#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ACAN	176	genome.wustl.edu	37	15	89400488	89400488	+	Missense_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr15:89400488T>G	ENST00000561243.1	+	11	4672	c.4672T>G	c.(4672-4674)Tct>Gct	p.S1558A	ACAN_ENST00000559004.1_Missense_Mutation_p.S1558A|ACAN_ENST00000439576.2_Missense_Mutation_p.S1558A|ACAN_ENST00000352105.7_Missense_Mutation_p.S1558A			P16112	PGCA_HUMAN	aggrecan	1590	CS-2.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			TCTAGAGACCTCTGCTTCTGA	0.542																																																	0													47.0	49.0	48.0					15																	89400488		1847	4094	5941	SO:0001583	missense	0			M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.4672T>G	15.37:g.89400488T>G	ENSP00000453342:p.Ser1558Ala		Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_Sushi_SCR_CCP,pfam_EG-like_dom,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Link,smart_EG-like_dom,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like_dom,prints_Link	p.S1558A	ENST00000561243.1	37	c.4672	CCDS53970.1	15	.	.	.	.	.	.	.	.	.	.	T	6.263	0.416621	0.11870	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	D;D	0.96104	-3.91;-3.91	4.19	3.05	0.35203	.	0.270296	0.19955	N	0.102330	D	0.93154	0.7820	L	0.40543	1.245	0.09310	N	1	P;P	0.46395	0.877;0.792	P;P	0.49799	0.622;0.622	D	0.85918	0.1444	10	0.30078	T	0.28	-7.4298	8.5955	0.33712	0.3244:0.0:0.0:0.6756	.	1558;1558	E7ENV9;E7EX88	.;.	A	1558;1558;1444	ENSP00000387356:S1558A;ENSP00000341615:S1558A	ENSP00000268134:S1444A	S	+	1	0	ACAN	87201492	0.002000	0.14202	0.034000	0.17996	0.615000	0.37417	0.619000	0.24388	0.917000	0.36895	0.533000	0.62120	TCT	ACAN	-	NULL	ENSG00000157766		0.542	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	ACAN	HGNC	protein_coding	OTTHUMT00000416267.2		0.00	85	0	T	NM_001135		89400488	+1			no_errors	ENST00000439576	ensembl	human	known	74_37	missense	5.56	51	3	SNP	0.043	G
LPAR5	57121	genome.wustl.edu	37	12	6748125	6748125	+	5'Flank	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr12:6748125G>T	ENST00000329858.4	-	0	0				ACRBP_ENST00000229243.2_Silent_p.R502R|ACRBP_ENST00000542357.1_5'UTR|LPAR5_ENST00000540335.1_5'Flank|ACRBP_ENST00000414226.2_Silent_p.R469R	NM_020400.5	NP_065133.1	Q9H1C0	LPAR5_HUMAN	lysophosphatidic acid receptor 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|large_intestine(1)|lung(1)|ovary(1)|skin(2)	7						CTCACCTTCCGATTGCGGTTT	0.537																																					NSCLC(74;891 2312 37538)												0													122.0	111.0	115.0					12																	6748125		2203	4300	6503	SO:0001631	upstream_gene_variant	0			AJ272207	CCDS8553.1	12p13.31	2012-08-08	2008-04-11	2008-04-11		ENSG00000184574		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	13307	protein-coding gene	gene with protein product		606926	"""G protein-coupled receptor 92"""	GPR93, GPR92		11062477, 11574155, 16774927, 16651401	Standard	NM_020400		Approved	KPG_010, LPA5	uc009zer.2	Q9H1C0			12.37:g.6748125G>T	Exception_encountered			Silent	SNP	pfam_Proacrosin-bd	p.R502	ENST00000329858.4	37	c.1504	CCDS8553.1	12																																																																																			ACRBP	-	NULL	ENSG00000111644		0.537	LPAR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACRBP	HGNC	protein_coding	OTTHUMT00000400699.1	-	0.00	65	0	G	NM_020400		6748125	-1	tier1	-	no_errors	ENST00000229243	ensembl	human	known	74_37	silent	7.02	53	4	SNP	0.002	T
ACSM5	54988	genome.wustl.edu	37	16	20448662	20448662	+	Silent	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr16:20448662C>A	ENST00000331849.4	+	12	1656	c.1509C>A	c.(1507-1509)gtC>gtA	p.V503V	CTD-2194A8.2_ENST00000574654.1_RNA	NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	503					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						CGGCTGTGGTCAGCAGCCCAG	0.567																																																	0													51.0	51.0	51.0					16																	20448662		2203	4298	6501	SO:0001819	synonymous_variant	0				CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.1509C>A	16.37:g.20448662C>A			Q96AV1|Q96CX8|Q9NWV3	Silent	SNP	pfam_AMP-dep_Synth/Lig	p.V503	ENST00000331849.4	37	c.1509	CCDS10585.1	16																																																																																			ACSM5	-	NULL	ENSG00000183549		0.567	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSM5	HGNC	protein_coding	OTTHUMT00000254413.1		0.00	92	0	C	NM_017888		20448662	+1			no_errors	ENST00000331849	ensembl	human	known	74_37	silent	5.00	76	4	SNP	1.000	A
ADORA1	134	genome.wustl.edu	37	1	203134225	203134225	+	Intron	DEL	T	T	-			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr1:203134225delT	ENST00000367236.4	+	3	1262				ADORA1_ENST00000309502.3_Intron|ADORA1_ENST00000337894.4_Intron|ADORA1_ENST00000367235.1_3'UTR|ADORA1_ENST00000472535.1_Intron	NM_001048230.1	NP_001041695.1	P30542	AA1R_HUMAN	adenosine A1 receptor						activation of MAPKK activity (GO:0000186)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|apoptotic signaling pathway (GO:0097190)|cell-cell signaling (GO:0007267)|cognition (GO:0050890)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|inflammatory response (GO:0006954)|lipid catabolic process (GO:0016042)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood pressure (GO:0045776)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of cell proliferation (GO:0008285)|negative regulation of circadian sleep/wake cycle, non-REM sleep (GO:0042323)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of heart contraction (GO:0045822)|negative regulation of hormone secretion (GO:0046888)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of mucus secretion (GO:0070256)|negative regulation of neurotrophin production (GO:0032900)|negative regulation of renal sodium excretion (GO:0035814)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|negative regulation of vasodilation (GO:0045908)|nervous system development (GO:0007399)|phagocytosis (GO:0006909)|positive regulation of blood pressure (GO:0045777)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of nucleoside transport (GO:0032244)|positive regulation of peptide secretion (GO:0002793)|positive regulation of potassium ion transport (GO:0043268)|positive regulation of protein dephosphorylation (GO:0035307)|protein targeting to membrane (GO:0006612)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of glomerular filtration (GO:0003093)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|relaxation of vascular smooth muscle (GO:0060087)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|temperature homeostasis (GO:0001659)	asymmetric synapse (GO:0032279)|axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled adenosine receptor activity (GO:0001609)|phospholipase C activity (GO:0004629)|purine nucleoside binding (GO:0001883)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(9)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	25					Adenosine(DB00640)|Aminophylline(DB01223)|Caffeine(DB00201)|Defibrotide(DB04932)|Dyphylline(DB00651)|Enprofylline(DB00824)|Gabapentin(DB00996)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Theobromine(DB01412)|Theophylline(DB00277)	TCTTAGATCCTGAAGACTCAG	0.502																																																	0																																										SO:0001627	intron_variant	0			BC026340	CCDS1434.1	1q32.1	2012-08-08			ENSG00000163485	ENSG00000163485		"""GPCR / Class A : Adenosine receptors"""	262	protein-coding gene	gene with protein product		102775				1662665, 2541503	Standard	NM_001048230		Approved	RDC7	uc001gzf.1	P30542	OTTHUMG00000042125	ENST00000367236.4:c.342-164T>-	1.37:g.203134225delT			A6NFY5|A6NGP4|A8K1L3|B3KXQ4|D2CGD0|Q6FHK3|Q8TAM8	RNA	DEL	-	NULL	ENST00000367236.4	37	NULL	CCDS1434.1	1																																																																																			ADORA1	-	-	ENSG00000163485		0.502	ADORA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADORA1	HGNC	protein_coding	OTTHUMT00000100273.1		0.00	86	0	T	NM_000674		203134225	+1	tier1		no_errors	ENST00000464019	ensembl	human	known	74_37	rna	18.52	44	10	DEL	0.000	-
ADORA1	134	genome.wustl.edu	37	1	203134226	203134226	+	Intron	SNP	G	G	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr1:203134226G>C	ENST00000367236.4	+	3	1262				ADORA1_ENST00000309502.3_Intron|ADORA1_ENST00000337894.4_Intron|ADORA1_ENST00000367235.1_3'UTR|ADORA1_ENST00000472535.1_Intron	NM_001048230.1	NP_001041695.1	P30542	AA1R_HUMAN	adenosine A1 receptor						activation of MAPKK activity (GO:0000186)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|apoptotic signaling pathway (GO:0097190)|cell-cell signaling (GO:0007267)|cognition (GO:0050890)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|inflammatory response (GO:0006954)|lipid catabolic process (GO:0016042)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood pressure (GO:0045776)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of cell proliferation (GO:0008285)|negative regulation of circadian sleep/wake cycle, non-REM sleep (GO:0042323)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of heart contraction (GO:0045822)|negative regulation of hormone secretion (GO:0046888)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of mucus secretion (GO:0070256)|negative regulation of neurotrophin production (GO:0032900)|negative regulation of renal sodium excretion (GO:0035814)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|negative regulation of vasodilation (GO:0045908)|nervous system development (GO:0007399)|phagocytosis (GO:0006909)|positive regulation of blood pressure (GO:0045777)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of nucleoside transport (GO:0032244)|positive regulation of peptide secretion (GO:0002793)|positive regulation of potassium ion transport (GO:0043268)|positive regulation of protein dephosphorylation (GO:0035307)|protein targeting to membrane (GO:0006612)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of glomerular filtration (GO:0003093)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|relaxation of vascular smooth muscle (GO:0060087)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|temperature homeostasis (GO:0001659)	asymmetric synapse (GO:0032279)|axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled adenosine receptor activity (GO:0001609)|phospholipase C activity (GO:0004629)|purine nucleoside binding (GO:0001883)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(9)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	25					Adenosine(DB00640)|Aminophylline(DB01223)|Caffeine(DB00201)|Defibrotide(DB04932)|Dyphylline(DB00651)|Enprofylline(DB00824)|Gabapentin(DB00996)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Theobromine(DB01412)|Theophylline(DB00277)	CTTAGATCCTGAAGACTCAGC	0.498																																																	0																																										SO:0001627	intron_variant	0			BC026340	CCDS1434.1	1q32.1	2012-08-08			ENSG00000163485	ENSG00000163485		"""GPCR / Class A : Adenosine receptors"""	262	protein-coding gene	gene with protein product		102775				1662665, 2541503	Standard	NM_001048230		Approved	RDC7	uc001gzf.1	P30542	OTTHUMG00000042125	ENST00000367236.4:c.342-163G>C	1.37:g.203134226G>C			A6NFY5|A6NGP4|A8K1L3|B3KXQ4|D2CGD0|Q6FHK3|Q8TAM8	RNA	SNP	-	NULL	ENST00000367236.4	37	NULL	CCDS1434.1	1																																																																																			ADORA1	-	-	ENSG00000163485		0.498	ADORA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADORA1	HGNC	protein_coding	OTTHUMT00000100273.1	-	0.00	84	0	G	NM_000674		203134226	+1	tier1	-	no_errors	ENST00000464019	ensembl	human	known	74_37	rna	18.52	44	10	SNP	0.000	C
AGMO	392636	genome.wustl.edu	37	7	15430475	15430475	+	Missense_Mutation	SNP	A	A	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr7:15430475A>C	ENST00000342526.3	-	7	901	c.732T>G	c.(730-732)gaT>gaG	p.D244E		NM_001004320.1	NP_001004320.1	Q6ZNB7	ALKMO_HUMAN	alkylglycerol monooxygenase	244					ether lipid metabolic process (GO:0046485)|fatty acid biosynthetic process (GO:0006633)|membrane lipid metabolic process (GO:0006643)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glyceryl-ether monooxygenase activity (GO:0050479)|iron ion binding (GO:0005506)			breast(1)|kidney(1)|large_intestine(6)|liver(1)|lung(30)|prostate(1)|skin(2)	42						CAAAAATTTTATCCCAAATAA	0.254																																																	0													32.0	35.0	34.0					7																	15430475		2179	4270	6449	SO:0001583	missense	0				CCDS34604.1	7p21.1	2013-03-04	2011-01-31	2011-01-31	ENSG00000187546	ENSG00000187546	1.14.16.5	"""Fatty acid hydroxylase domain containing"""	33784	protein-coding gene	gene with protein product		613738	"""transmembrane protein 195"""	TMEM195		20643956	Standard	NM_001004320		Approved	FLJ16237	uc003stb.1	Q6ZNB7	OTTHUMG00000152387	ENST00000342526.3:c.732T>G	7.37:g.15430475A>C	ENSP00000341662:p.Asp244Glu		A4D114|A6NCH5	Missense_Mutation	SNP	pfam_Fatty_acid_hydroxylase	p.D244E	ENST00000342526.3	37	c.732	CCDS34604.1	7	.	.	.	.	.	.	.	.	.	.	A	18.57	3.651626	0.67472	.	.	ENSG00000187546	ENST00000342526	D	0.95069	-3.6	5.33	0.234	0.15390	.	0.000000	0.85682	D	0.000000	D	0.97517	0.9187	H	0.95224	3.64	0.42933	D	0.99432	D	0.89917	1.0	D	0.91635	0.999	D	0.96458	0.9339	10	0.87932	D	0	-26.461	10.0992	0.42493	0.5613:0.0:0.4387:0.0	.	244	Q6ZNB7	ALKMO_HUMAN	E	244	ENSP00000341662:D244E	ENSP00000341662:D244E	D	-	3	2	AGMO	15397000	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	1.076000	0.30729	-0.117000	0.11872	0.482000	0.46254	GAT	AGMO	-	NULL	ENSG00000187546		0.254	AGMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGMO	HGNC	protein_coding	OTTHUMT00000326049.2	-	0.00	162	0	A	NM_001004320		15430475	-1	tier1	-	no_errors	ENST00000342526	ensembl	human	known	74_37	missense	17.26	163	34	SNP	0.998	C
AIDA	64853	genome.wustl.edu	37	1	222843563	222843563	+	Missense_Mutation	SNP	A	A	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr1:222843563A>G	ENST00000340020.6	-	9	942	c.736T>C	c.(736-738)Tac>Cac	p.Y246H	AIDA_ENST00000541237.1_Missense_Mutation_p.Y222H|AIDA_ENST00000355727.2_Missense_Mutation_p.Y164H|AIDA_ENST00000474863.1_5'UTR	NM_022831.2	NP_073742.2	Q96BJ3	AIDA_HUMAN	axin interactor, dorsalization associated	246					dorsal/ventral pattern formation (GO:0009953)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|regulation of protein homodimerization activity (GO:0043496)	cytoplasm (GO:0005737)				kidney(2)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	10						TTAGGCTTGTAGTGTTTGAAT	0.353																																																	0													57.0	55.0	55.0					1																	222843563		2203	4300	6503	SO:0001583	missense	0			BC043142	CCDS1533.1	1q41	2008-05-22	2008-05-22	2008-05-22	ENSG00000186063	ENSG00000186063			25761	protein-coding gene	gene with protein product	"""axin interaction partner and dorsalization antagonist"""	612375	"""chromosome 1 open reading frame 80"""	C1orf80		8619474, 9110174, 17681137	Standard	NM_022831		Approved	FLJ12806	uc001hnn.3	Q96BJ3	OTTHUMG00000037653	ENST00000340020.6:c.736T>C	1.37:g.222843563A>G	ENSP00000339161:p.Tyr246His		A8K1F0|Q49A81|Q5JRA4|Q658P1|Q9H9E8	Missense_Mutation	SNP	pfam_AIDA_N,superfamily_AIDA_N	p.Y222H	ENST00000340020.6	37	c.664	CCDS1533.1	1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.238298	0.79800	.	.	ENSG00000186063	ENST00000340020;ENST00000355727;ENST00000541237	.	.	.	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.78679	0.4321	M	0.72894	2.215	0.80722	D	1	D;D	0.69078	0.996;0.997	D;D	0.79784	0.988;0.993	T	0.80961	-0.1148	9	0.87932	D	0	.	16.315	0.82915	1.0:0.0:0.0:0.0	.	222;246	F5H715;Q96BJ3	.;AIDA_HUMAN	H	246;164;222	.	ENSP00000339161:Y246H	Y	-	1	0	AIDA	220910186	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.137000	0.94496	2.250000	0.74265	0.533000	0.62120	TAC	AIDA	-	pfam_AIDA_N	ENSG00000186063		0.353	AIDA-001	NOVEL	basic|appris_principal|CCDS	protein_coding	AIDA	HGNC	protein_coding	OTTHUMT00000091818.1	-	0.00	111	0	A	NM_022831		222843563	-1	tier1	-	no_errors	ENST00000541237	ensembl	human	known	74_37	missense	39.29	50	33	SNP	1.000	G
