#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
AACS	65985	genome.wustl.edu	37	12	125558421	125558421	+	Splice_Site	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr12:125558421G>T	ENST00000316519.6	+	2	339		c.e2-1		AACS_ENST00000261686.6_Splice_Site	NM_023928.3	NP_076417.2	Q86V21	AACS_HUMAN	acetoacetyl-CoA synthetase						adipose tissue development (GO:0060612)|cellular response to cholesterol (GO:0071397)|cellular response to glucose stimulus (GO:0071333)|cellular response to testosterone stimulus (GO:0071394)|fatty acid metabolic process (GO:0006631)|liver development (GO:0001889)|positive regulation of insulin secretion (GO:0032024)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|response to oleic acid (GO:0034201)|response to purine-containing compound (GO:0014074)|response to starvation (GO:0042594)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)	acetoacetate-CoA ligase activity (GO:0030729)|ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(4)|liver(1)|lung(16)|ovary(1)|stomach(1)	26	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;9.82e-05)|Epithelial(86;0.000642)|all cancers(50;0.00843)		TTCATTTTTAGAGAGTTATGA	0.418																																																	0													138.0	128.0	131.0					12																	125558421		2203	4300	6503	SO:0001630	splice_region_variant	0			AK022451	CCDS9263.1	12q24.31	2010-09-29			ENSG00000081760	ENSG00000081760	6.2.1.16	"""Acyl-CoA synthetase family"""	21298	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 1"""	614364				12623130, 17762044	Standard	NM_023928		Approved	FLJ12389, SUR-5, ACSF1	uc001uhc.3	Q86V21	OTTHUMG00000168550	ENST00000316519.6:c.134-1G>T	12.37:g.125558421G>T			Q49AB9|Q49AC3|Q658Q8|Q8IWD2|Q8NEW5|Q9BSJ9|Q9H829|Q9HA19	Splice_Site	SNP	-	e2-1	ENST00000316519.6	37	c.134-1	CCDS9263.1	12	.	.	.	.	.	.	.	.	.	.	.	12.79	2.044455	0.36085	.	.	ENSG00000081760	ENST00000316519;ENST00000536752;ENST00000261686	.	.	.	4.56	4.56	0.56223	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4648	0.84076	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AACS	124124374	1.000000	0.71417	0.525000	0.27900	0.312000	0.27988	7.958000	0.87877	2.251000	0.74343	0.491000	0.48974	.	AACS	-	-	ENSG00000081760		0.418	AACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AACS	HGNC	protein_coding	OTTHUMT00000400202.1		0.00	33	0	G	NM_023928	Intron	125558421	+1			no_errors	ENST00000316519	ensembl	human	known	74_37	splice_site	5.41	35	2	SNP	1.000	T
ABCA2	20	genome.wustl.edu	37	9	139916857	139916857	+	Silent	SNP	C	C	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr9:139916857C>T	ENST00000371605.3	-	5	657	c.510G>A	c.(508-510)tcG>tcA	p.S170S	ABCA2_ENST00000265662.5_Silent_p.S171S|ABCA2_ENST00000492260.1_5'UTR|ABCA2_ENST00000341511.6_Silent_p.S171S			Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 2	170					ATP catabolic process (GO:0006200)|cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|regulation of intracellular cholesterol transport (GO:0032383)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|nucleotide binding (GO:0000166)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|liver(1)|lung(25)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	41	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		TATTGGGCAGCGACAAGTTTT	0.642																																																	0													35.0	41.0	39.0					9																	139916857		2029	4165	6194	SO:0001819	synonymous_variant	0			U18235	CCDS43909.1	9q34	2012-03-14			ENSG00000107331	ENSG00000107331		"""ATP binding cassette transporters / subfamily A"""	32	protein-coding gene	gene with protein product		600047		ABC2		8088782	Standard	NM_212533		Approved		uc022bpy.1	Q9BZC7	OTTHUMG00000020958	ENST00000371605.3:c.510G>A	9.37:g.139916857C>T			A6NED5|Q5SPY5|Q5W9G5|Q76MW7|Q9HC28	Silent	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.S171	ENST00000371605.3	37	c.513		9																																																																																			ABCA2	-	NULL	ENSG00000107331		0.642	ABCA2-202	KNOWN	basic	protein_coding	ABCA2	HGNC	protein_coding		-	0.00	27	0	C	NM_001606		139916857	-1	tier1	-	no_errors	ENST00000265662	ensembl	human	known	74_37	silent	8.16	45	4	SNP	0.139	T
ABCC8	6833	genome.wustl.edu	37	11	17426153	17426153	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr11:17426153C>T	ENST00000389817.3	-	28	3531	c.3463G>A	c.(3463-3465)Gtc>Atc	p.V1155I	ABCC8_ENST00000302539.4_Missense_Mutation_p.V1156I			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	1155	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)	p.V1155I(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	TAGGAGATGACGGCCAGGGCT	0.597																																																	1	Substitution - Missense(1)	large_intestine(1)											97.0	66.0	76.0					11																	17426153		2200	4293	6493	SO:0001583	missense	0			L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.3463G>A	11.37:g.17426153C>T	ENSP00000374467:p.Val1155Ile		A6NMX8|E3UYX6|O75948|Q16583	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,prints_Sulphorea_rcpt,prints_Surea_rcpt-1,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.V1156I	ENST00000389817.3	37	c.3466	CCDS31437.1	11	.	.	.	.	.	.	.	.	.	.	C	18.59	3.655879	0.67586	.	.	ENSG00000006071	ENST00000389817;ENST00000302539	D;D	0.90197	-2.63;-2.63	5.32	5.32	0.75619	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.89972	0.6870	L	0.58583	1.82	0.80722	D	1	B	0.24092	0.097	B	0.27262	0.078	D	0.87259	0.2278	10	0.52906	T	0.07	.	19.0064	0.92852	0.0:1.0:0.0:0.0	.	1155	Q09428	ABCC8_HUMAN	I	1155;1156	ENSP00000374467:V1155I;ENSP00000303960:V1156I	ENSP00000303960:V1156I	V	-	1	0	ABCC8	17382729	1.000000	0.71417	0.993000	0.49108	0.987000	0.75469	7.805000	0.86005	2.477000	0.83638	0.514000	0.50259	GTC	ABCC8	-	pfam_ABC_transptr_TM_dom,superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom	ENSG00000006071		0.597	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABCC8	HGNC	protein_coding	OTTHUMT00000389093.1	-	0.00	40	0	C	NM_000352		17426153	-1	tier1	-	no_errors	ENST00000302539	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	T
ACSF3	197322	genome.wustl.edu	37	16	89211764	89211764	+	Missense_Mutation	SNP	G	G	T	rs192339782	byFrequency	TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr16:89211764G>T	ENST00000317447.4	+	9	1833	c.1456G>T	c.(1456-1458)Gcc>Tcc	p.A486S	ACSF3_ENST00000406948.3_Missense_Mutation_p.A486S|ACSF3_ENST00000537116.1_3'UTR|ACSF3_ENST00000378345.4_Missense_Mutation_p.A221S	NM_001127214.2|NM_001243279.1|NM_001284316.1|NM_174917.3	NP_001120686.1|NP_001230208.1|NP_001271245.1|NP_777577.2	Q4G176	ACSF3_HUMAN	acyl-CoA synthetase family member 3	486					fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|malonate catabolic process (GO:0090410)	mitochondrion (GO:0005739)	acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)|malonyl-CoA synthetase activity (GO:0090409)			central_nervous_system(1)|endometrium(1)|kidney(2)|lung(9)|prostate(1)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(80;0.0281)		CAAGGTCAGCGCCCTGGAGGT	0.627																																																	0													82.0	72.0	75.0					16																	89211764		2198	4300	6498	SO:0001583	missense	0			AK075499	CCDS10974.1, CCDS73926.1	16q24.3	2013-01-15			ENSG00000176715	ENSG00000176715		"""Acyl-CoA synthetase family"""	27288	protein-coding gene	gene with protein product	"""malonyl-CoA synthetase"""	614245				17762044, 21846720	Standard	XM_005256293		Approved		uc010cig.2	Q4G176	OTTHUMG00000138044	ENST00000317447.4:c.1456G>T	16.37:g.89211764G>T	ENSP00000320646:p.Ala486Ser		A8K4J8|C9JQL6|Q6INA0|Q8N2F7	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.A486S	ENST00000317447.4	37	c.1456	CCDS10974.1	16	.	.	.	.	.	.	.	.	.	.	G	22.4	4.284074	0.80803	.	.	ENSG00000176715	ENST00000317447;ENST00000406948;ENST00000378345;ENST00000544543	T;T;T;T	0.48201	0.82;0.82;0.82;0.82	4.69	3.7	0.42460	AMP-dependent synthetase/ligase (1);	0.136148	0.48286	U	0.000189	T	0.64472	0.2601	M	0.65498	2.005	0.44711	D	0.997704	D	0.65815	0.995	D	0.72982	0.979	T	0.63501	-0.6623	10	0.36615	T	0.2	-24.1555	14.1658	0.65475	0.0:0.1518:0.8482:0.0	.	486	Q4G176	ACSF3_HUMAN	S	486;486;221;221	ENSP00000320646:A486S;ENSP00000384627:A486S;ENSP00000367596:A221S;ENSP00000442781:A221S	ENSP00000320646:A486S	A	+	1	0	ACSF3	87739265	1.000000	0.71417	1.000000	0.80357	0.820000	0.46376	8.856000	0.92245	0.924000	0.37069	0.313000	0.20887	GCC	ACSF3	-	pfam_AMP-dep_Synth/Lig	ENSG00000176715		0.627	ACSF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSF3	HGNC	protein_coding	OTTHUMT00000269919.1	-	0.00	65	0	G	NM_174917		89211764	+1	tier1	-	no_errors	ENST00000317447	ensembl	human	known	74_37	missense	7.58	61	5	SNP	1.000	T
ACSS3	79611	genome.wustl.edu	37	12	81648675	81648675	+	Missense_Mutation	SNP	G	G	A	rs368687134		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr12:81648675G>A	ENST00000548058.1	+	16	2945	c.2035G>A	c.(2035-2037)Gta>Ata	p.V679I	ACSS3_ENST00000548324.1_Missense_Mutation_p.V361I|ACSS3_ENST00000261206.3_Missense_Mutation_p.V678I			Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	679						mitochondrion (GO:0005739)	acetate-CoA ligase activity (GO:0003987)|ATP binding (GO:0005524)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(7)|liver(3)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	51						TTTTGGCCACGTAGAAGAAAT	0.313																																																	0								G	ILE/VAL	0,4406		0,0,2203	92.0	97.0	95.0		2035	3.6	1.0	12		95	1,8599	1.2+/-3.3	0,1,4299	no	missense	ACSS3	NM_024560.2	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	679/687	81648675	1,13005	2203	4300	6503	SO:0001583	missense	0				CCDS9022.1	12q21.31	2014-08-08			ENSG00000111058	ENSG00000111058		"""Acyl-CoA synthetase family"""	24723	protein-coding gene	gene with protein product		614356				17762044	Standard	NM_024560		Approved	FLJ21963	uc001szl.1	Q9H6R3	OTTHUMG00000170179	ENST00000548058.1:c.2035G>A	12.37:g.81648675G>A	ENSP00000449535:p.Val679Ile		Q8NC66	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.V679I	ENST00000548058.1	37	c.2035	CCDS9022.1	12	.	.	.	.	.	.	.	.	.	.	G	0.820	-0.748859	0.03065	0.0	1.16E-4	ENSG00000111058	ENST00000548058;ENST00000261206;ENST00000548324	T;T;T	0.47869	1.94;1.95;0.83	5.95	3.59	0.41128	.	0.202495	0.50627	N	0.000109	T	0.13072	0.0317	N	0.01081	-1.03	0.25300	N	0.989284	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.0	T	0.33548	-0.9864	10	0.02654	T	1	-10.3099	4.293	0.10888	0.6465:0.0:0.2162:0.1373	.	361;679	Q9H6R3-2;Q9H6R3	.;ACSS3_HUMAN	I	679;678;361	ENSP00000449535:V679I;ENSP00000261206:V678I;ENSP00000448965:V361I	ENSP00000261206:V678I	V	+	1	0	ACSS3	80172806	0.972000	0.33761	1.000000	0.80357	0.501000	0.33797	1.635000	0.37134	0.489000	0.27749	-0.312000	0.09012	GTA	ACSS3	-	NULL	ENSG00000111058		0.313	ACSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACSS3	HGNC	protein_coding	OTTHUMT00000407794.1	-	0.00	85	0	G	NM_024560		81648675	+1	tier1	-	no_errors	ENST00000548058	ensembl	human	known	74_37	missense	15.25	98	18	SNP	0.996	A
ACTL6A	86	genome.wustl.edu	37	3	179293147	179293147	+	Intron	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr3:179293147C>A	ENST00000429709.2	+	6	689				ACTL6A_ENST00000450518.2_Intron|ACTL6A_ENST00000392662.1_Intron|ACTL6A_ENST00000467615.1_3'UTR	NM_004301.3	NP_004292.1	O96019	ACL6A_HUMAN	actin-like 6A						ATP-dependent chromatin remodeling (GO:0043044)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|nervous system development (GO:0007399)|neural retina development (GO:0003407)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	Ino80 complex (GO:0031011)|npBAF complex (GO:0071564)|NuA4 histone acetyltransferase complex (GO:0035267)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|urinary_tract(1)	21	all_cancers(143;3.94e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)			TTCCCTTTTACATCACCATCT	0.413																																																	0																																										SO:0001627	intron_variant	0			AK098691	CCDS3231.1, CCDS43174.1	3q26.33	2011-07-06			ENSG00000136518	ENSG00000136518		"""INO80 complex subunits"""	24124	protein-coding gene	gene with protein product	"""BAF complex 53 kDa subunit"", ""BRG1-associated factor"", ""actin-related protein 4"", ""INO80 complex subunit K"""	604958				9845365, 10380635	Standard	NM_004301		Approved	Actl6, BAF53A, Arp4, Baf53a, INO80K	uc003fjw.3	O96019	OTTHUMG00000157782	ENST00000429709.2:c.477-858C>A	3.37:g.179293147C>A			B3KMN1|D3DNR9|Q8TAE5|Q9BVS8|Q9H0W6	RNA	SNP	-	NULL	ENST00000429709.2	37	NULL	CCDS3231.1	3																																																																																			ACTL6A	-	-	ENSG00000136518		0.413	ACTL6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL6A	HGNC	protein_coding	OTTHUMT00000349599.1	-	0.00	33	0	C	NM_004301		179293147	+1	tier1	-	no_errors	ENST00000467615	ensembl	human	known	74_37	rna	11.49	77	10	SNP	0.000	A
ADAM17	6868	genome.wustl.edu	37	2	9666349	9666349	+	Missense_Mutation	SNP	C	C	G	rs142946965		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr2:9666349C>G	ENST00000310823.3	-	6	826	c.644G>C	c.(643-645)aGa>aCa	p.R215T	ADAM17_ENST00000497134.1_Missense_Mutation_p.R215T	NM_003183.4	NP_003174.3	P78536	ADA17_HUMAN	ADAM metallopeptidase domain 17	215					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell motility (GO:0048870)|collagen catabolic process (GO:0030574)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|germinal center formation (GO:0002467)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil mediated immunity (GO:0002446)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of chemokine production (GO:0032722)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|proteolysis (GO:0006508)|regulation of mast cell apoptotic process (GO:0033025)|response to drug (GO:0042493)|response to high density lipoprotein particle (GO:0055099)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|wound healing, spreading of epidermal cells (GO:0035313)	actin cytoskeleton (GO:0015629)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|interleukin-6 receptor binding (GO:0005138)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|Notch binding (GO:0005112)|PDZ domain binding (GO:0030165)|zinc ion binding (GO:0008270)			breast(1)|cervix(4)|endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)	28	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.225)		TGGGTCAGCTCTTCTTTTCAC	0.373																																																	0													170.0	150.0	157.0					2																	9666349		2203	4300	6503	SO:0001583	missense	0			U69611	CCDS1665.1	2p25	2010-08-05	2008-07-31		ENSG00000151694	ENSG00000151694		"""ADAM metallopeptidase domain containing"", ""CD molecules"""	195	protein-coding gene	gene with protein product		603639	"""tumor necrosis factor, alpha, converting enzyme"""	TACE		9034190, 9574564	Standard	NM_003183		Approved	cSVP, CD156B	uc002qzu.3	P78536	OTTHUMG00000090425	ENST00000310823.3:c.644G>C	2.37:g.9666349C>G	ENSP00000309968:p.Arg215Thr		O60226	Missense_Mutation	SNP	pfam_Blood-coag_inhib_Disintegrin,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B	p.R215T	ENST00000310823.3	37	c.644	CCDS1665.1	2	.	.	.	.	.	.	.	.	.	.	C	14.55	2.569895	0.45798	.	.	ENSG00000151694	ENST00000310823;ENST00000497134;ENST00000538558	T;T	0.65916	1.92;-0.18	5.46	3.65	0.41850	.	0.080829	0.85682	D	0.000000	T	0.68165	0.2971	L	0.59436	1.845	0.46279	D	0.998963	P;P	0.49862	0.929;0.929	P;P	0.55161	0.77;0.77	T	0.66881	-0.5811	10	0.45353	T	0.12	.	11.2026	0.48749	0.0:0.8023:0.1284:0.0693	.	215;215	B2RNB2;P78536	.;ADA17_HUMAN	T	215	ENSP00000309968:R215T;ENSP00000418728:R215T	ENSP00000309968:R215T	R	-	2	0	ADAM17	9583800	1.000000	0.71417	0.800000	0.32199	0.974000	0.67602	3.024000	0.49674	0.773000	0.33404	0.585000	0.79938	AGA	ADAM17	-	NULL	ENSG00000151694		0.373	ADAM17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM17	HGNC	protein_coding	OTTHUMT00000206857.1	-	0.00	28	0	C			9666349	-1	tier1	-	no_errors	ENST00000310823	ensembl	human	known	74_37	missense	20.51	61	16	SNP	0.999	G
ADAM22	53616	genome.wustl.edu	37	7	87822484	87822484	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr7:87822484G>A	ENST00000265727.7	+	30	2709	c.2630G>A	c.(2629-2631)aGc>aAc	p.S877N	ADAM22_ENST00000315984.7_Missense_Mutation_p.S870N|ADAM22_ENST00000398209.3_Missense_Mutation_p.S870N|ADAM22_ENST00000398204.4_Missense_Mutation_p.S841N			Q9P0K1	ADA22_HUMAN	ADAM metallopeptidase domain 22	877					adult locomotory behavior (GO:0008344)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell adhesion (GO:0007162)	integral component of membrane (GO:0016021)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(7)|kidney(4)|large_intestine(7)|liver(2)|lung(20)|ovary(6)|prostate(4)|skin(3)	53	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)			ATTGCCTCCAGCAGAAAATAC	0.448																																																	0													92.0	87.0	89.0					7																	87822484		1921	4129	6050	SO:0001583	missense	0			AB009671	CCDS43608.1, CCDS43609.1, CCDS43610.1, CCDS47637.1	7q21	2008-07-18	2005-08-18		ENSG00000008277	ENSG00000008277		"""ADAM metallopeptidase domain containing"""	201	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, and cysteine-rich protein 2"""	603709	"""a disintegrin and metalloproteinase domain 22"""			9693107, 10524237	Standard	NM_021723		Approved	MDC2	uc003ujn.3	Q9P0K1	OTTHUMG00000137417	ENST00000265727.7:c.2630G>A	7.37:g.87822484G>A	ENSP00000265727:p.Ser877Asn		O75075|O75076|Q9P0K2|Q9UIA1|Q9UKK2	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.S877N	ENST00000265727.7	37	c.2630	CCDS47637.1	7	.	.	.	.	.	.	.	.	.	.	G	31	5.096074	0.94197	.	.	ENSG00000008277	ENST00000398204;ENST00000265727;ENST00000315984;ENST00000398209;ENST00000426930	T;T;T;T;T	0.61510	4.31;3.89;3.42;3.7;0.1	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.66479	0.2793	N	0.24115	0.695	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.85130	0.996;0.993;0.997	T	0.66654	-0.5869	10	0.45353	T	0.12	.	19.8611	0.96785	0.0:0.0:1.0:0.0	.	841;877;870	Q9P0K1-5;Q9P0K1;Q9P0K1-2	.;ADA22_HUMAN;.	N	841;877;870;870;301	ENSP00000381262:S841N;ENSP00000265727:S877N;ENSP00000315900:S870N;ENSP00000381267:S870N;ENSP00000396233:S301N	ENSP00000265727:S877N	S	+	2	0	ADAM22	87660420	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.711000	0.92665	0.650000	0.86243	AGC	ADAM22	-	NULL	ENSG00000008277		0.448	ADAM22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADAM22	HGNC	protein_coding	OTTHUMT00000268370.2	-	0.00	44	0	G	NM_021723		87822484	+1	tier1	-	no_errors	ENST00000265727	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	A
ADAMTS10	81794	genome.wustl.edu	37	19	8665990	8665990	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr19:8665990G>T	ENST00000597188.1	-	6	902	c.632C>A	c.(631-633)aCc>aAc	p.T211N	ADAMTS10_ENST00000596709.1_5'UTR|ADAMTS10_ENST00000270328.4_Missense_Mutation_p.T211N	NM_030957.2	NP_112219.3	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 10	211						extracellular matrix (GO:0031012)|microfibril (GO:0001527)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(16)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(3)|skin(10)|urinary_tract(1)	53						TGGCTTCAAGGTCCGCAGCCA	0.642																																																	0													32.0	32.0	32.0					19																	8665990		2203	4300	6503	SO:0001583	missense	0			AF163762	CCDS12206.1, CCDS62529.1	19p13.2	2014-08-12	2005-08-19		ENSG00000142303	ENSG00000142303		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13201	protein-coding gene	gene with protein product		608990	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 10"""				Standard	XM_005272499		Approved	ADAM-TS10	uc002mkj.1	Q9H324	OTTHUMG00000182216	ENST00000597188.1:c.632C>A	19.37:g.8665990G>T	ENSP00000471851:p.Thr211Asn		M0QZE4	Missense_Mutation	SNP	pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.T211N	ENST00000597188.1	37	c.632	CCDS12206.1	19	.	.	.	.	.	.	.	.	.	.	G	6.809	0.518378	0.13005	.	.	ENSG00000142303	ENST00000270328	T	0.59364	0.27	5.47	3.24	0.37175	.	0.203724	0.40908	D	0.000985	T	0.37019	0.0988	N	0.19112	0.55	0.43982	D	0.996671	B	0.02656	0.0	B	0.04013	0.001	T	0.08472	-1.0720	10	0.15066	T	0.55	.	9.4575	0.38764	0.0:0.1402:0.5698:0.29	.	211	Q9H324	ATS10_HUMAN	N	211	ENSP00000270328:T211N	ENSP00000270328:T211N	T	-	2	0	ADAMTS10	8571990	1.000000	0.71417	0.956000	0.39512	0.387000	0.30353	3.427000	0.52785	0.612000	0.30071	0.555000	0.69702	ACC	ADAMTS10	-	NULL	ENSG00000142303		0.642	ADAMTS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS10	HGNC	protein_coding	OTTHUMT00000460085.3	-	0.00	23	0	G	NM_030957		8665990	-1	tier1	-	no_errors	ENST00000270328	ensembl	human	known	74_37	missense	18.52	22	5	SNP	0.960	T
ADAMTS15	170689	genome.wustl.edu	37	11	130332588	130332588	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr11:130332588C>A	ENST00000299164.2	+	4	1455	c.1455C>A	c.(1453-1455)ttC>ttA	p.F485L		NM_139055.2	NP_620686.1	Q8TE58	ATS15_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 15	485	Disintegrin.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(8)|urinary_tract(1)	36	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)		CCCGCCACTTCCCCTGGGCCG	0.622																																																	0													87.0	85.0	86.0					11																	130332588		2201	4297	6498	SO:0001583	missense	0			AJ315733	CCDS8488.1	11q25	2008-02-01	2005-08-19		ENSG00000166106	ENSG00000166106		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	16305	protein-coding gene	gene with protein product		607509	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 15"""			11867212	Standard	NM_139055		Approved		uc010scd.2	Q8TE58	OTTHUMG00000165657	ENST00000299164.2:c.1455C>A	11.37:g.130332588C>A	ENSP00000299164:p.Phe485Leu		Q32MI6	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS,prints_Pept_M12B_ADAM-TS8	p.F485L	ENST00000299164.2	37	c.1455	CCDS8488.1	11	.	.	.	.	.	.	.	.	.	.	C	14.01	2.407650	0.42715	.	.	ENSG00000166106	ENST00000299164	T	0.59906	0.23	5.48	0.397	0.16314	.	.	.	.	.	T	0.56543	0.1992	L	0.31845	0.965	0.58432	D	0.999999	D	0.76494	0.999	D	0.74023	0.982	T	0.53092	-0.8487	9	0.08179	T	0.78	.	9.7305	0.40359	0.0:0.5172:0.0:0.4828	.	485	Q8TE58	ATS15_HUMAN	L	485	ENSP00000299164:F485L	ENSP00000299164:F485L	F	+	3	2	ADAMTS15	129837798	0.844000	0.29557	1.000000	0.80357	0.996000	0.88848	0.048000	0.14078	0.284000	0.22305	-0.140000	0.14226	TTC	ADAMTS15	-	smart_ADAM_Cys-rich	ENSG00000166106		0.622	ADAMTS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS15	HGNC	protein_coding	OTTHUMT00000385638.1	-	0.00	41	0	C	NM_139055		130332588	+1	tier1	-	no_errors	ENST00000299164	ensembl	human	known	74_37	missense	16.98	44	9	SNP	0.994	A
ADCYAP1R1	117	genome.wustl.edu	37	7	31139801	31139801	+	Intron	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr7:31139801G>T	ENST00000304166.4	+	14	1335				ADCYAP1R1_ENST00000409489.1_Missense_Mutation_p.M397I|ADCYAP1R1_ENST00000396211.2_Missense_Mutation_p.M369I|ADCYAP1R1_ENST00000409363.1_Intron	NM_001118.4|NM_001199635.1|NM_001199636.1	NP_001109.2|NP_001186564.1|NP_001186565.1	P41586	PACR_HUMAN	adenylate cyclase activating polypeptide 1 (pituitary) receptor type I						activation of adenylate cyclase activity (GO:0007190)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)|vasoactive intestinal polypeptide receptor activity (GO:0004999)			endometrium(1)|large_intestine(4)|liver(2)|lung(24)|ovary(1)|skin(2)|stomach(1)	35						CTTGCAAGATGTCAGAACTGT	0.602																																					Ovarian(44;225 1186 2158 11092)												0																																										SO:0001627	intron_variant	0				CCDS5433.1, CCDS56480.1, CCDS56481.1	7p14.3	2012-09-20			ENSG00000078549	ENSG00000078549		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	242	protein-coding gene	gene with protein product	"""PACAP receptor 1"""	102981				7902709	Standard	NM_001199635		Approved	PAC1, PACAPR, PAC1R	uc003tcg.3	P41586	OTTHUMG00000023884	ENST00000304166.4:c.1047-3050G>T	7.37:g.31139801G>T			A8K1Y1|B7ZLA7|B8ZZK3|Q17S10	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_PACAP_1_rcpt,prints_GPCR_2_secretin-like	p.M397I	ENST00000304166.4	37	c.1191	CCDS5433.1	7	.	.	.	.	.	.	.	.	.	.	G	22.3	4.269268	0.80469	.	.	ENSG00000078549	ENST00000381667;ENST00000396211;ENST00000409489	T;T	0.46451	1.25;0.87	5.23	5.23	0.72850	.	0.000000	0.46758	U	0.000269	T	0.34513	0.0900	N	0.19112	0.55	0.39459	D	0.967537	B;B	0.23128	0.08;0.08	B;B	0.30943	0.122;0.122	T	0.25187	-1.0139	10	0.56958	D	0.05	.	16.6654	0.85252	0.0:0.0:1.0:0.0	.	368;369	B7ZLA7;Q17S10	.;.	I	168;369;397	ENSP00000379514:M369I;ENSP00000386395:M397I	ENSP00000371083:M168I	M	+	3	0	ADCYAP1R1	31106326	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.127000	0.94417	2.612000	0.88384	0.655000	0.94253	ATG	ADCYAP1R1	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like	ENSG00000078549		0.602	ADCYAP1R1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ADCYAP1R1	HGNC	protein_coding	OTTHUMT00000215041.3		0.00	18	0	G	NM_001118		31139801	+1			no_errors	ENST00000409489	ensembl	human	novel	74_37	missense	11.11	32	4	SNP	1.000	T
AFG3L1P	172	genome.wustl.edu	37	16	90066879	90066879	+	IGR	SNP	A	A	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr16:90066879A>T								AFG3L1P (3848 upstream) : DBNDD1 (4393 downstream)																							CTCCTGGAGAAGGAAGTACTG	0.602																																																	0																																										SO:0001628	intergenic_variant	0																															16.37:g.90066879A>T				RNA	SNP	-	NULL		37	NULL		16																																																																																			AFG3L1P	-	-	ENSG00000223959	0	0.602					AFG3L1P	HGNC				0.00	34	0	A			90066879	+1			no_errors	ENST00000388970	ensembl	human	known	74_37	rna	6.06	62	4	SNP	1.000	T
AIRE	326	genome.wustl.edu	37	21	45710820	45710820	+	Intron	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr21:45710820G>A	ENST00000291582.5	+	8	1006				AIRE_ENST00000329347.4_Missense_Mutation_p.G44D|AIRE_ENST00000355347.4_Missense_Mutation_p.G44D	NM_000383.3	NP_000374.1	O43918	AIRE_HUMAN	autoimmune regulator						humoral immune response (GO:0006959)|immune response (GO:0006955)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|transcription regulatory region DNA binding (GO:0044212)|translation regulator activity (GO:0045182)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|skin(2)|urinary_tract(1)	14				Colorectal(79;0.0806)		GGTGGTCAGGGCAGAATTTCA	0.602									Autoimmune PolyEndocrinopathy Candidiasis Ectodermal Dystrophy																																								0													95.0	107.0	103.0					21																	45710820		2203	4300	6503	SO:0001627	intron_variant	0	Familial Cancer Database	APECED	AB006684	CCDS13706.1	21q22.3	2014-09-17	2007-06-20		ENSG00000160224	ENSG00000160224		"""Zinc fingers, PHD-type"""	360	protein-coding gene	gene with protein product	"""autoimmune polyendocrinopathy candidiasis ectodermal dystrophy"""	607358	"""autoimmune regulator (autoimmune polyendocrinopathy candidiasis ectodermal dystrophy)"""	APECED		9398840	Standard	NM_000383		Approved	PGA1, APS1	uc002zei.3	O43918	OTTHUMG00000086921	ENST00000291582.5:c.880-158G>A	21.37:g.45710820G>A			B2RP50|O43922|O43932|O75745	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.G44D	ENST00000291582.5	37	c.131	CCDS13706.1	21	.	.	.	.	.	.	.	.	.	.	G	12.63	1.994376	0.35226	.	.	ENSG00000160224	ENST00000337909;ENST00000397994;ENST00000355347;ENST00000329347	D;D	0.96830	-4.07;-4.14	1.99	0.0655	0.14357	.	.	.	.	.	D	0.87849	0.6281	N	0.08118	0	0.09310	N	1	B	0.25904	0.137	B	0.21151	0.033	T	0.80111	-0.1519	9	0.87932	D	0	.	2.5345	0.04711	0.1758:0.0:0.5379:0.2863	.	44	B2RP50	.	D	44	ENSP00000347505:G44D;ENSP00000331055:G44D	ENSP00000331055:G44D	G	+	2	0	AIRE	44535248	.	.	0.001000	0.08648	0.005000	0.04900	.	.	0.004000	0.14682	0.462000	0.41574	GGC	AIRE	-	NULL	ENSG00000160224		0.602	AIRE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AIRE	HGNC	protein_coding	OTTHUMT00000195842.2	-	0.00	43	0	G			45710820	+1	tier1	-	no_errors	ENST00000355347	ensembl	human	known	74_37	missense	6.45	57	4	SNP	0.001	A
ALDH3A2	224	genome.wustl.edu	37	17	19564483	19564483	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr17:19564483G>T	ENST00000176643.6	+	6	1288	c.842G>T	c.(841-843)aGg>aTg	p.R281M	ALDH3A2_ENST00000339618.4_Missense_Mutation_p.R281M|SNORA31_ENST00000516540.1_RNA|ALDH3A2_ENST00000579855.1_Missense_Mutation_p.R281M|ALDH3A2_ENST00000581518.1_Missense_Mutation_p.R281M|ALDH3A2_ENST00000395575.2_Missense_Mutation_p.R281M|ALDH3A2_ENST00000571163.1_5'Flank			P51648	AL3A2_HUMAN	aldehyde dehydrogenase 3 family, member A2	281					cellular aldehyde metabolic process (GO:0006081)|central nervous system development (GO:0007417)|epidermis development (GO:0008544)|oxidation-reduction process (GO:0055114)|peripheral nervous system development (GO:0007422)|phytol metabolic process (GO:0033306)|sesquiterpenoid metabolic process (GO:0006714)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)|peroxisome (GO:0005777)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)|long-chain-alcohol oxidase activity (GO:0046577)|long-chain-aldehyde dehydrogenase activity (GO:0050061)|medium-chain-aldehyde dehydrogenase activity (GO:0052814)			endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(2)|ovary(2)|prostate(1)	13	all_cancers(12;1.39e-05)|all_epithelial(12;0.00158)|Breast(13;0.245)					GATTATGAAAGGATCATCAAT	0.353																																																	0													69.0	67.0	68.0					17																	19564483		2203	4300	6503	SO:0001583	missense	0			L47162	CCDS11210.1, CCDS32589.1	17p11.2	2010-05-07			ENSG00000072210	ENSG00000072210	1.2.1.3	"""Aldehyde dehydrogenases"""	403	protein-coding gene	gene with protein product	"""fatty aldehyde dehydrogenase"""	609523		SLS, ALDH10		7894487	Standard	NM_000382		Approved	FALDH	uc002gwa.1	P51648	OTTHUMG00000059471	ENST00000176643.6:c.842G>T	17.37:g.19564483G>T	ENSP00000176643:p.Arg281Met		Q6I9T3|Q93011|Q96J37	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,pfam_Acyl-CoA_reduct_LuxC,superfamily_Ald_DH/histidinol_DH,pirsf_Aldehyde_DH_NAD(P)	p.R281M	ENST00000176643.6	37	c.842	CCDS11210.1	17	.	.	.	.	.	.	.	.	.	.	G	16.30	3.084755	0.55861	.	.	ENSG00000072210	ENST00000176643;ENST00000395575;ENST00000339618	T;T;T	0.75821	-0.97;-0.97;-0.97	6.07	6.07	0.98685	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.000000	0.85682	D	0.000000	D	0.91794	0.7404	H	0.97365	3.99	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.80764	0.994;0.99	D	0.93784	0.7086	10	0.87932	D	0	-33.2456	19.6321	0.95713	0.0:0.0:1.0:0.0	.	281;281	P51648;P51648-2	AL3A2_HUMAN;.	M	281	ENSP00000176643:R281M;ENSP00000378942:R281M;ENSP00000345774:R281M	ENSP00000176643:R281M	R	+	2	0	ALDH3A2	19505075	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.715000	0.98748	2.884000	0.98904	0.655000	0.94253	AGG	ALDH3A2	-	pfam_Aldehyde_DH_dom,pfam_Acyl-CoA_reduct_LuxC,superfamily_Ald_DH/histidinol_DH,pirsf_Aldehyde_DH_NAD(P)	ENSG00000072210		0.353	ALDH3A2-001	KNOWN	basic|CCDS	protein_coding	ALDH3A2	HGNC	protein_coding	OTTHUMT00000132268.1	-	0.00	48	0	G			19564483	+1	tier1	-	no_errors	ENST00000339618	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	T
ALG9	79796	genome.wustl.edu	37	11	111739440	111739440	+	3'UTR	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr11:111739440C>A	ENST00000524880.1	-	0	1282				ALG9_ENST00000527228.1_5'UTR|ALG9_ENST00000398006.2_5'UTR|ALG9_ENST00000531154.1_5'UTR|ALG9_ENST00000527377.1_5'Flank			Q9H6U8	ALG9_HUMAN	ALG9, alpha-1,2-mannosyltransferase						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	dol-P-Man:Man(6)GlcNAc(2)-PP-Dol alpha-1,2-mannosyltransferase activity (GO:0052926)|dol-P-Man:Man(8)GlcNAc(2)-PP-Dol alpha-1,2-mannosyltransferase activity (GO:0052918)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.81e-07)|BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|all cancers(92;1.3e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0587)		AAACCCTTCCCCATAGATGAG	0.428																																																	0													87.0	84.0	85.0					11																	111739440		1875	4103	5978	SO:0001624	3_prime_UTR_variant	0				CCDS41714.1, CCDS53709.1, CCDS73379.1, CCDS73380.1	11q23	2013-02-26	2013-02-26	2004-08-26	ENSG00000086848	ENSG00000086848	2.4.1.259, 2.4.1.261	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	15672	protein-coding gene	gene with protein product	"""dolichyl-P-Man:Man(6)GlcNAc(2)-PP-dolichol alpha-1,2-mannosyltransferase"", ""dolichyl-P-Man:Man(8)GlcNAc(2)-PP-dolichol alpha-1,2-mannosyltransferase"", ""dol-P-Man dependent alpha-1,2-mannosyltransferase"""	606941	"""disrupted in bipolar affective disorder 1"", ""asparagine-linked glycosylation 9 homolog (yeast, alpha 1,2 mannosyltransferase)"", ""asparagine-linked glycosylation 9, alpha- 1,2-mannosyltransferase homolog (S. cerevisiae, alpha- 1,2-mannosyltransferase)"", ""asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae)"""	DIBD1		12030331, 15148656	Standard	NM_024740		Approved		uc021qql.1	Q9H6U8	OTTHUMG00000166819	ENST00000524880.1:c.*120G>T	11.37:g.111739440C>A			Q6ZMD5|Q7Z4R4|Q96GS7|Q96PB9|Q9H068	RNA	SNP	-	NULL	ENST00000524880.1	37	NULL		11	.	.	.	.	.	.	.	.	.	.	C	34	5.340417	0.95783	.	.	ENSG00000086848	ENST00000428306	.	.	.	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	D	0.86952	0.6057	M	0.93978	3.48	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	D	0.90440	0.4431	9	0.87932	D	0	-12.9835	18.735	0.91750	0.0:1.0:0.0:0.0	.	97;97	Q9H6U8-3;Q9H6U8	.;ALG9_HUMAN	V	330	.	ENSP00000387627:G330V	G	-	2	0	ALG9	111244650	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.487000	0.81328	2.433000	0.82419	0.591000	0.81541	GGG	ALG9	-	-	ENSG00000086848		0.428	ALG9-001	KNOWN	basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	ALG9	HGNC	protein_coding	OTTHUMT00000413376.1		0.00	67	0	C	NM_024740		111739440	-1			no_errors	ENST00000524386	ensembl	human	known	74_37	rna	5.26	72	4	SNP	1.000	A
ALOXE3	59344	genome.wustl.edu	37	17	8013843	8013843	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr17:8013843C>A	ENST00000448843.2	-	9	1301	c.961G>T	c.(961-963)Ggg>Tgg	p.G321W	ALOXE3_ENST00000380149.1_Missense_Mutation_p.G477W|ALOXE3_ENST00000318227.3_Missense_Mutation_p.G453W	NM_021628.2	NP_067641.2	Q9BYJ1	LOXE3_HUMAN	arachidonate lipoxygenase 3	321	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|ceramide biosynthetic process (GO:0046513)|establishment of skin barrier (GO:0061436)|fat cell differentiation (GO:0045444)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipoxygenase pathway (GO:0019372)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|sensory perception of pain (GO:0019233)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)	hepoxilin A3 synthase activity (GO:0051120)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)	31						AAGATGTTCCCCCTCTGCAGA	0.647											OREG0024154	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													49.0	46.0	47.0					17																	8013843		2191	4279	6470	SO:0001583	missense	0			AJ269499	CCDS11130.1, CCDS54084.1	17p13.1	2009-07-10			ENSG00000179148	ENSG00000179148	1.13.11.-	"""Arachidonate lipoxygenases"""	13743	protein-coding gene	gene with protein product		607206					Standard	NM_021628		Approved	eLOX3, E-LOX	uc010vuo.2	Q9BYJ1	OTTHUMG00000108179	ENST00000448843.2:c.961G>T	17.37:g.8013843C>A	ENSP00000400581:p.Gly321Trp	646	B2R981|B7Z3W0|Q3ZB74|Q9H4F2|Q9HC22	Missense_Mutation	SNP	pfam_LipOase_C,pfam_PLAT/LH2_dom,superfamily_LipOase_C,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom,prints_LipOase_C	p.G453W	ENST00000448843.2	37	c.1357	CCDS11130.1	17	.	.	.	.	.	.	.	.	.	.	C	21.0	4.082539	0.76528	.	.	ENSG00000179148	ENST00000380149;ENST00000318227;ENST00000448843	D;D;D	0.91740	-2.9;-2.9;-2.9	4.52	3.54	0.40534	Lipoxygenase, C-terminal (3);	0.104529	0.64402	D	0.000003	D	0.95965	0.8686	M	0.87381	2.88	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.96009	0.9000	10	0.87932	D	0	-15.6686	11.8921	0.52635	0.0:0.9122:0.0:0.0878	.	453;321;321	B7Z3W0;Q9BYJ1;B3KVD2	.;LOXE3_HUMAN;.	W	477;453;321	ENSP00000369494:G477W;ENSP00000314879:G453W;ENSP00000400581:G321W	ENSP00000314879:G453W	G	-	1	0	ALOXE3	7954568	1.000000	0.71417	0.997000	0.53966	0.960000	0.62799	4.747000	0.62141	1.098000	0.41479	0.563000	0.77884	GGG	ALOXE3	-	pfam_LipOase_C,superfamily_LipOase_C	ENSG00000179148		0.647	ALOXE3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ALOXE3	HGNC	protein_coding	OTTHUMT00000441475.1	-	0.00	40	0	C			8013843	-1	tier1	-	no_errors	ENST00000318227	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	A
ANO3	63982	genome.wustl.edu	37	11	26619955	26619955	+	Silent	SNP	G	G	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr11:26619955G>C	ENST00000256737.3	+	15	2343	c.1491G>C	c.(1489-1491)ctG>ctC	p.L497L	ANO3_ENST00000531568.1_Silent_p.L351L|ANO3_ENST00000525139.1_Silent_p.L481L|ANO3_ENST00000537978.1_Silent_p.L481L	NM_031418.2	NP_113606.2	Q9BYT9	ANO3_HUMAN	anoctamin 3	497					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	phospholipid scramblase activity (GO:0017128)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68						GGAGTATACTGACCTATACTT	0.363																																																	0													126.0	124.0	125.0					11																	26619955		2203	4299	6502	SO:0001819	synonymous_variant	0			AJ300461	CCDS31447.1	11p14.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000134343	ENSG00000134343		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	14004	protein-coding gene	gene with protein product	"""transmembrane protein 16C (eight membrane-spanning domains)"""	610110	"""chromosome 11 open reading frame 25"", ""transmembrane protein 16C"""	C11orf25, TMEM16C		12739008, 15067359, 23200863, 24692353	Standard	NM_031418		Approved	GENX-3947, DYT23	uc001mqt.4	Q9BYT9	OTTHUMG00000166096	ENST00000256737.3:c.1491G>C	11.37:g.26619955G>C			B7Z3F5	Silent	SNP	pfam_Anoctamin	p.L497	ENST00000256737.3	37	c.1491	CCDS31447.1	11																																																																																			ANO3	-	pfam_Anoctamin	ENSG00000134343		0.363	ANO3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANO3	HGNC	protein_coding	OTTHUMT00000387806.1	-	0.00	50	0	G	NM_031418		26619955	+1	tier1	-	no_errors	ENST00000256737	ensembl	human	known	74_37	silent	12.50	77	11	SNP	0.950	C
ANXA2	302	genome.wustl.edu	37	15	60644625	60644625	+	Missense_Mutation	SNP	C	C	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr15:60644625C>G	ENST00000396024.3	-	10	798	c.639G>C	c.(637-639)tgG>tgC	p.W213C	ANXA2_ENST00000421017.2_Missense_Mutation_p.W213C|ANXA2_ENST00000451270.2_Missense_Mutation_p.W213C|ANXA2_ENST00000332680.4_Missense_Mutation_p.W231C	NM_001136015.2	NP_001129487.1	P07355	ANXA2_HUMAN	annexin A2	213					angiogenesis (GO:0001525)|body fluid secretion (GO:0007589)|cellular response to acid chemical (GO:0071229)|collagen fibril organization (GO:0030199)|fibrinolysis (GO:0042730)|membrane budding (GO:0006900)|membrane raft assembly (GO:0001765)|negative regulation of catalytic activity (GO:0043086)|osteoclast development (GO:0036035)|positive regulation of binding (GO:0051099)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vesicle fusion (GO:0031340)|protein heterotetramerization (GO:0051290)|protein targeting to plasma membrane (GO:0072661)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell surface (GO:0009986)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|late endosome membrane (GO:0031902)|lipid particle (GO:0005811)|lysosomal membrane (GO:0005765)|macropinosome (GO:0044354)|membrane (GO:0016020)|midbody (GO:0030496)|myelin sheath adaxonal region (GO:0035749)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|sarcolemma (GO:0042383)|Schmidt-Lanterman incisure (GO:0043220)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phospholipase A2 inhibitor activity (GO:0019834)|poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)			kidney(1)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)	9					Tenecteplase(DB00031)	TGATGCTGATCCACTTGGGAA	0.557																																																	0													61.0	54.0	56.0					15																	60644625		2203	4298	6501	SO:0001583	missense	0			D00017	CCDS10175.1, CCDS32256.1	15q22.2	2012-10-02			ENSG00000182718	ENSG00000182718		"""Annexins"""	537	protein-coding gene	gene with protein product	"""annexin II"""	151740		ANX2, ANX2L4, CAL1H, LPC2D		7961821	Standard	NM_001136015		Approved	LIP2	uc002agm.3	P07355	OTTHUMG00000132763	ENST00000396024.3:c.639G>C	15.37:g.60644625C>G	ENSP00000379342:p.Trp213Cys		Q567R4|Q6N0B3|Q8TBV2|Q96DD5|Q9UDH8	Missense_Mutation	SNP	pfam_Annexin_repeat,smart_Annexin_repeat,prints_Annexin,prints_AnnexinII,prints_AnnexinV	p.W231C	ENST00000396024.3	37	c.693	CCDS10175.1	15	.	.	.	.	.	.	.	.	.	.	C	25.1	4.605420	0.87157	.	.	ENSG00000182718	ENST00000396024;ENST00000332680;ENST00000421017;ENST00000451270;ENST00000504475	T;T;T;T	0.03301	3.98;3.98;3.98;3.98	6.03	6.03	0.97812	Annexin repeat, conserved site (1);	0.000000	0.85682	U	0.000000	T	0.22820	0.0551	M	0.83692	2.655	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.984;0.997	T	0.00051	-1.2193	10	0.87932	D	0	.	19.3381	0.94329	0.0:1.0:0.0:0.0	.	231;213	P07355-2;P07355	.;ANXA2_HUMAN	C	213;231;213;213;96	ENSP00000379342:W213C;ENSP00000346032:W231C;ENSP00000411352:W213C;ENSP00000387545:W213C	ENSP00000346032:W231C	W	-	3	0	ANXA2	58431917	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.086000	0.76885	2.854000	0.98071	0.655000	0.94253	TGG	ANXA2	-	pfam_Annexin_repeat,smart_Annexin_repeat,prints_Annexin	ENSG00000182718		0.557	ANXA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANXA2	HGNC	protein_coding	OTTHUMT00000256135.1	-	0.00	44	0	C	NM_001002857		60644625	-1	tier1	-	no_errors	ENST00000332680	ensembl	human	known	74_37	missense	17.14	29	6	SNP	1.000	G
ANXA6	309	genome.wustl.edu	37	5	150497341	150497341	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr5:150497341C>A	ENST00000354546.5	-	19	1723	c.1496G>T	c.(1495-1497)aGg>aTg	p.R499M	ANXA6_ENST00000377751.5_Missense_Mutation_p.R156M|ANXA6_ENST00000521512.1_Missense_Mutation_p.R292M|ANXA6_ENST00000523714.1_Missense_Mutation_p.R467M|ANXA6_ENST00000356496.5_Missense_Mutation_p.R499M	NM_001155.4	NP_001146.2	P08133	ANXA6_HUMAN	annexin A6	499					calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|protein homooligomerization (GO:0051260)|regulation of muscle contraction (GO:0006937)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|cholesterol binding (GO:0015485)|GTP binding (GO:0005525)|ligand-gated ion channel activity (GO:0015276)|lipid binding (GO:0008289)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(1)|lung(9)	12		Medulloblastoma(196;0.0912)|all_hematologic(541;0.208)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AATGAGGATCCTCCTGAAGTG	0.582																																																	0													50.0	55.0	53.0					5																	150497341		1933	4137	6070	SO:0001583	missense	0			J03578	CCDS47315.1, CCDS54941.1	5q33.1	2008-02-05			ENSG00000197043	ENSG00000197043		"""Annexins"""	544	protein-coding gene	gene with protein product		114070		ANX6		3258820	Standard	NM_001155		Approved		uc003ltl.2	P08133	OTTHUMG00000164179	ENST00000354546.5:c.1496G>T	5.37:g.150497341C>A	ENSP00000346550:p.Arg499Met		B7Z8A7|D3DQH4|E9PGK1|Q6ZT79	Missense_Mutation	SNP	pfam_Annexin_repeat,smart_Annexin_repeat,prints_Annexin,prints_AnnexinVI,prints_AnnexinIV	p.R499M	ENST00000354546.5	37	c.1496	CCDS47315.1	5	.	.	.	.	.	.	.	.	.	.	C	23.2	4.388396	0.82902	.	.	ENSG00000197043	ENST00000354546;ENST00000523714;ENST00000377751;ENST00000356496;ENST00000521512;ENST00000540153	T;T;T;T;T	0.03717	3.83;3.83;3.83;3.83;3.83	5.25	5.25	0.73442	Annexin repeat, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.25158	0.0611	M	0.90870	3.155	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.70935	0.971;0.962;0.962	T	0.10660	-1.0620	10	0.87932	D	0	.	17.6098	0.88049	0.0:1.0:0.0:0.0	.	292;499;499	E5RK69;A6NN80;P08133	.;.;ANXA6_HUMAN	M	499;467;156;499;292;373	ENSP00000346550:R499M;ENSP00000430517:R467M;ENSP00000366980:R156M;ENSP00000348889:R499M;ENSP00000430420:R292M	ENSP00000346550:R499M	R	-	2	0	ANXA6	150477534	1.000000	0.71417	0.993000	0.49108	0.803000	0.45373	6.533000	0.73829	2.438000	0.82558	0.561000	0.74099	AGG	ANXA6	-	pfam_Annexin_repeat,smart_Annexin_repeat	ENSG00000197043		0.582	ANXA6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANXA6	HGNC	protein_coding	OTTHUMT00000377668.2		0.00	48	0	C	NM_001155		150497341	-1			no_errors	ENST00000354546	ensembl	human	known	74_37	missense	6.00	47	3	SNP	1.000	A
APOC1	341	genome.wustl.edu	37	19	45419665	45419666	+	Intron	INS	-	-	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr19:45419665_45419666insA	ENST00000588750.1	+	4	519				APOC1_ENST00000586638.1_Intron|APOC1_ENST00000588802.1_Intron|APOC1_ENST00000252491.4_Intron|APOC1_ENST00000589781.1_Intron|APOC1_ENST00000592885.1_Frame_Shift_Ins_p.E93fs			P02654	APOC1_HUMAN	apolipoprotein C-I						cholesterol efflux (GO:0033344)|cholesterol metabolic process (GO:0008203)|chylomicron remnant clearance (GO:0034382)|high-density lipoprotein particle remodeling (GO:0034375)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of lipid metabolic process (GO:0045833)|negative regulation of lipoprotein lipase activity (GO:0051005)|negative regulation of phosphatidylcholine catabolic process (GO:0010900)|negative regulation of receptor-mediated endocytosis (GO:0048261)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|phospholipid efflux (GO:0033700)|plasma lipoprotein particle remodeling (GO:0034369)|positive regulation of catalytic activity (GO:0043085)|positive regulation of cholesterol esterification (GO:0010873)|regulation of cholesterol transport (GO:0032374)|triglyceride metabolic process (GO:0006641)|very-low-density lipoprotein particle assembly (GO:0034379)|very-low-density lipoprotein particle clearance (GO:0034447)	chylomicron (GO:0042627)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|very-low-density lipoprotein particle (GO:0034361)	fatty acid binding (GO:0005504)|lipase inhibitor activity (GO:0055102)|phosphatidylcholine binding (GO:0031210)|phosphatidylcholine-sterol O-acyltransferase activator activity (GO:0060228)|phospholipase inhibitor activity (GO:0004859)			cervix(1)|large_intestine(1)|lung(2)	4	Lung NSC(12;0.0018)|all_lung(12;0.00481)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|Epithelial(262;0.174)		TGAACAGATTGAAAAAAAAACA	0.52																																																	0																																										SO:0001627	intron_variant	0			X00570	CCDS12648.1	19q13.2	2013-01-24				ENSG00000130208		"""Apolipoproteins"""	607	protein-coding gene	gene with protein product		107710					Standard	NM_001645		Approved		uc002pae.1	P02654		ENST00000588750.1:c.194+83->A	19.37:g.45419674_45419674dupA			B2R526|Q6IB97	Frame_Shift_Ins	INS	pfam_ApoC-I	p.T96fs	ENST00000588750.1	37	c.277_278	CCDS12648.1	19																																																																																			APOC1	-	NULL	ENSG00000130208		0.520	APOC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOC1	HGNC	protein_coding	OTTHUMT00000453245.1		0.00	18	0	-			45419666	+1	tier1		no_errors	ENST00000592885	ensembl	human	novel	74_37	frame_shift_ins	22.22	14	4	INS	0.009:0.005	A
APOL5	80831	genome.wustl.edu	37	22	36122764	36122764	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr22:36122764G>T	ENST00000249044.2	+	3	649	c.649G>T	c.(649-651)Gga>Tga	p.G217*		NM_030642.1	NP_085145.1	Q9BWW9	APOL5_HUMAN	apolipoprotein L, 5	217					lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	high-density lipoprotein particle binding (GO:0008035)|lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|skin(2)|urinary_tract(1)	19						GGCTTTCGGAGGAATAAATTG	0.443																																																	0													130.0	141.0	137.0					22																	36122764		2203	4300	6503	SO:0001587	stop_gained	0			AY014878	CCDS13920.1	22q12.3	2013-01-24			ENSG00000128313	ENSG00000128313		"""Apolipoproteins"""	14869	protein-coding gene	gene with protein product		607255				11374903	Standard	NM_030642		Approved	APOLV	uc003aof.3	Q9BWW9	OTTHUMG00000150588	ENST00000249044.2:c.649G>T	22.37:g.36122764G>T	ENSP00000249044:p.Gly217*		Q5TFL9|Q9UGW5	Nonsense_Mutation	SNP	pfam_ApoL	p.G217*	ENST00000249044.2	37	c.649	CCDS13920.1	22	.	.	.	.	.	.	.	.	.	.	G	14.65	2.598803	0.46318	.	.	ENSG00000128313	ENST00000249044	.	.	.	3.86	1.4	0.22301	.	3.319490	0.01574	U	0.020739	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	.	4.5448	0.12076	0.1365:0.0:0.6566:0.2069	.	.	.	.	X	217	.	ENSP00000249044:G217X	G	+	1	0	APOL5	34452710	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.115000	0.10741	0.027000	0.15297	0.609000	0.83330	GGA	APOL5	-	pfam_ApoL	ENSG00000128313		0.443	APOL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOL5	HGNC	protein_coding	OTTHUMT00000318979.1	-	0.00	29	0	G	NM_030642		36122764	+1	tier1	-	no_errors	ENST00000249044	ensembl	human	known	74_37	nonsense	7.27	51	4	SNP	0.000	T
APOL3	80833	genome.wustl.edu	37	22	36556899	36556899	+	Missense_Mutation	SNP	A	A	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr22:36556899A>C	ENST00000349314.2	-	1	78	c.41T>G	c.(40-42)tTt>tGt	p.F14C	APOL3_ENST00000361710.2_Intron|APOL3_ENST00000424878.2_Intron|APOL3_ENST00000397293.2_5'UTR|APOL3_ENST00000397287.2_Intron	NM_145640.2	NP_663615.1	O95236	APOL3_HUMAN	apolipoprotein L, 3	14					inflammatory response (GO:0006954)|lipoprotein metabolic process (GO:0042157)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)|signal transducer activity (GO:0004871)			endometrium(2)|large_intestine(1)|lung(1)|stomach(1)	5						CAAACATGCAAAACAGGATGC	0.547																																																	0													107.0	78.0	88.0					22																	36556899		2203	4300	6503	SO:0001583	missense	0			AF305227	CCDS13922.1, CCDS13924.1	22q13.1	2013-01-24			ENSG00000128284	ENSG00000128284		"""Apolipoproteins"""	14868	protein-coding gene	gene with protein product		607253				11374903	Standard	NM_145640		Approved	CG12-1, APOLIII	uc003aot.3	O95236	OTTHUMG00000150632	ENST00000349314.2:c.41T>G	22.37:g.36556899A>C	ENSP00000344577:p.Phe14Cys		B1AHI4|B1AHI5|Q5U5N4|Q9BQ82|Q9BQA3	Missense_Mutation	SNP	pfam_ApoL	p.F14C	ENST00000349314.2	37	c.41	CCDS13922.1	22	.	.	.	.	.	.	.	.	.	.	A	6.712	0.499978	0.12762	.	.	ENSG00000128284	ENST00000349314	T	0.05081	3.5	1.97	1.97	0.26223	.	24.677000	0.02948	N	0.141302	T	0.05410	0.0143	N	0.08118	0	0.21220	N	0.999756	D	0.67145	0.996	P	0.46172	0.506	T	0.29822	-0.9999	10	0.54805	T	0.06	.	5.9889	0.19450	1.0:0.0:0.0:0.0	.	14	O95236	APOL3_HUMAN	C	14	ENSP00000344577:F14C	ENSP00000344577:F14C	F	-	2	0	APOL3	34886845	0.004000	0.15560	0.001000	0.08648	0.013000	0.08279	1.050000	0.30404	1.155000	0.42497	0.491000	0.48974	TTT	APOL3	-	NULL	ENSG00000128284		0.547	APOL3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	APOL3	HGNC	protein_coding	OTTHUMT00000319268.1		0.00	20	0	A	NM_145641		36556899	-1			no_errors	ENST00000349314	ensembl	human	known	74_37	missense	9.62	47	5	SNP	0.001	C
ARHGAP12	94134	genome.wustl.edu	37	10	32096093	32096093	+	3'UTR	SNP	A	A	G	rs527662533	byFrequency	TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr10:32096093A>G	ENST00000344936.2	-	0	3268				ARHGAP12_ENST00000492028.1_5'UTR|ARHGAP12_ENST00000375250.5_3'UTR|ARHGAP12_ENST00000375245.4_3'UTR|ARHGAP12_ENST00000396144.4_3'UTR|ARHGAP12_ENST00000311380.4_3'UTR	NM_001270697.1|NM_018287.6	NP_001257626.1|NP_060757.4	Q8IWW6	RHG12_HUMAN	Rho GTPase activating protein 12						morphogenesis of an epithelial sheet (GO:0002011)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(11)|lung(10)|skin(1)|urinary_tract(2)	31		Prostate(175;0.0199)				GGCACTTAAGACTGCCACTGC	0.378																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AY033594	CCDS7170.1, CCDS59214.1, CCDS59215.1, CCDS59216.1, CCDS73082.1	10p11.22	2013-01-10			ENSG00000165322	ENSG00000165322		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	16348	protein-coding gene	gene with protein product		610577				11854031	Standard	NM_001270695		Approved	FLJ20737, FLJ10971, FLJ21785	uc001ivz.2	Q8IWW6	OTTHUMG00000017911	ENST00000344936.2:c.*493T>C	10.37:g.32096093A>G			B1ANY0|B1ANY1|B1ANY2|Q504X1|Q86UB3|Q8IWW7|Q8N3L1|Q9NT76	RNA	SNP	-	NULL	ENST00000344936.2	37	NULL	CCDS7170.1	10																																																																																			ARHGAP12	-	-	ENSG00000165322		0.378	ARHGAP12-009	KNOWN	basic|CCDS	protein_coding	ARHGAP12	HGNC	protein_coding	OTTHUMT00000047465.1	-	0.00	48	0	A			32096093	-1	tier1	-	no_errors	ENST00000492028	ensembl	human	known	74_37	rna	8.42	86	8	SNP	0.096	G
ARHGEF1	9138	genome.wustl.edu	37	19	42406690	42406690	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr19:42406690G>T	ENST00000354532.3	+	17	1653	c.1505G>T	c.(1504-1506)gGt>gTt	p.G502V	ARHGEF1_ENST00000378152.4_Missense_Mutation_p.G484V|ARHGEF1_ENST00000599846.1_Missense_Mutation_p.G558V|ARHGEF1_ENST00000337665.4_Missense_Mutation_p.G517V|ARHGEF1_ENST00000347545.4_Missense_Mutation_p.G469V	NM_004706.3	NP_004697.2	Q92888	ARHG1_HUMAN	Rho guanine nucleotide exchange factor (GEF) 1	502	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				cell proliferation (GO:0008283)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of axonogenesis (GO:0050770)|Rho protein signal transduction (GO:0007266)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|poly(A) RNA binding (GO:0044822)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		Renal(1328;0.000518)|Hepatocellular(1079;0.0046)|Medulloblastoma(540;0.0425)		Epithelial(262;5.89e-46)|GBM - Glioblastoma multiforme(1328;2.49e-12)|STAD - Stomach adenocarcinoma(1328;0.00644)		TAGTTTGATGGTGCTGAGGGC	0.577																																																	0													81.0	79.0	80.0					19																	42406690		2203	4300	6503	SO:0001583	missense	0			U64105	CCDS12590.1, CCDS12591.1, CCDS12592.1	19q13.13	2014-06-19			ENSG00000076928	ENSG00000076928		"""Rho guanine nucleotide exchange factors"""	681	protein-coding gene	gene with protein product		601855				8810315, 9135076	Standard	NM_004706		Approved	P115-RHOGEF, SUB1.5, LBCL2	uc002osa.3	Q92888	OTTHUMG00000182679	ENST00000354532.3:c.1505G>T	19.37:g.42406690G>T	ENSP00000346532:p.Gly502Val		O00513|Q8N4J4|Q96BF4|Q96F17|Q9BSB1	Missense_Mutation	SNP	pfam_RGS-like_dom,pfam_DH-domain,superfamily_Regulat_G_prot_signal_superfam,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.G517V	ENST00000354532.3	37	c.1550	CCDS12591.1	19	.	.	.	.	.	.	.	.	.	.	G	17.44	3.391200	0.62066	.	.	ENSG00000076928	ENST00000354532;ENST00000347545;ENST00000337665;ENST00000378152	T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.38	4.01	2.95	0.34219	Dbl homology (DH) domain (5);	0.149996	0.42964	D	0.000630	T	0.79764	0.4502	M	0.83774	2.66	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999	D;D;D;D;D	0.79108	0.986;0.992;0.979;0.967;0.985	T	0.81549	-0.0882	10	0.87932	D	0	-11.2171	9.0228	0.36211	0.1131:0.0:0.8868:0.0	.	161;484;517;469;502	Q49AN3;Q6NX52;Q92888-3;Q92888-2;Q92888	.;.;.;.;ARHG1_HUMAN	V	502;469;517;484	ENSP00000346532:G502V;ENSP00000344429:G469V;ENSP00000337261:G517V;ENSP00000367394:G484V	ENSP00000337261:G517V	G	+	2	0	ARHGEF1	47098530	1.000000	0.71417	0.997000	0.53966	0.983000	0.72400	4.394000	0.59671	1.971000	0.57363	0.456000	0.33151	GGT	ARHGEF1	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000076928		0.577	ARHGEF1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARHGEF1	HGNC	protein_coding	OTTHUMT00000463360.1	-	0.00	36	0	G	NM_199002		42406690	+1	tier1	-	no_errors	ENST00000337665	ensembl	human	known	74_37	missense	7.41	50	4	SNP	0.967	T
ARIH2	10425	genome.wustl.edu	37	3	49020390	49020390	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr3:49020390G>T	ENST00000356401.4	+	15	1727	c.1388G>T	c.(1387-1389)cGt>cTt	p.R463L	ARIH2_ENST00000449376.1_Missense_Mutation_p.R463L|RP13-131K19.1_ENST00000429681.1_RNA|RP13-131K19.1_ENST00000415982.1_RNA|RP13-131K19.2_ENST00000452042.1_RNA|RP13-131K19.7_ENST00000609473.1_lincRNA	NM_006321.2	NP_006312.1	O95376	ARI2_HUMAN	ariadne RBR E3 ubiquitin protein ligase 2	463					developmental cell growth (GO:0048588)|hematopoietic stem cell proliferation (GO:0071425)|multicellular organismal development (GO:0007275)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|nucleic acid binding (GO:0003676)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(193;9.42e-05)|Kidney(197;0.00258)|KIRC - Kidney renal clear cell carcinoma(197;0.00269)		AAAGTGGAGCGTGCAGACAGC	0.512																																																	0													107.0	97.0	101.0					3																	49020390		2203	4300	6503	SO:0001583	missense	0			AF099149	CCDS2780.1	3p21	2013-10-03	2013-10-03		ENSG00000177479	ENSG00000177479			690	protein-coding gene	gene with protein product	"""all-trans retinoic acid inducible RING finger"""	605615	"""ariadne (Drosophila) homolog 2"", ""ariadne homolog 2 (Drosophila)"""			10422847, 24058416	Standard	XM_005264798		Approved	TRIAD1	uc003cvb.3	O95376	OTTHUMG00000133547	ENST00000356401.4:c.1388G>T	3.37:g.49020390G>T	ENSP00000348769:p.Arg463Leu		Q9HBZ6|Q9UEM9	Missense_Mutation	SNP	pfam_Znf_C6HC,smart_Znf_RING,smart_Znf_C6HC,pfscan_Znf_RING	p.R463L	ENST00000356401.4	37	c.1388	CCDS2780.1	3	.	.	.	.	.	.	.	.	.	.	G	33	5.217496	0.95104	.	.	ENSG00000177479	ENST00000356401;ENST00000449376;ENST00000444790;ENST00000395481	D;D	0.83837	-1.77;-1.77	6.13	5.25	0.73442	.	0.053328	0.85682	D	0.000000	D	0.90099	0.6907	M	0.68317	2.08	0.80722	D	1	B;B;D	0.76494	0.02;0.02;0.999	B;B;D	0.70016	0.03;0.018;0.967	D	0.90914	0.4778	10	0.62326	D	0.03	.	17.5926	0.88001	0.0:0.1234:0.8766:0.0	.	388;463;463	B3KMG5;Q53ET9;O95376	.;.;ARI2_HUMAN	L	463;463;380;287	ENSP00000348769:R463L;ENSP00000403222:R463L	ENSP00000348769:R463L	R	+	2	0	ARIH2	48995394	1.000000	0.71417	0.973000	0.42090	0.967000	0.64934	6.165000	0.71891	1.589000	0.49982	0.644000	0.83932	CGT	ARIH2	-	NULL	ENSG00000177479		0.512	ARIH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARIH2	HGNC	protein_coding	OTTHUMT00000257525.1	-	0.00	46	0	G	NM_006321		49020390	+1	tier1	-	no_errors	ENST00000356401	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	T
ARL16	339231	genome.wustl.edu	37	17	79649152	79649152	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr17:79649152G>T	ENST00000397498.4	-	4	432	c.334C>A	c.(334-336)Cag>Aag	p.Q112K	HGS_ENST00000329138.4_5'Flank|ARL16_ENST00000573392.1_Missense_Mutation_p.Q8K|ARL16_ENST00000574938.1_Missense_Mutation_p.Q8K|ARL16_ENST00000576135.1_Missense_Mutation_p.Q26K|ARL16_ENST00000570561.1_Missense_Mutation_p.Q26K	NM_001040025.1	NP_001035114.1	Q0P5N6	ARL16_HUMAN	ADP-ribosylation factor-like 16	112					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			central_nervous_system(1)|endometrium(1)|lung(4)|skin(1)	7	all_neural(118;0.0878)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			GCAGAGAGCTGGGTGGGGTCA	0.532																																																	0													28.0	30.0	29.0					17																	79649152		1919	4126	6045	SO:0001583	missense	0				CCDS45813.1	17q25.3	2014-05-09				ENSG00000214087		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	27902	protein-coding gene	gene with protein product						12477932	Standard	NM_001040025		Approved		uc002kbf.3	Q0P5N6		ENST00000397498.4:c.334C>A	17.37:g.79649152G>T	ENSP00000380635:p.Gln112Lys			Missense_Mutation	SNP	pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1	p.Q112K	ENST00000397498.4	37	c.334	CCDS45813.1	17	.	.	.	.	.	.	.	.	.	.	G	23.2	4.383219	0.82792	.	.	ENSG00000214087	ENST00000397498	T	0.61742	0.08	4.19	4.19	0.49359	.	0.000000	0.64402	U	0.000001	T	0.70657	0.3249	L	0.52126	1.63	0.58432	D	0.999992	D;D	0.89917	0.999;1.0	D;D	0.91635	0.999;0.999	T	0.74763	-0.3555	10	0.87932	D	0	-13.1745	15.6695	0.77262	0.0:0.0:1.0:0.0	.	112;88	Q0P5N6;B4E3H0	ARL16_HUMAN;.	K	112	ENSP00000380635:Q112K	ENSP00000380635:Q112K	Q	-	1	0	ARL16	77259557	1.000000	0.71417	0.999000	0.59377	0.877000	0.50540	8.031000	0.88826	2.165000	0.68154	0.563000	0.77884	CAG	ARL16	-	pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1	ENSG00000214087		0.532	ARL16-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	ARL16	HGNC	protein_coding	OTTHUMT00000440514.1		0.00	45	0	G	XM_290777		79649152	-1			no_errors	ENST00000397498	ensembl	human	known	74_37	missense	5.97	63	4	SNP	1.000	T
ARMC1	55156	genome.wustl.edu	37	8	66539504	66539504	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr8:66539504G>T	ENST00000276569.3	-	2	374	c.130C>A	c.(130-132)Ctt>Att	p.L44I	ARMC1_ENST00000458464.2_Missense_Mutation_p.P5H|ARMC1_ENST00000523384.1_5'UTR	NM_018120.4	NP_060590.1	Q9NVT9	ARMC1_HUMAN	armadillo repeat containing 1	44					metal ion transport (GO:0030001)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|large_intestine(1)|lung(8)|skin(1)	14			Epithelial(68;0.103)|OV - Ovarian serous cystadenocarcinoma(28;0.235)			AATAAAATAAGGCCAGGCAGA	0.458																																																	0													137.0	135.0	136.0					8																	66539504		2203	4300	6503	SO:0001583	missense	0			BC011607	CCDS6181.1, CCDS69490.1	8q12.3	2013-02-14			ENSG00000104442	ENSG00000104442		"""Armadillo repeat containing"""	17684	protein-coding gene	gene with protein product							Standard	XM_005251264		Approved	FLJ10511, Arcp	uc003xvl.3	Q9NVT9	OTTHUMG00000164374	ENST00000276569.3:c.130C>A	8.37:g.66539504G>T	ENSP00000276569:p.Leu44Ile		B4E2W7|Q9H018|Q9H820	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,superfamily_HeavyMe-assoc_HMA,pirsf_UCP013899_metal-bd	p.L44I	ENST00000276569.3	37	c.130	CCDS6181.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	31|31	5.078136|5.078136	0.94000|0.94000	.|.	.|.	ENSG00000104442|ENSG00000104442	ENST00000276569;ENST00000518908;ENST00000519352|ENST00000458464	D;D;D|.	0.89196|.	-2.48;-2.48;-2.48|.	5.47|5.47	5.47|5.47	0.80525|0.80525	Armadillo-like helical (1);Armadillo-type fold (1);|.	0.062183|.	0.64402|.	D|.	0.000003|.	T|T	0.71467|0.71467	0.3343|0.3343	M|M	0.67700|0.67700	2.07|2.07	0.39401|0.39401	D|D	0.966597|0.966597	D|D	0.63046|0.53885	0.992|0.963	P|P	0.51701|0.50378	0.677|0.639	T|T	0.76154|0.76154	-0.3063|-0.3063	10|8	0.72032|0.66056	D|D	0.01|0.02	.|.	19.3248|19.3248	0.94258|0.94258	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	44|5	Q9NVT9|B4E2W7	ARMC1_HUMAN|.	I|H	44|5	ENSP00000276569:L44I;ENSP00000429191:L44I;ENSP00000429715:L44I|.	ENSP00000276569:L44I|ENSP00000388572:P5H	L|P	-|-	1|2	0|0	ARMC1|ARMC1	66702058|66702058	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	9.459000|9.459000	0.97638|0.97638	2.553000|2.553000	0.86117|0.86117	0.655000|0.655000	0.94253|0.94253	CTT|CCT	ARMC1	-	pfam_Armadillo,superfamily_ARM-type_fold,pirsf_UCP013899_metal-bd	ENSG00000104442		0.458	ARMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMC1	HGNC	protein_coding	OTTHUMT00000378480.1		0.00	17	0	G	NM_018120		66539504	-1			no_errors	ENST00000276569	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	T
ARMC1	55156	genome.wustl.edu	37	8	66539513	66539513	+	Silent	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr8:66539513G>A	ENST00000276569.3	-	2	365	c.121C>T	c.(121-123)Ctg>Ttg	p.L41L	ARMC1_ENST00000458464.2_Missense_Mutation_p.S2F|ARMC1_ENST00000523384.1_5'UTR	NM_018120.4	NP_060590.1	Q9NVT9	ARMC1_HUMAN	armadillo repeat containing 1	41					metal ion transport (GO:0030001)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|large_intestine(1)|lung(8)|skin(1)	14			Epithelial(68;0.103)|OV - Ovarian serous cystadenocarcinoma(28;0.235)			AGGCCAGGCAGACATCCCTGA	0.463																																																	0													147.0	143.0	145.0					8																	66539513		2203	4300	6503	SO:0001819	synonymous_variant	0			BC011607	CCDS6181.1, CCDS69490.1	8q12.3	2013-02-14			ENSG00000104442	ENSG00000104442		"""Armadillo repeat containing"""	17684	protein-coding gene	gene with protein product							Standard	XM_005251264		Approved	FLJ10511, Arcp	uc003xvl.3	Q9NVT9	OTTHUMG00000164374	ENST00000276569.3:c.121C>T	8.37:g.66539513G>A			B4E2W7|Q9H018|Q9H820	Missense_Mutation	SNP	superfamily_HeavyMe-assoc_HMA	p.S2F	ENST00000276569.3	37	c.5	CCDS6181.1	8	.	.	.	.	.	.	.	.	.	.	G	16.22	3.061756	0.55432	.	.	ENSG00000104442	ENST00000458464	.	.	.	5.47	4.59	0.56863	.	.	.	.	.	T	0.41949	0.1181	.	.	.	0.27337	N	0.95663	B	0.02656	0.0	B	0.04013	0.001	T	0.40905	-0.9538	7	0.87932	D	0	.	13.3655	0.60680	0.0774:0.0:0.9226:0.0	.	2	B4E2W7	.	F	2	.	ENSP00000388572:S2F	S	-	2	0	ARMC1	66702067	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.375000	0.44283	1.266000	0.44231	0.655000	0.94253	TCT	ARMC1	-	NULL	ENSG00000104442		0.463	ARMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMC1	HGNC	protein_coding	OTTHUMT00000378480.1		0.00	20	0	G	NM_018120		66539513	-1			no_errors	ENST00000458464	ensembl	human	known	74_37	missense	13.46	45	7	SNP	1.000	A
ASB6	140459	genome.wustl.edu	37	9	132400710	132400710	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr9:132400710C>A	ENST00000277458.4	-	6	790	c.625G>T	c.(625-627)Gat>Tat	p.D209Y	ASB6_ENST00000450050.2_Missense_Mutation_p.D130Y|RP11-483H20.4_ENST00000455074.1_RNA|ASB6_ENST00000277459.4_Missense_Mutation_p.K172N	NM_017873.3	NP_060343.1	Q9NWX5	ASB6_HUMAN	ankyrin repeat and SOCS box containing 6	209					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				NS(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)	15		Ovarian(14;0.00556)				GTGTCCCCATCTTTGGTGGTG	0.547																																																	0													69.0	74.0	72.0					9																	132400710		2203	4300	6503	SO:0001583	missense	0				CCDS6924.1, CCDS6925.1, CCDS75919.1	9q34.13	2013-01-10	2011-01-25		ENSG00000148331	ENSG00000148331		"""Ankyrin repeat domain containing"""	17181	protein-coding gene	gene with protein product		615051	"""ankyrin repeat and SOCS box-containing 6"""				Standard	NM_017873		Approved		uc004byf.2	Q9NWX5	OTTHUMG00000020787	ENST00000277458.4:c.625G>T	9.37:g.132400710C>A	ENSP00000277458:p.Asp209Tyr		Q5SZB7|Q9BV15	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C	p.D209Y	ENST00000277458.4	37	c.625	CCDS6924.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.45|19.45	3.829805|3.829805	0.71258|0.71258	.|.	.|.	ENSG00000148331|ENSG00000148331	ENST00000277458;ENST00000450050|ENST00000277459	T;T|T	0.52983|0.59364	0.64;0.64|0.27	4.45|4.45	4.45|4.45	0.53987|0.53987	Ankyrin repeat-containing domain (3);|.	0.051435|.	0.85682|.	D|.	0.000000|.	T|T	0.53578|0.53578	0.1805|0.1805	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	D;D;D|B	0.89917|0.24043	1.0;0.99;1.0|0.096	D;D;D|B	0.74023|0.30105	0.982;0.925;0.982|0.111	T|T	0.54642|0.54642	-0.8263|-0.8263	9|8	0.20519|0.46703	T|T	0.43|0.11	-25.2381|-25.2381	16.2407|16.2407	0.82405|0.82405	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	130;209;209|172	B4DRC4;A8K9U2;Q9NWX5|Q9NWX5-2	.;.;ASB6_HUMAN|.	Y|N	209;130|172	ENSP00000277458:D209Y;ENSP00000416172:D130Y|ENSP00000277459:K172N	ENSP00000277458:D209Y|ENSP00000277459:K172N	D|K	-|-	1|3	0|2	ASB6|ASB6	131440531|131440531	1.000000|1.000000	0.71417|0.71417	0.982000|0.982000	0.44146|0.44146	0.917000|0.917000	0.54804|0.54804	5.212000|5.212000	0.65225|0.65225	2.288000|2.288000	0.76882|0.76882	0.462000|0.462000	0.41574|0.41574	GAT|AAG	ASB6	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000148331		0.547	ASB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB6	HGNC	protein_coding	OTTHUMT00000054594.1	-	0.00	44	0	C	NM_017873		132400710	-1	tier1	-	no_errors	ENST00000277458	ensembl	human	known	74_37	missense	25.53	35	12	SNP	1.000	A
ASB9	140462	genome.wustl.edu	37	X	15287931	15287931	+	Silent	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chrX:15287931G>A	ENST00000380488.4	-	1	339	c.66C>T	c.(64-66)atC>atT	p.I22I	ASB9_ENST00000546332.1_Silent_p.I22I|ASB9_ENST00000380485.3_Silent_p.I22I|ASB9_ENST00000473862.1_5'UTR|ASB9_ENST00000380483.3_Silent_p.I22I	NM_001031739.2	NP_001026909.1	Q96DX5	ASB9_HUMAN	ankyrin repeat and SOCS box containing 9	22					intracellular signal transduction (GO:0035556)|positive regulation of protein catabolic process (GO:0045732)|protein ubiquitination (GO:0016567)	mitochondrion (GO:0005739)				breast(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(10)	15	Hepatocellular(33;0.183)					AAAGAAGCCTGATGCCAGGAA	0.587																																																	0													112.0	88.0	96.0					X																	15287931		2203	4300	6503	SO:0001819	synonymous_variant	0			AK000643	CCDS14163.1, CCDS35208.1, CCDS55372.1	Xp22.2	2013-01-10	2011-01-25		ENSG00000102048	ENSG00000102048		"""Ankyrin repeat domain containing"""	17184	protein-coding gene	gene with protein product		300890	"""ankyrin repeat and SOCS box-containing 9"""			12076535	Standard	NM_001031739		Approved	DKFZP564L0862, MGC4954, FLJ20636	uc004cwl.3	Q96DX5	OTTHUMG00000021172	ENST00000380488.4:c.66C>T	X.37:g.15287931G>A			A8K8A5|Q9BVF5|Q9NWS5|Q9Y4T3	Silent	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C	p.I22	ENST00000380488.4	37	c.66	CCDS35208.1	X																																																																																			ASB9	-	NULL	ENSG00000102048		0.587	ASB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB9	HGNC	protein_coding	OTTHUMT00000055844.1	-	0.00	17	0	G			15287931	-1	tier1	-	no_errors	ENST00000380488	ensembl	human	known	74_37	silent	41.94	18	13	SNP	0.000	A
ASPG	374569	genome.wustl.edu	37	14	104558980	104558980	+	Silent	SNP	C	C	T	rs374729572		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr14:104558980C>T	ENST00000551177.1	+	2	185	c.93C>T	c.(91-93)ccC>ccT	p.P31P	ASPG_ENST00000455920.2_Silent_p.P31P|ASPG_ENST00000546892.2_Silent_p.P31P	NM_001080464.2	NP_001073933.2	Q86U10	LPP60_HUMAN	asparaginase	31	Asparaginase/glutaminase. {ECO:0000255|PROSITE-ProRule:PRU01068}.				asparagine metabolic process (GO:0006528)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)		1-alkyl-2-acetylglycerophosphocholine esterase activity (GO:0003847)|asparaginase activity (GO:0004067)|lysophospholipase activity (GO:0004622)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	11						TGCTTGTGCCCGGGACGGGCC	0.677													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16983	0.0		0.0	False		,,,				2504	0.0																0								C		5,4061		0,5,2028	14.0	20.0	18.0		93	-8.7	0.0	14		18	0,7966		0,0,3983	no	coding-synonymous	ASPG	NM_001080464.2		0,5,6011	TT,TC,CC		0.0,0.123,0.0416		31/574	104558980	5,12027	2033	3983	6016	SO:0001819	synonymous_variant	0				CCDS45170.1, CCDS45170.2	14q32.33	2014-03-14	2014-03-14	2008-11-06	ENSG00000166183	ENSG00000166183	3.1.1.5, 3.5.1.1	"""Ankyrin repeat domain containing"""	20123	protein-coding gene	gene with protein product	"""60-kDa-lysophospholipase"""		"""chromosome 14 open reading frame 76"", ""asparaginase homolog (S. cerevisiae)"""	C14orf76			Standard	NM_001080464		Approved		uc001yoq.2	Q86U10		ENST00000551177.1:c.93C>T	14.37:g.104558980C>T			B9EGQ2|Q8IV80	Silent	SNP	pfam_Asparaginase/glutaminase,pfam_Ankyrin_rpt,superfamily_Asparaginase/glutaminase,superfamily_Ankyrin_rpt-contain_dom,smart_Asparaginase/glutaminase,smart_Ankyrin_rpt,prints_Asparaginase/glutaminase,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,tigrfam_AsnASEI	p.P31	ENST00000551177.1	37	c.93	CCDS45170.2	14																																																																																			ASPG	-	pfam_Asparaginase/glutaminase,superfamily_Asparaginase/glutaminase,smart_Asparaginase/glutaminase,tigrfam_AsnASEI	ENSG00000166183		0.677	ASPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASPG	HGNC	protein_coding	OTTHUMT00000407005.1		0.00	44	0	C	NM_001080464		104558980	+1			no_errors	ENST00000455920	ensembl	human	known	74_37	silent	5.33	71	4	SNP	0.006	T
ASS1	445	genome.wustl.edu	37	9	133352188	133352188	+	Intron	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr9:133352188G>A	ENST00000372394.1	+	10	1078				ASS1_ENST00000493984.2_Intron|ASS1_ENST00000352480.5_Intron|ASS1_ENST00000372393.3_Intron			P00966	ASSY_HUMAN	argininosuccinate synthase 1						acute-phase response (GO:0006953)|aging (GO:0007568)|arginine biosynthetic process (GO:0006526)|argininosuccinate metabolic process (GO:0000053)|aspartate metabolic process (GO:0006531)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to amine stimulus (GO:0071418)|cellular response to amino acid stimulus (GO:0071230)|cellular response to ammonium ion (GO:0071242)|cellular response to cAMP (GO:0071320)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to glucagon stimulus (GO:0071377)|cellular response to interferon-gamma (GO:0071346)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to oleic acid (GO:0071400)|cellular response to tumor necrosis factor (GO:0071356)|citrulline metabolic process (GO:0000052)|diaphragm development (GO:0060539)|kidney development (GO:0001822)|liver development (GO:0001889)|midgut development (GO:0007494)|negative regulation of leukocyte cell-cell adhesion (GO:1903038)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to growth hormone (GO:0060416)|response to mycotoxin (GO:0010046)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|perikaryon (GO:0043204)	amino acid binding (GO:0016597)|argininosuccinate synthase activity (GO:0004055)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|toxic substance binding (GO:0015643)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	17				OV - Ovarian serous cystadenocarcinoma(145;0.000514)	Adenosine triphosphate(DB00171)|L-Arginine(DB00125)|L-Aspartic Acid(DB00128)|L-Citrulline(DB00155)	GCAGATCCCCGCGGGAGGTGG	0.617																																																	0																																										SO:0001627	intron_variant	0			X01630	CCDS6933.1	9q34.1	2012-10-02	2010-04-20	2006-08-24	ENSG00000130707	ENSG00000130707	6.3.4.5		758	protein-coding gene	gene with protein product		603470	"""argininosuccinate synthetase"""	ASS		3513483, 852520	Standard	NM_054012		Approved	CTLN1	uc004bzm.3	P00966	OTTHUMG00000020806	ENST00000372394.1:c.598-70G>A	9.37:g.133352188G>A			Q6LDL2|Q86UZ0|Q96GT4	RNA	SNP	-	NULL	ENST00000372394.1	37	NULL	CCDS6933.1	9																																																																																			ASS1	-	-	ENSG00000130707		0.617	ASS1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ASS1	HGNC	protein_coding	OTTHUMT00000054652.1	-	0.00	23	0	G	NM_000050		133352188	+1	tier1	-	no_errors	ENST00000470849	ensembl	human	known	74_37	rna	25.00	24	8	SNP	0.004	A
ATP8B3	148229	genome.wustl.edu	37	19	1802525	1802525	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr19:1802525G>A	ENST00000310127.6	-	11	1262	c.1024C>T	c.(1024-1026)Cgc>Tgc	p.R342C	ATP8B3_ENST00000539485.1_Missense_Mutation_p.R342C|ATP8B3_ENST00000526092.2_Missense_Mutation_p.R289C|ATP8B3_ENST00000525591.1_Missense_Mutation_p.R289C	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3	342					binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCTGTGTTGCGAATCCTGCAG	0.557																																																	0													126.0	136.0	132.0					19																	1802525		2122	4227	6349	SO:0001583	missense	0			AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.1024C>T	19.37:g.1802525G>A	ENSP00000311336:p.Arg342Cys		Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.R342C	ENST00000310127.6	37	c.1024	CCDS45901.1	19	.	.	.	.	.	.	.	.	.	.	g	16.22	3.060609	0.55432	.	.	ENSG00000130270	ENST00000310127;ENST00000539485;ENST00000525591;ENST00000526092;ENST00000382339	T;T;T;T	0.75704	-0.96;-0.96;-0.96;-0.96	3.72	3.72	0.42706	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.059508	0.64402	U	0.000003	D	0.88720	0.6513	H	0.95328	3.655	0.47659	D	0.999483	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.997;0.999	D	0.90533	0.4497	10	0.87932	D	0	.	10.1732	0.42922	0.0:0.0:0.8005:0.1995	.	289;342;289	F5H3R9;O60423;Q7Z485	.;AT8B3_HUMAN;.	C	342;342;289;289;289	ENSP00000311336:R342C;ENSP00000443574:R342C;ENSP00000437115:R289C;ENSP00000445204:R289C	ENSP00000311336:R342C	R	-	1	0	ATP8B3	1753525	1.000000	0.71417	0.991000	0.47740	0.541000	0.35023	4.208000	0.58486	1.930000	0.55929	0.450000	0.29827	CGC	ATP8B3	-	pfam_ATPase_P-typ_transduc_dom_A,tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000130270		0.557	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	ATP8B3	HGNC	protein_coding	OTTHUMT00000388279.1	-	0.00	60	0	G	NM_138813		1802525	-1	tier1	-	no_errors	ENST00000539485	ensembl	human	known	74_37	missense	8.43	76	7	SNP	0.986	A
BARD1	580	genome.wustl.edu	37	2	215593433	215593433	+	Silent	SNP	C	C	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr2:215593433C>G	ENST00000260947.4	-	11	2435	c.2301G>C	c.(2299-2301)gtG>gtC	p.V767V	BARD1_ENST00000449967.2_3'UTR|BARD1_ENST00000432456.1_Silent_p.V138V	NM_000465.2|NM_001282543.1|NM_001282545.1|NM_001282548.1	NP_000456.2|NP_001269472.1|NP_001269474.1|NP_001269477.1	Q99728	BARD1_HUMAN	BRCA1 associated RING domain 1	767	BRCT 2. {ECO:0000255|PROSITE- ProRule:PRU00033}.				cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|negative regulation of mRNA 3'-end processing (GO:0031441)|negative regulation of protein export from nucleus (GO:0046826)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein catabolic process (GO:0045732)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of phosphorylation (GO:0042325)|tissue homeostasis (GO:0001894)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	kinase binding (GO:0019900)|ligase activity (GO:0016874)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(14)|prostate(4)|upper_aerodigestive_tract(1)	35		Renal(323;0.0243)		Epithelial(149;3.2e-06)|all cancers(144;0.000461)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		CAAAGGACATCACACAGTCTA	0.423									Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																																								0													55.0	55.0	55.0					2																	215593433		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease		CCDS2397.1, CCDS74645.1, CCDS74646.1, CCDS74647.1, CCDS74648.1	2q34-q35	2013-01-10			ENSG00000138376	ENSG00000138376		"""Ankyrin repeat domain containing"""	952	protein-coding gene	gene with protein product		601593				8944023, 9425226, 15159397	Standard	NM_001282548		Approved		uc002veu.2	Q99728	OTTHUMG00000133016	ENST00000260947.4:c.2301G>C	2.37:g.215593433C>G			F6MDH7|F6MDH8|F6MDH9|O43574|Q53SS5	Silent	SNP	pfam_Ankyrin_rpt,pfam_BRCT_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_BRCT_dom,smart_Ankyrin_rpt,smart_BRCT_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BRCT_dom,pfscan_Znf_RING,prints_Ankyrin_rpt	p.V767	ENST00000260947.4	37	c.2301	CCDS2397.1	2																																																																																			BARD1	-	superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	ENSG00000138376		0.423	BARD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BARD1	HGNC	protein_coding	OTTHUMT00000256602.1		0.00	31	0	C	NM_000465		215593433	-1			no_errors	ENST00000260947	ensembl	human	known	74_37	silent	8.33	33	3	SNP	1.000	G
BLK	640	genome.wustl.edu	37	8	11407731	11407731	+	Missense_Mutation	SNP	G	G	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr8:11407731G>C	ENST00000259089.4	+	6	1024	c.432G>C	c.(430-432)aaG>aaC	p.K144N	RP11-148O21.6_ENST00000602626.1_lincRNA|BLK_ENST00000529894.1_Missense_Mutation_p.K73N	NM_001715.2	NP_001706.2	P51451	BLK_HUMAN	BLK proto-oncogene, Src family tyrosine kinase	144	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				B cell receptor signaling pathway (GO:0050853)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of insulin secretion (GO:0032024)	plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			endometrium(1)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|skin(4)|stomach(1)	27			STAD - Stomach adenocarcinoma(15;0.00391)	COAD - Colon adenocarcinoma(149;0.207)		CAATCAACAAGGCCGGCTCCT	0.557																																																	0													97.0	95.0	96.0					8																	11407731		2203	4300	6503	SO:0001583	missense	0			BC004473	CCDS5982.1	8p23-p22	2014-06-25	2014-06-25		ENSG00000136573	ENSG00000136573		"""SH2 domain containing"""	1057	protein-coding gene	gene with protein product		191305	"""B lymphoid tyrosine kinase"""			7845672	Standard	NM_001715		Approved	MGC10442	uc003wty.3	P51451	OTTHUMG00000090729	ENST00000259089.4:c.432G>C	8.37:g.11407731G>C	ENSP00000259089:p.Lys144Asn		Q16291|Q96IN1	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_SH3_domain	p.K144N	ENST00000259089.4	37	c.432	CCDS5982.1	8	.	.	.	.	.	.	.	.	.	.	G	11.66	1.704390	0.30232	.	.	ENSG00000136573	ENST00000259089;ENST00000427279;ENST00000529894	D;D	0.89485	-2.52;-2.52	5.5	4.62	0.57501	SH2 motif (4);	0.000000	0.45606	D	0.000359	D	0.86130	0.5859	L	0.55213	1.73	0.80722	D	1	B	0.24651	0.108	B	0.31614	0.133	T	0.81922	-0.0711	10	0.36615	T	0.2	.	10.1902	0.43021	0.1694:0.0:0.8306:0.0	.	144	P51451	BLK_HUMAN	N	144;144;73	ENSP00000259089:K144N;ENSP00000433663:K73N	ENSP00000259089:K144N	K	+	3	2	BLK	11445140	0.835000	0.29415	0.938000	0.37757	0.646000	0.38490	1.416000	0.34759	1.299000	0.44798	0.650000	0.86243	AAG	BLK	-	pfam_SH2,smart_SH2,pfscan_SH2	ENSG00000136573		0.557	BLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLK	HGNC	protein_coding	OTTHUMT00000207460.1	-	0.00	34	0	G			11407731	+1	tier1	-	no_errors	ENST00000259089	ensembl	human	known	74_37	missense	26.32	28	10	SNP	0.946	C
BRAT1	221927	genome.wustl.edu	37	7	2577959	2577959	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr7:2577959C>A	ENST00000340611.4	-	14	2466	c.2210G>T	c.(2209-2211)cGg>cTg	p.R737L	BRAT1_ENST00000473879.1_5'Flank	NM_152743.3	NP_689956.2	Q6PJG6	BRAT1_HUMAN	BRCA1-associated ATM activator 1	737			R -> W (in dbSNP:rs60152725).		response to ionizing radiation (GO:0010212)	membrane (GO:0016020)|nucleus (GO:0005634)		p.R737L(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	23						CCTGGCCTCCCGCAGGCTGCT	0.662																																																	1	Substitution - Missense(1)	lung(1)											36.0	42.0	40.0					7																	2577959		2203	4298	6501	SO:0001583	missense	0			BC015632	CCDS5334.1	7p22.3	2011-03-22	2011-02-28	2011-03-22	ENSG00000106009	ENSG00000106009			21701	protein-coding gene	gene with protein product	"""BRCA1-associated protein required for ATM activation protein 1"""	614506	"""chromosome 7 open reading frame 27"""	C7orf27, BAAT1		16452482	Standard	NM_152743		Approved	MGC22916	uc003smi.3	Q6PJG6	OTTHUMG00000119091	ENST00000340611.4:c.2210G>T	7.37:g.2577959C>A	ENSP00000339637:p.Arg737Leu		A4D200|C9JY24|Q8IW85|Q8IZ43|Q8WVR8|Q96IV9|Q9H7J8|Q9UFA3	Missense_Mutation	SNP	pfam_HEAT,superfamily_ARM-type_fold	p.R737L	ENST00000340611.4	37	c.2210	CCDS5334.1	7	.	.	.	.	.	.	.	.	.	.	C	4.653	0.121406	0.08881	.	.	ENSG00000106009	ENST00000340611	T	0.30182	1.54	4.97	-0.527	0.11909	.	2.005690	0.02083	N	0.052541	T	0.25005	0.0607	L	0.44542	1.39	0.09310	N	1	B	0.27013	0.166	B	0.20577	0.03	T	0.11446	-1.0587	10	0.32370	T	0.25	-3.9329	5.1089	0.14798	0.0:0.2696:0.1785:0.5519	.	737	Q6PJG6	BRAT1_HUMAN	L	737	ENSP00000339637:R737L	ENSP00000339637:R737L	R	-	2	0	BRAT1	2544485	0.001000	0.12720	0.006000	0.13384	0.030000	0.12068	0.218000	0.17622	-0.103000	0.12175	0.561000	0.74099	CGG	BRAT1	-	NULL	ENSG00000106009		0.662	BRAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRAT1	HGNC	protein_coding	OTTHUMT00000239305.2		0.00	46	0	C	NM_152743		2577959	-1			no_errors	ENST00000340611	ensembl	human	known	74_37	missense	5.00	76	4	SNP	0.007	A
BTN3A3	10384	genome.wustl.edu	37	6	26444241	26444241	+	Missense_Mutation	SNP	G	G	A	rs376102561		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr6:26444241G>A	ENST00000244519.2	+	4	385	c.142G>A	c.(142-144)Gct>Act	p.A48T	BTN3A3_ENST00000339789.4_Missense_Mutation_p.A6T|BTN3A3_ENST00000361232.3_Missense_Mutation_p.A6T	NM_006994.4	NP_008925.1	O00478	BT3A3_HUMAN	butyrophilin, subfamily 3, member A3	48	Ig-like V-type 1.				T cell mediated immunity (GO:0002456)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)		p.A48T(1)		cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	30						GGGTGAAGACGCTGATCTGCC	0.572																																																	1	Substitution - Missense(1)	endometrium(1)											78.0	71.0	73.0					6																	26444241		2200	4293	6493	SO:0001583	missense	0			U90548	CCDS4611.1, CCDS4612.1, CCDS4612.2	6p22.1	2014-01-14			ENSG00000111801	ENSG00000111801		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	1140	protein-coding gene	gene with protein product		613595				10354554, 9149941	Standard	NM_006994		Approved	BTF3, BTN3.3	uc003nhz.3	O00478	OTTHUMG00000014451	ENST00000244519.2:c.142G>A	6.37:g.26444241G>A	ENSP00000244519:p.Ala48Thr		B4DWI7|E9PCP5	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Ig_V-set,superfamily_ConA-like_lec_gl_sf,smart_Ig_sub,smart_Ig_V-set_subgr,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Ig-like_dom,prints_Butyrophylin	p.A48T	ENST00000244519.2	37	c.142	CCDS4611.1	6	.	.	.	.	.	.	.	.	.	.	G	8.645	0.896819	0.17686	.	.	ENSG00000111801	ENST00000494393;ENST00000482451;ENST00000244519;ENST00000339789;ENST00000471353;ENST00000361232;ENST00000487627;ENST00000496719;ENST00000490254;ENST00000476281;ENST00000487272	T;T;T;T;T;T;T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33	2.74	-0.119	0.13543	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.24967	0.0606	L	0.35644	1.08	0.09310	N	1	P;B	0.40398	0.716;0.028	B;B	0.32149	0.141;0.012	T	0.05582	-1.0876	9	0.29301	T	0.29	.	4.7457	0.13036	0.178:0.0:0.6397:0.1824	.	6;48	E9PCP5;O00478	.;BT3A3_HUMAN	T	48;30;48;6;6;6;6;48;6;6;6	ENSP00000417234:A48T;ENSP00000419312:A30T;ENSP00000244519:A48T;ENSP00000344968:A6T;ENSP00000417717:A6T;ENSP00000355238:A6T;ENSP00000420339:A6T;ENSP00000420147:A48T;ENSP00000419736:A6T;ENSP00000419445:A6T	ENSP00000244519:A48T	A	+	1	0	BTN3A3	26552220	0.000000	0.05858	0.000000	0.03702	0.418000	0.31294	-1.087000	0.03383	-0.050000	0.13356	-0.226000	0.12346	GCT	BTN3A3	-	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	ENSG00000111801		0.572	BTN3A3-001	KNOWN	basic|CCDS	protein_coding	BTN3A3	HGNC	protein_coding	OTTHUMT00000040116.2		0.00	51	0	G	NM_006994		26444241	+1			no_errors	ENST00000244519	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.000	A
ERICH3	127254	genome.wustl.edu	37	1	75072384	75072384	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr1:75072384C>A	ENST00000326665.5	-	10	1608	c.1390G>T	c.(1390-1392)Ggg>Tgg	p.G464W	RP4-612J11.1_ENST00000416017.1_RNA|C1orf173_ENST00000420661.2_Missense_Mutation_p.G267W	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		464	Glu-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						TCTTTGAGCCCTGTTTTTATT	0.383																																																	0													172.0	174.0	174.0					1																	75072384		2203	4299	6502	SO:0001583	missense	0																														ENST00000326665.5:c.1390G>T	1.37:g.75072384C>A	ENSP00000322609:p.Gly464Trp		Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	NULL	p.G464W	ENST00000326665.5	37	c.1390	CCDS30755.1	1	.	.	.	.	.	.	.	.	.	.	C	12.81	2.048541	0.36181	.	.	ENSG00000178965	ENST00000326665;ENST00000420661	T;T	0.19250	2.63;2.16	4.07	1.15	0.20763	.	.	.	.	.	T	0.16896	0.0406	L	0.48642	1.525	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.74348	0.971;0.983	T	0.06180	-1.0841	9	0.72032	D	0.01	-0.134	2.7105	0.05174	0.132:0.4436:0.2589:0.1654	.	267;464	Q5RHP9-3;Q5RHP9	.;CA173_HUMAN	W	464;267	ENSP00000322609:G464W;ENSP00000398581:G267W	ENSP00000322609:G464W	G	-	1	0	C1orf173	74844972	0.000000	0.05858	0.000000	0.03702	0.127000	0.20565	0.918000	0.28678	0.275000	0.22094	0.655000	0.94253	GGG	C1orf173	-	NULL	ENSG00000178965		0.383	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf173	HGNC	protein_coding	OTTHUMT00000026516.1	-	0.00	37	0	C			75072384	-1	tier1	-	no_errors	ENST00000326665	ensembl	human	known	74_37	missense	21.74	36	10	SNP	0.000	A
C1orf106	55765	genome.wustl.edu	37	1	200868725	200868725	+	Splice_Site	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr1:200868725G>T	ENST00000367342.4	+	3	635	c.435G>T	c.(433-435)gcG>gcT	p.A145A	C1orf106_ENST00000413687.2_Splice_Site_p.A60A	NM_018265.3	NP_060735.3	Q3KP66	CA106_HUMAN	chromosome 1 open reading frame 106	145										endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(2)	21						TTCGGGAAGCGGTGAGGCCCC	0.642																																																	0													19.0	19.0	19.0					1																	200868725		2202	4300	6502	SO:0001630	splice_region_variant	0			AK001763	CCDS44292.1	1q32.1	2011-02-15			ENSG00000163362	ENSG00000163362			25599	protein-coding gene	gene with protein product						14702039	Standard	NM_018265		Approved	FLJ10901	uc001gvo.4	Q3KP66	OTTHUMG00000035789	ENST00000367342.4:c.435+1G>T	1.37:g.200868725G>T			B4E1K9|E9PFY0|Q9NV65|Q9NVI0	Silent	SNP	pfam_DUF3338	p.A145	ENST00000367342.4	37	c.435		1																																																																																			C1orf106	-	pfam_DUF3338	ENSG00000163362		0.642	C1orf106-001	KNOWN	basic	protein_coding	C1orf106	HGNC	protein_coding	OTTHUMT00000087057.2		0.00	42	0	G	NM_018265	Silent	200868725	+1			no_errors	ENST00000367342	ensembl	human	known	74_37	silent	5.19	73	4	SNP	1.000	T
C20orf202	400831	genome.wustl.edu	37	20	1187678	1187678	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr20:1187678C>T	ENST00000400633.1	+	2	364	c.301C>T	c.(301-303)Ccg>Tcg	p.P101S		NM_001009612.2	NP_001009612.1	A1L168	CT202_HUMAN	chromosome 20 open reading frame 202	101										endometrium(1)	1						GGGCTGCCAGCCGGTTTGCTC	0.652																																																	0													21.0	24.0	23.0					20																	1187678		692	1591	2283	SO:0001583	missense	0				CCDS46567.1	20p13	2009-09-10			ENSG00000215595	ENSG00000215595			37254	protein-coding gene	gene with protein product							Standard	NM_001009612		Approved		uc002wer.4	A1L168	OTTHUMG00000129375	ENST00000400633.1:c.301C>T	20.37:g.1187678C>T	ENSP00000383474:p.Pro101Ser			Missense_Mutation	SNP	NULL	p.P101S	ENST00000400633.1	37	c.301	CCDS46567.1	20	.	.	.	.	.	.	.	.	.	.	C	5.681	0.310287	0.10733	.	.	ENSG00000215595	ENST00000400633	.	.	.	3.76	1.78	0.24846	.	.	.	.	.	T	0.31918	0.0812	L	0.44542	1.39	0.09310	N	1	B	0.20261	0.043	B	0.15484	0.013	T	0.23013	-1.0200	8	0.45353	T	0.12	-2.3899	6.4272	0.21776	0.0:0.7722:0.0:0.2278	.	101	A1L168	CT202_HUMAN	S	101	.	ENSP00000383474:P101S	P	+	1	0	C20orf202	1135678	0.000000	0.05858	0.003000	0.11579	0.705000	0.40729	0.059000	0.14322	0.536000	0.28733	0.561000	0.74099	CCG	C20orf202	-	NULL	ENSG00000215595		0.652	C20orf202-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf202	HGNC	protein_coding	OTTHUMT00000251531.1	-	0.00	43	0	C	NM_001009612		1187678	+1	tier1	-	no_errors	ENST00000400633	ensembl	human	known	74_37	missense	8.77	52	5	SNP	0.003	T
C3orf30	152405	genome.wustl.edu	37	3	118865547	118865547	+	Missense_Mutation	SNP	G	G	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr3:118865547G>C	ENST00000295622.1	+	1	551	c.511G>C	c.(511-513)Gac>Cac	p.D171H	RP11-484M3.5_ENST00000490594.1_5'Flank|IGSF11_ENST00000441144.2_5'Flank|IGSF11_ENST00000354673.2_5'Flank|IGSF11_ENST00000425327.2_5'Flank	NM_152539.2	NP_689752.2	Q96M34	CC030_HUMAN	chromosome 3 open reading frame 30	171										NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(20)|ovary(2)|prostate(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(114;0.222)		TATGCCATCTGACCAGAGAGG	0.542																																																	0													66.0	68.0	67.0					3																	118865547		2203	4300	6503	SO:0001583	missense	0			AK057421	CCDS2984.1	3q13.32	2011-08-09			ENSG00000163424	ENSG00000163424			26553	protein-coding gene	gene with protein product							Standard	NM_152539		Approved	FLJ32859	uc003ecb.1	Q96M34	OTTHUMG00000159349	ENST00000295622.1:c.511G>C	3.37:g.118865547G>C	ENSP00000295622:p.Asp171His		A1L4B7	Missense_Mutation	SNP	superfamily_cAMP_dep_PK_reg_su_I/II_a/b	p.D171H	ENST00000295622.1	37	c.511	CCDS2984.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	13.40|13.40	2.225495|2.225495	0.39300|0.39300	.|.	.|.	ENSG00000163424|ENSG00000163424	ENST00000295622;ENST00000470341|ENST00000460150	T|.	0.23950|.	1.88|.	1.55|1.55	1.55|1.55	0.23275|0.23275	.|.	2.166740|.	0.02010|.	N|.	0.046958|.	T|.	0.34135|.	0.0887|.	L|L	0.34521|0.34521	1.04|1.04	0.24952|0.24952	N|N	0.99179|0.99179	D;D|.	0.89917|.	1.0;0.986|.	D;P|.	0.78314|.	0.991;0.85|.	T|.	0.24048|.	-1.0171|.	10|.	0.38643|.	T|.	0.18|.	.|.	9.0535|9.0535	0.36392|0.36392	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	171;171|.	E9PFE5;Q96M34|.	.;CC030_HUMAN|.	H|S	171|134	ENSP00000295622:D171H|.	ENSP00000295622:D171H|.	D|X	+|+	1|2	0|2	C3orf30|C3orf30	120348237|120348237	0.348000|0.348000	0.24861|0.24861	0.210000|0.210000	0.23637|0.23637	0.089000|0.089000	0.18198|0.18198	1.407000|1.407000	0.34657|0.34657	1.143000|1.143000	0.42306|0.42306	0.514000|0.514000	0.50259|0.50259	GAC|TGA	C3orf30	-	NULL	ENSG00000163424		0.542	C3orf30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf30	HGNC	protein_coding	OTTHUMT00000354838.1	-	0.00	25	0	G	NM_152539		118865547	+1	tier1	-	no_errors	ENST00000295622	ensembl	human	known	74_37	missense	18.60	35	8	SNP	0.946	C
CACNA1S	779	genome.wustl.edu	37	1	201047063	201047063	+	Silent	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr1:201047063G>T	ENST00000362061.3	-	11	1789	c.1563C>A	c.(1561-1563)ccC>ccA	p.P521P	CACNA1S_ENST00000367338.3_Silent_p.P521P	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	521					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	AGATGCCCAGGGGTGTCATGG	0.617																																																	0													78.0	62.0	67.0					1																	201047063		2203	4300	6503	SO:0001819	synonymous_variant	0			L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.1563C>A	1.37:g.201047063G>T			A4IF51|B1ALM2|Q12896|Q13934	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su,prints_VDCC_L_a1ssu	p.P521	ENST00000362061.3	37	c.1563	CCDS1407.1	1																																																																																			CACNA1S	-	pfam_Ion_trans_dom	ENSG00000081248		0.617	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1S	HGNC	protein_coding	OTTHUMT00000087049.1		0.00	57	0	G	NM_000069		201047063	-1			no_errors	ENST00000362061	ensembl	human	known	74_37	silent	5.97	63	4	SNP	0.985	T
CAD	790	genome.wustl.edu	37	2	27461302	27461302	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr2:27461302C>A	ENST00000403525.1	+	30	4819	c.4675C>A	c.(4675-4677)Ctg>Atg	p.L1559M	CAD_ENST00000264705.4_Missense_Mutation_p.L1622M			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCCCCAGATCCTGCTAATTAA	0.552																																																	0													71.0	70.0	70.0					2																	27461302		2203	4300	6503	SO:0001583	missense	0			D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.4675C>A	2.37:g.27461302C>A	ENSP00000384510:p.Leu1559Met		O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_ssu_N,pfam_Asp/Orn_carbamoyltranf_P-bd,pfam_GATASE,pfam_Asp_carbamoyltransf_Asp/Orn-bd,pfam_CarbamoylP_synth_lsu_oligo,pfam_CarbamoylP_synth_lsu_N,pfam_ATP-grasp_carboxylate-amine,pfam_MGS-like_dom,pfam_Dala_Dala_lig_C,pfam_Amidohydro_1,superfamily_Asp/Orn_carbamoylTrfase,superfamily_CarbamoylP_synth_lsu_oligo,superfamily_CarbamoylP_synth_ssu_N,superfamily_PreATP-grasp_dom,superfamily_MGS-like_dom,superfamily_Metal-dep_hydrolase_composite,smart_MGS-like_dom,pfscan_ATP-grasp,prints_CbamoylP_synth_lsu_CPSase_dom,prints_Asp_carbamoyltransf,prints_Asp/Orn_carbamoylTrfase,tigrfam_CarbamoylP_synth_lsu,tigrfam_CarbamoylP_synth_ssu,tigrfam_Asp_carbamoyltransf	p.L1622M	ENST00000403525.1	37	c.4864		2	.	.	.	.	.	.	.	.	.	.	C	13.14	2.148485	0.37923	.	.	ENSG00000084774	ENST00000264705;ENST00000403525	T;T	0.47177	0.85;0.85	4.94	4.94	0.65067	.	0.071221	0.56097	D	0.000029	T	0.42539	0.1207	L	0.40543	1.245	0.41517	D	0.988373	B;B	0.28178	0.202;0.124	B;B	0.28139	0.086;0.055	T	0.38564	-0.9655	10	0.46703	T	0.11	-0.3993	16.753	0.85492	0.0:1.0:0.0:0.0	.	1559;1622	F8VPD4;P27708	.;PYR1_HUMAN	M	1622;1559	ENSP00000264705:L1622M;ENSP00000384510:L1559M	ENSP00000264705:L1622M	L	+	1	2	CAD	27314806	1.000000	0.71417	1.000000	0.80357	0.762000	0.43233	2.856000	0.48341	2.292000	0.77174	0.561000	0.74099	CTG	CAD	-	NULL	ENSG00000084774		0.552	CAD-002	NOVEL	basic|exp_conf	protein_coding	CAD	HGNC	protein_coding	OTTHUMT00000324970.1	-	0.00	41	0	C			27461302	+1	tier1	-	no_errors	ENST00000264705	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	A
CALML4	91860	genome.wustl.edu	37	15	68486374	68486374	+	Silent	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr15:68486374G>T	ENST00000467889.1	-	5	754	c.570C>A	c.(568-570)acC>acA	p.T190T	CALML4_ENST00000395465.3_3'UTR|CALML4_ENST00000448060.2_Silent_p.T143T|RP11-315D16.2_ENST00000562767.1_3'UTR|CALML4_ENST00000540479.1_Silent_p.T114T	NM_033429.2	NP_219501.2	Q96GE6	CALL4_HUMAN	calmodulin-like 4	190	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)			large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	4						GTCCAGGAAGGGTGATCTTGT	0.398																																																	0													119.0	99.0	106.0					15																	68486374		2200	4298	6498	SO:0001819	synonymous_variant	0			AF308287	CCDS10226.2, CCDS42052.1, CCDS66808.1	15q22.31	2013-01-10			ENSG00000129007	ENSG00000129007		"""EF-hand domain containing"""	18445	protein-coding gene	gene with protein product							Standard	NM_033429		Approved	MGC4809, NY-BR-20	uc002arb.3	Q96GE6	OTTHUMG00000133287	ENST00000467889.1:c.570C>A	15.37:g.68486374G>T			B4DL15|F8W6Y4|Q6MZY3|Q6N048|Q9H286	Silent	SNP	smart_EF_hand_dom,pfscan_EF_hand_dom	p.T190	ENST00000467889.1	37	c.570	CCDS10226.2	15																																																																																			CALML4	-	smart_EF_hand_dom	ENSG00000129007		0.398	CALML4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALML4	HGNC	protein_coding	OTTHUMT00000257067.3	-	0.00	50	0	G	NM_033429		68486374	-1	tier1	-	no_errors	ENST00000467889	ensembl	human	known	74_37	silent	6.17	76	5	SNP	0.938	T
