAGCGG	0.572																																																	0													108.0	105.0	106.0					12																	47630009		2203	4300	6503	SO:0001583	missense	0			BC016154	CCDS8752.1	12q13.11	2012-06-11	2012-06-11	2012-06-11	ENSG00000179715	ENSG00000179715			28255	protein-coding gene	gene with protein product			"""family with sequence similarity 113, member B"""	FAM113B		20056006	Standard	NM_138371		Approved	MGC16044	uc001rpq.3	Q96HM7	OTTHUMG00000169617	ENST00000546455.1:c.1163G>A	12.37:g.47630009G>A	ENSP00000446688:p.Arg388His		Q96B20	Missense_Mutation	SNP	NULL	p.R388H	ENST00000546455.1	37	c.1163	CCDS8752.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	3.172|3.172	-0.169888|-0.169888	0.06461|0.06461	.|.	.|.	ENSG00000179715|ENSG00000179715	ENST00000546455;ENST00000432328|ENST00000330951	T;T|.	0.28255|.	1.62;1.62|.	3.24|3.24	-0.917|-0.917	0.10485|0.10485	.|.	0.971212|.	0.08380|.	N|.	0.954643|.	T|T	0.16428|0.16428	0.0395|0.0395	N|N	0.05078|0.05078	-0.115|-0.115	0.09310|0.09310	N|N	1|1	P|.	0.39326|.	0.668|.	B|.	0.24155|.	0.051|.	T|T	0.22382|0.22382	-1.0218|-1.0218	10|6	0.15066|0.87932	T|D	0.55|0	-1.5804|-1.5804	3.4496|3.4496	0.07493|0.07493	0.3683:0.2005:0.4312:0.0|0.3683:0.2005:0.4312:0.0	.|.	388|.	Q96HM7|.	F113B_HUMAN|.	H|I	388|232	ENSP00000446688:R388H;ENSP00000396040:R388H|.	ENSP00000396040:R388H|ENSP00000328560:V232I	R|V	+|+	2|1	0|0	FAM113B|FAM113B	45916276|45916276	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.005000|0.005000	0.04900|0.04900	-0.854000|-0.854000	0.04299|0.04299	-0.205000|-0.205000	0.10219|0.10219	-0.136000|-0.136000	0.14681|0.14681	CGT|GTT	PCED1B	-	NULL	ENSG00000179715		0.572	PCED1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCED1B	HGNC	protein_coding	OTTHUMT00000405079.1	-	0.00	54	0	G	NM_138371		47630009	+1	tier1	-	no_errors	ENST00000432328	ensembl	human	known	74_37	missense	26.67	21	8	SNP	0.000	A
PCSK1	5122	genome.wustl.edu	37	5	95757621	95757621	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr5:95757621C>A	ENST00000311106.3	-	5	820	c.583G>T	c.(583-585)Gat>Tat	p.D195Y	CTD-2337A12.1_ENST00000502645.2_RNA|PCSK1_ENST00000508626.1_Missense_Mutation_p.D148Y	NM_000439.4|NM_001177876.1	NP_000430.3|NP_001171347.1	P29120	NEC1_HUMAN	proprotein convertase subtilisin/kexin type 1	195	Peptidase S8.				cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|metabolic process (GO:0008152)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of insulin secretion (GO:0050796)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(14)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	36		all_cancers(142;2.67e-06)|all_epithelial(76;6.92e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0112)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;3.44e-16)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	GGAAATGGATCATGGTCATTA	0.303																																																	0													147.0	147.0	147.0					5																	95757621		2203	4300	6503	SO:0001583	missense	0				CCDS4081.1, CCDS54881.1	5q15-q21	2008-07-18			ENSG00000175426	ENSG00000175426			8743	protein-coding gene	gene with protein product	"""prohormone convertase 3"", ""prohormone convertase 1"", ""neuroendocrine convertase 1"", ""proprotein convertase 1"""	162150		NEC1		1765368	Standard	NM_000439		Approved	PC1, PC3, SPC3	uc003kls.2	P29120	OTTHUMG00000122089	ENST00000311106.3:c.583G>T	5.37:g.95757621C>A	ENSP00000308024:p.Asp195Tyr		B7Z8T7|E9PHA1|P78478|Q92532	Missense_Mutation	SNP	pfam_Peptidase_S8/S53_dom,pfam_PrprotnconvertsP,pfam_Proho_convert,superfamily_Peptidase_S8/S53_dom,superfamily_Galactose-bd-like,superfamily_Prot_inh_propept,prints_Peptidase_S8_subtilisin-rel	p.D195Y	ENST00000311106.3	37	c.583	CCDS4081.1	5	.	.	.	.	.	.	.	.	.	.	C	28.6	4.931223	0.92389	.	.	ENSG00000175426	ENST00000311106;ENST00000508626	D;D	0.81579	-1.51;-1.51	5.82	5.82	0.92795	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.000000	0.85682	D	0.000000	D	0.90625	0.7060	M	0.83953	2.67	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	D	0.90018	0.4126	10	0.48119	T	0.1	-27.6928	19.6917	0.96005	0.0:1.0:0.0:0.0	.	195	P29120	NEC1_HUMAN	Y	195;148	ENSP00000308024:D195Y;ENSP00000421600:D148Y	ENSP00000308024:D195Y	D	-	1	0	PCSK1	95783377	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.252000	0.78309	2.751000	0.94390	0.650000	0.86243	GAT	PCSK1	-	pfam_Peptidase_S8/S53_dom,superfamily_Peptidase_S8/S53_dom	ENSG00000175426		0.303	PCSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK1	HGNC	protein_coding	OTTHUMT00000242851.1		0.00	34	0	C	NM_000439		95757621	-1			no_errors	ENST00000311106	ensembl	human	known	74_37	missense	5.08	55	3	SNP	1.000	A
PCYOX1L	78991	genome.wustl.edu	37	5	148745521	148745521	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr5:148745521G>T	ENST00000274569.4	+	4	549	c.487G>T	c.(487-489)Gcc>Tcc	p.A163S	PCYOX1L_ENST00000514349.1_Missense_Mutation_p.A73S	NM_024028.3	NP_076933.3	Q8NBM8	PCYXL_HUMAN	prenylcysteine oxidase 1 like	163					prenylcysteine catabolic process (GO:0030328)	extracellular region (GO:0005576)|membrane (GO:0016020)	prenylcysteine oxidase activity (GO:0001735)			breast(2)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	11			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TAAGTACCAGGCCCACGGCTA	0.562																																					Ovarian(62;1136 1477 27277 27495)												0													80.0	81.0	81.0					5																	148745521		2203	4300	6503	SO:0001583	missense	0				CCDS4296.1	5q33.1	2008-02-05			ENSG00000145882	ENSG00000145882			28477	protein-coding gene	gene with protein product						12477932	Standard	NM_024028		Approved	MGC3265	uc003lqk.2	Q8NBM8	OTTHUMG00000130052	ENST00000274569.4:c.487G>T	5.37:g.148745521G>T	ENSP00000274569:p.Ala163Ser		Q7Z4S2|Q8NCY5|Q8NF69|Q9BTE8|Q9BWS3	Missense_Mutation	SNP	pfam_Prenylcys_lyase,pirsf_Prenylcysteine_Oxase	p.A163S	ENST00000274569.4	37	c.487	CCDS4296.1	5	.	.	.	.	.	.	.	.	.	.	G	11.91	1.778578	0.31502	.	.	ENSG00000145882	ENST00000274569;ENST00000514349	T;T	0.13089	2.62;2.62	5.27	5.27	0.74061	Prenylcysteine lyase (1);	0.000000	0.85682	D	0.000000	T	0.19005	0.0456	L	0.35593	1.075	0.54753	D	0.999981	B;P	0.48911	0.339;0.917	B;P	0.54759	0.16;0.76	T	0.01004	-1.1484	10	0.05351	T	0.99	-26.3546	18.8941	0.92416	0.0:0.0:1.0:0.0	.	73;163	E7EVZ5;Q8NBM8	.;PCYXL_HUMAN	S	163;73	ENSP00000274569:A163S;ENSP00000428512:A73S	ENSP00000274569:A163S	A	+	1	0	PCYOX1L	148725714	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	4.604000	0.61112	2.483000	0.83821	0.561000	0.74099	GCC	PCYOX1L	-	pfam_Prenylcys_lyase,pirsf_Prenylcysteine_Oxase	ENSG00000145882		0.562	PCYOX1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCYOX1L	HGNC	protein_coding	OTTHUMT00000252331.2	-	0.00	57	0	G	NM_024028		148745521	+1	tier1	-	no_errors	ENST00000274569	ensembl	human	known	74_37	missense	5.13	74	4	SNP	1.000	T
PDE6C	5146	genome.wustl.edu	37	10	95418860	95418860	+	Splice_Site	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr10:95418860G>T	ENST00000371447.3	+	18	2282		c.e18-1			NM_006204.3	NP_006195.3	P51160	PDE6C_HUMAN	phosphodiesterase 6C, cGMP-specific, cone, alpha prime						phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|visual perception (GO:0007601)	plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(12)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.123)			Caffeine(DB00201)	TTCTTCCTAAGGGCAATGATG	0.338																																																	0													106.0	94.0	98.0					10																	95418860		2203	4300	6503	SO:0001630	splice_region_variant	0			U31973	CCDS7429.1	10q24	2013-01-23			ENSG00000095464	ENSG00000095464	3.1.4.17	"""Phosphodiesterases"""	8787	protein-coding gene	gene with protein product		600827					Standard	NM_006204		Approved	PDEA2, ACHM5, COD4	uc001kiu.4	P51160	OTTHUMG00000018775	ENST00000371447.3:c.2145-1G>T	10.37:g.95418860G>T			A6NCR6|Q5VY29	Splice_Site	SNP	-	e18-1	ENST00000371447.3	37	c.2145-1	CCDS7429.1	10	.	.	.	.	.	.	.	.	.	.	G	22.5	4.298767	0.81025	.	.	ENSG00000095464	ENST00000371447	.	.	.	5.26	5.26	0.73747	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.7906	0.88551	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PDE6C	95408850	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.150000	0.94667	2.742000	0.94016	0.591000	0.81541	.	PDE6C	-	-	ENSG00000095464		0.338	PDE6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE6C	HGNC	protein_coding	OTTHUMT00000049437.1		0.00	65	0	G	NM_006204	Intron	95418860	+1			no_errors	ENST00000371447	ensembl	human	known	74_37	splice_site	5.56	68	4	SNP	1.000	T
PDK2	5164	genome.wustl.edu	37	17	48184157	48184157	+	Splice_Site	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr17:48184157G>T	ENST00000503176.1	+	5	678		c.e5-1		PDK2_ENST00000007708.3_Splice_Site	NM_002611.4	NP_002602.2	Q15119	PDK2_HUMAN	pyruvate dehydrogenase kinase, isozyme 2						cellular metabolic process (GO:0044237)|cellular response to nutrient (GO:0031670)|cellular response to reactive oxygen species (GO:0034614)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|protein phosphorylation (GO:0006468)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of cellular ketone metabolic process (GO:0010565)|regulation of gluconeogenesis (GO:0006111)|regulation of glucose metabolic process (GO:0010906)|regulation of pH (GO:0006885)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrial pyruvate dehydrogenase complex (GO:0005967)	ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|pyruvate dehydrogenase (acetyl-transferring) kinase activity (GO:0004740)			central_nervous_system(4)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	20						CCTGCCTGCAGCCCTCATCTT	0.582									Autosomal Dominant Polycystic Kidney Disease																																								0													132.0	96.0	108.0					17																	48184157		2203	4300	6503	SO:0001630	splice_region_variant	0	Familial Cancer Database	ADPKD	L42451	CCDS11559.1, CCDS56039.1	17q21.33	2012-07-18	2005-11-16		ENSG00000005882	ENSG00000005882			8810	protein-coding gene	gene with protein product		602525	"""pyruvate dehydrogenase kinase, isoenzyme 2"""			7499431	Standard	NM_001199898		Approved	PDHK2	uc002iqc.3	Q15119	OTTHUMG00000161948	ENST00000503176.1:c.518-1G>T	17.37:g.48184157G>T			A8K3A7|B3KNW0|Q6P515|Q9BS05	Splice_Site	SNP	-	e5-1	ENST00000503176.1	37	c.518-1	CCDS11559.1	17	.	.	.	.	.	.	.	.	.	.	G	16.72	3.201367	0.58234	.	.	ENSG00000005882	ENST00000007708;ENST00000508030;ENST00000503176;ENST00000503614;ENST00000505440;ENST00000510219	.	.	.	4.77	4.77	0.60923	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.7108	0.85385	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PDK2	45539156	1.000000	0.71417	1.000000	0.80357	0.613000	0.37349	9.601000	0.98297	2.475000	0.83589	0.455000	0.32223	.	PDK2	-	-	ENSG00000005882		0.582	PDK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDK2	HGNC	protein_coding	OTTHUMT00000366492.2		0.00	28	0	G	NM_002611	Intron	48184157	+1			no_errors	ENST00000503176	ensembl	human	known	74_37	splice_site	9.52	38	4	SNP	1.000	T
PEAR1	375033	genome.wustl.edu	37	1	156884559	156884559	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:156884559C>T	ENST00000338302.3	+	24	3308	c.3083C>T	c.(3082-3084)cCa>cTa	p.P1028L	PEAR1_ENST00000292357.7_Missense_Mutation_p.P1028L			Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	1028	Pro-rich.				recognition of apoptotic cell (GO:0043654)	integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(6)|lung(22)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)	43	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CGGCATCCCCCATCACCTCCA	0.622																																																	0													173.0	121.0	138.0					1																	156884559		2203	4300	6503	SO:0001583	missense	0			AK098809	CCDS30892.1	1q23.1	2008-02-05	2007-10-25	2007-10-25	ENSG00000187800	ENSG00000187800			33631	protein-coding gene	gene with protein product		610278	"""multiple EGF-like-domains 12"""	MEGF12		15851471	Standard	NM_001080471		Approved	JEDI, FLJ00193	uc001fqj.1	Q5VY43	OTTHUMG00000041293	ENST00000338302.3:c.3083C>T	1.37:g.156884559C>T	ENSP00000344465:p.Pro1028Leu		Q8TEK2	Missense_Mutation	SNP	pfam_EGF_laminin,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF_laminin,pfscan_EG-like_dom,pfscan_EMI_domain	p.P1028L	ENST00000338302.3	37	c.3083	CCDS30892.1	1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.306801	0.81247	.	.	ENSG00000187800	ENST00000338302;ENST00000292357	D;D	0.92099	-2.97;-2.97	4.95	4.95	0.65309	.	0.000000	0.43110	D	0.000613	D	0.86789	0.6017	L	0.59436	1.845	0.54753	D	0.99998	B	0.28636	0.218	B	0.21546	0.035	D	0.87571	0.2478	10	0.87932	D	0	.	15.7102	0.77620	0.0:1.0:0.0:0.0	.	1028	Q5VY43	PEAR1_HUMAN	L	1028	ENSP00000344465:P1028L;ENSP00000292357:P1028L	ENSP00000292357:P1028L	P	+	2	0	PEAR1	155151183	1.000000	0.71417	0.992000	0.48379	0.922000	0.55478	5.319000	0.65835	2.553000	0.86117	0.591000	0.81541	CCA	PEAR1	-	NULL	ENSG00000187800		0.622	PEAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEAR1	HGNC	protein_coding	OTTHUMT00000098937.2	-	0.00	99	0	C	NM_001080471		156884559	+1	tier1	-	no_errors	ENST00000292357	ensembl	human	known	74_37	missense	8.33	132	12	SNP	0.990	T
PET117	100303755	genome.wustl.edu	37	20	18122859	18122859	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr20:18122859G>T	ENST00000432901.3	+	2	187	c.104G>T	c.(103-105)cGt>cTt	p.R35L	CSRP2BP_ENST00000377681.3_5'Flank|CSRP2BP_ENST00000435364.3_5'Flank|CSRP2BP_ENST00000489634.2_5'Flank|CSRP2BP_ENST00000484001.1_3'UTR	NM_001164811.1	NP_001158283.1	Q6UWS5	PT117_HUMAN	PET117 homolog (S. cerevisiae)	35						mitochondrion (GO:0005739)				endometrium(1)	1						TAGAGGCTTCGTGACGGAGTT	0.393																																																	0													121.0	104.0	110.0					20																	18122859		692	1591	2283	SO:0001583	missense	0				CCDS54450.1	20p11.23	2012-02-23			ENSG00000232838	ENSG00000232838			40045	protein-coding gene	gene with protein product		614771					Standard	NM_001164811		Approved		uc021wba.1	Q6UWS5		ENST00000432901.3:c.104G>T	20.37:g.18122859G>T	ENSP00000397881:p.Arg35Leu			Missense_Mutation	SNP	NULL	p.R35L	ENST00000432901.3	37	c.104	CCDS54450.1	20	.	.	.	.	.	.	.	.	.	.	G	11.72	1.723368	0.30503	.	.	ENSG00000232838	ENST00000432901	.	.	.	5.1	0.878	0.19150	.	.	.	.	.	T	0.43678	0.1258	.	.	.	0.24991	N	0.99154	.	.	.	.	.	.	T	0.39820	-0.9595	5	0.66056	D	0.02	.	9.8483	0.41041	0.3625:0.0:0.6375:0.0	.	.	.	.	L	35	.	ENSP00000397881:R35L	R	+	2	0	AL050321.1	18070859	0.853000	0.29707	0.993000	0.49108	0.400000	0.30750	0.417000	0.21214	0.002000	0.14630	-0.244000	0.11960	CGT	PET117	-	NULL	ENSG00000232838		0.393	PET117-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PET117	HGNC	protein_coding	OTTHUMT00000472038.1	-	0.00	75	0	G			18122859	+1	tier1	-	no_errors	ENST00000432901	ensembl	human	known	74_37	missense	5.61	101	6	SNP	0.888	T
PGBD1	84547	genome.wustl.edu	37	6	28269344	28269344	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr6:28269344G>T	ENST00000405948.2	+	7	2133	c.1713G>T	c.(1711-1713)tgG>tgT	p.W571C	PGBD1_ENST00000259883.3_Missense_Mutation_p.W571C	NM_001184743.1|NM_032507.3	NP_001171672.1|NP_115896.1	Q96JS3	PGBD1_HUMAN	piggyBac transposable element derived 1	571						membrane (GO:0016020)|nucleus (GO:0005634)	scavenger receptor activity (GO:0005044)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	41						ATAAAATTTGGTGTGGTACAA	0.393																																																	0													77.0	77.0	77.0					6																	28269344		2203	4300	6503	SO:0001583	missense	0			D88259	CCDS4648.1	6p22.1	2013-01-09			ENSG00000137338	ENSG00000137338		"""-"""	19398	protein-coding gene	gene with protein product							Standard	NM_001184743		Approved	HUCEP-4, dJ874C20.4, SCAND4	uc003nkz.3	Q96JS3	OTTHUMG00000014520	ENST00000405948.2:c.1713G>T	6.37:g.28269344G>T	ENSP00000385213:p.Trp571Cys		Q53F43|Q6NTF5|Q8WWS4	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,pfscan_SRCR,pfscan_Tscrpt_reg_SCAN	p.W571C	ENST00000405948.2	37	c.1713	CCDS4648.1	6	.	.	.	.	.	.	.	.	.	.	G	15.86	2.957910	0.53400	.	.	ENSG00000137338	ENST00000405948;ENST00000259883	T;T	0.19105	2.17;2.17	4.66	4.66	0.58398	.	0.000000	0.52532	D	0.000063	T	0.35941	0.0949	M	0.73962	2.25	0.58432	D	0.999993	P	0.52316	0.952	D	0.65773	0.938	T	0.10683	-1.0619	10	0.87932	D	0	-13.6362	13.256	0.60079	0.0:0.0:1.0:0.0	.	571	Q96JS3	PGBD1_HUMAN	C	571	ENSP00000385213:W571C;ENSP00000259883:W571C	ENSP00000259883:W571C	W	+	3	0	PGBD1	28377323	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.127000	0.64727	2.581000	0.87130	0.655000	0.94253	TGG	PGBD1	-	NULL	ENSG00000137338		0.393	PGBD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PGBD1	HGNC	protein_coding	OTTHUMT00000040188.2	-	0.00	29	0	G			28269344	+1	tier1	-	no_errors	ENST00000259883	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	T
PEX3	8504	genome.wustl.edu	37	6	143780297	143780297	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr6:143780297C>T	ENST00000367591.4	+	2	212	c.149C>T	c.(148-150)gCc>gTc	p.A50V		NM_003630.2	NP_003621.1	P56589	PEX3_HUMAN	peroxisomal biogenesis factor 3	50					peroxisome membrane biogenesis (GO:0016557)|peroxisome organization (GO:0007031)|protein import into peroxisome membrane (GO:0045046)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of peroxisomal membrane (GO:0005779)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)|protein-lipid complex (GO:0032994)	lipid binding (GO:0008289)|protein dimerization activity (GO:0046983)			endometrium(1)|large_intestine(9)|lung(4)|ovary(2)|skin(2)	18				OV - Ovarian serous cystadenocarcinoma(155;5.73e-06)|GBM - Glioblastoma multiforme(68;0.0117)		GAATACATTGCCCAAGCACGA	0.358																																																	0													123.0	118.0	120.0					6																	143780297		2203	4300	6503	SO:0001583	missense	0			AJ001625	CCDS5199.1	6q24.2	2008-05-15			ENSG00000034693	ENSG00000034693			8858	protein-coding gene	gene with protein product		603164				9657383	Standard	NM_003630		Approved		uc003qjl.3	P56589	OTTHUMG00000015730	ENST00000367591.4:c.149C>T	6.37:g.143780297C>T	ENSP00000356563:p.Ala50Val		Q6FGP5	Missense_Mutation	SNP	pfam_Peroxin-3	p.A50V	ENST00000367591.4	37	c.149	CCDS5199.1	6	.	.	.	.	.	.	.	.	.	.	C	32	5.118970	0.94385	.	.	ENSG00000034693	ENST00000367591	T	0.49720	0.77	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.57519	0.2059	L	0.60845	1.875	0.80722	D	1	D;D	0.71674	0.975;0.998	P;D	0.67900	0.447;0.954	T	0.45906	-0.9229	10	0.27785	T	0.31	-12.2468	19.9658	0.97266	0.0:1.0:0.0:0.0	.	50;50	B4DV31;P56589	.;PEX3_HUMAN	V	50	ENSP00000356563:A50V	ENSP00000356563:A50V	A	+	2	0	PEX3	143821990	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	7.429000	0.80309	2.721000	0.93114	0.591000	0.81541	GCC	PEX3	-	pfam_Peroxin-3	ENSG00000034693		0.358	PEX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX3	HGNC	protein_coding	OTTHUMT00000042525.1		0.00	41	0	C			143780297	+1			no_errors	ENST00000367591	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	T
PGBD5	79605	genome.wustl.edu	37	1	230472966	230472966	+	Silent	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:230472966G>T	ENST00000525115.1	-	4	779	c.756C>A	c.(754-756)ctC>ctA	p.L252L	PGBD5_ENST00000530424.1_5'Flank|PGBD5_ENST00000321327.2_Silent_p.L351L|PGBD5_ENST00000391860.1_Silent_p.L206L			Q8N414	PGBD5_HUMAN	piggyBac transposable element derived 5	252						integral component of membrane (GO:0016021)				biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(2)|skin(1)	33	Breast(184;0.0397)	Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;0.201)		CCATGCTGTGGAGCTGGGGCT	0.557																																																	0													66.0	57.0	60.0					1																	230472966		2203	4300	6503	SO:0001819	synonymous_variant	0			AK021475		1q42.13	2008-02-05			ENSG00000177614	ENSG00000177614			19405	protein-coding gene	gene with protein product							Standard	NM_001258311		Approved	DKFZp761A0620, FLJ11413	uc031psq.1	Q8N414	OTTHUMG00000037759	ENST00000525115.1:c.756C>A	1.37:g.230472966G>T			A0PJF3|B9EK58|Q5SR37|Q6PJN2	Silent	SNP	NULL	p.L351	ENST00000525115.1	37	c.1053		1																																																																																			PGBD5	-	NULL	ENSG00000177614		0.557	PGBD5-002	PUTATIVE	basic|exp_conf	protein_coding	PGBD5	HGNC	protein_coding	OTTHUMT00000382617.1	-	0.00	78	0	G	NM_024554		230472966	-1	tier1	-	no_errors	ENST00000321327	ensembl	human	known	74_37	silent	5.13	111	6	SNP	0.435	T
PGBD2	267002	genome.wustl.edu	37	1	249212492	249212492	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:249212492C>A	ENST00000329291.5	+	3	1856	c.1709C>A	c.(1708-1710)aCc>aAc	p.T570N	PGBD2_ENST00000355360.4_Missense_Mutation_p.T319N|PGBD2_ENST00000539153.1_Missense_Mutation_p.T567N	NM_170725.2	NP_733843.1	Q6P3X8	PGBD2_HUMAN	piggyBac transposable element derived 2	570										NS(1)|endometrium(3)|lung(6)|ovary(1)|skin(3)	14	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.012)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			CACTCACAGACCAACACCCGG	0.532																																																	0													117.0	122.0	120.0					1																	249212492		2203	4300	6503	SO:0001583	missense	0			AF229602	CCDS31128.1, CCDS31129.1	1q	2008-02-05			ENSG00000185220	ENSG00000185220			19399	protein-coding gene	gene with protein product							Standard	XM_005270333		Approved		uc001ifh.3	Q6P3X8	OTTHUMG00000040424	ENST00000329291.5:c.1709C>A	1.37:g.249212492C>A	ENSP00000331643:p.Thr570Asn		B3KVR8|Q6MZF8	Missense_Mutation	SNP	NULL	p.T570N	ENST00000329291.5	37	c.1709	CCDS31128.1	1	.	.	.	.	.	.	.	.	.	.	.	9.258	1.042579	0.19748	.	.	ENSG00000185220	ENST00000355360;ENST00000329291;ENST00000539153	D;D;D	0.84370	-1.84;-1.84;-1.84	3.12	2.2	0.27929	.	0.000000	0.51477	D	0.000098	D	0.87390	0.6165	L	0.50333	1.59	0.25176	N	0.990242	D;D	0.76494	0.999;0.995	D;P	0.83275	0.996;0.72	T	0.76836	-0.2812	10	0.72032	D	0.01	.	6.1507	0.20310	0.0:0.8587:0.0:0.1413	.	567;570	F5H4U7;Q6P3X8	.;PGBD2_HUMAN	N	319;570;567	ENSP00000355424:T319N;ENSP00000331643:T570N;ENSP00000439950:T567N	ENSP00000331643:T570N	T	+	2	0	PGBD2	247179115	1.000000	0.71417	0.871000	0.34182	0.001000	0.01503	3.079000	0.50104	0.870000	0.35726	-0.218000	0.12543	ACC	PGBD2	-	NULL	ENSG00000185220		0.532	PGBD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PGBD2	HGNC	protein_coding	OTTHUMT00000097318.1	-	0.00	36	0	C			249212492	+1	tier1	-	no_errors	ENST00000329291	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.939	A
PHC1	1911	genome.wustl.edu	37	12	9085324	9085324	+	Missense_Mutation	SNP	C	C	T	rs368945524		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr12:9085324C>T	ENST00000543824.1	+	9	1603	c.1271C>T	c.(1270-1272)gCg>gTg	p.A424V	PHC1_ENST00000536844.1_Missense_Mutation_p.A203V|PHC1_ENST00000433847.2_3'UTR|PHC1_ENST00000544916.1_Missense_Mutation_p.A424V|PHC1_ENST00000433083.2_Missense_Mutation_p.A379V			P78364	PHC1_HUMAN	polyhomeotic homolog 1 (Drosophila)	424					cellular response to retinoic acid (GO:0071300)|histone ubiquitination (GO:0016574)|multicellular organismal development (GO:0007275)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|large_intestine(8)|liver(2)|lung(3)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	27						CTCCAGTTGGCgcagcagcag	0.607																																																	0													67.0	72.0	70.0					12																	9085324		2203	4298	6501	SO:0001583	missense	0			U89277	CCDS8597.1	12p13	2013-01-10	2006-09-12	2002-11-15	ENSG00000111752	ENSG00000111752		"""Sterile alpha motif (SAM) domain containing"""	3182	protein-coding gene	gene with protein product		602978	"""early development regulator 1 (homolog of polyhomeotic 1)"", ""polyhomeotic-like 1 (Drosophila)"""	EDR1		9121482	Standard	XM_005253334		Approved	HPH1, RAE28	uc001qvd.3	P78364	OTTHUMG00000168275	ENST00000543824.1:c.1271C>T	12.37:g.9085324C>T	ENSP00000440674:p.Ala424Val		D3DUV4|Q8WVM3|Q9BU63	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,pfam_Znf_MYM,superfamily_SAM/pointed,smart_SAM,pfscan_SAM,pfscan_Znf_FCS	p.A424V	ENST00000543824.1	37	c.1271	CCDS8597.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.27|16.27	3.076823|3.076823	0.55753|0.55753	.|.	.|.	ENSG00000111752|ENSG00000111752	ENST00000543824;ENST00000251757;ENST00000433083;ENST00000544916;ENST00000536844|ENST00000537610	T;T;T;T;T|.	0.74002|.	0.3;0.3;0.3;0.3;-0.8|.	4.86|4.86	4.86|4.86	0.63082|0.63082	.|.	0.194739|.	0.34676|.	N|.	0.003775|.	T|T	0.59569|0.59569	0.2203|0.2203	L|L	0.35854|0.35854	1.095|1.095	0.35668|0.35668	D|D	0.813076|0.813076	D;D;D|.	0.69078|.	0.996;0.993;0.997|.	P;P;P|.	0.54238|.	0.746;0.561;0.689|.	T|T	0.63924|0.63924	-0.6527|-0.6527	10|5	0.33141|.	T|.	0.24|.	-1.2229|-1.2229	17.7775|17.7775	0.88514|0.88514	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	424;424;424|.	B4DF21;P78364;B2RXH1|.	.;PHC1_HUMAN;.|.	V|C	424;424;379;424;203|60	ENSP00000440674:A424V;ENSP00000251757:A424V;ENSP00000399194:A379V;ENSP00000437659:A424V;ENSP00000440488:A203V|.	ENSP00000251757:A424V|.	A|R	+|+	2|1	0|0	PHC1|PHC1	8976591|8976591	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.915000|0.915000	0.54546|0.54546	4.694000|4.694000	0.61760|0.61760	2.517000|2.517000	0.84864|0.84864	0.650000|0.650000	0.86243|0.86243	GCG|CGC	PHC1	-	NULL	ENSG00000111752		0.607	PHC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHC1	HGNC	protein_coding	OTTHUMT00000399115.1	-	0.00	97	0	C	NM_004426		9085324	+1	tier1	-	no_errors	ENST00000543824	ensembl	human	known	74_37	missense	26.67	66	24	SNP	1.000	T
PHLDB2	90102	genome.wustl.edu	37	3	111632384	111632384	+	Silent	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr3:111632384C>T	ENST00000431670.2	+	3	1965	c.1554C>T	c.(1552-1554)gaC>gaT	p.D518D	PHLDB2_ENST00000495180.1_Silent_p.D104D|PHLDB2_ENST00000477695.1_Silent_p.D518D|PHLDB2_ENST00000393923.3_Silent_p.D545D|PHLDB2_ENST00000412622.1_Silent_p.D518D|PHLDB2_ENST00000393925.3_Silent_p.D518D|PHLDB2_ENST00000481953.1_Silent_p.D518D	NM_001134438.1	NP_001127910.1	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B, member 2	518						cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(8)|lung(23)|ovary(6)|skin(7)|stomach(1)	55						CTGATGCAGACTTGGCAAGCT	0.557																																																	0													124.0	125.0	125.0					3																	111632384		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS2962.1, CCDS46885.1, CCDS46886.1	3q13.13	2013-01-10			ENSG00000144824	ENSG00000144824		"""Pleckstrin homology (PH) domain containing"""	29573	protein-coding gene	gene with protein product		610298				12376540	Standard	NM_145753		Approved	LL5beta, FLJ21791, LL5b	uc003dyg.3	Q86SQ0	OTTHUMG00000159282	ENST00000431670.2:c.1554C>T	3.37:g.111632384C>T			A5PKZ3|Q59EA8|Q68CY3|Q6NT98|Q8N8U8|Q8NAB1|Q8NCU5	Silent	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.D518	ENST00000431670.2	37	c.1554	CCDS46886.1	3																																																																																			PHLDB2	-	NULL	ENSG00000144824		0.557	PHLDB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB2	HGNC	protein_coding	OTTHUMT00000354337.1	-	0.00	26	0	C	NM_145753		111632384	+1	tier1	-	no_errors	ENST00000393925	ensembl	human	known	74_37	silent	17.14	29	6	SNP	0.046	T
PIK3CB	5291	genome.wustl.edu	37	3	138452210	138452210	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr3:138452210G>A	ENST00000477593.1	-	7	1116	c.1043C>T	c.(1042-1044)aCt>aTt	p.T348I	PIK3CB_ENST00000289153.2_Missense_Mutation_p.T348I			P42338	PK3CB_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta	348	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.				activation of MAPK activity (GO:0000187)|autophagy (GO:0006914)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|embryonic cleavage (GO:0040016)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of autophagy (GO:0010508)|regulation of cell-matrix adhesion (GO:0001952)|regulation of clathrin-mediated endocytosis (GO:2000369)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)			NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	41					Caffeine(DB00201)	CACTTTTACAGTTTCCTCTGT	0.318																																																	0													120.0	122.0	121.0					3																	138452210		2201	4298	6499	SO:0001583	missense	0				CCDS3104.1	3q22.3	2013-09-19	2012-07-13		ENSG00000051382	ENSG00000051382	2.7.1.153		8976	protein-coding gene	gene with protein product		602925	"""phosphoinositide-3-kinase, catalytic, beta polypeptide"""	PIK3C1		8246984	Standard	NM_006219		Approved		uc011bmq.3	P42338	OTTHUMG00000159893	ENST00000477593.1:c.1043C>T	3.37:g.138452210G>A	ENSP00000418143:p.Thr348Ile		D3DNF0|Q24JU2	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_adapt-bd_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,superfamily_Kinase-like_dom,superfamily_C2_dom,superfamily_ARM-type_fold,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.T348I	ENST00000477593.1	37	c.1043	CCDS3104.1	3	.	.	.	.	.	.	.	.	.	.	G	12.67	2.008930	0.35415	.	.	ENSG00000051382	ENST00000477593;ENST00000289153	T;T	0.66099	-0.19;-0.19	5.46	4.58	0.56647	C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (1);	0.312845	0.32836	N	0.005582	T	0.40398	0.1115	N	0.04203	-0.255	0.80722	D	1	B	0.27013	0.166	B	0.32583	0.148	T	0.29761	-1.0001	10	0.32370	T	0.25	-7.1183	10.3895	0.44160	0.0:0.2656:0.5919:0.1425	.	348	P42338	PK3CB_HUMAN	I	348	ENSP00000418143:T348I;ENSP00000289153:T348I	ENSP00000289153:T348I	T	-	2	0	PIK3CB	139934900	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.118000	0.41949	1.277000	0.44412	0.591000	0.81541	ACT	PIK3CB	-	superfamily_C2_dom,smart_PI3K_C2_dom	ENSG00000051382		0.318	PIK3CB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3CB	HGNC	protein_coding	OTTHUMT00000358019.1	-	0.00	102	0	G			138452210	-1	tier1	-	no_errors	ENST00000289153	ensembl	human	known	74_37	missense	20.74	106	28	SNP	1.000	A
PIK3R2	5296	genome.wustl.edu	37	19	18271374	18271374	+	Splice_Site	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr19:18271374G>T	ENST00000593731.1	+	3	975		c.e3+1		PIK3R2_ENST00000222254.8_Splice_Site			O00459	P85B_HUMAN	phosphoinositide-3-kinase, regulatory subunit 2 (beta)						blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)	phosphatidylinositol 3-kinase regulator activity (GO:0035014)|receptor tyrosine kinase binding (GO:0030971)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(3)|pancreas(1)|stomach(1)	24					Isoprenaline(DB01064)	GAAAGGACAGGTAAGTTCCAG	0.592																																																	0													80.0	65.0	70.0					19																	18271374		2203	4298	6501	SO:0001630	splice_region_variant	0				CCDS12371.1	19p13.11	2013-03-28	2008-02-04		ENSG00000105647	ENSG00000105647		"""SH2 domain containing"""	8980	protein-coding gene	gene with protein product		603157				1314371	Standard	NM_005027		Approved	P85B, p85	uc002nia.2	O00459	OTTHUMG00000183383	ENST00000593731.1:c.415+1G>T	19.37:g.18271374G>T			Q5EAT5|Q9UPH9	Splice_Site	SNP	-	e2+1	ENST00000593731.1	37	c.415+1	CCDS12371.1	19	.	.	.	.	.	.	.	.	.	.	G	12.92	2.082245	0.36758	.	.	ENSG00000105647	ENST00000222254	.	.	.	4.45	3.33	0.38152	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.5554	0.56250	0.0:0.0:0.8334:0.1666	.	.	.	.	.	-1	.	.	.	+	.	.	PIK3R2	18132374	1.000000	0.71417	1.000000	0.80357	0.387000	0.30353	7.038000	0.76537	2.203000	0.70933	0.561000	0.74099	.	PIK3R2	-	-	ENSG00000105647		0.592	PIK3R2-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	PIK3R2	HGNC	protein_coding	OTTHUMT00000466386.2		0.00	85	0	G	NM_005027	Intron	18271374	+1			no_errors	ENST00000222254	ensembl	human	known	74_37	splice_site	5.45	52	3	SNP	1.000	T
PKD1L3	342372	genome.wustl.edu	37	16	71986875	71986875	+	RNA	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr16:71986875G>T	ENST00000534738.1	-	0	2926							Q7Z443	PK1L3_HUMAN	polycystic kidney disease 1-like 3						cation transport (GO:0006812)|cellular response to acidic pH (GO:0071468)|detection of chemical stimulus involved in sensory perception of sour taste (GO:0001581)|neuropeptide signaling pathway (GO:0007218)|sensory perception of sour taste (GO:0050915)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)			autonomic_ganglia(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|lung(3)|skin(2)	22						GAGGGGCAGAGTCTCCTGTGG	0.522																																																	0													116.0	107.0	110.0					16																	71986875		692	1591	2283			0			AY164485	CCDS73912.1	16q22.2	2008-02-05				ENSG00000277481			21716	protein-coding gene	gene with protein product		607895				12782129	Standard	NM_181536		Approved		uc010vmm.2	Q7Z443			16.37:g.71986875G>T				RNA	SNP	-	NULL	ENST00000534738.1	37	NULL		16																																																																																			PKD1L3	-	-	ENSG00000187008		0.522	PKD1L3-001	KNOWN	basic	processed_transcript	PKD1L3	HGNC	processed_transcript	OTTHUMT00000387876.1	-	0.00	29	0	G	NM_181536		71986875	-1	tier1	-	no_errors	ENST00000335106	ensembl	human	known	74_37	rna	7.27	51	4	SNP	0.000	T
PKHD1L1	93035	genome.wustl.edu	37	8	110527510	110527510	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr8:110527510G>T	ENST00000378402.5	+	72	11769	c.11665G>T	c.(11665-11667)Gaa>Taa	p.E3889*		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	3889					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			GAAACACTGTGAACTTAATAA	0.318										HNSCC(38;0.096)																																							0													76.0	68.0	71.0					8																	110527510		1837	4084	5921	SO:0001587	stop_gained	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.11665G>T	8.37:g.110527510G>T	ENSP00000367655:p.Glu3889*		Q567P2|Q9UF27	Nonsense_Mutation	SNP	pfam_IPT,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT,smart_PA14,smart_PbH1	p.E3889*	ENST00000378402.5	37	c.11665	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	G	27.2	4.810556	0.90707	.	.	ENSG00000205038	ENST00000378402;ENST00000526472	.	.	.	5.46	-1.89	0.07689	.	0.640835	0.16601	N	0.207347	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	.	5.7912	0.18361	0.5094:0.1437:0.3468:0.0	.	.	.	.	X	3889;817	.	ENSP00000367655:E3889X	E	+	1	0	PKHD1L1	110596686	0.767000	0.28508	0.156000	0.22583	0.572000	0.35998	0.335000	0.19806	-0.477000	0.06832	-0.237000	0.12165	GAA	PKHD1L1	-	NULL	ENSG00000205038		0.318	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1		0.00	40	0	G	NM_177531		110527510	+1			no_errors	ENST00000378402	ensembl	human	known	74_37	nonsense	5.08	56	3	SNP	0.643	T
PLCL1	5334	genome.wustl.edu	37	2	198950711	198950711	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr2:198950711C>T	ENST00000428675.1	+	2	2868	c.2470C>T	c.(2470-2472)Cgg>Tgg	p.R824W	PLCL1_ENST00000437704.2_Missense_Mutation_p.R726W	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	824					gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|inositol 1,4,5 trisphosphate binding (GO:0070679)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					Quinacrine(DB01103)	GCCTGGATATCGGCATGTTCC	0.453																																																	0													208.0	183.0	192.0					2																	198950711		2203	4300	6503	SO:0001583	missense	0			D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896			9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE		7633416	Standard	NM_006226		Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.2470C>T	2.37:g.198950711C>T	ENSP00000402861:p.Arg824Trp		Q3MJ90|Q53SD3|Q7Z3S3	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.R824W	ENST00000428675.1	37	c.2470	CCDS2326.2	2	.	.	.	.	.	.	.	.	.	.	C	14.98	2.698517	0.48307	.	.	ENSG00000115896	ENST00000428675;ENST00000437704	T;T	0.16597	2.33;2.33	5.5	4.6	0.57074	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.099179	0.43416	D	0.000565	T	0.43656	0.1257	M	0.83603	2.65	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.44375	-0.9332	9	.	.	.	.	12.3071	0.54908	0.4667:0.5333:0.0:0.0	.	824;750	Q15111;B4DYZ4	PLCL1_HUMAN;.	W	824;726	ENSP00000402861:R824W;ENSP00000414138:R726W	.	R	+	1	2	PLCL1	198658956	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.053000	0.49901	1.514000	0.48869	0.655000	0.94253	CGG	PLCL1	-	superfamily_C2_dom,smart_C2_dom,prints_Pinositol_PLipase_C	ENSG00000115896		0.453	PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCL1	HGNC	protein_coding	OTTHUMT00000340210.1	-	0.00	54	0	C	NM_006226		198950711	+1	tier1	-	no_errors	ENST00000428675	ensembl	human	known	74_37	missense	23.53	78	24	SNP	1.000	T
PLSCR2	57047	genome.wustl.edu	37	3	146171805	146171805	+	Missense_Mutation	SNP	G	G	T	rs375128168		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr3:146171805G>T	ENST00000497985.1	-	7	1125	c.686C>A	c.(685-687)gCg>gAg	p.A229E	PLSCR2_ENST00000336685.2_Missense_Mutation_p.A156E	NM_001199978.1	NP_001186907.1	Q9NRY7	PLS2_HUMAN	phospholipid scramblase 2	229					phospholipid scrambling (GO:0017121)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phospholipid scramblase activity (GO:0017128)	p.A156E(1)|p.A156V(1)|p.A229E(1)		endometrium(2)|large_intestine(5)|lung(7)|stomach(1)	15						ATCAACACCCGCAATACAGCT	0.323																																																	3	Substitution - Missense(3)	endometrium(2)|large_intestine(1)											123.0	118.0	120.0					3																	146171805		2203	4300	6503	SO:0001583	missense	0				CCDS56284.1, CCDS3134.1, CCDS75029.1	3q24	2008-07-18			ENSG00000163746	ENSG00000163746			16494	protein-coding gene	gene with protein product		607610				10930526	Standard	NM_001199978		Approved		uc003evw.2	Q9NRY7	OTTHUMG00000159429	ENST00000497985.1:c.686C>A	3.37:g.146171805G>T	ENSP00000420132:p.Ala229Glu		B4DXC3|J3KR76|Q0VAQ1|Q6NSW9|Q7Z4L7	Missense_Mutation	SNP	pfam_Scramblase,superfamily_Tubby_C-like	p.A156E	ENST00000497985.1	37	c.467	CCDS56284.1	3	.	.	.	.	.	.	.	.	.	.	.	7.777	0.708637	0.15239	.	.	ENSG00000163746	ENST00000336685;ENST00000535500;ENST00000497985;ENST00000489015	T;T;T	0.21932	1.98;1.98;1.98	3.64	-6.48	0.01896	.	0.176775	0.22413	U	0.060385	T	0.10380	0.0254	L	0.28344	0.845	0.09310	N	1	B;B	0.20988	0.05;0.007	B;B	0.29077	0.098;0.019	T	0.34675	-0.9819	10	0.02654	T	1	.	12.4847	0.55866	0.0:0.5673:0.199:0.2336	.	249;156	Q7Z4L7;Q9NRY7	.;PLS2_HUMAN	E	156;248;229;156	ENSP00000338707:A156E;ENSP00000420132:A229E;ENSP00000418444:A156E	ENSP00000338707:A156E	A	-	2	0	PLSCR2	147654495	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.183000	0.01255	-1.759000	0.01313	-0.467000	0.05162	GCG	PLSCR2	-	pfam_Scramblase,superfamily_Tubby_C-like	ENSG00000163746		0.323	PLSCR2-002	PUTATIVE	basic|exp_conf|CCDS	protein_coding	PLSCR2	HGNC	protein_coding	OTTHUMT00000355264.1		0.00	44	0	G	NM_020359		146171805	-1			no_errors	ENST00000336685	ensembl	human	known	74_37	missense	5.17	55	3	SNP	0.000	T
PNLIPRP2	5408	genome.wustl.edu	37	10	118404628	118404628	+	RNA	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr10:118404628C>T	ENST00000298771.7	+	0	1455				PNLIPRP2_ENST00000433618.4_RNA|PNLIPRP2_ENST00000537242.1_RNA	NR_103727.1		P54317	LIPR2_HUMAN	pancreatic lipase-related protein 2						galactolipid catabolic process (GO:0019376)|lipid digestion (GO:0044241)|phospholipid catabolic process (GO:0009395)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	acylglycerol lipase activity (GO:0047372)|calcium ion binding (GO:0005509)|galactolipase activity (GO:0047714)|phospholipase activity (GO:0004620)|triglyceride lipase activity (GO:0004806)			endometrium(1)|large_intestine(1)|lung(11)|prostate(3)	16				all cancers(201;0.015)		GCAGCTATTGCGGTAATAAAA	0.403																																																	0													66.0	68.0	67.0					10																	118404628		1891	4121	6012			0			M93284		10q26.12	2014-03-14				ENSG00000266200	3.1.1.3		9157	protein-coding gene	gene with protein product		604423				1379598	Standard	NM_005396		Approved	PLRP2	uc001lcq.3	P54317			10.37:g.118404628C>T			A8K627|Q6IB55	RNA	SNP	-	NULL	ENST00000298771.7	37	NULL		10																																																																																			PNLIPRP2	-	-	ENSG00000165862		0.403	PNLIPRP2-004	KNOWN	basic	processed_transcript	PNLIPRP2	HGNC	polymorphic_pseudogene	OTTHUMT00000050546.6	-	0.00	37	0	C	NM_005396		118404628	+1	tier1	-	no_errors	ENST00000298771	ensembl	human	known	74_37	rna	5.88	64	4	SNP	0.000	T
PNPLA1	285848	genome.wustl.edu	37	6	36270166	36270166	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr6:36270166C>A	ENST00000394571.2	+	6	1304	c.1304C>A	c.(1303-1305)cCt>cAt	p.P435H	PNPLA1_ENST00000312917.5_Missense_Mutation_p.P349H|PNPLA1_ENST00000388715.3_Missense_Mutation_p.P340H	NM_001145717.1	NP_001139189.2	Q8N8W4	PLPL1_HUMAN	patatin-like phospholipase domain containing 1	435	Pro-rich.				lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)			breast(1)|kidney(1)|large_intestine(4)|lung(9)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	22						GTGGGGGCACCTCAAACACTG	0.592											OREG0017382	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													123.0	121.0	121.0					6																	36270166		2203	4300	6503	SO:0001583	missense	0				CCDS34438.1, CCDS47416.1, CCDS54997.1	6p21.31	2009-01-12			ENSG00000180316	ENSG00000180316		"""Patatin-like phospholipase domain containing"""	21246	protein-coding gene	gene with protein product		612121				16799181, 19029121	Standard	NM_001145717		Approved	FLJ38755, dJ50J22.1	uc010jwf.2	Q8N8W4	OTTHUMG00000014590	ENST00000394571.2:c.1304C>A	6.37:g.36270166C>A	ENSP00000378072:p.Pro435His	861	A3RMU3|J3JS20|Q2A6N1|Q3SY95|Q3SY96|Q5R3L2	Missense_Mutation	SNP	pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase	p.P436H	ENST00000394571.2	37	c.1307	CCDS54997.1	6	.	.	.	.	.	.	.	.	.	.	C	14.13	2.442245	0.43326	.	.	ENSG00000180316	ENST00000388715;ENST00000312917;ENST00000457797;ENST00000394571	T;T;T;T	0.31510	1.67;1.67;1.49;1.49	5.4	-0.945	0.10388	.	2.172240	0.02086	N	0.052715	T	0.07234	0.0183	L	0.27053	0.805	0.09310	N	1	B;B	0.17038	0.005;0.02	B;B	0.17098	0.007;0.017	T	0.28106	-1.0054	10	0.66056	D	0.02	2.7331	1.9264	0.03318	0.1296:0.4598:0.1266:0.2841	.	435;349	Q8N8W4;Q8N8W4-3	PLPL1_HUMAN;.	H	340;349;436;435	ENSP00000373367:P340H;ENSP00000321116:P349H;ENSP00000391868:P436H;ENSP00000378072:P435H	ENSP00000321116:P349H	P	+	2	0	PNPLA1	36378144	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	-0.030000	0.12308	-0.557000	0.06126	0.650000	0.86243	CCT	PNPLA1	-	NULL	ENSG00000180316		0.592	PNPLA1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	PNPLA1	HGNC	protein_coding			0.00	42	0	C	NM_173676		36270166	+1			no_errors	ENST00000457797	ensembl	human	known	74_37	missense	6.67	56	4	SNP	0.000	A