AKAP9	10142	genome.wustl.edu	37	7	91687207	91687208	+	Intron	INS	-	-	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr7:91687207_91687208insT	ENST00000359028.2	+	24	5862				AKAP9_ENST00000356239.3_Intron|AKAP9_ENST00000491695.1_3'UTR|AKAP9_ENST00000358100.2_Intron			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9						G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			ttgttttttgattttttttggt	0.282			T	BRAF	papillary thyroid																																			Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	0																																										SO:0001627	intron_variant	0			AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.5638-3366->T	7.37:g.91687215_91687215dupT			A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	RNA	INS	-	NULL	ENST00000359028.2	37	NULL		7																																																																																			AKAP9	-	-	ENSG00000127914		0.282	AKAP9-202	KNOWN	basic	protein_coding	AKAP9	HGNC	protein_coding			0.00	22	0	-	NM_005751		91687208	+1	tier1		no_errors	ENST00000491695	ensembl	human	known	74_37	rna	20.00	12	3	INS	0.052:0.000	T
ALX1	8092	genome.wustl.edu	37	12	85674059	85674059	+	Missense_Mutation	SNP	A	A	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr12:85674059A>G	ENST00000316824.3	+	1	175	c.20A>G	c.(19-21)aAg>aGg	p.K7R		NM_006982.2	NP_008913.2	Q15699	ALX1_HUMAN	ALX homeobox 1	7					anterior/posterior pattern specification (GO:0009952)|brain development (GO:0007420)|cartilage condensation (GO:0001502)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|mesenchymal cell development (GO:0014031)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(16)|ovary(1)	26				GBM - Glioblastoma multiforme(134;0.134)		CTGAGCGAGAAGTTTGCCCTC	0.562																																																	0													62.0	62.0	62.0					12																	85674059		2203	4300	6503	SO:0001583	missense	0			U31986	CCDS9028.1	12q21.31	2011-06-20	2007-07-26	2007-07-26		ENSG00000180318		"""Homeoboxes / PRD class"""	1494	protein-coding gene	gene with protein product		601527	"""cartilage paired-class homeoprotein 1"""	CART1		8756334, 7592751	Standard	NM_006982		Approved		uc001tae.4	Q15699	OTTHUMG00000169820	ENST00000316824.3:c.20A>G	12.37:g.85674059A>G	ENSP00000315417:p.Lys7Arg		Q546C8|Q96FH4	Missense_Mutation	SNP	pfam_Homeobox_dom,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_OAR_dom,pfscan_Homeobox_dom	p.K7R	ENST00000316824.3	37	c.20	CCDS9028.1	12	.	.	.	.	.	.	.	.	.	.	A	19.44	3.828439	0.71143	.	.	ENSG00000180318	ENST00000316824	D	0.94000	-3.33	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	D	0.93449	0.7910	N	0.24115	0.695	0.58432	D	0.999992	D	0.57571	0.98	D	0.68192	0.956	D	0.94558	0.7760	10	0.72032	D	0.01	.	14.6385	0.68706	1.0:0.0:0.0:0.0	.	7	Q15699	ALX1_HUMAN	R	7	ENSP00000315417:K7R	ENSP00000315417:K7R	K	+	2	0	ALX1	84198190	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.371000	0.90123	1.916000	0.55485	0.528000	0.53228	AAG	ALX1	-	NULL	ENSG00000180318		0.562	ALX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALX1	HGNC	protein_coding	OTTHUMT00000406072.1	-	0.00	101	0	A	NM_006982		85674059	+1	tier1	-	no_errors	ENST00000316824	ensembl	human	known	74_37	missense	21.95	64	18	SNP	1.000	G
ALX1	8092	genome.wustl.edu	37	12	85677570	85677570	+	Missense_Mutation	SNP	A	A	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr12:85677570A>T	ENST00000316824.3	+	2	602	c.447A>T	c.(445-447)aaA>aaT	p.K149N		NM_006982.2	NP_008913.2	Q15699	ALX1_HUMAN	ALX homeobox 1	149					anterior/posterior pattern specification (GO:0009952)|brain development (GO:0007420)|cartilage condensation (GO:0001502)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|mesenchymal cell development (GO:0014031)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(16)|ovary(1)	26				GBM - Glioblastoma multiforme(134;0.134)		AGCTGGAGAAAGTCTTTCAGA	0.488																																																	0													128.0	127.0	127.0					12																	85677570		2203	4300	6503	SO:0001583	missense	0			U31986	CCDS9028.1	12q21.31	2011-06-20	2007-07-26	2007-07-26		ENSG00000180318		"""Homeoboxes / PRD class"""	1494	protein-coding gene	gene with protein product		601527	"""cartilage paired-class homeoprotein 1"""	CART1		8756334, 7592751	Standard	NM_006982		Approved		uc001tae.4	Q15699	OTTHUMG00000169820	ENST00000316824.3:c.447A>T	12.37:g.85677570A>T	ENSP00000315417:p.Lys149Asn		Q546C8|Q96FH4	Missense_Mutation	SNP	pfam_Homeobox_dom,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_OAR_dom,pfscan_Homeobox_dom	p.K149N	ENST00000316824.3	37	c.447	CCDS9028.1	12	.	.	.	.	.	.	.	.	.	.	A	16.46	3.130651	0.56828	.	.	ENSG00000180318	ENST00000316824	D	0.96491	-4.03	5.59	-0.479	0.12089	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.95341	0.8488	M	0.68593	2.085	0.80722	D	1	B	0.25719	0.132	B	0.40329	0.326	D	0.91365	0.5115	10	0.66056	D	0.02	.	9.3436	0.38096	0.5282:0.0:0.4718:0.0	.	149	Q15699	ALX1_HUMAN	N	149	ENSP00000315417:K149N	ENSP00000315417:K149N	K	+	3	2	ALX1	84201701	1.000000	0.71417	0.998000	0.56505	0.596000	0.36781	1.339000	0.33885	0.093000	0.17368	-0.977000	0.02584	AAA	ALX1	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	ENSG00000180318		0.488	ALX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALX1	HGNC	protein_coding	OTTHUMT00000406072.1	-	0.00	98	0	A	NM_006982		85677570	+1	tier1	-	no_errors	ENST00000316824	ensembl	human	known	74_37	missense	30.95	58	26	SNP	0.992	T
ANGEL2	90806	genome.wustl.edu	37	1	213186441	213186441	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr1:213186441G>T	ENST00000366962.3	-	2	533	c.379C>A	c.(379-381)Cac>Aac	p.H127N	ANGEL2_ENST00000360506.2_Intron|ANGEL2_ENST00000544555.1_Intron|ANGEL2_ENST00000535388.1_Intron|ANGEL2_ENST00000540642.1_Intron	NM_144567.3	NP_653168.2	Q5VTE6	ANGE2_HUMAN	angel homolog 2 (Drosophila)	127										central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(8)|skin(1)	24				OV - Ovarian serous cystadenocarcinoma(81;0.00446)|all cancers(67;0.0169)|Epithelial(68;0.0921)|GBM - Glioblastoma multiforme(131;0.185)		TTACCTTGGTGTTTTCTTCGT	0.378																																																	0													112.0	111.0	111.0					1																	213186441		2203	4299	6502	SO:0001583	missense	0			AL079275	CCDS1512.1, CCDS73027.1	1q32.3	2014-06-17			ENSG00000174606	ENSG00000174606			30534	protein-coding gene	gene with protein product						11943475	Standard	XM_005273344		Approved	KIAA0759L, FLJ12793, Ccr4d	uc001hjz.3	Q5VTE6	OTTHUMG00000036927	ENST00000366962.3:c.379C>A	1.37:g.213186441G>T	ENSP00000355929:p.His127Asn		B7Z2U4|D3DTA3|Q86X13|Q8NHH3	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase	p.H127N	ENST00000366962.3	37	c.379	CCDS1512.1	1	.	.	.	.	.	.	.	.	.	.	G	13.01	2.108121	0.37242	.	.	ENSG00000174606	ENST00000366962;ENST00000310246	T	0.21734	1.99	5.45	3.54	0.40534	.	0.230786	0.30311	N	0.009914	T	0.11024	0.0269	N	0.19112	0.55	0.80722	D	1	B;B	0.29716	0.255;0.057	B;B	0.21360	0.034;0.016	T	0.16217	-1.0410	10	0.25751	T	0.34	-14.9256	8.6641	0.34110	0.1384:0.0:0.7362:0.1254	.	105;127	Q96AL9;Q5VTE6	.;ANGE2_HUMAN	N	127;105	ENSP00000355929:H127N	ENSP00000309755:H105N	H	-	1	0	ANGEL2	211253064	0.937000	0.31787	1.000000	0.80357	0.997000	0.91878	0.657000	0.24963	1.420000	0.47138	0.563000	0.77884	CAC	ANGEL2	-	NULL	ENSG00000174606		0.378	ANGEL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGEL2	HGNC	protein_coding	OTTHUMT00000089693.1	-	0.00	79	0	G	NM_144567		213186441	-1	tier1	-	no_errors	ENST00000366962	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	T
ANGPT1	284	genome.wustl.edu	37	8	108348423	108348423	+	5'UTR	SNP	A	A	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr8:108348423A>C	ENST00000520734.1	-	0	215				ANGPT1_ENST00000520052.1_5'UTR			Q15389	ANGP1_HUMAN	angiopoietin 1						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell-substrate adhesion (GO:0031589)|glomerulus vasculature development (GO:0072012)|hemopoiesis (GO:0030097)|heparin biosynthetic process (GO:0030210)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of vascular permeability (GO:0043116)|positive chemotaxis (GO:0050918)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of receptor internalization (GO:0002092)|protein localization to cell surface (GO:0034394)|regulation of satellite cell proliferation (GO:0014842)|sprouting angiogenesis (GO:0002040)|Tie signaling pathway (GO:0048014)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(13)|ovary(4)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	43	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)			CTGTTGAAGAAGTTGCTTCTC	0.328																																																	0													123.0	114.0	117.0					8																	108348423		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			D13628	CCDS6306.1, CCDS56551.1	8q23.1	2013-02-06			ENSG00000154188	ENSG00000154188		"""Fibrinogen C domain containing"""	484	protein-coding gene	gene with protein product		601667				9545648	Standard	NM_001146		Approved	KIAA0003, Ang1	uc003ymn.3	Q15389	OTTHUMG00000164812	ENST00000520734.1:c.-71T>G	8.37:g.108348423A>C			Q5HYA0	Missense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	p.L177R	ENST00000520734.1	37	c.530		8	.	.	.	.	.	.	.	.	.	.	A	27.1	4.802173	0.90538	.	.	ENSG00000154188	ENST00000517746;ENST00000297450	T;T	0.41065	1.01;1.01	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.63838	0.2545	M	0.71036	2.16	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.71414	0.973;0.973	T	0.67321	-0.5700	10	0.72032	D	0.01	.	15.6906	0.77450	1.0:0.0:0.0:0.0	.	177;177	Q5HYA0;Q15389	.;ANGP1_HUMAN	R	177	ENSP00000428340:L177R;ENSP00000297450:L177R	ENSP00000297450:L177R	L	-	2	0	ANGPT1	108417599	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.095000	0.94175	2.187000	0.69744	0.533000	0.62120	CTT	ANGPT1	-	NULL	ENSG00000154188		0.328	ANGPT1-002	PUTATIVE	alternative_5_UTR|basic	protein_coding	ANGPT1	HGNC	protein_coding	OTTHUMT00000380428.2	-	0.00	103	0	A	NM_001146, NM_139290		108348423	-1	tier1	-	no_errors	ENST00000517746	ensembl	human	known	74_37	missense	30.84	74	33	SNP	1.000	C
ANKRD11	29123	genome.wustl.edu	37	16	89357110	89357110	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr16:89357110G>T	ENST00000301030.4	-	6	984	c.524C>A	c.(523-525)gCc>gAc	p.A175D	ANKRD11_ENST00000378330.2_Missense_Mutation_p.A175D	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	175					bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		GCGGATGGCGGCTCGGTGCAG	0.597																																																	0													61.0	64.0	63.0					16																	89357110		2198	4298	6496	SO:0001583	missense	0			AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.524C>A	16.37:g.89357110G>T	ENSP00000301030:p.Ala175Asp		Q6NTG1|Q6QMF8	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A175D	ENST00000301030.4	37	c.524	CCDS32513.1	16	.	.	.	.	.	.	.	.	.	.	G	36	5.771207	0.96922	.	.	ENSG00000167522	ENST00000301030;ENST00000378330;ENST00000378332	T;T	0.81415	-1.49;-1.49	5.45	5.45	0.79879	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	D	0.93700	0.7987	H	0.96720	3.87	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	D	0.95326	0.8425	10	0.87932	D	0	.	19.6454	0.95775	0.0:0.0:1.0:0.0	.	175;189;175	A8K4M9;Q59GC3;Q6UB99	.;.;ANR11_HUMAN	D	175;175;189	ENSP00000301030:A175D;ENSP00000367581:A175D	ENSP00000301030:A175D	A	-	2	0	ANKRD11	87884611	1.000000	0.71417	0.212000	0.23672	0.977000	0.68977	9.675000	0.98638	2.714000	0.92807	0.561000	0.74099	GCC	ANKRD11	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000167522		0.597	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD11	HGNC	protein_coding	OTTHUMT00000430462.3	-	0.00	56	0	G	NM_013275		89357110	-1	tier1	-	no_errors	ENST00000301030	ensembl	human	known	74_37	missense	12.77	41	6	SNP	1.000	T
ANKRD13D	338692	genome.wustl.edu	37	11	67067565	67067565	+	Silent	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr11:67067565C>A	ENST00000447274.2	+	10	1958	c.783C>A	c.(781-783)cgC>cgA	p.R261R	ANKRD13D_ENST00000511455.2_Silent_p.R348R|ANKRD13D_ENST00000514166.1_Silent_p.R261R|ANKRD13D_ENST00000308440.6_Silent_p.R261R|ANKRD13D_ENST00000515828.1_5'Flank			Q6ZTN6	AN13D_HUMAN	ankyrin repeat domain 13 family, member D	261						endosome (GO:0005768)|plasma membrane (GO:0005886)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			ACATTGGCCGCCCCATCGAGA	0.632																																																	0													122.0	114.0	117.0					11																	67067565		2200	4295	6495	SO:0001819	synonymous_variant	0			AK027313	CCDS31616.1, CCDS31616.2	11q13.2	2013-01-11		2005-08-09	ENSG00000172932	ENSG00000172932		"""Ankyrin repeat domain containing"""	27880	protein-coding gene	gene with protein product		615126					Standard	NM_207354		Approved		uc001okd.2	Q6ZTN6	OTTHUMG00000162929	ENST00000447274.2:c.783C>A	11.37:g.67067565C>A			D6RCN6|Q0VAK0|Q0VGC3|Q6ZVD0|Q86SU1	Silent	SNP	pfam_ANKRD13,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Ubiquitin-int_motif,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Ubiquitin-int_motif	p.R348	ENST00000447274.2	37	c.1044		11																																																																																			ANKRD13D	-	pfam_ANKRD13	ENSG00000172932		0.632	ANKRD13D-001	KNOWN	basic	protein_coding	ANKRD13D	HGNC	protein_coding	OTTHUMT00000371067.2	-	0.00	64	0	C	NM_207354		67067565	+1	tier1	-	no_errors	ENST00000511455	ensembl	human	known	74_37	silent	8.06	57	5	SNP	1.000	A
ANKRD20A11P	391267	genome.wustl.edu	37	21	15311645	15311645	+	IGR	SNP	T	T	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr21:15311645T>C								CYP4F29P (90960 upstream) : ANKRD20A11P (4444 downstream)																							TTGCTTCAACTTCTTTCTTAT	0.274																																																	0																																										SO:0001628	intergenic_variant	0																															21.37:g.15311645T>C				RNA	SNP	-	NULL		37	NULL		21																																																																																			ANKRD20A11P	-	-	ENSG00000215559	0	0.274					ANKRD20A11P	HGNC			-	0.00	216	0	T			15311645	-1	tier1	-	no_errors	ENST00000428576	ensembl	human	known	74_37	rna	38.17	115	71	SNP	0.985	C