CAPN15	6650	genome.wustl.edu	37	16	602930	602930	+	Missense_Mutation	SNP	A	A	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr16:602930A>G	ENST00000219611.2	+	13	3335	c.2972A>G	c.(2971-2973)aAc>aGc	p.N991S	LA16c-366D1.3_ENST00000565879.1_RNA	NM_005632.2	NP_005623.1	O75808	CAN15_HUMAN	calpain 15	991					proteolysis (GO:0006508)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										GTGGTGGAGAACCGACACCCC	0.642																																																	0													88.0	80.0	83.0					16																	602930		2199	4298	6497	SO:0001583	missense	0			U85647	CCDS10410.1	16p13.3	2013-06-27	2013-06-27	2013-06-27	ENSG00000103326	ENSG00000103326			11182	protein-coding gene	gene with protein product		603267	"""small optic lobes (Drosophila) homolog"", ""small optic lobes homolog (Drosophila)"""	SOLH		9722942	Standard	NM_005632		Approved		uc002chi.3	O75808	OTTHUMG00000119059	ENST00000219611.2:c.2972A>G	16.37:g.602930A>G	ENSP00000219611:p.Asn991Ser		B1B1M4|Q2KHS2|Q8WTY9|Q9BUW0	Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Znf_RanBP2,smart_Znf_RanBP2,smart_Peptidase_C2_calpain_cat,pfscan_Znf_RanBP2,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.N991S	ENST00000219611.2	37	c.2972	CCDS10410.1	16	.	.	.	.	.	.	.	.	.	.	a	17.61	3.432887	0.62844	.	.	ENSG00000103326	ENST00000219611	D	0.93189	-3.18	4.78	4.78	0.61160	.	0.000000	0.64402	U	0.000003	D	0.95928	0.8674	M	0.73217	2.22	0.58432	D	0.999998	D	0.71674	0.998	D	0.77004	0.989	D	0.96306	0.9225	10	0.87932	D	0	.	13.5599	0.61782	1.0:0.0:0.0:0.0	.	991	O75808	CAN15_HUMAN	S	991	ENSP00000219611:N991S	ENSP00000219611:N991S	N	+	2	0	SOLH	542931	1.000000	0.71417	1.000000	0.80357	0.504000	0.33889	7.113000	0.77095	2.133000	0.65898	0.454000	0.30748	AAC	CAPN15	-	NULL	ENSG00000103326		0.642	CAPN15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPN15	HGNC	protein_coding	OTTHUMT00000239271.1	-	0.00	35	0	A	NM_005632		602930	+1	tier1	-	no_errors	ENST00000219611	ensembl	human	known	74_37	missense	10.53	51	6	SNP	1.000	G
CAPN9	10753	genome.wustl.edu	37	1	230898516	230898516	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr1:230898516G>T	ENST00000271971.2	+	4	633	c.520G>T	c.(520-522)Gaa>Taa	p.E174*	CAPN9_ENST00000366666.2_Nonsense_Mutation_p.E111*|RP11-99J16__A.2_ENST00000412344.1_RNA|CAPN9_ENST00000354537.1_Nonsense_Mutation_p.E174*	NM_006615.2	NP_006606.1	O14815	CAN9_HUMAN	calpain 9	174	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				digestion (GO:0007586)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	25	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)				CGCCTTGCTGGAAAAAGCCTA	0.582																																																	0													74.0	64.0	68.0					1																	230898516		2203	4300	6503	SO:0001587	stop_gained	0			AF022799	CCDS1586.1, CCDS31053.1	1q42.11-q42.3	2013-01-10	2004-11-11		ENSG00000135773	ENSG00000135773		"""EF-hand domain containing"""	1486	protein-coding gene	gene with protein product	"""novel calpain large subunit-4"""	606401	"""calpain 9 (nCL-4)"""			9524069, 10835488	Standard	XM_005273010		Approved	nCL-4, GC36	uc001htz.1	O14815	OTTHUMG00000037779	ENST00000271971.2:c.520G>T	1.37:g.230898516G>T	ENSP00000271971:p.Glu174*		B1APS1|B1AQI0|Q9NS74	Nonsense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,smart_EF_hand_dom,prints_Calpain_cysteine_protease,pfscan_EF_hand_dom,pfscan_Peptidase_C2_calpain_cat	p.E174*	ENST00000271971.2	37	c.520	CCDS1586.1	1	.	.	.	.	.	.	.	.	.	.	G	39	7.644100	0.98409	.	.	ENSG00000135773	ENST00000271971;ENST00000354537;ENST00000366666	.	.	.	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.0115	0.92875	0.0:0.0:1.0:0.0	.	.	.	.	X	174;174;111	.	ENSP00000271971:E174X	E	+	1	0	CAPN9	228965139	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.342000	0.97044	2.489000	0.83994	0.591000	0.81541	GAA	CAPN9	-	pfam_Peptidase_C2_calpain_cat,smart_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease,pfscan_Peptidase_C2_calpain_cat	ENSG00000135773		0.582	CAPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPN9	HGNC	protein_coding	OTTHUMT00000092179.1	-	0.00	31	0	G	NM_006615		230898516	+1	tier1	-	no_errors	ENST00000271971	ensembl	human	known	74_37	nonsense	9.09	40	4	SNP	1.000	T
CARS2	79587	genome.wustl.edu	37	13	111329405	111329405	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr13:111329405G>T	ENST00000257347.4	-	7	764	c.701C>A	c.(700-702)gCg>gAg	p.A234E	CARS2_ENST00000535398.1_5'UTR	NM_024537.2	NP_078813.1	Q9HA77	SYCM_HUMAN	cysteinyl-tRNA synthetase 2, mitochondrial (putative)	234					cysteinyl-tRNA aminoacylation (GO:0006423)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|cysteine-tRNA ligase activity (GO:0004817)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|prostate(4)|skin(1)	13	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.163)		L-Cysteine(DB00151)	GGGTTTGGCCGCCTTCCACAG	0.632																																																	0													52.0	54.0	53.0					13																	111329405		2203	4300	6503	SO:0001583	missense	0			BC007220	CCDS9514.1	13q34	2011-07-01	2007-02-22		ENSG00000134905	ENSG00000134905	6.1.1.16	"""Aminoacyl tRNA synthetases / Class I"""	25695	protein-coding gene	gene with protein product	"""cysteine tRNA ligase 2, mitochondrial (putative)"""	612800				15779907	Standard	NM_024537		Approved	FLJ12118	uc001vrd.2	Q9HA77	OTTHUMG00000017347	ENST00000257347.4:c.701C>A	13.37:g.111329405G>T	ENSP00000257347:p.Ala234Glu		Q8NI84|Q96IV4	Missense_Mutation	SNP	pfam_Cys-tRNA/MSH_ligase,pfam_Methionyl/Leucyl_tRNA_Synth,pfam_aa-tRNA-synth_Ia,superfamily_tRNAsynth_1a_anticodon-bd,prints_Cys-tRNA/MSH_ligase,tigrfam_Cys-tRNA-ligase	p.A234E	ENST00000257347.4	37	c.701	CCDS9514.1	13	.	.	.	.	.	.	.	.	.	.	g	18.62	3.662386	0.67700	.	.	ENSG00000134905	ENST00000257347	T	0.34072	1.38	5.42	4.57	0.56435	Rossmann-like alpha/beta/alpha sandwich fold (1);	0.372817	0.29172	N	0.012934	T	0.60689	0.2288	M	0.86178	2.8	0.49130	D	0.99975	P	0.48294	0.908	P	0.57776	0.827	T	0.66156	-0.5994	10	0.46703	T	0.11	-22.9007	16.3654	0.83319	0.0:0.1318:0.8682:0.0	.	234	Q9HA77	SYCM_HUMAN	E	234	ENSP00000257347:A234E	ENSP00000257347:A234E	A	-	2	0	CARS2	110127406	0.892000	0.30473	0.880000	0.34516	0.381000	0.30169	1.232000	0.32636	1.268000	0.44264	0.556000	0.70494	GCG	CARS2	-	pfam_Cys-tRNA/MSH_ligase,tigrfam_Cys-tRNA-ligase	ENSG00000134905		0.632	CARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARS2	HGNC	protein_coding	OTTHUMT00000045772.3		0.00	29	0	G	NM_024537		111329405	-1			no_errors	ENST00000257347	ensembl	human	known	74_37	missense	5.56	50	3	SNP	0.998	T
CASP5	838	genome.wustl.edu	37	11	104874037	104874037	+	Silent	SNP	T	T	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr11:104874037T>C	ENST00000260315.3	-	4	506	c.507A>G	c.(505-507)gaA>gaG	p.E169E	CASP5_ENST00000444749.2_Silent_p.E111E|CASP5_ENST00000393141.2_Silent_p.E182E|CASP5_ENST00000526056.1_Silent_p.E182E|CASP5_ENST00000531367.1_Silent_p.E27E|CASP5_ENST00000418434.1_Silent_p.E27E|CASP5_ENST00000393139.2_Intron			P51878	CASP5_HUMAN	caspase 5, apoptosis-related cysteine peptidase	169					apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|execution phase of apoptosis (GO:0097194)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of inflammatory response (GO:0050727)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|NLRP1 inflammasome complex (GO:0072558)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|ovary(3)|skin(1)|urinary_tract(1)	35		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)		TCAGGAATTCTTCACGAGGAC	0.383																																																	0													142.0	142.0	142.0					11																	104874037		2202	4299	6501	SO:0001819	synonymous_variant	0				CCDS8328.2, CCDS44718.1, CCDS44719.1, CCDS44720.1	11q22.2-q22.3	2006-02-17	2005-08-17		ENSG00000137757	ENSG00000137757		"""Caspases"""	1506	protein-coding gene	gene with protein product		602665	"""caspase 5, apoptosis-related cysteine protease"""			7797592, 9250871	Standard	NM_004347		Approved	ICE(rel)III	uc010ruz.1	P51878	OTTHUMG00000048073	ENST00000260315.3:c.507A>G	11.37:g.104874037T>C			B4DKP5|Q0QVY7|Q0QVY8|Q0QVZ0|Q0QVZ1|Q0QVZ2|Q14DD6|Q1HBJ3|Q6DJV7	Silent	SNP	pfam_Pept_C14_caspase,pfam_CARD,superfamily_DEATH-like_dom,smart_CARD,smart_Pept_C14A_p45_core,pirsf_Caspase_IL-1_beta,pfscan_CARD,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	p.E182	ENST00000260315.3	37	c.546	CCDS8328.2	11																																																																																			CASP5	-	pirsf_Caspase_IL-1_beta	ENSG00000137757		0.383	CASP5-001	KNOWN	basic|CCDS	protein_coding	CASP5	HGNC	protein_coding	OTTHUMT00000109397.2		0.00	29	0	T	NM_004347		104874037	-1			no_errors	ENST00000393141	ensembl	human	known	74_37	silent	7.69	48	4	SNP	0.007	C
CCAR1	55749	genome.wustl.edu	37	10	70520826	70520826	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr10:70520826G>T	ENST00000265872.6	+	16	2102	c.1983G>T	c.(1981-1983)caG>caT	p.Q661H	CCAR1_ENST00000543719.1_Missense_Mutation_p.Q646H|MIR1254-1_ENST00000408257.1_RNA|CCAR1_ENST00000535016.1_Missense_Mutation_p.Q646H	NM_001282959.1|NM_001282960.1|NM_018237.2	NP_001269888.1|NP_001269889.1|NP_060707.2	Q8IX12	CCAR1_HUMAN	cell division cycle and apoptosis regulator 1	661	SAP. {ECO:0000255|PROSITE- ProRule:PRU00186}.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(7)|skin(3)	56						TAAAATCCCAGTTAATAGCCC	0.353																																																	0													70.0	73.0	72.0					10																	70520826		2203	4299	6502	SO:0001583	missense	0			AY249140	CCDS7282.1, CCDS60547.1	10q22.1	2004-02-19			ENSG00000060339	ENSG00000060339			24236	protein-coding gene	gene with protein product		612569				12816952	Standard	NM_018237		Approved	FLJ10590, CARP-1, CARP1	uc001joo.3	Q8IX12	OTTHUMG00000018361	ENST00000265872.6:c.1983G>T	10.37:g.70520826G>T	ENSP00000265872:p.Gln661His		A0JLT7|A1L4P7|A8K9D4|B4DNP8|B4DRK8|Q32NE3|Q5EBM3|Q5VUP6|Q6PIZ0|Q6X935|Q9H8N4|Q9NVA7|Q9NVQ0|Q9NWM6	Missense_Mutation	SNP	pfam_SAP_dom,superfamily_NA-bd_OB-fold,smart_SAP_dom,pfscan_SAP_dom	p.Q661H	ENST00000265872.6	37	c.1983	CCDS7282.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.51|15.51	2.854631|2.854631	0.51376|0.51376	.|.	.|.	ENSG00000060339|ENSG00000060339	ENST00000265872;ENST00000535016;ENST00000543719;ENST00000539539;ENST00000543225;ENST00000536012|ENST00000543706	T;T;T;T;T;T|.	0.29917|.	1.55;1.72;1.72;1.72;1.77;1.75|.	5.43|5.43	4.53|4.53	0.55603|0.55603	DNA-binding SAP (4);|.	0.060025|.	0.64402|.	D|.	0.000002|.	T|T	0.64757|0.64757	0.2627|0.2627	M|M	0.66939|0.66939	2.045|2.045	0.58432|0.58432	D|D	0.999999|0.999999	D;D;D|.	0.71674|.	0.988;0.996;0.998|.	D;D;D|.	0.81914|.	0.984;0.995;0.955|.	T|T	0.63730|0.63730	-0.6571|-0.6571	10|5	0.72032|.	D|.	0.01|.	-8.4663|-8.4663	10.399|10.399	0.44218|0.44218	0.1489:0.0:0.8511:0.0|0.1489:0.0:0.8511:0.0	.|.	646;661;635|.	Q8IX12-2;Q8IX12;F5H2E6|.	.;CCAR1_HUMAN;.|.	H|F	661;646;646;646;635;466|31	ENSP00000265872:Q661H;ENSP00000441820:Q646H;ENSP00000445254:Q646H;ENSP00000439252:Q646H;ENSP00000438610:Q635H;ENSP00000439642:Q466H|.	ENSP00000265872:Q661H|.	Q|V	+|+	3|1	2|0	CCAR1|CCAR1	70190832|70190832	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.959000|0.959000	0.62525|0.62525	4.424000|4.424000	0.59868|0.59868	1.299000|1.299000	0.44798|0.44798	0.655000|0.655000	0.94253|0.94253	CAG|GTT	CCAR1	-	pfam_SAP_dom,smart_SAP_dom,pfscan_SAP_dom	ENSG00000060339		0.353	CCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCAR1	HGNC	protein_coding	OTTHUMT00000048356.2	-	0.00	47	0	G	NM_018237		70520826	+1	tier1	-	no_errors	ENST00000265872	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	T
CCDC166	100130274	genome.wustl.edu	37	8	144790064	144790064	+	Missense_Mutation	SNP	C	C	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr8:144790064C>G	ENST00000542437.1	-	1	215	c.216G>C	c.(214-216)gaG>gaC	p.E72D	RP11-429J17.4_ENST00000527579.1_RNA	NM_001162914.1	NP_001156386.1	P0CW27	CC166_HUMAN	coiled-coil domain containing 166	72																	AGAGCCGGTTCTCCTCGCGCA	0.692																																																	0													11.0	13.0	13.0					8																	144790064		690	1588	2278	SO:0001583	missense	0				CCDS55280.1	8q24.3	2011-06-20			ENSG00000255181	ENSG00000255181			41910	protein-coding gene	gene with protein product							Standard	NM_001162914		Approved		uc011lkr.2	P0CW27	OTTHUMG00000165148	ENST00000542437.1:c.216G>C	8.37:g.144790064C>G	ENSP00000437468:p.Glu72Asp			Missense_Mutation	SNP	NULL	p.E72D	ENST00000542437.1	37	c.216	CCDS55280.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.94|19.94	3.919530|3.919530	0.73098|0.73098	.|.	.|.	ENSG00000255181|ENSG00000255181	ENST00000542437|ENST00000533508	T|.	0.39056|.	1.1|.	4.11|4.11	-0.241|-0.241	0.13043|0.13043	.|.	.|.	.|.	.|.	.|.	T|T	0.32793|0.32793	0.0841|0.0841	L|L	0.32530|0.32530	0.975|0.975	0.20307|0.20307	N|N	0.999919|0.999919	D|.	0.64830|.	0.994|.	D|.	0.63381|.	0.914|.	T|T	0.31081|0.31081	-0.9956|-0.9956	9|5	0.33141|.	T|.	0.24|.	.|.	9.2003|9.2003	0.37254|0.37254	0.0:0.604:0.0:0.396|0.0:0.604:0.0:0.396	.|.	72|.	P0CW27|.	CC166_HUMAN|.	D|T	72|54	ENSP00000437468:E72D|.	ENSP00000437468:E72D|.	E|R	-|-	3|2	2|0	CCDC166|CCDC166	144862052|144862052	0.898000|0.898000	0.30612|0.30612	0.999000|0.999000	0.59377|0.59377	0.990000|0.990000	0.78478|0.78478	-0.299000|-0.299000	0.08254|0.08254	0.055000|0.055000	0.16094|0.16094	0.561000|0.561000	0.74099|0.74099	GAG|AGA	CCDC166	-	NULL	ENSG00000255181		0.692	CCDC166-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC166	HGNC	protein_coding			0.00	20	0	C	NM_001162914		144790064	-1			no_errors	ENST00000542437	ensembl	human	known	74_37	missense	11.36	39	5	SNP	0.971	G
CCDC77	84318	genome.wustl.edu	37	12	549908	549908	+	Splice_Site	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr12:549908G>T	ENST00000239830.4	+	11	1346	c.1167G>T	c.(1165-1167)aaG>aaT	p.K389N	CCDC77_ENST00000412006.2_Splice_Site_p.K357N|CCDC77_ENST00000540180.1_Splice_Site_p.K357N|CCDC77_ENST00000422000.1_Splice_Site_p.K357N	NM_032358.3	NP_115734.1	Q9BR77	CCD77_HUMAN	coiled-coil domain containing 77	389						centrosome (GO:0005813)|membrane (GO:0016020)				cervix(1)|endometrium(1)|large_intestine(5)|liver(2)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(10;0.0149)|all_epithelial(11;0.035)|all_lung(10;0.111)|Ovarian(42;0.142)|Lung NSC(10;0.156)		OV - Ovarian serous cystadenocarcinoma(31;0.00123)|BRCA - Breast invasive adenocarcinoma(9;0.033)			AGATCTTCAAGGTACGAAATT	0.448																																																	0													94.0	97.0	96.0					12																	549908		2203	4300	6503	SO:0001630	splice_region_variant	0			AK027638	CCDS8503.1, CCDS44781.1	12p13.33	2006-02-16			ENSG00000120647	ENSG00000120647			28203	protein-coding gene	gene with protein product						12477932	Standard	NM_001130148		Approved	MGC13183	uc001qig.3	Q9BR77	OTTHUMG00000129214	ENST00000239830.4:c.1167+1G>T	12.37:g.549908G>T			B4DDE8	Missense_Mutation	SNP	NULL	p.K389N	ENST00000239830.4	37	c.1167	CCDS8503.1	12	.	.	.	.	.	.	.	.	.	.	G	18.70	3.679292	0.68042	.	.	ENSG00000120647	ENST00000540180;ENST00000422000;ENST00000543504;ENST00000239830;ENST00000412006	T;T;T;T;T	0.35236	1.32;1.32;1.32;1.32;1.32	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.58722	0.2142	M	0.62723	1.935	0.80722	D	1	D	0.76494	0.999	D	0.74023	0.982	T	0.56956	-0.7893	10	0.44086	T	0.13	-27.4168	18.9224	0.92530	0.0:0.0:1.0:0.0	.	389	Q9BR77	CCD77_HUMAN	N	357;357;357;389;357	ENSP00000440554:K357N;ENSP00000391870:K357N;ENSP00000445873:K357N;ENSP00000239830:K389N;ENSP00000412925:K357N	ENSP00000239830:K389N	K	+	3	2	CCDC77	420169	1.000000	0.71417	1.000000	0.80357	0.497000	0.33675	6.688000	0.74557	2.472000	0.83506	0.563000	0.77884	AAG	CCDC77	-	NULL	ENSG00000120647		0.448	CCDC77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC77	HGNC	protein_coding	OTTHUMT00000251296.1		0.00	41	0	G	NM_032358	Missense_Mutation	549908	+1			no_errors	ENST00000239830	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	T
CCDC63	160762	genome.wustl.edu	37	12	111336860	111336860	+	Missense_Mutation	SNP	G	G	A	rs148044780		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr12:111336860G>A	ENST00000308208.5	+	10	1515	c.1273G>A	c.(1273-1275)Gcc>Acc	p.A425T	CCDC63_ENST00000545036.1_Missense_Mutation_p.A385T|CCDC63_ENST00000552694.1_Missense_Mutation_p.A346T	NM_152591.1	NP_689804.1	Q8NA47	CCD63_HUMAN	coiled-coil domain containing 63	425										NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(15)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(1)	39						AAACTGTGACGCCACCAAGAT	0.498																																																	0								G	THR/ALA	0,4406		0,0,2203	100.0	88.0	92.0		1273	2.5	0.9	12	dbSNP_134	92	1,8599	1.2+/-3.3	0,1,4299	no	missense	CCDC63	NM_152591.1	58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	425/564	111336860	1,13005	2203	4300	6503	SO:0001583	missense	0			AK093162	CCDS9151.1, CCDS66470.1, CCDS73528.1	12q24.11	2013-02-19				ENSG00000173093			26669	protein-coding gene	gene with protein product	"""outer row dynein assembly 5 homolog (Chlamydomonas)"""						Standard	NM_001286243		Approved	ODA5, FLJ35843	uc001trv.1	Q8NA47	OTTHUMG00000169534	ENST00000308208.5:c.1273G>A	12.37:g.111336860G>A	ENSP00000312399:p.Ala425Thr		B4DY03|Q0P603|Q6P2E1	Missense_Mutation	SNP	NULL	p.A425T	ENST00000308208.5	37	c.1273	CCDS9151.1	12	.	.	.	.	.	.	.	.	.	.	G	12.94	2.088344	0.36855	0.0	1.16E-4	ENSG00000173093	ENST00000545036;ENST00000308208;ENST00000552694	T;T;T	0.42131	0.98;0.98;0.98	4.49	2.55	0.30701	.	0.472817	0.23863	N	0.043830	T	0.29389	0.0732	M	0.62154	1.92	0.25706	N	0.98553	P	0.43578	0.811	B	0.31946	0.138	T	0.21415	-1.0246	10	0.12430	T	0.62	.	8.7898	0.34843	0.0:0.1649:0.6642:0.1709	.	425	Q8NA47	CCD63_HUMAN	T	385;425;346	ENSP00000445881:A385T;ENSP00000312399:A425T;ENSP00000450217:A346T	ENSP00000312399:A425T	A	+	1	0	CCDC63	109821243	0.010000	0.17322	0.898000	0.35279	0.725000	0.41563	0.396000	0.20867	0.530000	0.28619	0.542000	0.68232	GCC	CCDC63	-	NULL	ENSG00000173093		0.498	CCDC63-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC63	HGNC	protein_coding	OTTHUMT00000404673.2	-	0.00	71	0	G	NM_152591		111336860	+1	tier1	rs148044780	no_errors	ENST00000308208	ensembl	human	known	74_37	missense	11.11	88	11	SNP	0.984	A
CCT6B	10693	genome.wustl.edu	37	17	33266647	33266647	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr17:33266647C>T	ENST00000314144.5	-	9	1169	c.1054G>A	c.(1054-1056)Gag>Aag	p.E352K	CCT6B_ENST00000421975.3_Missense_Mutation_p.E315K|CCT6B_ENST00000436961.3_Missense_Mutation_p.E307K	NM_006584.3	NP_006575.2	Q92526	TCPW_HUMAN	chaperonin containing TCP1, subunit 6B (zeta 2)	352					chaperone-mediated protein complex assembly (GO:0051131)|protein folding (GO:0006457)|protein transport (GO:0015031)|spermatogenesis (GO:0007283)	chaperonin-containing T-complex (GO:0005832)	ATP binding (GO:0005524)|protein transporter activity (GO:0008565)|unfolded protein binding (GO:0051082)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)	20		Ovarian(249;0.17)				AATGTATACTCATACACAAGA	0.348																																																	0													97.0	85.0	89.0					17																	33266647		2203	4300	6503	SO:0001583	missense	0			D78333	CCDS32617.1, CCDS54105.1, CCDS54106.1	17q	2011-09-02			ENSG00000132141	ENSG00000132141		"""Heat Shock Proteins / Chaperonins"""	1621	protein-coding gene	gene with protein product		610730				8812458, 9013858	Standard	NM_006584		Approved	Cctz2, TSA303	uc002hig.3	Q92526		ENST00000314144.5:c.1054G>A	17.37:g.33266647C>T	ENSP00000327191:p.Glu352Lys		B4DX20|B4DYB0|Q8TC34	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom,prints_Chaperone_TCP-1,prints_Chaprnin_Cpn60,tigrfam_Chap_CCT_zeta	p.E352K	ENST00000314144.5	37	c.1054	CCDS32617.1	17	.	.	.	.	.	.	.	.	.	.	C	17.23	3.337332	0.60963	.	.	ENSG00000132141	ENST00000421975;ENST00000314144;ENST00000436961	T;T;T	0.70164	-0.46;-0.46;-0.46	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	D	0.89178	0.6641	H	0.99435	4.565	0.80722	D	1	P;P;D	0.55385	0.931;0.933;0.971	D;D;D	0.66351	0.928;0.928;0.943	D	0.93366	0.6731	10	0.72032	D	0.01	-14.9254	15.4794	0.75514	0.0:1.0:0.0:0.0	.	307;315;352	B4DYB0;B4DX20;Q92526	.;.;TCPW_HUMAN	K	315;352;307	ENSP00000398044:E315K;ENSP00000327191:E352K;ENSP00000400917:E307K	ENSP00000327191:E352K	E	-	1	0	CCT6B	30290760	1.000000	0.71417	0.236000	0.24074	0.255000	0.26057	5.267000	0.65530	2.595000	0.87683	0.563000	0.77884	GAG	CCT6B	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom,tigrfam_Chap_CCT_zeta	ENSG00000132141		0.348	CCT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT6B	HGNC	protein_coding	OTTHUMT00000448014.1	-	0.00	28	0	C	NM_006584		33266647	-1	tier1	-	no_errors	ENST00000314144	ensembl	human	known	74_37	missense	13.79	50	8	SNP	0.911	T
CCT6P1	643253	genome.wustl.edu	37	7	65217249	65217249	+	RNA	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr7:65217249C>A	ENST00000442266.1	+	0	234									chaperonin containing TCP1, subunit 6 (zeta) pseudogene 1																		actaaaaatacaaaaattagc	0.468																																																	0																																												0			BC052238, BC073761		7q11.21	2010-06-29	2008-09-22	2008-09-22	ENSG00000228409	ENSG00000228409			33094	pseudogene	pseudogene			"""chaperonin containing TCP1, subunit 6A (zeta 1) pseudogene 1"""	CCT6AP1			Standard	NR_003110		Approved		uc003tug.3		OTTHUMG00000156733		7.37:g.65217249C>A				RNA	SNP	-	NULL	ENST00000442266.1	37	NULL		7																																																																																			CCT6P1	-	-	ENSG00000228409		0.468	CCT6P1-003	KNOWN	basic	processed_transcript	CCT6P1	HGNC	pseudogene	OTTHUMT00000345507.1		0.00	16	0	C	NR_003110		65217249	+1			no_errors	ENST00000442266	ensembl	human	known	74_37	rna	17.86	23	5	SNP	0.228	A
CDC14B	8555	genome.wustl.edu	37	9	99284790	99284790	+	Silent	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr9:99284790G>T	ENST00000375241.1	-	12	1792	c.1341C>A	c.(1339-1341)ctC>ctA	p.L447L	CDC14B_ENST00000481149.1_5'UTR|CDC14B_ENST00000265659.2_Silent_p.L447L|CDC14B_ENST00000375240.3_Silent_p.L447L|CDC14B_ENST00000463569.1_Silent_p.L447L|CDC14B_ENST00000375242.3_Silent_p.L410L|CDC14B_ENST00000375236.1_Silent_p.L447L	NM_003671.3|NM_033331.2	NP_003662.1|NP_201588.1	O60729	CC14B_HUMAN	cell division cycle 14B	447					activation of anaphase-promoting complex activity (GO:0051488)|DNA repair (GO:0006281)|G2 DNA damage checkpoint (GO:0031572)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)	15		Acute lymphoblastic leukemia(62;0.0559)				AGACTCACGTGAGAGGAATAG	0.438																																																	0													239.0	168.0	192.0					9																	99284790		2203	4300	6503	SO:0001819	synonymous_variant	0			AF023158	CCDS6721.1, CCDS6722.1, CCDS43853.1	9q22.3	2013-01-17	2013-01-17		ENSG00000081377	ENSG00000081377		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	1719	protein-coding gene	gene with protein product		603505	"""CDC14 (cell division cycle 14, S. cerevisiae) homolog B"", ""CDC14 cell division cycle 14 homolog B (S. cerevisiae)"""			9367992	Standard	NM_003671		Approved	Cdc14B1, Cdc14B2, CDC14B3, hCDC14B	uc004awj.3	O60729	OTTHUMG00000020300	ENST00000375241.1:c.1341C>A	9.37:g.99284790G>T			A6N5X8|A8MQ20|B1AL31|B1AL32|O43183|O60730|Q5JU08	Silent	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Dual-sp_phosphatase_subgr_cat,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.L447	ENST00000375241.1	37	c.1341	CCDS6722.1	9																																																																																			CDC14B	-	NULL	ENSG00000081377		0.438	CDC14B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC14B	HGNC	protein_coding	OTTHUMT00000053278.2	-	0.00	79	0	G	NM_033331		99284790	-1	tier1	-	no_errors	ENST00000375241	ensembl	human	known	74_37	silent	17.95	128	28	SNP	1.000	T
CDH23	64072	genome.wustl.edu	37	10	73572558	73572558	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr10:73572558C>A	ENST00000224721.6	+	67	9564	c.9559C>A	c.(9559-9561)Cct>Act	p.P3187T	CDH23_ENST00000475158.1_3'UTR|CDH23_ENST00000398788.3_Missense_Mutation_p.P942T	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	3182					calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						AGCTGTCAAGCCTGATGATGA	0.587																																																	0													46.0	50.0	49.0					10																	73572558		2091	4213	6304	SO:0001583	missense	0			AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.9559C>A	10.37:g.73572558C>A	ENSP00000224721:p.Pro3187Thr		C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P942T	ENST00000224721.6	37	c.2824		10	.	.	.	.	.	.	.	.	.	.	C	32	5.173999	0.94807	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000224721;ENST00000398788	D	0.84298	-1.83	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	D	0.91005	0.7171	L	0.54323	1.7	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.997;0.996;0.996	D	0.91174	0.4971	10	0.66056	D	0.02	.	19.1626	0.93539	0.0:1.0:0.0:0.0	.	79;79;3182;3182	Q5QGS5;Q5QGS6;E9PEX1;Q9H251	.;.;.;CAD23_HUMAN	T	3187;3182;3185;942	ENSP00000381768:P942T	ENSP00000224721:P3187T	P	+	1	0	CDH23	73242564	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	7.598000	0.82745	2.768000	0.95171	0.561000	0.74099	CCT	CDH23	-	NULL	ENSG00000107736		0.587	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	CDH23	HGNC	protein_coding	OTTHUMT00000051227.4	-	0.00	39	0	C	NM_052836		73572558	+1	tier1	-	no_errors	ENST00000398788	ensembl	human	known	74_37	missense	35.71	18	10	SNP	1.000	A
CDH9	1007	genome.wustl.edu	37	5	26902614	26902614	+	Silent	SNP	G	G	A	rs150876106		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr5:26902614G>A	ENST00000231021.4	-	7	1396	c.1224C>T	c.(1222-1224)taC>taT	p.Y408Y		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	408	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						CATCTGGATCGTATGCTGTAA	0.323																																					Melanoma(8;187 585 15745 40864 52829)												0								G		1,4405	2.1+/-5.4	0,1,2202	106.0	99.0	101.0		1224	0.2	1.0	5	dbSNP_134	101	0,8598		0,0,4299	no	coding-synonymous	CDH9	NM_016279.3		0,1,6501	AA,AG,GG		0.0,0.0227,0.0077		408/790	26902614	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	0			AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.1224C>T	5.37:g.26902614G>A			Q3B7I5	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Y408	ENST00000231021.4	37	c.1224	CCDS3893.1	5																																																																																			CDH9	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000113100		0.323	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH9	HGNC	protein_coding	OTTHUMT00000207352.1	-	0.00	31	0	G	NM_016279		26902614	-1	tier1	rs150876106	no_errors	ENST00000231021	ensembl	human	known	74_37	silent	6.06	62	4	SNP	1.000	A
CDK17	5128	genome.wustl.edu	37	12	96704833	96704833	+	Silent	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr12:96704833G>T	ENST00000261211.3	-	5	1143	c.540C>A	c.(538-540)tcC>tcA	p.S180S	CDK17_ENST00000543119.2_Silent_p.S180S|CDK17_ENST00000542666.1_Silent_p.S127S	NM_001170464.2|NM_002595.4	NP_001163935.1|NP_002586.2	Q00537	CDK17_HUMAN	cyclin-dependent kinase 17	180					protein phosphorylation (GO:0006468)		ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(6)|lung(11)|ovary(4)|prostate(2)|skin(1)	37						AACTTACTAAGGAAGCTCTAC	0.388																																																	0													137.0	127.0	130.0					12																	96704833		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS9061.1, CCDS53819.1	12q23.1	2011-11-08	2009-12-16	2009-12-16		ENSG00000059758		"""Cyclin-dependent kinases"""	8750	protein-coding gene	gene with protein product		603440	"""PCTAIRE protein kinase 2"""	PCTK2		9370357, 19884882	Standard	NM_001170464		Approved	PCTAIRE2	uc009ztk.3	Q00537		ENST00000261211.3:c.540C>A	12.37:g.96704833G>T			A8K1U6|B2RCQ2|Q8NEB8	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.S180	ENST00000261211.3	37	c.540	CCDS9061.1	12																																																																																			CDK17	-	superfamily_Kinase-like_dom	ENSG00000059758		0.388	CDK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK17	HGNC	protein_coding	OTTHUMT00000408751.1	-	0.00	49	0	G	NM_002595		96704833	-1	tier1	-	no_errors	ENST00000261211	ensembl	human	known	74_37	silent	6.33	74	5	SNP	0.752	T
CFH	3075	genome.wustl.edu	37	1	196695762	196695762	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr1:196695762C>A	ENST00000367429.4	+	13	2276	c.2036C>A	c.(2035-2037)aCa>aAa	p.T679K		NM_000186.3	NP_000177.2	P08603	CFAH_HUMAN	complement factor H	679	Sushi 11. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						GGAGAGTGGACAACTTTACCA	0.294																																																	0													84.0	86.0	85.0					1																	196695762		2203	4300	6503	SO:0001583	missense	0			Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000367429.4:c.2036C>A	1.37:g.196695762C>A	ENSP00000356399:p.Thr679Lys		A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.T679K	ENST00000367429.4	37	c.2036	CCDS1385.1	1	.	.	.	.	.	.	.	.	.	.	C	15.84	2.952531	0.53293	.	.	ENSG00000000971	ENST00000367429	T	0.68181	-0.31	5.53	5.53	0.82687	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.81927	0.4926	M	0.79343	2.45	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.82606	-0.0374	9	0.51188	T	0.08	.	16.1841	0.81934	0.0:1.0:0.0:0.0	.	679	P08603	CFAH_HUMAN	K	679	ENSP00000356399:T679K	ENSP00000356399:T679K	T	+	2	0	CFH	194962385	0.992000	0.36948	0.989000	0.46669	0.127000	0.20565	2.753000	0.47524	2.605000	0.88082	0.460000	0.39030	ACA	CFH	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000000971		0.294	CFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFH	HGNC	protein_coding	OTTHUMT00000086412.2	-	0.00	56	0	C	NM_000186		196695762	+1	tier1	-	no_errors	ENST00000367429	ensembl	human	known	74_37	missense	21.62	58	16	SNP	0.997	A
CHCHD4	131474	genome.wustl.edu	37	3	14157970	14157970	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr3:14157970G>T	ENST00000396914.3	-	2	258	c.77C>A	c.(76-78)gCa>gAa	p.A26E	CHCHD4_ENST00000295767.5_Missense_Mutation_p.A39E	NM_001098502.1	NP_001091972.1	Q8N4Q1	MIA40_HUMAN	coiled-coil-helix-coiled-coil-helix domain containing 4	26					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|protein import into mitochondrial intermembrane space (GO:0045041)|protein maturation by protein folding (GO:0022417)|protein targeting to mitochondrion (GO:0006626)	mitochondrial intermembrane space (GO:0005758)	protein disulfide oxidoreductase activity (GO:0015035)			kidney(1)|large_intestine(1)|lung(2)|prostate(1)	5						CACCAATTCTGCACTGCTTGG	0.488																																																	0													232.0	207.0	216.0					3																	14157970		2203	4300	6503	SO:0001583	missense	0			BC017082	CCDS2617.1, CCDS43054.1	3p25.1	2012-10-15			ENSG00000163528	ENSG00000163528		"""Coiled-coil-helix-coiled-coil-helix domain containing"""	26467	protein-coding gene	gene with protein product	"""translocase of inner mitochondrial membrane 40 homolog (S. cerevisiae)"", ""mitochondrial intermembrane space import and assembly 40 homolog (S. cerevisiae)"""	611077				22214851	Standard	NM_001098502		Approved	FLJ31709, TIMM40, MIA40	uc003byj.4	Q8N4Q1	OTTHUMG00000129805	ENST00000396914.3:c.77C>A	3.37:g.14157970G>T	ENSP00000380122:p.Ala26Glu		A8K3Z9|Q96AI2|Q96MY6	Missense_Mutation	SNP	pfam_CHCH	p.A39E	ENST00000396914.3	37	c.116	CCDS43054.1	3	.	.	.	.	.	.	.	.	.	.	G	17.03	3.284762	0.59867	.	.	ENSG00000163528	ENST00000295767;ENST00000396914	.	.	.	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	T	0.51669	0.1688	L	0.47716	1.5	0.80722	D	1	P;P	0.51537	0.779;0.946	B;B	0.43155	0.141;0.41	T	0.50558	-0.8814	9	0.10377	T	0.69	-23.3386	18.0519	0.89351	0.0:0.0:1.0:0.0	.	26;39	Q8N4Q1;Q8N4Q1-2	MIA40_HUMAN;.	E	39;26	.	ENSP00000295767:A39E	A	-	2	0	CHCHD4	14132971	1.000000	0.71417	0.940000	0.37924	0.192000	0.23643	9.760000	0.98935	2.251000	0.74343	0.491000	0.48974	GCA	CHCHD4	-	NULL	ENSG00000163528		0.488	CHCHD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHCHD4	HGNC	protein_coding	OTTHUMT00000340423.1		0.00	39	0	G	NM_144636		14157970	-1			no_errors	ENST00000295767	ensembl	human	known	74_37	missense	5.80	65	4	SNP	1.000	T
CHD7	55636	genome.wustl.edu	37	8	61654949	61654949	+	Missense_Mutation	SNP	C	C	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr8:61654949C>G	ENST00000423902.2	+	2	1437	c.958C>G	c.(958-960)Cag>Gag	p.Q320E	CHD7_ENST00000525508.1_Missense_Mutation_p.Q320E|CHD7_ENST00000524602.1_Missense_Mutation_p.Q320E	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	320					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			TAACCTAAATCAGGGATTAGT	0.413																																																	0													92.0	89.0	90.0					8																	61654949		1895	4114	6009	SO:0001583	missense	0			AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.958C>G	8.37:g.61654949C>G	ENSP00000392028:p.Gln320Glu		D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.Q320E	ENST00000423902.2	37	c.958	CCDS47865.1	8	.	.	.	.	.	.	.	.	.	.	C	13.59	2.282018	0.40394	.	.	ENSG00000171316	ENST00000307121;ENST00000423902;ENST00000524602;ENST00000525508	T;T;T	0.81247	-1.47;1.91;-1.08	5.67	5.67	0.87782	.	0.000000	0.40728	N	0.001022	D	0.85305	0.5666	L	0.43152	1.355	0.54753	D	0.999986	P	0.49447	0.924	P	0.62298	0.9	T	0.80659	-0.1284	10	0.21540	T	0.41	-13.4964	19.7706	0.96363	0.0:1.0:0.0:0.0	.	320	Q9P2D1	CHD7_HUMAN	E	320	ENSP00000392028:Q320E;ENSP00000437061:Q320E;ENSP00000436027:Q320E	ENSP00000307304:Q320E	Q	+	1	0	CHD7	61817503	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.557000	0.73937	2.697000	0.92050	0.655000	0.94253	CAG	CHD7	-	NULL	ENSG00000171316		0.413	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD7	HGNC	protein_coding	OTTHUMT00000383468.2	-	0.00	48	0	C	XM_098762		61654949	+1	tier1	-	no_errors	ENST00000423902	ensembl	human	known	74_37	missense	8.51	86	8	SNP	1.000	G
CHEK2P2	646096	genome.wustl.edu	37	15	20489414	20489414	+	RNA	SNP	A	A	C	rs9989327	byFrequency	TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr15:20489414A>C	ENST00000555186.1	+	0	402					NR_038836.1				checkpoint kinase 2 pseudogene 2																		TGAGCACAGGACTCAAGTGTC	0.418																																																	0																																												0					15q11.1	2011-11-11			ENSG00000259156	ENSG00000259156			43578	pseudogene	pseudogene							Standard	NR_038836		Approved		uc001ytf.1		OTTHUMG00000171660		15.37:g.20489414A>C				RNA	SNP	-	NULL	ENST00000555186.1	37	NULL		15																																																																																			CHEK2P2	-	-	ENSG00000259156		0.418	CHEK2P2-002	KNOWN	basic	processed_transcript	CHEK2P2	HGNC	pseudogene	OTTHUMT00000414654.1	-	0.00	189	0	A	NR_038836		20489414	+1	tier1	-	no_errors	ENST00000555186	ensembl	human	known	74_37	rna	5.29	214	12	SNP	0.807	C
CHP2	63928	genome.wustl.edu	37	16	23767768	23767768	+	Nonsense_Mutation	SNP	C	C	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr16:23767768C>T	ENST00000300113.2	+	5	835	c.412C>T	c.(412-414)Cag>Tag	p.Q138*		NM_022097.2	NP_071380.1	O43745	CHP2_HUMAN	calcineurin-like EF-hand protein 2	138	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cellular response to calcium ion (GO:0071277)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatase activity (GO:0010922)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(2)|stomach(1)	9				GBM - Glioblastoma multiforme(48;0.0144)		TGAGATGCTGCAGGTTGGCAG	0.537																																																	0													88.0	70.0	76.0					16																	23767768		2197	4300	6497	SO:0001587	stop_gained	0				CCDS10617.1	16p12.2	2013-01-11	2013-01-11		ENSG00000166869	ENSG00000166869		"""EF-hand domain containing"""	24927	protein-coding gene	gene with protein product						12226101	Standard	NM_022097		Approved		uc002dmb.1	O43745	OTTHUMG00000131611	ENST00000300113.2:c.412C>T	16.37:g.23767768C>T	ENSP00000300113:p.Gln138*		A8K2I8	Nonsense_Mutation	SNP	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	p.Q138*	ENST00000300113.2	37	c.412	CCDS10617.1	16	.	.	.	.	.	.	.	.	.	.	C	36	5.706326	0.96821	.	.	ENSG00000166869	ENST00000300113	.	.	.	3.67	3.67	0.42095	.	0.076227	0.52532	D	0.000067	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	-27.8216	13.6905	0.62542	0.0:1.0:0.0:0.0	.	.	.	.	X	138	.	ENSP00000300113:Q138X	Q	+	1	0	AC130454.2	23675269	0.996000	0.38824	0.973000	0.42090	0.270000	0.26580	3.493000	0.53266	2.333000	0.79357	0.591000	0.81541	CAG	CHP2	-	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	ENSG00000166869		0.537	CHP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHP2	HGNC	protein_coding	OTTHUMT00000254498.1		0.00	18	0	C	NM_022097		23767768	+1			no_errors	ENST00000300113	ensembl	human	known	74_37	nonsense	12.90	27	4	SNP	0.997	T
CHRND	1144	genome.wustl.edu	37	2	233398705	233398705	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr2:233398705C>A	ENST00000258385.3	+	10	1144	c.1112C>A	c.(1111-1113)cCt>cAt	p.P371H	CHRND_ENST00000543200.1_Missense_Mutation_p.P356H|CHRND_ENST00000457943.2_Missense_Mutation_p.P177H	NM_000751.2	NP_000742.1	Q07001	ACHD_HUMAN	cholinergic receptor, nicotinic, delta (muscle)	371					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|musculoskeletal movement (GO:0050881)|neuromuscular process (GO:0050905)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)	34		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.89e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00078)|Lung(119;0.00579)|LUSC - Lung squamous cell carcinoma(224;0.00754)	Galantamine(DB00674)	GGACCCAGCCCTGGGGCCCTG	0.632																																																	0													51.0	57.0	55.0					2																	233398705		2203	4300	6503	SO:0001583	missense	0			X55019	CCDS2494.1, CCDS58754.1	2q37.1	2012-02-11	2012-02-07		ENSG00000135902	ENSG00000135902		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1965	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, delta (muscle)"""	100720	"""cholinergic receptor, nicotinic, delta"""	ACHRD			Standard	NM_000751		Approved		uc002vsw.4	Q07001	OTTHUMG00000133261	ENST00000258385.3:c.1112C>A	2.37:g.233398705C>A	ENSP00000258385:p.Pro371His		A8K661|B4DT92|Q52LH4	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.P371H	ENST00000258385.3	37	c.1112	CCDS2494.1	2	.	.	.	.	.	.	.	.	.	.	C	10.12	1.263377	0.23051	.	.	ENSG00000135902	ENST00000543200;ENST00000258385;ENST00000457943	D;D;D	0.85629	-2.01;-2.01;-2.01	5.81	3.02	0.34903	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.949096	0.08758	N	0.898062	D	0.88683	0.6503	L	0.46157	1.445	0.09310	N	1	D;D;D;D	0.89917	0.999;0.999;1.0;1.0	D;D;D;D	0.72338	0.942;0.972;0.977;0.977	T	0.75722	-0.3218	10	0.35671	T	0.21	.	9.5618	0.39373	0.0:0.7533:0.117:0.1297	.	177;356;371;371	B4E3W4;B4DT92;A8K661;Q07001	.;.;.;ACHD_HUMAN	H	356;371;177	ENSP00000438380:P356H;ENSP00000258385:P371H;ENSP00000391055:P177H	ENSP00000258385:P371H	P	+	2	0	CHRND	233106949	0.004000	0.15560	0.002000	0.10522	0.001000	0.01503	1.717000	0.37991	0.804000	0.34136	-0.844000	0.03045	CCT	CHRND	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,tigrfam_Neur_channel	ENSG00000135902		0.632	CHRND-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRND	HGNC	protein_coding	OTTHUMT00000257038.2	-	0.00	46	0	C			233398705	+1	tier1	-	no_errors	ENST00000258385	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.010	A
CIRH1A	84916	genome.wustl.edu	37	16	69184518	69184518	+	Missense_Mutation	SNP	A	A	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr16:69184518A>C	ENST00000314423.7	+	7	994	c.817A>C	c.(817-819)Agt>Cgt	p.S273R	CIRH1A_ENST00000352319.4_Missense_Mutation_p.S273R|CIRH1A_ENST00000563094.1_Missense_Mutation_p.S273R|CIRH1A_ENST00000569615.2_3'UTR			Q969X6	CIR1A_HUMAN	cirrhosis, autosomal recessive 1A (cirhin)	273					maturation of SSU-rRNA (GO:0030490)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|t-UTP complex (GO:0034455)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(4)|prostate(1)|urinary_tract(1)	16				OV - Ovarian serous cystadenocarcinoma(108;0.125)		ATCTAACAGCAGTGAGAAGCA	0.537											OREG0023906	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Melanoma(69;1156 1278 4951 8715 52012)												0													136.0	122.0	127.0					16																	69184518		2198	4300	6498	SO:0001583	missense	0			AB075868	CCDS10872.1	16q22	2014-04-07			ENSG00000141076	ENSG00000141076		"""WD repeat domain containing"""	1983	protein-coding gene	gene with protein product	"""UTP4, small subunit (SSU) processome component, homolog (yeast)"""	607456				10820129, 20385600	Standard	NM_032830		Approved	NAIC, FLJ14728, KIAA1988, TEX292, CIRHIN, UTP4	uc002ews.4	Q969X6	OTTHUMG00000137570	ENST00000314423.7:c.817A>C	16.37:g.69184518A>C	ENSP00000327179:p.Ser273Arg	1112	Q8NCD9|Q8TF14|Q96SP0|Q96SR9|Q96SZ9|Q96T13|Q9BWK6	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_Quinonprotein_ADH-like_supfam,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.S273R	ENST00000314423.7	37	c.817	CCDS10872.1	16	.	.	.	.	.	.	.	.	.	.	A	9.107	1.005541	0.19199	.	.	ENSG00000141076	ENST00000314423;ENST00000352319	T;T	0.35605	1.53;1.3	5.86	3.51	0.40186	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	1.478000	0.03077	N	0.157959	T	0.26011	0.0634	L	0.33189	0.99	0.25198	N	0.990073	P;B;B	0.37688	0.605;0.017;0.004	B;B;B	0.33960	0.173;0.02;0.006	T	0.21827	-1.0234	10	0.27082	T	0.32	.	2.646	0.04984	0.5741:0.1248:0.0739:0.2272	.	273;273;273	Q969X6-2;Q969X6;Q969X6-3	.;CIR1A_HUMAN;.	R	273	ENSP00000327179:S273R;ENSP00000339164:S273R	ENSP00000327179:S273R	S	+	1	0	CIRH1A	67742019	0.005000	0.15991	0.801000	0.32222	0.869000	0.49853	0.169000	0.16641	1.052000	0.40392	0.416000	0.27883	AGT	CIRH1A	-	superfamily_WD40_repeat_dom,superfamily_Quinonprotein_ADH-like_supfam,pfscan_WD40_repeat_dom	ENSG00000141076		0.537	CIRH1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CIRH1A	HGNC	protein_coding	OTTHUMT00000268950.2	-	0.00	46	0	A	NM_032830		69184518	+1	tier1	-	no_errors	ENST00000314423	ensembl	human	known	74_37	missense	7.69	48	4	SNP	0.204	C
CLIC4	25932	genome.wustl.edu	37	1	25167367	25167367	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr1:25167367G>T	ENST00000374379.4	+	6	898	c.701G>T	c.(700-702)tGt>tTt	p.C234F		NM_013943.2	NP_039234.1	Q9Y696	CLIC4_HUMAN	chloride intracellular channel 4	234	GST C-terminal.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cell differentiation (GO:0030154)|cellular response to calcium ion (GO:0071277)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|endothelial cell morphogenesis (GO:0001886)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|fertilization (GO:0009566)|keratinocyte differentiation (GO:0030216)|multicellular organism growth (GO:0035264)|negative regulation of cell migration (GO:0030336)|regulation of cytoskeleton organization (GO:0051493)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|vacuolar acidification (GO:0007035)	actin cytoskeleton (GO:0015629)|apical part of cell (GO:0045177)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|microvillus (GO:0005902)|midbody (GO:0030496)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			large_intestine(3)|lung(2)|skin(1)	6		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000778)|all_lung(284;0.00106)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0479)|OV - Ovarian serous cystadenocarcinoma(117;1.06e-24)|Colorectal(126;1.03e-07)|COAD - Colon adenocarcinoma(152;4.93e-06)|STAD - Stomach adenocarcinoma(196;0.000418)|GBM - Glioblastoma multiforme(114;0.000451)|BRCA - Breast invasive adenocarcinoma(304;0.00215)|KIRC - Kidney renal clear cell carcinoma(1967;0.00216)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.18)		ACCAATACCTGTCCCAGTGAT	0.403																																																	0													131.0	121.0	124.0					1																	25167367		2203	4300	6503	SO:0001583	missense	0			AF097330	CCDS256.1	1p	2012-09-26			ENSG00000169504	ENSG00000169504		"""Ion channels / Chloride channels : Intracellular"""	13518	protein-coding gene	gene with protein product		606536				9139710, 10070163	Standard	NM_013943		Approved	DKFZP566G223, CLIC4L, P64H1, H1, huH1, p64H1	uc001bjo.2	Q9Y696	OTTHUMG00000003327	ENST00000374379.4:c.701G>T	1.37:g.25167367G>T	ENSP00000363500:p.Cys234Phe		Q9UFW9|Q9UQJ6	Missense_Mutation	SNP	superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold,prints_Int_Cl_channel,tigrfam_Int_Cl_channel	p.C234F	ENST00000374379.4	37	c.701	CCDS256.1	1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.777240	0.90195	.	.	ENSG00000169504	ENST00000374379	D	0.94232	-3.38	5.86	5.86	0.93980	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);	0.042342	0.85682	D	0.000000	D	0.97879	0.9303	H	0.94925	3.6	0.53688	D	0.999974	P;D	0.89917	0.685;1.0	B;D	0.87578	0.383;0.998	D	0.98156	1.0444	10	0.66056	D	0.02	-7.9205	20.1931	0.98233	0.0:0.0:1.0:0.0	.	214;234	B3KTR3;Q9Y696	.;CLIC4_HUMAN	F	234	ENSP00000363500:C234F	ENSP00000363500:C234F	C	+	2	0	CLIC4	25039954	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	9.869000	0.99810	2.771000	0.95319	0.563000	0.77884	TGT	CLIC4	-	superfamily_Glutathione-S-Trfase_C-like,tigrfam_Int_Cl_channel	ENSG00000169504		0.403	CLIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLIC4	HGNC	protein_coding	OTTHUMT00000009332.1	-	0.00	40	0	G	NM_013943		25167367	+1	tier1	-	no_errors	ENST00000374379	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	T
CMAHP	8418	genome.wustl.edu	37	6	25137894	25137894	+	RNA	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr6:25137894G>T	ENST00000377989.4	-	0	677							Q9Y471	CMAH_HUMAN	cytidine monophospho-N-acetylneuraminic acid hydroxylase, pseudogene						CMP-N-acetylneuraminate metabolic process (GO:0046381)	cytoplasm (GO:0005737)	2 iron, 2 sulfur cluster binding (GO:0051537)|oxidoreductase activity (GO:0016491)			NS(1)	1						CCTCCTTGGTGCTTGCACATA	0.428																																																	0																																												0					6p23-p22	2011-04-28	2011-04-28	2011-04-28	ENSG00000168405	ENSG00000168405			2098	pseudogene	pseudogene		603209	"""cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMP-N-acetylneuraminate monooxygenase)(pseudogene)"""	CMAH		7608218, 9624188	Standard	NR_002174		Approved		uc003ner.4	Q9Y471	OTTHUMG00000016099		6.37:g.25137894G>T			O95250|Q5TD41|Q5TD42|Q5TD43|Q5TD44|Q68DC3|Q9UEE7	RNA	SNP	-	NULL	ENST00000377989.4	37	NULL		6																																																																																			CMAHP	-	-	ENSG00000168405		0.428	CMAHP-002	KNOWN	basic	processed_transcript	CMAHP	HGNC	pseudogene	OTTHUMT00000043292.2	-	0.00	34	0	G	NR_002174		25137894	-1	tier1	-	no_errors	ENST00000377989	ensembl	human	known	74_37	rna	7.55	49	4	SNP	1.000	T
CNOT1	23019	genome.wustl.edu	37	16	58577315	58577316	+	Intron	INS	-	-	A	rs192650861|rs74558612|rs201890659|rs5817153	byFrequency	TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr16:58577315_58577316insA	ENST00000317147.5	-	31	4767				CNOT1_ENST00000441024.2_Frame_Shift_Ins_p.L1544fs|CNOT1_ENST00000245138.4_Intron|CNOT1_ENST00000569240.1_Intron	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1						gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		gaatataacagaaaaaaaaaaa	0.277																																																	0																																										SO:0001627	intron_variant	0			AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.4434+194->T	16.37:g.58577326_58577326dupA			Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Frame_Shift_Ins	INS	superfamily_ARM-type_fold	p.L1543fs	ENST00000317147.5	37	c.4630_4629	CCDS10799.1	16																																																																																			CNOT1	-	NULL	ENSG00000125107		0.277	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNOT1	HGNC	protein_coding	OTTHUMT00000257385.3		0.00	47	0	-	NM_016284		58577316	-1	tier1		no_errors	ENST00000441024	ensembl	human	known	74_37	frame_shift_ins	12.00	44	6	INS	0.004:0.000	A
CNOT1	23019	genome.wustl.edu	37	16	58580275	58580275	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr16:58580275G>T	ENST00000317147.5	-	29	4288	c.3956C>A	c.(3955-3957)cCa>cAa	p.P1319Q	CNOT1_ENST00000441024.2_Missense_Mutation_p.P1319Q|SNORA46_ENST00000384762.1_RNA|CNOT1_ENST00000245138.4_Missense_Mutation_p.P170Q|CNOT1_ENST00000569240.1_Missense_Mutation_p.P1314Q	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	1319	Interaction with CNOT6, CNOT6L, CNOT7 and CNOT8.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		ATCTTTCTTTGGAGCAGAGAG	0.428																																																	0													159.0	141.0	147.0					16																	58580275		2198	4300	6498	SO:0001583	missense	0			AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.3956C>A	16.37:g.58580275G>T	ENSP00000320949:p.Pro1319Gln		Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	pfam_CCR4-Not_Not1_C,superfamily_ARM-type_fold	p.P1319Q	ENST00000317147.5	37	c.3956	CCDS10799.1	16	.	.	.	.	.	.	.	.	.	.	G	33	5.208484	0.95069	.	.	ENSG00000125107	ENST00000317147;ENST00000245138;ENST00000394200;ENST00000441024	T;T	0.48201	0.83;0.82	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.67813	0.2933	M	0.76574	2.34	0.80722	D	1	D;D;D;D	0.76494	0.981;0.999;0.987;0.996	D;D;P;P	0.83275	0.932;0.996;0.67;0.906	T	0.62534	-0.6834	10	0.13470	T	0.59	.	19.1572	0.93516	0.0:0.0:1.0:0.0	.	170;1319;1319;1314	B5MDN3;A5YKK6-4;A5YKK6;A5YKK6-2	.;.;CNOT1_HUMAN;.	Q	1319;170;1314;1319	ENSP00000320949:P1319Q;ENSP00000413113:P1319Q	ENSP00000245138:P170Q	P	-	2	0	CNOT1	57137776	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.526000	0.85167	0.650000	0.86243	CCA	CNOT1	-	NULL	ENSG00000125107		0.428	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNOT1	HGNC	protein_coding	OTTHUMT00000257385.3	-	0.00	60	0	G	NM_016284		58580275	-1	tier1	-	no_errors	ENST00000317147	ensembl	human	known	74_37	missense	5.13	74	4	SNP	1.000	T
CNPY1	285888	genome.wustl.edu	37	7	155301589	155301589	+	Splice_Site	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr7:155301589C>A	ENST00000321736.5	-	2	306	c.144G>T	c.(142-144)gcG>gcT	p.A48A	CNPY1_ENST00000406197.1_Splice_Site_p.A48A|AC008060.5_ENST00000415333.1_RNA	NM_001103176.1	NP_001096646.1	Q3B7I2	CNPY1_HUMAN	canopy FGF signaling regulator 1	48										breast(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)	8	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)		GAGAGCTTACCGCAAATTTCA	0.348																																																	0													65.0	62.0	63.0					7																	155301589		1808	4072	5880	SO:0001630	splice_region_variant	0				CCDS43684.1	7q36.3	2014-02-12	2013-07-23		ENSG00000146910	ENSG00000146910			27786	protein-coding gene	gene with protein product		612493	"""canopy 1 homolog (zebrafish)"""			16488878	Standard	NM_001103176		Approved		uc003wmc.1	Q3B7I2	OTTHUMG00000151353	ENST00000321736.5:c.144+1G>T	7.37:g.155301589C>A			A6NGX3	Silent	SNP	pfam_DUF3456	p.A48	ENST00000321736.5	37	c.144	CCDS43684.1	7																																																																																			CNPY1	-	pfam_DUF3456	ENSG00000146910		0.348	CNPY1-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	CNPY1	HGNC	protein_coding	OTTHUMT00000322335.1	-	0.00	36	0	C	XM_001129537	Silent	155301589	-1	tier1	-	no_errors	ENST00000321736	ensembl	human	putative	74_37	silent	7.55	49	4	SNP	1.000	A
CPO	130749	genome.wustl.edu	37	2	207833984	207833984	+	Missense_Mutation	SNP	T	T	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr2:207833984T>C	ENST00000272852.3	+	9	995	c.949T>C	c.(949-951)Tat>Cat	p.Y317H		NM_173077.2	NP_775100.1	Q8IVL8	CBPO_HUMAN	carboxypeptidase O	317						extracellular region (GO:0005576)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	14				LUSC - Lung squamous cell carcinoma(261;0.0744)|Epithelial(149;0.0807)|Lung(261;0.142)		CAGTGGAACATATGGGTTTGT	0.512																																																	0													144.0	127.0	132.0					2																	207833984		2203	4300	6503	SO:0001583	missense	0				CCDS2372.1	2q34	2012-02-10			ENSG00000144410	ENSG00000144410			21011	protein-coding gene	gene with protein product	"""metallocarboxypeptidase O"", ""metallocarboxypeptidase C"""	609563				11836249	Standard	NM_173077		Approved		uc002vby.2	Q8IVL8	OTTHUMG00000088987	ENST00000272852.3:c.949T>C	2.37:g.207833984T>C	ENSP00000272852:p.Tyr317His		Q2M277|Q7RTW7	Missense_Mutation	SNP	pfam_Peptidase_M14,smart_Peptidase_M14,prints_Peptidase_M14	p.Y317H	ENST00000272852.3	37	c.949	CCDS2372.1	2	.	.	.	.	.	.	.	.	.	.	T	4.473	0.087580	0.08583	.	.	ENSG00000144410	ENST00000272852	T	0.32753	1.44	5.13	-6.49	0.01890	Peptidase M14, carboxypeptidase A (2);	0.569588	0.19535	N	0.111936	T	0.19208	0.0461	L	0.34521	1.04	0.09310	N	1	B	0.06786	0.001	B	0.12156	0.007	T	0.05084	-1.0907	10	0.52906	T	0.07	.	12.8006	0.57584	0.0:0.6688:0.1202:0.211	.	317	Q8IVL8	CBPO_HUMAN	H	317	ENSP00000272852:Y317H	ENSP00000272852:Y317H	Y	+	1	0	CPO	207542229	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.363000	0.07593	-1.508000	0.01800	-1.144000	0.01866	TAT	CPO	-	pfam_Peptidase_M14,smart_Peptidase_M14	ENSG00000144410		0.512	CPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPO	HGNC	protein_coding	OTTHUMT00000202040.2	-	0.00	63	0	T	NM_173077		207833984	+1	tier1	-	no_errors	ENST00000272852	ensembl	human	known	74_37	missense	28.33	43	17	SNP	0.000	C
COL4A4	1286	genome.wustl.edu	37	2	227985836	227985836	+	Missense_Mutation	SNP	C	C	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr2:227985836C>G	ENST00000396625.3	-	5	428	c.221G>C	c.(220-222)gGt>gCt	p.G74A	COL4A4_ENST00000329662.7_Missense_Mutation_p.G74A	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	74	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		TCCAATTGGACCCTGTGGCCC	0.532																																																	0													46.0	45.0	45.0					2																	227985836		1820	4074	5894	SO:0001583	missense	0				CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.221G>C	2.37:g.227985836C>G	ENSP00000379866:p.Gly74Ala		A8MTZ1|Q53RW9|Q53S42|Q53WR1	Missense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.G74A	ENST00000396625.3	37	c.221	CCDS42828.1	2	.	.	.	.	.	.	.	.	.	.	C	23.1	4.380784	0.82792	.	.	ENSG00000081052	ENST00000396625;ENST00000329662	D;D	0.99329	-5.75;-5.75	5.24	5.24	0.73138	.	.	.	.	.	D	0.99551	0.9839	M	0.91663	3.23	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.98216	1.0475	9	0.87932	D	0	.	18.8187	0.92088	0.0:1.0:0.0:0.0	.	74	P53420	CO4A4_HUMAN	A	74	ENSP00000379866:G74A;ENSP00000328553:G74A	ENSP00000328553:G74A	G	-	2	0	COL4A4	227694080	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	6.055000	0.71103	2.451000	0.82905	0.455000	0.32223	GGT	COL4A4	-	pfam_Collagen	ENSG00000081052		0.532	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL4A4	HGNC	protein_coding	OTTHUMT00000313770.1		0.00	8	0	C	NM_000092		227985836	-1			no_errors	ENST00000396625	ensembl	human	known	74_37	missense	36.84	12	7	SNP	1.000	G
CROCCP3	114819	genome.wustl.edu	37	1	16803494	16803494	+	RNA	SNP	C	C	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr1:16803494C>G	ENST00000263511.4	-	0	2262					NR_023386.1		Q8IVE0	CROL2_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 3						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											TGGCGCGGCTCAGCGCCTCCC	0.652																																																	0																																												0			AB067509		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000080947	ENSG00000080947			29405	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 2"""	CROCCL2		11572484	Standard	NR_023386		Approved	KIAA1922	uc001ayt.2	Q8IVE0	OTTHUMG00000037885		1.37:g.16803494C>G			Q96PW6	RNA	SNP	-	NULL	ENST00000263511.4	37	NULL		1																																																																																			CROCCP3	-	-	ENSG00000080947		0.652	CROCCP3-002	KNOWN	basic	processed_transcript	CROCCP3	HGNC	pseudogene	OTTHUMT00000458172.1	-	0.00	26	0	C	XM_057040		16803494	-1	tier1	-	no_errors	ENST00000263511	ensembl	human	known	74_37	rna	17.39	38	8	SNP	0.997	G
CSF2RB	1439	genome.wustl.edu	37	22	37325448	37325448	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr22:37325448G>T	ENST00000403662.3	+	5	618	c.396G>T	c.(394-396)caG>caT	p.Q132H	CSF2RB_ENST00000406230.1_Missense_Mutation_p.Q132H|CSF2RB_ENST00000262825.5_Missense_Mutation_p.Q132H|CSF2RB_ENST00000536485.1_Missense_Mutation_p.Q73H			P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)	132					cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)|interleukin-5-mediated signaling pathway (GO:0038043)|respiratory gaseous exchange (GO:0007585)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	granulocyte macrophage colony-stimulating factor receptor complex (GO:0030526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(3)|pancreas(1)|skin(5)|upper_aerodigestive_tract(2)	42					Sargramostim(DB00020)	CTCCAGTCCAGCCTCCTGAGC	0.652																																																	0													100.0	99.0	100.0					22																	37325448		2203	4300	6503	SO:0001583	missense	0			M59941	CCDS13936.1	22q12.3	2014-09-09			ENSG00000100368	ENSG00000100368		"""CD molecules"", ""Fibronectin type III domain containing"""	2436	protein-coding gene	gene with protein product		138981		IL3RB		1833064, 1424804	Standard	NM_000395		Approved	IL5RB, CD131	uc003aqa.4	P32927	OTTHUMG00000150546	ENST00000403662.3:c.396G>T	22.37:g.37325448G>T	ENSP00000384053:p.Gln132His		Q5JZI1|Q6ICE0	Missense_Mutation	SNP	pirsf_IL3_rcpt_beta,pfam_Fibronectin_type3,pfam_IL-6_rcpt_alpha-bd,pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.Q132H	ENST00000403662.3	37	c.396	CCDS13936.1	22	.	.	.	.	.	.	.	.	.	.	G	11.90	1.776683	0.31411	.	.	ENSG00000100368	ENST00000403662;ENST00000539104;ENST00000262825;ENST00000406230;ENST00000421539;ENST00000536485	T;T;T;T;T	0.69561	-0.41;-0.41;-0.41;-0.41;-0.41	5.16	5.16	0.70880	Fibronectin, type III (1);	0.000000	0.43110	D	0.000602	T	0.65460	0.2693	M	0.62016	1.91	0.38185	D	0.939747	P;P	0.36171	0.456;0.541	B;B	0.35278	0.199;0.115	T	0.73363	-0.4006	10	0.72032	D	0.01	-17.2342	15.9195	0.79552	0.0:0.0:1.0:0.0	.	132;132	P32927-2;P32927	.;IL3RB_HUMAN	H	132;132;132;132;52;73	ENSP00000384053:Q132H;ENSP00000262825:Q132H;ENSP00000385271:Q132H;ENSP00000393585:Q52H;ENSP00000440003:Q73H	ENSP00000262825:Q132H	Q	+	3	2	CSF2RB	35655394	1.000000	0.71417	0.999000	0.59377	0.155000	0.21991	3.737000	0.55060	2.543000	0.85770	0.655000	0.94253	CAG	CSF2RB	-	pirsf_IL3_rcpt_beta,superfamily_Fibronectin_type3	ENSG00000100368		0.652	CSF2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSF2RB	HGNC	protein_coding	OTTHUMT00000318854.1	-	0.00	31	0	G	NM_000395		37325448	+1	tier1	-	no_errors	ENST00000262825	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	T
CUL7	9820	genome.wustl.edu	37	6	43014654	43014654	+	Silent	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr6:43014654G>A	ENST00000265348.3	-	10	2446	c.2361C>T	c.(2359-2361)cgC>cgT	p.R787R	CUL7_ENST00000535468.1_Silent_p.R871R|CUL7_ENST00000478630.1_5'UTR			Q14999	CUL7_HUMAN	cullin 7	787					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epithelial to mesenchymal transition (GO:0001837)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|mitotic cytokinesis (GO:0000281)|placenta development (GO:0001890)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	3M complex (GO:1990393)|anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|Cul7-RING ubiquitin ligase complex (GO:0031467)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(8)|liver(1)|lung(11)|ovary(3)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	49			all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			TGATGAGTTTGCGGTAGAGGT	0.562																																																	0													104.0	88.0	94.0					6																	43014654		2203	4300	6503	SO:0001819	synonymous_variant	0			BC033647	CCDS4881.1, CCDS55003.1	6p21.1	2011-05-24	2004-03-22	2004-03-22	ENSG00000044090	ENSG00000044090			21024	protein-coding gene	gene with protein product		609577	"""KIAA0076"""	KIAA0076		12481031, 12904573	Standard	NM_014780		Approved	dJ20C7.5	uc011dvb.2	Q14999	OTTHUMG00000014718	ENST00000265348.3:c.2361C>T	6.37:g.43014654G>A			B4DYZ0|F5H0L1|Q5T654	Silent	SNP	pfam_Cullin_N,pfam_CPH_domain,pfam_APC_su10/DOC_dom,superfamily_Galactose-bd-like,superfamily_Cullin_homology,superfamily_ARM-type_fold,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.R871	ENST00000265348.3	37	c.2613	CCDS4881.1	6																																																																																			CUL7	-	superfamily_Galactose-bd-like	ENSG00000044090		0.562	CUL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUL7	HGNC	protein_coding	OTTHUMT00000040575.1	-	0.00	48	0	G	NM_014780		43014654	-1	tier1	-	no_errors	ENST00000535468	ensembl	human	known	74_37	silent	8.45	65	6	SNP	1.000	A
CWC15	51503	genome.wustl.edu	37	11	94696474	94696475	+	5'UTR	INS	-	-	A	rs58293261		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr11:94696474_94696475insA	ENST00000545018.1	-	0	886_887				CWC15_ENST00000279839.6_3'UTR			Q9P013	CWC15_HUMAN	CWC15 spliceosome-associated protein						mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	RNA binding (GO:0003723)						Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				CAGGGGAAAAGAAAAAAAAAAC	0.307																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AF161497	CCDS73369.1	11q21	2014-07-03	2014-07-03			ENSG00000150316			26939	protein-coding gene	gene with protein product			"""CWC15 homolog (S. cerevisiae)"", ""CWC15 spliceosome-associated protein homolog (S. cerevisiae)"""			10873569, 11884590	Standard	NM_016403		Approved	C11orf5, HSPC148, Cwf15, AD002	uc001pfd.4	Q9P013		ENST00000545018.1:c.-689->T	11.37:g.94696484_94696484dupA			B2RC17|Q05BV9|Q05DM1|Q9UI29	RNA	INS	-	NULL	ENST00000545018.1	37	NULL		11																																																																																			CWC15	-	-	ENSG00000150316		0.307	CWC15-001	KNOWN	basic	processed_transcript	CWC15	HGNC	protein_coding	OTTHUMT00000396686.2		0.00	11	0	-	NM_016403		94696475	-1	tier1		no_errors	ENST00000545018	ensembl	human	known	74_37	rna	40.91	13	9	INS	0.000:0.000	A
DAB1	1600	genome.wustl.edu	37	1	57538009	57538009	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr1:57538009C>T	ENST00000371231.1	-	4	419	c.385G>A	c.(385-387)Gtt>Att	p.V129I	DAB1_ENST00000371234.4_Missense_Mutation_p.V129I|DAB1_ENST00000485760.1_5'UTR|DAB1_ENST00000414851.2_Missense_Mutation_p.V129I|DAB1_ENST00000439789.2_Intron|DAB1_ENST00000371236.2_Missense_Mutation_p.V129I|DAB1_ENST00000420954.2_Missense_Mutation_p.V129I|DAB1_ENST00000371230.1_Missense_Mutation_p.V129I			O75553	DAB1_HUMAN	Dab, reelin signal transducer, homolog 1 (Drosophila)	129	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				adult walking behavior (GO:0007628)|cell-cell adhesion involved in neuronal-glial interactions involved in cerebral cortex radial glia guided migration (GO:0021813)|cerebellum structural organization (GO:0021589)|dendrite development (GO:0016358)|Golgi localization (GO:0051645)|lateral motor column neuron migration (GO:0097477)|midgut development (GO:0007494)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell adhesion (GO:0007162)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein kinase activity (GO:0045860)|radial glia guided migration of Purkinje cell (GO:0021942)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|ventral spinal cord development (GO:0021517)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)				central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(5)	64						TTCCCACAAACATATCCAAAG	0.458																																																	0													134.0	128.0	130.0					1																	57538009		2203	4300	6503	SO:0001583	missense	0			BC067445	CCDS607.1	1p32-p31	2013-10-03	2013-10-03		ENSG00000173406	ENSG00000173406			2661	protein-coding gene	gene with protein product		603448	"""disabled (Drosophila) homolog 1"", ""disabled homolog 1 (Drosophila)"", ""Dab, reelin signal transducer, homolog 1 (Drosophila)"", ""Dab reelin signal transducer 1"""			9790777	Standard	NM_021080		Approved		uc001cys.1	O75553	OTTHUMG00000008391	ENST00000371231.1:c.385G>A	1.37:g.57538009C>T	ENSP00000360275:p.Val129Ile		A4FU90|B3KTG3|Q4LE59|Q5T6M6|Q5T6M9|Q5T835|Q5T836|Q5T837|Q6NWS9|Q6NWT0|Q6NWT1|Q9NYA8	Missense_Mutation	SNP	pfam_PTB/PI_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom	p.V129I	ENST00000371231.1	37	c.385		1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.131288	0.77549	.	.	ENSG00000173406	ENST00000371236;ENST00000371233;ENST00000371234;ENST00000420954;ENST00000414851;ENST00000371231;ENST00000332102;ENST00000371230	T;T;T;T;T;T;T	0.56611	0.45;0.45;0.45;0.45;0.45;0.45;0.45	5.84	5.84	0.93424	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.054356	0.64402	D	0.000001	T	0.57666	0.2069	N	0.20986	0.625	0.80722	D	1	D;B;B;B	0.76494	0.999;0.01;0.195;0.002	D;B;P;B	0.79784	0.993;0.025;0.451;0.008	T	0.45220	-0.9276	10	0.05959	T	0.93	-9.5662	20.1466	0.98079	0.0:1.0:0.0:0.0	.	129;129;129;129	O75553-4;O75553;O75553-6;O75553-5	.;DAB1_HUMAN;.;.	I	129	ENSP00000360280:V129I;ENSP00000360278:V129I;ENSP00000395296:V129I;ENSP00000387581:V129I;ENSP00000360275:V129I;ENSP00000329120:V129I;ENSP00000360274:V129I	ENSP00000329120:V129I	V	-	1	0	DAB1	57310597	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.765000	0.68834	2.779000	0.95612	0.591000	0.81541	GTT	DAB1	-	pfam_PTB/PI_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom	ENSG00000173406		0.458	DAB1-010	KNOWN	basic	protein_coding	DAB1	HGNC	protein_coding	OTTHUMT00000027962.1	-	0.00	65	0	C	NM_021080		57538009	-1	tier1	-	no_errors	ENST00000371231	ensembl	human	known	74_37	missense	9.90	91	10	SNP	1.000	T
SLC25A32	81034	genome.wustl.edu	37	8	104427572	104427572	+	5'Flank	SNP	T	T	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr8:104427572T>C	ENST00000297578.4	-	0	0				DCAF13_ENST00000519682.1_5'Flank|DCAF13_ENST00000297579.5_Silent_p.T118T|SLC25A32_ENST00000543107.1_5'Flank|DCAF13_ENST00000521971.1_5'Flank|DCAF13_ENST00000521716.1_5'Flank	NM_030780.3	NP_110407.2	Q9H2D1	MFTC_HUMAN	solute carrier family 25 (mitochondrial folate carrier), member 32						folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|mitochondrial transport (GO:0006839)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	folic acid transporter activity (GO:0008517)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	9			OV - Ovarian serous cystadenocarcinoma(57;2.79e-06)|STAD - Stomach adenocarcinoma(118;0.197)		Folic Acid(DB00158)	GTCACGTGACTGGAAGTAGTC	0.637																																																	0													38.0	46.0	43.0					8																	104427572		2199	4297	6496	SO:0001631	upstream_gene_variant	0			AF283645	CCDS6300.1	8q22.3	2013-05-22	2013-03-15		ENSG00000164933	ENSG00000164933		"""Solute carriers"""	29683	protein-coding gene	gene with protein product		610815	"""solute carrier family 25, member 32"""			10978331	Standard	NM_030780		Approved	MFTC	uc003yll.4	Q9H2D1	OTTHUMG00000164790		8.37:g.104427572T>C	Exception_encountered		Q96JZ6|Q96SU7	Silent	SNP	pfam_Sof1,pfam_WD40_repeat,pfam_TIF_beta_prop-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T118	ENST00000297578.4	37	c.354	CCDS6300.1	8																																																																																			DCAF13	-	NULL	ENSG00000164934		0.637	SLC25A32-003	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF13	HGNC	protein_coding	OTTHUMT00000380290.2	-	0.00	49	0	T	NM_030780		104427572	+1	tier1	-	no_errors	ENST00000297579	ensembl	human	known	74_37	silent	8.75	73	7	SNP	0.984	C
DCAF16	54876	genome.wustl.edu	37	4	17805701	17805701	+	Missense_Mutation	SNP	T	T	C	rs184417488		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr4:17805701T>C	ENST00000382247.1	-	3	1124	c.64A>G	c.(64-66)Att>Gtt	p.I22V	DCAF16_ENST00000536863.1_Missense_Mutation_p.I22V|DCAF16_ENST00000507768.1_5'Flank	NM_017741.3	NP_060211.3	Q9NXF7	DCA16_HUMAN	DDB1 and CUL4 associated factor 16	22					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)				cervix(1)|endometrium(1)|lung(2)|ovary(1)	5						AGGTAACTAATATTTTCTTCT	0.433																																																	0													53.0	56.0	55.0					4																	17805701		2203	4300	6503	SO:0001583	missense	0			AK000287	CCDS3423.1	4p15.32	2009-07-17	2009-07-17	2009-07-17	ENSG00000163257	ENSG00000163257		"""DDB1 and CUL4 associated factors"""	25987	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 30"""	C4orf30		12477932	Standard	XM_005248169		Approved	FLJ20280	uc003gpn.3	Q9NXF7	OTTHUMG00000128536	ENST00000382247.1:c.64A>G	4.37:g.17805701T>C	ENSP00000371682:p.Ile22Val		B3KPB7	Missense_Mutation	SNP	NULL	p.I22V	ENST00000382247.1	37	c.64	CCDS3423.1	4	.	.	.	.	.	.	.	.	.	.	T	0.026	-1.374173	0.01214	.	.	ENSG00000163257	ENST00000382247;ENST00000536863	T;T	0.28454	1.61;1.61	3.78	-2.72	0.05968	.	.	.	.	.	T	0.12050	0.0293	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.23476	-1.0187	9	0.87932	D	0	-0.9114	0.8676	0.01207	0.1873:0.1843:0.1598:0.4686	.	22	Q9NXF7	DCA16_HUMAN	V	22	ENSP00000371682:I22V;ENSP00000445736:I22V	ENSP00000371682:I22V	I	-	1	0	DCAF16	17414799	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-0.593000	0.05740	-0.530000	0.06349	0.459000	0.35465	ATT	DCAF16	-	NULL	ENSG00000163257		0.433	DCAF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF16	HGNC	protein_coding	OTTHUMT00000250371.1	-	0.00	27	0	T	NM_017741		17805701	-1	tier1	-	no_errors	ENST00000382247	ensembl	human	known	74_37	missense	20.75	42	11	SNP	0.000	C
DCAF4L1	285429	genome.wustl.edu	37	4	41984513	41984513	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr4:41984513C>T	ENST00000333141.5	+	1	801	c.704C>T	c.(703-705)aCg>aTg	p.T235M		NM_001029955.3	NP_001025126.2	Q3SXM0	DC4L1_HUMAN	DDB1 and CUL4 associated factor 4-like 1	235										breast(1)|endometrium(5)|kidney(6)|large_intestine(11)|lung(12)|prostate(1)|skin(1)	37						TTTGCTAGTACGGCTCCTTTG	0.562																																																	0													157.0	152.0	154.0					4																	41984513		2203	4300	6503	SO:0001583	missense	0			BC035027	CCDS33978.1	4p13	2013-01-09	2009-07-17	2009-07-17		ENSG00000182308		"""WD repeat domain containing"""	27723	protein-coding gene	gene with protein product			"""WD repeat domain 21B"""	WDR21B			Standard	NM_001029955		Approved		uc003gwk.2	Q3SXM0		ENST00000333141.5:c.704C>T	4.37:g.41984513C>T	ENSP00000327796:p.Thr235Met		B3KVI3|Q3ZCW8|Q499Y5|Q9UFI0	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T235M	ENST00000333141.5	37	c.704	CCDS33978.1	4	.	.	.	.	.	.	.	.	.	.	C	2.953	-0.216376	0.06101	.	.	ENSG00000182308	ENST00000333141	T	0.19806	2.12	0.688	-1.02	0.10135	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	1.054160	0.07227	N	0.861930	T	0.07188	0.0182	N	0.03324	-0.35	0.09310	N	1	B	0.21071	0.051	B	0.04013	0.001	T	0.34601	-0.9822	10	0.20519	T	0.43	.	2.3984	0.04395	0.3222:0.354:0.3237:0.0	.	235	Q3SXM0	DC4L1_HUMAN	M	235	ENSP00000327796:T235M	ENSP00000327796:T235M	T	+	2	0	DCAF4L1	41679270	0.979000	0.34478	0.020000	0.16555	0.031000	0.12232	1.332000	0.33805	-0.381000	0.07882	0.313000	0.20887	ACG	DCAF4L1	-	superfamily_WD40_repeat_dom	ENSG00000182308		0.562	DCAF4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF4L1	HGNC	protein_coding	OTTHUMT00000360958.1		0.00	34	0	C	NM_001029955		41984513	+1			no_errors	ENST00000333141	ensembl	human	known	74_37	missense	5.56	34	2	SNP	0.151	T
DCDC1	341019	genome.wustl.edu	37	11	31329280	31329280	+	Missense_Mutation	SNP	G	G	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr11:31329280G>C	ENST00000452803.1	-	4	541	c.340C>G	c.(340-342)Cta>Gta	p.L114V	DCDC1_ENST00000597505.1_Missense_Mutation_p.L114V|RP1-296L11.1_ENST00000528872.1_RNA	NM_181807.3	NP_861523.2	P59894	DCDC1_HUMAN	doublecortin domain containing 1	114					intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					TAGCTATCTAGGTCTGATATT	0.428																																																	0													318.0	293.0	301.0					11																	31329280		2202	4299	6501	SO:0001583	missense	0			AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000452803.1:c.340C>G	11.37:g.31329280G>C	ENSP00000389792:p.Leu114Val		A6PVL6|B7WNX6|Q6ZU04	Missense_Mutation	SNP	pfscan_Doublecortin_dom	p.L114V	ENST00000452803.1	37	c.340	CCDS7872.1	11	.	.	.	.	.	.	.	.	.	.	G	11.12	1.545294	0.27652	.	.	ENSG00000188682	ENST00000452803	T	0.32988	1.43	5.7	5.7	0.88788	.	0.975889	0.08353	N	0.958975	T	0.18257	0.0438	N	0.14661	0.345	0.09310	N	0.999999	B	0.19583	0.037	B	0.18561	0.022	T	0.15867	-1.0422	10	0.05833	T	0.94	.	11.2459	0.48996	0.0:0.2411:0.6305:0.1284	.	114	P59894	DCDC1_HUMAN	V	114	ENSP00000389792:L114V	ENSP00000343496:L114V	L	-	1	2	DCDC1	31285856	0.017000	0.18338	0.945000	0.38365	0.965000	0.64279	0.340000	0.19892	2.683000	0.91414	0.650000	0.86243	CTA	DCDC1	-	NULL	ENSG00000170959		0.428	DCDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCDC1	HGNC	protein_coding	OTTHUMT00000316531.1	-	0.00	35	0	G	NM_181807		31329280	-1	tier1	-	no_errors	ENST00000452803	ensembl	human	known	74_37	missense	15.25	50	9	SNP	0.478	C
DDX18	8886	genome.wustl.edu	37	2	118578865	118578865	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr2:118578865G>T	ENST00000263239.2	+	4	771	c.643G>T	c.(643-645)Gaa>Taa	p.E215*	DDX18_ENST00000474694.1_3'UTR	NM_006773.3	NP_006764.3	Q9NVP1	DDX18_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 18	215	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(4)|large_intestine(3)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						ACCACTTCTGGAAGGCAGGTA	0.318																																																	0													77.0	78.0	78.0					2																	118578865		2203	4299	6502	SO:0001587	stop_gained	0			X98743	CCDS2120.1	2q21.2	2008-02-05	2003-06-13		ENSG00000088205	ENSG00000088205		"""DEAD-boxes"""	2741	protein-coding gene	gene with protein product		606355	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 18 (Myc-regulated)"""			8861962	Standard	NM_006773		Approved	MrDb	uc002tlh.1	Q9NVP1	OTTHUMG00000058521	ENST00000263239.2:c.643G>T	2.37:g.118578865G>T	ENSP00000263239:p.Glu215*		Q6GTZ9|Q6IAU4|Q92732|Q9BQB7	Nonsense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E215*	ENST00000263239.2	37	c.643	CCDS2120.1	2	.	.	.	.	.	.	.	.	.	.	G	38	7.066395	0.98040	.	.	ENSG00000088205	ENST00000263239	.	.	.	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12103	T	0.63	0.0187	17.0203	0.86432	0.0:0.0:1.0:0.0	.	.	.	.	X	215	.	ENSP00000263239:E215X	E	+	1	0	DDX18	118295335	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.070000	0.93974	2.775000	0.95449	0.650000	0.86243	GAA	DDX18	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000088205		0.318	DDX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX18	HGNC	protein_coding	OTTHUMT00000129632.3		0.00	36	0	G	NM_006773		118578865	+1			no_errors	ENST00000263239	ensembl	human	known	74_37	nonsense	7.27	51	4	SNP	1.000	T
DDX27	55661	genome.wustl.edu	37	20	47846772	47846772	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr20:47846772G>T	ENST00000371764.4	+	9	1019	c.1010G>T	c.(1009-1011)cGg>cTg	p.R337L	DDX27_ENST00000484427.1_3'UTR	NM_017895.7	NP_060365.7	Q96GQ7	DDX27_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 27	337	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	45			BRCA - Breast invasive adenocarcinoma(12;0.000899)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			GCAGCTCTTCGGGCAGCGCCT	0.612																																																	0													54.0	49.0	51.0					20																	47846772		2203	4300	6503	SO:0001583	missense	0			AL049766	CCDS13416.1	20q13.13	2010-07-06	2003-06-13		ENSG00000124228	ENSG00000124228		"""DEAD-boxes"""	15837	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 27"""				Standard	NM_017895		Approved	dJ686N3.1, DRS1	uc002xuh.3	Q96GQ7	OTTHUMG00000033072	ENST00000371764.4:c.1010G>T	20.37:g.47846772G>T	ENSP00000360828:p.Arg337Leu		A0AVB6|B7ZLY1|Q5VXM7|Q8WYG4|Q969N7|Q96F57|Q96L97|Q9BWY9|Q9BXF0|Q9H990|Q9NWU3|Q9P0C2|Q9UGD6	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.R337L	ENST00000371764.4	37	c.1010	CCDS13416.1	20	.	.	.	.	.	.	.	.	.	.	G	18.43	3.623297	0.66901	.	.	ENSG00000124228	ENST00000371764	T	0.15372	2.43	4.94	4.94	0.65067	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.40094	0.1103	M	0.64567	1.98	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.24621	-1.0155	10	0.87932	D	0	-19.184	15.6671	0.77238	0.0:0.0:1.0:0.0	.	337	Q96GQ7	DDX27_HUMAN	L	337	ENSP00000360828:R337L	ENSP00000360828:R337L	R	+	2	0	DDX27	47280179	1.000000	0.71417	1.000000	0.80357	0.042000	0.13812	9.631000	0.98424	2.303000	0.77524	0.462000	0.41574	CGG	DDX27	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000124228		0.612	DDX27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX27	HGNC	protein_coding	OTTHUMT00000080485.1		0.00	25	0	G			47846772	+1			no_errors	ENST00000371764	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	T
DGKK	139189	genome.wustl.edu	37	X	50114766	50114766	+	RNA	DEL	T	T	-			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chrX:50114766delT	ENST00000376025.2	-	0	3627							Q5KSL6	DGKK_HUMAN	diacylglycerol kinase, kappa						blood coagulation (GO:0007596)|diacylglycerol metabolic process (GO:0046339)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			central_nervous_system(1)|endometrium(12)|kidney(4)|large_intestine(5)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Ovarian(276;0.236)					CTCAGATAGCTTTTTGAACTC	0.443																																																	0													142.0	127.0	132.0					X																	50114766		1966	4139	6105			0			AB183864	CCDS75980.1	Xp11.22	2006-02-08				ENSG00000274588			32395	protein-coding gene	gene with protein product		300837				16210324	Standard	NM_001013742		Approved		uc010njr.2	Q5KSL6			X.37:g.50114766delT			B2RP91	RNA	DEL	-	NULL	ENST00000376025.2	37	NULL		X																																																																																			DGKK	-	-	ENSG00000204466		0.443	DGKK-001	KNOWN	basic	processed_transcript	DGKK	HGNC	processed_transcript	OTTHUMT00000368187.1		0.00	33	0	T	NM_001013742		50114766	-1	tier1		no_errors	ENST00000376025	ensembl	human	known	74_37	rna	17.78	37	8	DEL	0.865	-
DGKZ	8525	genome.wustl.edu	37	11	46392886	46392886	+	Missense_Mutation	SNP	C	C	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr11:46392886C>G	ENST00000454345.1	+	8	1283	c.1158C>G	c.(1156-1158)ttC>ttG	p.F386L	DGKZ_ENST00000395574.3_Missense_Mutation_p.F164L|DGKZ_ENST00000456247.2_Missense_Mutation_p.F197L|DGKZ_ENST00000527911.1_Missense_Mutation_p.F198L|DGKZ_ENST00000421244.2_Missense_Mutation_p.F198L|DGKZ_ENST00000343674.6_Missense_Mutation_p.F214L|DGKZ_ENST00000318201.8_Missense_Mutation_p.F175L|DGKZ_ENST00000528615.1_5'UTR|DGKZ_ENST00000532868.2_Missense_Mutation_p.F202L|DGKZ_ENST00000543978.1_Intron	NM_001105540.1	NP_001099010.1	Q13574	DGKZ_HUMAN	diacylglycerol kinase, zeta	386					blood coagulation (GO:0007596)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|lipid phosphorylation (GO:0046834)|mitotic G1 DNA damage checkpoint (GO:0031571)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of Ras protein signal transduction (GO:0046580)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|enzyme inhibitor activity (GO:0004857)|lipid kinase activity (GO:0001727)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein C-terminus binding (GO:0008022)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(12)|pancreas(1)|prostate(1)|skin(1)	25				GBM - Glioblastoma multiforme(35;0.0259)|Lung(87;0.141)		AGTTCACCTTCCACAGCAAGG	0.642																																																	0													92.0	92.0	92.0					11																	46392886		2202	4299	6501	SO:0001583	missense	0			U51477	CCDS7918.1, CCDS41640.1, CCDS44579.1, CCDS44580.1, CCDS55757.1, CCDS55758.1, CCDS55759.1, CCDS44579.2	11p11.2	2010-11-24	2010-11-24		ENSG00000149091	ENSG00000149091	2.7.1.107		2857	protein-coding gene	gene with protein product		601441	"""diacylglycerol kinase, zeta 104kDa"""			8626588	Standard	NM_003646		Approved	DAGK5, hDGKzeta, DGK-ZETA, DAGK6	uc001ncn.1	Q13574	OTTHUMG00000166437	ENST00000454345.1:c.1158C>G	11.37:g.46392886C>G	ENSP00000412178:p.Phe386Leu		B7Z2M9|B7Z6M3|E9PPW4|F6UCU9|G3V0F6|J3KNJ6|O00542|Q6ZVG7|Q8IVW9	Missense_Mutation	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.F386L	ENST00000454345.1	37	c.1158	CCDS41640.1	11	.	.	.	.	.	.	.	.	.	.	C	21.7	4.185638	0.78789	.	.	ENSG00000149091	ENST00000343674;ENST00000395574;ENST00000532868;ENST00000527911;ENST00000456247;ENST00000421244;ENST00000318201;ENST00000454345;ENST00000524448	D;D;D;D;D;D;T;D;D	0.92911	-3.13;-3.13;-3.13;-3.13;-3.13;-3.13;2.6;-3.13;-3.13	4.75	2.87	0.33458	Protein kinase C-like, phorbol ester/diacylglycerol binding (2);	0.000000	0.85682	D	0.000000	D	0.94801	0.8321	M	0.80982	2.52	0.80722	D	1	D;D;P;D;D;D;D;D;D	0.71674	0.974;0.998;0.876;0.972;0.972;0.966;0.966;0.972;0.998	P;D;P;D;D;D;P;D;D	0.70227	0.878;0.967;0.561;0.912;0.968;0.911;0.857;0.912;0.967	D	0.93338	0.6707	10	0.66056	D	0.02	.	7.8995	0.29725	0.0:0.6848:0.0:0.3152	.	175;163;141;198;386;197;198;164;214	B7Z2M9;B7Z6M3;B7Z8F6;E9PPW4;Q13574;Q13574-2;G3V0F6;A8MVN1;Q6ZVG7	.;.;.;.;DGKZ_HUMAN;.;.;.;.	L	214;164;163;198;197;198;175;386;82	ENSP00000343065:F214L;ENSP00000378941:F164L;ENSP00000436273:F163L;ENSP00000436291:F198L;ENSP00000395684:F197L;ENSP00000391021:F198L;ENSP00000320340:F175L;ENSP00000412178:F386L;ENSP00000435763:F82L	ENSP00000320340:F175L	F	+	3	2	DGKZ	46349462	0.998000	0.40836	1.000000	0.80357	0.997000	0.91878	0.504000	0.22626	0.538000	0.28769	0.561000	0.74099	TTC	DGKZ	-	pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_Prot_Kinase_C-like_PE/DAG-bd	ENSG00000149091		0.642	DGKZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKZ	HGNC	protein_coding	OTTHUMT00000389772.1	-	0.00	67	0	C	NM_001105540		46392886	+1	tier1	-	no_errors	ENST00000454345	ensembl	human	known	74_37	missense	11.48	107	14	SNP	1.000	G
DIDO1	11083	genome.wustl.edu	37	20	61542195	61542195	+	Missense_Mutation	SNP	G	G	T	rs149450567	byFrequency	TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr20:61542195G>T	ENST00000266070.4	-	3	1095	c.770C>A	c.(769-771)cCg>cAg	p.P257Q	DIDO1_ENST00000395335.2_Missense_Mutation_p.P257Q|DIDO1_ENST00000354665.4_Missense_Mutation_p.P257Q|DIDO1_ENST00000370366.1_Missense_Mutation_p.P257Q|DIDO1_ENST00000266071.5_Missense_Mutation_p.P257Q|DIDO1_ENST00000370371.4_Missense_Mutation_p.P257Q|DIDO1_ENST00000395343.1_Missense_Mutation_p.P257Q|DIDO1_ENST00000395340.1_Missense_Mutation_p.P257Q|DIDO1_ENST00000370368.1_Missense_Mutation_p.P257Q	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	257					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					TTCAGGCTTCGGTCGGCCCAA	0.567																																					Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)												0													155.0	152.0	153.0					20																	61542195		2203	4300	6503	SO:0001583	missense	0			AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.770C>A	20.37:g.61542195G>T	ENSP00000266070:p.Pro257Gln		A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	pfam_TFIIS_cen_dom,pfam_SPOC_C,pfam_Znf_PHD-finger,superfamily_TFIIS_cen_dom,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_TFS2M,pfscan_Znf_PHD-finger	p.P257Q	ENST00000266070.4	37	c.770	CCDS33506.1	20	.	.	.	.	.	.	.	.	.	.	G	5.027	0.190586	0.09547	.	.	ENSG00000101191	ENST00000266070;ENST00000395343;ENST00000395340;ENST00000395335;ENST00000370371;ENST00000370368;ENST00000354665;ENST00000370366;ENST00000266071	T;T;T;T;T;T;T;T;T	0.18657	3.06;3.06;2.69;2.69;2.2;2.2;2.2;2.22;2.22	5.31	1.89	0.25635	Zinc finger, FYVE/PHD-type (1);	1.037320	0.07739	U	0.946643	T	0.08846	0.0219	N	0.08118	0	0.09310	N	1	B;B;B;B	0.21821	0.032;0.035;0.057;0.061	B;B;B;B	0.18561	0.022;0.012;0.015;0.007	T	0.40021	-0.9585	10	0.12766	T	0.61	-7.4673	3.0778	0.06252	0.1232:0.2046:0.5257:0.1464	.	257;257;257;257	Q9BTC0-2;Q9BTC0-3;Q9BTC0-1;Q9BTC0	.;.;.;DIDO1_HUMAN	Q	257	ENSP00000266070:P257Q;ENSP00000378752:P257Q;ENSP00000378749:P257Q;ENSP00000378744:P257Q;ENSP00000359397:P257Q;ENSP00000359394:P257Q;ENSP00000346692:P257Q;ENSP00000359391:P257Q;ENSP00000266071:P257Q	ENSP00000266070:P257Q	P	-	2	0	DIDO1	61012640	0.029000	0.19370	0.002000	0.10522	0.025000	0.11179	1.112000	0.31172	0.478000	0.27488	0.561000	0.74099	CCG	DIDO1	-	superfamily_Znf_FYVE_PHD	ENSG00000101191		0.567	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIDO1	HGNC	protein_coding	OTTHUMT00000080091.2	-	0.00	38	0	G	NM_080796		61542195	-1	tier1	-	no_errors	ENST00000266070	ensembl	human	known	74_37	missense	6.67	55	4	SNP	0.003	T
DIXDC1	85458	genome.wustl.edu	37	11	111835289	111835289	+	Missense_Mutation	SNP	A	A	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr11:111835289A>G	ENST00000529225.1	+	3	354	c.74A>G	c.(73-75)tAt>tGt	p.Y25C	DIXDC1_ENST00000389821.4_3'UTR|DIXDC1_ENST00000531396.1_Missense_Mutation_p.Y26C|DIXDC1_ENST00000440460.2_Missense_Mutation_p.Y26C	NM_001278542.1	NP_001265471.1	Q155Q3	DIXC1_HUMAN	DIX domain containing 1	26	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				camera-type eye development (GO:0043010)|cell cycle (GO:0007049)|cerebellar cortex development (GO:0021695)|cerebral cortex radially oriented cell migration (GO:0021799)|forebrain development (GO:0030900)|forebrain ventricular zone progenitor cell division (GO:0021869)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of axonogenesis (GO:0050772)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of JNK cascade (GO:0046330)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of JNK cascade (GO:0046328)|regulation of microtubule cytoskeleton organization (GO:0070507)|Wnt signaling pathway (GO:0016055)	axon terminus (GO:0043679)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytosol (GO:0005829)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	gamma-tubulin binding (GO:0043015)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)			cervix(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)	17		all_cancers(61;7.58e-15)|all_epithelial(67;5.42e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;2.99e-07)|BRCA - Breast invasive adenocarcinoma(274;6.72e-07)|all cancers(92;6.25e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0548)		CTGCAGGCCTATGTGGCCTGG	0.498																																																	0													42.0	44.0	43.0					11																	111835289		1923	4130	6053	SO:0001583	missense	0			AB051522	CCDS60957.1, CCDS73381.1, CCDS73382.1	11q23.1	2014-03-20			ENSG00000150764	ENSG00000150764			23695	protein-coding gene	gene with protein product		610493				12792787	Standard	NM_001037954		Approved	KIAA1735, Dixin	uc001pmm.3	Q155Q3	OTTHUMG00000166912	ENST00000529225.1:c.74A>G	11.37:g.111835289A>G	ENSP00000434130:p.Tyr25Cys		A1A5D8|E9PRV4|Q6P2J8|Q6PIK4|Q86SR7|Q8IVY4|Q96N69|Q9C0C8	Missense_Mutation	SNP	pfam_DIX,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_DIX,pfscan_CH-domain,pfscan_DIX	p.Y26C	ENST00000529225.1	37	c.77		11	.	.	.	.	.	.	.	.	.	.	A	19.07	3.756728	0.69648	.	.	ENSG00000150764	ENST00000529225;ENST00000440460;ENST00000531396	T;T;T	0.61742	0.08;0.08;0.08	5.05	5.05	0.67936	Calponin homology domain (5);	0.000000	0.51477	D	0.000087	T	0.76176	0.3951	M	0.79475	2.455	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	T	0.79981	-0.1574	10	0.87932	D	0	-25.1122	14.9707	0.71232	1.0:0.0:0.0:0.0	.	26;26;25	Q155Q3;Q155Q3-4;E9PRV4	DIXC1_HUMAN;.;.	C	25;26;26	ENSP00000434130:Y25C;ENSP00000394352:Y26C;ENSP00000432959:Y26C	ENSP00000394352:Y26C	Y	+	2	0	DIXDC1	111340499	1.000000	0.71417	0.361000	0.25849	0.830000	0.47004	8.761000	0.91691	2.139000	0.66308	0.383000	0.25322	TAT	DIXDC1	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000150764		0.498	DIXDC1-002	PUTATIVE	basic	protein_coding	DIXDC1	HGNC	protein_coding	OTTHUMT00000391831.1	-	0.00	26	0	A	NM_001037954		111835289	+1	tier1	-	no_errors	ENST00000440460	ensembl	human	known	74_37	missense	27.66	34	13	SNP	0.996	G
DLC1	10395	genome.wustl.edu	37	8	13162754	13162754	+	Intron	SNP	A	A	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr8:13162754A>G	ENST00000276297.4	-	5	1758				DLC1_ENST00000511869.1_Missense_Mutation_p.F458L|DLC1_ENST00000316609.5_Intron	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein						actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						TTGGCGAGAAAACAGAACCAA	0.279																																																	0													74.0	78.0	77.0					8																	13162754		2202	4297	6499	SO:0001627	intron_variant	0			AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.1348+23T>C	8.37:g.13162754A>G			B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Missense_Mutation	SNP	NULL	p.F458L	ENST00000276297.4	37	c.1372	CCDS5989.1	8	.	.	.	.	.	.	.	.	.	.	A	10.28	1.307034	0.23821	.	.	ENSG00000164741	ENST00000511869	T	0.10960	2.82	5.46	2.95	0.34219	.	.	.	.	.	T	0.04272	0.0118	N	0.08118	0	0.09310	N	1	B	0.13594	0.008	B	0.16289	0.015	T	0.43669	-0.9377	9	0.06099	T	0.92	.	6.0888	0.19983	0.7749:0.0:0.0815:0.1436	.	458	E9PF76	.	L	458	ENSP00000425878:F458L	ENSP00000425878:F458L	F	-	1	0	DLC1	13207125	0.973000	0.33851	0.350000	0.25708	0.003000	0.03518	2.592000	0.46171	1.039000	0.40074	-0.270000	0.10280	TTT	DLC1	-	NULL	ENSG00000164741		0.279	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DLC1	HGNC	protein_coding	OTTHUMT00000207632.2	-	0.00	89	0	A	NM_182643, NM_006094		13162754	-1	tier1	-	no_errors	ENST00000511869	ensembl	human	novel	74_37	missense	15.57	141	26	SNP	0.314	G
DLK1	8788	genome.wustl.edu	37	14	101200909	101200909	+	Silent	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr14:101200909G>A	ENST00000341267.4	+	5	1070	c.828G>A	c.(826-828)ccG>ccA	p.P276P	DLK1_ENST00000331224.6_Intron	NM_003836.5	NP_003827	P80370	DLK1_HUMAN	delta-like 1 homolog (Drosophila)	276					cell differentiation (GO:0030154)|embryonic skeletal system development (GO:0048706)|multicellular organismal development (GO:0007275)|negative regulation of Notch signaling pathway (GO:0045746)|Notch signaling pathway (GO:0007219)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(16)|ovary(2)|prostate(1)|skin(1)	29		Melanoma(154;0.155)				ACGAGCTGCCGGTGCAGCAGC	0.652																																																	0													43.0	48.0	46.0					14																	101200909		2203	4300	6503	SO:0001819	synonymous_variant	0			U15979	CCDS9963.1	14q32	2011-12-05	2001-12-03			ENSG00000185559			2907	protein-coding gene	gene with protein product		176290	"""delta-like homolog (Drosophila)"""			8095043, 7925474	Standard	NM_003836		Approved	FA1, pG2, Pref-1, ZOG, Delta1	uc001yhs.4	P80370		ENST00000341267.4:c.828G>A	14.37:g.101200909G>A			P15803|Q96DW5	Silent	SNP	pfam_EG-like_dom,pfam_EGF_extracell,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.P276	ENST00000341267.4	37	c.828	CCDS9963.1	14																																																																																			DLK1	-	NULL	ENSG00000185559		0.652	DLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLK1	HGNC	protein_coding	OTTHUMT00000414389.1	-	0.00	48	0	G			101200909	+1	tier1	-	no_errors	ENST00000341267	ensembl	human	known	74_37	silent	19.23	42	10	SNP	0.001	A
DMBT1	1755	genome.wustl.edu	37	10	124390762	124390762	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr10:124390762G>T	ENST00000338354.3	+	46	6030	c.5924G>T	c.(5923-5925)tGt>tTt	p.C1975F	DMBT1_ENST00000368955.3_Missense_Mutation_p.C1965F|DMBT1_ENST00000368909.3_Missense_Mutation_p.C1975F|DMBT1_ENST00000344338.3_Missense_Mutation_p.C1965F|DMBT1_ENST00000368956.2_Missense_Mutation_p.C1347F|DMBT1_ENST00000330163.4_Missense_Mutation_p.C1347F|DMBT1_ENST00000359586.6_Missense_Mutation_p.C695F			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	1975	SRCR 14. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)	p.C1975Y(1)		breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				TCCCACAACTGTAATCATCGT	0.547																																					Ovarian(182;93 2026 18125 22222 38972)												1	Substitution - Missense(1)	prostate(1)											149.0	145.0	146.0					10																	124390762		2057	4203	6260	SO:0001583	missense	0				CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.5924G>T	10.37:g.124390762G>T	ENSP00000342210:p.Cys1975Phe		A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	pfam_SRCR,pfam_CUB_dom,pfam_ZP_dom,superfamily_Srcr_rcpt-rel,superfamily_CUB_dom,smart_Srcr_rcpt-rel,smart_CUB_dom,smart_ZP_dom,pfscan_CUB_dom,pfscan_SRCR,pfscan_ZP_dom,prints_SRCR	p.C1975F	ENST00000338354.3	37	c.5924		10	.	.	.	.	.	.	.	.	.	.	G	18.15	3.559487	0.65538	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000327438;ENST00000344338;ENST00000339712;ENST00000330163;ENST00000368909;ENST00000368955;ENST00000368956;ENST00000344467;ENST00000359586	T;T;T;T;T;T;T	0.52526	0.66;0.66;0.66;0.66;0.66;0.66;0.66	5.56	5.56	0.83823	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	.	.	.	.	T	0.79581	0.4470	H	0.95645	3.7	0.58432	D	0.999997	D;D;D;D;D;D;P	0.89917	1.0;0.999;1.0;0.999;1.0;0.997;0.937	D;D;D;D;D;D;P	0.97110	1.0;0.999;1.0;0.994;0.975;0.991;0.89	D	0.85227	0.1030	9	0.66056	D	0.02	.	19.6051	0.95577	0.0:0.0:1.0:0.0	.	695;1955;1224;2104;1347;1965;1975	F8WEF7;Q9UGM3-5;Q9UGM3-8;Q9UGM3-6;Q9UGM3-2;Q9UGM3-3;Q9UGM3	.;.;.;.;.;.;DMBT1_HUMAN	F	1975;2104;1975;1975;1975;1975;1347;1965;1347;1347;1975;1965;1347;121;695	ENSP00000342210:C1975F;ENSP00000343175:C1965F;ENSP00000327747:C1347F;ENSP00000357905:C1975F;ENSP00000357951:C1965F;ENSP00000357952:C1347F;ENSP00000352593:C695F	ENSP00000331522:C1347F	C	+	2	0	DMBT1	124380752	1.000000	0.71417	0.088000	0.20740	0.368000	0.29767	9.508000	0.98000	2.619000	0.88677	0.650000	0.86243	TGT	DMBT1	-	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR	ENSG00000187908		0.547	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	DMBT1	HGNC	protein_coding	OTTHUMT00000050792.2		0.00	28	0	G	NM_004406		124390762	+1			no_errors	ENST00000338354	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	T
DOK2	9046	genome.wustl.edu	37	8	21767244	21767244	+	Missense_Mutation	SNP	G	G	C	rs368473444		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr8:21767244G>C	ENST00000276420.4	-	5	1075	c.817C>G	c.(817-819)Cgg>Ggg	p.R273G	DOK2_ENST00000544659.1_Missense_Mutation_p.R119G	NM_003974.2	NP_003965.2	O60496	DOK2_HUMAN	docking protein 2, 56kDa	273	Pro-rich.				blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|leukocyte migration (GO:0050900)|Ras protein signal transduction (GO:0007265)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)	receptor signaling protein activity (GO:0005057)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(9)|ovary(2)|prostate(3)|skin(1)	26				Colorectal(74;0.0145)|COAD - Colon adenocarcinoma(73;0.0608)		TCATGCGGCCGAGAGTAGGGG	0.682																																																	0													49.0	56.0	53.0					8																	21767244		2203	4299	6502	SO:0001583	missense	0			AF034970	CCDS6016.1	8p21.3	2008-08-07	2002-08-29		ENSG00000147443	ENSG00000147443			2991	protein-coding gene	gene with protein product		604997	"""docking protein 2, 56kD"""			9478921, 14645010	Standard	NM_003974		Approved	p56dok-2, Dok-2	uc003wzy.1	O60496	OTTHUMG00000131075	ENST00000276420.4:c.817C>G	8.37:g.21767244G>C	ENSP00000276420:p.Arg273Gly		Q8N5A4	Missense_Mutation	SNP	pfam_Insln_rcpt_S1,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,pfscan_Pleckstrin_homology,pfscan_Insln_rcpt_S1	p.R273G	ENST00000276420.4	37	c.817	CCDS6016.1	8	.	.	.	.	.	.	.	.	.	.	G	13.08	2.131678	0.37630	.	.	ENSG00000147443	ENST00000276420;ENST00000544659;ENST00000518197	T;T;T	0.45668	1.89;1.48;0.89	5.42	3.62	0.41486	.	0.631001	0.14032	N	0.346038	T	0.39332	0.1074	M	0.75447	2.3	0.31778	N	0.631265	P;P	0.39551	0.678;0.678	B;B	0.37346	0.247;0.247	T	0.47711	-0.9096	10	0.35671	T	0.21	-6.668	5.0901	0.14704	0.1714:0.0:0.6608:0.1678	.	273;273	O60496;A8K7W1	DOK2_HUMAN;.	G	273;119;119	ENSP00000276420:R273G;ENSP00000443602:R119G;ENSP00000430729:R119G	ENSP00000276420:R273G	R	-	1	2	DOK2	21823190	0.409000	0.25368	0.984000	0.44739	0.201000	0.24016	2.160000	0.42348	0.653000	0.30826	-0.169000	0.13324	CGG	DOK2	-	NULL	ENSG00000147443		0.682	DOK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOK2	HGNC	protein_coding	OTTHUMT00000253735.3	-	0.00	44	0	G	NM_003974		21767244	-1	tier1	-	no_errors	ENST00000276420	ensembl	human	known	74_37	missense	19.19	80	19	SNP	0.976	C
DPPA3	359787	genome.wustl.edu	37	12	7867910	7867910	+	Missense_Mutation	SNP	A	A	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr12:7867910A>G	ENST00000345088.2	+	2	331	c.214A>G	c.(214-216)Agg>Ggg	p.R72G		NM_199286.2	NP_954980.1	Q6W0C5	DPPA3_HUMAN	developmental pluripotency associated 3	72					chromatin modification (GO:0016568)|embryonic cleavage (GO:0040016)|negative regulation of DNA demethylation (GO:1901536)|protection of DNA demethylation of female pronucleus (GO:0044726)|regulation of genetic imprinting (GO:2000653)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(2)	8				Kidney(36;0.0887)		AGCAGTCCTCAGGGAAATCGA	0.458																																																	0													83.0	75.0	78.0					12																	7867910		2203	4300	6503	SO:0001583	missense	0			AY317075	CCDS8582.1	12p13.31	2012-10-02			ENSG00000187569	ENSG00000187569			19199	protein-coding gene	gene with protein product		608408					Standard	NM_199286		Approved	Stella	uc001qtf.3	Q6W0C5	OTTHUMG00000168434	ENST00000345088.2:c.214A>G	12.37:g.7867910A>G	ENSP00000339250:p.Arg72Gly		Q0P5U3|Q6JZS6	Missense_Mutation	SNP	NULL	p.R72G	ENST00000345088.2	37	c.214	CCDS8582.1	12	.	.	.	.	.	.	.	.	.	.	A	7.381	0.628741	0.14257	.	.	ENSG00000187569	ENST00000345088	T	0.49432	0.78	2.48	0.469	0.16741	.	.	.	.	.	T	0.29093	0.0723	N	0.20986	0.625	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.19844	-1.0293	9	0.49607	T	0.09	-2.0612	4.4606	0.11665	0.2767:0.488:0.2353:0.0	.	72	Q6W0C5	DPPA3_HUMAN	G	72	ENSP00000339250:R72G	ENSP00000339250:R72G	R	+	1	2	DPPA3	7759177	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.918000	0.04021	0.127000	0.18452	-0.648000	0.03929	AGG	DPPA3	-	NULL	ENSG00000187569		0.458	DPPA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPPA3	HGNC	protein_coding	OTTHUMT00000399718.1	-	0.00	65	0	A	NM_199286		7867910	+1	tier1	-	no_errors	ENST00000345088	ensembl	human	known	74_37	missense	14.73	110	19	SNP	0.000	G