PNPLA6	10908	genome.wustl.edu	37	19	7620583	7620583	+	Silent	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr19:7620583C>T	ENST00000221249.6	+	27	3344	c.2913C>T	c.(2911-2913)atC>atT	p.I971I	PNPLA6_ENST00000450331.3_Silent_p.I971I|PNPLA6_ENST00000600737.1_Silent_p.I1009I|PNPLA6_ENST00000414982.3_Silent_p.I1019I|PNPLA6_ENST00000545201.2_Silent_p.I944I	NM_006702.4	NP_006693.3	Q8IY17	PLPL6_HUMAN	patatin-like phospholipase domain containing 6	1010					angiogenesis (GO:0001525)|cell death (GO:0008219)|lipid catabolic process (GO:0016042)|organ morphogenesis (GO:0009887)|phosphatidylcholine metabolic process (GO:0046470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)	35						GCTCTTTCATCGGAGCGTTGT	0.667																																																	0													37.0	39.0	39.0					19																	7620583		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ004832	CCDS32891.1, CCDS54206.1, CCDS54207.1, CCDS59343.1	19p13.2	2013-09-11						"""Patatin-like phospholipase domain containing"""	16268	protein-coding gene	gene with protein product	"""neuropathy target esterase"""	603197				9576844, 16799181, 19029121	Standard	NM_006702		Approved	NTE, sws, iPLA2delta, SPG39	uc010xjq.2	Q8IY17		ENST00000221249.6:c.2913C>T	19.37:g.7620583C>T			A6NGQ0|B4DFB9|B7Z7T2|F5H5K9|J3KQS3|O60859|Q86W58|Q9UG58	Silent	SNP	pfam_cNMP-bd_dom,pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.I1019	ENST00000221249.6	37	c.3057	CCDS32891.1	19																																																																																			PNPLA6	-	pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase	ENSG00000032444		0.667	PNPLA6-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	PNPLA6	HGNC	protein_coding	OTTHUMT00000459275.1	-	0.00	71	0	C	NM_006702		7620583	+1	tier1	-	no_errors	ENST00000414982	ensembl	human	known	74_37	silent	31.37	35	16	SNP	0.197	T
POGK	57645	genome.wustl.edu	37	1	166818561	166818561	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:166818561C>T	ENST00000367875.1	+	5	1105	c.745C>T	c.(745-747)Cgg>Tgg	p.R249W	POGK_ENST00000367876.4_Missense_Mutation_p.R249W|POGK_ENST00000536514.1_Missense_Mutation_p.R164W|POGK_ENST00000537173.1_Missense_Mutation_p.R131W			Q9P215	POGK_HUMAN	pogo transposable element with KRAB domain	249					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(1)|large_intestine(8)|lung(4)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	22						CGCCATGCGGCGGGCATTCCG	0.567																																					GBM(76;192 1530 30153 48742)												0													38.0	41.0	40.0					1																	166818561		2203	4300	6503	SO:0001583	missense	0			AB040946	CCDS1254.1	1q23.2	2013-01-08			ENSG00000143157	ENSG00000143157		"""-"""	18800	protein-coding gene	gene with protein product	"""KRAB box domain containing 2"""						Standard	NM_017542		Approved	KIAA15131, LST003, BASS2, KRBOX2	uc001gdt.1	Q9P215	OTTHUMG00000034325	ENST00000367875.1:c.745C>T	1.37:g.166818561C>T	ENSP00000356849:p.Arg249Trp		Q5TIJ1|Q8TE07	Missense_Mutation	SNP	pfam_DDE_SF_endonuclease_CENPB-like,pfam_Brinker_DNA-bd,pfam_HTH_CenpB_DNA-bd_dom,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,superfamily_Homeodomain-like,smart_Krueppel-associated_box,smart_HTH_CenpB_DNA-bd_dom,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.R249W	ENST00000367875.1	37	c.745	CCDS1254.1	1	.	.	.	.	.	.	.	.	.	.	C	16.78	3.217841	0.58560	.	.	ENSG00000143157	ENST00000537173;ENST00000536514;ENST00000367876;ENST00000367875	T;T;T;T	0.35973	1.29;1.28;4.54;4.54	5.5	3.61	0.41365	.	0.000000	0.45361	D	0.000366	T	0.23210	0.0561	N	0.24115	0.695	0.38313	D	0.943308	D;D;D	0.89917	1.0;1.0;0.978	D;D;B	0.74674	0.984;0.927;0.265	T	0.10660	-1.0620	8	.	.	.	-27.7935	5.0097	0.14306	0.1685:0.664:0.0:0.1675	.	131;164;249	G3V1P0;B4DS22;Q9P215	.;.;POGK_HUMAN	W	131;164;249;249	ENSP00000442763:R131W;ENSP00000441187:R164W;ENSP00000356850:R249W;ENSP00000356849:R249W	.	R	+	1	2	POGK	165085185	0.990000	0.36364	0.950000	0.38849	0.870000	0.49936	0.814000	0.27239	0.859000	0.35456	0.655000	0.94253	CGG	POGK	-	NULL	ENSG00000143157		0.567	POGK-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	POGK	HGNC	protein_coding	OTTHUMT00000082888.1	-	0.00	49	0	C	NM_017542		166818561	+1	tier1	-	no_errors	ENST00000367875	ensembl	human	known	74_37	missense	24.14	66	21	SNP	0.922	T
POM121L2	94026	genome.wustl.edu	37	6	27278524	27278524	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr6:27278524G>A	ENST00000444565.1	-	1	1425	c.1426C>T	c.(1426-1428)Cca>Tca	p.P476S	POM121L2_ENST00000377451.2_Missense_Mutation_p.P412S	NM_033482.3	NP_258443.2	Q96KW2	P12L2_HUMAN	POM121 transmembrane nucleoporin-like 2	476	Pro-rich.									breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	7						TCAGTAACTGGTAATGTGGGA	0.587																																																	0													98.0	105.0	103.0					6																	27278524		692	1591	2283	SO:0001583	missense	0			AL021808	CCDS59497.1	6p21.3	2012-03-13	2012-03-13		ENSG00000158553	ENSG00000158553			13973	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 2 (rat)"", ""POM121 membrane glycoprotein-like 2"""				Standard	NM_033482		Approved	POM121-L	uc011dku.1	Q96KW2	OTTHUMG00000014475	ENST00000444565.1:c.1426C>T	6.37:g.27278524G>A	ENSP00000392726:p.Pro476Ser		C9J1I7	Missense_Mutation	SNP	NULL	p.P476S	ENST00000444565.1	37	c.1426	CCDS59497.1	6	.	.	.	.	.	.	.	.	.	.	G	7.787	0.710707	0.15239	.	.	ENSG00000158553	ENST00000377451;ENST00000444565	T;T	0.18810	2.39;2.19	3.94	-1.23	0.09465	.	1.417790	0.05161	N	0.497852	T	0.04588	0.0125	L	0.39397	1.21	0.09310	N	1	B	0.24963	0.115	B	0.20767	0.031	T	0.38265	-0.9669	10	0.39692	T	0.17	.	0.7348	0.00963	0.1931:0.1571:0.3283:0.3215	.	476	C9J1I7	.	S	412;476	ENSP00000366671:P412S;ENSP00000392726:P476S	ENSP00000366671:P412S	P	-	1	0	POM121L2	27386503	0.000000	0.05858	0.000000	0.03702	0.053000	0.15095	-0.755000	0.04782	-0.268000	0.09312	-1.342000	0.01247	CCA	POM121L2	-	NULL	ENSG00000158553		0.587	POM121L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POM121L2	HGNC	protein_coding	OTTHUMT00000040143.2	-	0.00	81	0	G	NM_033482		27278524	-1	tier1	-	no_errors	ENST00000444565	ensembl	human	known	74_37	missense	42.48	64	48	SNP	0.000	A
POMC	5443	genome.wustl.edu	37	2	25384477	25384477	+	Missense_Mutation	SNP	T	T	C	rs200380417		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr2:25384477T>C	ENST00000405623.1	-	3	732	c.277A>G	c.(277-279)Agc>Ggc	p.S93G	RP11-509E16.1_ENST00000567599.1_lincRNA|POMC_ENST00000380794.1_Missense_Mutation_p.S93G|POMC_ENST00000264708.3_Missense_Mutation_p.S93G|POMC_ENST00000395826.2_Missense_Mutation_p.S93G			P01189	COLI_HUMAN	proopiomelanocortin	93					cell-cell signaling (GO:0007267)|cellular pigmentation (GO:0033059)|cellular protein metabolic process (GO:0044267)|generation of precursor metabolites and energy (GO:0006091)|glucose homeostasis (GO:0042593)|negative regulation of tumor necrosis factor production (GO:0032720)|neuropeptide signaling pathway (GO:0007218)|peptide hormone processing (GO:0016486)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of appetite (GO:0032098)|regulation of blood pressure (GO:0008217)|regulation of corticosterone secretion (GO:2000852)|regulation of glycogen metabolic process (GO:0070873)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|peroxisomal matrix (GO:0005782)|secretory granule (GO:0030141)|secretory granule lumen (GO:0034774)	G-protein coupled receptor binding (GO:0001664)|hormone activity (GO:0005179)|receptor binding (GO:0005102)|type 1 melanocortin receptor binding (GO:0070996)|type 3 melanocortin receptor binding (GO:0031781)|type 4 melanocortin receptor binding (GO:0031782)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(5)|ovary(1)	12	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Loperamide(DB00836)	ccgctgctgctgctgttgcGG	0.706																																					Colon(110;1515 1566 8452 10082 43216)												0													6.0	5.0	5.0					2																	25384477		1790	3648	5438	SO:0001583	missense	0				CCDS1717.1	2p23	2013-02-25	2008-07-31		ENSG00000115138	ENSG00000115138		"""Endogenous ligands"""	9201	protein-coding gene	gene with protein product	"""adrenocorticotropin"", ""beta-lipotropin"", ""alpha-melanocyte stimulating hormone"", ""beta-melanocyte stimulating hormone"", ""beta-endorphin"", ""adrenocorticotropic hormone"", ""opiomelanocortin prepropeptide"""	176830				6254047, 9620771	Standard	NM_001035256		Approved	MSH, POC, CLIP, ACTH, NPP, LPH	uc002rfz.1	P01189	OTTHUMG00000094764	ENST00000405623.1:c.277A>G	2.37:g.25384477T>C	ENSP00000384092:p.Ser93Gly		P78442|Q53T23|Q9UD39|Q9UD40	Missense_Mutation	SNP	pfam_Mcrtin_ACTH_cent,pfam_Melanocortin_N,pfam_Opioid_neuropept,prints_Mcortin_ACTH	p.S93G	ENST00000405623.1	37	c.277	CCDS1717.1	2	.	.	.	.	.	.	.	.	.	.	T	14.04	2.417467	0.42918	.	.	ENSG00000115138	ENST00000380794;ENST00000405623;ENST00000264708;ENST00000395826;ENST00000449220	T;T;T;T;T	0.80738	-1.41;-1.41;-1.41;-1.41;-1.41	4.68	4.68	0.58851	.	0.226724	0.44097	D	0.000500	D	0.87438	0.6177	M	0.69823	2.125	0.45272	D	0.998279	D	0.69078	0.997	D	0.75020	0.985	D	0.86337	0.1702	10	0.33141	T	0.24	-17.5951	13.2388	0.59985	0.0:0.0:0.0:1.0	.	93	P01189	COLI_HUMAN	G	93	ENSP00000370171:S93G;ENSP00000384092:S93G;ENSP00000264708:S93G;ENSP00000379170:S93G;ENSP00000387993:S93G	ENSP00000264708:S93G	S	-	1	0	POMC	25237981	1.000000	0.71417	0.989000	0.46669	0.146000	0.21551	3.558000	0.53749	1.864000	0.54056	0.260000	0.18958	AGC	POMC	-	NULL	ENSG00000115138		0.706	POMC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POMC	HGNC	protein_coding	OTTHUMT00000211573.3		0.00	18	0	T	NM_001035256		25384477	-1			no_errors	ENST00000264708	ensembl	human	known	74_37	missense	14.81	23	4	SNP	1.000	C
POMT2	29954	genome.wustl.edu	37	14	77772637	77772637	+	Intron	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr14:77772637G>T	ENST00000261534.4	-	3	641				POMT2_ENST00000556880.1_5'UTR	NM_013382.5	NP_037514.2	Q9UKY4	POMT2_HUMAN	protein-O-mannosyltransferase 2							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(1)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	14			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0292)		GTTTAGTGTGGCCCCAGGGTT	0.502																																																	0													62.0	57.0	59.0					14																	77772637		2203	4300	6503	SO:0001627	intron_variant	0			AF105020	CCDS9857.1	14q24	2014-09-17			ENSG00000009830	ENSG00000009830	2.4.1.109	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	19743	protein-coding gene	gene with protein product		607439				11162531, 12460945	Standard	NM_013382		Approved	LGMD2N	uc001xti.2	Q9UKY4	OTTHUMG00000171556	ENST00000261534.4:c.438+42C>A	14.37:g.77772637G>T			Q9NSG6|Q9P1W0|Q9P1W2	RNA	SNP	-	NULL	ENST00000261534.4	37	NULL	CCDS9857.1	14																																																																																			POMT2	-	-	ENSG00000009830		0.502	POMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POMT2	HGNC	protein_coding	OTTHUMT00000414155.1	-	0.00	44	0	G	NM_013382		77772637	-1	tier1	-	no_errors	ENST00000555788	ensembl	human	known	74_37	rna	6.15	60	4	SNP	0.136	T
POMZP3	22932	genome.wustl.edu	37	7	76240786	76240786	+	Missense_Mutation	SNP	A	A	C	rs71819724	byFrequency	TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr7:76240786A>C	ENST00000310842.4	-	6	1244	c.560T>G	c.(559-561)cTg>cGg	p.L187R	POMZP3_ENST00000275569.4_Intron|UPK3B_ENST00000443097.2_Intron|AC004980.7_ENST00000418663.1_RNA|UPK3B_ENST00000419923.2_Intron	NM_012230.3	NP_036362.3	Q6PJE2	POZP3_HUMAN	POM121 and ZP3 fusion	187										kidney(3)|lung(2)	5		Myeloproliferative disorder(862;0.204)				CTGCGGTTACAGGGAAGCAGA	0.517																																																	0													51.0	55.0	54.0					7																	76240786		1684	3181	4865	SO:0001583	missense	0			U10099	CCDS5590.1, CCDS43606.1	7q11.2	2010-06-24	2010-06-24		ENSG00000146707	ENSG00000146707			9203	protein-coding gene	gene with protein product	"""POM-ZP3 fusion protein"", ""POM121/ZP3 fusion protein"""	600587	"""POM (POM121 rat homolog) and ZP3 fusion"", ""POM (POM121 homolog, rat) and ZP3 fusion"""			7789967	Standard	NM_012230		Approved	POM-ZP3, POM121	uc003uft.3	Q6PJE2	OTTHUMG00000023514	ENST00000310842.4:c.560T>G	7.37:g.76240786A>C	ENSP00000309233:p.Leu187Arg		F6STJ3|Q12903|Q9BWB4	Missense_Mutation	SNP	pfam_ZP_dom	p.L187R	ENST00000310842.4	37	c.560	CCDS43606.1	7	.	.	.	.	.	.	.	.	.	.	N	12.82	2.052691	0.36181	.	.	ENSG00000146707	ENST00000310842	T	0.27256	1.68	.	.	.	.	48.261100	0.00760	U	0.001131	T	0.23926	0.0579	N	0.08118	0	0.09310	N	1	P	0.51240	0.943	P	0.55011	0.766	T	0.19745	-1.0296	8	0.87932	D	0	.	.	.	.	.	187	Q6PJE2	POZP3_HUMAN	R	187	ENSP00000309233:L187R	ENSP00000309233:L187R	L	-	2	0	POMZP3	76078722	0.049000	0.20398	0.276000	0.24689	0.537000	0.34900	-0.663000	0.05299	0.000000	0.14550	0.000000	0.15137	CTG	POMZP3	-	NULL	ENSG00000146707		0.517	POMZP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POMZP3	HGNC	protein_coding	OTTHUMT00000341775.1		0.00	29	0	A	NM_012230		76240786	-1			no_errors	ENST00000310842	ensembl	human	known	74_37	missense	5.88	66	6	SNP	0.466	C
POT1	25913	genome.wustl.edu	37	7	124503562	124503562	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr7:124503562G>T	ENST00000357628.3	-	8	986	c.388C>A	c.(388-390)Cac>Aac	p.H130N	POT1_ENST00000393329.1_5'UTR	NM_015450.2	NP_056265.2	Q9NUX5	POTE1_HUMAN	protection of telomeres 1	130					DNA duplex unwinding (GO:0032508)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of DNA strand elongation (GO:0060383)|positive regulation of helicase activity (GO:0051096)|positive regulation of telomerase activity (GO:0051973)|positive regulation of telomere maintenance via telomerase (GO:0032212)|telomere capping (GO:0016233)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DEAD/H-box RNA helicase binding (GO:0017151)|single-stranded telomeric DNA binding (GO:0043047)|telomerase inhibitor activity (GO:0010521)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(4)|liver(1)|lung(23)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47						ACCATTTTGTGGTCCTCAGTA	0.433																																					Esophageal Squamous(149;1032 1141 16047 36610 40540 42429 44687 51642)												0													162.0	148.0	153.0					7																	124503562		2203	4299	6502	SO:0001583	missense	0			AK022580	CCDS5793.1	7q31.33	2013-01-21	2013-01-21		ENSG00000128513	ENSG00000128513			17284	protein-coding gene	gene with protein product		606478	"""protection of telomeres 1 homolog (S. pombe)"""			11349150, 12391173	Standard	NR_003102		Approved	hPot1, DKFZp586D211	uc003vlm.3	Q9NUX5	OTTHUMG00000157194	ENST00000357628.3:c.388C>A	7.37:g.124503562G>T	ENSP00000350249:p.His130Asn		O95018|Q5MJ36|Q9H662|Q9NW19|Q9UG95	Missense_Mutation	SNP	pfam_Telomer_end-bd_POT1/Cdc13,superfamily_NA-bd_OB-fold,smart_Telomer_end-bd_POT1/Cdc13	p.H130N	ENST00000357628.3	37	c.388	CCDS5793.1	7	.	.	.	.	.	.	.	.	.	.	G	11.12	1.545129	0.27652	.	.	ENSG00000128513	ENST00000357628;ENST00000451720;ENST00000440969;ENST00000393326;ENST00000265391	T	0.40476	1.03	5.44	2.4	0.29515	Nucleic acid-binding, OB-fold-like (1);Telomere end binding protein (2);Nucleic acid-binding, OB-fold (1);	1.004790	0.07994	N	0.987559	T	0.24236	0.0587	N	0.08118	0	0.38643	D	0.951659	B	0.11235	0.004	B	0.17722	0.019	T	0.07986	-1.0744	10	0.17832	T	0.49	-24.1695	10.6888	0.45858	0.0:0.3973:0.4655:0.1372	.	130	Q9NUX5	POTE1_HUMAN	N	130;130;130;130;129	ENSP00000350249:H130N	ENSP00000265391:H129N	H	-	1	0	POT1	124290798	0.087000	0.21565	0.776000	0.31678	0.961000	0.63080	0.855000	0.27805	0.618000	0.30179	0.650000	0.86243	CAC	POT1	-	pfam_Telomer_end-bd_POT1/Cdc13,superfamily_NA-bd_OB-fold,smart_Telomer_end-bd_POT1/Cdc13	ENSG00000128513		0.433	POT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POT1	HGNC	protein_coding	OTTHUMT00000347861.1	-	0.00	32	0	G			124503562	-1	tier1	-	no_errors	ENST00000357628	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.600	T
POTEC	388468	genome.wustl.edu	37	18	14534903	14534903	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr18:14534903C>T	ENST00000358970.5	-	4	913	c.914G>A	c.(913-915)gGa>gAa	p.G305E	POTEC_ENST00000389891.4_5'UTR	NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	305										NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						ACCATACCTTCCATATCTATC	0.303																																																	0													9.0	15.0	13.0					18																	14534903		270	818	1088	SO:0001583	missense	0			BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.914G>A	18.37:g.14534903C>T	ENSP00000351856:p.Gly305Glu			Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.G305E	ENST00000358970.5	37	c.914	CCDS45835.1	18	.	.	.	.	.	.	.	.	.	.	C	11.02	1.517129	0.27123	.	.	ENSG00000183206	ENST00000358970;ENST00000389891	T	0.65732	-0.17	1.73	-0.873	0.10635	Ankyrin repeat-containing domain (4);	.	.	.	.	T	0.73218	0.3559	M	0.77616	2.38	0.09310	N	0.999997	D	0.89917	1.0	D	0.91635	0.999	T	0.60296	-0.7291	9	0.72032	D	0.01	.	4.2175	0.10542	0.0:0.4244:0.0:0.5756	.	305	B2RU33	POTEC_HUMAN	E	305	ENSP00000351856:G305E	ENSP00000351856:G305E	G	-	2	0	POTEC	14524903	0.511000	0.26179	0.029000	0.17559	0.031000	0.12232	0.406000	0.21032	-0.207000	0.10187	0.194000	0.17425	GGA	POTEC	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000183206		0.303	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	POTEC	HGNC	protein_coding	OTTHUMT00000371179.1	-	0.00	259	0	C	XM_496269		14534903	-1	tier1	-	no_errors	ENST00000358970	ensembl	human	known	74_37	missense	15.15	196	35	SNP	0.193	T
POTEH	23784	genome.wustl.edu	37	22	16279269	16279269	+	Missense_Mutation	SNP	A	A	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr22:16279269A>T	ENST00000343518.6	-	4	1005	c.954T>A	c.(952-954)caT>caA	p.H318Q	RNU6-816P_ENST00000390914.1_RNA|POTEH-AS1_ENST00000422014.1_RNA	NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H	318										NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						GTTTTTGCTCATGTACACCAA	0.328																																																	0																																										SO:0001583	missense	0			AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.954T>A	22.37:g.16279269A>T	ENSP00000340610:p.His318Gln		A2CEK4|A6NCI1|A9Z1W0	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.H318Q	ENST00000343518.6	37	c.954	CCDS46658.1	22	.	.	.	.	.	.	.	.	.	.	.	4.641	0.119243	0.08881	.	.	ENSG00000198062	ENST00000359587;ENST00000343518	T	0.51071	0.72	1.38	0.136	0.14780	Ankyrin repeat-containing domain (3);	2.018720	0.03867	U	0.274988	T	0.22859	0.0552	N	0.03917	-0.325	0.09310	N	1	P;P	0.37781	0.605;0.608	B;B	0.38378	0.259;0.272	T	0.10132	-1.0643	10	0.13853	T	0.58	.	4.0251	0.09683	0.6189:0.3811:0.0:0.0	.	318;281	Q6S545;A6NKF6	POTEH_HUMAN;.	Q	281;318	ENSP00000340610:H318Q	ENSP00000340610:H318Q	H	-	3	2	POTEH	14659269	0.073000	0.21202	0.003000	0.11579	0.095000	0.18619	0.435000	0.21510	-0.001000	0.14495	0.147000	0.16070	CAT	POTEH	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000198062		0.328	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	POTEH	HGNC	protein_coding	OTTHUMT00000276918.4	-	0.00	487	0	A	NM_001136213		16279269	-1	tier1	-	no_errors	ENST00000343518	ensembl	human	known	74_37	missense	8.46	701	65	SNP	0.022	T
PRAMEF1	65121	genome.wustl.edu	37	1	12855855	12855855	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:12855855C>A	ENST00000332296.7	+	4	1238	c.1135C>A	c.(1135-1137)Ctc>Atc	p.L379I	PRAMEF1_ENST00000400814.3_Missense_Mutation_p.L134I	NM_023013.2	NP_075389.1	O95521	PRAM1_HUMAN	PRAME family member 1	379					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GTGCTCCCAGCTCACCACCTT	0.552																																																	0													48.0	45.0	46.0					1																	12855855		2201	4293	6494	SO:0001583	missense	0			AL049686	CCDS148.1	1p36.21	2013-01-17			ENSG00000116721	ENSG00000116721		"""-"""	28840	protein-coding gene	gene with protein product							Standard	NM_023013		Approved		uc001auj.2	O95521	OTTHUMG00000001928	ENST00000332296.7:c.1135C>A	1.37:g.12855855C>A	ENSP00000332134:p.Leu379Ile		Q9UQP2	Missense_Mutation	SNP	NULL	p.L379I	ENST00000332296.7	37	c.1135	CCDS148.1	1	.	.	.	.	.	.	.	.	.	.	.	13.26	2.185131	0.38609	.	.	ENSG00000116721	ENST00000332296;ENST00000400814	T;T	0.04706	3.57;3.57	1.56	1.56	0.23342	.	0.000000	0.64402	D	0.000005	T	0.17152	0.0412	M	0.83953	2.67	0.09310	N	1	D	0.71674	0.998	D	0.72338	0.977	T	0.01105	-1.1450	10	0.59425	D	0.04	.	6.5617	0.22489	0.0:1.0:0.0:0.0	.	379	O95521	PRAM1_HUMAN	I	379;134	ENSP00000332134:L379I;ENSP00000383616:L134I	ENSP00000332134:L379I	L	+	1	0	PRAMEF1	12778442	0.218000	0.23608	0.265000	0.24526	0.072000	0.16883	2.049000	0.41288	1.170000	0.42753	0.205000	0.17691	CTC	PRAMEF1	-	NULL	ENSG00000116721		0.552	PRAMEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF1	HGNC	protein_coding	OTTHUMT00000005458.1	-	0.00	133	0	C	NM_023013		12855855	+1	tier1	-	no_errors	ENST00000332296	ensembl	human	known	74_37	missense	46.75	123	108	SNP	0.329	A
PRDM15	63977	genome.wustl.edu	37	21	43220665	43220666	+	IGR	DEL	AA	AA	-			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	AA	AA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr21:43220665_43220666delAA	ENST00000269844.3	-	0	4710				PRDM15_ENST00000398548.1_3'UTR|PRDM15_ENST00000422911.1_3'UTR|PRDM15_ENST00000470586.1_5'UTR|PRDM15_ENST00000538201.1_3'UTR|PRDM15_ENST00000447207.2_3'UTR	NM_022115.3	NP_071398.3	P57071	PRD15_HUMAN	PR domain containing 15						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(3)|skin(2)|stomach(2)|urinary_tract(1)	43						AAATAAAGTTAAAAAAAAAAAA	0.342																																																	0																																										SO:0001628	intergenic_variant	0			AF276513	CCDS13676.1, CCDS42932.1, CCDS63370.1	21q22.3	2013-01-08	2002-07-31		ENSG00000141956	ENSG00000141956		"""Zinc fingers, C2H2-type"""	13999	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 83"""	ZNF298, C21orf83		12036297, 12036298	Standard	NM_022115		Approved		uc002yzq.1	P57071	OTTHUMG00000086781		21.37:g.43220675_43220676delAA			E9PDJ6|E9PF37|E9PGL3|Q4W8S0|Q4W8S3|Q4W8S4|Q4W8S5|Q8N0X3|Q8NEX0|Q9NQV3	RNA	DEL	-	NULL	ENST00000269844.3	37	NULL	CCDS13676.1	21																																																																																			PRDM15	-	-	ENSG00000141956		0.342	PRDM15-201	KNOWN	basic|CCDS	protein_coding	PRDM15	HGNC	protein_coding			0.00	45	0	AA	NM_022115		43220666	-1	tier1		no_errors	ENST00000470586	ensembl	human	putative	74_37	rna	8.33	22	2	DEL	0.000:0.001	-
PRR23B	389151	genome.wustl.edu	37	3	138739030	138739030	+	Silent	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr3:138739030G>A	ENST00000329447.5	-	1	738	c.474C>T	c.(472-474)gaC>gaT	p.D158D	MRPS22_ENST00000495075.1_Intron	NM_001013650.2	NP_001013672.1	Q6ZRT6	PR23B_HUMAN	proline rich 23B	158										NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CGGGGTCCGCGTCCTCCTCGT	0.642																																																	0													36.0	43.0	41.0					3																	138739030		2203	4300	6503	SO:0001819	synonymous_variant	0			BC137146	CCDS33868.1	3q22.3	2014-06-03			ENSG00000184814	ENSG00000184814			33764	protein-coding gene	gene with protein product							Standard	NM_001013650		Approved	FLJ46116	uc003esy.1	Q6ZRT6	OTTHUMG00000160633	ENST00000329447.5:c.474C>T	3.37:g.138739030G>A			B2RNV9	Silent	SNP	pfam_UPF0572	p.D158	ENST00000329447.5	37	c.474	CCDS33868.1	3																																																																																			PRR23B	-	pfam_UPF0572	ENSG00000184814		0.642	PRR23B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRR23B	HGNC	protein_coding	OTTHUMT00000361501.1	-	0.00	163	0	G	NM_001013650		138739030	-1	tier1	-	no_errors	ENST00000329447	ensembl	human	known	74_37	silent	32.78	121	59	SNP	0.000	A
PRR23C	389152	genome.wustl.edu	37	3	138762947	138762947	+	Silent	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr3:138762947G>A	ENST00000413199.1	-	1	787	c.516C>T	c.(514-516)gcC>gcT	p.A172A	PRR23C_ENST00000502927.2_Silent_p.A172A|MRPS22_ENST00000495075.1_Intron	NM_001134657.1	NP_001128129.1	Q6ZRP0	PR23C_HUMAN	proline rich 23C	172										breast(2)|lung(7)|skin(2)	11						CGGCTGAGCCGGCTGCGGAGT	0.657																																																	0													21.0	27.0	25.0					3																	138762947		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS46924.1	3q22.3	2014-06-03				ENSG00000233701			37173	protein-coding gene	gene with protein product							Standard	NM_001134657		Approved	FLJ46210	uc011bmt.1	Q6ZRP0		ENST00000413199.1:c.516C>T	3.37:g.138762947G>A				Silent	SNP	pfam_UPF0572	p.A172	ENST00000413199.1	37	c.516	CCDS46924.1	3																																																																																			PRR23C	-	pfam_UPF0572	ENSG00000233701		0.657	PRR23C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRR23C	HGNC	protein_coding	OTTHUMT00000361502.1	-	0.00	113	0	G	NM_001134657		138762947	-1	tier1	-	no_errors	ENST00000413199	ensembl	human	known	74_37	silent	56.67	65	85	SNP	0.000	A
PRRC2A	7916	genome.wustl.edu	37	6	31595606	31595606	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr6:31595606G>A	ENST00000376033.2	+	12	1589	c.1355G>A	c.(1354-1356)cGa>cAa	p.R452Q	PRRC2A_ENST00000376007.4_Missense_Mutation_p.R452Q	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	452	2 X type B repeats.|4 X 57 AA type A repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						TGGCGGCAGCGACGAAAGCAG	0.642																																																	0													53.0	61.0	58.0					6																	31595606		1509	2708	4217	SO:0001583	missense	0			M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.1355G>A	6.37:g.31595606G>A	ENSP00000365201:p.Arg452Gln		B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Missense_Mutation	SNP	pfam_BAT2_N	p.R452Q	ENST00000376033.2	37	c.1355	CCDS4708.1	6	.	.	.	.	.	.	.	.	.	.	G	16.39	3.108683	0.56291	.	.	ENSG00000204469	ENST00000424184;ENST00000435052;ENST00000376007;ENST00000376033	T;T	0.15487	2.42;2.42	4.38	4.38	0.52667	.	0.000000	0.44902	D	0.000404	T	0.31136	0.0787	M	0.64997	1.995	0.53688	D	0.999976	D	0.89917	1.0	D	0.76575	0.988	T	0.06092	-1.0846	10	0.87932	D	0	-11.8439	16.2187	0.82244	0.0:0.0:1.0:0.0	.	452	P48634	PRC2A_HUMAN	Q	452;441;452;452	ENSP00000365175:R452Q;ENSP00000365201:R452Q	ENSP00000365175:R452Q	R	+	2	0	PRRC2A	31703585	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.090000	0.76916	2.453000	0.82957	0.561000	0.74099	CGA	PRRC2A	-	NULL	ENSG00000204469		0.642	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRC2A	HGNC	protein_coding	OTTHUMT00000259319.1	-	0.00	103	0	G	NM_080686		31595606	+1	tier1	-	no_errors	ENST00000376007	ensembl	human	known	74_37	missense	13.77	118	19	SNP	1.000	A
PSG1	5669	genome.wustl.edu	37	19	43372351	43372351	+	Missense_Mutation	SNP	C	C	A	rs150536125		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr19:43372351C>A	ENST00000436291.2	-	5	1261	c.1145G>T	c.(1144-1146)cGc>cTc	p.R382L	PSG1_ENST00000595356.1_Missense_Mutation_p.R382L|PSG1_ENST00000403380.3_Missense_Mutation_p.R289L|PSG1_ENST00000595124.1_Missense_Mutation_p.R289L|PSG1_ENST00000312439.6_Missense_Mutation_p.R382L|PSG1_ENST00000244296.2_Missense_Mutation_p.R382L	NM_001184825.1|NM_001184826.1	NP_001171754.1|NP_001171755.1	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1	382	Ig-like C2-type 3.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30		Prostate(69;0.00682)				AGTAATATGGCGGATAAAGAG	0.463																																																	0													189.0	196.0	193.0					19																	43372351		2201	4298	6499	SO:0001583	missense	0				CCDS12612.1, CCDS54275.1, CCDS59392.1, CCDS74380.1	19q13.2	2013-01-29			ENSG00000231924	ENSG00000231924		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9514	protein-coding gene	gene with protein product		176390		PSBG1			Standard	NM_006905		Approved	PSGGA, CD66f, PBG1		P11464	OTTHUMG00000151123	ENST00000436291.2:c.1145G>T	19.37:g.43372351C>A	ENSP00000413041:p.Arg382Leu		O75236|P11462|P11463|Q15231|Q15241|Q15243|Q16660|Q6ICR4|Q9P1W5|Q9UQ79	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R382L	ENST00000436291.2	37	c.1145	CCDS54275.1	19	.	.	.	.	.	.	.	.	.	.	N	0.007	-1.999293	0.00435	.	.	ENSG00000231924	ENST00000436291;ENST00000403380;ENST00000312439;ENST00000244296	T;T;T;T	0.12672	2.66;2.66;2.66;2.66	1.07	-2.14	0.07123	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.07279	0.0184	N	0.21545	0.675	0.09310	N	1	B;B;B;P;B;B;B	0.34699	0.022;0.073;0.045;0.464;0.003;0.0;0.293	B;B;B;B;B;B;B	0.36418	0.06;0.143;0.224;0.224;0.017;0.004;0.224	T	0.27606	-1.0069	9	0.22109	T	0.4	.	2.8303	0.05497	0.3844:0.2451:0.3705:0.0	.	382;289;382;289;382;289;254	P11464-4;G5E9F7;P11464;Q8NBY8;P11464-3;Q9UPK8;B4DTG5	.;.;PSG1_HUMAN;.;.;.;.	L	382;289;382;382	ENSP00000413041:R382L;ENSP00000385386:R289L;ENSP00000308970:R382L;ENSP00000244296:R382L	ENSP00000244296:R382L	R	-	2	0	PSG1	48064191	0.001000	0.12720	0.002000	0.10522	0.001000	0.01503	-0.445000	0.06845	-2.096000	0.00852	-3.242000	0.00051	CGC	PSG1	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000231924		0.463	PSG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PSG1	HGNC	protein_coding	OTTHUMT00000321426.1	-	0.00	175	0	C			43372351	-1	tier1	-	no_errors	ENST00000312439	ensembl	human	known	74_37	missense	24.32	306	99	SNP	0.003	A
PSG11	5680	genome.wustl.edu	37	19	43522939	43522939	+	Frame_Shift_Del	DEL	A	A	-			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr19:43522939delA	ENST00000401740.1	-	3	795	c.692delT	c.(691-693)gtcfs	p.V231fs	PSG11_ENST00000306322.7_Frame_Shift_Del_p.V109fs|PSG11_ENST00000595312.1_5'UTR|PSG11_ENST00000403486.1_Frame_Shift_Del_p.V109fs|PSG11_ENST00000320078.7_Frame_Shift_Del_p.V231fs			Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 11	231	Ig-like C2-type 1.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	26		Prostate(69;0.00682)				ATTCAGGGTGACTGGGTCACT	0.527																																																	0													190.0	200.0	197.0					19																	43522939		2201	4298	6499	SO:0001589	frameshift_variant	0			U25988	CCDS12614.2, CCDS12615.2	19q13.2	2013-01-29			ENSG00000243130	ENSG00000243130		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9516	protein-coding gene	gene with protein product	"""pregnancy specific beta-1-glycoprotein 13"""	176401		PSG13, PSG14		7794280	Standard	NM_001113410		Approved	MGC22484	uc002ovm.1	Q9UQ72	OTTHUMG00000151546	ENST00000401740.1:c.692delT	19.37:g.43522939delA	ENSP00000384995:p.Val231fs		B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	Frame_Shift_Del	DEL	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.V231fs	ENST00000401740.1	37	c.692	CCDS12614.2	19																																																																																			PSG11	-	smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000243130		0.527	PSG11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PSG11	HGNC	protein_coding	OTTHUMT00000323079.1		0.00	170	0	A	NM_002785		43522939	-1	tier1		no_errors	ENST00000320078	ensembl	human	known	74_37	frame_shift_del	18.57	307	70	DEL	0.007	-
PSG3	5671	genome.wustl.edu	37	19	43234055	43234055	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr19:43234055C>T	ENST00000327495.5	-	4	1047	c.863G>A	c.(862-864)cGa>cAa	p.R288Q	PSG3_ENST00000595140.1_Missense_Mutation_p.R288Q	NM_021016.3	NP_066296.2	Q16557	PSG3_HUMAN	pregnancy specific beta-1-glycoprotein 3	288	Ig-like C2-type 2.				defense response (GO:0006952)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36		Prostate(69;0.00682)				TTCAATGGGTCGCTTTACCCT	0.483																																																	0													80.0	84.0	82.0					19																	43234055		1510	2702	4212	SO:0001583	missense	0				CCDS12611.1	19q13.2	2013-01-29			ENSG00000221826	ENSG00000221826		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9520	protein-coding gene	gene with protein product		176392				2341148	Standard	NM_021016		Approved		uc002oue.3	Q16557	OTTHUMG00000151120	ENST00000327495.5:c.863G>A	19.37:g.43234055C>T	ENSP00000332215:p.Arg288Gln		Q08265|Q9BRW2|Q9UPL4|Q9UQ77	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R288Q	ENST00000327495.5	37	c.863	CCDS12611.1	19	.	.	.	.	.	.	.	.	.	.	a	0.033	-1.319906	0.01320	.	.	ENSG00000221826	ENST00000327495	T	0.09350	2.99	1.1	-2.21	0.06973	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.03136	0.0092	N	0.03608	-0.345	0.09310	N	1	B;B	0.24186	0.099;0.013	B;B	0.21917	0.037;0.009	T	0.34601	-0.9822	9	0.18710	T	0.47	.	0.1026	0.00049	0.3288:0.2364:0.2056:0.2292	.	266;288	Q08266;Q16557	.;PSG3_HUMAN	Q	288	ENSP00000332215:R288Q	ENSP00000332215:R288Q	R	-	2	0	PSG3	47925895	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.114000	0.10757	-2.467000	0.00532	-2.033000	0.00422	CGA	PSG3	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000221826		0.483	PSG3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	PSG3	HGNC	protein_coding	OTTHUMT00000321423.2	-	0.00	174	0	C	NM_021016		43234055	-1	tier1	-	no_errors	ENST00000327495	ensembl	human	known	74_37	missense	24.11	362	115	SNP	0.000	T
PTPN14	5784	genome.wustl.edu	37	1	214625231	214625231	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:214625231G>T	ENST00000366956.5	-	3	455	c.261C>A	c.(259-261)gaC>gaA	p.D87E	PTPN14_ENST00000543945.1_Missense_Mutation_p.D87E	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14	87	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)			NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		TAGCGAATTTGTCCAGATGTT	0.473																																					Colon(92;557 1424 24372 34121 40073)												0													116.0	112.0	113.0					1																	214625231		2203	4300	6503	SO:0001583	missense	0			X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.261C>A	1.37:g.214625231G>T	ENSP00000355923:p.Asp87Glu		Q5VSI0	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_FERM_central,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_Dual-sp_phosphatase_cat-dom,superfamily_FERM_central,smart_Band_41_domain,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-14/21,pfscan_FERM_domain,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam	p.D87E	ENST00000366956.5	37	c.261	CCDS1514.1	1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.197143	0.79015	.	.	ENSG00000152104	ENST00000366956;ENST00000543945	T;T	0.76186	-1.0;-1.0	5.45	5.45	0.79879	FERM, N-terminal (1);Band 4.1 domain (1);FERM domain (1);FERM conserved site (1);	0.000000	0.85682	D	0.000000	T	0.79387	0.4437	L	0.31120	0.905	0.80722	D	1	D	0.69078	0.997	D	0.80764	0.994	T	0.74612	-0.3607	10	0.20046	T	0.44	.	19.2695	0.94003	0.0:0.0:1.0:0.0	.	87	Q15678	PTN14_HUMAN	E	87	ENSP00000355923:D87E;ENSP00000443330:D87E	ENSP00000355923:D87E	D	-	3	2	PTPN14	212691854	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.555000	0.82223	2.565000	0.86533	0.555000	0.69702	GAC	PTPN14	-	pfam_FERM_N,smart_Band_41_domain,pirsf_Tyr_Pase_non-rcpt_typ-14/21,pfscan_FERM_domain	ENSG00000152104		0.473	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN14	HGNC	protein_coding	OTTHUMT00000089918.2	-	0.00	38	0	G	NM_005401		214625231	-1	tier1	-	no_errors	ENST00000366956	ensembl	human	known	74_37	missense	49.48	49	48	SNP	1.000	T
PTPRJ	5795	genome.wustl.edu	37	11	48146607	48146607	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr11:48146607C>A	ENST00000418331.2	+	6	1314	c.962C>A	c.(961-963)tCc>tAc	p.S321Y	PTPRJ_ENST00000440289.2_Missense_Mutation_p.S321Y	NM_002843.3	NP_002834.3	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	321	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				contact inhibition (GO:0060242)|heart development (GO:0007507)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of vascular permeability (GO:0043116)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of cell adhesion (GO:0045785)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion (GO:0030155)|vasculogenesis (GO:0001570)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|mitogen-activated protein kinase binding (GO:0051019)|phosphatase activity (GO:0016791)|platelet-derived growth factor receptor binding (GO:0005161)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|endometrium(7)|kidney(7)|large_intestine(5)|lung(15)|ovary(1)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						GACCCATCCTCCGGCCAGCAG	0.597																																																	0													99.0	110.0	106.0					11																	48146607		2201	4298	6499	SO:0001583	missense	0			U10886	CCDS7945.1, CCDS44596.1	11p11.2	2013-02-11			ENSG00000149177	ENSG00000149177		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9673	protein-coding gene	gene with protein product		600925				7937872, 7994032	Standard	NM_001098503		Approved	DEP1, HPTPeta, CD148	uc001ngp.4	Q12913	OTTHUMG00000166573	ENST00000418331.2:c.962C>A	11.37:g.48146607C>A	ENSP00000400010:p.Ser321Tyr		Q15255|Q6P4H4|Q8NHM2|Q9UDA9	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.S321Y	ENST00000418331.2	37	c.962	CCDS7945.1	11	.	.	.	.	.	.	.	.	.	.	C	9.953	1.220567	0.22457	.	.	ENSG00000149177	ENST00000278456;ENST00000418331;ENST00000440289	T;T	0.37584	2.46;1.19	4.77	-0.498	0.12019	Fibronectin, type III (1);	.	.	.	.	T	0.17195	0.0413	L	0.29908	0.895	0.09310	N	1	B;P	0.36282	0.004;0.546	B;B	0.28638	0.004;0.092	T	0.17289	-1.0374	9	0.16420	T	0.52	.	3.9448	0.09344	0.1582:0.4773:0.0:0.3646	.	321;321	Q12913;Q6P4H4	PTPRJ_HUMAN;.	Y	321	ENSP00000400010:S321Y;ENSP00000409733:S321Y	ENSP00000278456:S321Y	S	+	2	0	PTPRJ	48103183	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.117000	0.10708	-0.012000	0.14223	-0.251000	0.11542	TCC	PTPRJ	-	smart_Fibronectin_type3	ENSG00000149177		0.597	PTPRJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRJ	HGNC	protein_coding	OTTHUMT00000390525.1		0.00	49	0	C			48146607	+1			no_errors	ENST00000418331	ensembl	human	known	74_37	missense	7.02	53	4	SNP	0.000	A
PTPRK	5796	genome.wustl.edu	37	6	128304446	128304446	+	Missense_Mutation	SNP	C	C	G			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr6:128304446C>G	ENST00000368215.3	-	23	3324	c.3325G>C	c.(3325-3327)Gat>Cat	p.D1109H	PTPRK_ENST00000368213.5_Missense_Mutation_p.D1116H|PTPRK_ENST00000368210.3_Missense_Mutation_p.D1128H|PTPRK_ENST00000368207.3_Missense_Mutation_p.D1142H|PTPRK_ENST00000368226.4_Missense_Mutation_p.D1110H|PTPRK_ENST00000368227.3_Missense_Mutation_p.D1127H|PTPRK_ENST00000532331.1_Missense_Mutation_p.D1132H			Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	1109	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to reactive oxygen species (GO:0034614)|cellular response to UV (GO:0034644)|focal adhesion assembly (GO:0048041)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)		PTPRK/RSPO3(10)	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(14)|lung(24)|ovary(3)|pancreas(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	72				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		TTGTAAATATCAACAACACCC	0.368																																																	0													94.0	81.0	85.0					6																	128304446		2203	4300	6503	SO:0001583	missense	0			L77886	CCDS5137.1, CCDS47473.1, CCDS75517.1	6q22.2-q22.3	2013-02-11			ENSG00000152894	ENSG00000152894		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9674	protein-coding gene	gene with protein product		602545				9047348, 8663237	Standard	NM_002844		Approved	R-PTP-kappa	uc010kfc.3	Q15262	OTTHUMG00000015536	ENST00000368215.3:c.3325G>C	6.37:g.128304446C>G	ENSP00000357198:p.Asp1109His		B2RTQ8|B7ZMG0|Q14763|Q5TG10|Q5TG11	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Ig_sub,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.D1127H	ENST00000368215.3	37	c.3379		6	.	.	.	.	.	.	.	.	.	.	C	26.0	4.695317	0.88830	.	.	ENSG00000152894	ENST00000368226;ENST00000368227;ENST00000532331;ENST00000368213;ENST00000368210;ENST00000368215;ENST00000368207	T;T;T;T;T;T;T	0.36340	1.26;1.26;1.26;1.26;1.26;1.26;1.26	5.48	5.48	0.80851	Protein-tyrosine phosphatase, receptor/non-receptor type (4);Protein-tyrosine/Dual-specificity phosphatase (1);	0.095862	0.64402	D	0.000001	T	0.71108	0.3301	H	0.97315	3.98	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.996;0.995	D;D;D;P	0.77557	0.99;0.99;0.913;0.859	T	0.82388	-0.0482	10	0.87932	D	0	.	18.3063	0.90182	0.0:1.0:0.0:0.0	.	1132;1116;1109;1110	B7ZMG0;Q15262-3;Q15262;Q15262-2	.;.;PTPRK_HUMAN;.	H	1110;1127;1132;1116;1128;1109;1142	ENSP00000357209:D1110H;ENSP00000357210:D1127H;ENSP00000432973:D1132H;ENSP00000357196:D1116H;ENSP00000357193:D1128H;ENSP00000357198:D1109H;ENSP00000357190:D1142H	ENSP00000357190:D1142H	D	-	1	0	PTPRK	128346139	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	7.818000	0.86416	2.566000	0.86566	0.585000	0.79938	GAT	PTPRK	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	ENSG00000152894		0.368	PTPRK-005	KNOWN	basic|appris_candidate	protein_coding	PTPRK	HGNC	protein_coding	OTTHUMT00000042163.1	-	0.00	38	0	C			128304446	-1	tier1	-	no_errors	ENST00000368227	ensembl	human	known	74_37	missense	15.79	47	9	SNP	1.000	G
PTPRN2	5799	genome.wustl.edu	37	7	157985175	157985175	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr7:157985175G>T	ENST00000389418.4	-	5	402	c.393C>A	c.(391-393)caC>caA	p.H131Q	PTPRN2_ENST00000389413.3_Missense_Mutation_p.H131Q|PTPRN2_ENST00000404321.2_Missense_Mutation_p.H154Q|PTPRN2_ENST00000409483.1_Missense_Mutation_p.H93Q|PTPRN2_ENST00000389416.4_Missense_Mutation_p.H114Q	NM_002847.3	NP_002838.2	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N polypeptide 2	131					negative regulation of GTPase activity (GO:0034260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum lumen (GO:0005788)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)|secretory granule (GO:0030141)|terminal bouton (GO:0043195)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(1)|lung(42)|ovary(4)|pleura(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	86	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		TGCCAACGCTGTGTTTTGAGG	0.627																																																	0													51.0	59.0	56.0					7																	157985175		2203	4299	6502	SO:0001583	missense	0			AB002385	CCDS5947.1, CCDS5948.1, CCDS5949.1	7q36	2011-06-09			ENSG00000155093	ENSG00000155093		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9677	protein-coding gene	gene with protein product	"""IAR PTPRP"""	601698				8954911, 9220540	Standard	NM_130842		Approved	KIAA0387, phogrin, ICAAR, IA-2beta	uc003wno.3	Q92932	OTTHUMG00000152646	ENST00000389418.4:c.393C>A	7.37:g.157985175G>T	ENSP00000374069:p.His131Gln		E9PC57|Q8N4I5|Q92662|Q9Y4F8|Q9Y4I6	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Receptor_IA-2,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.H154Q	ENST00000389418.4	37	c.462	CCDS5947.1	7	.	.	.	.	.	.	.	.	.	.	G	2.618	-0.289214	0.05605	.	.	ENSG00000155093	ENST00000409483;ENST00000389413;ENST00000389416;ENST00000389418;ENST00000404321	T;T;T;T;T	0.02709	4.19;4.26;4.24;4.26;4.25	4.17	2.32	0.28847	.	.	.	.	.	T	0.01156	0.0038	N	0.02011	-0.69	0.09310	N	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0	T	0.49021	-0.8982	9	0.13470	T	0.59	.	5.0871	0.14689	0.0:0.6594:0.224:0.1166	.	154;93;131;114;131	Q92932-3;E7EM83;Q92932-2;E9PC57;Q92932	.;.;.;.;PTPR2_HUMAN	Q	93;131;114;131;154	ENSP00000387114:H93Q;ENSP00000374064:H131Q;ENSP00000374067:H114Q;ENSP00000374069:H131Q;ENSP00000385464:H154Q	ENSP00000374064:H131Q	H	-	3	2	PTPRN2	157677936	0.000000	0.05858	0.008000	0.14137	0.001000	0.01503	-0.144000	0.10280	1.041000	0.40125	-0.226000	0.12346	CAC	PTPRN2	-	NULL	ENSG00000155093		0.627	PTPRN2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTPRN2	HGNC	protein_coding	OTTHUMT00000353214.1	-	0.00	101	0	G			157985175	-1	tier1	-	no_errors	ENST00000404321	ensembl	human	known	74_37	missense	10.00	36	4	SNP	0.006	T