ANKRD20A5P	440482	genome.wustl.edu	37	18	14179564	14179564	+	RNA	SNP	C	C	T	rs138081840	byFrequency	TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr18:14179564C>T	ENST00000581935.1	+	0	469							A0PJZ0	A20A5_HUMAN	ankyrin repeat domain 20 family, member A5, pseudogene											lung(3)	3						CGCGCAGGAGCGGAGACCTTG	0.672																																																	0													15.0	16.0	15.0					18																	14179564		2180	4242	6422			0			BC022023		18p11.21	2011-06-01	2011-06-01	2011-06-01	ENSG00000186481	ENSG00000186481			33833	pseudogene	pseudogene			"""ankyrin repeat domain 20 family, member A5"""	ANKRD20A5			Standard	NR_040113		Approved	MGC26718	uc010xag.2	A0PJZ0	OTTHUMG00000157172		18.37:g.14179564C>T			Q4G1B6	RNA	SNP	-	NULL	ENST00000581935.1	37	NULL		18																																																																																			ANKRD20A5P	-	-	ENSG00000186481		0.672	ANKRD20A5P-002	KNOWN	basic	processed_transcript	ANKRD20A5P	HGNC	pseudogene	OTTHUMT00000442833.1	-	0.00	141	0	C			14179564	+1	tier1	-	no_errors	ENST00000581181	ensembl	human	known	74_37	rna	31.51	50	23	SNP	0.000	T
ANKRD30B	374860	genome.wustl.edu	37	18	14757822	14757822	+	Missense_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr18:14757822T>G	ENST00000358984.4	+	5	806	c.626T>G	c.(625-627)cTc>cGc	p.L209R	ANKRD30B_ENST00000447268.2_Missense_Mutation_p.L209R|RNU6-1210P_ENST00000363775.1_RNA|ANKRD30B_ENST00000579292.1_Intron	NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	209										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						AGCACAGCCCTCATGCTTGCC	0.368																																																	0													77.0	60.0	65.0					18																	14757822		692	1591	2283	SO:0001583	missense	0			BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.626T>G	18.37:g.14757822T>G	ENSP00000351875:p.Leu209Arg		B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.L209R	ENST00000358984.4	37	c.626	CCDS54182.1	18	.	.	.	.	.	.	.	.	.	.	N	4.722	0.134343	0.09032	.	.	ENSG00000180777	ENST00000358984;ENST00000447268	T;T	0.80304	-1.36;-1.36	0.971	0.971	0.19698	.	.	.	.	.	D	0.91626	0.7354	H	0.98629	4.285	0.09310	N	1	D	0.69078	0.997	D	0.72982	0.979	T	0.79727	-0.1682	9	0.66056	D	0.02	.	4.171	0.10329	0.0:0.0:0.0:1.0	.	209	F8WAG3	.	R	209	ENSP00000351875:L209R;ENSP00000399031:L209R	ENSP00000351875:L209R	L	+	2	0	ANKRD30B	14747822	0.271000	0.24162	0.094000	0.20943	0.052000	0.14988	1.242000	0.32755	0.701000	0.31803	0.255000	0.18592	CTC	ANKRD30B	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000180777		0.368	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD30B	HGNC	protein_coding	OTTHUMT00000443557.1	-	0.00	101	0	T	NM_001145029		14757822	+1	tier1	-	no_errors	ENST00000358984	ensembl	human	known	74_37	missense	31.15	42	19	SNP	0.105	G
ANKRD32	84250	genome.wustl.edu	37	5	93979038	93979038	+	Silent	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr5:93979038T>G	ENST00000265140.5	+	5	911	c.492T>G	c.(490-492)acT>acG	p.T164T		NM_032290.3	NP_115666.2	Q9BQI6	ANR32_HUMAN	ankyrin repeat domain 32	164	BRCT 2.					centrosome (GO:0005813)|nucleus (GO:0005634)				NS(1)|breast(2)|endometrium(2)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|skin(1)	13		all_cancers(142;1.51e-09)|all_epithelial(76;4.68e-12)|all_lung(232;5.94e-05)|Ovarian(174;0.000953)|Lung NSC(167;0.00105)|Colorectal(57;0.122)|Lung SC(612;0.152)		all cancers(79;3.88e-18)		GTGGAATAACTCATGTGATTG	0.303																																																	0													53.0	49.0	50.0					5																	93979038		692	1584	2276	SO:0001819	synonymous_variant	0			AL136560	CCDS4071.2	5q15	2013-01-10			ENSG00000133302	ENSG00000133302		"""Ankyrin repeat domain containing"""	25408	protein-coding gene	gene with protein product			"""BRCT domain containing 1"""	BRCTD1			Standard	NM_032290		Approved	DKFZp761C121, DKFZp564C0469	uc003kkr.4	Q9BQI6	OTTHUMG00000121133	ENST00000265140.5:c.492T>G	5.37:g.93979038T>G			B4DMG4|Q3B7K4|Q6NSA5|Q6PHW9|Q9Y402	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_BRCT_dom,smart_BRCT_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.T164	ENST00000265140.5	37	c.492	CCDS4071.2	5																																																																																			ANKRD32	-	smart_BRCT_dom	ENSG00000133302		0.303	ANKRD32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD32	HGNC	protein_coding	OTTHUMT00000241610.1	-	0.00	159	0	T	NM_032290		93979038	+1	tier1	-	no_errors	ENST00000265140	ensembl	human	known	74_37	silent	15.13	129	23	SNP	0.999	G
ANKRD32	84250	genome.wustl.edu	37	5	94024234	94024234	+	Silent	SNP	G	G	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr5:94024234G>A	ENST00000265140.5	+	17	2564	c.2145G>A	c.(2143-2145)ttG>ttA	p.L715L		NM_032290.3	NP_115666.2	Q9BQI6	ANR32_HUMAN	ankyrin repeat domain 32	715						centrosome (GO:0005813)|nucleus (GO:0005634)				NS(1)|breast(2)|endometrium(2)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|skin(1)	13		all_cancers(142;1.51e-09)|all_epithelial(76;4.68e-12)|all_lung(232;5.94e-05)|Ovarian(174;0.000953)|Lung NSC(167;0.00105)|Colorectal(57;0.122)|Lung SC(612;0.152)		all cancers(79;3.88e-18)		TACCAGCCTTGGGGAAAACTG	0.363																																																	0													95.0	97.0	96.0					5																	94024234		2203	4300	6503	SO:0001819	synonymous_variant	0			AL136560	CCDS4071.2	5q15	2013-01-10			ENSG00000133302	ENSG00000133302		"""Ankyrin repeat domain containing"""	25408	protein-coding gene	gene with protein product			"""BRCT domain containing 1"""	BRCTD1			Standard	NM_032290		Approved	DKFZp761C121, DKFZp564C0469	uc003kkr.4	Q9BQI6	OTTHUMG00000121133	ENST00000265140.5:c.2145G>A	5.37:g.94024234G>A			B4DMG4|Q3B7K4|Q6NSA5|Q6PHW9|Q9Y402	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_BRCT_dom,smart_BRCT_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.L715	ENST00000265140.5	37	c.2145	CCDS4071.2	5																																																																																			ANKRD32	-	NULL	ENSG00000133302		0.363	ANKRD32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD32	HGNC	protein_coding	OTTHUMT00000241610.1	-	0.00	64	0	G	NM_032290		94024234	+1	tier1	-	no_errors	ENST00000265140	ensembl	human	known	74_37	silent	15.38	55	10	SNP	1.000	A
ARHGAP20	57569	genome.wustl.edu	37	11	110450894	110450894	+	Silent	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr11:110450894T>G	ENST00000260283.4	-	16	3060	c.2776A>C	c.(2776-2778)Aga>Cga	p.R926R	ARHGAP20_ENST00000527598.1_Silent_p.R890R|ARHGAP20_ENST00000529591.1_Silent_p.R469R|ARHGAP20_ENST00000524756.1_Silent_p.R903R|ARHGAP20_ENST00000528829.1_Silent_p.R890R|ARHGAP20_ENST00000357139.3_Silent_p.R900R|ARHGAP20_ENST00000533353.1_Silent_p.R900R	NM_020809.3	NP_065860.2	Q9P2F6	RHG20_HUMAN	Rho GTPase activating protein 20	926					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(18)|lung(13)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	60		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;3.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|all cancers(92;0.000147)|OV - Ovarian serous cystadenocarcinoma(223;0.0475)		AGGTTTAATCTTGGGGGTAAA	0.488																																																	0													138.0	135.0	136.0					11																	110450894		2201	4298	6499	SO:0001819	synonymous_variant	0			AB037812	CCDS31673.1, CCDS58175.1, CCDS58176.1, CCDS58177.1	11q23.2	2011-06-29			ENSG00000137727	ENSG00000137727		"""Rho GTPase activating proteins"""	18357	protein-coding gene	gene with protein product		609568				14532992	Standard	NM_020809		Approved	KIAA1391	uc001pkz.2	Q9P2F6	OTTHUMG00000166590	ENST00000260283.4:c.2776A>C	11.37:g.110450894T>G			A8K8C5|B0YIW7|B0YIW8|Q6RJU1|Q6RJU2|Q6RJU3|Q6RJU5|Q8IXS1	Silent	SNP	pfam_RhoGAP_dom,pfam_Ras-assoc,superfamily_Rho_GTPase_activation_prot,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Ras-assoc,pfscan_RhoGAP_dom	p.R926	ENST00000260283.4	37	c.2776	CCDS31673.1	11																																																																																			ARHGAP20	-	NULL	ENSG00000137727		0.488	ARHGAP20-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP20	HGNC	protein_coding	OTTHUMT00000390628.1	-	0.00	159	0	T	NM_020809		110450894	-1	tier1	-	no_errors	ENST00000260283	ensembl	human	known	74_37	silent	12.08	181	25	SNP	0.001	G
ARCN1	372	genome.wustl.edu	37	11	118454686	118454686	+	Missense_Mutation	SNP	A	A	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr11:118454686A>G	ENST00000264028.4	+	4	705	c.610A>G	c.(610-612)Atc>Gtc	p.I204V	ARCN1_ENST00000392859.3_Missense_Mutation_p.I116V|ARCN1_ENST00000534182.2_Intron|ARCN1_ENST00000359415.4_Missense_Mutation_p.I245V	NM_001655.4	NP_001646.2	P48444	COPD_HUMAN	archain 1	204					adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer maturation (GO:0021691)|COPI coating of Golgi vesicle (GO:0048205)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|pigmentation (GO:0043473)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	clathrin adaptor complex (GO:0030131)|COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)|urinary_tract(1)	13	all_hematologic(175;0.0349)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		CACAGAGACCATCATTGAAAC	0.468																																																	0													97.0	91.0	93.0					11																	118454686		2200	4295	6495	SO:0001583	missense	0			X81197	CCDS8400.1, CCDS44749.1	11q23.3	2010-04-21	2003-01-29		ENSG00000095139	ENSG00000095139			649	protein-coding gene	gene with protein product		600820	"""coatomer protein complex, subunit delta"""	COPD		7782067, 8854871	Standard	NM_001655		Approved		uc001ptq.3	P48444	OTTHUMG00000166340	ENST00000264028.4:c.610A>G	11.37:g.118454686A>G	ENSP00000264028:p.Ile204Val		B4E1X2|E9PEU4|Q52M80	Missense_Mutation	SNP	pfam_Clathrin_mu_C,pfam_AP_mu_sigma_su,superfamily_Clathrin_mu_C,superfamily_Longin-like_dom,pfscan_Clathrin_mu_C	p.I204V	ENST00000264028.4	37	c.610	CCDS8400.1	11	.	.	.	.	.	.	.	.	.	.	A	9.594	1.127026	0.20959	.	.	ENSG00000095139	ENST00000392859;ENST00000359415;ENST00000264028	T;T;T	0.52526	0.66;0.66;0.66	5.89	4.75	0.60458	.	0.048661	0.85682	D	0.000000	T	0.35451	0.0932	L	0.38531	1.155	0.58432	D	0.999993	B;B;B	0.15141	0.003;0.012;0.003	B;B;B	0.12837	0.003;0.008;0.002	T	0.13124	-1.0521	10	0.15952	T	0.53	-12.8072	11.9761	0.53091	0.9304:0.0:0.0696:0.0	.	116;245;204	E9PEU4;B0YIW6;P48444	.;.;COPD_HUMAN	V	116;245;204	ENSP00000376599:I116V;ENSP00000352385:I245V;ENSP00000264028:I204V	ENSP00000264028:I204V	I	+	1	0	ARCN1	117959896	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	4.414000	0.59802	2.257000	0.74773	0.460000	0.39030	ATC	ARCN1	-	NULL	ENSG00000095139		0.468	ARCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARCN1	HGNC	protein_coding	OTTHUMT00000389278.1	-	0.00	45	0	A			118454686	+1	tier1	-	no_errors	ENST00000264028	ensembl	human	known	74_37	missense	24.64	52	17	SNP	1.000	G
ARHGAP35	2909	genome.wustl.edu	37	19	47422455	47422455	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr19:47422455G>T	ENST00000404338.3	+	1	523	c.523G>T	c.(523-525)Gat>Tat	p.D175Y		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	175					axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)	p.D175Y(4)									TAGGAACTTTGATGACCAGCT	0.453																																																	4	Substitution - Missense(4)	lung(4)											115.0	105.0	108.0					19																	47422455		1915	4144	6059	SO:0001583	missense	0			M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.523G>T	19.37:g.47422455G>T	ENSP00000385720:p.Asp175Tyr		A7E2A4|Q14452|Q9C0E1	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Small_GTPase,pfam_FF_domain,superfamily_Rho_GTPase_activation_prot,superfamily_P-loop_NTPase,superfamily_FF_domain,smart_FF_domain,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.D175Y	ENST00000404338.3	37	c.523	CCDS46127.1	19	.	.	.	.	.	.	.	.	.	.	G	16.96	3.266190	0.59540	.	.	ENSG00000160007	ENST00000317082;ENST00000501576;ENST00000404338	T	0.77620	-1.11	5.9	5.9	0.94986	.	0.048832	0.85682	D	0.000000	D	0.87140	0.6103	M	0.67953	2.075	0.80722	D	1	D	0.76494	0.999	D	0.67103	0.949	D	0.87463	0.2409	10	0.87932	D	0	-19.0795	19.0536	0.93054	0.0:0.0:1.0:0.0	.	175	Q9NRY4-2	.	Y	175	ENSP00000385720:D175Y	ENSP00000324820:D175Y	D	+	1	0	ARHGAP35	52114295	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	9.869000	0.99810	2.806000	0.96561	0.655000	0.94253	GAT	ARHGAP35	-	pfam_Small_GTPase,superfamily_P-loop_NTPase	ENSG00000160007		0.453	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP35	HGNC	protein_coding	OTTHUMT00000466652.1		0.00	73	0	G	NM_004491		47422455	+1			no_errors	ENST00000404338	ensembl	human	known	74_37	missense	5.80	65	4	SNP	1.000	T
ARHGEF6	9459	genome.wustl.edu	37	X	135761794	135761794	+	Missense_Mutation	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chrX:135761794C>A	ENST00000250617.6	-	16	2935	c.1730G>T	c.(1729-1731)cGa>cTa	p.R577L	ARHGEF6_ENST00000370622.1_Missense_Mutation_p.R423L|ARHGEF6_ENST00000370620.1_Missense_Mutation_p.R423L|ARHGEF6_ENST00000535227.1_Missense_Mutation_p.R450L	NM_004840.2	NP_004831.1	Q15052	ARHG6_HUMAN	Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6	577					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell junction assembly (GO:0034329)|JNK cascade (GO:0007254)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|intracellular (GO:0005622)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(1)|lung(14)|prostate(1)	38	Acute lymphoblastic leukemia(192;0.000127)					CAAGGGTCCTCGGGGCTGTCC	0.488																																																	0													119.0	123.0	122.0					X																	135761794		2203	4300	6503	SO:0001583	missense	0			D13631	CCDS14660.1	Xq26	2013-01-10	2002-05-23		ENSG00000129675	ENSG00000129675		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	685	protein-coding gene	gene with protein product	"""Rac/Cdc42 guanine exchange factor (GEF) 6"", ""PAK-interacting exchange factor, alpha"", ""rho guanine nucleotide exchange factor 6"""	300267	"""mental retardation, X-linked 46"""	MRX46		7584048, 9659915	Standard	NM_004840		Approved	alphaPIX, Cool-2, KIAA0006, alpha-PIX, Cool2	uc004fab.3	Q15052	OTTHUMG00000022518	ENST00000250617.6:c.1730G>T	X.37:g.135761794C>A	ENSP00000250617:p.Arg577Leu		A6NMW9|A8K6S7|B1AL37|Q15396|Q5JQ66|Q7Z3W1|Q86XH0	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_2,pfam_SH3_domain,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_DH-domain,superfamily_CH-domain,superfamily_SH3_domain,smart_CH-domain,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_CH-domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain,prints_SH3_domain,prints_SM22_calponin	p.R577L	ENST00000250617.6	37	c.1730	CCDS14660.1	X	.	.	.	.	.	.	.	.	.	.	C	15.75	2.925460	0.52759	.	.	ENSG00000129675	ENST00000250617;ENST00000370620;ENST00000370622;ENST00000535736;ENST00000535227	T;T;T;T	0.56941	0.44;0.57;0.57;0.43	5.66	4.79	0.61399	.	0.190614	0.47455	D	0.000223	T	0.58722	0.2142	L	0.47716	1.5	0.80722	D	1	D;P	0.57257	0.979;0.956	P;B	0.53062	0.717;0.357	T	0.59627	-0.7419	10	0.48119	T	0.1	.	15.6249	0.76848	0.0:0.8658:0.1342:0.0	.	450;577	B7Z3C7;Q15052	.;ARHG6_HUMAN	L	577;423;423;423;450	ENSP00000250617:R577L;ENSP00000359654:R423L;ENSP00000359656:R423L;ENSP00000439483:R450L	ENSP00000250617:R577L	R	-	2	0	ARHGEF6	135589460	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.123000	0.77176	1.125000	0.41998	0.544000	0.68410	CGA	ARHGEF6	-	NULL	ENSG00000129675		0.488	ARHGEF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF6	HGNC	protein_coding	OTTHUMT00000058511.2	-	0.00	123	0	C	NM_004840		135761794	-1	tier1	-	no_errors	ENST00000250617	ensembl	human	known	74_37	missense	5.13	74	4	SNP	1.000	A