DST	667	genome.wustl.edu	37	6	56371273	56371273	+	Nonsense_Mutation	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr6:56371273G>A	ENST00000361203.3	-	72	18479	c.18472C>T	c.(18472-18474)Cag>Tag	p.Q6158*	DST_ENST00000244364.6_Nonsense_Mutation_p.Q3855*|DST_ENST00000370788.2_Nonsense_Mutation_p.Q4072*|DST_ENST00000370754.5_Nonsense_Mutation_p.Q6447*|DST_ENST00000312431.6_3'UTR|DST_ENST00000370769.4_Nonsense_Mutation_p.Q6269*|DST_ENST00000340834.4_5'UTR|DST_ENST00000421834.2_Nonsense_Mutation_p.Q4181*|DST_ENST00000446842.2_Nonsense_Mutation_p.Q5943*			Q03001	DYST_HUMAN	dystonin	6158					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			ACGGCAGCCTGCATTGCCTCC	0.423																																																	0													67.0	66.0	66.0					6																	56371273		1982	4155	6137	SO:0001587	stop_gained	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.18472C>T	6.37:g.56371273G>A	ENSP00000354508:p.Gln6158*		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Nonsense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.Q6447*	ENST00000361203.3	37	c.19339		6	.	.	.	.	.	.	.	.	.	.	G	57	30.025291	0.99976	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	.	.	.	5.57	5.57	0.84162	.	0.000000	0.48286	D	0.000192	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	.	19.5247	0.95199	0.0:0.0:1.0:0.0	.	.	.	.	X	3855;6447;6269;4181;5943;4072;6158	.	ENSP00000244364:Q3855X	Q	-	1	0	DST	56479232	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.825000	0.86693	2.610000	0.88304	0.585000	0.79938	CAG	DST	-	superfamily_ABC1_TM_dom	ENSG00000151914		0.423	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	-	0.00	46	0	G	NM_001723		56371273	-1	tier1	-	no_errors	ENST00000370754	ensembl	human	known	74_37	nonsense	8.16	45	4	SNP	1.000	A
DTL	51514	genome.wustl.edu	37	1	212274230	212274230	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr1:212274230G>T	ENST00000366991.4	+	14	2212	c.1898G>T	c.(1897-1899)tGt>tTt	p.C633F	RN7SKP98_ENST00000517070.1_RNA|DTL_ENST00000475419.1_3'UTR|DTL_ENST00000542077.1_Missense_Mutation_p.C591F	NM_016448.2	NP_057532.2	Q9NZJ0	DTL_HUMAN	denticleless E3 ubiquitin protein ligase homolog (Drosophila)	633					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|G2 DNA damage checkpoint (GO:0031572)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|regulation of cell cycle (GO:0051726)|response to UV (GO:0009411)|translesion synthesis (GO:0019985)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|chromosome (GO:0005694)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(81;0.00796)|all cancers(67;0.0385)|Epithelial(68;0.102)		TCAGAAAGCTGTGGAACGCTA	0.468																																																	0													110.0	107.0	108.0					1																	212274230		2203	4300	6503	SO:0001583	missense	0			AF195765	CCDS1502.1, CCDS65778.1	1q32	2013-01-10	2012-02-23		ENSG00000143476	ENSG00000143476		"""DDB1 and CUL4 associated factors"", ""WD repeat domain containing"""	30288	protein-coding gene	gene with protein product	"""RA regulated nuclear matrix associated protein"", ""DDB1 and CUL4 associated factor 2"""	610617	"""denticleless homolog (Drosophila)"""			11278750	Standard	NM_001286229		Approved	RAMP, L2DTL, DCAF2	uc009xdc.3	Q9NZJ0	OTTHUMG00000037133	ENST00000366991.4:c.1898G>T	1.37:g.212274230G>T	ENSP00000355958:p.Cys633Phe		A8K8H8|D3DT98|Q5VT77|Q96SN0|Q9NW03|Q9NW34|Q9NWM5	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.C633F	ENST00000366991.4	37	c.1898	CCDS1502.1	1	.	.	.	.	.	.	.	.	.	.	G	6.303	0.423926	0.11928	.	.	ENSG00000143476	ENST00000366991;ENST00000542077;ENST00000420235	T;T	0.69435	-0.32;-0.4	5.95	4.98	0.66077	.	0.263596	0.36134	N	0.002778	T	0.35885	0.0947	N	0.08118	0	0.36310	D	0.857592	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.43750	-0.9372	10	0.06757	T	0.87	-8.8484	3.7032	0.08390	0.085:0.1165:0.5139:0.2847	.	591;633;591	F5GZ90;Q9NZJ0;B4E0E6	.;DTL_HUMAN;.	F	633;591;312	ENSP00000355958:C633F;ENSP00000443870:C591F	ENSP00000355958:C633F	C	+	2	0	DTL	210340853	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	1.762000	0.38451	2.824000	0.97209	0.655000	0.94253	TGT	DTL	-	NULL	ENSG00000143476		0.468	DTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTL	HGNC	protein_coding	OTTHUMT00000090182.1	-	0.00	64	0	G	NM_016448		212274230	+1	tier1	-	no_errors	ENST00000366991	ensembl	human	known	74_37	missense	5.13	74	4	SNP	0.992	T
DUSP10	11221	genome.wustl.edu	37	1	221875157	221875157	+	3'UTR	DEL	A	A	-			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr1:221875157delA	ENST00000366899.3	-	0	2284				DUSP10_ENST00000323825.3_3'UTR|DUSP10_ENST00000544095.1_3'UTR|DUSP10_ENST00000468085.1_5'UTR	NM_007207.4	NP_009138.1	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10						inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of respiratory burst involved in inflammatory response (GO:0060266)|oligodendrocyte differentiation (GO:0048709)|protein dephosphorylation (GO:0006470)|regulation of adaptive immune response (GO:0002819)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	MAP kinase phosphatase activity (GO:0033549)|MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(131;0.0103)		CCAGAGAAGGAAAAAAAAAAA	0.353																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB026436	CCDS1528.1	1q41	2011-06-09			ENSG00000143507	ENSG00000143507		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3065	protein-coding gene	gene with protein product		608867				10391943, 10597297	Standard	NM_007207		Approved	MKP-5, MKP5	uc001hmy.2	Q9Y6W6	OTTHUMG00000037269	ENST00000366899.3:c.*597T>-	1.37:g.221875157delA			D3DTB4|Q6GSI4|Q9H9Z5	RNA	DEL	-	NULL	ENST00000366899.3	37	NULL	CCDS1528.1	1																																																																																			DUSP10	-	-	ENSG00000143507		0.353	DUSP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP10	HGNC	protein_coding	OTTHUMT00000090716.1		0.00	25	0	A	NM_007207		221875157	-1	tier1		no_errors	ENST00000468085	ensembl	human	known	74_37	rna	6.67	28	2	DEL	0.000	-
DUSP10	11221	genome.wustl.edu	37	1	221912479	221912479	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr1:221912479C>A	ENST00000366899.3	-	2	846	c.608G>T	c.(607-609)cGg>cTg	p.R203L	DUSP10_ENST00000323825.3_Intron|DUSP10_ENST00000544095.1_5'Flank|DUSP10_ENST00000468085.1_5'Flank	NM_007207.4	NP_009138.1	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10	203	Interaction with MAP kinases.|Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.				inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of respiratory burst involved in inflammatory response (GO:0060266)|oligodendrocyte differentiation (GO:0048709)|protein dephosphorylation (GO:0006470)|regulation of adaptive immune response (GO:0002819)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	MAP kinase phosphatase activity (GO:0033549)|MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.R203Q(1)		NS(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(131;0.0103)		CTGCAGTCTCCGCCGGCTGAT	0.478																																																	1	Substitution - Missense(1)	prostate(1)											66.0	66.0	66.0					1																	221912479		2203	4300	6503	SO:0001583	missense	0			AB026436	CCDS1528.1	1q41	2011-06-09			ENSG00000143507	ENSG00000143507		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3065	protein-coding gene	gene with protein product		608867				10391943, 10597297	Standard	NM_007207		Approved	MKP-5, MKP5	uc001hmy.2	Q9Y6W6	OTTHUMG00000037269	ENST00000366899.3:c.608G>T	1.37:g.221912479C>A	ENSP00000355866:p.Arg203Leu		D3DTB4|Q6GSI4|Q9H9Z5	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,superfamily_Blood-coag_inhib_Disintegrin,smart_Rhodanese-like_dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Rhodanese-like_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_MKP,prints_Atypical_DUSP	p.R203L	ENST00000366899.3	37	c.608	CCDS1528.1	1	.	.	.	.	.	.	.	.	.	.	C	16.10	3.026441	0.54683	.	.	ENSG00000143507	ENST00000366899;ENST00000418487	T	0.51325	0.71	5.44	4.53	0.55603	Rhodanese-like (5);	0.000000	0.85682	D	0.000000	T	0.46814	0.1412	M	0.62723	1.935	0.80722	D	1	P	0.46457	0.878	B	0.41571	0.36	T	0.53287	-0.8460	10	0.87932	D	0	.	12.2604	0.54647	0.0:0.922:0.0:0.078	.	203	Q9Y6W6	DUS10_HUMAN	L	203;148	ENSP00000355866:R203L	ENSP00000355866:R203L	R	-	2	0	DUSP10	219979102	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	1.304000	0.44892	0.591000	0.81541	CGG	DUSP10	-	pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,pfscan_Rhodanese-like_dom,prints_MKP	ENSG00000143507		0.478	DUSP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP10	HGNC	protein_coding	OTTHUMT00000090716.1		0.00	29	0	C	NM_007207		221912479	-1			no_errors	ENST00000366899	ensembl	human	known	74_37	missense	5.88	32	2	SNP	1.000	A
DYNC1H1	1778	genome.wustl.edu	37	14	102452280	102452280	+	Missense_Mutation	SNP	G	G	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr14:102452280G>C	ENST00000360184.4	+	8	1882	c.1718G>C	c.(1717-1719)gGc>gCc	p.G573A		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	573	Interaction with DYNC1I2. {ECO:0000250}.|Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						GATCAGCTTGGCACAGCCAAG	0.547																																																	0													74.0	70.0	72.0					14																	102452280		2203	4300	6503	SO:0001583	missense	0			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.1718G>C	14.37:g.102452280G>C	ENSP00000348965:p.Gly573Ala		B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like,smart_AAA+_ATPase	p.G573A	ENST00000360184.4	37	c.1718	CCDS9966.1	14	.	.	.	.	.	.	.	.	.	.	G	10.53	1.376317	0.24857	.	.	ENSG00000197102	ENST00000360184	T	0.54071	0.59	5.85	5.85	0.93711	Dynein heavy chain, domain-1 (1);	0.000000	0.85682	D	0.000000	T	0.54854	0.1884	L	0.52573	1.65	0.80722	D	1	P	0.49307	0.922	P	0.48598	0.583	T	0.47328	-0.9126	10	0.07644	T	0.81	.	20.155	0.98106	0.0:0.0:1.0:0.0	.	573	Q14204	DYHC1_HUMAN	A	573	ENSP00000348965:G573A	ENSP00000348965:G573A	G	+	2	0	DYNC1H1	101522033	1.000000	0.71417	0.997000	0.53966	0.984000	0.73092	9.471000	0.97696	2.760000	0.94817	0.655000	0.94253	GGC	DYNC1H1	-	pfam_Dynein_heavy_dom-1	ENSG00000197102		0.547	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	HGNC	protein_coding	OTTHUMT00000414574.1	-	0.00	33	0	G	NM_001376		102452280	+1	tier1	-	no_errors	ENST00000360184	ensembl	human	known	74_37	missense	14.81	23	4	SNP	1.000	C
EDEM1	9695	genome.wustl.edu	37	3	5244667	5244667	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr3:5244667G>A	ENST00000256497.4	+	5	1008	c.875G>A	c.(874-876)gGa>gAa	p.G292E	EDEM1_ENST00000445686.1_Missense_Mutation_p.G97E	NM_014674.2	NP_055489.1	Q92611	EDEM1_HUMAN	ER degradation enhancer, mannosidase alpha-like 1	292					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	calcium ion binding (GO:0005509)|misfolded protein binding (GO:0051787)			NS(1)|breast(1)|endometrium(1)|large_intestine(5)|liver(2)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22				Epithelial(13;0.0588)|OV - Ovarian serous cystadenocarcinoma(96;0.0682)		CTAAAGACAGGAGTTCCTCCT	0.512																																																	0													69.0	70.0	70.0					3																	5244667		2203	4300	6503	SO:0001583	missense	0			D86967	CCDS33686.1	3p26.1	2008-02-05			ENSG00000134109	ENSG00000134109			18967	protein-coding gene	gene with protein product		607673				12610306	Standard	NM_014674		Approved	KIAA0212, EDEM	uc003bqi.3	Q92611	OTTHUMG00000154896	ENST00000256497.4:c.875G>A	3.37:g.5244667G>A	ENSP00000256497:p.Gly292Glu		A8K9C8|B4DXP3	Missense_Mutation	SNP	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47,prints_Glyco_hydro_47	p.G292E	ENST00000256497.4	37	c.875	CCDS33686.1	3	.	.	.	.	.	.	.	.	.	.	G	27.6	4.847895	0.91277	.	.	ENSG00000134109	ENST00000419550;ENST00000256497;ENST00000445686	T;T	0.72942	-0.7;-0.7	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	D	0.88104	0.6347	M	0.91140	3.18	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	1.0;1.0;0.997	D	0.90475	0.4456	10	0.87932	D	0	-22.9657	19.2502	0.93921	0.0:0.0:1.0:0.0	.	97;292;70	B4DXP3;Q92611;B4DPV5	.;EDEM1_HUMAN;.	E	70;292;97	ENSP00000256497:G292E;ENSP00000394099:G97E	ENSP00000256497:G292E	G	+	2	0	EDEM1	5219667	1.000000	0.71417	0.972000	0.41901	0.924000	0.55760	9.260000	0.95568	2.532000	0.85374	0.650000	0.86243	GGA	EDEM1	-	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47,prints_Glyco_hydro_47	ENSG00000134109		0.512	EDEM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDEM1	HGNC	protein_coding	OTTHUMT00000337566.2	-	0.00	46	0	G	NM_014674		5244667	+1	tier1	-	no_errors	ENST00000256497	ensembl	human	known	74_37	missense	18.06	59	13	SNP	0.999	A
EIF4EBP1	1978	genome.wustl.edu	37	8	37914778	37914778	+	Splice_Site	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr8:37914778G>A	ENST00000338825.4	+	2	558	c.325G>A	c.(325-327)Ggt>Agt	p.G109S	EIF4EBP1_ENST00000520657.1_3'UTR	NM_004095.3	NP_004086.1	Q13541	4EBP1_HUMAN	eukaryotic translation initiation factor 4E binding protein 1	109					cellular protein metabolic process (GO:0044267)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|lung development (GO:0030324)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of translational initiation (GO:0045947)|positive regulation of mitotic cell cycle (GO:0045931)|response to ethanol (GO:0045471)|response to ischemia (GO:0002931)|TOR signaling (GO:0031929)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|protein complex (GO:0043234)	translation repressor activity (GO:0030371)			endometrium(1)|lung(1)|ovary(1)|urinary_tract(1)	4	Colorectal(12;0.00627)	Lung NSC(58;0.118)|all_lung(54;0.195)				GCGGGCGGGCGGTGAGTGTCG	0.622																																					Melanoma(144;549 1821 15133 20335 46806)												0													30.0	34.0	32.0					8																	37914778		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS6100.1	8p12	2008-10-08			ENSG00000187840	ENSG00000187840			3288	protein-coding gene	gene with protein product	"""phosphorylated heat- and acid-stable protein regulated by insulin 1"""	602223				7935836	Standard	NM_004095		Approved	PHAS-I, 4E-BP1	uc003xks.3	Q13541	OTTHUMG00000164012	ENST00000338825.4:c.325+1G>A	8.37:g.37914778G>A			B2R502|D3DSW8|Q6IBN3	Missense_Mutation	SNP	pfam_EIF4EBP	p.G109S	ENST00000338825.4	37	c.325	CCDS6100.1	8	.	.	.	.	.	.	.	.	.	.	G	9.703	1.155035	0.21371	.	.	ENSG00000187840	ENST00000338825	.	.	.	4.89	1.4	0.22301	.	0.301229	0.28630	N	0.014664	T	0.23766	0.0575	L	0.45228	1.405	0.80722	D	1	P	0.43826	0.818	B	0.26416	0.069	T	0.11084	-1.0602	9	0.12430	T	0.62	-18.0991	5.1747	0.15129	0.2428:0.1678:0.5894:0.0	.	109	Q13541	4EBP1_HUMAN	S	109	.	ENSP00000340691:G109S	G	+	1	0	EIF4EBP1	38033935	0.826000	0.29277	0.796000	0.32109	0.096000	0.18686	0.629000	0.24538	1.057000	0.40506	-0.463000	0.05309	GGT	EIF4EBP1	-	pfam_EIF4EBP	ENSG00000187840		0.622	EIF4EBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF4EBP1	HGNC	protein_coding	OTTHUMT00000376743.1	-	0.00	56	0	G	NM_004095	Missense_Mutation	37914778	+1	tier1	-	no_errors	ENST00000338825	ensembl	human	known	74_37	missense	9.18	89	9	SNP	0.299	A
EML2	24139	genome.wustl.edu	37	19	46145561	46145561	+	5'Flank	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr19:46145561C>A	ENST00000245925.3	-	0	0				AC006132.1_ENST00000591087.1_3'UTR|AC006132.1_ENST00000593161.1_Silent_p.A34A|EML2_ENST00000536630.1_Silent_p.S20S|EML2_ENST00000587152.1_Silent_p.S74S|EML2_ENST00000589876.1_5'Flank	NM_012155.2	NP_036287.1	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like 2						negative regulation of microtubule polymerization (GO:0031115)|regulation of microtubule nucleation (GO:0010968)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(13)|ovary(1)|urinary_tract(1)	31		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		GCTCCAGCGCCGACACGCGGT	0.662											OREG0025558	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001631	upstream_gene_variant	0			AF103939	CCDS12670.1, CCDS54280.1, CCDS59399.1	19q13.32	2013-01-10				ENSG00000125746		"""WD repeat domain containing"""	18035	protein-coding gene	gene with protein product	"""echinoderm MT-associated protein (EMAP)-like protein 70"", ""microtubule-associated protein like echinoderm EMAP"""					11694528, 10521658	Standard	NM_012155		Approved	EMAP2, ELP70, EMAP-2	uc010xxm.2	O95834			19.37:g.46145561C>A	Exception_encountered	937	B7Z3I2|B7Z3Q9|K7ERL7|Q59EN8|Q8N5A2|Q9UG50	Silent	SNP	pfam_HELP,pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,superfamily_Quinoprot_gluc/sorb_DH,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S74	ENST00000245925.3	37	c.222	CCDS12670.1	19																																																																																			EML2	-	NULL	ENSG00000125746		0.662	EML2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	EML2	HGNC	protein_coding	OTTHUMT00000459608.1		0.00	58	0	C	NM_012155		46145561	-1			no_errors	ENST00000587152	ensembl	human	known	74_37	silent	5.48	69	4	SNP	1.000	A
TUBB8P12	260334	genome.wustl.edu	37	18	47974	47974	+	Missense_Mutation	SNP	G	G	A	rs4798099	byFrequency	TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr18:47974G>A	ENST00000573909.1	-	3	1181	c.649C>T	c.(649-651)Cgg>Tgg	p.R217W	RP11-683L23.1_ENST00000594555.1_5'UTR|RP11-683L23.1_ENST00000308911.6_Missense_Mutation_p.R251W																							GCCAGCTTCCGCAGGTCAGCA	0.632																																																	0																																										SO:0001583	missense	0																														ENST00000573909.1:c.649C>T	18.37:g.47974G>A	ENSP00000459638:p.Arg217Trp			Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Gamma_tubulin,prints_Delta_tubulin,prints_Alpha_tubulin	p.R251W	ENST00000573909.1	37	c.751		18	.	.	.	.	.	.	.	.	.	.	.	11.24	1.579662	0.28180	.	.	ENSG00000173213	ENST00000308911	D	0.84730	-1.89	0.109	0.109	0.14578	.	0.000000	0.64402	U	0.000012	D	0.84014	0.5379	.	.	.	0.28000	N	0.9353009999999999	.	.	.	.	.	.	D	0.83646	0.0153	6	0.87932	D	0	.	5.9913	0.19465	6.0E-4:0.0:0.9994:0.0	.	.	.	.	W	251	ENSP00000309431:R251W	ENSP00000309431:R251W	R	-	1	2	RP11-683L23.1	37974	0.983000	0.35010	0.101000	0.21167	0.103000	0.19146	2.269000	0.43346	0.181000	0.19994	0.184000	0.17185	CGG	RP11-683L23.1	-	superfamily_Tub_FtsZ_C,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Gamma_tubulin	ENSG00000173213		0.632	RP11-683L23.1-002	PUTATIVE	not_best_in_genome_evidence|basic	protein_coding	ENSG00000173213	Clone_based_vega_gene	protein_coding	OTTHUMT00000439819.1	-	0.00	70	0	G			47974	-1	tier1	-	no_errors	ENST00000308911	ensembl	human	known	74_37	missense	19.47	89	22	SNP	1.000	A
CICP9	100420293	genome.wustl.edu	37	10	38742324	38742324	+	lincRNA	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr10:38742324G>A	ENST00000428915.2	+	0	216																											AGCAGCCCGCGAGGCTGAGGC	0.642																																																	0																																												0																															10.37:g.38742324G>A				RNA	SNP	-	NULL	ENST00000428915.2	37	NULL		10																																																																																			RP11-291L22.4	-	-	ENSG00000203496		0.642	RP11-291L22.4-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	ENSG00000203496	Clone_based_vega_gene	lincRNA	OTTHUMT00000047653.3	-	0.00	35	0	G			38742324	+1	tier1	-	no_errors	ENST00000428915	ensembl	human	known	74_37	rna	16.42	56	11	SNP	0.664	A
SCRIB	23513	genome.wustl.edu	37	8	144872533	144872534	+	IGR	DNP	CT	CT	GG			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C|T	C|T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr8:144872533_144872534CT>GG	ENST00000320476.3	-	0	5143				SCRIB_ENST00000546337.1_5'Flank|RP11-429J17.8_ENST00000527139.1_RNA|RP11-429J17.8_ENST00000534089.1_RNA|RP11-429J17.8_ENST00000532625.1_RNA	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein						activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)				NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			TGGGAAGCCGCTGGTGTTCGAC	0.683																																					Pancreas(51;966 1133 10533 14576 29674)												0																																										SO:0001628	intergenic_variant	0			AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154	ENST00000320476.3:c.4891_4891delinsGG	8.37:g.144872533_144872534delinsGG			Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	RNA	SNP	-	NULL	ENST00000320476.3	37	NULL	CCDS6411.1	8																																																																																			RP11-429J17.8	-	-	ENSG00000214733		0.683	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENSG00000214733	Clone_based_vega_gene	protein_coding	OTTHUMT00000382215.1	-	0.00	48|47	0	C|T	NM_015356		144872533|144872534	+1	tier1	-	no_errors	ENST00000527139	ensembl	human	known	74_37	rna	6.56|6.35	114|118	8	SNP	0.991|0.998	G
AL391417.1	0	genome.wustl.edu	37	6	87183272	87183272	+	RNA	SNP	T	T	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr6:87183272T>C	ENST00000408174.1	-	0	41																											tacaacaTTTtggaggcccca	0.532																																																	0																																												0																															6.37:g.87183272T>C				RNA	SNP	-	NULL	ENST00000408174.1	37	NULL		6																																																																																			AL391417.1	-	-	ENSG00000221101		0.532	AL391417.1-201	NOVEL	basic	miRNA	ENSG00000221101	Clone_based_ensembl_gene	miRNA		-	0.00	106	0	T			87183272	-1	tier1	-	no_errors	ENST00000408174	ensembl	human	novel	74_37	rna	17.02	78	16	SNP	0.057	C
AC092724.1	0	genome.wustl.edu	37	16	77744272	77744272	+	RNA	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr16:77744272G>T	ENST00000408299.1	+	0	75																											ccaggaatctgcactttcaca	0.468																																																	0																																												0																															16.37:g.77744272G>T				RNA	SNP	-	NULL	ENST00000408299.1	37	NULL		16																																																																																			AC092724.1	-	-	ENSG00000221226		0.468	AC092724.1-201	NOVEL	basic	miRNA	ENSG00000221226	Clone_based_ensembl_gene	miRNA		-	0.00	28	0	G			77744272	+1	tier1	-	no_errors	ENST00000408299	ensembl	human	novel	74_37	rna	14.29	24	4	SNP	0.000	T
AC026781.1	0	genome.wustl.edu	37	5	92053169	92053169	+	RNA	SNP	G	G	A	rs2021050		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr5:92053169G>A	ENST00000408883.1	-	0	51																											gtgtgtgtgtgtgtgtatata	0.279																																																	0																																												0																															5.37:g.92053169G>A				RNA	SNP	-	NULL	ENST00000408883.1	37	NULL		5																																																																																			AC026781.1	-	-	ENSG00000221810		0.279	AC026781.1-201	NOVEL	basic	miRNA	ENSG00000221810	Clone_based_ensembl_gene	miRNA		-	0.00	26	0	G			92053169	-1	tier1	rs2021050	no_errors	ENST00000408883	ensembl	human	novel	74_37	rna	16.67	25	5	SNP	0.001	A
KRT16P6	353194	genome.wustl.edu	37	17	16722167	16722167	+	RNA	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr17:16722167G>A	ENST00000602730.1	+	0	6486				AC022596.6_ENST00000417510.1_RNA																							GAGAGGCTGTGAAGACAGAAA	0.592																																																	0																																												0																															17.37:g.16722167G>A				RNA	SNP	-	NULL	ENST00000602730.1	37	NULL		17																																																																																			AC022596.6	-	-	ENSG00000226145		0.592	RP11-219A15.4-001	KNOWN	basic|readthrough_transcript	processed_transcript	ENSG00000226145	Clone_based_vega_gene	processed_transcript	OTTHUMT00000468034.1	-	0.00	121	0	G			16722167	-1	tier1	-	no_errors	ENST00000417510	ensembl	human	known	74_37	rna	6.19	212	14	SNP	0.047	A
KRT16P6	353194	genome.wustl.edu	37	17	16722629	16722629	+	RNA	SNP	C	C	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr17:16722629C>T	ENST00000602730.1	+	0	6486				AC022596.6_ENST00000417510.1_RNA																							GCCAGAGCTCCGAAATCTCGC	0.567																																																	0																																												0																															17.37:g.16722629C>T				RNA	SNP	-	NULL	ENST00000602730.1	37	NULL		17																																																																																			AC022596.6	-	-	ENSG00000226145		0.567	RP11-219A15.4-001	KNOWN	basic|readthrough_transcript	processed_transcript	ENSG00000226145	Clone_based_vega_gene	processed_transcript	OTTHUMT00000468034.1	-	0.00	62	0	C			16722629	-1	tier1	-	no_errors	ENST00000417510	ensembl	human	known	74_37	rna	7.62	97	8	SNP	0.438	T
DLG5	9231	genome.wustl.edu	37	10	79551102	79551103	+	3'UTR	DEL	AA	AA	-	rs78250856		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	AA	AA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr10:79551102_79551103delAA	ENST00000372391.2	-	0	6860_6861				RP13-39P12.3_ENST00000601701.1_RNA|RP13-39P12.3_ENST00000434097.2_RNA|DLG5_ENST00000372388.2_3'UTR|DLG5_ENST00000459739.1_5'Flank	NM_004747.3	NP_004738.3	Q8TDM6	DLG5_HUMAN	discs, large homolog 5 (Drosophila)						apical protein localization (GO:0045176)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|intracellular signal transduction (GO:0035556)|metanephric collecting duct development (GO:0072205)|midbrain development (GO:0030901)|negative regulation of cell proliferation (GO:0008285)|polarized epithelial cell differentiation (GO:0030859)|protein complex assembly (GO:0006461)|protein localization to adherens junction (GO:0071896)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|zonula adherens assembly (GO:0045186)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cytoskeletal protein binding (GO:0008092)|receptor signaling complex scaffold activity (GO:0030159)			breast(9)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(17)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	60	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			TCAGAAGTGCAAAAAAAAAAAA	0.416																																																	0																																										SO:0001624	3_prime_UTR_variant	0			U61843	CCDS7353.2	10q23	2008-07-09	2001-11-28		ENSG00000151208	ENSG00000151208			2904	protein-coding gene	gene with protein product		604090	"""discs, large (Drosophila) homolog 5"""			9738934	Standard	XM_005270276		Approved	P-dlg, KIAA0583	uc001jzk.3	Q8TDM6	OTTHUMG00000018548	ENST00000372391.2:c.*1096TT>-	10.37:g.79551112_79551113delAA			A6H8Y3|Q149N1|Q5T1H7|Q5T1H8|Q6DKG3|Q86WC0|Q8TDM7|Q9UE73|Q9Y4E3	RNA	DEL	-	NULL	ENST00000372391.2	37	NULL	CCDS7353.2	10																																																																																			RP13-39P12.3	-	-	ENSG00000228748		0.416	DLG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000228748	Clone_based_vega_gene	protein_coding	OTTHUMT00000048900.2		0.00	36	0	AA			79551103	+1	tier1		no_errors	ENST00000601701	ensembl	human	known	74_37	rna	10.00	36	4	DEL	0.981:0.979	-
RP11-782C8.2	0	genome.wustl.edu	37	1	143196753	143196753	+	lincRNA	SNP	A	A	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr1:143196753A>G	ENST00000412204.2	-	0	1841				RP11-782C8.1_ENST00000438000.1_lincRNA																							CTTTAGCCAAATTGACACATT	0.323																																																	0																																												0																															1.37:g.143196753A>G				RNA	SNP	-	NULL	ENST00000412204.2	37	NULL		1																																																																																			RP11-782C8.2	-	-	ENSG00000232274		0.323	RP11-782C8.2-004	KNOWN	basic	lincRNA	ENSG00000232274	Clone_based_vega_gene	lincRNA	OTTHUMT00000037567.2	-	0.00	111	0	A			143196753	-1	tier1	-	no_errors	ENST00000412204	ensembl	human	known	74_37	rna	11.74	203	27	SNP	0.270	G
LOC101929268	101929268	genome.wustl.edu	37	8	49504162	49504162	+	lincRNA	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr8:49504162C>A	ENST00000430626.1	+	0	530				RP11-770E5.1_ENST00000522575.1_RNA																							GCCCTGTGTCCTGACACTATG	0.647																																																	0													34.0	37.0	36.0					8																	49504162		692	1591	2283			0																															8.37:g.49504162C>A				RNA	SNP	-	NULL	ENST00000430626.1	37	NULL		8																																																																																			AC026904.1	-	-	ENSG00000233858		0.647	AC026904.1-001	KNOWN	basic	lincRNA	ENSG00000233858	Clone_based_vega_gene	lincRNA	OTTHUMT00000280498.1	-	0.00	25	0	C			49504162	+1	tier1	-	no_errors	ENST00000430626	ensembl	human	known	74_37	rna	11.11	32	4	SNP	0.002	A
CTNNA2	1496	genome.wustl.edu	37	2	80831111	80831111	+	Intron	SNP	C	C	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr2:80831111C>T	ENST00000402739.4	+	15	2194				AC008067.2_ENST00000599412.2_RNA|CTNNA2_ENST00000361291.4_Intron|CTNNA2_ENST00000540488.1_Intron|CTNNA2_ENST00000496558.1_Intron|AC008067.2_ENST00000609950.1_RNA|CTNNA2_ENST00000343114.3_Intron|AC008067.2_ENST00000595478.1_RNA|CTNNA2_ENST00000466387.1_Intron|AC008067.2_ENST00000596887.1_RNA|AC008067.2_ENST00000596783.1_RNA|AC008067.2_ENST00000430876.1_RNA|CTNNA2_ENST00000541047.1_Intron	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2						axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						TAAAATACAACACTAGACTCC	0.368																																																	0																																										SO:0001627	intron_variant	0				CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.2190-88C>T	2.37:g.80831111C>T			B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	RNA	SNP	-	NULL	ENST00000402739.4	37	NULL		2																																																																																			AC008067.2	-	-	ENSG00000237031		0.368	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	ENSG00000237031	Clone_based_vega_gene	protein_coding	OTTHUMT00000328511.4	-	0.00	34	0	C	NM_004389		80831111	-1	tier1	-	no_errors	ENST00000596783	ensembl	human	known	74_37	rna	18.46	53	12	SNP	0.000	T
AC010874.1	0	genome.wustl.edu	37	Y	5742305	5742305	+	RNA	SNP	A	A	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chrY:5742305A>C	ENST00000516070.2	+	0	19																											ctggtgcgaaagtaattgtgt	0.308																																																	0																																												0																															Y.37:g.5742305A>C				RNA	SNP	-	NULL	ENST00000516070.2	37	NULL		Y																																																																																			AC010874.1	-	-	ENSG00000251879		0.308	AC010874.1-201	NOVEL	basic	miRNA	ENSG00000251879	Clone_based_ensembl_gene	miRNA		-	0.00	20	0	A			5742305	+1	tier1	-	no_errors	ENST00000516070	ensembl	human	novel	74_37	rna	32.31	44	21	SNP	0.999	C
EP300	2033	genome.wustl.edu	37	22	41565565	41565565	+	Missense_Mutation	SNP	A	A	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr22:41565565A>G	ENST00000263253.7	+	26	5450	c.4231A>G	c.(4231-4233)Act>Gct	p.T1411A	RNU6-375P_ENST00000517050.1_RNA|RP1-85F18.6_ENST00000415054.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	1411	Acetyl-CoA binding. {ECO:0000269|PubMed:24819397}.|CBP/p300-type HAT. {ECO:0000255|PROSITE- ProRule:PRU01065}.				apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						ATGCTTGAGGACTGCAGTCTA	0.328			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																															Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	0													94.0	91.0	92.0					22																	41565565		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Broad Thumb-Hallux syndrome	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.4231A>G	22.37:g.41565565A>G	ENSP00000263253:p.Thr1411Ala		B1AKC2	Missense_Mutation	SNP	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX_dom,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX_dom,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX_dom,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.T1411A	ENST00000263253.7	37	c.4231	CCDS14010.1	22	.	.	.	.	.	.	.	.	.	.	A	22.2	4.259523	0.80246	.	.	ENSG00000100393	ENST00000263253	D	0.94138	-3.36	5.55	5.55	0.83447	.	0.000000	0.46758	D	0.000274	D	0.97794	0.9276	H	0.95884	3.735	0.53688	D	0.999972	D	0.69078	0.997	D	0.80764	0.994	D	0.99146	1.0857	10	0.87932	D	0	-9.8464	15.6988	0.77521	1.0:0.0:0.0:0.0	.	1411	Q09472	EP300_HUMAN	A	1411	ENSP00000263253:T1411A	ENSP00000263253:T1411A	T	+	1	0	EP300	39895511	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.237000	0.95368	2.115000	0.64714	0.455000	0.32223	ACT	EP300	-	pfam_Histone_H3-K56_AcTrfase_RTT109	ENSG00000100393		0.328	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EP300	HGNC	protein_coding	OTTHUMT00000320600.1	-	0.00	18	0	A	NM_001429		41565565	+1	tier1	-	no_errors	ENST00000263253	ensembl	human	known	74_37	missense	20.00	48	12	SNP	1.000	G
EPHX3	79852	genome.wustl.edu	37	19	15342090	15342090	+	Silent	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr19:15342090G>A	ENST00000221730.3	-	3	667	c.447C>T	c.(445-447)gaC>gaT	p.D149D	EPHX3_ENST00000602233.1_Silent_p.D149D|EPHX3_ENST00000435261.1_Silent_p.D149D	NM_024794.2	NP_079070.1	Q9H6B9	EPHX3_HUMAN	epoxide hydrolase 3	149						extracellular region (GO:0005576)	hydrolase activity (GO:0016787)			endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)|skin(1)	7						CCAGCAGCAGGTCGATTGTGT	0.602																																																	0													102.0	99.0	100.0					19																	15342090		2203	4300	6503	SO:0001819	synonymous_variant	0			AK026061	CCDS12327.1	19p13.13	2011-10-05	2009-04-06	2009-04-06	ENSG00000105131	ENSG00000105131		"""Abhydrolase domain containing"""	23760	protein-coding gene	gene with protein product			"""abhydrolase domain containing 9"""	ABHD9			Standard	NM_024794		Approved	FLJ22408	uc002nap.3	Q9H6B9		ENST00000221730.3:c.447C>T	19.37:g.15342090G>A			A3KMR3	Silent	SNP	pfam_AB_hydrolase_1,prints_Epox_hydrolase-like,prints_AB_hydrolase_1	p.D149	ENST00000221730.3	37	c.447	CCDS12327.1	19																																																																																			EPHX3	-	pfam_AB_hydrolase_1	ENSG00000105131		0.602	EPHX3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	EPHX3	HGNC	protein_coding	OTTHUMT00000465797.1	-	0.00	16	0	G	NM_024794		15342090	-1	tier1	-	no_errors	ENST00000221730	ensembl	human	known	74_37	silent	20.69	23	6	SNP	0.198	A
ERBB4	2066	genome.wustl.edu	37	2	212566719	212566719	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr2:212566719G>A	ENST00000342788.4	-	12	1772	c.1462C>T	c.(1462-1464)Cgg>Tgg	p.R488W	ERBB4_ENST00000436443.1_Missense_Mutation_p.R488W|ERBB4_ENST00000402597.1_Missense_Mutation_p.R488W	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	488					cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	CTGTTGTCCCGGATTACTATT	0.343										TSP Lung(8;0.080)																																							0													141.0	133.0	136.0					2																	212566719		2203	4300	6503	SO:0001583	missense	0			L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.1462C>T	2.37:g.212566719G>A	ENSP00000342235:p.Arg488Trp		B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R488W	ENST00000342788.4	37	c.1462	CCDS2394.1	2	.	.	.	.	.	.	.	.	.	.	G	22.5	4.292624	0.80914	.	.	ENSG00000178568	ENST00000342788;ENST00000436443;ENST00000402597	T;T;T	0.75589	-0.94;-0.95;-0.95	5.71	5.71	0.89125	.	0.168444	0.52532	D	0.000073	T	0.81019	0.4736	L	0.56769	1.78	0.58432	D	0.999993	D;D;D;D;D	0.65815	0.995;0.992;0.99;0.995;0.991	P;P;P;P;P	0.53035	0.583;0.716;0.472;0.583;0.575	T	0.81724	-0.0802	10	0.59425	D	0.04	.	19.8769	0.96880	0.0:0.0:1.0:0.0	.	488;488;347;488;488	Q15303-4;Q15303-2;Q53QS8;Q15303-3;Q15303	.;.;.;.;ERBB4_HUMAN	W	488	ENSP00000342235:R488W;ENSP00000403204:R488W;ENSP00000385565:R488W	ENSP00000342235:R488W	R	-	1	2	ERBB4	212274964	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.318000	0.79029	2.712000	0.92718	0.650000	0.86243	CGG	ERBB4	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt	ENSG00000178568		0.343	ERBB4-001	KNOWN	basic|CCDS	protein_coding	ERBB4	HGNC	protein_coding	OTTHUMT00000256597.1	-	0.00	38	0	G	NM_001042599		212566719	-1	tier1	-	no_errors	ENST00000342788	ensembl	human	known	74_37	missense	24.39	62	20	SNP	1.000	A
F2R	2149	genome.wustl.edu	37	5	76028843	76028843	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr5:76028843G>T	ENST00000319211.4	+	2	1058	c.793G>T	c.(793-795)Ggc>Tgc	p.G265C		NM_001992.3	NP_001983.2	P25116	PAR1_HUMAN	coagulation factor II (thrombin) receptor	265					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPKK activity (GO:0000186)|anatomical structure morphogenesis (GO:0009653)|blood coagulation (GO:0007596)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|establishment of synaptic specificity at neuromuscular junction (GO:0007529)|G-protein coupled receptor signaling pathway (GO:0007186)|homeostasis of number of cells within a tissue (GO:0048873)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of renin secretion into blood stream (GO:1900134)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|platelet dense granule organization (GO:0060155)|positive regulation of blood coagulation (GO:0030194)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasoconstriction (GO:0045907)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of blood coagulation (GO:0030193)|regulation of interleukin-1 beta production (GO:0032651)|regulation of sensory perception of pain (GO:0051930)|release of sequestered calcium ion into cytosol (GO:0051209)|response to lipopolysaccharide (GO:0032496)|response to wounding (GO:0009611)|STAT protein import into nucleus (GO:0007262)|tyrosine phosphorylation of STAT protein (GO:0007260)	caveola (GO:0005901)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|platelet dense tubular network (GO:0031094)|postsynaptic membrane (GO:0045211)	G-protein alpha-subunit binding (GO:0001965)|G-protein beta-subunit binding (GO:0031681)|G-protein coupled receptor activity (GO:0004930)|receptor binding (GO:0005102)|thrombin receptor activity (GO:0015057)	p.G265C(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|lung(7)|ovary(3)	16		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Prostate(461;0.00955)|Ovarian(174;0.0129)		all cancers(79;4.43e-43)	Streptokinase(DB00086)	CCTGCTCGAAGGCTACTATGC	0.502																																																	1	Substitution - Missense(1)	lung(1)											129.0	134.0	132.0					5																	76028843		2203	4300	6503	SO:0001583	missense	0			M62424	CCDS4032.1	5q13	2012-08-08			ENSG00000181104	ENSG00000181104		"""GPCR / Class A : Protease activated receptors"""	3537	protein-coding gene	gene with protein product		187930				8395910	Standard	NM_001992		Approved	TR, CF2R, PAR1, PAR-1	uc003ken.4	P25116	OTTHUMG00000131299	ENST00000319211.4:c.793G>T	5.37:g.76028843G>T	ENSP00000321326:p.Gly265Cys		Q53XV0|Q96RF7|Q9BUN4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Thrmbn_rcpt,prints_GPCR_Rhodpsn,prints_Protea_act_rcpt	p.G265C	ENST00000319211.4	37	c.793	CCDS4032.1	5	.	.	.	.	.	.	.	.	.	.	G	15.57	2.872623	0.51695	.	.	ENSG00000181104	ENST00000319211	T	0.37411	1.2	4.71	3.75	0.43078	GPCR, rhodopsin-like superfamily (1);	0.680368	0.15730	N	0.247482	T	0.53514	0.1801	M	0.74647	2.275	0.33361	D	0.572296	D	0.76494	0.999	D	0.65323	0.934	T	0.62882	-0.6760	10	0.40728	T	0.16	-24.3362	8.3041	0.32032	0.273:0.0:0.727:0.0	.	265	P25116	PAR1_HUMAN	C	265	ENSP00000321326:G265C	ENSP00000321326:G265C	G	+	1	0	F2R	76064599	0.000000	0.05858	0.430000	0.26722	0.965000	0.64279	0.456000	0.21859	1.189000	0.43028	0.561000	0.74099	GGC	F2R	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000181104		0.502	F2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F2R	HGNC	protein_coding	OTTHUMT00000254068.2		0.00	14	0	G			76028843	+1			no_errors	ENST00000319211	ensembl	human	known	74_37	missense	9.52	19	2	SNP	0.278	T
F5	2153	genome.wustl.edu	37	1	169513762	169513762	+	Splice_Site	SNP	C	C	G	rs528213970		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr1:169513762C>G	ENST00000367796.3	-	12	1964		c.e12-1		F5_ENST00000367797.3_Intron			P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)						blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	AGTGTAAAATCTGTTAAAATT	0.388													N|||	1	0.000199681	0.0	0.0	5008	,	,		20641	0.0		0.0	False		,,,				2504	0.001																0													41.0	38.0	39.0					1																	169513762		2203	4300	6503	SO:0001630	splice_region_variant	0			M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367796.3:c.1763-1G>C	1.37:g.169513762C>G			A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Splice_Site	SNP	-	e12-1	ENST00000367796.3	37	c.1763-1		1	.	.	.	.	.	.	.	.	.	.	C	3.497	-0.102714	0.06967	.	.	ENSG00000198734	ENST00000367796	.	.	.	5.03	-1.64	0.08318	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.8402	0.01148	0.2524:0.3543:0.1128:0.2805	.	.	.	.	.	-1	.	.	.	-	.	.	F5	167780386	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.137000	0.03219	-0.507000	0.06549	-0.274000	0.10170	.	F5	-	-	ENSG00000198734		0.388	F5-002	NOVEL	not_organism_supported|basic|appris_candidate_longest	protein_coding	F5	HGNC	protein_coding	OTTHUMT00000083713.1	-	0.00	23	0	C	NM_000130	Intron	169513762	-1	tier1	-	no_errors	ENST00000367796	ensembl	human	novel	74_37	splice_site	23.08	19	6	SNP	0.000	G
FAM129A	116496	genome.wustl.edu	37	1	184764681	184764681	+	Missense_Mutation	SNP	G	G	T	rs35545276	byFrequency	TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr1:184764681G>T	ENST00000367511.3	-	14	2410	c.2217C>A	c.(2215-2217)caC>caA	p.H739Q	FAM129A_ENST00000487074.1_5'UTR	NM_052966.2	NP_443198.1	Q9BZQ8	NIBAN_HUMAN	family with sequence similarity 129, member A	739	Glu-rich.				negative regulation of protein phosphorylation (GO:0001933)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(6)|liver(1)|lung(22)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	45						CTTGGGGAACGTGGCTCTCCC	0.532																																																	0													127.0	135.0	132.0					1																	184764681		2203	4300	6503	SO:0001583	missense	0			AF288391	CCDS1364.1	1q25	2008-10-08	2006-11-23	2006-11-23	ENSG00000135842	ENSG00000135842			16784	protein-coding gene	gene with protein product	"""cell growth inhibiting protein 39"""		"""chromosome 1 open reading frame 24"""	C1orf24		15085203, 16444351	Standard	NM_052966		Approved	NIBAN, GIG39	uc001gra.4	Q9BZQ8	OTTHUMG00000035388	ENST00000367511.3:c.2217C>A	1.37:g.184764681G>T	ENSP00000356481:p.His739Gln		Q2TTR2|Q5TEM8|Q8TEI5|Q9H593|Q9H9Y8|Q9HCB9	Missense_Mutation	SNP	NULL	p.H739Q	ENST00000367511.3	37	c.2217	CCDS1364.1	1	.	.	.	.	.	.	.	.	.	.	G	7.537	0.659871	0.14645	.	.	ENSG00000135842	ENST00000367511	T	0.09163	3.01	5.44	-5.59	0.02505	.	2.525960	0.01511	N	0.017944	T	0.05181	0.0138	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.37842	-0.9688	10	0.13108	T	0.6	0.297	9.4901	0.38953	0.3787:0.4809:0.1404:0.0	.	739	Q9BZQ8	NIBAN_HUMAN	Q	739	ENSP00000356481:H739Q	ENSP00000356481:H739Q	H	-	3	2	FAM129A	183031304	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-1.224000	0.02959	-0.570000	0.06022	-0.658000	0.03865	CAC	FAM129A	-	NULL	ENSG00000135842		0.532	FAM129A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM129A	HGNC	protein_coding	OTTHUMT00000085786.1		0.00	22	0	G			184764681	-1			no_errors	ENST00000367511	ensembl	human	known	74_37	missense	9.09	40	4	SNP	0.000	T
FAM135B	51059	genome.wustl.edu	37	8	139160865	139160865	+	Missense_Mutation	SNP	A	A	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr8:139160865A>C	ENST00000395297.1	-	14	3516	c.3346T>G	c.(3346-3348)Tta>Gta	p.L1116V		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	1116										NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			AGTACAGTTAAGTCACTGTAC	0.378										HNSCC(54;0.14)																																							0													94.0	85.0	88.0					8																	139160865		2203	4300	6503	SO:0001583	missense	0			AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.3346T>G	8.37:g.139160865A>C	ENSP00000378710:p.Leu1116Val		B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	pfam_DUF676_lipase-like,pfam_DUF3657,pfam_PGAP1-like	p.L1116V	ENST00000395297.1	37	c.3346	CCDS6375.2	8	.	.	.	.	.	.	.	.	.	.	A	12.94	2.087593	0.36855	.	.	ENSG00000147724	ENST00000395297	T	0.15834	2.39	5.78	4.61	0.57282	.	0.168206	0.39274	N	0.001417	T	0.20536	0.0494	L	0.38531	1.155	0.34370	D	0.691972	B;D	0.76494	0.36;0.999	B;D	0.63793	0.22;0.918	T	0.24835	-1.0149	10	0.02654	T	1	-1.2126	7.002	0.24815	0.7751:0.1509:0.074:0.0	.	1116;1116	Q49AJ0-4;Q49AJ0	.;F135B_HUMAN	V	1116	ENSP00000378710:L1116V	ENSP00000378710:L1116V	L	-	1	2	FAM135B	139230047	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	2.665000	0.46791	0.994000	0.38892	-0.323000	0.08544	TTA	FAM135B	-	NULL	ENSG00000147724		0.378	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM135B	HGNC	protein_coding	OTTHUMT00000313590.3		0.00	49	0	A	NM_015912		139160865	-1			no_errors	ENST00000395297	ensembl	human	known	74_37	missense	13.75	69	11	SNP	1.000	C
FAM138B	654412	genome.wustl.edu	37	2	114336404	114336404	+	lincRNA	DEL	A	A	-			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr2:114336404delA	ENST00000432583.2	+	0	1207									family with sequence similarity 138, member B																		agtgagaaataaacttccatt	0.403																																																	0																																												0					2q13	2013-01-30			ENSG00000226516	ENSG00000226516		"""Long non-coding RNAs"""	33582	non-coding RNA	RNA, long non-coding						11779631, 15233989	Standard	NR_026821		Approved	F379	uc002tjz.3		OTTHUMG00000047820		2.37:g.114336404delA				RNA	DEL	-	NULL	ENST00000432583.2	37	NULL		2																																																																																			FAM138B	-	-	ENSG00000226516		0.403	FAM138B-002	KNOWN	basic	lincRNA	FAM138B	HGNC	lincRNA	OTTHUMT00000109027.3		0.00	10	0	A	NR_026821		114336404	+1			no_errors	ENST00000432583	ensembl	human	known	74_37	rna	22.22	7	2	DEL	0.000	0
FAM149B1	317662	genome.wustl.edu	37	10	74992864	74992864	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr10:74992864G>T	ENST00000242505.6	+	10	1469	c.1295G>T	c.(1294-1296)aGc>aTc	p.S432I		NM_173348.1	NP_775483.1	Q96BN6	F149B_HUMAN	family with sequence similarity 149, member B1	432										breast(2)|endometrium(1)|kidney(1)|stomach(3)	7						ATCAGCACGAGCCATTCATGT	0.478																																																	0													52.0	46.0	48.0					10																	74992864		692	1591	2283	SO:0001583	missense	0			AB023191	CCDS44435.1	10q22.2	2008-10-27	2007-11-14	2007-11-14	ENSG00000138286	ENSG00000138286			29162	protein-coding gene	gene with protein product			"""KIAA0974"""	KIAA0974		10231032	Standard	NM_173348		Approved		uc009xqz.3	Q96BN6	OTTHUMG00000067794	ENST00000242505.6:c.1295G>T	10.37:g.74992864G>T	ENSP00000242505:p.Ser432Ile		Q9Y2I0	Missense_Mutation	SNP	pfam_DUF3719	p.S432I	ENST00000242505.6	37	c.1295	CCDS44435.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.02|18.02	3.530180|3.530180	0.64860|0.64860	.|.	.|.	ENSG00000138286|ENSG00000138286	ENST00000372955|ENST00000242505;ENST00000429173;ENST00000445951	.|T;T	.|0.50813	.|0.73;0.73	5.92|5.92	5.92|5.92	0.95590|0.95590	.|.	.|0.130243	.|0.64402	.|D	.|0.000001	T|T	0.65207|0.65207	0.2669|0.2669	M|M	0.64997|0.64997	1.995|1.995	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.71674	.|0.998;0.995;0.995;0.997	.|D;D;P;D	.|0.65987	.|0.924;0.913;0.873;0.94	T|T	0.66031|0.66031	-0.6024|-0.6024	5|10	.|0.72032	.|D	.|0.01	-2.003|-2.003	15.8168|15.8168	0.78608|0.78608	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|410;222;432;424	.|B4E0M2;B3KN32;Q96BN6;Q96BN6-2	.|.;.;F149B_HUMAN;.	S|I	365|432;222;227	.|ENSP00000242505:S432I;ENSP00000402293:S227I	.|ENSP00000242505:S432I	A|S	+|+	1|2	0|0	FAM149B1|FAM149B1	74662870|74662870	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.319000|0.319000	0.28217|0.28217	2.800000|2.800000	0.47900|0.47900	2.809000|2.809000	0.96659|0.96659	0.557000|0.557000	0.71058|0.71058	GCC|AGC	FAM149B1	-	NULL	ENSG00000138286		0.478	FAM149B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM149B1	HGNC	protein_coding	OTTHUMT00000145438.1	-	0.00	28	0	G	NM_173348		74992864	+1	tier1	-	no_errors	ENST00000242505	ensembl	human	known	74_37	missense	26.83	30	11	SNP	1.000	T
FAM182A	284800	genome.wustl.edu	37	20	26061832	26061832	+	RNA	SNP	A	A	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr20:26061832A>C	ENST00000376398.2	+	0	852					NR_026713.1		Q5T1J6	F182A_HUMAN	family with sequence similarity 182, member A											breast(1)|endometrium(2)|kidney(1)	4						AGAAATGGTGAGAGAACTTTG	0.473																																																	0													20.0	16.0	17.0					20																	26061832		692	1588	2280			0			AL391119		20p11	2013-03-18	2008-08-05	2008-08-05	ENSG00000125804	ENSG00000125804			16222	other	unknown			"""chromosome 20 open reading frame 91"""	C20orf91			Standard	NR_026713		Approved	bB329D4.1, C20orf91A	uc010gdq.3	Q5T1J6	OTTHUMG00000032144		20.37:g.26061832A>C			A2RRD0|Q8N947	RNA	SNP	-	NULL	ENST00000376398.2	37	NULL		20																																																																																			FAM182A	-	-	ENSG00000125804		0.473	FAM182A-001	KNOWN	basic	lincRNA	FAM182A	HGNC	processed_transcript	OTTHUMT00000078473.2	-	0.00	47	0	A			26061832	+1	tier1	-	no_errors	ENST00000376398	ensembl	human	known	74_37	rna	5.32	89	5	SNP	0.200	C
FAM209B	388799	genome.wustl.edu	37	20	55108439	55108439	+	Silent	SNP	C	C	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr20:55108439C>G	ENST00000371325.1	+	1	138	c.42C>G	c.(40-42)ctC>ctG	p.L14L		NM_001013646.2	NP_001013668.2	Q5JX69	F209B_HUMAN	family with sequence similarity 209, member B	14						integral component of membrane (GO:0016021)|nucleus (GO:0005634)											TTCTGTGCCTCACCTGCAGCT	0.557																																																	0													94.0	85.0	88.0					20																	55108439		2203	4296	6499	SO:0001819	synonymous_variant	0			AL109806	CCDS33494.1	20q13.31	2011-11-24	2011-11-24	2011-11-24	ENSG00000213714	ENSG00000213714			16101	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 107"""	C20orf107			Standard	NM_001013646		Approved	dJ1153D9.4	uc002xxz.4	Q5JX69	OTTHUMG00000032800	ENST00000371325.1:c.42C>G	20.37:g.55108439C>G			Q3KRB5	Silent	SNP	NULL	p.L14	ENST00000371325.1	37	c.42	CCDS33494.1	20																																																																																			FAM209B	-	NULL	ENSG00000213714		0.557	FAM209B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM209B	HGNC	protein_coding	OTTHUMT00000079816.1	-	0.00	40	0	C			55108439	+1	tier1	-	no_errors	ENST00000371325	ensembl	human	known	74_37	silent	13.33	52	8	SNP	0.000	G
FAM214A	56204	genome.wustl.edu	37	15	52970255	52970255	+	5'UTR	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr15:52970255G>A	ENST00000261844.7	-	0	116				FAM214A_ENST00000562351.1_5'UTR	NM_019600.2	NP_062546.2	Q32MH5	F214A_HUMAN	family with sequence similarity 214, member A																		GCTGTGAAATGCACCTGTGGG	0.448																																																	0													85.0	86.0	86.0					15																	52970255		1864	4087	5951	SO:0001623	5_prime_UTR_variant	0			AB037791	CCDS45263.1, CCDS66773.1	15q21.2-q21.3	2011-12-01	2011-12-01	2011-12-01	ENSG00000047346	ENSG00000047346			25609	protein-coding gene	gene with protein product			"""KIAA1370"""	KIAA1370		10718198	Standard	XM_005254547		Approved	FLJ10980	uc002acg.4	Q32MH5		ENST00000261844.7:c.-37C>T	15.37:g.52970255G>A			A8KA52|B4DEP5|B4DF40|F5H8G0|Q32MH6|Q4G0R7|Q5XJ16|Q6PDA3|Q9NV24|Q9P2H7	RNA	SNP	-	NULL	ENST00000261844.7	37	NULL	CCDS45263.1	15																																																																																			FAM214A	-	-	ENSG00000047346		0.448	FAM214A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM214A	HGNC	protein_coding	OTTHUMT00000419914.1	-	0.00	33	0	G	NM_019600		52970255	-1	tier1	-	no_errors	ENST00000562351	ensembl	human	putative	74_37	rna	17.02	38	8	SNP	0.001	A
FER1L4	80307	genome.wustl.edu	37	20	34164370	34164370	+	IGR	SNP	C	C	T	rs570952152		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr20:34164370C>T								ERGIC3 (18965 upstream) : FER1L4 (5670 downstream)																							CCCTTGCCCTCGGTACAGAGG	0.517													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19144	0.0		0.0	False		,,,				2504	0.0																0																																										SO:0001628	intergenic_variant	0																															20.37:g.34164370C>T				RNA	SNP	-	NULL		37	NULL		20																																																																																			FER1L4	-	-	ENSG00000088340	0	0.517					FER1L4	HGNC			-	0.00	46	0	C			34164370	-1	tier1	-	no_errors	ENST00000440443	ensembl	human	known	74_37	rna	9.41	77	8	SNP	1.000	T
FGFR1	2260	genome.wustl.edu	37	8	38287203	38287203	+	Missense_Mutation	SNP	A	A	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr8:38287203A>C	ENST00000447712.2	-	3	1296	c.355T>G	c.(355-357)Tca>Gca	p.S119A	FGFR1_ENST00000356207.5_Intron|FGFR1_ENST00000341462.5_Missense_Mutation_p.S119A|FGFR1_ENST00000397103.1_Intron|FGFR1_ENST00000532791.1_Missense_Mutation_p.S119A|FGFR1_ENST00000397108.4_Missense_Mutation_p.S119A|FGFR1_ENST00000326324.6_Intron|FGFR1_ENST00000335922.5_Missense_Mutation_p.S111A|FGFR1_ENST00000397091.5_Missense_Mutation_p.S119A|FGFR1_ENST00000397113.2_Missense_Mutation_p.S119A|FGFR1_ENST00000425967.3_Missense_Mutation_p.S152A	NM_001174063.1|NM_015850.3|NM_023110.2	NP_001167534.1|NP_056934.2|NP_075598.2	P11362	FGFR1_HUMAN	fibroblast growth factor receptor 1	119	Ig-like C2-type 1.				angiogenesis (GO:0001525)|auditory receptor cell development (GO:0060117)|axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell maturation (GO:0048469)|cell migration (GO:0016477)|chondrocyte differentiation (GO:0002062)|chordate embryonic development (GO:0043009)|embryonic limb morphogenesis (GO:0030326)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lung-associated mesenchyme development (GO:0060484)|MAPK cascade (GO:0000165)|mesenchymal cell differentiation (GO:0048762)|midbrain development (GO:0030901)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|outer ear morphogenesis (GO:0042473)|paraxial mesoderm development (GO:0048339)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)|regulation of cell differentiation (GO:0045595)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of lateral mesodermal cell fate specification (GO:0048378)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ventricular zone neuroblast division (GO:0021847)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)		FGFR1/ZNF703(2)	breast(2)|central_nervous_system(7)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	50	all_cancers(2;9.05e-47)|all_epithelial(2;2.64e-50)|all_lung(3;1.71e-23)|Lung NSC(2;3.61e-23)|Colorectal(12;0.000442)	Breast(189;1.48e-05)|all_lung(54;0.00354)|Lung NSC(58;0.0138)|Hepatocellular(245;0.065)	Epithelial(3;3.96e-34)|all cancers(3;3.06e-30)|BRCA - Breast invasive adenocarcinoma(5;2.28e-21)|COAD - Colon adenocarcinoma(9;0.24)		Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	TACCAACCTGAAACATTGACG	0.632		1	T	"""BCR, FOP, ZNF198, CEP1"""	"""MPD, NHL"""		"""Pfeiffer syndrome, Kallman syndrome"""																														Melanoma(146;1153 1840 21453 21841 43625)			Dom	yes		8	8p11.2-p11.1	2260	fibroblast growth factor receptor 1	yes	L	0													78.0	67.0	70.0					8																	38287203		2197	4290	6487	SO:0001583	missense	0			M34185	CCDS6107.2, CCDS43730.1, CCDS43731.1, CCDS43732.1, CCDS55221.1, CCDS55222.1, CCDS55223.1	8p11.23-p11.22	2014-04-03	2008-08-01		ENSG00000077782	ENSG00000077782	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3688	protein-coding gene	gene with protein product	"""Pfeiffer syndrome"""	136350	"""fms-related tyrosine kinase 2"""	FLT2, KAL2		2162671	Standard	NM_015850		Approved	H2, H3, H4, H5, CEK, FLG, BFGFR, N-SAM, CD331	uc011lbu.2	P11362	OTTHUMG00000147366	ENST00000447712.2:c.355T>G	8.37:g.38287203A>C	ENSP00000400162:p.Ser119Ala		A8K6T9|A8K8V5|C1KBH8|P17049|Q02063|Q02065|Q14306|Q14307|Q53H63|Q59H40|Q5BJG2|Q8N685|Q9UD50|Q9UDF0|Q9UDF1|Q9UDF2	Missense_Mutation	SNP	pirsf_FGF_rcpt_fam,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.S152A	ENST00000447712.2	37	c.454	CCDS6107.2	8	.	.	.	.	.	.	.	.	.	.	A	14.23	2.473115	0.43942	.	.	ENSG00000077782	ENST00000397091;ENST00000425967;ENST00000447712;ENST00000341462;ENST00000310729;ENST00000532791;ENST00000397113;ENST00000335922;ENST00000397108;ENST00000326296;ENST00000525001	T;T;T;T;T;T;T;T;T	0.79247	-1.25;-1.25;-1.25;-1.25;-1.25;-1.25;-1.25;-1.25;-1.25	5.16	5.16	0.70880	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.392064	0.26510	N	0.023978	T	0.71962	0.3402	L	0.45581	1.43	0.43164	D	0.99495	B;B;B;B;B	0.24920	0.114;0.114;0.07;0.114;0.114	B;B;B;B;B	0.24394	0.036;0.036;0.016;0.053;0.036	T	0.68507	-0.5390	10	0.30854	T	0.27	.	14.9947	0.71421	1.0:0.0:0.0:0.0	.	119;152;119;111;119	P11362-7;P11362-21;P11362;P11362-20;P11362-2	.;.;FGFR1_HUMAN;.;.	A	119;152;119;119;119;119;119;111;119;119;119	ENSP00000380280:S119A;ENSP00000393312:S152A;ENSP00000400162:S119A;ENSP00000340636:S119A;ENSP00000432972:S119A;ENSP00000380302:S119A;ENSP00000337247:S111A;ENSP00000380297:S119A;ENSP00000434712:S119A	ENSP00000311337:S119A	S	-	1	0	FGFR1	38406360	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.923000	0.48868	1.953000	0.56701	0.379000	0.24179	TCA	FGFR1	-	pirsf_FGF_rcpt_fam,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000077782		0.632	FGFR1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FGFR1	HGNC	protein_coding		-	0.00	47	0	A			38287203	-1	tier1	-	no_errors	ENST00000425967	ensembl	human	known	74_37	missense	12.50	84	12	SNP	1.000	C
FGG	2266	genome.wustl.edu	37	4	155528013	155528013	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr4:155528013G>A	ENST00000336098.3	-	8	1011	c.973C>T	c.(973-975)Cct>Tct	p.P325S	FGG_ENST00000404648.3_Missense_Mutation_p.P325S|FGG_ENST00000405164.1_Missense_Mutation_p.P333S|FGG_ENST00000407946.1_Missense_Mutation_p.P333S	NM_021870.2	NP_068656.2	P02679	FIBG_HUMAN	fibrinogen gamma chain	325	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(9)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	TTGTCACTAGGATCATCGCCA	0.473																																																	0													254.0	224.0	234.0					4																	155528013		2203	4300	6503	SO:0001583	missense	0				CCDS3788.1, CCDS47153.1	4q28	2014-09-17			ENSG00000171557	ENSG00000171557		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3694	protein-coding gene	gene with protein product		134850	"""fibrinogen, gamma polypeptide"""				Standard	NM_000509		Approved		uc003ioj.3	P02679	OTTHUMG00000150329	ENST00000336098.3:c.973C>T	4.37:g.155528013G>A	ENSP00000336829:p.Pro325Ser		A8K057|P04469|P04470|Q53Y18|Q96A14|Q96KJ3|Q9UC62|Q9UC63|Q9UCF3	Missense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C_dom,pfam_Fibrinogen_a/b/g_coil_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	p.P325S	ENST00000336098.3	37	c.973	CCDS3788.1	4	.	.	.	.	.	.	.	.	.	.	G	12.41	1.929911	0.34096	.	.	ENSG00000171557	ENST00000404648;ENST00000405164;ENST00000336098;ENST00000407946	T;T;T;T	0.74632	-0.86;-0.86;-0.86;-0.86	5.79	1.55	0.23275	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 2 (1);	0.151034	0.64402	N	0.000010	T	0.66954	0.2842	M	0.78801	2.425	0.58432	D	0.999999	B;P;P;P;P	0.40602	0.247;0.637;0.723;0.723;0.676	B;B;B;B;B	0.38327	0.187;0.187;0.271;0.271;0.177	T	0.59037	-0.7529	10	0.16420	T	0.52	.	5.8618	0.18752	0.0749:0.293:0.5098:0.1223	.	222;333;325;333;325	D3DP16;C9JC84;P02679;C9JEU5;P02679-2	.;.;FIBG_HUMAN;.;.	S	325;333;325;333	ENSP00000384860:P325S;ENSP00000384101:P333S;ENSP00000336829:P325S;ENSP00000384552:P333S	ENSP00000336829:P325S	P	-	1	0	FGG	155747463	1.000000	0.71417	0.997000	0.53966	0.568000	0.35870	0.988000	0.29616	0.215000	0.20761	0.650000	0.86243	CCT	FGG	-	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	ENSG00000171557		0.473	FGG-002	KNOWN	basic|CCDS	protein_coding	FGG	HGNC	protein_coding	OTTHUMT00000317581.1	-	0.00	51	0	G	NM_021870		155528013	-1	tier1	-	no_errors	ENST00000336098	ensembl	human	known	74_37	missense	13.92	68	11	SNP	1.000	A
FHAD1	114827	genome.wustl.edu	37	1	15653613	15653613	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr1:15653613G>T	ENST00000375998.4	+	11	1532	c.1532G>T	c.(1531-1533)cGg>cTg	p.R511L	FHAD1_ENST00000375999.3_Missense_Mutation_p.R511L|FHAD1_ENST00000358897.4_Missense_Mutation_p.R511L|FHAD1_ENST00000401090.2_Missense_Mutation_p.R181L|FHAD1_ENST00000375995.3_Missense_Mutation_p.R116L|FHAD1_ENST00000417793.1_Missense_Mutation_p.R511L|RP3-467K16.2_ENST00000428747.1_RNA			B1AJZ9	FHAD1_HUMAN	forkhead-associated (FHA) phosphopeptide binding domain 1	511										skin(1)|stomach(1)	2						AAGCCGTTCCGGGACAAGCCC	0.592																																																	0													29.0	35.0	33.0					1																	15653613		692	1591	2283	SO:0001583	missense	0			AK093300		1p36.21	2012-04-19			ENSG00000142621	ENSG00000142621			29408	protein-coding gene	gene with protein product						11572484	Standard	NM_052929		Approved	KIAA1937	uc001awb.2	B1AJZ9	OTTHUMG00000002088	ENST00000375998.4:c.1532G>T	1.37:g.15653613G>T	ENSP00000365166:p.Arg511Leu		Q0P6F5|Q8N8D3|Q8N9T6|Q8NA05	Missense_Mutation	SNP	pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.R511L	ENST00000375998.4	37	c.1532		1	.	.	.	.	.	.	.	.	.	.	g	4.769	0.142983	0.09083	.	.	ENSG00000142621	ENST00000358897;ENST00000417793;ENST00000375999;ENST00000375998;ENST00000524761;ENST00000375995;ENST00000401090	D;D;D;D;D;D;D	0.84070	-1.8;-1.8;-1.8;-1.8;-1.8;-1.8;-1.8	5.38	-5.59	0.02505	.	1.282430	0.05324	N	0.527087	T	0.63105	0.2483	N	0.14661	0.345	0.24000	N	0.99621	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.46582	-0.9181	10	0.24483	T	0.36	-2.5532	3.6575	0.08226	0.2068:0.5018:0.1655:0.1259	.	511;202	B1AJZ9;B1AJZ8	FHAD1_HUMAN;.	L	511;511;511;511;67;116;181	ENSP00000351770:R511L;ENSP00000407615:R511L;ENSP00000365167:R511L;ENSP00000365166:R511L;ENSP00000436559:R67L;ENSP00000365163:R116L;ENSP00000383868:R181L	ENSP00000351770:R511L	R	+	2	0	FHAD1	15526200	0.063000	0.20901	0.165000	0.22776	0.003000	0.03518	-0.034000	0.12225	-0.946000	0.03677	-1.362000	0.01212	CGG	FHAD1	-	NULL	ENSG00000142621		0.592	FHAD1-026	PUTATIVE	basic|appris_candidate_longest	protein_coding	FHAD1	HGNC	protein_coding	OTTHUMT00000393400.2		0.00	24	0	G	NM_052929		15653613	+1			no_errors	ENST00000375999	ensembl	human	known	74_37	missense	5.41	35	2	SNP	0.008	T
FLAD1	80308	genome.wustl.edu	37	1	154960625	154960625	+	Silent	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr1:154960625G>T	ENST00000292180.3	+	2	739	c.417G>T	c.(415-417)ctG>ctT	p.L139L	FLAD1_ENST00000368433.1_Silent_p.L139L|FLAD1_ENST00000487371.1_3'UTR|FLAD1_ENST00000315144.10_Silent_p.L42L|FLAD1_ENST00000405236.2_Silent_p.L40L|FLAD1_ENST00000368431.3_Silent_p.L40L|FLAD1_ENST00000368432.1_Silent_p.L42L|FLAD1_ENST00000368428.1_5'Flank|FLAD1_ENST00000295530.2_5'UTR	NM_025207.4	NP_079483.3	Q8NFF5	FAD1_HUMAN	flavin adenine dinucleotide synthetase 1	139	Molybdenum cofactor biosynthesis protein- like.				FAD biosynthetic process (GO:0006747)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|riboflavin metabolic process (GO:0006771)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|FMN adenylyltransferase activity (GO:0003919)			endometrium(3)|kidney(4)|large_intestine(2)|lung(7)|ovary(3)|skin(3)	22	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GCCGGACACTGCGCTCCCTAG	0.567																																																	0													177.0	157.0	164.0					1																	154960625		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS1078.1, CCDS1079.1, CCDS53371.1, CCDS53372.1	1q22	2013-03-05	2013-03-05		ENSG00000160688	ENSG00000160688	2.7.7.2		24671	protein-coding gene	gene with protein product		610595	"""Fad1, flavin adenine dinucleotide synthetase, homolog (yeast)"", ""FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae)"", ""flavin adenine dinucleotide synthetase"""				Standard	NM_001184891		Approved	PP591, FAD1	uc001fgf.2	Q8NFF5	OTTHUMG00000037416	ENST00000292180.3:c.417G>T	1.37:g.154960625G>T			Q8N5J1|Q8N686|Q8WU93|Q8WUJ4|Q96CR8|Q99764|Q9HBN6	Silent	SNP	pfam_Mopterin-bd_dom,superfamily_Mopterin-bd_dom,smart_Mopterin-bd_dom	p.L40	ENST00000292180.3	37	c.120	CCDS1078.1	1																																																																																			FLAD1	-	pfam_Mopterin-bd_dom,superfamily_Mopterin-bd_dom,smart_Mopterin-bd_dom	ENSG00000160688		0.567	FLAD1-001	NOVEL	basic|CCDS	protein_coding	FLAD1	HGNC	protein_coding	OTTHUMT00000091089.1	-	0.00	53	0	G	NM_025207		154960625	+1	tier1	-	no_errors	ENST00000405236	ensembl	human	known	74_37	silent	5.26	72	4	SNP	1.000	T
FLJ36000	284124	genome.wustl.edu	37	17	21911506	21911506	+	lincRNA	SNP	T	T	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr17:21911506T>G	ENST00000581223.2	+	0	2231					NR_027084.1																						CCACTTTGGGTTCGTGGAGAC	0.522																																																	0																																												0																															17.37:g.21911506T>G				RNA	SNP	-	NULL	ENST00000581223.2	37	NULL		17																																																																																			RP11-744K17.9	-	-	ENSG00000266795		0.522	RP11-744K17.9-001	KNOWN	basic	lincRNA	FLJ36000	Clone_based_vega_gene	lincRNA	OTTHUMT00000451067.1	-	0.00	40	0	T			21911506	+1	tier1	-	no_errors	ENST00000581223	ensembl	human	known	74_37	rna	17.14	29	6	SNP	0.016	G
FLRT2	23768	genome.wustl.edu	37	14	86092339	86092339	+	3'UTR	SNP	A	A	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr14:86092339A>C	ENST00000330753.4	+	0	5248					NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		CAATGGAGACAGTCATGTGCA	0.433																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.*2498A>C	14.37:g.86092339A>C			A0AV84|B7ZLP3	RNA	SNP	-	NULL	ENST00000330753.4	37	NULL	CCDS9877.1	14																																																																																			FLRT2	-	-	ENSG00000185070		0.433	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLRT2	HGNC	protein_coding	OTTHUMT00000413193.1	-	0.00	22	0	A			86092339	+1	tier1	-	no_errors	ENST00000553650	ensembl	human	putative	74_37	rna	14.71	29	5	SNP	0.000	C
FOXN2	3344	genome.wustl.edu	37	2	48573460	48573460	+	Missense_Mutation	SNP	C	C	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr2:48573460C>G	ENST00000340553.3	+	3	368	c.107C>G	c.(106-108)gCt>gGt	p.A36G		NM_002158.3	NP_002149.2	P32314	FOXN2_HUMAN	forkhead box N2	36					transcription, DNA-templated (GO:0006351)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	13		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.0272)|LUSC - Lung squamous cell carcinoma(58;0.036)			TTGCCTGAAGCTGTTGATGCT	0.458																																																	0													114.0	116.0	115.0					2																	48573460		2203	4300	6503	SO:0001583	missense	0				CCDS1838.1	2p22-p16	2008-02-05	2006-10-02	2006-10-02	ENSG00000170802	ENSG00000170802		"""Forkhead boxes"""	5281	protein-coding gene	gene with protein product		143089	"""human T-cell leukemia virus enhancer factor"""	HTLF		1639393	Standard	NM_002158		Approved		uc002rwh.1	P32314	OTTHUMG00000129168	ENST00000340553.3:c.107C>G	2.37:g.48573460C>G	ENSP00000343633:p.Ala36Gly		Q15769|Q6P4Q2	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.A36G	ENST00000340553.3	37	c.107	CCDS1838.1	2	.	.	.	.	.	.	.	.	.	.	C	15.95	2.983531	0.53827	.	.	ENSG00000170802	ENST00000413569;ENST00000340553	D;D	0.95690	-3.78;-3.71	5.28	5.28	0.74379	.	0.051482	0.85682	D	0.000000	D	0.94470	0.8220	L	0.57536	1.79	0.58432	D	0.999999	D	0.56521	0.976	P	0.46885	0.53	D	0.93812	0.7111	10	0.46703	T	0.11	.	13.6342	0.62213	0.1549:0.8451:0.0:0.0	.	36	P32314	FOXN2_HUMAN	G	36	ENSP00000388486:A36G;ENSP00000343633:A36G	ENSP00000343633:A36G	A	+	2	0	FOXN2	48426964	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.418000	0.52721	2.741000	0.93983	0.591000	0.81541	GCT	FOXN2	-	NULL	ENSG00000170802		0.458	FOXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXN2	HGNC	protein_coding	OTTHUMT00000251240.3		0.00	37	0	C	NM_002158		48573460	+1			no_errors	ENST00000340553	ensembl	human	known	74_37	missense	8.11	34	3	SNP	1.000	G
FRAS1	80144	genome.wustl.edu	37	4	79188042	79188042	+	Missense_Mutation	SNP	G	G	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr4:79188042G>C	ENST00000325942.6	+	8	1182	c.742G>C	c.(742-744)Gag>Cag	p.E248Q	FRAS1_ENST00000264899.6_Missense_Mutation_p.E248Q|FRAS1_ENST00000264895.6_Missense_Mutation_p.E248Q	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	248	VWFC 4. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						TGACCGGGGTGAGGTCAGGTG	0.483																																																	0													61.0	59.0	60.0					4																	79188042		2023	4191	6214	SO:0001583	missense	0			AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.742G>C	4.37:g.79188042G>C	ENSP00000326330:p.Glu248Gln		A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	pfam_Calx_beta,pfam_VWF_C,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_VWC_out,smart_VWF_C,smart_Furin_repeat,smart_EG-like_dom,smart_Calx_beta,pfscan_VWF_C	p.E248Q	ENST00000325942.6	37	c.742	CCDS54772.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	3.802|3.802	-0.041551|-0.041551	0.07452|0.07452	.|.	.|.	ENSG00000138759|ENSG00000138759	ENST00000325942;ENST00000264895;ENST00000264899;ENST00000380674|ENST00000508900	T;T;T|.	0.71934|.	-0.61;-0.61;-0.61|.	5.33|5.33	1.54|1.54	0.23209|0.23209	.|.	0.450107|.	0.23426|.	N|.	0.048317|.	T|.	0.18676|.	0.0448|.	N|N	0.11560|0.11560	0.145|0.145	0.09310|0.09310	N|N	1|1	B;B|.	0.17038|.	0.02;0.006|.	B;B|.	0.21360|.	0.023;0.034|.	T|.	0.28170|.	-1.0052|.	10|.	0.10636|.	T|.	0.68|.	.|.	8.0768|8.0768	0.30720|0.30720	0.142:0.4227:0.4353:0.0|0.142:0.4227:0.4353:0.0	.|.	248;248|.	E9PHH6;A2RRR8|.	.;.|.	Q|S	248|90	ENSP00000326330:E248Q;ENSP00000264895:E248Q;ENSP00000264899:E248Q|.	ENSP00000264895:E248Q|.	E|X	+|+	1|2	0|2	FRAS1|FRAS1	79407066|79407066	0.003000|0.003000	0.15002|0.15002	0.034000|0.034000	0.17996|0.17996	0.017000|0.017000	0.09413|0.09413	0.549000|0.549000	0.23329|0.23329	0.033000|0.033000	0.15463|0.15463	-0.219000|-0.219000	0.12488|0.12488	GAG|TGA	FRAS1	-	pfam_VWF_C,smart_VWC_out,smart_VWF_C,pfscan_VWF_C	ENSG00000138759		0.483	FRAS1-001	NOVEL	basic|CCDS	protein_coding	FRAS1	HGNC	protein_coding	OTTHUMT00000362706.2	-	0.00	51	0	G			79188042	+1	tier1	-	no_errors	ENST00000264895	ensembl	human	known	74_37	missense	8.05	80	7	SNP	0.000	C
FRMD4A	55691	genome.wustl.edu	37	10	13824953	13824953	+	Missense_Mutation	SNP	A	A	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr10:13824953A>G	ENST00000357447.2	-	6	721	c.353T>C	c.(352-354)tTc>tCc	p.F118S	FRMD4A_ENST00000358621.4_Missense_Mutation_p.F103S|FRMD4A_ENST00000378503.1_Missense_Mutation_p.F118S|FRMD4A_ENST00000342409.2_Missense_Mutation_p.F134S	NM_018027.3	NP_060497.3	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A	118	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)				breast(4)|endometrium(9)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	41						GTTCAGAAAGAAAAGCTCAAT	0.418																																																	0													193.0	189.0	191.0					10																	13824953		2203	4300	6503	SO:0001583	missense	0			AB037715	CCDS7101.1	10p14	2004-07-15	2004-07-15	2004-07-15	ENSG00000151474	ENSG00000151474			25491	protein-coding gene	gene with protein product			"""FERM domain containing 4"""	FRMD4		10718198	Standard	NM_018027		Approved	FLJ10210, KIAA1294, bA295P9.4	uc001ims.3	Q9P2Q2	OTTHUMG00000017708	ENST00000357447.2:c.353T>C	10.37:g.13824953A>G	ENSP00000350032:p.Phe118Ser		A7E2Y3|Q5T377	Missense_Mutation	SNP	pfam_DUF3338,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam	p.F118S	ENST00000357447.2	37	c.353	CCDS7101.1	10	.	.	.	.	.	.	.	.	.	.	A	26.5	4.739777	0.89573	.	.	ENSG00000151474	ENST00000358621;ENST00000357447;ENST00000378503;ENST00000264546;ENST00000342409	T;T;T;T;T	0.36520	1.25;1.25;1.25;1.25;1.25	5.53	5.53	0.82687	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.000000	0.85682	D	0.000000	T	0.67878	0.2940	M	0.91354	3.2	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.994;0.999	T	0.76247	-0.3029	10	0.87932	D	0	-20.0677	14.6439	0.68745	1.0:0.0:0.0:0.0	.	134;151;118	Q5T378;Q5T376;Q9P2Q2	.;.;FRM4A_HUMAN	S	103;118;118;151;134	ENSP00000351438:F103S;ENSP00000350032:F118S;ENSP00000367764:F118S;ENSP00000264546:F151S;ENSP00000344237:F134S	ENSP00000264546:F151S	F	-	2	0	FRMD4A	13864959	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.685000	0.91246	2.103000	0.63969	0.460000	0.39030	TTC	FRMD4A	-	pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	ENSG00000151474		0.418	FRMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRMD4A	HGNC	protein_coding	OTTHUMT00000046889.1	-	0.00	59	0	A	NM_018027		13824953	-1	tier1	-	no_errors	ENST00000357447	ensembl	human	known	74_37	missense	28.81	42	17	SNP	1.000	G
FUT11	170384	genome.wustl.edu	37	10	75533542	75533542	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr10:75533542G>T	ENST00000372841.3	+	2	1346	c.1303G>T	c.(1303-1305)Ggc>Tgc	p.G435C	FUT11_ENST00000465695.1_3'UTR|FUT11_ENST00000394790.1_Missense_Mutation_p.G435C|RMRPP1_ENST00000517236.1_RNA|AC022400.2_ENST00000595757.1_5'Flank	NM_173540.2	NP_775811.2	Q495W5	FUT11_HUMAN	fucosyltransferase 11 (alpha (1,3) fucosyltransferase)	435					protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)	7	Prostate(51;0.0112)					ACCTGGCTTTGGCAATGTGGA	0.552																																																	0													62.0	66.0	65.0					10																	75533542		2203	4300	6503	SO:0001583	missense	0			BC036037	CCDS7333.1, CCDS60558.1	10q22.3	2014-01-02			ENSG00000196968	ENSG00000196968		"""Fucosyltransferases"""	19233	protein-coding gene	gene with protein product						11698403, 24318988	Standard	NM_173540		Approved	MGC33202	uc001jva.3	Q495W5	OTTHUMG00000018483	ENST00000372841.3:c.1303G>T	10.37:g.75533542G>T	ENSP00000361932:p.Gly435Cys		Q495W7|Q8IYE4	Missense_Mutation	SNP	pfam_Glyco_trans_10,pirsf_Alpha-1_3-FUT_met	p.G435C	ENST00000372841.3	37	c.1303	CCDS7333.1	10	.	.	.	.	.	.	.	.	.	.	G	27.1	4.797695	0.90538	.	.	ENSG00000196968	ENST00000372841;ENST00000394790	T;T	0.49139	1.25;0.79	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.70020	0.3176	M	0.76328	2.33	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.69654	0.912;0.965	T	0.71504	-0.4573	10	0.62326	D	0.03	-35.0865	19.786	0.96437	0.0:0.0:1.0:0.0	.	435;435	Q495W5;Q495W5-2	FUT11_HUMAN;.	C	435	ENSP00000361932:G435C;ENSP00000378270:G435C	ENSP00000361932:G435C	G	+	1	0	FUT11	75203548	1.000000	0.71417	1.000000	0.80357	0.789000	0.44602	9.624000	0.98398	2.676000	0.91093	0.563000	0.77884	GGC	FUT11	-	pirsf_Alpha-1_3-FUT_met	ENSG00000196968		0.552	FUT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUT11	HGNC	protein_coding	OTTHUMT00000048689.1	-	0.00	59	0	G	NM_173540		75533542	+1	tier1	-	no_errors	ENST00000372841	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	T
G2E3	55632	genome.wustl.edu	37	14	31074771	31074772	+	Frame_Shift_Ins	INS	-	-	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr14:31074771_31074772insA	ENST00000206595.6	+	11	1225_1226	c.1071_1072insA	c.(1072-1074)aaafs	p.K358fs	G2E3_ENST00000438909.2_Frame_Shift_Ins_p.K312fs|G2E3_ENST00000553504.1_Frame_Shift_Ins_p.K388fs|G2E3_ENST00000544007.1_Intron	NM_017769.3	NP_060239.2	Q7L622	G2E3_HUMAN	G2/M-phase specific E3 ubiquitin protein ligase	358					apoptotic process (GO:0006915)|blastocyst development (GO:0001824)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23						GATTCCAAATTAAAAAAAAAAC	0.272																																																	0																																										SO:0001589	frameshift_variant	0			AK000340	CCDS9638.1	14q12	2013-01-28	2010-09-17	2009-02-03	ENSG00000092140	ENSG00000092140		"""Zinc fingers, PHD-type"""	20338	protein-coding gene	gene with protein product	"""PHD finger protein 7B"""	611299	"""KIAA1333"""	KIAA1333		18511420, 17239372	Standard	NM_017769		Approved	FLJ20333, PHF7B	uc001wqk.2	Q7L622	OTTHUMG00000140204	ENST00000206595.6:c.1081dupA	14.37:g.31074781_31074781dupA	ENSP00000206595:p.Lys358fs		Q9BVR2|Q9H9E9|Q9NXC0|Q9P2L3	Frame_Shift_Ins	INS	pfam_HECT,superfamily_HECT,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_HECT,pfscan_HECT	p.T360fs	ENST00000206595.6	37	c.1071_1072	CCDS9638.1	14																																																																																			G2E3	-	superfamily_HECT	ENSG00000092140		0.272	G2E3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	G2E3	HGNC	protein_coding	OTTHUMT00000276613.2		0.00	36	0	0	NM_017769		31074772	+1			no_errors	ENST00000206595	ensembl	human	known	74_37	frame_shift_ins	9.64	75	8	INS	1.000:0.994	A
GALNTL6	442117	genome.wustl.edu	37	4	172735821	172735821	+	Silent	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr4:172735821G>T	ENST00000506823.1	+	2	747	c.90G>T	c.(88-90)ctG>ctT	p.L30L	GALNTL6_ENST00000511251.1_Silent_p.L30L	NM_001034845.2	NP_001030017.2	Q49A17	GLTL6_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 6	30					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(2)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	45						TCTGGTCTCTGTACAAGGATA	0.483																																																	0													100.0	98.0	99.0					4																	172735821		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS34104.1	4q34.1	2014-03-13	2014-03-13		ENSG00000174473	ENSG00000174473		"""Glycosyltransferase family 2 domain containing"""	33844	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 6"""	615138	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6"""				Standard	NM_001034845		Approved	GALNT17, GalNAc-T6L	uc003isv.3	Q49A17	OTTHUMG00000160807	ENST00000506823.1:c.90G>T	4.37:g.172735821G>T			Q2L4S6	Silent	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.L30	ENST00000506823.1	37	c.90	CCDS34104.1	4																																																																																			GALNTL6	-	NULL	ENSG00000174473		0.483	GALNTL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNTL6	HGNC	protein_coding	OTTHUMT00000362395.1	-	0.00	43	0	G	NM_001034845		172735821	+1	tier1	-	no_errors	ENST00000506823	ensembl	human	known	74_37	silent	6.06	62	4	SNP	0.953	T
GBF1	8729	genome.wustl.edu	37	10	104139119	104139119	+	Missense_Mutation	SNP	G	G	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr10:104139119G>C	ENST00000369983.3	+	34	4830	c.4570G>C	c.(4570-4572)Gag>Cag	p.E1524Q		NM_001199378.1|NM_001199379.1|NM_004193.2	NP_001186307.1|NP_001186308.1|NP_004184.1	Q92538	GBF1_HUMAN	golgi brefeldin A resistant guanine nucleotide exchange factor 1	1524					COPI coating of Golgi vesicle (GO:0048205)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of ARF protein signal transduction (GO:0032012)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	cis-Golgi network (GO:0005801)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(14)|kidney(8)|large_intestine(15)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	71		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		ACGCCACCTGGAGACAGGTGG	0.607																																																	0													59.0	56.0	57.0					10																	104139119		2203	4300	6503	SO:0001583	missense	0			D87435	CCDS7533.1	10q24	2010-02-12	2010-02-12		ENSG00000107862	ENSG00000107862			4181	protein-coding gene	gene with protein product		603698	"""golgi-specific brefeldin A resistance factor 1"""			9828135	Standard	NM_004193		Approved	KIAA0248, ARF1GEF	uc001kux.2	Q92538	OTTHUMG00000018955	ENST00000369983.3:c.4570G>C	10.37:g.104139119G>C	ENSP00000359000:p.Glu1524Gln		Q5VXX3|Q96CK6|Q96HZ3|Q9H473	Missense_Mutation	SNP	pfam_Sec7_dom,superfamily_Sec7_dom,superfamily_ARM-type_fold,smart_Sec7_dom,pfscan_Sec7_dom	p.E1524Q	ENST00000369983.3	37	c.4570	CCDS7533.1	10	.	.	.	.	.	.	.	.	.	.	G	13.12	2.142983	0.37825	.	.	ENSG00000107862	ENST00000369983	T	0.11063	2.81	5.03	3.15	0.36227	.	0.145654	0.64402	N	0.000009	T	0.14614	0.0353	M	0.66439	2.03	0.48511	D	0.999665	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.003;0.003;0.003	T	0.03773	-1.1005	10	0.35671	T	0.21	-4.5422	15.4209	0.75009	0.0:0.2634:0.7366:0.0	.	1520;1520;1524	Q149P1;Q149P0;Q92538	.;.;GBF1_HUMAN	Q	1524	ENSP00000359000:E1524Q	ENSP00000359000:E1524Q	E	+	1	0	GBF1	104129109	1.000000	0.71417	0.999000	0.59377	0.420000	0.31355	6.527000	0.73803	0.694000	0.31654	-0.218000	0.12543	GAG	GBF1	-	NULL	ENSG00000107862		0.607	GBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBF1	HGNC	protein_coding	OTTHUMT00000050051.1		0.00	45	0	G			104139119	+1			no_errors	ENST00000369983	ensembl	human	known	74_37	missense	9.68	28	3	SNP	1.000	C
GCC2	9648	genome.wustl.edu	37	2	109086106	109086106	+	Splice_Site	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr2:109086106G>T	ENST00000309863.6	+	6	1035		c.e6-1		GCC2_ENST00000485546.1_Splice_Site	NM_181453.3	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain containing 2						Golgi ribbon formation (GO:0090161)|late endosome to Golgi transport (GO:0034499)|microtubule anchoring (GO:0034453)|microtubule organizing center organization (GO:0031023)|protein localization to Golgi apparatus (GO:0034067)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|recycling endosome to Golgi transport (GO:0071955)|regulation of protein exit from endoplasmic reticulum (GO:0070861)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	identical protein binding (GO:0042802)			breast(8)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	54						TTTTGTAATAGGATTCTGTAA	0.318																																																	0													47.0	55.0	52.0					2																	109086106		2186	4296	6482	SO:0001630	splice_region_variant	0			BC020645	CCDS33268.1	2q12.3	2008-02-05	2004-03-05		ENSG00000135968	ENSG00000135968			23218	protein-coding gene	gene with protein product		612711	"""GRIP and coiled-coil domain-containing 2"""			12446665	Standard	NM_181453		Approved	GCC185, KIAA0336	uc002tec.3	Q8IWJ2	OTTHUMG00000153214	ENST00000309863.6:c.322-1G>T	2.37:g.109086106G>T			A6H8X8|O15045|Q4ZG46|Q8TDH3|Q9H2G8	Splice_Site	SNP	-	e6-1	ENST00000309863.6	37	c.322-1	CCDS33268.1	2	.	.	.	.	.	.	.	.	.	.	G	11.57	1.677920	0.29783	.	.	ENSG00000135968	ENST00000435553;ENST00000309863;ENST00000409821;ENST00000409896	.	.	.	5.37	5.37	0.77165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.466	0.94939	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GCC2	108452538	1.000000	0.71417	0.984000	0.44739	0.154000	0.21943	7.396000	0.79891	2.661000	0.90470	0.460000	0.39030	.	GCC2	-	-	ENSG00000135968		0.318	GCC2-014	KNOWN	basic|appris_principal|CCDS	protein_coding	GCC2	HGNC	protein_coding	OTTHUMT00000358516.3	-	0.00	27	0	G	NM_014635	Intron	109086106	+1	tier1	-	no_errors	ENST00000309863	ensembl	human	known	74_37	splice_site	5.71	66	4	SNP	1.000	T
GJA8	2703	genome.wustl.edu	37	1	147380796	147380796	+	Silent	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr1:147380796G>A	ENST00000369235.1	+	1	714	c.714G>A	c.(712-714)agG>agA	p.R238R	GJA8_ENST00000240986.4_Silent_p.R238R			P48165	CXA8_HUMAN	gap junction protein, alpha 8, 50kDa	238					cell-cell signaling (GO:0007267)|lens development in camera-type eye (GO:0002088)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of plasma membrane (GO:0005887)	channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)	37	all_hematologic(923;0.0276)					CCTTGAAGAGGCCTGTAGAGC	0.557																																					Melanoma(76;1255 1795 8195 52096)												0													69.0	65.0	66.0					1																	147380796		2203	4300	6503	SO:0001819	synonymous_variant	0			U34802	CCDS30834.1	1q21.1	2008-02-05	2007-01-16		ENSG00000121634	ENSG00000121634		"""Ion channels / Gap junction proteins (connexins)"""	4281	protein-coding gene	gene with protein product	"""connexin 50"""	600897	"""gap junction protein, alpha 8, 50kD (connexin 50)"", ""gap junction protein, alpha 8, 50kDa (connexin 50)"""	CAE1, CZP1, CAE		9497259, 7796604	Standard	NM_005267		Approved	CX50	uc001epu.2	P48165	OTTHUMG00000024085	ENST00000369235.1:c.714G>A	1.37:g.147380796G>A			A7L5M5|Q5VVN9|Q9NP25	Silent	SNP	pfam_Connexin_N,pfam_Connexin50,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin,prints_Connexin50	p.R238	ENST00000369235.1	37	c.714	CCDS30834.1	1																																																																																			GJA8	-	NULL	ENSG00000121634		0.557	GJA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GJA8	HGNC	protein_coding	OTTHUMT00000060647.1	-	0.00	38	0	G	NM_005267		147380796	+1	tier1	-	no_errors	ENST00000240986	ensembl	human	known	74_37	silent	21.05	45	12	SNP	1.000	A
GLI1	2735	genome.wustl.edu	37	12	57858936	57858936	+	Silent	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr12:57858936G>T	ENST00000228682.2	+	5	523	c.432G>T	c.(430-432)ggG>ggT	p.G144G	GLI1_ENST00000546141.1_Silent_p.G103G|GLI1_ENST00000543426.1_Silent_p.G16G	NM_005269.2	NP_005260.1	P08151	GLI1_HUMAN	GLI family zinc finger 1	144					cerebellar cortex morphogenesis (GO:0021696)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral pattern formation (GO:0009953)|epidermal cell differentiation (GO:0009913)|lung development (GO:0030324)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|notochord regression (GO:0060032)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|regulation of smoothened signaling pathway (GO:0008589)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|spermatogenesis (GO:0007283)|ventral midline development (GO:0007418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|primary cilium (GO:0072372)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(8)|lung(22)|ovary(6)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69			GBM - Glioblastoma multiforme(3;3.99e-32)			ACCAAAAAGGGCCCTCGCCTT	0.577																																					Pancreas(157;841 1936 10503 41495 50368)												0													64.0	64.0	64.0					12																	57858936		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS8940.1, CCDS53806.1, CCDS53807.1	12q13.2-q13.3	2013-01-25	2009-03-05	2005-01-14		ENSG00000111087		"""Zinc fingers, C2H2-type"""	4317	protein-coding gene	gene with protein product		165220	"""glioma-associated oncogene homolog 1 (zinc finger protein)"", ""glioma-associated oncogene family zinc finger 1"""	GLI		2850480	Standard	NM_005269		Approved		uc001snx.3	P08151		ENST00000228682.2:c.432G>T	12.37:g.57858936G>T			D0EUY3|E9PQQ9|F5H6H8|Q8TDN9	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G144	ENST00000228682.2	37	c.432	CCDS8940.1	12																																																																																			GLI1	-	NULL	ENSG00000111087		0.577	GLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLI1	HGNC	protein_coding	OTTHUMT00000394197.1	-	0.00	62	0	G	NM_005269		57858936	+1	tier1	-	no_errors	ENST00000228682	ensembl	human	known	74_37	silent	13.64	95	15	SNP	0.991	T
GPC5	2262	genome.wustl.edu	37	13	92408605	92408605	+	Missense_Mutation	SNP	A	A	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr13:92408605A>G	ENST00000377067.3	+	5	1583	c.1211A>G	c.(1210-1212)cAg>cGg	p.Q404R	GPC5_ENST00000483422.1_3'UTR	NM_004466.4	NP_004457.1	P78333	GPC5_HUMAN	glypican 5	404					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(4)|endometrium(6)|kidney(4)|large_intestine(7)|lung(34)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				CTAGCTGATCAGCTTTGTGCT	0.378																																																	0													147.0	144.0	145.0					13																	92408605		2203	4300	6503	SO:0001583	missense	0			AF001462	CCDS9468.1	13q32	2011-08-01			ENSG00000179399	ENSG00000179399		"""Proteoglycans / Cell Surface : Glypicans"""	4453	protein-coding gene	gene with protein product	"""glypican proteoglycan 5"""	602446				9070915, 20304703, 19556317, 15057823	Standard	NM_004466		Approved		uc010tif.2	P78333	OTTHUMG00000017200	ENST00000377067.3:c.1211A>G	13.37:g.92408605A>G	ENSP00000366267:p.Gln404Arg		B2R726|O60436|Q9BX27	Missense_Mutation	SNP	pfam_Glypican	p.Q404R	ENST00000377067.3	37	c.1211	CCDS9468.1	13	.	.	.	.	.	.	.	.	.	.	A	8.940	0.965625	0.18583	.	.	ENSG00000179399	ENST00000377067	T	0.49720	0.77	5.32	5.32	0.75619	.	0.368895	0.31589	N	0.007383	T	0.35711	0.0941	L	0.45137	1.4	0.43160	D	0.994945	B	0.10296	0.003	B	0.14023	0.01	T	0.19712	-1.0297	10	0.02654	T	1	-16.4053	12.6855	0.56946	1.0:0.0:0.0:0.0	.	404	P78333	GPC5_HUMAN	R	404	ENSP00000366267:Q404R	ENSP00000366267:Q404R	Q	+	2	0	GPC5	91206606	1.000000	0.71417	0.999000	0.59377	0.600000	0.36913	6.987000	0.76206	2.016000	0.59253	0.443000	0.29094	CAG	GPC5	-	pfam_Glypican	ENSG00000179399		0.378	GPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC5	HGNC	protein_coding	OTTHUMT00000045454.1		0.00	26	0	A	NM_004466		92408605	+1			no_errors	ENST00000377067	ensembl	human	known	74_37	missense	11.11	48	6	SNP	1.000	G
GPC5	2262	genome.wustl.edu	37	13	92408660	92408660	+	Missense_Mutation	SNP	A	A	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr13:92408660A>C	ENST00000377067.3	+	5	1638	c.1266A>C	c.(1264-1266)gaA>gaC	p.E422D	GPC5_ENST00000483422.1_3'UTR	NM_004466.4	NP_004457.1	P78333	GPC5_HUMAN	glypican 5	422					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(4)|endometrium(6)|kidney(4)|large_intestine(7)|lung(34)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				GGAATGGAGAAGATATAGTAA	0.393																																																	0													148.0	146.0	146.0					13																	92408660		2203	4300	6503	SO:0001583	missense	0			AF001462	CCDS9468.1	13q32	2011-08-01			ENSG00000179399	ENSG00000179399		"""Proteoglycans / Cell Surface : Glypicans"""	4453	protein-coding gene	gene with protein product	"""glypican proteoglycan 5"""	602446				9070915, 20304703, 19556317, 15057823	Standard	NM_004466		Approved		uc010tif.2	P78333	OTTHUMG00000017200	ENST00000377067.3:c.1266A>C	13.37:g.92408660A>C	ENSP00000366267:p.Glu422Asp		B2R726|O60436|Q9BX27	Missense_Mutation	SNP	pfam_Glypican	p.E422D	ENST00000377067.3	37	c.1266	CCDS9468.1	13	.	.	.	.	.	.	.	.	.	.	A	14.76	2.632786	0.47049	.	.	ENSG00000179399	ENST00000377067	T	0.49720	0.77	5.32	-4.17	0.03857	.	0.231122	0.44902	D	0.000402	T	0.37865	0.1019	L	0.54323	1.7	0.23645	N	0.997211	B	0.09022	0.002	B	0.18871	0.023	T	0.30966	-0.9960	10	0.45353	T	0.12	0.0047	12.4067	0.55443	0.4404:0.0:0.5596:0.0	.	422	P78333	GPC5_HUMAN	D	422	ENSP00000366267:E422D	ENSP00000366267:E422D	E	+	3	2	GPC5	91206661	0.999000	0.42202	0.117000	0.21633	0.406000	0.30931	0.604000	0.24164	-0.827000	0.04278	-0.410000	0.06199	GAA	GPC5	-	pfam_Glypican	ENSG00000179399		0.393	GPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC5	HGNC	protein_coding	OTTHUMT00000045454.1	-	0.00	36	0	A	NM_004466		92408660	+1	tier1	-	no_errors	ENST00000377067	ensembl	human	known	74_37	missense	13.33	52	8	SNP	0.692	C
GPR98	84059	genome.wustl.edu	37	5	90041472	90041472	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr5:90041472G>T	ENST00000405460.2	+	52	10930	c.10834G>T	c.(10834-10836)Gat>Tat	p.D3612Y		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	3612	Calx-beta 23. {ECO:0000305|PubMed:11606593}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.D3612N(1)		NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TATCCTTGATGATACAGTTCC	0.348																																																	1	Substitution - Missense(1)	lung(1)											81.0	76.0	78.0					5																	90041472		1826	4085	5911	SO:0001583	missense	0			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.10834G>T	5.37:g.90041472G>T	ENSP00000384582:p.Asp3612Tyr		O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.D3612Y	ENST00000405460.2	37	c.10834	CCDS47246.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.6|27.6	4.849604|4.849604	0.91277|0.91277	.|.	.|.	ENSG00000164199|ENSG00000164199	ENST00000405460;ENST00000296619|ENST00000509621	T|.	0.57107|.	0.42|.	5.59|5.59	5.59|5.59	0.84812|0.84812	Na-Ca exchanger/integrin-beta4 (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.86381|0.86381	0.5919|0.5919	M|M	0.91459|0.91459	3.21|3.21	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;0.995|.	D|D	0.88589|0.88589	0.3142|0.3142	10|5	0.87932|.	D|.	0|.	.|.	19.6119|19.6119	0.95610|0.95610	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	3612;3612|.	E7ETI5;Q8WXG9|.	.;GPR98_HUMAN|.	Y|I	3612|1177	ENSP00000384582:D3612Y|.	ENSP00000296619:D3612Y|.	D|M	+|+	1|3	0|0	GPR98|GPR98	90077228|90077228	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.982000|0.982000	0.71751|0.71751	9.455000|9.455000	0.97625|0.97625	2.648000|2.648000	0.89879|0.89879	0.563000|0.563000	0.77884|0.77884	GAT|ATG	GPR98	-	pfam_Calx_beta	ENSG00000164199		0.348	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	HGNC	protein_coding	OTTHUMT00000369993.2		0.00	31	0	G	NM_032119		90041472	+1			no_errors	ENST00000405460	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	T
GRID2IP	392862	genome.wustl.edu	37	7	6550294	6550294	+	Silent	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr7:6550294G>A	ENST00000457091.2	-	10	1598	c.1599C>T	c.(1597-1599)ggC>ggT	p.G533G	GRID2IP_ENST00000452113.1_Silent_p.G342G|GRID2IP_ENST00000435185.1_Silent_p.G349G	NM_001145118.1	NP_001138590.1	A4D2P6	GRD2I_HUMAN	glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein	533					long term synaptic depression (GO:0060292)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				endometrium(4)	4						CCTGGCGCTCGCCTGGGATCA	0.647																																																	0													91.0	105.0	101.0					7																	6550294		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS47537.1	7p22	2007-10-05	2006-03-01		ENSG00000215045	ENSG00000215045			18464	protein-coding gene	gene with protein product		610639	"""glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1"""			14612983	Standard	NM_001145118		Approved		uc011jwx.2	A4D2P6	OTTHUMG00000155531	ENST00000457091.2:c.1599C>T	7.37:g.6550294G>A				Silent	SNP	pfam_FH2_Formin,pfam_PDZ,superfamily_PDZ,smart_PDZ,smart_FH2_Formin,pfscan_PDZ	p.G533	ENST00000457091.2	37	c.1599	CCDS47537.1	7																																																																																			GRID2IP	-	NULL	ENSG00000215045		0.647	GRID2IP-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	GRID2IP	HGNC	protein_coding	OTTHUMT00000340534.1	-	0.00	90	0	G	XM_294249		6550294	-1	tier1	-	no_errors	ENST00000457091	ensembl	human	putative	74_37	silent	13.84	137	22	SNP	0.952	A
GRM2	2912	genome.wustl.edu	37	3	51746583	51746583	+	Frame_Shift_Del	DEL	C	C	-			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr3:51746583delC	ENST00000395052.3	+	3	779	c.545delC	c.(544-546)gccfs	p.A182fs	GRM2_ENST00000442933.2_Frame_Shift_Del_p.A182fs|GRM2_ENST00000475478.1_Intron	NM_000839.3	NP_000830.2	Q14416	GRM2_HUMAN	glutamate receptor, metabotropic 2	182					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|glutamate secretion (GO:0014047)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(1)|lung(11)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GACTACTTTGCCCGCACAGTG	0.557																																																	0													173.0	152.0	159.0					3																	51746583		2203	4300	6503	SO:0001589	frameshift_variant	0			L35318	CCDS2834.1	3p21.2	2013-09-20			ENSG00000164082	ENSG00000164082		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4594	protein-coding gene	gene with protein product		604099				7620613	Standard	NM_000839		Approved	GPRC1B, mGlu2, MGLUR2	uc010hlv.3	Q14416	OTTHUMG00000156902	ENST00000395052.3:c.545delC	3.37:g.51746583delC	ENSP00000378492:p.Ala182fs		B0M0K7|Q14CU5|Q52MC6|Q9H3N6	Frame_Shift_Del	DEL	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_2,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_3,prints_GPCR_3_GABA_rcpt_B	p.R183fs	ENST00000395052.3	37	c.545	CCDS2834.1	3																																																																																			GRM2	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,prints_GPCR_3	ENSG00000164082		0.557	GRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM2	HGNC	protein_coding	OTTHUMT00000346542.1		0.00	51	0	C			51746583	+1	tier1		no_errors	ENST00000395052	ensembl	human	known	74_37	frame_shift_del	17.20	77	16	DEL	1.000	-
GTSF1	121355	genome.wustl.edu	37	12	54849903	54849905	+	3'UTR	DEL	AGA	AGA	-	rs141540913	byFrequency	TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	AGA	AGA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr12:54849903_54849905delAGA	ENST00000552397.1	-	0	1453_1455				RP11-753H16.5_ENST00000552785.1_RNA|RP11-753H16.3_ENST00000550474.1_RNA|GTSF1_ENST00000552395.1_5'UTR|GTSF1_ENST00000305879.5_3'UTR			Q8WW33	GTSF1_HUMAN	gametocyte specific factor 1							cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5		Myeloproliferative disorder(1001;0.00452)				ACCCACTGGTAGAAGAAGAAGCA	0.384																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK098819	CCDS8881.1	12q13.2	2008-02-04	2007-11-27	2007-11-27		ENSG00000170627			26565	protein-coding gene	gene with protein product			"""family with sequence similarity 112, member B"""	FAM112B		12477932	Standard	NM_144594		Approved	FLJ32942	uc001sgb.3	Q8WW33		ENST00000552397.1:c.*55TCT>-	12.37:g.54849909_54849911delAGA			B3KQ60|Q0VGM4|Q8N778	RNA	DEL	-	NULL	ENST00000552397.1	37	NULL	CCDS8881.1	12																																																																																			GTSF1	-	-	ENSG00000170627		0.384	GTSF1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GTSF1	HGNC	protein_coding	OTTHUMT00000406187.1		0.00	39	0	AGA	NM_144594		54849905	-1	tier1		no_errors	ENST00000552336	ensembl	human	known	74_37	rna	16.67	40	8	DEL	1.000:1.000:1.000	-