PYGO1	26108	genome.wustl.edu	37	15	55838889	55838889	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr15:55838889G>T	ENST00000302000.6	-	3	686	c.592C>A	c.(592-594)Ccc>Acc	p.P198T	PYGO1_ENST00000563719.1_Missense_Mutation_p.P198T	NM_015617.1	NP_056432.1	Q9Y3Y4	PYGO1_HUMAN	pygopus family PHD finger 1	198	Asn-rich.				hematopoietic progenitor cell differentiation (GO:0002244)|kidney development (GO:0001822)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein localization to nucleus (GO:0034504)|spermatid nucleus differentiation (GO:0007289)|Wnt signaling pathway (GO:0016055)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(4)|kidney(2)|large_intestine(6)|lung(6)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	27				all cancers(107;0.0131)|GBM - Glioblastoma multiforme(80;0.18)		GCCAAATCGGGGTTAGAAACT	0.353																																																	0													69.0	73.0	72.0					15																	55838889		2193	4292	6485	SO:0001583	missense	0			AF457207	CCDS10155.1	15q21.1	2013-10-09	2013-10-09		ENSG00000171016	ENSG00000171016		"""Zinc fingers, PHD-type"""	30256	protein-coding gene	gene with protein product		606902	"""pygopus homolog 1 (Drosophila)"""			11988739	Standard	NM_015617		Approved		uc002adf.1	Q9Y3Y4	OTTHUMG00000132009	ENST00000302000.6:c.592C>A	15.37:g.55838889G>T	ENSP00000302327:p.Pro198Thr		A7Y2D6	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.P198T	ENST00000302000.6	37	c.592	CCDS10155.1	15	.	.	.	.	.	.	.	.	.	.	G	12.00	1.807646	0.31961	.	.	ENSG00000171016	ENST00000302000;ENST00000401688	T	0.60040	0.22	4.78	4.78	0.61160	.	0.086761	0.49916	D	0.000124	T	0.64011	0.2560	L	0.27053	0.805	0.42544	D	0.993086	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.992	T	0.65166	-0.6234	10	0.42905	T	0.14	-11.907	15.3579	0.74443	0.0:0.0:1.0:0.0	.	198;198	A7Y2D6;Q9Y3Y4	.;PYGO1_HUMAN	T	198	ENSP00000302327:P198T	ENSP00000302327:P198T	P	-	1	0	PYGO1	53626181	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	2.968000	0.49224	2.374000	0.81015	0.585000	0.79938	CCC	PYGO1	-	NULL	ENSG00000171016		0.353	PYGO1-001	KNOWN	basic|CCDS	protein_coding	PYGO1	HGNC	protein_coding	OTTHUMT00000254977.2	-	0.00	51	0	G	NM_015617		55838889	-1	tier1	-	no_errors	ENST00000302000	ensembl	human	known	74_37	missense	36.76	43	25	SNP	1.000	T
RAD54L	8438	genome.wustl.edu	37	1	46738139	46738139	+	Splice_Site	SNP	T	T	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:46738139T>C	ENST00000371975.4	+	11	1845	c.1171T>C	c.(1171-1173)Tgc>Cgc	p.C391R	RAD54L_ENST00000442598.1_Splice_Site_p.C391R|RAD54L_ENST00000473251.1_3'UTR	NM_003579.3	NP_003570.2	Q92698	RAD54_HUMAN	RAD54-like (S. cerevisiae)	391					chromosome organization (GO:0051276)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|meiotic nuclear division (GO:0007126)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			breast(2)|cervix(1)|kidney(3)|large_intestine(5)|liver(1)|lung(6)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	25	Acute lymphoblastic leukemia(166;0.155)	Breast(1374;0.0634)		KIRC - Kidney renal clear cell carcinoma(1967;0.000896)		TTTCTCTAGATGCCTGATACG	0.423								Direct reversal of damage;Homologous recombination																																									0													125.0	123.0	124.0					1																	46738139		2203	4300	6503	SO:0001630	splice_region_variant	0			X97795	CCDS532.1	1p32	2008-02-05	2001-11-28		ENSG00000085999	ENSG00000085999			9826	protein-coding gene	gene with protein product		603615	"""RAD54 (S.cerevisiae)-like"""			8805304	Standard	NM_003579		Approved	hHR54, hRAD54, RAD54A	uc009vye.2	Q92698	OTTHUMG00000007772	ENST00000371975.4:c.1170-1T>C	1.37:g.46738139T>C			Q5TE31|Q6IUY3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,pfam_Rad54_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.C391R	ENST00000371975.4	37	c.1171	CCDS532.1	1	.	.	.	.	.	.	.	.	.	.	T	18.69	3.678357	0.68042	.	.	ENSG00000085999	ENST00000442598;ENST00000371975;ENST00000535499	D;D	0.93247	-3.19;-3.19	4.43	4.43	0.53597	SNF2-related (1);	0.097489	0.64402	D	0.000001	D	0.95996	0.8696	M	0.73319	2.225	0.80722	D	1	P;D	0.89917	0.847;1.0	B;D	0.85130	0.289;0.997	D	0.96482	0.9357	10	0.87932	D	0	-11.8029	14.1824	0.65583	0.0:0.0:0.0:1.0	.	211;391	G3V1N0;Q92698	.;RAD54_HUMAN	R	391;391;211	ENSP00000396113:C391R;ENSP00000361043:C391R	ENSP00000361043:C391R	C	+	1	0	RAD54L	46510726	1.000000	0.71417	1.000000	0.80357	0.631000	0.37964	7.266000	0.78452	2.009000	0.58944	0.524000	0.50904	TGC	RAD54L	-	pfam_SNF2_N,superfamily_P-loop_NTPase	ENSG00000085999		0.423	RAD54L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD54L	HGNC	protein_coding	OTTHUMT00000021272.1	-	0.00	34	0	T	NM_003579	Missense_Mutation	46738139	+1	tier1	-	no_errors	ENST00000371975	ensembl	human	known	74_37	missense	6.49	72	5	SNP	1.000	C
RAPGEF4	11069	genome.wustl.edu	37	2	173894894	173894894	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr2:173894894G>T	ENST00000397081.3	+	26	2704	c.2561G>T	c.(2560-2562)tGt>tTt	p.C854F	RAPGEF4_ENST00000540783.1_Missense_Mutation_p.C701F|RAPGEF4_ENST00000397087.3_Missense_Mutation_p.C710F|RAPGEF4_ENST00000264111.6_Missense_Mutation_p.C853F|RAPGEF4_ENST00000409036.1_Missense_Mutation_p.C854F|RAPGEF4_ENST00000535187.1_Missense_Mutation_p.C634F|RAPGEF4_ENST00000539331.1_Missense_Mutation_p.C701F|RAPGEF4_ENST00000538974.1_Missense_Mutation_p.C683F	NM_007023.3	NP_008954.2	Q8WZA2	RPGF4_HUMAN	Rap guanine nucleotide exchange factor (GEF) 4	854	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				blood coagulation (GO:0007596)|calcium ion-dependent exocytosis (GO:0017156)|cAMP-mediated signaling (GO:0019933)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|insulin secretion (GO:0030073)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of exocytosis (GO:0017157)|regulation of insulin secretion (GO:0050796)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cAMP-dependent protein kinase complex (GO:0005952)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase regulator activity (GO:0008603)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(14)|lung(13)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47			OV - Ovarian serous cystadenocarcinoma(117;0.194)			TGTTTCAGCTGTAAGGAGTAT	0.383																																																	0													113.0	108.0	109.0					2																	173894894		1869	4106	5975	SO:0001583	missense	0			U78516	CCDS42775.1, CCDS42776.1, CCDS63060.1, CCDS63061.1, CCDS74604.1	2q31-q32	2008-02-05	2004-03-26		ENSG00000091428	ENSG00000091428			16626	protein-coding gene	gene with protein product	"""cAMP-regulated guanine nucleotide exchange factor II"", "" exchange protein directly activated by cAMP 2"""	606058	"""RAP guanine-nucleotide-exchange factor (GEF) 4"""			10777494, 9856955	Standard	NM_007023		Approved	cAMP-GEFII, CGEF2	uc002uhv.4	Q8WZA2	OTTHUMG00000133677	ENST00000397081.3:c.2561G>T	2.37:g.173894894G>T	ENSP00000380271:p.Cys854Phe		B2R7R3|B7Z283|B7Z3T6|B7Z912|O95636|Q8IXK6|Q8TAA4	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_cNMP-bd_dom,pfam_DEP_dom,pfam_Ras-like_Gua-exchang_fac_N,pfam_Ras-assoc,superfamily_Ras_GEF_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_DEP_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_cNMP-bd_dom,pfscan_DEP_dom,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N,prints_cAMP/cGMP_kin	p.C854F	ENST00000397081.3	37	c.2561	CCDS42775.1	2	.	.	.	.	.	.	.	.	.	.	G	25.2	4.613248	0.87359	.	.	ENSG00000091428	ENST00000264111;ENST00000397081;ENST00000409036;ENST00000397087;ENST00000538974;ENST00000540783;ENST00000539331;ENST00000535187;ENST00000397085	T;T;T;T;T;T;T;T;T	0.40225	1.04;1.04;1.04;1.04;1.04;1.04;1.04;1.04;1.04	6.03	6.03	0.97812	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	T	0.74913	0.3779	M	0.92784	3.345	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.76575	0.965;0.988	T	0.79773	-0.1662	10	0.87932	D	0	.	20.5666	0.99351	0.0:0.0:1.0:0.0	.	710;854	Q8WZA2-3;Q8WZA2	.;RPGF4_HUMAN	F	853;854;854;710;683;701;701;634;85	ENSP00000264111:C853F;ENSP00000380271:C854F;ENSP00000387104:C854F;ENSP00000380276:C710F;ENSP00000440135:C683F;ENSP00000440250:C701F;ENSP00000437384:C701F;ENSP00000438011:C634F;ENSP00000380274:C85F	ENSP00000264111:C853F	C	+	2	0	RAPGEF4	173603140	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.412000	0.80091	2.854000	0.98071	0.655000	0.94253	TGT	RAPGEF4	-	pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25	ENSG00000091428		0.383	RAPGEF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAPGEF4	HGNC	protein_coding	OTTHUMT00000257864.2	-	0.00	37	0	G	NM_007023		173894894	+1	tier1	-	no_errors	ENST00000397081	ensembl	human	known	74_37	missense	5.26	72	4	SNP	1.000	T
RASGRF2	5924	genome.wustl.edu	37	5	80419466	80419466	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr5:80419466C>A	ENST00000265080.4	+	16	2543	c.2476C>A	c.(2476-2478)Cta>Ata	p.L826I		NM_006909.2	NP_008840.1	O14827	RGRF2_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 2	826					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			biliary_tract(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(28)|ovary(5)|prostate(3)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		AGCAGCAGTCCTAGAGTCTGC	0.483																																																	0													86.0	80.0	82.0					5																	80419466		2203	4300	6503	SO:0001583	missense	0			AF023130	CCDS4052.1	5q13	2013-01-10			ENSG00000113319	ENSG00000113319		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9876	protein-coding gene	gene with protein product		606614					Standard	NM_006909		Approved	GRF2, Ras-GRF2	uc003kha.2	O14827	OTTHUMG00000119015	ENST00000265080.4:c.2476C>A	5.37:g.80419466C>A	ENSP00000265080:p.Leu826Ile		B9EG89|Q9UK56	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_Ras_GEF_dom,superfamily_DH-domain,smart_Pleckstrin_homology,smart_DH-domain,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_DH-domain,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.L826I	ENST00000265080.4	37	c.2476	CCDS4052.1	5	.	.	.	.	.	.	.	.	.	.	C	12.84	2.057669	0.36277	.	.	ENSG00000113319	ENST00000265080	T	0.74842	-0.88	5.98	3.24	0.37175	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (1);	4.928250	0.00166	N	0.000002	T	0.74321	0.3701	M	0.65975	2.015	0.34144	D	0.666787	B	0.23650	0.089	B	0.17433	0.018	T	0.53107	-0.8485	10	0.29301	T	0.29	.	9.5623	0.39378	0.0:0.7295:0.0:0.2705	.	826	O14827	RGRF2_HUMAN	I	826	ENSP00000265080:L826I	ENSP00000265080:L826I	L	+	1	2	RASGRF2	80455222	0.995000	0.38212	0.026000	0.17262	0.147000	0.21601	1.638000	0.37165	0.412000	0.25729	0.591000	0.81541	CTA	RASGRF2	-	pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N	ENSG00000113319		0.483	RASGRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASGRF2	HGNC	protein_coding	OTTHUMT00000239215.2	-	0.00	59	0	C	NM_006909		80419466	+1	tier1	-	no_errors	ENST00000265080	ensembl	human	known	74_37	missense	6.76	69	5	SNP	0.882	A
RASL10B	91608	genome.wustl.edu	37	17	34062293	34062293	+	Silent	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr17:34062293C>T	ENST00000268864.3	+	2	467	c.90C>T	c.(88-90)agC>agT	p.S30S		NM_033315.3	NP_201572.1	Q96S79	RSLAB_HUMAN	RAS-like, family 10, member B	30	Small GTPase-like.				GTP catabolic process (GO:0006184)|positive regulation of peptide hormone secretion (GO:0090277)|regulation of systemic arterial blood pressure by atrial natriuretic peptide (GO:0003050)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)			breast(2)|endometrium(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		ACGAGTTCAGCGAGGTCTGCG	0.652																																																	0													96.0	75.0	82.0					17																	34062293		2203	4300	6503	SO:0001819	synonymous_variant	0			BC041133	CCDS11297.1	17q21.1	2014-05-09			ENSG00000141150	ENSG00000270885			30295	protein-coding gene	gene with protein product		612128				12477932	Standard	NM_033315		Approved	VTS58635, RRP17	uc002hju.3	Q96S79	OTTHUMG00000188385	ENST00000268864.3:c.90C>T	17.37:g.34062293C>T			B3KV31	Silent	SNP	pfam_Small_GTPase,pfam_MIRO-like,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,prints_Small_GTPase	p.S30	ENST00000268864.3	37	c.90	CCDS11297.1	17																																																																																			RASL10B	-	pfam_Small_GTPase,pfam_MIRO-like,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type	ENSG00000141150		0.652	RASL10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASL10B	HGNC	protein_coding	OTTHUMT00000256498.2	-	0.00	76	0	C	NM_033315		34062293	+1	tier1	-	no_errors	ENST00000268864	ensembl	human	known	74_37	silent	34.41	61	32	SNP	1.000	T
FDX1L	112812	genome.wustl.edu	37	19	10428164	10428164	+	5'Flank	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr19:10428164G>A	ENST00000393708.3	-	0	0				CTD-2369P2.12_ENST00000586529.1_Missense_Mutation_p.A147V|FDX1L_ENST00000494368.1_5'Flank|RAVER1_ENST00000293677.6_Missense_Mutation_p.A746V|CTD-2369P2.10_ENST00000452032.2_5'Flank|FDX1L_ENST00000541276.1_5'Flank|FDX1L_ENST00000492239.1_5'Flank	NM_001031734.2	NP_001026904.1	Q6P4F2	ADXL_HUMAN	ferredoxin 1-like						oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)			NS(2)|endometrium(1)|large_intestine(1)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	10			OV - Ovarian serous cystadenocarcinoma(20;9.5e-10)|Epithelial(33;2.11e-06)|all cancers(31;5.06e-06)			GTAGGAGTCCGCGTAGTGGCC	0.592																																																	0													53.0	59.0	57.0					19																	10428164		2076	4204	6280	SO:0001631	upstream_gene_variant	0			AK097022	CCDS32905.1	19p13.2	2012-10-09			ENSG00000267673	ENSG00000267673			30546	protein-coding gene	gene with protein product		614585				12477932	Standard	NM_001031734		Approved	MGC19604	uc002mny.1	Q6P4F2	OTTHUMG00000141299		19.37:g.10428164G>A	Exception_encountered		Q8N8B8	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.A746V	ENST00000393708.3	37	c.2237	CCDS32905.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	33|33	5.254818|5.254818	0.95336|0.95336	.|.	.|.	ENSG00000161847|ENSG00000161847	ENST00000293677|ENST00000331131	T|.	0.46451|.	0.87|.	5.01|5.01	5.01|5.01	0.66863|0.66863	.|.	3.435300|.	0.01124|.	N|.	0.005847|.	T|T	0.46718|0.46718	0.1407|0.1407	M|M	0.61703|0.61703	1.905|1.905	0.53688|0.53688	D|D	0.999973|0.999973	D|P	0.89917|0.51537	1.0|0.946	D|B	0.78314|0.33521	0.991|0.165	T|T	0.58967|0.58967	-0.7542|-0.7542	10|8	0.72032|0.59425	D|D	0.01|0.04	-1.2971|-1.2971	15.7941|15.7941	0.78394|0.78394	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	746|603	E9PAU2|Q8IY67	.|RAVR1_HUMAN	V|W	746|603	ENSP00000293677:A746V|.	ENSP00000293677:A746V|ENSP00000327543:R603W	A|R	-|-	2|1	0|2	RAVER1|RAVER1	10289164|10289164	1.000000|1.000000	0.71417|0.71417	0.990000|0.990000	0.47175|0.47175	0.973000|0.973000	0.67179|0.67179	8.067000|8.067000	0.89488|0.89488	2.323000|2.323000	0.78572|0.78572	0.561000|0.561000	0.74099|0.74099	GCG|CGG	RAVER1	-	NULL	ENSG00000161847		0.592	FDX1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAVER1	HGNC	protein_coding	OTTHUMT00000280567.2	-	0.00	123	0	G			10428164	-1	tier1	-	no_errors	ENST00000293677	ensembl	human	known	74_37	missense	39.84	73	49	SNP	1.000	A
RBMXL3	139804	genome.wustl.edu	37	X	114424944	114424944	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chrX:114424944G>T	ENST00000424776.3	+	1	982	c.940G>T	c.(940-942)Gcc>Tcc	p.A314S	LRCH2_ENST00000317135.8_Intron|LRCH2_ENST00000538422.1_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	314							nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						ATGCGGCGCTGCCCCTGTGTG	0.627																																																	0													32.0	34.0	33.0					X																	114424944		692	1591	2283	SO:0001583	missense	0			AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.940G>T	X.37:g.114424944G>T	ENSP00000417451:p.Ala314Ser		B4DXC0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.A314S	ENST00000424776.3	37	c.940	CCDS55478.1	X	.	.	.	.	.	.	.	.	.	.	G	0.185	-1.058225	0.01950	.	.	ENSG00000175718	ENST00000424776	T	0.04406	3.63	0.682	-1.36	0.09085	.	.	.	.	.	T	0.01870	0.0059	N	0.08118	0	0.09310	N	1	B	0.32409	0.37	B	0.19666	0.026	T	0.39901	-0.9591	8	0.87932	D	0	.	.	.	.	.	314	Q8N7X1	RMXL3_HUMAN	S	314	ENSP00000417451:A314S	ENSP00000417451:A314S	A	+	1	0	RBMXL3	114331200	0.016000	0.18221	0.000000	0.03702	0.000000	0.00434	0.144000	0.16135	-2.581000	0.00462	-2.834000	0.00106	GCC	RBMXL3	-	NULL	ENSG00000175718		0.627	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL3	HGNC	protein_coding	OTTHUMT00000057968.3		0.00	84	0	G	NM_001145346		114424944	+1			no_errors	ENST00000424776	ensembl	human	known	74_37	missense	5.41	70	4	SNP	0.000	T
RRP8	23378	genome.wustl.edu	37	11	6623228	6623228	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr11:6623228G>T	ENST00000254605.6	-	2	434	c.317C>A	c.(316-318)tCt>tAt	p.S106Y	RRP8_ENST00000534343.1_Intron|ILK_ENST00000396751.2_5'Flank|ILK_ENST00000299421.4_5'Flank|RP11-732A19.8_ENST00000527191.1_RNA|ILK_ENST00000537806.1_5'Flank|ILK_ENST00000528995.1_5'Flank|ILK_ENST00000420936.2_5'Flank	NM_015324.3	NP_056139.1	O43159	RRP8_HUMAN	ribosomal RNA processing 8, methyltransferase, homolog (yeast)	106					cellular response to glucose starvation (GO:0042149)|chromatin modification (GO:0016568)|chromatin silencing at rDNA (GO:0000183)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of cell cycle arrest (GO:0071158)|regulation of transcription by glucose (GO:0046015)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|rDNA heterochromatin (GO:0033553)	methylated histone binding (GO:0035064)|poly(A) RNA binding (GO:0044822)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)	13						TTCTTCCTCAGAGTCACTGCA	0.448																																																	0													172.0	159.0	163.0					11																	6623228		2201	4296	6497	SO:0001583	missense	0			AB007869	CCDS31411.1	11p15.4	2009-02-23	2009-02-23	2009-02-23	ENSG00000132275	ENSG00000132275			29030	protein-coding gene	gene with protein product	RRP8 methyltransferase homolog (S. cerevisiae)	615818	"""KIAA0409"""	KIAA0409		9455477	Standard	NM_015324		Approved		uc001med.3	O43159		ENST00000254605.6:c.317C>A	11.37:g.6623228G>T	ENSP00000254605:p.Ser106Tyr		Q7KZ78|Q9BVM6	Missense_Mutation	SNP	pfam_Methyltransferase-rel,pfam_Methyltransf_11	p.S106Y	ENST00000254605.6	37	c.317	CCDS31411.1	11	.	.	.	.	.	.	.	.	.	.	G	10.66	1.413708	0.25465	.	.	ENSG00000132275	ENST00000254605;ENST00000533907	T;T	0.54071	1.31;0.59	5.03	2.05	0.26809	.	0.761220	0.12161	N	0.494013	T	0.32041	0.0816	N	0.17082	0.46	0.58432	D	0.999997	B	0.10296	0.003	B	0.06405	0.002	T	0.14392	-1.0474	10	0.56958	D	0.05	-15.9007	3.6197	0.08090	0.0908:0.1676:0.568:0.1736	.	106	O43159	RRP8_HUMAN	Y	106	ENSP00000254605:S106Y;ENSP00000436246:S106Y	ENSP00000254605:S106Y	S	-	2	0	RRP8	6579804	0.895000	0.30542	0.721000	0.30653	0.733000	0.41908	0.703000	0.25646	0.364000	0.24374	0.655000	0.94253	TCT	RRP8	-	NULL	ENSG00000132275		0.448	RRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRP8	HGNC	protein_coding	OTTHUMT00000384505.1	-	0.00	68	0	G	NM_015324		6623228	-1	tier1	-	no_errors	ENST00000254605	ensembl	human	known	74_37	missense	5.97	63	4	SNP	0.839	T
RSPH10B	222967	genome.wustl.edu	37	7	5997557	5997557	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr7:5997557C>T	ENST00000405415.1	-	7	1147	c.761G>A	c.(760-762)cGg>cAg	p.R254Q	RSPH10B_ENST00000441023.2_Missense_Mutation_p.R254Q|RSPH10B_ENST00000539903.1_Missense_Mutation_p.R20Q|RSPH10B_ENST00000404406.1_Missense_Mutation_p.R254Q|RSPH10B_ENST00000535104.1_5'UTR|RSPH10B_ENST00000337579.3_Missense_Mutation_p.R254Q			P0C881	R10B1_HUMAN	radial spoke head 10 homolog B (Chlamydomonas)	254										breast(1)|kidney(1)|lung(4)|ovary(1)|skin(4)	11		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0974)		CCTCTCCCACCGCCCGGTGTA	0.557																																																	0																																										SO:0001583	missense	0				CCDS34598.1	7p22.2	2008-07-04			ENSG00000155026	ENSG00000155026			27362	protein-coding gene	gene with protein product						16507594	Standard	NM_173565		Approved		uc003sph.1	P0C881	OTTHUMG00000152378	ENST00000405415.1:c.761G>A	7.37:g.5997557C>T	ENSP00000385443:p.Arg254Gln		A6NMW7|Q86ST9|Q8NE68	Missense_Mutation	SNP	pfam_MORN,smart_MORN	p.R254Q	ENST00000405415.1	37	c.761	CCDS34598.1	7	.	.	.	.	.	.	.	.	.	.	C	0.015	-1.541548	0.00934	.	.	ENSG00000155026	ENST00000539903;ENST00000405415;ENST00000404406;ENST00000337579;ENST00000354951;ENST00000441023	T;T;T;T;T	0.39997	1.05;1.08;1.08;1.08;1.08	3.87	2.55	0.30701	.	0.483859	0.21137	N	0.079554	T	0.05090	0.0136	N	0.00009	-3.085	0.24350	N	0.994925	B;B;B	0.11235	0.001;0.004;0.003	B;B;B	0.04013	0.0;0.001;0.0	T	0.41484	-0.9506	10	0.02654	T	1	.	8.2325	0.31605	0.0:0.1027:0.0:0.8973	.	20;254;113	B7Z298;P0C881;F5GXE3	.;R10B1_HUMAN;.	Q	20;254;254;254;113;254	ENSP00000445203:R20Q;ENSP00000385443:R254Q;ENSP00000384097:R254Q;ENSP00000338556:R254Q;ENSP00000400988:R254Q	ENSP00000338556:R254Q	R	-	2	0	RSPH10B	5964083	0.499000	0.26083	0.918000	0.36340	0.049000	0.14656	0.640000	0.24705	0.471000	0.27319	-0.702000	0.03669	CGG	RSPH10B	-	pfam_MORN,smart_MORN	ENSG00000155026		0.557	RSPH10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPH10B	HGNC	protein_coding	OTTHUMT00000325465.2	-	0.00	40	0	C	NM_173565		5997557	-1	tier1	-	no_errors	ENST00000337579	ensembl	human	known	74_37	missense	12.00	44	6	SNP	1.000	T
RTKN2	219790	genome.wustl.edu	37	10	63983041	63983041	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr10:63983041G>T	ENST00000373789.3	-	7	833	c.737C>A	c.(736-738)gCt>gAt	p.A246D	RTKN2_ENST00000395265.1_Missense_Mutation_p.A246D|RTKN2_ENST00000315289.2_Missense_Mutation_p.A27D	NM_145307.2	NP_660350.2	Q8IZC4	RTKN2_HUMAN	rhotekin 2	246					hemopoiesis (GO:0030097)|positive regulation of cell proliferation (GO:0008284)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(3)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Prostate(12;0.0297)|all_hematologic(501;0.215)					ACTATCCTCAGCACTTTCCAA	0.289																																																	0													124.0	123.0	124.0					10																	63983041		2203	4298	6501	SO:0001583	missense	0			BC025765	CCDS7263.1, CCDS73140.1	10q21.3	2013-01-10	2007-12-14	2007-12-14	ENSG00000182010	ENSG00000182010		"""Pleckstrin homology (PH) domain containing"""	19364	protein-coding gene	gene with protein product			"""pleckstrin homology domain containing, family K member 1"""	PLEKHK1		15504364	Standard	NM_001282941		Approved	Em:AC024597.2, bA531F24.1, FLJ39352	uc001jlw.3	Q8IZC4	OTTHUMG00000018299	ENST00000373789.3:c.737C>A	10.37:g.63983041G>T	ENSP00000362894:p.Ala246Asp		Q3ZCR1|Q68DZ6|Q8N8K1|Q8TAV2	Missense_Mutation	SNP	pfam_Pleckstrin_homology,superfamily_HR1_rho-bd,smart_HR1_rho-bd,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.A246D	ENST00000373789.3	37	c.737	CCDS7263.1	10	.	.	.	.	.	.	.	.	.	.	G	19.06	3.754412	0.69648	.	.	ENSG00000182010	ENST00000315289;ENST00000395265;ENST00000373789	T;T;T	0.51071	0.72;0.84;0.84	5.84	4.0	0.46444	.	0.468130	0.26424	N	0.024452	T	0.51839	0.1698	M	0.64997	1.995	0.47009	D	0.999283	D;P	0.56287	0.975;0.782	P;P	0.50754	0.649;0.506	T	0.53676	-0.8405	10	0.87932	D	0	-8.8579	8.3588	0.32346	0.2973:0.0:0.7027:0.0	.	27;246	Q5SVY4;Q8IZC4	.;RTKN2_HUMAN	D	27;246;246	ENSP00000325379:A27D;ENSP00000378682:A246D;ENSP00000362894:A246D	ENSP00000325379:A27D	A	-	2	0	RTKN2	63653047	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	1.187000	0.32090	0.826000	0.34661	0.557000	0.71058	GCT	RTKN2	-	NULL	ENSG00000182010		0.289	RTKN2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RTKN2	HGNC	protein_coding	OTTHUMT00000091618.1	-	0.00	41	0	G	NM_145307		63983041	-1	tier1	-	no_errors	ENST00000373789	ensembl	human	known	74_37	missense	5.71	66	4	SNP	0.997	T
SLC46A1	113235	genome.wustl.edu	37	17	26723195	26723195	+	3'UTR	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr17:26723195G>T	ENST00000440501.1	-	0	4952				SARM1_ENST00000457710.3_Nonsense_Mutation_p.E655*|SLC46A1_ENST00000321666.5_3'UTR|SLC46A1_ENST00000584729.1_5'UTR|SARM1_ENST00000379061.4_3'UTR	NM_080669.4	NP_542400.2	Q96NT5	PCFT_HUMAN	solute carrier family 46 (folate transporter), member 1						cellular iron ion homeostasis (GO:0006879)|folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|heme transporter activity (GO:0015232)|methotrexate transporter activity (GO:0015350)			lung(5)	5	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	Folic Acid(DB00158)|Methotrexate(DB00563)|Sulfasalazine(DB00795)	CGAATACCAGGAGGCCACCAT	0.607																																																	0													78.0	68.0	71.0					17																	26723195		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			AK054669	CCDS74019.1, CCDS74020.1	17q11.2	2014-09-17	2007-09-24			ENSG00000076351		"""Solute carriers"""	30521	protein-coding gene	gene with protein product	"""heme carrier protein 1"", ""proton-coupled folate transporter"""	611672	"""solute carrier family 46, member 1"""			16143108, 17129779	Standard	XM_005277786		Approved	HCP1, MGC9564, PCFT	uc002hbf.2	Q96NT5		ENST00000440501.1:c.*3477C>A	17.37:g.26723195G>T			Q1HE20|Q86T92|Q8TEG3|Q96FL0	Nonsense_Mutation	SNP	pfam_SAM_2,pfam_SAM_type1,superfamily_ARM-type_fold,superfamily_TIR_dom,superfamily_SAM/pointed,smart_SAM,smart_TIR_dom,pfscan_SAM	p.E655*	ENST00000440501.1	37	c.1963		17	.	.	.	.	.	.	.	.	.	.	G	41	9.150458	0.99082	.	.	ENSG00000004139	ENST00000457710;ENST00000003834	.	.	.	4.84	4.84	0.62591	.	0.059111	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-27.3339	17.9677	0.89105	0.0:0.0:1.0:0.0	.	.	.	.	X	687;655	.	ENSP00000003834:E655X	E	+	1	0	SARM1	23747322	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.718000	0.74713	2.222000	0.72286	0.561000	0.74099	GAG	SARM1	-	smart_TIR_dom	ENSG00000004139		0.607	SLC46A1-202	KNOWN	basic|appris_principal	protein_coding	SARM1	HGNC	protein_coding			0.00	49	0	G	NM_080669		26723195	+1			no_errors	ENST00000457710	ensembl	human	novel	74_37	nonsense	5.26	54	3	SNP	1.000	T
SCARB1	949	genome.wustl.edu	37	12	125348162	125348162	+	Silent	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr12:125348162G>T	ENST00000415380.2	-	1	230	c.105C>A	c.(103-105)ctC>ctA	p.L35L	SCARB1_ENST00000261693.6_Silent_p.L35L|SCARB1_ENST00000546215.1_Silent_p.L35L|SCARB1_ENST00000376788.1_Silent_p.L35L|SCARB1_ENST00000339570.5_Silent_p.L35L|SCARB1_ENST00000535005.1_Intron			Q8WTV0	SCRB1_HUMAN	scavenger receptor class B, member 1	35					adhesion of symbiont to host (GO:0044406)|androgen biosynthetic process (GO:0006702)|blood vessel endothelial cell migration (GO:0043534)|cell adhesion (GO:0007155)|cholesterol catabolic process (GO:0006707)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol import (GO:0070508)|detection of lipopolysaccharide (GO:0032497)|endothelial cell proliferation (GO:0001935)|high-density lipoprotein particle clearance (GO:0034384)|high-density lipoprotein particle remodeling (GO:0034375)|lipopolysaccharide transport (GO:0015920)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle clearance (GO:0034383)|phospholipid transport (GO:0015914)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of triglyceride biosynthetic process (GO:0010867)|receptor-mediated endocytosis (GO:0006898)|recognition of apoptotic cell (GO:0043654)|regulation of phagocytosis (GO:0050764)|regulation of phosphatidylcholine catabolic process (GO:0010899)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|viral process (GO:0016032)|wound healing (GO:0042060)	caveola (GO:0005901)|cell surface (GO:0009986)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein binding (GO:0034185)|high-density lipoprotein particle binding (GO:0008035)|high-density lipoprotein particle receptor activity (GO:0070506)|lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(7)|prostate(1)	17	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000116)|Epithelial(86;0.000415)|all cancers(50;0.00395)	Phosphatidylserine(DB00144)	GCTGCTTGATGAGCGACGGCA	0.721																																																	0													26.0	23.0	24.0					12																	125348162		2201	4300	6501	SO:0001819	synonymous_variant	0			Z22555	CCDS9259.1, CCDS45008.1	12q24.32	2008-08-05	2002-09-06	2002-09-06	ENSG00000073060	ENSG00000073060			1664	protein-coding gene	gene with protein product		601040	"""CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 1"""	CD36L1		7689561	Standard	NM_001082959		Approved	SRB1, CLA-1, CLA1, SR-BI	uc001ugm.4	Q8WTV0	OTTHUMG00000168544	ENST00000415380.2:c.105C>A	12.37:g.125348162G>T			F8W8N0|Q14016|Q52LZ5|Q6KFX4	Silent	SNP	pfam_CD36,prints_CD36,prints_CD36_antigen	p.L35	ENST00000415380.2	37	c.105		12																																																																																			SCARB1	-	pfam_CD36	ENSG00000073060		0.721	SCARB1-006	KNOWN	basic	protein_coding	SCARB1	HGNC	protein_coding	OTTHUMT00000400165.1	-	0.00	111	0	G	NM_005505		125348162	-1	tier1	-	no_errors	ENST00000415380	ensembl	human	known	74_37	silent	5.33	71	4	SNP	0.988	T
SCYL1	57410	genome.wustl.edu	37	11	65299049	65299049	+	Silent	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr11:65299049G>T	ENST00000270176.5	+	8	1088	c.1011G>T	c.(1009-1011)gtG>gtT	p.V337V	SCYL1_ENST00000420247.2_Silent_p.V337V|SCYL1_ENST00000533862.1_Silent_p.V337V|SCYL1_ENST00000524944.1_Silent_p.V337V|SCYL1_ENST00000525364.1_Silent_p.V337V|SCYL1_ENST00000279270.6_Silent_p.V337V|SCYL1_ENST00000527009.1_Silent_p.V194V	NM_020680.3	NP_065731.3	Q96KG9	NTKL_HUMAN	SCY1-like 1 (S. cerevisiae)	337					peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|transcription, DNA-templated (GO:0006351)	cis-Golgi network (GO:0005801)|COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|protein tyrosine kinase activity (GO:0004713)			ovary(1)|skin(1)	2						CCTTTCAGGTGGGCAAGTTCC	0.557																																																	0													70.0	73.0	72.0					11																	65299049		2111	4218	6329	SO:0001819	synonymous_variant	0			AF225424	CCDS41672.1, CCDS44646.1	11q11-q12	2008-07-21	2002-11-26	2002-11-29	ENSG00000142186	ENSG00000142186			14372	protein-coding gene	gene with protein product	"""teratoma-associated tyrosine kinase"", ""telomerase transcriptional elements-interacting factor"", ""telomerase regulation-associated protein"""	607982	"""N-terminal kinase-like"""	NTKL		11118629	Standard	NM_020680		Approved	HT019, P105, GKLP, NKTL, TAPK, TRAP, TEIF, MGC78454	uc001oea.1	Q96KG9	OTTHUMG00000166325	ENST00000270176.5:c.1011G>T	11.37:g.65299049G>T			A6NJF1|Q96G50|Q96KG8|Q96KH1|Q9HAW5|Q9HBL3|Q9NR53	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_ARM-type_fold,superfamily_Kinase-like_dom,pfscan_Prot_kinase_dom	p.V337	ENST00000270176.5	37	c.1011	CCDS41672.1	11																																																																																			SCYL1	-	superfamily_ARM-type_fold	ENSG00000142186		0.557	SCYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCYL1	HGNC	protein_coding	OTTHUMT00000389159.2	-	0.00	76	0	G	NM_020680		65299049	+1	tier1	-	no_errors	ENST00000270176	ensembl	human	known	74_37	silent	5.19	72	4	SNP	1.000	T
SEMA6D	80031	genome.wustl.edu	37	15	48063590	48063590	+	Nonsense_Mutation	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr15:48063590C>T	ENST00000316364.5	+	19	3269	c.2830C>T	c.(2830-2832)Cga>Tga	p.R944*	SEMA6D_ENST00000389432.2_Nonsense_Mutation_p.R901*|SEMA6D_ENST00000389433.2_Nonsense_Mutation_p.R925*|SEMA6D_ENST00000358066.4_Nonsense_Mutation_p.R882*|SEMA6D_ENST00000558014.1_Nonsense_Mutation_p.R882*|SEMA6D_ENST00000558816.1_3'UTR|SEMA6D_ENST00000355997.3_3'UTR|SEMA6D_ENST00000389428.3_Nonsense_Mutation_p.R869*|SEMA6D_ENST00000354744.4_Nonsense_Mutation_p.R888*|SEMA6D_ENST00000536845.2_Nonsense_Mutation_p.R944*|SEMA6D_ENST00000537942.1_Nonsense_Mutation_p.R882*	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	944					axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		CCCAACCAAGCGAGTGGATGT	0.512																																																	0													109.0	111.0	110.0					15																	48063590		2198	4297	6495	SO:0001587	stop_gained	0			AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.2830C>T	15.37:g.48063590C>T	ENSP00000324857:p.Arg944*		A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Nonsense_Mutation	SNP	pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,pfscan_Semap_dom	p.R944*	ENST00000316364.5	37	c.2830	CCDS32225.1	15	.	.	.	.	.	.	.	.	.	.	C	41	9.108550	0.99068	.	.	ENSG00000137872	ENST00000537942;ENST00000536845;ENST00000316364;ENST00000389433;ENST00000389432;ENST00000354744;ENST00000358066;ENST00000389428	.	.	.	5.8	-0.0948	0.13643	.	0.236027	0.40728	N	0.001038	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.0584	0.86541	0.6624:0.3376:0.0:0.0	.	.	.	.	X	882;944;944;925;901;888;882;869	.	ENSP00000324857:R944X	R	+	1	2	SEMA6D	45850882	0.999000	0.42202	0.993000	0.49108	0.991000	0.79684	0.686000	0.25392	-0.282000	0.09128	0.563000	0.77884	CGA	SEMA6D	-	NULL	ENSG00000137872		0.512	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SEMA6D	HGNC	protein_coding	OTTHUMT00000416868.1	-	0.00	27	0	C	NM_024966		48063590	+1	tier1	-	no_errors	ENST00000316364	ensembl	human	known	74_37	nonsense	40.00	9	6	SNP	1.000	T
SERPINE2	5270	genome.wustl.edu	37	2	224849554	224849554	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr2:224849554C>A	ENST00000258405.4	-	5	1041	c.799G>T	c.(799-801)Gcc>Tcc	p.A267S	SERPINE2_ENST00000409840.3_Missense_Mutation_p.A267S|SERPINE2_ENST00000409304.1_Missense_Mutation_p.A267S|SERPINE2_ENST00000447280.2_Missense_Mutation_p.A279S	NM_001136528.1|NM_006216.3	NP_001130000.1|NP_006207.1	P07093	GDN_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2	267					blood coagulation (GO:0007596)|cerebellar granular layer morphogenesis (GO:0021683)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|innervation (GO:0060384)|long-term synaptic potentiation (GO:0060291)|mating plug formation (GO:0042628)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of plasminogen activation (GO:0010757)|negative regulation of platelet activation (GO:0010544)|negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein processing (GO:0010955)|negative regulation of proteolysis (GO:0045861)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of sodium ion transport (GO:0010766)|positive regulation of astrocyte differentiation (GO:0048711)|regulation of cell migration (GO:0030334)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of timing of cell differentiation (GO:0048505)|secretion by cell (GO:0032940)|secretory granule organization (GO:0033363)|seminal vesicle epithelium development (GO:0061108)	cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extrinsic component of external side of plasma membrane (GO:0031232)|neuromuscular junction (GO:0031594)|platelet alpha granule (GO:0031091)|vesicle (GO:0031982)	glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)	17		Renal(207;0.025)|all_lung(227;0.0586)|Lung NSC(271;0.0682)|all_hematologic(139;0.0797)		Epithelial(121;5.68e-10)|all cancers(144;1.9e-07)|Lung(261;0.0088)|LUSC - Lung squamous cell carcinoma(224;0.00902)		GGGATGATGGCAGACAGCGGA	0.542																																																	0													139.0	117.0	124.0					2																	224849554		2203	4300	6503	SO:0001583	missense	0			M17783	CCDS2460.1, CCDS46525.1, CCDS46526.1	2q36.1	2014-02-18	2005-08-18		ENSG00000135919	ENSG00000135919		"""Serine (or cysteine) peptidase inhibitors"""	8951	protein-coding gene	gene with protein product	"""glial-derived nexin 1"""	177010	"""serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2"""	PI7		7665170, 24172014	Standard	NM_006216		Approved	PN1, GDN, PNI, nexin	uc002vnu.2	P07093	OTTHUMG00000133163	ENST00000258405.4:c.799G>T	2.37:g.224849554C>A	ENSP00000258405:p.Ala267Ser		B2R6A4|B4DIF2|Q53S15|Q5D0C4	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.A267S	ENST00000258405.4	37	c.799	CCDS2460.1	2	.	.	.	.	.	.	.	.	.	.	C	16.75	3.209190	0.58343	.	.	ENSG00000135919	ENST00000409304;ENST00000258405;ENST00000409840;ENST00000447280;ENST00000432738	D;D;D;D;D	0.84070	-1.8;-1.8;-1.8;-1.8;-1.8	5.97	5.97	0.96955	Serpin domain (3);	0.223441	0.47852	D	0.000201	T	0.80127	0.4566	L	0.35593	1.075	0.47374	D	0.999407	P;P	0.44776	0.843;0.843	P;P	0.44772	0.46;0.46	T	0.75611	-0.3258	10	0.20519	T	0.43	.	20.428	0.99075	0.0:1.0:0.0:0.0	.	279;267	B4DIF2;P07093	.;GDN_HUMAN	S	267;267;267;279;267	ENSP00000386412:A267S;ENSP00000258405:A267S;ENSP00000386969:A267S;ENSP00000415786:A279S;ENSP00000408452:A267S	ENSP00000258405:A267S	A	-	1	0	SERPINE2	224557798	0.985000	0.35326	0.982000	0.44146	0.503000	0.33858	2.606000	0.46291	2.837000	0.97791	0.655000	0.94253	GCC	SERPINE2	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	ENSG00000135919		0.542	SERPINE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SERPINE2	HGNC	protein_coding	OTTHUMT00000256865.2	-	0.00	43	0	C	NM_006216		224849554	-1	tier1	-	no_errors	ENST00000258405	ensembl	human	known	74_37	missense	54.37	46	56	SNP	0.992	A
SETD5	55209	genome.wustl.edu	37	3	9512170	9512170	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr3:9512170G>A	ENST00000406341.1	+	18	2942	c.2752G>A	c.(2752-2754)Gca>Aca	p.A918T	SETD5_ENST00000402466.1_Missense_Mutation_p.A820T|SETD5_ENST00000302463.6_Missense_Mutation_p.A820T|SETD5_ENST00000402198.1_Missense_Mutation_p.A918T|SETD5_ENST00000407969.1_Missense_Mutation_p.A937T			Q9C0A6	SETD5_HUMAN	SET domain containing 5	918										NS(2)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(3)|prostate(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)		CCTGGATTTGGCAAAAGTAGG	0.483																																																	0													172.0	159.0	163.0					3																	9512170		1891	4112	6003	SO:0001583	missense	0			BC020956	CCDS46741.1, CCDS74892.1	3p25.3	2011-12-13			ENSG00000168137	ENSG00000168137			25566	protein-coding gene	gene with protein product		615743				11214970	Standard	XM_005265299		Approved	FLJ10707	uc003brt.3	Q9C0A6	OTTHUMG00000150491	ENST00000406341.1:c.2752G>A	3.37:g.9512170G>A	ENSP00000383939:p.Ala918Thr		Q6AI17|Q8WUB6|Q9H3X4|Q9H6V7|Q9H7S3|Q9NVI9	Missense_Mutation	SNP	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	p.A918T	ENST00000406341.1	37	c.2752	CCDS46741.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.07|10.07	1.250064|1.250064	0.22880|0.22880	.|.	.|.	ENSG00000168137|ENSG00000168137	ENST00000402198;ENST00000402466;ENST00000406341;ENST00000407969;ENST00000302463|ENST00000399686;ENST00000421188	D;D;D;D;D|.	0.91631|.	-2.56;-2.88;-2.56;-2.56;-2.88|.	5.46|5.46	1.4|1.4	0.22301|0.22301	.|.	0.181621|.	0.48286|.	N|.	0.000195|.	T|T	0.15955|0.15955	0.0384|0.0384	N|N	0.08118|0.08118	0|0	0.21740|0.21740	N|N	0.999563|0.999563	B;B;B|.	0.02656|.	0.0;0.0;0.0|.	B;B;B|.	0.01281|.	0.0;0.0;0.0|.	T|T	0.26395|0.26395	-1.0104|-1.0104	10|5	0.25751|.	T|.	0.34|.	-3.2769|-3.2769	5.1418|5.1418	0.14963|0.14963	0.4818:0.244:0.2742:0.0|0.4818:0.244:0.2742:0.0	.|.	587;820;918|.	B3KXG4;Q9C0A6-3;Q9C0A6|.	.;.;SETD5_HUMAN|.	T|D	918;820;918;937;820|585;248	ENSP00000385852:A918T;ENSP00000384429:A820T;ENSP00000383939:A918T;ENSP00000384114:A937T;ENSP00000302028:A820T|.	ENSP00000302028:A820T|.	A|G	+|+	1|2	0|0	SETD5|SETD5	9487170|9487170	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	0.685000|0.685000	0.25378|0.25378	0.376000|0.376000	0.24707|0.24707	-0.482000|-0.482000	0.04802|0.04802	GCA|GGC	SETD5	-	NULL	ENSG00000168137		0.483	SETD5-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	SETD5	HGNC	protein_coding	OTTHUMT00000318425.1		0.00	49	0	G	XM_371614		9512170	+1			no_errors	ENST00000402198	ensembl	human	known	74_37	missense	6.45	58	4	SNP	0.997	A
SF1	7536	genome.wustl.edu	37	11	64534503	64534505	+	In_Frame_Del	DEL	GGC	GGC	-	rs71581802|rs71583705		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	GGC	GGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr11:64534503_64534505delGGC	ENST00000377390.3	-	12	1786_1788	c.1449_1451delGCC	c.(1447-1452)ccgcct>cct	p.483_484PP>P	SF1_ENST00000227503.9_In_Frame_Del_p.483_484PP>P|SF1_ENST00000433274.2_In_Frame_Del_p.457_458PP>P|SF1_ENST00000334944.5_In_Frame_Del_p.483_484PP>P|SF1_ENST00000489544.1_5'Flank|SF1_ENST00000377394.3_In_Frame_Del_p.A485del|SF1_ENST00000422298.2_In_Frame_Del_p.368_369PP>P|SF1_ENST00000377387.1_In_Frame_Del_p.608_609PP>P	NM_004630.3	NP_004621.2	Q15637	SF01_HUMAN	splicing factor 1	483	Pro-rich.				Leydig cell differentiation (GO:0033327)|male sex determination (GO:0030238)|mRNA 3'-splice site recognition (GO:0000389)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of smooth muscle cell proliferation (GO:0048662)|regulation of steroid biosynthetic process (GO:0050810)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal complex assembly (GO:0000245)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|ribosome (GO:0005840)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(12)|ovary(2)|skin(2)	31						CCCACTGGGAGGCGGCGGCGGCG	0.68																																																	0																																										SO:0001651	inframe_deletion	0			D26120	CCDS8080.1, CCDS8081.1, CCDS31599.1, CCDS44642.1, CCDS44642.2, CCDS53660.1, CCDS53661.1	11q13	2014-09-17	2001-12-19	2002-01-11	ENSG00000168066	ENSG00000168066		"""Zinc fingers, CCHC domain containing"""	12950	protein-coding gene	gene with protein product		601516	"""zinc finger protein 162"""	ZNF162		7912130, 9573336	Standard	NM_201997		Approved	ZFM1, ZCCHC25	uc001oaz.2	Q15637	OTTHUMG00000066833	ENST00000377390.3:c.1449_1451delGCC	11.37:g.64534512_64534514delGGC	ENSP00000366607:p.Pro485del		B7Z1Q1|C9JJE2|Q14818|Q14819|Q15913|Q8IY00|Q92744|Q92745|Q969H7|Q9BW01|Q9UEI0	In_Frame_Del	DEL	pfam_KH_dom_type_1,pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_KH_dom,smart_Znf_CCHC,pfscan_Znf_CCHC,pfscan_KH_dom_type_1	p.P485in_frame_del	ENST00000377390.3	37	c.1451_1449	CCDS31599.1	11																																																																																			SF1	-	NULL	ENSG00000168066		0.680	SF1-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SF1	HGNC	protein_coding	OTTHUMT00000143242.1		0.00	27	0	GGC	NM_004630		64534505	-1	tier1		no_errors	ENST00000377390	ensembl	human	known	74_37	in_frame_del	8.00	23	2	DEL	1.000:1.000:0.998	-