ARID1A	8289	genome.wustl.edu	37	1	27089531	27089532	+	Frame_Shift_Ins	INS	-	-	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr1:27089531_27089532insG	ENST00000324856.7	+	8	2858_2859	c.2487_2488insG	c.(2488-2490)ggafs	p.G830fs	RN7SL501P_ENST00000578818.1_RNA|ARID1A_ENST00000457599.2_Frame_Shift_Ins_p.G830fs|ARID1A_ENST00000374152.2_Frame_Shift_Ins_p.G447fs	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	830					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		CAGGCATGGCTGGAGGCATAAA	0.579			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																			Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	0																																										SO:0001589	frameshift_variant	0			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.2489dupG	1.37:g.27089533_27089533dupG	ENSP00000320485:p.Gly830fs		D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Frame_Shift_Ins	INS	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.G830fs	ENST00000324856.7	37	c.2487_2488	CCDS285.1	1																																																																																			ARID1A	-	NULL	ENSG00000117713		0.579	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARID1A	HGNC	protein_coding	OTTHUMT00000011437.2		0.00	36	0	-	NM_139135		27089532	+1	tier1		no_errors	ENST00000324856	ensembl	human	known	74_37	frame_shift_ins	45.95	20	17	INS	0.982:1.000	G
ATP8A1	10396	genome.wustl.edu	37	4	42583708	42583708	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr4:42583708G>T	ENST00000381668.5	-	10	995	c.764C>A	c.(763-765)gCt>gAt	p.A255D	ATP8A1_ENST00000264449.10_Missense_Mutation_p.A255D	NM_006095.2	NP_006086.1	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1	255					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	51					Phosphatidylserine(DB00144)	TCTCAACTGAGCTCCTCGAAG	0.408																																																	0													146.0	133.0	137.0					4																	42583708		2203	4300	6503	SO:0001583	missense	0			AF067820	CCDS3466.1, CCDS47049.1	4p13	2010-04-20	2007-09-19		ENSG00000124406	ENSG00000124406		"""ATPases / P-type"""	13531	protein-coding gene	gene with protein product		609542	"""ATPase, aminophospholipid transporter (APLT), Class I, type 8A, member 1"""			10198212, 9548971	Standard	NM_006095		Approved	ATPIA	uc003gwr.2	Q9Y2Q0	OTTHUMG00000099403	ENST00000381668.5:c.764C>A	4.37:g.42583708G>T	ENSP00000371084:p.Ala255Asp		Q32M35|Q32M36|Q4W5J7|Q4W5P2	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.A255D	ENST00000381668.5	37	c.764	CCDS3466.1	4	.	.	.	.	.	.	.	.	.	.	G	36	5.705485	0.96812	.	.	ENSG00000124406	ENST00000381668;ENST00000264449	D;D	0.90955	-2.76;-2.76	5.92	5.92	0.95590	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.85682	D	0.000000	D	0.97340	0.9130	H	0.97131	3.945	0.80722	D	1	D;D;D	0.76494	0.999;0.996;0.998	D;D;D	0.85130	0.997;0.978;0.984	D	0.97900	1.0302	10	0.87932	D	0	.	20.3151	0.98650	0.0:0.0:1.0:0.0	.	255;255;255	B4DII6;Q32M35;Q9Y2Q0	.;.;AT8A1_HUMAN	D	255	ENSP00000371084:A255D;ENSP00000264449:A255D	ENSP00000264449:A255D	A	-	2	0	ATP8A1	42278465	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.869000	0.99810	2.809000	0.96659	0.467000	0.42956	GCT	ATP8A1	-	pfam_ATPase_P-typ_transduc_dom_A,tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000124406		0.408	ATP8A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATP8A1	HGNC	protein_coding	OTTHUMT00000216861.2	-	0.00	85	0	G	NM_006095		42583708	-1	tier1	-	no_errors	ENST00000381668	ensembl	human	known	74_37	missense	8.62	53	5	SNP	1.000	T
BACH1	571	genome.wustl.edu	37	21	30715103	30715103	+	Silent	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr21:30715103G>T	ENST00000399921.1	+	5	2403	c.2160G>T	c.(2158-2160)ggG>ggT	p.G720G	BACH1_ENST00000286800.3_Silent_p.G720G	NM_206866.1	NP_996749.1	Q9BX63	FANCJ_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 1	0					DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|urinary_tract(2)	27						AGAGTGGTGGGATCTCAGATT	0.502																																																	0													48.0	49.0	49.0					21																	30715103		2202	4298	6500	SO:0001819	synonymous_variant	0			AF026200	CCDS13585.1	21q22.1	2013-01-10			ENSG00000156273	ENSG00000156273		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	935	protein-coding gene	gene with protein product		602751				9544839, 9479503	Standard	NR_027655		Approved	BACH-1, BTBD24	uc002ynj.3	O14867	OTTHUMG00000078878	ENST00000399921.1:c.2160G>T	21.37:g.30715103G>T			Q3MJE2|Q8NCI5	Silent	SNP	pfam_BTB_POZ,pfam_bZIP,superfamily_BTB/POZ_fold,superfamily_TF_DNA-bd,smart_BTB/POZ-like,smart_bZIP,pfscan_BTB/POZ-like,pfscan_bZIP	p.G720	ENST00000399921.1	37	c.2160	CCDS13585.1	21																																																																																			BACH1	-	NULL	ENSG00000156273		0.502	BACH1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BACH1	HGNC	protein_coding	OTTHUMT00000171974.1	-	0.00	29	0	G	NM_206866		30715103	+1	tier1	-	no_errors	ENST00000286800	ensembl	human	known	74_37	silent	31.25	11	5	SNP	0.089	T
BCL2L14	79370	genome.wustl.edu	37	12	12247487	12247487	+	Intron	SNP	C	C	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr12:12247487C>G	ENST00000308721.5	+	5	884				BCL2L14_ENST00000396367.1_Intron|BCL2L14_ENST00000266434.4_Missense_Mutation_p.Q241E|BCL2L14_ENST00000396369.1_Intron|BCL2L14_ENST00000586576.1_Intron|BCL2L14_ENST00000589718.1_Intron	NM_138723.1	NP_620049.1	Q9BZR8	B2L14_HUMAN	BCL2-like 14 (apoptosis facilitator)						apoptotic process (GO:0006915)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular organelle (GO:0043229)|membrane (GO:0016020)	protein kinase binding (GO:0019901)			large_intestine(1)|lung(2)|skin(3)	6		Prostate(47;0.0872)		BRCA - Breast invasive adenocarcinoma(232;0.154)		CACCAGCATCCAGGGTTTTCC	0.478																																																	0													111.0	92.0	98.0					12																	12247487		2203	4300	6503	SO:0001627	intron_variant	0			AF281254	CCDS8645.1, CCDS8646.1	12p13-p12	2014-03-07			ENSG00000121380	ENSG00000121380			16657	protein-coding gene	gene with protein product		606126				11054413	Standard	NM_030766		Approved	BCLG, BCL-G	uc001rac.3	Q9BZR8	OTTHUMG00000159528	ENST00000308721.5:c.679-111C>G	12.37:g.12247487C>G			A8KAD0|Q96QR5|Q9BZR7	Missense_Mutation	SNP	NULL	p.Q241E	ENST00000308721.5	37	c.721	CCDS8645.1	12	.	.	.	.	.	.	.	.	.	.	C	10.48	1.362028	0.24684	.	.	ENSG00000121380	ENST00000266434	.	.	.	3.66	0.81	0.18732	.	.	.	.	.	T	0.26085	0.0636	.	.	.	0.09310	N	1	B	0.20550	0.046	B	0.15484	0.013	T	0.29518	-1.0009	7	0.62326	D	0.03	.	1.0118	0.01498	0.185:0.4248:0.1803:0.21	.	241	Q9BZR8-2	.	E	241	.	ENSP00000266434:Q241E	Q	+	1	0	BCL2L14	12138754	0.000000	0.05858	0.000000	0.03702	0.279000	0.26890	0.096000	0.15147	0.172000	0.19760	0.650000	0.86243	CAG	BCL2L14	-	NULL	ENSG00000121380		0.478	BCL2L14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL2L14	HGNC	protein_coding	OTTHUMT00000355994.3	-	0.00	40	0	C	NM_030766		12247487	+1	tier1	-	no_errors	ENST00000266434	ensembl	human	known	74_37	missense	44.12	19	15	SNP	0.000	G
BCO1	53630	genome.wustl.edu	37	16	81303800	81303800	+	Missense_Mutation	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr16:81303800C>A	ENST00000258168.2	+	7	1341	c.880C>A	c.(880-882)Cct>Act	p.P294T	BCMO1_ENST00000425577.2_Missense_Mutation_p.P225T	NM_017429.2	NP_059125.2														breast(2)|endometrium(1)|large_intestine(4)|lung(9)|prostate(3)|skin(3)|stomach(1)	23						GACCAGGCAGCCTGTGCAGAC	0.527																																																	0													172.0	145.0	154.0					16																	81303800		2202	4300	6502	SO:0001583	missense	0																														ENST00000258168.2:c.880C>A	16.37:g.81303800C>A	ENSP00000258168:p.Pro294Thr			Missense_Mutation	SNP	pfam_Carotenoid_Oase	p.P294T	ENST00000258168.2	37	c.880	CCDS10934.1	16	.	.	.	.	.	.	.	.	.	.	C	4.222	0.040124	0.08148	.	.	ENSG00000135697	ENST00000258168;ENST00000425577	D;D	0.94576	-3.46;-3.46	5.62	2.39	0.29439	.	0.392722	0.25839	N	0.027971	D	0.87148	0.6105	L	0.39245	1.2	0.21147	N	0.999775	B;B	0.25772	0.134;0.08	B;B	0.25759	0.063;0.063	T	0.70532	-0.4846	10	0.09590	T	0.72	-17.398	3.4874	0.07625	0.1247:0.5511:0.1596:0.1646	.	225;294	E7EM88;Q9HAY6	.;BCDO1_HUMAN	T	294;225	ENSP00000258168:P294T;ENSP00000400586:P225T	ENSP00000258168:P294T	P	+	1	0	BCMO1	79861301	0.500000	0.26091	0.677000	0.29947	0.222000	0.24845	0.999000	0.29757	1.381000	0.46364	0.650000	0.86243	CCT	BCMO1	-	pfam_Carotenoid_Oase	ENSG00000135697		0.527	BCMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCMO1	HGNC	protein_coding	OTTHUMT00000269056.1		0.00	82	0	C			81303800	+1			no_errors	ENST00000258168	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.470	A
BICD1	636	genome.wustl.edu	37	12	32487601	32487601	+	Splice_Site	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr12:32487601G>T	ENST00000281474.5	+	6	2355	c.2252G>T	c.(2251-2253)aGa>aTa	p.R751I	BICD1_ENST00000548411.1_Splice_Site_p.R751I	NM_001714.2	NP_001705.2	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 (Drosophila)	751	Interacts with RAB6A.				anatomical structure morphogenesis (GO:0009653)|intracellular mRNA localization (GO:0008298)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900737)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein localization to organelle (GO:0033365)|regulation of proteinase activated receptor activity (GO:1900276)|RNA processing (GO:0006396)|stress granule assembly (GO:0034063)|viral process (GO:0016032)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|host cell viral assembly compartment (GO:0072517)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	cytoskeletal adaptor activity (GO:0008093)|dynactin binding (GO:0034452)|dynein binding (GO:0045502)|proteinase activated receptor binding (GO:0031871)|Rab GTPase binding (GO:0017137)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			TTTGCAACAAGGTAACAGTAT	0.438																																																	0													154.0	140.0	145.0					12																	32487601		2203	4300	6503	SO:0001630	splice_region_variant	0			U90028	CCDS8726.1, CCDS44859.1	12p11.2-p11.1	2005-01-13	2001-11-28			ENSG00000151746			1049	protein-coding gene	gene with protein product		602204	"""Bicaudal D (Drosophila) homolog 1"""			9367685	Standard	NM_001714		Approved		uc001rku.3	Q96G01	OTTHUMG00000169307	ENST00000281474.5:c.2252+1G>T	12.37:g.32487601G>T			A8K2C3|F8W113|O43892|O43893	Missense_Mutation	SNP	pfam_Bicaudal-D_microtubule-assoc,superfamily_SPOC_like_C_dom	p.R751I	ENST00000281474.5	37	c.2252	CCDS8726.1	12	.	.	.	.	.	.	.	.	.	.	G	27.4	4.828662	0.90955	.	.	ENSG00000151746	ENST00000548411;ENST00000281474	T;T	0.67865	-0.29;-0.29	4.97	4.97	0.65823	.	0.000000	0.85682	D	0.000000	D	0.85478	0.5706	M	0.90705	3.14	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.88911	0.3359	10	0.87932	D	0	.	18.2608	0.90035	0.0:0.0:1.0:0.0	.	751;751	F8W113;Q96G01	.;BICD1_HUMAN	I	751	ENSP00000446793:R751I;ENSP00000281474:R751I	ENSP00000281474:R751I	R	+	2	0	BICD1	32378868	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	9.611000	0.98342	2.318000	0.78349	0.591000	0.81541	AGA	BICD1	-	pfam_Bicaudal-D_microtubule-assoc	ENSG00000151746		0.438	BICD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BICD1	HGNC	protein_coding	OTTHUMT00000403380.1	-	0.00	64	0	G	NM_001714	Missense_Mutation	32487601	+1	tier1	-	no_errors	ENST00000281474	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	T
BIRC6	57448	genome.wustl.edu	37	2	32640225	32640225	+	Silent	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:32640225G>T	ENST00000421745.2	+	10	2000	c.1866G>T	c.(1864-1866)ctG>ctT	p.L622L		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	622					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					ATTCTCCTCTGGTAAGGAGGA	0.383																																					Pancreas(94;175 1509 16028 18060 45422)												0													73.0	72.0	72.0					2																	32640225		2203	4300	6503	SO:0001819	synonymous_variant	0			AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.1866G>T	2.37:g.32640225G>T			Q9ULD1	Silent	SNP	pfam_DUF3643,pfam_UBQ-conjugat_E2,pfam_BIR,pfam_UEV_N,superfamily_UBQ-conjugating_enzyme/RWD,superfamily_Galactose-bd-like,superfamily_WD40_repeat_dom,smart_BIR,pfscan_BIR,pfscan_UBQ-conjugat_E2	p.L622	ENST00000421745.2	37	c.1866	CCDS33175.2	2																																																																																			BIRC6	-	NULL	ENSG00000115760		0.383	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BIRC6	HGNC	protein_coding	OTTHUMT00000318769.3	-	0.00	67	0	G	NM_016252		32640225	+1	tier1	-	no_errors	ENST00000421745	ensembl	human	known	74_37	silent	6.41	73	5	SNP	0.187	T
BRI3BP	140707	genome.wustl.edu	37	12	125509682	125509682	+	Silent	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr12:125509682C>T	ENST00000341446.8	+	3	553	c.462C>T	c.(460-462)ttC>ttT	p.F154F		NM_080626.5	NP_542193.3			BRI3 binding protein											large_intestine(1)|lung(8)|ovary(1)	10	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.35e-05)|Epithelial(86;0.000426)|all cancers(50;0.00576)		ACGTGGTGTTCGGCCGCTTCT	0.652																																																	0													122.0	94.0	103.0					12																	125509682		2203	4300	6503	SO:0001819	synonymous_variant	0			AF284094	CCDS9262.1	12q24.1	2008-08-04			ENSG00000184992	ENSG00000184992			14251	protein-coding gene	gene with protein product		615627				11860200, 17765869	Standard	NM_080626		Approved	BNAS1, KG19, HCCR-2	uc001uha.1	Q8WY22	OTTHUMG00000168548	ENST00000341446.8:c.462C>T	12.37:g.125509682C>T				Silent	SNP	NULL	p.F154	ENST00000341446.8	37	c.462	CCDS9262.1	12																																																																																			BRI3BP	-	NULL	ENSG00000184992		0.652	BRI3BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRI3BP	HGNC	protein_coding	OTTHUMT00000400200.2		0.00	61	0	C	NM_080626		125509682	+1			no_errors	ENST00000341446	ensembl	human	known	74_37	silent	5.00	57	3	SNP	0.930	T