HBG2	3048	genome.wustl.edu	37	11	5275627	5275627	+	Silent	SNP	A	A	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr11:5275627A>C	ENST00000380259.2	-	7	1450	c.210T>G	c.(208-210)acT>acG	p.T70T	HBG2_ENST00000380252.1_Silent_p.T60T|HBG2_ENST00000336906.4_Silent_p.T70T			P69892	HBG2_HUMAN	hemoglobin, gamma G	70					blood coagulation (GO:0007596)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|hemoglobin complex (GO:0005833)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)			endometrium(1)|large_intestine(2)|lung(7)|prostate(1)|skin(2)	13		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTCCCAAGGAAGTCAGCACCT	0.532																																																	0													314.0	243.0	267.0					11																	5275627		2201	4298	6499	SO:0001819	synonymous_variant	0			BC029387	CCDS7755.1	11p15.5	2014-05-19			ENSG00000196565	ENSG00000196565			4832	protein-coding gene	gene with protein product		142250				2649166	Standard	NM_000184		Approved	HBG-T1		P69892	OTTHUMG00000066673	ENST00000380259.2:c.210T>G	11.37:g.5275627A>C			A8MZE0|P02096|P62027|Q14491|Q68NH9|Q96FH6|Q96FH7	Silent	SNP	pfam_Globin,superfamily_Globin-like,pfscan_Globin,prints_Haemoglobin_b,prints_Myoglobin	p.T70	ENST00000380259.2	37	c.210	CCDS7755.1	11																																																																																			HBG2	-	pfam_Globin,superfamily_Globin-like,pfscan_Globin,prints_Myoglobin	ENSG00000196565		0.532	HBG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HBG2	HGNC	protein_coding	OTTHUMT00000142967.2	-	0.00	151	0	A	NM_000184		5275627	-1	tier1	-	no_errors	ENST00000336906	ensembl	human	known	74_37	silent	10.91	147	18	SNP	0.000	C
HERC1	8925	genome.wustl.edu	37	15	64066900	64066900	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr15:64066900C>T	ENST00000443617.2	-	2	1010	c.923G>A	c.(922-924)cGt>cAt	p.R308H		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	308					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						TACCAAAGAACGCCTCATCTG	0.368																																																	0													61.0	56.0	58.0					15																	64066900		1892	4119	6011	SO:0001583	missense	0			U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.923G>A	15.37:g.64066900C>T	ENSP00000390158:p.Arg308His		Q8IW65	Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_WD40_repeat,pfam_SPRY_rcpt,superfamily_RCC1/BLIP-II,superfamily_HECT,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl_sf,superfamily_UBA-like,superfamily_ARM-type_fold,smart_SPla/RYanodine_receptor_subgr,smart_WD40_repeat,smart_HECT,pfscan_B30.2/SPRY,pfscan_HECT,pfscan_Reg_chr_condens,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Reg_chr_condens	p.R308H	ENST00000443617.2	37	c.923	CCDS45277.1	15	.	.	.	.	.	.	.	.	.	.	C	25.7	4.662374	0.88251	.	.	ENSG00000103657	ENST00000443617;ENST00000425434	T	0.25414	1.8	5.43	5.43	0.79202	.	0.000000	0.64402	U	0.000001	T	0.37461	0.1004	L	0.44542	1.39	0.80722	D	1	D;D;D	0.63880	0.99;0.993;0.983	P;P;P	0.52710	0.707;0.544;0.513	T	0.04216	-1.0968	10	0.52906	T	0.07	.	19.6166	0.95636	0.0:1.0:0.0:0.0	.	308;308;308	B4DKS2;C9JUT5;Q15751	.;.;HERC1_HUMAN	H	308	ENSP00000390158:R308H	ENSP00000389613:R308H	R	-	2	0	HERC1	61853953	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.873000	0.69644	2.721000	0.93114	0.655000	0.94253	CGT	HERC1	-	NULL	ENSG00000103657		0.368	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC1	HGNC	protein_coding	OTTHUMT00000418523.1	-	0.00	41	0	C	NM_003922		64066900	-1	tier1	-	no_errors	ENST00000443617	ensembl	human	known	74_37	missense	9.23	58	6	SNP	1.000	T
HILPDA	29923	genome.wustl.edu	37	7	128097963	128097964	+	3'UTR	INS	-	-	A	rs376818816		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr7:128097963_128097964insA	ENST00000257696.4	+	0	842_843				RP11-212P7.3_ENST00000462662.1_RNA|RP11-155G14.6_ENST00000493710.1_RNA|HILPDA_ENST00000435296.2_3'UTR|HILPDA_ENST00000481454.1_3'UTR	NM_001098786.1|NM_013332.3	NP_001092256.1|NP_037464.1	Q9Y5L2	HLPDA_HUMAN	hypoxia inducible lipid droplet-associated						autocrine signaling (GO:0035425)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine production (GO:0001819)|positive regulation of lipid storage (GO:0010884)|response to stress (GO:0006950)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|secretory granule (GO:0030141)	receptor binding (GO:0005102)										gactccatctcaaaaaaaaaag	0.53																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF144755	CCDS5802.1	7q32.1	2011-11-02	2011-11-02	2011-11-02	ENSG00000135245	ENSG00000135245			28859	protein-coding gene	gene with protein product	"""hypoxia inducible gene 2"""		"""chromosome 7 open reading frame 68"""	C7orf68		10690527, 15930302	Standard	NM_001098786		Approved	FLJ21076, HIG-2, HIG2	uc010lli.3	Q9Y5L2	OTTHUMG00000157712	ENST00000257696.4:c.*450->A	7.37:g.128097973_128097973dupA			A4D0Z5|Q52LY5|Q53HJ7	RNA	INS	-	NULL	ENST00000257696.4	37	NULL	CCDS5802.1	7																																																																																			HILPDA	-	-	ENSG00000135245		0.530	HILPDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HILPDA	HGNC	protein_coding	OTTHUMT00000349450.1		0.00	22	0	-	NM_013332		128097964	+1	tier1		no_errors	ENST00000466473	ensembl	human	known	74_37	rna	17.39	19	4	INS	0.010:0.015	A
HMCN1	83872	genome.wustl.edu	37	1	185951416	185951416	+	Missense_Mutation	SNP	C	C	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr1:185951416C>G	ENST00000271588.4	+	18	2914	c.2685C>G	c.(2683-2685)agC>agG	p.S895R	HMCN1_ENST00000367492.2_Missense_Mutation_p.S895R|HMCN1_ENST00000485744.1_3'UTR	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	895	Ig-like C2-type 6.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TTGGAATCAGCCCTTCAGTGG	0.453																																																	0													190.0	181.0	184.0					1																	185951416		2203	4300	6503	SO:0001583	missense	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.2685C>G	1.37:g.185951416C>G	ENSP00000271588:p.Ser895Arg		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd_dom,pfam_Thrombospondin_1_rpt,superfamily_GFP,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.S895R	ENST00000271588.4	37	c.2685	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	C	13.28	2.189968	0.38707	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.66815	-0.23;-0.23	5.05	0.741	0.18336	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.042903	0.85682	D	0.000000	T	0.57403	0.2051	N	0.20986	0.625	0.52501	D	0.99995	B;D	0.53462	0.137;0.96	B;P	0.58077	0.232;0.832	T	0.51434	-0.8706	10	0.21014	T	0.42	.	5.1095	0.14802	0.1324:0.5793:0.0:0.2883	.	279;895	Q96RW7-3;Q96RW7	.;HMCN1_HUMAN	R	895	ENSP00000271588:S895R;ENSP00000356462:S895R	ENSP00000271588:S895R	S	+	3	2	HMCN1	184218039	0.996000	0.38824	0.995000	0.50966	0.906000	0.53458	0.374000	0.20501	0.253000	0.21552	-0.766000	0.03442	AGC	HMCN1	-	pfam_Ig_I-set,pfscan_Ig-like_dom	ENSG00000143341		0.453	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	-	0.00	53	0	C	NM_031935		185951416	+1	tier1	-	no_errors	ENST00000271588	ensembl	human	known	74_37	missense	10.39	69	8	SNP	1.000	G
HMGB1P5	10354	genome.wustl.edu	37	3	22424293	22424293	+	RNA	SNP	C	C	G	rs141464414	byFrequency	TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr3:22424293C>G	ENST00000451497.1	+	0	858									high mobility group box 1 pseudogene 5																		GCAGCTTATACGAAATAATTG	0.333																																																	0																																												0			AF076677		3p24	2011-09-21	2011-04-05	2010-10-15	ENSG00000132967	ENSG00000132967		"""High mobility group / HMG-box pseudogenes"""	4997	pseudogene	pseudogene			"""high-mobility group (nonhistone chromosomal) protein 1-like 5"", ""high-mobility group (nonhistone chromosomal) protein 1-like 5 pseudogene"", ""high-mobility group box 1-like 5 pseudogene"", ""high-mobility group box 1-like 15"", ""high-mobility group box 1 pseudogene 2"", ""high-mobility group box 1-like 5"", ""high-mobility group box 1 pseudogene 5"""	HMG1L5, HMGB1L15, HMGB1P2, HMGB1L5		9925949	Standard	NG_000897		Approved				OTTHUMG00000155591		3.37:g.22424293C>G				RNA	SNP	-	NULL	ENST00000451497.1	37	NULL		3																																																																																			HMGB1P5	-	-	ENSG00000132967		0.333	HMGB1P5-002	KNOWN	basic	processed_transcript	HMGB1P5	HGNC	pseudogene	OTTHUMT00000340803.1		0.00	28	0	C	NG_000897		22424293	+1			no_errors	ENST00000451497	ensembl	human	known	74_37	rna	8.89	41	4	SNP	0.996	G
HNRNPUL2	221092	genome.wustl.edu	37	11	62491164	62491164	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr11:62491164G>T	ENST00000301785.5	-	4	978	c.786C>A	c.(784-786)gaC>gaA	p.D262E	HNRNPUL2-BSCL2_ENST00000403734.2_Missense_Mutation_p.D262E	NM_001079559.2	NP_001073027.1	Q1KMD3	HNRL2_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 2	262	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20						CTCCATAGCGGTCTTTGCTCA	0.468																																																	0													81.0	78.0	79.0					11																	62491164		1867	4104	5971	SO:0001583	missense	0				CCDS41659.1	11q12	2013-07-16		2008-04-18	ENSG00000214753	ENSG00000214753			25451	protein-coding gene	gene with protein product				HNRPUL2			Standard	NM_001079559		Approved	DKFZp762N1910	uc001nuw.3	Q1KMD3	OTTHUMG00000167773	ENST00000301785.5:c.786C>A	11.37:g.62491164G>T	ENSP00000301785:p.Asp262Glu		Q8N3B3	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_SAP_dom,pfam_Zeta_toxin_domain,pfam_Chromatin_KTI12,superfamily_ConA-like_lec_gl_sf,superfamily_P-loop_NTPase,smart_SAP_dom,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_SAP_dom	p.D262E	ENST00000301785.5	37	c.786	CCDS41659.1	11	.	.	.	.	.	.	.	.	.	.	G	24.3	4.519753	0.85495	.	.	ENSG00000214753	ENST00000301785	T	0.78924	-1.22	5.09	4.18	0.49190	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);	0.054264	0.64402	D	0.000001	T	0.72598	0.3480	L	0.54323	1.7	0.47276	D	0.999376	P	0.42692	0.787	B	0.40134	0.32	T	0.75077	-0.3445	10	0.62326	D	0.03	-21.9767	11.1994	0.48733	0.0881:0.0:0.9119:0.0	.	262	Q1KMD3	HNRL2_HUMAN	E	262	ENSP00000301785:D262E	ENSP00000301785:D262E	D	-	3	2	HNRNPUL2	62247740	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.929000	0.56514	1.392000	0.46585	0.655000	0.94253	GAC	HNRNPUL2	-	superfamily_ConA-like_lec_gl_sf,pfscan_B30.2/SPRY	ENSG00000214753		0.468	HNRNPUL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPUL2	HGNC	protein_coding	OTTHUMT00000396208.2	-	0.00	39	0	G	XM_495877		62491164	-1	tier1	-	no_errors	ENST00000301785	ensembl	human	known	74_37	missense	14.29	48	8	SNP	1.000	T
HOOK2	29911	genome.wustl.edu	37	19	12881826	12881826	+	Silent	SNP	C	C	A	rs545818457		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr19:12881826C>A	ENST00000397668.3	-	10	895	c.822G>T	c.(820-822)gcG>gcT	p.A274A	HOOK2_ENST00000264827.5_Silent_p.A274A|HOOK2_ENST00000589965.1_Intron	NM_013312.2	NP_037444.2	Q96ED9	HOOK2_HUMAN	hook microtubule-tethering protein 2	274	Sufficient for interaction with microtubules.				early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	centrosome (GO:0005813)|FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(5)|skin(1)	20						GCTGCAGCTCCGCAACCTCCC	0.657																																																	0													29.0	35.0	33.0					19																	12881826		2069	4198	6267	SO:0001819	synonymous_variant	0			AF044924	CCDS42507.1, CCDS42508.1	19p13.2	2013-08-21	2013-08-21						19885	protein-coding gene	gene with protein product		607824	"""hook homolog 2 (Drosophila)"""			9927460	Standard	NM_013312		Approved	HK2	uc002muy.2	Q96ED9		ENST00000397668.3:c.822G>T	19.37:g.12881826C>A			O60562	Silent	SNP	pfam_Hook-related_fam,superfamily_UBA-like	p.A274	ENST00000397668.3	37	c.822	CCDS42508.1	19																																																																																			HOOK2	-	pfam_Hook-related_fam	ENSG00000095066		0.657	HOOK2-002	KNOWN	basic|CCDS	protein_coding	HOOK2	HGNC	protein_coding	OTTHUMT00000451008.1		0.00	32	0	C	NM_013312		12881826	-1			no_errors	ENST00000397668	ensembl	human	known	74_37	silent	7.14	39	3	SNP	0.000	A
HOXA1	3198	genome.wustl.edu	37	7	27135319	27135319	+	Silent	SNP	G	G	A	rs2074398		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr7:27135319G>A	ENST00000343060.4	-	1	274	c.213C>T	c.(211-213)caC>caT	p.H71H	HOTAIRM1_ENST00000495032.1_RNA|HOXA1_ENST00000355633.5_Silent_p.H71H|HOTAIRM1_ENST00000425358.2_RNA|HOTAIRM1_ENST00000429611.3_RNA|HOTAIRM1_ENST00000434063.3_RNA	NM_005522.4	NP_005513	P49639	HXA1_HUMAN	homeobox A1	71	Poly-His.				abducens nerve formation (GO:0021599)|anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|artery morphogenesis (GO:0048844)|central nervous system neuron differentiation (GO:0021953)|cochlea development (GO:0090102)|cochlea morphogenesis (GO:0090103)|cognition (GO:0050890)|embryonic neurocranium morphogenesis (GO:0048702)|facial nerve structural organization (GO:0021612)|facial nucleus development (GO:0021754)|inner ear development (GO:0048839)|motor neuron axon guidance (GO:0008045)|multicellular organismal development (GO:0007275)|neuromuscular process (GO:0050905)|optokinetic behavior (GO:0007634)|outer ear morphogenesis (GO:0042473)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of behavior (GO:0050795)|rhombomere 3 development (GO:0021569)|rhombomere 4 development (GO:0021570)|rhombomere 5 development (GO:0021571)|semicircular canal formation (GO:0060876)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(14)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						ggtggcgatggtggtggtggt	0.642											OREG0003750	type=REGULATORY REGION|Gene=BC031342|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0													37.0	40.0	39.0					7																	27135319		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS5401.1, CCDS5402.2	7p15.2	2011-06-20	2005-12-22		ENSG00000105991	ENSG00000105991		"""Homeoboxes / ANTP class : HOXL subclass"""	5099	protein-coding gene	gene with protein product		142955	"""homeo box A1"""	HOX1F, HOX1		1973146	Standard	NM_153620		Approved		uc003sye.3	P49639	OTTHUMG00000023207	ENST00000343060.4:c.213C>T	7.37:g.27135319G>A		792	A4D184|B2R8U7|O43363	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,prints_Homeobox_metazoa,pfscan_Homeobox_dom	p.H71	ENST00000343060.4	37	c.213	CCDS5401.1	7																																																																																			HOXA1	-	NULL	ENSG00000105991		0.642	HOXA1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	HOXA1	HGNC	protein_coding	OTTHUMT00000358454.1	-	0.00	43	0	G			27135319	-1	tier1	rs2074398	no_errors	ENST00000343060	ensembl	human	known	74_37	silent	5.88	64	4	SNP	0.999	A
HPS4	89781	genome.wustl.edu	37	22	26860050	26860050	+	Missense_Mutation	SNP	G	G	T	rs372833027		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr22:26860050G>T	ENST00000398145.2	-	11	2162	c.1546C>A	c.(1546-1548)Cag>Aag	p.Q516K	HPS4_ENST00000402105.3_Missense_Mutation_p.Q511K|HPS4_ENST00000493455.2_5'UTR|HPS4_ENST00000398141.1_Missense_Mutation_p.Q529K|HPS4_ENST00000336873.5_Missense_Mutation_p.Q516K	NM_022081.5	NP_071364.4	Q9NQG7	HPS4_HUMAN	Hermansky-Pudlak syndrome 4	516					blood coagulation (GO:0007596)|hemostasis (GO:0007599)|lysosome organization (GO:0007040)|melanocyte differentiation (GO:0030318)|positive regulation of eye pigmentation (GO:0048075)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)	BLOC-3 complex (GO:0031085)|cytoplasm (GO:0005737)|lysosome (GO:0005764)|melanosome (GO:0042470)|membrane (GO:0016020)|platelet dense granule (GO:0042827)	protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(3)|kidney(5)|large_intestine(4)|lung(12)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	32						CCAGCACCCTGACAGTTTGCT	0.582									Hermansky-Pudlak syndrome																																								0													100.0	97.0	98.0					22																	26860050		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	HPS, HPS1-8		CCDS13835.1, CCDS46677.1	22q12.1	2014-09-17			ENSG00000100099	ENSG00000100099			15844	protein-coding gene	gene with protein product		606682				11836498, 12663659	Standard	NM_022081		Approved	KIAA1667, LE	uc003aci.4	Q9NQG7	OTTHUMG00000030459	ENST00000398145.2:c.1546C>A	22.37:g.26860050G>T	ENSP00000381213:p.Gln516Lys		B1AHQ4|Q5H8V6|Q96LX6|Q9BY93|Q9UH37|Q9UH38	Missense_Mutation	SNP	NULL	p.Q529K	ENST00000398145.2	37	c.1585	CCDS13835.1	22	.	.	.	.	.	.	.	.	.	.	G	1.488	-0.555292	0.03967	.	.	ENSG00000100099	ENST00000398145;ENST00000398141;ENST00000402105;ENST00000336873	T;T;T;T	0.30182	1.54;1.54;1.54;1.54	4.42	2.27	0.28462	.	0.825859	0.10682	N	0.646264	T	0.21307	0.0513	L	0.35723	1.085	0.09310	N	1	B;B;B;B;B;B	0.17667	0.023;0.023;0.023;0.023;0.023;0.023	B;B;B;B;B;B	0.18561	0.022;0.01;0.01;0.022;0.022;0.01	T	0.28427	-1.0044	9	.	.	.	-0.0733	5.1283	0.14896	0.1061:0.0:0.69:0.2038	.	516;516;516;516;529;511	Q6ICH6;Q6P1K3;Q9NQG7;A8K2E6;Q9NQG7-4;Q9NQG7-3	.;.;HPS4_HUMAN;.;.;.	K	516;529;511;516	ENSP00000381213:Q516K;ENSP00000381210:Q529K;ENSP00000384185:Q511K;ENSP00000338457:Q516K	.	Q	-	1	0	HPS4	25190050	0.023000	0.18921	0.000000	0.03702	0.001000	0.01503	2.092000	0.41700	0.476000	0.27440	0.655000	0.94253	CAG	HPS4	-	NULL	ENSG00000100099		0.582	HPS4-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HPS4	HGNC	protein_coding	OTTHUMT00000320778.1		0.00	36	0	G	NM_022081		26860050	-1			no_errors	ENST00000398141	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.000	T
HSP90AB2P	391634	genome.wustl.edu	37	4	13338995	13338995	+	RNA	SNP	A	A	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr4:13338995A>C	ENST00000602906.1	+	0	783							Q58FF8	H90B2_HUMAN	heat shock protein 90kDa alpha (cytosolic), class B member 2, pseudogene						protein folding (GO:0006457)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			kidney(3)|lung(1)	4						ACATCACCCAAGAGGAGTATG	0.408																																																	0																																												0			AY956763		4p15.33	2012-04-18	2011-04-15		ENSG00000205940	ENSG00000205940			32537	pseudogene	pseudogene			"""heat shock protein 90kDa alpha (cytosolic), class B member 2 (pseudogene)"""			16269234	Standard	NG_032979		Approved	HSP90BB		Q58FF8			4.37:g.13338995A>C				RNA	SNP	-	NULL	ENST00000602906.1	37	NULL		4																																																																																			HSP90AB2P	-	-	ENSG00000205940		0.408	HSP90AB2P-001	KNOWN	basic	processed_transcript	HSP90AB2P	HGNC	pseudogene	OTTHUMT00000359156.2	-	0.00	46	0	A			13338995	+1	tier1	-	no_errors	ENST00000602906	ensembl	human	known	74_37	rna	12.63	83	12	SNP	0.994	C
HTR5A	3361	genome.wustl.edu	37	7	154863168	154863168	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr7:154863168G>T	ENST00000287907.2	+	1	1135	c.559G>T	c.(559-561)Gag>Tag	p.E187*	HTR5A-AS1_ENST00000493904.1_5'UTR|HTR5A-AS1_ENST00000395731.2_5'UTR|HTR5A-AS1_ENST00000543018.1_5'UTR	NM_024012.3	NP_076917.1	P47898	5HT5A_HUMAN	5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled	187					cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hippocampus development (GO:0021766)|response to estradiol (GO:0032355)|serotonin receptor signaling pathway (GO:0007210)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	serotonin receptor activity (GO:0004993)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(3)|stomach(1)	48	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)	Asenapine(DB06216)|Loxapine(DB00408)|Olanzapine(DB00334)	GACGTACTCTGAGGGCAGCGA	0.622																																																	0													80.0	64.0	69.0					7																	154863168		2203	4300	6503	SO:0001587	stop_gained	0				CCDS5936.1	7q36.1	2012-08-08	2012-02-03		ENSG00000157219	ENSG00000157219		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5300	protein-coding gene	gene with protein product		601305	"""5-hydroxytryptamine (serotonin) receptor 5A"""			7988681	Standard	NM_024012		Approved	5-HT5A	uc003wlu.2	P47898	OTTHUMG00000151327	ENST00000287907.2:c.559G>T	7.37:g.154863168G>T	ENSP00000287907:p.Glu187*		Q2M2D2	Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_5HT5A_rcpt,prints_5HT_rcpt	p.E187*	ENST00000287907.2	37	c.559	CCDS5936.1	7	.	.	.	.	.	.	.	.	.	.	G	41	8.750137	0.98939	.	.	ENSG00000157219	ENST00000287907	.	.	.	4.77	4.77	0.60923	.	0.051956	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	.	18.0029	0.89202	0.0:0.0:1.0:0.0	.	.	.	.	X	187	.	ENSP00000287907:E187X	E	+	1	0	HTR5A	154494101	1.000000	0.71417	0.265000	0.24526	0.423000	0.31445	4.948000	0.63590	2.489000	0.83994	0.655000	0.94253	GAG	HTR5A	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_5HT5A_rcpt	ENSG00000157219		0.622	HTR5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR5A	HGNC	protein_coding	OTTHUMT00000322240.1	-	0.00	51	0	G	NM_024012		154863168	+1	tier1	-	no_errors	ENST00000287907	ensembl	human	known	74_37	nonsense	8.51	43	4	SNP	0.997	T
HUNK	30811	genome.wustl.edu	37	21	33371416	33371416	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr21:33371416G>T	ENST00000270112.2	+	11	2424	c.2064G>T	c.(2062-2064)gaG>gaT	p.E688D		NM_014586.1	NP_055401.1	P57058	HUNK_HUMAN	hormonally up-regulated Neu-associated kinase	688					multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(2)|stomach(1)	30						GGCCCCTGGAGGCCAGCCTGC	0.597																																																	0													57.0	64.0	62.0					21																	33371416		2203	4300	6503	SO:0001583	missense	0			AJ271722	CCDS13610.1	21q22.1	2008-06-05	2008-06-05		ENSG00000142149	ENSG00000142149			13326	protein-coding gene	gene with protein product		606532	"""hormonally upregulated Neu-associated kinase"""			10662544, 10830953	Standard	NM_014586		Approved		uc002yph.3	P57058	OTTHUMG00000085019	ENST00000270112.2:c.2064G>T	21.37:g.33371416G>T	ENSP00000270112:p.Glu688Asp			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.E688D	ENST00000270112.2	37	c.2064	CCDS13610.1	21	.	.	.	.	.	.	.	.	.	.	G	10.67	1.415871	0.25552	.	.	ENSG00000142149	ENST00000270112	T	0.72505	-0.66	4.42	1.59	0.23543	.	0.086934	0.47455	N	0.000223	T	0.51244	0.1663	L	0.29908	0.895	0.33722	D	0.617122	B	0.06786	0.001	B	0.06405	0.002	T	0.45920	-0.9228	10	0.42905	T	0.14	-22.2686	3.7951	0.08736	0.4128:0.181:0.4062:0.0	.	688	P57058	HUNK_HUMAN	D	688	ENSP00000270112:E688D	ENSP00000270112:E688D	E	+	3	2	HUNK	32293287	1.000000	0.71417	1.000000	0.80357	0.603000	0.37013	0.416000	0.21198	0.135000	0.18707	-0.218000	0.12543	GAG	HUNK	-	NULL	ENSG00000142149		0.597	HUNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUNK	HGNC	protein_coding	OTTHUMT00000192782.1		0.00	50	0	G	NM_014586		33371416	+1			no_errors	ENST00000270112	ensembl	human	known	74_37	missense	5.26	72	4	SNP	1.000	T
HYAL4	23553	genome.wustl.edu	37	7	123508663	123508663	+	Silent	SNP	C	C	G	rs373941618		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr7:123508663C>G	ENST00000223026.4	+	3	974	c.336C>G	c.(334-336)ctC>ctG	p.L112L	HYAL4_ENST00000476325.1_Silent_p.L112L	NM_012269.2	NP_036401.2	Q2M3T9	HYAL4_HUMAN	hyaluronoglucosaminidase 4	112					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate catabolic process (GO:0030207)|glycosaminoglycan catabolic process (GO:0006027)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)	hyalurononglucosaminidase activity (GO:0004415)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	23						ATGGAGGTCTCCCACAGAACA	0.408																																																	0													67.0	73.0	71.0					7																	123508663		2203	4300	6503	SO:0001819	synonymous_variant	0			AF009010	CCDS5789.1	7q31.3	2010-01-14			ENSG00000106302	ENSG00000106302			5323	protein-coding gene	gene with protein product	"""hyaluronidase 4"""	604510				10493834	Standard	NM_012269		Approved		uc003vlc.3	Q2M3T9	OTTHUMG00000157349	ENST00000223026.4:c.336C>G	7.37:g.123508663C>G			D0VXG1|Q9UL99|Q9Y6T9	Silent	SNP	pfam_Hyaluronidase,superfamily_Glycoside_hydrolase_SF,pirsf_Hyaluronidase,prints_Hyaluronidase	p.L112	ENST00000223026.4	37	c.336	CCDS5789.1	7																																																																																			HYAL4	-	pfam_Hyaluronidase,superfamily_Glycoside_hydrolase_SF,pirsf_Hyaluronidase,prints_Hyaluronidase	ENSG00000106302		0.408	HYAL4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HYAL4	HGNC	protein_coding	OTTHUMT00000348545.1	-	0.00	78	0	C	NM_012269		123508663	+1	tier1	-	no_errors	ENST00000223026	ensembl	human	known	74_37	silent	17.05	73	15	SNP	0.183	G
IFNGR1	3459	genome.wustl.edu	37	6	137540466	137540466	+	5'UTR	SNP	C	C	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr6:137540466C>T	ENST00000367739.4	-	0	120				IFNGR1_ENST00000543628.1_5'Flank|IFNGR1_ENST00000367735.2_5'UTR|IFNGR1_ENST00000478333.1_5'UTR	NM_000416.2	NP_000407.1	P15260	INGR1_HUMAN	interferon gamma receptor 1						cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to virus (GO:0009615)|signal transduction (GO:0007165)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|vesicle (GO:0031982)	interferon-gamma receptor activity (GO:0004906)			central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	18	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000829)|OV - Ovarian serous cystadenocarcinoma(155;0.00389)	Interferon gamma-1b(DB00033)	GAGAGCCATGCTGCTACCGAC	0.672																																																	0													35.0	35.0	35.0					6																	137540466		2201	4299	6500	SO:0001623	5_prime_UTR_variant	0				CCDS5185.1	6q23-q24	2014-09-17			ENSG00000027697	ENSG00000027697		"""Interferons"", ""CD molecules"""	5439	protein-coding gene	gene with protein product		107470		IFNGR			Standard	NM_000416		Approved	CD119	uc003qho.2	P15260	OTTHUMG00000015656	ENST00000367739.4:c.-2G>A	6.37:g.137540466C>T			B4DFT7|E1P587|Q53Y96	RNA	SNP	-	NULL	ENST00000367739.4	37	NULL	CCDS5185.1	6																																																																																			IFNGR1	-	-	ENSG00000027697		0.672	IFNGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNGR1	HGNC	protein_coding	OTTHUMT00000042401.1	-	0.00	50	0	C			137540466	-1	tier1	-	no_errors	ENST00000478333	ensembl	human	known	74_37	rna	6.90	54	4	SNP	0.008	T
IFT74	80173	genome.wustl.edu	37	9	27056331	27056331	+	Splice_Site	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr9:27056331G>T	ENST00000443698.1	+	18	1668		c.e18-1		IFT74_ENST00000380062.5_Splice_Site|IFT74_ENST00000433700.1_Splice_Site	NM_001099222.1	NP_001092692.1	Q96LB3	IFT74_HUMAN	intraflagellar transport 74						cilium assembly (GO:0042384)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|keratinocyte development (GO:0003334)|negative regulation of epithelial cell proliferation (GO:0050680)|Notch signaling pathway (GO:0007219)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|nucleus (GO:0005634)	beta-tubulin binding (GO:0048487)|chromatin binding (GO:0003682)			endometrium(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)	6		all_neural(11;2.36e-10)		Lung(218;1.4e-05)|LUSC - Lung squamous cell carcinoma(38;0.000114)		GATCTTTCTAGAAATTACATC	0.279																																																	0													73.0	73.0	73.0					9																	27056331		1795	4063	5858	SO:0001630	splice_region_variant	0			AK023707	CCDS43793.1, CCDS47955.1	9p21.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000096872	ENSG00000096872		"""Intraflagellar transport homologs"""	21424	protein-coding gene	gene with protein product	"""capillary morphogenesis protein 1"""	608040	"""coiled-coil domain containing 2"", ""intraflagellar transport 74 homolog (Chlamydomonas)"""	CCDC2		11683410	Standard	NM_001099223		Approved	CMG1, CMG-1, FLJ22621	uc003zqg.4	Q96LB3	OTTHUMG00000021028	ENST00000443698.1:c.1498-1G>T	9.37:g.27056331G>T			Q3B789|Q5VY34|Q6PGQ8|Q9H643|Q9H8G7	Splice_Site	SNP	-	e17-1	ENST00000443698.1	37	c.1498-1	CCDS43793.1	9	.	.	.	.	.	.	.	.	.	.	G	18.15	3.559629	0.65538	.	.	ENSG00000096872	ENST00000433700;ENST00000443698;ENST00000380062	.	.	.	5.27	5.27	0.74061	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8844	0.92370	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	IFT74	27046331	1.000000	0.71417	1.000000	0.80357	0.807000	0.45602	7.442000	0.80503	2.466000	0.83321	0.655000	0.94253	.	IFT74	-	-	ENSG00000096872		0.279	IFT74-202	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT74	HGNC	protein_coding	OTTHUMT00000055476.2		0.00	23	0	G	NM_025103	Intron	27056331	+1			no_errors	ENST00000380062	ensembl	human	known	74_37	splice_site	7.55	49	4	SNP	1.000	T
IGDCC4	57722	genome.wustl.edu	37	15	65674432	65674432	+	3'UTR	SNP	T	T	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr15:65674432T>A	ENST00000352385.2	-	0	5877				IGDCC4_ENST00000558048.1_5'UTR	NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						TTTTCTTCTTTAAAAAAAAAA	0.353																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.*1915A>T	15.37:g.65674432T>A			Q9HCE4	RNA	SNP	-	NULL	ENST00000352385.2	37	NULL	CCDS10206.1	15																																																																																			IGDCC4	-	-	ENSG00000103742		0.353	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	IGDCC4	HGNC	protein_coding	OTTHUMT00000256825.2	-	0.00	28	0	T	NM_020962		65674432	-1	tier1	-	no_errors	ENST00000558048	ensembl	human	known	74_37	rna	10.00	45	5	SNP	0.000	A
IZUMO3	100129669	genome.wustl.edu	37	9	24544258	24544258	+	Missense_Mutation	SNP	A	A	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr9:24544258A>G	ENST00000543880.2	-	5	662	c.431T>C	c.(430-432)cTt>cCt	p.L144P	IZUMO3_ENST00000604921.1_Missense_Mutation_p.L138P|RP11-20A20.2_ENST00000602851.1_lincRNA			Q5VZ72	IZUM3_HUMAN	IZUMO family member 3	144						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)										CCAACAATCAAGAATGGGACC	0.433																																																	0																																										SO:0001583	missense	0				CCDS65020.1	9p21.3	2014-02-17	2010-07-29	2010-07-29	ENSG00000205442	ENSG00000205442		"""-"""	31421	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 134"""	C9orf134		19658160, 22957301	Standard	NM_001271706		Approved	bA20A20.1	uc031tdg.1	Q5VZ72	OTTHUMG00000019704	ENST00000543880.2:c.431T>C	9.37:g.24544258A>G	ENSP00000438895:p.Leu144Pro			Missense_Mutation	SNP	NULL	p.L144P	ENST00000543880.2	37	c.431		9	.	.	.	.	.	.	.	.	.	.	A	19.34	3.808295	0.70797	.	.	ENSG00000205442	ENST00000543880;ENST00000418122	T;T	0.37058	1.22;1.22	5.44	5.44	0.79542	.	.	.	.	.	T	0.50120	0.1597	.	.	.	.	.	.	.	.	.	.	.	.	T	0.65286	-0.6205	5	0.87932	D	0	.	11.8116	0.52185	1.0:0.0:0.0:0.0	.	.	.	.	P	144;57	ENSP00000438895:L144P;ENSP00000391107:L57P	ENSP00000391107:L57P	L	-	2	0	IZUMO3	24534258	0.997000	0.39634	0.732000	0.30844	0.971000	0.66376	4.007000	0.57093	2.284000	0.76573	0.528000	0.53228	CTT	IZUMO3	-	NULL	ENSG00000205442		0.433	IZUMO3-001	NOVEL	not_organism_supported|basic	protein_coding	IZUMO3	HGNC	protein_coding	OTTHUMT00000467652.1	-	0.00	62	0	A	NM_001271706		24544258	-1	tier1	-	no_errors	ENST00000543880	ensembl	human	novel	74_37	missense	11.86	52	7	SNP	0.907	G
JAKMIP1	152789	genome.wustl.edu	37	4	6066624	6066624	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr4:6066624C>T	ENST00000282924.5	-	9	1899	c.1414G>A	c.(1414-1416)Gaa>Aaa	p.E472K	JAKMIP1_ENST00000409021.3_Missense_Mutation_p.E472K|JAKMIP1_ENST00000409371.3_Missense_Mutation_p.E287K|JAKMIP1_ENST00000410077.2_Missense_Mutation_p.E307K|JAKMIP1_ENST00000409831.1_Missense_Mutation_p.E472K|JAKMIP1_ENST00000457227.2_5'UTR	NM_144720.3	NP_653321.1	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein 1	472	Mediates interaction with TYK2 and GABBR1.				cognition (GO:0050890)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|microtubule (GO:0005874)|ribonucleoprotein complex (GO:0030529)	GABA receptor binding (GO:0050811)|RNA binding (GO:0003723)			NS(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						AAGTCTTCTTCGGGCGTGGCT	0.532																																																	0													160.0	134.0	143.0					4																	6066624		2203	4300	6503	SO:0001583	missense	0			AK056126	CCDS3385.1, CCDS47005.1	4p16.1	2013-10-11	2009-08-13		ENSG00000152969	ENSG00000152969			26460	protein-coding gene	gene with protein product		611195				18941173	Standard	NM_144720		Approved	MARLIN1, JAMIP1, Gababrbp, FLJ31564	uc010idb.1	Q96N16	OTTHUMG00000125491	ENST00000282924.5:c.1414G>A	4.37:g.6066624C>T	ENSP00000282924:p.Glu472Lys		A6H2J2|A6H2J3|A6H2J4|A6H2J5|A8MTK6|B4DHZ8|B8ZZR7|D3DVT0|Q86Y69|Q8N7G3	Missense_Mutation	SNP	NULL	p.E472K	ENST00000282924.5	37	c.1414	CCDS3385.1	4	.	.	.	.	.	.	.	.	.	.	C	23.3	4.396387	0.83011	.	.	ENSG00000152969	ENST00000409021;ENST00000409371;ENST00000425341;ENST00000429819;ENST00000282924;ENST00000409831;ENST00000410077	T;T;T;T;T	0.32988	1.85;1.44;1.85;1.85;1.43	4.45	4.45	0.53987	.	0.000000	0.64402	D	0.000002	T	0.46425	0.1392	M	0.62723	1.935	0.54753	D	0.999989	D;D;D;D;D	0.69078	0.987;0.986;0.997;0.997;0.986	P;P;P;P;P	0.56042	0.573;0.555;0.79;0.715;0.63	T	0.46762	-0.9168	10	0.48119	T	0.1	.	16.0347	0.80617	0.0:1.0:0.0:0.0	.	307;472;287;472;472	B4DHZ8;F2Z2K5;Q96N16-5;Q96N16-2;Q96N16	.;.;.;.;JKIP1_HUMAN	K	472;287;472;364;472;472;307	ENSP00000386711:E472K;ENSP00000387042:E287K;ENSP00000282924:E472K;ENSP00000386925:E472K;ENSP00000386745:E307K	ENSP00000282924:E472K	E	-	1	0	JAKMIP1	6117525	1.000000	0.71417	0.851000	0.33527	0.948000	0.59901	7.140000	0.77322	2.202000	0.70862	0.561000	0.74099	GAA	JAKMIP1	-	NULL	ENSG00000152969		0.532	JAKMIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JAKMIP1	HGNC	protein_coding	OTTHUMT00000246816.2	-	0.00	75	0	C	NM_144720		6066624	-1	tier1	-	no_errors	ENST00000409021	ensembl	human	known	74_37	missense	29.89	61	26	SNP	1.000	T
KCNK2	3776	genome.wustl.edu	37	1	215408174	215408174	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr1:215408174G>A	ENST00000444842.2	+	7	1117	c.967G>A	c.(967-969)Gga>Aga	p.G323R	KCNK2_ENST00000391894.2_Missense_Mutation_p.G308R|KCNK2_ENST00000391895.2_Missense_Mutation_p.G319R	NM_001017425.2|NM_014217.3	NP_001017425.2|NP_055032.1	O95069	KCNK2_HUMAN	potassium channel, subfamily K, member 2	323					G-protein coupled receptor signaling pathway (GO:0007186)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|potassium ion leak channel activity (GO:0022841)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)|Dronedarone(DB04855)	GTTCCAGGTGGGAGAGTTCAG	0.413																																																	0													100.0	103.0	102.0					1																	215408174		2203	4300	6503	SO:0001583	missense	0			AF004711	CCDS31024.1, CCDS41466.1, CCDS41467.1	1q41	2012-03-07			ENSG00000082482	ENSG00000082482		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6277	protein-coding gene	gene with protein product		603219				9721223, 16382106	Standard	NM_001017424		Approved	K2p2.1, TREK-1	uc001hkr.4	O95069	OTTHUMG00000037017	ENST00000444842.2:c.967G>A	1.37:g.215408174G>A	ENSP00000394033:p.Gly323Arg		A1Z1V3|A8K618|B2RCS4|B7ZL56|D3DTA5|Q5DP47|Q5DP48|Q9NRT2|Q9UNE3	Missense_Mutation	SNP	pfam_2pore_dom_K_chnl_dom,prints_2pore_dom_K_chnl_TREK,prints_2pore_dom_K_chnl,prints_2pore_dom_K_chnl_TRAAK,prints_2pore_dom_K_chnl_TASK	p.G323R	ENST00000444842.2	37	c.967	CCDS41467.1	1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.499344	0.85069	.	.	ENSG00000082482	ENST00000391895;ENST00000391894;ENST00000444842	T;T;T	0.22743	1.94;1.94;1.94	5.92	5.92	0.95590	.	0.000000	0.33075	U	0.005313	T	0.36744	0.0978	L	0.36672	1.1	0.80722	D	1	D;D;D	0.89917	0.997;0.996;1.0	D;D;D	0.80764	0.972;0.939;0.994	T	0.01993	-1.1233	10	0.12103	T	0.63	.	20.3206	0.98668	0.0:0.0:1.0:0.0	.	308;323;319	O95069-2;O95069;O95069-3	.;KCNK2_HUMAN;.	R	319;308;323	ENSP00000375765:G319R;ENSP00000375764:G308R;ENSP00000394033:G323R	ENSP00000375764:G308R	G	+	1	0	KCNK2	213474797	1.000000	0.71417	1.000000	0.80357	0.825000	0.46686	9.869000	0.99810	2.813000	0.96785	0.561000	0.74099	GGA	KCNK2	-	prints_2pore_dom_K_chnl_TREK,prints_2pore_dom_K_chnl_TRAAK	ENSG00000082482		0.413	KCNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK2	HGNC	protein_coding	OTTHUMT00000089856.2	-	0.00	28	0	G	NM_014217		215408174	+1	tier1	-	no_errors	ENST00000444842	ensembl	human	known	74_37	missense	8.00	46	4	SNP	1.000	A
KCTD7	154881	genome.wustl.edu	37	7	66104124	66104124	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr7:66104124G>T	ENST00000275532.3	+	4	959	c.775G>T	c.(775-777)Gtg>Ttg	p.V259L	KCTD7_ENST00000443322.1_Missense_Mutation_p.V259L	NM_001167961.2|NM_153033.4	NP_001161433.1|NP_694578.1	Q96MP8	KCTD7_HUMAN	potassium channel tetramerization domain containing 7	259					cell death (GO:0008219)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|urinary_tract(1)	16						GGGTCTCACCGTGGACCACCA	0.572																																																	0													124.0	89.0	101.0					7																	66104124		2203	4300	6503	SO:0001583	missense	0			AK056631	CCDS5534.1, CCDS55117.1	7q11.21	2014-09-17	2013-06-20		ENSG00000243335	ENSG00000243335			21957	protein-coding gene	gene with protein product		611725	"""potassium channel tetramerisation domain containing 7"""			12477932	Standard	NM_001167961		Approved	FLJ32069, EPM3, CLN14	uc003tve.3	Q96MP8	OTTHUMG00000129543	ENST00000275532.3:c.775G>T	7.37:g.66104124G>T	ENSP00000275532:p.Val259Leu		A4D2M4|Q8IVR0	Missense_Mutation	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	p.V259L	ENST00000275532.3	37	c.775	CCDS5534.1	7	.	.	.	.	.	.	.	.	.	.	G	17.39	3.378824	0.61735	.	.	ENSG00000243335	ENST00000275532;ENST00000443322	T;T	0.67865	-0.28;-0.29	5.47	5.47	0.80525	.	.	.	.	.	T	0.59445	0.2194	L	0.43923	1.385	0.80722	D	1	B	0.33940	0.433	B	0.26517	0.07	T	0.61412	-0.7068	9	0.49607	T	0.09	.	18.3248	0.90250	0.0:0.0:1.0:0.0	.	259	Q96MP8	KCTD7_HUMAN	L	259	ENSP00000275532:V259L;ENSP00000411624:V259L	ENSP00000275532:V259L	V	+	1	0	KCTD7	65741559	1.000000	0.71417	0.954000	0.39281	0.897000	0.52465	7.282000	0.78630	2.573000	0.86826	0.655000	0.94253	GTG	KCTD7	-	NULL	ENSG00000243335		0.572	KCTD7-001	KNOWN	basic|CCDS	protein_coding	KCTD7	HGNC	protein_coding	OTTHUMT00000251733.2		0.00	24	0	G	NM_153033		66104124	+1			no_errors	ENST00000275532	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.998	T
KDM2A	22992	genome.wustl.edu	37	11	66999063	66999063	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr11:66999063G>T	ENST00000529006.2	+	12	1557	c.1111G>T	c.(1111-1113)Ggg>Tgg	p.G371W	KDM2A_ENST00000526258.1_3'UTR|KDM2A_ENST00000398645.2_Missense_Mutation_p.G371W	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A	371					histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						GTTGGAGTCTGGGAATGGGGA	0.473																																																	0													83.0	74.0	77.0					11																	66999063		1913	4134	6047	SO:0001583	missense	0			BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.1111G>T	11.37:g.66999063G>T	ENSP00000432786:p.Gly371Trp		D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	Missense_Mutation	SNP	pfam_Znf_CXXC,pfam_F-box_dom,pfam_JmjC_dom,superfamily_Znf_FYVE_PHD,smart_JmjC_dom,smart_Znf_PHD,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.G371W	ENST00000529006.2	37	c.1111	CCDS44657.1	11	.	.	.	.	.	.	.	.	.	.	G	19.49	3.837430	0.71373	.	.	ENSG00000173120	ENST00000398645;ENST00000529006	T;T	0.36340	1.26;1.26	5.59	5.59	0.84812	.	0.875918	0.10001	N	0.728456	T	0.34600	0.0903	N	0.08118	0	0.80722	D	1	D	0.59767	0.986	P	0.52627	0.704	T	0.28808	-1.0032	10	0.37606	T	0.19	-13.3654	17.1157	0.86688	0.0:0.0:1.0:0.0	.	371	Q9Y2K7	KDM2A_HUMAN	W	371	ENSP00000381640:G371W;ENSP00000432786:G371W	ENSP00000381640:G371W	G	+	1	0	KDM2A	66755639	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	5.024000	0.64090	2.783000	0.95769	0.655000	0.94253	GGG	KDM2A	-	NULL	ENSG00000173120		0.473	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM2A	HGNC	protein_coding	OTTHUMT00000393140.2	-	0.00	60	0	G	NM_012308		66999063	+1	tier1	-	no_errors	ENST00000529006	ensembl	human	known	74_37	missense	5.19	73	4	SNP	1.000	T
KIAA1551	55196	genome.wustl.edu	37	12	32136172	32136172	+	Silent	SNP	T	T	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr12:32136172T>C	ENST00000312561.4	+	4	2697	c.2283T>C	c.(2281-2283)gcT>gcC	p.A761A	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	761																	TTCAGATAGCTGTAGTGTCAC	0.388																																																	0													81.0	78.0	79.0					12																	32136172		2203	4300	6503	SO:0001819	synonymous_variant	0			AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.2283T>C	12.37:g.32136172T>C			B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Silent	SNP	NULL	p.A761	ENST00000312561.4	37	c.2283	CCDS8725.2	12																																																																																			KIAA1551	-	NULL	ENSG00000174718		0.388	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1551	HGNC	protein_coding	OTTHUMT00000250307.2	-	0.00	37	0	T	NM_018169		32136172	+1	tier1	-	no_errors	ENST00000312561	ensembl	human	known	74_37	silent	11.49	76	10	SNP	0.157	C
KIAA1919	91749	genome.wustl.edu	37	6	111587146	111587146	+	Missense_Mutation	SNP	C	C	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr6:111587146C>G	ENST00000368847.4	+	4	734	c.381C>G	c.(379-381)ttC>ttG	p.F127L		NM_153369.2	NP_699200.2	Q5TF39	NAGT1_HUMAN	KIAA1919	127					carbohydrate transport (GO:0008643)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			large_intestine(3)|lung(2)|ovary(4)|skin(3)	12		all_cancers(87;2.35e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.0209)		OV - Ovarian serous cystadenocarcinoma(136;0.055)|all cancers(137;0.0871)|Epithelial(106;0.0884)		CCTTACACTTCTCTTTTGCCT	0.483																																																	0													91.0	94.0	93.0					6																	111587146		2203	4300	6503	SO:0001583	missense	0			BC036115	CCDS5090.1	6q22	2013-10-02			ENSG00000173214	ENSG00000173214			21053	protein-coding gene	gene with protein product							Standard	NM_153369		Approved	MGC33953, MFSD4B	uc003puv.4	Q5TF39	OTTHUMG00000015372	ENST00000368847.4:c.381C>G	6.37:g.111587146C>G	ENSP00000357840:p.Phe127Leu		A8K9M0|Q8IYB6|Q96PW9|Q9P0D6	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.F127L	ENST00000368847.4	37	c.381	CCDS5090.1	6	.	.	.	.	.	.	.	.	.	.	C	27.0	4.795032	0.90453	.	.	ENSG00000173214	ENST00000368847	T	0.57107	0.42	5.85	5.85	0.93711	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	T	0.69566	0.3125	M	0.80508	2.5	0.58432	D	0.999999	D	0.65815	0.995	D	0.77557	0.99	T	0.63919	-0.6528	10	0.27785	T	0.31	-20.5152	20.168	0.98156	0.0:1.0:0.0:0.0	.	127	Q5TF39	NAGT1_HUMAN	L	127	ENSP00000357840:F127L	ENSP00000357840:F127L	F	+	3	2	KIAA1919	111693839	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	3.426000	0.52778	2.774000	0.95407	0.643000	0.83706	TTC	KIAA1919	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	ENSG00000173214		0.483	KIAA1919-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1919	HGNC	protein_coding	OTTHUMT00000041827.1	-	0.00	39	0	C	NM_153369		111587146	+1	tier1	-	no_errors	ENST00000368847	ensembl	human	known	74_37	missense	20.51	31	8	SNP	1.000	G
KLHL10	317719	genome.wustl.edu	37	17	40001402	40001402	+	Nonsense_Mutation	SNP	G	G	T	rs374019359		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr17:40001402G>T	ENST00000293303.4	+	3	862	c.709G>T	c.(709-711)Gag>Tag	p.E237*		NM_152467.3	NP_689680.2	Q6JEL2	KLH10_HUMAN	kelch-like family member 10	237					cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia morphogenesis (GO:0048808)|male gonad development (GO:0008584)|protein ubiquitination (GO:0016567)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	26		Breast(137;0.000162)				AATGCATGCTGAGTACTTCAT	0.433																																																	0													87.0	81.0	83.0					17																	40001402		2048	4197	6245	SO:0001587	stop_gained	0			AK057224	CCDS42340.1	17q21.2	2013-01-30	2013-01-30		ENSG00000161594	ENSG00000161594		"""Kelch-like"", ""BTB/POZ domain containing"""	18829	protein-coding gene	gene with protein product		608778	"""kelch-like 10 (Drosophila)"""				Standard	NM_152467		Approved	FLJ32662	uc010cxr.3	Q6JEL2	OTTHUMG00000152510	ENST00000293303.4:c.709G>T	17.37:g.40001402G>T	ENSP00000293303:p.Glu237*		Q6NW28|Q96MC0	Nonsense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.E237*	ENST00000293303.4	37	c.709	CCDS42340.1	17	.	.	.	.	.	.	.	.	.	.	G	35	5.528153	0.96446	.	.	ENSG00000161594	ENST00000293303	.	.	.	5.51	5.51	0.81932	.	0.336736	0.35772	N	0.002983	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1556	0.89689	0.0:0.0:1.0:0.0	.	.	.	.	X	237	.	.	E	+	1	0	KLHL10	37254928	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.810000	0.62598	2.873000	0.98535	0.561000	0.74099	GAG	KLHL10	-	pfam_BACK,smart_BACK,pirsf_Kelch-like_gigaxonin	ENSG00000161594		0.433	KLHL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL10	HGNC	protein_coding	OTTHUMT00000326535.1	-	0.00	30	0	G	NM_152467		40001402	+1	tier1	-	no_errors	ENST00000293303	ensembl	human	known	74_37	nonsense	10.00	36	4	SNP	0.996	T
KMT2A	4297	genome.wustl.edu	37	11	118348845	118348845	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr11:118348845C>A	ENST00000389506.5	+	5	3498	c.3498C>A	c.(3496-3498)gaC>gaA	p.D1166E	KMT2A_ENST00000354520.4_Missense_Mutation_p.D1166E|KMT2A_ENST00000534358.1_Missense_Mutation_p.D1166E			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	1166					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										TGCCTGAGGACTGTGGTGTTT	0.507																																																	0													169.0	165.0	166.0					11																	118348845		2200	4296	6496	SO:0001583	missense	0			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.3498C>A	11.37:g.118348845C>A	ENSP00000374157:p.Asp1166Glu		E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_Bromodomain,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pirsf_MeTrfase_trithorax,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC,pfscan_Bromodomain	p.D1166E	ENST00000389506.5	37	c.3498	CCDS31686.1	11	.	.	.	.	.	.	.	.	.	.	C	22.0	4.231607	0.79688	.	.	ENSG00000118058	ENST00000534358;ENST00000531904;ENST00000389506;ENST00000354520;ENST00000359313;ENST00000533790	D;T;D;D	0.92048	-2.94;0.67;-2.94;-2.96	6.06	6.06	0.98353	Zinc finger, CXXC-type (2);	0.000000	0.85682	D	0.000000	D	0.95427	0.8515	L	0.53249	1.67	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.95021	0.8160	10	0.72032	D	0.01	.	20.6208	0.99490	0.0:1.0:0.0:0.0	.	1166;1166	E9PQG7;Q03164	.;MLL1_HUMAN	E	1166;1199;1166;1166;76;244	ENSP00000436786:D1166E;ENSP00000432391:D1199E;ENSP00000374157:D1166E;ENSP00000346516:D1166E	ENSP00000346516:D1166E	D	+	3	2	MLL	117854055	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.015000	0.57152	2.882000	0.98803	0.655000	0.94253	GAC	KMT2A	-	pfam_Znf_CXXC,pirsf_MeTrfase_trithorax,pfscan_Znf_CXXC	ENSG00000118058		0.507	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2A	HGNC	protein_coding	OTTHUMT00000399085.2	-	0.00	53	0	C	NM_005933		118348845	+1	tier1	-	no_errors	ENST00000389506	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	A
KMT2C	58508	genome.wustl.edu	37	7	151859283	151859283	+	Frame_Shift_Del	DEL	T	T	-			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr7:151859283delT	ENST00000262189.6	-	43	11597	c.11379delA	c.(11377-11379)aaafs	p.K3793fs	KMT2C_ENST00000355193.2_Frame_Shift_Del_p.K3793fs	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	3793					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TGCCCTCAGGTTTTTGATTCA	0.403																																																	0													44.0	46.0	46.0					7																	151859283		2203	4300	6503	SO:0001589	frameshift_variant	0			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.11379delA	7.37:g.151859283delT	ENSP00000262189:p.Lys3793fs		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Frame_Shift_Del	DEL	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.K3793fs	ENST00000262189.6	37	c.11379	CCDS5931.1	7																																																																																			KMT2C	-	NULL	ENSG00000055609		0.403	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2C	HGNC	protein_coding	OTTHUMT00000318887.3		0.00	33	0	T			151859283	-1	tier1		no_errors	ENST00000355193	ensembl	human	known	74_37	frame_shift_del	7.89	35	3	DEL	1.000	-
LCT	3938	genome.wustl.edu	37	2	136564731	136564731	+	Silent	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr2:136564731G>T	ENST00000264162.2	-	9	4150	c.4140C>A	c.(4138-4140)ggC>ggA	p.G1380G		NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	1380	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	TCCAGATGAAGCCCTCAGGAA	0.577																																																	0													156.0	123.0	134.0					2																	136564731		2203	4300	6503	SO:0001819	synonymous_variant	0			X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.4140C>A	2.37:g.136564731G>T			Q4ZG58	Silent	SNP	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	p.G1380	ENST00000264162.2	37	c.4140	CCDS2178.1	2																																																																																			LCT	-	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF	ENSG00000115850		0.577	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCT	HGNC	protein_coding	OTTHUMT00000254657.1		0.00	52	0	G	NM_002299		136564731	-1			no_errors	ENST00000264162	ensembl	human	known	74_37	silent	5.19	73	4	SNP	1.000	T
LEMD3	23592	genome.wustl.edu	37	12	65632541	65632541	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr12:65632541G>A	ENST00000308330.2	+	6	1894	c.1868G>A	c.(1867-1869)cGt>cAt	p.R623H		NM_001167614.1|NM_014319.4	NP_001161086.1|NP_055134.2	Q9Y2U8	MAN1_HUMAN	LEM domain containing 3	623					negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of cell cycle (GO:0051726)|skeletal muscle cell differentiation (GO:0035914)	integral component of membrane (GO:0016021)|integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	36			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0104)		TTTTGGTGTCGTTTTCGACGT	0.353																																																	0													202.0	175.0	184.0					12																	65632541		2203	4300	6503	SO:0001583	missense	0			AF263918	CCDS8972.1	12q14	2008-02-05			ENSG00000174106	ENSG00000174106			28887	protein-coding gene	gene with protein product		607844				10671519, 15489854	Standard	NM_014319		Approved	MAN1	uc001ssl.2	Q9Y2U8	OTTHUMG00000168840	ENST00000308330.2:c.1868G>A	12.37:g.65632541G>A	ENSP00000308369:p.Arg623His		Q9NT47|Q9NYA5	Missense_Mutation	SNP	pfam_Inner-Nucl-membr_MAN1,pfam_LEM_dom,superfamily_LEM/LEM-like_dom,smart_LEM_dom,pfscan_LEM_dom	p.R623H	ENST00000308330.2	37	c.1868	CCDS8972.1	12	.	.	.	.	.	.	.	.	.	.	G	27.0	4.795785	0.90453	.	.	ENSG00000174106	ENST00000308330	T	0.52983	0.64	4.89	4.89	0.63831	Inner nuclear membrane protein MAN1 (1);	0.000000	0.85682	D	0.000000	T	0.68833	0.3044	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.68758	-0.5324	9	.	.	.	-9.3081	18.9427	0.92610	0.0:0.0:1.0:0.0	.	623	Q9Y2U8	MAN1_HUMAN	H	623	ENSP00000308369:R623H	.	R	+	2	0	LEMD3	63918808	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.295000	0.89937	2.653000	0.90120	0.655000	0.94253	CGT	LEMD3	-	pfam_Inner-Nucl-membr_MAN1	ENSG00000174106		0.353	LEMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEMD3	HGNC	protein_coding	OTTHUMT00000401312.2	-	0.00	24	0	G			65632541	+1	tier1	-	no_errors	ENST00000308330	ensembl	human	known	74_37	missense	14.04	49	8	SNP	1.000	A
LINC00052	145978	genome.wustl.edu	37	15	88121520	88121521	+	lincRNA	DEL	TC	TC	-	rs558084890|rs367939444|rs142830514	byFrequency	TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	TC	TC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr15:88121520_88121521delTC	ENST00000560153.1	+	0	389_390				RP11-648K4.2_ENST00000560439.1_lincRNA	NR_026869.1		Q96N35	TMM83_HUMAN	long intergenic non-protein coding RNA 52							integral component of membrane (GO:0016021)											tctgtttatgtctctctctctc	0.431																																																	0																																												0			AK056023		15q25.3	2012-10-12	2011-08-10	2011-08-10		ENSG00000259527		"""Long non-coding RNAs"""	26455	non-coding RNA	RNA, long non-coding			"""transmembrane protein 83"", ""non-protein coding RNA 52"""	TMEM83, NCRNA00052			Standard	NR_026869		Approved	FLJ31461	uc002bmc.1	Q96N35			15.37:g.88121530_88121531delTC				RNA	DEL	-	NULL	ENST00000560153.1	37	NULL		15																																																																																			LINC00052	-	-	ENSG00000259527		0.431	LINC00052-002	KNOWN	basic	lincRNA	LINC00052	HGNC	lincRNA	OTTHUMT00000416151.1		0.00	24	0	TC	XR_017978		88121521	+1	tier1		no_errors	ENST00000560153	ensembl	human	known	74_37	rna	13.33	26	4	DEL	0.018:0.021	-
LINC00686	140865	genome.wustl.edu	37	20	61326439	61326440	+	lincRNA	INS	-	-	CTGCACCTGCACCTGCAC	rs386816062|rs138220488|rs145607453		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr20:61326439_61326440insCTGCACCTGCACCTGCAC	ENST00000435412.1	-	0	267_268									long intergenic non-protein coding RNA 686																		CCGTCTGCCGTctgcacctgca	0.624																																																	0																																												0			D80415		20q13.33	2012-10-24	2012-10-24	2012-10-24	ENSG00000237687	ENSG00000237687		"""Long non-coding RNAs"""	16221	non-coding RNA	RNA, long non-coding			"""chromosome 20 open reading frame 90"""	C20orf90			Standard			Approved	bA93B14.2			OTTHUMG00000032927		20.37:g.61326439_61326440insCTGCACCTGCACCTGCAC				RNA	INS	-	NULL	ENST00000435412.1	37	NULL		20																																																																																			LINC00686	-	-	ENSG00000237687		0.624	LINC00686-001	KNOWN	basic	lincRNA	LINC00686	HGNC	lincRNA	OTTHUMT00000080056.1		0.00	15	0	0			61326440	-1			no_errors	ENST00000435412	ensembl	human	known	74_37	rna	10.64	42	5	INS	0.017:0.023	CTGCACCTGCACCTGCAC
LMAN2	10960	genome.wustl.edu	37	5	176765595	176765595	+	Silent	SNP	G	G	T	rs547434469		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr5:176765595G>T	ENST00000303127.7	-	3	531	c.327C>A	c.(325-327)ctC>ctA	p.L109L	LMAN2_ENST00000506310.1_5'UTR|RN7SL562P_ENST00000582768.1_RNA|LMAN2_ENST00000515209.1_Silent_p.L109L	NM_006816.2	NP_006807.1	Q12907	LMAN2_HUMAN	lectin, mannose-binding 2	109	L-type lectin-like. {ECO:0000255|PROSITE- ProRule:PRU00658}.				positive regulation of phagocytosis (GO:0050766)|protein transport (GO:0015031)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|glycoprotein binding (GO:0001948)|heat shock protein binding (GO:0031072)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|upper_aerodigestive_tract(1)	16	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCCAGTCTTTGAGGAAGCACG	0.627																																																	0													222.0	185.0	197.0					5																	176765595		2203	4300	6503	SO:0001819	synonymous_variant	0			U10362	CCDS4417.1	5q35	2008-02-05		2003-07-04	ENSG00000169223	ENSG00000169223			16986	protein-coding gene	gene with protein product		609551	"""chromosome 5 open reading frame 8"""	C5orf8		12609988	Standard	NM_006816		Approved	GP36B, VIP36	uc003mge.3	Q12907	OTTHUMG00000130860	ENST00000303127.7:c.327C>A	5.37:g.176765595G>T			Q53HH1	Silent	SNP	pfam_Lectin_leg,superfamily_ConA-like_lec_gl_sf	p.L109	ENST00000303127.7	37	c.327	CCDS4417.1	5																																																																																			LMAN2	-	pfam_Lectin_leg,superfamily_ConA-like_lec_gl_sf	ENSG00000169223		0.627	LMAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMAN2	HGNC	protein_coding	OTTHUMT00000253434.1		0.00	19	0	G	NM_006816		176765595	-1			no_errors	ENST00000303127	ensembl	human	known	74_37	silent	7.02	53	4	SNP	1.000	T
RNF213	57674	genome.wustl.edu	37	17	78327572	78327572	+	Intron	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr17:78327572C>A	ENST00000582970.1	+	34	10721				CTD-2047H16.4_ENST00000572151.1_RNA|CTD-2047H16.4_ENST00000575034.1_RNA|RNF213_ENST00000508628.2_Intron|RNF213_ENST00000336301.6_Intron	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213						ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			CGCCGCTGTGCAGGGGTGAGG	0.587																																																	0																																										SO:0001627	intron_variant	0			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.10578+106C>A	17.37:g.78327572C>A			C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	RNA	SNP	-	NULL	ENST00000582970.1	37	NULL	CCDS58606.1	17																																																																																			CTD-2047H16.4	-	-	ENSG00000263069		0.587	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	LOC100294362	Clone_based_vega_gene	protein_coding	OTTHUMT00000443298.1	-	0.00	24	0	C	NM_020914		78327572	-1	tier1	-	no_errors	ENST00000575034	ensembl	human	known	74_37	rna	13.79	25	4	SNP	0.000	A
PDE6B	5158	genome.wustl.edu	37	4	647856	647856	+	Intron	SNP	C	C	A	rs71602494		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr4:647856C>A	ENST00000496514.1	+	5	873				PDE6B_ENST00000429163.2_Intron|PDE6B_ENST00000255622.6_Intron|RP11-1191J2.2_ENST00000468356.1_RNA|RP11-1191J2.2_ENST00000598370.1_RNA|RP11-1191J2.2_ENST00000489312.1_RNA|RP11-1191J2.2_ENST00000599030.1_RNA			P35913	PDE6B_HUMAN	phosphodiesterase 6B, cGMP-specific, rod, beta						cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			NS(1)|breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|urinary_tract(1)	30					Caffeine(DB00201)	ACCCTCACCTCTTCTCTGCCC	0.647																																					GBM(71;463 1194 9848 25922 46834)												0													59.0	63.0	62.0					4																	647856		2203	4299	6502	SO:0001627	intron_variant	0			BC000249	CCDS33932.1, CCDS46993.1, CCDS54703.1	4p16.3	2014-01-28	2008-07-31		ENSG00000133256	ENSG00000133256	3.1.4.17	"""Phosphodiesterases"""	8786	protein-coding gene	gene with protein product	"""congenital stationary night blindness 3, autosomal dominant"""	180072		PDEB		1313787	Standard	NM_001145292		Approved	CSNB3, rd1, RP40, CSNBAD2	uc003gap.3	P35913	OTTHUMG00000159909	ENST00000496514.1:c.853-13C>A	4.37:g.647856C>A			B7Z9T9|E7ETT3|Q53XN5|Q9BWH5|Q9UD49	RNA	SNP	-	NULL	ENST00000496514.1	37	NULL	CCDS33932.1	4																																																																																			RP11-1191J2.2	-	-	ENSG00000242686		0.647	PDE6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LOC101928521	Clone_based_vega_gene	protein_coding	OTTHUMT00000358109.1	-	0.00	45	0	C	NM_000283		647856	-1	tier1	-	no_errors	ENST00000468356	ensembl	human	known	74_37	rna	7.23	76	6	SNP	0.000	A
LPHN2	23266	genome.wustl.edu	37	1	82409086	82409086	+	Nonsense_Mutation	SNP	C	C	A	rs375748710		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr1:82409086C>A	ENST00000370728.1	+	8	1476	c.831C>A	c.(829-831)taC>taA	p.Y277*	LPHN2_ENST00000271029.4_Nonsense_Mutation_p.Y277*|LPHN2_ENST00000370727.1_Nonsense_Mutation_p.Y277*|LPHN2_ENST00000370721.1_Nonsense_Mutation_p.Y281*|LPHN2_ENST00000370723.1_Nonsense_Mutation_p.Y277*|LPHN2_ENST00000370717.2_Nonsense_Mutation_p.Y277*|LPHN2_ENST00000370713.1_Nonsense_Mutation_p.Y277*|LPHN2_ENST00000319517.6_Nonsense_Mutation_p.Y277*|LPHN2_ENST00000370715.1_Nonsense_Mutation_p.Y277*|LPHN2_ENST00000469377.2_Intron|LPHN2_ENST00000370725.1_Nonsense_Mutation_p.Y277*|LPHN2_ENST00000370730.1_Nonsense_Mutation_p.Y277*|LPHN2_ENST00000359929.3_Nonsense_Mutation_p.Y277*|LPHN2_ENST00000394879.1_Nonsense_Mutation_p.Y277*|LPHN2_ENST00000335786.5_Nonsense_Mutation_p.Y277*			O95490	LPHN2_HUMAN	latrophilin 2	277	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(37)|ovary(3)|pancreas(1)|prostate(3)|skin(22)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	119				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		GGGTCATTTACGCCACTGAAC	0.423																																																	0													142.0	133.0	136.0					1																	82409086		2203	4300	6503	SO:0001587	stop_gained	0			AJ131581	CCDS689.1, CCDS72811.1	1p31.1	2014-08-08	2003-03-17	2003-05-02	ENSG00000117114	ENSG00000117114		"""-"", ""GPCR / Class B : Orphans"""	18582	protein-coding gene	gene with protein product		607018	"""latrophilin 1"""	LPHH1		10760572	Standard	XR_248786		Approved	KIAA0786, LEC1	uc001diu.3	O95490	OTTHUMG00000009844	ENST00000370728.1:c.831C>A	1.37:g.82409086C>A	ENSP00000359763:p.Tyr277*		A5XEI2|B1ALT8|B1ALT9|B1ALU0|B1ALU2|B1ALU4|B1ALU5|B1ALU6|O94882|Q5VX76|Q9UKY5|Q9UKY6	Nonsense_Mutation	SNP	pfam_GPCR_2_latrophilin_rcpt_C,pfam_Olfac-like,pfam_DUF3497,pfam_GPCR_2_secretin-like,pfam_Lectin_gal-bd_dom,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,smart_Olfac-like,smart_GPCR_2_extracellular_dom,smart_GPS_dom,prints_GPCR_2_latrophilin,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_Lectin_gal-bd_dom,pfscan_Olfac-like,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like	p.Y277*	ENST00000370728.1	37	c.831		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	42|42	9.382907|9.382907	0.99155|0.99155	.|.	.|.	ENSG00000117114|ENSG00000117114	ENST00000449420|ENST00000370721;ENST00000370728;ENST00000370730;ENST00000370727;ENST00000370725;ENST00000370723;ENST00000359929;ENST00000370715;ENST00000370713;ENST00000319517;ENST00000370717;ENST00000394879;ENST00000271029;ENST00000335786	.|.	.|.	.|.	5.52|5.52	0.473|0.473	0.16763|0.16763	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.08088|.	0.0202|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.34453|.	-0.9828|.	3|.	.|0.02654	.|T	.|1	.|.	10.3562|10.3562	0.43964|0.43964	0.0:0.3219:0.0:0.6781|0.0:0.3219:0.0:0.6781	.|.	.|.	.|.	.|.	K|X	145|281;277;277;277;277;277;277;277;277;277;277;277;277;277	.|.	.|ENSP00000271029:Y277X	T|Y	+|+	2|3	0|2	LPHN2|LPHN2	82181674|82181674	1.000000|1.000000	0.71417|0.71417	0.989000|0.989000	0.46669|0.46669	0.968000|0.968000	0.65278|0.65278	0.853000|0.853000	0.27777|0.27777	-0.461000|-0.461000	0.06993|0.06993	-0.556000|-0.556000	0.04195|0.04195	ACG|TAC	LPHN2	-	pfam_Olfac-like,smart_Olfac-like,pfscan_Olfac-like	ENSG00000117114		0.423	LPHN2-007	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	LPHN2	HGNC	protein_coding	OTTHUMT00000027188.1	-	0.00	15	0	C	NM_012302		82409086	+1	tier1	-	no_errors	ENST00000370717	ensembl	human	known	74_37	nonsense	14.81	23	4	SNP	1.000	A
LRCH4	4034	genome.wustl.edu	37	7	100174539	100174539	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr7:100174539G>T	ENST00000310300.6	-	13	1506	c.1454C>A	c.(1453-1455)cCc>cAc	p.P485H	LRCH4_ENST00000497245.1_Missense_Mutation_p.P33H	NM_002319.3	NP_002310.2	O75427	LRCH4_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 4	485					nervous system development (GO:0007399)	PML body (GO:0016605)				NS(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	23	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TCCAGCTATGGGAAGGGGCTC	0.667																																																	0													15.0	14.0	14.0					7																	100174539		2183	4258	6441	SO:0001583	missense	0			AF053356	CCDS34706.1	7q22	2008-05-20	2004-05-27	2004-05-28	ENSG00000077454	ENSG00000077454			6691	protein-coding gene	gene with protein product				LRN, LRRN1		9799793	Standard	XM_005250346		Approved		uc003uvj.3	O75427	OTTHUMG00000159544	ENST00000310300.6:c.1454C>A	7.37:g.100174539G>T	ENSP00000309689:p.Pro485His		A4D2D5|Q8WV85|Q96ID0	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_CH-domain,superfamily_CH-domain,smart_Leu-rich_rpt_typical-subtyp,smart_CH-domain,pfscan_CH-domain	p.P485H	ENST00000310300.6	37	c.1454	CCDS34706.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.86|12.86	2.063466|2.063466	0.36373|0.36373	.|.	.|.	ENSG00000077454|ENSG00000077454	ENST00000310300;ENST00000497245|ENST00000485554	T;T|.	0.49720|.	1.31;0.77|.	4.07|4.07	2.09|2.09	0.27110|0.27110	.|.	0.892416|0.892416	0.09812|0.09812	N|N	0.752663|0.752663	T|T	0.23171|0.23171	0.0560|0.0560	N|N	0.19112|0.19112	0.55|0.55	0.22639|0.22639	N|N	0.998901|0.998901	P|.	0.45283|.	0.855|.	B|.	0.38500|.	0.275|.	T|T	0.23762|0.23762	-1.0179|-1.0179	10|7	0.46703|0.36615	T|T	0.11|0.2	-2.6206|-2.6206	4.3332|4.3332	0.11073|0.11073	0.1173:0.0:0.6583:0.2244|0.1173:0.0:0.6583:0.2244	.|.	485|.	O75427|.	LRCH4_HUMAN|.	H|T	485;33|10	ENSP00000309689:P485H;ENSP00000419870:P33H|.	ENSP00000309689:P485H|ENSP00000419674:P10T	P|P	-|-	2|1	0|0	LRCH4|LRCH4	100012475|100012475	0.279000|0.279000	0.24239|0.24239	0.488000|0.488000	0.27440|0.27440	0.938000|0.938000	0.57974|0.57974	1.447000|1.447000	0.35101|0.35101	1.079000|1.079000	0.41038|0.41038	0.549000|0.549000	0.68633|0.68633	CCC|CCA	LRCH4	-	NULL	ENSG00000077454		0.667	LRCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRCH4	HGNC	protein_coding	OTTHUMT00000356110.1	-	0.00	41	0	G	NM_002319		100174539	-1	tier1	-	no_errors	ENST00000310300	ensembl	human	known	74_37	missense	25.00	27	9	SNP	0.418	T
LRRC53	100144878	genome.wustl.edu	37	1	74946454	74946454	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr1:74946454G>A	ENST00000294635.4	-	3	401	c.287C>T	c.(286-288)tCt>tTt	p.S96F	FPGT-TNNI3K_ENST00000557284.2_Intron|TNNI3K_ENST00000370891.2_Intron|TNNI3K_ENST00000326637.3_Intron|LRRC53_ENST00000416014.2_Missense_Mutation_p.S96F			A6NM62	LRC53_HUMAN	leucine rich repeat containing 53	96						integral component of membrane (GO:0016021)				NS(1)|breast(1)|lung(2)	4						AGTGAGCGAAGAGCTGGATAT	0.522																																																	0																																										SO:0001583	missense	0					1p31.3	2010-08-31			ENSG00000162621	ENSG00000162621			25255	protein-coding gene	gene with protein product							Standard			Approved			A6NM62	OTTHUMG00000009621	ENST00000294635.4:c.287C>T	1.37:g.74946454G>A	ENSP00000294635:p.Ser96Phe			Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.S96F	ENST00000294635.4	37	c.287		1	.	.	.	.	.	.	.	.	.	.	G	16.06	3.015890	0.54468	.	.	ENSG00000162621	ENST00000416014;ENST00000294635	T;T	0.51817	0.78;0.69	5.05	5.05	0.67936	.	0.248044	0.28784	N	0.014152	T	0.54581	0.1867	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53493	-0.8431	7	0.44086	T	0.13	-5.6019	17.5216	0.87789	0.0:0.0:1.0:0.0	.	.	.	.	F	96	ENSP00000391861:S96F;ENSP00000294635:S96F	ENSP00000294635:S96F	S	-	2	0	LRRC53	74719042	0.944000	0.32072	0.584000	0.28653	0.733000	0.41908	3.535000	0.53575	2.503000	0.84419	0.455000	0.32223	TCT	LRRC53	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000162621		0.522	LRRC53-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	LRRC53	HGNC	protein_coding	OTTHUMT00000026515.2	-	0.00	17	0	G			74946454	-1	tier1	-	no_errors	ENST00000294635	ensembl	human	novel	74_37	missense	20.00	20	5	SNP	0.689	A
LYNX1	66004	genome.wustl.edu	37	8	143856632	143856632	+	Intron	SNP	G	G	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr8:143856632G>C	ENST00000335822.5	-	3	782				LYNX1_ENST00000395192.2_Missense_Mutation_p.L102V|LYNX1_ENST00000522906.1_5'Flank|LYNX1_ENST00000523332.1_Intron|LYNX1_ENST00000345173.6_Missense_Mutation_p.L102V|LYNX1_ENST00000398906.1_Missense_Mutation_p.L102V	NM_023946.2	NP_076435.1	Q9BZG9	LYNX1_HUMAN	Ly6/neurotoxin 1							anchored component of membrane (GO:0031225)|cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				endometrium(1)|lung(2)|skin(1)	4	all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					GCCAGGGCCAGGGTGGCCGGG	0.632																																																	0													45.0	43.0	43.0					8																	143856632		2202	4300	6502	SO:0001627	intron_variant	0			AF321824	CCDS6389.1, CCDS34951.1, CCDS34952.1	8q24.3	2008-03-12			ENSG00000180155	ENSG00000180155			29604	protein-coding gene	gene with protein product		606110				12573258, 10402197	Standard	NM_023946		Approved	SLURP2	uc003yxd.1	Q9BZG9	OTTHUMG00000164694	ENST00000335822.5:c.154+378C>G	8.37:g.143856632G>C			D3DWI7|G3XAC2|Q86SR0	Missense_Mutation	SNP	pfam_LY6_UPAR,smart_LY6_UPA_recep-like	p.L102V	ENST00000335822.5	37	c.304	CCDS34951.1	8	.	.	.	.	.	.	.	.	.	.	G	0.106	-1.145104	0.01714	.	.	ENSG00000180155	ENST00000395192;ENST00000398906;ENST00000345173	T;T;T	0.25579	1.79;1.79;1.79	4.6	2.72	0.32119	Ly-6 antigen / uPA receptor -like (1);	.	.	.	.	T	0.12561	0.0305	N	0.08118	0	0.09310	N	1	B	0.23058	0.079	B	0.23574	0.047	T	0.24977	-1.0145	9	0.33141	T	0.24	.	7.1144	0.25409	0.2335:0.0:0.7665:0.0	.	102	Q9BZG9	LYNX1_HUMAN	V	102	ENSP00000378618:L102V;ENSP00000381878:L102V;ENSP00000332495:L102V	ENSP00000332495:L102V	L	-	1	2	LYNX1	143853634	0.053000	0.20554	0.627000	0.29227	0.015000	0.08874	0.652000	0.24888	1.041000	0.40125	0.655000	0.94253	CTG	LYNX1	-	smart_LY6_UPA_recep-like	ENSG00000180155		0.632	LYNX1-001	KNOWN	basic|CCDS	protein_coding	LYNX1	HGNC	protein_coding	OTTHUMT00000379786.3	-	0.00	30	0	G	NM_177476		143856632	-1	tier1	-	no_errors	ENST00000345173	ensembl	human	known	74_37	missense	43.75	36	28	SNP	0.399	C
LYNX1	66004	genome.wustl.edu	37	8	143857078	143857078	+	Silent	SNP	G	G	A	rs372261422		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr8:143857078G>A	ENST00000335822.5	-	3	714	c.87C>T	c.(85-87)aaC>aaT	p.N29N	LYNX1_ENST00000395192.2_Silent_p.N29N|LYNX1_ENST00000522906.1_5'UTR|LYNX1_ENST00000523332.1_Silent_p.N29N|LYNX1_ENST00000345173.6_Silent_p.N29N|LYNX1_ENST00000398906.1_Silent_p.N29N	NM_023946.2	NP_076435.1	Q9BZG9	LYNX1_HUMAN	Ly6/neurotoxin 1	29						anchored component of membrane (GO:0031225)|cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				endometrium(1)|lung(2)|skin(1)	4	all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					AGTTGTCTCCGTTGTAGGCAC	0.657																																																	0								G	,,,	3,4399		0,3,2198	76.0	60.0	65.0		87,87,87,87	-8.6	0.9	8		65	0,8596		0,0,4298	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	LYNX1	NM_023946.2,NM_177457.3,NM_177476.2,NM_177477.2	,,,	0,3,6496	AA,AG,GG		0.0,0.0682,0.0231	,,,	29/132,29/117,29/117,29/117	143857078	3,12995	2201	4298	6499	SO:0001819	synonymous_variant	0			AF321824	CCDS6389.1, CCDS34951.1, CCDS34952.1	8q24.3	2008-03-12			ENSG00000180155	ENSG00000180155			29604	protein-coding gene	gene with protein product		606110				12573258, 10402197	Standard	NM_023946		Approved	SLURP2	uc003yxd.1	Q9BZG9	OTTHUMG00000164694	ENST00000335822.5:c.87C>T	8.37:g.143857078G>A			D3DWI7|G3XAC2|Q86SR0	Silent	SNP	pfam_LY6_UPAR	p.N29	ENST00000335822.5	37	c.87	CCDS34951.1	8																																																																																			LYNX1	-	pfam_LY6_UPAR	ENSG00000180155		0.657	LYNX1-001	KNOWN	basic|CCDS	protein_coding	LYNX1	HGNC	protein_coding	OTTHUMT00000379786.3	-	0.00	32	0	G	NM_177476		143857078	-1	tier1	-	no_errors	ENST00000335822	ensembl	human	known	74_37	silent	10.14	62	7	SNP	0.704	A
LZTS2	84445	genome.wustl.edu	37	10	102763685	102763685	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr10:102763685C>T	ENST00000370220.1	+	2	3893	c.830C>T	c.(829-831)tCc>tTc	p.S277F	LZTS2_ENST00000370223.3_Missense_Mutation_p.S277F					leucine zipper, putative tumor suppressor 2											breast(1)|large_intestine(6)|lung(7)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22				Epithelial(162;7.3e-09)|all cancers(201;3.72e-07)		GGCCGGTCCTCCTCCAGCAAG	0.711																																					Esophageal Squamous(8;38 437 13604 19902 37640)												0													25.0	31.0	29.0					10																	102763685		2199	4296	6495	SO:0001583	missense	0			AB058716	CCDS7507.1	10q24	2004-03-18			ENSG00000107816	ENSG00000107816			29381	protein-coding gene	gene with protein product		610454				11347906, 11709705	Standard	NM_032429		Approved	KIAA1813, LAPSER1	uc001ksj.3	Q9BRK4	OTTHUMG00000018914	ENST00000370220.1:c.830C>T	10.37:g.102763685C>T	ENSP00000359240:p.Ser277Phe			Missense_Mutation	SNP	NULL	p.S277F	ENST00000370220.1	37	c.830	CCDS7507.1	10	.	.	.	.	.	.	.	.	.	.	C	17.31	3.358024	0.61403	.	.	ENSG00000107816	ENST00000370223;ENST00000315797;ENST00000370220	T;T	0.60548	0.18;0.18	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	T	0.75243	0.3823	M	0.75085	2.285	0.58432	D	0.999998	D	0.76494	0.999	D	0.66716	0.946	T	0.76321	-0.3002	9	.	.	.	-21.5724	18.2715	0.90070	0.0:1.0:0.0:0.0	.	277	Q9BRK4	LZTS2_HUMAN	F	277	ENSP00000359243:S277F;ENSP00000359240:S277F	.	S	+	2	0	LZTS2	102753675	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.824000	0.62701	2.467000	0.83353	0.561000	0.74099	TCC	LZTS2	-	NULL	ENSG00000107816		0.711	LZTS2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LZTS2	HGNC	protein_coding	OTTHUMT00000049872.1		0.00	30	0	C	XM_046743		102763685	+1			no_errors	ENST00000370220	ensembl	human	known	74_37	missense	9.09	20	2	SNP	1.000	T
MAML3	55534	genome.wustl.edu	37	4	140812013	140812013	+	Nonsense_Mutation	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr4:140812013G>A	ENST00000509479.2	-	2	1433	c.577C>T	c.(577-579)Cga>Tga	p.R193*	MAML3_ENST00000327122.5_Nonsense_Mutation_p.R37*|MAML3_ENST00000398940.1_5'Flank	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					ATGTCCTTTCGAATTCGTTTG	0.473																																																	0													73.0	70.0	71.0					4																	140812013		1998	4164	6162	SO:0001587	stop_gained	0			AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.577C>T	4.37:g.140812013G>A	ENSP00000421180:p.Arg193*			Nonsense_Mutation	SNP	pfam_Neuroggenic_mastermind-like_N	p.R193*	ENST00000509479.2	37	c.577	CCDS54805.1	4	.	.	.	.	.	.	.	.	.	.	G	45	11.846677	0.99609	.	.	ENSG00000196782	ENST00000509479;ENST00000327122	.	.	.	5.3	5.3	0.74995	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.8858	0.63708	0.0:0.0:0.8476:0.1524	.	.	.	.	X	193;37	.	ENSP00000313316:R37X	R	-	1	2	MAML3	141031463	1.000000	0.71417	0.996000	0.52242	0.934000	0.57294	4.360000	0.59455	2.469000	0.83416	0.585000	0.79938	CGA	MAML3	-	NULL	ENSG00000196782		0.473	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAML3	HGNC	protein_coding	OTTHUMT00000364934.2	-	0.00	44	0	G			140812013	-1	tier1	-	no_errors	ENST00000509479	ensembl	human	known	74_37	nonsense	16.88	64	13	SNP	1.000	A
MAP3K10	4294	genome.wustl.edu	37	19	40711051	40711051	+	Missense_Mutation	SNP	G	G	T	rs376121895		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr19:40711051G>T	ENST00000253055.3	+	4	1324	c.1036G>T	c.(1036-1038)Ggg>Tgg	p.G346W	AC118344.1_ENST00000408124.1_RNA	NM_002446.3	NP_002437.2	Q02779	M3K10_HUMAN	mitogen-activated protein kinase kinase kinase 10	346	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|JNK cascade (GO:0007254)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|protein autophosphorylation (GO:0046777)|signal transduction (GO:0007165)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|bHLH transcription factor binding (GO:0043425)|JUN kinase kinase kinase activity (GO:0004706)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription corepressor activity (GO:0003714)			NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	24						AGACCCCCACGGGCGGCCAGA	0.602																																																	0													81.0	87.0	85.0					19																	40711051		2203	4300	6503	SO:0001583	missense	0			X90846	CCDS12549.1	19q13.2	2014-08-12			ENSG00000130758		2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6849	protein-coding gene	gene with protein product	"""MKN28 kinase"", ""mixed lineage kinase 2"", ""MKN28 derived nonreceptor_type serine/threonine kinase"""	600137		MLK2		8536694, 7731697	Standard	NM_002446		Approved	MST, MEKK10	uc002ona.3	Q02779	OTTHUMG00000182591	ENST00000253055.3:c.1036G>T	19.37:g.40711051G>T	ENSP00000253055:p.Gly346Trp		Q12761|Q14871	Missense_Mutation	SNP	pirsf_MAPKKK9/10/11,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH3_2,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,pfscan_SH3_domain,pfscan_Prot_kinase_dom	p.G346W	ENST00000253055.3	37	c.1036	CCDS12549.1	19	.	.	.	.	.	.	.	.	.	.	G	17.55	3.417345	0.62622	.	.	ENSG00000130758	ENST00000253055	D	0.82803	-1.65	5.2	2.96	0.34315	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.169383	0.52532	N	0.000071	T	0.80706	0.4674	N	0.25485	0.75	0.40537	D	0.980982	P	0.48911	0.917	P	0.62813	0.907	T	0.79822	-0.1641	10	0.66056	D	0.02	.	4.478	0.11753	0.1816:0.1971:0.6213:0.0	.	346	Q02779	M3K10_HUMAN	W	346	ENSP00000253055:G346W	ENSP00000253055:G346W	G	+	1	0	MAP3K10	45402891	0.025000	0.19082	0.958000	0.39756	0.851000	0.48451	0.516000	0.22817	2.564000	0.86499	0.585000	0.79938	GGG	MAP3K10	-	pirsf_MAPKKK9/10/11,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000130758		0.602	MAP3K10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP3K10	HGNC	protein_coding	OTTHUMT00000462552.1	-	0.00	32	0	G	NM_002446		40711051	+1	tier1	-	no_errors	ENST00000253055	ensembl	human	known	74_37	missense	10.53	34	4	SNP	0.950	T
MATN4	8785	genome.wustl.edu	37	20	43933251	43933251	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr20:43933251G>A	ENST00000372754.1	-	2	268	c.260C>T	c.(259-261)cCt>cTt	p.P87L	RBPJL_ENST00000343694.3_5'Flank|MATN4_ENST00000372751.4_Intron|MATN4_ENST00000372756.1_Missense_Mutation_p.P87L|MATN4_ENST00000353917.5_Missense_Mutation_p.P87L|RBPJL_ENST00000372743.1_5'Flank|MATN4_ENST00000360607.6_Missense_Mutation_p.P87L|RBPJL_ENST00000372741.3_5'Flank|MATN4_ENST00000342716.4_Missense_Mutation_p.P87L|MATN4_ENST00000537548.1_Missense_Mutation_p.P87L			O95460	MATN4_HUMAN	matrilin 4	87	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|response to axon injury (GO:0048678)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	27		Myeloproliferative disorder(115;0.0122)				CGCGCGGAGAGGGAAGACGCT	0.657																																																	0													36.0	33.0	34.0					20																	43933251		2202	4300	6502	SO:0001583	missense	0			AJ007581	CCDS13348.1, CCDS46607.1	20q13.1-q13.2	2008-07-07			ENSG00000124159	ENSG00000124159			6910	protein-coding gene	gene with protein product		603897				9827539, 9027493	Standard	NM_003833		Approved		uc002xnn.2	O95460	OTTHUMG00000033043	ENST00000372754.1:c.260C>T	20.37:g.43933251G>A	ENSP00000361840:p.Pro87Leu		A6NH94|A6NKN5|Q5QPU2|Q5QPU3|Q5QPU4|Q8N2M5|Q8N2M7|Q9H1F8|Q9H1F9	Missense_Mutation	SNP	pfam_VWF_A,pfam_EGF-like_Ca-bd_dom,pfam_Matrilin_coiled-coil_trimer,smart_VWF_A,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_VWF_A	p.P87L	ENST00000372754.1	37	c.260		20	.	.	.	.	.	.	.	.	.	.	G	12.02	1.813355	0.32053	.	.	ENSG00000124159	ENST00000372754;ENST00000372756;ENST00000353917;ENST00000360607;ENST00000342716;ENST00000537548;ENST00000255132	T;T;T;T;T;T	0.79845	-1.31;-1.31;-1.31;-1.31;-1.31;-1.31	4.18	2.16	0.27623	.	0.175410	0.27554	N	0.018845	T	0.67720	0.2923	N	0.13327	0.33	0.80722	D	1	B;B;B	0.24317	0.049;0.101;0.004	B;B;B	0.31946	0.057;0.138;0.007	T	0.59247	-0.7490	10	0.34782	T	0.22	.	13.1219	0.59331	0.0:0.3068:0.6932:0.0	.	87;87;87	A6NNA4;O95460-4;O95460-2	.;.;.	L	87	ENSP00000361840:P87L;ENSP00000361842:P87L;ENSP00000243983:P87L;ENSP00000353819:P87L;ENSP00000343164:P87L;ENSP00000440328:P87L	ENSP00000255132:P87L	P	-	2	0	MATN4	43366665	1.000000	0.71417	0.681000	0.30009	0.443000	0.32047	5.845000	0.69437	0.381000	0.24851	0.462000	0.41574	CCT	MATN4	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000124159		0.657	MATN4-002	KNOWN	non_canonical_conserved|non_canonical_U12|not_organism_supported|basic|appris_candidate_longest	protein_coding	MATN4	HGNC	protein_coding	OTTHUMT00000080335.1		0.00	29	0	G			43933251	-1			no_errors	ENST00000372754	ensembl	human	known	74_37	missense	10.87	41	5	SNP	1.000	A
MCM10	55388	genome.wustl.edu	37	10	13213247	13213247	+	Silent	SNP	G	G	T	rs142919178	byFrequency	TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr10:13213247G>T	ENST00000484800.2	+	3	436	c.333G>T	c.(331-333)acG>acT	p.T111T	MCM10_ENST00000378694.1_Silent_p.T111T|MCM10_ENST00000378714.3_Silent_p.T111T			Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10	111	N-terminal domain. {ECO:0000250}.				cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(4)|ovary(2)|skin(1)|stomach(1)	9						GAGAGAAAACGAATGAAGAGT	0.453																																																	0													45.0	44.0	44.0					10																	13213247		2203	4300	6503	SO:0001819	synonymous_variant	0			AB042719	CCDS7095.1, CCDS7096.1	10p13	2008-08-01	2007-04-04		ENSG00000065328	ENSG00000065328			18043	protein-coding gene	gene with protein product		609357	"""MCM10 minichromosome maintenance deficient 10 (S. cerevisiae)"""			11095689, 17699597	Standard	NM_018518		Approved	PRO2249, CNA43, DNA43	uc001ima.3	Q7L590	OTTHUMG00000017694	ENST00000484800.2:c.333G>T	10.37:g.13213247G>T			A8K9I6|B7ZKZ8|Q3MIR3|Q7LD55|Q96GX4|Q96NB6|Q9H0D7|Q9H3P9|Q9P177	Silent	SNP	pfam_Rep_factor_Mcm10,pfam_Znf_Mcm10/DnaG	p.T111	ENST00000484800.2	37	c.333	CCDS7096.1	10																																																																																			MCM10	-	NULL	ENSG00000065328		0.453	MCM10-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MCM10	HGNC	protein_coding	OTTHUMT00000356853.1	-	0.00	31	0	G	NM_182751		13213247	+1	tier1	-	no_errors	ENST00000484800	ensembl	human	known	74_37	silent	9.76	37	4	SNP	0.006	T
ME3	10873	genome.wustl.edu	37	11	86152470	86152470	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr11:86152470C>T	ENST00000393324.3	-	14	1919	c.1666G>A	c.(1666-1668)Gcg>Acg	p.A556T	ME3_ENST00000359636.2_Missense_Mutation_p.A556T|RP11-317J19.1_ENST00000524610.1_RNA|ME3_ENST00000543262.1_Missense_Mutation_p.A556T	NM_001014811.1	NP_001014811.1	Q16798	MAON_HUMAN	malic enzyme 3, NADP(+)-dependent, mitochondrial	556					aerobic respiration (GO:0009060)|malate metabolic process (GO:0006108)|oxidation-reduction process (GO:0055114)|oxygen metabolic process (GO:0072592)|pyruvate metabolic process (GO:0006090)	mitochondrion (GO:0005739)	cofactor binding (GO:0048037)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|malate dehydrogenase (decarboxylating) (NADP+) activity (GO:0004473)|malic enzyme activity (GO:0004470)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|oxaloacetate decarboxylase activity (GO:0008948)			endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|skin(3)|stomach(2)|urinary_tract(1)	27		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)				TGTTTGTACGCGTAGTCGAGA	0.488																																																	0													179.0	168.0	172.0					11																	86152470		2202	4299	6501	SO:0001583	missense	0			X79440	CCDS8277.1	11q14.2	2012-09-20			ENSG00000151376	ENSG00000151376	1.1.1.40		6985	protein-coding gene	gene with protein product		604626				7818469	Standard	NM_001161586		Approved		uc001pbz.3	Q16798	OTTHUMG00000167217	ENST00000393324.3:c.1666G>A	11.37:g.86152470C>T	ENSP00000376998:p.Ala556Thr		B7Z6V0|Q8TBJ0	Missense_Mutation	SNP	pfam_Malic_NAD-bd,pfam_Malic_N,smart_Malic_NAD-bd,prints_Malic_OxRdtase	p.A556T	ENST00000393324.3	37	c.1666	CCDS8277.1	11	.	.	.	.	.	.	.	.	.	.	C	22.2	4.263446	0.80358	.	.	ENSG00000151376	ENST00000359636;ENST00000543262;ENST00000393324;ENST00000524826	T;T;T;T	0.58210	0.35;0.35;0.35;0.35	4.44	4.44	0.53790	Malic enzyme, NAD-binding (2);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.68495	0.3007	H	0.96333	3.805	0.80722	D	1	P	0.39094	0.659	B	0.38106	0.265	T	0.80086	-0.1529	9	.	.	.	-20.8153	17.6259	0.88093	0.0:1.0:0.0:0.0	.	556	Q16798	MAON_HUMAN	T	556	ENSP00000352657:A556T;ENSP00000440246:A556T;ENSP00000376998:A556T;ENSP00000431182:A556T	.	A	-	1	0	ME3	85830118	1.000000	0.71417	0.998000	0.56505	0.971000	0.66376	7.410000	0.80065	2.435000	0.82474	0.655000	0.94253	GCG	ME3	-	pfam_Malic_NAD-bd,smart_Malic_NAD-bd	ENSG00000151376		0.488	ME3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ME3	HGNC	protein_coding	OTTHUMT00000393767.2	-	0.00	73	0	C			86152470	-1	tier1	-	no_errors	ENST00000359636	ensembl	human	known	74_37	missense	18.33	98	22	SNP	1.000	T
MEOX2	4223	genome.wustl.edu	37	7	15725824	15725824	+	Missense_Mutation	SNP	G	G	C	rs372066707|rs544898693	byFrequency	TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr7:15725824G>C	ENST00000262041.5	-	1	613	c.204C>G	c.(202-204)caC>caG	p.H68Q	AC005550.4_ENST00000442176.1_lincRNA|AC005550.5_ENST00000438923.1_lincRNA	NM_005924.4	NP_005915.2	P50222	MEOX2_HUMAN	mesenchyme homeobox 2	68	Poly-His.				angiogenesis (GO:0001525)|blood circulation (GO:0008015)|limb development (GO:0060173)|multicellular organismal development (GO:0007275)|neuron death (GO:0070997)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle tissue development (GO:0007519)|somite specification (GO:0001757)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (126;0.0822)		ggtggtggtggtgCCCCCTGT	0.577																																					Esophageal Squamous(140;197 1769 16409 18257 29929)												0													31.0	31.0	31.0					7																	15725824		2203	4300	6503	SO:0001583	missense	0				CCDS34605.1	7p22.1-p21.3	2014-07-15	2005-12-22		ENSG00000106511	ENSG00000106511		"""Homeoboxes / ANTP class : HOXL subclass"""	7014	protein-coding gene	gene with protein product	"""growth arrest-specific homeobox"""	600535	"""mesenchyme homeo box 2 (growth arrest-specific homeo box)"", ""mesenchyme homeobox 2 (growth arrest-specific homeo box)"""	GAX		7713505	Standard	NM_005924		Approved	MOX2	uc003stc.3	P50222	OTTHUMG00000152390	ENST00000262041.5:c.204C>G	7.37:g.15725824G>C	ENSP00000262041:p.His68Gln		B2R8I7|O75263|Q9UPL6	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.H68Q	ENST00000262041.5	37	c.204	CCDS34605.1	7	.	.	.	.	.	.	.	.	.	.	G	5.969	0.362769	0.11296	.	.	ENSG00000106511	ENST00000262041	D	0.90261	-2.64	3.2	1.28	0.21552	.	0.072188	0.53938	D	0.000044	T	0.81545	0.4845	L	0.36672	1.1	0.40985	D	0.984803	B	0.21452	0.056	B	0.15052	0.012	T	0.70153	-0.4950	10	0.28530	T	0.3	-17.1018	5.0424	0.14465	0.2928:0.0:0.7072:0.0	.	68	P50222	MEOX2_HUMAN	Q	68	ENSP00000262041:H68Q	ENSP00000262041:H68Q	H	-	3	2	MEOX2	15692349	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.151000	0.42263	0.526000	0.28541	0.572000	0.79292	CAC	MEOX2	-	NULL	ENSG00000106511		0.577	MEOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEOX2	HGNC	protein_coding	OTTHUMT00000326058.2		0.00	40	0	G	NM_005924		15725824	-1			no_errors	ENST00000262041	ensembl	human	known	74_37	missense	7.46	62	5	SNP	0.991	C
METTL13	51603	genome.wustl.edu	37	1	171752987	171752987	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr1:171752987G>T	ENST00000361735.3	+	2	527	c.261G>T	c.(259-261)atG>atT	p.M87I	METTL13_ENST00000362019.3_Start_Codon_SNP_p.M1I|METTL13_ENST00000367737.5_Missense_Mutation_p.M87I|METTL13_ENST00000458517.1_Missense_Mutation_p.M86I	NM_015935.4	NP_057019.3	Q8N6R0	MET13_HUMAN	methyltransferase like 13	87							methyltransferase activity (GO:0008168)			breast(3)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(8)|lung(17)|stomach(3)	41						TCAAGCAAATGAAGGAATGTA	0.493																																																	0													163.0	148.0	153.0					1																	171752987		2203	4300	6503	SO:0001583	missense	0			AF132936	CCDS1299.1, CCDS1300.1, CCDS30936.1	1q24-q25.3	2009-02-23	2009-02-23	2009-02-23	ENSG00000010165	ENSG00000010165			24248	protein-coding gene	gene with protein product			"""KIAA0859"""	KIAA0859		10810093, 10048485	Standard	NM_001007239		Approved	CGI-01	uc001ghz.3	Q8N6R0	OTTHUMG00000034912	ENST00000361735.3:c.261G>T	1.37:g.171752987G>T	ENSP00000354920:p.Met87Ile		A6NFK0|A8K6S5|O94940|Q53EZ6|Q5TGP9|Q5TGQ0|Q8N2P8|Q96J11|Q96SQ0|Q9Y2Z1|Q9Y3M6	Missense_Mutation	SNP	pfam_Methyltransf_11,pfam_Spermidine/spermine_synthase	p.M87I	ENST00000361735.3	37	c.261	CCDS1299.1	1	.	.	.	.	.	.	.	.	.	.	G	16.83	3.232560	0.58777	.	.	ENSG00000010165	ENST00000458517;ENST00000362019;ENST00000367737;ENST00000361735;ENST00000367736;ENST00000341850	T;T;T;T;T	0.62788	1.02;1.39;0.0;1.02;1.02	5.02	5.02	0.67125	Methyltransferase type 11 (1);	0.000000	0.85682	D	0.000000	T	0.80586	0.4651	M	0.90252	3.1	0.80722	D	1	B;D;B	0.61080	0.372;0.989;0.213	B;D;B	0.72982	0.29;0.979;0.224	D	0.85262	0.1051	10	0.87932	D	0	-24.2449	17.9252	0.88982	0.0:0.0:1.0:0.0	.	86;87;87	B4E2X3;Q8N6R0-1;Q8N6R0	.;.;MTL13_HUMAN	I	86;1;87;87;4;1	ENSP00000401955:M86I;ENSP00000355393:M1I;ENSP00000356711:M87I;ENSP00000354920:M87I;ENSP00000356710:M4I	ENSP00000341732:M1I	M	+	3	0	METTL13	170019610	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.457000	0.80775	2.287000	0.76781	0.655000	0.94253	ATG	METTL13	-	pfam_Methyltransf_11	ENSG00000010165		0.493	METTL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL13	HGNC	protein_coding	OTTHUMT00000084528.5	-	0.00	53	0	G	NM_014955		171752987	+1	tier1	-	no_errors	ENST00000361735	ensembl	human	known	74_37	missense	15.53	87	16	SNP	1.000	T
MFN1	55669	genome.wustl.edu	37	3	179095183	179095183	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr3:179095183G>A	ENST00000471841.1	+	12	1402	c.1276G>A	c.(1276-1278)Gaa>Aaa	p.E426K	MFN1_ENST00000263969.5_Missense_Mutation_p.E426K|MFN1_ENST00000280653.7_Missense_Mutation_p.E426K	NM_033540.2	NP_284941	Q8IWA4	MFN1_HUMAN	mitofusin 1	426					mitochondrial fusion (GO:0008053)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(3)|prostate(1)|urinary_tract(1)	31	all_cancers(143;1.67e-16)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.00225)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			TTTGGTTGATGAATTTTGTTC	0.254																																																	0													86.0	88.0	87.0					3																	179095183		2203	4296	6499	SO:0001583	missense	0			AF054986	CCDS3228.1	3q26.32	2006-12-13			ENSG00000171109	ENSG00000171109			18262	protein-coding gene	gene with protein product		608506				8358434, 11181170	Standard	NM_033540		Approved	FLJ20693	uc003fjs.3	Q8IWA4	OTTHUMG00000157385	ENST00000471841.1:c.1276G>A	3.37:g.179095183G>A	ENSP00000420617:p.Glu426Lys		B2RAR1|D3DNR6|O15323|O60639|Q9BZB5|Q9NWQ2	Missense_Mutation	SNP	pfam_Fzo/mitofusin_HR2,pfam_Dynamin_GTPase,superfamily_P-loop_NTPase	p.E426K	ENST00000471841.1	37	c.1276	CCDS3228.1	3	.	.	.	.	.	.	.	.	.	.	G	18.20	3.572022	0.65765	.	.	ENSG00000171109	ENST00000471841;ENST00000280653;ENST00000539169;ENST00000263969;ENST00000474903	D;D;D;D	0.86297	-2.1;-2.1;-2.1;-2.1	5.49	5.49	0.81192	.	0.088442	0.85682	D	0.000000	D	0.83487	0.5265	L	0.53249	1.67	0.58432	D	0.999992	B;B;B	0.28378	0.01;0.209;0.058	B;B;B	0.25759	0.016;0.063;0.063	T	0.80852	-0.1197	10	0.41790	T	0.15	-20.4859	12.6783	0.56908	0.0759:0.0:0.9241:0.0	.	426;454;426	Q8IWA4-3;Q4AEJ4;Q8IWA4	.;.;MFN1_HUMAN	K	426;426;426;426;289	ENSP00000420617:E426K;ENSP00000280653:E426K;ENSP00000263969:E426K;ENSP00000419926:E289K	ENSP00000263969:E426K	E	+	1	0	MFN1	180577877	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.408000	0.73285	2.576000	0.86940	0.591000	0.81541	GAA	MFN1	-	NULL	ENSG00000171109		0.254	MFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFN1	HGNC	protein_coding	OTTHUMT00000348654.2	-	0.00	47	0	G	NM_017927		179095183	+1	tier1	-	no_errors	ENST00000263969	ensembl	human	known	74_37	missense	13.01	107	16	SNP	1.000	A
MFSD4	148808	genome.wustl.edu	37	1	205555336	205555336	+	Splice_Site	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr1:205555336G>A	ENST00000367147.4	+	6	1242		c.e6+1		MFSD4_ENST00000539267.1_Splice_Site|MFSD4_ENST00000536357.1_Splice_Site	NM_181644.4	NP_857595.3	Q8N468	MFSD4_HUMAN	major facilitator superfamily domain containing 4						transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0908)			CATCAACGTGGTAAGCAGCTG	0.582																																																	0													60.0	64.0	63.0					1																	205555336		2203	4300	6503	SO:0001630	splice_region_variant	0			BC036549	CCDS1455.1	1q32.1	2008-02-05			ENSG00000174514	ENSG00000174514			25433	protein-coding gene	gene with protein product							Standard	NM_181644		Approved	DKFZp761N1114, FLJ34577, UNQ3064, FLJ25004	uc001hcv.4	Q8N468	OTTHUMG00000037197	ENST00000367147.4:c.1149+1G>A	1.37:g.205555336G>A			B7Z8X3|Q6UY25|Q8NAY0|Q8TCP4	Splice_Site	SNP	-	e6+1	ENST00000367147.4	37	c.1149+1	CCDS1455.1	1	.	.	.	.	.	.	.	.	.	.	G	18.42	3.621156	0.66787	.	.	ENSG00000174514	ENST00000367147;ENST00000539267;ENST00000536357	.	.	.	5.26	5.26	0.73747	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.8038	0.88596	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MFSD4	203821959	1.000000	0.71417	1.000000	0.80357	0.606000	0.37113	9.420000	0.97426	2.626000	0.88956	0.650000	0.86243	.	MFSD4	-	-	ENSG00000174514		0.582	MFSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFSD4	HGNC	protein_coding	OTTHUMT00000090391.1	-	0.00	33	0	G	NM_181644	Intron	205555336	+1	tier1	-	no_errors	ENST00000367147	ensembl	human	known	74_37	splice_site	9.30	38	4	SNP	1.000	A
MIF	4282	genome.wustl.edu	37	22	24237106	24237106	+	Nonsense_Mutation	SNP	G	G	T	rs201060788		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr22:24237106G>T	ENST00000215754.7	+	2	727	c.256G>T	c.(256-258)Gag>Tag	p.E86*	AP000350.10_ENST00000433835.3_Silent_p.P193P|AP000350.4_ENST00000406213.1_3'UTR	NM_002415.1	NP_002406.1	P03971	MIS_HUMAN	macrophage migration inhibitory factor (glycosylation-inhibiting factor)	542					aging (GO:0007568)|cell-cell signaling (GO:0007267)|gonadal mesoderm development (GO:0007506)|Mullerian duct regression (GO:0001880)|positive regulation of gene expression (GO:0010628)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|preantral ovarian follicle growth (GO:0001546)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|sex determination (GO:0007530)|sex differentiation (GO:0007548)|urogenital system development (GO:0001655)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)|receptor binding (GO:0005102)			urinary_tract(1)	1						CCTGCTGGCCGAGCGCCTGCG	0.746																																																	0													3.0	4.0	3.0					22																	24237106		1914	3862	5776	SO:0001587	stop_gained	0			M25639	CCDS13819.1	22q11.23	2007-04-26			ENSG00000240972	ENSG00000240972			7097	protein-coding gene	gene with protein product		153620		GLIF		7558020, 2552447	Standard	NM_002415		Approved	GIF	uc002zyr.1	P14174	OTTHUMG00000150773	ENST00000215754.7:c.256G>T	22.37:g.24237106G>T	ENSP00000215754:p.Glu86*		O75246|Q6GTN3	Nonsense_Mutation	SNP	pfam_Macrophage_inhib_fac,superfamily_Tautomerase/MIF_sf	p.E86*	ENST00000215754.7	37	c.256	CCDS13819.1	22	.	.	.	.	.	.	.	.	.	.	N	39	7.612746	0.98390	.	.	ENSG00000240972	ENST00000215754	.	.	.	5.09	-0.334	0.12666	.	0.218816	0.45867	D	0.000337	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.8663	0.6509	0.00826	0.1681:0.198:0.2357:0.3981	.	.	.	.	X	86	.	ENSP00000215754:E86X	E	+	1	0	MIF	22567106	1.000000	0.71417	0.999000	0.59377	0.668000	0.39293	4.843000	0.62838	0.217000	0.20800	0.291000	0.19559	GAG	MIF	-	pfam_Macrophage_inhib_fac,superfamily_Tautomerase/MIF_sf	ENSG00000240972		0.746	MIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIF	HGNC	protein_coding	OTTHUMT00000320009.1		0.00	18	0	G	NM_002415		24237106	+1			no_errors	ENST00000215754	ensembl	human	known	74_37	nonsense	9.09	30	3	SNP	1.000	T
TRIM13	10206	genome.wustl.edu	37	13	50570574	50570574	+	5'Flank	DEL	T	T	-			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr13:50570574delT	ENST00000378182.3	+	0	0				TRIM13_ENST00000420995.2_5'Flank|MIR3613_ENST00000579844.1_RNA|TRIM13_ENST00000457662.2_5'Flank|TRIM13_ENST00000356017.4_5'Flank	NM_001007278.1|NM_005798.3|NM_052811.2|NM_213590.1	NP_001007279.1|NP_005789.2|NP_434698.1|NP_998755.1	O60858	TRI13_HUMAN	tripartite motif containing 13						anatomical structure morphogenesis (GO:0009653)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell death (GO:0010942)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macroautophagy (GO:0016239)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|response to gamma radiation (GO:0010332)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(5)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	10		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.53e-10)|COAD - Colon adenocarcinoma(199;0.205)		AGGGTTGGGCTTTTTTTTTTG	0.493																																																	0																																										SO:0001631	upstream_gene_variant	0			AF220127	CCDS9423.1, CCDS41888.1	13q14	2013-01-09	2011-01-25	2006-09-26	ENSG00000204977	ENSG00000204977		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9976	protein-coding gene	gene with protein product		605661	"""ret finger protein 2"", ""tripartite motif-containing 13"""	RFP2		9599022	Standard	NM_213590		Approved	Leu5, RNF77, DLEU5	uc001vdp.1	O60858	OTTHUMG00000016926		13.37:g.50570574delT	Exception_encountered		B2RB49|Q5UBW0|Q5W0U8|Q5W0U9|Q9BQ47|Q9C021	RNA	DEL	-	NULL	ENST00000378182.3	37	NULL	CCDS9423.1	13																																																																																			MIR3613	-	-	ENSG00000264864		0.493	TRIM13-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	MIR3613	HGNC	protein_coding	OTTHUMT00000354875.1		0.00	29	0	T	NM_001007278		50570574	-1	tier1		no_errors	ENST00000579844	ensembl	human	known	74_37	rna	14.63	35	6	DEL	1.000	-
GATAD2A	54815	genome.wustl.edu	37	19	19545876	19545876	+	Intron	DEL	C	C	-	rs543697853		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr19:19545876delC	ENST00000360315.3	+	2	306				GATAD2A_ENST00000252577.5_Intron|GATAD2A_ENST00000537887.1_Intron|MIR640_ENST00000385086.1_RNA|GATAD2A_ENST00000404158.1_Intron	NM_017660.3	NP_060130.3	Q86YP4	P66A_HUMAN	GATA zinc finger domain containing 2A						anterior neuropore closure (GO:0021506)|blood vessel development (GO:0001568)|DNA methylation (GO:0006306)|embryonic body morphogenesis (GO:0010172)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|neural fold formation (GO:0001842)|programmed cell death (GO:0012501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|NuRD complex (GO:0016581)	protein binding, bridging (GO:0030674)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	13						tgctctgtgaccctgggcaag	0.527																																																	0													90.0	85.0	86.0					19																	19545876		1568	3582	5150	SO:0001627	intron_variant	0			AL390164	CCDS12402.2	19p13.11	2013-01-25			ENSG00000167491	ENSG00000167491		"""GATA zinc finger domain containing"""	29989	protein-coding gene	gene with protein product	"""p66 alpha"""	614997				12183469	Standard	NM_017660		Approved	p66alpha	uc010xqt.2	Q86YP4	OTTHUMG00000152541	ENST00000360315.3:c.-6-30273C>-	19.37:g.19545876delC			B5MC40|Q7L3J2|Q96F28|Q9NPU2|Q9NXS1	RNA	DEL	-	NULL	ENST00000360315.3	37	NULL	CCDS12402.2	19																																																																																			MIR640	-	-	ENSG00000207821		0.527	GATAD2A-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	MIR640	HGNC	protein_coding	OTTHUMT00000326671.4		0.00	38	0	C	NM_017660		19545876	+1	tier1		no_errors	ENST00000385086	ensembl	human	known	74_37	rna	18.03	50	11	DEL	0.003	-