SF3A3	10946	genome.wustl.edu	37	1	38442611	38442611	+	Missense_Mutation	SNP	T	T	G			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:38442611T>G	ENST00000373019.4	-	12	1905	c.950A>C	c.(949-951)aAc>aCc	p.N317T	SF3A3_ENST00000448721.2_Missense_Mutation_p.N264T|SF3A3_ENST00000489537.1_5'Flank	NM_006802.2	NP_006793.1	Q12874	SF3A3_HUMAN	splicing factor 3a, subunit 3, 60kDa	317					gene expression (GO:0010467)|mRNA 3'-splice site recognition (GO:0000389)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(3)|prostate(2)	12	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				AATGTCTTTGTTCCTTTCAGT	0.393																																																	0													136.0	138.0	137.0					1																	38442611		2202	4300	6502	SO:0001583	missense	0			U08815	CCDS428.1	1p34.3	2012-06-07	2002-08-29		ENSG00000183431	ENSG00000183431			10767	protein-coding gene	gene with protein product		605596	"""splicing factor 3a, subunit 3, 60kD"""			7816610, 8022796	Standard	NM_006802		Approved	SF3a60, SAP61, PRP9, PRPF9	uc001cci.3	Q12874	OTTHUMG00000004438	ENST00000373019.4:c.950A>C	1.37:g.38442611T>G	ENSP00000362110:p.Asn317Thr		D3DPT5|Q15460|Q5VT87	Missense_Mutation	SNP	pfam_DUF3449,pfam_SF3a60_bindingd,pfscan_Znf_C2H2_matrin	p.N317T	ENST00000373019.4	37	c.950	CCDS428.1	1	.	.	.	.	.	.	.	.	.	.	T	16.11	3.029549	0.54790	.	.	ENSG00000183431	ENST00000373019;ENST00000448721	.	.	.	5.69	5.69	0.88448	.	0.042869	0.85682	D	0.000000	T	0.51058	0.1652	L	0.46157	1.445	0.80722	D	1	B;B	0.32245	0.009;0.361	B;B	0.31614	0.004;0.133	T	0.47209	-0.9135	9	0.23891	T	0.37	-22.648	15.6555	0.77129	0.0:0.0:0.0:1.0	.	264;317	E7EUT8;Q12874	.;SF3A3_HUMAN	T	317;264	.	ENSP00000362110:N317T	N	-	2	0	SF3A3	38215198	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.611000	0.82962	2.193000	0.70182	0.477000	0.44152	AAC	SF3A3	-	NULL	ENSG00000183431		0.393	SF3A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3A3	HGNC	protein_coding	OTTHUMT00000012976.1	-	0.00	50	0	T	NM_006802		38442611	-1	tier1	-	no_errors	ENST00000373019	ensembl	human	known	74_37	missense	7.07	92	7	SNP	1.000	G
SFRP2	6423	genome.wustl.edu	37	4	154702638	154702638	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr4:154702638G>A	ENST00000274063.4	-	3	1137	c.853C>T	c.(853-855)Cgc>Tgc	p.R285C		NM_003013.2	NP_003004.1	Q96HF1	SFRP2_HUMAN	secreted frizzled-related protein 2	285	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				bone morphogenesis (GO:0060349)|brain development (GO:0007420)|cardiac left ventricle morphogenesis (GO:0003214)|cell-cell signaling (GO:0007267)|cellular response to extracellular stimulus (GO:0031668)|cellular response to X-ray (GO:0071481)|chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|convergent extension involved in axis elongation (GO:0060028)|digestive tract morphogenesis (GO:0048546)|embryonic digit morphogenesis (GO:0042733)|gonad development (GO:0008406)|hematopoietic stem cell proliferation (GO:0071425)|male gonad development (GO:0008584)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dermatome development (GO:0061185)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of gene expression (GO:0010629)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of mesodermal cell fate specification (GO:0042662)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of planar cell polarity pathway involved in axis elongation (GO:2000041)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-anal tail morphogenesis (GO:0036342)|regulation of stem cell division (GO:2000035)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|sclerotome development (GO:0061056)|vasculature development (GO:0001944)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	endopeptidase activator activity (GO:0061133)|fibronectin binding (GO:0001968)|integrin binding (GO:0005178)|metalloenzyme activator activity (GO:0010577)|PDZ domain binding (GO:0030165)|receptor agonist activity (GO:0048018)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.R285C(1)		breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(1)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	16	all_hematologic(180;0.093)	Renal(120;0.117)				CGGGAGATGCGCTTGAACTCT	0.617																																																	1	Substitution - Missense(1)	prostate(1)											111.0	90.0	97.0					4																	154702638		2203	4300	6503	SO:0001583	missense	0			AF017986	CCDS34082.1	4q31.3	2008-08-29			ENSG00000145423	ENSG00000145423		"""Secreted frizzled-related proteins"""	10777	protein-coding gene	gene with protein product		604157				9391078	Standard	NM_003013		Approved	SARP1, SDF-5, FRP-2	uc003inv.1	Q96HF1	OTTHUMG00000161559	ENST00000274063.4:c.853C>T	4.37:g.154702638G>A	ENSP00000274063:p.Arg285Cys		B3KQR2|O14778|Q9HAP5	Missense_Mutation	SNP	pfam_Frizzled_dom,pfam_Netrin_module_non-TIMP,superfamily_Frizzled_dom,superfamily_TIMP-like_OB-fold,smart_Frizzled_dom,smart_Netrin_module_non-TIMP,pfscan_Frizzled_dom,pfscan_Netrin_domain	p.R285C	ENST00000274063.4	37	c.853	CCDS34082.1	4	.	.	.	.	.	.	.	.	.	.	G	18.55	3.647889	0.67358	.	.	ENSG00000145423	ENST00000274063	T	0.26223	1.75	5.95	5.95	0.96441	Tissue inhibitor of metalloproteinases-like, OB-fold (1);Netrin domain (1);Netrin module, non-TIMP type (2);	0.000000	0.85682	D	0.000000	T	0.47728	0.1461	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	T	0.28073	-1.0055	10	0.52906	T	0.07	.	15.9197	0.79552	0.0:0.0:0.8643:0.1357	.	285	Q96HF1	SFRP2_HUMAN	C	285	ENSP00000274063:R285C	ENSP00000274063:R285C	R	-	1	0	SFRP2	154922088	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.495000	0.53280	2.811000	0.96726	0.655000	0.94253	CGC	SFRP2	-	pfam_Netrin_module_non-TIMP,superfamily_TIMP-like_OB-fold,smart_Netrin_module_non-TIMP,pfscan_Netrin_domain	ENSG00000145423		0.617	SFRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFRP2	HGNC	protein_coding	OTTHUMT00000365296.1	-	0.00	36	0	G			154702638	-1	tier1	-	no_errors	ENST00000274063	ensembl	human	known	74_37	missense	32.73	36	18	SNP	1.000	A
SGK1	6446	genome.wustl.edu	37	6	134583168	134583168	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr6:134583168G>T	ENST00000367858.5	-	2	785	c.188C>A	c.(187-189)tCc>tAc	p.S63Y	SGK1_ENST00000524929.1_Missense_Mutation_p.S63Y	NM_001143676.1	NP_001137148.1	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1	0					apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|ion transmembrane transport (GO:0034220)|long-term memory (GO:0007616)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of gastric acid secretion (GO:0060453)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|renal sodium ion absorption (GO:0070294)|response to stress (GO:0006950)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|sodium channel regulator activity (GO:0017080)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(21)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(4)|stomach(1)	46	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		TTGACACAAGGAAGACTCGAA	0.532																																																	0													203.0	181.0	188.0					6																	134583168		1568	3582	5150	SO:0001583	missense	0			AJ000512	CCDS5170.1, CCDS47476.1, CCDS47477.1, CCDS47478.1	6q23	2008-02-05	2007-12-05	2007-12-05	ENSG00000118515	ENSG00000118515			10810	protein-coding gene	gene with protein product		602958	"""serum/glucocorticoid regulated kinase"""	SGK		9114008, 9722955	Standard	NM_005627		Approved		uc003qeo.4	O00141	OTTHUMG00000015613	ENST00000367858.5:c.188C>A	6.37:g.134583168G>T	ENSP00000356832:p.Ser63Tyr		B7UUP7|B7UUP8|B7UUP9|B7Z5B2|E1P583|Q5TCN2|Q5TCN3|Q5TCN4|Q5VY65|Q9UN56	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_Phox,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_dom	p.S63Y	ENST00000367858.5	37	c.188	CCDS47476.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.38|14.38	2.519239|2.519239	0.44866|0.44866	.|.	.|.	ENSG00000118515|ENSG00000118515	ENST00000460769|ENST00000367858;ENST00000461976;ENST00000524929	.|T	.|0.75938	.|-0.98	5.88|5.88	5.01|5.01	0.66863|0.66863	.|.	.|0.727288	.|0.12420	.|N	.|0.470560	T|T	0.59824|0.59824	0.2222|0.2222	L|L	0.29908|0.29908	0.895|0.895	0.09310|0.09310	N|N	1|1	.|P;B	.|0.47253	.|0.892;0.115	.|P;B	.|0.47251	.|0.542;0.055	T|T	0.59984|0.59984	-0.7351|-0.7351	5|10	.|0.87932	.|D	.|0	.|.	15.434|15.434	0.75129|0.75129	0.0:0.1382:0.8618:0.0|0.0:0.1382:0.8618:0.0	.|.	.|63;63	.|Q7Z3I4;O00141-2	.|.;.	L|Y	10|63;32;63	.|ENSP00000356832:S63Y	.|ENSP00000356832:S63Y	F|S	-|-	3|2	2|0	SGK1|SGK1	134624861|134624861	0.304000|0.304000	0.24472|0.24472	0.960000|0.960000	0.40013|0.40013	0.119000|0.119000	0.20118|0.20118	3.660000|3.660000	0.54496|0.54496	1.465000|1.465000	0.48006|0.48006	-0.176000|-0.176000	0.13171|0.13171	TTC|TCC	SGK1	-	NULL	ENSG00000118515		0.532	SGK1-001	KNOWN	basic|CCDS	protein_coding	SGK1	HGNC	protein_coding	OTTHUMT00000042304.2		0.00	45	0	G			134583168	-1			no_errors	ENST00000367858	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.284	T
SGSM1	129049	genome.wustl.edu	37	22	25243762	25243762	+	Splice_Site	SNP	G	G	T	rs538422718	byFrequency	TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr22:25243762G>T	ENST00000400359.4	+	4	308	c.301G>T	c.(301-303)Gcg>Tcg	p.A101S	SGSM1_ENST00000400358.4_Splice_Site_p.A101S	NM_001039948.2|NM_133454.2	NP_001035037.1|NP_597711.1	Q2NKQ1	SGSM1_HUMAN	small G protein signaling modulator 1	101	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.					Golgi apparatus (GO:0005794)	Rab GTPase activator activity (GO:0005097)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(14)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	41						GATCGAGAGCGCGTGAGTGCA	0.577																																																	0													20.0	21.0	20.0					22																	25243762		2040	4199	6239	SO:0001630	splice_region_variant	0			AB075821	CCDS46674.1, CCDS46675.1, CCDS74834.1	22q11.23	2013-07-09	2007-08-14	2007-08-14	ENSG00000167037	ENSG00000167037		"""Small G protein signaling modulators"""	29410	protein-coding gene	gene with protein product		611417	"""RUN and TBC1 domain containing 2"""	RUTBC2		11853319, 17509819, 22637480	Standard	NM_133454		Approved	KIAA1941	uc003abg.2	Q2NKQ1	OTTHUMG00000150837	ENST00000400359.4:c.302+1G>T	22.37:g.25243762G>T			A5LGW1|A8MUT4|B0QYW0|B0QYW1|B5MEG1|B9A6J4|Q5TFL3|Q8TF60	Missense_Mutation	SNP	pfam_Run,pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Run,smart_Rab-GTPase-TBC_dom,pfscan_Run,pfscan_Rab-GTPase-TBC_dom	p.A101S	ENST00000400359.4	37	c.301	CCDS46674.1	22	.	.	.	.	.	.	.	.	.	.	G	1.779	-0.482349	0.04383	.	.	ENSG00000167037	ENST00000403206;ENST00000400358;ENST00000400359	T;T	0.29655	1.56;1.56	3.95	-3.42	0.04825	RUN (2);	0.639174	0.17621	N	0.167709	T	0.09686	0.0238	N	0.02539	-0.55	0.32783	N	0.502214	B;B;B;B;B	0.27559	0.021;0.026;0.15;0.065;0.181	B;B;B;B;B	0.29862	0.032;0.046;0.066;0.098;0.108	T	0.40194	-0.9576	10	0.10902	T	0.67	-3.4421	9.8588	0.41101	0.5816:0.0:0.4184:0.0	.	101;76;76;101;76	Q2NKQ1-4;C9J7S8;Q2NKQ1-3;Q2NKQ1;B9A6J4	.;.;.;SGSM1_HUMAN;.	S	76;101;101	ENSP00000383211:A101S;ENSP00000383212:A101S	ENSP00000383211:A101S	A	+	1	0	SGSM1	23573762	0.887000	0.30362	0.550000	0.28217	0.466000	0.32739	0.082000	0.14847	-0.693000	0.05121	-1.267000	0.01435	GCG	SGSM1	-	pfam_Run,pfscan_Run	ENSG00000167037		0.577	SGSM1-004	KNOWN	basic|CCDS	protein_coding	SGSM1	HGNC	protein_coding	OTTHUMT00000320282.1	-	0.00	112	0	G	XM_059318	Missense_Mutation	25243762	+1	tier1	-	no_errors	ENST00000400359	ensembl	human	known	74_37	missense	19.33	96	23	SNP	0.737	T
SH3GL2	6456	genome.wustl.edu	37	9	17747117	17747117	+	Silent	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr9:17747117C>T	ENST00000380607.4	+	2	219	c.99C>T	c.(97-99)ttC>ttT	p.F33F	SH3GL2_ENST00000537391.1_5'UTR	NM_003026.2	NP_003017.1	Q99962	SH3G2_HUMAN	SH3-domain GRB2-like 2	33	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.|Binds and tubulates liposomes. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|epidermal growth factor receptor signaling pathway (GO:0007173)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of receptor internalization (GO:0002090)|signal transduction (GO:0007165)|synaptic vesicle endocytosis (GO:0048488)	clathrin-coated endocytic vesicle membrane (GO:0030669)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)			NS(1)|breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(11)|skin(3)|upper_aerodigestive_tract(1)	26				GBM - Glioblastoma multiforme(50;2.71e-10)|Lung(42;0.203)		ATGATGACTTCAAAGAGATGG	0.398																																																	0													132.0	114.0	120.0					9																	17747117		2203	4300	6503	SO:0001819	synonymous_variant	0			X99657	CCDS6483.1	9p22	2008-02-05			ENSG00000107295	ENSG00000107295			10831	protein-coding gene	gene with protein product		604465				9169142	Standard	XM_005251549		Approved	SH3P4, SH3D2A, CNSA2, EEN-B1	uc003zna.3	Q99962	OTTHUMG00000019601	ENST00000380607.4:c.99C>T	9.37:g.17747117C>T			B2R618|Q9NQK5	Silent	SNP	pfam_BAR_dom,pfam_SH3_2,pfam_SH3_domain,pfam_BAR_dom-cont,superfamily_SH3_domain,smart_BAR_dom,smart_SH3_domain,pfscan_BAR_dom,pfscan_SH3_domain,prints_SH3_domain,prints_Spectrin_alpha_SH3	p.F33	ENST00000380607.4	37	c.99	CCDS6483.1	9																																																																																			SH3GL2	-	pfam_BAR_dom,smart_BAR_dom,pfscan_BAR_dom	ENSG00000107295		0.398	SH3GL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3GL2	HGNC	protein_coding	OTTHUMT00000051796.1	-	0.00	93	0	C	NM_003026		17747117	+1	tier1	-	no_errors	ENST00000380607	ensembl	human	known	74_37	silent	36.61	71	41	SNP	1.000	T
SH3RF1	57630	genome.wustl.edu	37	4	170057668	170057668	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr4:170057668G>T	ENST00000284637.9	-	5	1210	c.869C>A	c.(868-870)cCa>cAa	p.P290Q	SH3RF1_ENST00000508685.1_5'UTR	NM_020870.3	NP_065921.2	Q7Z6J0	SH3R1_HUMAN	SH3 domain containing ring finger 1	290					negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|protein ubiquitination (GO:0016567)|regulation of JNK cascade (GO:0046328)	cell projection (GO:0042995)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31		Prostate(90;0.00267)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)		GGAGTGCTTTGGGGCAGTGCT	0.562																																																	0													180.0	162.0	168.0					4																	170057668		2203	4300	6503	SO:0001583	missense	0			BC033203	CCDS34099.1	4q32.3	2013-01-09	2006-02-13	2006-02-13	ENSG00000154447	ENSG00000154447		"""RING-type (C3HC4) zinc fingers"""	17650	protein-coding gene	gene with protein product	"""plenty of SH3 domains"""		"""SH3 multiple domains 2"""	SH3MD2		9482736	Standard	NM_020870		Approved	POSH, RNF142, KIAA1494	uc003isa.1	Q7Z6J0	OTTHUMG00000161010	ENST00000284637.9:c.869C>A	4.37:g.170057668G>T	ENSP00000284637:p.Pro290Gln		Q05BT2|Q8IW46|Q9HAM2|Q9P234	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Znf_C3HC4_RING-type,superfamily_SH3_domain,smart_Znf_RING,smart_SH3_domain,pfscan_SH3_domain,pfscan_Znf_RING,prints_p67phox,prints_SH3_domain	p.P290Q	ENST00000284637.9	37	c.869	CCDS34099.1	4	.	.	.	.	.	.	.	.	.	.	G	2.524	-0.310067	0.05458	.	.	ENSG00000154447	ENST00000284637	T	0.04502	3.61	5.48	4.58	0.56647	.	0.481847	0.24547	N	0.037594	T	0.01558	0.0050	N	0.00656	-1.285	0.28473	N	0.915347	B	0.02656	0.0	B	0.04013	0.001	T	0.42932	-0.9422	10	0.10902	T	0.67	-3.4117	11.9822	0.53125	0.0:0.0:0.6687:0.3313	.	290	Q7Z6J0	SH3R1_HUMAN	Q	290	ENSP00000284637:P290Q	ENSP00000284637:P290Q	P	-	2	0	SH3RF1	170294243	1.000000	0.71417	0.995000	0.50966	0.127000	0.20565	5.336000	0.65935	2.743000	0.94032	0.655000	0.94253	CCA	SH3RF1	-	NULL	ENSG00000154447		0.562	SH3RF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3RF1	HGNC	protein_coding	OTTHUMT00000363382.3	-	0.00	48	0	G	NM_020870		170057668	-1	tier1	-	no_errors	ENST00000284637	ensembl	human	known	74_37	missense	5.97	63	4	SNP	0.999	T
SHANK2	22941	genome.wustl.edu	37	11	70666754	70666754	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr11:70666754C>T	ENST00000423696.2	-	2	107	c.71G>A	c.(70-72)cGc>cAc	p.R24H	SHANK2_ENST00000338508.4_Missense_Mutation_p.R404H|SHANK2_ENST00000468619.1_5'UTR			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	24					adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			CCGCCGCCGGCGGTTGGAGTA	0.697																																																	0																																										SO:0001583	missense	0			AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.71G>A	11.37:g.70666754C>T	ENSP00000394536:p.Arg24His		C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,pfam_SH3_2,pfam_PDZ,pfam_SH3_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_PDZ,superfamily_SAM/pointed,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,smart_PDZ,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PDZ,pfscan_SAM,pfscan_SH3_domain	p.R404H	ENST00000423696.2	37	c.1211		11	.	.	.	.	.	.	.	.	.	.	C	14.60	2.582499	0.46006	.	.	ENSG00000162105	ENST00000338508;ENST00000423696;ENST00000433693;ENST00000294018;ENST00000425049	T;T;T	0.45276	0.9;2.04;1.95	4.38	3.47	0.39725	.	0.000000	0.50627	U	0.000116	T	0.58308	0.2113	L	0.60455	1.87	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.59484	-0.7446	10	0.56958	D	0.05	.	12.281	0.54762	0.0:0.9167:0.0:0.0833	.	403	Q9UPX8-3	.	H	404;24;33;34;50	ENSP00000345193:R404H;ENSP00000394536:R24H;ENSP00000294018:R34H	ENSP00000294018:R34H	R	-	2	0	SHANK2	70344402	1.000000	0.71417	0.998000	0.56505	0.923000	0.55619	4.183000	0.58317	0.961000	0.38030	0.462000	0.41574	CGC	SHANK2	-	NULL	ENSG00000162105		0.697	SHANK2-203	KNOWN	basic	protein_coding	SHANK2	HGNC	protein_coding			0.00	21	0	C	NM_012309		70666754	-1			no_errors	ENST00000338508	ensembl	human	known	74_37	missense	25.00	12	4	SNP	0.999	T
SHANK3	85358	genome.wustl.edu	37	22	51159738	51159738	+	Silent	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr22:51159738G>A	ENST00000414786.2	+	21	3662	c.3435G>A	c.(3433-3435)ccG>ccA	p.P1145P	SHANK3_ENST00000445220.2_Silent_p.P1161P|SHANK3_ENST00000262795.3_Silent_p.P1175P			Q9BYB0	SHAN3_HUMAN	SH3 and multiple ankyrin repeat domains 3	1159					adult behavior (GO:0030534)|alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|brain morphogenesis (GO:0048854)|dendritic spine morphogenesis (GO:0060997)|guanylate kinase-associated protein clustering (GO:0097117)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell volume (GO:0045794)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glutamate receptor signaling pathway (GO:1900451)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse structural plasticity (GO:0051835)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density assembly (GO:0097107)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of long term synaptic depression (GO:1900452)|regulation of long-term synaptic potentiation (GO:1900271)|social behavior (GO:0035176)|striatal medium spiny neuron differentiation (GO:0021773)|synapse assembly (GO:0007416)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|neuron spine (GO:0044309)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(5)	8		all_cancers(38;3.75e-11)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.22)		TGGCTTCCCCGGCTTTCTCCC	0.687																																																	0													23.0	28.0	26.0					22																	51159738		1903	4099	6002	SO:0001819	synonymous_variant	0			AB051437		22q13.3	2013-11-14			ENSG00000251322	ENSG00000251322		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14294	protein-coding gene	gene with protein product	"""proline rich synapse associated protein 2"", ""shank postsynaptic density protein"""	606230				11258795, 11431708, 10806096, 17173049	Standard	NM_033517		Approved	SPANK-2, prosap2, KIAA1650, PSAP2	uc031ryd.1	Q9BYB0	OTTHUMG00000150169	ENST00000414786.2:c.3435G>A	22.37:g.51159738G>A			D7UT47|Q8TET3	Silent	SNP	pfam_SAM_type1,pfam_Ankyrin_rpt,pfam_SAM_2,pfam_SH3_2,pfam_PDZ,superfamily_Ankyrin_rpt-contain_dom,superfamily_PDZ,superfamily_SAM/pointed,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,smart_PDZ,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PDZ,pfscan_SAM,pfscan_SH3_domain	p.P1175	ENST00000414786.2	37	c.3525		22																																																																																			SHANK3	-	NULL	ENSG00000251322		0.687	SHANK3-001	KNOWN	non_canonical_polymorphism|basic|appris_candidate	protein_coding	SHANK3	HGNC	protein_coding	OTTHUMT00000316674.2	-	0.00	88	0	G	NM_001080420		51159738	+1	tier1	-	no_errors	ENST00000262795	ensembl	human	known	74_37	silent	36.08	62	35	SNP	0.975	A
SIK1	150094	genome.wustl.edu	37	21	44837639	44837639	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr21:44837639C>T	ENST00000270162.6	-	13	1892	c.1760G>A	c.(1759-1761)cGg>cAg	p.R587Q		NM_173354.3	NP_775490.2	P57059	SIK1_HUMAN	salt-inducible kinase 1	587	RK-rich region. {ECO:0000250}.				cardiac muscle cell differentiation (GO:0055007)|cell cycle (GO:0007049)|entrainment of circadian clock by photoperiod (GO:0043153)|intracellular signal transduction (GO:0035556)|negative regulation of CREB transcription factor activity (GO:0032792)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of triglyceride biosynthetic process (GO:0010868)|positive regulation of anoikis (GO:2000210)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell differentiation (GO:0045595)|regulation of mitotic cell cycle (GO:0007346)|regulation of myotube differentiation (GO:0010830)|regulation of sodium ion transport (GO:0002028)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|cAMP response element binding protein binding (GO:0008140)|magnesium ion binding (GO:0000287)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(2)|testis(2)|urinary_tract(1)	21					Dabrafenib(DB08912)	CAGCTGCTGCCGAAAGGCCTT	0.637																																																	0													28.0	21.0	23.0					21																	44837639		2192	4290	6482	SO:0001583	missense	0			BC038504	CCDS33575.1	21q22.3	2008-12-23	2008-12-23	2008-12-23	ENSG00000142178	ENSG00000142178			11142	protein-coding gene	gene with protein product	"""myocardial SNF1-like kinase"""	605705	"""SNF1-like kinase"""	SNF1LK		7893599	Standard	NM_173354		Approved	msk	uc002zdf.2	P57059	OTTHUMG00000086874	ENST00000270162.6:c.1760G>A	21.37:g.44837639C>T	ENSP00000270162:p.Arg587Gln		A6NC84|Q5R2V5|Q6ZNL8|Q86YJ2	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ser/Thr_kinase_SIK1/2,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R587Q	ENST00000270162.6	37	c.1760	CCDS33575.1	21	.	.	.	.	.	.	.	.	.	.	C	26.4	4.737596	0.89573	.	.	ENSG00000142178	ENST00000270162	D	0.86097	-2.07	4.05	4.05	0.47172	.	0.000000	0.85682	D	0.000000	D	0.88288	0.6396	M	0.79475	2.455	0.53005	D	0.999961	D	0.63880	0.993	P	0.50136	0.632	D	0.90412	0.4410	10	0.72032	D	0.01	.	14.7637	0.69623	0.0:1.0:0.0:0.0	.	587	P57059	SIK1_HUMAN	Q	587	ENSP00000270162:R587Q	ENSP00000270162:R587Q	R	-	2	0	SIK1	43662067	1.000000	0.71417	0.998000	0.56505	0.735000	0.41995	6.633000	0.74286	1.973000	0.57446	0.561000	0.74099	CGG	SIK1	-	pirsf_Ser/Thr_kinase_SIK1/2	ENSG00000142178		0.637	SIK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIK1	HGNC	protein_coding	OTTHUMT00000195654.1	-	0.00	187	0	C	NM_173354		44837639	-1	tier1	-	no_errors	ENST00000270162	ensembl	human	known	74_37	missense	37.07	73	43	SNP	1.000	T
SIRT1	23411	genome.wustl.edu	37	10	69666016	69666016	+	Intron	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr10:69666016G>T	ENST00000212015.6	+	5	995				SIRT1_ENST00000406900.1_Missense_Mutation_p.C2F|SIRT1_ENST00000403579.1_Missense_Mutation_p.C2F|SIRT1_ENST00000432464.1_Intron	NM_012238.4	NP_036370.2	Q96EB6	SIR1_HUMAN	sirtuin 1						angiogenesis (GO:0001525)|cell aging (GO:0007569)|cellular glucose homeostasis (GO:0001678)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to starvation (GO:0009267)|cellular response to tumor necrosis factor (GO:0071356)|cellular triglyceride homeostasis (GO:0035356)|cholesterol homeostasis (GO:0042632)|chromatin organization (GO:0006325)|chromatin silencing (GO:0006342)|chromatin silencing at rDNA (GO:0000183)|circadian regulation of gene expression (GO:0032922)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|establishment of chromatin silencing (GO:0006343)|fatty acid homeostasis (GO:0055089)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of chromatin silencing (GO:0006344)|methylation-dependent chromatin silencing (GO:0006346)|muscle organ development (GO:0007517)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|negative regulation of cell growth (GO:0030308)|negative regulation of cellular response to testosterone stimulus (GO:2000655)|negative regulation of cellular senescence (GO:2000773)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of helicase activity (GO:0051097)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of neuron death (GO:1901215)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of peptidyl-lysine acetylation (GO:2000757)|negative regulation of phosphorylation (GO:0042326)|negative regulation of prostaglandin biosynthetic process (GO:0031393)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|ovulation from ovarian follicle (GO:0001542)|peptidyl-lysine acetylation (GO:0018394)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular senescence (GO:2000774)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of chromatin silencing (GO:0031937)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA repair (GO:0045739)|positive regulation of histone H3-K9 methylation (GO:0051574)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of macroautophagy (GO:0016239)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein deacetylation (GO:0006476)|protein destabilization (GO:0031648)|protein ubiquitination (GO:0016567)|pyrimidine dimer repair by nucleotide-excision repair (GO:0000720)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cell proliferation (GO:0042127)|regulation of endodeoxyribonuclease activity (GO:0032071)|regulation of glucose metabolic process (GO:0010906)|regulation of mitotic cell cycle (GO:0007346)|regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035358)|regulation of protein import into nucleus, translocation (GO:0033158)|regulation of smooth muscle cell apoptotic process (GO:0034391)|response to hydrogen peroxide (GO:0042542)|response to insulin (GO:0032868)|response to oxidative stress (GO:0006979)|rRNA processing (GO:0006364)|single strand break repair (GO:0000012)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)|triglyceride mobilization (GO:0006642)|viral process (GO:0016032)|white fat cell differentiation (GO:0050872)	chromatin silencing complex (GO:0005677)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear envelope (GO:0005635)|nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|rDNA heterochromatin (GO:0033553)	bHLH transcription factor binding (GO:0043425)|deacetylase activity (GO:0019213)|enzyme binding (GO:0019899)|histone binding (GO:0042393)|histone deacetylase activity (GO:0004407)|HLH domain binding (GO:0043398)|identical protein binding (GO:0042802)|keratin filament binding (GO:1990254)|metal ion binding (GO:0046872)|mitogen-activated protein kinase binding (GO:0051019)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (GO:0017136)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent protein deacetylase activity (GO:0034979)|p53 binding (GO:0002039)|protein C-terminus binding (GO:0008022)|protein deacetylase activity (GO:0033558)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(3)|skin(1)	14						ACCAGTATGTGCCTGTGCAGT	0.343																																																	0													18.0	16.0	17.0					10																	69666016		876	1991	2867	SO:0001627	intron_variant	0			AF083106	CCDS7273.1, CCDS44412.1	10q21	2010-06-25	2010-06-25		ENSG00000096717	ENSG00000096717			14929	protein-coding gene	gene with protein product		604479	"""sirtuin (silent mating type information regulation 2, S. cerevisiae, homolog) 1"", ""sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae)"""			10381378	Standard	NM_012238		Approved	SIR2L1	uc001jnd.3	Q96EB6	OTTHUMG00000018340	ENST00000212015.6:c.943-531G>T	10.37:g.69666016G>T			Q2XNF6|Q5JVQ0|Q9GZR9|Q9Y6F0	Missense_Mutation	SNP	pfam_Sirtuin,pfscan_Ssirtuin_cat_dom	p.C2F	ENST00000212015.6	37	c.5	CCDS7273.1	10	.	.	.	.	.	.	.	.	.	.	G	13.39	2.223795	0.39300	.	.	ENSG00000096717	ENST00000406900;ENST00000403579	T;T	0.23950	1.88;1.88	3.85	3.85	0.44370	.	.	.	.	.	T	0.22589	0.0545	.	.	.	0.80722	D	1	P	0.42039	0.769	B	0.37387	0.248	T	0.07947	-1.0746	8	0.87932	D	0	.	11.4911	0.50381	0.0:0.0:1.0:0.0	.	2	B0QZ35	.	F	2	ENSP00000384508:C2F;ENSP00000384063:C2F	ENSP00000384063:C2F	C	+	2	0	SIRT1	69336022	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.956000	0.56722	2.172000	0.68678	0.467000	0.42956	TGC	SIRT1	-	pfscan_Ssirtuin_cat_dom	ENSG00000096717		0.343	SIRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRT1	HGNC	protein_coding	OTTHUMT00000048296.1	-	0.00	59	0	G			69666016	+1	tier1	-	no_errors	ENST00000403579	ensembl	human	novel	74_37	missense	5.88	64	4	SNP	1.000	T
SLC22A12	116085	genome.wustl.edu	37	11	64359294	64359294	+	Missense_Mutation	SNP	G	G	T	rs201567912		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr11:64359294G>T	ENST00000377574.1	+	1	1013	c.266G>T	c.(265-267)cGc>cTc	p.R89L	SLC22A12_ENST00000473690.1_5'UTR|SLC22A12_ENST00000377572.1_Missense_Mutation_p.R89L|SLC22A12_ENST00000336464.7_Missense_Mutation_p.R89L|SLC22A12_ENST00000377567.2_Missense_Mutation_p.R89L	NM_144585.2	NP_653186.2	Q96S37	S22AC_HUMAN	solute carrier family 22 (organic anion/urate transporter), member 12	89					cellular homeostasis (GO:0019725)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)|urate transport (GO:0015747)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|urate transmembrane transporter activity (GO:0015143)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27					Losartan(DB00678)|Probenecid(DB01032)	CACCAGTGCCGCCGCTTCCGC	0.667																																																	0													23.0	27.0	26.0					11																	64359294		2196	4294	6490	SO:0001583	missense	0			AB071863	CCDS8075.1, CCDS60835.1, CCDS60836.1	11q13.1	2013-05-22	2008-01-11		ENSG00000197891	ENSG00000197891		"""Solute carriers"""	17989	protein-coding gene	gene with protein product		607096	"""solute carrier family 22 (organic anion/cation transporter), member 12"""			12024214	Standard	NM_144585		Approved	OAT4L, RST, URAT1	uc009yps.2	Q96S37	OTTHUMG00000045213	ENST00000377574.1:c.266G>T	11.37:g.64359294G>T	ENSP00000366797:p.Arg89Leu		B7WPG1|G3XAN7|Q19PF7|Q19PF8|Q19PF9|Q19PG0|Q6UXW3|Q96DT2	Missense_Mutation	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.R89L	ENST00000377574.1	37	c.266	CCDS8075.1	11	.	.	.	.	.	.	.	.	.	.	G	9.688	1.151104	0.21371	.	.	ENSG00000197891	ENST00000377567;ENST00000377574;ENST00000377572;ENST00000336464	T;T;T;T	0.11169	2.8;2.8;2.8;2.8	4.4	-3.38	0.04883	.	0.452831	0.22567	N	0.058382	T	0.04543	0.0124	N	0.13198	0.31	0.21105	N	0.999784	B;B;P;B	0.35383	0.078;0.078;0.498;0.078	B;B;B;B	0.36608	0.028;0.028;0.229;0.028	T	0.43734	-0.9373	10	0.10111	T	0.7	.	8.6014	0.33747	0.0809:0.0:0.2911:0.628	.	89;89;89;89	B5ME56;B3KV05;Q96S37-2;Q96S37	.;.;.;S22AC_HUMAN	L	89	ENSP00000366790:R89L;ENSP00000366797:R89L;ENSP00000366795:R89L;ENSP00000336836:R89L	ENSP00000336836:R89L	R	+	2	0	SLC22A12	64115870	0.000000	0.05858	0.089000	0.20774	0.132000	0.20833	-0.585000	0.05794	-0.818000	0.04329	0.484000	0.47621	CGC	SLC22A12	-	NULL	ENSG00000197891		0.667	SLC22A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A12	HGNC	protein_coding	OTTHUMT00000104966.2		0.00	99	0	G	NM_144585		64359294	+1			no_errors	ENST00000377574	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.779	T
SLC22A4	6583	genome.wustl.edu	37	5	131663064	131663064	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr5:131663064G>T	ENST00000200652.3	+	5	1093	c.919G>T	c.(919-921)Gct>Tct	p.A307S	AC034220.3_ENST00000417795.1_RNA	NM_003059.2	NP_003050.2	Q9H015	S22A4_HUMAN	solute carrier family 22 (organic cation/zwitterion transporter), member 4	307					body fluid secretion (GO:0007589)|carnitine metabolic process (GO:0009437)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cation transmembrane transport (GO:0098655)|organic cation transport (GO:0015695)|quaternary ammonium group transport (GO:0015697)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|triglyceride metabolic process (GO:0006641)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|carnitine transmembrane transporter activity (GO:0015226)|cation:cation antiporter activity (GO:0015491)|nucleotide binding (GO:0000166)|PDZ domain binding (GO:0030165)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|secondary active organic cation transmembrane transporter activity (GO:0008513)|symporter activity (GO:0015293)			endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|urinary_tract(1)	16		all_cancers(142;0.0752)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Amiloride(DB00594)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Choline(DB00122)|Cimetidine(DB00501)|Clonidine(DB00575)|Desipramine(DB01151)|Guanidine(DB00536)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|L-Arginine(DB00125)|L-Carnitine(DB00583)|L-Lysine(DB00123)|Levofloxacin(DB01137)|Mepyramine(DB06691)|Nicotine(DB00184)|Ofloxacin(DB01165)|Procainamide(DB01035)|Quinidine(DB00908)|Quinine(DB00468)|Spermine(DB00127)|Testosterone(DB00624)|Tiotropium(DB01409)|Verapamil(DB00661)	GAACAACATAGCTGTACCAGC	0.378																																																	0													78.0	78.0	78.0					5																	131663064		2203	4300	6503	SO:0001583	missense	0			AB007448	CCDS4153.1	5q23.3	2013-07-18	2013-07-18		ENSG00000197208	ENSG00000197208		"""Solute carriers"""	10968	protein-coding gene	gene with protein product		604190	"""solute carrier family 22 (organic cation/ergothioneine transporter), member 4"""			9426230, 15795384	Standard	NM_003059		Approved	OCTN1, MGC34546	uc003kwq.3	Q9H015	OTTHUMG00000059648	ENST00000200652.3:c.919G>T	5.37:g.131663064G>T	ENSP00000200652:p.Ala307Ser		O14546	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	p.A307S	ENST00000200652.3	37	c.919	CCDS4153.1	5	.	.	.	.	.	.	.	.	.	.	G	8.346	0.829775	0.16749	.	.	ENSG00000197208	ENST00000200652	T	0.73152	-0.72	5.85	-6.21	0.02065	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	1.046210	0.07454	N	0.899478	T	0.35451	0.0932	N	0.02973	-0.45	0.09310	N	1	B	0.10296	0.003	B	0.13407	0.009	T	0.26087	-1.0113	10	0.11794	T	0.64	.	4.2944	0.10894	0.3239:0.37:0.2291:0.0771	.	307	Q9H015	S22A4_HUMAN	S	307	ENSP00000200652:A307S	ENSP00000200652:A307S	A	+	1	0	SLC22A4	131690963	0.000000	0.05858	0.000000	0.03702	0.238000	0.25445	-0.676000	0.05221	-1.241000	0.02526	0.655000	0.94253	GCT	SLC22A4	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	ENSG00000197208		0.378	SLC22A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A4	HGNC	protein_coding	OTTHUMT00000132661.1	-	0.00	58	0	G	NM_003059		131663064	+1	tier1	-	no_errors	ENST00000200652	ensembl	human	known	74_37	missense	5.00	76	4	SNP	0.000	T
SLC9A3	6550	genome.wustl.edu	37	5	475247	475247	+	Splice_Site	SNP	C	C	A	rs189017275		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr5:475247C>A	ENST00000264938.3	-	16	2261	c.2252G>T	c.(2251-2253)gGa>gTa	p.G751V	CTD-2228K2.7_ENST00000607005.1_RNA|SLC9A3_ENST00000514375.1_Splice_Site_p.G742V|CTD-2228K2.7_ENST00000606319.1_RNA|CTD-2228K2.5_ENST00000510604.1_5'Flank|CTD-2228K2.7_ENST00000607286.1_RNA|CTD-2228K2.5_ENST00000510714.1_5'Flank|CTD-2228K2.7_ENST00000606288.1_RNA|CTD-2228K2.5_ENST00000342584.3_5'Flank	NM_004174.2	NP_004165.2	P48764	SL9A3_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3	751					ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|sodium:proton antiporter activity (GO:0015385)			NS(2)|biliary_tract(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(16)|prostate(3)|skin(2)|urinary_tract(1)	37			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			GTTGTCAATTCCTAGGAGAGA	0.682																																																	0													33.0	42.0	39.0					5																	475247		2203	4299	6502	SO:0001630	splice_region_variant	0				CCDS3855.1, CCDS64116.1	5p15.3	2013-05-22	2012-03-22		ENSG00000066230	ENSG00000066230		"""Solute carriers"""	11073	protein-coding gene	gene with protein product		182307	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3"""	NHE3		8096830	Standard	NM_004174		Approved		uc003jbe.2	P48764	OTTHUMG00000090315	ENST00000264938.3:c.2252-1G>T	5.37:g.475247C>A			B7ZKR2|E9PF67|Q3MIW3	Missense_Mutation	SNP	pfam_Cation/H_exchanger,superfamily_Reg_factor_effector_dom,prints_Na/H_exchanger_3/5,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.G751V	ENST00000264938.3	37	c.2252	CCDS3855.1	5	.	.	.	.	.	.	.	.	.	.	C	21.2	4.120658	0.77323	.	.	ENSG00000066230	ENST00000264938;ENST00000514375	T;T	0.73789	-0.78;-0.78	5.05	5.05	0.67936	.	1.760780	0.02682	N	0.109725	D	0.89005	0.6592	M	0.78637	2.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.75110	-0.3433	10	0.66056	D	0.02	.	16.1676	0.81782	0.0:1.0:0.0:0.0	.	742;751	E9PF67;P48764	.;SL9A3_HUMAN	V	751;742	ENSP00000264938:G751V;ENSP00000422983:G742V	ENSP00000264938:G751V	G	-	2	0	SLC9A3	528247	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	6.056000	0.71111	2.350000	0.79820	0.462000	0.41574	GGA	SLC9A3	-	NULL	ENSG00000066230		0.682	SLC9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A3	HGNC	protein_coding	OTTHUMT00000206677.2	-	0.00	24	0	C	NM_004174	Missense_Mutation	475247	-1	tier1	-	no_errors	ENST00000264938	ensembl	human	known	74_37	missense	16.00	21	4	SNP	1.000	A
SLC23A1	9963	genome.wustl.edu	37	5	138717693	138717693	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr5:138717693G>T	ENST00000348729.3	-	3	242	c.196C>A	c.(196-198)Ctg>Atg	p.L66M	SLC23A1_ENST00000353963.3_Missense_Mutation_p.L66M|SLC23A1_ENST00000503919.1_5'UTR	NM_005847.4	NP_005838	Q9UHI7	S23A1_HUMAN	solute carrier family 23 (ascorbic acid transporter), member 1	66					brain development (GO:0007420)|dehydroascorbic acid transport (GO:0070837)|L-ascorbic acid metabolic process (GO:0019852)|L-ascorbic acid transport (GO:0015882)|lung development (GO:0030324)|nucleobase transport (GO:0015851)|nucleobase-containing compound metabolic process (GO:0006139)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transepithelial L-ascorbic acid transport (GO:0070904)|vitamin metabolic process (GO:0006766)|vitamin transmembrane transport (GO:0035461)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|brush border (GO:0005903)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular organelle (GO:0043229)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dehydroascorbic acid transporter activity (GO:0033300)|L-ascorbate:sodium symporter activity (GO:0008520)|L-ascorbic acid transporter activity (GO:0015229)|nucleobase transmembrane transporter activity (GO:0015205)|sodium ion transmembrane transporter activity (GO:0015081)|sodium-dependent L-ascorbate transmembrane transporter activity (GO:0070890)			biliary_tract(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(5)|ovary(1)	19			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		Vitamin C(DB00126)	GCCTCAGCCAGCAGGAAGGGC	0.612																																																	0													89.0	64.0	73.0					5																	138717693		2203	4300	6503	SO:0001583	missense	0			AF058317	CCDS4212.1, CCDS4213.1	5q31.2	2013-07-18	2013-07-18	2003-03-21	ENSG00000170482	ENSG00000170482		"""Solute carriers"""	10974	protein-coding gene	gene with protein product		603790	"""solute carrier family 23 (nucleobase transporters), member 2"""	SLC23A2		9804989, 10331392	Standard	NM_005847		Approved	YSPL3, SVCT1	uc003leg.3	Q9UHI7	OTTHUMG00000129228	ENST00000348729.3:c.196C>A	5.37:g.138717693G>T	ENSP00000302701:p.Leu66Met		O95191|Q8WWB6|Q9UGH4|Q9UI39	Missense_Mutation	SNP	pfam_Xant/urac/vitC	p.L66M	ENST00000348729.3	37	c.196	CCDS4212.1	5	.	.	.	.	.	.	.	.	.	.	G	19.41	3.821963	0.71028	.	.	ENSG00000170482	ENST00000353963;ENST00000348729;ENST00000339881;ENST00000453898;ENST00000508270	T;T;T	0.19394	2.15;2.15;2.15	4.82	2.1	0.27182	.	0.079486	0.53938	D	0.000058	T	0.47229	0.1434	M	0.87038	2.855	0.58432	D	0.999992	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.45483	-0.9258	10	0.66056	D	0.02	-9.507	9.5598	0.39362	0.2251:0.0:0.7749:0.0	.	66;66	Q9UHI7;Q9UHI7-2	S23A1_HUMAN;.	M	66;66;66;66;140	ENSP00000302851:L66M;ENSP00000302701:L66M;ENSP00000427271:L140M	ENSP00000343584:L66M	L	-	1	2	SLC23A1	138745592	1.000000	0.71417	0.996000	0.52242	0.980000	0.70556	3.969000	0.56816	0.257000	0.21650	0.448000	0.29417	CTG	SLC23A1	-	pfam_Xant/urac/vitC	ENSG00000170482		0.612	SLC23A1-001	KNOWN	basic|CCDS	protein_coding	SLC23A1	HGNC	protein_coding	OTTHUMT00000374185.1		0.00	59	0	G	NM_152685		138717693	-1			no_errors	ENST00000353963	ensembl	human	known	74_37	missense	5.45	52	3	SNP	1.000	T
SLC9A4	389015	genome.wustl.edu	37	2	103121712	103121712	+	Splice_Site	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr2:103121712G>T	ENST00000295269.4	+	4	1437		c.e4-1			NM_001011552.3	NP_001011552.2	Q6AI14	SL9A4_HUMAN	solute carrier family 9, subfamily A (NHE4, cation proton antiporter 4), member 4						epithelial cell development (GO:0002064)|gastric acid secretion (GO:0001696)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						TCCTTTTATAGAATCACAGCC	0.483																																																	0													69.0	63.0	65.0					2																	103121712		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS33264.1	2q12.1	2013-05-22	2012-03-22		ENSG00000180251	ENSG00000180251		"""Solute carriers"""	11077	protein-coding gene	gene with protein product		600531	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 4"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 4"""			8199403	Standard	NM_001011552		Approved	NHE4	uc002tbz.4	Q6AI14	OTTHUMG00000153093	ENST00000295269.4:c.981-1G>T	2.37:g.103121712G>T			Q69YK0	Splice_Site	SNP	-	e4-1	ENST00000295269.4	37	c.981-1	CCDS33264.1	2	.	.	.	.	.	.	.	.	.	.	G	17.54	3.414617	0.62511	.	.	ENSG00000180251	ENST00000295269	.	.	.	5.39	5.39	0.77823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.4595	0.61219	0.0:0.0:0.8435:0.1565	.	.	.	.	.	-1	.	.	.	+	.	.	SLC9A4	102488144	1.000000	0.71417	0.968000	0.41197	0.812000	0.45895	7.858000	0.86971	2.692000	0.91855	0.491000	0.48974	.	SLC9A4	-	-	ENSG00000180251		0.483	SLC9A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A4	HGNC	protein_coding	OTTHUMT00000329498.1		0.00	22	0	G	NM_001011552.3	Intron	103121712	+1			no_errors	ENST00000295269	ensembl	human	known	74_37	splice_site	5.88	32	2	SNP	0.999	T