LSP1	4046	genome.wustl.edu	37	11	1911544	1911544	+	Intron	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr11:1911544C>T	ENST00000311604.3	+	11	1208				LSP1_ENST00000485341.1_Intron|LSP1_ENST00000406638.2_Intron|LSP1_ENST00000381775.1_Intron|C11orf89_ENST00000391480.1_Missense_Mutation_p.E91K|LSP1_ENST00000405957.2_Intron	NM_002339.2	NP_002330.1	P33241	LSP1_HUMAN	lymphocyte-specific protein 1						cellular component movement (GO:0006928)|cellular defense response (GO:0006968)|chemotaxis (GO:0006935)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|signal transducer activity (GO:0004871)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	16		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|Lung(200;0.0729)|LUSC - Lung squamous cell carcinoma(625;0.0856)		CGTGGGGCTTCGGCGGGGTGC	0.731																																																	0																																										SO:0001627	intron_variant	0			M33552	CCDS31334.1, CCDS31335.1, CCDS58110.1	11p15.5	2008-02-05			ENSG00000130592	ENSG00000130592			6707	protein-coding gene	gene with protein product		153432				2174784	Standard	NM_001242932		Approved	WP34	uc001luj.3	P33241	OTTHUMG00000012252	ENST00000311604.3:c.1018-1459C>T	11.37:g.1911544C>T			B3KPP1|B3KRR6|E9PBV6|E9PFP3|Q16096|Q53H48|Q6FHM3|Q9BUY8	Missense_Mutation	SNP	NULL	p.E91K	ENST00000311604.3	37	c.271	CCDS31334.1	11	.	.	.	.	.	.	.	.	.	.	.	11.47	1.649492	0.29336	.	.	ENSG00000184682	ENST00000391480	T	0.62105	0.05	2.29	-1.89	0.07689	.	.	.	.	.	T	0.29556	0.0737	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.25363	-1.0134	6	0.06757	T	0.87	.	5.4774	0.16704	0.0:0.4725:0.3051:0.2223	.	.	.	.	K	91	ENSP00000375311:E91K	ENSP00000375311:E91K	E	-	1	0	C11orf89	1868120	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-1.090000	0.03372	-0.122000	0.11766	0.305000	0.20034	GAA	C11orf89	-	NULL	ENSG00000184682		0.731	LSP1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	C11orf89	HGNC	protein_coding	OTTHUMT00000034045.3	-	0.00	16	0	C	NM_002339		1911544	-1	tier1	-	no_errors	ENST00000391480	ensembl	human	known	74_37	missense	61.11	7	11	SNP	0.000	T
C11orf84	144097	genome.wustl.edu	37	11	63594542	63594542	+	Missense_Mutation	SNP	C	C	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr11:63594542C>G	ENST00000294244.4	+	6	1376	c.1077C>G	c.(1075-1077)gaC>gaG	p.D359E		NM_138471.1	NP_612480.1	Q9BUA3	CK084_HUMAN	chromosome 11 open reading frame 84	359										endometrium(3)|kidney(1)|lung(3)|skin(1)	8						ACACCTCAGACTGGCCCACAG	0.617																																																	0													65.0	55.0	58.0					11																	63594542		2201	4298	6499	SO:0001583	missense	0			BC007540	CCDS31594.1	11q13.1	2014-02-10			ENSG00000168005	ENSG00000168005			25115	protein-coding gene	gene with protein product						12477932	Standard	NM_138471		Approved		uc001nxt.3	Q9BUA3	OTTHUMG00000167746	ENST00000294244.4:c.1077C>G	11.37:g.63594542C>G	ENSP00000294244:p.Asp359Glu		Q68CV7|Q6PHS2|Q96IH0	Missense_Mutation	SNP	NULL	p.D359E	ENST00000294244.4	37	c.1077	CCDS31594.1	11	.	.	.	.	.	.	.	.	.	.	C	4.484	0.089670	0.08632	.	.	ENSG00000168005	ENST00000294244	T	0.48201	0.82	5.67	-0.045	0.13853	.	0.758973	0.11883	N	0.520342	T	0.33352	0.0860	L	0.43152	1.355	0.09310	N	0.999997	B	0.06786	0.001	B	0.06405	0.002	T	0.34477	-0.9827	10	0.87932	D	0	-3.8349	2.0695	0.03610	0.1423:0.4072:0.2773:0.1731	.	359	Q9BUA3	CK084_HUMAN	E	359	ENSP00000294244:D359E	ENSP00000294244:D359E	D	+	3	2	C11orf84	63351118	0.158000	0.22850	0.172000	0.22920	0.319000	0.28217	-0.243000	0.08915	-0.020000	0.14032	-0.257000	0.10917	GAC	C11orf84	-	NULL	ENSG00000168005		0.617	C11orf84-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf84	HGNC	protein_coding	OTTHUMT00000396084.1	-	0.00	107	0	C	NM_138471		63594542	+1	tier1	-	no_errors	ENST00000294244	ensembl	human	known	74_37	missense	14.88	143	25	SNP	0.142	G
C15orf32	145858	genome.wustl.edu	37	15	93015606	93015606	+	Silent	SNP	A	A	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr15:93015606A>G	ENST00000333334.2	+	1	723	c.228A>G	c.(226-228)caA>caG	p.Q76Q	RP11-763K15.1_ENST00000554440.1_lincRNA|C15orf32_ENST00000556865.1_Silent_p.Q76Q	NM_153040.2	NP_694585.1	Q32M92	CO032_HUMAN	chromosome 15 open reading frame 32	76										endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(2)	12	Lung NSC(78;0.0893)|all_lung(78;0.125)		BRCA - Breast invasive adenocarcinoma(143;0.0493)|OV - Ovarian serous cystadenocarcinoma(32;0.125)			caaacaaccaagtttatcaga	0.453																																																	0													70.0	69.0	69.0					15																	93015606		2198	4298	6496	SO:0001819	synonymous_variant	0				CCDS10373.1, CCDS73784.1	15q26.1	2014-09-10			ENSG00000183643	ENSG00000183643			26549	protein-coding gene	gene with protein product							Standard	NM_153040		Approved	FLJ32831	uc002brc.1	Q32M92	OTTHUMG00000149844	ENST00000333334.2:c.228A>G	15.37:g.93015606A>G			C5HTZ8|Q96M45	Silent	SNP	NULL	p.Q76	ENST00000333334.2	37	c.228	CCDS10373.1	15																																																																																			C15orf32	-	NULL	ENSG00000183643		0.453	C15orf32-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C15orf32	HGNC	protein_coding	OTTHUMT00000313527.2	-	0.00	97	0	A	NM_153040		93015606	+1	tier1	-	no_errors	ENST00000333334	ensembl	human	known	74_37	silent	25.35	53	18	SNP	0.921	G
C16orf62	57020	genome.wustl.edu	37	16	19640046	19640046	+	Missense_Mutation	SNP	A	A	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr16:19640046A>G	ENST00000251143.5	+	17	1483	c.1471A>G	c.(1471-1473)Aaa>Gaa	p.K491E	C16orf62_ENST00000438132.3_Missense_Mutation_p.K580E|C16orf62_ENST00000417362.2_Missense_Mutation_p.K424E|C16orf62_ENST00000448695.1_Missense_Mutation_p.K341E|C16orf62_ENST00000542263.1_Missense_Mutation_p.K513E|C16orf62_ENST00000543152.1_Missense_Mutation_p.K240E			Q7Z3J2	CP062_HUMAN	chromosome 16 open reading frame 62	491						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	36						CGAAGCTTGGAAAGTCATCAC	0.358																																																	0													113.0	106.0	108.0					16																	19640046		2197	4300	6497	SO:0001583	missense	0				CCDS32397.1, CCDS32397.2, CCDS73840.1	16p12.3	2012-05-30			ENSG00000103544	ENSG00000103544			24641	protein-coding gene	gene with protein product						10493829	Standard	NM_020314		Approved	MGC16824	uc002dgn.3	Q7Z3J2	OTTHUMG00000167925	ENST00000251143.5:c.1471A>G	16.37:g.19640046A>G	ENSP00000251143:p.Lys491Glu		A8K2M1|O43329|Q69YI1|Q6PDA0|Q7L371|Q86W66|Q8WXA5|Q9H0L7|Q9H7C8	Missense_Mutation	SNP	NULL	p.K580E	ENST00000251143.5	37	c.1738		16	.	.	.	.	.	.	.	.	.	.	A	23.9	4.471590	0.84533	.	.	ENSG00000103544	ENST00000438132;ENST00000542263;ENST00000251143;ENST00000417362;ENST00000448695	T;T;T;T;T	0.58358	0.34;0.34;0.34;0.34;0.34	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.68997	0.3062	L	0.58510	1.815	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.78314	0.991;0.991	T	0.67818	-0.5572	9	.	.	.	-19.8885	16.1219	0.81365	1.0:0.0:0.0:0.0	.	513;491	F5H7K1;Q7Z3J2	.;CP062_HUMAN	E	580;513;491;424;341	ENSP00000400815:K580E;ENSP00000442468:K513E;ENSP00000251143:K491E;ENSP00000395973:K424E;ENSP00000398009:K341E	.	K	+	1	0	C16orf62	19547547	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.455000	0.90355	2.285000	0.76669	0.533000	0.62120	AAA	C16orf62	-	NULL	ENSG00000103544		0.358	C16orf62-201	KNOWN	basic|appris_principal	protein_coding	C16orf62	HGNC	protein_coding		-	0.00	86	0	A	NM_020314		19640046	+1	tier1	-	no_errors	ENST00000438132	ensembl	human	known	74_37	missense	24.42	64	21	SNP	1.000	G
C16orf78	123970	genome.wustl.edu	37	16	49407922	49407922	+	Silent	SNP	A	A	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr16:49407922A>G	ENST00000299191.3	+	1	189	c.72A>G	c.(70-72)gaA>gaG	p.E24E		NM_144602.2	NP_653203.1	Q8WTQ4	CP078_HUMAN	chromosome 16 open reading frame 78	24						nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|upper_aerodigestive_tract(1)	22						AGACTGCTGAAGATAGGCGCA	0.517																																																	0													151.0	131.0	138.0					16																	49407922		2199	4300	6499	SO:0001819	synonymous_variant	0			BC021181	CCDS10738.1	16q12.1	2008-02-05			ENSG00000166152	ENSG00000166152			28479	protein-coding gene	gene with protein product						12477932	Standard	NM_144602		Approved	MGC33367	uc002efr.3	Q8WTQ4	OTTHUMG00000133149	ENST00000299191.3:c.72A>G	16.37:g.49407922A>G				Silent	SNP	NULL	p.E24	ENST00000299191.3	37	c.72	CCDS10738.1	16																																																																																			C16orf78	-	NULL	ENSG00000166152		0.517	C16orf78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf78	HGNC	protein_coding	OTTHUMT00000256846.1	-	0.00	134	0	A	NM_144602		49407922	+1	tier1	-	no_errors	ENST00000299191	ensembl	human	known	74_37	silent	27.35	85	32	SNP	0.994	G
C17orf85	55421	genome.wustl.edu	37	17	3716411	3716411	+	Missense_Mutation	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr17:3716411C>T	ENST00000389005.4	-	13	1817	c.1790G>A	c.(1789-1791)cGg>cAg	p.R597Q	C17orf85_ENST00000158149.3_Missense_Mutation_p.R317Q	NM_001114118.2	NP_001107590.1	Q53F19	CQ085_HUMAN	chromosome 17 open reading frame 85	597							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(2)|lung(4)|skin(1)|urinary_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (3;0.0725)		GTTATCTAACCGGCTCTTCTT	0.562																																																	0													117.0	119.0	118.0					17																	3716411		2203	4300	6503	SO:0001583	missense	0				CCDS45578.1	17p13.2	2012-10-23			ENSG00000074356	ENSG00000074356			24612	protein-coding gene	gene with protein product	"""ELG protein"""					11412301	Standard	NM_001114118		Approved	HSA277841, ELG	uc010ckl.2	Q53F19	OTTHUMG00000177672	ENST00000389005.4:c.1790G>A	17.37:g.3716411C>T	ENSP00000373657:p.Arg597Gln		B3KWG7|Q7L406|Q96FK1|Q9NXZ4	Missense_Mutation	SNP	pfam_DUF2414	p.R597Q	ENST00000389005.4	37	c.1790	CCDS45578.1	17	.	.	.	.	.	.	.	.	.	.	C	29.3	4.997731	0.93227	.	.	ENSG00000074356	ENST00000389005;ENST00000158149	.	.	.	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.66733	0.2819	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.68652	-0.5352	9	0.87932	D	0	-9.6678	18.0364	0.89305	0.0:1.0:0.0:0.0	.	597	Q53F19	CQ085_HUMAN	Q	597;317	.	ENSP00000158149:R317Q	R	-	2	0	C17orf85	3663160	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.993000	0.76245	2.941000	0.99782	0.655000	0.94253	CGG	C17orf85	-	NULL	ENSG00000074356		0.562	C17orf85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf85	HGNC	protein_coding	OTTHUMT00000438385.1	-	0.00	62	0	C	NM_018553		3716411	-1	tier1	-	no_errors	ENST00000389005	ensembl	human	known	74_37	missense	50.00	22	22	SNP	1.000	T
C19orf66	55337	genome.wustl.edu	37	19	10197926	10197926	+	Splice_Site	DEL	G	G	-			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr19:10197926delG	ENST00000253110.11	+	3	443		c.e3-1		CTD-2240E14.4_ENST00000589622.1_RNA|C19orf66_ENST00000397881.3_Splice_Site|C19orf66_ENST00000591813.1_Splice_Site	NM_018381.2	NP_060851.2	Q9NUL5	CS066_HUMAN	chromosome 19 open reading frame 66											large_intestine(3)|skin(1)	4						CTCCCCCGCAGGGGTAAAGCA	0.602																																																	0													61.0	63.0	62.0					19																	10197926		1900	4116	6016	SO:0001630	splice_region_variant	0				CCDS45957.1	19p13.2	2012-10-26			ENSG00000130813	ENSG00000130813			25649	protein-coding gene	gene with protein product						12477932	Standard	NM_018381		Approved	FLJ11286	uc002mmu.4	Q9NUL5		ENST00000253110.11:c.146-1G>-	19.37:g.10197926delG			A8MQT9|Q4G188|Q8IYH6|Q8N8V1	Splice_Site	DEL	-	e3-1	ENST00000253110.11	37	c.146-1	CCDS45957.1	19																																																																																			C19orf66	-	-	ENSG00000130813		0.602	C19orf66-001	KNOWN	basic|CCDS	protein_coding	C19orf66	HGNC	protein_coding	OTTHUMT00000451129.1		0.00	90	0	G	NM_018381	Intron	10197926	+1	tier1		no_errors	ENST00000253110	ensembl	human	known	74_37	splice_site_del	19.57	74	18	DEL	0.836	-
C4orf50	389197	genome.wustl.edu	37	4	5990804	5990804	+	5'Flank	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr4:5990804T>G	ENST00000324058.5	-	0	0				C4orf50_ENST00000531445.1_Missense_Mutation_p.K232T			Q6ZRC1	CD050_HUMAN	chromosome 4 open reading frame 50											breast(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(2)|skin(3)|urinary_tract(1)	15						CAGTTCTTTCTTTAACTGAGA	0.443																																																	0																																										SO:0001631	upstream_gene_variant	0			BC140710		4p16.1	2009-04-14			ENSG00000181215	ENSG00000181215			33766	protein-coding gene	gene with protein product							Standard	XM_003119922		Approved	FLJ46481		Q6ZRC1	OTTHUMG00000149971		4.37:g.5990804T>G	Exception_encountered			Missense_Mutation	SNP	NULL	p.K232T	ENST00000324058.5	37	c.695		4	.	.	.	.	.	.	.	.	.	.	T	10.59	1.393272	0.25118	.	.	ENSG00000181215	ENST00000531445	T	0.28895	1.59	5.2	-3.3	0.05003	.	.	.	.	.	T	0.29288	0.0729	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.38308	-0.9667	6	0.33141	T	0.24	.	13.3014	0.60328	0.0:0.6856:0.0:0.3144	.	.	.	.	T	232	ENSP00000437121:K232T	ENSP00000437121:K232T	K	-	2	0	C4orf50	6041705	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.335000	0.02662	-0.486000	0.06744	-1.151000	0.01829	AAG	C4orf50	-	NULL	ENSG00000181215		0.443	C4orf50-201	KNOWN	basic|appris_candidate	protein_coding	C4orf50	HGNC	protein_coding		-	0.00	62	0	T	NM_207405		5990804	-1	tier1	-	no_errors	ENST00000531445	ensembl	human	known	74_37	missense	52.24	32	35	SNP	0.000	G
C6	729	genome.wustl.edu	37	5	41160404	41160404	+	Missense_Mutation	SNP	C	C	A	rs562300050		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr5:41160404C>A	ENST00000263413.3	-	11	1788	c.1524G>T	c.(1522-1524)agG>agT	p.R508S	C6_ENST00000337836.5_Missense_Mutation_p.R508S|C6_ENST00000475349.1_5'UTR	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	508	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)		p.R508S(1)		central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				GCAAAGCTTTCCTGAGGTTGT	0.522																																																	1	Substitution - Missense(1)	lung(1)											216.0	185.0	195.0					5																	41160404		2203	4300	6503	SO:0001583	missense	0			J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.1524G>T	5.37:g.41160404C>A	ENSP00000263413:p.Arg508Ser			Missense_Mutation	SNP	pfam_MACPF,pfam_Sushi_SCR_CCP,pfam_Thrombospondin_1_rpt,pfam_LDrepeatLR_classA_rpt,pfam_Kazal_dom,superfamily_Sushi_SCR_CCP,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,smart_Sushi_SCR_CCP,smart_FacI_MAC,prints_MAC_perforin,pfscan_LDrepeatLR_classA_rpt,pfscan_Sushi_SCR_CCP,pfscan_Thrombospondin_1_rpt	p.R508S	ENST00000263413.3	37	c.1524	CCDS3936.1	5	.	.	.	.	.	.	.	.	.	.	C	21.2	4.120441	0.77323	.	.	ENSG00000039537	ENST00000337836;ENST00000263413	D;D	0.84730	-1.89;-1.89	6.06	5.19	0.71726	Membrane attack complex component/perforin (MACPF) domain (3);	0.197793	0.52532	D	0.000080	D	0.86272	0.5893	M	0.72894	2.215	0.45056	D	0.998075	P	0.42161	0.772	B	0.44315	0.446	D	0.86783	0.1980	10	0.54805	T	0.06	-13.7581	13.3841	0.60785	0.0:0.8694:0.0:0.1306	.	508	P13671	CO6_HUMAN	S	508	ENSP00000338861:R508S;ENSP00000263413:R508S	ENSP00000263413:R508S	R	-	3	2	C6	41196161	0.863000	0.29885	1.000000	0.80357	0.899000	0.52679	1.477000	0.35431	1.576000	0.49790	0.655000	0.94253	AGG	C6	-	pfam_MACPF,smart_MACPF,prints_MAC_perforin	ENSG00000039537		0.522	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6	HGNC	protein_coding	OTTHUMT00000211592.1		0.00	70	0	C			41160404	-1			no_errors	ENST00000263413	ensembl	human	known	74_37	missense	5.00	57	3	SNP	1.000	A