MMP28	79148	genome.wustl.edu	37	17	34122276	34122276	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr17:34122276C>T	ENST00000250144.8	-	1	435	c.106G>A	c.(106-108)Gcg>Acg	p.A36T		NM_001032278.1	NP_001027449.1	Q9H239	MMP28_HUMAN	matrix metallopeptidase 28	36					negative regulation of macrophage chemotaxis (GO:0010760)	cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|lung(7)|ovary(1)|skin(5)	16		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)	Marimastat(DB00786)	CGTACCTCCGCCTCCTTGCGC	0.711																																																	0													8.0	11.0	10.0					17																	34122276		1822	3509	5331	SO:0001583	missense	0			AF315683	CCDS45651.1, CCDS74036.1	17q12	2014-08-12	2005-08-08		ENSG00000271447	ENSG00000271447			14366	protein-coding gene	gene with protein product		608417	"""matrix metalloproteinase 28"""			11121398, 11255011	Standard	NM_024302		Approved	MMP-25, MM28, EPILYSIN, MMP-28	uc002hjy.1	Q9H239	OTTHUMG00000188387	ENST00000250144.8:c.106G>A	17.37:g.34122276C>T	ENSP00000250144:p.Ala36Thr		Q96F04|Q96TE2	Missense_Mutation	SNP	pfam_Peptidoglycan-bd-like,superfamily_Peptidoglycan-bd-like	p.A36T	ENST00000250144.8	37	c.106	CCDS45651.1	17	.	.	.	.	.	.	.	.	.	.	C	23.5	4.420108	0.83559	.	.	ENSG00000129270	ENST00000338839;ENST00000538544;ENST00000250144	T	0.40476	1.03	4.41	3.41	0.39046	Peptidoglycan binding-like (2);Metallopeptidase, catalytic domain (1);	.	.	.	.	T	0.46268	0.1384	.	.	.	0.21386	N	0.999708	P;P	0.51933	0.949;0.698	P;B	0.51516	0.672;0.419	T	0.25293	-1.0136	8	0.48119	T	0.1	.	9.7717	0.40593	0.205:0.795:0.0:0.0	.	36;36	Q9H239-2;Q9H239	.;MMP28_HUMAN	T	36	ENSP00000250144:A36T	ENSP00000250144:A36T	A	-	1	0	MMP28	31146389	0.985000	0.35326	0.991000	0.47740	0.924000	0.55760	1.853000	0.39358	1.403000	0.46800	0.650000	0.86243	GCG	MMP28	-	pfam_Peptidoglycan-bd-like,superfamily_Peptidoglycan-bd-like	ENSG00000129270		0.711	MMP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP28	HGNC	protein_coding	OTTHUMT00000449269.1		0.00	26	0	C	NM_024302		34122276	-1			no_errors	ENST00000587639	ensembl	human	known	74_37	missense	9.43	48	5	SNP	0.992	T
MROH8	140699	genome.wustl.edu	37	20	35743674	35743674	+	Missense_Mutation	SNP	C	C	T	rs370293792		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr20:35743674C>T	ENST00000400441.3	-	19	2436	c.2437G>A	c.(2437-2439)Gtt>Att	p.V813I	MROH8_ENST00000441008.2_Missense_Mutation_p.V799I|MROH8_ENST00000217333.8_Missense_Mutation_p.V642I			Q9H579	MROH8_HUMAN	maestro heat-like repeat family member 8	0																	GCTGACAGAACGATCTTCTCA	0.468																																																	0								C	ILE/VAL	2,4068		0,2,2033	250.0	242.0	244.0		2438	3.3	0.7	20		244	0,8368		0,0,4184	no	missense	C20orf132	NM_152503.4	29	0,2,6217	TT,TC,CC		0.0,0.0491,0.0161	benign	823/1053	35743674	2,12436	2035	4184	6219	SO:0001583	missense	0			AL136172		20q11.22	2012-12-19	2012-12-19	2012-12-19	ENSG00000101353	ENSG00000101353		"""maestro heat-like repeat containing"""	16125	protein-coding gene	gene with protein product	"""hypothetical protein LOC140699"""		"""chromosome 20 open reading frame 131"", ""chromosome 20 open reading frame 132"""	C20orf131, C20orf132		11780052, 15635413	Standard	NM_152503		Approved	dJ621N11.4, dJ621N11.3	uc010zvu.2	Q9H579	OTTHUMG00000032407	ENST00000400441.3:c.2437G>A	20.37:g.35743674C>T	ENSP00000383291:p.Val813Ile		Q5JYQ6	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.V813I	ENST00000400441.3	37	c.2437		20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	6.979|6.979	0.550574|0.550574	0.13374|0.13374	4.91E-4|4.91E-4	0.0|0.0	ENSG00000101353|ENSG00000101353	ENST00000417458|ENST00000441008;ENST00000400441;ENST00000217333	.|T;T;T	.|0.65732	.|-0.17;1.47;-0.14	5.27|5.27	3.31|3.31	0.37934|0.37934	.|.	.|0.443676	.|0.21221	.|N	.|0.078160	T|T	0.36441|0.36441	0.0967|0.0967	N|N	0.19112|0.19112	0.55|0.55	0.23076|0.23076	N|N	0.998339|0.998339	.|B;P	.|0.39964	.|0.081;0.697	.|B;B	.|0.29440	.|0.029;0.102	T|T	0.12604|0.12604	-1.0541|-1.0541	5|10	.|0.23302	.|T	.|0.38	-10.6196|-10.6196	7.4717|7.4717	0.27353|0.27353	0.0:0.7972:0.0:0.2028|0.0:0.7972:0.0:0.2028	.|.	.|813;647	.|E7ETR9;Q9H579-2	.|.;.	H|I	440|799;813;642	.|ENSP00000392144:V799I;ENSP00000383291:V813I;ENSP00000217333:V642I	.|ENSP00000217333:V642I	R|V	-|-	2|1	0|0	C20orf132|C20orf132	35177088|35177088	0.448000|0.448000	0.25681|0.25681	0.668000|0.668000	0.29813|0.29813	0.036000|0.036000	0.12997|0.12997	0.071000|0.071000	0.14594|0.14594	0.685000|0.685000	0.31468|0.31468	0.655000|0.655000	0.94253|0.94253	CGT|GTT	MROH8	-	superfamily_ARM-type_fold	ENSG00000101353		0.468	MROH8-202	KNOWN	basic|appris_principal	protein_coding	MROH8	HGNC	protein_coding		-	0.00	55	0	C	NM_152503		35743674	-1	tier1	-	no_errors	ENST00000400441	ensembl	human	known	74_37	missense	28.30	75	30	SNP	0.836	T
MS4A2	2206	genome.wustl.edu	37	11	59856281	59856281	+	Missense_Mutation	SNP	C	C	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr11:59856281C>G	ENST00000278888.3	+	1	145	c.43C>G	c.(43-45)Cag>Gag	p.Q15E		NM_000139.4	NP_000130.1	Q01362	FCERB_HUMAN	membrane-spanning 4-domains, subfamily A, member 2	15					activation of phospholipase C activity (GO:0007202)|cytokine secretion (GO:0050663)|Fc-epsilon receptor signaling pathway (GO:0038095)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of mast cell degranulation (GO:0043306)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|Fc-epsilon receptor I complex (GO:0032998)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(4)|lung(9)|ovary(1)|upper_aerodigestive_tract(2)	17		all_epithelial(135;0.245)			Omalizumab(DB00043)	TGCTCTCCCACAGGAGCCTTC	0.408																																																	0													64.0	66.0	65.0					11																	59856281		2201	4295	6496	SO:0001583	missense	0			M89796	CCDS7980.1, CCDS73292.1	11q12-q13	2012-02-28	2012-02-28		ENSG00000149534	ENSG00000149534			7316	protein-coding gene	gene with protein product	"""Fc fragment of IgE, high affinity I, receptor for; beta polypeptide"""	147138	"""IgE responsiveness (atopic)"", ""membrane-spanning 4-domains, subfamily A, member 2 (Fc fragment of IgE, high affinity I, receptor for; beta polypeptide)"""	FCER1B, IGER, APY		1386024	Standard	NM_000139		Approved	MS4A1	uc001nop.3	Q01362	OTTHUMG00000167239	ENST00000278888.3:c.43C>G	11.37:g.59856281C>G	ENSP00000278888:p.Gln15Glu		Q54A81	Missense_Mutation	SNP	pfam_CD20-like	p.Q15E	ENST00000278888.3	37	c.43	CCDS7980.1	11	.	.	.	.	.	.	.	.	.	.	C	0.027	-1.359939	0.01245	.	.	ENSG00000149534	ENST00000524868;ENST00000278888	D;T	0.84442	-1.85;2.08	4.48	1.43	0.22495	.	1.889150	0.02092	N	0.053247	T	0.79885	0.4523	L	0.32530	0.975	0.09310	N	1	B	0.24043	0.096	B	0.18263	0.021	T	0.60850	-0.7181	10	0.22109	T	0.4	-3.1905	12.2337	0.54503	0.0:0.4839:0.5161:0.0	.	15	Q01362	FCERB_HUMAN	E	15	ENSP00000433311:Q15E;ENSP00000278888:Q15E	ENSP00000278888:Q15E	Q	+	1	0	MS4A2	59612857	0.028000	0.19301	0.169000	0.22859	0.014000	0.08584	0.544000	0.23253	0.345000	0.23873	-0.182000	0.12963	CAG	MS4A2	-	NULL	ENSG00000149534		0.408	MS4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MS4A2	HGNC	protein_coding	OTTHUMT00000393844.1	-	0.00	36	0	C			59856281	+1	tier1	-	no_errors	ENST00000278888	ensembl	human	known	74_37	missense	8.16	45	4	SNP	0.198	G
MSH6	2956	genome.wustl.edu	37	2	48026124	48026124	+	Missense_Mutation	SNP	G	G	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr2:48026124G>C	ENST00000234420.5	+	4	1154	c.1002G>C	c.(1000-1002)aaG>aaC	p.K334N	MSH6_ENST00000540021.1_Missense_Mutation_p.K204N|FBXO11_ENST00000405808.1_Intron|MSH6_ENST00000538136.1_Missense_Mutation_p.K32N	NM_000179.2	NP_000170.1	P52701	MSH6_HUMAN	mutS homolog 6	334					ATP catabolic process (GO:0006200)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|response to UV (GO:0009411)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|MutSalpha complex (GO:0032301)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|guanine/thymine mispair binding (GO:0032137)|methylated histone binding (GO:0035064)|mismatched DNA binding (GO:0030983)	p.0?(2)		breast(8)|central_nervous_system(29)|cervix(1)|endometrium(32)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(75)|lung(25)|ovary(3)|prostate(3)|skin(10)|stomach(22)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	229		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			CAGAAACCAAGAATACTTTGA	0.458			"""Mis, N, F, S"""		colorectal	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																														yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p16	2956	mutS homolog 6 (E. coli)		E	2	Whole gene deletion(2)	haematopoietic_and_lymphoid_tissue(2)											132.0	139.0	137.0					2																	48026124		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	U54777	CCDS1836.1, CCDS62906.1, CCDS62907.1	2p16	2014-09-17	2013-09-12		ENSG00000116062	ENSG00000116062			7329	protein-coding gene	gene with protein product		600678	"""mutS (E. coli) homolog 6"", ""mutS homolog 6 (E. coli)"""	GTBP		7604266	Standard	NM_000179		Approved		uc002rwd.4	P52701	OTTHUMG00000129129	ENST00000234420.5:c.1002G>C	2.37:g.48026124G>C	ENSP00000234420:p.Lys334Asn		B4DF41|B4E3I4|F5H2F9|O43706|O43917|Q8TCX4|Q9BTB5	Missense_Mutation	SNP	pfam_DNA_mismatch_repair_MutS_C,pfam_DNA_mismatch_repair_MutS-lik_N,pfam_DNA_mismatch_repair_MutS_core,pfam_PWWP_dom,pfam_DNA_mismatch_repair_MutS_clamp,pfam_DNA_mmatch_repair_MutS_con_dom,superfamily_DNA_mismatch_repair_MutS_core,superfamily_P-loop_NTPase,superfamily_DNA_mismatch_repair_MutS_N,superfamily_DNA_mmatch_repair_MutS_con_dom,smart_PWWP_dom,smart_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_C,pirsf_DNA_mismatch_repair_Msh6,pfscan_PWWP_dom	p.K334N	ENST00000234420.5	37	c.1002	CCDS1836.1	2	.	.	.	.	.	.	.	.	.	.	G	19.58	3.854122	0.71719	.	.	ENSG00000116062	ENST00000234420;ENST00000544857;ENST00000540021;ENST00000538136	D;D;D	0.88354	-1.98;-2.07;-2.37	4.41	3.53	0.40419	.	0.171885	0.50627	D	0.000110	D	0.86764	0.6011	M	0.70275	2.135	0.80722	D	1	P;B;B	0.41597	0.756;0.155;0.119	B;B;B	0.38985	0.287;0.194;0.185	D	0.84405	0.0562	10	0.31617	T	0.26	-11.7357	12.2044	0.54345	0.083:0.0:0.917:0.0	.	204;334;334	B4DF41;P52701;P52701-2	.;MSH6_HUMAN;.	N	334;332;204;32	ENSP00000234420:K334N;ENSP00000446475:K204N;ENSP00000438580:K32N	ENSP00000234420:K334N	K	+	3	2	MSH6	47879628	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	3.385000	0.52485	1.076000	0.40961	0.655000	0.94253	AAG	MSH6	-	pirsf_DNA_mismatch_repair_Msh6	ENSG00000116062		0.458	MSH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSH6	HGNC	protein_coding	OTTHUMT00000251180.4	-	0.00	54	0	G	NM_000179		48026124	+1	tier1	-	no_errors	ENST00000234420	ensembl	human	known	74_37	missense	8.11	68	6	SNP	1.000	C
MTFR1	9650	genome.wustl.edu	37	8	66621257	66621258	+	Missense_Mutation	DNP	TT	TT	AG			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr8:66621257_66621258TT>AG	ENST00000262146.4	+	8	1106_1107	c.980_981TT>AG	c.(979-981)aTT>aAG	p.I327K	MTFR1_ENST00000458689.2_Missense_Mutation_p.I294K	NM_014637.3	NP_055452.3	Q15390	MTFR1_HUMAN	mitochondrial fission regulator 1	327					aerobic respiration (GO:0009060)|mitochondrial fission (GO:0000266)|mitochondrion organization (GO:0007005)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(1)|pancreas(1)|urinary_tract(1)	11			Epithelial(68;0.0526)|BRCA - Breast invasive adenocarcinoma(89;0.156)|all cancers(69;0.171)|OV - Ovarian serous cystadenocarcinoma(28;0.194)			AAGGCTTTAATTGAAAATGTAT	0.381																																																	0																																										SO:0001583	missense	0				CCDS6182.1, CCDS55240.1	8q13.1	2012-11-30							29510	protein-coding gene	gene with protein product	"""likely ortholog of chicken chondrocyte protein with a poly proline region"""					7584026, 7584028, 15389597	Standard	NM_014637		Approved	CHPPR, KIAA0009, FAM54A2	uc003xvn.2	Q15390		Exception_encountered	8.37:g.66621257_66621258delinsAG	ENSP00000262146:p.Ile327Lys		E7EP84|Q6IB94|Q7Z669|Q86XH5|Q8IVD7	Missense_Mutation	SNP	pfam_Mtfr1	p.I327N|p.I327M	ENST00000262146.4	37	c.980|c.981	CCDS6182.1	8																																																																																			MTFR1	-	NULL	ENSG00000066855		0.381	MTFR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MTFR1	HGNC	protein_coding	OTTHUMT00000378894.1		0.00	55|58	0	T	NM_014637		66621257|66621258	+1			no_errors	ENST00000262146	ensembl	human	known	74_37	missense	5.38	87|88	5	SNP	1.000	A|G
MTPAP	55149	genome.wustl.edu	37	10	30658036	30658036	+	5'UTR	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr10:30658036C>A	ENST00000488290.1	-	0	377				RN7SL241P_ENST00000482973.2_RNA			Q9NVV4	PAPD1_HUMAN	mitochondrial poly(A) polymerase						cell death (GO:0008219)|histone mRNA catabolic process (GO:0071044)|mRNA polyadenylation (GO:0006378)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)|protein homodimerization activity (GO:0042803)|UTP binding (GO:0002134)			breast(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						GCCTGTCATGCTTCTTCTCCT	0.597																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AL122121	CCDS7165.1	10p12.1	2014-01-30	2009-01-12	2009-01-12	ENSG00000107951	ENSG00000107951			25532	protein-coding gene	gene with protein product	"""TUTase1"""	613669	"""PAP associated domain containing 1"""	PAPD1		12239557, 15769737, 15547249	Standard	NM_018109		Approved	FLJ10486, mtPAP, SPAX4	uc001iva.4	Q9NVV4	OTTHUMG00000017895	ENST00000488290.1:c.-3726G>T	10.37:g.30658036C>A			D3DRX0|Q659E3|Q6P7E5|Q9HA74	RNA	SNP	-	NULL	ENST00000488290.1	37	NULL		10																																																																																			MTPAP	-	-	ENSG00000107951		0.597	MTPAP-002	KNOWN	basic	processed_transcript	MTPAP	HGNC	protein_coding	OTTHUMT00000047427.1	-	0.00	114	0	C	NM_018109		30658036	-1	tier1	-	no_errors	ENST00000471055	ensembl	human	known	74_37	rna	7.41	175	14	SNP	0.856	A
MUC16	94025	genome.wustl.edu	37	19	8976800	8976800	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr19:8976800G>T	ENST00000397910.4	-	73	42469	c.42266C>A	c.(42265-42267)tCa>tAa	p.S14089*	MUC16_ENST00000380951.5_Nonsense_Mutation_p.S730*|MUC16_ENST00000596956.1_5'UTR	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	14119				Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CATATCTGGTGAATACTGGAG	0.572																																																	0													114.0	113.0	113.0					19																	8976800		1969	4146	6115	SO:0001587	stop_gained	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.42266C>A	19.37:g.8976800G>T	ENSP00000381008:p.Ser14089*		Q6ZQW5|Q96RK2	Nonsense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.S14089*	ENST00000397910.4	37	c.42266	CCDS54212.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	31|31	5.103690|5.103690	0.94245|0.94245	.|.	.|.	ENSG00000181143|ENSG00000181143	ENST00000542240|ENST00000397910;ENST00000380951	.|.	.|.	.|.	4.37|4.37	2.16|2.16	0.27623|0.27623	.|.	.|0.665496	.|0.11564	.|N	.|0.551464	T|.	0.38295|.	0.1035|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.43798|.	-0.9369|.	3|.	.|.	.|.	.|.	.|.	5.3244|5.3244	0.15898|0.15898	0.1054:0.0:0.6948:0.1998|0.1054:0.0:0.6948:0.1998	.|.	.|.	.|.	.|.	N|X	912|14089;730	.|.	.|.	H|S	-|-	1|2	0|0	MUC16|MUC16	8837800|8837800	0.004000|0.004000	0.15560|0.15560	0.001000|0.001000	0.08648|0.08648	0.001000|0.001000	0.01503|0.01503	1.442000|1.442000	0.35046|0.35046	0.562000|0.562000	0.29204|0.29204	-0.389000|-0.389000	0.06534|0.06534	CAC|TCA	MUC16	-	pfam_SEA_dom	ENSG00000181143		0.572	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	51	0	G	NM_024690		8976800	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	nonsense	5.19	73	4	SNP	0.001	T
MUC4	4585	genome.wustl.edu	37	3	195480039	195480039	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr3:195480039C>A	ENST00000346145.4	-	19	2722	c.2683G>T	c.(2683-2685)Ggc>Tgc	p.G895C	MUC4_ENST00000475231.1_Missense_Mutation_p.G5079C|MUC4_ENST00000463781.3_Missense_Mutation_p.G5131C|MUC4_ENST00000349607.4_Missense_Mutation_p.G844C	NM_004532.5	NP_004523.3	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	1888	Ser-rich.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TAGCAGTGGCCTTGATTGTAG	0.592																																																	0													148.0	141.0	143.0					3																	195480039		2203	4300	6503	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000346145.4:c.2683G>T	3.37:g.195480039C>A	ENSP00000304207:p.Gly895Cys		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.G5131C	ENST00000346145.4	37	c.15391	CCDS3310.1	3	.	.	.	.	.	.	.	.	.	.	.	11.55	1.671785	0.29693	.	.	ENSG00000145113	ENST00000349607;ENST00000346145;ENST00000463781;ENST00000475231;ENST00000392409	T;T;T;T	0.41758	0.99;1.35;1.25;1.3	5.58	5.58	0.84498	.	0.000000	0.52532	D	0.000062	T	0.66915	0.2838	M	0.80183	2.485	0.35308	D	0.783635	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;0.999;0.999;1.0;1.0;0.999	T	0.75690	-0.3230	10	0.51188	T	0.08	-23.4407	16.2775	0.82651	0.0:1.0:0.0:0.0	.	5003;844;895;5131;5079;1836	E7ESK3;Q99102-12;Q99102-13;E9PDY6;E7ENC5;Q99102-10	.;.;.;.;.;.	C	844;895;5131;5079;1631	ENSP00000338109:G844C;ENSP00000304207:G895C;ENSP00000417498:G5131C;ENSP00000420243:G5079C	ENSP00000304207:G895C	G	-	1	0	MUC4	196965710	0.998000	0.40836	0.956000	0.39512	0.045000	0.14185	3.835000	0.55805	2.630000	0.89119	0.549000	0.68633	GGC	MUC4	-	smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000145113		0.592	MUC4-015	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000341862.1		0.00	45	0	C	NM_018406		195480039	-1			no_errors	ENST00000463781	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.892	A
MUC5B	727897	genome.wustl.edu	37	11	1263696	1263696	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr11:1263696G>T	ENST00000529681.1	+	31	5644	c.5586G>T	c.(5584-5586)caG>caT	p.Q1862H	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.Q1865H	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	1862	7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		ACGAAGACCAGACAGGCAGGT	0.612																																																	0													58.0	76.0	70.0					11																	1263696		2183	4276	6459	SO:0001583	missense	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.5586G>T	11.37:g.1263696G>T	ENSP00000436812:p.Gln1862His		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.Q1865H	ENST00000529681.1	37	c.5595	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	G	8.983	0.975932	0.18736	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.23348	1.91;1.91	4.65	1.56	0.23342	.	.	.	.	.	T	0.54224	0.1845	H	0.95151	3.63	0.23120	N	0.99826	D;D	0.63046	0.992;0.992	P;P	0.59357	0.856;0.856	T	0.46091	-0.9216	9	0.87932	D	0	.	7.4711	0.27349	0.1588:0.1356:0.7056:0.0	.	2555;1865	A7Y9J9;E9PBJ0	.;.	H	1862;1865;1863;1932	ENSP00000436812:Q1862H;ENSP00000415793:Q1865H	ENSP00000343037:Q1863H	Q	+	3	2	MUC5B	1220272	0.284000	0.24287	0.267000	0.24556	0.321000	0.28281	0.340000	0.19892	0.366000	0.24427	0.313000	0.20887	CAG	MUC5B	-	NULL	ENSG00000117983		0.612	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	-	0.00	47	0	G	XM_001126093		1263696	+1	tier1	-	no_errors	ENST00000447027	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.510	T
MXI1	4601	genome.wustl.edu	37	10	112045705	112045705	+	3'UTR	DEL	A	A	-			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr10:112045705delA	ENST00000239007.7	+	0	1865				MXI1_ENST00000361248.4_3'UTR|MXI1_ENST00000332674.5_3'UTR|MXI1_ENST00000485566.1_3'UTR	NM_005962.4	NP_005953.4	P50539	MXI1_HUMAN	MAX interactor 1, dimerization protein						cytoplasmic sequestering of transcription factor (GO:0042994)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(1)	10		Breast(234;0.052)|Lung NSC(174;0.223)		Epithelial(162;1.33e-05)|all cancers(201;0.000277)|BRCA - Breast invasive adenocarcinoma(275;0.127)		GCTTATCCATAAAAAAAAATA	0.318																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC016678	CCDS7563.1, CCDS7564.2, CCDS31284.1	10q24-q25	2012-11-15	2012-11-15		ENSG00000119950	ENSG00000119950		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	7534	protein-coding gene	gene with protein product		600020	"""MAX interacting protein 1"", ""MAX interactor 1"""			7959753	Standard	NM_130439		Approved	MXD2, MAD2, MXI, bHLHc11	uc001kyy.3	P50539	OTTHUMG00000019033	ENST00000239007.7:c.*960A>-	10.37:g.112045705delA			B1ANN7|D3DR25|D3DRA9|Q15887|Q6FHW2|Q96E53	RNA	DEL	-	NULL	ENST00000239007.7	37	NULL	CCDS7564.2	10																																																																																			MXI1	-	-	ENSG00000119950		0.318	MXI1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	MXI1	HGNC	protein_coding	OTTHUMT00000050316.1		0.00	17	0	A	NM_130439		112045705	+1	tier1		no_errors	ENST00000485566	ensembl	human	known	74_37	rna	12.12	29	4	DEL	0.827	-
MYO19	80179	genome.wustl.edu	37	17	34852182	34852182	+	Silent	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr17:34852182G>T	ENST00000431794.3	-	26	3348	c.2826C>A	c.(2824-2826)ccC>ccA	p.P942P	MYO19_ENST00000268852.9_Silent_p.P742P|ZNHIT3_ENST00000592616.1_Intron|ZNHIT3_ENST00000588253.1_Intron|ZNHIT3_ENST00000590858.1_Intron	NM_001163735.1	NP_001157207.1	Q96H55	MYO19_HUMAN	myosin XIX	942	Mitochondrial targeting.					cytoplasm (GO:0005737)|mitochondrial outer membrane (GO:0005741)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|urinary_tract(1)	20		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		TAATGCTGTAGGGTGAAGGTT	0.512																																																	0													135.0	144.0	141.0					17																	34852182		2064	4211	6275	SO:0001819	synonymous_variant	0			BC008900	CCDS45654.1, CCDS54112.1, CCDS59283.1	17q12	2014-08-12	2007-09-26	2007-09-26	ENSG00000278259	ENSG00000278259		"""Myosins / Myosin superfamily : Class XIX"""	26234	protein-coding gene	gene with protein product			"""myosin head domain containing 1"""	MYOHD1		17877792, 19932026	Standard	NM_001033580		Approved	FLJ22865	uc010wcy.2	Q96H55	OTTHUMG00000188437	ENST00000431794.3:c.2826C>A	17.37:g.34852182G>T			Q59GS4|Q9H5X2	Silent	SNP	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.P942	ENST00000431794.3	37	c.2826	CCDS54112.1	17																																																																																			MYO19	-	NULL	ENSG00000141140		0.512	MYO19-006	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO19	HGNC	protein_coding	OTTHUMT00000451074.1	-	0.00	50	0	G	NM_025109		34852182	-1	tier1	-	no_errors	ENST00000431794	ensembl	human	known	74_37	silent	5.80	65	4	SNP	0.028	T
MYO1B	4430	genome.wustl.edu	37	2	192267361	192267361	+	Nonsense_Mutation	SNP	C	C	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr2:192267361C>T	ENST00000392318.3	+	24	2720	c.2473C>T	c.(2473-2475)Cga>Tga	p.R825*	MYO1B_ENST00000439065.2_Nonsense_Mutation_p.R70*|MYO1B_ENST00000339514.4_Intron|MYO1B_ENST00000304164.4_Nonsense_Mutation_p.R825*|MYO1B_ENST00000392316.1_Nonsense_Mutation_p.R796*	NM_001130158.1	NP_001123630.1	O43795	MYO1B_HUMAN	myosin IB	825	IQ 5. {ECO:0000255|PROSITE- ProRule:PRU00116}.				actin filament bundle assembly (GO:0051017)|actin filament organization (GO:0007015)|actin filament-based movement (GO:0030048)|metabolic process (GO:0008152)|post-Golgi vesicle-mediated transport (GO:0006892)	actin filament (GO:0005884)|brush border (GO:0005903)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(1)|central_nervous_system(6)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(19)|ovary(1)	55			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)			ATTCTAGGCTCGAAGGGAATT	0.438																																																	0													130.0	103.0	111.0					2																	192267361		1568	3582	5150	SO:0001587	stop_gained	0			L29138	CCDS2311.1, CCDS46477.1	2q12-q34	2011-09-27			ENSG00000128641	ENSG00000128641		"""Myosins / Myosin superfamily : Class I"""	7596	protein-coding gene	gene with protein product		606537				8022818, 8449985	Standard	NM_012223		Approved	myr1	uc010fsg.2	O43795	OTTHUMG00000132718	ENST00000392318.3:c.2473C>T	2.37:g.192267361C>T	ENSP00000376132:p.Arg825*		O43794|Q7Z6L5	Nonsense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R825*	ENST00000392318.3	37	c.2473	CCDS46477.1	2	.	.	.	.	.	.	.	.	.	.	C	41	9.000514	0.99031	.	.	ENSG00000128641	ENST00000392318;ENST00000304164;ENST00000392316;ENST00000439065	.	.	.	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.0534	0.89356	0.0:1.0:0.0:0.0	.	.	.	.	X	825;825;796;70	.	ENSP00000306382:R825X	R	+	1	2	MYO1B	191975606	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.149000	0.77396	2.699000	0.92147	0.561000	0.74099	CGA	MYO1B	-	superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	ENSG00000128641		0.438	MYO1B-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MYO1B	HGNC	protein_coding	OTTHUMT00000334774.1		0.00	23	0	C	NM_012223		192267361	+1			no_errors	ENST00000304164	ensembl	human	known	74_37	nonsense	9.68	111	12	SNP	1.000	T
NALCN	259232	genome.wustl.edu	37	13	101717782	101717782	+	Silent	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr13:101717782G>T	ENST00000251127.6	-	40	4659	c.4578C>A	c.(4576-4578)ggC>ggA	p.G1526G		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	1526					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					AGGTGACGTCGCCGCCATTGT	0.577																																																	0													162.0	128.0	139.0					13																	101717782		2203	4300	6503	SO:0001819	synonymous_variant	0			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.4578C>A	13.37:g.101717782G>T			Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Silent	SNP	pfam_Ion_trans_dom	p.G1526	ENST00000251127.6	37	c.4578	CCDS9498.1	13																																																																																			NALCN	-	NULL	ENSG00000102452		0.577	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NALCN	HGNC	protein_coding	OTTHUMT00000045663.2		0.00	27	0	G	NM_052867		101717782	-1			no_errors	ENST00000251127	ensembl	human	known	74_37	silent	6.45	29	2	SNP	0.004	T
NCOA2	10499	genome.wustl.edu	37	8	71078930	71078930	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr8:71078930G>A	ENST00000452400.2	-	7	782	c.601C>T	c.(601-603)Cgg>Tgg	p.R201W		NM_006540.2	NP_006531.1	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	201					cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucose metabolic process (GO:0010906)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|signal transducer activity (GO:0004871)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)		PAX3/NCOA2(4)|HEY1/NCOA2(10)	NS(1)|breast(4)|endometrium(7)|kidney(4)|large_intestine(10)|lung(25)|ovary(1)|pancreas(2)|prostate(2)|skin(4)	60	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			ACCAGCATCCGACAATTGAAG	0.448			T	"""RUNXBP2, HEY1"""	"""AML, Chondrosarcoma"""																																			Dom	yes		8	8q13.1	10499	nuclear receptor coactivator 2 (TIF2)		L	0													215.0	208.0	210.0					8																	71078930		1892	4115	6007	SO:0001583	missense	0			X97674	CCDS47872.1	8q13.3	2011-07-01			ENSG00000140396	ENSG00000140396		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7669	protein-coding gene	gene with protein product		601993				9111344, 8670870	Standard	XM_005251128		Approved	TIF2, GRIP1, NCoA-2, KAT13C, bHLHe75	uc003xyn.1	Q15596	OTTHUMG00000164671	ENST00000452400.2:c.601C>T	8.37:g.71078930G>A	ENSP00000399968:p.Arg201Trp		Q14CD2	Missense_Mutation	SNP	pfam_DUF1518,pfam_SRC-1,pfam_Nuc_rcpt_coact_Ncoa-typ,pfam_PAS_fold,superfamily_PAS,superfamily_Nuc_rcpt_coact,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,pirsf_Nuclear_rcpt_coactivator,pfscan_PAS,pfscan_bHLH_dom	p.R201W	ENST00000452400.2	37	c.601	CCDS47872.1	8	.	.	.	.	.	.	.	.	.	.	G	26.3	4.725867	0.89298	.	.	ENSG00000140396	ENST00000452400	T	0.03124	4.04	5.97	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.27697	0.0681	H	0.94808	3.585	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.40646	-0.9552	10	0.87932	D	0	.	15.4012	0.74843	0.0666:0.0:0.9334:0.0	.	201	Q15596	NCOA2_HUMAN	W	201	ENSP00000399968:R201W	ENSP00000399968:R201W	R	-	1	2	NCOA2	71241484	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.884000	0.87274	1.536000	0.49237	0.655000	0.94253	CGG	NCOA2	-	pirsf_Nuclear_rcpt_coactivator	ENSG00000140396		0.448	NCOA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA2	HGNC	protein_coding	OTTHUMT00000379696.1	-	0.00	68	0	G			71078930	-1	tier1	-	no_errors	ENST00000452400	ensembl	human	known	74_37	missense	12.34	135	19	SNP	1.000	A
NEDD1	121441	genome.wustl.edu	37	12	97330537	97330537	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr12:97330537C>A	ENST00000266742.4	+	8	1207	c.868C>A	c.(868-870)Cac>Aac	p.H290N	NEDD1_ENST00000557644.1_Missense_Mutation_p.H297N|NEDD1_ENST00000429527.2_Missense_Mutation_p.H290N|NEDD1_ENST00000411739.2_Missense_Mutation_p.H201N|NEDD1_ENST00000457368.2_Missense_Mutation_p.H201N	NM_152905.3	NP_690869.1	Q8NHV4	NEDD1_HUMAN	neural precursor cell expressed, developmentally down-regulated 1	290					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	apical part of cell (GO:0045177)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|pericentriolar material (GO:0000242)|spindle pole (GO:0000922)				breast(2)|endometrium(1)|kidney(2)|large_intestine(9)|lung(8)	22						CATCAGTGCTCACAAGACATC	0.358																																																	0													116.0	117.0	117.0					12																	97330537		2203	4300	6503	SO:0001583	missense	0				CCDS9063.1, CCDS44955.1, CCDS44956.1	12q23.1	2013-01-10			ENSG00000139350	ENSG00000139350		"""WD repeat domain containing"""	7723	protein-coding gene	gene with protein product		600372					Standard	NM_001135175		Approved	GCP-WD, TUBGCP7	uc001tev.4	Q8NHV4	OTTHUMG00000170604	ENST00000266742.4:c.868C>A	12.37:g.97330537C>A	ENSP00000266742:p.His290Asn		B0AZN0|B4E145|G3V3F1|Q8NA30	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.H297N	ENST00000266742.4	37	c.889	CCDS9063.1	12	.	.	.	.	.	.	.	.	.	.	C	32	5.117223	0.94385	.	.	ENSG00000139350	ENST00000266742;ENST00000429527;ENST00000411739;ENST00000557644;ENST00000457368	T;T;T;T;T	0.44482	1.08;1.08;0.92;1.08;0.92	5.65	5.65	0.86999	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.75796	0.3898	H	0.94964	3.605	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.78314	0.991;0.981	T	0.82438	-0.0457	10	0.72032	D	0.01	.	19.7278	0.96172	0.0:1.0:0.0:0.0	.	297;290	G3V3F1;Q8NHV4	.;NEDD1_HUMAN	N	290;290;201;297;201	ENSP00000266742:H290N;ENSP00000404978:H290N;ENSP00000411307:H201N;ENSP00000451211:H297N;ENSP00000407964:H201N	ENSP00000266742:H290N	H	+	1	0	NEDD1	95854668	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.447000	0.80620	2.656000	0.90262	0.591000	0.81541	CAC	NEDD1	-	superfamily_WD40_repeat_dom	ENSG00000139350		0.358	NEDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEDD1	HGNC	protein_coding	OTTHUMT00000409792.1	-	0.00	34	0	C			97330537	+1	tier1	-	no_errors	ENST00000557644	ensembl	human	known	74_37	missense	5.19	73	4	SNP	1.000	A
NEMF	9147	genome.wustl.edu	37	14	50251372	50251372	+	Silent	SNP	C	C	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr14:50251372C>G	ENST00000298310.5	-	33	3662	c.3213G>C	c.(3211-3213)ctG>ctC	p.L1071L	NEMF_ENST00000556925.1_5'UTR|NEMF_ENST00000546046.1_Silent_p.L1050L|NEMF_ENST00000382135.2_Silent_p.L271L|NEMF_ENST00000545773.1_Silent_p.L1029L			O60524	NEMF_HUMAN	nuclear export mediator factor	1071					nuclear export (GO:0051168)	nucleus (GO:0005634)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(13)|liver(1)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	36						TTTTTACATTCAGAAGATTGG	0.333																																																	0													60.0	63.0	62.0					14																	50251372		2203	4297	6500	SO:0001819	synonymous_variant	0			AF039687	CCDS9694.1	14q21.3	2012-11-19	2011-01-31	2011-01-31	ENSG00000165525	ENSG00000165525			10663	protein-coding gene	gene with protein product		608378	"""serologically defined colon cancer antigen 1"""	SDCCAG1		9610721, 10575219	Standard	XR_429334		Approved	NY-CO-1, FLJ10051	uc001wxc.3	O60524	OTTHUMG00000170857	ENST00000298310.5:c.3213G>C	14.37:g.50251372C>G			A0JLQ3|B3KSK1|B4DDL3|B4DHA9|B4E3F3|Q32Q66|Q8WW70|Q9NWG1	Silent	SNP	pfam_Fibro-bd_N,pfam_DUF3441,pfam_DUF814,superfamily_FlgN-like_dom	p.L1071	ENST00000298310.5	37	c.3213	CCDS9694.1	14																																																																																			NEMF	-	NULL	ENSG00000165525		0.333	NEMF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEMF	HGNC	protein_coding	OTTHUMT00000410798.1	-	0.00	42	0	C	NM_004713		50251372	-1	tier1	-	no_errors	ENST00000298310	ensembl	human	known	74_37	silent	6.17	76	5	SNP	1.000	G
NEUROD4	58158	genome.wustl.edu	37	12	55421005	55421005	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr12:55421005G>T	ENST00000242994.3	+	2	1160	c.782G>T	c.(781-783)gGg>gTg	p.G261V		NM_021191.2	NP_067014.2	Q9HD90	NDF4_HUMAN	neuronal differentiation 4	261					amacrine cell differentiation (GO:0035881)|cell fate commitment (GO:0045165)|glial cell differentiation (GO:0010001)|neuroblast proliferation (GO:0007405)|neuron development (GO:0048666)|neuron migration (GO:0001764)|Notch signaling pathway (GO:0007219)|positive regulation of cell differentiation (GO:0045597)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	41						AGCATCAGTGGGAACTTCTCC	0.507																																																	0													119.0	115.0	116.0					12																	55421005		2203	4300	6503	SO:0001583	missense	0			AF203901	CCDS8886.1	12q13.13	2013-05-21	2012-02-22			ENSG00000123307		"""Basic helix-loop-helix proteins"""	13802	protein-coding gene	gene with protein product		611635	"""neurogenic differentiation 4"""				Standard	NM_021191		Approved	Atoh3, ATH-3, MATH-3, bHLHa4	uc001sgp.4	Q9HD90		ENST00000242994.3:c.782G>T	12.37:g.55421005G>T	ENSP00000242994:p.Gly261Val		B2RAC9	Missense_Mutation	SNP	pfam_Neurogenic_DUF,pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pirsf_TF_bHLH_NeuroD,pfscan_bHLH_dom	p.G261V	ENST00000242994.3	37	c.782	CCDS8886.1	12	.	.	.	.	.	.	.	.	.	.	G	24.0	4.477997	0.84747	.	.	ENSG00000123307	ENST00000242994	T	0.71103	-0.54	5.85	5.85	0.93711	Neurogenic differentiation factor, domain of unknown function (1);	0.047454	0.85682	D	0.000000	D	0.85375	0.5682	M	0.81802	2.56	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.86176	0.1603	10	0.87932	D	0	-30.5834	18.0364	0.89305	0.0:0.0:1.0:0.0	.	261	Q9HD90	NDF4_HUMAN	V	261	ENSP00000242994:G261V	ENSP00000242994:G261V	G	+	2	0	NEUROD4	53707272	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.941000	0.99782	0.655000	0.94253	GGG	NEUROD4	-	pfam_Neurogenic_DUF,pirsf_TF_bHLH_NeuroD	ENSG00000123307		0.507	NEUROD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEUROD4	HGNC	protein_coding	OTTHUMT00000406104.1	-	0.00	55	0	G			55421005	+1	tier1	-	no_errors	ENST00000242994	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	T
NFXL1	152518	genome.wustl.edu	37	4	47912867	47912867	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr4:47912867G>T	ENST00000507489.1	-	3	556	c.380C>A	c.(379-381)aCg>aAg	p.T127K	NFXL1_ENST00000329043.3_Missense_Mutation_p.T127K|NFXL1_ENST00000381538.3_Missense_Mutation_p.T127K	NM_001278624.1	NP_001265553.1	Q6ZNB6	NFXL1_HUMAN	nuclear transcription factor, X-box binding-like 1	127						integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.T127M(1)		NS(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(4)	27						TGTTATAAACGTATTTGCAAG	0.348																																																	1	Substitution - Missense(1)	large_intestine(1)											140.0	143.0	142.0					4																	47912867		2201	4298	6499	SO:0001583	missense	0			AY134856	CCDS3478.2	4p12	2008-02-05			ENSG00000170448	ENSG00000170448			18726	protein-coding gene	gene with protein product	"""ovarian zinc finger protein"""						Standard	NM_152995		Approved	HOZFP	uc003gxp.3	Q6ZNB6	OTTHUMG00000128621	ENST00000507489.1:c.380C>A	4.37:g.47912867G>T	ENSP00000422037:p.Thr127Lys		B1Q2K1|Q86VG1|Q8WVH1	Missense_Mutation	SNP	pfam_Znf_NFX1,smart_Znf_NFX1,pfscan_Znf_RING	p.T127K	ENST00000507489.1	37	c.380	CCDS3478.2	4	.	.	.	.	.	.	.	.	.	.	G	13.73	2.324916	0.41197	.	.	ENSG00000170448	ENST00000381538;ENST00000507489;ENST00000329043	T;T;T	0.39592	1.07;1.07;1.07	5.58	5.58	0.84498	.	0.150451	0.43110	D	0.000601	T	0.32882	0.0844	L	0.34521	1.04	0.51012	D	0.999907	B	0.18461	0.028	B	0.17433	0.018	T	0.21109	-1.0255	10	0.05959	T	0.93	-14.4081	19.5641	0.95386	0.0:0.0:1.0:0.0	.	127	Q6ZNB6	NFXL1_HUMAN	K	127	ENSP00000370949:T127K;ENSP00000422037:T127K;ENSP00000333113:T127K	ENSP00000333113:T127K	T	-	2	0	NFXL1	47607624	1.000000	0.71417	0.998000	0.56505	0.698000	0.40448	8.267000	0.89874	2.619000	0.88677	0.591000	0.81541	ACG	NFXL1	-	NULL	ENSG00000170448		0.348	NFXL1-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NFXL1	HGNC	protein_coding	OTTHUMT00000361636.1		0.00	27	0	G	NM_152995		47912867	-1			no_errors	ENST00000381538	ensembl	human	known	74_37	missense	6.45	29	2	SNP	1.000	T
NHSL1	57224	genome.wustl.edu	37	6	138753852	138753852	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr6:138753852C>T	ENST00000427025.2	-	5	2270	c.1642G>A	c.(1642-1644)Ggc>Agc	p.G548S	NHSL1_ENST00000343505.5_Missense_Mutation_p.G544S|MIR3145_ENST00000580727.1_RNA	NM_020464.1	NP_065197.1	Q5SYE7	NHSL1_HUMAN	NHS-like 1	548										breast(2)|endometrium(4)|kidney(1)	7						TGCCCTCCGCCCCCTGAATAA	0.542																																																	0													50.0	39.0	43.0					6																	138753852		692	1591	2283	SO:0001583	missense	0			AB037778	CCDS47487.1, CCDS55063.1	6q23.3	2009-02-18	2004-10-07	2004-10-07	ENSG00000135540	ENSG00000135540			21021	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 63"""	C6orf63			Standard	NM_001144060		Approved	bA43P8.1, KIAA1357	uc011edp.2	Q5SYE7	OTTHUMG00000016321	ENST00000427025.2:c.1642G>A	6.37:g.138753852C>T	ENSP00000394546:p.Gly548Ser		Q3ZCS5|Q5SYE8|Q9P2J0	Missense_Mutation	SNP	NULL	p.G548S	ENST00000427025.2	37	c.1642	CCDS55063.1	6	.	.	.	.	.	.	.	.	.	.	C	15.61	2.884253	0.51908	.	.	ENSG00000135540	ENST00000427025;ENST00000343505	T;T	0.34859	1.34;1.82	5.0	3.22	0.36961	.	0.777811	0.11325	N	0.575628	T	0.10508	0.0257	N	0.25647	0.755	0.09310	N	1	B;B	0.23377	0.084;0.084	B;B	0.18561	0.022;0.022	T	0.30060	-0.9991	10	0.28530	T	0.3	-3.0169	11.3052	0.49332	0.0:0.8512:0.0:0.1488	.	544;548	E2QRJ1;Q5SYE7	.;NHSL1_HUMAN	S	548;544	ENSP00000394546:G548S;ENSP00000344672:G544S	ENSP00000344672:G544S	G	-	1	0	NHSL1	138795545	0.011000	0.17503	0.002000	0.10522	0.698000	0.40448	2.119000	0.41958	0.620000	0.30215	0.655000	0.94253	GGC	NHSL1	-	NULL	ENSG00000135540		0.542	NHSL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	NHSL1	HGNC	protein_coding	OTTHUMT00000043700.2	-	0.00	17	0	C	XM_050421		138753852	-1	tier1	-	no_errors	ENST00000427025	ensembl	human	known	74_37	missense	35.00	13	7	SNP	0.004	T
NIN	51199	genome.wustl.edu	37	14	51239693	51239693	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr14:51239693G>T	ENST00000382041.3	-	8	977	c.787C>A	c.(787-789)Caa>Aaa	p.Q263K	NIN_ENST00000245441.5_Missense_Mutation_p.Q263K|NIN_ENST00000453196.1_Missense_Mutation_p.Q263K|NIN_ENST00000530997.2_Missense_Mutation_p.Q263K|NIN_ENST00000389868.3_Missense_Mutation_p.Q263K|NIN_ENST00000324330.9_Missense_Mutation_p.Q263K|NIN_ENST00000382043.4_Missense_Mutation_p.Q263K	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)	263					centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					CTTTTTAGTTGTCTATATGGA	0.313			T	PDGFRB	MPD																																			Dom	yes		14	14q24	51199	ninein (GSK3B interacting protein)		L	0													118.0	116.0	117.0					14																	51239693		2203	4300	6503	SO:0001583	missense	0			AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.787C>A	14.37:g.51239693G>T	ENSP00000371472:p.Gln263Lys		A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Missense_Mutation	SNP	superfamily_tRNA-bd_arm,pfscan_EF_hand_dom	p.Q263K	ENST00000382041.3	37	c.787	CCDS32079.1	14	.	.	.	.	.	.	.	.	.	.	G	18.28	3.589624	0.66105	.	.	ENSG00000100503	ENST00000245441;ENST00000311149;ENST00000389868;ENST00000382043;ENST00000324292;ENST00000382041;ENST00000324330;ENST00000453196;ENST00000453401	D;T;D;T;D;D;T	0.95103	-3.61;-0.29;-3.61;1.92;-3.61;-3.61;1.92	4.87	4.87	0.63330	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.96043	0.8711	L	0.50333	1.59	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.999;0.997;0.993;0.982	D;D;D;D;D	0.76071	0.987;0.972;0.984;0.971;0.968	D	0.95460	0.8542	10	0.39692	T	0.17	-14.4593	17.3524	0.87327	0.0:0.0:1.0:0.0	.	269;263;263;263;263	Q8N4C6-5;C9J066;Q8N4C6;Q5BKU3;Q8N4C6-7	.;.;NIN_HUMAN;.;.	K	263;263;263;263;269;263;263;263;225	ENSP00000245441:Q263K;ENSP00000374518:Q263K;ENSP00000371474:Q263K;ENSP00000371472:Q263K;ENSP00000324210:Q263K;ENSP00000412391:Q263K;ENSP00000398641:Q225K	ENSP00000245441:Q263K	Q	-	1	0	NIN	50309443	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.543000	0.90651	2.398000	0.81561	0.460000	0.39030	CAA	NIN	-	NULL	ENSG00000100503		0.313	NIN-016	KNOWN	basic|CCDS	protein_coding	NIN	HGNC	protein_coding	OTTHUMT00000395207.2	-	0.00	30	0	G	NM_182946		51239693	-1	tier1	-	no_errors	ENST00000245441	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	T
NIPAL2	79815	genome.wustl.edu	37	8	99217371	99217371	+	Missense_Mutation	SNP	G	G	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr8:99217371G>C	ENST00000341166.3	-	7	1014	c.759C>G	c.(757-759)atC>atG	p.I253M	NIPAL2_ENST00000520545.1_5'UTR|NIPAL2_ENST00000430223.2_Missense_Mutation_p.I253M	NM_024759.1	NP_079035.1	Q9H841	NPAL2_HUMAN	NIPA-like domain containing 2	253						integral component of membrane (GO:0016021)	magnesium ion transmembrane transporter activity (GO:0015095)			cervix(3)|kidney(1)|large_intestine(2)|lung(5)|stomach(1)	12						CTATCATGATGATAAACATGA	0.368																																																	0													101.0	97.0	99.0					8																	99217371		2203	4300	6503	SO:0001583	missense	0			AK024017	CCDS6278.1	8q22.2	2009-03-24		2009-03-24	ENSG00000104361	ENSG00000104361			25854	protein-coding gene	gene with protein product				NPAL2		14702039	Standard	NM_024759		Approved	FLJ13955	uc003yil.1	Q9H841	OTTHUMG00000164668	ENST00000341166.3:c.759C>G	8.37:g.99217371G>C	ENSP00000339256:p.Ile253Met		A2RTY8	Missense_Mutation	SNP	pfam_Mg_trans_NIPA	p.I253M	ENST00000341166.3	37	c.759	CCDS6278.1	8	.	.	.	.	.	.	.	.	.	.	G	14.85	2.658686	0.47467	.	.	ENSG00000104361	ENST00000430223;ENST00000341166	D;D	0.91068	-2.78;-2.78	4.56	3.67	0.42095	.	0.215770	0.40064	N	0.001189	D	0.89567	0.6752	L	0.49126	1.545	0.25781	N	0.984724	B;P	0.43542	0.263;0.81	B;P	0.50659	0.232;0.647	T	0.82686	-0.0334	10	0.52906	T	0.07	-1.4987	7.4452	0.27207	0.236:0.0:0.764:0.0	.	253;253	A2RTY8;Q9H841	.;NPAL2_HUMAN	M	253	ENSP00000407087:I253M;ENSP00000339256:I253M	ENSP00000339256:I253M	I	-	3	3	NIPAL2	99286547	1.000000	0.71417	0.997000	0.53966	0.989000	0.77384	1.079000	0.30766	2.058000	0.61347	0.462000	0.41574	ATC	NIPAL2	-	pfam_Mg_trans_NIPA	ENSG00000104361		0.368	NIPAL2-001	KNOWN	basic|CCDS	protein_coding	NIPAL2	HGNC	protein_coding	OTTHUMT00000379677.1	-	0.00	50	0	G	NM_024759		99217371	-1	tier1	-	no_errors	ENST00000341166	ensembl	human	known	74_37	missense	11.50	100	13	SNP	0.998	C
NLRP1	22861	genome.wustl.edu	37	17	5424238	5424238	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr17:5424238G>T	ENST00000572272.1	-	14	3877	c.3878C>A	c.(3877-3879)tCt>tAt	p.S1293Y	NLRP1_ENST00000577119.1_Intron|NLRP1_ENST00000269280.4_Intron|NLRP1_ENST00000345221.3_Intron|NLRP1_ENST00000262467.5_Missense_Mutation_p.S1297Y|NLRP1_ENST00000354411.3_Missense_Mutation_p.S1263Y			Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1	1293					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				ACCAGACCCAGACACAGTGTA	0.517																																																	0													83.0	71.0	75.0					17																	5424238		2203	4300	6503	SO:0001583	missense	0			AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000		ENST00000572272.1:c.3878C>A	17.37:g.5424238G>T	ENSP00000460475:p.Ser1293Tyr		E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	Missense_Mutation	SNP	pfam_CARD,pfam_DAPIN,pfam_Leu-rich_rpt,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_CARD,pfscan_DAPIN,prints_Disease_R	p.S1293Y	ENST00000572272.1	37	c.3878	CCDS42246.1	17	.	.	.	.	.	.	.	.	.	.	G	16.16	3.043755	0.55003	.	.	ENSG00000091592	ENST00000544378;ENST00000262467;ENST00000269280;ENST00000354411	T;T;T	0.21932	1.98;1.98;1.98	4.59	2.5	0.30297	.	0.000000	0.38272	N	0.001742	T	0.46405	0.1391	M	0.82323	2.585	0.21064	N	0.999793	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	1.0;1.0;0.998	T	0.34700	-0.9818	10	0.87932	D	0	.	11.1186	0.48275	0.0:0.3613:0.6387:0.0	.	1263;1293;1297	Q9C000-4;Q9C000;E9PE50	.;NALP1_HUMAN;.	Y	1297;1297;1293;1263	ENSP00000442029:S1297Y;ENSP00000262467:S1297Y;ENSP00000346390:S1263Y	ENSP00000262467:S1297Y	S	-	2	0	NLRP1	5364962	0.935000	0.31712	0.012000	0.15200	0.274000	0.26718	1.861000	0.39438	0.631000	0.30412	0.644000	0.83932	TCT	NLRP1	-	NULL	ENSG00000091592		0.517	NLRP1-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP1	HGNC	protein_coding	OTTHUMT00000439517.1		0.00	26	0	G	NM_033004		5424238	-1			no_errors	ENST00000572272	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.025	T
NME6	10201	genome.wustl.edu	37	3	48336237	48336237	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr3:48336237G>T	ENST00000452211.1	-	7	688	c.451C>A	c.(451-453)Cag>Aag	p.Q151K	NME6_ENST00000426723.1_Missense_Mutation_p.Q84K|NME6_ENST00000426689.2_Missense_Mutation_p.Q151K|NME6_ENST00000435684.1_Missense_Mutation_p.N137K|ZNF589_ENST00000412564.1_Intron|NME6_ENST00000450160.1_Missense_Mutation_p.N137K|NME6_ENST00000447314.1_Missense_Mutation_p.Q106K|NME6_ENST00000421967.1_Missense_Mutation_p.Q159K|NME6_ENST00000444069.1_5'UTR|NME6_ENST00000442597.1_Missense_Mutation_p.Q151K|NME6_ENST00000415644.1_Missense_Mutation_p.Q84K|NME6_ENST00000415053.1_Missense_Mutation_p.Q151K|NME6_ENST00000451657.1_Missense_Mutation_p.N137K			O75414	NDK6_HUMAN	NME/NM23 nucleoside diphosphate kinase 6	151					apoptotic process (GO:0006915)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|negative regulation of cell growth (GO:0030308)|negative regulation of mitosis (GO:0045839)|UTP biosynthetic process (GO:0006228)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside diphosphate kinase activity (GO:0004550)			breast(1)|large_intestine(5)	6				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00609)		TACCAGCGCTGTTCACTGAAG	0.547																																																	0													85.0	81.0	82.0					3																	48336237		2203	4300	6503	SO:0001583	missense	0			AF051941	CCDS2763.1	3p21.31	2012-05-18	2012-05-18		ENSG00000172113	ENSG00000172113			20567	protein-coding gene	gene with protein product		608294	"""non-metastatic cells 6, protein expressed in (nucleoside-diphosphate kinase)"""			10453732, 19852809	Standard	NM_005793		Approved	NM23-H6, IPIA-ALPHA	uc003cso.3	O75414	OTTHUMG00000133531	ENST00000452211.1:c.451C>A	3.37:g.48336237G>T	ENSP00000392352:p.Gln151Lys		B4DGW7|B4DM99|Q53HM5|Q96E73|Q9BQ63	Missense_Mutation	SNP	pfam_Nucleoside_diP_kinase,superfamily_Nucleoside_diP_kinase,smart_Nucleoside_diP_kinase,prints_Nucleoside_diP_kinase	p.Q159K	ENST00000452211.1	37	c.475		3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.81|19.81	3.896917|3.896917	0.72639|0.72639	.|.	.|.	ENSG00000172113|ENSG00000172113	ENST00000450160;ENST00000451657;ENST00000435684|ENST00000421967;ENST00000426689;ENST00000452211;ENST00000426723;ENST00000415644;ENST00000415053;ENST00000442597;ENST00000447314;ENST00000425930	.|T;T;T;T;T;T;T	.|0.62639	.|0.57;0.58;0.58;0.58;0.58;0.01;0.6	4.48|4.48	3.58|3.58	0.41010|0.41010	.|.	.|0.502444	.|0.23418	.|N	.|0.048388	T|T	0.43277|0.43277	0.1240|0.1240	N|N	0.24115|0.24115	0.695|0.695	0.21802|0.21802	N|N	0.999534|0.999534	B|B;B;B	0.13145|0.24426	0.007|0.103;0.001;0.0	B|B;B;B	0.11329|0.25140	0.006|0.058;0.004;0.002	T|T	0.20273|0.20273	-1.0280|-1.0280	7|10	.|0.10636	.|T	.|0.68	-3.3817|-3.3817	10.4676|10.4676	0.44618|0.44618	0.0:0.1973:0.8027:0.0|0.0:0.1973:0.8027:0.0	.|.	137|84;151;151	O75414-3|O75414-2;O75414;C9J9V6	.|.;NDK6_HUMAN;.	K|K	137|159;151;151;84;84;151;151;106;151	.|ENSP00000416658:Q159K;ENSP00000440286:Q151K;ENSP00000392352:Q151K;ENSP00000399582:Q151K;ENSP00000406642:Q151K;ENSP00000414842:Q106K;ENSP00000411116:Q151K	.|ENSP00000399582:Q151K	N|Q	-|-	3|1	2|0	NME6|NME6	48311241|48311241	0.002000|0.002000	0.14202|0.14202	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	0.991000|0.991000	0.29654|0.29654	1.206000|1.206000	0.43276|0.43276	0.561000|0.561000	0.74099|0.74099	AAC|CAG	NME6	-	superfamily_Nucleoside_diP_kinase,smart_Nucleoside_diP_kinase	ENSG00000172113		0.547	NME6-005	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_candidate	protein_coding	NME6	HGNC	protein_coding	OTTHUMT00000346107.1	-	0.00	14	0	G	NM_005793		48336237	-1	tier1	-	no_errors	ENST00000421967	ensembl	human	known	74_37	missense	19.05	17	4	SNP	1.000	T
NOTCH3	4854	genome.wustl.edu	37	19	15302440	15302440	+	Silent	SNP	C	C	T	rs145049433		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr19:15302440C>T	ENST00000263388.2	-	6	906	c.831G>A	c.(829-831)gaG>gaA	p.E277E		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	277	EGF-like 7. {ECO:0000255|PROSITE- ProRule:PRU00076}.				forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			GCAGCTGACACTCATCCACGT	0.642																																																	0								C		0,4404		0,0,2202	65.0	50.0	55.0		831	-1.5	1.0	19	dbSNP_134	55	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	NOTCH3	NM_000435.2		0,2,6500	TT,TC,CC		0.0233,0.0,0.0154		277/2322	15302440	2,13002	2202	4300	6502	SO:0001819	synonymous_variant	0			U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.831G>A	19.37:g.15302440C>T			Q9UEB3|Q9UPL3|Q9Y6L8	Silent	SNP	pirsf_Notch,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,pfam_Ankyrin_rpt,pfam_Notch_dom,pfam_Notch_NODP_dom,pfam_Notch_NOD_dom,pfam_EGF_extracell,pfam_DUF3454_notch,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_3,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.E277	ENST00000263388.2	37	c.831	CCDS12326.1	19																																																																																			NOTCH3	-	pirsf_Notch,pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000074181		0.642	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH3	HGNC	protein_coding	OTTHUMT00000465714.1	-	0.00	46	0	C	NM_000435		15302440	-1	tier1	rs145049433	no_errors	ENST00000263388	ensembl	human	known	74_37	silent	12.31	57	8	SNP	0.998	T
NPAS4	266743	genome.wustl.edu	37	11	66191995	66191995	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr11:66191995C>A	ENST00000311034.2	+	7	1810	c.1634C>A	c.(1633-1635)cCc>cAc	p.P545H		NM_178864.3	NP_849195.2	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	545					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|kidney(3)|large_intestine(11)|liver(2)|lung(20)|ovary(1)|prostate(3)|skin(3)	49						CTGGACAGCCCCAGCCAAACC	0.582																																																	0													120.0	129.0	126.0					11																	66191995		2200	4295	6495	SO:0001583	missense	0			AB049469	CCDS8138.1	11q13.2	2013-05-21			ENSG00000174576	ENSG00000174576		"""Basic helix-loop-helix proteins"""	18983	protein-coding gene	gene with protein product		608554				14701734	Standard	NM_178864		Approved	PASD10, NXF, Le-PAS, bHLHe79	uc001ohx.1	Q8IUM7	OTTHUMG00000167045	ENST00000311034.2:c.1634C>A	11.37:g.66191995C>A	ENSP00000311196:p.Pro545His		B7ZL81|Q8N8S5|Q8N9Q9	Missense_Mutation	SNP	pfam_PAS_fold_3,superfamily_PAS,smart_PAS,pfscan_PAS	p.P545H	ENST00000311034.2	37	c.1634	CCDS8138.1	11	.	.	.	.	.	.	.	.	.	.	C	13.92	2.381057	0.42207	.	.	ENSG00000174576	ENST00000311034	T	0.23950	1.88	4.69	4.69	0.59074	.	0.115412	0.39834	N	0.001249	T	0.29684	0.0741	N	0.14661	0.345	0.30535	N	0.766992	D	0.69078	0.997	P	0.59012	0.85	T	0.15665	-1.0429	10	0.66056	D	0.02	-12.1373	15.1587	0.72764	0.0:1.0:0.0:0.0	.	545	Q8IUM7	NPAS4_HUMAN	H	545	ENSP00000311196:P545H	ENSP00000311196:P545H	P	+	2	0	NPAS4	65948571	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.317000	0.59184	2.443000	0.82685	0.655000	0.94253	CCC	NPAS4	-	NULL	ENSG00000174576		0.582	NPAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAS4	HGNC	protein_coding	OTTHUMT00000392634.1		0.00	9	0	C	NM_178864		66191995	+1			no_errors	ENST00000311034	ensembl	human	known	74_37	missense	6.67	28	2	SNP	1.000	A
NRG1	3084	genome.wustl.edu	37	8	32607085	32607085	+	Intron	SNP	T	T	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr8:32607085T>G	ENST00000405005.3	+	8	700				NRG1_ENST00000523079.1_Intron|NRG1_ENST00000521670.1_Intron|NRG1_ENST00000356819.4_Missense_Mutation_p.L233R|NRG1_ENST00000519301.1_Missense_Mutation_p.L178R|NRG1_ENST00000523681.1_3'UTR|NRG1_ENST00000287842.3_Intron|NRG1_ENST00000287845.5_Missense_Mutation_p.L199R|NRG1_ENST00000338921.4_Intron|NRG1_ENST00000341377.5_Intron|NRG1_ENST00000539990.1_Intron			Q02297	NRG1_HUMAN	neuregulin 1						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		GCAGAGCATCTTGGGATTGAA	0.378																																																	0													154.0	152.0	153.0					8																	32607085		2203	4300	6503	SO:0001627	intron_variant	0			L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.701-4805T>G	8.37:g.32607085T>G			A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Missense_Mutation	SNP	pfam_Neuregulin_1_C,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Ig-like_dom,prints_Neuregulin	p.L233R	ENST00000405005.3	37	c.698	CCDS6085.1	8	.	.	.	.	.	.	.	.	.	.	T	21.1	4.105481	0.77096	.	.	ENSG00000157168	ENST00000518104;ENST00000519301;ENST00000523534;ENST00000356819;ENST00000287845;ENST00000518084	T;T;T;T;T	0.80480	-1.24;-1.38;-1.09;-1.02;-0.96	5.59	5.59	0.84812	.	.	.	.	.	D	0.86297	0.5899	L	0.43152	1.355	0.80722	D	1	B;B;D;P	0.89917	0.402;0.331;1.0;0.631	B;B;D;B	0.91635	0.153;0.107;0.999;0.316	D	0.87738	0.2583	9	0.87932	D	0	.	15.7861	0.78304	0.0:0.0:0.0:1.0	.	199;233;236;233	F8W9E3;Q7RTW4;Q02297-2;Q02297-6	.;.;.;.	R	195;178;301;233;199;79	ENSP00000430053:L195R;ENSP00000429582:L178R;ENSP00000429067:L301R;ENSP00000349275:L233R;ENSP00000287845:L199R	ENSP00000287845:L199R	L	+	2	0	NRG1	32726627	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.101000	0.71479	2.134000	0.65973	0.528000	0.53228	CTT	NRG1	-	NULL	ENSG00000157168		0.378	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	NRG1	HGNC	protein_coding	OTTHUMT00000472504.1	-	0.00	15	0	T			32607085	+1	tier1	-	no_errors	ENST00000356819	ensembl	human	known	74_37	missense	28.21	28	11	SNP	1.000	G
NRK	203447	genome.wustl.edu	37	X	105153087	105153087	+	Missense_Mutation	SNP	T	T	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chrX:105153087T>G	ENST00000243300.9	+	13	1757	c.1454T>G	c.(1453-1455)gTt>gGt	p.V485G	NRK_ENST00000428173.2_Missense_Mutation_p.V486G	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	485	Gln-rich.				activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						CAGGCACAGGTTAGGGCACCT	0.542										HNSCC(51;0.14)																																							0													49.0	50.0	49.0					X																	105153087		2036	4182	6218	SO:0001583	missense	0			BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.1454T>G	X.37:g.105153087T>G	ENSP00000434830:p.Val485Gly		Q32ND6|Q5H9K2|Q6ZMP2	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Citron,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_dom	p.V486G	ENST00000243300.9	37	c.1457		X	.	.	.	.	.	.	.	.	.	.	T	0.581	-0.836981	0.02692	.	.	ENSG00000123572	ENST00000243300;ENST00000428173	T;T	0.27557	1.66;1.66	4.49	-0.211	0.13172	.	1.149250	0.06491	N	0.734545	T	0.16599	0.0399	N	0.21448	0.665	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.27020	-1.0086	10	0.23302	T	0.38	.	1.2256	0.01932	0.1305:0.2204:0.1942:0.455	.	153;485	Q7Z2Y5-2;Q7Z2Y5	.;NRK_HUMAN	G	485;486	ENSP00000434830:V485G;ENSP00000438378:V486G	ENSP00000434830:V485G	V	+	2	0	NRK	105039743	0.992000	0.36948	0.015000	0.15790	0.168000	0.22595	0.227000	0.17795	-0.142000	0.11354	-0.223000	0.12442	GTT	NRK	-	NULL	ENSG00000123572		0.542	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	NRK	HGNC	protein_coding	OTTHUMT00000106480.6	-	0.00	15	0	T	NM_198465		105153087	+1	tier1	-	no_errors	ENST00000428173	ensembl	human	known	74_37	missense	34.78	15	8	SNP	0.001	G
NRXN3	9369	genome.wustl.edu	37	14	80328055	80328055	+	Silent	SNP	G	G	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr14:80328055G>C	ENST00000557594.1	+	6	2615	c.1662G>C	c.(1660-1662)gtG>gtC	p.V554V	NRXN3_ENST00000554719.1_Silent_p.V978V|NRXN3_ENST00000335750.5_Silent_p.V978V|NRXN3_ENST00000428277.2_Silent_p.V376V|NRXN3_ENST00000281127.7_Silent_p.V349V|NRXN3_ENST00000556003.1_3'UTR	NM_001272020.1	NP_001258949.1	Q9HDB5	NRX3B_HUMAN	neurexin 3	554					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		CCTCAGAGGTGATCCGGGAGT	0.582																																																	0													56.0	56.0	56.0					14																	80328055		2203	4300	6503	SO:0001819	synonymous_variant	0			AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000557594.1:c.1662G>C	14.37:g.80328055G>C			A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Silent	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_EG-like_dom,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Laminin_G	p.V978	ENST00000557594.1	37	c.2934		14																																																																																			NRXN3	-	NULL	ENSG00000021645		0.582	NRXN3-004	NOVEL	basic	protein_coding	NRXN3	HGNC	protein_coding	OTTHUMT00000413790.1	-	0.00	32	0	G	NM_001105250		80328055	+1	tier1	-	no_errors	ENST00000335750	ensembl	human	known	74_37	silent	15.52	49	9	SNP	1.000	C
NUP188	23511	genome.wustl.edu	37	9	131720321	131720321	+	Silent	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr9:131720321C>A	ENST00000372577.2	+	6	381	c.360C>A	c.(358-360)gcC>gcA	p.A120A		NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	120					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						AGAGCCAGGCCTTAATCCTGA	0.393																																																	0													99.0	91.0	94.0					9																	131720321		2203	4300	6503	SO:0001819	synonymous_variant	0			D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.360C>A	9.37:g.131720321C>A			Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Silent	SNP	pfam_Nucleoporin_Nup188,superfamily_ARM-type_fold	p.A120	ENST00000372577.2	37	c.360	CCDS35156.1	9																																																																																			NUP188	-	pfam_Nucleoporin_Nup188	ENSG00000095319		0.393	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP188	HGNC	protein_coding	OTTHUMT00000054529.2	-	0.00	39	0	C			131720321	+1	tier1	-	no_errors	ENST00000372577	ensembl	human	known	74_37	silent	6.45	58	4	SNP	0.999	A
OFD1	8481	genome.wustl.edu	37	X	13767593	13767593	+	Missense_Mutation	SNP	T	T	G	rs312262858		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chrX:13767593T>G	ENST00000340096.6	+	9	1203	c.876T>G	c.(874-876)gaT>gaG	p.D292E	OFD1_ENST00000490265.1_3'UTR|OFD1_ENST00000380550.3_Missense_Mutation_p.D292E|OFD1_ENST00000380567.1_Missense_Mutation_p.D152E|OFD1_ENST00000398395.3_Missense_Mutation_p.D292E	NM_003611.2	NP_003602.1	O75665	OFD1_HUMAN	oral-facial-digital syndrome 1	292					axoneme assembly (GO:0035082)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of fibroblast growth factor receptor signaling pathway involved in neural plate anterior/posterior pattern formation (GO:2000314)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|gamma-tubulin binding (GO:0043015)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	25						TACTAAAAGATATGGATTTGC	0.318																																																	0													62.0	60.0	60.0					X																	13767593		2203	4297	6500	SO:0001583	missense	0			Y15164	CCDS14157.1	Xp22	2014-06-18			ENSG00000046651	ENSG00000046651			2567	protein-coding gene	gene with protein product		300170	"""retinitis pigmentosa 23 (X-linked recessive)"""	CXorf5, RP23		9722947, 9215688, 22619378	Standard	NM_003611		Approved	71-7A, JBTS10	uc004cvp.4	O75665	OTTHUMG00000021159	ENST00000340096.6:c.876T>G	X.37:g.13767593T>G	ENSP00000344314:p.Asp292Glu		B9ZVU5|O75666|Q4VAK4	Missense_Mutation	SNP	superfamily_Lipoprotein_6,smart_LisH_dimerisation,pfscan_LisH_dimerisation	p.D292E	ENST00000340096.6	37	c.876	CCDS14157.1	X	.	.	.	.	.	.	.	.	.	.	T	12.91	2.080782	0.36758	.	.	ENSG00000046651	ENST00000380550;ENST00000398395;ENST00000340096;ENST00000380567;ENST00000543598	D;D;D;D	0.96300	-3.81;-3.55;-3.97;-1.94	5.66	0.138	0.14793	.	0.088949	0.85682	D	0.000000	D	0.94699	0.8290	L	0.41124	1.26	0.31476	N	0.667749	D;D;P;D;P	0.65815	0.989;0.991;0.907;0.995;0.955	P;P;P;D;P	0.62955	0.708;0.898;0.684;0.909;0.753	D	0.90037	0.4139	10	0.02654	T	1	-36.2286	11.4073	0.49904	0.0:0.4418:0.0:0.5582	.	155;292;292;152;292	F5H2Z4;A8K2T9;O75665-3;A6NF31;O75665	.;.;.;.;OFD1_HUMAN	E	292;292;292;152;155	ENSP00000369923:D292E;ENSP00000381432:D292E;ENSP00000344314:D292E;ENSP00000369941:D152E	ENSP00000344314:D292E	D	+	3	2	OFD1	13677514	0.958000	0.32768	0.765000	0.31456	0.963000	0.63663	-0.071000	0.11505	0.004000	0.14682	0.486000	0.48141	GAT	OFD1	-	NULL	ENSG00000046651		0.318	OFD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OFD1	HGNC	protein_coding	OTTHUMT00000055808.1	-	0.00	46	0	T	NM_003611		13767593	+1	tier1	-	no_errors	ENST00000340096	ensembl	human	known	74_37	missense	35.06	50	27	SNP	0.970	G
OR10AG1	282770	genome.wustl.edu	37	11	55735082	55735082	+	Missense_Mutation	SNP	T	T	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr11:55735082T>G	ENST00000312345.2	-	1	908	c.858A>C	c.(856-858)aaA>aaC	p.K286N		NM_001005491.1	NP_001005491.1	Q8NH19	O10AG_HUMAN	olfactory receptor, family 10, subfamily AG, member 1	286						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(24)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	40	Esophageal squamous(21;0.0137)					CCATGATATCTTTGTTCCTCA	0.338																																																	0													55.0	61.0	59.0					11																	55735082		2201	4296	6497	SO:0001583	missense	0			AB065594	CCDS31514.1	11q11	2012-08-09			ENSG00000174970	ENSG00000174970		"""GPCR / Class A : Olfactory receptors"""	19607	protein-coding gene	gene with protein product							Standard	NM_001005491		Approved		uc010rit.2	Q8NH19	OTTHUMG00000166824	ENST00000312345.2:c.858A>C	11.37:g.55735082T>G	ENSP00000311477:p.Lys286Asn		B2RNH4|Q6IEU3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.K286N	ENST00000312345.2	37	c.858	CCDS31514.1	11	.	.	.	.	.	.	.	.	.	.	T	15.36	2.811730	0.50527	.	.	ENSG00000174970	ENST00000312345	T	0.45668	0.89	5.08	-0.168	0.13343	.	0.331554	0.26010	N	0.026892	T	0.60702	0.2289	M	0.85630	2.765	0.30706	N	0.74978	D	0.71674	0.998	D	0.67231	0.95	T	0.62798	-0.6778	10	0.54805	T	0.06	.	9.7886	0.40692	0.0:0.5592:0.0:0.4408	.	286	Q8NH19	O10AG_HUMAN	N	286	ENSP00000311477:K286N	ENSP00000311477:K286N	K	-	3	2	OR10AG1	55491658	0.913000	0.31002	0.941000	0.38009	0.689000	0.40095	-0.136000	0.10405	0.032000	0.15435	0.386000	0.25728	AAA	OR10AG1	-	prints_GPCR_Rhodpsn	ENSG00000174970		0.338	OR10AG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10AG1	HGNC	protein_coding	OTTHUMT00000391531.1	-	0.00	33	0	T	NM_001005491		55735082	-1	tier1	-	no_errors	ENST00000312345	ensembl	human	known	74_37	missense	10.59	76	9	SNP	0.999	G
OR10Z1	128368	genome.wustl.edu	37	1	158576639	158576639	+	Missense_Mutation	SNP	T	T	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr1:158576639T>G	ENST00000361284.1	+	1	411	c.411T>G	c.(409-411)aaT>aaG	p.N137K		NM_001004478.1	NP_001004478.1	Q8NGY1	O10Z1_HUMAN	olfactory receptor, family 10, subfamily Z, member 1	137						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(6)|lung(21)|pancreas(1)|prostate(3)|skin(4)	37	all_hematologic(112;0.0378)					GCCACATGAATCCTACCCTCT	0.512																																																	0													94.0	94.0	94.0					1																	158576639		2203	4300	6503	SO:0001583	missense	0			AB065635	CCDS30901.1	1q23.1	2012-08-23			ENSG00000198967	ENSG00000198967		"""GPCR / Class A : Olfactory receptors"""	14996	protein-coding gene	gene with protein product							Standard	NM_001004478		Approved		uc010pio.2	Q8NGY1	OTTHUMG00000019637	ENST00000361284.1:c.411T>G	1.37:g.158576639T>G	ENSP00000354707:p.Asn137Lys		Q5VYL0|Q6IFR7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.N137K	ENST00000361284.1	37	c.411	CCDS30901.1	1	.	.	.	.	.	.	.	.	.	.	T	10.17	1.275701	0.23307	.	.	ENSG00000198967	ENST00000361284	T	0.36878	1.23	5.3	0.418	0.16429	GPCR, rhodopsin-like superfamily (1);	0.896444	0.09352	N	0.813964	T	0.15739	0.0379	M	0.62266	1.93	0.09310	N	1	B	0.20459	0.045	B	0.20184	0.028	T	0.40021	-0.9585	10	0.72032	D	0.01	.	5.6692	0.17713	0.0:0.447:0.1724:0.3806	.	137	Q8NGY1	O10Z1_HUMAN	K	137	ENSP00000354707:N137K	ENSP00000354707:N137K	N	+	3	2	OR10Z1	156843263	0.000000	0.05858	0.042000	0.18584	0.807000	0.45602	-0.550000	0.06034	0.142000	0.18901	0.533000	0.62120	AAT	OR10Z1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000198967		0.512	OR10Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10Z1	HGNC	protein_coding	OTTHUMT00000051853.1	-	0.00	27	0	T	NM_001004478		158576639	+1	tier1	-	no_errors	ENST00000361284	ensembl	human	known	74_37	missense	19.51	33	8	SNP	0.000	G
OR51G1	79324	genome.wustl.edu	37	11	4944886	4944886	+	Silent	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr11:4944886G>A	ENST00000321961.2	-	1	751	c.684C>T	c.(682-684)ctC>ctT	p.L228L	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001005237.1	NP_001005237.1	Q8NGK1	O51G1_HUMAN	olfactory receptor, family 51, subfamily G, member 1	228						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(3)|skin(4)|soft_tissue(1)	25		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.58e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		AGGCAATGCTGAGCACGGTGC	0.542																																																	0													129.0	102.0	111.0					11																	4944886		2201	4298	6499	SO:0001819	synonymous_variant	0			AB065793	CCDS31366.1	11p15.4	2012-08-09			ENSG00000176879	ENSG00000176879		"""GPCR / Class A : Olfactory receptors"""	14738	protein-coding gene	gene with protein product				OR51G3P			Standard	NM_001005237		Approved		uc010qyr.2	Q8NGK1	OTTHUMG00000066532	ENST00000321961.2:c.684C>T	11.37:g.4944886G>A			B9EGW8|Q6IFH6	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L228	ENST00000321961.2	37	c.684	CCDS31366.1	11																																																																																			OR51G1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000176879		0.542	OR51G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51G1	HGNC	protein_coding	OTTHUMT00000142345.1	-	0.00	27	0	G	NM_001005237		4944886	-1	tier1	-	no_errors	ENST00000321961	ensembl	human	known	74_37	silent	28.00	18	7	SNP	0.000	A
OR52E2	119678	genome.wustl.edu	37	11	5080750	5080750	+	Silent	SNP	C	C	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr11:5080750C>T	ENST00000321522.2	-	1	107	c.108G>A	c.(106-108)gtG>gtA	p.V36V		NM_001005164.2	NP_001005164.2	Q8NGJ4	O52E2_HUMAN	olfactory receptor, family 52, subfamily E, member 2	36						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|lung(13)|ovary(2)|skin(3)	20		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.03e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.191)		CGATCATGTACACAGCACAGA	0.507																																																	0													122.0	108.0	113.0					11																	5080750		2201	4298	6499	SO:0001819	synonymous_variant	0			AB065800	CCDS31371.1	11p15.4	2012-08-09			ENSG00000176787	ENSG00000176787		"""GPCR / Class A : Olfactory receptors"""	14769	protein-coding gene	gene with protein product							Standard	NM_001005164		Approved		uc010qyw.2	Q8NGJ4	OTTHUMG00000066608	ENST00000321522.2:c.108G>A	11.37:g.5080750C>T				Silent	SNP	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.V36	ENST00000321522.2	37	c.108	CCDS31371.1	11																																																																																			OR52E2	-	prints_GPCR_Rhodpsn	ENSG00000176787		0.507	OR52E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52E2	HGNC	protein_coding	OTTHUMT00000142815.1	-	0.00	44	0	C	NM_001005164		5080750	-1	tier1	-	no_errors	ENST00000321522	ensembl	human	known	74_37	silent	15.38	44	8	SNP	0.988	T
OR52A4	390053	genome.wustl.edu	37	11	5142536	5142536	+	RNA	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr11:5142536G>A	ENST00000498233.1	-	0	862							A6NMU1	O52A4_HUMAN	olfactory receptor, family 52, subfamily A, member 4							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(1)|lung(12)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	22		Medulloblastoma(188;0.0049)|all_neural(188;0.0442)|Breast(177;0.0675)		Epithelial(150;1.7e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.2)		CTGGCAAATGGAACCAAAAAA	0.463																																																	0													55.0	52.0	53.0					11																	5142536		2201	4298	6499			0					11p15.4	2012-10-03	2012-10-03	2012-10-03	ENSG00000205494	ENSG00000205494		"""GPCR / Class A : Olfactory receptors"""	19579	pseudogene	pseudogene							Standard	NG_029079		Approved			A6NMU1	OTTHUMG00000066610		11.37:g.5142536G>A				RNA	SNP	-	NULL	ENST00000498233.1	37	NULL		11																																																																																			OR52A4	-	-	ENSG00000205494		0.463	OR52A4-002	KNOWN	basic	processed_transcript	OR52A4	HGNC	pseudogene	OTTHUMT00000268565.1	-	0.00	31	0	G	NG_029079		5142536	-1	tier1	-	no_errors	ENST00000481634	ensembl	human	known	74_37	rna	17.65	14	3	SNP	0.000	A
OR5M3	219482	genome.wustl.edu	37	11	56237478	56237478	+	Missense_Mutation	SNP	A	A	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr11:56237478A>C	ENST00000312240.2	-	1	536	c.496T>G	c.(496-498)Ttc>Gtc	p.F166V		NM_001004742.2	NP_001004742.2	Q8NGP4	OR5M3_HUMAN	olfactory receptor, family 5, subfamily M, member 3	166						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F166V(1)		NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(7)|lung(15)|ovary(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	37	Esophageal squamous(21;0.00448)					TTTCCACAGAAGTACAAGCCG	0.393																																																	1	Substitution - Missense(1)	large_intestine(1)											109.0	98.0	102.0					11																	56237478		2201	4295	6496	SO:0001583	missense	0			AB065746	CCDS31532.1	11q11	2012-08-09			ENSG00000174937	ENSG00000174937		"""GPCR / Class A : Olfactory receptors"""	14806	protein-coding gene	gene with protein product							Standard	NM_001004742		Approved		uc010rjk.2	Q8NGP4	OTTHUMG00000166875	ENST00000312240.2:c.496T>G	11.37:g.56237478A>C	ENSP00000312208:p.Phe166Val		B2RNM7|Q6IEW4|Q96RC0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F166V	ENST00000312240.2	37	c.496	CCDS31532.1	11	.	.	.	.	.	.	.	.	.	.	A	16.83	3.231911	0.58777	.	.	ENSG00000174937	ENST00000312240	T	0.00145	8.67	5.22	2.83	0.33086	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	D	0.000142	T	0.00552	0.0018	H	0.94886	3.595	0.25362	N	0.988772	D	0.89917	1.0	D	0.97110	1.0	T	0.40117	-0.9580	10	0.87932	D	0	-21.1363	5.1044	0.14775	0.7543:0.0:0.0867:0.159	.	166	Q8NGP4	OR5M3_HUMAN	V	166	ENSP00000312208:F166V	ENSP00000312208:F166V	F	-	1	0	OR5M3	55994054	0.149000	0.22717	0.996000	0.52242	0.777000	0.43975	0.830000	0.27462	0.284000	0.22305	0.448000	0.29417	TTC	OR5M3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000174937		0.393	OR5M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5M3	HGNC	protein_coding	OTTHUMT00000391639.1	-	0.00	64	0	A	NM_001004742		56237478	-1	tier1	-	no_errors	ENST00000312240	ensembl	human	known	74_37	missense	14.47	65	11	SNP	0.962	C
OR8U1	219417	genome.wustl.edu	37	11	56143261	56143261	+	Missense_Mutation	SNP	T	T	A	rs199607712|rs386753757		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr11:56143261T>A	ENST00000302270.1	+	1	162	c.162T>A	c.(160-162)agT>agA	p.S54R		NM_001005204.1	NP_001005204.1	Q8NH10	OR8U1_HUMAN	olfactory receptor, family 8, subfamily U, member 1	54						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(23)|ovary(4)|skin(1)|stomach(1)	39	Esophageal squamous(21;0.00448)					CGGATACAAGTCTCAACACAC	0.413																																																	0													333.0	301.0	311.0					11																	56143261		1968	4154	6122	SO:0001583	missense	0			AB065603	CCDS41647.1	11q11	2012-08-09			ENSG00000172199	ENSG00000172199		"""GPCR / Class A : Olfactory receptors"""	19611	protein-coding gene	gene with protein product							Standard	NM_001005204		Approved			Q8NH10	OTTHUMG00000166860	ENST00000302270.1:c.162T>A	11.37:g.56143261T>A	ENSP00000304188:p.Ser54Arg			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S54R	ENST00000302270.1	37	c.162	CCDS41647.1	11	.	.	.	.	.	.	.	.	.	.	T	0.004	-2.283717	0.00251	.	.	ENSG00000172199	ENST00000302270	T	0.00580	6.43	5.78	-3.07	0.05363	GPCR, rhodopsin-like superfamily (1);	0.256554	0.27581	N	0.018728	T	0.00144	0.0004	N	0.00260	-1.75	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.46247	-0.9205	10	0.02654	T	1	.	0.2744	0.00236	0.2793:0.1795:0.263:0.2782	.	54	Q8NH10	OR8U1_HUMAN	R	54	ENSP00000304188:S54R	ENSP00000304188:S54R	S	+	3	2	OR8U1	55899837	0.000000	0.05858	0.153000	0.22517	0.001000	0.01503	-1.796000	0.01750	-0.105000	0.12132	-2.344000	0.00244	AGT	OR8U1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000172199		0.413	OR8U1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8U1	HGNC	protein_coding	OTTHUMT00000391607.1		0.00	41	0	T	NM_001005204		56143261	+1			no_errors	ENST00000302270	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.000	A
OR6M1	390261	genome.wustl.edu	37	11	123677011	123677011	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr11:123677011G>T	ENST00000309154.2	-	1	84	c.47C>A	c.(46-48)cCa>cAa	p.P16Q		NM_001005325.1	NP_001005325.1	Q8NGM8	OR6M1_HUMAN	olfactory receptor, family 6, subfamily M, member 1	16						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(2)|skin(5)|urinary_tract(1)	29		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.028)		CAGGAGAGCTGGGAAGGCAAT	0.433																																																	0													87.0	77.0	80.0					11																	123677011		2202	4299	6501	SO:0001583	missense	0			AB065762	CCDS31696.1	11q24.1	2012-08-09			ENSG00000196099	ENSG00000196099		"""GPCR / Class A : Olfactory receptors"""	14711	protein-coding gene	gene with protein product							Standard	NM_001005325		Approved		uc010rzz.2	Q8NGM8	OTTHUMG00000166012	ENST00000309154.2:c.47C>A	11.37:g.123677011G>T	ENSP00000311038:p.Pro16Gln		B2RNK0|Q6IEW9|Q96R37	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.P16Q	ENST00000309154.2	37	c.47	CCDS31696.1	11	.	.	.	.	.	.	.	.	.	.	G	8.885	0.952619	0.18431	.	.	ENSG00000196099	ENST00000309154	T	0.00502	6.95	3.57	3.57	0.40892	.	0.000000	0.33075	U	0.005312	T	0.00552	0.0018	L	0.52266	1.64	0.28279	N	0.924066	P	0.46784	0.884	B	0.43155	0.41	T	0.49818	-0.8899	10	0.87932	D	0	.	8.8778	0.35356	0.0:0.2304:0.7696:0.0	.	16	Q8NGM8	OR6M1_HUMAN	Q	16	ENSP00000311038:P16Q	ENSP00000311038:P16Q	P	-	2	0	OR6M1	123182221	0.033000	0.19621	0.387000	0.26183	0.045000	0.14185	2.128000	0.42045	1.806000	0.52798	0.637000	0.83480	CCA	OR6M1	-	NULL	ENSG00000196099		0.433	OR6M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6M1	HGNC	protein_coding	OTTHUMT00000387437.1		0.00	14	0	G	NM_001005325		123677011	-1			no_errors	ENST00000309154	ensembl	human	known	74_37	missense	11.76	15	2	SNP	0.947	T
ORAI3	93129	genome.wustl.edu	37	16	30964759	30964759	+	Missense_Mutation	SNP	T	T	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr16:30964759T>A	ENST00000318663.4	+	2	706	c.482T>A	c.(481-483)cTc>cAc	p.L161H	AC135048.13_ENST00000566056.1_RNA|ORAI3_ENST00000566237.1_Missense_Mutation_p.L161H|ORAI3_ENST00000562699.1_Intron	NM_152288.2	NP_689501.1	Q9BRQ5	ORAI3_HUMAN	ORAI calcium release-activated calcium modulator 3	161					store-operated calcium entry (GO:0002115)	integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)	6						GGCACCTTTCTCTTCCTTGCT	0.607											OREG0023742	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													134.0	148.0	144.0					16																	30964759		2197	4300	6497	SO:0001583	missense	0			BC006126	CCDS10697.1	16p11.2	2007-08-14	2007-08-14	2007-08-14	ENSG00000175938	ENSG00000175938		"""ORAI calcium release-activated calcium modulators"""	28185	protein-coding gene	gene with protein product		610930	"""transmembrane protein 142C"""	TMEM142C		16582901	Standard	NM_152288		Approved	MGC13024	uc002eac.3	Q9BRQ5	OTTHUMG00000132409	ENST00000318663.4:c.482T>A	16.37:g.30964759T>A	ENSP00000322249:p.Leu161His	821	Q96BI8	Missense_Mutation	SNP	pfam_CRAC_channel	p.L161H	ENST00000318663.4	37	c.482	CCDS10697.1	16	.	.	.	.	.	.	.	.	.	.	T	25.7	4.664991	0.88251	.	.	ENSG00000175938	ENST00000318663;ENST00000420438	T	0.55052	0.54	5.74	5.74	0.90152	.	0.000000	0.51477	D	0.000082	T	0.72503	0.3468	M	0.73430	2.235	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.76099	-0.3083	10	0.87932	D	0	-13.5276	15.0151	0.71578	0.0:0.0:0.0:1.0	.	161	Q9BRQ5	ORAI3_HUMAN	H	161	ENSP00000322249:L161H	ENSP00000322249:L161H	L	+	2	0	ORAI3	30872260	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.040000	0.89188	2.196000	0.70406	0.528000	0.53228	CTC	ORAI3	-	pfam_CRAC_channel	ENSG00000175938		0.607	ORAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ORAI3	HGNC	protein_coding	OTTHUMT00000255545.20	-	0.00	33	0	T	NM_152288		30964759	+1	tier1	-	no_errors	ENST00000318663	ensembl	human	known	74_37	missense	10.87	41	5	SNP	1.000	A
PADI3	51702	genome.wustl.edu	37	1	17592157	17592157	+	Missense_Mutation	SNP	T	T	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr1:17592157T>C	ENST00000375460.3	+	4	390	c.350T>C	c.(349-351)aTc>aCc	p.I117T		NM_016233.2	NP_057317.2	Q9ULW8	PADI3_HUMAN	peptidyl arginine deiminase, type III	117					protein citrullination (GO:0018101)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|liver(2)|lung(10)|ovary(2)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;1.17e-05)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	CTTGCAGACATCTCTCTGGAT	0.562																																																	0													173.0	154.0	161.0					1																	17592157		2203	4300	6503	SO:0001583	missense	0			AB026831	CCDS179.1	1p36.13	2008-02-05			ENSG00000142619	ENSG00000142619	3.5.3.15	"""Peptidyl arginine deiminases"""	18337	protein-coding gene	gene with protein product		606755				11069618	Standard	NM_016233		Approved	PDI3	uc001bai.3	Q9ULW8	OTTHUMG00000002373	ENST00000375460.3:c.350T>C	1.37:g.17592157T>C	ENSP00000364609:p.Ile117Thr		Q58EY7|Q70SX5	Missense_Mutation	SNP	pfam_PAD_C,pfam_Prot_Arg_deaminase_cen_dom,pfam_PAD_N,superfamily_Prot_Arg_deaminase_cen_dom,superfamily_Cupredoxin,pirsf_Protein-arginine_deiminase_sub	p.I117T	ENST00000375460.3	37	c.350	CCDS179.1	1	.	.	.	.	.	.	.	.	.	.	T	16.98	3.272174	0.59649	.	.	ENSG00000142619	ENST00000375460	T	0.26660	1.72	5.4	5.4	0.78164	Protein-arginine deiminase (PAD), central domain (2);	0.107337	0.64402	D	0.000008	T	0.53351	0.1791	M	0.86502	2.82	0.46222	D	0.998931	D	0.61697	0.99	P	0.62491	0.903	T	0.61700	-0.7009	10	0.62326	D	0.03	-21.3772	14.2564	0.66055	0.0:0.0:0.0:1.0	.	117	Q9ULW8	PADI3_HUMAN	T	117	ENSP00000364609:I117T	ENSP00000364609:I117T	I	+	2	0	PADI3	17464744	1.000000	0.71417	0.641000	0.29422	0.465000	0.32709	5.589000	0.67523	2.044000	0.60594	0.533000	0.62120	ATC	PADI3	-	pfam_Prot_Arg_deaminase_cen_dom,superfamily_Prot_Arg_deaminase_cen_dom,pirsf_Protein-arginine_deiminase_sub	ENSG00000142619		0.562	PADI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PADI3	HGNC	protein_coding	OTTHUMT00000006805.1	-	0.00	49	0	T			17592157	+1	tier1	-	no_errors	ENST00000375460	ensembl	human	known	74_37	missense	33.33	38	19	SNP	1.000	C
PANK3	79646	genome.wustl.edu	37	5	167988433	167988433	+	Missense_Mutation	SNP	T	T	A	rs77612793	byFrequency	TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr5:167988433T>A	ENST00000239231.6	-	5	1217	c.901A>T	c.(901-903)Att>Ttt	p.I301F	PANK3_ENST00000520504.1_5'UTR|MIR103A1_ENST00000362165.1_RNA	NM_024594.3	NP_078870.1	Q9H999	PANK3_HUMAN	pantothenate kinase 3	301					coenzyme A biosynthetic process (GO:0015937)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)	p.I301F(2)		NS(1)|cervix(2)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	Renal(175;0.000159)|Lung NSC(126;0.0441)|all_lung(126;0.0909)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0989)|OV - Ovarian serous cystadenocarcinoma(192;0.147)|Epithelial(171;0.188)		ACAGAACCAATGTTATTGGTG	0.333													T|||	528	0.105431	0.0484	0.1138	5008	,	,		18239	0.1369		0.1392	False		,,,				2504	0.1094																2	Substitution - Missense(2)	NS(1)|skin(1)											63.0	64.0	64.0					5																	167988433		2203	4300	6503	SO:0001583	missense	0			AK022961	CCDS4368.1	5q35.1	2008-02-05			ENSG00000120137	ENSG00000120137			19365	protein-coding gene	gene with protein product		606161				11479594	Standard	NM_024594		Approved	FLJ12899	uc003lzz.2	Q9H999	OTTHUMG00000130410	ENST00000239231.6:c.901A>T	5.37:g.167988433T>A	ENSP00000239231:p.Ile301Phe		D3DQL1|Q53FJ9|Q7RTX4	Missense_Mutation	SNP	pfam_Type_II_PanK,tigrfam_Type_II_PanK	p.I301F	ENST00000239231.6	37	c.901	CCDS4368.1	5	.	.	.	.	.	.	.	.	.	.	T	27.3	4.819248	0.90873	.	.	ENSG00000120137	ENST00000239231	D	0.99769	-6.7	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	D	0.99846	0.9929	H	0.95950	3.745	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	D	0.96634	0.9469	10	0.87932	D	0	-14.7534	13.8724	0.63626	0.0:0.0:0.0:1.0	.	301	Q9H999	PANK3_HUMAN	F	301	ENSP00000239231:I301F	ENSP00000239231:I301F	I	-	1	0	PANK3	167921011	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.308000	0.72820	1.870000	0.54199	0.454000	0.30748	ATT	PANK3	-	pfam_Type_II_PanK,tigrfam_Type_II_PanK	ENSG00000120137		0.333	PANK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PANK3	HGNC	protein_coding	OTTHUMT00000252793.2	-	0.00	52	0	T	NM_024594		167988433	-1	tier1	rs77612793	no_errors	ENST00000239231	ensembl	human	known	74_37	missense	10.96	65	8	SNP	1.000	A
PAPPA2	60676	genome.wustl.edu	37	1	176564298	176564298	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr1:176564298C>T	ENST00000367662.3	+	3	2722	c.1558C>T	c.(1558-1560)Cgg>Tgg	p.R520W	PAPPA2_ENST00000367661.3_Missense_Mutation_p.R520W	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	520	Metalloprotease.				bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R520G(2)		NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						CTGGCCCCTTCGGGGAGAGAA	0.537																																																	2	Substitution - Missense(2)	lung(2)											51.0	52.0	51.0					1																	176564298		2003	4172	6175	SO:0001583	missense	0			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.1558C>T	1.37:g.176564298C>T	ENSP00000356634:p.Arg520Trp		A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	pfam_Notch_dom,pfam_Sushi_SCR_CCP,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.R520W	ENST00000367662.3	37	c.1558	CCDS41438.1	1	.	.	.	.	.	.	.	.	.	.	C	12.27	1.886360	0.33348	.	.	ENSG00000116183	ENST00000367662;ENST00000367661	T;T	0.58506	0.33;0.33	5.24	4.24	0.50183	.	0.325968	0.32785	N	0.005642	T	0.70640	0.3247	M	0.68952	2.095	0.36330	D	0.858822	D;D	0.89917	1.0;1.0	D;D	0.76071	0.987;0.948	T	0.77419	-0.2595	10	0.87932	D	0	-14.6877	9.8148	0.40846	0.1505:0.7702:0.0:0.0793	.	520;520	Q9BXP8;A9Z1Y8	PAPP2_HUMAN;.	W	520	ENSP00000356634:R520W;ENSP00000356633:R520W	ENSP00000356633:R520W	R	+	1	2	PAPPA2	174830921	0.967000	0.33354	0.684000	0.30055	0.067000	0.16453	2.019000	0.41001	2.439000	0.82584	0.650000	0.86243	CGG	PAPPA2	-	NULL	ENSG00000116183		0.537	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA2	HGNC	protein_coding	OTTHUMT00000084763.1		0.00	44	0	C			176564298	+1			no_errors	ENST00000367662	ensembl	human	known	74_37	missense	8.57	32	3	SNP	0.662	T
PARP3	10039	genome.wustl.edu	37	3	51982404	51982404	+	Missense_Mutation	SNP	G	G	A	rs368229941		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr3:51982404G>A	ENST00000417220.2	+	12	1998	c.1510G>A	c.(1510-1512)Gag>Aag	p.E504K	PARP3_ENST00000431474.1_Missense_Mutation_p.E504K|PARP3_ENST00000486510.1_3'UTR|PARP3_ENST00000398755.3_Missense_Mutation_p.E511K			Q9Y6F1	PARP3_HUMAN	poly (ADP-ribose) polymerase family, member 3	504	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|positive regulation of DNA ligation (GO:0051106)|protein ADP-ribosylation (GO:0006471)|protein localization to site of double-strand break (GO:1990166)|regulation of mitotic spindle organization (GO:0060236)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	catalytic activity (GO:0003824)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000541)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GCCCTGCCCAGAGTTCAGCAG	0.642																																																	0								G	LYS/GLU,LYS/GLU	4,4068		0,4,2032	64.0	65.0	65.0		1531,1510	-0.5	0.0	3		65	0,8386		0,0,4193	no	missense,missense	PARP3	NM_001003931.2,NM_005485.4	56,56	0,4,6225	AA,AG,GG		0.0,0.0982,0.0321	benign,benign	511/541,504/534	51982404	4,12454	2036	4193	6229	SO:0001583	missense	0			AF083068	CCDS43097.1, CCDS46839.1	3p22.2-p21.1	2010-07-14	2004-08-20	2004-08-26	ENSG00000041880	ENSG00000041880	2.4.2.30	"""Poly (ADP-ribose) polymerases"""	273	protein-coding gene	gene with protein product	"""poly(ADP-ribose) synthetase-3"", ""NAD+ ADP-ribosyltransferase 3"", ""poly(ADP-ribose) polymerase 3"""	607726	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 3"""	ADPRTL3		10329013	Standard	NM_001003931		Approved	ADPRT3, IRT1, hPARP-3, pADPRT-3	uc003dbz.3	Q9Y6F1	OTTHUMG00000156931	ENST00000417220.2:c.1510G>A	3.37:g.51982404G>A	ENSP00000395951:p.Glu504Lys		Q8NER9|Q96CG2|Q9UG81	Missense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfam_Poly(ADP-ribose)pol_reg_dom,pfam_WGR_domain,superfamily_Poly(ADP-ribose)pol_reg_dom,superfamily_WGR_domain,smart_WGR_domain,pfscan_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_reg_dom	p.E511K	ENST00000417220.2	37	c.1531	CCDS43097.1	3	.	.	.	.	.	.	.	.	.	.	G	0.041	-1.285456	0.01387	9.82E-4	0.0	ENSG00000041880	ENST00000417220;ENST00000431474;ENST00000398755	T;T;T	0.14022	2.54;2.54;2.54	4.78	-0.514	0.11958	Poly(ADP-ribose) polymerase, catalytic domain (2);	0.861304	0.10506	N	0.666777	T	0.03564	0.0102	N	0.03948	-0.315	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.40979	-0.9534	10	0.02654	T	1	-6.6145	1.2102	0.01903	0.3148:0.2659:0.2911:0.1282	.	511;504	Q9Y6F1-2;Q9Y6F1	.;PARP3_HUMAN	K	504;504;511	ENSP00000395951:E504K;ENSP00000401511:E504K;ENSP00000381740:E511K	ENSP00000381740:E511K	E	+	1	0	PARP3	51957444	0.000000	0.05858	0.006000	0.13384	0.149000	0.21700	-0.060000	0.11712	-0.182000	0.10602	0.561000	0.74099	GAG	PARP3	-	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom	ENSG00000041880		0.642	PARP3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PARP3	HGNC	protein_coding	OTTHUMT00000348612.2	-	0.00	39	0	G	NM_005485.4		51982404	+1	tier1	-	no_errors	ENST00000398755	ensembl	human	known	74_37	missense	13.56	51	8	SNP	0.000	A
PBX1	5087	genome.wustl.edu	37	1	164768988	164768988	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr1:164768988G>T	ENST00000420696.2	+	4	751	c.563G>T	c.(562-564)cGg>cTg	p.R188L	PBX1_ENST00000559240.1_Missense_Mutation_p.R188L|PBX1_ENST00000560641.1_Missense_Mutation_p.R83L|PBX1_ENST00000540246.1_Missense_Mutation_p.R83L|PBX1_ENST00000367897.1_Missense_Mutation_p.R188L|PBX1_ENST00000540236.1_Missense_Mutation_p.R188L|PBX1_ENST00000401534.1_Missense_Mutation_p.R188L	NM_001204961.1|NM_001204963.1|NM_002585.3	NP_001191890.1|NP_001191892.1|NP_002576.1	P40424	PBX1_HUMAN	pre-B-cell leukemia homeobox 1	188					adrenal gland development (GO:0030325)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic hemopoiesis (GO:0035162)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system development (GO:0048706)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|proximal/distal pattern formation (GO:0009954)|regulation of ossification (GO:0030278)|sex differentiation (GO:0007548)|spleen development (GO:0048536)|steroid biosynthetic process (GO:0006694)|thymus development (GO:0048538)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)		EWSR1/PBX1(3)	large_intestine(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	4						GAGCAAAGCCGGACCAGGCCC	0.567			T	"""TCF3, EWSR1"""	"""pre B-ALL, myoepithelioma"""																																			Dom	yes		1	1q23	5087	pre-B-cell leukemia transcription factor 1		"""L, M"""	0													95.0	82.0	86.0					1																	164768988		2203	4300	6503	SO:0001583	missense	0			M86546	CCDS1246.1, CCDS55654.1	1q23.3	2011-06-20	2007-01-30		ENSG00000185630	ENSG00000185630		"""Homeoboxes / TALE class"""	8632	protein-coding gene	gene with protein product		176310	"""pre-B-cell leukemia transcription factor 1"""				Standard	NM_002585		Approved		uc001gct.3	P40424	OTTHUMG00000034307	ENST00000420696.2:c.563G>T	1.37:g.164768988G>T	ENSP00000405890:p.Arg188Leu		B4DSC1|F5H4U9|Q5T488	Missense_Mutation	SNP	pfam_PBX,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.R188L	ENST00000420696.2	37	c.563	CCDS1246.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.525358	0.96431	.	.	ENSG00000185630	ENST00000420696;ENST00000367897;ENST00000540236;ENST00000401534;ENST00000540246	T;T;T;T;T	0.35973	1.28;1.28;1.28;1.28;1.28	5.76	5.76	0.90799	PBX (1);	0.000000	0.85682	D	0.000000	T	0.60894	0.2304	M	0.85299	2.745	0.80722	D	1	P;D;D;D;D	0.69078	0.887;0.989;0.973;0.997;0.978	P;D;P;D;P	0.74348	0.73;0.963;0.875;0.983;0.898	T	0.65010	-0.6272	10	0.62326	D	0.03	-13.2983	19.571	0.95419	0.0:0.0:1.0:0.0	.	83;188;188;188;188	B7Z774;A8K5V0;F5H4U9;P40424;Q53YC7	.;.;.;PBX1_HUMAN;.	L	188;188;188;188;83	ENSP00000405890:R188L;ENSP00000356872:R188L;ENSP00000439943:R188L;ENSP00000384856:R188L;ENSP00000440869:R83L	ENSP00000356872:R188L	R	+	2	0	PBX1	163035612	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.338000	0.96553	2.713000	0.92767	0.655000	0.94253	CGG	PBX1	-	pfam_PBX	ENSG00000185630		0.567	PBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PBX1	HGNC	protein_coding	OTTHUMT00000082864.4		0.00	27	0	G	NM_002585		164768988	+1			no_errors	ENST00000420696	ensembl	human	known	74_37	missense	6.25	30	2	SNP	1.000	T
PCDH11Y	83259	genome.wustl.edu	37	Y	4968285	4968285	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chrY:4968285C>A	ENST00000333703.4	+	5	3146	c.2633C>A	c.(2632-2634)cCa>cAa	p.P878Q	PCDH11Y_ENST00000215473.6_Missense_Mutation_p.P889Q|PCDH11Y_ENST00000362095.5_Missense_Mutation_p.P889Q	NM_001278619.1|NM_032971.2	NP_001265548.1|NP_116753.1	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked	889					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|kidney(2)|large_intestine(7)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						TGGGCTACCCCAAACCCAGAA	0.413																																																	0													39.0	36.0	36.0					Y																	4968285		616	1950	2566	SO:0001583	missense	0			AF332217	CCDS14776.1, CCDS14777.1, CCDS76066.1	Yp11.2	2010-01-26	2002-05-22	2002-05-24	ENSG00000099715	ENSG00000099715		"""Cadherins / Protocadherins : Non-clustered"""	15813	protein-coding gene	gene with protein product		400022	"""protocadherin 22"""	PCDH22		10644456, 11003707	Standard	NM_032971		Approved	PCDHY	uc004fqo.3	Q9BZA8	OTTHUMG00000035105	ENST00000333703.4:c.2633C>A	Y.37:g.4968285C>A	ENSP00000330552:p.Pro878Gln		Q70LR6|Q70LR8|Q70LS0|Q70LS1|Q70LS2|Q70LS3|Q70LS4|Q70LS5|Q8WY34|Q9BZA9|Q9H4E1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P889Q	ENST00000333703.4	37	c.2666	CCDS14776.1	Y																																																																																			PCDH11Y	-	pfam_Protocadherin	ENSG00000099715		0.413	PCDH11Y-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDH11Y	HGNC	protein_coding	OTTHUMT00000084979.2	-	0.00	19	0	C	NM_032973		4968285	+1	tier1	-	no_errors	ENST00000215473	ensembl	human	known	74_37	missense	24.24	25	8	SNP	1.000	A
PCNT	5116	genome.wustl.edu	37	21	47821471	47821471	+	Missense_Mutation	SNP	G	G	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr21:47821471G>C	ENST00000359568.5	+	26	4905	c.4798G>C	c.(4798-4800)Gag>Cag	p.E1600Q	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	1600					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					ATAGGATAAAGAGGTGTTAAA	0.448																																																	0													62.0	62.0	62.0					21																	47821471		2203	4300	6503	SO:0001583	missense	0			AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.4798G>C	21.37:g.47821471G>C	ENSP00000352572:p.Glu1600Gln		O43152|Q7Z7C9	Missense_Mutation	SNP	pfam_PACT_domain	p.E1600Q	ENST00000359568.5	37	c.4798	CCDS33592.1	21	.	.	.	.	.	.	.	.	.	.	G	14.00	2.403778	0.42613	.	.	ENSG00000160299	ENST00000359568	T	0.61158	0.13	5.64	5.64	0.86602	.	1.284110	0.05957	N	0.639867	T	0.78123	0.4234	M	0.65975	2.015	0.28112	N	0.930979	D;D	0.89917	1.0;1.0	D;D	0.71870	0.975;0.946	T	0.68021	-0.5519	10	0.66056	D	0.02	.	17.1775	0.86845	0.0:0.0:1.0:0.0	.	1482;1600	O95613-2;O95613	.;PCNT_HUMAN	Q	1600	ENSP00000352572:E1600Q	ENSP00000352572:E1600Q	E	+	1	0	PCNT	46645899	1.000000	0.71417	0.594000	0.28785	0.117000	0.20001	4.570000	0.60872	2.661000	0.90470	0.655000	0.94253	GAG	PCNT	-	NULL	ENSG00000160299		0.448	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNT	HGNC	protein_coding	OTTHUMT00000207336.1	-	0.00	25	0	G	NM_006031		47821471	+1	tier1	-	no_errors	ENST00000359568	ensembl	human	known	74_37	missense	21.21	26	7	SNP	1.000	C
PCSK5	5125	genome.wustl.edu	37	9	78973464	78973464	+	Missense_Mutation	SNP	G	G	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr9:78973464G>C	ENST00000545128.1	+	37	5747	c.5209G>C	c.(5209-5211)Gca>Cca	p.A1737P		NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	1737					anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						GGTTAGGCCTGCAACTGAGCA	0.483																																																	0													98.0	88.0	91.0					9																	78973464		876	1991	2867	SO:0001583	missense	0				CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.5209G>C	9.37:g.78973464G>C	ENSP00000446280:p.Ala1737Pro		F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	pfam_Peptidase_S8/S53_dom,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53_dom,superfamily_Galactose-bd-like,superfamily_Growth_fac_rcpt_N_dom,superfamily_Prot_inh_propept,smart_Furin_repeat,smart_EG-like_dom,prints_Peptidase_S8_subtilisin-rel	p.A1737P	ENST00000545128.1	37	c.5209	CCDS55320.1	9	.	.	.	.	.	.	.	.	.	.	G	10.25	1.298618	0.23650	.	.	ENSG00000099139	ENST00000545128;ENST00000376754;ENST00000424854	T;T	0.50548	0.74;1.59	5.88	1.13	0.20643	.	1.317020	0.04836	N	0.439602	T	0.43700	0.1259	L	0.46157	1.445	0.09310	N	1	.	.	.	.	.	.	T	0.38866	-0.9641	8	0.31617	T	0.26	-1.117	5.4114	0.16351	0.2235:0.3065:0.47:0.0	.	.	.	.	P	1737;1467;1437	ENSP00000446280:A1737P;ENSP00000411654:A1437P	ENSP00000365945:A1467P	A	+	1	0	PCSK5	78163284	0.000000	0.05858	0.010000	0.14722	0.021000	0.10359	0.152000	0.16302	0.797000	0.33971	0.555000	0.69702	GCA	PCSK5	-	NULL	ENSG00000099139		0.483	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK5	HGNC	protein_coding		-	0.00	48	0	G			78973464	+1	tier1	-	no_errors	ENST00000545128	ensembl	human	known	74_37	missense	9.76	74	8	SNP	0.000	C
PCSK6	5046	genome.wustl.edu	37	15	101971641	101971641	+	Silent	SNP	G	G	T	rs376291078		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr15:101971641G>T	ENST00000348070.1	-	5	537	c.538C>A	c.(538-540)Cgg>Agg	p.R180R	PCSK6_ENST00000398181.2_Silent_p.R180R|PCSK6_ENST00000561177.1_5'UTR|PCSK6_ENST00000344273.2_Silent_p.R180R|PCSK6_ENST00000331826.7_Silent_p.R15R|PCSK6_ENST00000358417.3_Silent_p.R180R	NM_002570.3|NM_138320.1	NP_002561.1|NP_612193.1	P29122	PCSK6_HUMAN	proprotein convertase subtilisin/kexin type 6	181					determination of left/right symmetry (GO:0007368)|glycoprotein metabolic process (GO:0009100)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|regulation of BMP signaling pathway (GO:0030510)|secretion by cell (GO:0032940)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|nerve growth factor binding (GO:0048406)|serine-type endopeptidase activity (GO:0004252)	p.R180W(3)|p.R15W(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			ATTTCCGACCGGCAGCGACTG	0.527																																																	4	Substitution - Missense(4)	lung(4)											62.0	63.0	63.0					15																	101971641		2079	4215	6294	SO:0001819	synonymous_variant	0				CCDS73789.1, CCDS73790.1, CCDS73791.1, CCDS73792.1, CCDS73793.1	15q26	2008-07-18	2004-06-14	2004-06-16		ENSG00000140479			8569	protein-coding gene	gene with protein product	"""subtilisin-like protease"", ""subtilisin-like proprotein convertase 4"", ""subtilisin/kexin-like protease PACE4"""	167405	"""paired basic amino acid cleaving system 4"""	PACE4		1741956	Standard	NM_002570		Approved	SPC4	uc002bwy.3	P29122		ENST00000348070.1:c.538C>A	15.37:g.101971641G>T			Q15099|Q15100|Q9UEG7|Q9UEJ1|Q9UEJ2|Q9UEJ7|Q9UEJ8|Q9UEJ9|Q9Y4G9|Q9Y4H0|Q9Y4H1	Silent	SNP	pfam_Peptidase_S8/S53_dom,pfam_PrprotnconvertsP,pfam_PLAC,superfamily_Peptidase_S8/S53_dom,superfamily_Galactose-bd-like,superfamily_Growth_fac_rcpt_N_dom,superfamily_Prot_inh_propept,smart_Furin_repeat,smart_EG-like_dom,pfscan_PLAC,prints_Peptidase_S8_subtilisin-rel	p.R180	ENST00000348070.1	37	c.538		15																																																																																			PCSK6	-	pfam_Peptidase_S8/S53_dom,superfamily_Peptidase_S8/S53_dom	ENSG00000140479		0.527	PCSK6-203	KNOWN	basic|appris_candidate_longest	protein_coding	PCSK6	HGNC	protein_coding		-	0.00	41	0	G	NM_002570		101971641	-1	tier1	-	no_errors	ENST00000348070	ensembl	human	known	74_37	silent	7.69	60	5	SNP	0.998	T