SLCO1B3	28234	genome.wustl.edu	37	12	21014003	21014003	+	Missense_Mutation	SNP	A	A	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr12:21014003A>C	ENST00000381545.3	+	6	631	c.412A>C	c.(412-414)Agt>Cgt	p.S138R	SLCO1B3_ENST00000261196.2_Missense_Mutation_p.S138R|SLCO1B7_ENST00000554957.1_Intron|SLCO1B3_ENST00000553473.1_Missense_Mutation_p.S138R|LST3_ENST00000381541.3_Intron|LST3_ENST00000540229.1_Missense_Mutation_p.S138R	NM_019844.3	NP_062818.1	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family, member 1B3	138					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(23)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(2)	63	Esophageal squamous(101;0.149)				Atorvastatin(DB01076)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Digoxin(DB00390)|Docetaxel(DB01248)|Estradiol(DB00783)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Olmesartan(DB00275)|Ouabain(DB01092)|Paclitaxel(DB01229)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Rosuvastatin(DB01098)|Valsartan(DB00177)	TTCAACATCAAGTTTATCAAC	0.279																																																	0													54.0	52.0	53.0					12																	21014003		2197	4284	6481	SO:0001583	missense	0				CCDS8684.1	12p12	2013-05-22	2003-11-25	2003-11-26		ENSG00000111700		"""Solute carriers"""	10961	protein-coding gene	gene with protein product		605495	"""solute carrier family 21 (organic anion transporter), member 8"""	SLC21A8			Standard	NM_019844		Approved	OATP8, OATP1B3	uc001rel.4	Q9NPD5	OTTHUMG00000169011	ENST00000381545.3:c.412A>C	12.37:g.21014003A>C	ENSP00000370956:p.Ser138Arg		E7EMT8|Q5JAR4	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.S138R	ENST00000381545.3	37	c.412	CCDS8684.1	12	.	.	.	.	.	.	.	.	.	.	A	13.24	2.176805	0.38413	.	.	ENSG00000111700;ENSG00000111700;ENSG00000111700;ENSG00000111700;ENSG00000257046	ENST00000540853;ENST00000261196;ENST00000381545;ENST00000553473;ENST00000540229	T;T;T;T;T	0.39229	1.09;1.09;1.09;1.09;1.09	2.88	0.325	0.15903	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.990483	0.08229	N	0.977823	T	0.35566	0.0936	L	0.46947	1.48	0.09310	N	1	P;B	0.39480	0.675;0.389	B;B	0.43123	0.409;0.213	T	0.33497	-0.9866	10	0.30854	T	0.27	.	3.8203	0.08833	0.6411:0.2219:0.1371:0.0	.	138;138	Q5JAR4;Q9NPD5	.;SO1B3_HUMAN	R	138	ENSP00000442000:S138R;ENSP00000261196:S138R;ENSP00000370956:S138R;ENSP00000451758:S138R;ENSP00000441269:S138R	ENSP00000441269:S138R	S	+	1	0	SLCO1B3;RP11-545J16.1	20905270	0.887000	0.30362	0.024000	0.17045	0.646000	0.38490	2.064000	0.41432	1.192000	0.43071	0.383000	0.25322	AGT	SLCO1B3	-	pfam_OA_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000111700		0.279	SLCO1B3-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	SLCO1B3	HGNC	protein_coding	OTTHUMT00000401936.1	-	0.00	108	0	A	NM_019844		21014003	+1	tier1	-	no_errors	ENST00000553473	ensembl	human	known	74_37	missense	29.09	117	48	SNP	0.001	C
SLITRK5	26050	genome.wustl.edu	37	13	88329844	88329844	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr13:88329844G>A	ENST00000325089.6	+	2	2420	c.2201G>A	c.(2200-2202)cGc>cAc	p.R734H	SLITRK5_ENST00000400028.3_Missense_Mutation_p.R493H	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	734					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					GTGCATCACCGCGGGCCCGCG	0.657																																																	0													40.0	44.0	43.0					13																	88329844		2198	4291	6489	SO:0001583	missense	0			AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.2201G>A	13.37:g.88329844G>A	ENSP00000366283:p.Arg734His		B3KNB8|B4DSH5|Q5VT81	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.R734H	ENST00000325089.6	37	c.2201	CCDS9465.1	13	.	.	.	.	.	.	.	.	.	.	G	16.42	3.118532	0.56505	.	.	ENSG00000165300	ENST00000325089;ENST00000400028	T;T	0.58358	0.34;0.68	4.71	4.71	0.59529	.	0.198849	0.40469	U	0.001097	T	0.35941	0.0949	N	0.19112	0.55	0.35520	D	0.801326	B;B	0.11235	0.004;0.0	B;B	0.04013	0.001;0.0	T	0.38972	-0.9636	9	.	.	.	-10.9319	13.1547	0.59509	0.0:0.0:1.0:0.0	.	493;734	B4DSH5;O94991	.;SLIK5_HUMAN	H	734;493	ENSP00000366283:R734H;ENSP00000442244:R493H	.	R	+	2	0	SLITRK5	87127845	0.978000	0.34361	1.000000	0.80357	0.682000	0.39822	-0.017000	0.12590	2.131000	0.65755	0.555000	0.69702	CGC	SLITRK5	-	NULL	ENSG00000165300		0.657	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK5	HGNC	protein_coding	OTTHUMT00000045416.3	-	0.00	41	0	G			88329844	+1	tier1	-	no_errors	ENST00000325089	ensembl	human	known	74_37	missense	26.19	31	11	SNP	1.000	A
SMARCC2	6601	genome.wustl.edu	37	12	56559127	56559128	+	Frame_Shift_Ins	INS	-	-	G			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr12:56559127_56559128insG	ENST00000267064.4	-	26	3199_3200	c.3113_3114insC	c.(3112-3114)ccafs	p.P1038fs	SMARCC2_ENST00000347471.4_Frame_Shift_Ins_p.P1069fs|SMARCC2_ENST00000550164.1_Frame_Shift_Ins_p.P1069fs|RP11-977G19.5_ENST00000553176.1_RNA|SMARCC2_ENST00000394023.3_Frame_Shift_Ins_p.P1069fs	NM_003075.3	NP_003066.2	Q8TAQ2	SMRC2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	1038	Pro-rich.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(18;0.123)			GGGGAACCCCTGGTGGGACTGC	0.584																																																	0																																										SO:0001589	frameshift_variant	0			U66616	CCDS8907.1, CCDS8908.1, CCDS55835.1	12q13.2	2008-05-14				ENSG00000139613			11105	protein-coding gene	gene with protein product		601734				8804307, 9693044	Standard	NM_001130420		Approved	BAF170, Rsc8, CRACC2	uc001skb.3	Q8TAQ2	OTTHUMG00000170288	ENST00000267064.4:c.3114dupC	12.37:g.56559129_56559129dupG	ENSP00000267064:p.Pro1038fs		F8VTJ5|Q59GV3|Q92923|Q96E12|Q96GY4	Frame_Shift_Ins	INS	pfam_SWIRM,pfam_SANT/Myb,superfamily_Homeodomain-like,superfamily_BRCT_dom,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_SANT/Myb,pfscan_SWIRM,pfscan_Myb-like_dom	p.G1039fs	ENST00000267064.4	37	c.3114_3113	CCDS8907.1	12																																																																																			SMARCC2	-	NULL	ENSG00000139613		0.584	SMARCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SMARCC2	HGNC	protein_coding	OTTHUMT00000408370.1		0.00	143	0	0			56559128	-1			no_errors	ENST00000267064	ensembl	human	known	74_37	frame_shift_ins	5.41	140	8	INS	1.000:1.000	G
SMOC2	64094	genome.wustl.edu	37	6	169053815	169053815	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr6:169053815G>A	ENST00000356284.2	+	11	1412	c.1192G>A	c.(1192-1194)Gtg>Atg	p.V398M	SMOC2_ENST00000354536.5_Missense_Mutation_p.V409M	NM_001166412.1	NP_001159884.1	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2	398	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)|signal transduction (GO:0007165)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.V409M(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	32		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		ATACTGTGACGTGAATAATGA	0.458																																																	1	Substitution - Missense(1)	lung(1)											124.0	117.0	119.0					6																	169053815		2203	4300	6503	SO:0001583	missense	0			AB014730	CCDS5307.1, CCDS55076.1	6q27	2013-01-10			ENSG00000112562	ENSG00000112562		"""EF-hand domain containing"""	20323	protein-coding gene	gene with protein product		607223				12031507	Standard	NM_022138		Approved	SMAP2	uc003qwr.2	Q9H3U7	OTTHUMG00000016050	ENST00000356284.2:c.1192G>A	6.37:g.169053815G>A	ENSP00000348630:p.Val398Met		B3KPS7|Q4G169|Q5TAT7|Q5TAT8|Q86VV9|Q96SF3|Q9H1L3|Q9H1L4|Q9H3U0|Q9H4F7|Q9HCV2	Missense_Mutation	SNP	pfam_Thyroglobulin_1,pfam_SPARC/Testican_Ca-bd-dom,pfam_Kazal_dom,superfamily_Thyroglobulin_1,smart_Kazal_dom,smart_Thyroglobulin_1,pfscan_EF_hand_dom,pfscan_Thyroglobulin_1	p.V409M	ENST00000356284.2	37	c.1225	CCDS55076.1	6	.	.	.	.	.	.	.	.	.	.	G	7.649	0.682463	0.14907	.	.	ENSG00000112562	ENST00000356284;ENST00000354536;ENST00000366793;ENST00000392101;ENST00000538593;ENST00000417208	T;T	0.36520	1.25;1.25	4.92	4.03	0.46877	SPARC/Testican, calcium-binding domain (1);EF-hand-like domain (1);	0.418347	0.24215	N	0.040490	T	0.11965	0.0291	L	0.43152	1.355	0.31740	N	0.635896	B;B	0.31318	0.319;0.076	B;B	0.26094	0.066;0.03	T	0.08953	-1.0697	10	0.34782	T	0.22	-4.0834	7.5074	0.27553	0.0909:0.1675:0.7417:0.0	.	398;409	Q9H3U7;Q9H3U7-2	SMOC2_HUMAN;.	M	398;409;398;75;75;18	ENSP00000348630:V398M;ENSP00000346537:V409M	ENSP00000346537:V409M	V	+	1	0	SMOC2	168795740	1.000000	0.71417	0.055000	0.19348	0.172000	0.22775	1.981000	0.40628	1.021000	0.39600	0.655000	0.94253	GTG	SMOC2	-	pfam_SPARC/Testican_Ca-bd-dom,pfscan_EF_hand_dom	ENSG00000112562		0.458	SMOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMOC2	HGNC	protein_coding	OTTHUMT00000043201.1	-	0.00	112	0	G			169053815	+1	tier1	-	no_errors	ENST00000354536	ensembl	human	known	74_37	missense	31.36	81	37	SNP	0.998	A
SNHG14	104472715	genome.wustl.edu	37	15	25287217	25287217	+	RNA	SNP	A	A	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr15:25287217A>C	ENST00000552781.1	+	0	328				SNORD109A_ENST00000459128.1_RNA																							AGGACAAATAAGACTCTCAGA	0.478																																																	0													36.0	34.0	35.0					15																	25287217		876	1991	2867			0																															15.37:g.25287217A>C				RNA	SNP	-	NULL	ENST00000552781.1	37	NULL		15																																																																																			SNORD109A	-	-	ENSG00000270246		0.478	RP11-701H24.10-001	KNOWN	basic|readthrough_transcript	processed_transcript	SNORD109A	HGNC	processed_transcript	OTTHUMT00000473258.1	-	0.00	47	0	A			25287217	+1	tier1	-	no_errors	ENST00000604135	ensembl	human	known	74_37	rna	40.30	40	27	SNP	0.020	C
SNHG14	104472715	genome.wustl.edu	37	15	25330419	25330419	+	RNA	SNP	T	T	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr15:25330419T>C	ENST00000546682.1	+	0	403				SNORD116-20_ENST00000384529.1_lincRNA|SNORD116-18_ENST00000383961.1_RNA|SNORD116-16_ENST00000384533.1_RNA|SNHG14_ENST00000553108.1_RNA|SNORD116-19_ENST00000384729.1_RNA|SNORD116-17_ENST00000383929.1_RNA|SNHG14_ENST00000549804.2_RNA	NR_003361.1				small nucleolar RNA host gene 14 (non-protein coding)																		AGGGAGTCCCTTGATATGTGT	0.517																																																	0																																												0					15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25330419T>C				RNA	SNP	-	NULL	ENST00000546682.1	37	NULL		15																																																																																			SNHG14	-	-	ENSG00000224078		0.517	SNHG14-022	KNOWN	basic	antisense	SNHG14	HGNC	processed_transcript	OTTHUMT00000408281.1	-	0.00	91	0	T			25330419	+1	tier1	-	no_errors	ENST00000546682	ensembl	human	known	74_37	rna	28.10	87	34	SNP	0.000	C
SNTG1	54212	genome.wustl.edu	37	8	51449339	51449339	+	Silent	SNP	T	T	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr8:51449339T>C	ENST00000522124.1	+	11	1312	c.651T>C	c.(649-651)tcT>tcC	p.S217S	SNTG1_ENST00000517473.1_Silent_p.S217S|SNTG1_ENST00000518864.1_Silent_p.S217S|SNTG1_ENST00000276467.5_Silent_p.S217S	NM_018967.2	NP_061840.1	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	217					cell communication (GO:0007154)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)|syntrophin complex (GO:0016013)	protein C-terminus binding (GO:0008022)			NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(36)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	66		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				CGCGCTTCTCTCAGTATGTGC	0.478																																																	0													207.0	184.0	192.0					8																	51449339		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ003030	CCDS6147.1, CCDS75737.1	8q11-q12	2008-07-03				ENSG00000147481			13740	protein-coding gene	gene with protein product		608714				10747910	Standard	NM_018967		Approved	SYN4, G1SYN	uc003xqs.1	Q9NSN8		ENST00000522124.1:c.651T>C	8.37:g.51449339T>C			Q2M3Q0|Q9NY98	Silent	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology	p.S217	ENST00000522124.1	37	c.651	CCDS6147.1	8																																																																																			SNTG1	-	smart_Pleckstrin_homology	ENSG00000147481		0.478	SNTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNTG1	HGNC	protein_coding	OTTHUMT00000377964.1	-	0.00	15	0	T			51449339	+1	tier1	-	no_errors	ENST00000518864	ensembl	human	known	74_37	silent	23.81	16	5	SNP	0.998	C
SNX6	58533	genome.wustl.edu	37	14	35032375	35032375	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr14:35032375G>T	ENST00000362031.4	-	14	1240	c.1210C>A	c.(1210-1212)Cta>Ata	p.L404I	SNX6_ENST00000355110.5_Missense_Mutation_p.L280I|RP11-671J11.4_ENST00000554608.1_RNA|RP11-671J11.4_ENST00000555361.1_RNA|SNX6_ENST00000396534.3_Missense_Mutation_p.L276I|SNX6_ENST00000396526.3_Missense_Mutation_p.L276I	NM_152233.2	NP_689419.2	Q9UNH7	SNX6_HUMAN	sorting nexin 6	392					intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|intracellular (GO:0005622)|nucleus (GO:0005634)	phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)			endometrium(4)|lung(1)|ovary(1)	6	Breast(36;0.0473)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00199)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.0245)		AGCAACTGTAGATTACCCTAA	0.343																																																	0													60.0	58.0	58.0					14																	35032375		2203	4300	6503	SO:0001583	missense	0			AF121856	CCDS9648.1, CCDS41942.1	14q13	2010-08-05			ENSG00000129515	ENSG00000129515		"""Sorting nexins"""	14970	protein-coding gene	gene with protein product		606098				11279102	Standard	XM_006720224		Approved		uc001wsf.1	Q9UNH7	OTTHUMG00000140213	ENST00000362031.4:c.1210C>A	14.37:g.35032375G>T	ENSP00000355217:p.Leu404Ile		C0H5W9|Q9Y449	Missense_Mutation	SNP	pfam_Phox,pfam_Vps5_C,pfam_BAR_dom,superfamily_Phox,pirsf_Snx5_Snx6,pfscan_Phox	p.L404I	ENST00000362031.4	37	c.1210	CCDS41942.1	14	.	.	.	.	.	.	.	.	.	.	G	5.549	0.286125	0.10513	.	.	ENSG00000129515	ENST00000396526;ENST00000396534;ENST00000362031;ENST00000355110	T;T;T;T	0.24151	1.87;1.87;1.87;1.87	4.37	3.46	0.39613	Vps5 C-terminal (1);	0.000000	0.64402	D	0.000001	T	0.20536	0.0494	N	0.10874	0.06	0.52501	D	0.999958	D;D	0.57257	0.979;0.979	D;D	0.71414	0.973;0.973	T	0.29243	-1.0018	10	0.09590	T	0.72	-6.0194	3.8689	0.09029	0.3451:0.0:0.6549:0.0	.	280;392	B4DJS7;Q9UNH7	.;SNX6_HUMAN	I	276;276;404;280	ENSP00000379779:L276I;ENSP00000379785:L276I;ENSP00000355217:L404I;ENSP00000347230:L280I	ENSP00000347230:L280I	L	-	1	2	SNX6	34102126	1.000000	0.71417	0.998000	0.56505	0.862000	0.49288	4.719000	0.61937	2.360000	0.80028	0.462000	0.41574	CTA	SNX6	-	pfam_Vps5_C,pfam_BAR_dom,pirsf_Snx5_Snx6	ENSG00000129515		0.343	SNX6-002	KNOWN	downstream_ATG|basic|appris_principal|CCDS	protein_coding	SNX6	HGNC	protein_coding	OTTHUMT00000276642.3	-	0.00	50	0	G			35032375	-1	tier1	-	no_errors	ENST00000362031	ensembl	human	known	74_37	missense	7.41	50	4	SNP	1.000	T
SOGA3	387104	genome.wustl.edu	37	6	127836128	127836128	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr6:127836128G>T	ENST00000525778.1	-	3	1911	c.1166C>A	c.(1165-1167)gCc>gAc	p.A389D	SOGA3_ENST00000465909.2_Missense_Mutation_p.A389D|SOGA3_ENST00000481848.2_Missense_Mutation_p.A389D|SOGA3_ENST00000368268.2_Missense_Mutation_p.A389D|SOGA3_ENST00000556132.1_Missense_Mutation_p.A389D			Q5TF21	SOGA3_HUMAN	SOGA family member 3	389					regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											CAGTTGACAGGCATCCTCCTC	0.562																																																	0													196.0	197.0	197.0					6																	127836128		2124	4251	6375	SO:0001583	missense	0			AK096490	CCDS43505.1	6q22.33	2013-03-28	2012-02-27	2012-02-27	ENSG00000214338	ENSG00000214338			21494	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 174"""	C6orf174			Standard	NM_001012279		Approved	dJ403A15.3	uc003qbd.3	Q5TF21	OTTHUMG00000166438	ENST00000525778.1:c.1166C>A	6.37:g.127836128G>T	ENSP00000434570:p.Ala389Asp			Missense_Mutation	SNP	pfam_SOGA	p.A389D	ENST00000525778.1	37	c.1166	CCDS43505.1	6	.	.	.	.	.	.	.	.	.	.	G	33	5.195349	0.94960	.	.	ENSG00000214338	ENST00000556132;ENST00000368268;ENST00000525778;ENST00000465909	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	5.65	5.65	0.86999	.	0.109437	0.64402	D	0.000006	T	0.47691	0.1459	M	0.63843	1.955	0.80722	D	1	P	0.47302	0.893	P	0.51701	0.677	T	0.44528	-0.9322	10	0.54805	T	0.06	-15.5471	19.3474	0.94370	0.0:0.0:1.0:0.0	.	389	Q5TF21	CF174_HUMAN	D	389	ENSP00000451768:A389D;ENSP00000357251:A389D;ENSP00000434570:A389D;ENSP00000435559:A389D	ENSP00000435559:A389D	A	-	2	0	C6orf174	127877821	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.012000	0.88631	2.666000	0.90696	0.557000	0.71058	GCC	SOGA3	-	NULL	ENSG00000214338		0.562	SOGA3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SOGA3	HGNC	protein_coding	OTTHUMT00000388246.1	-	0.00	70	0	G	NM_001012279		127836128	-1	tier1	-	no_errors	ENST00000368268	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	T
SON	6651	genome.wustl.edu	37	21	34932343	34932343	+	Intron	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr21:34932343G>T	ENST00000356577.4	+	6	7132				SON_ENST00000381692.2_Intron|SON_ENST00000300278.4_Missense_Mutation_p.G2273V|SON_ENST00000290239.6_Intron	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein						cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						CCCAACATTGGGCCCTCCCTG	0.443																																																	0													130.0	116.0	121.0					21																	34932343		2203	4300	6503	SO:0001627	intron_variant	0			AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.6657+262G>T	21.37:g.34932343G>T			D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	superfamily_WD40_repeat_dom	p.G2273V	ENST00000356577.4	37	c.6818	CCDS13629.1	21	.	.	.	.	.	.	.	.	.	.	G	12.37	1.917040	0.33815	.	.	ENSG00000159140	ENST00000300278	T	0.10960	2.82	5.58	5.58	0.84498	.	.	.	.	.	T	0.34948	0.0915	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.04693	-1.0933	8	0.87932	D	0	.	15.0702	0.72030	0.0:0.0:1.0:0.0	.	2273	P18583-3	.	V	2273	ENSP00000300278:G2273V	ENSP00000300278:G2273V	G	+	2	0	SON	33854213	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.489000	0.60309	2.629000	0.89072	0.563000	0.77884	GGG	SON	-	NULL	ENSG00000159140		0.443	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SON	HGNC	protein_coding	OTTHUMT00000140978.2	-	0.00	58	0	G	NM_138927		34932343	+1	tier1	-	no_errors	ENST00000300278	ensembl	human	known	74_37	missense	6.45	58	4	SNP	1.000	T
SORL1	6653	genome.wustl.edu	37	11	121458833	121458833	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr11:121458833G>A	ENST00000260197.7	+	28	4048	c.3919G>A	c.(3919-3921)Gat>Aat	p.D1307N	SORL1_ENST00000534286.1_Missense_Mutation_p.D217N|SORL1_ENST00000527934.1_5'Flank|SORL1_ENST00000532694.1_Missense_Mutation_p.D153N|SORL1_ENST00000525532.1_Missense_Mutation_p.D251N	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	1307	LDL-receptor class A 6. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		CGACGGGTCCGATGAGGATGC	0.587																																																	0													94.0	78.0	83.0					11																	121458833		2203	4299	6502	SO:0001583	missense	0			Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.3919G>A	11.37:g.121458833G>A	ENSP00000260197:p.Asp1307Asn		B2RNX7|Q92856	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_Fibronectin_type3,pfam_LDLR_classB_rpt,superfamily_Fibronectin_type3,superfamily_LDrepeatLR_classA_rpt,smart_VPS10,smart_LDLR_classB_rpt,smart_LDrepeatLR_classA_rpt,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.D1307N	ENST00000260197.7	37	c.3919	CCDS8436.1	11	.	.	.	.	.	.	.	.	.	.	G	31	5.070005	0.93950	.	.	ENSG00000137642	ENST00000260197;ENST00000525532;ENST00000532694;ENST00000534286	D;D;D;D	0.98701	-5.08;-5.08;-5.08;-5.08	5.52	5.52	0.82312	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99351	0.9772	M	0.91663	3.23	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.98991	1.0808	10	0.87932	D	0	.	19.4741	0.94979	0.0:0.0:1.0:0.0	.	1307	Q92673	SORL_HUMAN	N	1307;251;153;217	ENSP00000260197:D1307N;ENSP00000434634:D251N;ENSP00000432131:D153N;ENSP00000436447:D217N	ENSP00000260197:D1307N	D	+	1	0	SORL1	120964043	1.000000	0.71417	0.098000	0.21074	0.064000	0.16182	9.434000	0.97515	2.595000	0.87683	0.655000	0.94253	GAT	SORL1	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt	ENSG00000137642		0.587	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORL1	HGNC	protein_coding	OTTHUMT00000387626.2		0.00	26	0	G	NM_003105		121458833	+1			no_errors	ENST00000260197	ensembl	human	known	74_37	missense	9.68	28	3	SNP	0.996	A
SPINT1	6692	genome.wustl.edu	37	15	41148489	41148489	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr15:41148489G>A	ENST00000344051.4	+	10	1586	c.1352G>A	c.(1351-1353)gGc>gAc	p.G451D	SPINT1_ENST00000431806.1_Missense_Mutation_p.G435D|SPINT1_ENST00000562057.1_Missense_Mutation_p.G435D			O43278	SPIT1_HUMAN	serine peptidase inhibitor, Kunitz type 1	451					branching involved in labyrinthine layer morphogenesis (GO:0060670)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|placenta blood vessel development (GO:0060674)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	16		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		GATGTGTTTGGCCTGAGGCGG	0.547																																																	0													154.0	127.0	136.0					15																	41148489		2203	4300	6503	SO:0001583	missense	0				CCDS10067.1, CCDS45231.1	15q13.3	2008-02-05	2005-08-17		ENSG00000166145	ENSG00000166145			11246	protein-coding gene	gene with protein product		605123	"""serine protease inhibitor, Kunitz type 1"""				Standard	XM_006720657		Approved	HAI, MANSC2	uc001zna.3	O43278	OTTHUMG00000130068	ENST00000344051.4:c.1352G>A	15.37:g.41148489G>A	ENSP00000342098:p.Gly451Asp		Q7Z7D2	Missense_Mutation	SNP	pfam_Prot_inh_Kunz-m,pfam_MANSC_N,pfam_LDrepeatLR_classA_rpt,superfamily_Prot_inh_Kunz-m,superfamily_LDrepeatLR_classA_rpt,superfamily_PKD_dom,smart_MANSC_N,smart_Prot_inh_Kunz-m,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_MANSC,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.G451D	ENST00000344051.4	37	c.1352	CCDS10067.1	15	.	.	.	.	.	.	.	.	.	.	G	17.41	3.382965	0.61845	.	.	ENSG00000166145	ENST00000344051;ENST00000536281;ENST00000431806	D;D	0.95622	-3.74;-3.76	5.38	4.47	0.54385	.	0.439592	0.28908	N	0.013753	D	0.97056	0.9038	M	0.75447	2.3	0.41356	D	0.987398	D;D;D	0.89917	1.0;0.99;1.0	D;P;D	0.91635	0.999;0.828;0.986	D	0.96753	0.9555	10	0.46703	T	0.11	-9.9339	11.8004	0.52124	0.0838:0.0:0.9162:0.0	.	435;435;451	B2RBU9;O43278-2;O43278	.;.;SPIT1_HUMAN	D	451;418;435	ENSP00000342098:G451D;ENSP00000409935:G435D	ENSP00000342098:G451D	G	+	2	0	SPINT1	38935781	0.998000	0.40836	0.919000	0.36401	0.733000	0.41908	2.889000	0.48601	1.412000	0.46977	0.561000	0.74099	GGC	SPINT1	-	NULL	ENSG00000166145		0.547	SPINT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPINT1	HGNC	protein_coding	OTTHUMT00000252359.2		0.00	36	0	G	NM_003710		41148489	+1			no_errors	ENST00000344051	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.972	A
SPRY4	81848	genome.wustl.edu	37	5	141694439	141694439	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr5:141694439C>T	ENST00000434127.2	-	2	478	c.235G>A	c.(235-237)Gcc>Acc	p.A79T	SPRY4_ENST00000503582.1_5'Flank|SPRY4_ENST00000344120.4_Missense_Mutation_p.A102T	NM_001127496.1	NP_001120968.1	Q9C004	SPY4_HUMAN	sprouty homolog 4 (Drosophila)	79					multicellular organismal development (GO:0007275)|negative regulation of MAP kinase activity (GO:0043407)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)		p.A102T(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(1)	18		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCACAGCGGGCGGGCGTCGGG	0.657									Testicular Cancer, Familial Clustering of																																								1	Substitution - Missense(1)	large_intestine(1)											27.0	34.0	32.0					5																	141694439		2200	4297	6497	SO:0001583	missense	0	Familial Cancer Database		AF227516	CCDS4274.1, CCDS47296.1	5q31.3	2010-08-05			ENSG00000187678	ENSG00000187678			15533	protein-coding gene	gene with protein product		607984				16465403	Standard	NM_030964		Approved		uc010jgi.1	Q9C004	OTTHUMG00000129663	ENST00000434127.2:c.235G>A	5.37:g.141694439C>T	ENSP00000399468:p.Ala79Thr		A4FVB2|A4FVB3|Q6QIX2|Q9C003	Missense_Mutation	SNP	pfam_Sprouty	p.A102T	ENST00000434127.2	37	c.304	CCDS47296.1	5	.	.	.	.	.	.	.	.	.	.	C	5.663	0.306885	0.10733	.	.	ENSG00000187678	ENST00000344120;ENST00000434127;ENST00000359661	T;T	0.63580	-0.05;-0.04	5.77	1.58	0.23477	.	0.687272	0.14744	N	0.301020	T	0.31575	0.0801	N	0.08118	0	0.21105	N	0.999789	B;B	0.22003	0.063;0.006	B;B	0.12156	0.007;0.002	T	0.16928	-1.0386	10	0.09590	T	0.72	-17.321	4.2449	0.10667	0.2178:0.4614:0.2244:0.0964	.	79;79	Q9C004-2;Q9C004	.;SPY4_HUMAN	T	102;79;79	ENSP00000344967:A102T;ENSP00000399468:A79T	ENSP00000344967:A102T	A	-	1	0	SPRY4	141674623	0.001000	0.12720	0.452000	0.26994	0.562000	0.35680	-0.102000	0.10956	0.740000	0.32651	-0.314000	0.08810	GCC	SPRY4	-	NULL	ENSG00000187678		0.657	SPRY4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRY4	HGNC	protein_coding	OTTHUMT00000370652.1		0.00	61	0	C			141694439	-1			no_errors	ENST00000344120	ensembl	human	known	74_37	missense	5.88	48	3	SNP	0.099	T
SPTA1	6708	genome.wustl.edu	37	1	158637762	158637762	+	Missense_Mutation	SNP	T	T	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:158637762T>C	ENST00000368147.4	-	15	2104	c.1924A>G	c.(1924-1926)Aaa>Gaa	p.K642E		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	642					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TGGCCAGTTTTCTGTATGTTT	0.478																																																	0													171.0	166.0	167.0					1																	158637762		1864	4098	5962	SO:0001583	missense	0			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.1924A>G	1.37:g.158637762T>C	ENSP00000357129:p.Lys642Glu		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_hand_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.K642E	ENST00000368147.4	37	c.1924	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	T	12.85	2.062779	0.36373	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.42513	0.97;0.97	4.95	3.81	0.43845	.	0.611782	0.12628	N	0.452417	T	0.24084	0.0583	L	0.52266	1.64	0.32654	N	0.518951	B	0.25719	0.132	B	0.36766	0.232	T	0.15435	-1.0437	10	0.23891	T	0.37	.	11.0075	0.47644	0.0:0.0:0.1563:0.8437	.	642	P02549	SPTA1_HUMAN	E	642	ENSP00000357130:K642E;ENSP00000357129:K642E	ENSP00000357129:K642E	K	-	1	0	SPTA1	156904386	1.000000	0.71417	0.512000	0.27736	0.381000	0.30169	4.038000	0.57318	0.898000	0.36418	0.528000	0.53228	AAA	SPTA1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000163554		0.478	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3	-	0.00	36	0	T	NM_003126		158637762	-1	tier1	-	no_errors	ENST00000368147	ensembl	human	known	74_37	missense	31.71	28	13	SNP	1.000	C
SRCAP	10847	genome.wustl.edu	37	16	30736370	30736371	+	Frame_Shift_Ins	INS	-	-	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr16:30736370_30736371insC	ENST00000262518.4	+	25	6010_6011	c.5625_5626insC	c.(5626-5628)cccfs	p.P1876fs	SRCAP_ENST00000344771.4_Frame_Shift_Ins_p.P1718fs|SRCAP_ENST00000395059.2_Frame_Shift_Ins_p.P1814fs	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	1876	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CTCGACGCCAGCCCCCCCCACC	0.569																																																	0																																										SO:0001589	frameshift_variant	0			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.5633dupC	16.37:g.30736378_30736378dupC	ENSP00000262518:p.Pro1876fs		B0JZA6|O15026|Q7Z744|Q9Y5L9	Frame_Shift_Ins	INS	pfam_SNF2_N,pfam_Helicase/SANT-assoc_DNA-bd,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,smart_AT_hook_DNA-bd_motif,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_AT_hook-like	p.P1878fs	ENST00000262518.4	37	c.5625_5626	CCDS10689.2	16																																																																																			SRCAP	-	NULL	ENSG00000080603		0.569	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRCAP	HGNC	protein_coding	OTTHUMT00000255523.1		0.00	60	0	0	NM_006662		30736371	+1			no_errors	ENST00000262518	ensembl	human	known	74_37	frame_shift_ins	5.10	149	8	INS	1.000:1.000	C
SRSF6	6431	genome.wustl.edu	37	20	42088794	42088794	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr20:42088794G>A	ENST00000244020.3	+	4	609	c.503G>A	c.(502-504)gGc>gAc	p.G168D		NM_006275.5	NP_006266.2	Q13247	SRSF6_HUMAN	serine/arginine-rich splicing factor 6	168	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splice site selection (GO:0006376)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell death (GO:0060548)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of keratinocyte proliferation (GO:0010837)|regulation of wound healing (GO:0061041)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|RNA binding (GO:0003723)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|upper_aerodigestive_tract(2)	5						AAACTGGATGGCACAGAAATA	0.443																																																	0													112.0	108.0	110.0					20																	42088794		2203	4297	6500	SO:0001583	missense	0			U30883	CCDS13318.1	20q12-q13.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000124193	ENSG00000124193		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10788	protein-coding gene	gene with protein product	"""pre-mRNA splicing factor SRP55"", ""SR splicing factor 6"""	601944	"""splicing factor, arginine/serine-rich 6"""	SFRS6		7556075, 20516191	Standard	NM_006275		Approved	SRP55, B52	uc010zwg.2	Q13247	OTTHUMG00000032502	ENST00000244020.3:c.503G>A	20.37:g.42088794G>A	ENSP00000244020:p.Gly168Asp		B7Z6J3|E1P5W6|Q13244|Q13245|Q96J06|Q9UJB8|Q9Y3N7	Missense_Mutation	SNP	pfam_RRM_dom,pfam_RRM_3,smart_RRM_dom,pfscan_RRM_dom	p.G168D	ENST00000244020.3	37	c.503	CCDS13318.1	20	.	.	.	.	.	.	.	.	.	.	G	16.92	3.255789	0.59321	.	.	ENSG00000124193	ENST00000244020	T	0.26067	1.76	6.08	6.08	0.98989	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.043260	0.85682	D	0.000000	T	0.40448	0.1117	L	0.45470	1.425	0.80722	D	1	P;P	0.49358	0.923;0.65	P;P	0.58266	0.836;0.679	T	0.01472	-1.1346	10	0.12766	T	0.61	.	19.4436	0.94836	0.0:0.0:1.0:0.0	.	168;168	Q13247;A8K588	SRSF6_HUMAN;.	D	168	ENSP00000244020:G168D	ENSP00000244020:G168D	G	+	2	0	SRSF6	41522208	1.000000	0.71417	1.000000	0.80357	0.533000	0.34776	7.895000	0.87343	2.894000	0.99253	0.591000	0.81541	GGC	SRSF6	-	pfam_RRM_dom,pfam_RRM_3,smart_RRM_dom,pfscan_RRM_dom	ENSG00000124193		0.443	SRSF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRSF6	HGNC	protein_coding	OTTHUMT00000079292.1		0.00	74	0	G	NM_006275		42088794	+1			no_errors	ENST00000244020	ensembl	human	known	74_37	missense	5.43	87	5	SNP	1.000	A
STAU2	27067	genome.wustl.edu	37	8	74621378	74621378	+	Start_Codon_SNP	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr8:74621378C>A	ENST00000524300.1	-	4	353	c.3G>T	c.(1-3)atG>atT	p.M1I	STAU2_ENST00000521210.1_Intron|STAU2_ENST00000521727.1_Intron|STAU2_ENST00000355780.5_Intron|STAU2_ENST00000522695.1_Intron|STAU2_ENST00000523558.1_Intron|RP11-463D19.2_ENST00000358757.5_Intron|STAU2_ENST00000519961.1_Start_Codon_SNP_p.M1I|RP11-463D19.1_ENST00000533978.1_lincRNA|STAU2_ENST00000522509.1_Intron|STAU2_ENST00000522962.1_5'UTR|STAU2_ENST00000524104.1_Intron|STAU2_ENST00000517542.1_Intron|STAU2_ENST00000521419.1_Intron|STAU2_ENST00000521451.1_Intron	NM_001164380.1|NM_001164381.1	NP_001157852.1|NP_001157853.1	Q9NUL3	STAU2_HUMAN	staufen double-stranded RNA binding protein 2	1					transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)	19	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)			TTGGGTTTGCCATTTTATCTT	0.358																																																	0													81.0	67.0	72.0					8																	74621378		692	1590	2282	SO:0001582	initiator_codon_variant	0			Y19062	CCDS6214.1, CCDS55244.1, CCDS55245.1, CCDS55246.1, CCDS55247.1, CCDS55248.1	8q21.11	2013-06-05	2013-06-05		ENSG00000040341	ENSG00000040341			11371	protein-coding gene	gene with protein product		605920	"""staufen (Drosophila, RNA-binding protein) homolog 2"", ""staufen, RNA binding protein, homolog 2 (Drosophila)"""			10585778	Standard	NM_014393		Approved	39K2	uc003xzm.3	Q9NUL3	OTTHUMG00000164499	ENST00000524300.1:c.3G>T	8.37:g.74621378C>A	ENSP00000428756:p.Met1Ile		B7Z1I6|B7Z292|B7Z8B4|E7ER74|E9PEI3|E9PF26|E9PF50|Q6AHY7|Q96HM0|Q96HM1|Q9NVI5|Q9UGG6	Missense_Mutation	SNP	pfam_dsRNA-bd_dom,smart_dsRNA-bd_dom,pfscan_dsRNA-bd_dom	p.M1I	ENST00000524300.1	37	c.3	CCDS55247.1	8	.	.	.	.	.	.	.	.	.	.	C	20.3	3.960976	0.74016	.	.	ENSG00000040341	ENST00000524300;ENST00000519961	T;T	0.35048	1.33;1.33	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.43389	0.1245	.	.	.	0.80722	D	1	B;B	0.34241	0.063;0.444	B;B	0.38880	0.039;0.284	T	0.40384	-0.9566	9	0.72032	D	0.01	-40.9463	19.6052	0.95577	0.0:1.0:0.0:0.0	.	1;1	E7EVJ4;E9PF26	.;.	I	1	ENSP00000428756:M1I;ENSP00000430907:M1I	ENSP00000430907:M1I	M	-	3	0	STAU2	74783932	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.711000	0.84669	2.625000	0.88918	0.655000	0.94253	ATG	STAU2	-	NULL	ENSG00000040341		0.358	STAU2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAU2	HGNC	protein_coding	OTTHUMT00000379000.2	-	0.00	33	0	C	NM_001164380	Missense_Mutation	74621378	-1	tier1	-	no_errors	ENST00000524300	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	A
STK33	65975	genome.wustl.edu	37	11	8478953	8478953	+	Nonsense_Mutation	SNP	G	G	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr11:8478953G>C	ENST00000447869.1	-	5	1550	c.632C>G	c.(631-633)tCa>tGa	p.S211*	STK33_ENST00000396673.1_Nonsense_Mutation_p.S211*|STK33_ENST00000396672.1_Nonsense_Mutation_p.S211*|STK33_ENST00000534493.1_Nonsense_Mutation_p.S170*|STK33_ENST00000358872.3_Nonsense_Mutation_p.S24*|STK33_ENST00000315204.1_Nonsense_Mutation_p.S211*			Q9BYT3	STK33_HUMAN	serine/threonine kinase 33	211	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|skin(3)	23				Epithelial(150;2.13e-06)|BRCA - Breast invasive adenocarcinoma(625;0.239)		CTCATTCTCTGAGAAATGCCC	0.393																																																	0													142.0	133.0	136.0					11																	8478953		2201	4296	6497	SO:0001587	stop_gained	0			AJ303380	CCDS7789.1, CCDS73253.1, CCDS73254.1	11p15.3	2010-03-10			ENSG00000130413	ENSG00000130413			14568	protein-coding gene	gene with protein product		607670				11738831	Standard	NM_030906		Approved		uc001mgj.1	Q9BYT3	OTTHUMG00000140275	ENST00000447869.1:c.632C>G	11.37:g.8478953G>C	ENSP00000416750:p.Ser211*		Q658S6|Q8NEF5	Nonsense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.S211*	ENST00000447869.1	37	c.632	CCDS7789.1	11	.	.	.	.	.	.	.	.	.	.	G	18.03	3.531763	0.64972	.	.	ENSG00000130413	ENST00000447869;ENST00000315204;ENST00000396672;ENST00000358872;ENST00000396673;ENST00000534493;ENST00000524760;ENST00000418597;ENST00000422559	.	.	.	4.86	4.86	0.63082	.	0.201243	0.41500	D	0.000878	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	16.1697	0.81793	0.0:0.0:1.0:0.0	.	.	.	.	X	211;211;211;24;211;170;123;170;170	.	ENSP00000320754:S211X	S	-	2	0	STK33	8435529	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.159000	0.71856	2.256000	0.74724	0.460000	0.39030	TCA	STK33	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000130413		0.393	STK33-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	STK33	HGNC	protein_coding	OTTHUMT00000276819.2	-	0.00	48	0	G	NM_030906		8478953	-1	tier1	-	no_errors	ENST00000315204	ensembl	human	known	74_37	nonsense	79.37	13	50	SNP	1.000	C
STRBP	55342	genome.wustl.edu	37	9	125898332	125898332	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr9:125898332C>A	ENST00000348403.5	-	16	2190	c.1761G>T	c.(1759-1761)aaG>aaT	p.K587N	STRBP_ENST00000447404.2_Missense_Mutation_p.K587N|STRBP_ENST00000360998.3_Missense_Mutation_p.K573N	NM_018387.4	NP_060857.2	Q96SI9	STRBP_HUMAN	spermatid perinuclear RNA binding protein	587	Poly-Lys.				cellular component movement (GO:0006928)|mechanosensory behavior (GO:0007638)|multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(6)|prostate(1)|skin(2)	26						GAGGGATAATCTTCTTTTTCT	0.403																																																	0													120.0	117.0	118.0					9																	125898332		2203	4300	6503	SO:0001583	missense	0			AK002169	CCDS6851.1, CCDS55337.1	9q33.1-q33.3	2008-08-29	2001-11-28		ENSG00000165209	ENSG00000165209			16462	protein-coding gene	gene with protein product		611138	"""spermatid perinuclear RNA-binding protein"", ""interleukin enhancer binding factor 3-like"""	ILF3L			Standard	NM_018387		Approved	FLJ11307, SPNR	uc004bns.3	Q96SI9	OTTHUMG00000020636	ENST00000348403.5:c.1761G>T	9.37:g.125898332C>A	ENSP00000321347:p.Lys587Asn		Q32NB9|Q9BUE1|Q9BXG4|Q9H0B4|Q9H7V1|Q9NUK4	Missense_Mutation	SNP	pfam_DZF,pfam_dsRNA-bd_dom,smart_DZF,smart_dsRNA-bd_dom,pfscan_dsRNA-bd_dom	p.K587N	ENST00000348403.5	37	c.1761	CCDS6851.1	9	.	.	.	.	.	.	.	.	.	.	C	17.45	3.391823	0.62066	.	.	ENSG00000165209	ENST00000447404;ENST00000348403;ENST00000360998	T;T;T	0.19806	2.39;2.39;2.12	5.33	4.43	0.53597	.	0.000000	0.85682	D	0.000000	T	0.19604	0.0471	L	0.29908	0.895	0.45129	D	0.998149	P;D	0.53151	0.93;0.958	B;P	0.47346	0.342;0.544	T	0.01596	-1.1316	10	0.87932	D	0	-12.1788	9.6283	0.39763	0.0:0.7824:0.0:0.2176	.	587;573	Q96SI9;Q96SI9-2	STRBP_HUMAN;.	N	587;587;573	ENSP00000415968:K587N;ENSP00000321347:K587N;ENSP00000354271:K573N	ENSP00000321347:K587N	K	-	3	2	STRBP	124938153	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.241000	0.43097	1.387000	0.46486	0.655000	0.94253	AAG	STRBP	-	NULL	ENSG00000165209		0.403	STRBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STRBP	HGNC	protein_coding	OTTHUMT00000053982.1	-	0.00	39	0	C			125898332	-1	tier1	-	no_errors	ENST00000348403	ensembl	human	known	74_37	missense	6.76	68	5	SNP	1.000	A
SUPT20H	55578	genome.wustl.edu	37	13	37595648	37595648	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr13:37595648G>T	ENST00000350612.6	-	21	1973	c.1753C>A	c.(1753-1755)Cta>Ata	p.L585I	SUPT20H_ENST00000360252.4_Missense_Mutation_p.L586I|SUPT20H_ENST00000464744.1_Missense_Mutation_p.L586I|SUPT20H_ENST00000475892.1_Missense_Mutation_p.L664I|SUPT20H_ENST00000356185.3_Missense_Mutation_p.L586I	NM_001014286.2	NP_001014308.2	Q8NEM7	SP20H_HUMAN	suppressor of Ty 20 homolog (S. cerevisiae)	585					autophagy (GO:0006914)|chromatin organization (GO:0006325)|gastrulation (GO:0007369)	SAGA complex (GO:0000124)|SAGA-type complex (GO:0070461)	transcription cofactor activity (GO:0003712)										CCTGAGGGTAGAAGGCCGCTC	0.502																																																	0													55.0	48.0	50.0					13																	37595648		2203	4300	6503	SO:0001583	missense	0			AF093250	CCDS9362.1, CCDS31959.1, CCDS61311.1	13q13	2012-11-29	2012-11-29	2012-11-29	ENSG00000102710	ENSG00000102710			20596	protein-coding gene	gene with protein product	"""p38 interacting protein"", ""transcription factor (p38 interacting protein)"""	613417	"""chromosome 13 open reading frame 19"", ""family with sequence similarity 48, member A"""	C13orf19, FAM48A		12070015 , 16685401	Standard	NM_001278480		Approved	SPT20, bA421P11.4, P38IP	uc001uwg.3	Q8NEM7	OTTHUMG00000016747	ENST00000350612.6:c.1753C>A	13.37:g.37595648G>T	ENSP00000218894:p.Leu585Ile		E7ER46|Q71RF3|Q9Y6A6	Missense_Mutation	SNP	pfam_Spt20	p.L585I	ENST00000350612.6	37	c.1753	CCDS31959.1	13	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.44|18.44	3.624960|3.624960	0.66901|0.66901	.|.	.|.	ENSG00000102710|ENSG00000102710	ENST00000469488|ENST00000360252;ENST00000475892;ENST00000350612;ENST00000356185;ENST00000536874;ENST00000464744	.|T;T;T;T;T	.|0.63744	.|0.33;-0.06;0.95;0.33;0.33	5.73|5.73	4.77|4.77	0.60923|0.60923	.|.	.|0.000000	.|0.64402	.|D	.|0.000005	T|T	0.72843|0.72843	0.3511|0.3511	M|M	0.78801|0.78801	2.425|2.425	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D	.|0.89917	.|0.997;1.0;0.998;1.0;0.998	.|D;D;D;D;D	.|0.78314	.|0.991;0.94;0.956;0.94;0.956	T|T	0.72988|0.72988	-0.4124|-0.4124	5|10	.|0.36615	.|T	.|0.2	-8.989|-8.989	3.7536|3.7536	0.08576|0.08576	0.3339:0.0:0.6661:0.0|0.3339:0.0:0.6661:0.0	.|.	.|664;586;586;585;585	.|E7ER46;A8K8L1;Q8NEM7-2;Q8NEM7;F5GX46	.|.;.;.;FA48A_HUMAN;.	L|I	139|586;664;585;586;585;586	.|ENSP00000353388:L586I;ENSP00000417510:L664I;ENSP00000218894:L585I;ENSP00000348512:L586I;ENSP00000419754:L586I	.|ENSP00000218894:L585I	F|L	-|-	3|1	2|2	FAM48A|FAM48A	36493648|36493648	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.923000|0.923000	0.55619|0.55619	3.805000|3.805000	0.55575|0.55575	2.720000|2.720000	0.93068|0.93068	0.591000|0.591000	0.81541|0.81541	TTC|CTA	SUPT20H	-	NULL	ENSG00000102710		0.502	SUPT20H-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SUPT20H	HGNC	protein_coding	OTTHUMT00000354766.1		0.00	23	0	G	NM_017569		37595648	-1			no_errors	ENST00000350612	ensembl	human	known	74_37	missense	5.71	33	2	SNP	1.000	T
TADA2B	93624	genome.wustl.edu	37	4	7056185	7056185	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr4:7056185G>T	ENST00000310074.7	+	2	856	c.667G>T	c.(667-669)Gcc>Tcc	p.A223S	TADA2B_ENST00000515646.1_Missense_Mutation_p.A131S|TADA2B_ENST00000512388.1_Missense_Mutation_p.A148S	NM_152293.2	NP_689506.2	Q86TJ2	TAD2B_HUMAN	transcriptional adaptor 2B	223					chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	SAGA-type complex (GO:0070461)|STAGA complex (GO:0030914)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	18						GAAGAACATCGCCCGTGACTA	0.567																																																	0													75.0	82.0	80.0					4																	7056185		2026	4204	6230	SO:0001583	missense	0			AK026299	CCDS47007.1	4p16.1	2009-10-02			ENSG00000173011	ENSG00000173011			30781	protein-coding gene	gene with protein product		608790				12972612, 18936164	Standard	NM_152293		Approved	MGC21874	uc003gjw.4	Q86TJ2	OTTHUMG00000159983	ENST00000310074.7:c.667G>T	4.37:g.7056185G>T	ENSP00000308022:p.Ala223Ser		A0AUJ8|A4QMR7|B3KSN0|B3KU86|Q6MZG9	Missense_Mutation	SNP	pfam_SANT/Myb,pfam_Znf_ZZ,superfamily_Homeodomain-like,smart_Znf_ZZ,smart_SANT/Myb,pirsf_Transcriptional_adaptor_2,pfscan_Znf_ZZ,pfscan_Myb-like_dom	p.A223S	ENST00000310074.7	37	c.667	CCDS47007.1	4	.	.	.	.	.	.	.	.	.	.	G	25.1	4.598885	0.87055	.	.	ENSG00000173011	ENST00000310074;ENST00000512388;ENST00000515646	T;T;T	0.42900	0.96;0.96;0.96	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.42381	0.1200	L	0.45228	1.405	0.80722	D	1	P;P	0.47253	0.837;0.892	B;B	0.42995	0.4;0.404	T	0.40776	-0.9545	10	0.54805	T	0.06	-40.6654	18.9307	0.92564	0.0:0.0:1.0:0.0	.	148;223	Q86TJ2-2;Q86TJ2	.;TAD2B_HUMAN	S	223;148;131	ENSP00000308022:A223S;ENSP00000423947:A148S;ENSP00000423181:A131S	ENSP00000308022:A223S	A	+	1	0	TADA2B	7107086	1.000000	0.71417	1.000000	0.80357	0.837000	0.47467	9.319000	0.96338	2.481000	0.83766	0.561000	0.74099	GCC	TADA2B	-	pirsf_Transcriptional_adaptor_2	ENSG00000173011		0.567	TADA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TADA2B	HGNC	protein_coding	OTTHUMT00000358687.2	-	0.00	84	0	G	NM_152293		7056185	+1	tier1	-	no_errors	ENST00000310074	ensembl	human	known	74_37	missense	31.58	52	24	SNP	1.000	T