C6	729	genome.wustl.edu	37	5	41176582	41176582	+	Missense_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr5:41176582T>G	ENST00000263413.3	-	8	1427	c.1163A>C	c.(1162-1164)aAc>aCc	p.N388T	C6_ENST00000337836.5_Missense_Mutation_p.N388T|C6_ENST00000475349.1_5'UTR	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	388	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)				central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				GTTACCTGAGTTCTTTAGTTC	0.393																																																	0													69.0	66.0	67.0					5																	41176582		2203	4300	6503	SO:0001583	missense	0			J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.1163A>C	5.37:g.41176582T>G	ENSP00000263413:p.Asn388Thr			Missense_Mutation	SNP	pfam_MACPF,pfam_Sushi_SCR_CCP,pfam_Thrombospondin_1_rpt,pfam_LDrepeatLR_classA_rpt,pfam_Kazal_dom,superfamily_Sushi_SCR_CCP,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,smart_Sushi_SCR_CCP,smart_FacI_MAC,prints_MAC_perforin,pfscan_LDrepeatLR_classA_rpt,pfscan_Sushi_SCR_CCP,pfscan_Thrombospondin_1_rpt	p.N388T	ENST00000263413.3	37	c.1163	CCDS3936.1	5	.	.	.	.	.	.	.	.	.	.	T	8.404	0.842564	0.16963	.	.	ENSG00000039537	ENST00000337836;ENST00000263413	D;D	0.84298	-1.83;-1.83	5.36	4.18	0.49190	Membrane attack complex component/perforin (MACPF) domain (3);	0.434887	0.29396	N	0.012271	T	0.73659	0.3615	L	0.28344	0.845	0.40939	D	0.984457	B	0.12630	0.006	B	0.19666	0.026	T	0.64892	-0.6300	10	0.25106	T	0.35	-18.9299	7.2055	0.25905	0.0:0.0727:0.148:0.7793	.	388	P13671	CO6_HUMAN	T	388	ENSP00000338861:N388T;ENSP00000263413:N388T	ENSP00000263413:N388T	N	-	2	0	C6	41212339	1.000000	0.71417	0.993000	0.49108	0.622000	0.37654	1.713000	0.37951	1.032000	0.39892	0.482000	0.46254	AAC	C6	-	pfam_MACPF,smart_MACPF	ENSG00000039537		0.393	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6	HGNC	protein_coding	OTTHUMT00000211592.1	-	0.00	108	0	T			41176582	-1	tier1	-	no_errors	ENST00000263413	ensembl	human	known	74_37	missense	12.37	85	12	SNP	0.995	G
C6orf118	168090	genome.wustl.edu	37	6	165715286	165715286	+	Silent	SNP	T	T	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr6:165715286T>C	ENST00000230301.8	-	2	545	c.525A>G	c.(523-525)gaA>gaG	p.E175E	C6orf118_ENST00000543069.1_Silent_p.E71E	NM_144980.3	NP_659417.2	Q5T5N4	CF118_HUMAN	chromosome 6 open reading frame 118	175										breast(1)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)		GCCGGAGTTCTTCCCTCCTGC	0.632																																																	0													37.0	43.0	41.0					6																	165715286		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS5288.1	6q27	2012-02-06			ENSG00000112539	ENSG00000112539			21233	protein-coding gene	gene with protein product							Standard	NM_144980		Approved	MGC23884, bA85G2.1	uc003qum.4	Q5T5N4	OTTHUMG00000015984	ENST00000230301.8:c.525A>G	6.37:g.165715286T>C			Q8TC11	Silent	SNP	superfamily_Ribonuclease/ribotoxin	p.E175	ENST00000230301.8	37	c.525	CCDS5288.1	6																																																																																			C6orf118	-	superfamily_Ribonuclease/ribotoxin	ENSG00000112539		0.632	C6orf118-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C6orf118	HGNC	protein_coding	OTTHUMT00000043026.1	-	0.00	53	0	T	NM_144980		165715286	-1	tier1	-	no_errors	ENST00000230301	ensembl	human	known	74_37	silent	63.64	12	21	SNP	0.069	C
CABIN1	23523	genome.wustl.edu	37	22	24466851	24466851	+	Missense_Mutation	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr22:24466851C>T	ENST00000398319.2	+	17	2718	c.2333C>T	c.(2332-2334)gCc>gTc	p.A778V	CABIN1_ENST00000405822.2_Missense_Mutation_p.A728V|CABIN1_ENST00000263119.5_Missense_Mutation_p.A778V	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	778					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						GGTGAGGCTGCCGCCAAGGAG	0.587																																																	0													99.0	86.0	91.0					22																	24466851		2203	4300	6503	SO:0001583	missense	0			AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.2333C>T	22.37:g.24466851C>T	ENSP00000381364:p.Ala778Val		G5E9F3|Q6PHY0|Q9Y460	Missense_Mutation	SNP	pfam_MEF2_binding,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.A778V	ENST00000398319.2	37	c.2333	CCDS13823.1	22	.	.	.	.	.	.	.	.	.	.	C	19.78	3.890295	0.72524	.	.	ENSG00000099991	ENST00000263119;ENST00000405822;ENST00000398319	T;T;T	0.32023	1.47;1.47;1.47	5.39	5.39	0.77823	.	0.298694	0.38897	N	0.001521	T	0.29423	0.0733	L	0.38175	1.15	0.80722	D	1	B;B	0.10296	0.003;0.001	B;B	0.09377	0.004;0.002	T	0.04041	-1.0982	10	0.59425	D	0.04	.	18.5776	0.91161	0.0:1.0:0.0:0.0	.	728;778	G5E9F3;Q9Y6J0	.;CABIN_HUMAN	V	778;728;778	ENSP00000263119:A778V;ENSP00000384694:A728V;ENSP00000381364:A778V	ENSP00000263119:A778V	A	+	2	0	CABIN1	22796851	0.034000	0.19679	0.091000	0.20842	0.866000	0.49608	2.439000	0.44846	2.716000	0.92895	0.650000	0.86243	GCC	CABIN1	-	NULL	ENSG00000099991		0.587	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CABIN1	HGNC	protein_coding	OTTHUMT00000320161.2	-	0.00	68	0	C	NM_012295		24466851	+1	tier1	-	no_errors	ENST00000263119	ensembl	human	known	74_37	missense	23.08	30	9	SNP	0.844	T
CACNA1C	775	genome.wustl.edu	37	12	2659137	2659137	+	Silent	SNP	C	C	T	rs368065584		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr12:2659137C>T	ENST00000347598.4	+	10	1419	c.1419C>T	c.(1417-1419)tcC>tcT	p.S473S	CACNA1C_ENST00000399655.1_Silent_p.S473S|CACNA1C_ENST00000399641.1_Silent_p.S473S|CACNA1C_ENST00000399606.1_Silent_p.S473S|CACNA1C_ENST00000491104.1_3'UTR|CACNA1C_ENST00000399621.1_Silent_p.S473S|CACNA1C_ENST00000399617.1_Silent_p.S473S|CACNA1C_ENST00000399644.1_Silent_p.S473S|CACNA1C_ENST00000399595.1_Silent_p.S473S|CACNA1C_ENST00000399649.1_Silent_p.S473S|CACNA1C_ENST00000399597.1_Silent_p.S473S|CACNA1C_ENST00000399603.1_Silent_p.S473S|CACNA1C_ENST00000399591.1_Silent_p.S473S|CACNA1C_ENST00000399601.1_Silent_p.S473S|CACNA1C_ENST00000402845.3_Silent_p.S473S|CACNA1C_ENST00000327702.7_Silent_p.S473S|CACNA1C_ENST00000480911.1_Silent_p.S473S|CACNA1C_ENST00000406454.3_Silent_p.S473S|CACNA1C_ENST00000399634.1_Silent_p.S473S|CACNA1C_ENST00000399638.1_Silent_p.S473S|CACNA1C_ENST00000335762.5_Silent_p.S498S|CACNA1C_ENST00000399629.1_Silent_p.S473S|CACNA1C_ENST00000344100.3_Silent_p.S473S|CACNA1C_ENST00000399637.1_Silent_p.S473S	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	473					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	AGACCGAGTCCGTCAACACCG	0.592																																																	0								C	,,,,,,,,,,,,,,,,,,,,,,	0,4214		0,0,2107	54.0	60.0	58.0		1419,1419,1419,1419,1419,1419,1419,1419,1419,1419,1419,1419,1419,1419,1419,1419,1419,1410,1419,1419,1419,1419,1419	-6.1	1.0	12		58	6,8450		0,6,4222	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	CACNA1C	NM_000719.6,NM_001129827.1,NM_001129829.1,NM_001129830.1,NM_001129831.1,NM_001129832.1,NM_001129833.1,NM_001129834.1,NM_001129835.1,NM_001129836.1,NM_001129837.1,NM_001129838.1,NM_001129839.1,NM_001129840.1,NM_001129841.1,NM_001129842.1,NM_001129843.1,NM_001129844.1,NM_001129846.1,NM_001167623.1,NM_001167624.1,NM_001167625.1,NM_199460.2	,,,,,,,,,,,,,,,,,,,,,,	0,6,6329	TT,TC,CC		0.071,0.0,0.0474	,,,,,,,,,,,,,,,,,,,,,,	473/2139,473/2187,473/2180,473/2174,473/2167,473/2159,473/2158,473/2158,473/2158,473/2156,473/2147,473/2147,473/2145,473/2139,473/2139,473/2139,473/2139,470/2136,473/2128,473/2139,473/2174,473/2199,473/2222	2659137	6,12664	2107	4228	6335	SO:0001819	synonymous_variant	0			AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.1419C>T	12.37:g.2659137C>T			B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCC_L_a1csu,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.S473	ENST00000347598.4	37	c.1419	CCDS44788.1	12																																																																																			CACNA1C	-	NULL	ENSG00000151067		0.592	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1C	HGNC	protein_coding	OTTHUMT00000317035.1	-	0.00	33	0	C	NM_000719		2659137	+1	tier1	-	no_errors	ENST00000399634	ensembl	human	known	74_37	silent	20.37	43	11	SNP	0.359	T
CACNA1E	777	genome.wustl.edu	37	1	181740473	181740473	+	Silent	SNP	G	G	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr1:181740473G>A	ENST00000367573.2	+	36	4926	c.4926G>A	c.(4924-4926)cgG>cgA	p.R1642R	CACNA1E_ENST00000360108.3_Silent_p.R1623R|CACNA1E_ENST00000367567.4_Silent_p.R1249R|RNA5SP70_ENST00000517168.1_RNA|CACNA1E_ENST00000358338.5_Silent_p.R1574R|CACNA1E_ENST00000367570.1_Silent_p.R1642R|CACNA1E_ENST00000357570.5_Silent_p.R1593R|CACNA1E_ENST00000526775.1_Silent_p.R1623R	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1642					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						ACATCAACCGGCACAACAACT	0.468																																																	0													119.0	109.0	112.0					1																	181740473		1935	4126	6061	SO:0001819	synonymous_variant	0			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.4926G>A	1.37:g.181740473G>A			B1AM12|B1AM13|B1AM14|Q14580|Q14581	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_hand_dom,prints_VDCCAlpha1,prints_VDCC_R_a1su	p.R1642	ENST00000367573.2	37	c.4926	CCDS55664.1	1																																																																																			CACNA1E	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel	ENSG00000198216		0.468	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	HGNC	protein_coding	OTTHUMT00000090793.2	-	0.00	70	0	G	NM_000721		181740473	+1	tier1	-	no_errors	ENST00000367573	ensembl	human	known	74_37	silent	5.88	80	5	SNP	0.997	A
CACNA1G	8913	genome.wustl.edu	37	17	48649985	48649985	+	Missense_Mutation	SNP	C	C	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr17:48649985C>G	ENST00000359106.5	+	6	817	c.817C>G	c.(817-819)Cag>Gag	p.Q273E	CACNA1G_ENST00000512389.1_Missense_Mutation_p.Q273E|CACNA1G_ENST00000505165.1_Missense_Mutation_p.Q273E|CACNA1G_ENST00000513689.2_Missense_Mutation_p.Q273E|CACNA1G_ENST00000513964.1_Missense_Mutation_p.Q273E|CACNA1G_ENST00000507896.1_Missense_Mutation_p.Q273E|CACNA1G_ENST00000502264.1_Missense_Mutation_p.Q273E|CACNA1G_ENST00000514717.1_Missense_Mutation_p.Q273E|CACNA1G_ENST00000416767.4_Missense_Mutation_p.Q273E|CACNA1G_ENST00000354983.4_Missense_Mutation_p.Q273E|CACNA1G_ENST00000515165.1_Missense_Mutation_p.Q273E|CACNA1G_ENST00000507510.2_Missense_Mutation_p.Q273E|CACNA1G_ENST00000515411.1_Missense_Mutation_p.Q273E|CACNA1G_ENST00000358244.5_Missense_Mutation_p.Q273E|CACNA1G_ENST00000507336.1_Missense_Mutation_p.Q273E|CACNA1G_ENST00000510115.1_Missense_Mutation_p.Q273E|CACNA1G_ENST00000507609.1_Missense_Mutation_p.Q273E|CACNA1G_ENST00000514079.1_Missense_Mutation_p.Q273E|CACNA1G_ENST00000442258.2_Missense_Mutation_p.Q273E|CACNA1G_ENST00000360761.4_Missense_Mutation_p.Q273E|CACNA1G_ENST00000503485.1_Missense_Mutation_p.Q273E|CACNA1G_ENST00000352832.5_Missense_Mutation_p.Q273E|CACNA1G_ENST00000515765.1_Missense_Mutation_p.Q273E|CACNA1G_ENST00000510366.1_Missense_Mutation_p.Q273E|CACNA1G_ENST00000514181.1_Missense_Mutation_p.Q273E|CACNA1G_ENST00000429973.2_Missense_Mutation_p.Q273E	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	273					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	CATCTGCTCCCAGCCACGCGA	0.652																																																	0													19.0	21.0	20.0					17																	48649985		2070	4202	6272	SO:0001583	missense	0			AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.817C>G	17.37:g.48649985C>G	ENSP00000352011:p.Gln273Glu		D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_VDCCAlpha1	p.Q273E	ENST00000359106.5	37	c.817	CCDS45730.1	17	.	.	.	.	.	.	.	.	.	.	c	5.328	0.245840	0.10077	.	.	ENSG00000006283	ENST00000360761;ENST00000352832;ENST00000416767;ENST00000354983;ENST00000442258;ENST00000502264;ENST00000512389;ENST00000513964;ENST00000514717;ENST00000510366;ENST00000503485;ENST00000507510;ENST00000507336;ENST00000513689;ENST00000507609;ENST00000510115;ENST00000515165;ENST00000514181;ENST00000515765;ENST00000514079;ENST00000358244;ENST00000359106;ENST00000429973;ENST00000515411;ENST00000505165;ENST00000507896	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.96716	-3.96;-3.96;-4.1;-3.91;-3.96;-3.96;-3.98;-4.05;-4.02;-4.03;-4.04;-3.92;-3.93;-3.99;-3.94;-3.9;-3.98;-3.94;-3.92;-3.98;-3.96;-3.93;-3.98;-3.92;-3.97;-3.98	5.36	5.36	0.76844	Ion transport (1);	0.000000	0.40064	N	0.001194	D	0.96411	0.8829	L	0.41415	1.275	0.47476	D	0.999434	P;B;D;D;P;P;P;B;P;B;B;B;B;B;D;B;D;P;B;B;P;B;B;B;D;D	0.61080	0.946;0.099;0.981;0.957;0.516;0.785;0.956;0.22;0.956;0.099;0.34;0.081;0.099;0.211;0.975;0.096;0.989;0.907;0.333;0.099;0.92;0.182;0.117;0.025;0.959;0.987	D;B;D;P;B;P;D;B;D;B;B;B;B;B;D;B;P;P;B;B;D;B;B;B;P;P	0.69479	0.945;0.058;0.928;0.888;0.267;0.567;0.964;0.196;0.964;0.058;0.156;0.051;0.085;0.147;0.964;0.147;0.869;0.648;0.267;0.085;0.924;0.147;0.096;0.066;0.76;0.793	D	0.93735	0.7045	10	0.07325	T	0.83	.	19.1516	0.93491	0.0:1.0:0.0:0.0	.	273;273;273;273;273;273;273;273;273;273;273;273;273;273;273;273;273;273;273;273;273;273;273;273;273;273	Q19QZ5;Q19QZ1;Q19QZ4;Q19R07;Q19QY8;Q19R10;Q19QZ6;Q19QZ3;Q19R06;Q19R00;Q19R04;O43497-10;Q19QZ9;Q19QZ7;Q19R08;Q19QZ8;Q19R03;O43497-4;Q19R02;Q19R12;Q19R17;Q19R11;Q2TAC4;O43497;Q19R13;O43497-11	.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;CAC1G_HUMAN;.;.	E	273	ENSP00000353990:Q273E;ENSP00000339302:Q273E;ENSP00000392390:Q273E;ENSP00000347078:Q273E;ENSP00000409759:Q273E;ENSP00000425522:Q273E;ENSP00000426261:Q273E;ENSP00000425451:Q273E;ENSP00000422407:Q273E;ENSP00000426814:Q273E;ENSP00000427238:Q273E;ENSP00000423112:Q273E;ENSP00000420918:Q273E;ENSP00000426172:Q273E;ENSP00000423045:Q273E;ENSP00000427173:Q273E;ENSP00000426098:Q273E;ENSP00000425698:Q273E;ENSP00000426232:Q273E;ENSP00000423317:Q273E;ENSP00000350979:Q273E;ENSP00000352011:Q273E;ENSP00000414388:Q273E;ENSP00000423155:Q273E;ENSP00000422268:Q273E;ENSP00000421518:Q273E	ENSP00000339302:Q273E	Q	+	1	0	CACNA1G	46004984	0.990000	0.36364	1.000000	0.80357	0.984000	0.73092	2.871000	0.48459	2.541000	0.85698	0.505000	0.49811	CAG	CACNA1G	-	pfam_Ion_trans_dom	ENSG00000006283		0.652	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	CACNA1G	HGNC	protein_coding	OTTHUMT00000367895.1	-	0.00	51	0	C	NM_018896		48649985	+1	tier1	-	no_errors	ENST00000359106	ensembl	human	known	74_37	missense	7.55	49	4	SNP	1.000	G