PCSK7	9159	genome.wustl.edu	37	11	117077812	117077812	+	Nonsense_Mutation	SNP	C	C	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr11:117077812C>T	ENST00000320934.3	-	15	2481	c.1851G>A	c.(1849-1851)tgG>tgA	p.W617*	PCSK7_ENST00000540028.1_3'UTR|PCSK7_ENST00000529458.1_Intron	NM_004716.2	NP_004707.2	Q16549	PCSK7_HUMAN	proprotein convertase subtilisin/kexin type 7	617					peptide hormone processing (GO:0016486)|protein processing (GO:0016485)	integral component of Golgi membrane (GO:0030173)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(3)|large_intestine(2)|lung(8)|ovary(1)|skin(1)	16	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.72e-06)|Epithelial(105;6.71e-05)|all cancers(92;0.000537)		CTACTGCACTCCACACAGAGC	0.622			T	IGH@	MLCLS																																			Dom	yes		11	11q23.3	9159	proprotein convertase subtilisin/kexin type 7		L	0													72.0	64.0	67.0					11																	117077812		2200	4274	6474	SO:0001587	stop_gained	0			U40623	CCDS8382.1	11q23-q24	2008-02-01			ENSG00000160613	ENSG00000160613			8748	protein-coding gene	gene with protein product		604872				8615762, 9820811	Standard	XM_006718938		Approved	PC7, PC8, LPC, SPC7	uc001pqr.3	Q16549	OTTHUMG00000165640	ENST00000320934.3:c.1851G>A	11.37:g.117077812C>T	ENSP00000325917:p.Trp617*		B0YJ60|Q3C1X1|Q53GM4|Q96FK8|Q9UL57	Nonsense_Mutation	SNP	pfam_Peptidase_S8/S53_dom,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53_dom,superfamily_Galactose-bd-like,superfamily_Prot_inh_propept,prints_Peptidase_S8_subtilisin-rel	p.W617*	ENST00000320934.3	37	c.1851	CCDS8382.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	44|44	10.859407|10.859407	0.99479|0.99479	.|.	.|.	ENSG00000160613|ENSG00000160613	ENST00000543900|ENST00000320934	.|.	.|.	.|.	5.01|5.01	5.01|5.01	0.66863|0.66863	.|.	.|0.377447	.|0.31347	.|N	.|0.007817	T|.	0.73931|.	0.3650|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.73930|.	-0.3827|.	5|.	0.48119|0.45353	T|T	0.1|0.12	-15.4137|-15.4137	17.0602|17.0602	0.86546|0.86546	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	K|X	569|617	.|.	ENSP00000445538:E569K|ENSP00000325917:W617X	E|W	-|-	1|3	0|0	PCSK7|PCSK7	116583022|116583022	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.923000|0.923000	0.55619|0.55619	4.276000|4.276000	0.58933|0.58933	2.599000|2.599000	0.87857|0.87857	0.643000|0.643000	0.83706|0.83706	GAG|TGG	PCSK7	-	superfamily_Galactose-bd-like	ENSG00000160613		0.622	PCSK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK7	HGNC	protein_coding	OTTHUMT00000385529.2		0.00	63	0	C	NM_004716		117077812	-1			no_errors	ENST00000320934	ensembl	human	known	74_37	nonsense	7.75	131	11	SNP	1.000	T
PDCD11	22984	genome.wustl.edu	37	10	105185131	105185131	+	Missense_Mutation	SNP	G	G	T	rs375454630		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr10:105185131G>T	ENST00000369797.3	+	20	3248	c.3154G>T	c.(3154-3156)Gtt>Ttt	p.V1052F		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	1052	S1 motif 9. {ECO:0000255|PROSITE- ProRule:PRU00180}.				mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		TACCCATGTGGTTGTGACTCT	0.512																																																	0													186.0	142.0	157.0					10																	105185131		2203	4300	6503	SO:0001583	missense	0			D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.3154G>T	10.37:g.105185131G>T	ENSP00000358812:p.Val1052Phe		Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Missense_Mutation	SNP	pfam_Rbsml_prot_S1_RNA-bd_dom,pfam_Suf,superfamily_NA-bd_OB-fold,smart_RNA-binding_domain_S1,smart_HAT,pfscan_TPR-contain_dom,pfscan_Rbsml_prot_S1_RNA-bd_dom,prints_Ribosomal_S1	p.V1052F	ENST00000369797.3	37	c.3154	CCDS31276.1	10	.	.	.	.	.	.	.	.	.	.	G	19.45	3.829716	0.71258	.	.	ENSG00000148843	ENST00000369797;ENST00000543503	T	0.32272	1.46	6.04	3.92	0.45320	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);RNA-binding domain, S1 (1);Ribosomal protein S1, RNA-binding domain (2);	0.342437	0.30118	N	0.010361	T	0.14098	0.0341	N	0.00859	-1.14	0.34095	D	0.661121	D	0.57571	0.98	P	0.56563	0.801	T	0.21586	-1.0241	10	0.46703	T	0.11	-10.2257	0.8224	0.01114	0.1757:0.2355:0.3485:0.2403	.	1052	Q14690	RRP5_HUMAN	F	1052	ENSP00000358812:V1052F	ENSP00000358812:V1052F	V	+	1	0	PDCD11	105175121	0.993000	0.37304	1.000000	0.80357	0.928000	0.56348	1.995000	0.40767	1.502000	0.48669	0.561000	0.74099	GTT	PDCD11	-	pfam_Rbsml_prot_S1_RNA-bd_dom,superfamily_NA-bd_OB-fold,smart_RNA-binding_domain_S1,pfscan_Rbsml_prot_S1_RNA-bd_dom	ENSG00000148843		0.512	PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDCD11	HGNC	protein_coding	OTTHUMT00000050151.1	-	0.00	41	0	G			105185131	+1	tier1	-	no_errors	ENST00000369797	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.972	T
PDE9A	5152	genome.wustl.edu	37	21	44195473	44195473	+	3'UTR	SNP	G	G	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr21:44195473G>C	ENST00000291539.6	+	0	1912				PDE9A_ENST00000398225.3_3'UTR|PDE9A_ENST00000470987.1_3'UTR|PDE9A_ENST00000380328.2_3'UTR|PDE9A_ENST00000398234.3_3'UTR|PDE9A_ENST00000335512.4_3'UTR|PDE9A_ENST00000328862.6_3'UTR|PDE9A_ENST00000398227.3_3'UTR|PDE9A_ENST00000335440.6_3'UTR|PDE9A_ENST00000398224.3_3'UTR|PDE9A_ENST00000398232.3_3'UTR|PDE9A_ENST00000539837.1_3'UTR|PDE9A_ENST00000398229.3_3'UTR|PDE9A_ENST00000398236.3_3'UTR|PDE9A_ENST00000349112.3_3'UTR	NM_002606.2	NP_002597.1	O76083	PDE9A_HUMAN	phosphodiesterase 9A						blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|metabolic process (GO:0008152)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|large_intestine(6)|lung(8)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	27					Caffeine(DB00201)	GTGCAGGGAAGAGCTGCCCTG	0.527																																																	0													27.0	36.0	33.0					21																	44195473		692	1591	2283	SO:0001624	3_prime_UTR_variant	0			AF048837	CCDS13690.1, CCDS33567.1, CCDS33568.1, CCDS33569.1, CCDS33570.1, CCDS33571.1, CCDS42941.1, CCDS42942.1, CCDS42943.1, CCDS42944.1, CCDS42945.1, CCDS42946.1, CCDS42947.1	21q22.3	2005-11-29			ENSG00000160191	ENSG00000160191	3.1.4.17	"""Phosphodiesterases"""	8795	protein-coding gene	gene with protein product		602973				9624146	Standard	NM_001001584		Approved		uc002zbm.3	O76083	OTTHUMG00000086825	ENST00000291539.6:c.*70G>C	21.37:g.44195473G>C			B2RBI5|B4DFI5|D3DSJ8|D3DSJ9|O75490|O75491|O95225|Q53Y40|Q5QD39|Q86SF7|Q86SI6|Q86SJ3|Q86WN3|Q86WN4|Q86WN5|Q86WN6|Q86WN7|Q86WN8|Q86WN9|Q86WP0	RNA	SNP	-	NULL	ENST00000291539.6	37	NULL	CCDS13690.1	21																																																																																			PDE9A	-	-	ENSG00000160191		0.527	PDE9A-016	KNOWN	basic|CCDS	protein_coding	PDE9A	HGNC	protein_coding	OTTHUMT00000195466.1	-	0.00	15	0	G			44195473	+1	tier1	-	no_errors	ENST00000460989	ensembl	human	known	74_37	rna	35.71	9	5	SNP	0.000	C
PDS5A	23244	genome.wustl.edu	37	4	39900405	39900405	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr4:39900405G>T	ENST00000303538.8	-	15	2161	c.1622C>A	c.(1621-1623)aCc>aAc	p.T541N	PDS5A_ENST00000503396.1_Missense_Mutation_p.T541N	NM_001100399.1	NP_001093869.1			PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae)											breast(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(9)|lung(14)|prostate(3)|skin(1)|urinary_tract(1)	39						ACTTGCTATGGTCATCAGTTT	0.328																																																	0													84.0	74.0	77.0					4																	39900405		1844	4087	5931	SO:0001583	missense	0			AF294791	CCDS47045.1, CCDS54759.1	4p14	2007-06-20			ENSG00000121892	ENSG00000121892			29088	protein-coding gene	gene with protein product		613200				11076961, 15855230	Standard	NM_001100399		Approved	KIAA0648, PIG54, SCC-112	uc003guv.4	Q29RF7	OTTHUMG00000160582	ENST00000303538.8:c.1622C>A	4.37:g.39900405G>T	ENSP00000303427:p.Thr541Asn			Missense_Mutation	SNP	superfamily_ARM-type_fold	p.T541N	ENST00000303538.8	37	c.1622	CCDS47045.1	4	.	.	.	.	.	.	.	.	.	.	G	11.22	1.574671	0.28092	.	.	ENSG00000121892	ENST00000303538;ENST00000503396	T	0.63913	-0.07	5.28	5.28	0.74379	Armadillo-type fold (1);	0.104917	0.64402	D	0.000005	T	0.45955	0.1368	N	0.12569	0.235	0.50039	D	0.999845	B;B	0.09022	0.001;0.002	B;B	0.10450	0.003;0.005	T	0.35450	-0.9788	9	.	.	.	-7.5844	18.9171	0.92510	0.0:0.0:1.0:0.0	.	541;541	Q29RF7-3;Q29RF7	.;PDS5A_HUMAN	N	541	ENSP00000303427:T541N	.	T	-	2	0	PDS5A	39576800	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.350000	0.59392	2.466000	0.83321	0.591000	0.81541	ACC	PDS5A	-	superfamily_ARM-type_fold	ENSG00000121892		0.328	PDS5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDS5A	HGNC	protein_coding	OTTHUMT00000361287.1		0.00	44	0	G	NM_015200		39900405	-1			no_errors	ENST00000303538	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	T
PEAR1	375033	genome.wustl.edu	37	1	156882694	156882694	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr1:156882694G>T	ENST00000338302.3	+	19	2567	c.2342G>T	c.(2341-2343)tGg>tTg	p.W781L	PEAR1_ENST00000292357.7_Missense_Mutation_p.W781L			Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	781					recognition of apoptotic cell (GO:0043654)	integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(6)|lung(22)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)	43	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TATCGGCACTGGCAAAAAGGC	0.602																																																	0													105.0	106.0	105.0					1																	156882694		2203	4300	6503	SO:0001583	missense	0			AK098809	CCDS30892.1	1q23.1	2008-02-05	2007-10-25	2007-10-25	ENSG00000187800	ENSG00000187800			33631	protein-coding gene	gene with protein product		610278	"""multiple EGF-like-domains 12"""	MEGF12		15851471	Standard	NM_001080471		Approved	JEDI, FLJ00193	uc001fqj.1	Q5VY43	OTTHUMG00000041293	ENST00000338302.3:c.2342G>T	1.37:g.156882694G>T	ENSP00000344465:p.Trp781Leu		Q8TEK2	Missense_Mutation	SNP	pfam_EGF_laminin,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF_laminin,pfscan_EG-like_dom,pfscan_EMI_domain	p.W781L	ENST00000338302.3	37	c.2342	CCDS30892.1	1	.	.	.	.	.	.	.	.	.	.	G	15.86	2.959136	0.53400	.	.	ENSG00000187800	ENST00000338302;ENST00000292357	D;D	0.88277	-2.36;-2.36	5.23	5.23	0.72850	.	0.000000	0.45126	D	0.000386	T	0.73682	0.3618	L	0.51422	1.61	0.36052	D	0.84083	B	0.06786	0.001	B	0.04013	0.001	T	0.63853	-0.6543	10	0.09843	T	0.71	.	9.6738	0.40028	0.0921:0.0:0.9079:0.0	.	781	Q5VY43	PEAR1_HUMAN	L	781	ENSP00000344465:W781L;ENSP00000292357:W781L	ENSP00000292357:W781L	W	+	2	0	PEAR1	155149318	1.000000	0.71417	0.997000	0.53966	0.967000	0.64934	8.305000	0.89960	2.717000	0.92951	0.563000	0.77884	TGG	PEAR1	-	NULL	ENSG00000187800		0.602	PEAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEAR1	HGNC	protein_coding	OTTHUMT00000098937.2	-	0.00	30	0	G	NM_001080471		156882694	+1	tier1	-	no_errors	ENST00000292357	ensembl	human	known	74_37	missense	8.70	42	4	SNP	0.999	T
PEG10	23089	genome.wustl.edu	37	7	94293534	94293534	+	Missense_Mutation	SNP	G	G	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr7:94293534G>C	ENST00000482108.1	+	2	1145	c.666G>C	c.(664-666)gaG>gaC	p.E222D	PEG10_ENST00000488574.1_Missense_Mutation_p.E222D	NM_001040152.1|NM_001172438.1|NM_001184962.1	NP_001035242.1|NP_001165909.1|NP_001171891.1	Q86TG7	PEG10_HUMAN	paternally expressed 10	222	Necessary for interaction with ALK1.				apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|placenta development (GO:0001890)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(9)|prostate(3)|skin(1)	21	all_cancers(62;8.26e-10)|all_epithelial(64;5.59e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			CCCACCTCGAGGTCGCCAAGT	0.617																																																	0																																										SO:0001583	missense	0			AB049834	CCDS55126.1, CCDS75636.1, CCDS75637.1	7q21	2007-12-07			ENSG00000242265	ENSG00000242265			14005	protein-coding gene	gene with protein product		609810				11318613, 15716091, 16093683	Standard	NM_001172437		Approved	KIAA1051, HB-1, MEF3L, RGAG3, Mar2, Mart2	uc011kie.2	Q86TG7	OTTHUMG00000155578	ENST00000482108.1:c.666G>C	7.37:g.94293534G>C	ENSP00000417587:p.Glu222Asp		Q96A68|Q9UPV1	Missense_Mutation	SNP	pfam_Retrotrans_gag_dom,superfamily_Znf_CCHC,pfscan_Znf_CCHC	p.E222D	ENST00000482108.1	37	c.666	CCDS55126.1	7	.	.	.	.	.	.	.	.	.	.	G	4.861	0.160071	0.09287	.	.	ENSG00000242265	ENST00000482108;ENST00000488574	T;T	0.10477	2.87;2.87	4.05	-4.63	0.03359	.	.	.	.	.	T	0.03871	0.0109	N	0.10809	0.05	0.09310	N	1	B;B	0.20671	0.047;0.047	B;B	0.17098	0.017;0.017	T	0.44667	-0.9313	9	0.02654	T	1	.	8.46	0.32923	0.2058:0.0:0.6688:0.1254	.	298;222	B4DSP0;Q86TG7	.;PEG10_HUMAN	D	222	ENSP00000417587:E222D;ENSP00000418944:E222D	ENSP00000417587:E222D	E	+	3	2	PEG10	94131470	0.299000	0.24426	0.003000	0.11579	0.657000	0.38888	-0.161000	0.10026	-0.941000	0.03700	0.555000	0.69702	GAG	PEG10	-	NULL	ENSG00000242265		0.617	PEG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG10	HGNC	protein_coding	OTTHUMT00000340751.1	-	0.00	26	0	G	NM_015068		94293534	+1	tier1	-	no_errors	ENST00000482108	ensembl	human	known	74_37	missense	18.60	35	8	SNP	0.028	C
PELP1	27043	genome.wustl.edu	37	17	4594211	4594211	+	Missense_Mutation	SNP	C	C	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr17:4594211C>G	ENST00000574876.1	-	3	409	c.392G>C	c.(391-393)tGg>tCg	p.W131S	PELP1_ENST00000436683.2_5'UTR|PELP1_ENST00000269230.7_Missense_Mutation_p.W131S|PELP1_ENST00000301396.4_Missense_Mutation_p.W131S|PELP1_ENST00000572293.1_Missense_Mutation_p.W181S|AC091153.4_ENST00000441700.2_RNA|PELP1_ENST00000570823.1_5'UTR			Q8IZL8	PELP1_HUMAN	proline, glutamate and leucine rich protein 1	131					cellular response to estrogen stimulus (GO:0071391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	15						GCTCCGAAGCCAAGACACACA	0.537																																																	0													72.0	72.0	72.0					17																	4594211		1992	4165	6157	SO:0001583	missense	0				CCDS58503.1, CCDS58503.2, CCDS62038.1	17p13.2	2012-05-02	2008-02-21			ENSG00000141456			30134	protein-coding gene	gene with protein product		609455	"""proline, glutamic acid and leucine rich protein 1"""			11481323, 12682072	Standard	NM_014389		Approved	MNAR	uc002fyi.4	Q8IZL8		ENST00000574876.1:c.392G>C	17.37:g.4594211C>G	ENSP00000461625:p.Trp131Ser		O15450|Q5EGN3|Q6NTE6|Q96FT1|Q9BU60	Missense_Mutation	SNP	pfam_Uncharacterised_NUC202,superfamily_ARM-type_fold	p.W131S	ENST00000574876.1	37	c.392	CCDS58503.1	17	.	.	.	.	.	.	.	.	.	.	C	13.91	2.377435	0.42105	.	.	ENSG00000141456	ENST00000301396;ENST00000269230	T;T	0.68331	-0.32;-0.16	5.04	5.04	0.67666	.	0.075738	0.56097	D	0.000023	T	0.70168	0.3193	L	0.34521	1.04	0.80722	D	1	P	0.52577	0.954	P	0.57057	0.812	T	0.73623	-0.3924	10	0.87932	D	0	-12.1646	15.9204	0.79562	0.0:1.0:0.0:0.0	.	131	Q8IZL8	PELP1_HUMAN	S	131	ENSP00000301396:W131S;ENSP00000269230:W131S	ENSP00000269230:W131S	W	-	2	0	AC091153.1	4540960	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.378000	0.73150	2.609000	0.88269	0.563000	0.77884	TGG	PELP1	-	superfamily_ARM-type_fold	ENSG00000141456		0.537	PELP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PELP1	HGNC	protein_coding	OTTHUMT00000439140.2	-	0.00	74	0	C	NM_014389		4594211	-1	tier1	-	no_errors	ENST00000301396	ensembl	human	known	74_37	missense	16.30	112	22	SNP	1.000	G
PHLDB2	90102	genome.wustl.edu	37	3	111604363	111604363	+	Intron	SNP	C	C	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr3:111604363C>G	ENST00000431670.2	+	2	1746				PHLDB2_ENST00000412622.1_Intron|PHLDB2_ENST00000393923.3_Intron|PHLDB2_ENST00000393925.3_Intron|PHLDB2_ENST00000478922.1_Nonsense_Mutation_p.S480*|PHLDB2_ENST00000477695.1_Intron|PHLDB2_ENST00000481953.1_Intron	NM_001134438.1	NP_001127910.1	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B, member 2							cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(8)|lung(23)|ovary(6)|skin(7)|stomach(1)	55						ATAGGATATTCATGTTCACTA	0.433																																																	0																																										SO:0001627	intron_variant	0				CCDS2962.1, CCDS46885.1, CCDS46886.1	3q13.13	2013-01-10			ENSG00000144824	ENSG00000144824		"""Pleckstrin homology (PH) domain containing"""	29573	protein-coding gene	gene with protein product		610298				12376540	Standard	NM_145753		Approved	LL5beta, FLJ21791, LL5b	uc003dyg.3	Q86SQ0	OTTHUMG00000159282	ENST00000431670.2:c.1335+104C>G	3.37:g.111604363C>G			A5PKZ3|Q59EA8|Q68CY3|Q6NT98|Q8N8U8|Q8NAB1|Q8NCU5	Nonsense_Mutation	SNP	NULL	p.S480*	ENST00000431670.2	37	c.1439	CCDS46886.1	3	.	.	.	.	.	.	.	.	.	.	C	21.1	4.092155	0.76756	.	.	ENSG00000144824	ENST00000478922	.	.	.	5.05	3.26	0.37387	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.8924	0.29686	0.0:0.8103:0.0:0.1897	.	.	.	.	X	480	.	.	S	+	2	0	PHLDB2	113087053	0.005000	0.15991	0.001000	0.08648	0.001000	0.01503	2.128000	0.42045	0.661000	0.30985	-0.136000	0.14681	TCA	PHLDB2	-	NULL	ENSG00000144824		0.433	PHLDB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB2	HGNC	protein_coding	OTTHUMT00000354337.1	-	0.00	35	0	C	NM_145753		111604363	+1	tier1	-	no_errors	ENST00000478922	ensembl	human	putative	74_37	nonsense	18.18	45	10	SNP	0.001	G
PIPOX	51268	genome.wustl.edu	37	17	27382229	27382229	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr17:27382229G>T	ENST00000323372.4	+	6	1282	c.956G>T	c.(955-957)tGc>tTc	p.C319F	PIPOX_ENST00000583215.1_3'UTR	NM_016518.2	NP_057602.2	Q9P0Z9	SOX_HUMAN	pipecolic acid oxidase	319					L-lysine catabolic process to acetyl-CoA via L-pipecolate (GO:0033514)|oxidation-reduction process (GO:0055114)|tetrahydrofolate metabolic process (GO:0046653)	peroxisome (GO:0005777)	L-pipecolate oxidase activity (GO:0050031)|receptor binding (GO:0005102)|sarcosine oxidase activity (GO:0008115)			endometrium(2)|large_intestine(4)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	10	Lung NSC(42;0.015)		Epithelial(11;9.87e-06)|BRCA - Breast invasive adenocarcinoma(11;3.92e-05)|all cancers(11;5.59e-05)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)		Glycine(DB00145)	ATTGAGAGCTGCATGTACACG	0.577																																																	0													134.0	117.0	123.0					17																	27382229		2203	4300	6503	SO:0001583	missense	0			AF134593	CCDS11248.1	17p13.2	2008-07-18			ENSG00000179761	ENSG00000179761			17804	protein-coding gene	gene with protein product	"""L-pipecolic acid oxidase"""					10772957, 10642506	Standard	NM_016518		Approved	LPIPOX	uc002hdr.1	Q9P0Z9	OTTHUMG00000132679	ENST00000323372.4:c.956G>T	17.37:g.27382229G>T	ENSP00000317721:p.Cys319Phe		B3KNH0|Q96H28|Q9C070	Missense_Mutation	SNP	pfam_FAD-dep_OxRdtase,tigrfam_SoxA_mon	p.C319F	ENST00000323372.4	37	c.956	CCDS11248.1	17	.	.	.	.	.	.	.	.	.	.	G	21.6	4.173260	0.78452	.	.	ENSG00000179761	ENST00000323372	D	0.83837	-1.77	5.87	5.87	0.94306	FAD dependent oxidoreductase (1);	0.000000	0.85682	D	0.000000	D	0.94618	0.8265	H	0.96748	3.875	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95806	0.8837	10	0.87932	D	0	-3.2856	18.9818	0.92757	0.0:0.0:1.0:0.0	.	319	Q9P0Z9	SOX_HUMAN	F	319	ENSP00000317721:C319F	ENSP00000317721:C319F	C	+	2	0	PIPOX	24406355	1.000000	0.71417	0.998000	0.56505	0.726000	0.41606	8.287000	0.89918	2.780000	0.95670	0.563000	0.77884	TGC	PIPOX	-	pfam_FAD-dep_OxRdtase,tigrfam_SoxA_mon	ENSG00000179761		0.577	PIPOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIPOX	HGNC	protein_coding	OTTHUMT00000255954.1	-	0.00	34	0	G	NM_016518		27382229	+1	tier1	-	no_errors	ENST00000323372	ensembl	human	known	74_37	missense	9.30	39	4	SNP	1.000	T
PITPNM2	57605	genome.wustl.edu	37	12	123489971	123489971	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr12:123489971C>A	ENST00000542749.1	-	5	831	c.768G>T	c.(766-768)aaG>aaT	p.K256N	PITPNM2_ENST00000320201.4_Missense_Mutation_p.K256N|PITPNM2_ENST00000546049.1_Missense_Mutation_p.K256N|PITPNM2_ENST00000392428.1_Intron|PITPNM2_ENST00000451868.2_5'UTR|PITPNM2_ENST00000280562.5_Missense_Mutation_p.K256N			Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein, membrane-associated 2	256					metabolic process (GO:0008152)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)			NS(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	39	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		ACTGGGCCATCTTACGGGAAA	0.627																																																	0													181.0	144.0	156.0					12																	123489971		2203	4300	6503	SO:0001583	missense	0			AF334585	CCDS9242.1, CCDS73543.1	12q24.31	2008-02-05				ENSG00000090975			21044	protein-coding gene	gene with protein product		608920				10022914	Standard	XM_005253582		Approved	RDGBA2, RDGB2, NIR3	uc001uej.1	Q9BZ72		ENST00000542749.1:c.768G>T	12.37:g.123489971C>A	ENSP00000437611:p.Lys256Asn		Q9P271	Missense_Mutation	SNP	pfam_PI_transfer,pfam_DDHD,pfam_LNS2,superfamily_HAD-like_dom,smart_LNS2,pfscan_DDHD,prints_PI_transfer	p.K256N	ENST00000542749.1	37	c.768	CCDS9242.1	12	.	.	.	.	.	.	.	.	.	.	C	19.87	3.907481	0.72868	.	.	ENSG00000090975	ENST00000280562;ENST00000320201;ENST00000542749	T;T;T	0.47177	0.85;0.85;0.85	4.72	3.81	0.43845	START-like domain (1);	0.000000	0.85682	D	0.000000	T	0.66499	0.2795	M	0.81497	2.545	0.80722	D	1	D;D;D	0.89917	0.996;0.999;1.0	D;D;D	0.85130	0.954;0.993;0.997	T	0.68519	-0.5387	10	0.72032	D	0.01	-36.5299	8.8199	0.35018	0.0:0.8247:0.0:0.1753	.	256;256;256	A5D8U3;Q9BZ72-2;Q9BZ72	.;.;PITM2_HUMAN	N	256	ENSP00000280562:K256N;ENSP00000322218:K256N;ENSP00000437611:K256N	ENSP00000280562:K256N	K	-	3	2	PITPNM2	122055924	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.496000	0.35638	1.084000	0.41184	0.561000	0.74099	AAG	PITPNM2	-	NULL	ENSG00000090975		0.627	PITPNM2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	PITPNM2	HGNC	protein_coding	OTTHUMT00000401342.1	-	0.00	39	0	C	NM_020845		123489971	-1	tier1	-	no_errors	ENST00000320201	ensembl	human	known	74_37	missense	18.33	49	11	SNP	1.000	A
PLCG2	5336	genome.wustl.edu	37	16	81965160	81965160	+	Missense_Mutation	SNP	G	G	T	rs547100313		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr16:81965160G>T	ENST00000359376.3	+	25	2854	c.2640G>T	c.(2638-2640)caG>caT	p.Q880H		NM_002661.3	NP_002652.2	P16885	PLCG2_HUMAN	phospholipase C, gamma 2 (phosphatidylinositol-specific)	880				Q -> E (in Ref. 1; AAA60112/CAA32194 and 3; AAQ76815). {ECO:0000305}.	B cell differentiation (GO:0030183)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid catabolic process (GO:0009395)|platelet activation (GO:0030168)|release of sequestered calcium ion into cytosol (GO:0051209)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(18)|lung(21)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	58						AGCCCAAGCAGCAGGGCGATC	0.512													G|||	1	0.000199681	0.0	0.0	5008	,	,		21108	0.0		0.001	False		,,,				2504	0.0																0													76.0	82.0	80.0					16																	81965160		1910	4119	6029	SO:0001583	missense	0				CCDS42204.1	16q24.1	2014-09-17				ENSG00000197943	3.1.4.11	"""SH2 domain containing"""	9066	protein-coding gene	gene with protein product		600220				7835906	Standard	XR_248240		Approved		uc002fgt.3	P16885		ENST00000359376.3:c.2640G>T	16.37:g.81965160G>T	ENSP00000352336:p.Gln880His		D3DUL3|Q3ZTS2|Q59H45|Q969T5	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_SH2,pfam_PLipase_C_Pinositol-sp_Y,pfam_SH3_domain,pfam_C2_dom,pfam_PLipase_C_EF-hand-like,pfam_SH3_2,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_SH2,smart_SH3_domain,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pirsf_PLC-gamma,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C,prints_SH2,prints_SH3_domain	p.Q880H	ENST00000359376.3	37	c.2640	CCDS42204.1	16	.	.	.	.	.	.	.	.	.	.	G	12.38	1.921106	0.33908	.	.	ENSG00000197943	ENST00000359376	T	0.52295	0.67	5.54	2.33	0.28932	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (1);Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.227351	0.52532	D	0.000063	T	0.23410	0.0566	N	0.14661	0.345	0.09310	N	0.999999	B	0.06786	0.001	B	0.01281	0.0	T	0.06899	-1.0801	10	0.48119	T	0.1	.	1.401	0.02270	0.233:0.1163:0.4168:0.234	.	880	P16885	PLCG2_HUMAN	H	880	ENSP00000352336:Q880H	ENSP00000352336:Q880H	Q	+	3	2	PLCG2	80522661	0.981000	0.34729	1.000000	0.80357	0.982000	0.71751	0.668000	0.25127	1.293000	0.44690	0.655000	0.94253	CAG	PLCG2	-	superfamily_PLC-like_Pdiesterase_TIM-brl,smart_Pleckstrin_homology,pirsf_PLC-gamma	ENSG00000197943		0.512	PLCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCG2	HGNC	protein_coding	OTTHUMT00000432429.1	-	0.00	46	0	G			81965160	+1	tier1	-	no_errors	ENST00000359376	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.957	T
PLEC	5339	genome.wustl.edu	37	8	144995480	144995480	+	Missense_Mutation	SNP	C	C	T	rs199661077		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr8:144995480C>T	ENST00000322810.4	-	32	9089	c.8920G>A	c.(8920-8922)Gag>Aag	p.E2974K	PLEC_ENST00000356346.3_Missense_Mutation_p.E2823K|PLEC_ENST00000398774.2_Missense_Mutation_p.E2805K|PLEC_ENST00000527096.1_Missense_Mutation_p.E2860K|PLEC_ENST00000354589.3_Missense_Mutation_p.E2837K|PLEC_ENST00000357649.2_Missense_Mutation_p.E2841K|PLEC_ENST00000354958.2_Missense_Mutation_p.E2815K|PLEC_ENST00000436759.2_Missense_Mutation_p.E2864K|PLEC_ENST00000345136.3_Missense_Mutation_p.E2837K	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2974	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						TTCATCTCCTCGTCGAAGTAG	0.677													C|||	1	0.000199681	0.0	0.0	5008	,	,		18695	0.0		0.001	False		,,,				2504	0.0																0								C	LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU	0,4034		0,0,2017	65.0	73.0	70.0		8590,8467,8443,8920,8413,8509,8521,8509	3.1	1.0	8		70	21,8313		0,21,4146	no	missense,missense,missense,missense,missense,missense,missense,missense	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	56,56,56,56,56,56,56,56	0,21,6163	TT,TC,CC		0.252,0.0,0.1698	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	2864/4575,2823/4534,2815/4526,2974/4685,2805/4516,2837/4548,2841/4552,2837/4548	144995480	21,12347	2017	4167	6184	SO:0001583	missense	0			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.8920G>A	8.37:g.144995480C>T	ENSP00000323856:p.Glu2974Lys		Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	pfam_Plectin_repeat,pfam_CH-domain,pfam_S10_plectin_N,superfamily_CH-domain,superfamily_Chorismate_mutase_type_II,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,pfscan_CH-domain	p.E2974K	ENST00000322810.4	37	c.8920	CCDS43772.1	8	.	.	.	.	.	.	.	.	.	.	C	12.96	2.093481	0.36952	0.0	0.00252	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.74002	-0.8;-0.8;-0.8;-0.8;-0.8;-0.8;-0.8;-0.8;-0.8	4.95	3.09	0.35607	.	0.570097	0.14600	U	0.309709	T	0.64023	0.2561	L	0.52573	1.65	0.31525	N	0.661857	B;B;B;B;B;B;B;B	0.21309	0.025;0.025;0.025;0.054;0.025;0.025;0.025;0.025	B;B;B;B;B;B;B;B	0.16722	0.009;0.009;0.009;0.016;0.009;0.009;0.009;0.009	T	0.57888	-0.7733	10	0.16896	T	0.51	.	7.905	0.29757	0.0:0.7147:0.1337:0.1515	.	2864;2823;2815;2974;2805;2837;2841;2837	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	K	2837;2841;2837;2805;2974;2815;2823;2864;2860	ENSP00000344848:E2837K;ENSP00000350277:E2841K;ENSP00000346602:E2837K;ENSP00000381756:E2805K;ENSP00000323856:E2974K;ENSP00000347044:E2815K;ENSP00000348702:E2823K;ENSP00000388180:E2864K;ENSP00000434583:E2860K	ENSP00000323856:E2974K	E	-	1	0	PLEC	145067468	0.897000	0.30589	0.998000	0.56505	0.771000	0.43674	0.635000	0.24629	0.581000	0.29539	0.456000	0.33151	GAG	PLEC	-	pfam_Plectin_repeat,smart_Plectin_repeat	ENSG00000178209		0.677	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEC	HGNC	protein_coding	OTTHUMT00000383281.1	-	0.00	30	0	C	NM_000445		144995480	-1	tier1	rs199661077	no_errors	ENST00000322810	ensembl	human	known	74_37	missense	8.70	84	8	SNP	1.000	T
PODXL2	50512	genome.wustl.edu	37	3	127387367	127387367	+	Silent	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr3:127387367G>T	ENST00000342480.6	+	5	1329	c.1290G>T	c.(1288-1290)ggG>ggT	p.G430G		NM_015720.2	NP_056535.1	Q9NZ53	PDXL2_HUMAN	podocalyxin-like 2	430					leukocyte tethering or rolling (GO:0050901)	integral component of plasma membrane (GO:0005887)	glycosaminoglycan binding (GO:0005539)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	26						GCCACCATGGGGCCTGGCACA	0.657																																																	0													18.0	16.0	17.0					3																	127387367		2203	4297	6500	SO:0001819	synonymous_variant	0			AF219137	CCDS3044.1	3q21.3	2005-02-18			ENSG00000114631	ENSG00000114631			17936	protein-coding gene	gene with protein product	"""endoglycan"""					10722749	Standard	NM_015720		Approved	PODLX2, endoglycan	uc003ejq.3	Q9NZ53	OTTHUMG00000159642	ENST00000342480.6:c.1290G>T	3.37:g.127387367G>T			Q6UVY4|Q8WUV6	Silent	SNP	pfam_CD34/Podocalyxin	p.G430	ENST00000342480.6	37	c.1290	CCDS3044.1	3																																																																																			PODXL2	-	pfam_CD34/Podocalyxin	ENSG00000114631		0.657	PODXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PODXL2	HGNC	protein_coding	OTTHUMT00000356638.1		0.00	22	0	G	NM_015720		127387367	+1			no_errors	ENST00000342480	ensembl	human	known	74_37	silent	12.20	36	5	SNP	0.998	T
PLSCR5	389158	genome.wustl.edu	37	3	146311842	146311842	+	Missense_Mutation	SNP	G	G	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr3:146311842G>C	ENST00000443512.1	-	4	1321	c.318C>G	c.(316-318)atC>atG	p.I106M	PLSCR5_ENST00000492200.1_Missense_Mutation_p.I106M|PLSCR5_ENST00000482567.1_Missense_Mutation_p.I94M	NM_001085420.1	NP_001078889.1	A0PG75	PLS5_HUMAN	phospholipid scramblase family, member 5	106										endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|urinary_tract(1)	12						GATTGAAGCAGATGCTTTCCT	0.423																																																	0													138.0	136.0	137.0					3																	146311842		1913	4129	6042	SO:0001583	missense	0			AY436642	CCDS46931.1	3q24	2004-06-28			ENSG00000231213	ENSG00000231213			19952	protein-coding gene	gene with protein product							Standard	NM_001085420		Approved		uc010hvc.3	A0PG75	OTTHUMG00000159437	ENST00000443512.1:c.318C>G	3.37:g.146311842G>C	ENSP00000390111:p.Ile106Met		B2RXK5	Missense_Mutation	SNP	pfam_Scramblase,superfamily_Tubby_C-like	p.I106M	ENST00000443512.1	37	c.318	CCDS46931.1	3	.	.	.	.	.	.	.	.	.	.	G	13.72	2.319927	0.41096	.	.	ENSG00000231213	ENST00000492200;ENST00000482567;ENST00000443512	T;T;T	0.21734	1.99;1.99;1.99	5.69	2.91	0.33838	Tubby, C-terminal (1);	.	.	.	.	T	0.15132	0.0365	L	0.29908	0.895	0.25815	N	0.984354	P;P	0.39022	0.655;0.454	B;B	0.40782	0.34;0.285	T	0.21518	-1.0243	9	0.87932	D	0	-15.6785	2.4553	0.04528	0.2008:0.2318:0.4483:0.1191	.	94;106	B2RXK5;A0PG75	.;PLS5_HUMAN	M	106;94;106	ENSP00000417184:I106M;ENSP00000418626:I94M;ENSP00000390111:I106M	ENSP00000390111:I106M	I	-	3	3	PLSCR5	147794532	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	2.466000	0.45084	0.328000	0.23435	0.650000	0.86243	ATC	PLSCR5	-	pfam_Scramblase,superfamily_Tubby_C-like	ENSG00000231213		0.423	PLSCR5-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	PLSCR5	HGNC	protein_coding	OTTHUMT00000355365.1		0.00	27	0	G	XM_371670		146311842	-1			no_errors	ENST00000443512	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	C
POLH	5429	genome.wustl.edu	37	6	43582040	43582040	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr6:43582040G>A	ENST00000372236.4	+	11	2183	c.1888G>A	c.(1888-1890)Gag>Aag	p.E630K	POLH_ENST00000535400.1_Missense_Mutation_p.E568K|POLH_ENST00000372226.1_3'UTR	NM_006502.2	NP_006493.1	O75417	DPOLQ_HUMAN	polymerase (DNA directed), eta	1215					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			breast(4)|endometrium(5)|kidney(1)|large_intestine(6)|lung(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	21	all_cancers(18;1.89e-05)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000753)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0826)|OV - Ovarian serous cystadenocarcinoma(102;0.167)			TCTAGCTGCTGAGGACCAAGT	0.502								DNA polymerases (catalytic subunits)	Xeroderma Pigmentosum																																								0													116.0	118.0	117.0					6																	43582040		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	AB024313	CCDS4902.1	6p21	2014-09-17			ENSG00000170734	ENSG00000170734			9181	protein-coding gene	gene with protein product		603968				10385124, 10398605	Standard	NM_006502		Approved	RAD30A, XP-V	uc003ovq.4	Q9Y253	OTTHUMG00000014743	ENST00000372236.4:c.1888G>A	6.37:g.43582040G>A	ENSP00000361310:p.Glu630Lys		O95160|Q6VMB5	Missense_Mutation	SNP	pfam_DNA_repair_prot_UmuC-like,pfam_DNA_pol_Y-fam_little_finger,superfamily_DNA_pol_Y-fam_little_finger,pirsf_DNA_pol_eta,pfscan_DNA_repair_prot_UmuC-like_N	p.E630K	ENST00000372236.4	37	c.1888	CCDS4902.1	6	.	.	.	.	.	.	.	.	.	.	G	33	5.243191	0.95272	.	.	ENSG00000170734	ENST00000372236;ENST00000535400	T;T	0.63744	0.09;-0.06	5.58	5.58	0.84498	.	0.099613	0.64402	D	0.000002	T	0.73931	0.3650	M	0.74881	2.28	0.80722	D	1	D;D	0.76494	0.999;0.999	D;P	0.64144	0.922;0.895	T	0.74586	-0.3616	10	0.54805	T	0.06	-15.8155	18.1114	0.89537	0.0:0.0:1.0:0.0	.	568;630	B4DG64;Q9Y253	.;POLH_HUMAN	K	630;568	ENSP00000361310:E630K;ENSP00000442102:E568K	ENSP00000361310:E630K	E	+	1	0	POLH	43690018	1.000000	0.71417	0.997000	0.53966	0.951000	0.60555	9.168000	0.94781	2.778000	0.95560	0.655000	0.94253	GAG	POLH	-	pirsf_DNA_pol_eta	ENSG00000170734		0.502	POLH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLH	HGNC	protein_coding	OTTHUMT00000040666.1	-	0.00	59	0	G	NM_006502		43582040	+1	tier1	-	no_errors	ENST00000372236	ensembl	human	known	74_37	missense	5.49	155	9	SNP	1.000	A
POLQ	10721	genome.wustl.edu	37	3	121207908	121207908	+	Silent	SNP	T	T	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr3:121207908T>C	ENST00000264233.5	-	16	3998	c.3870A>G	c.(3868-3870)agA>agG	p.R1290R		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	1290					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		TTTCTTGTAGTCTAGAAATAT	0.333								DNA polymerases (catalytic subunits)																													Pancreas(152;907 1925 26081 31236 36904)												0													73.0	78.0	76.0					3																	121207908		2203	4300	6503	SO:0001819	synonymous_variant	0			AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.3870A>G	3.37:g.121207908T>C			O95160|Q6VMB5	Silent	SNP	pfam_DNA-dir_DNA_pol_A_palm_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_RNaseH-like_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_DNA-dir_DNA_pol_A_palm_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_DNA_polymerase_A	p.R1290	ENST00000264233.5	37	c.3870	CCDS33833.1	3																																																																																			POLQ	-	NULL	ENSG00000051341		0.333	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLQ	HGNC	protein_coding	OTTHUMT00000355097.1	-	0.00	21	0	T	NM_199420		121207908	-1	tier1	-	no_errors	ENST00000264233	ensembl	human	known	74_37	silent	15.62	27	5	SNP	0.000	C
PPP1R9A	55607	genome.wustl.edu	37	7	94919602	94919602	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr7:94919602C>T	ENST00000433881.1	+	16	3816	c.3284C>T	c.(3283-3285)gCt>gTt	p.A1095V	PPP1R9A_ENST00000433360.1_Missense_Mutation_p.A1371V|PPP1R9A_ENST00000424654.1_Missense_Mutation_p.A1250V|PPP1R9A_ENST00000289495.5_Missense_Mutation_p.A1293V|PPP1R9A_ENST00000456331.2_Missense_Mutation_p.A1250V|PPP1R9A_ENST00000340694.4_Missense_Mutation_p.A1095V			Q9ULJ8	NEB1_HUMAN	protein phosphatase 1, regulatory subunit 9A	1095					actin filament organization (GO:0007015)|calcium-mediated signaling (GO:0019722)|neuron projection development (GO:0031175)	cell junction (GO:0030054)|cortical actin cytoskeleton (GO:0030864)|dendritic spine (GO:0043197)|filopodium (GO:0030175)|growth cone (GO:0030426)|synapse (GO:0045202)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(11)|liver(2)|lung(22)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(8)|urinary_tract(5)	71	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		STAD - Stomach adenocarcinoma(171;0.0031)			GCCGAGGGTGCTGGTGAGCAG	0.468										HNSCC(28;0.073)																																							0													80.0	74.0	76.0					7																	94919602		2203	4300	6503	SO:0001583	missense	0			AB033048	CCDS34683.1, CCDS55127.1, CCDS55128.1	7q21.3	2013-01-10	2011-10-04		ENSG00000158528	ENSG00000158528		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Sterile alpha motif (SAM) domain containing"""	14946	protein-coding gene	gene with protein product		602468	"""protein phosphatase 1, regulatory (inhibitor) subunit 9A"""			10574462	Standard	NM_001166160		Approved	Neurabin-I, KIAA1222, FLJ20068	uc010lfj.3	Q9ULJ8	OTTHUMG00000155566	ENST00000433881.1:c.3284C>T	7.37:g.94919602C>T	ENSP00000398870:p.Ala1095Val		A1L494|B2RWQ1|E9PCA0|E9PCK6|E9PDX1|F8W7J9|O76059|Q9NXT2	Missense_Mutation	SNP	pfam_SAM_2,pfam_SAM_type1,pfam_PDZ,superfamily_PDZ,superfamily_SAM/pointed,superfamily_Smac_DIABLO-like,smart_PDZ,smart_SAM,pfscan_PDZ,pfscan_SAM	p.A1293V	ENST00000433881.1	37	c.3878	CCDS34683.1	7	.	.	.	.	.	.	.	.	.	.	C	13.86	2.361929	0.41801	.	.	ENSG00000158528	ENST00000433360;ENST00000340694;ENST00000424654;ENST00000433881;ENST00000289495;ENST00000456331	T;T;T;T;T;T	0.17370	2.34;2.43;2.33;2.43;2.28;2.33	4.87	0.791	0.18619	.	1.119980	0.06732	N	0.776792	T	0.09818	0.0241	N	0.14661	0.345	0.09310	N	1	B;B;B;B;B;B	0.19445	0.008;0.034;0.034;0.036;0.02;0.008	B;B;B;B;B;B	0.19148	0.006;0.015;0.024;0.016;0.006;0.006	T	0.37103	-0.9720	10	0.72032	D	0.01	.	3.125	0.06405	0.1468:0.5668:0.1336:0.1528	.	1087;1293;1371;1311;1250;1095	B7ZLX4;F8W7J9;E9PDX1;D6W5R0;E9PCK6;Q9ULJ8	.;.;.;.;.;NEB1_HUMAN	V	1371;1095;1250;1095;1293;1250	ENSP00000405514:A1371V;ENSP00000344524:A1095V;ENSP00000411342:A1250V;ENSP00000398870:A1095V;ENSP00000289495:A1293V;ENSP00000402893:A1250V	ENSP00000289495:A1293V	A	+	2	0	PPP1R9A	94757538	0.008000	0.16893	0.000000	0.03702	0.000000	0.00434	0.894000	0.28350	0.040000	0.15660	-0.140000	0.14226	GCT	PPP1R9A	-	NULL	ENSG00000158528		0.468	PPP1R9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R9A	HGNC	protein_coding	OTTHUMT00000340662.1		0.00	25	0	C	NM_001166160		94919602	+1			no_errors	ENST00000289495	ensembl	human	known	74_37	missense	10.53	34	4	SNP	0.001	T
PPP2R2A	5520	genome.wustl.edu	37	8	26220325	26220325	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr8:26220325G>A	ENST00000380737.3	+	7	1092	c.763G>A	c.(763-765)Gac>Aac	p.D255N	PPP2R2A_ENST00000315985.7_Missense_Mutation_p.D265N	NM_002717.3	NP_002708.1	P63151	2ABA_HUMAN	protein phosphatase 2, regulatory subunit B, alpha	255					G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)|response to morphine (GO:0043278)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			kidney(1)|large_intestine(2)|ovary(1)	4		all_cancers(63;0.086)|Ovarian(32;2.61e-05)|all_epithelial(46;0.0514)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.000754)|Epithelial(17;3.02e-15)|all cancers(2;1.52e-13)|OV - Ovarian serous cystadenocarcinoma(2;1.89e-10)|Colorectal(74;0.155)		TCGGCTATGTGACATGAGGGC	0.373																																																	0													84.0	77.0	79.0					8																	26220325		2203	4300	6503	SO:0001583	missense	0			M64929	CCDS34867.1, CCDS55213.1	8p21.2	2013-01-10	2010-04-14		ENSG00000221914	ENSG00000221914	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9304	protein-coding gene	gene with protein product	"""PP2A subunit B isoform alpha"""	604941	"""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, alpha isoform"""			1849734	Standard	NM_001177591		Approved	PR52A, PR55A, B55A		P63151	OTTHUMG00000163850	ENST00000380737.3:c.763G>A	8.37:g.26220325G>A	ENSP00000370113:p.Asp255Asn		B2RBU8|B4E1T7|P50409|Q00007	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_PP2A_PR55,prints_PP2A_PR55	p.D255N	ENST00000380737.3	37	c.763	CCDS34867.1	8	.	.	.	.	.	.	.	.	.	.	G	35	5.552278	0.96501	.	.	ENSG00000221914	ENST00000380737;ENST00000524169;ENST00000315985	T;T;T	0.76839	0.96;-1.05;0.96	5.67	5.67	0.87782	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	U	0.000000	D	0.91126	0.7206	M	0.91663	3.23	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.995	D;D;D	0.87578	0.991;0.998;0.966	D	0.92472	0.5986	10	0.87932	D	0	-10.5039	19.7612	0.96319	0.0:0.0:1.0:0.0	.	265;255;256	B4E1T7;P63151;Q6ZP32	.;2ABA_HUMAN;.	N	255;34;265	ENSP00000370113:D255N;ENSP00000430320:D34N;ENSP00000325074:D265N	ENSP00000325074:D265N	D	+	1	0	PPP2R2A	26276242	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.415000	0.97375	2.670000	0.90874	0.655000	0.94253	GAC	PPP2R2A	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_PP2A_PR55,prints_PP2A_PR55	ENSG00000221914		0.373	PPP2R2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R2A	HGNC	protein_coding	OTTHUMT00000375954.2	-	0.00	40	0	G	NM_002717		26220325	+1	tier1	-	no_errors	ENST00000380737	ensembl	human	known	74_37	missense	18.84	56	13	SNP	1.000	A
PPT2	9374	genome.wustl.edu	37	6	32122851	32122854	+	Frame_Shift_Del	DEL	GAGA	GAGA	-			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	GAGA	GAGA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr6:32122851_32122854delGAGA	ENST00000324816.6	+	3	796_799	c.228_231delGAGA	c.(226-231)gggagafs	p.GR76fs	PPT2-EGFL8_ENST00000422437.1_Frame_Shift_Del_p.GR76fs|PRRT1_ENST00000375150.2_5'Flank|PPT2_ENST00000395523.1_Frame_Shift_Del_p.GR76fs|PPT2_ENST00000375143.2_Frame_Shift_Del_p.GR76fs|PPT2_ENST00000445576.2_Frame_Shift_Del_p.GR76fs|PPT2_ENST00000493548.1_3'UTR|PPT2_ENST00000437001.2_Intron|PPT2_ENST00000361568.2_Frame_Shift_Del_p.GR82fs|PPT2-EGFL8_ENST00000453656.2_3'UTR|PRRT1_ENST00000375152.2_5'Flank|PPT2_ENST00000375137.2_Frame_Shift_Del_p.GR76fs			Q9UMR5	PPT2_HUMAN	palmitoyl-protein thioesterase 2	76					cellular protein modification process (GO:0006464)|macromolecule depalmitoylation (GO:0098734)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	palmitoyl hydrolase activity (GO:0098599)|palmitoyl-(protein) hydrolase activity (GO:0008474)|thiolester hydrolase activity (GO:0016790)			NS(1)|endometrium(2)|large_intestine(2)|lung(10)|prostate(1)|urinary_tract(1)	17						TCTTCGATGGGAGAGAGAGCTTGC	0.608																																																	0																																										SO:0001589	frameshift_variant	0			AF020543	CCDS4740.1, CCDS4742.1	6p21.3	2012-07-02			ENSG00000221988	ENSG00000221988	3.1.2.22		9326	protein-coding gene	gene with protein product		603298				9341199, 10051407	Standard	NM_138717		Approved		uc003nzw.3	Q9UMR5	OTTHUMG00000031257	ENST00000324816.6:c.228_231delGAGA	6.37:g.32122855_32122858delGAGA	ENSP00000320528:p.Gly76fs		A2ABC9|A2ABD1|A2ARM7|A2BFH7|A2BFH9|A2BFI2|A8K9L4|B0S868|G8JLE1|O14799|Q0P6K0|Q5JP13|Q5JP14|Q5JQF0|Q5SSX4|Q5SSX5|Q5SSX6|Q5STJ4|Q5STJ5|Q5STJ6|Q6FI80|Q99945	Frame_Shift_Del	DEL	pfam_Palm_thioest,prints_Palm_thioest	p.E84fs	ENST00000324816.6	37	c.246_249	CCDS4742.1	6																																																																																			PPT2	-	pfam_Palm_thioest	ENSG00000221988		0.608	PPT2-207	KNOWN	basic|appris_principal|CCDS	protein_coding	PPT2	HGNC	protein_coding	OTTHUMT00000076552.4		0.00	40	0	GAGA	NM_138717		32122854	+1	tier1		no_errors	ENST00000361568	ensembl	human	known	74_37	frame_shift_del	22.73	51	15	DEL	0.455:0.517:0.541:0.539	-
PRDM10	56980	genome.wustl.edu	37	11	129827739	129827739	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr11:129827739G>T	ENST00000360871.3	-	3	367	c.136C>A	c.(136-138)Cca>Aca	p.P46T	PRDM10_ENST00000528746.1_Missense_Mutation_p.P46T|PRDM10_ENST00000358825.5_Missense_Mutation_p.P46T	NM_199437.1	NP_955469.1	Q9NQV6	PRD10_HUMAN	PR domain containing 10	46				P -> S (in Ref. 6; AAI12935). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(2)|endometrium(6)|kidney(3)|large_intestine(14)|lung(15)|pancreas(2)|skin(1)|stomach(3)|urinary_tract(2)	48	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)		ACCTGCTGTGGGGGGCGAACC	0.547																																																	0													253.0	224.0	234.0					11																	129827739		2201	4297	6498	SO:0001583	missense	0			AF275817	CCDS8484.1, CCDS8485.1, CCDS44771.1, CCDS44772.1	11q24.3	2013-01-08			ENSG00000170325	ENSG00000170325		"""Zinc fingers, C2H2-type"""	13995	protein-coding gene	gene with protein product	"""PRDM zinc finger transcription factor"", ""PR-domain family member 7"", ""tristanin"""					12175877	Standard	NM_020228		Approved	KIAA1231, PFM7, MGC131802	uc001qfm.3	Q9NQV6	OTTHUMG00000165762	ENST00000360871.3:c.136C>A	11.37:g.129827739G>T	ENSP00000354118:p.Pro46Thr		B7ZL71|G3XAE5|J3KP23|Q17R90|Q2KHR4|Q863Z2|Q9NXI4|Q9ULI9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P46T	ENST00000360871.3	37	c.136	CCDS8484.1	11	.	.	.	.	.	.	.	.	.	.	G	14.53	2.564128	0.45694	.	.	ENSG00000170325	ENST00000358825;ENST00000360871;ENST00000528746;ENST00000527581;ENST00000531431	T;T;T;T;T	0.42900	3.01;3.02;3.03;0.98;0.96	5.76	4.75	0.60458	.	0.346744	0.32041	N	0.006673	T	0.21509	0.0518	N	0.08118	0	0.80722	D	1	B	0.19200	0.034	B	0.21708	0.036	T	0.09122	-1.0689	10	0.62326	D	0.03	-25.6168	5.5001	0.16825	0.1565:0.2124:0.6311:0.0	.	46	G3XAE5	.	T	46	ENSP00000351686:P46T;ENSP00000354118:P46T;ENSP00000431262:P46T;ENSP00000432093:P46T;ENSP00000436681:P46T	ENSP00000351686:P46T	P	-	1	0	PRDM10	129332949	0.996000	0.38824	0.969000	0.41365	0.922000	0.55478	2.440000	0.44855	2.728000	0.93425	0.655000	0.94253	CCA	PRDM10	-	NULL	ENSG00000170325		0.547	PRDM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM10	HGNC	protein_coding	OTTHUMT00000386076.1	-	0.00	55	0	G	NM_199437		129827739	-1	tier1	-	no_errors	ENST00000358825	ensembl	human	known	74_37	missense	6.82	82	6	SNP	0.846	T
PRDM15	63977	genome.wustl.edu	37	21	43287442	43287442	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr21:43287442G>A	ENST00000269844.3	-	5	696	c.586C>T	c.(586-588)Ccc>Tcc	p.P196S	PRDM15_ENST00000538201.1_Intron|PRDM15_ENST00000422911.1_Intron|PRDM15_ENST00000398548.1_Intron	NM_022115.3	NP_071398.3	P57071	PRD15_HUMAN	PR domain containing 15	196					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(3)|skin(2)|stomach(2)|urinary_tract(1)	43						AGGGCTGGGGGCAGATTTTCC	0.507																																																	0													97.0	101.0	99.0					21																	43287442		2203	4300	6503	SO:0001583	missense	0			AF276513	CCDS13676.1, CCDS42932.1, CCDS63370.1	21q22.3	2013-01-08	2002-07-31		ENSG00000141956	ENSG00000141956		"""Zinc fingers, C2H2-type"""	13999	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 83"""	ZNF298, C21orf83		12036297, 12036298	Standard	NM_022115		Approved		uc002yzq.1	P57071	OTTHUMG00000086781	ENST00000269844.3:c.586C>T	21.37:g.43287442G>A	ENSP00000269844:p.Pro196Ser		E9PDJ6|E9PF37|E9PGL3|Q4W8S0|Q4W8S3|Q4W8S4|Q4W8S5|Q8N0X3|Q8NEX0|Q9NQV3	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.P196S	ENST00000269844.3	37	c.586	CCDS13676.1	21	.	.	.	.	.	.	.	.	.	.	G	4.671	0.124737	0.08931	.	.	ENSG00000141956	ENST00000269844	T	0.10668	2.85	0.467	-0.895	0.10560	.	.	.	.	.	T	0.07548	0.0190	N	0.08118	0	0.09310	N	1	P	0.48350	0.909	P	0.50440	0.641	T	0.27468	-1.0073	8	0.87932	D	0	.	.	.	.	.	196	P57071	PRD15_HUMAN	S	196	ENSP00000269844:P196S	ENSP00000269844:P196S	P	-	1	0	PRDM15	42160511	0.002000	0.14202	0.002000	0.10522	0.008000	0.06430	-0.127000	0.10547	-0.460000	0.07003	-1.027000	0.02421	CCC	PRDM15	-	NULL	ENSG00000141956		0.507	PRDM15-201	KNOWN	basic|CCDS	protein_coding	PRDM15	HGNC	protein_coding		-	0.00	37	0	G	NM_022115		43287442	-1	tier1	-	no_errors	ENST00000269844	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.002	A
PRDM6	93166	genome.wustl.edu	37	5	122435621	122435621	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr5:122435621G>T	ENST00000407847.4	+	3	1279	c.865G>T	c.(865-867)Gca>Tca	p.A289S	PRDM6_ENST00000464424.1_3'UTR	NM_001136239.1	NP_001129711.1	Q9NQX0	PRDM6_HUMAN	PR domain containing 6	289	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				negative regulation of smooth muscle cell differentiation (GO:0051151)|negative regulation of transcription, DNA-templated (GO:0045892)|neurogenesis (GO:0022008)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	7						GAAGGTGCAGGCAGGCGCCGT	0.677																																																	0													18.0	20.0	20.0					5																	122435621		691	1591	2282	SO:0001583	missense	0			AF272898	CCDS47259.1	5q21-q23	2013-01-08			ENSG00000061455	ENSG00000061455		"""Zinc fingers, C2H2-type"""	9350	protein-coding gene	gene with protein product							Standard	NM_001136239		Approved		uc003kti.3	Q9NQX0	OTTHUMG00000150469	ENST00000407847.4:c.865G>T	5.37:g.122435621G>T	ENSP00000384725:p.Ala289Ser		B5MCJ4|Q9NQW9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_SET_dom,smart_SET_dom,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.A289S	ENST00000407847.4	37	c.865	CCDS47259.1	5	.	.	.	.	.	.	.	.	.	.	G	14.29	2.491911	0.44352	.	.	ENSG00000061455	ENST00000407847	T	0.72505	-0.66	5.91	3.12	0.35913	SET domain (3);	0.422973	0.25839	N	0.027967	T	0.50854	0.1640	N	0.14661	0.345	0.31300	N	0.688367	B	0.10296	0.003	B	0.12837	0.008	T	0.52631	-0.8550	10	0.49607	T	0.09	-7.3359	8.6695	0.34140	0.3617:0.0:0.6383:0.0	.	289	Q9NQX0	PRDM6_HUMAN	S	289	ENSP00000384725:A289S	ENSP00000384725:A289S	A	+	1	0	PRDM6	122463520	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.969000	0.29370	0.819000	0.34492	0.655000	0.94253	GCA	PRDM6	-	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	ENSG00000061455		0.677	PRDM6-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PRDM6	HGNC	protein_coding	OTTHUMT00000318226.2		0.00	25	0	G	XM_049619		122435621	+1			no_errors	ENST00000407847	ensembl	human	known	74_37	missense	10.53	34	4	SNP	0.988	T
PRKRA	8575	genome.wustl.edu	37	2	179296885	179296885	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr2:179296885G>T	ENST00000325748.4	-	8	1081	c.881C>A	c.(880-882)gCa>gAa	p.A294E	PRKRA_ENST00000432031.2_Missense_Mutation_p.A283E|PRKRA_ENST00000438687.3_Missense_Mutation_p.A181E|PRKRA_ENST00000487082.1_Missense_Mutation_p.A269E|AC009948.5_ENST00000436616.2_RNA|AC009948.5_ENST00000415236.1_RNA|AC009948.5_ENST00000450044.1_RNA|AC009948.5_ENST00000454488.1_RNA|AC009948.5_ENST00000453026.2_RNA|AC009948.5_ENST00000420672.1_RNA	NM_003690.4	NP_003681.1	O75569	PRKRA_HUMAN	protein kinase, interferon-inducible double stranded RNA dependent activator	294	DRBM 3. {ECO:0000255|PROSITE- ProRule:PRU00266}.|Sufficient for self-association and interaction with TARBP2.				cellular response to oxidative stress (GO:0034599)|gene expression (GO:0010467)|immune response (GO:0006955)|middle ear morphogenesis (GO:0042474)|negative regulation of cell proliferation (GO:0008285)|outer ear morphogenesis (GO:0042473)|positive regulation of catalytic activity (GO:0043085)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|production of siRNA involved in RNA interference (GO:0030422)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)|skeletal system morphogenesis (GO:0048705)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	enzyme activator activity (GO:0008047)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.A294G(1)		central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|skin(2)	19			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.00634)|all cancers(119;0.0265)			ATCACTTTGTGCATTGCCACA	0.418																																					Melanoma(200;68 3001 23825 48764)												1	Substitution - Missense(1)	lung(1)											140.0	126.0	131.0					2																	179296885		2203	4300	6503	SO:0001583	missense	0			AF072860	CCDS2279.1, CCDS46460.1, CCDS46461.1	2q31.2	2009-08-25			ENSG00000180228	ENSG00000180228			9438	protein-coding gene	gene with protein product	"""protein activator of the interferon-induced protein kinase"""	603424				9687506, 10336432	Standard	NM_003690		Approved	PACT, RAX, HSD14, DYT16	uc002umf.3	O75569	OTTHUMG00000132576	ENST00000325748.4:c.881C>A	2.37:g.179296885G>T	ENSP00000318176:p.Ala294Glu		A8K3I6|Q53G24|Q6X7T5|Q8NDK4	Missense_Mutation	SNP	pfam_dsRNA-bd_dom,smart_dsRNA-bd_dom,pfscan_dsRNA-bd_dom	p.A294E	ENST00000325748.4	37	c.881	CCDS2279.1	2	.	.	.	.	.	.	.	.	.	.	G	26.9	4.782233	0.90282	.	.	ENSG00000180228	ENST00000325748;ENST00000438687;ENST00000487082;ENST00000432031	D;D;D;D	0.95035	-3.59;-3.59;-3.59;-3.59	5.12	5.12	0.69794	Double-stranded RNA-binding (2);	0.000000	0.85682	D	0.000000	D	0.97238	0.9097	M	0.82517	2.595	0.58432	D	0.999998	D;D	0.67145	0.995;0.996	D;D	0.70016	0.921;0.967	D	0.97799	1.0243	10	0.66056	D	0.02	.	17.3325	0.87269	0.0:0.0:1.0:0.0	.	294;283	O75569;O75569-2	PRKRA_HUMAN;.	E	294;181;269;283	ENSP00000318176:A294E;ENSP00000398980:A181E;ENSP00000430604:A269E;ENSP00000393883:A283E	ENSP00000318176:A294E	A	-	2	0	PRKRA	179005131	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.606000	0.90888	2.402000	0.81655	0.467000	0.42956	GCA	PRKRA	-	smart_dsRNA-bd_dom,pfscan_dsRNA-bd_dom	ENSG00000180228		0.418	PRKRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKRA	HGNC	protein_coding	OTTHUMT00000255782.2	-	0.00	45	0	G	NM_003690		179296885	-1	tier1	-	no_errors	ENST00000325748	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	T
PRRT2	112476	genome.wustl.edu	37	16	29824421	29824421	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr16:29824421G>T	ENST00000358758.7	+	2	329	c.46G>T	c.(46-48)Gag>Tag	p.E16*	PRRT2_ENST00000567551.1_3'UTR|AC009133.20_ENST00000569039.1_RNA|AC009133.14_ENST00000569981.1_RNA|PRRT2_ENST00000567659.1_Nonsense_Mutation_p.E16*|PAGR1_ENST00000320330.6_5'Flank|PRRT2_ENST00000300797.6_Nonsense_Mutation_p.E16*	NM_001256442.1|NM_001256443.1|NM_145239.2	NP_001243371.1|NP_001243372.1|NP_660282.2	Q7Z6L0	PRRT2_HUMAN	proline-rich transmembrane protein 2	16					neuromuscular process controlling posture (GO:0050884)|response to biotic stimulus (GO:0009607)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	8						GGGGGTTGAGGAGAGTCCCAA	0.602																																																	0													50.0	53.0	52.0					16																	29824421		2197	4300	6497	SO:0001587	stop_gained	0			BC011405	CCDS10654.1, CCDS58445.1, CCDS58446.1	16p11.2	2014-02-03			ENSG00000167371	ENSG00000167371		"""Proline-rich transmembrane proteins"""	30500	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 1"""	614386	"""infantile convulsions and paroxysmal choreoathetosis"""	ICCA		22101681, 22243967	Standard	NM_145239		Approved	FLJ25513, DKFZp547J199, IFITMD1, FICCA	uc002dud.3	Q7Z6L0	OTTHUMG00000177142	ENST00000358758.7:c.46G>T	16.37:g.29824421G>T	ENSP00000351608:p.Glu16*		A8K8M8|Q8N2N8|Q8NAQ7|Q8ND36|Q96FA8	Nonsense_Mutation	SNP	pfam_CD225/Dispanin_fam	p.E16*	ENST00000358758.7	37	c.46	CCDS10654.1	16	.	.	.	.	.	.	.	.	.	.	G	18.14	3.556959	0.65425	.	.	ENSG00000167371	ENST00000358758;ENST00000300797	.	.	.	4.25	3.29	0.37713	.	0.543878	0.15817	N	0.243205	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-0.2356	7.7643	0.28970	0.1149:0.0:0.8851:0.0	.	.	.	.	X	16	.	ENSP00000300797:E16X	E	+	1	0	PRRT2	29731922	0.016000	0.18221	0.211000	0.23655	0.782000	0.44232	0.811000	0.27198	1.158000	0.42547	0.563000	0.77884	GAG	PRRT2	-	NULL	ENSG00000167371		0.602	PRRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRT2	HGNC	protein_coding	OTTHUMT00000255161.3	-	0.00	52	0	G	NM_145239		29824421	+1	tier1	-	no_errors	ENST00000567659	ensembl	human	known	74_37	nonsense	7.69	60	5	SNP	0.416	T
PRTG	283659	genome.wustl.edu	37	15	55912219	55912219	+	Frame_Shift_Del	DEL	G	G	-	rs370777308		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr15:55912219delG	ENST00000389286.4	-	20	3491	c.3444delC	c.(3442-3444)cccfs	p.P1148fs		NM_173814.4	NP_776175.2			protogenin											breast(1)|endometrium(6)|kidney(4)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		ATCAGAGGTTGGGGGGTGTGG	0.493																																																	0													64.0	64.0	64.0					15																	55912219		1926	4145	6071	SO:0001589	frameshift_variant	0			AK098622	CCDS42040.1	15q21.3	2013-02-11	2010-06-24		ENSG00000166450	ENSG00000166450		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26373	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 5"""	613261	"""protogenin homolog (Gallus gallus)"""				Standard	NM_173814		Approved	FLJ25756, IGDCC5	uc002adg.3	Q2VWP7		ENST00000389286.4:c.3444delC	15.37:g.55912219delG	ENSP00000373937:p.Pro1148fs			Frame_Shift_Del	DEL	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.N1149fs	ENST00000389286.4	37	c.3444	CCDS42040.1	15																																																																																			PRTG	-	NULL	ENSG00000166450		0.493	PRTG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRTG	HGNC	protein_coding	OTTHUMT00000419357.1		0.00	59	0	G	NM_173814		55912219	-1	tier1		no_errors	ENST00000389286	ensembl	human	known	74_37	frame_shift_del	16.25	67	13	DEL	0.181	-
PSD2	84249	genome.wustl.edu	37	5	139193041	139193041	+	Silent	SNP	C	C	T	rs529058855		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr5:139193041C>T	ENST00000274710.3	+	3	724	c.519C>T	c.(517-519)tgC>tgT	p.C173C		NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	173					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGACAGCTGCGTCAGCTTCG	0.647													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16366	0.0		0.0	False		,,,				2504	0.0																0													40.0	43.0	42.0					5																	139193041		2203	4300	6503	SO:0001819	synonymous_variant	0			AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.519C>T	5.37:g.139193041C>T			D3DQD3|Q8N3J8	Silent	SNP	pfam_Sec7_dom,pfam_Pleckstrin_homology,superfamily_Sec7_dom,smart_Sec7_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7_dom,prints_PH_dom-spectrin-type	p.C173	ENST00000274710.3	37	c.519	CCDS4216.1	5																																																																																			PSD2	-	NULL	ENSG00000146005		0.647	PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSD2	HGNC	protein_coding	OTTHUMT00000251339.1	-	0.00	45	0	C	NM_032289		139193041	+1	tier1	-	no_errors	ENST00000274710	ensembl	human	known	74_37	silent	14.81	46	8	SNP	0.704	T
PSIP1	11168	genome.wustl.edu	37	9	15472611	15472612	+	Intron	INS	-	-	A	rs113876575|rs201263257		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr9:15472611_15472612insA	ENST00000380733.4	-	10	1321				PSIP1_ENST00000380738.4_Intron|PSIP1_ENST00000380716.4_Intron|PSIP1_ENST00000380715.1_Intron|PSIP1_ENST00000397519.2_Intron			O75475	PSIP1_HUMAN	PC4 and SFRS1 interacting protein 1						establishment of integrated proviral latency (GO:0075713)|mRNA 5'-splice site recognition (GO:0000395)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to heat (GO:0009408)|response to oxidative stress (GO:0006979)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear heterochromatin (GO:0005720)|nuclear periphery (GO:0034399)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription coactivator activity (GO:0001105)|supercoiled DNA binding (GO:0097100)			breast(2)|endometrium(2)|kidney(1)|lung(3)|prostate(1)	9				GBM - Glioblastoma multiforme(50;2.38e-06)		CCAAAATTTAGAAAAAAAAAAA	0.342																																																	0																																										SO:0001627	intron_variant	0			AF098482	CCDS6479.1, CCDS6480.1	9p22.2	2008-02-05	2004-02-24		ENSG00000164985	ENSG00000164985			9527	protein-coding gene	gene with protein product		603620	"""PC4 and SFRS1 interacting protein 2"""	PSIP2		9822615, 9885563	Standard	NM_033222		Approved	p52, LEDGF, p75	uc003zlw.4	O75475	OTTHUMG00000021021	ENST00000380733.4:c.977+17->T	9.37:g.15472622_15472622dupA			D3DRI9|O00256|O95368|Q6P391|Q86YB9|Q9NZI3|Q9UER6	RNA	INS	-	NULL	ENST00000380733.4	37	NULL	CCDS6479.1	9																																																																																			PSIP1	-	-	ENSG00000164985		0.342	PSIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PSIP1	HGNC	protein_coding	OTTHUMT00000055445.1		0.00	20	0	-	NM_033222		15472612	-1	tier1		no_errors	ENST00000495873	ensembl	human	known	74_37	rna	17.50	33	7	INS	0.001:0.001	A
PSME2	5721	genome.wustl.edu	37	14	24612685	24612685	+	Missense_Mutation	SNP	T	T	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr14:24612685T>C	ENST00000216802.5	-	11	1292	c.653A>G	c.(652-654)cAt>cGt	p.H218R	EMC9_ENST00000216799.4_5'Flank|EMC9_ENST00000419198.2_5'Flank|PSME2_ENST00000471700.2_5'UTR|PSME2_ENST00000560410.1_Missense_Mutation_p.H207R|EMC9_ENST00000558200.1_5'Flank|EMC9_ENST00000560403.1_5'Flank	NM_002818.2	NP_002809.2	Q9UL46	PSME2_HUMAN	proteasome (prosome, macropain) activator subunit 2 (PA28 beta)	218					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome activator complex (GO:0008537)|proteasome complex (GO:0000502)				endometrium(1)|lung(3)|prostate(2)	6				GBM - Glioblastoma multiforme(265;0.00839)		GCTGATGATATGATAAAGCTC	0.483																																																	0													100.0	96.0	98.0					14																	24612685		2203	4300	6503	SO:0001583	missense	0				CCDS9614.1	14q11.2	2010-03-10			ENSG00000100911	ENSG00000100911		"""Proteasome (prosome, macropain) subunits"""	9569	protein-coding gene	gene with protein product		602161				7789512	Standard	NM_002818		Approved	PA28beta	uc001wmj.3	Q9UL46	OTTHUMG00000028797	ENST00000216802.5:c.653A>G	14.37:g.24612685T>C	ENSP00000216802:p.His218Arg		Q15129	Missense_Mutation	SNP	pfam_Proteasome_activ_pa28_C,pfam_Proteasome_activ_pa28_N,superfamily_Proteasome_activ_pa28	p.H218R	ENST00000216802.5	37	c.653	CCDS9614.1	14	.	.	.	.	.	.	.	.	.	.	T	22.1	4.250454	0.80024	.	.	ENSG00000100911	ENST00000216802	T	0.41758	0.99	5.15	5.15	0.70609	Proteasome activator pa28, REG beta subunit (2);	0.049688	0.85682	D	0.000000	T	0.48624	0.1510	L	0.36672	1.1	0.39509	D	0.968328	D	0.54601	0.967	P	0.58266	0.836	T	0.53725	-0.8398	10	0.87932	D	0	0.5674	11.6538	0.51306	0.0:0.0:0.0:1.0	.	218	Q9UL46	PSME2_HUMAN	R	218	ENSP00000216802:H218R	ENSP00000216802:H218R	H	-	2	0	PSME2	23682525	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	5.911000	0.69939	2.077000	0.62373	0.459000	0.35465	CAT	PSME2	-	pfam_Proteasome_activ_pa28_C,superfamily_Proteasome_activ_pa28	ENSG00000100911		0.483	PSME2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSME2	HGNC	protein_coding	OTTHUMT00000071918.3	-	0.00	51	0	T	NM_002818		24612685	-1	tier1	-	no_errors	ENST00000216802	ensembl	human	known	74_37	missense	14.47	65	11	SNP	1.000	C
PTPRA	5786	genome.wustl.edu	37	20	3005267	3005267	+	Splice_Site	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr20:3005267G>T	ENST00000216877.6	+	16	1987	c.1587G>T	c.(1585-1587)aaG>aaT	p.K529N	PTPRA_ENST00000425918.2_Splice_Site_p.K549N|PTPRA_ENST00000399903.2_Splice_Site_p.K538N|PTPRA_ENST00000356147.3_Splice_Site_p.K529N|PTPRA_ENST00000318266.5_Splice_Site_p.K529N|PTPRA_ENST00000358719.4_Splice_Site_p.K394N|PTPRA_ENST00000380393.3_Splice_Site_p.K538N	NM_080840.2	NP_543030.1	P18433	PTPRA_HUMAN	protein tyrosine phosphatase, receptor type, A	538					axon guidance (GO:0007411)|insulin receptor signaling pathway (GO:0008286)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein phosphorylation (GO:0006468)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						AGGAGTTTAAGGTGAGTTGGA	0.458																																																	0													104.0	105.0	105.0					20																	3005267		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS13038.1, CCDS13039.1	20p13	2011-06-09			ENSG00000132670	ENSG00000132670		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9664	protein-coding gene	gene with protein product		176884		PTPRL2, PTPA		2172030, 2169617	Standard	NM_080840		Approved	LRP, HLPR, HPTPA, RPTPA	uc002whn.3	P18433	OTTHUMG00000031718	ENST00000216877.6:c.1587+1G>T	20.37:g.3005267G>T			A8K2G8|D3DVX5|Q14513|Q7Z2I2|Q96TD9	Missense_Mutation	SNP	pirsf_Tyr_Pase_rcpt_a/e-type,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.K549N	ENST00000216877.6	37	c.1647	CCDS13039.1	20	.	.	.	.	.	.	.	.	.	.	G	22.5	4.301506	0.81136	.	.	ENSG00000132670	ENST00000380393;ENST00000216877;ENST00000399903;ENST00000358719;ENST00000542217;ENST00000425918;ENST00000318266;ENST00000356147	T;T;T;T;T;T;T	0.12361	2.69;2.69;2.69;2.69;2.69;2.69;2.69	5.8	4.66	0.58398	Protein-tyrosine phosphatase, receptor/non-receptor type (2);	0.000000	0.85682	U	0.000000	T	0.28067	0.0692	L	0.37630	1.12	0.80722	D	1	P;D;B	0.76494	0.629;0.999;0.188	B;D;B	0.77004	0.364;0.989;0.124	T	0.00956	-1.1501	10	0.87932	D	0	.	15.7488	0.77967	0.0756:0.0:0.9244:0.0	.	549;538;529	B7Z2A4;P18433;P18433-4	.;PTPRA_HUMAN;.	N	538;529;538;394;148;549;529;529	ENSP00000369756:K538N;ENSP00000216877:K529N;ENSP00000382787:K538N;ENSP00000351559:K394N;ENSP00000393553:K549N;ENSP00000314568:K529N;ENSP00000348468:K529N	ENSP00000216877:K529N	K	+	3	2	PTPRA	2953267	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	6.742000	0.74843	2.758000	0.94735	0.561000	0.74099	AAG	PTPRA	-	pirsf_Tyr_Pase_rcpt_a/e-type,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000132670		0.458	PTPRA-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PTPRA	HGNC	protein_coding	OTTHUMT00000077682.3		0.00	68	0	G		Missense_Mutation	3005267	+1			no_errors	ENST00000425918	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
PTPRD	5789	genome.wustl.edu	37	9	8507340	8507340	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr9:8507340G>T	ENST00000381196.4	-	19	2181	c.1638C>A	c.(1636-1638)aaC>aaA	p.N546K	PTPRD_ENST00000358503.5_Missense_Mutation_p.N533K|PTPRD_ENST00000355233.5_Missense_Mutation_p.N546K|PTPRD_ENST00000486161.1_Missense_Mutation_p.N546K|PTPRD_ENST00000397617.3_Missense_Mutation_p.N536K|PTPRD_ENST00000540109.1_Missense_Mutation_p.N546K|PTPRD_ENST00000356435.5_Missense_Mutation_p.N546K|PTPRD_ENST00000397606.3_Missense_Mutation_p.N536K|PTPRD_ENST00000397611.3_Missense_Mutation_p.N543K|PTPRD_ENST00000537002.1_Missense_Mutation_p.N543K|PTPRD_ENST00000360074.4_Missense_Mutation_p.N533K	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	546	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		CCAGTTCATAGTTGGCAATGG	0.433										TSP Lung(15;0.13)																																							0													216.0	190.0	199.0					9																	8507340		2203	4300	6503	SO:0001583	missense	0			X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.1638C>A	9.37:g.8507340G>T	ENSP00000370593:p.Asn546Lys		B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom,prints_Tyr_Pase_rcpt/non-rcpt	p.N546K	ENST00000381196.4	37	c.1638	CCDS43786.1	9	.	.	.	.	.	.	.	.	.	.	G	3.906	-0.021130	0.07634	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000355233;ENST00000397617;ENST00000397611;ENST00000537002;ENST00000346816;ENST00000540109;ENST00000486161;ENST00000397606	T;T;T;T;T;T;T;T;T;T;T	0.56103	0.48;0.48;0.48;0.48;0.48;0.48;0.48;0.48;0.48;0.48;0.48	6.06	6.06	0.98353	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.321942	0.42053	D	0.000763	T	0.32823	0.0842	N	0.02286	-0.61	0.41099	D	0.985656	B;B;B;B;B;B;B;B;B	0.22211	0.0;0.001;0.001;0.001;0.0;0.0;0.002;0.066;0.003	B;B;B;B;B;B;B;B;B	0.29440	0.004;0.006;0.01;0.021;0.001;0.003;0.007;0.102;0.033	T	0.27839	-1.0062	9	.	.	.	.	20.6397	0.99537	0.0:0.0:1.0:0.0	.	536;540;546;546;543;543;533;546;546	Q3KPJ2;Q3KPI9;Q3KPJ0;Q3KPJ1;F5GWT7;F5GWY7;G3XAE2;Q2HXI4;P23468	.;.;.;.;.;.;.;.;PTPRD_HUMAN	K	546;546;533;533;546;536;543;543;546;546;546;536	ENSP00000370593:N546K;ENSP00000348812:N546K;ENSP00000353187:N533K;ENSP00000351293:N533K;ENSP00000347373:N546K;ENSP00000380741:N536K;ENSP00000380735:N543K;ENSP00000440515:N543K;ENSP00000438164:N546K;ENSP00000417093:N546K;ENSP00000380731:N536K	.	N	-	3	2	PTPRD	8497340	1.000000	0.71417	0.998000	0.56505	0.582000	0.36321	3.399000	0.52586	2.880000	0.98712	0.650000	0.86243	AAC	PTPRD	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000153707		0.433	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRD	HGNC	protein_coding	OTTHUMT00000055395.3	-	0.00	72	0	G			8507340	-1	tier1	-	no_errors	ENST00000356435	ensembl	human	known	74_37	missense	5.15	92	5	SNP	1.000	T
PTPRJ	5795	genome.wustl.edu	37	11	48149344	48149344	+	Frame_Shift_Del	DEL	T	T	-			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr11:48149344delT	ENST00000418331.2	+	7	1458	c.1106delT	c.(1105-1107)gttfs	p.V369fs	PTPRJ_ENST00000440289.2_Frame_Shift_Del_p.V369fs	NM_002843.3	NP_002834.3	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	369	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				contact inhibition (GO:0060242)|heart development (GO:0007507)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of vascular permeability (GO:0043116)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of cell adhesion (GO:0045785)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion (GO:0030155)|vasculogenesis (GO:0001570)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|mitogen-activated protein kinase binding (GO:0051019)|phosphatase activity (GO:0016791)|platelet-derived growth factor receptor binding (GO:0005161)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|endometrium(7)|kidney(7)|large_intestine(5)|lung(15)|ovary(1)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						GCTATTCAGGTTTTTGACGTC	0.493																																																	0													94.0	85.0	88.0					11																	48149344		2201	4298	6499	SO:0001589	frameshift_variant	0			U10886	CCDS7945.1, CCDS44596.1	11p11.2	2013-02-11			ENSG00000149177	ENSG00000149177		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9673	protein-coding gene	gene with protein product		600925				7937872, 7994032	Standard	NM_001098503		Approved	DEP1, HPTPeta, CD148	uc001ngp.4	Q12913	OTTHUMG00000166573	ENST00000418331.2:c.1106delT	11.37:g.48149344delT	ENSP00000400010:p.Val369fs		Q15255|Q6P4H4|Q8NHM2|Q9UDA9	Frame_Shift_Del	DEL	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.F370fs	ENST00000418331.2	37	c.1106	CCDS7945.1	11																																																																																			PTPRJ	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000149177		0.493	PTPRJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRJ	HGNC	protein_coding	OTTHUMT00000390525.1		0.00	33	0	T			48149344	+1	tier1		no_errors	ENST00000418331	ensembl	human	known	74_37	frame_shift_del	5.13	37	2	DEL	0.051	-
RANBP9	10048	genome.wustl.edu	37	6	13632610	13632610	+	Frame_Shift_Del	DEL	T	T	-			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr6:13632610delT	ENST00000011619.3	-	12	1997	c.1939delA	c.(1939-1941)atgfs	p.M647fs	RANBP9_ENST00000539980.1_Frame_Shift_Del_p.M418fs|NOL7_ENST00000474485.1_Intron|RANBP9_ENST00000469916.1_5'UTR	NM_005493.2	NP_005484.2	Q96S59	RANB9_HUMAN	RAN binding protein 9	647	Interaction with FMR1.				axon guidance (GO:0007411)|microtubule nucleation (GO:0007020)|protein complex assembly (GO:0006461)	cytosol (GO:0005829)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|Ran GTPase binding (GO:0008536)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|skin(1)	16	Breast(50;0.00669)|Ovarian(93;0.0634)	all_hematologic(90;0.117)	Epithelial(50;0.223)			ACCTTCAACATTTTTTTGTTT	0.378																																																	0													147.0	140.0	143.0					6																	13632610		2203	4300	6503	SO:0001589	frameshift_variant	0			AB008515	CCDS4529.1	6p23	2010-05-25			ENSG00000010017	ENSG00000010017			13727	protein-coding gene	gene with protein product	"""Ran Binding Protein in the Microtubule organizing center"""	603854				9817760	Standard	NM_005493		Approved	RanBPM	uc003nbb.3	Q96S59	OTTHUMG00000015642	ENST00000011619.3:c.1939delA	6.37:g.13632610delT	ENSP00000011619:p.Met647fs		A0PJA2|B2R8E1|O94764|Q6P3T7|Q7LBR2|Q7Z7F9	Frame_Shift_Del	DEL	pfam_SPRY_rcpt,pfam_CTLH/CRA,pfam_LisH_dimerisation_subgr,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,smart_LisH_dimerisation,smart_CTLH_C,smart_CRA_dom,pfscan_B30.2/SPRY,pfscan_LisH_dimerisation,pfscan_CTLH_C	p.M647fs	ENST00000011619.3	37	c.1939	CCDS4529.1	6																																																																																			RANBP9	-	pfam_CTLH/CRA,smart_CRA_dom	ENSG00000010017		0.378	RANBP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RANBP9	HGNC	protein_coding	OTTHUMT00000042373.1		0.00	26	0	T			13632610	-1	tier1		no_errors	ENST00000011619	ensembl	human	known	74_37	frame_shift_del	10.71	25	3	DEL	1.000	-
RC3H1	149041	genome.wustl.edu	37	1	173933252	173933252	+	Missense_Mutation	SNP	C	C	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr1:173933252C>G	ENST00000367696.2	-	11	2041	c.1690G>C	c.(1690-1692)Gat>Cat	p.D564H	RC3H1_ENST00000367694.2_Missense_Mutation_p.D564H|RC3H1_ENST00000258349.4_Missense_Mutation_p.D564H			Q5TC82	RC3H1_HUMAN	ring finger and CCCH-type domains 1	564	Pro-rich.				B cell homeostasis (GO:0001782)|cytoplasmic mRNA processing body assembly (GO:0033962)|lymph node development (GO:0048535)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of germinal center formation (GO:0002635)|negative regulation of T-helper cell differentiation (GO:0045623)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|posttranscriptional regulation of gene expression (GO:0010608)|protein ubiquitination (GO:0016567)|regulation of germinal center formation (GO:0002634)|regulation of mRNA stability (GO:0043488)|regulation of T cell receptor signaling pathway (GO:0050856)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	50						GGAGGCAGATCTGCTGGCCCC	0.443																																																	0													119.0	116.0	117.0					1																	173933252		2203	4300	6503	SO:0001583	missense	0			AK093501	CCDS30940.1, CCDS72987.1	1q25.1	2013-01-18	2010-09-15		ENSG00000135870	ENSG00000135870		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	29434	protein-coding gene	gene with protein product	"""KIAA2025 protein"""	609424	"""ring finger and CCCH-type zinc finger domains 1"""			15917799	Standard	XM_005244918		Approved	KIAA2025, roquin, RP5-1198E17.5, RNF198	uc001gju.4	Q5TC82	OTTHUMG00000037275	ENST00000367696.2:c.1690G>C	1.37:g.173933252C>G	ENSP00000356669:p.Asp564His		B3KVK1|Q5W180|Q5W181|Q8IVE6|Q8N9V1	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_RING,smart_Znf_CCCH,pfscan_Znf_RING	p.D564H	ENST00000367696.2	37	c.1690	CCDS30940.1	1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.357352	0.82243	.	.	ENSG00000135870	ENST00000367696;ENST00000258349;ENST00000367694	T;T;T	0.47177	0.85;0.85;0.85	5.86	5.86	0.93980	.	0.325326	0.32190	N	0.006459	T	0.45955	0.1368	L	0.44542	1.39	0.80722	D	1	P;P;P;P	0.48764	0.862;0.862;0.915;0.862	B;B;P;B	0.50659	0.445;0.445;0.647;0.445	T	0.33803	-0.9854	10	0.49607	T	0.09	-5.3776	20.1859	0.98214	0.0:1.0:0.0:0.0	.	564;564;564;564	B9EGU6;B7ZMB3;Q5TC82-2;Q5TC82	.;.;.;RC3H1_HUMAN	H	564	ENSP00000356669:D564H;ENSP00000258349:D564H;ENSP00000356667:D564H	ENSP00000258349:D564H	D	-	1	0	RC3H1	172199875	1.000000	0.71417	0.997000	0.53966	0.981000	0.71138	5.486000	0.66856	2.777000	0.95525	0.591000	0.81541	GAT	RC3H1	-	NULL	ENSG00000135870		0.443	RC3H1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RC3H1	HGNC	protein_coding	OTTHUMT00000090733.2	-	0.00	68	0	C	NM_172071		173933252	-1	tier1	-	no_errors	ENST00000258349	ensembl	human	known	74_37	missense	20.14	111	28	SNP	1.000	G
RECK	8434	genome.wustl.edu	37	9	36083446	36083446	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr9:36083446C>A	ENST00000377966.3	+	8	1090	c.524C>A	c.(523-525)cCt>cAt	p.P175H	RECK_ENST00000479053.1_3'UTR	NM_021111.2	NP_066934.1	O95980	RECK_HUMAN	reversion-inducing-cysteine-rich protein with kazal motifs	175	5 X Knot repeats.				blood vessel maturation (GO:0001955)|embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)	anchored component of membrane (GO:0031225)|membrane (GO:0016020)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(7)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|pancreas(1)|skin(2)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)			GACTCTTCTCCTGGTCCATCT	0.398																																																	0													95.0	88.0	90.0					9																	36083446		2203	4300	6503	SO:0001583	missense	0			E13833	CCDS6597.1	9p13.3	2008-05-15			ENSG00000122707	ENSG00000122707			11345	protein-coding gene	gene with protein product		605227		ST15		9789069	Standard	NM_021111		Approved	hRECK	uc003zyv.3	O95980	OTTHUMG00000019898	ENST00000377966.3:c.524C>A	9.37:g.36083446C>A	ENSP00000367202:p.Pro175His		B2RNS1|Q5W0K6|Q8WX37	Missense_Mutation	SNP	pfam_Kazal_dom,superfamily_Prot_inh_PMP,smart_Kazal_dom	p.P175H	ENST00000377966.3	37	c.524	CCDS6597.1	9	.	.	.	.	.	.	.	.	.	.	C	28.8	4.955877	0.92726	.	.	ENSG00000122707	ENST00000377966	T	0.46819	0.86	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.57066	0.2028	N	0.24115	0.695	0.54753	D	0.999988	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.991	T	0.61417	-0.7067	10	0.87932	D	0	-14.9005	17.1032	0.86655	0.0:1.0:0.0:0.0	.	175;175;175;175	B2RCE6;A8K9D8;O95980;Q6P9E2	.;.;RECK_HUMAN;.	H	175	ENSP00000367202:P175H	ENSP00000367202:P175H	P	+	2	0	RECK	36073446	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.601000	0.82783	2.628000	0.89032	0.650000	0.86243	CCT	RECK	-	NULL	ENSG00000122707		0.398	RECK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RECK	HGNC	protein_coding	OTTHUMT00000052409.1		0.00	41	0	C			36083446	+1			no_errors	ENST00000377966	ensembl	human	known	74_37	missense	5.97	63	4	SNP	1.000	A
RELN	5649	genome.wustl.edu	37	7	103338500	103338500	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr7:103338500G>T	ENST00000428762.1	-	10	1102	c.943C>A	c.(943-945)Ctt>Att	p.L315I	RELN_ENST00000424685.2_Missense_Mutation_p.L315I|RELN_ENST00000343529.5_Missense_Mutation_p.L315I	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	315					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TCCTCAGGAAGGTAGAGGATA	0.448																																					NSCLC(146;835 1944 15585 22231 52158)												0													195.0	185.0	189.0					7																	103338500		2203	4300	6503	SO:0001583	missense	0				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.943C>A	7.37:g.103338500G>T	ENSP00000392423:p.Leu315Ile		A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	pfam_EGF_extracell,pfam_Reeler_dom,pfam_BNR_rpt,superfamily_Sialidases,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Reeler_dom	p.L315I	ENST00000428762.1	37	c.943	CCDS47680.1	7	.	.	.	.	.	.	.	.	.	.	g	26.9	4.782887	0.90282	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.38722	1.12;1.12;1.12	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.65575	0.2704	M	0.66939	2.045	0.58432	D	0.999999	D;D	0.71674	0.998;0.997	D;D	0.77557	0.99;0.978	T	0.60444	-0.7262	10	0.44086	T	0.13	.	20.6485	0.99592	0.0:0.0:1.0:0.0	.	315;315	P78509-2;P78509	.;RELN_HUMAN	I	315	ENSP00000392423:L315I;ENSP00000345694:L315I;ENSP00000388446:L315I	ENSP00000345694:L315I	L	-	1	0	RELN	103125736	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.218000	0.77991	2.891000	0.99171	0.651000	0.88453	CTT	RELN	-	NULL	ENSG00000189056		0.448	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	HGNC	protein_coding	OTTHUMT00000348148.1	-	0.00	38	0	G	NM_005045		103338500	-1	tier1	-	no_errors	ENST00000424685	ensembl	human	known	74_37	missense	15.69	43	8	SNP	1.000	T
RET	5979	genome.wustl.edu	37	10	43601870	43601870	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr10:43601870C>A	ENST00000355710.3	+	5	1146	c.914C>A	c.(913-915)cCt>cAt	p.P305H	RET_ENST00000340058.5_Missense_Mutation_p.P305H	NM_020975.4	NP_066124.1	P07949	RET_HUMAN	ret proto-oncogene	305					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to retinoic acid (GO:0071300)|embryonic epithelial tube formation (GO:0001838)|enteric nervous system development (GO:0048484)|homophilic cell adhesion (GO:0007156)|innervation (GO:0060384)|lymphocyte migration into lymphoid organs (GO:0097021)|MAPK cascade (GO:0000165)|membrane protein proteolysis (GO:0033619)|neural crest cell migration (GO:0001755)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch morphogenesis (GO:0061146)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration (GO:0030335)|positive regulation of cell size (GO:0045793)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior midgut development (GO:0007497)|protein phosphorylation (GO:0006468)|regulation of axonogenesis (GO:0050770)|regulation of cell adhesion (GO:0030155)|response to drug (GO:0042493)|response to pain (GO:0048265)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ureter maturation (GO:0035799)|ureteric bud development (GO:0001657)	endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		CCDC6/RET(4)|KIF5B/RET(79)	NS(2)|adrenal_gland(26)|breast(5)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|lung(27)|ovary(5)|prostate(3)|skin(1)|thyroid(504)|upper_aerodigestive_tract(1)|urinary_tract(1)	607		Ovarian(717;0.0423)			Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	GACGTGGTACCTGCATCAGGG	0.662		1	"""T, Mis, N, F"""	"""H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma"""	Hirschsprung disease		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma																												Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)		yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	10	10q11.2	5979	ret proto-oncogene	yes	"""E, O"""	0													59.0	45.0	50.0					10																	43601870		2203	4299	6502	SO:0001583	missense	0	Familial Cancer Database	MEN2B, Wagenmann-Froboese s.;MEN2A, Sipple disease, incl MEN2C;FMTC	BC004257	CCDS7200.1, CCDS53525.1	10q11.2	2014-09-17	2007-02-16		ENSG00000165731	ENSG00000165731		"""Cadherins / Cadherin-related"""	9967	protein-coding gene	gene with protein product	"""cadherin-related family member 16"""	164761	"""multiple endocrine neoplasia and medullary thyroid carcinoma 1"", ""Hirschsprung disease 1"""	HSCR1, MEN2A, MTC1, MEN2B		2687772, 1611909	Standard	NM_020975		Approved	PTC, CDHF12, RET51, CDHR16	uc001jal.3	P07949	OTTHUMG00000018024	ENST00000355710.3:c.914C>A	10.37:g.43601870C>A	ENSP00000347942:p.Pro305His		A8K6Z2|Q15250|Q9BTB0|Q9H4A2	Missense_Mutation	SNP	pirsf_Tyr_kinase_Ret_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Cadherin,superfamily_Kinase-like_dom,superfamily_Cadherin-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Cadherin	p.P305H	ENST00000355710.3	37	c.914	CCDS7200.1	10	.	.	.	.	.	.	.	.	.	.	C	16.03	3.007081	0.54361	.	.	ENSG00000165731	ENST00000355710;ENST00000340058;ENST00000535749	T;D	0.82167	-1.44;-1.58	5.05	5.05	0.67936	.	0.160627	0.56097	D	0.000026	D	0.89632	0.6771	M	0.63843	1.955	0.58432	D	0.999996	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.976;0.976;0.996	D	0.90438	0.4429	10	0.87932	D	0	.	15.9341	0.79688	0.0:1.0:0.0:0.0	.	51;305;305	B4DGX8;P07949;P07949-2	.;RET_HUMAN;.	H	305	ENSP00000347942:P305H;ENSP00000344798:P305H	ENSP00000344798:P305H	P	+	2	0	RET	42921876	0.997000	0.39634	0.777000	0.31699	0.154000	0.21943	4.705000	0.61838	2.618000	0.88619	0.467000	0.42956	CCT	RET	-	pirsf_Tyr_kinase_Ret_rcpt,superfamily_Cadherin-like	ENSG00000165731		0.662	RET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RET	HGNC	protein_coding	OTTHUMT00000047694.2		0.00	28	0	C	NM_020975		43601870	+1			no_errors	ENST00000355710	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.910	A
RIPK4	54101	genome.wustl.edu	37	21	43187118	43187118	+	Silent	SNP	C	C	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr21:43187118C>G	ENST00000352483.2	-	1	148	c.84G>C	c.(82-84)gtG>gtC	p.V28V	RIPK4_ENST00000542057.1_5'Flank|RIPK4_ENST00000332512.3_Silent_p.V28V|RIPK4_ENST00000544709.1_5'Flank			P57078	RIPK4_HUMAN	receptor-interacting serine-threonine kinase 4	28	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				morphogenesis of an epithelium (GO:0002009)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						CGCCCGAGCCCACCTTCTCCC	0.692																																																	0													32.0	27.0	29.0					21																	43187118		2203	4294	6497	SO:0001819	synonymous_variant	0			AJ278016	CCDS13675.1	21q22.3	2013-01-10	2004-07-06	2004-07-06	ENSG00000183421	ENSG00000183421		"""Ankyrin repeat domain containing"""	496	protein-coding gene	gene with protein product	"""protein kinase C-associated kinase"", ""PKC-delta-interacting protein kinase"""	605706	"""ankyrin repeat domain 3"""	ANKRD3		10830953	Standard	NM_020639		Approved	DIK, ANKK2, RIP4, PKK	uc002yzn.1	P57078	OTTHUMG00000086770	ENST00000352483.2:c.84G>C	21.37:g.43187118C>G			Q96KH0	Silent	SNP	pfam_Ankyrin_rpt,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom,prints_Ankyrin_rpt,prints_Ser-Thr/Tyr_kinase_cat_dom	p.V28	ENST00000352483.2	37	c.84		21																																																																																			RIPK4	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000183421		0.692	RIPK4-201	KNOWN	basic	protein_coding	RIPK4	HGNC	protein_coding		-	0.00	20	0	C	NM_020639		43187118	-1	tier1	-	no_errors	ENST00000352483	ensembl	human	known	74_37	silent	22.73	17	5	SNP	0.997	G
RMDN3	55177	genome.wustl.edu	37	15	41036287	41036287	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr15:41036287G>A	ENST00000260385.6	-	5	1935	c.868C>T	c.(868-870)Ctc>Ttc	p.L290F	RMDN3_ENST00000558560.1_Intron|RMDN3_ENST00000338376.3_Missense_Mutation_p.L290F			Q96TC7	RMD3_HUMAN	regulator of microtubule dynamics 3	290					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|cellular calcium ion homeostasis (GO:0006874)	integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)											TCCTCAGTGAGCTCACACATG	0.572																																																	0													116.0	101.0	106.0					15																	41036287		2203	4300	6503	SO:0001583	missense	0			AK001441	CCDS10063.1	15q15.1	2013-01-11	2013-01-11	2013-01-11	ENSG00000137824	ENSG00000137824			25550	protein-coding gene	gene with protein product		611873	"""family with sequence similarity 82, member A2"""	FAM82C, FAM82A2		12975309	Standard	XM_005254531		Approved	FLJ10579, PTPIP51, RMD3	uc001zmp.1	Q96TC7	OTTHUMG00000130066	ENST00000260385.6:c.868C>T	15.37:g.41036287G>A	ENSP00000260385:p.Leu290Phe		A9UMZ9|B3KRR3|Q6ZWE9|Q96H23|Q96SD6|Q9H6G1|Q9NVQ6	Missense_Mutation	SNP	NULL	p.L290F	ENST00000260385.6	37	c.868	CCDS10063.1	15	.	.	.	.	.	.	.	.	.	.	G	23.9	4.475798	0.84640	.	.	ENSG00000137824	ENST00000260385;ENST00000338376;ENST00000426872	T;T	0.51574	0.7;0.7	6.17	6.17	0.99709	.	0.344337	0.30159	N	0.010266	T	0.50394	0.1613	L	0.55017	1.72	0.35158	D	0.770371	D	0.54047	0.964	P	0.48795	0.59	T	0.57359	-0.7825	10	0.28530	T	0.3	-9.346	13.509	0.61499	0.0:0.0:0.7495:0.2505	.	290	Q96TC7	RMD3_HUMAN	F	290;290;227	ENSP00000260385:L290F;ENSP00000342493:L290F	ENSP00000260385:L290F	L	-	1	0	FAM82A2	38823579	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.996000	0.49449	2.941000	0.99782	0.655000	0.94253	CTC	RMDN3	-	NULL	ENSG00000137824		0.572	RMDN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RMDN3	HGNC	protein_coding	OTTHUMT00000252357.1	-	0.00	35	0	G	NM_018145		41036287	-1	tier1	-	no_errors	ENST00000260385	ensembl	human	known	74_37	missense	10.81	33	4	SNP	0.976	A
RND2	8153	genome.wustl.edu	37	17	41180521	41180521	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr17:41180521G>A	ENST00000587250.2	+	5	615	c.508G>A	c.(508-510)Gtc>Atc	p.V170I	RND2_ENST00000544533.1_Missense_Mutation_p.V171I|CTD-3199J23.4_ENST00000225973.5_lincRNA			P52198	RND2_HUMAN	Rho family GTPase 2	170					GTP catabolic process (GO:0006184)|positive regulation of collateral sprouting (GO:0048672)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			large_intestine(1)|skin(1)	2		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.156)		TGAGCGCAGCGTCAGGGATGT	0.622																																																	0													67.0	63.0	65.0					17																	41180521		2203	4300	6503	SO:0001583	missense	0			X95456	CCDS11452.1	17q21.31	2012-10-02	2005-01-24	2005-01-24	ENSG00000108830	ENSG00000108830			18315	protein-coding gene	gene with protein product		601555	"""ras homolog gene family, member N"""	ARHN			Standard	XM_005257706		Approved	Rho7, RhoN	uc002icn.3	P52198	OTTHUMG00000180817	ENST00000587250.2:c.508G>A	17.37:g.41180521G>A	ENSP00000466680:p.Val170Ile		A8K2D4|O00690|O00734|Q5U0P6|Q99535	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.V171I	ENST00000587250.2	37	c.511	CCDS11452.1	17	.	.	.	.	.	.	.	.	.	.	G	28.7	4.941209	0.92526	.	.	ENSG00000108830	ENST00000544533;ENST00000225973	T	0.80653	-1.4	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.81621	0.4861	L	0.36672	1.1	0.80722	D	1	P	0.41643	0.758	P	0.48704	0.587	T	0.82420	-0.0466	10	0.66056	D	0.02	.	19.2909	0.94098	0.0:0.0:1.0:0.0	.	170	P52198	RND2_HUMAN	I	171;170	ENSP00000439328:V171I	ENSP00000225973:V170I	V	+	1	0	RND2	38434047	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.623000	0.98386	2.894000	0.99253	0.655000	0.94253	GTC	RND2	-	pfam_Small_GTPase,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase	ENSG00000108830		0.622	RND2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RND2	HGNC	protein_coding	OTTHUMT00000453111.2	-	0.00	33	0	G	NM_005440		41180521	+1	tier1	-	no_errors	ENST00000544533	ensembl	human	known	74_37	missense	17.02	39	8	SNP	1.000	A
RNF17	56163	genome.wustl.edu	37	13	25378525	25378525	+	Silent	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr13:25378525G>T	ENST00000255324.5	+	15	2101	c.2049G>T	c.(2047-2049)acG>acT	p.T683T	RNF17_ENST00000255325.6_Intron|RNF17_ENST00000381921.1_Silent_p.T683T	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	683					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		TTTCAGTAACGGTTTGTCATA	0.284																																																	0													81.0	81.0	81.0					13																	25378525		2200	4300	6500	SO:0001819	synonymous_variant	0			AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.2049G>T	13.37:g.25378525G>T			Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Silent	SNP	pfam_Tudor,smart_Tudor,pfscan_Tudor,pfscan_Znf_RING	p.T683	ENST00000255324.5	37	c.2049	CCDS9308.2	13																																																																																			RNF17	-	pfam_Tudor	ENSG00000132972		0.284	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF17	HGNC	protein_coding	OTTHUMT00000044217.1	-	0.00	31	0	G	NM_031994		25378525	+1	tier1	-	no_errors	ENST00000255324	ensembl	human	known	74_37	silent	5.97	63	4	SNP	0.999	T
RUNDC3B	154661	genome.wustl.edu	37	7	87436688	87436688	+	Splice_Site	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr7:87436688G>T	ENST00000338056.3	+	10	1419	c.1008G>T	c.(1006-1008)ctG>ctT	p.L336L	RUNDC3B_ENST00000394654.3_Splice_Site_p.L319L|RUNDC3B_ENST00000493037.1_Intron	NM_001134405.1|NM_138290.2	NP_001127877.1|NP_612147.1	Q96NL0	RUN3B_HUMAN	RUN domain containing 3B	336										breast(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(2)	26	Esophageal squamous(14;0.00164)					ATATTCACAGGACTGTGCTAA	0.408																																																	0													134.0	124.0	127.0					7																	87436688		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS5609.1, CCDS47635.1, CCDS47636.1	7q21.12	2009-01-14			ENSG00000105784	ENSG00000105784			30286	protein-coding gene	gene with protein product						12645870	Standard	NM_138290		Approved	RPIP9, RPIB9	uc003ujb.3	Q96NL0	OTTHUMG00000131035	ENST00000338056.3:c.1008-1G>T	7.37:g.87436688G>T			B4DFD0|E9PBR4|Q8IWW5|Q8NB55|Q8TBG7	Silent	SNP	pfam_Run,smart_Run,pfscan_Run	p.L336	ENST00000338056.3	37	c.1008	CCDS5609.1	7																																																																																			RUNDC3B	-	NULL	ENSG00000105784		0.408	RUNDC3B-001	KNOWN	basic|CCDS	protein_coding	RUNDC3B	HGNC	protein_coding	OTTHUMT00000253679.1	-	0.00	48	0	G	NM_138290	Silent	87436688	+1	tier1	-	no_errors	ENST00000338056	ensembl	human	known	74_37	silent	5.00	76	4	SNP	1.000	T
SAMSN1	64092	genome.wustl.edu	37	21	15882762	15882762	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr21:15882762C>T	ENST00000400566.1	-	5	511	c.430G>A	c.(430-432)Gat>Aat	p.D144N	SAMSN1_ENST00000285670.2_Missense_Mutation_p.D212N|SAMSN1_ENST00000400564.1_Intron	NM_022136.4	NP_071419.3	Q9NSI8	SAMN1_HUMAN	SAM domain, SH3 domain and nuclear localization signals 1	144					negative regulation of adaptive immune response (GO:0002820)|negative regulation of B cell activation (GO:0050869)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)	cell projection (GO:0042995)|cytosol (GO:0005829)|nucleus (GO:0005634)	phosphotyrosine binding (GO:0001784)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	24				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.00118)|Colorectal(24;0.00961)|Lung(58;0.164)		CTTGTACCATCTGAACAGCTT	0.463																																																	0													100.0	95.0	97.0					21																	15882762		2064	4213	6277	SO:0001583	missense	0			AF222927	CCDS42906.1, CCDS58786.1, CCDS74774.1	21q11	2013-01-10	2006-12-13		ENSG00000155307	ENSG00000155307		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	10528	protein-coding gene	gene with protein product	"""nuclear localization signals, SAM and SH3 domain containing 1"", ""SAM and SH3 domain containing 2"", ""hematopoietic adapter-containing SH3 and sterile &#945;-motif (SAM) domains 1"", ""Src homology domain 3 (SH3)-containing adapter protein SH3 lymphocyte protein 2"""	607978				11536050, 11594764	Standard	NM_022136		Approved	NASH1, SASH2, SH3D6B, HACS1, SLy2	uc002yjv.1	Q9NSI8	OTTHUMG00000074317	ENST00000400566.1:c.430G>A	21.37:g.15882762C>T	ENSP00000383411:p.Asp144Asn		B3KWJ3|F8WAA1|Q8NFF7|Q9C041	Missense_Mutation	SNP	pfam_rSAM/SH3_domain-containing,pfam_SAM_2,pfam_SAM_type1,pfam_SH3_2,superfamily_SAM/pointed,superfamily_SH3_domain,smart_SH3_domain,smart_SAM,pfscan_SAM	p.D144N	ENST00000400566.1	37	c.430	CCDS42906.1	21	.	.	.	.	.	.	.	.	.	.	C	13.93	2.383904	0.42308	.	.	ENSG00000155307	ENST00000285670;ENST00000400566	T;T	0.44482	0.92;0.92	5.78	5.78	0.91487	.	0.103153	0.64402	D	0.000003	T	0.63319	0.2501	M	0.70275	2.135	0.51482	D	0.999928	D;P	0.89917	1.0;0.901	D;P	0.87578	0.998;0.583	T	0.55373	-0.8151	10	0.10902	T	0.67	-24.7453	20.012	0.97458	0.0:1.0:0.0:0.0	.	212;144	F8WAA1;Q9NSI8	.;SAMN1_HUMAN	N	212;144	ENSP00000285670:D212N;ENSP00000383411:D144N	ENSP00000285670:D212N	D	-	1	0	SAMSN1	14804633	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	4.486000	0.60286	2.731000	0.93534	0.655000	0.94253	GAT	SAMSN1	-	pfam_rSAM/SH3_domain-containing	ENSG00000155307		0.463	SAMSN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMSN1	HGNC	protein_coding	OTTHUMT00000157914.1	-	0.00	56	0	C			15882762	-1	tier1	-	no_errors	ENST00000400566	ensembl	human	known	74_37	missense	9.09	70	7	SNP	1.000	T
SCAF1	58506	genome.wustl.edu	37	19	50155769	50155769	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr19:50155769G>A	ENST00000360565.3	+	7	2247	c.2123G>A	c.(2122-2124)gGc>gAc	p.G708D		NM_021228.2	NP_067051.2	Q9H7N4	SFR19_HUMAN	SR-related CTD-associated factor 1	708	Ser-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	20		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.196)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00113)|GBM - Glioblastoma multiforme(134;0.0204)		ATCACGGTGGGCCGGCTTGAC	0.692																																																	0													20.0	18.0	19.0					19																	50155769		2192	4298	6490	SO:0001583	missense	0			AK024444	CCDS33074.1	19q13.3-q13.4	2011-01-10			ENSG00000126461	ENSG00000126461			30403	protein-coding gene	gene with protein product						11461075	Standard	NM_021228		Approved	SR-A1, FLJ00034	uc002poq.3	Q9H7N4		ENST00000360565.3:c.2123G>A	19.37:g.50155769G>A	ENSP00000353769:p.Gly708Asp		Q7Z5V7|Q8WVA1|Q9NR59	Missense_Mutation	SNP	NULL	p.G708D	ENST00000360565.3	37	c.2123	CCDS33074.1	19	.	.	.	.	.	.	.	.	.	.	G	11.98	1.800362	0.31869	.	.	ENSG00000126461	ENST00000360565	T	0.34275	1.37	3.56	2.48	0.30137	.	0.217442	0.23060	N	0.052393	T	0.22589	0.0545	N	0.24115	0.695	0.27235	N	0.959298	P	0.50156	0.932	P	0.45310	0.476	T	0.05869	-1.0859	9	.	.	.	-22.9789	3.5164	0.07726	0.2193:0.2287:0.552:0.0	.	708	Q9H7N4	SFR19_HUMAN	D	708	ENSP00000353769:G708D	.	G	+	2	0	SCAF1	54847581	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.997000	0.49457	0.671000	0.31185	0.561000	0.74099	GGC	SCAF1	-	NULL	ENSG00000126461		0.692	SCAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAF1	HGNC	protein_coding	OTTHUMT00000465764.1	-	0.00	36	0	G	NM_021228		50155769	+1	tier1	-	no_errors	ENST00000360565	ensembl	human	known	74_37	missense	28.17	51	20	SNP	0.911	A
SCN10A	6336	genome.wustl.edu	37	3	38830463	38830463	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr3:38830463G>T	ENST00000449082.2	-	3	453	c.454C>A	c.(454-456)Ctt>Att	p.L152I		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	152					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	TTCTCTGGAAGGTCAGTTCGG	0.373																																																	0													136.0	129.0	131.0					3																	38830463		2203	4300	6503	SO:0001583	missense	0			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.454C>A	3.37:g.38830463G>T	ENSP00000390600:p.Leu152Ile		A6NDQ1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_asu,prints_PKD_2	p.L152I	ENST00000449082.2	37	c.454	CCDS33736.1	3	.	.	.	.	.	.	.	.	.	.	G	13.26	2.184702	0.38609	.	.	ENSG00000185313	ENST00000449082	D	0.97529	-4.42	5.18	-1.24	0.09435	.	0.528838	0.20166	N	0.097848	D	0.91784	0.7401	L	0.40543	1.245	0.09310	N	0.999999	B	0.25955	0.138	B	0.18561	0.022	D	0.84749	0.0755	10	0.72032	D	0.01	.	3.132	0.06426	0.3285:0.1036:0.4528:0.1152	.	152	Q9Y5Y9	SCNAA_HUMAN	I	152	ENSP00000390600:L152I	ENSP00000390600:L152I	L	-	1	0	SCN10A	38805467	0.000000	0.05858	0.079000	0.20413	0.763000	0.43281	0.134000	0.15932	-0.042000	0.13535	0.650000	0.86243	CTT	SCN10A	-	NULL	ENSG00000185313		0.373	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN10A	HGNC	protein_coding	OTTHUMT00000109745.3	-	0.00	48	0	G	NM_006514		38830463	-1	tier1	-	no_errors	ENST00000449082	ensembl	human	known	74_37	missense	5.19	73	4	SNP	0.068	T