TBC1D13	54662	genome.wustl.edu	37	9	131565639	131565639	+	Silent	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr9:131565639C>T	ENST00000372648.5	+	8	804	c.654C>T	c.(652-654)taC>taT	p.Y218Y	TBC1D13_ENST00000539497.1_Silent_p.Y37Y|TBC1D13_ENST00000466056.1_3'UTR|TBC1D13_ENST00000223865.8_Intron	NM_018201.3	NP_060671.3	Q9NVG8	TBC13_HUMAN	TBC1 domain family, member 13	218	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	6						TGTTCATCTACGCCAAGCTCA	0.542																																																	0													153.0	122.0	133.0					9																	131565639		2203	4300	6503	SO:0001819	synonymous_variant	0			AK001605	CCDS6911.1, CCDS69677.1	9q34.13	2013-07-09			ENSG00000107021	ENSG00000107021			25571	protein-coding gene	gene with protein product						22762500	Standard	XM_005252060		Approved	FLJ10743	uc010myj.3	Q9NVG8	OTTHUMG00000020760	ENST00000372648.5:c.654C>T	9.37:g.131565639C>T			A7E2E7|B3KW04|B9EGJ8|Q5T270|Q5T271	Silent	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.Y218	ENST00000372648.5	37	c.654	CCDS6911.1	9																																																																																			TBC1D13	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000107021		0.542	TBC1D13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D13	HGNC	protein_coding	OTTHUMT00000054496.1	-	0.00	129	0	C	NM_018201		131565639	+1	tier1	-	no_errors	ENST00000372648	ensembl	human	known	74_37	silent	80.36	22	90	SNP	0.361	T
TBXA2R	6915	genome.wustl.edu	37	19	3595872	3595872	+	Silent	SNP	C	C	G			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr19:3595872C>G	ENST00000375190.4	-	3	1239	c.846G>C	c.(844-846)ctG>ctC	p.L282L	TBXA2R_ENST00000587717.1_5'Flank|TBXA2R_ENST00000589966.1_Missense_Mutation_p.V153L|TBXA2R_ENST00000411851.3_Silent_p.L282L	NM_001060.5|NM_201636.2	NP_001051.1|NP_963998.2	P21731	TA2R_HUMAN	thromboxane A2 receptor	282					blood coagulation (GO:0007596)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of vasoconstriction (GO:0045907)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to nutrient (GO:0007584)|second-messenger-mediated signaling (GO:0019932)|thromboxane A2 signaling pathway (GO:0038193)	acrosomal vesicle (GO:0001669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|thromboxane A2 receptor activity (GO:0004961)			kidney(1)|lung(2)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	8		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)	Ridogrel(DB01207)	TGGTGCGGGACAGCTGCCCGG	0.667																																																	0													17.0	20.0	19.0					19																	3595872		2171	4264	6435	SO:0001819	synonymous_variant	0				CCDS42467.1, CCDS54198.1	19p13.3	2014-09-17						"""GPCR / Class A : Prostanoid receptors"""	11608	protein-coding gene	gene with protein product		188070				1825698	Standard	NM_001060		Approved		uc021umv.1	P21731		ENST00000375190.4:c.846G>C	19.37:g.3595872C>G			O75228|Q6DK52|Q9UCY1|Q9UCY2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Thbox_rcpt,prints_Prostanoid_rcpt	p.V153L	ENST00000375190.4	37	c.457	CCDS42467.1	19																																																																																			TBXA2R	-	NULL	ENSG00000006638		0.667	TBXA2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBXA2R	HGNC	protein_coding	OTTHUMT00000453081.2	-	0.00	96	0	C			3595872	-1	tier1	-	no_errors	ENST00000589966	ensembl	human	putative	74_37	missense	7.00	93	7	SNP	0.964	G
TENM3	55714	genome.wustl.edu	37	4	183600932	183600932	+	Silent	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr4:183600932C>T	ENST00000511685.1	+	8	1563	c.1440C>T	c.(1438-1440)gcC>gcT	p.A480A	TENM3_ENST00000406950.2_Silent_p.A480A			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	480					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										TTCATGAGGCCGGCTTTATCC	0.517																																																	0													48.0	54.0	52.0					4																	183600932		1858	4087	5945	SO:0001819	synonymous_variant	0			AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.1440C>T	4.37:g.183600932C>T			Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Silent	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Cyt_c-like_dom,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.A480	ENST00000511685.1	37	c.1440	CCDS47165.1	4																																																																																			TENM3	-	NULL	ENSG00000218336		0.517	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM3	HGNC	protein_coding	OTTHUMT00000361734.1	-	0.00	46	0	C			183600932	+1	tier1	-	no_errors	ENST00000406950	ensembl	human	known	74_37	silent	44.62	36	29	SNP	0.763	T
TIAM2	26230	genome.wustl.edu	37	6	155486407	155486407	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr6:155486407G>T	ENST00000461783.3	+	11	3498	c.2225G>T	c.(2224-2226)aGa>aTa	p.R742I	TIAM2_ENST00000360366.4_Missense_Mutation_p.R742I|TIAM2_ENST00000318981.5_Missense_Mutation_p.R742I|TIAM2_ENST00000529824.2_Missense_Mutation_p.R742I|TIAM2_ENST00000456144.1_Missense_Mutation_p.R742I|TIAM2_ENST00000367174.2_Missense_Mutation_p.R94I|TIAM2_ENST00000528391.2_Missense_Mutation_p.R54I|TIAM2_ENST00000456877.2_Missense_Mutation_p.R54I			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	742					apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		GTATGTTCTAGAGATGACTCT	0.408																																																	0													65.0	65.0	65.0					6																	155486407		2203	4300	6503	SO:0001583	missense	0				CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.2225G>T	6.37:g.155486407G>T	ENSP00000437188:p.Arg742Ile		B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,superfamily_HR1_rho-bd,smart_Pleckstrin_homology,smart_Raf-like_ras-bd,smart_PDZ,smart_DH-domain,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_Raf-like_ras-bd,pfscan_DH-domain	p.R742I	ENST00000461783.3	37	c.2225	CCDS34558.1	6	.	.	.	.	.	.	.	.	.	.	G	24.1	4.496962	0.85069	.	.	ENSG00000146426	ENST00000461783;ENST00000528928;ENST00000528535;ENST00000456144;ENST00000318981;ENST00000367174;ENST00000360366;ENST00000529824;ENST00000456877;ENST00000528391	T;T;T;T;T;T;T;T;T	0.38722	1.27;1.3;1.38;1.27;1.12;1.45;1.38;1.32;1.29	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.58018	0.2093	M	0.73962	2.25	0.58432	D	0.999999	D;D;D;D	0.89917	0.998;1.0;1.0;1.0	D;D;D;D	0.91635	0.972;0.999;0.999;0.997	T	0.62746	-0.6789	10	0.87932	D	0	.	14.7456	0.69488	0.0:0.1443:0.8557:0.0	.	54;742;742;742	E9PKT1;Q8IVF5-2;Q8IVF5-5;Q8IVF5	.;.;.;TIAM2_HUMAN	I	742;988;742;742;742;94;742;742;54;54	ENSP00000437188:R742I;ENSP00000434901:R742I;ENSP00000407746:R742I;ENSP00000327315:R742I;ENSP00000356142:R94I;ENSP00000353528:R742I;ENSP00000433348:R742I;ENSP00000407183:R54I;ENSP00000435335:R54I	ENSP00000327315:R742I	R	+	2	0	TIAM2	155528099	1.000000	0.71417	0.999000	0.59377	0.955000	0.61496	7.100000	0.76989	2.526000	0.85167	0.655000	0.94253	AGA	TIAM2	-	NULL	ENSG00000146426		0.408	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	TIAM2	HGNC	protein_coding	OTTHUMT00000387980.2		0.00	54	0	G	NM_012454		155486407	+1			no_errors	ENST00000456144	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	T
TIAM2	26230	genome.wustl.edu	37	6	155486490	155486490	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr6:155486490G>T	ENST00000461783.3	+	11	3581	c.2308G>T	c.(2308-2310)Ggg>Tgg	p.G770W	TIAM2_ENST00000360366.4_Missense_Mutation_p.G770W|TIAM2_ENST00000318981.5_Missense_Mutation_p.G770W|TIAM2_ENST00000529824.2_Missense_Mutation_p.G770W|TIAM2_ENST00000456144.1_Missense_Mutation_p.G770W|TIAM2_ENST00000367174.2_Missense_Mutation_p.G122W|TIAM2_ENST00000528391.2_Missense_Mutation_p.G82W|TIAM2_ENST00000456877.2_Missense_Mutation_p.G82W			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	770					apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		TTCGTTAAAAGGGCTGGACAC	0.458																																																	0													76.0	73.0	74.0					6																	155486490		2203	4300	6503	SO:0001583	missense	0				CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.2308G>T	6.37:g.155486490G>T	ENSP00000437188:p.Gly770Trp		B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,superfamily_HR1_rho-bd,smart_Pleckstrin_homology,smart_Raf-like_ras-bd,smart_PDZ,smart_DH-domain,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_Raf-like_ras-bd,pfscan_DH-domain	p.G770W	ENST00000461783.3	37	c.2308	CCDS34558.1	6	.	.	.	.	.	.	.	.	.	.	G	22.7	4.325571	0.81580	.	.	ENSG00000146426	ENST00000461783;ENST00000528928;ENST00000528535;ENST00000456144;ENST00000318981;ENST00000367174;ENST00000360366;ENST00000529824;ENST00000456877;ENST00000528391	T;T;T;T;T;T;T;T;T	0.19532	2.47;2.44;2.54;2.47;2.14;2.8;2.54;2.6;2.19	5.21	4.33	0.51752	.	0.057553	0.64402	D	0.000001	T	0.33962	0.0881	M	0.68593	2.085	0.47698	D	0.999492	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.997;0.999;0.999;0.999	T	0.24977	-1.0145	10	0.87932	D	0	.	14.0405	0.64672	0.074:0.0:0.926:0.0	.	82;770;770;770	E9PKT1;Q8IVF5-2;Q8IVF5-5;Q8IVF5	.;.;.;TIAM2_HUMAN	W	770;1016;770;770;770;122;770;770;82;82	ENSP00000437188:G770W;ENSP00000434901:G770W;ENSP00000407746:G770W;ENSP00000327315:G770W;ENSP00000356142:G122W;ENSP00000353528:G770W;ENSP00000433348:G770W;ENSP00000407183:G82W;ENSP00000435335:G82W	ENSP00000327315:G770W	G	+	1	0	TIAM2	155528182	1.000000	0.71417	0.972000	0.41901	0.990000	0.78478	7.194000	0.77789	1.164000	0.42652	0.655000	0.94253	GGG	TIAM2	-	NULL	ENSG00000146426		0.458	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	TIAM2	HGNC	protein_coding	OTTHUMT00000387980.2	-	0.00	64	0	G	NM_012454		155486490	+1	tier1	-	no_errors	ENST00000456144	ensembl	human	known	74_37	missense	5.75	82	5	SNP	1.000	T
TMEM59	9528	genome.wustl.edu	37	1	54502396	54502396	+	Intron	DEL	A	A	-			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:54502396delA	ENST00000234831.5	-	7	957				TMEM59_ENST00000371348.1_Intron|TMEM59_ENST00000470395.1_5'UTR|TMEM59_ENST00000371341.1_Intron|TMEM59_ENST00000371344.1_Intron	NM_004872.3	NP_004863.2	Q9BXS4	TMM59_HUMAN	transmembrane protein 59						autophagy (GO:0006914)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of protein glycosylation in Golgi (GO:0090285)|negative regulation of protein processing (GO:0010955)|positive regulation of autophagy (GO:0010508)	extracellular vesicular exosome (GO:0070062)|Golgi cis cisterna (GO:0000137)|Golgi medial cisterna (GO:0005797)|Golgi trans cisterna (GO:0000138)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	endopeptidase activity (GO:0004175)			kidney(3)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	7						GAGTTACTGGAAAAAAAAAAT	0.328																																																	0										51,129,4086		0,0,51,0,129,1953	37.0	35.0	36.0			-3.2	0.0	1		38	78,285,7891		0,0,78,0,285,3764	no	intron	TMEM59	NM_004872.3		0,0,129,0,414,5717	A1A1,A1A2,A1R,A2A2,A2R,RR		4.3979,4.2194,4.3371			54502396	129,414,11977	2203	4300	6503	SO:0001627	intron_variant	0			AF047439	CCDS586.1	1p32.3	2008-05-14	2005-07-22	2005-07-22	ENSG00000116209	ENSG00000116209			1239	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 8"""	C1orf8		9653160	Standard	NM_004872		Approved	HSPC001	uc001cwp.3	Q9BXS4	OTTHUMG00000008437	ENST00000234831.5:c.708-5T>-	1.37:g.54502396delA			B3KQL7|O75393|Q4VBP9|Q5T705|Q96KX7	RNA	DEL	-	NULL	ENST00000234831.5	37	NULL	CCDS586.1	1																																																																																			TMEM59	-	-	ENSG00000116209		0.328	TMEM59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM59	HGNC	protein_coding	OTTHUMT00000023254.2		0.00	40	0	A	NM_004872		54502396	-1	tier1		no_errors	ENST00000470395	ensembl	human	known	74_37	rna	7.79	71	6	DEL	0.000	-
TMEM69	51249	genome.wustl.edu	37	1	46158897	46158897	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:46158897G>T	ENST00000372025.4	+	3	1221	c.64G>T	c.(64-66)Gtg>Ttg	p.V22L	TMEM69_ENST00000496366.1_3'UTR|RP11-767N6.7_ENST00000430643.1_RNA	NM_016486.3	NP_057570.2	Q5SWH9	TMM69_HUMAN	transmembrane protein 69	22						integral component of membrane (GO:0016021)				kidney(3)|lung(4)|ovary(1)	8	Acute lymphoblastic leukemia(166;0.155)					CTCTTTCCCAGTGGGACTAAG	0.363																																																	0													162.0	157.0	159.0					1																	46158897		1837	4091	5928	SO:0001583	missense	0			BC040289, BC013608	CCDS41325.1	1p34.1	2008-02-05	2005-08-17	2005-08-17	ENSG00000159596	ENSG00000159596			28035	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 154"""	C1orf154			Standard	NM_016486		Approved	FLJ21029	uc001cor.1	Q5SWH9	OTTHUMG00000040993	ENST00000372025.4:c.64G>T	1.37:g.46158897G>T	ENSP00000361095:p.Val22Leu		Q3SWW5|Q7Z2G0|Q9P0P9	Missense_Mutation	SNP	pfam_DUF3429	p.V22L	ENST00000372025.4	37	c.64	CCDS41325.1	1	.	.	.	.	.	.	.	.	.	.	G	5.022	0.189801	0.09547	.	.	ENSG00000159596	ENST00000372025	.	.	.	5.28	-8.58	0.00897	.	0.973050	0.08449	N	0.944218	T	0.18593	0.0446	N	0.20986	0.625	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.21999	-1.0229	9	0.12766	T	0.61	0.7743	5.1655	0.15082	0.6144:0.0973:0.1896:0.0987	.	22	Q5SWH9	TMM69_HUMAN	L	22	.	ENSP00000361095:V22L	V	+	1	0	TMEM69	45931484	0.000000	0.05858	0.001000	0.08648	0.052000	0.14988	-0.999000	0.03697	-1.477000	0.01872	-0.367000	0.07326	GTG	TMEM69	-	NULL	ENSG00000159596		0.363	TMEM69-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM69	HGNC	protein_coding	OTTHUMT00000098390.1	-	0.00	29	0	G	NM_016486		46158897	+1	tier1	-	no_errors	ENST00000372025	ensembl	human	known	74_37	missense	6.15	60	4	SNP	0.000	T
TMX3	54495	genome.wustl.edu	37	18	66348308	66348308	+	Silent	SNP	T	T	G			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr18:66348308T>G	ENST00000299608.2	-	14	1261	c.945A>C	c.(943-945)tcA>tcC	p.S315S		NM_019022.3	NP_061895.3	Q96JJ7	TMX3_HUMAN	thioredoxin-related transmembrane protein 3	315					cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein disulfide isomerase activity (GO:0003756)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	17						ATTGCTGGTTTGAAGTATTCA	0.308																																																	0													120.0	119.0	119.0					18																	66348308		2203	4300	6503	SO:0001819	synonymous_variant	0			BX647846	CCDS32840.1	18q22	2011-10-19	2009-02-23	2009-02-23		ENSG00000166479		"""Protein disulfide isomerases"""	24718	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 13"""		"""thioredoxin domain containing 10"""	TXNDC10		15623505	Standard	NM_019022		Approved	FLJ20793, KIAA1830, PDIA13	uc002lkf.3	Q96JJ7		ENST00000299608.2:c.945A>C	18.37:g.66348308T>G			B3KV75|Q52LT7|Q8N5J0|Q9NWJ9	Silent	SNP	pfam_Thioredoxin_domain,pfam_Calsequestrin,superfamily_Thioredoxin-like_fold,prints_Thioredoxin	p.S315	ENST00000299608.2	37	c.945	CCDS32840.1	18																																																																																			TMX3	-	pfam_Calsequestrin,superfamily_Thioredoxin-like_fold	ENSG00000166479		0.308	TMX3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	TMX3	HGNC	protein_coding	OTTHUMT00000420155.1	-	0.00	26	0	T	NM_019022		66348308	-1	tier1	-	no_errors	ENST00000299608	ensembl	human	known	74_37	silent	25.71	26	9	SNP	0.995	G
TNFAIP3	7128	genome.wustl.edu	37	6	138197171	138197171	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr6:138197171G>T	ENST00000237289.4	+	5	739	c.673G>T	c.(673-675)Gcc>Tcc	p.A225S	TNFAIP3_ENST00000485192.1_3'UTR	NM_001270507.1|NM_001270508.1|NM_006290.3	NP_001257436.1|NP_001257437.1|NP_006281.1	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	225	Interaction with ubiquitin. {ECO:0000305}.|OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.|TRAF-binding.				apoptotic process (GO:0006915)|B-1 B cell homeostasis (GO:0001922)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of B cell activation (GO:0050869)|negative regulation of bone resorption (GO:0045779)|negative regulation of CD40 signaling pathway (GO:2000349)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast proliferation (GO:0090291)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 3 signaling pathway (GO:0034140)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of protein catabolic process (GO:0045732)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked deubiquitination (GO:0070536)|protein oligomerization (GO:0051259)|regulation of defense response to virus by host (GO:0050691)|regulation of germinal center formation (GO:0002634)|regulation of vascular wound healing (GO:0061043)|response to molecule of bacterial origin (GO:0002237)|tolerance induction to lipopolysaccharide (GO:0072573)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|protease binding (GO:0002020)|protein self-association (GO:0043621)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.0?(25)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(196)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	225	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		TTCCAATTTCGCCCCTTTGAA	0.433			"""D, N, F"""		"""marginal zone B-cell lymphomas, Hodgkin's lymphoma, primary mediastinal B cell lymphoma"""																																GBM(130;153 1739 22295 28918 47987)			Rec	yes		6	6q23	7128	"""tumor necrosis factor, alpha-induced protein 3"""		L	25	Whole gene deletion(25)	haematopoietic_and_lymphoid_tissue(25)											91.0	95.0	94.0					6																	138197171		2203	4300	6503	SO:0001583	missense	0			M59465	CCDS5187.1	6q23-q25	2013-01-21			ENSG00000118503	ENSG00000118503		"""OTU domain containing"""	11896	protein-coding gene	gene with protein product		191163				2118515	Standard	NM_006290		Approved	A20, OTUD7C	uc031spw.1	P21580	OTTHUMG00000015664	ENST00000237289.4:c.673G>T	6.37:g.138197171G>T	ENSP00000237289:p.Ala225Ser		B2R767|E1P588|Q2HIX9|Q5VXQ7|Q9NSR6	Missense_Mutation	SNP	pfam_Znf_A20,pfam_OTU,smart_Znf_A20,pfscan_OTU,pfscan_Znf_A20	p.A225S	ENST00000237289.4	37	c.673	CCDS5187.1	6	.	.	.	.	.	.	.	.	.	.	G	12.39	1.922908	0.33908	.	.	ENSG00000118503	ENST00000237289;ENST00000535574;ENST00000535332;ENST00000544646	T	0.29917	1.55	5.92	4.0	0.46444	Ovarian tumour, otubain (2);	0.210386	0.51477	N	0.000095	T	0.06826	0.0174	N	0.04705	-0.18	0.45515	D	0.998471	B	0.16802	0.019	B	0.20767	0.031	T	0.12656	-1.0539	10	0.24483	T	0.36	1.2307	13.0506	0.58952	0.0:0.0:0.5975:0.4025	.	225	P21580	TNAP3_HUMAN	S	225	ENSP00000237289:A225S	ENSP00000237289:A225S	A	+	1	0	TNFAIP3	138238864	0.997000	0.39634	0.938000	0.37757	0.980000	0.70556	2.290000	0.43531	1.461000	0.47929	0.650000	0.86243	GCC	TNFAIP3	-	pfam_OTU,pfscan_OTU	ENSG00000118503		0.433	TNFAIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFAIP3	HGNC	protein_coding	OTTHUMT00000042414.1		0.00	65	0	G			138197171	+1			no_errors	ENST00000237289	ensembl	human	known	74_37	missense	5.19	73	4	SNP	0.937	T
TNIP3	79931	genome.wustl.edu	37	4	122075707	122075707	+	Splice_Site	SNP	T	T	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr4:122075707T>C	ENST00000509841.1	-	8	800	c.722A>G	c.(721-723)aAg>aGg	p.K241R	TNIP3_ENST00000507879.1_Splice_Site_p.K234R|TNIP3_ENST00000057513.3_Splice_Site_p.K164R|TNIP3_ENST00000454328.1_Splice_Site_p.K164R	NM_001244764.1	NP_001231693.1			TNFAIP3 interacting protein 3											NS(1)|endometrium(4)|large_intestine(4)|lung(9)|ovary(1)|prostate(3)|skin(2)	24						GACTGATACCTTATTGAGGCG	0.373																																																	0													182.0	169.0	173.0					4																	122075707		2203	4300	6503	SO:0001630	splice_region_variant	0			AJ320534	CCDS3718.1, CCDS58925.1, CCDS58926.1	4q27	2008-02-05			ENSG00000050730	ENSG00000050730			19315	protein-coding gene	gene with protein product		608019				11345586	Standard	NM_024873		Approved	LIND, FLJ21162, ABIN-3	uc021xrj.1	Q96KP6	OTTHUMG00000132969	ENST00000509841.1:c.723+1A>G	4.37:g.122075707T>C				Missense_Mutation	SNP	NULL	p.K164R	ENST00000509841.1	37	c.491	CCDS58926.1	4	.	.	.	.	.	.	.	.	.	.	T	20.6	4.021812	0.75275	.	.	ENSG00000050730	ENST00000057513;ENST00000454328;ENST00000507879;ENST00000509841	T;T;T;T	0.62105	0.05;0.05;0.05;0.05	4.71	4.71	0.59529	.	0.165608	0.41712	D	0.000830	T	0.75554	0.3865	M	0.66506	2.035	0.36413	D	0.863848	D;D;D	0.76494	0.997;0.997;0.999	P;P;D	0.69479	0.881;0.881;0.964	T	0.81990	-0.0679	10	0.56958	D	0.05	-17.302	14.0733	0.64874	0.0:0.0:0.0:1.0	.	234;164;164	B4DVF5;A5HU65;Q96KP6	.;.;TNIP3_HUMAN	R	164;164;234;241	ENSP00000057513:K164R;ENSP00000411817:K164R;ENSP00000427106:K234R;ENSP00000426613:K241R	ENSP00000057513:K164R	K	-	2	0	TNIP3	122295157	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	4.407000	0.59754	2.066000	0.61787	0.533000	0.62120	AAG	TNIP3	-	NULL	ENSG00000050730		0.373	TNIP3-003	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	TNIP3	HGNC	protein_coding	OTTHUMT00000364000.4	-	0.00	59	0	T	NM_024873	Missense_Mutation	122075707	-1	tier1	-	no_errors	ENST00000057513	ensembl	human	known	74_37	missense	36.17	60	34	SNP	1.000	C
TNR	7143	genome.wustl.edu	37	1	175331871	175331871	+	Missense_Mutation	SNP	C	C	T	rs546435742	byFrequency	TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:175331871C>T	ENST00000367674.2	-	14	3490	c.2782G>A	c.(2782-2784)Gaa>Aaa	p.E928K	TNR_ENST00000263525.2_Missense_Mutation_p.E928K			Q92752	TENR_HUMAN	tenascin R	928	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					ATTTCGTATTCGGTAGCTGGG	0.527													C|||	2	0.000399361	0.0	0.0	5008	,	,		21447	0.0		0.0	False		,,,				2504	0.002																0													216.0	184.0	195.0					1																	175331871		2203	4300	6503	SO:0001583	missense	0			X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.2782G>A	1.37:g.175331871C>T	ENSP00000356646:p.Glu928Lys		C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_Fibronectin_type3	p.E928K	ENST00000367674.2	37	c.2782	CCDS1318.1	1	.	.	.	.	.	.	.	.	.	.	C	16.22	3.061258	0.55432	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.57436	0.4;0.4	5.59	5.59	0.84812	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.053554	0.64402	D	0.000001	T	0.45196	0.1330	L	0.46885	1.475	0.58432	D	0.999999	B	0.15719	0.014	B	0.22152	0.038	T	0.30119	-0.9989	10	0.20046	T	0.44	.	12.1138	0.53854	0.0:0.9191:0.0:0.0809	.	928	Q92752	TENR_HUMAN	K	928;928;838	ENSP00000356646:E928K;ENSP00000263525:E928K	ENSP00000263525:E928K	E	-	1	0	TNR	173598494	0.995000	0.38212	0.944000	0.38274	0.523000	0.34469	3.240000	0.51368	2.625000	0.88918	0.650000	0.86243	GAA	TNR	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000116147		0.527	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNR	HGNC	protein_coding	OTTHUMT00000084414.4	-	0.00	76	0	C	NM_003285		175331871	-1	tier1	-	no_errors	ENST00000263525	ensembl	human	known	74_37	missense	19.02	149	35	SNP	0.997	T
TNXB	7148	genome.wustl.edu	37	6	32036806	32036806	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr6:32036806G>T	ENST00000375244.3	-	16	5896	c.5695C>A	c.(5695-5697)Ctc>Atc	p.L1899I	TNXB_ENST00000375247.2_Missense_Mutation_p.L1899I			P22105	TENX_HUMAN	tenascin XB	1981	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						ATCCAGGAGAGATGCAGGGTG	0.582																																																	0													90.0	101.0	97.0					6																	32036806		1344	2597	3941	SO:0001583	missense	0			X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.5695C>A	6.37:g.32036806G>T	ENSP00000364393:p.Leu1899Ile		P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.L1899I	ENST00000375244.3	37	c.5695		6	.	.	.	.	.	.	.	.	.	.	G	20.3	3.973653	0.74246	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.61510	0.1;0.1	4.94	4.0	0.46444	.	0.000000	0.41001	D	0.000966	T	0.68265	0.2982	M	0.88377	2.95	0.24573	N	0.993913	D	0.76494	0.999	D	0.81914	0.995	T	0.59830	-0.7380	10	0.27785	T	0.31	.	11.6068	0.51037	0.0:0.0:0.8222:0.1778	.	1899	P22105-3	.	I	1899	ENSP00000364393:L1899I;ENSP00000364396:L1899I	ENSP00000364393:L1899I	L	-	1	0	TNXB	32144784	0.994000	0.37717	0.946000	0.38457	0.874000	0.50279	2.522000	0.45572	2.469000	0.83416	0.655000	0.94253	CTC	TNXB	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000168477		0.582	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	TNXB	HGNC	protein_coding	OTTHUMT00000268927.2	-	0.00	59	0	G	NM_019105		32036806	-1	tier1	-	no_errors	ENST00000375247	ensembl	human	known	74_37	missense	6.45	58	4	SNP	0.932	T
TPTE2	93492	genome.wustl.edu	37	13	20038637	20038637	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr13:20038637G>T	ENST00000400230.2	-	10	744	c.700C>A	c.(700-702)Cca>Aca	p.P234T	TPTE2_ENST00000457266.2_Missense_Mutation_p.P123T|TPTE2_ENST00000382978.1_Missense_Mutation_p.P194T|TPTE2_ENST00000255310.6_Missense_Mutation_p.P157T|TPTE2_ENST00000390680.2_Missense_Mutation_p.P157T|TPTE2_ENST00000382975.4_Missense_Mutation_p.P194T|TPTE2_ENST00000382977.4_Missense_Mutation_p.P234T|TPTE2_ENST00000400103.2_Missense_Mutation_p.P123T			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	234	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		CCAGAAGATGGAAATGACATA	0.294																																																	0													98.0	93.0	95.0					13																	20038637		2203	4297	6500	SO:0001583	missense	0			AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.700C>A	13.37:g.20038637G>T	ENSP00000383089:p.Pro234Thr		A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Missense_Mutation	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_Ion_trans_dom,pfam_Dual-sp_phosphatase_cat-dom,superfamily_C2_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.P234T	ENST00000400230.2	37	c.700	CCDS45014.1	13	.	.	.	.	.	.	.	.	.	.	g	10.53	1.376647	0.24857	.	.	ENSG00000132958	ENST00000382978;ENST00000400103;ENST00000400230;ENST00000255310;ENST00000390680;ENST00000382977;ENST00000382975;ENST00000457266;ENST00000343548;ENST00000419256	D;D;D;D;D;D;D;D	0.99388	-5.81;-5.81;-5.81;-5.81;-5.81;-5.81;-5.81;-5.81	2.73	2.73	0.32206	Phosphatase tensin type (1);	0.000000	0.85682	D	0.000000	D	0.99576	0.9847	H	0.98276	4.19	0.54753	D	0.999986	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.97855	1.0277	9	.	.	.	-22.8043	9.1217	0.36791	0.0:0.0:1.0:0.0	.	123;157;234	A8MX64;Q6XPS3-3;Q6XPS3	.;.;TPTE2_HUMAN	T	194;123;234;157;157;234;194;123;234;103	ENSP00000372438:P194T;ENSP00000382974:P123T;ENSP00000383089:P234T;ENSP00000255310:P157T;ENSP00000375098:P157T;ENSP00000372437:P234T;ENSP00000372435:P194T;ENSP00000442218:P123T	.	P	-	1	0	TPTE2	18936637	1.000000	0.71417	1.000000	0.80357	0.021000	0.10359	6.542000	0.73869	1.831000	0.53308	0.467000	0.42956	CCA	TPTE2	-	pfscan_Phosphatase_tensin-typ	ENSG00000132958		0.294	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	TPTE2	HGNC	protein_coding			0.00	76	0	G	NM_199254		20038637	-1			no_errors	ENST00000382977	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	T
TRIM11	81559	genome.wustl.edu	37	1	228582844	228582844	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:228582844C>A	ENST00000284551.6	-	6	1247	c.969G>T	c.(967-969)gaG>gaT	p.E323D	TRIM11_ENST00000460651.1_5'UTR|RP11-245P10.8_ENST00000602963.1_RNA|TRIM11_ENST00000493030.2_Missense_Mutation_p.E198D	NM_145214.2	NP_660215.1	Q96F44	TRI11_HUMAN	tripartite motif containing 11	323	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of neurogenesis (GO:0050768)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of viral entry into host cell (GO:0046598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|skin(1)	18		Prostate(94;0.0724)				GGTCAAAGCGCTCTGGGCTGT	0.706																																																	0													14.0	15.0	15.0					1																	228582844		2194	4293	6487	SO:0001583	missense	0			AF220125	CCDS31048.1	1q42.13	2013-01-09	2011-01-25		ENSG00000154370	ENSG00000154370		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16281	protein-coding gene	gene with protein product		607868	"""tripartite motif-containing 11"""			11331580	Standard	NM_145214		Approved	RNF92, BIA1	uc001hss.3	Q96F44	OTTHUMG00000039773	ENST00000284551.6:c.969G>T	1.37:g.228582844C>A	ENSP00000284551:p.Glu323Asp		A6NKE2|B2RB82|B3KUS3|B4DX88|Q5VSU1|Q8NCA6|Q9C022	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_C3HC4_RING-type,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.E323D	ENST00000284551.6	37	c.969	CCDS31048.1	1	.	.	.	.	.	.	.	.	.	.	C	12.09	1.832657	0.32421	.	.	ENSG00000154370	ENST00000284551	T	0.15139	2.45	5.08	3.07	0.35406	Concanavalin A-like lectin/glucanase (1);SPRY-associated (1);B30.2/SPRY domain (1);	0.294250	0.24730	N	0.036062	T	0.14570	0.0352	L	0.51422	1.61	0.80722	D	1	B;B	0.09022	0.001;0.002	B;B	0.13407	0.006;0.009	T	0.05599	-1.0875	10	0.27082	T	0.32	.	8.1966	0.31400	0.0:0.7504:0.1598:0.0898	.	322;323	Q96F44-3;Q96F44	.;TRI11_HUMAN	D	323	ENSP00000284551:E323D	ENSP00000284551:E323D	E	-	3	2	TRIM11	226649467	0.359000	0.24955	0.987000	0.45799	0.427000	0.31564	-0.014000	0.12656	1.276000	0.44395	0.655000	0.94253	GAG	TRIM11	-	superfamily_ConA-like_lec_gl_sf,smart_PRY,pfscan_B30.2/SPRY	ENSG00000154370		0.706	TRIM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM11	HGNC	protein_coding	OTTHUMT00000095995.3	-	0.00	65	0	C	NM_145214		228582844	-1	tier1	-	no_errors	ENST00000284551	ensembl	human	known	74_37	missense	7.59	73	6	SNP	1.000	A
TRIM5	85363	genome.wustl.edu	37	11	5701291	5701291	+	Silent	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr11:5701291G>T	ENST00000380034.3	-	2	373	c.117C>A	c.(115-117)ctC>ctA	p.L39L	TRIM5_ENST00000380027.1_Silent_p.L39L|TRIM5_ENST00000396855.3_Silent_p.L39L|TRIM5_ENST00000396847.3_Silent_p.L39L|TRIM5_ENST00000396853.4_Silent_p.L39L|TRIM5_ENST00000305836.5_Silent_p.L39L|TRIM5_ENST00000483835.1_5'Flank	NM_033034.2|NM_033092.2	NP_149023.2|NP_149083.2	Q9C035	TRIM5_HUMAN	tripartite motif containing 5	39					activation of innate immune response (GO:0002218)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein K63-linked ubiquitination (GO:0070534)|protein trimerization (GO:0070206)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|signaling pattern recognition receptor activity (GO:0008329)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)|Lung NSC(207;0.138)|all_lung(207;0.221)		Epithelial(150;7.21e-09)|BRCA - Breast invasive adenocarcinoma(625;0.139)		GGTTTGCAGTGAGGCATGCTT	0.552																																																	0													121.0	107.0	112.0					11																	5701291		2201	4297	6498	SO:0001819	synonymous_variant	0			AF220025	CCDS31392.1, CCDS31393.1, CCDS31394.1	11p15	2014-06-03	2011-01-25		ENSG00000132256	ENSG00000132256		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16276	protein-coding gene	gene with protein product	"""tripartite motif protein TRIM5"", ""tripartite motif protein TRIM"""	608487	"""tripartite motif-containing 5"""			11331580	Standard	NM_033034		Approved	RNF88, TRIM5alpha	uc001mbm.2	Q9C035	OTTHUMG00000066893	ENST00000380034.3:c.117C>A	11.37:g.5701291G>T			A6NGQ1|A8WFA8|D3DQS8|D3DQS9|G3GJY1|Q2MLV4|Q2MLV8|Q2MLV9|Q2MLW1|Q2MLW3|Q2MLW4|Q2MLW6|Q2MLW7|Q2MLX1|Q2MLX2|Q2MLX3|Q2MLX5|Q2MLY3|Q2MLY4|Q2V6Q6|Q6GX26|Q8WU46|Q96SR5|Q9C031|Q9C032|Q9C033|Q9C034	Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING	p.L39	ENST00000380034.3	37	c.117	CCDS31393.1	11																																																																																			TRIM5	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	ENSG00000132256		0.552	TRIM5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIM5	HGNC	protein_coding	OTTHUMT00000143360.3		0.00	62	0	G	NM_033034		5701291	-1			no_errors	ENST00000305836	ensembl	human	known	74_37	silent	6.15	61	4	SNP	0.953	T
TRPV4	59341	genome.wustl.edu	37	12	110240891	110240891	+	Missense_Mutation	SNP	C	C	T	rs373108373		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr12:110240891C>T	ENST00000418703.2	-	3	711	c.617G>A	c.(616-618)cGc>cAc	p.R206H	TRPV4_ENST00000346520.2_Missense_Mutation_p.R206H|TRPV4_ENST00000537083.1_Missense_Mutation_p.R206H|TRPV4_ENST00000544971.1_Missense_Mutation_p.R206H|TRPV4_ENST00000261740.2_Missense_Mutation_p.R206H|TRPV4_ENST00000392719.2_Missense_Mutation_p.R206H|TRPV4_ENST00000541794.1_Missense_Mutation_p.R206H|TRPV4_ENST00000536838.1_Missense_Mutation_p.R172H	NM_001177431.1	NP_001170902.1	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel, subfamily V, member 4	206					actin cytoskeleton reorganization (GO:0031532)|actin filament organization (GO:0007015)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cell death (GO:0008219)|cell volume homeostasis (GO:0006884)|cell-cell junction assembly (GO:0007043)|cellular calcium ion homeostasis (GO:0006874)|cellular hypotonic response (GO:0071476)|cellular response to heat (GO:0034605)|cellular response to osmotic stress (GO:0071470)|cortical microtubule organization (GO:0043622)|hyperosmotic salinity response (GO:0042538)|ion transmembrane transport (GO:0034220)|microtubule polymerization (GO:0046785)|negative regulation of neuron projection development (GO:0010977)|osmosensory signaling pathway (GO:0007231)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of microtubule depolymerization (GO:0031117)|regulation of response to osmotic stress (GO:0047484)|response to mechanical stimulus (GO:0009612)|transmembrane transport (GO:0055085)|vasopressin secretion (GO:0030103)	adherens junction (GO:0005912)|cell surface (GO:0009986)|cilium (GO:0005929)|cortical actin cytoskeleton (GO:0030864)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|beta-tubulin binding (GO:0048487)|calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)|cation channel activity (GO:0005261)|microtubule binding (GO:0008017)|osmosensor activity (GO:0005034)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(7)|ovary(3)|prostate(2)|skin(4)|stomach(1)	35						GGTGTCGTTGCGGCCATTGCT	0.582																																																	0													133.0	105.0	114.0					12																	110240891		2203	4300	6503	SO:0001583	missense	0			AF263523	CCDS9134.1, CCDS9135.1, CCDS53827.1, CCDS53828.1, CCDS53829.1	12q24.1	2014-09-17				ENSG00000111199		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18083	protein-coding gene	gene with protein product	"""osmosensitive transient receptor potential channel 4"""	605427				11025659, 11081638, 16382100, 20037587	Standard	NM_147204		Approved	OTRPC4, TRP12, VROAC, VRL-2, VR-OAC, CMT2C	uc001tpk.2	Q9HBA0		ENST00000418703.2:c.617G>A	12.37:g.110240891C>T	ENSP00000406191:p.Arg206His		B7ZKQ6|Q17R79|Q2Y122|Q2Y123|Q2Y124|Q86YZ6|Q8NDY7|Q8NG64|Q96Q92|Q96RS7|Q9HBC0	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Ion_trans_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPV1-4_channel,prints_TRPV4_channel,tigrfam_TRP_channel	p.R206H	ENST00000418703.2	37	c.617	CCDS9134.1	12	.	.	.	.	.	.	.	.	.	.	C	11.92	1.783003	0.31593	.	.	ENSG00000111199	ENST00000418703;ENST00000261740;ENST00000392719;ENST00000346520;ENST00000544971;ENST00000537083;ENST00000541794;ENST00000536838	D;D;D;D;D;D;D;D	0.89343	-2.48;-2.48;-2.31;-2.5;-2.32;-2.5;-2.31;-2.48	4.51	2.69	0.31865	.	0.368310	0.31450	N	0.007624	T	0.79311	0.4424	L	0.34521	1.04	0.22947	N	0.998522	B;B;B;B;B	0.19706	0.024;0.008;0.038;0.003;0.004	B;B;B;B;B	0.13407	0.002;0.001;0.009;0.005;0.001	T	0.60667	-0.7218	10	0.15952	T	0.53	-1.4684	7.5579	0.27835	0.0:0.7313:0.0:0.2687	.	206;206;206;206;172	Q9HBA0-2;Q9HBA0;Q9HBA0-6;Q9HBA0-4;Q9HBA0-5	.;TRPV4_HUMAN;.;.;.	H	206;206;206;206;206;206;206;172	ENSP00000406191:R206H;ENSP00000261740:R206H;ENSP00000376480:R206H;ENSP00000319003:R206H;ENSP00000443611:R206H;ENSP00000442738:R206H;ENSP00000442167:R206H;ENSP00000444336:R172H	ENSP00000261740:R206H	R	-	2	0	TRPV4	108725274	0.003000	0.15002	0.959000	0.39883	0.561000	0.35649	0.306000	0.19279	0.475000	0.27415	0.561000	0.74099	CGC	TRPV4	-	tigrfam_TRP_channel	ENSG00000111199		0.582	TRPV4-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TRPV4	HGNC	protein_coding	OTTHUMT00000403270.1	-	0.00	62	0	C	NM_021625		110240891	-1	tier1	-	no_errors	ENST00000261740	ensembl	human	known	74_37	missense	12.90	54	8	SNP	1.000	T
TSHZ3	57616	genome.wustl.edu	37	19	31769762	31769762	+	Missense_Mutation	SNP	C	C	T	rs200738522		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr19:31769762C>T	ENST00000240587.4	-	2	1264	c.937G>A	c.(937-939)Gcc>Acc	p.A313T		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	313					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					ATTTTGGCGGCGACAGGAGTG	0.542																																																	0													86.0	87.0	87.0					19																	31769762		2203	4300	6503	SO:0001583	missense	0			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.937G>A	19.37:g.31769762C>T	ENSP00000240587:p.Ala313Thr		Q9H0G6|Q9P254	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.A313T	ENST00000240587.4	37	c.937	CCDS12421.2	19	.	.	.	.	.	.	.	.	.	.	C	3.099	-0.185174	0.06340	.	.	ENSG00000121297	ENST00000240587	T	0.12039	2.72	5.46	0.995	0.19838	.	0.107758	0.64402	N	0.000007	T	0.06280	0.0162	N	0.08118	0	0.49389	D	0.999786	B	0.12630	0.006	B	0.08055	0.003	T	0.36504	-0.9745	10	0.29301	T	0.29	-1.1298	10.0143	0.42006	0.0:0.729:0.0:0.271	.	313	Q63HK5	TSH3_HUMAN	T	313	ENSP00000240587:A313T	ENSP00000240587:A313T	A	-	1	0	TSHZ3	36461602	0.977000	0.34250	0.029000	0.17559	0.209000	0.24338	2.485000	0.45250	0.036000	0.15547	-0.736000	0.03550	GCC	TSHZ3	-	NULL	ENSG00000121297		0.542	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ3	HGNC	protein_coding	OTTHUMT00000316743.2	-	0.00	34	0	C	NM_020856		31769762	-1	tier1	rs200738522	no_errors	ENST00000240587	ensembl	human	known	74_37	missense	21.69	61	18	SNP	0.907	T
TTC28	23331	genome.wustl.edu	37	22	28389392	28389392	+	Missense_Mutation	SNP	C	C	T	rs557556022		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr22:28389392C>T	ENST00000397906.2	-	18	5500	c.5359G>A	c.(5359-5361)Gct>Act	p.A1787T	TTC28-AS1_ENST00000424161.1_RNA|TTC28-AS1_ENST00000430853.1_RNA|TTC28-AS1_ENST00000428584.1_RNA|TTC28-AS1_ENST00000433317.1_RNA|TTC28-AS1_ENST00000417497.1_RNA|TTC28-AS1_ENST00000454741.1_RNA|TTC28-AS1_ENST00000452612.1_RNA|TTC28-AS1_ENST00000453632.1_RNA|TTC28-AS1_ENST00000434221.1_RNA|TTC28-AS1_ENST00000430525.1_RNA|TTC28-AS1_ENST00000435348.1_RNA	NM_001145418.1	NP_001138890.1	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28	1787					mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)				endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)	12						AAGCCCACAGCGGTGAGGAGG	0.662													C|||	1	0.000199681	0.0	0.0	5008	,	,		17717	0.001		0.0	False		,,,				2504	0.0																0													45.0	48.0	47.0					22																	28389392		692	1591	2283	SO:0001583	missense	0			AB028966	CCDS46678.1	22q12.1	2013-01-10			ENSG00000100154	ENSG00000100154		"""Tetratricopeptide (TTC) repeat domain containing"""	29179	protein-coding gene	gene with protein product		615098				10470851	Standard	NM_001145418		Approved	KIAA1043	uc003adp.4	Q96AY4	OTTHUMG00000151006	ENST00000397906.2:c.5359G>A	22.37:g.28389392C>T	ENSP00000381003:p.Ala1787Thr		K7ZRV2|O95928|O95929|Q5W189|Q9NTE4|Q9UG31|Q9UGG5|Q9UPV8|Q9Y3S5	Missense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.A1787T	ENST00000397906.2	37	c.5359	CCDS46678.1	22	.	.	.	.	.	.	.	.	.	.	C	37	5.986613	0.97173	.	.	ENSG00000100154	ENST00000397906;ENST00000431039	D	0.91894	-2.93	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	D	0.93452	0.7911	L	0.50333	1.59	0.80722	D	1	D	0.69078	0.997	P	0.56163	0.793	D	0.94221	0.7467	10	0.87932	D	0	-15.3252	17.6499	0.88161	0.0:1.0:0.0:0.0	.	1787	Q96AY4	TTC28_HUMAN	T	1787;74	ENSP00000381003:A1787T	ENSP00000381003:A1787T	A	-	1	0	TTC28	26719392	0.993000	0.37304	0.692000	0.30179	0.990000	0.78478	5.699000	0.68310	2.491000	0.84063	0.563000	0.77884	GCT	TTC28	-	NULL	ENSG00000100154		0.662	TTC28-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	TTC28	HGNC	protein_coding	OTTHUMT00000320930.2	-	0.00	87	0	C	XM_929318		28389392	-1	tier1	-	no_errors	ENST00000397906	ensembl	human	novel	74_37	missense	50.00	29	29	SNP	0.999	T
TTN	7273	genome.wustl.edu	37	2	179396213	179396213	+	Silent	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr2:179396213G>T	ENST00000591111.1	-	308	100430	c.100206C>A	c.(100204-100206)cgC>cgA	p.R33402R	TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000460472.2_Silent_p.R25978R|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_Silent_p.R35043R|TTN_ENST00000342175.6_Silent_p.R26170R|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN_ENST00000359218.5_Silent_p.R26103R|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000589355.1_RNA|TTN_ENST00000342992.6_Silent_p.R32475R|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000592600.1_RNA			Q8WZ42	TITIN_HUMAN	titin	33402					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTCATCTCTGCGTTGGGAAG	0.488																																																	0													122.0	121.0	121.0					2																	179396213		1940	4156	6096	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.100206C>A	2.37:g.179396213G>T			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.R32475	ENST00000591111.1	37	c.97425		2																																																																																			TTN	-	superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom	ENSG00000155657		0.488	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	40	0	G	NM_133378		179396213	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	silent	9.30	39	4	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179401681	179401681	+	Silent	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr2:179401681G>T	ENST00000591111.1	-	306	95456	c.95232C>A	c.(95230-95232)atC>atA	p.I31744I	TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000460472.2_Silent_p.I24320I|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_Silent_p.I33385I|TTN_ENST00000342175.6_Silent_p.I24512I|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000415561.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN_ENST00000359218.5_Silent_p.I24445I|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342992.6_Silent_p.I30817I|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000592600.1_RNA			Q8WZ42	TITIN_HUMAN	titin	31744	Fibronectin type-III 130. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GACTCTTAATGATCACAACTG	0.378																																																	0													47.0	45.0	45.0					2																	179401681		1869	4107	5976	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.95232C>A	2.37:g.179401681G>T			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.I30817	ENST00000591111.1	37	c.92451		2																																																																																			TTN	-	superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom	ENSG00000155657		0.378	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1		0.00	43	0	G	NM_133378		179401681	-1			no_errors	ENST00000342992	ensembl	human	known	74_37	silent	6.98	40	3	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179404446	179404446	+	Silent	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr2:179404446G>T	ENST00000591111.1	-	302	93647	c.93423C>A	c.(93421-93423)ggC>ggA	p.G31141G	TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000460472.2_Silent_p.G23717G|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_Silent_p.G32782G|TTN_ENST00000342175.6_Silent_p.G23909G|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000415561.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN_ENST00000359218.5_Silent_p.G23842G|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000588804.1_RNA|RP11-65L3.4_ENST00000604692.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000342992.6_Silent_p.G30214G|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000592600.1_RNA			Q8WZ42	TITIN_HUMAN	titin	31141	Ig-like 139.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.G23842G(1)|p.G23909G(1)|p.G23717G(1)|p.G30212G(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAGCCTTCTTGCCACATTTAT	0.478																																																	4	Substitution - coding silent(4)	large_intestine(4)											122.0	112.0	115.0					2																	179404446		1985	4162	6147	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.93423C>A	2.37:g.179404446G>T			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.G30214	ENST00000591111.1	37	c.90642		2																																																																																			TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2	ENSG00000155657		0.478	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1		0.00	21	0	G	NM_133378		179404446	-1			no_errors	ENST00000342992	ensembl	human	known	74_37	silent	7.69	24	2	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179424606	179424608	+	In_Frame_Del	DEL	TTC	TTC	-			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	TTC	TTC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr2:179424606_179424608delTTC	ENST00000591111.1	-	276	81552_81554	c.81328_81330delGAA	c.(81328-81330)gaadel	p.E27110del	TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000460472.2_In_Frame_Del_p.E19686del|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_In_Frame_Del_p.E28751del|TTN_ENST00000342175.6_In_Frame_Del_p.E19878del|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_In_Frame_Del_p.E19811del|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000342992.6_In_Frame_Del_p.E26183del|TTN-AS1_ENST00000592600.1_RNA			Q8WZ42	TITIN_HUMAN	titin	27110	Ig-like 129.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAAATAAAGGTTCTTCTTCTCTT	0.433																																																	0																																										SO:0001651	inframe_deletion	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.81328_81330delGAA	2.37:g.179424612_179424614delTTC	ENSP00000465570:p.Glu27110del		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	In_Frame_Del	DEL	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.E26183in_frame_del	ENST00000591111.1	37	c.78549_78547		2																																																																																			TTN	-	superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,pfscan_Ig-like_dom	ENSG00000155657		0.433	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1		0.00	26	0	TTC	NM_133378		179424608	-1			no_errors	ENST00000342992	ensembl	human	known	74_37	in_frame_del	12.50	49	7	DEL	1.000:1.000:1.000	0