CACNA1G	8913	genome.wustl.edu	37	17	48678463	48678463	+	Silent	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr17:48678463G>T	ENST00000359106.5	+	19	3843	c.3843G>T	c.(3841-3843)gtG>gtT	p.V1281V	CACNA1G_ENST00000512389.1_Silent_p.V1281V|CACNA1G_ENST00000505165.1_Silent_p.V1281V|CACNA1G_ENST00000513689.2_Silent_p.V1281V|CACNA1G_ENST00000513964.1_Silent_p.V1281V|CACNA1G_ENST00000507896.1_Silent_p.V1281V|CACNA1G_ENST00000502264.1_Silent_p.V1258V|CACNA1G_ENST00000514717.1_Silent_p.V1258V|CACNA1G_ENST00000416767.4_Silent_p.V1281V|CACNA1G_ENST00000354983.4_Silent_p.V1258V|CACNA1G_ENST00000515165.1_Silent_p.V1281V|CACNA1G_ENST00000507510.2_Silent_p.V1281V|CACNA1G_ENST00000515411.1_Silent_p.V1281V|CACNA1G_ENST00000358244.5_Silent_p.V1258V|CACNA1G_ENST00000507336.1_Silent_p.V1281V|CACNA1G_ENST00000510115.1_Silent_p.V1258V|CACNA1G_ENST00000507609.1_Silent_p.V1281V|CACNA1G_ENST00000514079.1_Silent_p.V1281V|CACNA1G_ENST00000442258.2_Silent_p.V1258V|CACNA1G_ENST00000360761.4_Silent_p.V1258V|CACNA1G_ENST00000503485.1_Silent_p.V1281V|CACNA1G_ENST00000352832.5_Silent_p.V1258V|CACNA1G_ENST00000515765.1_Silent_p.V1281V|CACNA1G_ENST00000510366.1_Silent_p.V1281V|CACNA1G_ENST00000514181.1_Silent_p.V1281V|CACNA1G_ENST00000429973.2_Silent_p.V1281V	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	1281					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	TCGACCACGTGGTCCTTGTCA	0.612																																																	0													125.0	124.0	124.0					17																	48678463		2152	4242	6394	SO:0001819	synonymous_variant	0			AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.3843G>T	17.37:g.48678463G>T			D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Silent	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_VDCCAlpha1	p.V1281	ENST00000359106.5	37	c.3843	CCDS45730.1	17																																																																																			CACNA1G	-	NULL	ENSG00000006283		0.612	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	CACNA1G	HGNC	protein_coding	OTTHUMT00000367895.1	-	0.00	66	0	G	NM_018896		48678463	+1	tier1	-	no_errors	ENST00000359106	ensembl	human	known	74_37	silent	5.80	65	4	SNP	1.000	T
CAD	790	genome.wustl.edu	37	2	27462287	27462287	+	Missense_Mutation	SNP	G	G	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:27462287G>A	ENST00000403525.1	+	32	5297	c.5153G>A	c.(5152-5154)gGc>gAc	p.G1718D	CAD_ENST00000264705.4_Missense_Mutation_p.G1781D			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AAAGTGAAGGGCACCGTCCGC	0.592																																																	0													87.0	75.0	79.0					2																	27462287		2203	4300	6503	SO:0001583	missense	0			D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.5153G>A	2.37:g.27462287G>A	ENSP00000384510:p.Gly1718Asp		O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_ssu_N,pfam_Asp/Orn_carbamoyltranf_P-bd,pfam_GATASE,pfam_Asp_carbamoyltransf_Asp/Orn-bd,pfam_CarbamoylP_synth_lsu_oligo,pfam_CarbamoylP_synth_lsu_N,pfam_ATP-grasp_carboxylate-amine,pfam_MGS-like_dom,pfam_Dala_Dala_lig_C,pfam_Amidohydro_1,superfamily_Asp/Orn_carbamoylTrfase,superfamily_CarbamoylP_synth_lsu_oligo,superfamily_CarbamoylP_synth_ssu_N,superfamily_PreATP-grasp_dom,superfamily_MGS-like_dom,superfamily_Metal-dep_hydrolase_composite,smart_MGS-like_dom,pfscan_ATP-grasp,prints_CbamoylP_synth_lsu_CPSase_dom,prints_Asp_carbamoyltransf,prints_Asp/Orn_carbamoylTrfase,tigrfam_CarbamoylP_synth_lsu,tigrfam_CarbamoylP_synth_ssu,tigrfam_Asp_carbamoyltransf	p.G1781D	ENST00000403525.1	37	c.5342		2	.	.	.	.	.	.	.	.	.	.	G	26.1	4.706270	0.89018	.	.	ENSG00000084774	ENST00000264705;ENST00000403525	D;D	0.99032	-5.35;-5.28	4.88	4.88	0.63580	Metal-dependent hydrolase, composite domain (1);	0.000000	0.85682	D	0.000000	D	0.99591	0.9852	H	0.98178	4.165	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.97625	1.0138	10	0.87932	D	0	-0.782	16.9731	0.86305	0.0:0.0:1.0:0.0	.	1718;1781	F8VPD4;P27708	.;PYR1_HUMAN	D	1781;1718	ENSP00000264705:G1781D;ENSP00000384510:G1718D	ENSP00000264705:G1781D	G	+	2	0	CAD	27315791	1.000000	0.71417	1.000000	0.80357	0.736000	0.42039	9.317000	0.96327	2.407000	0.81776	0.561000	0.74099	GGC	CAD	-	superfamily_Metal-dep_hydrolase_composite	ENSG00000084774		0.592	CAD-002	NOVEL	basic|exp_conf	protein_coding	CAD	HGNC	protein_coding	OTTHUMT00000324970.1		0.00	19	0	G			27462287	+1			no_errors	ENST00000264705	ensembl	human	known	74_37	missense	11.11	24	3	SNP	1.000	A
CASD1	64921	genome.wustl.edu	37	7	94162522	94162522	+	Silent	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr7:94162522C>A	ENST00000297273.4	+	6	752	c.465C>A	c.(463-465)tcC>tcA	p.S155S		NM_022900.4	NP_075051.4	Q96PB1	CASD1_HUMAN	CAS1 domain containing 1	155						integral component of membrane (GO:0016021)				NS(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	31	all_cancers(62;6.71e-10)|all_epithelial(64;5e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			TTTAGGATTCCATTGCAAAGC	0.313																																																	0													93.0	90.0	91.0					7																	94162522		2203	4297	6500	SO:0001819	synonymous_variant	0			AF355594	CCDS5636.1	7q22	2006-03-09			ENSG00000127995	ENSG00000127995			16014	protein-coding gene	gene with protein product	"""chromosome 7 open reading frame 12"""	611686				11703667, 11528394	Standard	NM_022900		Approved	FLJ21213, FLJ21879, C7orf12	uc003uni.4	Q96PB1	OTTHUMG00000023356	ENST00000297273.4:c.465C>A	7.37:g.94162522C>A			B3KW13|O14574|Q3LIE2|Q6P4R4|Q9H6T9|Q9H770	Silent	SNP	pfam_Cas1_AcylTrans_dom,superfamily_Cyclin-like	p.S155	ENST00000297273.4	37	c.465	CCDS5636.1	7																																																																																			CASD1	-	superfamily_Cyclin-like	ENSG00000127995		0.313	CASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASD1	HGNC	protein_coding	OTTHUMT00000255216.1		0.00	70	0	C	NM_022900		94162522	+1			no_errors	ENST00000297273	ensembl	human	known	74_37	silent	6.45	58	4	SNP	0.994	A
CASP4	837	genome.wustl.edu	37	11	104839336	104839336	+	5'UTR	SNP	C	C	A	rs532512892	byFrequency	TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr11:104839336C>A	ENST00000444739.2	-	0	827				CASP4_ENST00000531333.1_5'UTR	NM_001225.3	NP_001216.1	P49662	CASP4_HUMAN	caspase 4, apoptosis-related cysteine peptidase						apoptotic process (GO:0006915)|execution phase of apoptosis (GO:0097194)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of inflammatory response (GO:0050727)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|IPAF inflammasome complex (GO:0072557)|membrane (GO:0016020)|mitochondrion (GO:0005739)|NLRP3 inflammasome complex (GO:0072559)	cysteine-type endopeptidase activity (GO:0004197)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(1)|skin(1)|urinary_tract(2)	23		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000854)|Epithelial(105;0.00879)|all cancers(92;0.0357)		TTCCTTATTGCAAAGGGCGGA	0.418																																																	0													38.0	33.0	34.0					11																	104839336		692	1591	2283	SO:0001623	5_prime_UTR_variant	0			U25804	CCDS8327.1, CCDS41704.1	11q22.2-q22.3	2006-02-17	2005-08-17		ENSG00000196954	ENSG00000196954		"""Caspases"""	1505	protein-coding gene	gene with protein product		602664	"""caspase 4, apoptosis-related cysteine protease"""			7797510, 9250871	Standard	NM_001225		Approved	ICE(rel)II, ICH-2, TX	uc001pid.1	P49662	OTTHUMG00000166078	ENST00000444739.2:c.-84G>T	11.37:g.104839336C>A			A2NHL8|A2NHM0	RNA	SNP	-	NULL	ENST00000444739.2	37	NULL	CCDS8327.1	11																																																																																			CASP4	-	-	ENSG00000196954		0.418	CASP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASP4	HGNC	protein_coding	OTTHUMT00000387751.1	-	0.00	47	0	C	NM_001225		104839336	-1	tier1	-	no_errors	ENST00000531333	ensembl	human	putative	74_37	rna	7.27	50	4	SNP	0.000	A
CFAP53	220136	genome.wustl.edu	37	18	47788534	47788534	+	Missense_Mutation	SNP	C	C	T	rs373884778		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr18:47788534C>T	ENST00000398545.4	-	2	242	c.125G>A	c.(124-126)cGc>cAc	p.R42H		NM_145020.3	NP_659457.2														endometrium(1)|kidney(4)|large_intestine(6)|lung(6)|ovary(1)|pancreas(1)|skin(1)	20				STAD - Stomach adenocarcinoma(97;2.66e-05)|Colorectal(21;7.57e-05)|Lung(128;0.00932)|READ - Rectum adenocarcinoma(32;0.164)		CTGATGGCTGCGTCGGATTCT	0.438													C|||	1	0.000199681	0.0	0.0	5008	,	,		18855	0.001		0.0	False		,,,				2504	0.0																0													120.0	115.0	117.0					18																	47788534		1924	4129	6053	SO:0001583	missense	0																														ENST00000398545.4:c.125G>A	18.37:g.47788534C>T	ENSP00000381553:p.Arg42His			Missense_Mutation	SNP	NULL	p.R42H	ENST00000398545.4	37	c.125	CCDS11940.2	18	.	.	.	.	.	.	.	.	.	.	C	5.657	0.305928	0.10733	.	.	ENSG00000172361	ENST00000398545	T	0.35048	1.33	4.85	0.0608	0.14337	.	0.138507	0.22268	U	0.062301	T	0.23688	0.0573	L	0.35854	1.095	0.09310	N	1	B	0.13145	0.007	B	0.04013	0.001	T	0.14952	-1.0454	10	0.45353	T	0.12	0.0534	7.1026	0.25346	0.0:0.5065:0.0:0.4935	.	42	Q96M91	CCD11_HUMAN	H	42	ENSP00000381553:R42H	ENSP00000381553:R42H	R	-	2	0	CCDC11	46042532	0.000000	0.05858	0.001000	0.08648	0.167000	0.22549	-1.265000	0.02844	0.079000	0.16929	0.563000	0.77884	CGC	CCDC11	-	NULL	ENSG00000172361		0.438	CCDC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC11	HGNC	protein_coding	OTTHUMT00000255922.3	-	0.00	62	0	C			47788534	-1	tier1	-	no_errors	ENST00000398545	ensembl	human	known	74_37	missense	25.00	27	9	SNP	0.000	T
CCDC129	223075	genome.wustl.edu	37	7	31592728	31592728	+	Silent	SNP	G	G	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr7:31592728G>A	ENST00000407970.3	+	2	128	c.90G>A	c.(88-90)gcG>gcA	p.A30A	CCDC129_ENST00000409210.1_5'Flank|CCDC129_ENST00000482748.1_Intron|CCDC129_ENST00000451887.2_Silent_p.A56A|CCDC129_ENST00000319386.3_Silent_p.A30A	NM_001257967.1|NM_194300.3	NP_001244896.1|NP_919276.2	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	30										cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(31)	44						CCAAAAGCGCGTGGGCTCCGC	0.537																																																	0													87.0	66.0	73.0					7																	31592728		2203	4300	6503	SO:0001819	synonymous_variant	0			AK128026	CCDS5435.2, CCDS59050.1, CCDS75577.1	7p14.3	2006-08-21			ENSG00000180347	ENSG00000180347			27363	protein-coding gene	gene with protein product						14702039	Standard	NM_001257967		Approved	FLJ38344	uc011kad.1	Q6ZRS4	OTTHUMG00000128611	ENST00000407970.3:c.90G>A	7.37:g.31592728G>A			A2RU17|B3KTI9|B4DHB0|B4E2R1|F5H3V5	Silent	SNP	NULL	p.A56	ENST00000407970.3	37	c.168	CCDS5435.2	7																																																																																			CCDC129	-	NULL	ENSG00000180347		0.537	CCDC129-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCDC129	HGNC	protein_coding	OTTHUMT00000318975.1	-	0.00	82	0	G	NM_194300		31592728	+1	tier1	-	no_errors	ENST00000451887	ensembl	human	known	74_37	silent	13.39	110	17	SNP	0.002	A
CCDC141	285025	genome.wustl.edu	37	2	179839848	179839848	+	Silent	SNP	A	A	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:179839848A>G	ENST00000409284.1	-	4	579	c.462T>C	c.(460-462)acT>acC	p.T154T	CCDC141_ENST00000420890.2_Silent_p.T154T			Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	154										NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			CAAACTCATGAGTATTCTGGA	0.333																																																	0																																										SO:0001819	synonymous_variant	0			AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000409284.1:c.462T>C	2.37:g.179839848A>G			H7C0P1|J3KNW6|Q8N8H3	Silent	SNP	pfam_Ig_I-set,pfam_Spectrin_repeat,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.T154	ENST00000409284.1	37	c.462		2																																																																																			CCDC141	-	NULL	ENSG00000163492		0.333	CCDC141-003	PUTATIVE	basic	protein_coding	CCDC141	HGNC	protein_coding	OTTHUMT00000335873.1	-	0.00	66	0	A	NM_173648		179839848	-1	tier1	-	no_errors	ENST00000420890	ensembl	human	known	74_37	silent	6.56	57	4	SNP	0.967	G
CCDC169	728591	genome.wustl.edu	37	13	36801320	36801320	+	3'UTR	SNP	T	T	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr13:36801320T>C	ENST00000503173.1	-	0	773				CCDC169_ENST00000239860.6_3'UTR|CCDC169_ENST00000491049.2_3'UTR|CCDC169_ENST00000379864.2_3'UTR|SOHLH2_ENST00000554962.1_Intron|CCDC169-SOHLH2_ENST00000511166.1_Intron	NM_001198908.1	NP_001185837.1	A6NNP5	CC169_HUMAN	coiled-coil domain containing 169											breast(1)|endometrium(1)	2						gtggtgcacatgtctgagtat	0.488																																																	0													48.0	40.0	42.0					13																	36801320		692	1591	2283	SO:0001624	3_prime_UTR_variant	0				CCDS45027.1, CCDS45028.1, CCDS45029.1, CCDS53863.1, CCDS55897.1	13q13.3	2011-08-09	2011-08-09	2011-08-09	ENSG00000242715	ENSG00000242715			34361	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 38"""	C13orf38			Standard	NM_001144981		Approved	RP11-251J8.1, LOC728591		A6NNP5	OTTHUMG00000016731	ENST00000503173.1:c.*18A>G	13.37:g.36801320T>C			A6NC13|A6NCT2|B7ZW45|B7ZW49|B9EJF2|Q9H1T4|Q9H1T5	RNA	SNP	-	NULL	ENST00000503173.1	37	NULL	CCDS55897.1	13																																																																																			CCDC169	-	-	ENSG00000242715		0.488	CCDC169-012	NOVEL	basic|CCDS	protein_coding	CCDC169	HGNC	protein_coding	OTTHUMT00000368253.1	-	0.00	71	0	T	NM_001144981		36801320	-1	tier1	-	no_errors	ENST00000479850	ensembl	human	known	74_37	rna	10.77	58	7	SNP	0.071	C
CCDC88C	440193	genome.wustl.edu	37	14	91780030	91780030	+	Silent	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr14:91780030G>T	ENST00000389857.6	-	15	2216	c.2130C>A	c.(2128-2130)cgC>cgA	p.R710R		NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	710					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				CCACCAGCCTGCGCAGCTCCA	0.602																																																	0													49.0	51.0	51.0					14																	91780030		2149	4258	6407	SO:0001819	synonymous_variant	0				CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.2130C>A	14.37:g.91780030G>T			Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Silent	SNP	pfam_Hook-related_fam,superfamily_Prefoldin,superfamily_Fum_Rdtase/Succ_DH_flav-like_C	p.R710	ENST00000389857.6	37	c.2130	CCDS45151.1	14																																																																																			CCDC88C	-	NULL	ENSG00000015133		0.602	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC88C	HGNC	protein_coding	OTTHUMT00000411650.1	-	0.00	21	0	G	XM_029353		91780030	-1	tier1	-	no_errors	ENST00000389857	ensembl	human	known	74_37	silent	18.75	13	3	SNP	0.000	T