SDCBP2	27111	genome.wustl.edu	37	20	1299025	1299025	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr20:1299025C>A	ENST00000360779.3	-	4	335	c.162G>T	c.(160-162)atG>atT	p.M54I	SDCBP2_ENST00000339987.3_Missense_Mutation_p.M54I|SDCBP2_ENST00000381812.1_Missense_Mutation_p.M54I	NM_080489.4	NP_536737.3	Q9H190	SDCB2_HUMAN	syndecan binding protein (syntenin) 2	54					intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|nervous system development (GO:0007399)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.M54I(2)		endometrium(1)|large_intestine(3)|lung(1)|skin(1)|stomach(1)	7						GGGAAAGACCCATATAATTTT	0.483																																																	2	Substitution - Missense(2)	endometrium(2)											81.0	81.0	81.0					20																	1299025		1871	4112	5983	SO:0001583	missense	0			AF131809	CCDS13013.1, CCDS42848.1	20p13	2008-07-02			ENSG00000125775	ENSG00000125775			15756	protein-coding gene	gene with protein product						11152476	Standard	NM_080489		Approved	ST-2, SITAC18	uc021vzn.1	Q9H190	OTTHUMG00000031661	ENST00000360779.3:c.162G>T	20.37:g.1299025C>A	ENSP00000354013:p.Met54Ile		O95892|Q5W0X1|Q9BZ42|Q9H567|Q9NRY8	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.M54I	ENST00000360779.3	37	c.162	CCDS42848.1	20	.	.	.	.	.	.	.	.	.	.	C	20.3	3.969981	0.74246	.	.	ENSG00000125775	ENST00000381812;ENST00000360779;ENST00000339987	T;T;T	0.38887	1.11;1.11;1.11	4.82	3.88	0.44766	.	0.000000	0.85682	D	0.000000	T	0.64260	0.2582	M	0.86651	2.83	0.50171	D	0.999858	B;D	0.69078	0.275;0.997	B;D	0.64506	0.067;0.926	T	0.69595	-0.5103	10	0.72032	D	0.01	-9.5711	10.485	0.44717	0.1928:0.8072:0.0:0.0	.	54;54	B4DKI5;Q9H190	.;SDCB2_HUMAN	I	54	ENSP00000371233:M54I;ENSP00000354013:M54I;ENSP00000342935:M54I	ENSP00000342935:M54I	M	-	3	0	SDCBP2	1247025	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.498000	0.60373	1.240000	0.43803	0.655000	0.94253	ATG	SDCBP2	-	NULL	ENSG00000125775		0.483	SDCBP2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SDCBP2	HGNC	protein_coding	OTTHUMT00000077513.2		0.00	12	0	C	NM_080489		1299025	-1			no_errors	ENST00000339987	ensembl	human	known	74_37	missense	13.33	13	2	SNP	1.000	A
SEMA4F	10505	genome.wustl.edu	37	2	74901691	74901691	+	Missense_Mutation	SNP	T	T	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr2:74901691T>A	ENST00000357877.2	+	8	1038	c.889T>A	c.(889-891)Tgt>Agt	p.C297S	SEMA4F_ENST00000339773.5_Missense_Mutation_p.C142S	NM_004263.3	NP_004254.2	O95754	SEM4F_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F	297	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)|negative regulation of axon extension (GO:0030517)|nervous system development (GO:0007399)|retinal ganglion cell axon guidance (GO:0031290)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor activity (GO:0004872)			biliary_tract(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	45						TGACCTGCTCTGTCCAGGGCC	0.587																																																	0													97.0	96.0	97.0					2																	74901691		2203	4300	6503	SO:0001583	missense	0			AF038652	CCDS1955.1, CCDS62942.1, CCDS74529.1	2p13.1	2008-05-21			ENSG00000135622	ENSG00000135622		"""Semaphorins"""	10734	protein-coding gene	gene with protein product	"""m-Sema M"""	603706		SEMAM		10051670	Standard	NM_004263		Approved	SEMAW	uc002sna.2	O95754	OTTHUMG00000129952	ENST00000357877.2:c.889T>A	2.37:g.74901691T>A	ENSP00000350547:p.Cys297Ser		Q542Y7|Q9NS35	Missense_Mutation	SNP	pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,pfscan_Semap_dom	p.C297S	ENST00000357877.2	37	c.889	CCDS1955.1	2	.	.	.	.	.	.	.	.	.	.	T	20.9	4.059268	0.76074	.	.	ENSG00000135622	ENST00000357877;ENST00000339773;ENST00000453930	D;D;D	0.95482	-3.72;-3.72;-3.72	5.33	5.33	0.75918	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	D	0.98093	0.9371	M	0.92923	3.36	0.51482	D	0.99992	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99081	1.0837	10	0.87932	D	0	.	13.2471	0.60029	0.0:0.0:0.0:1.0	.	142;297	O95754-2;O95754	.;SEM4F_HUMAN	S	297;142;142	ENSP00000350547:C297S;ENSP00000342675:C142S;ENSP00000409141:C142S	ENSP00000342675:C142S	C	+	1	0	SEMA4F	74755199	1.000000	0.71417	0.946000	0.38457	0.820000	0.46376	7.599000	0.82757	2.025000	0.59659	0.240000	0.17902	TGT	SEMA4F	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000135622		0.587	SEMA4F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA4F	HGNC	protein_coding	OTTHUMT00000252214.2	-	0.00	25	0	T	NM_004263		74901691	+1	tier1	-	no_errors	ENST00000357877	ensembl	human	known	74_37	missense	20.59	27	7	SNP	1.000	A
SF3B1	23451	genome.wustl.edu	37	2	198268376	198268376	+	Nonsense_Mutation	SNP	A	A	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr2:198268376A>T	ENST00000335508.6	-	12	1743	c.1652T>A	c.(1651-1653)tTa>tAa	p.L551*	SF3B1_ENST00000462613.1_5'Flank|SNORA4_ENST00000365564.1_RNA	NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	551	Interaction with SF3B14.				anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)			NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			TTTCACAAGTAAATGACGCTC	0.373			Mis		myelodysplastic syndrome																																			Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	0													97.0	98.0	98.0					2																	198268376		2203	4300	6503	SO:0001587	stop_gained	0			AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.1652T>A	2.37:g.198268376A>T	ENSP00000335321:p.Leu551*		E9PCH3	Nonsense_Mutation	SNP	pfam_SF3b_su1,superfamily_ARM-type_fold	p.L551*	ENST00000335508.6	37	c.1652	CCDS33356.1	2	.	.	.	.	.	.	.	.	.	.	A	39	7.482987	0.98312	.	.	ENSG00000115524	ENST00000335508	.	.	.	6.17	6.17	0.99709	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	.	.	.	X	551	.	ENSP00000335321:L551X	L	-	2	0	SF3B1	197976621	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.169000	0.94788	2.371000	0.80710	0.533000	0.62120	TTA	SF3B1	-	superfamily_ARM-type_fold	ENSG00000115524		0.373	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3B1	HGNC	protein_coding	OTTHUMT00000335245.2	-	0.00	41	0	A			198268376	-1	tier1	-	no_errors	ENST00000335508	ensembl	human	known	74_37	nonsense	11.69	68	9	SNP	1.000	T
SH2D4A	63898	genome.wustl.edu	37	8	19214753	19214753	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr8:19214753G>T	ENST00000265807.3	+	5	964	c.553G>T	c.(553-555)Gca>Tca	p.A185S	SH2D4A_ENST00000519207.1_Missense_Mutation_p.A185S|SH2D4A_ENST00000518040.1_Missense_Mutation_p.A140S	NM_001174160.1|NM_022071.3	NP_001167631.1|NP_071354.2	Q9H788	SH24A_HUMAN	SH2 domain containing 4A	185					negative regulation of phosphatase activity (GO:0010923)	cytoplasm (GO:0005737)	phosphatase binding (GO:0019902)			endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|stomach(1)	16				Colorectal(111;0.0732)		ACAAATGTTGGCAGATTCAAT	0.393																																																	0													129.0	128.0	128.0					8																	19214753		2203	4300	6503	SO:0001583	missense	0			AY190323	CCDS6009.1, CCDS55206.1	8p21	2013-02-14			ENSG00000104611	ENSG00000104611		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""SH2 domain containing"""	26102	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 38"""	614968					Standard	NM_022071		Approved	FLJ20967, SH2A, PPP1R38	uc003wzc.3	Q9H788	OTTHUMG00000097005	ENST00000265807.3:c.553G>T	8.37:g.19214753G>T	ENSP00000265807:p.Ala185Ser		B4DDR1|Q5XKC1|Q6NXE9|Q86YM2|Q96C88|Q9H7F7	Missense_Mutation	SNP	pfam_SH2,smart_SH2,pfscan_SH2	p.A185S	ENST00000265807.3	37	c.553	CCDS6009.1	8	.	.	.	.	.	.	.	.	.	.	G	19.94	3.920595	0.73213	.	.	ENSG00000104611	ENST00000265807;ENST00000518040;ENST00000519207	T;D;T	0.94576	2.74;-3.46;2.74	5.46	5.46	0.80206	.	0.100118	0.42548	D	0.000691	D	0.91240	0.7239	N	0.08118	0	0.28801	N	0.898784	D;P	0.56521	0.976;0.939	P;B	0.54346	0.749;0.433	D	0.86515	0.1812	10	0.34782	T	0.22	.	15.1697	0.72862	0.0:0.0:1.0:0.0	.	140;185	B4DDR1;Q9H788	.;SH24A_HUMAN	S	185;140;185	ENSP00000265807:A185S;ENSP00000429482:A140S;ENSP00000428684:A185S	ENSP00000265807:A185S	A	+	1	0	SH2D4A	19259033	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.497000	0.53295	2.713000	0.92767	0.655000	0.94253	GCA	SH2D4A	-	NULL	ENSG00000104611		0.393	SH2D4A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SH2D4A	HGNC	protein_coding	OTTHUMT00000214094.1	-	0.00	36	0	G	NM_022071		19214753	+1	tier1	-	no_errors	ENST00000265807	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	T
SHARPIN	81858	genome.wustl.edu	37	8	145154264	145154264	+	Missense_Mutation	SNP	C	C	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr8:145154264C>G	ENST00000398712.2	-	6	1274	c.838G>C	c.(838-840)Gag>Cag	p.E280Q	SHARPIN_ENST00000533948.1_5'Flank	NM_030974.3	NP_112236.3	Q9H0F6	SHRPN_HUMAN	SHANK-associated RH domain interactor	280	Interaction with SHANK1. {ECO:0000250}.|Ubiquitin-like.				apoptotic nuclear changes (GO:0030262)|brain development (GO:0007420)|keratinization (GO:0031424)|mitochondrion organization (GO:0007005)|negative regulation of inflammatory response (GO:0050728)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein homooligomerization (GO:0051260)|protein linear polyubiquitination (GO:0097039)|regulation of CD40 signaling pathway (GO:2000348)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendrite (GO:0030425)|LUBAC complex (GO:0071797)|postsynaptic density (GO:0014069)	polyubiquitin binding (GO:0031593)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|lung(2)|ovary(2)	7	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.1e-42)|Epithelial(56;1.58e-40)|all cancers(56;6.12e-36)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			AGGCTGCGCTCAGGCACACAC	0.627																																																	0													55.0	65.0	62.0					8																	145154264		2152	4259	6411	SO:0001583	missense	0			AL136816	CCDS43777.1	8q24.3	2005-08-09				ENSG00000179526			25321	protein-coding gene	gene with protein product		611885				11178875, 12753155	Standard	NM_030974		Approved	DKFZP434N1923, SIPL1	uc003zba.3	Q9H0F6		ENST00000398712.2:c.838G>C	8.37:g.145154264C>G	ENSP00000381698:p.Glu280Gln		A6NEG3|C0L3L2|D3DWL3|Q8IXF5|Q8IXF6|Q8N2E7|Q8TB25|Q9BUE4	Missense_Mutation	SNP	pfam_Znf_RanBP2,smart_Znf_RanBP2,pfscan_Znf_RanBP2	p.E280Q	ENST00000398712.2	37	c.838	CCDS43777.1	8	.	.	.	.	.	.	.	.	.	.	C	14.96	2.692305	0.48202	.	.	ENSG00000179526	ENST00000398712;ENST00000359551	T;T	0.44083	0.93;0.93	4.63	4.63	0.57726	.	0.177414	0.50627	D	0.000110	T	0.28599	0.0708	N	0.20986	0.625	0.31994	N	0.604198	P	0.37330	0.59	B	0.37198	0.243	T	0.28459	-1.0043	10	0.21540	T	0.41	.	12.8664	0.57941	0.0:1.0:0.0:0.0	.	280	Q9H0F6	SHRPN_HUMAN	Q	280	ENSP00000381698:E280Q;ENSP00000352551:E280Q	ENSP00000352551:E280Q	E	-	1	0	SHARPIN	145226252	0.980000	0.34600	0.998000	0.56505	0.875000	0.50365	1.766000	0.38491	2.424000	0.82194	0.555000	0.69702	GAG	SHARPIN	-	NULL	ENSG00000179526		0.627	SHARPIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHARPIN	HGNC	protein_coding	OTTHUMT00000382901.1	-	0.00	40	0	C	NM_030974		145154264	-1	tier1	-	no_errors	ENST00000398712	ensembl	human	known	74_37	missense	10.40	112	13	SNP	1.000	G
SKIV2L	6499	genome.wustl.edu	37	6	31931788	31931788	+	Silent	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr6:31931788G>A	ENST00000375394.2	+	16	1859	c.1746G>A	c.(1744-1746)caG>caA	p.Q582Q	SKIV2L_ENST00000544581.1_Silent_p.Q389Q	NM_006929.4	NP_008860.4	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like (S. cerevisiae)	582					ATP catabolic process (GO:0006200)	nucleus (GO:0005634)|Ski complex (GO:0055087)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|large_intestine(1)|ovary(1)	4						GTGATGAGCAGGCCTCAGGCC	0.657																																																	0													110.0	115.0	113.0					6																	31931788		1510	2709	4219	SO:0001819	synonymous_variant	0				CCDS4731.1	6p21	2010-02-17	2001-11-28		ENSG00000204351	ENSG00000204351			10898	protein-coding gene	gene with protein product		600478	"""superkiller viralicidic activity 2 (S. cerevisiae homolog)-like"""	SKIV2		7759100, 9799600	Standard	XM_006715168		Approved	HLP, DDX13, SKI2W, 170A	uc003nyn.1	Q15477	OTTHUMG00000031146	ENST00000375394.2:c.1746G>A	6.37:g.31931788G>A			O15005|Q12902|Q15476|Q5ST66	Silent	SNP	pfam_DSH_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pirsf_RNA_helicase_ATP-dep_SK12/DOB1,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.Q582	ENST00000375394.2	37	c.1746	CCDS4731.1	6																																																																																			SKIV2L	-	superfamily_P-loop_NTPase,pirsf_RNA_helicase_ATP-dep_SK12/DOB1	ENSG00000204351		0.657	SKIV2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKIV2L	HGNC	protein_coding	OTTHUMT00000076264.3	-	0.00	31	0	G			31931788	+1	tier1	-	no_errors	ENST00000375394	ensembl	human	known	74_37	silent	15.25	50	9	SNP	1.000	A
SKIV2L	6499	genome.wustl.edu	37	6	31937096	31937096	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr6:31937096G>T	ENST00000375394.2	+	27	3552	c.3439G>T	c.(3439-3441)Gag>Tag	p.E1147*	SKIV2L_ENST00000544581.1_Nonsense_Mutation_p.E954*|STK19_ENST00000375331.2_5'Flank|DXO_ENST00000478221.1_5'Flank|STK19_ENST00000375333.2_5'Flank	NM_006929.4	NP_008860.4	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like (S. cerevisiae)	1147					ATP catabolic process (GO:0006200)	nucleus (GO:0005634)|Ski complex (GO:0055087)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|large_intestine(1)|ovary(1)	4						GCGGATTGGTGAGGTCCAGGT	0.577																																																	0													117.0	118.0	118.0					6																	31937096		2203	4300	6503	SO:0001587	stop_gained	0				CCDS4731.1	6p21	2010-02-17	2001-11-28		ENSG00000204351	ENSG00000204351			10898	protein-coding gene	gene with protein product		600478	"""superkiller viralicidic activity 2 (S. cerevisiae homolog)-like"""	SKIV2		7759100, 9799600	Standard	XM_006715168		Approved	HLP, DDX13, SKI2W, 170A	uc003nyn.1	Q15477	OTTHUMG00000031146	ENST00000375394.2:c.3439G>T	6.37:g.31937096G>T	ENSP00000364543:p.Glu1147*		O15005|Q12902|Q15476|Q5ST66	Nonsense_Mutation	SNP	pfam_DSH_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pirsf_RNA_helicase_ATP-dep_SK12/DOB1,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E1147*	ENST00000375394.2	37	c.3439	CCDS4731.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	41|41	8.887629|8.887629	0.98990|0.98990	.|.	.|.	ENSG00000204351|ENSG00000204351	ENST00000375394;ENST00000433155;ENST00000544581|ENST00000491994	.|.	.|.	.|.	5.29|5.29	5.29|5.29	0.74685|0.74685	.|.	0.178675|.	0.48286|.	D|.	0.000189|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.14656|.	T|.	0.56|.	-29.0832|-29.0832	12.7175|12.7175	0.57123|0.57123	0.0:0.2811:0.7189:0.0|0.0:0.2811:0.7189:0.0	.|.	.|.	.|.	.|.	X|L	1147;989;954|145	.|.	ENSP00000364543:E1147X|.	E|X	+|+	1|2	0|2	SKIV2L|SKIV2L	32045075|32045075	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	3.401000|3.401000	0.52601|0.52601	2.460000|2.460000	0.83146|0.83146	0.655000|0.655000	0.94253|0.94253	GAG|TGA	SKIV2L	-	pfam_DSH_C,pirsf_RNA_helicase_ATP-dep_SK12/DOB1	ENSG00000204351		0.577	SKIV2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKIV2L	HGNC	protein_coding	OTTHUMT00000076264.3		0.00	19	0	G			31937096	+1			no_errors	ENST00000375394	ensembl	human	known	74_37	nonsense	5.13	74	4	SNP	1.000	T
SLC22A13	9390	genome.wustl.edu	37	3	38318435	38318435	+	Nonsense_Mutation	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr3:38318435C>A	ENST00000311856.4	+	9	1428	c.1379C>A	c.(1378-1380)tCa>tAa	p.S460*		NM_004256.3	NP_004247.2	Q9Y226	S22AD_HUMAN	solute carrier family 22 (organic anion/urate transporter), member 13	460					nicotinate transport (GO:2001142)|organic cation transport (GO:0015695)|urate transport (GO:0015747)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	nicotinate transporter activity (GO:0090416)|organic cation transmembrane transporter activity (GO:0015101)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|urinary_tract(1)	20				KIRC - Kidney renal clear cell carcinoma(284;0.0533)|Kidney(284;0.067)		GGCATCTTCTCACGGATCGGG	0.627																																																	0													51.0	40.0	44.0					3																	38318435		2203	4300	6503	SO:0001587	stop_gained	0			AB010438	CCDS2676.1	3p22.2	2013-07-18	2013-07-18	2003-10-15	ENSG00000172940	ENSG00000172940		"""Solute carriers"""	8494	protein-coding gene	gene with protein product		604047	"""organic cationic transporter-like 3"", ""solute carrier family 22 (organic anion transporter), member 13"""	ORCTL3		10072596, 18411268	Standard	NM_004256		Approved	OCTL1, OCTL3, OAT10	uc003chz.3	Q9Y226	OTTHUMG00000131086	ENST00000311856.4:c.1379C>A	3.37:g.38318435C>A	ENSP00000310241:p.Ser460*		B2RCV9|Q8IYG1	Nonsense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.S460*	ENST00000311856.4	37	c.1379	CCDS2676.1	3	.	.	.	.	.	.	.	.	.	.	C	21.0	4.085227	0.76642	.	.	ENSG00000172940	ENST00000311856	.	.	.	3.03	3.03	0.35002	.	0.062797	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	.	14.311	0.66416	0.0:1.0:0.0:0.0	.	.	.	.	X	460	.	ENSP00000310241:S460X	S	+	2	0	SLC22A13	38293439	0.980000	0.34600	0.860000	0.33809	0.624000	0.37722	5.341000	0.65964	2.023000	0.59567	0.650000	0.86243	TCA	SLC22A13	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000172940		0.627	SLC22A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A13	HGNC	protein_coding	OTTHUMT00000253746.2	-	0.00	18	0	C	NM_004256		38318435	+1	tier1	-	no_errors	ENST00000311856	ensembl	human	known	74_37	nonsense	25.00	27	9	SNP	0.992	A
SLC25A53	401612	genome.wustl.edu	37	X	103349671	103349671	+	Silent	SNP	C	C	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chrX:103349671C>T	ENST00000357421.4	-	2	450	c.270G>A	c.(268-270)ttG>ttA	p.L90L		NM_001012755.3	NP_001012773.2	Q5H9E4	S2553_HUMAN	solute carrier family 25, member 53	90					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)											GAGTCCCTTGCAACGTCTTGG	0.552																																																	0													64.0	62.0	63.0					X																	103349671		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS35363.1	Xq22.2	2013-05-22	2012-03-29	2012-03-29	ENSG00000176274	ENSG00000269743		"""Solute carriers"""	31894	protein-coding gene	gene with protein product			"""mitochondrial carrier triple repeat 6"""	MCART6			Standard	NM_001012755		Approved		uc004elu.3	Q5H9E4	OTTHUMG00000022124	ENST00000357421.4:c.270G>A	X.37:g.103349671C>T			B2RTT9	Silent	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	p.L90	ENST00000357421.4	37	c.270	CCDS35363.1	X																																																																																			SLC25A53	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000176274		0.552	SLC25A53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A53	HGNC	protein_coding	OTTHUMT00000057761.1	-	0.00	38	0	C	NM_001012755		103349671	-1	tier1	-	no_errors	ENST00000357421	ensembl	human	known	74_37	silent	23.26	33	10	SNP	0.991	T
SLC5A2	6524	genome.wustl.edu	37	16	31497501	31497501	+	Missense_Mutation	SNP	T	T	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr16:31497501T>C	ENST00000330498.3	+	5	498	c.479T>C	c.(478-480)tTc>tCc	p.F160S	AC026471.6_ENST00000565137.1_RNA	NM_003041.3	NP_003032.1	P31639	SC5A2_HUMAN	solute carrier family 5 (sodium/glucose cotransporter), member 2	160					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	low-affinity glucose:sodium symporter activity (GO:0005362)			endometrium(2)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	25					Canagliflozin(DB08907)|Dapagliflozin(DB06292)	GTGGACATGTTCTCCGGAGCT	0.597																																																	0													99.0	80.0	86.0					16																	31497501		2197	4300	6497	SO:0001583	missense	0				CCDS10714.1	16p11.2	2013-05-22			ENSG00000140675	ENSG00000140675		"""Solute carriers"""	11037	protein-coding gene	gene with protein product		182381		SGLT2		8244402	Standard	NM_003041		Approved		uc002ecf.4	P31639	OTTHUMG00000176620	ENST00000330498.3:c.479T>C	16.37:g.31497501T>C	ENSP00000327943:p.Phe160Ser		A2RRD2	Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.F160S	ENST00000330498.3	37	c.479	CCDS10714.1	16	.	.	.	.	.	.	.	.	.	.	T	19.29	3.798635	0.70567	.	.	ENSG00000140675	ENST00000330498;ENST00000419665	D;D	0.88664	-2.41;-2.41	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	D	0.94660	0.8278	M	0.87827	2.91	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.95310	0.8411	10	0.87932	D	0	.	12.8424	0.57811	0.0:0.0:0.0:1.0	.	160	P31639	SC5A2_HUMAN	S	160	ENSP00000327943:F160S;ENSP00000410601:F160S	ENSP00000327943:F160S	F	+	2	0	SLC5A2	31405002	1.000000	0.71417	1.000000	0.80357	0.739000	0.42172	3.286000	0.51724	2.128000	0.65567	0.459000	0.35465	TTC	SLC5A2	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	ENSG00000140675		0.597	SLC5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A2	HGNC	protein_coding	OTTHUMT00000255627.2	-	0.00	36	0	T			31497501	+1	tier1	-	no_errors	ENST00000330498	ensembl	human	known	74_37	missense	16.67	40	8	SNP	1.000	C
SLC6A5	9152	genome.wustl.edu	37	11	20649547	20649547	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr11:20649547C>A	ENST00000525748.1	+	9	1690	c.1417C>A	c.(1417-1419)Cag>Aag	p.Q473K		NM_004211.3	NP_004202.2	Q9Y345	SC6A5_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 5	473					glycine import (GO:0036233)|synaptic transmission (GO:0007268)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine:sodium symporter activity (GO:0015375)|neurotransmitter:sodium symporter activity (GO:0005328)	p.Q473E(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(34)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	63					Glycine(DB00145)	TGCTGCCACTCAGATTTTCTT	0.493																																																	1	Substitution - Missense(1)	skin(1)											125.0	113.0	117.0					11																	20649547		2203	4300	6503	SO:0001583	missense	0			AF085412	CCDS7854.1	11p15.1	2013-07-19	2013-07-19		ENSG00000165970	ENSG00000165970		"""Solute carriers"""	11051	protein-coding gene	gene with protein product	"""glycine transporter 2"""	604159	"""solute carrier family 6 (neurotransmitter transporter, glycine), member 5"""	NET1		9845349	Standard	NM_004211		Approved	GLYT2	uc001mqd.3	Q9Y345	OTTHUMG00000166024	ENST00000525748.1:c.1417C>A	11.37:g.20649547C>A	ENSP00000434364:p.Gln473Lys		O95288|Q4VAM7|Q9BX77	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport	p.Q473K	ENST00000525748.1	37	c.1417	CCDS7854.1	11	.	.	.	.	.	.	.	.	.	.	C	34	5.357086	0.95854	.	.	ENSG00000165970	ENST00000525748	D	0.81579	-1.51	5.65	5.65	0.86999	.	0.052295	0.85682	D	0.000000	D	0.94155	0.8125	H	0.98089	4.145	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.95666	0.8719	10	0.87932	D	0	.	20.0965	0.97849	0.0:1.0:0.0:0.0	.	473	Q9Y345	SC6A5_HUMAN	K	473	ENSP00000434364:Q473K	ENSP00000434364:Q473K	Q	+	1	0	SLC6A5	20606123	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.776000	0.85560	2.824000	0.97209	0.655000	0.94253	CAG	SLC6A5	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport	ENSG00000165970		0.493	SLC6A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A5	HGNC	protein_coding	OTTHUMT00000387497.2		0.00	28	0	C	NM_004211		20649547	+1			no_errors	ENST00000525748	ensembl	human	known	74_37	missense	6.38	44	3	SNP	1.000	A
SLC6A7	6534	genome.wustl.edu	37	5	149580709	149580709	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr5:149580709G>T	ENST00000230671.2	+	6	1152	c.781G>T	c.(781-783)Gga>Tga	p.G261*	SLC6A7_ENST00000524041.1_Nonsense_Mutation_p.G261*	NM_014228.3	NP_055043.2	Q99884	SC6A7_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 7	261					proline transport (GO:0015824)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|skin(1)|stomach(1)	16		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		L-Proline(DB00172)	GCTGGTCCGCGGAGTCACCCT	0.602																																																	0													144.0	114.0	124.0					5																	149580709		2203	4300	6503	SO:0001587	stop_gained	0			S80071	CCDS4305.1	5q32	2013-07-19	2013-07-19		ENSG00000011083	ENSG00000011083		"""Solute carriers"""	11054	protein-coding gene	gene with protein product	"""brain-specific L-proline transporter"", ""sodium-dependent proline transporter"""	606205	"""solute carrier family 6 (neurotransmitter transporter, L-proline), member 7"""			7651355	Standard	NM_014228		Approved	PROT	uc003lrr.3	Q99884	OTTHUMG00000130046	ENST00000230671.2:c.781G>T	5.37:g.149580709G>T	ENSP00000230671:p.Gly261*		Q0VG81|Q52LU6	Nonsense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport	p.G261*	ENST00000230671.2	37	c.781	CCDS4305.1	5	.	.	.	.	.	.	.	.	.	.	G	42	9.214436	0.99103	.	.	ENSG00000011083	ENST00000230671;ENST00000524041	.	.	.	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.8226	0.92103	0.0:0.0:1.0:0.0	.	.	.	.	X	261	.	ENSP00000230671:G261X	G	+	1	0	SLC6A7	149560902	1.000000	0.71417	0.912000	0.35992	0.973000	0.67179	9.869000	0.99810	2.436000	0.82500	0.561000	0.74099	GGA	SLC6A7	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport	ENSG00000011083		0.602	SLC6A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A7	HGNC	protein_coding	OTTHUMT00000252325.1		0.00	25	0	G	NM_014228		149580709	+1			no_errors	ENST00000230671	ensembl	human	known	74_37	nonsense	5.13	37	2	SNP	1.000	T
SLC9A9	285195	genome.wustl.edu	37	3	143100997	143100997	+	Intron	SNP	G	G	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr3:143100997G>C	ENST00000316549.6	-	13	1678				SLC9A9-AS2_ENST00000490153.1_RNA	NM_173653.3	NP_775924.1	Q8IVB4	SL9A9_HUMAN	solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9						ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|recycling endosome (GO:0055037)	sodium:proton antiporter activity (GO:0015385)			breast(2)|endometrium(5)|kidney(2)|large_intestine(13)|lung(29)|ovary(2)|skin(3)|stomach(1)	57						CCCTGCTGCAGAAGGAATGAG	0.448																																																	0													93.0	91.0	91.0					3																	143100997		2203	4300	6503	SO:0001627	intron_variant	0			AY254100	CCDS33872.1	3q23-q24	2014-01-28	2012-03-22		ENSG00000181804	ENSG00000181804		"""Solute carriers"""	20653	protein-coding gene	gene with protein product		608396	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 9"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 9"""			14569117	Standard	NM_173653		Approved	FLJ35613, NHE9	uc003evn.3	Q8IVB4	OTTHUMG00000159373	ENST00000316549.6:c.1470-41C>G	3.37:g.143100997G>C			A6NMQ9|Q3LIC2|Q5JPI6|Q5WA58|Q8NAB9	RNA	SNP	-	NULL	ENST00000316549.6	37	NULL	CCDS33872.1	3																																																																																			SLC9A9-AS2	-	-	ENSG00000244493		0.448	SLC9A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A9-AS2	HGNC	protein_coding	OTTHUMT00000354994.1	-	0.00	30	0	G	NM_173653		143100997	+1	tier1	-	no_errors	ENST00000490153	ensembl	human	known	74_37	rna	8.51	43	4	SNP	0.003	C
SMAD4	4089	genome.wustl.edu	37	18	48575671	48575671	+	Nonsense_Mutation	SNP	C	C	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr18:48575671C>G	ENST00000342988.3	+	4	969	c.431C>G	c.(430-432)tCa>tGa	p.S144*	SMAD4_ENST00000452201.2_Nonsense_Mutation_p.S144*|SMAD4_ENST00000588745.1_Nonsense_Mutation_p.S144*|SMAD4_ENST00000398417.2_Nonsense_Mutation_p.S144*|RP11-729L2.2_ENST00000590722.2_3'UTR	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	144					atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.S144*(5)|p.?(4)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		TAAGATCTCTCAGGATTAACA	0.294																																																	45	Whole gene deletion(36)|Substitution - Nonsense(5)|Unknown(4)	pancreas(26)|lung(4)|breast(4)|large_intestine(3)|stomach(3)|upper_aerodigestive_tract(2)|skin(1)|oesophagus(1)|NS(1)											182.0	163.0	169.0					18																	48575671		2202	4298	6500	SO:0001587	stop_gained	0			U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.431C>G	18.37:g.48575671C>G	ENSP00000341551:p.Ser144*		A8K405	Nonsense_Mutation	SNP	pfam_SMAD_dom_Dwarfin-type,pfam_MAD_homology1_Dwarfin-type,superfamily_SMAD_FHA_domain,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,smart_SMAD_dom_Dwarfin-type,pfscan_MAD_homology_MH1,pfscan_SMAD_dom_Dwarfin-type	p.S144*	ENST00000342988.3	37	c.431	CCDS11950.1	18	.	.	.	.	.	.	.	.	.	.	C	42	9.517242	0.99193	.	.	ENSG00000141646	ENST00000452201;ENST00000342988;ENST00000544926;ENST00000398417	.	.	.	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	.	19.1014	0.93275	0.0:1.0:0.0:0.0	.	.	.	.	X	144	.	ENSP00000341551:S144X	S	+	2	0	SMAD4	46829669	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.885000	0.63142	2.810000	0.96702	0.585000	0.79938	TCA	SMAD4	-	NULL	ENSG00000141646		0.294	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SMAD4	HGNC	protein_coding	OTTHUMT00000255993.3	-	0.00	25	0	C	NM_005359		48575671	+1	tier1	-	no_errors	ENST00000342988	ensembl	human	known	74_37	nonsense	15.09	45	8	SNP	1.000	G
SMARCA2	6595	genome.wustl.edu	37	9	2159836	2159836	+	Intron	SNP	G	G	A	rs559064348		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr9:2159836G>A	ENST00000382203.1	+	28	4190				SMARCA2_ENST00000349721.2_Intron|SMARCA2_ENST00000382194.1_Intron|SMARCA2_ENST00000324954.5_De_novo_Start_InFrame|RNU2-25P_ENST00000411041.1_RNA|SMARCA2_ENST00000382186.1_Intron|SMARCA2_ENST00000302401.3_Missense_Mutation_p.R9H|SMARCA2_ENST00000357248.2_Intron|SMARCA2_ENST00000382185.1_De_novo_Start_InFrame			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2						aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		CTAGCAGCTCGCTGCTTTGCT	0.388																																																	0													28.0	27.0	27.0					9																	2159836		876	1991	2867	SO:0001627	intron_variant	0			D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.3982-1850G>A	9.37:g.2159836G>A			B1ALG3|B1ALG4|D3DRH4|D3DRH5	Missense_Mutation	SNP	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.R9H	ENST00000382203.1	37	c.26	CCDS34977.1	9	.	.	.	.	.	.	.	.	.	.	G	19.39	3.818571	0.71028	.	.	ENSG00000080503	ENST00000302401;ENST00000423555;ENST00000417599	T;T;T	0.56275	2.86;0.47;2.8	5.93	5.93	0.95920	.	.	.	.	.	T	0.74726	0.3754	.	.	.	0.80722	D	1	D	0.71674	0.998	D	0.69479	0.964	T	0.75822	-0.3182	8	0.72032	D	0.01	.	20.3539	0.98825	0.0:0.0:1.0:0.0	.	9	B1ALF6	.	H	9;7;7	ENSP00000305411:R9H;ENSP00000413057:R7H;ENSP00000387486:R7H	ENSP00000305411:R9H	R	+	2	0	SMARCA2	2149836	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	9.049000	0.93837	2.826000	0.97356	0.655000	0.94253	CGC	SMARCA2	-	NULL	ENSG00000080503		0.388	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	SMARCA2	HGNC	protein_coding	OTTHUMT00000051505.1	-	0.00	48	0	G	NM_003070		2159836	+1	tier1	-	no_errors	ENST00000302401	ensembl	human	known	74_37	missense	5.97	63	4	SNP	1.000	A
SMARCC2	6601	genome.wustl.edu	37	12	56558481	56558481	+	Silent	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr12:56558481G>T	ENST00000267064.4	-	27	3260	c.3174C>A	c.(3172-3174)ccC>ccA	p.P1058P	SMARCC2_ENST00000347471.4_Silent_p.P1089P|RP11-977G19.5_ENST00000553176.1_RNA|SMARCC2_ENST00000550164.1_Silent_p.P1089P|SMARCC2_ENST00000394023.3_Silent_p.P1089P	NM_003075.3	NP_003066.2	Q8TAQ2	SMRC2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	1058	Pro-rich.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(18;0.123)			GCATCATTGAGGGAGGAGTTT	0.527																																																	0													30.0	30.0	30.0					12																	56558481		2203	4300	6503	SO:0001819	synonymous_variant	0			U66616	CCDS8907.1, CCDS8908.1, CCDS55835.1	12q13.2	2008-05-14				ENSG00000139613			11105	protein-coding gene	gene with protein product		601734				8804307, 9693044	Standard	NM_001130420		Approved	BAF170, Rsc8, CRACC2	uc001skb.3	Q8TAQ2	OTTHUMG00000170288	ENST00000267064.4:c.3174C>A	12.37:g.56558481G>T			F8VTJ5|Q59GV3|Q92923|Q96E12|Q96GY4	Silent	SNP	pfam_SWIRM,pfam_SANT/Myb,superfamily_Homeodomain-like,superfamily_BRCT_dom,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_SANT/Myb,pfscan_SWIRM,pfscan_Myb-like_dom	p.P1058	ENST00000267064.4	37	c.3174	CCDS8907.1	12																																																																																			SMARCC2	-	NULL	ENSG00000139613		0.527	SMARCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SMARCC2	HGNC	protein_coding	OTTHUMT00000408370.1	-	0.00	39	0	G			56558481	-1	tier1	-	no_errors	ENST00000267064	ensembl	human	known	74_37	silent	7.84	47	4	SNP	1.000	T
SMC5	23137	genome.wustl.edu	37	9	72892250	72892250	+	Silent	SNP	A	A	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr9:72892250A>G	ENST00000361138.5	+	4	463	c.405A>G	c.(403-405)gtA>gtG	p.V135V		NM_015110.3	NP_055925.2	Q8IY18	SMC5_HUMAN	structural maintenance of chromosomes 5	135					cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|mitotic nuclear division (GO:0007067)|positive regulation of maintenance of mitotic sister chromatid cohesion (GO:0034184)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|telomere maintenance via recombination (GO:0000722)	cell junction (GO:0030054)|chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(4)	35						GAAATCTTGTAATCACCCGTG	0.299																																																	0													62.0	64.0	63.0					9																	72892250		2203	4300	6503	SO:0001819	synonymous_variant	0			AB011166	CCDS6632.1	9q21.11	2008-02-05	2006-07-06	2006-07-06	ENSG00000198887	ENSG00000198887		"""Structural maintenance of chromosomes proteins"""	20465	protein-coding gene	gene with protein product		609386	"""SMC5 structural maintenance of chromosomes 5-like 1 (yeast)"""	SMC5L1		9628581	Standard	NM_015110		Approved	KIAA0594	uc004ahr.2	Q8IY18	OTTHUMG00000019992	ENST00000361138.5:c.405A>G	9.37:g.72892250A>G			A6NM81|O60335|Q05D92|Q5VZ60|Q96SB9	Silent	SNP	pfam_RecF/RecN/SMC_N,superfamily_P-loop_NTPase	p.V135	ENST00000361138.5	37	c.405	CCDS6632.1	9																																																																																			SMC5	-	pfam_RecF/RecN/SMC_N,superfamily_P-loop_NTPase	ENSG00000198887		0.299	SMC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC5	HGNC	protein_coding	OTTHUMT00000052603.1	-	0.00	82	0	A	NM_015110		72892250	+1	tier1	-	no_errors	ENST00000361138	ensembl	human	known	74_37	silent	9.92	109	12	SNP	0.805	G
DANCR	57291	genome.wustl.edu	37	4	53579529	53579529	+	RNA	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr4:53579529G>A	ENST00000411630.2	+	0	234				SNORA26_ENST00000391286.1_RNA|MIR4449_ENST00000578365.1_RNA	NR_024031.1		P0C864	DANCR_HUMAN	differentiation antagonizing non-protein coding RNA																		CCTGTCTGGAGTCACAACTGA	0.398																																																	0													129.0	126.0	127.0					4																	53579529		876	1991	2867			0			BC015222		4q12	2013-07-03	2012-02-09	2012-02-09	ENSG00000226950	ENSG00000226950		"""Long non-coding RNAs"", ""-"""	28964	non-coding RNA	RNA, long non-coding	"""anti-differentiation ncRNA"", ""adipogenesis up-regulated transcript 2"""	614625	"""KIAA0114"", ""small nucleolar RNA host gene 13 (non-protein coding)"""	KIAA0114, SNHG13		7788527, 22302877, 19531736	Standard	NR_024031		Approved	ANCR, AGU2	uc003gzo.2	P0C864	OTTHUMG00000154670		4.37:g.53579529G>A			A0A024RD90	RNA	SNP	-	NULL	ENST00000411630.2	37	NULL		4																																																																																			SNORA26	-	-	ENSG00000212588		0.398	DANCR-001	KNOWN	basic	lincRNA	SNORA26	HGNC	processed_transcript	OTTHUMT00000336530.1	-	0.00	70	0	G	NR_024031		53579529	+1	tier1	-	no_errors	ENST00000391286	ensembl	human	known	74_37	rna	14.56	88	15	SNP	1.000	A
SOCS6	9306	genome.wustl.edu	37	18	67992971	67992971	+	Missense_Mutation	SNP	G	G	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr18:67992971G>C	ENST00000397942.3	+	2	1383	c.1067G>C	c.(1066-1068)aGa>aCa	p.R356T	SOCS6_ENST00000582322.1_Missense_Mutation_p.R356T	NM_004232.3	NP_004223.2	O14544	SOCS6_HUMAN	suppressor of cytokine signaling 6	356					defense response (GO:0006952)|JAK-STAT cascade (GO:0007259)|negative regulation of signal transduction (GO:0009968)|negative regulation of T cell activation (GO:0050868)|proteasomal protein catabolic process (GO:0010498)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)	cytoplasm (GO:0005737)|immunological synapse (GO:0001772)				NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)	22		Esophageal squamous(42;0.129)|Colorectal(73;0.152)				GGGGTTGCAAGAGTTTATGAC	0.483																																					Melanoma(84;1024 1361 24382 36583 42651)												0													78.0	75.0	76.0					18																	67992971		2203	4300	6503	SO:0001583	missense	0			AB006968	CCDS11998.1	18q22	2013-02-14	2004-02-25	2004-02-27	ENSG00000170677	ENSG00000170677		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	16833	protein-coding gene	gene with protein product		605118	"""suppressor of cytokine signaling 4"""	SOCS4		9344848, 11042152	Standard	NM_004232		Approved	CIS4, SSI4, HSPC060, STATI4, STAI4, Cish4	uc002lkr.1	O14544	OTTHUMG00000132816	ENST00000397942.3:c.1067G>C	18.37:g.67992971G>C	ENSP00000381034:p.Arg356Thr		Q8WUM3	Missense_Mutation	SNP	pfam_SOCS_C,pfam_SH2,smart_SH2,smart_SOCS_C,pfscan_SOCS_C,pfscan_SH2	p.R356T	ENST00000397942.3	37	c.1067	CCDS11998.1	18	.	.	.	.	.	.	.	.	.	.	G	19.87	3.906841	0.72868	.	.	ENSG00000170677	ENST00000397942	T	0.30182	1.54	5.19	5.19	0.71726	.	0.064345	0.56097	D	0.000024	T	0.29882	0.0747	L	0.32530	0.975	0.58432	D	0.999999	P	0.35714	0.517	B	0.37198	0.243	T	0.12041	-1.0563	10	0.66056	D	0.02	-15.918	18.7481	0.91802	0.0:0.0:1.0:0.0	.	356	O14544	SOCS6_HUMAN	T	356	ENSP00000381034:R356T	ENSP00000381034:R356T	R	+	2	0	SOCS6	66143951	1.000000	0.71417	0.411000	0.26484	0.971000	0.66376	7.708000	0.84633	2.426000	0.82243	0.561000	0.74099	AGA	SOCS6	-	NULL	ENSG00000170677		0.483	SOCS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOCS6	HGNC	protein_coding	OTTHUMT00000256270.2	-	0.00	48	0	G			67992971	+1	tier1	-	no_errors	ENST00000397942	ensembl	human	known	74_37	missense	12.12	58	8	SNP	1.000	C
SPAG6	9576	genome.wustl.edu	37	10	22690089	22690089	+	Splice_Site	SNP	G	G	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr10:22690089G>C	ENST00000376624.3	+	9	1339		c.e9-1		SPAG6_ENST00000376601.1_Splice_Site|SPAG6_ENST00000490361.1_Splice_Site|RP11-301N24.3_ENST00000422675.1_RNA|SPAG6_ENST00000538630.1_Splice_Site|SPAG6_ENST00000313311.6_Splice_Site|SPAG6_ENST00000376603.2_Splice_Site	NM_001253855.1|NM_012443.3	NP_001240784.1|NP_036575.1	O75602	SPAG6_HUMAN	sperm associated antigen 6						cell projection organization (GO:0030030)|spermatid development (GO:0007286)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|motile cilium (GO:0031514)|nucleus (GO:0005634)				breast(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|prostate(1)|skin(2)	27						TGTATTTCTAGAGTAAAAAAG	0.318																																																	0													79.0	80.0	79.0					10																	22690089		2203	4300	6503	SO:0001630	splice_region_variant	0			AF079363	CCDS7139.1, CCDS7140.1, CCDS58071.1, CCDS73072.1	10p12.31	2014-01-21			ENSG00000077327	ENSG00000077327		"""Armadillo repeat containing"""	11215	protein-coding gene	gene with protein product	"""axoneme central apparatus protein"""	605730				10493827	Standard	NM_012443		Approved	Repro-SA-1, pf16, CT141	uc001iri.3	O75602	OTTHUMG00000017808	ENST00000376624.3:c.1198-1G>C	10.37:g.22690089G>C			A8K1I8|B4DXZ4|Q5VUX5|Q5VUX6|Q5VUX7|Q6FI74|Q8NHQ6	Splice_Site	SNP	-	e9-1	ENST00000376624.3	37	c.1426-1	CCDS7139.1	10	.	.	.	.	.	.	.	.	.	.	G	21.1	4.092318	0.76756	.	.	ENSG00000077327	ENST00000376624;ENST00000376603;ENST00000376601;ENST00000538630;ENST00000456231;ENST00000313311	.	.	.	5.22	5.22	0.72569	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.7921	0.91978	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SPAG6	22730095	1.000000	0.71417	0.974000	0.42286	0.911000	0.54048	4.891000	0.63185	2.443000	0.82685	0.650000	0.86243	.	SPAG6	-	-	ENSG00000077327		0.318	SPAG6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG6	HGNC	protein_coding	OTTHUMT00000047187.1	-	0.00	33	0	G		Intron	22690089	+1	tier1	-	no_errors	ENST00000376603	ensembl	human	known	74_37	splice_site	17.91	54	12	SNP	1.000	C
SPARCL1	8404	genome.wustl.edu	37	4	88414816	88414816	+	Missense_Mutation	SNP	T	T	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr4:88414816T>C	ENST00000282470.6	-	4	1606	c.1136A>G	c.(1135-1137)tAt>tGt	p.Y379C	SPARCL1_ENST00000503414.1_Missense_Mutation_p.Y254C|SPARCL1_ENST00000418378.1_Missense_Mutation_p.Y379C	NM_004684.4	NP_004675.3	Q14515	SPRL1_HUMAN	SPARC-like 1 (hevin)	379					signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(2)|stomach(2)	21				OV - Ovarian serous cystadenocarcinoma(123;0.00118)		TTTGAGGTGATAGGCAATGGA	0.458																																																	0													80.0	82.0	81.0					4																	88414816		2203	4300	6503	SO:0001583	missense	0			X86693	CCDS3622.1	4q22-q25	2013-01-10	2008-08-29		ENSG00000152583	ENSG00000152583		"""EF-hand domain containing"""	11220	protein-coding gene	gene with protein product		606041	"""SPARC-like 1 (mast9, hevin)"""			8488563, 7600298, 16844696	Standard	NM_001128310		Approved	MAST9	uc003hqs.4	Q14515	OTTHUMG00000130605	ENST00000282470.6:c.1136A>G	4.37:g.88414816T>C	ENSP00000282470:p.Tyr379Cys		B4E2Z0|E7ESU2|Q14800	Missense_Mutation	SNP	pfam_SPARC/Testican_Ca-bd-dom,pfam_Kazal_dom,pfam_Follistatin/Osteonectin_EGF,smart_Fol_N,smart_Kazal_dom,pirsf_SPARC-like_p1,pfscan_EF_hand_dom	p.Y379C	ENST00000282470.6	37	c.1136	CCDS3622.1	4	.	.	.	.	.	.	.	.	.	.	T	13.81	2.348347	0.41599	.	.	ENSG00000152583	ENST00000282470;ENST00000418378;ENST00000438050;ENST00000503414	D;D;D	0.90504	-2.68;-2.68;-2.68	4.32	3.11	0.35812	.	0.701394	0.13869	N	0.357131	D	0.91509	0.7319	L	0.36672	1.1	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.82099	-0.0625	10	0.72032	D	0.01	-6.83	7.9305	0.29899	0.0:0.0:0.209:0.791	.	379;379	Q8N4S1;Q14515	.;SPRL1_HUMAN	C	379;379;254;254	ENSP00000282470:Y379C;ENSP00000414856:Y379C;ENSP00000422903:Y254C	ENSP00000282470:Y379C	Y	-	2	0	SPARCL1	88633840	0.405000	0.25336	0.034000	0.17996	0.021000	0.10359	3.705000	0.54823	0.953000	0.37825	0.533000	0.62120	TAT	SPARCL1	-	pirsf_SPARC-like_p1	ENSG00000152583		0.458	SPARCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPARCL1	HGNC	protein_coding	OTTHUMT00000253059.2	-	0.00	20	0	T			88414816	-1	tier1	-	no_errors	ENST00000282470	ensembl	human	known	74_37	missense	16.22	31	6	SNP	0.054	C
SPARCL1	8404	genome.wustl.edu	37	4	88420738	88420738	+	Splice_Site	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr4:88420738C>A	ENST00000282470.6	-	2	460		c.e2-1		SPARCL1_ENST00000503414.1_Splice_Site|SPARCL1_ENST00000418378.1_Splice_Site	NM_004684.4	NP_004675.3	Q14515	SPRL1_HUMAN	SPARC-like 1 (hevin)						signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(2)|stomach(2)	21				OV - Ovarian serous cystadenocarcinoma(123;0.00118)		CTTTCCAGATCTGTGAACCAA	0.393																																																	0													97.0	103.0	101.0					4																	88420738		2203	4300	6503	SO:0001630	splice_region_variant	0			X86693	CCDS3622.1	4q22-q25	2013-01-10	2008-08-29		ENSG00000152583	ENSG00000152583		"""EF-hand domain containing"""	11220	protein-coding gene	gene with protein product		606041	"""SPARC-like 1 (mast9, hevin)"""			8488563, 7600298, 16844696	Standard	NM_001128310		Approved	MAST9	uc003hqs.4	Q14515	OTTHUMG00000130605	ENST00000282470.6:c.11-1G>T	4.37:g.88420738C>A			B4E2Z0|E7ESU2|Q14800	Splice_Site	SNP	-	e1-1	ENST00000282470.6	37	c.1-1	CCDS3622.1	4																																																																																			SPARCL1	-	-	ENSG00000152583		0.393	SPARCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPARCL1	HGNC	protein_coding	OTTHUMT00000253059.2	-	0.00	58	0	C		Intron	88420738	-1	tier1	-	no_errors	ENST00000282470	ensembl	human	known	74_37	splice_site	17.74	51	11	SNP	0.995	A
SPATA9	83890	genome.wustl.edu	37	5	94994532	94994532	+	Missense_Mutation	SNP	T	T	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr5:94994532T>C	ENST00000274432.8	-	5	701	c.560A>G	c.(559-561)gAa>gGa	p.E187G	SPATA9_ENST00000477047.2_5'UTR|RFESD_ENST00000508206.1_Intron	NM_031952.3	NP_114158.2	Q9BWV2	SPAT9_HUMAN	spermatogenesis associated 9	187					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)				large_intestine(3)|lung(4)	7		all_cancers(142;1.28e-06)|all_epithelial(76;1.55e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.00473)|Colorectal(57;0.0846)|Breast(839;0.198)		all cancers(79;8.91e-16)		TCTACAATTTTCACTCTCCTC	0.413																																																	0													130.0	121.0	124.0					5																	94994532		2203	4299	6502	SO:0001583	missense	0			AK093225	CCDS4076.1	5q15	2008-02-05			ENSG00000145757	ENSG00000145757			22988	protein-coding gene	gene with protein product		608039				12493713	Standard	NM_031952		Approved	NYD-SP16, FLJ35906	uc003klj.1	Q9BWV2	OTTHUMG00000121169	ENST00000274432.8:c.560A>G	5.37:g.94994532T>C	ENSP00000274432:p.Glu187Gly		A8K8H3|Q4G122|Q86X33|Q8NA28	Missense_Mutation	SNP	NULL	p.E187G	ENST00000274432.8	37	c.560	CCDS4076.1	5	.	.	.	.	.	.	.	.	.	.	T	6.749	0.507005	0.12883	.	.	ENSG00000145757	ENST00000274432	T	0.32988	1.43	5.35	2.86	0.33363	.	0.572586	0.16992	N	0.191242	T	0.16938	0.0407	N	0.19112	0.55	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.12477	-1.0546	10	0.45353	T	0.12	-5.6571	4.634	0.12516	0.1676:0.0906:0.0:0.7418	.	187	Q9BWV2	SPAT9_HUMAN	G	187	ENSP00000274432:E187G	ENSP00000274432:E187G	E	-	2	0	SPATA9	95020288	0.001000	0.12720	0.005000	0.12908	0.023000	0.10783	0.448000	0.21726	1.071000	0.40834	0.519000	0.50382	GAA	SPATA9	-	NULL	ENSG00000145757		0.413	SPATA9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA9	HGNC	protein_coding	OTTHUMT00000304036.1	-	0.00	29	0	T	NM_031952		94994532	-1	tier1	-	no_errors	ENST00000274432	ensembl	human	known	74_37	missense	16.67	30	6	SNP	0.001	C
SPATS1	221409	genome.wustl.edu	37	6	44329688	44329688	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr6:44329688C>T	ENST00000288390.2	+	4	880	c.533C>T	c.(532-534)tCa>tTa	p.S178L	SPATS1_ENST00000323108.8_Missense_Mutation_p.S178L|RP11-444E17.6_ENST00000505802.1_3'UTR			Q496A3	SPAS1_HUMAN	spermatogenesis associated, serine-rich 1	178										NS(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(2)|lung(5)|skin(1)|urinary_tract(1)	14	all_lung(25;0.00469)|Ovarian(13;0.0273)|all_hematologic(164;0.208)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			AGGTCTCTATCAGAGAGGACG	0.483																																																	0													195.0	186.0	189.0					6																	44329688		2203	4300	6503	SO:0001583	missense	0			AK058171	CCDS4911.1	6p21.1	2003-08-08			ENSG00000249481	ENSG00000249481			22957	protein-coding gene	gene with protein product							Standard	NM_145026		Approved	SPATA8, FLJ25442, SRSP1	uc021yzz.1	Q496A3	OTTHUMG00000014764	ENST00000288390.2:c.533C>T	6.37:g.44329688C>T	ENSP00000424400:p.Ser178Leu		Q496A2|Q496A5|Q96LJ0	Missense_Mutation	SNP	NULL	p.S178L	ENST00000288390.2	37	c.533	CCDS4911.1	6	.	.	.	.	.	.	.	.	.	.	C	17.60	3.430563	0.62844	.	.	ENSG00000249481	ENST00000323108;ENST00000288390	T;T	0.50548	0.74;0.74	5.71	4.84	0.62591	.	0.986626	0.08242	N	0.975888	T	0.41766	0.1173	M	0.62723	1.935	0.27787	N	0.942953	P	0.52316	0.952	P	0.49276	0.605	T	0.36286	-0.9754	10	0.66056	D	0.02	.	12.1284	0.53930	0.1712:0.8288:0.0:0.0	.	178	Q496A3	SPAS1_HUMAN	L	178	ENSP00000437552:S178L;ENSP00000424400:S178L	ENSP00000424400:S178L	S	+	2	0	SPATS1	44437666	0.217000	0.23597	0.860000	0.33809	0.469000	0.32828	1.124000	0.31320	1.412000	0.46977	0.655000	0.94253	TCA	SPATS1	-	NULL	ENSG00000249481		0.483	SPATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATS1	HGNC	protein_coding	OTTHUMT00000040738.2	-	0.00	47	0	C	NM_145026		44329688	+1	tier1	-	no_errors	ENST00000288390	ensembl	human	known	74_37	missense	23.44	49	15	SNP	0.928	T
SPEF2	79925	genome.wustl.edu	37	5	35709149	35709149	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr5:35709149C>A	ENST00000356031.3	+	19	2919	c.2765C>A	c.(2764-2766)cCa>cAa	p.P922Q	SPEF2_ENST00000440995.2_Missense_Mutation_p.P917Q|CTD-2113L7.1_ENST00000510433.1_RNA|SPEF2_ENST00000509059.1_Missense_Mutation_p.P917Q	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	922					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CCTCCTGAACCAGAAAAAGAG	0.428																																																	0													86.0	84.0	85.0					5																	35709149		1868	4105	5973	SO:0001583	missense	0			AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.2765C>A	5.37:g.35709149C>A	ENSP00000348314:p.Pro922Gln		Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Missense_Mutation	SNP	pfam_DUF1042,pfam_Adenylate_kin,pfam_HATC_dom_C,superfamily_P-loop_NTPase,superfamily_CH-domain,pfscan_CH-domain	p.P922Q	ENST00000356031.3	37	c.2765	CCDS43309.1	5	.	.	.	.	.	.	.	.	.	.	C	14.54	2.564698	0.45694	.	.	ENSG00000152582	ENST00000356031;ENST00000509059;ENST00000440995	T;T;T	0.09255	3.36;3.0;3.41	5.82	4.95	0.65309	.	0.456346	0.20991	N	0.082024	T	0.15392	0.0371	L	0.59436	1.845	0.80722	D	1	P;P;P	0.39883	0.567;0.693;0.567	B;P;B	0.44518	0.265;0.452;0.177	T	0.00609	-1.1646	10	0.36615	T	0.2	.	9.8431	0.41010	0.0:0.9092:0.0:0.0908	.	917;917;922	D6REZ4;Q9C093-2;Q9C093	.;.;SPEF2_HUMAN	Q	922;917;917	ENSP00000348314:P922Q;ENSP00000421593:P917Q;ENSP00000412125:P917Q	ENSP00000348314:P922Q	P	+	2	0	SPEF2	35744906	0.997000	0.39634	0.996000	0.52242	0.779000	0.44077	2.105000	0.41825	2.754000	0.94517	0.650000	0.86243	CCA	SPEF2	-	NULL	ENSG00000152582		0.428	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEF2	HGNC	protein_coding	OTTHUMT00000367199.1	-	0.00	29	0	C	NM_144722		35709149	+1	tier1	-	no_errors	ENST00000356031	ensembl	human	known	74_37	missense	6.15	61	4	SNP	0.998	A
SPEF2	79925	genome.wustl.edu	37	5	35795828	35795828	+	Missense_Mutation	SNP	T	T	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr5:35795828T>G	ENST00000356031.3	+	33	4915	c.4761T>G	c.(4759-4761)gaT>gaG	p.D1587E	SPEF2_ENST00000440995.2_Missense_Mutation_p.D1582E|CTD-2113L7.1_ENST00000510433.1_RNA|SPEF2_ENST00000303129.4_Missense_Mutation_p.D384E	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	1587					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TTACAGGAGATGAAGATATAA	0.348																																																	0													111.0	104.0	106.0					5																	35795828		1806	4063	5869	SO:0001583	missense	0			AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.4761T>G	5.37:g.35795828T>G	ENSP00000348314:p.Asp1587Glu		Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Missense_Mutation	SNP	pfam_DUF1042,pfam_Adenylate_kin,pfam_HATC_dom_C,superfamily_P-loop_NTPase,superfamily_CH-domain,pfscan_CH-domain	p.D1587E	ENST00000356031.3	37	c.4761	CCDS43309.1	5	.	.	.	.	.	.	.	.	.	.	T	16.06	3.014561	0.54468	.	.	ENSG00000152582	ENST00000356031;ENST00000440995;ENST00000303129	T;T;T	0.63744	-0.06;-0.06;-0.06	5.52	1.43	0.22495	.	0.170388	0.51477	N	0.000092	T	0.49762	0.1576	L	0.53249	1.67	0.25632	N	0.986294	B;B;B	0.30236	0.274;0.192;0.031	B;B;B	0.34722	0.188;0.054;0.014	T	0.27297	-1.0078	10	0.19590	T	0.45	.	3.6589	0.08232	0.1314:0.0747:0.1367:0.6572	.	384;1582;1587	Q9C093-4;Q9C093-2;Q9C093	.;.;SPEF2_HUMAN	E	1587;1582;384	ENSP00000348314:D1587E;ENSP00000412125:D1582E;ENSP00000303843:D384E	ENSP00000303843:D384E	D	+	3	2	SPEF2	35831585	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	0.975000	0.29449	0.434000	0.26340	0.383000	0.25322	GAT	SPEF2	-	NULL	ENSG00000152582		0.348	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEF2	HGNC	protein_coding	OTTHUMT00000367199.1	-	0.00	33	0	T	NM_144722		35795828	+1	tier1	-	no_errors	ENST00000356031	ensembl	human	known	74_37	missense	11.49	77	10	SNP	1.000	G
SPG20	23111	genome.wustl.edu	37	13	36900829	36900829	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr13:36900829C>A	ENST00000451493.1	-	5	1388	c.1171G>T	c.(1171-1173)Gat>Tat	p.D391Y	SPG20_ENST00000495510.1_5'UTR|SPG20_ENST00000438666.2_Missense_Mutation_p.D391Y|SPG20_ENST00000355182.4_Missense_Mutation_p.D391Y|SPG20_ENST00000494062.2_Missense_Mutation_p.D391Y	NM_001142295.1	NP_001135767.1	Q8N0X7	SPG20_HUMAN	spastic paraplegia 20 (Troyer syndrome)	391					abscission (GO:0009838)|adipose tissue development (GO:0060612)|cell death (GO:0008219)|cell division (GO:0051301)|lipid particle organization (GO:0034389)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of collateral sprouting in absence of injury (GO:0048698)|neuromuscular process (GO:0050905)|regulation of mitochondrial membrane potential (GO:0051881)	cytoplasm (GO:0005737)|lipid particle (GO:0005811)|midbody (GO:0030496)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	27		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;2.42e-08)|Epithelial(112;1.58e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00128)|BRCA - Breast invasive adenocarcinoma(63;0.0125)|GBM - Glioblastoma multiforme(144;0.026)		CTTGAAGTATCTTTAGCCTAA	0.353																																																	0													72.0	64.0	67.0					13																	36900829		2203	4300	6503	SO:0001583	missense	0			AB011182	CCDS9356.1	13q13.1	2008-07-04	2007-04-23		ENSG00000133104	ENSG00000133104			18514	protein-coding gene	gene with protein product	"""spartin"""	607111				6022528, 12134148	Standard	NM_001142294		Approved	KIAA0610, TAHCCP1	uc001uvm.3	Q8N0X7	OTTHUMG00000016730	ENST00000451493.1:c.1171G>T	13.37:g.36900829C>A	ENSP00000414147:p.Asp391Tyr		O60349|Q86Y67|Q9H1T2|Q9H1T3	Missense_Mutation	SNP	pfam_Senescence/spartin,pfam_MIT,smart_MIT	p.D391Y	ENST00000451493.1	37	c.1171	CCDS9356.1	13	.	.	.	.	.	.	.	.	.	.	C	15.31	2.797068	0.50208	.	.	ENSG00000133104	ENST00000438666;ENST00000355182;ENST00000451493;ENST00000423217	D;D;D	0.90004	-2.6;-2.6;-2.6	5.68	4.84	0.62591	.	0.921722	0.09305	N	0.820379	D	0.89914	0.6853	L	0.40543	1.245	0.39616	D	0.969961	P;D	0.55385	0.911;0.971	P;P	0.52309	0.594;0.695	D	0.86345	0.1707	10	0.62326	D	0.03	-9.2231	14.7443	0.69480	0.0:0.9305:0.0:0.0695	.	391;391	B3KMI3;Q8N0X7	.;SPG20_HUMAN	Y	391	ENSP00000406061:D391Y;ENSP00000347314:D391Y;ENSP00000414147:D391Y	ENSP00000347314:D391Y	D	-	1	0	SPG20	35798829	0.991000	0.36638	0.726000	0.30738	0.691000	0.40173	4.408000	0.59761	1.396000	0.46663	0.563000	0.77884	GAT	SPG20	-	NULL	ENSG00000133104		0.353	SPG20-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SPG20	HGNC	protein_coding	OTTHUMT00000044494.2	-	0.00	33	0	C			36900829	-1	tier1	-	no_errors	ENST00000355182	ensembl	human	known	74_37	missense	21.05	30	8	SNP	0.994	A
SRGAP2-AS1	100873165	genome.wustl.edu	37	1	206553834	206553835	+	RNA	INS	-	-	T	rs529950543	byFrequency	TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr1:206553834_206553835insT	ENST00000450872.1	-	0	561_562									SRGAP2 antisense RNA 1																		ATTTAGGCATCTTTTTTTTTTT	0.361													|||unknown(HR)	28	0.00559105	0.0061	0.0	5008	,	,		17750	0.0188		0.0	False		,,,				2504	0.001																0																																												0			AK127439		1q32.1	2012-10-12	2012-08-15		ENSG00000233501	ENSG00000233501		"""Long non-coding RNAs"""	40902	non-coding RNA	RNA, long non-coding			"""SRGAP2 antisense RNA 1 (non-protein coding)"""				Standard	NR_104189		Approved				OTTHUMG00000036348		1.37:g.206553845_206553845dupT				RNA	INS	-	NULL	ENST00000450872.1	37	NULL		1																																																																																			SRGAP2-AS1	-	-	ENSG00000233501		0.361	SRGAP2-AS1-001	KNOWN	basic	antisense	SRGAP2-AS1	HGNC	antisense	OTTHUMT00000088497.1		0.00	30	0	0			206553835	-1			no_errors	ENST00000450872	ensembl	human	known	74_37	rna	8.08	91	8	INS	0.918:0.853	T
SRPK3	26576	genome.wustl.edu	37	X	153047267	153047267	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chrX:153047267G>T	ENST00000370101.3	+	4	415	c.369G>T	c.(367-369)gaG>gaT	p.E123D	SRPK3_ENST00000489426.1_Missense_Mutation_p.E190D|SRPK3_ENST00000370108.3_Missense_Mutation_p.E123D|SRPK3_ENST00000370100.1_Missense_Mutation_p.E81D|SRPK3_ENST00000370104.1_Missense_Mutation_p.E123D|SRPK3_ENST00000393786.3_Missense_Mutation_p.E123D	NM_001170760.1|NM_014370.3	NP_001164231.1|NP_055185.2	Q9UPE1	SRPK3_HUMAN	SRSF protein kinase 3	123	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|muscle tissue development (GO:0060537)|skeletal muscle tissue development (GO:0007519)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(2)|lung(4)|ovary(2)|pancreas(2)|urinary_tract(1)	13	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					CTGTGGATGAGATCAAGCTCC	0.622																																					Esophageal Squamous(167;766 3400 32156)												0													122.0	93.0	103.0					X																	153047267		2202	4300	6502	SO:0001583	missense	0			AF027406	CCDS35441.1, CCDS55537.1, CCDS55538.1	Xq28	2010-06-23	2010-06-23	2006-08-17	ENSG00000184343	ENSG00000184343			11402	protein-coding gene	gene with protein product			"""serine/threonine kinase 23"", ""SFRS protein kinase 3"""	STK23		16140986	Standard	NM_014370		Approved	MSSK1	uc004fil.3	Q9UPE1	OTTHUMG00000024207	ENST00000370101.3:c.369G>T	X.37:g.153047267G>T	ENSP00000359119:p.Glu123Asp		Q13583|Q4F970|Q562F5|Q9UM62	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	p.E123D	ENST00000370101.3	37	c.369	CCDS35441.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.7|21.7	4.188318|4.188318	0.78789|0.78789	.|.	.|.	ENSG00000184343|ENSG00000184343	ENST00000489426;ENST00000393786;ENST00000370104;ENST00000370108;ENST00000370101;ENST00000370100|ENST00000430541	T;T;T;T;T;T|.	0.59772|.	0.24;0.24;0.24;0.24;0.24;0.24|.	5.93|5.93	5.04|5.04	0.67666|0.67666	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.56097|.	D|.	0.000036|.	T|T	0.79816|0.79816	0.4511|0.4511	M|M	0.90595|0.90595	3.13|3.13	0.58432|0.58432	D|D	0.999999|0.999999	D;D;D;D;D|.	0.71674|.	0.998;0.992;0.989;0.957;0.998|.	D;D;D;D;D|.	0.87578|.	0.996;0.973;0.99;0.966;0.998|.	T|T	0.82847|0.82847	-0.0255|-0.0255	10|5	0.87932|.	D|.	0|.	-41.6856|-41.6856	12.3332|12.3332	0.55051|0.55051	0.0881:0.0:0.9119:0.0|0.0881:0.0:0.9119:0.0	.|.	81;123;123;123;190|.	Q9UPE1-2;Q9UPE1-4;Q9UPE1-3;Q9UPE1;E7ETV6|.	.;.;.;SRPK3_HUMAN;.|.	D|I	190;123;123;123;123;81|137	ENSP00000420058:E190D;ENSP00000377376:E123D;ENSP00000359122:E123D;ENSP00000359126:E123D;ENSP00000359119:E123D;ENSP00000359118:E81D|.	ENSP00000359118:E81D|.	E|R	+|+	3|2	2|0	SRPK3|SRPK3	152700461|152700461	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	1.835000|1.835000	0.39181|0.39181	1.199000|1.199000	0.43173|0.43173	0.529000|0.529000	0.55759|0.55759	GAG|AGA	SRPK3	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	ENSG00000184343		0.622	SRPK3-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	SRPK3	HGNC	protein_coding	OTTHUMT00000354501.1	-	0.00	42	0	G	NM_014370		153047267	+1	tier1	-	no_errors	ENST00000370101	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	T
SRRM5	100170229	genome.wustl.edu	37	19	44116715	44116715	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr19:44116715C>A	ENST00000607544.1	+	3	764	c.442C>A	c.(442-444)Cat>Aat	p.H148N	ZNF428_ENST00000300811.3_Intron|SRRM5_ENST00000417606.1_Missense_Mutation_p.H148N|SRRM5_ENST00000526798.1_Missense_Mutation_p.H163N			B3KS81	SRRM5_HUMAN	serine/arginine repetitive matrix 5	148	Ser-rich.									endometrium(11)|kidney(2)|skin(1)|stomach(1)	15						GATAAGAACTCATGGTGCCAG	0.617																																																	0													44.0	54.0	51.0					19																	44116715		692	1591	2283	SO:0001583	missense	0			AK297891	CCDS46095.1	19q13.31	2013-09-20			ENSG00000226763	ENSG00000226763			37248	protein-coding gene	gene with protein product							Standard	NM_001145641		Approved		uc010xwr.2	B3KS81	OTTHUMG00000165480	ENST00000607544.1:c.442C>A	19.37:g.44116715C>A	ENSP00000476253:p.His148Asn		B4DNF0	Missense_Mutation	SNP	NULL	p.H163N	ENST00000607544.1	37	c.487	CCDS46095.1	19	.	.	.	.	.	.	.	.	.	.	C	12.65	2.001996	0.35320	.	.	ENSG00000226763	ENST00000526798;ENST00000417606	.	.	.	4.19	3.15	0.36227	.	.	.	.	.	T	0.28101	0.0693	N	0.19112	0.55	0.09310	N	0.999996	B	0.20671	0.047	B	0.20767	0.031	T	0.17167	-1.0378	8	0.42905	T	0.14	.	9.6323	0.39787	0.2075:0.7925:0.0:0.0	.	148	B3KS81	SRRM5_HUMAN	N	163;148	.	ENSP00000414512:H148N	H	+	1	0	SRRM5	48808555	0.447000	0.25673	0.004000	0.12327	0.772000	0.43724	1.673000	0.37534	1.357000	0.45904	0.655000	0.94253	CAT	SRRM5	-	NULL	ENSG00000226763		0.617	SRRM5-001	KNOWN	alternative_5_UTR|upstream_ATG|basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	SRRM5	HGNC	protein_coding	OTTHUMT00000384398.2		0.00	65	0	C	NM_001145641		44116715	+1			no_errors	ENST00000526798	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.024	A
STK32A	202374	genome.wustl.edu	37	5	146730628	146730628	+	Splice_Site	SNP	G	G	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr5:146730628G>C	ENST00000397936.3	+	7	806	c.473G>C	c.(472-474)gGg>gCg	p.G158A	STK32A_ENST00000398523.3_Splice_Site_p.G158A	NM_001112724.1	NP_001106195.1	Q8WU08	ST32A_HUMAN	serine/threonine kinase 32A	158	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|prostate(1)|skin(1)	13			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCTCTGCAGGGCACGTGCAC	0.468																																																	0													80.0	69.0	72.0					5																	146730628		1568	3582	5150	SO:0001630	splice_region_variant	0				CCDS47299.1, CCDS75351.1	5q32	2008-02-05			ENSG00000169302	ENSG00000169302			28317	protein-coding gene	gene with protein product						12477932	Standard	NM_001112724		Approved	MGC22688, YANK1	uc010jgn.1	Q8WU08	OTTHUMG00000163411	ENST00000397936.3:c.473-1G>C	5.37:g.146730628G>C			B3KSY0	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.G158A	ENST00000397936.3	37	c.473	CCDS47299.1	5	.	.	.	.	.	.	.	.	.	.	G	20.5	3.996477	0.74818	.	.	ENSG00000169302	ENST00000397936;ENST00000398523	T;T	0.30981	1.51;1.51	5.31	5.31	0.75309	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.45606	D	0.000346	T	0.53658	0.1810	M	0.69358	2.11	0.80722	D	1	D;D;D	0.89917	1.0;0.998;1.0	D;P;D	0.79784	0.993;0.905;0.989	T	0.51513	-0.8696	9	.	.	.	.	15.8829	0.79216	0.0:0.0:1.0:0.0	.	158;158;158	B7Z9H7;Q8WU08;Q8WU08-3	.;ST32A_HUMAN;.	A	158	ENSP00000381030:G158A;ENSP00000381535:G158A	.	G	+	2	0	STK32A	146710821	1.000000	0.71417	1.000000	0.80357	0.764000	0.43329	6.408000	0.73285	2.489000	0.83994	0.561000	0.74099	GGG	STK32A	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000169302		0.468	STK32A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	STK32A	HGNC	protein_coding	OTTHUMT00000373306.1	-	0.00	22	0	G	NM_145001	Missense_Mutation	146730628	+1	tier1	-	no_errors	ENST00000397936	ensembl	human	known	74_37	missense	14.29	36	6	SNP	1.000	C
GTF2A1L	11036	genome.wustl.edu	37	2	48906575	48906575	+	Missense_Mutation	SNP	G	G	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr2:48906575G>C	ENST00000403751.3	+	9	1468	c.1431G>C	c.(1429-1431)gaG>gaC	p.E477D	STON1-GTF2A1L_ENST00000394751.3_Missense_Mutation_p.E1134D|STON1-GTF2A1L_ENST00000309827.2_Missense_Mutation_p.E1181D|STON1-GTF2A1L_ENST00000394754.1_Missense_Mutation_p.E1181D|STON1-GTF2A1L_ENST00000402114.2_Intron|GTF2A1L_ENST00000430487.2_Missense_Mutation_p.E443D|STON1-GTF2A1L_ENST00000405008.1_Missense_Mutation_p.E1181D	NM_006872.3	NP_006863.2	Q9UNN4	TF2AY_HUMAN	general transcription factor IIA, 1-like	477					cognition (GO:0050890)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|transcription factor TFIIA complex (GO:0005672)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)	p.E1181D(1)		lung(7)	7		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			GTGATGCAGAGTGGTAAACCT	0.348																																																	1	Substitution - Missense(1)	lung(1)											163.0	146.0	152.0					2																	48906575		2203	4300	6503	SO:0001583	missense	0			AF106857	CCDS46281.1, CCDS54359.1	2p16.3	2007-08-02			ENSG00000242441	ENSG00000242441			30727	protein-coding gene	gene with protein product	"""TFIIA alpha/beta like factor"""	605358				10364255, 11889132, 16525715	Standard	NM_006872		Approved	ALF		Q9UNN4	OTTHUMG00000152038	ENST00000403751.3:c.1431G>C	2.37:g.48906575G>C	ENSP00000384597:p.Glu477Asp		B4DY14|Q53FD9|Q5D050	Missense_Mutation	SNP	pfam_TFIIA_asu/bsu,pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C,superfamily_TFIIA_b-brl,superfamily_TFIIA_a-hlx,pfscan_Clathrin_mu_C,pfscan_SHD	p.E1181D	ENST00000403751.3	37	c.3543	CCDS46281.1	2	.	.	.	.	.	.	.	.	.	.	G	20.1	3.937714	0.73557	.	.	ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000242441;ENSG00000242441	ENST00000405008;ENST00000394754;ENST00000309827;ENST00000394751;ENST00000394749;ENST00000430487;ENST00000403751	T;T;T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08;-0.08;-0.08	5.79	3.05	0.35203	Transcription factor IIA, beta-barrel (2);	0.000000	0.85682	D	0.000000	T	0.78597	0.4308	M	0.87827	2.91	0.80722	D	1	D;D;P;D	0.89917	1.0;0.999;0.861;0.986	D;D;P;D	0.83275	0.996;0.991;0.856;0.961	T	0.77757	-0.2468	10	0.87932	D	0	.	8.3723	0.32423	0.2968:0.0:0.7032:0.0	.	443;1134;477;1181	Q9UNN4-2;A8MXJ1;Q9UNN4;Q53S48	.;.;TF2AY_HUMAN;.	D	1181;1181;1181;1134;476;443;477	ENSP00000385499:E1181D;ENSP00000378236:E1181D;ENSP00000311493:E1181D;ENSP00000378234:E1134D;ENSP00000387896:E443D;ENSP00000384597:E477D	ENSP00000384597:E477D	E	+	3	2	STON1-GTF2A1L;GTF2A1L	48760079	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.001000	0.49488	0.371000	0.24564	-0.136000	0.14681	GAG	STON1-GTF2A1L	-	pfam_TFIIA_asu/bsu,superfamily_TFIIA_b-brl	ENSG00000068781		0.348	GTF2A1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STON1-GTF2A1L	HGNC	protein_coding	OTTHUMT00000323852.4	-	0.00	56	0	G	NM_006872		48906575	+1	tier1	-	no_errors	ENST00000309827	ensembl	human	known	74_37	missense	12.62	90	13	SNP	1.000	C
SYCP1	6847	genome.wustl.edu	37	1	115537701	115537701	+	3'UTR	SNP	T	T	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr1:115537701T>G	ENST00000369522.3	+	0	3232				SYCP1_ENST00000369518.1_3'UTR|SYCP1_ENST00000477590.1_3'UTR	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1						chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)		RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TAATATTTTGTTCTTATTTGC	0.264																																																	0																																										SO:0001624	3_prime_UTR_variant	0			D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.*61T>G	1.37:g.115537701T>G			O14963|Q5VXJ6	RNA	SNP	-	NULL	ENST00000369522.3	37	NULL	CCDS879.1	1																																																																																			SYCP1	-	-	ENSG00000198765		0.264	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP1	HGNC	protein_coding	OTTHUMT00000033386.1	-	0.00	31	0	T	NM_003176		115537701	+1	tier1	-	no_errors	ENST00000477590	ensembl	human	known	74_37	rna	17.91	55	12	SNP	0.000	G
SYNE3	161176	genome.wustl.edu	37	14	95906111	95906111	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr14:95906111G>A	ENST00000334258.5	-	12	2098	c.2084C>T	c.(2083-2085)gCa>gTa	p.A695V	SYNE3_ENST00000554873.1_Missense_Mutation_p.A452V|SYNE3_ENST00000557275.1_Missense_Mutation_p.A695V	NM_152592.3	NP_689805.3	Q6ZMZ3	SYNE3_HUMAN	spectrin repeat containing, nuclear envelope family member 3	695					cytoskeletal anchoring at nuclear membrane (GO:0090286)|cytoskeleton organization (GO:0007010)|establishment of protein localization to membrane (GO:0090150)|regulation of cell shape (GO:0008360)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear outer membrane (GO:0005640)|SUN-KASH complex (GO:0034993)	actin filament binding (GO:0051015)			breast(1)|endometrium(2)|lung(25)	28						CGGGAATTCTGCCACCAGCCT	0.617																																																	0													38.0	41.0	40.0					14																	95906111		2203	4300	6503	SO:0001583	missense	0			AK098471	CCDS9935.1	14q32.13	2012-05-31	2012-05-31	2012-05-31	ENSG00000176438	ENSG00000176438			19861	protein-coding gene	gene with protein product		610861	"""chromosome 14 open reading frame 49"""	C14orf49			Standard	NM_152592		Approved	FLJ25605, NET53, Nesprin-3, Nesp3	uc001yei.4	Q6ZMZ3	OTTHUMG00000171632	ENST00000334258.5:c.2084C>T	14.37:g.95906111G>A	ENSP00000334308:p.Ala695Val		A6H8H3|Q86SX5|Q8N7G8	Missense_Mutation	SNP	pfam_KASH,pfam_Spectrin_repeat,superfamily_Retrov_capsid_C,smart_Spectrin/alpha-actinin,pfscan_KASH	p.A695V	ENST00000334258.5	37	c.2084	CCDS9935.1	14	.	.	.	.	.	.	.	.	.	.	G	19.53	3.844803	0.71603	.	.	ENSG00000176438	ENST00000334258;ENST00000554873;ENST00000557275	T;T;T	0.55588	0.51;0.51;0.51	5.34	2.34	0.29019	.	0.370391	0.19615	N	0.110060	T	0.61223	0.2330	M	0.71581	2.175	0.42806	D	0.993941	P;P	0.49358	0.905;0.923	P;P	0.54100	0.53;0.742	T	0.61917	-0.6964	10	0.54805	T	0.06	-1.6909	9.6137	0.39679	0.0:0.1366:0.5809:0.2825	.	695;695	Q6ZMZ3-2;Q6ZMZ3	.;SYNE3_HUMAN	V	695;452;695	ENSP00000334308:A695V;ENSP00000452154:A452V;ENSP00000450562:A695V	ENSP00000334308:A695V	A	-	2	0	C14orf49	94975864	0.906000	0.30813	0.524000	0.27887	0.935000	0.57460	1.320000	0.33666	0.604000	0.29930	0.561000	0.74099	GCA	SYNE3	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000176438		0.617	SYNE3-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE3	HGNC	protein_coding	OTTHUMT00000420529.2	-	0.00	42	0	G	NM_152592		95906111	-1	tier1	-	no_errors	ENST00000334258	ensembl	human	known	74_37	missense	11.83	82	11	SNP	0.480	A
TANC2	26115	genome.wustl.edu	37	17	61482569	61482569	+	Silent	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr17:61482569C>A	ENST00000424789.2	+	18	3200	c.3196C>A	c.(3196-3198)Cga>Aga	p.R1066R	RP11-269G24.3_ENST00000583552.1_RNA|TANC2_ENST00000389520.4_Silent_p.R1066R|AC015923.1_ENST00000431604.1_RNA	NM_025185.3	NP_079461.2	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2	1066					in utero embryonic development (GO:0001701)					breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|upper_aerodigestive_tract(3)	44						GCCAAACCGCCGAGGAGCAGT	0.617																																																	0													19.0	21.0	20.0					17																	61482569		2011	4162	6173	SO:0001819	synonymous_variant	0			AB032974	CCDS45754.1	17q23.3	2013-01-11				ENSG00000170921		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30212	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	615047					Standard	NM_025185		Approved	DKFZP564D166, FLJ10215, FLJ11824, KIAA1148, KIAA1636, rols, ROLSA	uc002jal.4	Q9HCD6		ENST00000424789.2:c.3196C>A	17.37:g.61482569C>A			Q9HAC3|Q9NW88|Q9NXY9|Q9ULS2	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_P-loop_NTPase,smart_Ankyrin_rpt,smart_TPR_repeat,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_Ankyrin_rpt	p.R1066	ENST00000424789.2	37	c.3196	CCDS45754.1	17																																																																																			TANC2	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000170921		0.617	TANC2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TANC2	HGNC	protein_coding	OTTHUMT00000444765.1		0.00	24	0	C			61482569	+1			no_errors	ENST00000424789	ensembl	human	known	74_37	silent	5.71	33	2	SNP	1.000	A
TANGO6	79613	genome.wustl.edu	37	16	68912159	68912159	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr16:68912159C>A	ENST00000261778.1	+	6	1282	c.1270C>A	c.(1270-1272)Ctt>Att	p.L424I		NM_024562.1	NP_078838.1	Q9C0B7	TNG6_HUMAN	transport and golgi organization 6 homolog (Drosophila)	424						integral component of membrane (GO:0016021)											GTTAGCTCCTCTTCATCGATG	0.428																																																	0													78.0	76.0	77.0					16																	68912159		2060	4208	6268	SO:0001583	missense	0				CCDS45516.1	16q22.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000103047	ENSG00000103047			25749	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 7"""	TMCO7		11214970	Standard	NM_024562		Approved	FLJ12688, KIAA1746	uc002ewi.4	Q9C0B7	OTTHUMG00000176743	ENST00000261778.1:c.1270C>A	16.37:g.68912159C>A	ENSP00000261778:p.Leu424Ile		Q569F9|Q9H9K1	Missense_Mutation	SNP	pfam_DUF2435,pfam_DUF2411,superfamily_ARM-type_fold	p.L424I	ENST00000261778.1	37	c.1270	CCDS45516.1	16	.	.	.	.	.	.	.	.	.	.	C	12.70	2.017096	0.35606	.	.	ENSG00000103047	ENST00000261778	.	.	.	5.49	2.06	0.26882	.	.	.	.	.	T	0.38188	0.1031	L	0.41236	1.265	0.35905	D	0.830689	B	0.17465	0.022	B	0.17433	0.018	T	0.42275	-0.9461	8	0.39692	T	0.17	-4.6178	4.7356	0.12986	0.1992:0.5872:0.1283:0.0852	.	424	Q9C0B7	TMCO7_HUMAN	I	424	.	ENSP00000261778:L424I	L	+	1	0	TMCO7	67469660	0.992000	0.36948	0.989000	0.46669	0.920000	0.55202	1.492000	0.35594	1.337000	0.45525	-0.136000	0.14681	CTT	TANGO6	-	NULL	ENSG00000103047		0.428	TANGO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TANGO6	HGNC	protein_coding	OTTHUMT00000433471.2	-	0.00	80	0	C	XM_928235.2		68912159	+1	tier1	-	no_errors	ENST00000261778	ensembl	human	known	74_37	missense	19.80	81	20	SNP	0.973	A
TBC1D12	23232	genome.wustl.edu	37	10	96163148	96163148	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr10:96163148G>T	ENST00000225235.4	+	1	888	c.778G>T	c.(778-780)Gcg>Tcg	p.A260S		NM_015188.1	NP_056003.1	O60347	TBC12_HUMAN	TBC1 domain family, member 12	260							Rab GTPase activator activity (GO:0005097)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(2)	20		Colorectal(252;0.0429)				TAATGGGGGTGCGGAGCCGCG	0.701																																																	0													6.0	9.0	8.0					10																	96163148		1727	3822	5549	SO:0001583	missense	0			AB011180	CCDS41553.1	10q23.33	2013-09-20			ENSG00000108239	ENSG00000108239			29082	protein-coding gene	gene with protein product						9628581	Standard	NM_015188		Approved	KIAA0608	uc001kjr.2	O60347	OTTHUMG00000018794	ENST00000225235.4:c.778G>T	10.37:g.96163148G>T	ENSP00000225235:p.Ala260Ser		Q5VYA6|Q8WX26|Q8WX59|Q9UG83	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.A260S	ENST00000225235.4	37	c.778	CCDS41553.1	10	.	.	.	.	.	.	.	.	.	.	G	22.0	4.232145	0.79688	.	.	ENSG00000108239	ENST00000225235	T	0.06218	3.33	3.63	3.63	0.41609	.	0.390669	0.18763	N	0.131823	T	0.03520	0.0101	N	0.14661	0.345	0.27825	N	0.941671	P	0.46987	0.888	B	0.38985	0.287	T	0.26643	-1.0097	10	0.07325	T	0.83	-6.7312	13.1335	0.59395	0.0:0.0:1.0:0.0	.	260	O60347	TBC12_HUMAN	S	260	ENSP00000225235:A260S	ENSP00000225235:A260S	A	+	1	0	TBC1D12	96153138	.	.	0.595000	0.28798	0.273000	0.26683	.	.	2.022000	0.59522	0.462000	0.41574	GCG	TBC1D12	-	NULL	ENSG00000108239		0.701	TBC1D12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D12	HGNC	protein_coding	OTTHUMT00000049482.2		0.00	20	0	G			96163148	+1			no_errors	ENST00000225235	ensembl	human	known	74_37	missense	12.12	29	4	SNP	0.834	T
TBX20	57057	genome.wustl.edu	37	7	35289630	35289630	+	Missense_Mutation	SNP	C	C	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr7:35289630C>G	ENST00000408931.3	-	2	839	c.313G>C	c.(313-315)Gag>Cag	p.E105Q		NM_001077653.2|NM_001166220.1	NP_001071121.1|NP_001159692.1	Q9UMR3	TBX20_HUMAN	T-box 20	105					aortic valve morphogenesis (GO:0003180)|atrial septum morphogenesis (GO:0060413)|blood circulation (GO:0008015)|cardiac chamber formation (GO:0003207)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|dorsal/ventral pattern formation (GO:0009953)|embryonic heart tube elongation (GO:0036306)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cushion formation (GO:0003272)|endocardial cushion morphogenesis (GO:0003203)|endoderm formation (GO:0001706)|foramen ovale closure (GO:0035922)|heart looping (GO:0001947)|lateral mesoderm formation (GO:0048370)|muscle contraction (GO:0006936)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron migration (GO:0001764)|outflow tract septum morphogenesis (GO:0003148)|patterning of blood vessels (GO:0001569)|pericardium morphogenesis (GO:0003344)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary valve formation (GO:0003193)|pulmonary vein morphogenesis (GO:0060577)|tricuspid valve development (GO:0003175)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|lung(9)|prostate(1)|skin(1)|stomach(1)	18						TCCTTGGTCTCCAGGCTGCAG	0.592																																																	0													68.0	60.0	63.0					7																	35289630		2203	4300	6503	SO:0001583	missense	0			AJ237589	CCDS43568.1	7p14.3	2014-09-17			ENSG00000164532	ENSG00000164532		"""T-boxes"""	11598	protein-coding gene	gene with protein product		606061				10936053	Standard	NM_001077653		Approved		uc011kas.2	Q9UMR3	OTTHUMG00000099411	ENST00000408931.3:c.313G>C	7.37:g.35289630C>G	ENSP00000386170:p.Glu105Gln		A4D1Y6|Q000T4|Q0IJ70|Q0VAS1|Q9Y2N5	Missense_Mutation	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.E105Q	ENST00000408931.3	37	c.313	CCDS43568.1	7	.	.	.	.	.	.	.	.	.	.	C	15.14	2.745625	0.49151	.	.	ENSG00000164532	ENST00000408931	D	0.88431	-2.38	5.59	4.71	0.59529	p53-like transcription factor, DNA-binding (1);	0.045657	0.85682	D	0.000000	D	0.93106	0.7805	M	0.66560	2.04	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	D	0.92566	0.6062	10	0.41790	T	0.15	.	14.5037	0.67739	0.0:0.9297:0.0:0.0703	.	105	Q9UMR3	TBX20_HUMAN	Q	105	ENSP00000386170:E105Q	ENSP00000386170:E105Q	E	-	1	0	TBX20	35256155	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.818000	0.86416	1.363000	0.46019	-0.140000	0.14226	GAG	TBX20	-	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box	ENSG00000164532		0.592	TBX20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBX20	HGNC	protein_coding	OTTHUMT00000216870.2	-	0.00	34	0	C	NM_020417		35289630	-1	tier1	-	no_errors	ENST00000408931	ensembl	human	known	74_37	missense	17.54	47	10	SNP	1.000	G
TCF7	6932	genome.wustl.edu	37	5	133473797	133473797	+	Silent	SNP	C	C	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr5:133473797C>T	ENST00000321584.4	+	4	685	c.489C>T	c.(487-489)taC>taT	p.Y163Y	TCF7_ENST00000432532.2_Silent_p.Y48Y|TCF7_ENST00000520958.1_Silent_p.Y48Y|TCF7_ENST00000378560.4_Silent_p.Y48Y|TCF7_ENST00000517478.1_3'UTR|TCF7_ENST00000321603.6_Silent_p.Y163Y|TCF7_ENST00000395029.1_Silent_p.Y163Y|TCF7_ENST00000395023.1_Silent_p.Y48Y|TCF7_ENST00000378564.1_Silent_p.Y163Y|TCF7_ENST00000518915.1_Silent_p.Y48Y|TCF7_ENST00000342854.5_Silent_p.Y163Y			P36402	TCF7_HUMAN	transcription factor 7 (T-cell specific, HMG-box)	163					alpha-beta T cell differentiation (GO:0046632)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cellular response to interleukin-4 (GO:0071353)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic hindgut morphogenesis (GO:0048619)|generation of neurons (GO:0048699)|immune response (GO:0006955)|neural tube development (GO:0021915)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|T cell receptor V(D)J recombination (GO:0033153)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			kidney(2)|large_intestine(7)|lung(2)|skin(1)	12		Breast(839;0.058)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TCTCTCTCTACGAACATTTCA	0.592																																																	0													129.0	120.0	123.0					5																	133473797		2203	4300	6503	SO:0001819	synonymous_variant	0			Z47362	CCDS4169.1, CCDS4170.1, CCDS43362.1, CCDS47263.1, CCDS47263.2	5q31	2008-02-05			ENSG00000081059	ENSG00000081059			11639	protein-coding gene	gene with protein product		189908					Standard	NM_003202		Approved	TCF-1	uc003kyt.3	P36402	OTTHUMG00000129124	ENST00000321584.4:c.489C>T	5.37:g.133473797C>T			B3KSH3|Q86WR9|Q9UKI4	Missense_Mutation	SNP	NULL	p.T66M	ENST00000321584.4	37	c.197		5																																																																																			TCF7	-	NULL	ENSG00000081059		0.592	TCF7-201	KNOWN	basic	protein_coding	TCF7	HGNC	protein_coding			0.00	60	0	C	NM_201634		133473797	+1			no_errors	ENST00000517741	ensembl	human	known	74_37	missense	5.00	56	3	SNP	0.995	T
TECTA	7007	genome.wustl.edu	37	11	120980130	120980130	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr11:120980130G>A	ENST00000392793.1	+	4	680	c.409G>A	c.(409-411)Gca>Aca	p.A137T	TECTA_ENST00000264037.2_Missense_Mutation_p.A137T			O75443	TECTA_HUMAN	tectorin alpha	137	NIDO. {ECO:0000255|PROSITE- ProRule:PRU00570}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.A137T(1)	TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		CAAAGACATGGCAACCTTCTC	0.458																																																	1	Substitution - Missense(1)	large_intestine(1)											110.0	109.0	109.0					11																	120980130		2203	4299	6502	SO:0001583	missense	0			AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.409G>A	11.37:g.120980130G>A	ENSP00000376543:p.Ala137Thr			Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_ZP_dom,pfam_Nidogen_extracell_dom,pfam_TIL_dom,superfamily_TIL_dom,smart_Nidogen_extracell_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,smart_ZP_dom,pfscan_ZP_dom	p.A137T	ENST00000392793.1	37	c.409	CCDS8434.1	11	.	.	.	.	.	.	.	.	.	.	G	11.44	1.639706	0.29157	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	T;T	0.37411	1.2;1.2	5.57	1.31	0.21738	Nidogen, extracellular domain (2);	0.273737	0.36740	N	0.002429	T	0.19005	0.0456	N	0.16656	0.425	0.25431	N	0.988185	B	0.17667	0.023	B	0.20955	0.032	T	0.22417	-1.0217	10	0.18710	T	0.47	.	8.639	0.33966	0.1457:0.447:0.4073:0.0	.	137	O75443	TECTA_HUMAN	T	137	ENSP00000376543:A137T;ENSP00000264037:A137T	ENSP00000264037:A137T	A	+	1	0	TECTA	120485340	0.327000	0.24678	1.000000	0.80357	0.996000	0.88848	-0.089000	0.11180	0.289000	0.22422	-0.126000	0.14955	GCA	TECTA	-	smart_Nidogen_extracell_dom	ENSG00000109927		0.458	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TECTA	HGNC	protein_coding	OTTHUMT00000313850.1	-	0.00	47	0	G	NM_005422		120980130	+1	tier1	-	no_errors	ENST00000264037	ensembl	human	known	74_37	missense	7.55	48	4	SNP	0.967	A
TENM1	10178	genome.wustl.edu	37	X	123838994	123838994	+	Missense_Mutation	SNP	A	A	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chrX:123838994A>G	ENST00000371130.3	-	5	947	c.884T>C	c.(883-885)cTt>cCt	p.L295P	TENM1_ENST00000422452.2_Missense_Mutation_p.L295P	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	295	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										GCTTCGAGGAAGAGGCCTGGG	0.527																																																	0													146.0	135.0	139.0					X																	123838994		2203	4300	6503	SO:0001583	missense	0			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.884T>C	X.37:g.123838994A>G	ENSP00000360171:p.Leu295Pro		B2RTR5|Q5JZ17	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD	p.L295P	ENST00000371130.3	37	c.884	CCDS14609.1	X	.	.	.	.	.	.	.	.	.	.	A	20.9	4.069830	0.76301	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	T;T	0.49432	0.78;0.78	5.39	5.39	0.77823	Teneurin intracellular, N-terminal (2);	0.000000	0.64402	D	0.000003	T	0.66317	0.2777	M	0.68317	2.08	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.91635	0.999;0.99;0.997	T	0.66952	-0.5793	10	0.44086	T	0.13	.	14.6346	0.68680	1.0:0.0:0.0:0.0	.	295;295;295	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	P	295	ENSP00000360171:L295P;ENSP00000403954:L295P	ENSP00000360171:L295P	L	-	2	0	ODZ1	123666675	1.000000	0.71417	0.997000	0.53966	0.991000	0.79684	9.244000	0.95423	1.905000	0.55150	0.425000	0.28330	CTT	TENM1	-	pfam_Ten_N	ENSG00000009694		0.527	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM1	HGNC	protein_coding	OTTHUMT00000058985.1	-	0.00	38	0	A	NM_014253		123838994	-1	tier1	-	no_errors	ENST00000422452	ensembl	human	known	74_37	missense	20.69	46	12	SNP	1.000	G
TET2	54790	genome.wustl.edu	37	4	106155750	106155750	+	Silent	SNP	C	C	A	rs142173406		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr4:106155750C>A	ENST00000540549.1	+	3	1511	c.651C>A	c.(649-651)tcC>tcA	p.S217S	TET2_ENST00000545826.1_Silent_p.S217S|TET2_ENST00000394764.1_Silent_p.S217S|TET2_ENST00000513237.1_Silent_p.S238S|TET2_ENST00000305737.2_Silent_p.S217S|TET2_ENST00000380013.4_Silent_p.S217S|TET2_ENST00000413648.2_Silent_p.S217S			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	217					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)	p.V218fs*32(3)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		CTGCCTCTTCCGTGGAACACA	0.413			"""Mis N, F"""		MDS																																			Rec	yes		4	4q24	54790	tet oncogene family member 2		L	3	Deletion - Frameshift(3)	haematopoietic_and_lymphoid_tissue(3)											85.0	74.0	78.0					4																	106155750		2203	4300	6503	SO:0001819	synonymous_variant	0			AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.651C>A	4.37:g.106155750C>A			B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Silent	SNP	NULL	p.S217	ENST00000540549.1	37	c.651	CCDS47120.1	4																																																																																			TET2	-	NULL	ENSG00000168769		0.413	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	TET2	HGNC	protein_coding	OTTHUMT00000253952.2		0.00	41	0	C	NM_017628		106155750	+1			no_errors	ENST00000380013	ensembl	human	known	74_37	silent	5.00	57	3	SNP	0.987	A
TFPI	7035	genome.wustl.edu	37	2	188331737	188331737	+	Missense_Mutation	SNP	T	T	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr2:188331737T>G	ENST00000233156.3	-	8	1135	c.841A>C	c.(841-843)Att>Ctt	p.I281L	TFPI_ENST00000392365.1_Missense_Mutation_p.I281L|AC007319.1_ENST00000453517.1_RNA|AC007319.1_ENST00000412276.1_RNA	NM_006287.4	NP_006278.1	P10646	TFPI1_HUMAN	tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor)	281					blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|negative regulation of endopeptidase activity (GO:0010951)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.0554)		Coagulation factor VIIa(DB00036)|Dalteparin(DB06779)	TTGGTTTTAATTAGGCCTCCT	0.254																																																	0													28.0	32.0	30.0					2																	188331737		2148	4191	6339	SO:0001583	missense	0				CCDS2294.1, CCDS33349.1	2q32	2008-06-02			ENSG00000003436	ENSG00000003436			11760	protein-coding gene	gene with protein product	"""extrinsic pathway inhibitor"""	152310		LACI		1993173	Standard	XM_005246818		Approved	EPI, TFI, TFPI1	uc002upy.3	P10646	OTTHUMG00000132634	ENST00000233156.3:c.841A>C	2.37:g.188331737T>G	ENSP00000233156:p.Ile281Leu		O95103|Q53TS4	Missense_Mutation	SNP	pirsf_Prot_inhib_I2_TFPI,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,smart_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m	p.I281L	ENST00000233156.3	37	c.841	CCDS2294.1	2	.	.	.	.	.	.	.	.	.	.	T	17.00	3.276825	0.59758	.	.	ENSG00000003436	ENST00000392365;ENST00000233156;ENST00000426055	T;T;T	0.55413	0.65;0.65;0.52	4.8	3.65	0.41850	.	0.140767	0.43919	D	0.000511	T	0.45955	0.1368	M	0.64997	1.995	0.26377	N	0.976796	P	0.47841	0.901	P	0.44696	0.458	T	0.34601	-0.9822	10	0.09338	T	0.73	.	7.1627	0.25672	0.0:0.1031:0.0:0.8968	.	281	P10646	TFPI1_HUMAN	L	281	ENSP00000376172:I281L;ENSP00000233156:I281L;ENSP00000397248:I281L	ENSP00000233156:I281L	I	-	1	0	TFPI	188039982	0.992000	0.36948	0.972000	0.41901	0.729000	0.41735	1.475000	0.35409	0.796000	0.33947	0.533000	0.62120	ATT	TFPI	-	pirsf_Prot_inhib_I2_TFPI	ENSG00000003436		0.254	TFPI-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TFPI	HGNC	protein_coding	OTTHUMT00000255881.1	-	0.00	44	0	T	NM_006287		188331737	-1	tier1	-	no_errors	ENST00000233156	ensembl	human	known	74_37	missense	16.39	102	20	SNP	1.000	G
TIAM1	7074	genome.wustl.edu	37	21	32537327	32537327	+	Silent	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr21:32537327G>T	ENST00000286827.3	-	17	3414	c.2943C>A	c.(2941-2943)acC>acA	p.T981T	TIAM1_ENST00000541036.1_Silent_p.T921T	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	981					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						CTGGCCCCTCGGTCTCCTCTG	0.502																																																	0													86.0	81.0	83.0					21																	32537327		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.2943C>A	21.37:g.32537327G>T			B7ZLR6|F5GZ53|Q17RT7	Silent	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Raf-like_ras-bd,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_Pleckstrin_homology,smart_Raf-like_ras-bd,smart_PDZ,smart_DH-domain,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_Raf-like_ras-bd,pfscan_DH-domain	p.T981	ENST00000286827.3	37	c.2943	CCDS13609.1	21																																																																																			TIAM1	-	NULL	ENSG00000156299		0.502	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIAM1	HGNC	protein_coding	OTTHUMT00000192552.1		0.00	22	0	G	NM_003253		32537327	-1			no_errors	ENST00000286827	ensembl	human	known	74_37	silent	8.51	43	4	SNP	0.196	T
TIGIT	201633	genome.wustl.edu	37	3	114026796	114026796	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr3:114026796G>A	ENST00000486257.1	+	5	810	c.553G>A	c.(553-555)Gga>Aga	p.G185R	TIGIT_ENST00000496848.1_3'UTR|TIGIT_ENST00000481065.1_Missense_Mutation_p.G252R|TIGIT_ENST00000383671.3_Missense_Mutation_p.G185R			Q495A1	TIGIT_HUMAN	T cell immunoreceptor with Ig and ITIM domains	185					negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|positive regulation of interleukin-10 production (GO:0032733)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(7)|prostate(1)	17						AAAATCAGCTGGACAGGAGGA	0.527																																																	0													84.0	86.0	85.0					3																	114026796		2203	4300	6503	SO:0001583	missense	0			AK097192	CCDS2980.1	3q13.31	2013-01-11	2008-10-13	2008-10-13	ENSG00000181847	ENSG00000181847		"""Immunoglobulin superfamily / V-set domain containing"""	26838	protein-coding gene	gene with protein product		612859	"""V-set and immunoglobulin domain containing 9"", ""V-set and transmembrane domain containing 3"""	VSIG9, VSTM3		19011627	Standard	NM_173799		Approved	FLJ39873, DKFZp667A205	uc003ebg.2	Q495A1	OTTHUMG00000159331	ENST00000486257.1:c.553G>A	3.37:g.114026796G>A	ENSP00000419085:p.Gly185Arg		Q495A3|Q5JPD8|Q6MZS2|Q8N877	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like_dom	p.G185R	ENST00000486257.1	37	c.553	CCDS2980.1	3	.	.	.	.	.	.	.	.	.	.	G	10.55	1.380786	0.24944	.	.	ENSG00000181847	ENST00000461158;ENST00000481065;ENST00000486257;ENST00000383671	T;T;T;T	0.56776	0.52;0.44;0.53;0.53	4.06	4.06	0.47325	.	0.345587	0.25045	N	0.033565	T	0.34395	0.0896	N	0.19112	0.55	0.09310	N	1	B	0.33694	0.421	B	0.29942	0.109	T	0.21348	-1.0248	10	0.33141	T	0.24	-1.4464	12.048	0.53491	0.0:0.0:1.0:0.0	.	185	Q495A1	TIGIT_HUMAN	R	164;252;185;185	ENSP00000418917:G164R;ENSP00000420552:G252R;ENSP00000419085:G185R;ENSP00000373167:G185R	ENSP00000373167:G185R	G	+	1	0	TIGIT	115509486	0.426000	0.25506	0.036000	0.18154	0.006000	0.05464	2.601000	0.46249	2.558000	0.86282	0.655000	0.94253	GGA	TIGIT	-	NULL	ENSG00000181847		0.527	TIGIT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGIT	HGNC	protein_coding	OTTHUMT00000354690.1	-	0.00	31	0	G	NM_173799		114026796	+1	tier1	-	no_errors	ENST00000383671	ensembl	human	known	74_37	missense	9.09	50	5	SNP	0.047	A
TLN1	7094	genome.wustl.edu	37	9	35700259	35700259	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr9:35700259G>A	ENST00000314888.9	-	49	6942	c.6589C>T	c.(6589-6591)Cgc>Tgc	p.R2197C	TLN1_ENST00000540444.1_Missense_Mutation_p.R2085C	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	2197					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TCTTCCTGGCGACAGGAATTG	0.547																																																	0													68.0	66.0	67.0					9																	35700259		2203	4300	6503	SO:0001583	missense	0			AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.6589C>T	9.37:g.35700259G>A	ENSP00000316029:p.Arg2197Cys		A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	pfam_Talin_cent,pfam_Vinculin-bd_dom,pfam_ILWEQ_dom,pfam_FERM_N,pfam_FERM_central,pfam_Insln_rcpt_S1,superfamily_Talin_cent,superfamily_Vinculin/catenin,superfamily_FERM_central,smart_Band_41_domain,smart_ILWEQ_dom,pfscan_FERM_domain,pfscan_ILWEQ_dom	p.R2197C	ENST00000314888.9	37	c.6589	CCDS35009.1	9	.	.	.	.	.	.	.	.	.	.	G	34	5.322456	0.95708	.	.	ENSG00000137076	ENST00000314888;ENST00000540444	T;T	0.69435	-0.4;-0.39	5.2	5.2	0.72013	.	0.057011	0.64402	D	0.000002	T	0.72763	0.3501	M	0.76002	2.32	0.80722	D	1	D	0.69078	0.997	P	0.46510	0.519	T	0.78663	-0.2116	10	0.72032	D	0.01	-9.9539	18.3575	0.90362	0.0:0.0:1.0:0.0	.	2197	Q9Y490	TLN1_HUMAN	C	2197;2085	ENSP00000316029:R2197C;ENSP00000442981:R2085C	ENSP00000316029:R2197C	R	-	1	0	TLN1	35690259	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.082000	0.57635	2.436000	0.82500	0.655000	0.94253	CGC	TLN1	-	NULL	ENSG00000137076		0.547	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN1	HGNC	protein_coding	OTTHUMT00000052353.2	-	0.00	29	0	G	NM_006289		35700259	-1	tier1	-	no_errors	ENST00000314888	ensembl	human	known	74_37	missense	11.36	39	5	SNP	1.000	A
TMEM132C	92293	genome.wustl.edu	37	12	129190255	129190255	+	Silent	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr12:129190255G>T	ENST00000435159.2	+	9	2742	c.2742G>T	c.(2740-2742)gtG>gtT	p.V914V	TMEM132C_ENST00000315208.8_Silent_p.V530V|TMEM132C_ENST00000537538.1_Silent_p.V299V	NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	914						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						ACGACCTGGTGCAGACTCCGC	0.622																																																	0													21.0	29.0	26.0					12																	129190255		692	1591	2283	SO:0001819	synonymous_variant	0			AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.2742G>T	12.37:g.129190255G>T			Q69YX8	Silent	SNP	NULL	p.V914	ENST00000435159.2	37	c.2742		12																																																																																			TMEM132C	-	NULL	ENSG00000181234		0.622	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	TMEM132C	HGNC	protein_coding		-	0.00	52	0	G	XM_044062		129190255	+1	tier1	-	no_errors	ENST00000435159	ensembl	human	known	74_37	silent	21.15	40	11	SNP	0.993	T
TMEM87A	25963	genome.wustl.edu	37	15	42560178	42560178	+	Missense_Mutation	SNP	G	G	T	rs372515263		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr15:42560178G>T	ENST00000389834.4	-	3	522	c.258C>A	c.(256-258)agC>agA	p.S86R	TMEM87A_ENST00000448392.1_Missense_Mutation_p.S25R|TMEM87A_ENST00000307216.6_Missense_Mutation_p.S86R|TMEM87A_ENST00000568432.1_5'UTR	NM_015497.3	NP_056312.2	Q8NBN3	TM87A_HUMAN	transmembrane protein 87A	86						integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(4)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	24		all_cancers(109;4.28e-16)|all_epithelial(112;1.04e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;1.03e-06)		AACAATCAGCGCTTTTCAGAT	0.328																																																	0													99.0	98.0	99.0					15																	42560178		2202	4299	6501	SO:0001583	missense	0			AF132733	CCDS32205.1, CCDS45243.1, CCDS66742.1	15q15.1	2005-10-30				ENSG00000103978			24522	protein-coding gene	gene with protein product						12477932	Standard	XM_005254287		Approved	DKFZP564G2022	uc021sjr.1	Q8NBN3		ENST00000389834.4:c.258C>A	15.37:g.42560178G>T	ENSP00000374484:p.Ser86Arg		Q6NT77|Q8NCA4|Q9BS46|Q9P103|Q9Y3Y7	Missense_Mutation	SNP	pfam_TM_rcpt_euk	p.S86R	ENST00000389834.4	37	c.258	CCDS32205.1	15	.	.	.	.	.	.	.	.	.	.	G	16.03	3.006403	0.54361	.	.	ENSG00000103978	ENST00000389834;ENST00000448392;ENST00000535305;ENST00000307216	.	.	.	4.88	2.6	0.31112	.	0.197188	0.45867	D	0.000335	T	0.34337	0.0894	N	0.19112	0.55	0.35201	D	0.774306	P;P;P	0.50819	0.538;0.842;0.939	B;B;P	0.48114	0.168;0.419;0.567	T	0.43877	-0.9364	9	0.49607	T	0.09	-6.6306	5.8701	0.18799	0.795:0.0:0.205:0.0	.	86;25;86	Q8NBN3;Q8NBN3-3;Q8NBN3-2	TM87A_HUMAN;.;.	R	86;25;62;86	.	ENSP00000305894:S86R	S	-	3	2	TMEM87A	40347470	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.523000	0.35932	0.993000	0.38866	-0.339000	0.08088	AGC	TMEM87A	-	NULL	ENSG00000103978		0.328	TMEM87A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	TMEM87A	HGNC	protein_coding	OTTHUMT00000420482.2		0.00	26	0	G	NM_015497		42560178	-1			no_errors	ENST00000389834	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	T
TMEM91	641649	genome.wustl.edu	37	19	41889665	41889665	+	Missense_Mutation	SNP	G	G	A	rs370308690		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr19:41889665G>A	ENST00000392002.2	+	4	1066	c.406G>A	c.(406-408)Gcc>Acc	p.A136T	TMEM91_ENST00000436170.2_Intron|TMEM91_ENST00000604123.1_Intron|TMEM91_ENST00000542945.1_3'UTR|TMEM91_ENST00000539627.1_3'UTR|CTC-435M10.3_ENST00000540732.1_Intron|TMEM91_ENST00000413014.2_Intron|TMEM91_ENST00000447302.2_Intron|CTC-435M10.3_ENST00000604424.1_Intron|TMEM91_ENST00000544232.1_Intron|TMEM91_ENST00000356385.4_3'UTR|BCKDHA_ENST00000595085.1_Intron	NM_001098821.1	NP_001092291.1	Q6ZNR0	TMM91_HUMAN	transmembrane protein 91	136					hematopoietic progenitor cell differentiation (GO:0002244)|response to biotic stimulus (GO:0009607)	integral component of membrane (GO:0016021)				lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	5						GGCAGGGGCCGCCTCCCGCCG	0.697																																																	0								G	,THR/ALA,,,,	1,4103		0,1,2051	24.0	30.0	28.0		,406,,,,	1.8	1.0	19		28	0,8338		0,0,4169	no	utr-3,missense,intron,intron,intron,intron	TMEM91	NM_001042595.2,NM_001098821.1,NM_001098822.1,NM_001098823.1,NM_001098824.1,NM_001098825.1	,58,,,,	0,1,6220	AA,AG,GG		0.0,0.0244,0.0080	,,,,,	,136/173,,,,	41889665	1,12441	2052	4169	6221	SO:0001583	missense	0			AK130820, BC063705	CCDS42571.1, CCDS42572.1, CCDS46082.1, CCDS46083.1, CCDS46084.1	19q13.2	2009-10-16							32393	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 6"""					12477932	Standard	NM_001098824		Approved	FLJ27310, IFITMD6		Q6ZNR0		ENST00000392002.2:c.406G>A	19.37:g.41889665G>A	ENSP00000375859:p.Ala136Thr		C9J9D1|C9JZ62|C9K046|Q6P434	Missense_Mutation	SNP	pfam_CD225/Dispanin_fam	p.A136T	ENST00000392002.2	37	c.406	CCDS42571.1	19	.	.	.	.	.	.	.	.	.	.	G	18.67	3.674108	0.67928	2.44E-4	0.0	ENSG00000142046	ENST00000392002	D	0.87729	-2.29	4.09	1.78	0.24846	.	.	.	.	.	T	0.79587	0.4471	L	0.49126	1.545	0.80722	D	1	P	0.51537	0.946	B	0.41174	0.349	T	0.73978	-0.3812	9	0.15499	T	0.54	.	8.1677	0.31237	0.092:0.0:0.7516:0.1563	.	136	Q6ZNR0	TMM91_HUMAN	T	136	ENSP00000375859:A136T	ENSP00000375859:A136T	A	+	1	0	TMEM91	46581505	0.994000	0.37717	0.996000	0.52242	0.998000	0.95712	2.172000	0.42463	1.080000	0.41073	0.561000	0.74099	GCC	TMEM91	-	pfam_CD225/Dispanin_fam	ENSG00000142046		0.697	TMEM91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM91	HGNC	protein_coding	OTTHUMT00000398302.2	-	0.00	51	0	G			41889665	+1	tier1	-	no_errors	ENST00000392002	ensembl	human	known	74_37	missense	11.96	73	11	SNP	0.986	A
TMTC1	83857	genome.wustl.edu	37	12	29659767	29659767	+	3'UTR	SNP	C	C	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr12:29659767C>T	ENST00000539277.1	-	0	2719				TMTC1_ENST00000552618.1_3'UTR|TMTC1_ENST00000256062.5_3'UTR|TMTC1_ENST00000551659.1_3'UTR|TMTC1_ENST00000319685.8_5'UTR	NM_001193451.1	NP_001180380.1	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat containing 1							integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(1)|endometrium(4)|kidney(3)|large_intestine(17)|lung(45)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					GAGGTTGGGTCAGACGGTGGT	0.448																																																	0													231.0	219.0	223.0					12																	29659767		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0				CCDS8718.1, CCDS53772.1	12p11.22	2014-06-09	2006-01-06			ENSG00000133687		"""Tetratricopeptide (TTC) repeat domain containing"""	24099	protein-coding gene	gene with protein product		615855				24764305	Standard	NM_001193451		Approved	ARG99, OLF, FLJ31400, FLJ41625	uc021qwi.1	Q8IUR5	OTTHUMG00000169324	ENST00000539277.1:c.*12G>A	12.37:g.29659767C>T			D0EP37|F5H8B5|Q6PIU4|Q6ZSM5|Q96N52|Q9BXM2	RNA	SNP	-	NULL	ENST00000539277.1	37	NULL	CCDS53772.1	12																																																																																			TMTC1	-	-	ENSG00000133687		0.448	TMTC1-002	PUTATIVE	basic|CCDS	protein_coding	TMTC1	HGNC	protein_coding	OTTHUMT00000403509.1	-	0.00	47	0	C	NM_031920		29659767	-1	tier1	-	no_errors	ENST00000319685	ensembl	human	known	74_37	rna	6.25	75	5	SNP	0.000	T