TTN	7273	genome.wustl.edu	37	2	179439379	179439379	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr2:179439379G>T	ENST00000591111.1	-	276	66781	c.66557C>A	c.(66556-66558)cCt>cAt	p.P22186H	TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.P14762H|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P23827H|TTN_ENST00000342175.6_Missense_Mutation_p.P14954H|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P14887H|RP11-171I2.5_ENST00000604215.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P21259H|TTN-AS1_ENST00000592600.1_RNA			Q8WZ42	TITIN_HUMAN	titin	22186					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGGAGGTCCAGGAACCTTAAA	0.458																																																	0													107.0	100.0	102.0					2																	179439379		1923	4151	6074	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.66557C>A	2.37:g.179439379G>T	ENSP00000465570:p.Pro22186His		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.P21259H	ENST00000591111.1	37	c.63776		2	.	.	.	.	.	.	.	.	.	.	G	14.04	2.416018	0.42817	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07	5.7	5.7	0.88788	Fibronectin, type III (3);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.88314	0.6403	H	0.98426	4.23	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;1.0;1.0;0.998	D	0.92392	0.5922	9	0.87932	D	0	.	19.8266	0.96619	0.0:0.0:1.0:0.0	.	14762;14887;14954;22186	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	H	21259;14762;14954;14887;14760	ENSP00000343764:P21259H;ENSP00000434586:P14762H;ENSP00000340554:P14954H;ENSP00000352154:P14887H	ENSP00000340554:P14954H	P	-	2	0	TTN	179147625	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.807000	0.99171	2.699000	0.92147	0.650000	0.86243	CCT	TTN	-	superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.458	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	39	0	G	NM_133378		179439379	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	12.07	51	7	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179453427	179453427	+	Silent	SNP	G	G	T	rs368452607		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr2:179453427G>T	ENST00000591111.1	-	254	58326	c.58102C>A	c.(58102-58104)Cga>Aga	p.R19368R	TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000460472.2_Silent_p.R11944R|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_Silent_p.R21009R|TTN_ENST00000342175.6_Silent_p.R12136R|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000359218.5_Silent_p.R12069R|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342992.6_Silent_p.R18441R|TTN-AS1_ENST00000590743.1_RNA			Q8WZ42	TITIN_HUMAN	titin	19368	Fibronectin type-III 40. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R12136*(1)|p.R18441*(1)|p.R18439*(1)|p.R11944*(1)|p.R12069*(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGGACCCATCGTGTTGAATGC	0.423																																																	5	Substitution - Nonsense(5)	lung(5)						G	,,,	1,3807		0,1,1903	164.0	154.0	157.0		35830,55321,36205,36406	5.3	0.9	2		157	0,8244		0,0,4122	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	TTN	NM_003319.4,NM_133378.4,NM_133432.3,NM_133437.3	,,,	0,1,6025	TT,TG,GG		0.0,0.0263,0.0083	,,,	11944/26927,18441/33424,12069/27052,12136/27119	179453427	1,12051	1904	4122	6026	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.58102C>A	2.37:g.179453427G>T			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.R18441	ENST00000591111.1	37	c.55321		2																																																																																			TTN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.423	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1		0.00	35	0	G	NM_133378		179453427	-1			no_errors	ENST00000342992	ensembl	human	known	74_37	silent	5.17	55	3	SNP	0.985	T
TTN	7273	genome.wustl.edu	37	2	179577515	179577515	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr2:179577515G>T	ENST00000591111.1	-	92	26510	c.26286C>A	c.(26284-26286)ttC>ttA	p.F8762L	TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.F9079L|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.F7835L			Q8WZ42	TITIN_HUMAN	titin	12915	Ig-like 70.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TATCTACATCGAACAACTCCA	0.423																																																	0													89.0	84.0	85.0					2																	179577515		1931	4124	6055	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.26286C>A	2.37:g.179577515G>T	ENSP00000465570:p.Phe8762Leu		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.F7835L	ENST00000591111.1	37	c.23505		2	.	.	.	.	.	.	.	.	.	.	G	13.14	2.148714	0.37923	.	.	ENSG00000155657	ENST00000342992	T	0.65732	-0.17	5.48	2.98	0.34508	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.43656	0.1257	N	0.12887	0.27	0.80722	D	1	P	0.35124	0.485	B	0.36504	0.226	T	0.46843	-0.9162	9	0.87932	D	0	.	9.5076	0.39056	0.8547:0.0:0.1453:0.0	.	8762	Q8WZ42	TITIN_HUMAN	L	7835	ENSP00000343764:F7835L	ENSP00000343764:F7835L	F	-	3	2	TTN	179285760	0.999000	0.42202	1.000000	0.80357	0.991000	0.79684	2.332000	0.43903	1.002000	0.39104	-0.290000	0.09829	TTC	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000155657		0.423	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1		0.00	29	0	G	NM_133378		179577515	-1			no_errors	ENST00000342992	ensembl	human	known	74_37	missense	9.52	19	2	SNP	1.000	T
TUBA3C	7278	genome.wustl.edu	37	13	19751215	19751215	+	Missense_Mutation	SNP	A	A	G			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr13:19751215A>G	ENST00000400113.3	-	4	1012	c.908T>C	c.(907-909)gTc>gCc	p.V303A		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	303					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		GTCACACTTGACCATCTGATT	0.602																																																	0													168.0	144.0	152.0					13																	19751215		2203	4300	6503	SO:0001583	missense	0			AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.908T>C	13.37:g.19751215A>G	ENSP00000382982:p.Val303Ala		A6NJQ0|Q5W099|Q6PEY3|Q96F18	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin,prints_Beta_tubulin	p.V303A	ENST00000400113.3	37	c.908	CCDS9284.1	13	.	.	.	.	.	.	.	.	.	.	a	11.68	1.710104	0.30322	.	.	ENSG00000198033	ENST00000400113;ENST00000360801	D	0.84146	-1.81	1.21	1.21	0.21127	.	0.000000	0.42294	U	0.000739	D	0.83991	0.5374	.	.	.	0.39940	D	0.974408	.	.	.	.	.	.	T	0.80944	-0.1156	7	0.45353	T	0.12	.	6.5532	0.22446	1.0:0.0:0.0:0.0	.	.	.	.	A	303	ENSP00000382982:V303A	ENSP00000354037:V303A	V	-	2	0	TUBA3C	18649215	1.000000	0.71417	0.998000	0.56505	0.661000	0.39034	7.474000	0.81024	0.809000	0.34255	0.155000	0.16302	GTC	TUBA3C	-	pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tub_FtsZ_C,smart_Tubulin/FtsZ_2-layer-sand-dom	ENSG00000198033		0.602	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	TUBA3C	HGNC	protein_coding	OTTHUMT00000044007.2	-	0.00	184	0	A	NM_006001		19751215	-1	tier1	-	no_errors	ENST00000400113	ensembl	human	known	74_37	missense	12.96	141	21	SNP	1.000	G
TUBGCP4	27229	genome.wustl.edu	37	15	43678001	43678001	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr15:43678001G>T	ENST00000260383.7	+	8	990	c.736G>T	c.(736-738)Gaa>Taa	p.E246*	TUBGCP4_ENST00000564079.1_Nonsense_Mutation_p.E246*|TUBGCP4_ENST00000399460.3_Nonsense_Mutation_p.E110*			Q9UGJ1	GCP4_HUMAN	tubulin, gamma complex associated protein 4	246					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|protein complex assembly (GO:0006461)	centrosome (GO:0005813)|cytosol (GO:0005829)|gamma-tubulin ring complex (GO:0008274)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|spindle pole (GO:0000922)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(4)|prostate(2)|upper_aerodigestive_tract(2)	21		all_cancers(109;1.27e-10)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.72e-06)|all_lung(180;1.59e-05)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;3.53e-07)		CCTGATTGAGGAAGAGAACAT	0.438																																																	0													117.0	107.0	110.0					15																	43678001		1937	4157	6094	SO:0001587	stop_gained	0			AJ249677	CCDS42030.1, CCDS66745.1	15q15.3	2014-08-12			ENSG00000137822	ENSG00000137822			16691	protein-coding gene	gene with protein product		609610				10562286	Standard	NM_001286414		Approved	76P, FLJ14797	uc001zrn.3	Q9UGJ1	OTTHUMG00000176647	ENST00000260383.7:c.736G>T	15.37:g.43678001G>T	ENSP00000260383:p.Glu246*		B3KNK6|Q969X3|Q9NVF0	Nonsense_Mutation	SNP	pfam_TUBGCP	p.E246*	ENST00000260383.7	37	c.736		15	.	.	.	.	.	.	.	.	.	.	G	37	6.454026	0.97581	.	.	ENSG00000137822	ENST00000260383;ENST00000399460	.	.	.	5.74	4.83	0.62350	.	0.043243	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-19.4138	14.1301	0.65247	0.0718:0.0:0.9282:0.0	.	.	.	.	X	246;110	.	ENSP00000260383:E246X	E	+	1	0	TUBGCP4	41465293	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.813000	0.99286	1.576000	0.49790	0.561000	0.74099	GAA	TUBGCP4	-	pfam_TUBGCP	ENSG00000137822		0.438	TUBGCP4-001	KNOWN	basic|appris_candidate_longest	protein_coding	TUBGCP4	HGNC	protein_coding	OTTHUMT00000432970.1	-	0.00	71	0	G	NM_014444		43678001	+1	tier1	-	no_errors	ENST00000260383	ensembl	human	known	74_37	nonsense	5.41	70	4	SNP	1.000	T
TUSC2	11334	genome.wustl.edu	37	3	50363557	50363557	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr3:50363557C>A	ENST00000232496.4	-	3	471	c.328G>T	c.(328-330)Gtg>Ttg	p.V110L	TUSC2_ENST00000462137.1_Intron	NM_007275.1	NP_009206.1	O75896	TUSC2_HUMAN	tumor suppressor candidate 2	110					cell cycle (GO:0007049)|cell maturation (GO:0048469)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|chemokine (C-C motif) ligand 5 production (GO:0071609)|inflammatory response (GO:0006954)|interleukin-15 production (GO:0032618)|natural killer cell differentiation (GO:0001779)|negative regulation of interleukin-17 production (GO:0032700)|neutrophil mediated killing of gram-negative bacterium (GO:0070945)|phagocytosis (GO:0006909)|positive regulation of interleukin-10 production (GO:0032733)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to defense-related host reactive oxygen species production (GO:0052567)	mitochondrion (GO:0005739)				lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		CAGGGTCACACCTCATAGAGG	0.602																																																	0													45.0	36.0	39.0					3																	50363557		2202	4295	6497	SO:0001583	missense	0			AF055479	CCDS2819.1	3p21.3	2010-09-21	2004-01-20	2004-01-21	ENSG00000114383	ENSG00000114383			17034	protein-coding gene	gene with protein product		607052	"""PDGFA associated protein 2"""	PDAP2		8780057, 11593436	Standard	NM_007275		Approved	FUS1, PAP, C3orf11	uc003czy.1	O75896	OTTHUMG00000156877	ENST00000232496.4:c.328G>T	3.37:g.50363557C>A	ENSP00000232496:p.Val110Leu		B2R4Y9	Missense_Mutation	SNP	NULL	p.V110L	ENST00000232496.4	37	c.328	CCDS2819.1	3	.	.	.	.	.	.	.	.	.	.	C	19.24	3.789680	0.70337	.	.	ENSG00000114383	ENST00000232496	.	.	.	5.6	1.27	0.21489	.	0.351696	0.32218	N	0.006418	T	0.56077	0.1961	M	0.63428	1.95	0.42723	D	0.993681	B	0.26602	0.154	B	0.21360	0.034	T	0.58025	-0.7709	9	0.66056	D	0.02	.	11.9831	0.53131	0.0:0.7433:0.0:0.2567	.	110	O75896	TUSC2_HUMAN	L	110	.	ENSP00000232496:V110L	V	-	1	0	TUSC2	50338561	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	1.315000	0.33608	0.324000	0.23333	-0.137000	0.14449	GTG	TUSC2	-	NULL	ENSG00000114383		0.602	TUSC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUSC2	HGNC	protein_coding	OTTHUMT00000346399.1	-	0.00	97	0	C	NM_007275		50363557	-1	tier1	-	no_errors	ENST00000232496	ensembl	human	known	74_37	missense	17.05	73	15	SNP	1.000	A
TYRO3	7301	genome.wustl.edu	37	15	41853368	41853368	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr15:41853368G>T	ENST00000263798.3	+	2	392	c.168G>T	c.(166-168)caG>caT	p.Q56H	TYRO3_ENST00000559066.1_Missense_Mutation_p.Q11H	NM_006293.3	NP_006284.2	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase	56	Ig-like C2-type 1.				apoptotic cell clearance (GO:0043277)|cell adhesion (GO:0007155)|forebrain cell migration (GO:0021885)|natural killer cell differentiation (GO:0001779)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|neuron cellular homeostasis (GO:0070050)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein autophosphorylation (GO:0046777)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(26)|ovary(3)|prostate(1)	43		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		CAGTGTCTCAGGGGCAGCCGG	0.577																																																	0													68.0	69.0	69.0					15																	41853368		2203	4300	6503	SO:0001583	missense	0			D50479	CCDS10080.1	15q15.1-q21.1	2013-02-11			ENSG00000092445	ENSG00000092445	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12446	protein-coding gene	gene with protein product		600341		RSE		7851890	Standard	NM_006293		Approved	Dtk, Brt, Tif, Sky	uc001zof.2	Q06418	OTTHUMG00000130341	ENST00000263798.3:c.168G>T	15.37:g.41853368G>T	ENSP00000263798:p.Gln56His		O14953|Q86VR3	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.Q56H	ENST00000263798.3	37	c.168	CCDS10080.1	15	.	.	.	.	.	.	.	.	.	.	G	19.19	3.779084	0.70107	.	.	ENSG00000092445	ENST00000263798	D	0.83837	-1.77	4.78	2.74	0.32292	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.39909	N	0.001232	D	0.89632	0.6771	M	0.79258	2.445	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.90118	0.4197	10	0.66056	D	0.02	-17.5847	11.722	0.51688	0.1687:0.0:0.8313:0.0	.	56;117	Q06418;Q59FM9	TYRO3_HUMAN;.	H	56	ENSP00000263798:Q56H	ENSP00000263798:Q56H	Q	+	3	2	TYRO3	39640660	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.146000	0.58072	1.241000	0.43820	0.549000	0.68633	CAG	TYRO3	-	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000092445		0.577	TYRO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYRO3	HGNC	protein_coding	OTTHUMT00000252693.2	-	0.00	69	0	G			41853368	+1	tier1	-	no_errors	ENST00000263798	ensembl	human	known	74_37	missense	5.06	75	4	SNP	1.000	T
UGT1A10	54575	genome.wustl.edu	37	2	234545575	234545575	+	Missense_Mutation	SNP	A	A	G			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr2:234545575A>G	ENST00000344644.5	+	1	476	c.407A>G	c.(406-408)tAc>tGc	p.Y136C	UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000373445.1_Missense_Mutation_p.Y136C	NM_019075.2	NP_061948.1	Q9HAW8	UD110_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A10	136					cellular glucuronidation (GO:0052695)|flavone metabolic process (GO:0051552)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(2)|skin(3)	32		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0334)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;1.96e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000468)|Lung(119;0.00381)|LUSC - Lung squamous cell carcinoma(224;0.008)	Acetaminophen(DB00316)|Etodolac(DB00749)|Losartan(DB00678)|Mycophenolate mofetil(DB00688)|Valproic Acid(DB00313)	TTAGTAGAATACTTAAAGGAG	0.358																																																	0													123.0	131.0	128.0					2																	234545575		2203	4299	6502	SO:0001583	missense	0			U39550	CCDS33403.1	2q37	2010-03-05	2005-07-20		ENSG00000242515	ENSG00000242515		"""UDP glucuronosyltransferases"""	12531	other	complex locus constituent		606435	"""UDP glycosyltransferase 1 family, polypeptide A10"""			9295054, 9325166	Standard	NM_019075		Approved	UGT1J		Q9HAW8	OTTHUMG00000059121	ENST00000344644.5:c.407A>G	2.37:g.234545575A>G	ENSP00000343838:p.Tyr136Cys		O00474|Q6NT91|Q7Z6H8	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.Y136C	ENST00000344644.5	37	c.407	CCDS33403.1	2	.	.	.	.	.	.	.	.	.	.	A	5.974	0.363645	0.11296	.	.	ENSG00000242515	ENST00000344644;ENST00000373445	T;T	0.59638	0.25;0.25	3.52	3.52	0.40303	.	.	.	.	.	T	0.75788	0.3897	M	0.80746	2.51	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.99	T	0.65236	-0.6217	9	0.62326	D	0.03	.	12.5346	0.56135	1.0:0.0:0.0:0.0	.	136;136	Q9HAW8;Q7Z6H8	UD110_HUMAN;.	C	136	ENSP00000343838:Y136C;ENSP00000362544:Y136C	ENSP00000343838:Y136C	Y	+	2	0	UGT1A10	234210314	0.000000	0.05858	0.042000	0.18584	0.156000	0.22039	0.108000	0.15396	1.624000	0.50355	0.333000	0.21579	TAC	UGT1A10	-	pfam_UDP_glucos_trans	ENSG00000242515		0.358	UGT1A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT1A10	HGNC	protein_coding	OTTHUMT00000130986.1	-	0.00	54	0	A	NM_019075		234545575	+1	tier1	-	no_errors	ENST00000344644	ensembl	human	known	74_37	missense	7.96	104	9	SNP	0.001	G
URB1	9875	genome.wustl.edu	37	21	33694247	33694247	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr21:33694247G>T	ENST00000382751.3	-	34	5463	c.5348C>A	c.(5347-5349)aCa>aAa	p.T1783K		NM_014825.2	NP_055640.2	O60287	NPA1P_HUMAN	URB1 ribosome biogenesis 1 homolog (S. cerevisiae)	1783						nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(3)|skin(1)|stomach(1)	19						CTTCTGCTCTGTTTTTTGCTA	0.473																																																	0													36.0	38.0	38.0					21																	33694247		692	1591	2283	SO:0001583	missense	0			AB011111	CCDS46645.1	21q22.11	2006-11-28	2006-11-28	2006-11-28	ENSG00000142207	ENSG00000142207			17344	protein-coding gene	gene with protein product	nucleolar preribosomal-associated protein 1	608865	"""chromosome 21 open reading frame 108"""	C21orf108		9628581	Standard	NM_014825		Approved	KIAA0539, NPA1	uc002ypn.2	O60287	OTTHUMG00000064919	ENST00000382751.3:c.5348C>A	21.37:g.33694247G>T	ENSP00000372199:p.Thr1783Lys		D3DSE5|Q96NX1|Q9NYQ1	Missense_Mutation	SNP	pfam_Npa1_N,superfamily_ARM-type_fold	p.T1783K	ENST00000382751.3	37	c.5348	CCDS46645.1	21	.	.	.	.	.	.	.	.	.	.	G	1.853	-0.464626	0.04476	.	.	ENSG00000142207	ENST00000382751	T	0.29142	1.58	5.09	2.82	0.32997	.	0.404768	0.31859	N	0.006956	T	0.17323	0.0416	L	0.43152	1.355	0.09310	N	1	B	0.21688	0.059	B	0.13407	0.009	T	0.28170	-1.0052	10	0.05721	T	0.95	-10.1252	4.2764	0.10811	0.1712:0.0:0.5816:0.2472	.	1783	O60287	NPA1P_HUMAN	K	1783	ENSP00000372199:T1783K	ENSP00000372199:T1783K	T	-	2	0	URB1	32616118	0.015000	0.18098	0.002000	0.10522	0.056000	0.15407	2.215000	0.42862	1.071000	0.40834	0.561000	0.74099	ACA	URB1	-	superfamily_ARM-type_fold	ENSG00000142207		0.473	URB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	URB1	HGNC	protein_coding	OTTHUMT00000139400.2	-	0.00	55	0	G			33694247	-1	tier1	-	no_errors	ENST00000382751	ensembl	human	known	74_37	missense	39.53	26	17	SNP	0.007	T
UROC1	131669	genome.wustl.edu	37	3	126208173	126208173	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr3:126208173C>A	ENST00000290868.2	-	17	1707	c.1654G>T	c.(1654-1656)Gac>Tac	p.D552Y	UROC1_ENST00000383579.3_Missense_Mutation_p.D612Y	NM_144639.2	NP_653240.1	Q96N76	HUTU_HUMAN	urocanate hydratase 1	552					cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	urocanate hydratase activity (GO:0016153)	p.D552N(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(1)|skin(1)	39				GBM - Glioblastoma multiforme(114;0.17)		AAGGGGCTGTCGGTGCCGCTC	0.537																																																	1	Substitution - Missense(1)	large_intestine(1)											147.0	136.0	140.0					3																	126208173		2203	4300	6503	SO:0001583	missense	0			AK055862	CCDS3038.1, CCDS54636.1	3q21.2	2012-08-21	2012-08-21		ENSG00000159650	ENSG00000159650	4.2.1.49		26444	protein-coding gene	gene with protein product	"""urocanase 1"""	613012	"""urocanase domain containing 1"""			19304569	Standard	NM_144639		Approved	FLJ31300, HMFN0320	uc010hsi.2	Q96N76	OTTHUMG00000162753	ENST00000290868.2:c.1654G>T	3.37:g.126208173C>A	ENSP00000290868:p.Asp552Tyr		E9PE13|Q14C64|Q68CJ7	Missense_Mutation	SNP	pfam_Urocanase,superfamily_Urocanase,pirsf_Urocanase	p.D552Y	ENST00000290868.2	37	c.1654	CCDS3038.1	3	.	.	.	.	.	.	.	.	.	.	C	21.3	4.133796	0.77662	.	.	ENSG00000159650	ENST00000290868;ENST00000383579	T;T	0.47528	0.84;0.84	4.59	4.59	0.56863	Urocanase domain (2);Urocanase conserved site (1);	0.000000	0.85682	D	0.000000	T	0.77498	0.4139	H	0.95780	3.72	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85043	0.0924	10	0.87932	D	0	-10.501	15.247	0.73513	0.0:1.0:0.0:0.0	.	612;552	E9PE13;Q96N76	.;HUTU_HUMAN	Y	552;612	ENSP00000290868:D552Y;ENSP00000373073:D612Y	ENSP00000290868:D552Y	D	-	1	0	UROC1	127690863	1.000000	0.71417	0.989000	0.46669	0.773000	0.43773	6.781000	0.75068	2.247000	0.74100	0.491000	0.48974	GAC	UROC1	-	pfam_Urocanase,superfamily_Urocanase,pirsf_Urocanase	ENSG00000159650		0.537	UROC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UROC1	HGNC	protein_coding	OTTHUMT00000370325.2		0.00	57	0	C	NM_144639		126208173	-1			no_errors	ENST00000290868	ensembl	human	known	74_37	missense	5.66	50	3	SNP	0.999	A
USP29	57663	genome.wustl.edu	37	19	57641839	57641839	+	Missense_Mutation	SNP	A	A	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr19:57641839A>C	ENST00000254181.4	+	4	2250	c.1796A>C	c.(1795-1797)aAg>aCg	p.K599T	USP29_ENST00000598197.1_Missense_Mutation_p.K599T	NM_020903.2	NP_065954.1	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	599	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			breast(3)|endometrium(4)|kidney(3)|large_intestine(15)|lung(47)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GAACCAGACAAGAATGCCGAC	0.478																																																	0													68.0	67.0	68.0					19																	57641839		2203	4300	6503	SO:0001583	missense	0				CCDS33124.1	19q13.4	2008-06-23	2005-08-08			ENSG00000131864		"""Ubiquitin-specific peptidases"""	18563	protein-coding gene	gene with protein product		609546	"""ubiquitin specific protease 29"""			12838346	Standard	NM_020903		Approved		uc002qny.3	Q9HBJ7		ENST00000254181.4:c.1796A>C	19.37:g.57641839A>C	ENSP00000254181:p.Lys599Thr			Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.K599T	ENST00000254181.4	37	c.1796	CCDS33124.1	19	.	.	.	.	.	.	.	.	.	.	A	10.76	1.441021	0.25900	.	.	ENSG00000131864	ENST00000254181	T	0.50001	0.76	2.52	-1.06	0.10002	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	.	.	.	.	T	0.35624	0.0938	L	0.41824	1.3	0.09310	N	1	P	0.48503	0.911	P	0.47470	0.548	T	0.19451	-1.0305	9	0.20519	T	0.43	-0.4653	2.186	0.03887	0.4181:0.0:0.323:0.2589	.	599	Q9HBJ7	UBP29_HUMAN	T	599	ENSP00000254181:K599T	ENSP00000254181:K599T	K	+	2	0	USP29	62333651	0.001000	0.12720	0.000000	0.03702	0.012000	0.07955	0.011000	0.13264	-0.371000	0.08004	0.383000	0.25322	AAG	USP29	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000131864		0.478	USP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP29	HGNC	protein_coding	OTTHUMT00000465075.1	-	0.00	30	0	A			57641839	+1	tier1	-	no_errors	ENST00000254181	ensembl	human	known	74_37	missense	26.32	56	20	SNP	0.000	C
UTP3	57050	genome.wustl.edu	37	4	71555010	71555010	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr4:71555010G>A	ENST00000254803.2	+	1	815	c.616G>A	c.(616-618)Gat>Aat	p.D206N		NM_020368.2	NP_065101.1	Q9NQZ2	SAS10_HUMAN	UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae)	206					brain development (GO:0007420)|chromatin modification (GO:0016568)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(4)	18			Lung(101;0.235)			GGTCGTGAAGGATTTGGCTAA	0.483																																																	0													68.0	68.0	68.0					4																	71555010		2203	4300	6503	SO:0001583	missense	0			AL136590	CCDS3546.1	4q13.3	2008-02-05			ENSG00000132467	ENSG00000132467			24477	protein-coding gene	gene with protein product	"""disrupter of silencing 10"""	611614				12477932	Standard	NM_020368		Approved	FLJ23256, DKFZp761F222, SAS10, CRLZ1	uc003hfo.3	Q9NQZ2	OTTHUMG00000129911	ENST00000254803.2:c.616G>A	4.37:g.71555010G>A	ENSP00000254803:p.Asp206Asn		Q6FI82	Missense_Mutation	SNP	pfam_Sas10_C_dom,pfam_Sas10/Utp3/C1D	p.D206N	ENST00000254803.2	37	c.616	CCDS3546.1	4	.	.	.	.	.	.	.	.	.	.	G	19.38	3.816655	0.70912	.	.	ENSG00000132467	ENST00000254803	T	0.39592	1.07	5.44	5.44	0.79542	.	0.099847	0.64402	D	0.000003	T	0.44787	0.1310	M	0.62154	1.92	0.80722	D	1	P	0.36974	0.576	B	0.35039	0.194	T	0.46978	-0.9152	10	0.51188	T	0.08	-3.9163	19.2714	0.94011	0.0:0.0:1.0:0.0	.	206	Q9NQZ2	SAS10_HUMAN	N	206	ENSP00000254803:D206N	ENSP00000254803:D206N	D	+	1	0	UTP3	71773874	1.000000	0.71417	0.999000	0.59377	0.891000	0.51852	6.949000	0.75971	2.542000	0.85734	0.603000	0.83216	GAT	UTP3	-	NULL	ENSG00000132467		0.483	UTP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP3	HGNC	protein_coding	OTTHUMT00000252163.2	-	0.00	52	0	G	NM_020368		71555010	+1	tier1	-	no_errors	ENST00000254803	ensembl	human	known	74_37	missense	11.94	59	8	SNP	1.000	A
VAV3	10451	genome.wustl.edu	37	1	108145687	108145687	+	Missense_Mutation	SNP	T	T	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:108145687T>C	ENST00000370056.4	-	23	2388	c.2114A>G	c.(2113-2115)gAa>gGa	p.E705G	VAV3_ENST00000544443.1_Missense_Mutation_p.E109G|VAV3_ENST00000415432.2_Missense_Mutation_p.E145G|VAV3_ENST00000343258.4_5'UTR|VAV3_ENST00000527011.1_Missense_Mutation_p.E705G	NM_006113.4	NP_006104.4	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor	705	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.|Sufficient for interaction with ROS1.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of signal transduction (GO:0009967)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|vesicle fusion (GO:0006906)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|SH3/SH2 adaptor activity (GO:0005070)			NS(2)|breast(5)|endometrium(4)|kidney(2)|large_intestine(14)|lung(20)|ovary(6)|prostate(3)|stomach(1)|urinary_tract(1)	58		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		AATTGCATATTCTCCTGACTC	0.373																																																	0													161.0	146.0	151.0					1																	108145687		2203	4300	6503	SO:0001583	missense	0			AF118886	CCDS785.1, CCDS44181.1	1p13.3	2013-02-14	2007-07-25		ENSG00000134215	ENSG00000134215		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12659	protein-coding gene	gene with protein product		605541	"""vav 3 oncogene"""				Standard	NM_001079874		Approved		uc001dvk.1	Q9UKW4	OTTHUMG00000010995	ENST00000370056.4:c.2114A>G	1.37:g.108145687T>C	ENSP00000359073:p.Glu705Gly		B1AMM0|B1APV5|B4E232|B7ZLR1|E9PQ97|O60498|O95230|Q9Y5X8	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_2,pfam_CAMSAP_CH,pfam_SH3_domain,pfam_SH2,pfam_CH-domain,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_CH-domain,superfamily_SH3_domain,smart_CH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_SH3_domain,smart_SH2,pfscan_CH-domain,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain,prints_SH2,prints_SH3_domain,prints_SM22_calponin	p.E705G	ENST00000370056.4	37	c.2114	CCDS785.1	1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.153179	0.78114	.	.	ENSG00000134215	ENST00000370056;ENST00000527011;ENST00000544443;ENST00000415432	D;D;D;D	0.88664	-2.41;-2.41;-2.41;-2.41	5.73	5.73	0.89815	SH2 motif (5);	0.000000	0.85682	D	0.000000	D	0.91774	0.7398	L	0.55481	1.735	0.80722	D	1	D;P;D;P	0.89917	1.0;0.597;1.0;0.837	D;P;D;P	0.97110	1.0;0.781;0.999;0.788	D	0.92788	0.6246	10	0.66056	D	0.02	.	16.0313	0.80579	0.0:0.0:0.0:1.0	.	705;109;705;145	E9PQ97;B7Z3Z5;Q9UKW4;Q9UKW4-3	.;.;VAV3_HUMAN;.	G	705;705;109;145	ENSP00000359073:E705G;ENSP00000432540:E705G;ENSP00000446404:E109G;ENSP00000394897:E145G	ENSP00000359073:E705G	E	-	2	0	VAV3	107947210	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.503000	0.81632	2.187000	0.69744	0.383000	0.25322	GAA	VAV3	-	pfam_SH2,smart_SH2,pfscan_SH2,prints_SH2	ENSG00000134215		0.373	VAV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAV3	HGNC	protein_coding	OTTHUMT00000030242.2	-	0.00	48	0	T	NM_006113		108145687	-1	tier1	-	no_errors	ENST00000370056	ensembl	human	known	74_37	missense	58.06	26	36	SNP	1.000	C
VPS4A	27183	genome.wustl.edu	37	16	69350218	69350218	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr16:69350218G>A	ENST00000254950.11	+	3	380	c.224G>A	c.(223-225)cGa>cAa	p.R75Q	RP11-343C2.11_ENST00000570054.2_Missense_Mutation_p.R99Q	NM_013245.2	NP_037377.1			vacuolar protein sorting 4 homolog A (S. cerevisiae)											NS(1)|central_nervous_system(1)|large_intestine(2)|lung(3)	7		Ovarian(137;0.101)				GATTATTTACGAAGCAAAGAG	0.567																																																	0													83.0	98.0	93.0					16																	69350218		2074	4200	6274	SO:0001583	missense	0			AF112215	CCDS45517.1	16q23.1	2010-04-21	2006-04-04		ENSG00000132612	ENSG00000132612		"""ATPases / AAA-type"""	13488	protein-coding gene	gene with protein product		609982	"""vacuolar protein sorting 4A (yeast homolog)"", ""vacuolar protein sorting 4A (yeast)"""			10637304, 11563910	Standard	NM_013245		Approved	VPS4, VPS4-1, FLJ22197, SKD2, SKD1, SKD1A	uc002eww.3	Q9UN37		ENST00000254950.11:c.224G>A	16.37:g.69350218G>A	ENSP00000254950:p.Arg75Gln			Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Vps4_C,pfam_MIT,pfam_IstB_ATP-bd,pfam_ATPase_dyneun-rel_AAA,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_MIT,smart_AAA+_ATPase	p.R75Q	ENST00000254950.11	37	c.224	CCDS45517.1	16	.	.	.	.	.	.	.	.	.	.	G	15.30	2.793187	0.50102	.	.	ENSG00000132612	ENST00000254950	T	0.21191	2.02	5.71	4.76	0.60689	MIT (1);	0.060082	0.64402	D	0.000002	T	0.09905	0.0243	N	0.05306	-0.075	0.39966	D	0.974723	B	0.24092	0.097	B	0.17433	0.018	T	0.18999	-1.0319	10	0.30078	T	0.28	-6.6692	9.7851	0.40670	0.1587:0.0:0.8413:0.0	.	75	Q9UN37	VPS4A_HUMAN	Q	75	ENSP00000254950:R75Q	ENSP00000254950:R75Q	R	+	2	0	VPS4A	67907719	1.000000	0.71417	0.802000	0.32245	0.991000	0.79684	4.450000	0.60041	1.413000	0.46997	0.655000	0.94253	CGA	VPS4A	-	smart_MIT	ENSG00000132612		0.567	VPS4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS4A	HGNC	protein_coding	OTTHUMT00000430563.3	-	0.00	119	0	G	NM_013245		69350218	+1	tier1	-	no_errors	ENST00000254950	ensembl	human	known	74_37	missense	27.81	109	42	SNP	0.998	A
WASL	8976	genome.wustl.edu	37	7	123329200	123329200	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr7:123329200G>T	ENST00000223023.4	-	10	1684	c.1352C>A	c.(1351-1353)gCt>gAt	p.A451D		NM_003941.2	NP_003932.3	O00401	WASL_HUMAN	Wiskott-Aldrich syndrome-like	451					actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cellular protein complex localization (GO:0034629)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane budding (GO:0006900)|mitotic nuclear division (GO:0007067)|nitric oxide metabolic process (GO:0046209)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of filopodium assembly (GO:0051491)|protein complex assembly (GO:0006461)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|response to bacterium (GO:0009617)|small molecule metabolic process (GO:0044281)|spindle localization (GO:0051653)|transcription, DNA-templated (GO:0006351)|vesicle organization (GO:0016050)|vesicle transport along actin filament (GO:0030050)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	small GTPase regulator activity (GO:0005083)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TTGGCCATCAGCCACCTTGGA	0.408																																																	0													126.0	125.0	125.0					7																	123329200		2203	4300	6503	SO:0001583	missense	0			D88460	CCDS34743.1	7q31.3	2008-02-01			ENSG00000106299	ENSG00000106299			12735	protein-coding gene	gene with protein product		605056				9422512, 9322739	Standard	NM_003941		Approved	N-WASP, NWASP	uc003vkz.3	O00401	OTTHUMG00000157346	ENST00000223023.4:c.1352C>A	7.37:g.123329200G>T	ENSP00000223023:p.Ala451Asp		A1JUI9|Q7Z746	Missense_Mutation	SNP	pfam_WH1/EVH1,pfam_CRIB_dom,pfam_WH2_dom,superfamily_WASP_C,smart_WH1/EVH1,smart_CRIB_dom,smart_WH2_dom,pfscan_CRIB_dom,pfscan_WH1/EVH1,pfscan_WH2_dom	p.A451D	ENST00000223023.4	37	c.1352	CCDS34743.1	7	.	.	.	.	.	.	.	.	.	.	G	15.82	2.945603	0.53079	.	.	ENSG00000106299	ENST00000223023	D	0.99701	-6.45	5.29	4.41	0.53225	Wiscott-Aldrich syndrome, C-terminal (1);	0.425937	0.25164	N	0.032642	D	0.97368	0.9139	N	0.02247	-0.625	0.23806	N	0.996798	B	0.15930	0.015	B	0.17979	0.02	D	0.94003	0.7277	10	0.52906	T	0.07	-15.0063	13.8823	0.63688	0.074:0.0:0.926:0.0	.	451	O00401	WASL_HUMAN	D	451	ENSP00000223023:A451D	ENSP00000223023:A451D	A	-	2	0	WASL	123116436	1.000000	0.71417	0.998000	0.56505	0.747000	0.42532	5.855000	0.69510	1.209000	0.43321	0.585000	0.79938	GCT	WASL	-	superfamily_WASP_C	ENSG00000106299		0.408	WASL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WASL	HGNC	protein_coding	OTTHUMT00000348522.1		0.00	36	0	G	NM_003941		123329200	-1			no_errors	ENST00000223023	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	T
WDR16	146845	genome.wustl.edu	37	17	9489127	9489127	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr17:9489127G>T	ENST00000576499.1	+	2	122	c.108G>T	c.(106-108)caG>caT	p.Q36H	WDR16_ENST00000299764.5_Missense_Mutation_p.Q46H|WDR16_ENST00000396219.3_Intron|WDR16_ENST00000352665.5_Missense_Mutation_p.Q36H					WD repeat domain 16											NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	31						ATCCTGACCAGGAGCATATGA	0.438																																																	0													185.0	171.0	175.0					17																	9489127		2203	4300	6503	SO:0001583	missense	0			AB065281	CCDS11149.2, CCDS42262.1	17p13.1	2014-08-01			ENSG00000166596	ENSG00000166596		"""WD repeat domain containing"""	16053	protein-coding gene	gene with protein product	"""WD40-repeat protein upregulated in HCC"""	609804				15967112	Standard	NM_001080556		Approved	WDRPUH, FLJ37528	uc002gly.3	Q8N1V2	OTTHUMG00000150149	ENST00000576499.1:c.108G>T	17.37:g.9489127G>T	ENSP00000476293:p.Gln36His			Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q46H	ENST00000576499.1	37	c.138		17	.	.	.	.	.	.	.	.	.	.	G	15.89	2.967058	0.53507	.	.	ENSG00000166596	ENST00000352665;ENST00000299764	T;T	0.29655	1.56;4.95	5.86	4.89	0.63831	WD40 repeat-like-containing domain (1);	0.434279	0.25854	N	0.027870	T	0.34337	0.0894	L	0.46157	1.445	0.33993	D	0.64935	P;P	0.51240	0.943;0.844	P;B	0.46940	0.532;0.332	T	0.52147	-0.8614	10	0.49607	T	0.09	-23.1893	13.7952	0.63166	0.075:0.0:0.925:0.0	.	46;36	Q8N1V2-2;Q8N1V2	.;WDR16_HUMAN	H	36;46	ENSP00000339449:Q36H;ENSP00000299764:Q46H	ENSP00000299764:Q46H	Q	+	3	2	WDR16	9429852	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	1.364000	0.34171	1.462000	0.47948	0.585000	0.79938	CAG	WDR16	-	superfamily_WD40_repeat_dom	ENSG00000166596		0.438	WDR16-009	PUTATIVE	basic|exp_conf	protein_coding	WDR16	HGNC	protein_coding	OTTHUMT00000439850.2	-	0.00	48	0	G	NM_145054		9489127	+1	tier1	-	no_errors	ENST00000299764	ensembl	human	known	74_37	missense	6.35	59	4	SNP	1.000	T
WDR27	253769	genome.wustl.edu	37	6	170052081	170052081	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr6:170052081G>T	ENST00000448612.1	-	14	1535	c.1426C>A	c.(1426-1428)Caa>Aaa	p.Q476K	WDR27_ENST00000423258.1_Missense_Mutation_p.Q349K|WDR27_ENST00000333572.6_Missense_Mutation_p.Q476K|WDR27_ENST00000546525.1_5'UTR	NM_182552.4	NP_872358.4	A2RRH5	WDR27_HUMAN	WD repeat domain 27	446						nucleus (GO:0005634)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)|skin(1)	12		Breast(66;1.53e-05)|Ovarian(120;0.216)		OV - Ovarian serous cystadenocarcinoma(33;6.48e-20)|BRCA - Breast invasive adenocarcinoma(81;3.56e-07)|GBM - Glioblastoma multiforme(31;0.00168)		ACCAGGCGTTGGTCCTTCATG	0.433																																																	0													109.0	104.0	105.0					6																	170052081		1979	4163	6142	SO:0001583	missense	0			AK131435	CCDS47520.1, CCDS47520.2, CCDS56459.1	6q27	2013-01-09	2003-06-18		ENSG00000184465	ENSG00000184465		"""WD repeat domain containing"""	21248	protein-coding gene	gene with protein product							Standard	NM_182552		Approved	MGC43690	uc003qwx.3	A2RRH5	OTTHUMG00000016061	ENST00000448612.1:c.1426C>A	6.37:g.170052081G>T	ENSP00000416289:p.Gln476Lys		A5PLM8|C9JGV0|Q5T066	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q476K	ENST00000448612.1	37	c.1426	CCDS47520.2	6	.	.	.	.	.	.	.	.	.	.	G	7.325	0.617704	0.14129	.	.	ENSG00000184465	ENST00000448612;ENST00000333572;ENST00000423258	T;T;T	0.23348	2.0;2.25;1.91	4.59	2.66	0.31614	.	0.312440	0.25253	N	0.032002	T	0.09113	0.0225	L	0.58101	1.795	0.39273	D	0.964415	P;P;B	0.39022	0.506;0.655;0.314	B;B;B	0.38264	0.083;0.269;0.068	T	0.10543	-1.0625	10	0.06365	T	0.9	-3.3717	10.8694	0.46875	0.0:0.0:0.6851:0.3149	.	476;349;476	F2Z2U5;A2RRH5-2;C9JGV0	.;.;.	K	476;476;349	ENSP00000416289:Q476K;ENSP00000330265:Q476K;ENSP00000397869:Q349K	ENSP00000330265:Q476K	Q	-	1	0	WDR27	169794006	0.949000	0.32298	0.054000	0.19295	0.004000	0.04260	1.332000	0.33805	0.380000	0.24823	0.563000	0.77884	CAA	WDR27	-	NULL	ENSG00000184465		0.433	WDR27-010	KNOWN	basic|CCDS	protein_coding	WDR27	HGNC	protein_coding	OTTHUMT00000407334.1	-	0.00	73	0	G	NM_182552		170052081	-1	tier1	-	no_errors	ENST00000448612	ensembl	human	known	74_37	missense	5.56	68	4	SNP	0.608	T
XAB2	56949	genome.wustl.edu	37	19	7685536	7685536	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr19:7685536G>T	ENST00000358368.4	-	15	2028	c.1991C>A	c.(1990-1992)gCg>gAg	p.A664E	XAB2_ENST00000534844.1_Missense_Mutation_p.A661E	NM_020196.2	NP_064581.2	Q9HCS7	SYF1_HUMAN	XPA binding protein 2	664					blastocyst development (GO:0001824)|DNA repair (GO:0006281)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|transcription, DNA-templated (GO:0006351)|transcription-coupled nucleotide-excision repair (GO:0006283)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	26						CATCTCACGCGCGTGCTCGTC	0.662								Direct reversal of damage;Nucleotide excision repair (NER)																																									0													33.0	34.0	34.0					19																	7685536		2203	4300	6503	SO:0001583	missense	0			AB026111	CCDS32892.1	19p13.3	2013-08-21				ENSG00000076924			14089	protein-coding gene	gene with protein product	"""SYF1 homolog, RNA splicing factor (S. cerevisiae)"", ""SYF1 pre-mRNA-splicing factor"""	610850				10944529	Standard	NM_020196		Approved	HCNP, HCRN, SYF1, NTC90	uc002mgx.3	Q9HCS7		ENST00000358368.4:c.1991C>A	19.37:g.7685536G>T	ENSP00000351137:p.Ala664Glu		Q8TET6|Q96HB0|Q96IW0|Q9NRG6|Q9ULP3	Missense_Mutation	SNP	smart_HAT,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.A664E	ENST00000358368.4	37	c.1991	CCDS32892.1	19	.	.	.	.	.	.	.	.	.	.	G	12.67	2.006540	0.35415	.	.	ENSG00000076924	ENST00000358368;ENST00000534844	T;T	0.40225	1.04;1.04	4.31	3.26	0.37387	Tetratricopeptide-like helical (1);	0.142130	0.46145	D	0.000312	T	0.54111	0.1838	M	0.88450	2.955	0.51767	D	0.999939	D	0.54047	0.964	P	0.47044	0.535	T	0.64635	-0.6361	10	0.87932	D	0	-25.3541	11.0621	0.47953	0.0929:0.0:0.9071:0.0	.	664	Q9HCS7	SYF1_HUMAN	E	664;661	ENSP00000351137:A664E;ENSP00000438225:A661E	ENSP00000351137:A664E	A	-	2	0	XAB2	7591536	0.832000	0.29368	0.839000	0.33178	0.046000	0.14306	3.857000	0.55972	1.018000	0.39521	0.460000	0.39030	GCG	XAB2	-	NULL	ENSG00000076924		0.662	XAB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	XAB2	HGNC	protein_coding	OTTHUMT00000461021.1		0.00	98	0	G	NM_020196		7685536	-1			no_errors	ENST00000358368	ensembl	human	known	74_37	missense	5.71	66	4	SNP	0.987	T