TNIP1	10318	genome.wustl.edu	37	5	150410286	150410286	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr5:150410286C>A	ENST00000389378.2	-	18	2487	c.1899G>T	c.(1897-1899)gaG>gaT	p.E633D	TNIP1_ENST00000520931.1_Missense_Mutation_p.E580D|TNIP1_ENST00000523338.1_Intron|TNIP1_ENST00000523200.1_Missense_Mutation_p.E569D|TNIP1_ENST00000524280.1_Missense_Mutation_p.R537M|TNIP1_ENST00000518977.1_Intron|TNIP1_ENST00000521423.1_5'Flank|TNIP1_ENST00000521591.1_Missense_Mutation_p.E633D|TNIP1_ENST00000315050.7_Missense_Mutation_p.E633D|TNIP1_ENST00000522226.1_Missense_Mutation_p.E633D	NM_001252385.1|NM_001252393.1|NM_001258454.1|NM_006058.4	NP_001239314.1|NP_001239322.1|NP_001245383.1|NP_006049.3	Q15025	TNIP1_HUMAN	TNFAIP3 interacting protein 1	633	Pro-rich.				defense response (GO:0006952)|glycoprotein biosynthetic process (GO:0009101)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|modulation by symbiont of host I-kappaB kinase/NF-kappaB cascade (GO:0085032)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of viral genome replication (GO:0045071)|positive regulation of inflammatory response (GO:0050729)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|translation (GO:0006412)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	mitogen-activated protein kinase binding (GO:0051019)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(5)|ovary(2)|prostate(2)|skin(3)	23		Medulloblastoma(196;0.0911)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ACTGAGGCCCCTCACGGTCAT	0.443																																																	0													83.0	82.0	83.0					5																	150410286		2203	4300	6503	SO:0001583	missense	0			AJ011895	CCDS34280.1, CCDS58982.1, CCDS58983.1, CCDS58984.1, CCDS58985.1, CCDS75359.1	5q32-q33.1	2008-07-18							16903	protein-coding gene	gene with protein product	"""virion-associated nuclear-shuttling protein"", ""Nef-associated factor 1 SNP"""	607714				9923610, 11090181	Standard	NM_001252385		Approved	NAF1, KIAA0113, ABIN-1, VAN	uc003ltj.3	Q15025		ENST00000389378.2:c.1899G>T	5.37:g.150410286C>A	ENSP00000374029:p.Glu633Asp		A4F1W8|A4F1W9|A4F1X2|A4F1X4|A4F1X5|A4F1X6|A4F1X7|A4F1X9|B7Z699|E7EPY1|E7ET96|O76008|Q05KP3|Q05KP4|Q6N077|Q96EL9|Q99833|Q9H1J3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.E633D	ENST00000389378.2	37	c.1899	CCDS34280.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.11|10.11	1.261281|1.261281	0.23051|0.23051	.|.	.|.	ENSG00000145901|ENSG00000145901	ENST00000520931;ENST00000389378;ENST00000315050;ENST00000417127;ENST00000539213;ENST00000522226;ENST00000521591;ENST00000523200|ENST00000544828;ENST00000524280	T;T;T;T;T;T|T	0.11712|0.62788	2.77;2.77;2.77;2.77;2.77;2.75|-0.0	5.44|5.44	-2.34|-2.34	0.06704|0.06704	.|.	0.637227|.	0.14743|.	N|.	0.301049|.	T|T	0.38532|0.38532	0.1044|0.1044	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	1|1	B;B|B	0.09022|0.12013	0.002;0.001|0.005	B;B|B	0.08055|0.15870	0.003;0.003|0.014	T|T	0.22730|0.22730	-1.0208|-1.0208	10|9	0.16420|0.46703	T|T	0.52|0.11	-2.4862|-2.4862	0.3226|0.3226	0.00305|0.00305	0.2581:0.2521:0.2527:0.237|0.2581:0.2521:0.2527:0.237	.|.	569;633|537	E7ET96;Q15025|E7EPY1	.;TNIP1_HUMAN|.	D|M	580;633;633;526;595;633;633;569|494;537	ENSP00000429891:E580D;ENSP00000374029:E633D;ENSP00000317891:E633D;ENSP00000428187:E633D;ENSP00000430760:E633D;ENSP00000431105:E569D|ENSP00000429912:R537M	ENSP00000317891:E633D|ENSP00000429912:R537M	E|R	-|-	3|2	2|0	TNIP1|TNIP1	150390479|150390479	0.000000|0.000000	0.05858|0.05858	0.208000|0.208000	0.23602|0.23602	0.855000|0.855000	0.48748|0.48748	-1.016000|-1.016000	0.03633|0.03633	-0.488000|-0.488000	0.06726|0.06726	0.448000|0.448000	0.29417|0.29417	GAG|AGG	TNIP1	-	NULL	ENSG00000145901		0.443	TNIP1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TNIP1	HGNC	protein_coding	OTTHUMT00000374914.1		0.00	27	0	C	NM_006058		150410286	-1			no_errors	ENST00000315050	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.047	A
TNXB	7148	genome.wustl.edu	37	6	32030234	32030234	+	Missense_Mutation	SNP	G	G	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr6:32030234G>C	ENST00000375244.3	-	20	7069	c.6868C>G	c.(6868-6870)Cca>Gca	p.P2290A	TNXB_ENST00000375247.2_Missense_Mutation_p.P2290A			P22105	TENX_HUMAN	tenascin XB	2353	Fibronectin type-III 15. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						GTCGAGGCTGGGGCCATTTCT	0.582																																																	0													25.0	29.0	28.0					6																	32030234		1286	2545	3831	SO:0001583	missense	0			X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.6868C>G	6.37:g.32030234G>C	ENSP00000364393:p.Pro2290Ala		P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.P2290A	ENST00000375244.3	37	c.6868		6	.	.	.	.	.	.	.	.	.	.	G	7.786	0.710522	0.15239	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.59772	0.54;0.24	3.57	0.621	0.17643	.	0.360285	0.20644	N	0.088356	T	0.32285	0.0824	M	0.91872	3.25	0.09310	N	1	B	0.02656	0.0	B	0.10450	0.005	T	0.43426	-0.9392	10	0.08599	T	0.76	.	4.2501	0.10691	0.224:0.3762:0.3998:0.0	.	2290	P22105-3	.	A	2290	ENSP00000364393:P2290A;ENSP00000364396:P2290A	ENSP00000364393:P2290A	P	-	1	0	TNXB	32138212	0.000000	0.05858	0.001000	0.08648	0.022000	0.10575	-0.310000	0.08135	-0.102000	0.12197	0.491000	0.48974	CCA	TNXB	-	NULL	ENSG00000168477		0.582	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	TNXB	HGNC	protein_coding	OTTHUMT00000268927.2	-	0.00	35	0	G	NM_019105		32030234	-1	tier1	-	no_errors	ENST00000375247	ensembl	human	known	74_37	missense	8.62	53	5	SNP	0.002	C
TP53	7157	genome.wustl.edu	37	17	7577017	7577017	+	Splice_Site	SNP	A	A	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr17:7577017A>C	ENST00000269305.4	-	8	1109		c.e8+1		TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.?(6)|p.A307fs*34(1)|p.L308fs*31(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTGCTTGCTTACCTCGCTTAG	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	16	Whole gene deletion(8)|Unknown(6)|Deletion - Frameshift(2)	bone(4)|haematopoietic_and_lymphoid_tissue(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|lung(2)|stomach(1)|urinary_tract(1)|ovary(1)											128.0	112.0	117.0					17																	7577017		2203	4300	6503	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.919+1T>G	17.37:g.7577017A>C			Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	-	e7+2	ENST00000269305.4	37	c.919+2	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	8.950	0.968007	0.18659	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	4.81	3.72	0.42706	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.7248	0.28753	0.8139:0.0:0.0:0.1861	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7517742	1.000000	0.71417	0.780000	0.31762	0.217000	0.24651	7.280000	0.78610	0.855000	0.35359	0.459000	0.35465	.	TP53	-	-	ENSG00000141510		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	55	0	A	NM_000546	Intron	7577017	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	splice_site	41.76	53	38	SNP	0.853	C
TPP1	1200	genome.wustl.edu	37	11	6638054	6638054	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr11:6638054G>T	ENST00000299427.6	-	7	784	c.724C>A	c.(724-726)Cag>Aag	p.Q242K	TPP1_ENST00000533371.1_5'UTR|RP11-732A19.9_ENST00000545572.1_RNA|TPP1_ENST00000534644.1_5'Flank	NM_000391.3	NP_000382.3	P49638	TTPA_HUMAN	tripeptidyl peptidase I	0	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				embryonic placenta development (GO:0001892)|intermembrane transport (GO:0046909)|intracellular pH reduction (GO:0051452)|lipid metabolic process (GO:0006629)|negative regulation of cell death (GO:0060548)|negative regulation of establishment of blood-brain barrier (GO:0090212)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|response to toxic substance (GO:0009636)|transport (GO:0006810)|vitamin E metabolic process (GO:0042360)|vitamin transport (GO:0051180)	cytosol (GO:0005829)|late endosome (GO:0005770)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|transporter activity (GO:0005215)|vitamin E binding (GO:0008431)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(9)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;3.45e-09)|BRCA - Breast invasive adenocarcinoma(625;0.131)	Vitamin E(DB00163)	CGCATGAACTGAGCCAGGTCT	0.587																																																	0													99.0	99.0	99.0					11																	6638054		2201	4296	6497	SO:0001583	missense	0			AF017456	CCDS7770.1	11p15.4	2014-09-17	2004-12-09	2004-12-10	ENSG00000166340	ENSG00000166340			2073	protein-coding gene	gene with protein product	"""TPP I"""	607998	"""ceroid-lipofuscinosis, neuronal 2, late infantile (Jansky-Bielschowsky disease)"", ""spinocerebellar ataxia, autosomal recessive 7"""	CLN2, SCAR7		9653647, 23418007	Standard	NM_000391		Approved		uc001mel.1	O14773	OTTHUMG00000133404	ENST00000299427.6:c.724C>A	11.37:g.6638054G>T	ENSP00000299427:p.Gln242Lys		Q71V64	Missense_Mutation	SNP	pfam_Peptidase_S53_propep,pfam_Peptidase_S8/S53_dom,superfamily_Peptidase_S8/S53_dom,superfamily_Prot_inh_propept,smart_Peptidase_S53_propep	p.Q242K	ENST00000299427.6	37	c.724	CCDS7770.1	11	.	.	.	.	.	.	.	.	.	.	G	10.89	1.477986	0.26511	.	.	ENSG00000166340	ENST00000299427	D	0.98996	-5.31	4.48	1.52	0.23074	Peptidase S8/S53, subtilisin/kexin/sedolisin (2);	0.162895	0.53938	N	0.000059	D	0.94248	0.8153	N	0.16478	0.41	0.80722	D	1	B	0.22414	0.069	B	0.12156	0.007	D	0.88254	0.2918	10	0.08599	T	0.76	-12.1596	6.1193	0.20144	0.0:0.6582:0.16:0.1819	.	242	O14773	TPP1_HUMAN	K	242	ENSP00000299427:Q242K	ENSP00000299427:Q242K	Q	-	1	0	TPP1	6594630	0.766000	0.28496	0.953000	0.39169	0.917000	0.54804	1.464000	0.35288	0.346000	0.23899	-0.565000	0.04167	CAG	TPP1	-	superfamily_Peptidase_S8/S53_dom	ENSG00000166340		0.587	TPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPP1	HGNC	protein_coding	OTTHUMT00000257261.2	-	0.00	61	0	G			6638054	-1	tier1	-	no_errors	ENST00000299427	ensembl	human	known	74_37	missense	6.45	58	4	SNP	0.961	T
TPH1	7166	genome.wustl.edu	37	11	18057536	18057536	+	Missense_Mutation	SNP	G	G	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr11:18057536G>C	ENST00000250018.2	-	2	833	c.271C>G	c.(271-273)Cta>Gta	p.L91V	TPH1_ENST00000341556.2_Missense_Mutation_p.L91V	NM_004179.2	NP_004170.1	P17752	TPH1_HUMAN	tryptophan hydroxylase 1	91	ACT. {ECO:0000255|PROSITE- ProRule:PRU01007}.			NL -> TP (in Ref. 2; AAA67050). {ECO:0000305}.	aromatic amino acid family metabolic process (GO:0009072)|bone remodeling (GO:0046849)|cellular nitrogen compound metabolic process (GO:0034641)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|mammary gland alveolus development (GO:0060749)|negative regulation of ossification (GO:0030279)|response to immobilization stress (GO:0035902)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|neuron projection (GO:0043005)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|tryptophan 5-monooxygenase activity (GO:0004510)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(14)|prostate(1)|stomach(1)	25					L-Tryptophan(DB00150)|Tetrahydrobiopterin(DB00360)	TTATCTGGTAGATTCACAGAG	0.328																																																	0													80.0	80.0	80.0					11																	18057536		2200	4293	6493	SO:0001583	missense	0			X52836	CCDS7829.1	11p15.3-p14	2012-10-02	2008-07-31	2003-04-04	ENSG00000129167	ENSG00000129167	1.14.16.4		12008	protein-coding gene	gene with protein product	"""tryptophan 5-monooxygenase"""	191060	"""tryptophan hydroxylase (tryptophan 5-monooxygenase)"""	TPRH, TPH		1463016	Standard	NM_004179		Approved		uc001mnp.2	P17752	OTTHUMG00000166421	ENST00000250018.2:c.271C>G	11.37:g.18057536G>C	ENSP00000250018:p.Leu91Val		D3DQX6|O95188|O95189|Q16736|Q3KPG8	Missense_Mutation	SNP	pfam_Aromatic-AA_hydroxylase_C,pfam_ACT_dom,superfamily_Aromatic-AA_hydroxylase_C,pirsf_Tyrosine_3-monooxygenase-like,prints_Aromatic-AA_hydroxylase_C,tigrfam_Trp_5_mOase	p.L91V	ENST00000250018.2	37	c.271	CCDS7829.1	11	.	.	.	.	.	.	.	.	.	.	G	10.68	1.418252	0.25552	.	.	ENSG00000129167	ENST00000250018;ENST00000341556;ENST00000528338	D;D;D	0.99716	-6.12;-6.13;-6.51	5.51	1.28	0.21552	.	0.316417	0.39210	N	0.001437	D	0.96839	0.8968	N	0.08118	0	0.09310	N	0.999995	B	0.02656	0.0	B	0.06405	0.002	D	0.94909	0.8063	10	0.15499	T	0.54	-8.0E-4	7.1395	0.25548	0.1384:0.0:0.607:0.2546	.	91	P17752	TPH1_HUMAN	V	91;91;101	ENSP00000250018:L91V;ENSP00000343550:L91V;ENSP00000436081:L101V	ENSP00000250018:L91V	L	-	1	2	TPH1	18014112	1.000000	0.71417	0.966000	0.40874	0.973000	0.67179	2.909000	0.48758	0.309000	0.22966	0.655000	0.94253	CTA	TPH1	-	pirsf_Tyrosine_3-monooxygenase-like,tigrfam_Trp_5_mOase	ENSG00000129167		0.328	TPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPH1	HGNC	protein_coding	OTTHUMT00000389696.1	-	0.00	31	0	G	NM_004179		18057536	-1	tier1	-	no_errors	ENST00000341556	ensembl	human	known	74_37	missense	16.95	49	10	SNP	1.000	C
TRIM14	9830	genome.wustl.edu	37	9	100857153	100857153	+	Silent	SNP	C	C	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr9:100857153C>T	ENST00000341469.2	-	4	705	c.696G>A	c.(694-696)aaG>aaA	p.K232K	TRIM14_ENST00000538344.1_5'Flank|TRIM14_ENST00000342043.3_Silent_p.K232K|TRIM14_ENST00000375098.3_Silent_p.K232K	NM_014788.2	NP_055603.2	Q14142	TRI14_HUMAN	tripartite motif containing 14	232					innate immune response (GO:0045087)|negative regulation of viral transcription (GO:0032897)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)	cytoplasm (GO:0005737)|intracellular (GO:0005622)	zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	9		Acute lymphoblastic leukemia(62;0.0559)				ACTTACTTTCCTTAAGGCGAA	0.512																																					Colon(14;460 597 13826 51781)												0													120.0	104.0	109.0					9																	100857153		2203	4300	6503	SO:0001819	synonymous_variant	0			AF220130	CCDS6734.1	9q31.1	2011-04-20	2011-01-25		ENSG00000106785	ENSG00000106785		"""Tripartite motif containing / Tripartite motif containing"""	16283	protein-coding gene	gene with protein product		606556	"""tripartite motif-containing 14"""			11331580	Standard	XM_005252320		Approved	KIAA0129	uc004ayd.2	Q14142	OTTHUMG00000020339	ENST00000341469.2:c.696G>A	9.37:g.100857153C>T			A8K9W0|E7EQC4|F8W956|Q548W9|Q5TBQ8|Q6ZWL7|Q9BRD8|Q9C020	Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,prints_Butyrophylin	p.K232	ENST00000341469.2	37	c.696	CCDS6734.1	9																																																																																			TRIM14	-	NULL	ENSG00000106785		0.512	TRIM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM14	HGNC	protein_coding	OTTHUMT00000053350.1	-	0.00	97	0	C	NM_014788		100857153	-1	tier1	-	no_errors	ENST00000341469	ensembl	human	known	74_37	silent	20.35	90	23	SNP	0.984	T
TRPC6	7225	genome.wustl.edu	37	11	101353851	101353851	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr11:101353851C>T	ENST00000344327.3	-	5	1763	c.1339G>A	c.(1339-1341)Gca>Aca	p.A447T	TRPC6_ENST00000360497.4_Missense_Mutation_p.A392T|TRPC6_ENST00000532133.1_Missense_Mutation_p.A447T|TRPC6_ENST00000348423.4_Missense_Mutation_p.A331T	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	447					aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.A447T(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		AAGGAGGCTGCGTGTGCTACA	0.418																																					Colon(166;1315 1927 11094 12848 34731)												1	Substitution - Missense(1)	large_intestine(1)											105.0	95.0	98.0					11																	101353851		2203	4299	6502	SO:0001583	missense	0			AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.1339G>A	11.37:g.101353851C>T	ENSP00000340913:p.Ala447Thr		Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,pfam_PKD1_2_channel,superfamily_Ankyrin_rpt-contain_dom,superfamily_ARM-type_fold,smart_Ankyrin_rpt,prints_TRPC6_channel,prints_TRPC_channel,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,tigrfam_TRP_channel	p.A447T	ENST00000344327.3	37	c.1339	CCDS8311.1	11	.	.	.	.	.	.	.	.	.	.	C	17.16	3.319186	0.60524	.	.	ENSG00000137672	ENST00000344327;ENST00000532133;ENST00000348423;ENST00000360497	T;T;T;T	0.38722	1.12;1.12;1.12;1.12	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.59169	0.2174	L	0.48218	1.51	0.80722	D	1	D;P;D	0.89917	1.0;0.905;1.0	D;B;D	0.91635	0.999;0.346;0.998	T	0.50931	-0.8769	10	0.27785	T	0.31	-0.7414	19.431	0.94765	0.0:1.0:0.0:0.0	.	392;331;447	Q9Y210-3;Q9Y210-2;Q9Y210	.;.;TRPC6_HUMAN	T	447;447;331;392	ENSP00000340913:A447T;ENSP00000435574:A447T;ENSP00000343672:A331T;ENSP00000353687:A392T	ENSP00000340913:A447T	A	-	1	0	TRPC6	100859061	1.000000	0.71417	0.850000	0.33497	0.989000	0.77384	7.818000	0.86416	2.584000	0.87258	0.591000	0.81541	GCA	TRPC6	-	tigrfam_TRP_channel	ENSG00000137672		0.418	TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC6	HGNC	protein_coding	OTTHUMT00000394770.1		0.00	46	0	C	NM_004621		101353851	-1			no_errors	ENST00000344327	ensembl	human	known	74_37	missense	5.00	57	3	SNP	1.000	T
TRPS1	7227	genome.wustl.edu	37	8	116617053	116617053	+	Silent	SNP	G	G	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr8:116617053G>C	ENST00000220888.5	-	3	1263	c.1104C>G	c.(1102-1104)tcC>tcG	p.S368S	TRPS1_ENST00000395715.3_Silent_p.S381S|TRPS1_ENST00000519674.1_Silent_p.S368S|TRPS1_ENST00000519076.1_Silent_p.S322S|TRPS1_ENST00000520276.1_Silent_p.S372S			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	368					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			CAACCTCAGAGGAGGGGAGAG	0.408									Langer-Giedion syndrome																																								0													113.0	106.0	108.0					8																	116617053		1834	4091	5925	SO:0001819	synonymous_variant	0	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.1104C>G	8.37:g.116617053G>C			B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Silent	SNP	pfam_Znf_GATA,smart_Znf_C2H2-like,smart_Znf_GATA,pfscan_Znf_C2H2,pfscan_Znf_GATA,prints_Znf_GATA	p.S381	ENST00000220888.5	37	c.1143		8																																																																																			TRPS1	-	NULL	ENSG00000104447		0.408	TRPS1-002	KNOWN	basic	protein_coding	TRPS1	HGNC	protein_coding	OTTHUMT00000286436.3	-	0.00	44	0	G	NM_014112		116617053	-1	tier1	-	no_errors	ENST00000395715	ensembl	human	known	74_37	silent	10.53	68	8	SNP	1.000	C
TSGA10	80705	genome.wustl.edu	37	2	99720580	99720580	+	Splice_Site	SNP	A	A	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr2:99720580A>G	ENST00000393483.3	-	10	1305	c.461T>C	c.(460-462)cTt>cCt	p.L154P	TSGA10_ENST00000478090.1_5'UTR|TSGA10_ENST00000355053.4_Splice_Site_p.L154P|TSGA10_ENST00000410001.1_Splice_Site_p.L154P|TSGA10_ENST00000539964.1_Splice_Site_p.L154P|TSGA10_ENST00000542655.1_Splice_Site_p.L154P	NM_025244.2	NP_079520.1	Q9BZW7	TSG10_HUMAN	testis specific, 10	154					cell projection assembly (GO:0030031)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|membrane (GO:0016020)|motile cilium (GO:0031514)|neuron projection (GO:0043005)|nucleus (GO:0005634)				NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	34						TTCATCATCAAGCTATACAAG	0.383																																																	0													155.0	139.0	145.0					2																	99720580		2202	4300	6502	SO:0001630	splice_region_variant	0			AF254756	CCDS2037.1	2q11.2	2009-08-06			ENSG00000135951	ENSG00000135951			14927	protein-coding gene	gene with protein product	"""cancer/testis antigen 79"""	607166				11179690	Standard	NM_025244		Approved	CEP4L, CT79	uc002szi.4	Q9BZW7	OTTHUMG00000130637	ENST00000393483.3:c.460-1T>C	2.37:g.99720580A>G			B7Z925|D3DVH7|Q8NEP0|Q9BWX0	Missense_Mutation	SNP	NULL	p.L154P	ENST00000393483.3	37	c.461	CCDS2037.1	2	.	.	.	.	.	.	.	.	.	.	A	19.38	3.816168	0.70912	.	.	ENSG00000135951	ENST00000393483;ENST00000410001;ENST00000355053;ENST00000539964;ENST00000409564;ENST00000393482;ENST00000542655	T;T;T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67;0.67;0.67	5.36	5.36	0.76844	.	0.000000	0.47093	D	0.000254	T	0.66307	0.2776	M	0.73598	2.24	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.66351	0.943;0.943	T	0.70364	-0.4892	10	0.72032	D	0.01	-6.2363	13.4119	0.60948	1.0:0.0:0.0:0.0	.	154;154	B7Z925;Q9BZW7	.;TSG10_HUMAN	P	154	ENSP00000377123:L154P;ENSP00000386956:L154P;ENSP00000347161:L154P;ENSP00000444419:L154P;ENSP00000386508:L154P;ENSP00000377122:L154P;ENSP00000445623:L154P	ENSP00000347161:L154P	L	-	2	0	TSGA10	99087012	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.013000	0.70776	2.260000	0.74910	0.529000	0.55759	CTT	TSGA10	-	NULL	ENSG00000135951		0.383	TSGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSGA10	HGNC	protein_coding	OTTHUMT00000253125.1	-	0.00	36	0	A	NM_182911	Missense_Mutation	99720580	-1	tier1	-	no_errors	ENST00000355053	ensembl	human	known	74_37	missense	14.93	57	10	SNP	1.000	G
TSPAN11	441631	genome.wustl.edu	37	12	31135479	31135479	+	Missense_Mutation	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr12:31135479G>A	ENST00000261177.9	+	6	528	c.469G>A	c.(469-471)Gga>Aga	p.G157R	TSPAN11_ENST00000544427.1_Missense_Mutation_p.G147R|TSPAN11_ENST00000546076.1_Missense_Mutation_p.G157R|TSPAN11_ENST00000535215.1_Missense_Mutation_p.G86R	NM_001080509.2	NP_001073978.1	A1L157	TSN11_HUMAN	tetraspanin 11	157						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)	11	all_lung(12;3.11e-10)|Lung NSC(12;5.24e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					CAAGTGCTGTGGAAGCAACAG	0.607																																																	0													35.0	38.0	37.0					12																	31135479		2202	4298	6500	SO:0001583	missense	0				CCDS31765.1	12p11.21	2013-02-14				ENSG00000110900		"""Tetraspanins"""	30795	protein-coding gene	gene with protein product							Standard	NM_001080509		Approved		uc001rjp.3	A1L157		ENST00000261177.9:c.469G>A	12.37:g.31135479G>A	ENSP00000261177:p.Gly157Arg		A1L158|B2RUX6	Missense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.G157R	ENST00000261177.9	37	c.469	CCDS31765.1	12	.	.	.	.	.	.	.	.	.	.	G	16.65	3.181560	0.57800	.	.	ENSG00000110900	ENST00000546076;ENST00000535215;ENST00000544427;ENST00000261177	D;D;D;D	0.99201	-5.55;-5.55;-5.55;-5.55	4.13	4.13	0.48395	Tetraspanin, EC2 domain (1);	0.000000	0.85682	U	0.000000	D	0.99477	0.9814	H	0.95950	3.745	0.80722	D	1	D;D	0.76494	0.999;0.993	D;D	0.76071	0.987;0.965	D	0.98200	1.0467	10	0.72032	D	0.01	.	13.865	0.63583	0.0:0.0:1.0:0.0	.	147;157	F5H0F0;A1L157	.;TSN11_HUMAN	R	157;86;147;157	ENSP00000437403:G157R;ENSP00000445503:G86R;ENSP00000439895:G147R;ENSP00000261177:G157R	ENSP00000261177:G157R	G	+	1	0	TSPAN11	31026746	1.000000	0.71417	0.290000	0.24890	0.327000	0.28475	9.191000	0.94940	1.814000	0.52955	0.313000	0.20887	GGA	TSPAN11	-	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2	ENSG00000110900		0.607	TSPAN11-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TSPAN11	HGNC	protein_coding	OTTHUMT00000399888.1	-	0.00	42	0	G	XM_497334		31135479	+1	tier1	-	no_errors	ENST00000261177	ensembl	human	known	74_37	missense	8.08	91	8	SNP	1.000	A
TSR1	55720	genome.wustl.edu	37	17	2237952	2237952	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr17:2237952C>A	ENST00000301364.5	-	5	1874	c.795G>T	c.(793-795)gaG>gaT	p.E265D	SGSM2_ENST00000574563.1_5'Flank|TSR1_ENST00000576112.2_Missense_Mutation_p.E249D|SGSM2_ENST00000268989.3_5'Flank|SGSM2_ENST00000426855.2_5'Flank	NM_018128.4	NP_060598.3	Q2NL82	TSR1_HUMAN	TSR1, 20S rRNA accumulation, homolog (S. cerevisiae)	265					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)	p.E265D(1)		autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	20						CCAAGTTATTCTCTTCACTAG	0.458																																																	1	Substitution - Missense(1)	large_intestine(1)											103.0	100.0	101.0					17																	2237952		2203	4300	6503	SO:0001583	missense	0			AK026565	CCDS32525.1	17p13.3	2006-04-20	2006-04-20			ENSG00000167721			25542	protein-coding gene	gene with protein product		611214	"""TSR1, 20S rRNA accumulation, homolog (yeast)"""			10718198	Standard	NM_018128		Approved	FLJ10534	uc002fuj.3	Q2NL82		ENST00000301364.5:c.795G>T	17.37:g.2237952C>A	ENSP00000301364:p.Glu265Asp		Q8WUY5|Q9NVT0|Q9P2E6	Missense_Mutation	SNP	pfam_BMS1_TSR1_C,pfam_AARP2CN,superfamily_Transl_B-barrel,smart_AARP2CN	p.E265D	ENST00000301364.5	37	c.795	CCDS32525.1	17	.	.	.	.	.	.	.	.	.	.	C	10.63	1.405566	0.25378	.	.	ENSG00000167721	ENST00000301364	T	0.46063	0.88	5.4	1.24	0.21308	AARP2CN (2);	0.454838	0.26899	N	0.021936	T	0.27419	0.0673	L	0.39397	1.21	0.38784	D	0.954836	B	0.13594	0.008	B	0.17098	0.017	T	0.09122	-1.0689	10	0.17832	T	0.49	-15.1336	6.0485	0.19773	0.0:0.5398:0.1231:0.3372	.	265	Q2NL82	TSR1_HUMAN	D	265	ENSP00000301364:E265D	ENSP00000301364:E265D	E	-	3	2	TSR1	2184702	0.833000	0.29383	0.923000	0.36655	0.867000	0.49689	0.180000	0.16860	0.026000	0.15269	-0.126000	0.14955	GAG	TSR1	-	pfam_AARP2CN,smart_AARP2CN	ENSG00000167721		0.458	TSR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TSR1	HGNC	protein_coding	OTTHUMT00000438180.2		0.00	21	0	C	NM_018128		2237952	-1			no_errors	ENST00000301364	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.991	A
TST	7263	genome.wustl.edu	37	22	37407109	37407109	+	Missense_Mutation	SNP	G	G	T	rs11554714	byFrequency	TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr22:37407109G>T	ENST00000403892.3	-	2	1587	c.853C>A	c.(853-855)Cca>Aca	p.P285T	Y_RNA_ENST00000516603.1_RNA|TST_ENST00000249042.3_Missense_Mutation_p.P285T	NM_001270483.1	NP_001257412.1	Q16762	THTR_HUMAN	thiosulfate sulfurtransferase (rhodanese)	285	Rhodanese 2. {ECO:0000255|PROSITE- ProRule:PRU00173}.				cellular nitrogen compound metabolic process (GO:0034641)|cyanate catabolic process (GO:0009440)|epithelial cell differentiation (GO:0030855)|rRNA import into mitochondrion (GO:0035928)|rRNA transport (GO:0051029)|small molecule metabolic process (GO:0044281)|sulfide oxidation, using sulfide:quinone oxidoreductase (GO:0070221)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	5S rRNA binding (GO:0008097)|thiosulfate sulfurtransferase activity (GO:0004792)			kidney(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)|urinary_tract(1)	7						CGGCTCTCTGGGGGGGCCCGG	0.622																																																	0			GRCh37	CM067799	TST	M	rs11554714						53.0	58.0	56.0					22																	37407109		2202	4296	6498	SO:0001583	missense	0			Z73420	CCDS13938.1	22q13.1	2002-02-05			ENSG00000128311	ENSG00000128311	2.8.1.1		12388	protein-coding gene	gene with protein product		180370				1953758	Standard	NM_003312		Approved	RDS	uc003aqh.4	Q16762	OTTHUMG00000150533	ENST00000403892.3:c.853C>A	22.37:g.37407109G>T	ENSP00000385828:p.Pro285Thr		B3KRM1|Q6IB06	Missense_Mutation	SNP	pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,pfscan_Rhodanese-like_dom	p.P285T	ENST00000403892.3	37	c.853	CCDS13938.1	22	.	.	.	.	.	.	.	.	.	.	G	22.2	4.259873	0.80246	.	.	ENSG00000128311	ENST00000403892;ENST00000249042;ENST00000413912	T;T	0.57107	0.42;0.42	5.08	5.08	0.68730	Rhodanese-like (3);	0.000000	0.85682	D	0.000000	T	0.46288	0.1385	N	0.20530	0.585	0.80722	D	1	B	0.27997	0.197	B	0.35931	0.214	T	0.49303	-0.8954	10	0.62326	D	0.03	0.0104	18.6721	0.91516	0.0:0.0:1.0:0.0	.	285	Q16762	THTR_HUMAN	T	285;285;232	ENSP00000385828:P285T;ENSP00000249042:P285T	ENSP00000249042:P285T	P	-	1	0	TST	35737055	1.000000	0.71417	0.816000	0.32577	0.592000	0.36648	5.719000	0.68462	2.636000	0.89361	0.655000	0.94253	CCA	TST	-	superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,pfscan_Rhodanese-like_dom	ENSG00000128311		0.622	TST-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TST	HGNC	protein_coding	OTTHUMT00000318790.1		0.00	17	0	G			37407109	-1			no_errors	ENST00000249042	ensembl	human	known	74_37	missense	6.06	31	2	SNP	0.997	T
TTYH2	94015	genome.wustl.edu	37	17	72233537	72233537	+	Missense_Mutation	SNP	C	C	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr17:72233537C>G	ENST00000269346.4	+	4	593	c.519C>G	c.(517-519)ttC>ttG	p.F173L	TTYH2_ENST00000529107.1_Missense_Mutation_p.F152L	NM_032646.5	NP_116035.5	Q9BSA4	TTYH2_HUMAN	tweety family member 2	173						chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(14)|ovary(3)|pancreas(1)|stomach(3)|upper_aerodigestive_tract(1)	36						CCCTGAAGTTCATACAGCAGA	0.592																																																	0													84.0	79.0	80.0					17																	72233537		2203	4300	6503	SO:0001583	missense	0				CCDS32717.1, CCDS45770.1	17q25.1	2013-09-02	2013-09-02		ENSG00000141540	ENSG00000141540			13877	protein-coding gene	gene with protein product		608855	"""tweety (Drosophila) homolog 2"", ""tweety homolog 2 (Drosophila)"""			11597145	Standard	XM_005257824		Approved	C17orf29	uc002jkc.3	Q9BSA4	OTTHUMG00000166018	ENST00000269346.4:c.519C>G	17.37:g.72233537C>G	ENSP00000269346:p.Phe173Leu		B3KX97|Q3B7H8|Q3B7R9|Q6AWB4|Q8NBB7|Q96PK1	Missense_Mutation	SNP	pfam_Tweety	p.F173L	ENST00000269346.4	37	c.519	CCDS32717.1	17	.	.	.	.	.	.	.	.	.	.	C	16.36	3.100444	0.56183	.	.	ENSG00000141540	ENST00000269346;ENST00000529107	T;T	0.10763	2.84;2.84	5.52	2.43	0.29744	.	0.048245	0.85682	N	0.000000	T	0.15565	0.0375	M	0.81802	2.56	0.80722	D	1	B;B	0.27013	0.166;0.014	B;B	0.32289	0.143;0.021	T	0.01844	-1.1262	10	0.39692	T	0.17	-27.5661	7.8854	0.29646	0.0:0.7178:0.1334:0.1487	.	152;173	B4DKD1;Q9BSA4	.;TTYH2_HUMAN	L	173;152	ENSP00000269346:F173L;ENSP00000433089:F152L	ENSP00000269346:F173L	F	+	3	2	TTYH2	69745132	0.885000	0.30320	0.540000	0.28089	0.967000	0.64934	1.428000	0.34892	0.281000	0.22233	0.655000	0.94253	TTC	TTYH2	-	pfam_Tweety	ENSG00000141540		0.592	TTYH2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	TTYH2	HGNC	protein_coding	OTTHUMT00000387459.1	-	0.00	26	0	C			72233537	+1	tier1	-	no_errors	ENST00000269346	ensembl	human	known	74_37	missense	12.20	36	5	SNP	0.993	G
TXLNB	167838	genome.wustl.edu	37	6	139564385	139564385	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr6:139564385G>T	ENST00000358430.3	-	10	1565	c.1333C>A	c.(1333-1335)Cgt>Agt	p.R445S	RP1-225E12.3_ENST00000585874.1_RNA	NM_153235.3	NP_694967.3	Q8N3L3	TXLNB_HUMAN	taxilin beta	445						cytoplasm (GO:0005737)		p.R445S(1)|p.R445C(1)		breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37				OV - Ovarian serous cystadenocarcinoma(155;0.000185)|GBM - Glioblastoma multiforme(68;0.000235)		TGTAAAGCACGGCAGAGGTTC	0.433																																																	2	Substitution - Missense(2)	large_intestine(1)|lung(1)											67.0	66.0	66.0					6																	139564385		2203	4300	6503	SO:0001583	missense	0				CCDS34545.1	6q23.3	2008-02-05	2005-07-29	2005-07-29	ENSG00000164440	ENSG00000164440			21617	protein-coding gene	gene with protein product		611438	"""chromosome 6 open reading frame 198"""	C6orf198		15184072	Standard	NM_153235		Approved	DKFZp451A175, MDP77, dJ522B19.2	uc021zfy.1	Q8N3L3	OTTHUMG00000015688	ENST00000358430.3:c.1333C>A	6.37:g.139564385G>T	ENSP00000351206:p.Arg445Ser		Q5VTF3|Q76L25|Q86T52|Q8N3S2	Missense_Mutation	SNP	pfam_Taxilin_fam	p.R445S	ENST00000358430.3	37	c.1333	CCDS34545.1	6	.	.	.	.	.	.	.	.	.	.	G	21.0	4.076969	0.76415	.	.	ENSG00000164440	ENST00000358430	T	0.39229	1.09	6.06	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.66268	0.2772	M	0.89715	3.055	0.58432	D	0.999995	D	0.89917	1.0	D	0.91635	0.999	T	0.71241	-0.4651	9	.	.	.	-13.3987	15.9512	0.79840	0.0:0.0:0.7919:0.2081	.	445	Q8N3L3	TXLNB_HUMAN	S	445	ENSP00000351206:R445S	.	R	-	1	0	TXLNB	139606078	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.625000	0.46452	2.882000	0.98803	0.655000	0.94253	CGT	TXLNB	-	pfam_Taxilin_fam	ENSG00000164440		0.433	TXLNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TXLNB	HGNC	protein_coding	OTTHUMT00000042458.1		0.00	17	0	G	NM_153235		139564385	-1			no_errors	ENST00000358430	ensembl	human	known	74_37	missense	6.25	30	2	SNP	1.000	T
UBE4B	10277	genome.wustl.edu	37	1	10132108	10132108	+	Missense_Mutation	SNP	G	G	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr1:10132108G>C	ENST00000253251.8	+	2	886	c.47G>C	c.(46-48)cGa>cCa	p.R16P	UBE4B_ENST00000377153.1_Missense_Mutation_p.R16P|UBE4B_ENST00000343090.6_Missense_Mutation_p.R16P|UBE4B_ENST00000377157.3_5'UTR					ubiquitination factor E4B											NS(3)|breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(14)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	48		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		CGCCTTGCACGACTTGCTGGT	0.547																																																	0													79.0	74.0	76.0					1																	10132108		2203	4300	6503	SO:0001583	missense	0			AF091093	CCDS110.1, CCDS41245.1	1p36.1	2013-01-28	2011-05-19		ENSG00000130939	ENSG00000130939		"""U-box domain containing"""	12500	protein-coding gene	gene with protein product		613565	"""ubiquitination factor E4B (homologous to yeast UFD2)"", ""ubiquitination factor E4B (UFD2 homolog, yeast)"""			9734811, 10089879	Standard	NM_006048		Approved	UBOX3, E4, UFD2, KIAA0684	uc001aqs.4	O95155	OTTHUMG00000001797	ENST00000253251.8:c.47G>C	1.37:g.10132108G>C	ENSP00000253251:p.Arg16Pro			Missense_Mutation	SNP	pfam_Ub_conjug_fac_E4_core,pfam_Ubox_domain,smart_Ubox_domain	p.R16P	ENST00000253251.8	37	c.47	CCDS110.1	1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.796178	0.90453	.	.	ENSG00000130939	ENST00000253251;ENST00000377153;ENST00000343090	T;T	0.61980	0.31;0.06	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	T	0.72463	0.3463	L	0.36672	1.1	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.79108	0.992;0.986	T	0.74754	-0.3558	10	0.59425	D	0.04	-6.7824	18.6423	0.91399	0.0:0.0:1.0:0.0	.	16;16	O95155;O95155-2	UBE4B_HUMAN;.	P	16	ENSP00000253251:R16P;ENSP00000343001:R16P	ENSP00000253251:R16P	R	+	2	0	UBE4B	10054695	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	9.097000	0.94193	2.475000	0.83589	0.462000	0.41574	CGA	UBE4B	-	NULL	ENSG00000130939		0.547	UBE4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE4B	HGNC	protein_coding	OTTHUMT00000005017.1	-	0.00	35	0	G	NM_006048		10132108	+1	tier1	-	no_errors	ENST00000343090	ensembl	human	known	74_37	missense	14.00	43	7	SNP	1.000	C
UBR4	23352	genome.wustl.edu	37	1	19510612	19510612	+	Silent	SNP	G	G	T	rs545822812		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr1:19510612G>T	ENST00000375254.3	-	16	2023	c.1996C>A	c.(1996-1998)Cgg>Agg	p.R666R	UBR4_ENST00000375226.2_Silent_p.R666R|UBR4_ENST00000375217.2_Silent_p.R666R|UBR4_ENST00000375267.2_Silent_p.R666R	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	666					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R666W(1)		breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		AAATTGTTCCGAGAGTTCAGC	0.423																																																	1	Substitution - Missense(1)	large_intestine(1)											108.0	105.0	106.0					1																	19510612		2203	4300	6503	SO:0001819	synonymous_variant	0			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.1996C>A	1.37:g.19510612G>T			A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Silent	SNP	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.R666	ENST00000375254.3	37	c.1996	CCDS189.1	1																																																																																			UBR4	-	NULL	ENSG00000127481		0.423	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR4	HGNC	protein_coding	OTTHUMT00000007085.1		0.00	18	0	G	NM_020765		19510612	-1			no_errors	ENST00000375267	ensembl	human	known	74_37	silent	6.25	30	2	SNP	1.000	T
UBAP2L	9898	genome.wustl.edu	37	1	154241426	154241426	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr1:154241426G>T	ENST00000361546.2	+	25	3206	c.3164G>T	c.(3163-3165)gGc>gTc	p.G1055V	UBAP2L_ENST00000428931.1_Missense_Mutation_p.G1055V|UBAP2L_ENST00000484819.1_3'UTR|UBAP2L_ENST00000271877.7_Missense_Mutation_p.G1065V			Q14157	UBP2L_HUMAN	ubiquitin associated protein 2-like	1055					binding of sperm to zona pellucida (GO:0007339)		poly(A) RNA binding (GO:0044822)	p.G551V(1)|p.G1055V(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(20)|ovary(1)|prostate(1)|urinary_tract(2)	50	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			CAGCAGGATGGCCAGGTAATA	0.547																																																	2	Substitution - Missense(2)	lung(2)											110.0	102.0	105.0					1																	154241426		2203	4300	6503	SO:0001583	missense	0			BC003170	CCDS1063.1, CCDS44229.1, CCDS72925.1	1q21.3	2008-02-05			ENSG00000143569	ENSG00000143569			29877	protein-coding gene	gene with protein product						8590280, 11230159	Standard	NM_014847		Approved	NICE-4, KIAA0144	uc001fep.4	Q14157	OTTHUMG00000035983	ENST00000361546.2:c.3164G>T	1.37:g.154241426G>T	ENSP00000355343:p.Gly1055Val		B4E0U8|Q5VU75|Q5VU76|Q9BTU3|Q9UGL2|Q9UGL3|Q9UGL4|Q9UGL5	Missense_Mutation	SNP	pfam_DUF3697_Uba2,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.G1055V	ENST00000361546.2	37	c.3164	CCDS1063.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.84|15.84	2.951729|2.951729	0.53186|0.53186	.|.	.|.	ENSG00000143569|ENSG00000143569	ENST00000428931;ENST00000456955;ENST00000433006;ENST00000271877;ENST00000361546|ENST00000433615;ENST00000428595	T;T;T|.	0.39997|.	1.05;1.05;1.05|.	5.73|5.73	4.82|4.82	0.62117|0.62117	.|.	0.060939|.	0.64402|.	D|.	0.000004|.	T|T	0.47507|0.47507	0.1449|0.1449	L|L	0.55990|0.55990	1.75|1.75	0.80722|0.80722	D|D	1|1	D;D;P;D|.	0.76494|.	0.959;0.997;0.875;0.999|.	P;P;B;D|.	0.72625|.	0.58;0.852;0.362;0.978|.	T|T	0.50127|0.50127	-0.8864|-0.8864	10|5	0.87932|.	D|.	0|.	-2.0338|-2.0338	9.2134|9.2134	0.37333|0.37333	0.0778:0.1458:0.7764:0.0|0.0778:0.1458:0.7764:0.0	.|.	1065;551;1055;1055|.	F8W726;C9JD99;Q14157-3;Q14157|.	.;.;.;UBP2L_HUMAN|.	V|C	1055;551;551;1065;1055|385;333	ENSP00000389445:G1055V;ENSP00000271877:G1065V;ENSP00000355343:G1055V|.	ENSP00000271877:G1065V|.	G|W	+|+	2|3	0|0	UBAP2L|UBAP2L	152508050|152508050	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.461000|7.461000	0.80834|0.80834	1.434000|1.434000	0.47414|0.47414	0.467000|0.467000	0.42956|0.42956	GGC|TGG	UBAP2L	-	NULL	ENSG00000143569		0.547	UBAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBAP2L	HGNC	protein_coding	OTTHUMT00000087673.1		0.00	38	0	G	NM_014847		154241426	+1			no_errors	ENST00000361546	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	T
UHRF2	115426	genome.wustl.edu	37	9	6506918	6506918	+	3'UTR	SNP	G	G	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr9:6506918G>A	ENST00000276893.5	+	0	3316				UHRF2_ENST00000485617.2_3'UTR	NM_152896.2	NP_690856.1	Q96PU4	UHRF2_HUMAN	ubiquitin-like with PHD and ring finger domains 2, E3 ubiquitin protein ligase						cell cycle (GO:0007049)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|positive regulation of cell cycle arrest (GO:0071158)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|ubiquitin-dependent protein catabolic process (GO:0006511)	nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)	17		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0392)|Lung(218;0.129)		TCTCACCAGTGGTTTTACATC	0.363																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF274049	CCDS6469.1	9p24.1	2013-01-28	2012-02-23		ENSG00000147854	ENSG00000147854		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	12557	protein-coding gene	gene with protein product	"""Np95-like ring finger protein"""	615211	"""ubiquitin-like with PHD and ring finger domains 2"""			12176013	Standard	NM_152896		Approved	RNF107, NIRF, URF2, MGC33463	uc003zjy.3	Q96PU4	OTTHUMG00000019521	ENST00000276893.5:c.*739G>A	9.37:g.6506918G>A			Q5VYR1|Q5VYR3|Q659C8|Q8TAG7	RNA	SNP	-	NULL	ENST00000276893.5	37	NULL	CCDS6469.1	9																																																																																			UHRF2	-	-	ENSG00000147854		0.363	UHRF2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	UHRF2	HGNC	protein_coding	OTTHUMT00000051665.3	-	0.00	19	0	G	NM_152306		6506918	+1	tier1	-	no_errors	ENST00000485617	ensembl	human	known	74_37	rna	20.00	36	9	SNP	1.000	A
UCK1	83549	genome.wustl.edu	37	9	134404652	134404652	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr9:134404652G>T	ENST00000372215.4	-	4	464	c.371C>A	c.(370-372)cCa>cAa	p.P124Q	UCK1_ENST00000372208.3_Missense_Mutation_p.P124Q|UCK1_ENST00000372210.3_Missense_Mutation_p.P115Q|UCK1_ENST00000372211.3_Missense_Mutation_p.P129Q|UCK1_ENST00000459858.1_5'UTR	NM_001261450.1|NM_001261451.1|NM_031432.2	NP_001248379.1|NP_001248380.1|NP_113620.1	Q9HA47	UCK1_HUMAN	uridine-cytidine kinase 1	124					CTP salvage (GO:0044211)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)	cytosol (GO:0005829)	ATP binding (GO:0005524)|nucleoside kinase activity (GO:0019206)|uridine kinase activity (GO:0004849)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|skin(1)|upper_aerodigestive_tract(1)	6				OV - Ovarian serous cystadenocarcinoma(145;2.34e-05)|Epithelial(140;0.000219)		CGTGGTCTCTGGTAACCTGAG	0.602																																					Melanoma(42;523 1129 28385 43975 48113)												0													49.0	48.0	48.0					9																	134404652		2203	4300	6503	SO:0001583	missense	0			AF237290	CCDS6944.1, CCDS48046.1, CCDS59151.1, CCDS59152.1	9q34.1	2008-02-05			ENSG00000130717	ENSG00000130717	2.7.1.48		14859	protein-coding gene	gene with protein product		609328				11306702	Standard	NM_031432		Approved	URK1, FLJ12255	uc031tfj.1	Q9HA47	OTTHUMG00000020823	ENST00000372215.4:c.371C>A	9.37:g.134404652G>T	ENSP00000361289:p.Pro124Gln		Q5JT09|Q5JT10|Q5JT12|Q5JT13|Q6IA74|Q96BJ0	Missense_Mutation	SNP	pfam_PRK/URK,superfamily_P-loop_NTPase,prints_Uridine_kinase	p.P129Q	ENST00000372215.4	37	c.386	CCDS6944.1	9	.	.	.	.	.	.	.	.	.	.	G	1.737	-0.492678	0.04322	.	.	ENSG00000130717	ENST00000372215;ENST00000372208;ENST00000372211;ENST00000372210	.	.	.	4.99	0.502	0.16932	Phosphoribulokinase/uridine kinase (1);	0.571816	0.18689	N	0.133919	T	0.29355	0.0731	L	0.35854	1.095	0.09310	N	0.999999	B;B;B	0.12013	0.0;0.005;0.0	B;B;B	0.17433	0.002;0.018;0.002	T	0.19484	-1.0304	9	0.27082	T	0.32	-9.2465	9.5984	0.39589	0.4878:0.0:0.5122:0.0	.	115;124;124	Q5JT10;Q9HA47-2;Q9HA47	.;.;UCK1_HUMAN	Q	124;124;129;115	.	ENSP00000361282:P124Q	P	-	2	0	UCK1	133394473	0.140000	0.22579	0.017000	0.16124	0.109000	0.19521	1.856000	0.39389	-0.143000	0.11334	-0.812000	0.03155	CCA	UCK1	-	pfam_PRK/URK,superfamily_P-loop_NTPase	ENSG00000130717		0.602	UCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UCK1	HGNC	protein_coding	OTTHUMT00000054726.1		0.00	28	0	G	NM_031432		134404652	-1			no_errors	ENST00000372211	ensembl	human	known	74_37	missense	9.09	40	4	SNP	0.018	T
URB1	9875	genome.wustl.edu	37	21	33687246	33687246	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr21:33687246C>T	ENST00000382751.3	-	39	6914	c.6799G>A	c.(6799-6801)Gca>Aca	p.A2267T		NM_014825.2	NP_055640.2	O60287	NPA1P_HUMAN	URB1 ribosome biogenesis 1 homolog (S. cerevisiae)	2267						nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(3)|skin(1)|stomach(1)	19						TCTGAGGCTGCGCTGGCGGCG	0.612																																																	0													21.0	25.0	24.0					21																	33687246		692	1591	2283	SO:0001583	missense	0			AB011111	CCDS46645.1	21q22.11	2006-11-28	2006-11-28	2006-11-28	ENSG00000142207	ENSG00000142207			17344	protein-coding gene	gene with protein product	nucleolar preribosomal-associated protein 1	608865	"""chromosome 21 open reading frame 108"""	C21orf108		9628581	Standard	NM_014825		Approved	KIAA0539, NPA1	uc002ypn.2	O60287	OTTHUMG00000064919	ENST00000382751.3:c.6799G>A	21.37:g.33687246C>T	ENSP00000372199:p.Ala2267Thr		D3DSE5|Q96NX1|Q9NYQ1	Missense_Mutation	SNP	pfam_Npa1_N,superfamily_ARM-type_fold	p.A2267T	ENST00000382751.3	37	c.6799	CCDS46645.1	21	.	.	.	.	.	.	.	.	.	.	C	12.00	1.805916	0.31961	.	.	ENSG00000142207	ENST00000382751	T	0.30182	1.54	5.32	-10.6	0.00265	.	1.743440	0.03463	N	0.212431	T	0.13415	0.0325	N	0.11201	0.11	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.17349	-1.0372	10	0.35671	T	0.21	1.4372	7.2302	0.26038	0.1034:0.5216:0.0643:0.3108	.	2267	O60287	NPA1P_HUMAN	T	2267	ENSP00000372199:A2267T	ENSP00000372199:A2267T	A	-	1	0	URB1	32609117	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.520000	0.02241	-3.317000	0.00189	-0.229000	0.12294	GCA	URB1	-	NULL	ENSG00000142207		0.612	URB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	URB1	HGNC	protein_coding	OTTHUMT00000139400.2	-	0.00	27	0	C			33687246	-1	tier1	-	no_errors	ENST00000382751	ensembl	human	known	74_37	missense	10.26	35	4	SNP	0.000	T
VPS18	57617	genome.wustl.edu	37	15	41192668	41192668	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr15:41192668G>T	ENST00000220509.5	+	4	1991	c.1652G>T	c.(1651-1653)gGg>gTg	p.G551V	VPS18_ENST00000558474.1_Intron	NM_020857.2	NP_065908.1	Q9P253	VPS18_HUMAN	vacuolar protein sorting 18 homolog (S. cerevisiae)	551					endosome organization (GO:0007032)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|vesicle-mediated transport (GO:0016192)|viral entry into host cell (GO:0046718)	actin filament (GO:0005884)|early endosome (GO:0005769)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	metal ion binding (GO:0046872)			autonomic_ganglia(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	28		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.07e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.164)		GCCAGTCATGGGGACACAGAA	0.582																																																	0													129.0	134.0	132.0					15																	41192668		2203	4300	6503	SO:0001583	missense	0			AF308802	CCDS10069.1	15q14-q15	2006-12-19	2006-12-19		ENSG00000104142	ENSG00000104142			15972	protein-coding gene	gene with protein product		608551	"""vacuolar protein sorting protein 18"""			11250079, 16203730	Standard	NM_020857		Approved	KIAA1475, PEP3	uc001zne.3	Q9P253	OTTHUMG00000130135	ENST00000220509.5:c.1652G>T	15.37:g.41192668G>T	ENSP00000220509:p.Gly551Val		Q8TCG0|Q96DI3|Q9H268	Missense_Mutation	SNP	pfam_Pep3_Vps18,pfam_Clathrin_H-chain/VPS_repeat,superfamily_ARM-type_fold	p.G551V	ENST00000220509.5	37	c.1652	CCDS10069.1	15	.	.	.	.	.	.	.	.	.	.	G	20.7	4.027737	0.75390	.	.	ENSG00000104142	ENST00000220509	T	0.26810	1.71	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.62986	0.2473	M	0.91768	3.24	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.70502	-0.4854	10	0.87932	D	0	-46.3739	20.0212	0.97504	0.0:0.0:1.0:0.0	.	551	Q9P253	VPS18_HUMAN	V	551	ENSP00000220509:G551V	ENSP00000220509:G551V	G	+	2	0	VPS18	38979960	1.000000	0.71417	0.999000	0.59377	0.953000	0.61014	9.869000	0.99810	2.735000	0.93741	0.561000	0.74099	GGG	VPS18	-	superfamily_ARM-type_fold	ENSG00000104142		0.582	VPS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS18	HGNC	protein_coding	OTTHUMT00000252443.2		0.00	32	0	G			41192668	+1			no_errors	ENST00000220509	ensembl	human	known	74_37	missense	8.11	34	3	SNP	1.000	T
VPS8	23355	genome.wustl.edu	37	3	184675247	184675247	+	Missense_Mutation	SNP	C	C	A	rs201443606		TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr3:184675247C>A	ENST00000437079.3	+	37	3292	c.3121C>A	c.(3121-3123)Cca>Aca	p.P1041T	VPS8_ENST00000436792.2_Missense_Mutation_p.P1039T|VPS8_ENST00000446204.2_Missense_Mutation_p.P949T|VPS8_ENST00000287546.4_Missense_Mutation_p.P1041T	NM_001009921.2	NP_001009921.1	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog (S. cerevisiae)	1041							zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			TCAGTTCAACCCAACCCAAGT	0.388																																																	0													83.0	79.0	80.0					3																	184675247		1893	4115	6008	SO:0001583	missense	0			AK056661	CCDS46972.1	3q27.2	2006-07-07	2006-07-07	2006-07-07	ENSG00000156931	ENSG00000156931			29122	protein-coding gene	gene with protein product			"""KIAA0804"""	KIAA0804		9872452	Standard	NM_001009921		Approved	FLJ32099	uc003fpb.1	Q8N3P4	OTTHUMG00000156707	ENST00000437079.3:c.3121C>A	3.37:g.184675247C>A	ENSP00000397879:p.Pro1041Thr		A8K8Q8|B9EIQ1|C9JB61|O94896|Q63HP2|Q9BVP9|Q9H9B0	Missense_Mutation	SNP	superfamily_Quinonprotein_ADH-like_supfam,superfamily_ARM-type_fold,smart_Znf_RING,pfscan_Znf_RING,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P1041T	ENST00000437079.3	37	c.3121	CCDS46971.1	3	.	.	.	.	.	.	.	.	.	.	C	19.21	3.783283	0.70222	.	.	ENSG00000156931	ENST00000287546;ENST00000437079;ENST00000436792;ENST00000446204	T;T;T;T	0.35789	1.29;1.29;1.29;1.33	5.46	5.46	0.80206	Quinonprotein alcohol dehydrogenase-like (1);	0.000000	0.85682	D	0.000000	T	0.60612	0.2282	M	0.78801	2.425	0.58432	D	0.999999	D;D;P	0.55605	0.959;0.972;0.946	P;D;P	0.64506	0.503;0.926;0.509	T	0.64015	-0.6506	10	0.66056	D	0.02	-20.5427	16.2413	0.82409	0.0:1.0:0.0:0.0	.	1041;949;1039	Q8N3P4;Q8N3P4-2;Q8N3P4-3	VPS8_HUMAN;.;.	T	1041;1041;1039;949	ENSP00000287546:P1041T;ENSP00000397879:P1041T;ENSP00000404704:P1039T;ENSP00000405483:P949T	ENSP00000287546:P1041T	P	+	1	0	VPS8	186157941	0.978000	0.34361	0.603000	0.28903	0.968000	0.65278	4.413000	0.59795	2.549000	0.85964	0.655000	0.94253	CCA	VPS8	-	superfamily_Quinonprotein_ADH-like_supfam	ENSG00000156931		0.388	VPS8-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS8	HGNC	protein_coding		-	0.00	51	0	C	NM_015303		184675247	+1	tier1	-	no_errors	ENST00000287546	ensembl	human	known	74_37	missense	5.26	72	4	SNP	0.874	A
VWA3A	146177	genome.wustl.edu	37	16	22159581	22159581	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr16:22159581G>T	ENST00000389398.5	+	28	3034	c.2938G>T	c.(2938-2940)Gag>Tag	p.E980*	VWA3A_ENST00000563755.1_Nonsense_Mutation_p.E82*|VWA3A_ENST00000389397.4_Nonsense_Mutation_p.E82*	NM_173615.3	NP_775886.3	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A	980	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.					extracellular region (GO:0005576)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7				GBM - Glioblastoma multiforme(48;0.0439)		GGTGAAGACAGAGCTGGTTTT	0.572																																																	0													66.0	66.0	66.0					16																	22159581		1970	4165	6135	SO:0001587	stop_gained	0			AK128606, AK098260	CCDS45441.1	16p12.1	2008-02-05				ENSG00000175267			27088	protein-coding gene	gene with protein product						12477932	Standard	XM_006721021		Approved	FLJ46765, FLJ40941	uc010vbq.2	A6NCI4		ENST00000389398.5:c.2938G>T	16.37:g.22159581G>T	ENSP00000374049:p.Glu980*		A4QMU8|A6NNC0|Q6UTX4|Q6ZQZ9|Q8IUY6|Q8N9W1	Nonsense_Mutation	SNP	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.E980*	ENST00000389398.5	37	c.2938	CCDS45441.1	16	.	.	.	.	.	.	.	.	.	.	G	23.5	4.422856	0.83559	.	.	ENSG00000175267	ENST00000389398;ENST00000389397;ENST00000299840	.	.	.	5.1	5.1	0.69264	.	0.300232	0.31233	N	0.008010	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	16.4323	0.83853	0.0:0.0:1.0:0.0	.	.	.	.	X	980;82;603	.	ENSP00000299840:E603X	E	+	1	0	VWA3A	22067082	1.000000	0.71417	0.982000	0.44146	0.659000	0.38960	5.542000	0.67218	2.539000	0.85634	0.650000	0.86243	GAG	VWA3A	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000175267		0.572	VWA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA3A	HGNC	protein_coding	OTTHUMT00000430052.1	-	0.00	61	0	G			22159581	+1	tier1	-	no_errors	ENST00000389398	ensembl	human	known	74_37	nonsense	7.02	53	4	SNP	1.000	T
WASH6P	653440	genome.wustl.edu	37	X	155252161	155252161	+	RNA	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chrX:155252161G>T	ENST00000461007.1	+	0	1169				AJ271736.10_ENST00000285718.7_RNA			Q9NQA3	WASH6_HUMAN	WAS protein family homolog 6 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										GTGTGGGCGGGAGGCCCGGCC	0.652																																																	0																																												0			AI042587		Xq28 and Yq12	2014-08-28	2008-01-16	2008-01-16	ENSG00000182484	ENSG00000182484		"""Pseudoautosomal regions / PAR2"", ""WAS protein homologs"""	31685	pseudogene	pseudogene			"""family with sequence similarity 39, member A"", ""chromosomes X and Y open reading frame 1"""	FAM39A, CXYorf1		10655549, 12566406, 18159949	Standard	NG_008380		Approved			Q9NQA3	OTTHUMG00000022677		X.37:g.155252161G>T			A6NGF1|Q8N305	RNA	SNP	-	NULL	ENST00000461007.1	37	NULL		X																																																																																			WASH6P	-	-	ENSG00000182484		0.652	WASH6P-016	KNOWN	basic	processed_transcript	WASH6P	HGNC	pseudogene	OTTHUMT00000058840.1	-	0.00	48	0	G	NG_008380		155252161	+1	tier1	-	no_errors	ENST00000340131	ensembl	human	known	74_37	rna	11.32	94	12	SNP	0.958	T
WDFY3	23001	genome.wustl.edu	37	4	85660182	85660183	+	Frame_Shift_Ins	INS	-	-	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr4:85660182_85660183insT	ENST00000295888.4	-	40	6961_6962	c.6554_6555insA	c.(6553-6555)tacfs	p.Y2185fs	WDFY3_ENST00000322366.6_Frame_Shift_Ins_p.Y2185fs	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	2185					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		TATCTTGGCTGTAACTACCATC	0.411																																																	0																																										SO:0001589	frameshift_variant	0			AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.6555dupA	4.37:g.85660183_85660183dupT	ENSP00000295888:p.Tyr2185fs		Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Frame_Shift_Ins	INS	pfam_BEACH_dom,pfam_Znf_FYVE,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_Znf_FYVE_PHD,superfamily_ConA-like_lec_gl_sf,superfamily_Cyclin-like,superfamily_ARM-type_fold,smart_WD40_repeat,smart_Znf_FYVE,pfscan_BEACH_dom,pfscan_Znf_FYVE-rel,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Y2185fs	ENST00000295888.4	37	c.6555_6554	CCDS3609.1	4																																																																																			WDFY3	-	NULL	ENSG00000163625		0.411	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY3	HGNC	protein_coding	OTTHUMT00000252811.2		0.00	58	0	0	NM_014991		85660183	-1			no_errors	ENST00000295888	ensembl	human	known	74_37	frame_shift_ins	8.40	109	10	INS	1.000:1.000	T
WDFY3	23001	genome.wustl.edu	37	4	85687071	85687071	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr4:85687071G>T	ENST00000295888.4	-	32	5487	c.5080C>A	c.(5080-5082)Cta>Ata	p.L1694I	WDFY3_ENST00000322366.6_Missense_Mutation_p.L1694I	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	1694					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		TTACTTAGTAGGACAACAAGA	0.408																																																	0													144.0	136.0	139.0					4																	85687071		2203	4300	6503	SO:0001583	missense	0			AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.5080C>A	4.37:g.85687071G>T	ENSP00000295888:p.Leu1694Ile		Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_Znf_FYVE,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_Znf_FYVE_PHD,superfamily_ConA-like_lec_gl_sf,superfamily_Cyclin-like,superfamily_ARM-type_fold,smart_WD40_repeat,smart_Znf_FYVE,pfscan_BEACH_dom,pfscan_Znf_FYVE-rel,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L1694I	ENST00000295888.4	37	c.5080	CCDS3609.1	4	.	.	.	.	.	.	.	.	.	.	G	8.990	0.977443	0.18812	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	T;T	0.58652	0.32;0.32	5.6	2.89	0.33648	.	0.000000	0.85682	D	0.000000	T	0.36468	0.0968	L	0.31420	0.93	0.54753	D	0.999989	P	0.36027	0.533	B	0.27796	0.083	T	0.14420	-1.0473	10	0.22706	T	0.39	.	9.0734	0.36506	0.2768:0.0:0.7232:0.0	.	1694	Q8IZQ1	WDFY3_HUMAN	I	1694	ENSP00000318466:L1694I;ENSP00000295888:L1694I	ENSP00000295888:L1694I	L	-	1	2	WDFY3	85906095	1.000000	0.71417	0.995000	0.50966	0.617000	0.37484	2.560000	0.45896	1.358000	0.45922	0.655000	0.94253	CTA	WDFY3	-	NULL	ENSG00000163625		0.408	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY3	HGNC	protein_coding	OTTHUMT00000252811.2	-	0.00	36	0	G	NM_014991		85687071	-1	tier1	-	no_errors	ENST00000295888	ensembl	human	known	74_37	missense	6.15	61	4	SNP	1.000	T
WDFY4	57705	genome.wustl.edu	37	10	49988153	49988153	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr10:49988153G>T	ENST00000325239.5	+	18	3592	c.3565G>T	c.(3565-3567)Ggc>Tgc	p.G1189C	WDFY4_ENST00000413659.2_Intron	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	1189						integral component of membrane (GO:0016021)		p.G1189C(1)		NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						ACAGGTCATTGGCTCTGCCAA	0.512																																																	1	Substitution - Missense(1)	prostate(1)											112.0	98.0	102.0					10																	49988153		692	1591	2283	SO:0001583	missense	0			AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.3565G>T	10.37:g.49988153G>T	ENSP00000320563:p.Gly1189Cys		B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G1189C	ENST00000325239.5	37	c.3565	CCDS44385.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.26|19.26	3.794106|3.794106	0.70452|0.70452	.|.	.|.	ENSG00000128815|ENSG00000128815	ENST00000426033;ENST00000325239|ENST00000312002	T|.	0.58060|.	0.36|.	5.85|5.85	5.85|5.85	0.93711|0.93711	.|.	.|.	.|.	.|.	.|.	T|T	0.63177|0.63177	0.2489|0.2489	L|L	0.42245|0.42245	1.32|1.32	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	T|T	0.56938|0.56938	-0.7896|-0.7896	8|5	.|.	.|.	.|.	.|.	17.3136|17.3136	0.87216|0.87216	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1189|.	Q6ZS81|.	WDFY4_HUMAN|.	C|L	1189|279	ENSP00000320563:G1189C|.	.|.	G|W	+|+	1|2	0|0	WDFY4|WDFY4	49658159|49658159	1.000000|1.000000	0.71417|0.71417	0.967000|0.967000	0.41034|0.41034	0.522000|0.522000	0.34438|0.34438	5.756000|5.756000	0.68757|0.68757	2.767000|2.767000	0.95098|0.95098	0.655000|0.655000	0.94253|0.94253	GGC|TGG	WDFY4	-	NULL	ENSG00000128815		0.512	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	HGNC	protein_coding			0.00	18	0	G	XM_033379		49988153	+1			no_errors	ENST00000325239	ensembl	human	known	74_37	missense	12.50	28	4	SNP	1.000	T
WDR17	116966	genome.wustl.edu	37	4	177071685	177071685	+	Missense_Mutation	SNP	C	C	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr4:177071685C>T	ENST00000280190.4	+	17	2473	c.2317C>T	c.(2317-2319)Ctt>Ttt	p.L773F	WDR17_ENST00000507824.2_Missense_Mutation_p.L756F|WDR17_ENST00000393643.2_Missense_Mutation_p.L749F|WDR17_ENST00000508596.1_Missense_Mutation_p.L749F			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	773										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		TGATAGCTTACTTCCTCAGAA	0.338																																																	0													110.0	107.0	108.0					4																	177071685		2203	4300	6503	SO:0001583	missense	0			AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.2317C>T	4.37:g.177071685C>T	ENSP00000280190:p.Leu773Phe		E7EQX0|Q0QD35	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.L773F	ENST00000280190.4	37	c.2317	CCDS3825.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.4|21.4	4.136518|4.136518	0.77662|0.77662	.|.	.|.	ENSG00000150627|ENSG00000150627	ENST00000508596;ENST00000393643;ENST00000280190;ENST00000507824|ENST00000443118	T;T;T|.	0.61040|.	0.18;0.2;0.14|.	5.69|5.69	5.69|5.69	0.88448|0.88448	.|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.77765|0.77765	0.4179|0.4179	M|M	0.75447|0.75447	2.3|2.3	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.85130|.	0.997;0.997|.	T|T	0.76377|0.76377	-0.2981|-0.2981	10|5	0.54805|.	T|.	0.06|.	-12.3828|-12.3828	19.8155|19.8155	0.96566|0.96566	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	749;773|.	E7EQX0;Q8IZU2|.	.;WDR17_HUMAN|.	F|I	749;749;773;756|15	ENSP00000422763:L749F;ENSP00000377258:L749F;ENSP00000280190:L773F|.	ENSP00000280190:L773F|.	L|T	+|+	1|2	0|0	WDR17|WDR17	177308679|177308679	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.964000|0.964000	0.63967|0.63967	5.513000|5.513000	0.67037|0.67037	2.691000|2.691000	0.91804|0.91804	0.563000|0.563000	0.77884|0.77884	CTT|ACT	WDR17	-	NULL	ENSG00000150627		0.338	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR17	HGNC	protein_coding	OTTHUMT00000362334.2	-	0.00	40	0	C			177071685	+1	tier1	-	no_errors	ENST00000280190	ensembl	human	known	74_37	missense	13.16	66	10	SNP	1.000	T
XIRP1	165904	genome.wustl.edu	37	3	39225951	39225951	+	Silent	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr3:39225951G>T	ENST00000340369.3	-	2	5214	c.4986C>A	c.(4984-4986)tcC>tcA	p.S1662S	XIRP1_ENST00000421646.1_Silent_p.S345S|XIRP1_ENST00000396251.1_3'UTR	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	1662					cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		AATCTCGGCTGGAAGGTAAAA	0.547																																																	0													87.0	88.0	87.0					3																	39225951		2203	4300	6503	SO:0001819	synonymous_variant	0			AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.4986C>A	3.37:g.39225951G>T			A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Silent	SNP	pfam_Actin-binding_Xin_repeat	p.S1662	ENST00000340369.3	37	c.4986	CCDS2683.1	3																																																																																			XIRP1	-	NULL	ENSG00000168334		0.547	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	XIRP1	HGNC	protein_coding	OTTHUMT00000254065.1	-	0.00	50	0	G	XM_093522		39225951	-1	tier1	-	no_errors	ENST00000340369	ensembl	human	known	74_37	silent	5.00	76	4	SNP	0.135	T
XIRP2	129446	genome.wustl.edu	37	2	168105269	168105269	+	Missense_Mutation	SNP	A	A	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr2:168105269A>C	ENST00000409195.1	+	9	7456	c.7367A>C	c.(7366-7368)aAa>aCa	p.K2456T	XIRP2_ENST00000295237.9_Missense_Mutation_p.K2456T|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.K2234T|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409728.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	2281					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						ATGGAATGTAAAATTACTACC	0.388																																																	0													80.0	80.0	80.0					2																	168105269		1872	4121	5993	SO:0001583	missense	0			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.7367A>C	2.37:g.168105269A>C	ENSP00000386840:p.Lys2456Thr		A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	pfam_Actin-binding_Xin_repeat	p.K2456T	ENST00000409195.1	37	c.7367	CCDS42769.1	2	.	.	.	.	.	.	.	.	.	.	A	6.341	0.430974	0.12045	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.03094	4.05;4.05;4.05	5.52	2.96	0.34315	.	0.547283	0.18235	N	0.147458	T	0.04770	0.0129	M	0.63428	1.95	0.09310	N	1	B;B;B	0.20052	0.024;0.041;0.041	B;B;B	0.12156	0.003;0.007;0.007	T	0.33854	-0.9852	10	0.25751	T	0.34	-14.0917	7.612	0.28135	0.6088:0.2636:0.0:0.1276	.	2281;2281;2234	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	T	2456;2456;2234	ENSP00000386840:K2456T;ENSP00000295237:K2456T;ENSP00000387255:K2234T	ENSP00000295237:K2456T	K	+	2	0	XIRP2	167813515	0.016000	0.18221	0.027000	0.17364	0.233000	0.25261	1.487000	0.35540	1.019000	0.39547	-0.332000	0.08345	AAA	XIRP2	-	NULL	ENSG00000163092		0.388	XIRP2-001	KNOWN	basic|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333547.1	-	0.00	49	0	A	NM_152381		168105269	+1	tier1	-	no_errors	ENST00000295237	ensembl	human	known	74_37	missense	14.89	40	7	SNP	0.002	C
XIRP2	129446	genome.wustl.edu	37	2	168115797	168115797	+	Missense_Mutation	SNP	G	G	T	rs75758327	byFrequency	TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr2:168115797G>T	ENST00000409728.1	+	11	2929	c.2840G>T	c.(2839-2841)aGa>aTa	p.R947I	XIRP2_ENST00000295237.9_3'UTR|XIRP2_ENST00000420519.1_Missense_Mutation_p.R947I|XIRP2_ENST00000409756.2_Missense_Mutation_p.R914I|XIRP2_ENST00000409043.1_Missense_Mutation_p.R914I|XIRP2_ENST00000409273.1_3'UTR|XIRP2_ENST00000409605.1_Missense_Mutation_p.R692I|XIRP2_ENST00000409195.1_3'UTR	NM_001199143.1	NP_001186072.1	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	0					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TTGTTTCCCAGAGTGGAGGTG	0.448																																																	0													79.0	73.0	75.0					2																	168115797		1937	4147	6084	SO:0001583	missense	0			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409728.1:c.2840G>T	2.37:g.168115797G>T	ENSP00000386619:p.Arg947Ile		A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.R947I	ENST00000409728.1	37	c.2840	CCDS56143.1	2	.	.	.	.	.	.	.	.	.	.	G	15.12	2.738222	0.49045	.	.	ENSG00000163092	ENST00000409043;ENST00000409728;ENST00000409756;ENST00000420519;ENST00000409605	T;T;T;T;T	0.78364	-1.17;-1.17;-1.17;-1.17;-1.17	5.7	-1.62	0.08372	.	.	.	.	.	T	0.60805	0.2297	.	.	.	0.09310	N	1	P;P	0.44380	0.834;0.834	B;B	0.37144	0.178;0.242	T	0.55042	-0.8202	8	0.72032	D	0.01	.	1.9647	0.03393	0.2847:0.2083:0.4003:0.1066	.	914;947	A4UGR9-4;A4UGR9-6	.;.	I	914;947;914;947;692	ENSP00000386454:R914I;ENSP00000386619:R947I;ENSP00000386724:R914I;ENSP00000415541:R947I;ENSP00000386981:R692I	ENSP00000386454:R914I	R	+	2	0	XIRP2	167824043	0.000000	0.05858	0.000000	0.03702	0.043000	0.13939	0.318000	0.19504	-0.318000	0.08665	0.650000	0.86243	AGA	XIRP2	-	NULL	ENSG00000163092		0.448	XIRP2-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333552.1	-	0.00	33	0	G	NM_152381		168115797	+1	tier1	-	no_errors	ENST00000420519	ensembl	human	known	74_37	missense	9.76	37	4	SNP	0.000	T
ZBTB49	166793	genome.wustl.edu	37	4	4304045	4304045	+	Nonsense_Mutation	SNP	C	C	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr4:4304045C>G	ENST00000337872.4	+	3	603	c.482C>G	c.(481-483)tCa>tGa	p.S161*	ZBTB49_ENST00000538529.1_5'UTR|ZBTB49_ENST00000355834.3_Nonsense_Mutation_p.S161*	NM_145291.3	NP_660334.3	Q6ZSB9	ZBT49_HUMAN	zinc finger and BTB domain containing 49	161					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	28						CAGGAATGTTCAGCAGATGCA	0.453																																																	0													128.0	124.0	125.0					4																	4304045		2203	4300	6503	SO:0001587	stop_gained	0			AK095878	CCDS3375.1	4p16.2	2013-01-08	2010-01-26	2010-01-26	ENSG00000168826	ENSG00000168826		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	19883	protein-coding gene	gene with protein product			"""zinc finger protein 509"""	ZNF509		12477932	Standard	NM_145291		Approved	FLJ38559	uc003ghu.3	Q6ZSB9	OTTHUMG00000090325	ENST00000337872.4:c.482C>G	4.37:g.4304045C>G	ENSP00000338807:p.Ser161*		Q59FJ4|Q5EBN0|Q8TB80	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.S161*	ENST00000337872.4	37	c.482	CCDS3375.1	4	.	.	.	.	.	.	.	.	.	.	C	21.3	4.135631	0.77662	.	.	ENSG00000168826	ENST00000355834;ENST00000337872	.	.	.	5.17	5.17	0.71159	.	0.551754	0.16580	N	0.208232	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	12.3936	0.55373	0.0:0.9225:0.0:0.0775	.	.	.	.	X	161	.	ENSP00000338807:S161X	S	+	2	0	ZBTB49	4354946	0.050000	0.20438	0.005000	0.12908	0.006000	0.05464	3.076000	0.50081	2.585000	0.87301	0.591000	0.81541	TCA	ZBTB49	-	NULL	ENSG00000168826		0.453	ZBTB49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB49	HGNC	protein_coding	OTTHUMT00000206688.3	-	0.00	25	0	C	NM_145291		4304045	+1	tier1	-	no_errors	ENST00000337872	ensembl	human	known	74_37	nonsense	13.64	38	6	SNP	0.078	G
ZCCHC6	79670	genome.wustl.edu	37	9	88924479	88924479	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr9:88924479C>A	ENST00000375963.3	-	20	3653	c.3481G>T	c.(3481-3483)Ggt>Tgt	p.G1161C	ZCCHC6_ENST00000375957.1_Intron|ZCCHC6_ENST00000375961.2_Intron|ZCCHC6_ENST00000375960.2_Missense_Mutation_p.G925C|ZCCHC6_ENST00000277141.6_Missense_Mutation_p.G450C	NM_001185059.1|NM_024617.3	NP_001171988.1|NP_078893.2	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	1161					RNA 3'-end processing (GO:0031123)		poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	46						GATGCATCACCAATATCACAC	0.393																																																	0													84.0	82.0	82.0					9																	88924479		2203	4300	6503	SO:0001583	missense	0			AL832026	CCDS35057.1, CCDS55323.1	9q21	2014-03-05			ENSG00000083223	ENSG00000083223		"""Zinc fingers, CCHC domain containing"""	25817	protein-coding gene	gene with protein product	"""TUTase7"""					11214970	Standard	NM_001185059		Approved	KIAA1711, FLJ13409, PAPD6, TUT7	uc004aoq.3	Q5VYS8	OTTHUMG00000020137	ENST00000375963.3:c.3481G>T	9.37:g.88924479C>A	ENSP00000365130:p.Gly1161Cys		Q5H9T0|Q5VYS5|Q5VYS7|Q658Z9|Q659A2|Q6MZJ3|Q8N5F0|Q96N57|Q96NE8|Q9C0F2|Q9H8M6	Missense_Mutation	SNP	pfam_PAP_assoc,pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_U1,smart_Znf_CCHC,pfscan_Znf_CCHC	p.G1161C	ENST00000375963.3	37	c.3481	CCDS35057.1	9	.	.	.	.	.	.	.	.	.	.	C	25.8	4.670743	0.88348	.	.	ENSG00000083223	ENST00000277141;ENST00000375960;ENST00000375963	T;T;T	0.55760	0.5;0.5;0.5	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.70745	0.3259	L	0.60455	1.87	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.992;0.998	T	0.72083	-0.4397	10	0.72032	D	0.01	2.5357	19.1356	0.93426	0.0:1.0:0.0:0.0	.	925;1161	Q5VYS8-4;Q5VYS8	.;TUT7_HUMAN	C	450;925;1161	ENSP00000277141:G450C;ENSP00000365127:G925C;ENSP00000365130:G1161C	ENSP00000277141:G450C	G	-	1	0	ZCCHC6	88114299	1.000000	0.71417	0.999000	0.59377	0.975000	0.68041	7.320000	0.79064	2.826000	0.97356	0.655000	0.94253	GGT	ZCCHC6	-	NULL	ENSG00000083223		0.393	ZCCHC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC6	HGNC	protein_coding	OTTHUMT00000052918.1	-	0.00	39	0	C	NM_024617		88924479	-1	tier1	-	no_errors	ENST00000375963	ensembl	human	known	74_37	missense	5.80	65	4	SNP	1.000	A
ZFP28	140612	genome.wustl.edu	37	19	57066294	57066294	+	Missense_Mutation	SNP	T	T	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr19:57066294T>A	ENST00000301318.3	+	8	2211	c.2140T>A	c.(2140-2142)Tca>Aca	p.S714T	AC007228.11_ENST00000596587.1_RNA	NM_020828.1	NP_065879.1	Q8NHY6	ZFP28_HUMAN	ZFP28 zinc finger protein	714					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(6)|ovary(1)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	35		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0302)		TGGTGATAACTCATCCTGTAC	0.433																																					Ovarian(124;554 1662 19430 21141 52494)												0													107.0	106.0	106.0					19																	57066294		2203	4300	6503	SO:0001583	missense	0				CCDS12946.1	19q13.43	2013-01-08	2012-11-27			ENSG00000196867		"""Zinc fingers, C2H2-type"", ""-"""	17801	protein-coding gene	gene with protein product			"""zinc finger protein 28 homolog (mouse)"""				Standard	NM_020828		Approved	KIAA1431, mkr5	uc002qnj.3	Q8NHY6		ENST00000301318.3:c.2140T>A	19.37:g.57066294T>A	ENSP00000301318:p.Ser714Thr		A0JNV6|K7ES88|Q8NHU8|Q9BY30|Q9P2B6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S714T	ENST00000301318.3	37	c.2140	CCDS12946.1	19	.	.	.	.	.	.	.	.	.	.	T	11.57	1.678175	0.29783	.	.	ENSG00000196867	ENST00000301318	T	0.17854	2.25	4.0	4.0	0.46444	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.38164	N	0.001791	T	0.37489	0.1005	M	0.75447	2.3	0.09310	N	0.999994	D	0.71674	0.998	D	0.76071	0.987	T	0.09292	-1.0681	10	0.59425	D	0.04	.	8.7894	0.34841	0.0:0.0:0.1905:0.8095	.	714	Q8NHY6	ZFP28_HUMAN	T	714	ENSP00000301318:S714T	ENSP00000301318:S714T	S	+	1	0	ZFP28	61758106	0.000000	0.05858	1.000000	0.80357	0.977000	0.68977	-0.082000	0.11304	1.808000	0.52836	0.454000	0.30748	TCA	ZFP28	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196867		0.433	ZFP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP28	HGNC	protein_coding	OTTHUMT00000458409.1	-	0.00	30	0	T	NM_020828		57066294	+1	tier1	-	no_errors	ENST00000301318	ensembl	human	known	74_37	missense	43.18	25	19	SNP	0.034	A
ZNF117	51351	genome.wustl.edu	37	7	64439685	64439685	+	Missense_Mutation	SNP	T	T	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr7:64439685T>G	ENST00000282869.6	-	4	1548	c.264A>C	c.(262-264)gaA>gaC	p.E88D		NM_015852.3	NP_056936.2	Q03924	ZN117_HUMAN	zinc finger protein 117	88					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|prostate(1)|skin(1)	22		Lung NSC(55;0.0295)|all_lung(88;0.0691)				TATGGAAAACTTCTACATATT	0.289																																																	0													42.0	40.0	41.0					7																	64439685		1927	4155	6082	SO:0001583	missense	0			M27879	CCDS43593.1	7q11.2	2013-01-08	2006-06-12		ENSG00000152926	ENSG00000152926		"""Zinc fingers, C2H2-type"""	12897	protein-coding gene	gene with protein product		194624	"""zinc finger protein 117 (HPF9)"""			1427907	Standard	NM_015852		Approved	HPF9, H-plk	uc003ttr.2	Q03924	OTTHUMG00000156631	ENST00000282869.6:c.264A>C	7.37:g.64439685T>G	ENSP00000282869:p.Glu88Asp		Q02313|Q7Z7Q7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E88D	ENST00000282869.6	37	c.264	CCDS43593.1	7	.	.	.	.	.	.	.	.	.	.	.	7.736	0.700280	0.15106	.	.	ENSG00000152926	ENST00000398695;ENST00000282869	T	0.36157	1.27	1.11	1.11	0.20524	.	.	.	.	.	T	0.24198	0.0586	L	0.32530	0.975	0.09310	N	1	B	0.20459	0.045	B	0.18263	0.021	T	0.27157	-1.0082	9	0.87932	D	0	.	3.881	0.09079	0.0:0.0:0.3891:0.6109	.	88	Q03924	ZN117_HUMAN	D	88	ENSP00000282869:E88D	ENSP00000282869:E88D	E	-	3	2	ZNF117	64077120	0.001000	0.12720	0.002000	0.10522	0.004000	0.04260	0.389000	0.20751	0.446000	0.26666	0.254000	0.18369	GAA	ZNF117	-	NULL	ENSG00000152926		0.289	ZNF117-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF117	HGNC	protein_coding	OTTHUMT00000344863.3	-	0.00	26	0	T	NM_024498		64439685	-1	tier1	-	no_errors	ENST00000282869	ensembl	human	known	74_37	missense	15.49	60	11	SNP	0.002	G
ZNF22	7570	genome.wustl.edu	37	10	45498857	45498857	+	Nonsense_Mutation	SNP	C	C	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr10:45498857C>G	ENST00000298299.3	+	2	634	c.41C>G	c.(40-42)tCa>tGa	p.S14*	CEP164P1_ENST00000456938.2_RNA|C10orf25_ENST00000298298.1_5'Flank	NM_006963.4	NP_008894.2	P17026	ZNF22_HUMAN	zinc finger protein 22	14					odontogenesis (GO:0042476)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|kidney(2)|lung(2)	8		Prostate(175;0.0352)|all_neural(218;0.202)				TCTCGGAGCTCAAGCCAAGGA	0.458																																																	0													60.0	64.0	63.0					10																	45498857		2203	4300	6503	SO:0001587	stop_gained	0			BC041139	CCDS7211.1	10q11	2013-01-08	2012-07-12		ENSG00000165512	ENSG00000165512		"""Zinc fingers, C2H2-type"""	13012	protein-coding gene	gene with protein product		194529					Standard	NM_006963		Approved	KOX15, HKR-T1, ZNF422, Zfp422	uc001jbw.3	P17026	OTTHUMG00000018064	ENST00000298299.3:c.41C>G	10.37:g.45498857C>G	ENSP00000298299:p.Ser14*		Q5T741|Q96FM4	Nonsense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S14*	ENST00000298299.3	37	c.41	CCDS7211.1	10	.	.	.	.	.	.	.	.	.	.	C	40	8.453381	0.98817	.	.	ENSG00000165512	ENST00000298299	.	.	.	4.94	4.94	0.65067	.	0.385029	0.19198	N	0.120243	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	-1.3829	16.0476	0.80731	0.0:1.0:0.0:0.0	.	.	.	.	X	14	.	ENSP00000298299:S14X	S	+	2	0	ZNF22	44818863	0.000000	0.05858	1.000000	0.80357	0.961000	0.63080	0.503000	0.22610	2.706000	0.92434	0.655000	0.94253	TCA	ZNF22	-	NULL	ENSG00000165512		0.458	ZNF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF22	HGNC	protein_coding	OTTHUMT00000047761.1	-	0.00	43	0	C	NM_006963		45498857	+1	tier1	-	no_errors	ENST00000298299	ensembl	human	known	74_37	nonsense	14.29	48	8	SNP	0.949	G
ZNF253	56242	genome.wustl.edu	37	19	20003455	20003455	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr19:20003455C>A	ENST00000589717.1	+	4	1491	c.1399C>A	c.(1399-1401)Ctt>Att	p.L467I	ZNF253_ENST00000355650.4_Missense_Mutation_p.L391I|AC011477.1_ENST00000578823.1_RNA|CTC-559E9.8_ENST00000585571.1_RNA	NM_021047.2	NP_066385.2	O75346	ZN253_HUMAN	zinc finger protein 253	467					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(6)|lung(11)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GTCCTCAGACCTTAATAAACA	0.333																																																	0													57.0	64.0	62.0					19																	20003455		2092	4248	6340	SO:0001583	missense	0			AF038951	CCDS42532.1	19p12	2014-02-12	2003-12-17		ENSG00000256771	ENSG00000256771		"""Zinc fingers, C2H2-type"", ""-"""	13497	protein-coding gene	gene with protein product		606954	"""zinc finger protein 411"""	ZNF411		10585455	Standard	NM_021047		Approved	BMZF-1, FLJ90391	uc002noj.3	O75346	OTTHUMG00000182369	ENST00000589717.1:c.1399C>A	19.37:g.20003455C>A	ENSP00000468720:p.Leu467Ile		A4FVA7|Q0P6G3|Q6P0L2|Q8NCA3|Q8NCF9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L467I	ENST00000589717.1	37	c.1399	CCDS42532.1	19	.	.	.	.	.	.	.	.	.	.	c	12.96	2.095052	0.36952	.	.	ENSG00000256771	ENST00000355650	.	.	.	0.81	0.81	0.18732	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.30696	0.0773	N	0.08118	0	0.09310	N	1	D	0.57257	0.979	D	0.62955	0.909	T	0.19160	-1.0314	7	.	.	.	.	6.9761	0.24677	0.0:1.0:0.0:0.0	.	467	O75346	ZN253_HUMAN	I	467	.	.	L	+	1	0	ZNF253	19864455	0.351000	0.24887	0.393000	0.26258	0.391000	0.30476	1.875000	0.39578	0.181000	0.19994	0.184000	0.17185	CTT	ZNF253	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000256771		0.333	ZNF253-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF253	HGNC	protein_coding	OTTHUMT00000460802.1	-	0.00	46	0	C	NM_021047		20003455	+1	tier1	-	no_errors	ENST00000589717	ensembl	human	known	74_37	missense	9.30	39	4	SNP	0.048	A
ZNF277	11179	genome.wustl.edu	37	7	111982780	111982780	+	Missense_Mutation	SNP	T	T	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr7:111982780T>A	ENST00000361822.3	+	12	1478	c.1349T>A	c.(1348-1350)cTa>cAa	p.L450Q	AC004112.4_ENST00000411413.1_RNA|AC004112.4_ENST00000431064.1_RNA	NM_021994.2	NP_068834.2	Q9NRM2	ZN277_HUMAN	zinc finger protein 277	450					cellular response to hydrogen peroxide (GO:0070301)|regulation of cellular senescence (GO:2000772)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			breast(4)|endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	15						CAGTTGCTACTATAAGAGTAC	0.328																																																	0													56.0	55.0	55.0					7																	111982780		2203	4300	6503	SO:0001583	missense	0			AF209198	CCDS5755.2	7q31.1	2012-10-05	2007-10-23	2007-10-23	ENSG00000198839	ENSG00000198839			13070	protein-coding gene	gene with protein product		605465	"""zinc finger protein (C2H2 type) 277"", ""zinc finger protein 277 pseudogene"""	ZNF277P		10860669, 16213364, 16395595	Standard	NM_021994		Approved	NRIF4	uc003vge.2	Q9NRM2	OTTHUMG00000150209	ENST00000361822.3:c.1349T>A	7.37:g.111982780T>A	ENSP00000354501:p.Leu450Gln		Q75MZ2|Q75MZ3|Q8WY14	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L450Q	ENST00000361822.3	37	c.1349	CCDS5755.2	7	.	.	.	.	.	.	.	.	.	.	T	16.67	3.187579	0.57909	.	.	ENSG00000198839	ENST00000361822;ENST00000421864	T	0.36157	1.27	5.73	-0.103	0.13609	.	0.687728	0.15025	N	0.284780	T	0.14356	0.0347	N	0.08118	0	0.09310	N	0.999994	B	0.10296	0.003	B	0.08055	0.003	T	0.16928	-1.0386	10	0.87932	D	0	2.0E-4	0.6663	0.00851	0.228:0.1597:0.3196:0.2927	.	450	Q9NRM2	ZN277_HUMAN	Q	450;118	ENSP00000354501:L450Q	ENSP00000354501:L450Q	L	+	2	0	ZNF277	111770016	0.000000	0.05858	0.130000	0.21974	0.952000	0.60782	-0.094000	0.11094	0.178000	0.19917	0.533000	0.62120	CTA	ZNF277	-	NULL	ENSG00000198839		0.328	ZNF277-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF277	HGNC	protein_coding	OTTHUMT00000316843.2	-	0.00	35	0	T	NM_021994		111982780	+1	tier1	-	no_errors	ENST00000361822	ensembl	human	known	74_37	missense	20.00	44	11	SNP	0.003	A
ZNF33A	7581	genome.wustl.edu	37	10	38343841	38343841	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr10:38343841G>T	ENST00000458705.2	+	5	944	c.786G>T	c.(784-786)ttG>ttT	p.L262F	ZNF33A_ENST00000469037.2_Intron|ZNF33A_ENST00000307441.9_Missense_Mutation_p.L262F|ZNF33A_ENST00000432900.2_Missense_Mutation_p.L269F|ZNF33A_ENST00000374618.3_Missense_Mutation_p.L263F			Q06730	ZN33A_HUMAN	zinc finger protein 33A	262					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(2)|large_intestine(8)|liver(2)|lung(27)|ovary(2)|prostate(1)|skin(2)	46						CATCCCTCTTGTTCCATCAGA	0.383																																																	0													72.0	68.0	69.0					10																	38343841		2203	4300	6503	SO:0001583	missense	0			D31763	CCDS31182.1, CCDS60514.1, CCDS73088.1, CCDS73089.1	10p11.2	2013-01-08	2005-03-18		ENSG00000189180	ENSG00000189180		"""Zinc fingers, C2H2-type"", ""-"""	13096	protein-coding gene	gene with protein product	"""zinc finger and ZAK associated protein with KRAB domain"""	194521	"""zinc finger protein 33a (KOX 31)"", ""zinc finger protein 11A"""	ZNF33, ZNF11A		2014798, 8464732	Standard	NM_006974		Approved	KOX5, KOX31, KIAA0065, FLJ23404, ZZAPK	uc031pui.1	Q06730	OTTHUMG00000017983	ENST00000458705.2:c.786G>T	10.37:g.38343841G>T	ENSP00000387713:p.Leu262Phe		A8K9X9|B4E0M8|F6TH33|F8WAJ5|P17013|Q5VZ86	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L269F	ENST00000458705.2	37	c.807	CCDS31182.1	10	.	.	.	.	.	.	.	.	.	.	G	0.242	-1.012933	0.02095	.	.	ENSG00000189180	ENST00000374618;ENST00000432900;ENST00000458705;ENST00000307441	T;T;T;T	0.06371	3.33;3.33;3.31;3.31	2.05	-4.09	0.03951	.	0.928993	0.08737	N	0.901195	T	0.03651	0.0104	L	0.39514	1.22	0.09310	N	1	B;B;B	0.20671	0.047;0.007;0.007	B;B;B	0.17433	0.018;0.006;0.009	T	0.48570	-0.9024	10	0.09084	T	0.74	.	1.1321	0.01747	0.2902:0.1629:0.3841:0.1628	.	269;262;263	F6TH33;Q06730;F8WAJ5	.;ZN33A_HUMAN;.	F	263;269;262;262	ENSP00000363747:L263F;ENSP00000402467:L269F;ENSP00000387713:L262F;ENSP00000304268:L262F	ENSP00000304268:L262F	L	+	3	2	ZNF33A	38383847	0.000000	0.05858	0.020000	0.16555	0.310000	0.27922	-2.260000	0.01177	-1.047000	0.03242	0.460000	0.39030	TTG	ZNF33A	-	NULL	ENSG00000189180		0.383	ZNF33A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF33A	HGNC	protein_coding	OTTHUMT00000047614.1		0.00	17	0	G	NM_006974		38343841	+1			no_errors	ENST00000432900	ensembl	human	known	74_37	missense	5.00	76	4	SNP	0.000	T
ZNF445	353274	genome.wustl.edu	37	3	44488954	44488954	+	Missense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr3:44488954G>T	ENST00000396077.2	-	8	2556	c.2209C>A	c.(2209-2211)Cct>Act	p.P737T	ZNF445_ENST00000425708.2_Missense_Mutation_p.P737T	NM_181489.5	NP_852466.1	P59923	ZN445_HUMAN	zinc finger protein 445	737					transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|skin(3)	31				KIRC - Kidney renal clear cell carcinoma(197;0.0514)|Kidney(197;0.0646)		CCGCCCTCAGGTTTTCTTTTC	0.493																																																	0													93.0	97.0	95.0					3																	44488954		2203	4300	6503	SO:0001583	missense	0			AY262260	CCDS2713.1	3p21.32	2013-01-09	2003-10-07		ENSG00000185219	ENSG00000185219		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	21018	protein-coding gene	gene with protein product			"""zinc finger protein 168"""	ZNF168		7814019	Standard	NM_181489		Approved	ZKSCAN15, ZSCAN47	uc003cnf.2	P59923	OTTHUMG00000133042	ENST00000396077.2:c.2209C>A	3.37:g.44488954G>T	ENSP00000379387:p.Pro737Thr		Q3MJD1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.P737T	ENST00000396077.2	37	c.2209	CCDS2713.1	3	.	.	.	.	.	.	.	.	.	.	g	10.84	1.462817	0.26248	.	.	ENSG00000185219	ENST00000425708;ENST00000396077	T;T	0.07114	3.22;3.22	3.49	-0.819	0.10829	.	0.604741	0.14979	N	0.287396	T	0.08313	0.0207	N	0.08118	0	0.09310	N	1	D;D	0.89917	0.999;1.0	D;D	0.80764	0.92;0.994	T	0.27297	-1.0078	10	0.36615	T	0.2	.	3.5815	0.07955	0.0884:0.1433:0.4742:0.2941	.	725;737	B7ZKX2;P59923	.;ZN445_HUMAN	T	737	ENSP00000413073:P737T;ENSP00000379387:P737T	ENSP00000379387:P737T	P	-	1	0	ZNF445	44463958	0.000000	0.05858	0.000000	0.03702	0.721000	0.41392	-0.072000	0.11486	-0.167000	0.10871	0.306000	0.20318	CCT	ZNF445	-	NULL	ENSG00000185219		0.493	ZNF445-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF445	HGNC	protein_coding	OTTHUMT00000256647.2		0.00	17	0	G	NM_181489		44488954	-1			no_errors	ENST00000396077	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.000	T
ZNF483	158399	genome.wustl.edu	37	9	114303963	114303963	+	Nonsense_Mutation	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr9:114303963G>T	ENST00000309235.5	+	6	906	c.748G>T	c.(748-750)Gaa>Taa	p.E250*	ZNF483_ENST00000358151.4_Intron	NM_133464.2	NP_597721.2	Q8TF39	ZN483_HUMAN	zinc finger protein 483	250					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(11)|ovary(1)|skin(5)	31						TAAAATAATAGAAAGGTGCCT	0.378																																																	0													47.0	50.0	49.0					9																	114303963		2202	4298	6500	SO:0001587	stop_gained	0			AB075842	CCDS35105.1, CCDS35106.1	9q32	2013-01-09			ENSG00000173258	ENSG00000173258		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23384	protein-coding gene	gene with protein product							Standard	NM_001007169		Approved	ZKSCAN16, KIAA1962, ZSCAN48	uc004bff.2	Q8TF39	OTTHUMG00000020490	ENST00000309235.5:c.748G>T	9.37:g.114303963G>T	ENSP00000311679:p.Glu250*		Q5VZN2|Q8NAE1	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.E250*	ENST00000309235.5	37	c.748	CCDS35106.1	9	.	.	.	.	.	.	.	.	.	.	G	35	5.539866	0.96474	.	.	ENSG00000173258	ENST00000309235	.	.	.	4.36	4.36	0.52297	.	0.143842	0.32343	N	0.006228	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	-19.2079	10.672	0.45764	0.0:0.1936:0.8064:0.0	.	.	.	.	X	250	.	ENSP00000311679:E250X	E	+	1	0	ZNF483	113343784	0.977000	0.34250	0.984000	0.44739	0.968000	0.65278	1.697000	0.37784	2.732000	0.93576	0.591000	0.81541	GAA	ZNF483	-	NULL	ENSG00000173258		0.378	ZNF483-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF483	HGNC	protein_coding	OTTHUMT00000053641.1		0.00	18	0	G	XM_088567		114303963	+1			no_errors	ENST00000309235	ensembl	human	known	74_37	nonsense	9.76	37	4	SNP	1.000	T
ZNF517	340385	genome.wustl.edu	37	8	146029026	146029026	+	Splice_Site	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr8:146029026G>T	ENST00000531720.1	+	2	79	c.34G>T	c.(34-36)Gag>Tag	p.E12*	ZNF517_ENST00000525105.1_Splice_Site_p.E12*|ZNF517_ENST00000359971.3_Splice_Site_p.E12*|ZNF517_ENST00000526178.1_Intron			Q6ZMY9	ZN517_HUMAN	zinc finger protein 517	12					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)			GTGGTTGCAGGAGGCGGTTGT	0.552																																																	0													174.0	165.0	168.0					8																	146029026		2203	4300	6503	SO:0001630	splice_region_variant	0			AK096527	CCDS6434.1	8q24.3	2013-01-08				ENSG00000197363		"""Zinc fingers, C2H2-type"", ""-"""	27984	protein-coding gene	gene with protein product							Standard	NM_213605		Approved		uc003zed.1	Q6ZMY9		ENST00000531720.1:c.34-1G>T	8.37:g.146029026G>T				Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E12*	ENST00000531720.1	37	c.34	CCDS6434.1	8	.	.	.	.	.	.	.	.	.	.	G	21.3	4.123894	0.77436	.	.	ENSG00000197363	ENST00000359971;ENST00000528012;ENST00000531720;ENST00000525105	.	.	.	2.41	2.41	0.29592	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.535	0.44998	0.0:0.0:1.0:0.0	.	.	.	.	X	12	.	.	E	+	1	0	ZNF517	145999830	0.990000	0.36364	0.138000	0.22173	0.468000	0.32798	1.597000	0.36729	1.346000	0.45694	0.591000	0.81541	GAG	ZNF517	-	superfamily_Krueppel-associated_box	ENSG00000197363		0.552	ZNF517-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF517	HGNC	protein_coding	OTTHUMT00000382642.1		0.00	29	0	G	XM_291261	Nonsense_Mutation	146029026	+1			no_errors	ENST00000359971	ensembl	human	known	74_37	nonsense	6.25	60	4	SNP	0.567	T
ZNF587B	100293516	genome.wustl.edu	37	19	58352658	58352658	+	Missense_Mutation	SNP	C	C	G			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr19:58352658C>G	ENST00000442832.4	+	3	850	c.616C>G	c.(616-618)Ccc>Gcc	p.P206A	ZNF587B_ENST00000594901.1_Missense_Mutation_p.P206A|ZNF587B_ENST00000316462.4_Intron|CTD-2583A14.10_ENST00000598031.1_Intron	NM_001204818.1	NP_001191747.1	E7ETH6	Z587B_HUMAN	zinc finger protein 587B	206					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)										GTGTGTGTCTCCCTTTCAGTG	0.498																																																	0																																										SO:0001583	missense	0			AK299091	CCDS56109.1	19q13.43	2013-01-08				ENSG00000269343		"""Zinc fingers, C2H2-type"", ""-"""	37142	protein-coding gene	gene with protein product							Standard	NM_001204818		Approved		uc021vcp.1	E7ETH6		ENST00000442832.4:c.616C>G	19.37:g.58352658C>G	ENSP00000392410:p.Pro206Ala		B4DR41	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P206A	ENST00000442832.4	37	c.616	CCDS56109.1	19	.	.	.	.	.	.	.	.	.	.	.	0.007	-2.000334	0.00431	.	.	ENSG00000198466	ENST00000442832	T	0.04406	3.63	2.17	-4.33	0.03677	.	.	.	.	.	T	0.02571	0.0078	N	0.17594	0.5	.	.	.	B;B	0.16166	0.016;0.004	B;B	0.17433	0.018;0.004	T	0.46020	-0.9221	7	.	.	.	.	5.6318	0.17514	0.3334:0.3368:0.3297:0.0	.	206;155	E7ETH6;Q92967	.;.	A	206	ENSP00000392410:P206A	.	P	+	1	0	ZNF587	63044470	0.000000	0.05858	0.000000	0.03702	0.047000	0.14425	-2.059000	0.01393	-1.727000	0.01368	0.306000	0.20318	CCC	ZNF587B	-	NULL	ENSG00000269343		0.498	ZNF587B-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	ZNF587B	HGNC	protein_coding	OTTHUMT00000466834.2	-	0.00	61	0	C	NM_001204818		58352658	+1	tier1	-	no_errors	ENST00000442832	ensembl	human	known	74_37	missense	15.60	91	17	SNP	0.000	G
ZNF624	57547	genome.wustl.edu	37	17	16527822	16527822	+	Splice_Site	SNP	G	G	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr17:16527822G>T	ENST00000311331.7	-	6	469	c.378C>A	c.(376-378)gaC>gaA	p.D126E		NM_020787.3	NP_065838.2	Q9P2J8	ZN624_HUMAN	zinc finger protein 624	126					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|endometrium(1)|kidney(1)|large_intestine(8)|lung(9)|ovary(1)|prostate(1)|skin(1)	26				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		TGGGCTCCATGTCTGGGGCAA	0.383																																					NSCLC(186;1023 2134 13330 38202 39800)												0													73.0	69.0	70.0					17																	16527822		2203	4300	6503	SO:0001630	splice_region_variant	0			AB037770	CCDS11180.1	17p11.2	2013-01-08			ENSG00000197566	ENSG00000197566		"""Zinc fingers, C2H2-type"", ""-"""	29254	protein-coding gene	gene with protein product						10718198	Standard	NM_020787		Approved	KIAA1349	uc010cpi.2	Q9P2J8	OTTHUMG00000058996	ENST00000311331.7:c.377-1C>A	17.37:g.16527822G>T			Q3SY62|Q3SY63|Q6ZN27	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D126E	ENST00000311331.7	37	c.378	CCDS11180.1	17	.	.	.	.	.	.	.	.	.	.	G	0.015	-1.566359	0.00903	.	.	ENSG00000197566	ENST00000311331	T	0.05855	3.38	2.95	-0.264	0.12950	.	.	.	.	.	T	0.03783	0.0107	N	0.21282	0.65	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47837	-0.9086	9	0.16420	T	0.52	.	5.9038	0.18982	0.0:0.4593:0.37:0.1708	.	126	Q9P2J8	ZN624_HUMAN	E	126	ENSP00000310472:D126E	ENSP00000310472:D126E	D	-	3	2	ZNF624	16468547	0.000000	0.05858	0.004000	0.12327	0.304000	0.27724	-0.570000	0.05895	-0.003000	0.14444	0.655000	0.94253	GAC	ZNF624	-	NULL	ENSG00000197566		0.383	ZNF624-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF624	HGNC	protein_coding	OTTHUMT00000130512.3	-	0.00	60	0	G	XM_047617	Missense_Mutation	16527822	-1	tier1	-	no_errors	ENST00000311331	ensembl	human	known	74_37	missense	5.71	66	4	SNP	0.001	T
ZNF708	7562	genome.wustl.edu	37	19	21493355	21493355	+	Silent	SNP	C	C	T			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr19:21493355C>T	ENST00000356929.3	-	2	275	c.78G>A	c.(76-78)caG>caA	p.Q26Q		NM_021269.2	NP_067092.2	P17019	ZN708_HUMAN	zinc finger protein 708	0					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(2)|skin(2)|stomach(1)	32						TATATAAATTCTGCTGTGCTG	0.343																																																	0													65.0	70.0	68.0					19																	21493355		2203	4300	6503	SO:0001819	synonymous_variant	0			X52339	CCDS32980.1	19p12	2014-02-14	2006-08-22	2005-08-16	ENSG00000182141	ENSG00000182141		"""Zinc fingers, C2H2-type"", ""-"""	12945	protein-coding gene	gene with protein product			"""zinc finger protein 15-like 1 (KOX 8)"", ""zinc finger protein 708"", ""zinc finger protein 708 (KOX8)"""	ZNF15, ZNF15L1		2014798	Standard	NM_021269		Approved	KOX8	uc002npq.1	P17019	OTTHUMG00000182841	ENST00000356929.3:c.78G>A	19.37:g.21493355C>T			Q6ZMR0	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q26	ENST00000356929.3	37	c.78	CCDS32980.1	19																																																																																			ZNF708	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000182141		0.343	ZNF708-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF708	HGNC	protein_coding	OTTHUMT00000463953.1	-	0.00	56	0	C	NM_021269		21493355	-1	tier1	-	no_errors	ENST00000356929	ensembl	human	known	74_37	silent	17.71	79	17	SNP	0.019	T
ZNF783	100289678	genome.wustl.edu	37	7	148978697	148978697	+	Missense_Mutation	SNP	C	C	A			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr7:148978697C>A	ENST00000434415.1	+	6	1067	c.904C>A	c.(904-906)Ccc>Acc	p.P302T	ZNF783_ENST00000489518.1_Intron	NM_001195220.1	NP_001182149.1	Q6ZMS7	ZN783_HUMAN	zinc finger family member 783	0					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|prostate(1)	22	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.0014)			GTGTAGAATCCCCCGAGGGCC	0.687																																																	0													32.0	37.0	35.0					7																	148978697		1885	4098	5983	SO:0001583	missense	0			AK131504	CCDS56519.1	7q36.1	2013-01-08	2008-05-28		ENSG00000204946	ENSG00000204946		"""Zinc fingers, C2H2-type"", ""-"""	27222	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001195220		Approved	DKFZp667J212	uc011kuo.2	Q6ZMS7	OTTHUMG00000158969	ENST00000434415.1:c.904C>A	7.37:g.148978697C>A	ENSP00000410890:p.Pro302Thr		C9J9J2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,pfam_DUF3669_Znf,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.P302T	ENST00000434415.1	37	c.904	CCDS56519.1	7	.	.	.	.	.	.	.	.	.	.	C	2.472	-0.321595	0.05386	.	.	ENSG00000204946	ENST00000434415	T	0.06933	3.24	4.65	2.79	0.32731	.	.	.	.	.	T	0.04588	0.0125	N	0.08118	0	0.09310	N	0.999997	.	.	.	.	.	.	T	0.45293	-0.9271	7	0.20046	T	0.44	.	9.3621	0.38201	0.0:0.8162:0.0:0.1838	.	.	.	.	T	302	ENSP00000410890:P302T	ENSP00000410890:P302T	P	+	1	0	ZNF783	148609630	0.000000	0.05858	0.053000	0.19242	0.049000	0.14656	0.025000	0.13577	1.181000	0.42912	0.655000	0.94253	CCC	ZNF783	-	NULL	ENSG00000204946		0.687	ZNF783-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF783	HGNC	protein_coding	OTTHUMT00000352715.1		0.00	21	0	C	NM_001195220		148978697	+1			no_errors	ENST00000434415	ensembl	human	known	74_37	missense	10.26	35	4	SNP	0.008	A
ZNF880	400713	genome.wustl.edu	37	19	52887244	52887244	+	Silent	SNP	T	T	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr19:52887244T>C	ENST00000422689.2	+	4	426	c.411T>C	c.(409-411)ccT>ccC	p.P137P		NM_001145434.1	NP_001138906.1	Q6PDB4	ZN880_HUMAN	zinc finger protein 880	137					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	10						TCGAAAAACCTATCAACAATT	0.303																																																	0													71.0	58.0	62.0					19																	52887244		692	1591	2283	SO:0001819	synonymous_variant	0			BC058819	CCDS46164.1	19q13.41	2013-01-08			ENSG00000221923	ENSG00000221923		"""Zinc fingers, C2H2-type"", ""-"""	37249	protein-coding gene	gene with protein product							Standard	NM_001145434		Approved		uc002pzc.3	Q6PDB4	OTTHUMG00000167972	ENST00000422689.2:c.411T>C	19.37:g.52887244T>C			B4DNA6	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P137	ENST00000422689.2	37	c.411	CCDS46164.1	19																																																																																			ZNF880	-	NULL	ENSG00000221923		0.303	ZNF880-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF880	HGNC	protein_coding	OTTHUMT00000397374.1		0.00	53	0	T	NM_001145434		52887244	+1			no_errors	ENST00000422689	ensembl	human	known	74_37	silent	6.93	94	7	SNP	0.001	C
ZSWIM8	23053	genome.wustl.edu	37	10	75549245	75549245	+	Missense_Mutation	SNP	G	G	C			TCGA-R6-A6Y0-01B-11D-A33E-09	TCGA-R6-A6Y0-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	456e2823-cc87-4c9d-9b2a-0f64ca6dc37f	3915e0c1-2ad5-46d6-ba8c-adc6eebb9946	g.chr10:75549245G>C	ENST00000605216.1	+	4	795	c.578G>C	c.(577-579)gGg>gCg	p.G193A	ZSWIM8_ENST00000604524.1_Missense_Mutation_p.G193A|ZSWIM8_ENST00000603114.1_Missense_Mutation_p.G193A|ZSWIM8_ENST00000398706.2_Missense_Mutation_p.G193A|ZSWIM8_ENST00000604729.1_Missense_Mutation_p.G193A	NM_001242487.1	NP_001229416.1	A7E2V4	ZSWM8_HUMAN	zinc finger, SWIM-type containing 8	193							zinc ion binding (GO:0008270)										TGTGGGGCTGGGGCCAAATGG	0.607																																																	0													57.0	69.0	65.0					10																	75549245		2188	4281	6469	SO:0001583	missense	0			BC151206, BC040726	CCDS44440.1, CCDS60560.1	10q22.3	2012-11-02	2012-11-02	2012-11-02	ENSG00000214655	ENSG00000214655		"""Zinc fingers, SWIM-type"""	23528	protein-coding gene	gene with protein product			"""KIAA0913"""	KIAA0913			Standard	NM_015037		Approved	4832404P21Rik	uc001jvj.3	A7E2V4	OTTHUMG00000018486	ENST00000605216.1:c.578G>C	10.37:g.75549245G>C	ENSP00000474748:p.Gly193Ala		B2RP37|O94987|Q17RS8|Q2TAB8|Q6P439|Q8IW81|Q8NB34|Q9H8F3	Missense_Mutation	SNP	pfscan_Znf_SWIM	p.G193A	ENST00000605216.1	37	c.578		10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.80|10.80	1.453724|1.453724	0.26161|0.26161	.|.	.|.	ENSG00000214655|ENSG00000214655	ENST00000398706|ENST00000446546	T|.	0.39997|.	1.05|.	5.23|5.23	5.23|5.23	0.72850|0.72850	Zinc finger, SWIM-type (1);|.	.|.	.|.	.|.	.|.	T|T	0.36248|0.36248	0.0960|0.0960	N|N	0.02539|0.02539	-0.55|-0.55	0.58432|0.58432	D|D	0.999998|0.999998	D;D;D|.	0.76494|.	0.999;0.999;0.999|.	D;D;D|.	0.83275|.	0.996;0.996;0.996|.	T|T	0.36383|0.36383	-0.9750|-0.9750	9|6	0.10902|0.22109	T|T	0.67|0.4	.|.	19.0053|19.0053	0.92848|0.92848	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	193;193;193|.	A7E2V4;A7E2V4-5;A7E2V4-4|.	K0913_HUMAN;.;.|.	A|R	193|278	ENSP00000381693:G193A|.	ENSP00000381693:G193A|ENSP00000408406:G278R	G|G	+|+	2|1	0|0	KIAA0913|KIAA0913	75219251|75219251	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	1.000000|1.000000	0.99986|0.99986	9.592000|9.592000	0.98245|0.98245	2.728000|2.728000	0.93425|0.93425	0.655000|0.655000	0.94253|0.94253	GGG|GGG	ZSWIM8	-	pfscan_Znf_SWIM	ENSG00000214655		0.607	ZSWIM8-012	NOVEL	basic|appris_principal	protein_coding	ZSWIM8	HGNC	protein_coding	OTTHUMT00000468545.1	-	0.00	39	0	G	NM_001242487		75549245	+1	tier1	-	no_errors	ENST00000398706	ensembl	human	known	74_37	missense	23.68	29	9	SNP	1.000	C