XDH	7498	genome.wustl.edu	37	2	31609316	31609316	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr2:31609316G>T	ENST00000379416.3	-	9	805	c.757C>A	c.(757-759)Cct>Act	p.P253T	XDH_ENST00000491727.1_5'UTR	NM_000379.3	NP_000370.2	P47989	XDH_HUMAN	xanthine dehydrogenase	253	FAD-binding PCMH-type. {ECO:0000255|PROSITE-ProRule:PRU00718}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|lactation (GO:0007595)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of gene expression (GO:0010629)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|negative regulation of vasculogenesis (GO:2001213)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)|xanthine catabolic process (GO:0009115)	cytosol (GO:0005829)|extracellular space (GO:0005615)|peroxisome (GO:0005777)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|protein homodimerization activity (GO:0042803)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)|xanthine oxidase activity (GO:0004855)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(31)|ovary(1)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(1)	74	Acute lymphoblastic leukemia(172;0.155)				Aldesleukin(DB00041)|Allopurinol(DB00437)|Azathioprine(DB00993)|Carboplatin(DB00958)|Carvedilol(DB01136)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|L-Carnitine(DB00583)|Menadione(DB00170)|Mercaptopurine(DB01033)|Nitrofural(DB00336)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Spermine(DB00127)|Trifluoperazine(DB00831)	TTGGCGTCAGGGTGCTGAGCC	0.617																																					Colon(66;682 1445 30109 40147)												0													109.0	89.0	96.0					2																	31609316		2203	4300	6503	SO:0001583	missense	0			D11456	CCDS1775.1	2p23.1	2009-07-10	2003-03-20		ENSG00000158125	ENSG00000158125	1.17.1.4		12805	protein-coding gene	gene with protein product		607633	"""xanthene dehydrogenase"""			8224915	Standard	NM_000379		Approved	XOR, XO	uc002rnv.1	P47989	OTTHUMG00000099385	ENST00000379416.3:c.757C>A	2.37:g.31609316G>T	ENSP00000368727:p.Pro253Thr		Q16681|Q16712|Q4PJ16	Missense_Mutation	SNP	pfam_AldOxase/xan_DH_Mopterin-bd,pfam_Mopterin_DH_FAD-bd,pfam_Ald_Oxase/Xan_DH_a/b,pfam_2Fe-2S-bd,pfam_CO_DH_flav_C,pfam_2Fe-2S_ferredoxin-type,superfamily_AldOxase/xan_DH_Mopterin-bd,superfamily_FAD-bd_2,superfamily_Ald_Oxase/Xan_DH_a/b,superfamily_2Fe-2S-bd,superfamily_CO_DH_flav_C,superfamily_2Fe-2S_ferredoxin-type,pirsf_Ald_Oxase/xanthine_DH,pfscan_2Fe-2S_ferredoxin-type,tigrfam_Xanthine_DH_ssu	p.P253T	ENST00000379416.3	37	c.757	CCDS1775.1	2	.	.	.	.	.	.	.	.	.	.	G	15.89	2.967315	0.53507	.	.	ENSG00000158125	ENST00000379416	T	0.26957	1.7	5.9	5.9	0.94986	FAD-binding, type 2, subdomain 1 (1);FAD-binding, type 2 (2);Xanthine dehydrogenase, small subunit (1);Molybdopterin dehydrogenase, FAD-binding (1);	0.046236	0.85682	D	0.000000	T	0.63977	0.2557	M	0.93462	3.42	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	T	0.72110	-0.4389	10	0.66056	D	0.02	.	19.1042	0.93287	0.0:0.0:1.0:0.0	.	253	P47989	XDH_HUMAN	T	253	ENSP00000368727:P253T	ENSP00000368727:P253T	P	-	1	0	XDH	31462820	1.000000	0.71417	0.187000	0.23214	0.003000	0.03518	7.601000	0.82783	2.811000	0.96726	0.638000	0.83543	CCT	XDH	-	pfam_Mopterin_DH_FAD-bd,superfamily_FAD-bd_2,pirsf_Ald_Oxase/xanthine_DH,tigrfam_Xanthine_DH_ssu	ENSG00000158125		0.617	XDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XDH	HGNC	protein_coding	OTTHUMT00000216840.1		0.00	27	0	G	NM_000379		31609316	-1			no_errors	ENST00000379416	ensembl	human	known	74_37	missense	5.88	64	4	SNP	0.978	T
XIRP1	165904	genome.wustl.edu	37	3	39226171	39226171	+	Missense_Mutation	SNP	G	G	T	rs367987838	byFrequency	TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr3:39226171G>T	ENST00000340369.3	-	2	4994	c.4766C>A	c.(4765-4767)aCa>aAa	p.T1589K	XIRP1_ENST00000421646.1_Missense_Mutation_p.T272K|XIRP1_ENST00000396251.1_3'UTR	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	1589					cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		ACTGCTGACTGTGACACTGAT	0.587																																																	0													188.0	174.0	178.0					3																	39226171		2203	4300	6503	SO:0001583	missense	0			AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.4766C>A	3.37:g.39226171G>T	ENSP00000343140:p.Thr1589Lys		A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Missense_Mutation	SNP	pfam_Actin-binding_Xin_repeat	p.T1589K	ENST00000340369.3	37	c.4766	CCDS2683.1	3	.	.	.	.	.	.	.	.	.	.	G	11.15	1.553521	0.27739	.	.	ENSG00000168334	ENST00000340369;ENST00000421646	T;T	0.18174	3.98;2.23	4.37	0.452	0.16634	.	0.562398	0.17780	U	0.162266	T	0.09949	0.0244	L	0.47716	1.5	0.09310	N	1	B	0.33694	0.421	B	0.24541	0.054	T	0.36480	-0.9746	10	0.07813	T	0.8	.	7.6425	0.28303	0.4888:0.0:0.5112:0.0	.	1589	Q702N8	XIRP1_HUMAN	K	1589;272	ENSP00000343140:T1589K;ENSP00000391645:T272K	ENSP00000343140:T1589K	T	-	2	0	XIRP1	39201175	0.000000	0.05858	0.000000	0.03702	0.970000	0.65996	0.117000	0.15583	-0.039000	0.13602	0.655000	0.94253	ACA	XIRP1	-	NULL	ENSG00000168334		0.587	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	XIRP1	HGNC	protein_coding	OTTHUMT00000254065.1	-	0.00	54	0	G	XM_093522		39226171	-1	tier1	-	no_errors	ENST00000340369	ensembl	human	known	74_37	missense	6.45	58	4	SNP	0.000	T
XPO1	7514	genome.wustl.edu	37	2	61719269	61719269	+	Silent	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr2:61719269G>T	ENST00000401558.2	-	16	2515	c.1788C>A	c.(1786-1788)cgC>cgA	p.R596R	XPO1_ENST00000406957.1_Silent_p.R596R|XPO1_ENST00000404992.2_Silent_p.R596R	NM_003400.3	NP_003391.1	O14980	XPO1_HUMAN	exportin 1	596	Necessary for HTLV-1 Rex-mediated mRNA export.				gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein export from nucleus (GO:0006611)|protein localization to nucleus (GO:0034504)|regulation of centrosome duplication (GO:0010824)|regulation of protein catabolic process (GO:0042176)|regulation of protein export from nucleus (GO:0046825)|response to drug (GO:0042493)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|RNA metabolic process (GO:0016070)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)	annulate lamellae (GO:0005642)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleocytoplasmic transporter activity (GO:0005487)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			CGAAATGCCTGCGGCATTTTT	0.373			Mis		CLL																																		-'	Dom	yes		2	2p15	7514	"""exportin 1 (CRM1 homolog, yeast)"""		L	0													79.0	80.0	80.0					2																	61719269		2203	4300	6503	SO:0001819	synonymous_variant	0			Y08614	CCDS33205.1	2p15	2014-02-19	2014-02-19		ENSG00000082898	ENSG00000082898		"""Exportins"""	12825	protein-coding gene	gene with protein product	"""chromosome region maintenance 1 homolog (yeast)"""	602559	"""exportin 1 (CRM1, yeast, homolog)"", ""exportin 1 (CRM1 homolog, yeast)"""			9205132, 9368044	Standard	XM_005264544		Approved	CRM1, emb	uc002sbj.3	O14980	OTTHUMG00000152316	ENST00000401558.2:c.1788C>A	2.37:g.61719269G>T			A6NL14|A8K1K5|D6W5E2|Q63HP8|Q68CP3|Q99433	Silent	SNP	pfam_CRM1_C_dom,pfam_Exportin-1/Importin-b-like,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.R596	ENST00000401558.2	37	c.1788	CCDS33205.1	2																																																																																			XPO1	-	superfamily_ARM-type_fold	ENSG00000082898		0.373	XPO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO1	HGNC	protein_coding	OTTHUMT00000325872.3		0.00	59	0	G	NM_003400		61719269	-1			no_errors	ENST00000401558	ensembl	human	known	74_37	silent	5.43	87	5	SNP	0.907	T
ZBED1	9189	genome.wustl.edu	37	X	2407512	2407512	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chrX:2407512G>A	ENST00000381223.4	-	2	1452	c.1249C>T	c.(1249-1251)Ccc>Tcc	p.P417S	ZBED1_ENST00000515319.1_5'Flank|ZBED1_ENST00000381218.3_Missense_Mutation_p.P417S|DHRSX_ENST00000334651.5_Intron|ZBED1_ENST00000381222.2_Missense_Mutation_p.P417S	NM_001171135.1|NM_001171136.1|NM_004729.3	NP_001164606.1|NP_001164607.1|NP_004720.1	O96006	ZBED1_HUMAN	zinc finger, BED-type containing 1	417					metabolic process (GO:0008152)	nuclear chromosome (GO:0000228)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transposase activity (GO:0004803)			endometrium(8)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	25		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CTGATGGTGGGGTACCTGGAG	0.627																																																	0													127.0	112.0	117.0					X																	2407512		2203	4296	6499	SO:0001583	missense	0			AB018328	CCDS14118.1	Xp22.33 and Yp11	2013-05-03	2004-01-14	2004-01-16	ENSG00000214717	ENSG00000214717		"""Pseudoautosomal regions / PAR1"", ""Zinc fingers, BED-type"""	447	protein-coding gene	gene with protein product		300178	"""Ac-like transposable element"""	ALTE		9872452, 9887332, 23533661	Standard	NM_001171135		Approved	TRAMP, KIAA0785, DREF, hDREF	uc004cqh.2	O96006	OTTHUMG00000021069	ENST00000381223.4:c.1249C>T	X.37:g.2407512G>A	ENSP00000370621:p.Pro417Ser		Q96BY4	Missense_Mutation	SNP	pfam_HATC_dom_C,pfam_Znf_BED_prd,superfamily_RNaseH-like_dom,smart_Znf_BED_prd,pfscan_Znf_BED_prd	p.P417S	ENST00000381223.4	37	c.1249	CCDS14118.1	X	.	.	.	.	.	.	.	.	.	.	G	8.053	0.766414	0.15983	.	.	ENSG00000214717	ENST00000381223;ENST00000381222;ENST00000381218	T;T;T	0.23754	1.89;1.89;1.89	3.06	3.06	0.35304	Ribonuclease H-like (1);	0.185776	0.33057	N	0.005325	T	0.46658	0.1404	.	.	.	0.09310	N	1	D	0.89917	1.0	D	0.79108	0.992	T	0.33343	-0.9872	9	0.45353	T	0.12	-47.0428	13.6519	0.62316	0.0:0.0:1.0:0.0	.	417	O96006	ZBED1_HUMAN	S	417	ENSP00000370621:P417S;ENSP00000370620:P417S;ENSP00000370616:P417S	ENSP00000370616:P417S	P	-	1	0	ZBED1	2417512	1.000000	0.71417	0.542000	0.28115	0.156000	0.22039	6.419000	0.73345	1.155000	0.42497	0.519000	0.50382	CCC	ZBED1	-	superfamily_RNaseH-like_dom	ENSG00000214717		0.627	ZBED1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBED1	HGNC	protein_coding	OTTHUMT00000144310.3	-	0.00	80	0	G	NM_004729		2407512	-1	tier1	-	no_errors	ENST00000381218	ensembl	human	known	74_37	missense	10.81	66	8	SNP	1.000	A
ZCWPW2	152098	genome.wustl.edu	37	3	28566121	28566121	+	Missense_Mutation	SNP	G	G	A	rs527953274		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr3:28566121G>A	ENST00000383768.2	+	10	1201	c.1013G>A	c.(1012-1014)tGt>tAt	p.C338Y	ZCWPW2_ENST00000421010.1_Missense_Mutation_p.C338Y			Q504Y3	ZCPW2_HUMAN	zinc finger, CW type with PWWP domain 2	338							zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(6)|ovary(2)	17						GCTGGAGAATGTATTGAGGAT	0.303													G|||	1	0.000199681	0.0	0.0014	5008	,	,		13528	0.0		0.0	False		,,,				2504	0.0																0													61.0	70.0	67.0					3																	28566121		2199	4298	6497	SO:0001583	missense	0			BC065764	CCDS33723.1	3p23	2005-08-22			ENSG00000206559	ENSG00000206559			23574	protein-coding gene	gene with protein product						14607086	Standard	XM_005264892		Approved	ZCW2	uc003cei.3	Q504Y3	OTTHUMG00000155705	ENST00000383768.2:c.1013G>A	3.37:g.28566121G>A	ENSP00000373278:p.Cys338Tyr			Missense_Mutation	SNP	pfam_Znf_CW,pfam_PWWP_dom,pfscan_PWWP_dom,pfscan_Znf_CW	p.C338Y	ENST00000383768.2	37	c.1013	CCDS33723.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.96|16.96	3.265730|3.265730	0.59540|0.59540	.|.	.|.	ENSG00000206559|ENSG00000206559	ENST00000383768;ENST00000421010|ENST00000419130	T;T|.	0.51071|.	0.72;0.72|.	6.03|6.03	3.29|3.29	0.37713|0.37713	.|.	0.000000|.	0.64402|.	D|.	0.000010|.	T|T	0.40670|0.40670	0.1126|0.1126	L|L	0.34521|0.34521	1.04|1.04	0.32374|0.32374	N|N	0.55549|0.55549	B|.	0.17465|.	0.022|.	B|.	0.14578|.	0.011|.	T|T	0.47018|0.47018	-0.9149|-0.9149	10|5	0.87932|.	D|.	0|.	-18.8087|-18.8087	9.7617|9.7617	0.40537|0.40537	0.2195:0.0:0.7805:0.0|0.2195:0.0:0.7805:0.0	.|.	338|.	Q504Y3|.	ZCPW2_HUMAN|.	Y|I	338|222	ENSP00000373278:C338Y;ENSP00000412386:C338Y|.	ENSP00000373278:C338Y|.	C|M	+|+	2|3	0|0	ZCWPW2|ZCWPW2	28541125|28541125	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.990000|0.990000	0.78478|0.78478	2.944000|2.944000	0.49034|0.49034	0.436000|0.436000	0.26393|0.26393	-0.123000|-0.123000	0.14984|0.14984	TGT|ATG	ZCWPW2	-	NULL	ENSG00000206559		0.303	ZCWPW2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCWPW2	HGNC	protein_coding	OTTHUMT00000341318.1		0.00	69	0	G	XM_087384		28566121	+1			no_errors	ENST00000383768	ensembl	human	known	74_37	missense	7.53	86	7	SNP	1.000	A
ZFHX4	79776	genome.wustl.edu	37	8	77766811	77766811	+	Silent	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr8:77766811C>T	ENST00000521891.2	+	10	8102	c.7654C>T	c.(7654-7656)Ctg>Ttg	p.L2552L	ZFHX4_ENST00000050961.6_Silent_p.L2507L|ZFHX4_ENST00000518282.1_Silent_p.L2526L|ZFHX4_ENST00000455469.2_Silent_p.L2507L	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2507					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TGGACAACTGCTGGGCAGTTC	0.517										HNSCC(33;0.089)																																							0													96.0	95.0	95.0					8																	77766811		1956	4140	6096	SO:0001819	synonymous_variant	0				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.7654C>T	8.37:g.77766811C>T			G3V138|Q18PS0|Q6ZN20	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.L2552	ENST00000521891.2	37	c.7654	CCDS47878.2	8																																																																																			ZFHX4	-	NULL	ENSG00000091656		0.517	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2	-	0.00	29	0	C	NM_024721		77766811	+1	tier1	-	no_errors	ENST00000521891	ensembl	human	known	74_37	silent	29.55	31	13	SNP	1.000	T
ZFAT	57623	genome.wustl.edu	37	8	135490915	135490915	+	Missense_Mutation	SNP	G	G	A	rs577332990		TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr8:135490915G>A	ENST00000377838.3	-	16	3716	c.3542C>T	c.(3541-3543)aCg>aTg	p.T1181M	ZFAT_ENST00000520727.1_Missense_Mutation_p.T1169M|ZFAT_ENST00000520214.1_Missense_Mutation_p.T1169M|ZFAT_ENST00000520356.1_Missense_Mutation_p.T1083M|ZFAT_ENST00000523399.1_Missense_Mutation_p.T1119M|ZFAT_ENST00000429442.2_Silent_p.D1132D	NM_001174157.1|NM_020863.3	NP_001167628.1|NP_065914.2	Q9P243	ZFAT_HUMAN	zinc finger and AT hook domain containing	1181					hematopoietic progenitor cell differentiation (GO:0002244)|spongiotrophoblast layer development (GO:0060712)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(9)|large_intestine(8)|lung(16)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			TTGCTGGACCGTCTCCTGGAT	0.642													g|||	1	0.000199681	0.0	0.0014	5008	,	,		19032	0.0		0.0	False		,,,				2504	0.0																0													21.0	24.0	23.0					8																	135490915		2057	4172	6229	SO:0001583	missense	0			BC025423	CCDS43768.1, CCDS47924.1, CCDS43768.2, CCDS55275.1, CCDS55276.1	8q24.23	2008-06-05	2008-01-25	2008-01-25	ENSG00000066827	ENSG00000066827		"""Zinc fingers, C2H2-type"""	19899	protein-coding gene	gene with protein product		610931	"""zinc finger protein 406"""	ZNF406, ZFAT1		10819331, 18329245	Standard	NM_020863		Approved	KIAA1485	uc003yup.3	Q9P243	OTTHUMG00000164321	ENST00000377838.3:c.3542C>T	8.37:g.135490915G>A	ENSP00000367069:p.Thr1181Met		B7ZL15|E9PER3|Q3MIM5|Q6PJ01|Q75PJ6|Q75PJ7|Q75PJ9|Q86X64	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T1181M	ENST00000377838.3	37	c.3542	CCDS47924.1	8	.	.	.	.	.	.	.	.	.	.	N	20.3	3.964563	0.74131	.	.	ENSG00000066827	ENST00000520356;ENST00000520727;ENST00000377838;ENST00000520214;ENST00000521673;ENST00000318135;ENST00000523399	T;T;T;T;T	0.10192	2.9;2.92;2.91;2.92;2.93	5.19	5.19	0.71726	.	0.249276	0.40469	N	0.001093	T	0.19248	0.0462	N	0.24115	0.695	0.37439	D	0.914344	D;P;D;D	0.89917	0.998;0.73;0.99;1.0	P;B;B;P	0.61800	0.828;0.064;0.425;0.894	T	0.06356	-1.0831	10	0.52906	T	0.07	-15.9866	17.6918	0.88270	0.0:0.0:1.0:0.0	.	300;1119;1083;1181	B7Z741;E9PER3;E9PBN4;Q9P243	.;.;.;ZFAT_HUMAN	M	1083;1169;1181;1169;101;1068;1119	ENSP00000427879:T1083M;ENSP00000427831:T1169M;ENSP00000367069:T1181M;ENSP00000428483:T1169M;ENSP00000429091:T1119M	ENSP00000326997:T1068M	T	-	2	0	ZFAT	135560097	1.000000	0.71417	0.997000	0.53966	0.940000	0.58332	7.780000	0.85658	2.432000	0.82394	0.651000	0.88453	ACG	ZFAT	-	NULL	ENSG00000066827		0.642	ZFAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFAT	HGNC	protein_coding	OTTHUMT00000378272.1	-	0.00	39	0	G	NM_001029939		135490915	-1	tier1	-	no_errors	ENST00000377838	ensembl	human	known	74_37	missense	12.50	28	4	SNP	1.000	A
ZFP30	22835	genome.wustl.edu	37	19	38126679	38126679	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr19:38126679C>T	ENST00000351218.2	-	6	1320	c.763G>A	c.(763-765)Gga>Aga	p.G255R	ZFP30_ENST00000589018.1_Intron|ZFP30_ENST00000392144.1_Missense_Mutation_p.G255R|ZFP30_ENST00000514101.2_Missense_Mutation_p.G255R	NM_014898.2	NP_055713.1	Q9Y2G7	ZFP30_HUMAN	ZFP30 zinc finger protein	255					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	21			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTAAGTTGTCCTCTAACTCTA	0.428																																																	0													87.0	87.0	87.0					19																	38126679		2203	4300	6503	SO:0001583	missense	0			AB023178	CCDS33005.1	19q13.13	2013-01-08	2012-11-27		ENSG00000120784	ENSG00000120784		"""Zinc fingers, C2H2-type"", ""-"""	29555	protein-coding gene	gene with protein product			"""zinc finger protein 30 homolog (mouse)"""			10231032	Standard	NM_014898		Approved	ZNF745, KIAA0961	uc002ogx.1	Q9Y2G7	OTTHUMG00000048177	ENST00000351218.2:c.763G>A	19.37:g.38126679C>T	ENSP00000343581:p.Gly255Arg		Q58EY8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G255R	ENST00000351218.2	37	c.763	CCDS33005.1	19	.	.	.	.	.	.	.	.	.	.	C	13.51	2.258800	0.39896	.	.	ENSG00000120784	ENST00000351218;ENST00000514101;ENST00000392144	T;T;T	0.07114	3.22;3.22;3.22	3.99	3.99	0.46301	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.34178	N	0.004199	T	0.13200	0.0320	N	0.16602	0.42	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.04005	-1.0985	10	0.59425	D	0.04	.	9.3874	0.38352	0.3353:0.6647:0.0:0.0	.	255;255	D3Y2A0;Q9Y2G7	.;ZFP30_HUMAN	R	255	ENSP00000343581:G255R;ENSP00000422930:G255R;ENSP00000375988:G255R	ENSP00000343581:G255R	G	-	1	0	ZFP30	42818519	0.000000	0.05858	0.979000	0.43373	0.866000	0.49608	-0.918000	0.04021	2.223000	0.72356	0.655000	0.94253	GGA	ZFP30	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000120784		0.428	ZFP30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP30	HGNC	protein_coding	OTTHUMT00000109601.2	-	0.00	54	0	C	NM_014898		38126679	-1	tier1	-	no_errors	ENST00000351218	ensembl	human	known	74_37	missense	11.65	91	12	SNP	0.037	T
ZIM2	23619	genome.wustl.edu	37	19	57286732	57286732	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr19:57286732C>A	ENST00000391708.3	-	12	1450	c.908G>T	c.(907-909)gGa>gTa	p.G303V	AC006115.3_ENST00000597946.1_RNA|ZIM2_ENST00000601070.1_Missense_Mutation_p.G303V|AC006115.3_ENST00000595954.1_RNA|AC006115.3_ENST00000594400.1_RNA|ZIM2_ENST00000599935.1_Missense_Mutation_p.G303V|ZIM2_ENST00000593711.1_Missense_Mutation_p.G303V|ZIM2_ENST00000221722.5_Missense_Mutation_p.G303V	NM_001146326.1|NM_001146327.1	NP_001139798.1|NP_001139799.1	Q9NZV7	ZIM2_HUMAN	zinc finger, imprinted 2	303					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0314)		GGGATCCTTTCCTAGAGGATC	0.453																																																	0													119.0	114.0	116.0					19																	57286732		2203	4300	6503	SO:0001583	missense	0			AF166122	CCDS33123.1	19q13.4	2012-10-31				ENSG00000269699		"""Zinc fingers, C2H2-type"""	12875	protein-coding gene	gene with protein product							Standard	NM_015363		Approved	ZNF656		Q9NZV7		ENST00000391708.3:c.908G>T	19.37:g.57286732C>A	ENSP00000375589:p.Gly303Val		Q2M3K1	Missense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G303V	ENST00000391708.3	37	c.908	CCDS33123.1	19	.	.	.	.	.	.	.	.	.	.	C	14.45	2.538981	0.45176	.	.	ENSG00000198300	ENST00000391708;ENST00000221722	T;T	0.04758	3.56;3.56	3.89	0.45	0.16624	.	.	.	.	.	T	0.02494	0.0076	N	0.14661	0.345	.	.	.	B	0.32653	0.379	B	0.26517	0.07	T	0.40590	-0.9555	8	0.59425	D	0.04	.	2.8917	0.05678	0.3745:0.3962:0.0:0.2293	.	303	Q9NZV7	ZIM2_HUMAN	V	303	ENSP00000375589:G303V;ENSP00000221722:G303V	ENSP00000221722:G303V	G	-	2	0	ZIM2	61978544	0.000000	0.05858	0.131000	0.22000	0.731000	0.41821	-0.337000	0.07852	0.176000	0.19873	0.655000	0.94253	GGA	ZIM2	-	NULL	ENSG00000269699		0.453	ZIM2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIM2	HGNC	protein_coding	OTTHUMT00000416094.2	-	0.00	48	0	C			57286732	-1	tier1	-	no_errors	ENST00000221722	ensembl	human	known	74_37	missense	7.14	52	4	SNP	0.918	A
ZMYM1	79830	genome.wustl.edu	37	1	35580031	35580031	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:35580031G>A	ENST00000373330.1	+	11	2774	c.2600G>A	c.(2599-2601)cGa>cAa	p.R867Q	ZMYM1_ENST00000359858.4_Missense_Mutation_p.R867Q|ZMYM1_ENST00000373329.1_3'UTR			Q5SVZ6	ZMYM1_HUMAN	zinc finger, MYM-type 1	867						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(8)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TTCCTGTATCGAGTGCTGAGT	0.328																																																	0													56.0	48.0	50.0					1																	35580031		1805	4069	5874	SO:0001583	missense	0			AK096206	CCDS41302.1	1p34.3	2008-05-02	2005-09-12		ENSG00000197056	ENSG00000197056		"""Zinc fingers, MYM type"""	26253	protein-coding gene	gene with protein product			"""zinc finger, MYM domain containing 1"""			12477932	Standard	XM_005271216		Approved	FLJ23151, MYM	uc001bym.3	Q5SVZ6	OTTHUMG00000004374	ENST00000373330.1:c.2600G>A	1.37:g.35580031G>A	ENSP00000362427:p.Arg867Gln		D3DPR7|Q7Z3Q4	Missense_Mutation	SNP	pfam_Znf_MYM,pfam_HATC_dom_C,superfamily_RNaseH-like_dom,smart_TRASH_dom	p.R867Q	ENST00000373330.1	37	c.2600	CCDS41302.1	1	.	.	.	.	.	.	.	.	.	.	G	9.977	1.227061	0.22542	.	.	ENSG00000197056	ENST00000359858;ENST00000373329;ENST00000373330	T;T;T	0.21543	2.0;2.0;2.0	4.11	3.2	0.36748	Ribonuclease H-like (1);	0.000000	0.39210	N	0.001421	T	0.34308	0.0893	L	0.54323	1.7	0.25624	N	0.986362	D;D	0.76494	0.999;0.997	D;D	0.72625	0.978;0.968	T	0.03630	-1.1018	9	.	.	.	-7.0029	6.5197	0.22269	0.2123:0.0:0.7876:0.0	.	848;867	B4DSJ9;Q5SVZ6	.;ZMYM1_HUMAN	Q	867;792;867	ENSP00000352920:R867Q;ENSP00000362426:R792Q;ENSP00000362427:R867Q	.	R	+	2	0	ZMYM1	35352618	1.000000	0.71417	0.977000	0.42913	0.006000	0.05464	1.378000	0.34328	1.332000	0.45431	-0.391000	0.06502	CGA	ZMYM1	-	superfamily_RNaseH-like_dom	ENSG00000197056		0.328	ZMYM1-001	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZMYM1	HGNC	protein_coding	OTTHUMT00000012705.1	-	0.00	58	0	G	NM_024772		35580031	+1	tier1	-	no_errors	ENST00000359858	ensembl	human	novel	74_37	missense	28.95	54	22	SNP	0.972	A
ZMYM3	9203	genome.wustl.edu	37	X	70473041	70473041	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chrX:70473041C>A	ENST00000353904.2	-	2	252	c.65G>T	c.(64-66)gGa>gTa	p.G22V	ZMYM3_ENST00000489332.1_5'UTR|ZMYM3_ENST00000373982.1_Missense_Mutation_p.G22V|ZMYM3_ENST00000373988.1_Missense_Mutation_p.G22V|ZMYM3_ENST00000373984.3_Missense_Mutation_p.G22V|ZMYM3_ENST00000314425.5_Missense_Mutation_p.G22V|ZMYM3_ENST00000373978.1_Missense_Mutation_p.G22V|ZMYM3_ENST00000373998.1_Missense_Mutation_p.G22V|ZMYM3_ENST00000373981.1_Missense_Mutation_p.G22V	NM_005096.3	NP_005087.1	Q14202	ZMYM3_HUMAN	zinc finger, MYM-type 3	22					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(7)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(17)|ovary(1)|prostate(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(35;0.156)					TGGTAGGTCTCCAGCCAGGGG	0.557											OREG0019858	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													23.0	25.0	24.0					X																	70473041		2023	4166	6189	SO:0001583	missense	0			AB002383	CCDS14409.1, CCDS55443.1, CCDS55444.1	Xq13.1	2013-01-08	2005-12-19	2005-12-19	ENSG00000147130	ENSG00000147130		"""Zinc fingers, MYM type"""	13054	protein-coding gene	gene with protein product		300061	"""zinc finger protein 261"""	ZNF261		10486218	Standard	NM_201599		Approved	ZNF198L2, DXS6673E, KIAA0385, MYM	uc004dzh.2	Q14202	OTTHUMG00000021799	ENST00000353904.2:c.65G>T	X.37:g.70473041C>A	ENSP00000343909:p.Gly22Val	1122	D3DVV3|O15089|Q96E26	Missense_Mutation	SNP	pfam_Znf_MYM,pfam_DUF3504,smart_TRASH_dom	p.G22V	ENST00000353904.2	37	c.65	CCDS14409.1	X	.	.	.	.	.	.	.	.	.	.	c	17.01	3.279612	0.59758	.	.	ENSG00000147130	ENST00000314425;ENST00000373998;ENST00000353904;ENST00000373984;ENST00000373988;ENST00000373982;ENST00000373981;ENST00000373978	T;T;T;T;T;T;T;T	0.33438	1.41;1.41;1.41;1.41;1.41;1.41;1.41;1.41	4.64	4.64	0.57946	.	0.000000	0.48767	D	0.000165	T	0.40862	0.1134	N	0.19112	0.55	0.58432	D	0.999999	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.87578	0.996;0.998;0.994	T	0.43228	-0.9404	10	0.62326	D	0.03	-5.4295	15.0413	0.71793	0.0:1.0:0.0:0.0	.	22;22;22	Q96E26;Q14202-2;Q14202	.;.;ZMYM3_HUMAN	V	22	ENSP00000322845:G22V;ENSP00000363110:G22V;ENSP00000343909:G22V;ENSP00000363096:G22V;ENSP00000363100:G22V;ENSP00000363094:G22V;ENSP00000363093:G22V;ENSP00000363090:G22V	ENSP00000322845:G22V	G	-	2	0	ZMYM3	70389766	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	3.044000	0.49830	1.898000	0.54952	0.287000	0.19450	GGA	ZMYM3	-	NULL	ENSG00000147130		0.557	ZMYM3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZMYM3	HGNC	protein_coding	OTTHUMT00000057154.1	-	0.00	70	0	C	NM_201599		70473041	-1	tier1	-	no_errors	ENST00000373988	ensembl	human	known	74_37	missense	5.26	72	4	SNP	1.000	A
ZNF177	7730	genome.wustl.edu	37	19	9491836	9491836	+	Missense_Mutation	SNP	A	A	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr19:9491836A>C	ENST00000589262.1	+	6	895	c.829A>C	c.(829-831)Act>Cct	p.T277P	ZNF177_ENST00000602856.1_3'UTR|ZNF177_ENST00000590616.1_Intron|ZNF177_ENST00000602738.1_Missense_Mutation_p.T117P|ZNF177_ENST00000541595.2_Missense_Mutation_p.T117P|ZNF177_ENST00000434737.2_Missense_Mutation_p.T277P|ZNF177_ENST00000343499.4_Missense_Mutation_p.T117P|ZNF177_ENST00000446085.4_3'UTR	NM_001172651.1	NP_001166122.1	Q13360	ZN177_HUMAN	zinc finger protein 177	277					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	blood microparticle (GO:0072562)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|stomach(2)	13						CTGTGTCAGAACTCACTCTGG	0.433																																																	0													86.0	79.0	81.0					19																	9491836		2203	4300	6503	SO:0001583	missense	0			U37263, BC012012	CCDS12212.1, CCDS54214.1	19p13.2	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	12966	protein-coding gene	gene with protein product		601276					Standard	NM_003451		Approved		uc021uon.1	Q13360		ENST00000589262.1:c.829A>C	19.37:g.9491836A>C	ENSP00000468531:p.Thr277Pro		B4DY57|E9PDG0|I3L0I4|Q96ER2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T277P	ENST00000589262.1	37	c.829	CCDS54214.1	19	.	.	.	.	.	.	.	.	.	.	A	9.411	1.080504	0.20309	.	.	ENSG00000188629	ENST00000541595;ENST00000343499;ENST00000434737	T;T;T	0.12984	5.23;5.23;2.63	2.82	1.79	0.24919	.	.	.	.	.	T	0.17066	0.0410	M	0.78344	2.41	0.25697	N	0.985626	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.06481	-1.0824	8	0.48119	T	0.1	.	7.7665	0.28982	0.3912:0.6088:0.0:0.0	.	277;117	B4DY57;Q13360	.;ZN177_HUMAN	P	117;117;277	ENSP00000445323:T117P;ENSP00000341497:T117P;ENSP00000415070:T277P	ENSP00000341497:T117P	T	+	1	0	ZNF177	9352836	0.000000	0.05858	0.007000	0.13788	0.967000	0.64934	0.534000	0.23098	0.606000	0.29965	0.460000	0.39030	ACT	ZNF177	-	pfscan_Znf_C2H2	ENSG00000188629		0.433	ZNF177-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF177	HGNC	protein_coding	OTTHUMT00000449028.1	-	0.00	25	0	A	NM_003451		9491836	+1	tier1	-	no_errors	ENST00000434737	ensembl	human	known	74_37	missense	50.00	25	25	SNP	0.118	C
ZNF32	7580	genome.wustl.edu	37	10	44139834	44139834	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr10:44139834C>A	ENST00000395797.1	-	3	674	c.486G>T	c.(484-486)gaG>gaT	p.E162D	ZNF32-AS3_ENST00000458063.1_RNA|ZNF32_ENST00000485351.1_5'Flank|ZNF32-AS2_ENST00000418966.1_RNA|ZNF32-AS1_ENST00000453284.1_RNA|ZNF32_ENST00000374433.2_Missense_Mutation_p.E162D	NM_001005368.1	NP_001005368.1	P17041	ZNF32_HUMAN	zinc finger protein 32	162					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(2)|ovary(1)|pancreas(1)|urinary_tract(1)	14		all_neural(218;0.0182)|Ovarian(717;0.0443)|Renal(717;0.157)		Lung(62;0.179)		AAATAGCACACTCGTAGGGTT	0.488																																																	0													106.0	104.0	105.0					10																	44139834		2203	4300	6503	SO:0001583	missense	0			U69645	CCDS7206.1	10q22-q25	2013-01-08	2006-05-11		ENSG00000169740	ENSG00000169740		"""Zinc fingers, C2H2-type"""	13095	protein-coding gene	gene with protein product		194539	"""zinc finger protein 32 (KOX 30)"""				Standard	XM_005271822		Approved	KOX30	uc001jbc.3	P17041	OTTHUMG00000018043	ENST00000395797.1:c.486G>T	10.37:g.44139834C>A	ENSP00000379143:p.Glu162Asp		Q92951	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E162D	ENST00000395797.1	37	c.486	CCDS7206.1	10	.	.	.	.	.	.	.	.	.	.	C	14.87	2.665959	0.47677	.	.	ENSG00000169740	ENST00000374433;ENST00000395797	T;T	0.07688	3.17;3.17	4.52	1.62	0.23740	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.49305	D	0.000142	T	0.06188	0.0160	L	0.33293	1	0.09310	N	0.99999	B	0.23650	0.089	B	0.27262	0.078	T	0.30534	-0.9975	10	0.72032	D	0.01	-17.7149	3.8366	0.08897	0.1675:0.5582:0.0:0.2743	.	162	P17041	ZNF32_HUMAN	D	162	ENSP00000363556:E162D;ENSP00000379143:E162D	ENSP00000363556:E162D	E	-	3	2	ZNF32	43459840	0.000000	0.05858	0.924000	0.36721	0.981000	0.71138	-1.624000	0.02038	0.383000	0.24910	0.655000	0.94253	GAG	ZNF32	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000169740		0.488	ZNF32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF32	HGNC	protein_coding	OTTHUMT00000047723.1	-	0.00	65	0	C	NM_006973		44139834	-1	tier1	-	no_errors	ENST00000374433	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.028	A
ZNF451	26036	genome.wustl.edu	37	6	56965914	56965914	+	Intron	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr6:56965914G>A	ENST00000370706.4	+	3	430				ZNF451_ENST00000370708.4_Missense_Mutation_p.E234K|ZNF451_ENST00000491832.2_Intron|ZNF451_ENST00000357489.3_Intron|ZNF451_ENST00000370702.1_Intron	NM_001031623.2	NP_001026794.1	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			ATCCACAGTTGAAGAAGAAAC	0.433																																																	0																																										SO:0001627	intron_variant	0			AB011148	CCDS4960.1, CCDS43477.1, CCDS59026.1	6p12.1	2012-08-08			ENSG00000112200	ENSG00000112200		"""Zinc fingers, C2H2-type"""	21091	protein-coding gene	gene with protein product		615708				9628581	Standard	NM_001031623		Approved	KIAA0576, COASTER, dJ417I1.1, KIAA1702	uc003pdm.2	Q9Y4E5	OTTHUMG00000014916	ENST00000370706.4:c.186+1975G>A	6.37:g.56965914G>A			Q5VVE9|Q5VVF1|Q86YE4|Q8N380|Q8TD15|Q9C0G1|Q9NQM1	Missense_Mutation	SNP	pfam_LAP2alpha	p.E234K	ENST00000370706.4	37	c.700	CCDS43477.1	6	.	.	.	.	.	.	.	.	.	.	G	17.63	3.437246	0.62955	.	.	ENSG00000112200	ENST00000370708	T	0.70164	-0.46	4.42	4.42	0.53409	.	.	.	.	.	T	0.32971	0.0847	N	0.08118	0	0.80722	D	1	B	0.23185	0.081	B	0.20767	0.031	T	0.36212	-0.9757	9	0.66056	D	0.02	.	12.8246	0.57712	0.0:0.0:1.0:0.0	.	234	Q9Y4E5-4	.	K	234	ENSP00000359742:E234K	ENSP00000359742:E234K	E	+	1	0	ZNF451	57073873	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	1.733000	0.38156	2.732000	0.93576	0.591000	0.81541	GAA	ZNF451	-	NULL	ENSG00000112200		0.433	ZNF451-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF451	HGNC	protein_coding	OTTHUMT00000041035.2		0.00	21	0	G	NM_015555		56965914	+1			no_errors	ENST00000370708	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	A
ZNF461	92283	genome.wustl.edu	37	19	37129824	37129824	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr19:37129824C>T	ENST00000588268.1	-	6	1650	c.1423G>A	c.(1423-1425)Ggt>Agt	p.G475S	ZNF461_ENST00000540605.2_5'UTR|ZNF461_ENST00000360357.4_Missense_Mutation_p.G452S	NM_153257.2	NP_694989.2	Q8TAF7	ZN461_HUMAN	zinc finger protein 461	475					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(4)|lung(17)|prostate(1)|urinary_tract(2)	29	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			AAGGCCTTACCACATATCATG	0.393																																																	0													59.0	63.0	61.0					19																	37129824		2200	4298	6498	SO:0001583	missense	0			BX649031	CCDS54257.1, CCDS74348.1	19q13.13	2013-01-08				ENSG00000197808		"""Zinc fingers, C2H2-type"", ""-"""	21629	protein-coding gene	gene with protein product		608640				11579202, 15004467	Standard	XM_005259402		Approved	GIOT-1, MGC33911	uc002oem.3	Q8TAF7		ENST00000588268.1:c.1423G>A	19.37:g.37129824C>T	ENSP00000467931:p.Gly475Ser		A8K9W9|Q6VSF7|Q9ULZ8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G475S	ENST00000588268.1	37	c.1423	CCDS54257.1	19	.	.	.	.	.	.	.	.	.	.	C	19.13	3.768159	0.69878	.	.	ENSG00000197808	ENST00000396893;ENST00000396896;ENST00000360357;ENST00000540605;ENST00000396892	T	0.07114	3.22	3.48	2.43	0.29744	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.21307	0.0513	L	0.60845	1.875	0.34439	D	0.699376	D;D;D	0.76494	0.999;0.995;0.999	D;D;D	0.72338	0.977;0.925;0.977	T	0.19647	-1.0299	9	0.66056	D	0.02	.	9.5758	0.39457	0.0:0.8903:0.0:0.1097	.	452;397;475	B4DRP8;Q59G30;Q8TAF7	.;.;ZN461_HUMAN	S	475;206;452;348;169	ENSP00000353515:G452S	ENSP00000353515:G452S	G	-	1	0	ZNF461	41821664	0.997000	0.39634	0.991000	0.47740	0.889000	0.51656	3.401000	0.52601	0.787000	0.33731	0.491000	0.48974	GGT	ZNF461	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197808		0.393	ZNF461-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF461	HGNC	protein_coding	OTTHUMT00000453202.1	-	0.00	58	0	C	NM_153257		37129824	-1	tier1	-	no_errors	ENST00000588268	ensembl	human	known	74_37	missense	23.73	89	28	SNP	1.000	T
ZNF48	197407	genome.wustl.edu	37	16	30409330	30409330	+	Silent	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr16:30409330C>A	ENST00000320159.2	+	2	1135	c.759C>A	c.(757-759)ccC>ccA	p.P253P	SEPT1_ENST00000570039.1_5'Flank	NM_001214906.1|NM_001214907.1|NM_001214909.1|NM_152652.2	NP_001201835.1|NP_001201836.1|NP_001201838.1|NP_689865.2	Q96MX3	ZNF48_HUMAN	zinc finger protein 48	253					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(11)|ovary(2)|pancreas(1)|skin(1)	21						CAGTGGTGCCCCGACGGCAGC	0.637																																																	0													34.0	41.0	39.0					16																	30409330		2197	4298	6495	SO:0001819	synonymous_variant	0			M88358, AK056313	CCDS10679.1, CCDS73868.1	16p11.2	2013-01-08			ENSG00000180035	ENSG00000180035		"""Zinc fingers, C2H2-type"""	13114	protein-coding gene	gene with protein product			"""zinc finger protein 553"""	ZNF553		1505991	Standard	NM_152652		Approved	DKFZp762K013, FLJ31751, MGC43952	uc021tgi.1	Q96MX3	OTTHUMG00000048195	ENST00000320159.2:c.759C>A	16.37:g.30409330C>A			Q15920|Q4G0R3|Q69YP3|Q96IL9	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P253	ENST00000320159.2	37	c.759	CCDS10679.1	16																																																																																			ZNF48	-	NULL	ENSG00000180035		0.637	ZNF48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF48	HGNC	protein_coding	OTTHUMT00000255549.2	-	0.00	86	0	C	NM_152652		30409330	+1	tier1	-	no_errors	ENST00000320159	ensembl	human	known	74_37	silent	8.72	136	13	SNP	0.637	A
ZNF496	84838	genome.wustl.edu	37	1	247464366	247464366	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr1:247464366C>T	ENST00000294753.4	-	9	1683	c.1219G>A	c.(1219-1221)Gtg>Atg	p.V407M	ZNF496_ENST00000462139.1_5'UTR|ZNF496_ENST00000366498.2_Missense_Mutation_p.V443M	NM_032752.1	NP_116141.1	Q96IT1	ZN496_HUMAN	zinc finger protein 496	407					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear body (GO:0016604)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	36	all_cancers(71;0.000136)|all_epithelial(71;2.62e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)		OV - Ovarian serous cystadenocarcinoma(106;0.00703)			TTCGGACACACGTAGGACTTC	0.652																																																	0													48.0	47.0	48.0					1																	247464366		2203	4300	6503	SO:0001583	missense	0			BC007263	CCDS1631.1	1q44	2013-01-09			ENSG00000162714	ENSG00000162714		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23713	protein-coding gene	gene with protein product		613911				12477932	Standard	NM_032752		Approved	ZKSCAN17, MGC15548, ZSCAN49	uc001ico.3	Q96IT1	OTTHUMG00000041164	ENST00000294753.4:c.1219G>A	1.37:g.247464366C>T	ENSP00000294753:p.Val407Met		Q8TBS2	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.V443M	ENST00000294753.4	37	c.1327	CCDS1631.1	1	.	.	.	.	.	.	.	.	.	.	C	16.76	3.212966	0.58452	.	.	ENSG00000162714	ENST00000294753;ENST00000366498	T;T	0.54279	0.58;0.58	4.5	1.51	0.23008	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.477023	0.17996	N	0.155045	T	0.52933	0.1765	L	0.45352	1.415	0.24520	N	0.994167	D;D	0.63880	0.993;0.977	P;P	0.55923	0.759;0.787	T	0.39961	-0.9588	10	0.48119	T	0.1	-26.8964	7.7545	0.28917	0.0:0.6896:0.0:0.3104	.	443;407	Q96IT1-2;Q96IT1	.;ZN496_HUMAN	M	407;443	ENSP00000294753:V407M;ENSP00000355454:V443M	ENSP00000294753:V407M	V	-	1	0	ZNF496	245530989	0.000000	0.05858	0.979000	0.43373	0.913000	0.54294	-2.008000	0.01456	0.590000	0.29694	0.655000	0.94253	GTG	ZNF496	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000162714		0.652	ZNF496-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF496	HGNC	protein_coding	OTTHUMT00000098655.2	-	0.00	99	0	C	NM_032752		247464366	-1	tier1	-	no_errors	ENST00000366498	ensembl	human	known	74_37	missense	6.86	95	7	SNP	0.905	T
ZNF627	199692	genome.wustl.edu	37	19	11727779	11727779	+	Missense_Mutation	SNP	T	T	C			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr19:11727779T>C	ENST00000361113.5	+	4	669	c.461T>C	c.(460-462)tTt>tCt	p.F154S	ZNF627_ENST00000588174.1_3'UTR	NM_145295.3	NP_660338.1	Q7L945	ZN627_HUMAN	zinc finger protein 627	154					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14						CATCGCTCTTTTCCAGTACGT	0.413																																					Melanoma(112;173 1614 10731 17751 23322)												0													84.0	81.0	82.0					19																	11727779		2104	4257	6361	SO:0001583	missense	0			AK074846	CCDS42502.1	19p13.2	2013-01-08				ENSG00000198551		"""Zinc fingers, C2H2-type"", ""-"""	30570	protein-coding gene	gene with protein product		612248				12477932	Standard	NM_145295		Approved	FLJ90365	uc002msk.2	Q7L945		ENST00000361113.5:c.461T>C	19.37:g.11727779T>C	ENSP00000354414:p.Phe154Ser		O14846|Q4KMP9|Q6NT81|Q9BRG4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F154S	ENST00000361113.5	37	c.461	CCDS42502.1	19	.	.	.	.	.	.	.	.	.	.	t	16.46	3.128423	0.56721	.	.	ENSG00000198551	ENST00000361113	T	0.28666	1.6	1.36	1.36	0.22044	.	.	.	.	.	T	0.50463	0.1617	M	0.81239	2.535	0.09310	N	1	D	0.63046	0.992	D	0.66497	0.944	T	0.26430	-1.0103	9	0.72032	D	0.01	.	6.8018	0.23756	0.0:0.0:0.0:1.0	.	154	Q7L945	ZN627_HUMAN	S	154	ENSP00000354414:F154S	ENSP00000354414:F154S	F	+	2	0	ZNF627	11588779	0.020000	0.18652	0.001000	0.08648	0.839000	0.47603	3.301000	0.51842	0.901000	0.36495	0.260000	0.18958	TTT	ZNF627	-	NULL	ENSG00000198551		0.413	ZNF627-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF627	HGNC	protein_coding	OTTHUMT00000458875.1	-	0.00	110	0	T	NM_145295		11727779	+1	tier1	-	no_errors	ENST00000361113	ensembl	human	known	74_37	missense	26.28	101	36	SNP	0.001	C
ZNF581	51545	genome.wustl.edu	37	19	56156513	56156513	+	Silent	SNP	G	G	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr19:56156513G>A	ENST00000587252.1	+	2	849	c.576G>A	c.(574-576)acG>acA	p.T192T	CCDC106_ENST00000308964.3_5'Flank|CCDC106_ENST00000586790.1_5'Flank|ZNF581_ENST00000270451.5_Silent_p.T192T|ZNF581_ENST00000588537.1_Silent_p.T192T			Q9P0T4	ZN581_HUMAN	zinc finger protein 581	192					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)|lung(1)|ovary(1)	3		Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.105)		AGAAACACACGCGGTGGAAGC	0.632																																																	0													37.0	39.0	38.0					19																	56156513		2203	4300	6503	SO:0001819	synonymous_variant	0			AK026203	CCDS12932.1	19q13.42	2013-09-20			ENSG00000171425	ENSG00000171425		"""Zinc fingers, C2H2-type"""	25017	protein-coding gene	gene with protein product						11042152	Standard	NM_016535		Approved	HSPC189, FLJ22550	uc002qlq.3	Q9P0T4	OTTHUMG00000180869	ENST00000587252.1:c.576G>A	19.37:g.56156513G>A			B2RDM6	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T192	ENST00000587252.1	37	c.576	CCDS12932.1	19																																																																																			ZNF581	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000171425		0.632	ZNF581-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF581	HGNC	protein_coding	OTTHUMT00000453430.1	-	0.00	212	0	G	NM_016535		56156513	+1	tier1	-	no_errors	ENST00000270451	ensembl	human	known	74_37	silent	21.12	182	49	SNP	0.000	A
ZNF770	54989	genome.wustl.edu	37	15	35275397	35275397	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chr15:35275397G>T	ENST00000356321.4	-	3	583	c.239C>A	c.(238-240)cCt>cAt	p.P80H		NM_014106.3	NP_054825.2	Q6IQ21	ZN770_HUMAN	zinc finger protein 770	80					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)	29		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)		ACATTTAAAAGGCAGACTATG	0.353																																																	0													85.0	85.0	85.0					15																	35275397		2201	4298	6499	SO:0001583	missense	0			BC071603	CCDS10042.1	15q14	2013-01-08			ENSG00000198146	ENSG00000198146		"""Zinc fingers, C2H2-type"""	26061	protein-coding gene	gene with protein product							Standard	NM_014106		Approved	FLJ20582, PRO1914	uc001ziw.3	Q6IQ21	OTTHUMG00000129689	ENST00000356321.4:c.239C>A	15.37:g.35275397G>T	ENSP00000348673:p.Pro80His		Q6ZMZ6|Q9NWV2	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P80H	ENST00000356321.4	37	c.239	CCDS10042.1	15	.	.	.	.	.	.	.	.	.	.	G	16.94	3.261152	0.59431	.	.	ENSG00000198146	ENST00000356321	T	0.21361	2.01	4.86	4.86	0.63082	.	0.000000	0.64402	D	0.000002	T	0.47358	0.1441	M	0.72624	2.21	0.54753	D	0.999984	D	0.89917	1.0	D	0.97110	1.0	T	0.49437	-0.8940	10	0.87932	D	0	-9.9616	17.1786	0.86848	0.0:0.0:1.0:0.0	.	80	Q6IQ21	ZN770_HUMAN	H	80	ENSP00000348673:P80H	ENSP00000348673:P80H	P	-	2	0	ZNF770	33062689	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.849000	0.62882	2.515000	0.84797	0.655000	0.94253	CCT	ZNF770	-	NULL	ENSG00000198146		0.353	ZNF770-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF770	HGNC	protein_coding	OTTHUMT00000251896.2	-	0.00	75	0	G	NM_014106		35275397	-1	tier1	-	no_errors	ENST00000356321	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	T
ZNF81	347344	genome.wustl.edu	37	X	47775683	47775683	+	Silent	SNP	C	C	A			TCGA-R6-A6XG-01B-11D-A33E-09	TCGA-R6-A6XG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	766dcd2a-8fce-43da-826c-7d1b73bedbce	26e187fb-b287-4cd8-80ec-215cae9d6379	g.chrX:47775683C>A	ENST00000376954.1	+	6	2006	c.1638C>A	c.(1636-1638)acC>acA	p.T546T	ZNF81_ENST00000338637.7_Silent_p.T546T			P51508	ZNF81_HUMAN	zinc finger protein 81	546					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(1)|lung(1)|skin(1)	4		all_lung(315;0.0973)				AACACCAGACCATTCACACTG	0.423																																																	0													61.0	60.0	60.0					X																	47775683		2152	4264	6416	SO:0001819	synonymous_variant	0			AK126949	CCDS43933.1	Xp11.23	2013-01-08	2006-05-12		ENSG00000197779	ENSG00000197779		"""Zinc fingers, C2H2-type"", ""-"""	13156	protein-coding gene	gene with protein product		314998	"""zinc finger protein 81 (HFZ20)"", ""mental retardation, X-linked 45"""	MRX45		8507979, 15121780	Standard	NM_007137		Approved	HFZ20	uc022bvq.1	P51508	OTTHUMG00000021462	ENST00000376954.1:c.1638C>A	X.37:g.47775683C>A			Q6RX22|Q96QH6	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T546	ENST00000376954.1	37	c.1638	CCDS43933.1	X																																																																																			ZNF81	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197779		0.423	ZNF81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF81	HGNC	protein_coding	OTTHUMT00000056455.2	-	0.00	18	0	C	NM_007137		47775683	+1	tier1	-	no_errors	ENST00000338637	ensembl	human	known	74_37	silent	100.00	0	18	SNP	0.987	A