CD300LF	146722	genome.wustl.edu	37	17	72700795	72700795	+	Silent	SNP	G	G	A	rs144991054		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr17:72700795G>A	ENST00000326165.6	-	2	315	c.204C>T	c.(202-204)acC>acT	p.T68T	CD300LF_ENST00000464910.1_Silent_p.T71T|CD300LF_ENST00000301573.9_Silent_p.T68T|CD300LF_ENST00000343125.4_Silent_p.T71T|CD300LF_ENST00000469092.1_Silent_p.T71T|RAB37_ENST00000402449.4_Intron|RAB37_ENST00000340415.3_Intron|CD300LF_ENST00000581500.1_Silent_p.T71T|CD300LF_ENST00000361254.4_Silent_p.T71T|CD300LF_ENST00000583937.1_Silent_p.T68T	NM_139018.3	NP_620587.2	Q8TDQ1	CLM1_HUMAN	CD300 molecule-like family member f	68	Ig-like V-type.				immune system process (GO:0002376)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|large_intestine(1)|lung(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	12						CTGACCCACTGGTTTTAACAA	0.512																																																	0								G	,	0,4406		0,0,2203	250.0	228.0	236.0		204,	4.5	0.5	17	dbSNP_134	236	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,intron	CD300LF,RAB37	NM_139018.3,NM_175738.4	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	68/291,	72700795	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			BC028199	CCDS11704.1, CCDS74148.1, CCDS74149.1, CCDS74150.1, CCDS74151.1, CCDS74152.1	17q25.2	2013-01-11	2006-03-29		ENSG00000186074	ENSG00000186074		"""Immunoglobulin superfamily / V-set domain containing"""	29883	protein-coding gene	gene with protein product		609807	"""CD300 antigen like family member F"""			12975309	Standard	NM_139018		Approved	IREM1, NKIR, IGSF13, CD300f, CLM1	uc002jlg.3	Q8TDQ1	OTTHUMG00000067609	ENST00000326165.6:c.204C>T	17.37:g.72700795G>A			B2RCL2|C9JDN3|Q3Y6P0|Q6UX24|Q7Z6A6|Q7Z7I4|Q7Z7I5|Q8N6D0|Q8NAF5	Silent	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	p.T68	ENST00000326165.6	37	c.204	CCDS11704.1	17																																																																																			CD300LF	-	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000186074		0.512	CD300LF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD300LF	HGNC	protein_coding	OTTHUMT00000145085.1	-	0.00	101	0	G	NM_139018		72700795	-1	tier1	rs144991054	no_errors	ENST00000326165	ensembl	human	known	74_37	silent	43.75	54	42	SNP	0.814	A
CD97	976	genome.wustl.edu	37	19	14515276	14515276	+	Nonsense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr19:14515276G>T	ENST00000242786.5	+	13	1611	c.1531G>T	c.(1531-1533)Gag>Tag	p.E511*	CD97_ENST00000357355.3_Nonsense_Mutation_p.E462*|CD97_ENST00000358600.3_Nonsense_Mutation_p.E418*|CTC-548K16.5_ENST00000590626.1_RNA	NM_078481.3	NP_510966.1	P48960	CD97_HUMAN	CD97 molecule	511	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						CTGGGCCACCGAGGGCTGCCA	0.632																																																	0													67.0	66.0	66.0					19																	14515276		2203	4300	6503	SO:0001587	stop_gained	0				CCDS32929.1, CCDS32930.1, CCDS32931.1	19p13	2014-08-08	2006-03-28			ENSG00000123146		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	1711	protein-coding gene	gene with protein product	"""leukocyte antigen CD97"", ""seven-span transmembrane protein"", ""seven-transmembrane, heterodimeric receptor associated with inflammation"", ""seven transmembrane helix receptor"""	601211	"""CD97 antigen"""			7636245, 8786105	Standard	NM_078481		Approved	TM7LN1	uc002myl.3	P48960		ENST00000242786.5:c.1531G>T	19.37:g.14515276G>T	ENSP00000242786:p.Glu511*		A8K7Z4|B2RBJ9|O00718|O76101|Q8NG72|Q8TBQ7	Nonsense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_EGF-like_Ca-bd_dom,pfam_GPS_dom,pfam_EG-like_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_CD97,prints_GPCR_2_secretin-like,prints_GPCR_2_EMR1_rcpt	p.E511*	ENST00000242786.5	37	c.1531	CCDS32929.1	19	.	.	.	.	.	.	.	.	.	.	G	21.5	4.152625	0.78001	.	.	ENSG00000123146	ENST00000242786;ENST00000357355;ENST00000358600;ENST00000393059	.	.	.	4.85	-4.41	0.03590	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	.	6.8444	0.23980	0.1948:0.0:0.548:0.2571	.	.	.	.	X	511;462;418;461	.	ENSP00000242786:E511X	E	+	1	0	CD97	14376276	0.000000	0.05858	0.001000	0.08648	0.011000	0.07611	-1.275000	0.02817	-1.160000	0.02804	-0.367000	0.07326	GAG	CD97	-	pfam_GPS_dom,smart_GPS_dom,pfscan_GPS_dom,prints_GPCR_2_EMR1_rcpt	ENSG00000123146		0.632	CD97-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CD97	HGNC	protein_coding	OTTHUMT00000459821.2		0.00	41	0	G	NM_078481		14515276	+1			no_errors	ENST00000242786	ensembl	human	known	74_37	nonsense	5.71	33	2	SNP	0.000	T
CDH12	1010	genome.wustl.edu	37	5	21783579	21783579	+	Silent	SNP	A	A	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr5:21783579A>G	ENST00000382254.1	-	11	2367	c.1281T>C	c.(1279-1281)gaT>gaC	p.D427D	CDH12_ENST00000522262.1_Silent_p.D387D|CDH12_ENST00000521384.1_5'UTR|CDH12_ENST00000504376.2_Silent_p.D427D	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	427	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						AGCTGTCCCCATCACTCTTCC	0.373										HNSCC(59;0.17)																																							0													194.0	188.0	190.0					5																	21783579		2203	4300	6503	SO:0001819	synonymous_variant	0			L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.1281T>C	5.37:g.21783579A>G			B2RBT1|B7Z2U6|Q86UD2	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D427	ENST00000382254.1	37	c.1281	CCDS3890.1	5																																																																																			CDH12	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000154162		0.373	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH12	HGNC	protein_coding	OTTHUMT00000207139.1	-	0.00	76	0	A	NM_004061		21783579	-1	tier1	-	no_errors	ENST00000382254	ensembl	human	known	74_37	silent	25.37	50	17	SNP	1.000	G
CDKL5	6792	genome.wustl.edu	37	X	18668594	18668594	+	Silent	SNP	T	T	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chrX:18668594T>C	ENST00000379989.3	+	21	3147	c.2862T>C	c.(2860-2862)ctT>ctC	p.L954L	CDKL5_ENST00000379996.3_Silent_p.L954L|RS1_ENST00000476595.1_5'UTR|RS1_ENST00000379984.3_Intron	NM_001037343.1	NP_001032420.1	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	954					neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of Rac GTPase activity (GO:0032855)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite development (GO:0050773)	cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic growth cone (GO:0044294)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|skin(5)|stomach(1)	44	Hepatocellular(33;0.183)					ACCGAGCCCTTCATCGTCCAA	0.547																																																	0													159.0	114.0	129.0					X																	18668594		2203	4300	6503	SO:0001819	synonymous_variant	0			Y15057	CCDS14186.1	Xp22	2011-11-04	2002-11-26	2002-11-29	ENSG00000008086	ENSG00000008086		"""Cyclin-dependent kinases"""	11411	protein-coding gene	gene with protein product		300203	"""serine/threonine kinase 9"""	STK9		9721213, 16935860	Standard	XM_005274584		Approved	EIEE2	uc004cym.3	O76039	OTTHUMG00000021214	ENST00000379989.3:c.2862T>C	X.37:g.18668594T>C			G9B9X4|Q14198|Q5H985|Q8IYC7|Q9UJL6	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.L954	ENST00000379989.3	37	c.2862	CCDS14186.1	X																																																																																			CDKL5	-	NULL	ENSG00000008086		0.547	CDKL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDKL5	HGNC	protein_coding	OTTHUMT00000055945.2	-	0.00	144	0	T	NM_003159		18668594	+1	tier1	-	no_errors	ENST00000379989	ensembl	human	known	74_37	silent	52.44	39	43	SNP	0.003	C
CHFR	55743	genome.wustl.edu	37	12	133417504	133417504	+	IGR	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr12:133417504C>A	ENST00000432561.2	-	0	2648				CHFR_ENST00000541341.1_Intron|CHFR_ENST00000537522.1_3'UTR|CHFR_ENST00000541837.2_5'UTR|CHFR_ENST00000266880.7_3'UTR|CHFR_ENST00000315585.7_3'UTR|CHFR_ENST00000450056.2_3'UTR|CHFR_ENST00000443047.2_3'UTR			Q96EP1	CHFR_HUMAN	checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase						mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|modification-dependent protein catabolic process (GO:0019941)|protein polyubiquitination (GO:0000209)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)|PML body (GO:0016605)	ligase activity (GO:0016874)|nucleotide binding (GO:0000166)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.00552)|all_epithelial(31;0.226)		OV - Ovarian serous cystadenocarcinoma(86;2.59e-08)|Epithelial(86;6.38e-07)|all cancers(50;1.56e-05)		TGGAAGGTTTCTTTTTTTAAT	0.413																																																	0																																										SO:0001628	intergenic_variant	0			AK001658	CCDS31937.1, CCDS53847.1, CCDS53848.1, CCDS53849.1	12q24.33	2012-02-23	2012-02-23			ENSG00000072609		"""RING-type (C3HC4) zinc fingers"""	20455	protein-coding gene	gene with protein product		605209	"""checkpoint with forkhead and ring finger domains"""			10935642, 11807090	Standard	NM_001161344		Approved	FLJ10796, RNF196	uc001ulf.2	Q96EP1			12.37:g.133417504C>A			A6NEN5|B4DZ77|B4E2L6|Q96SL3|Q9NRT4|Q9NT32|Q9NVD5	RNA	SNP	-	NULL	ENST00000432561.2	37	NULL	CCDS53849.1	12																																																																																			CHFR	-	-	ENSG00000072609		0.413	CHFR-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	CHFR	HGNC	protein_coding	OTTHUMT00000397130.2	-	0.00	59	0	C			133417504	-1	tier1	-	no_errors	ENST00000541837	ensembl	human	known	74_37	rna	25.00	57	19	SNP	0.000	A
CHRM3	1131	genome.wustl.edu	37	1	240071039	240071039	+	Missense_Mutation	SNP	C	C	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr1:240071039C>G	ENST00000255380.4	+	5	1067	c.288C>G	c.(286-288)aaC>aaG	p.N96K		NM_000740.2	NP_000731.1	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3	96					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|energy reserve metabolic process (GO:0006112)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of insulin secretion (GO:0050796)|regulation of vascular smooth muscle contraction (GO:0003056)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|smooth muscle contraction (GO:0006939)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)|receptor activity (GO:0004872)			breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(19)|ovary(4)|prostate(1)|skin(12)|upper_aerodigestive_tract(1)	51	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Fesoterodine(DB06702)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Isopropamide(DB01625)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methacholine(DB06709)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tramadol(DB00193)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	TTAAGGTCAACAAGCAGCTGA	0.473																																																	0													126.0	103.0	111.0					1																	240071039		2203	4300	6503	SO:0001583	missense	0			U29589	CCDS1616.1	1q43	2012-09-20			ENSG00000133019	ENSG00000133019		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1952	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 3"""	118494					Standard	XM_005273032		Approved		uc001hyp.3	P20309	OTTHUMG00000039649	ENST00000255380.4:c.288C>G	1.37:g.240071039C>G	ENSP00000255380:p.Asn96Lys		Q0VAJ8|Q4QRI3|Q5VXY2|Q9HB60	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Musac_Ach_M3_rcpt,prints_Musac_Ach_rcpt,prints_GPCR_Rhodpsn	p.N96K	ENST00000255380.4	37	c.288	CCDS1616.1	1	.	.	.	.	.	.	.	.	.	.	C	17.56	3.419674	0.62622	.	.	ENSG00000133019	ENST00000255380;ENST00000448020	T;T	0.35973	2.13;1.28	5.9	5.9	0.94986	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.56001	0.1956	L	0.60904	1.88	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.55842	-0.8077	10	0.72032	D	0.01	-35.7685	13.4661	0.61254	0.0:0.9291:0.0:0.0709	.	96	P20309	ACM3_HUMAN	K	96	ENSP00000255380:N96K;ENSP00000404764:N96K	ENSP00000255380:N96K	N	+	3	2	CHRM3	238137662	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	2.627000	0.46469	2.788000	0.95919	0.650000	0.86243	AAC	CHRM3	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Musac_Ach_rcpt	ENSG00000133019		0.473	CHRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRM3	HGNC	protein_coding	OTTHUMT00000095644.2	-	0.00	119	0	C	NM_000740		240071039	+1	tier1	-	no_errors	ENST00000255380	ensembl	human	known	74_37	missense	21.05	60	16	SNP	1.000	G
CIZ1	25792	genome.wustl.edu	37	9	130941243	130941243	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr9:130941243G>T	ENST00000393608.1	-	8	1445	c.1243C>A	c.(1243-1245)Ccc>Acc	p.P415T	CIZ1_ENST00000277465.4_Intron|CIZ1_ENST00000541172.1_Missense_Mutation_p.P314T|CIZ1_ENST00000325721.8_Missense_Mutation_p.P386T|CIZ1_ENST00000372948.3_Intron|CIZ1_ENST00000372954.1_Intron|CIZ1_ENST00000357558.5_Intron|CIZ1_ENST00000476727.2_Intron|CIZ1_ENST00000538431.1_Missense_Mutation_p.P415T|CIZ1_ENST00000372938.5_Missense_Mutation_p.P415T	NM_012127.2	NP_036259.2	Q9ULV3	CIZ1_HUMAN	CDKN1A interacting zinc finger protein 1	415	Gln-rich.				maintenance of protein location in nucleus (GO:0051457)|positive regulation of DNA-dependent DNA replication initiation (GO:0032298)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|liver(1)|lung(9)|ovary(3)|prostate(2)|urinary_tract(2)	35						TGCCTTGGGGGCTGTGAATGT	0.627																																																	0													110.0	99.0	103.0					9																	130941243		2203	4300	6503	SO:0001583	missense	0			AB030835	CCDS6894.1, CCDS48033.1, CCDS48034.1, CCDS75910.1	9q34.1	2012-10-05			ENSG00000148337	ENSG00000148337			16744	protein-coding gene	gene with protein product		611420				10529385	Standard	NM_001131015		Approved	LSFR1, ZNF356	uc011mas.2	Q9ULV3	OTTHUMG00000020735	ENST00000393608.1:c.1243C>A	9.37:g.130941243G>T	ENSP00000377232:p.Pro415Thr		A8K9J8|B4E131|B7ZAS8|Q5SYW3|Q5SYW5|Q8WU72|Q9H868|Q9NYM8|Q9UHK4|Q9Y3F9|Q9Y3G0	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like,pfscan_Znf_C2H2_matrin	p.P415T	ENST00000393608.1	37	c.1243	CCDS6894.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.72|11.72	1.721422|1.721422	0.30503|0.30503	.|.	.|.	ENSG00000148337|ENSG00000148337	ENST00000372941|ENST00000393608;ENST00000538431;ENST00000325721;ENST00000541172;ENST00000372938;ENST00000415526	.|T;T;T;T;T;T	.|0.32272	.|1.52;1.46;1.49;1.91;1.52;2.1	3.94|3.94	3.04|3.04	0.35103|0.35103	.|.	.|0.573473	.|0.14658	.|N	.|0.306111	.|T	.|0.17023	.|0.0409	N|N	0.08118|0.08118	0|0	0.24075|0.24075	N|N	0.995968|0.995968	.|B;P;B;P	.|0.42296	.|0.437;0.775;0.437;0.573	.|B;B;B;B	.|0.42282	.|0.186;0.382;0.134;0.261	.|T	.|0.08006	.|-1.0743	.|9	.|.	.|.	.|.	.|-8.4667	10.1728|10.1728	0.42920|0.42920	0.1002:0.0:0.8998:0.0|0.1002:0.0:0.8998:0.0	.|.	.|415;415;415;386	.|B7Z3U7;F5H2X7;Q9ULV3;Q9ULV3-2	.|.;.;CIZ1_HUMAN;.	.|T	-1|415;415;386;314;415;337	.|ENSP00000377232:P415T;ENSP00000439244:P415T;ENSP00000320374:P386T;ENSP00000445057:P314T;ENSP00000362029:P415T;ENSP00000398011:P337T	.|.	.|P	-|-	.|1	.|0	CIZ1|CIZ1	129981064|129981064	0.582000|0.582000	0.26749|0.26749	0.531000|0.531000	0.27976|0.27976	0.164000|0.164000	0.22412|0.22412	0.103000|0.103000	0.15292|0.15292	1.248000|1.248000	0.43934|0.43934	0.561000|0.561000	0.74099|0.74099	.|CCC	CIZ1	-	NULL	ENSG00000148337		0.627	CIZ1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CIZ1	HGNC	protein_coding	OTTHUMT00000054399.1		0.00	49	0	G	NM_012127		130941243	-1			no_errors	ENST00000538431	ensembl	human	known	74_37	missense	6.45	58	4	SNP	0.976	T
CLCN1	1180	genome.wustl.edu	37	7	143028688	143028688	+	Missense_Mutation	SNP	G	G	T	rs143009041		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr7:143028688G>T	ENST00000343257.2	+	10	1196	c.1109G>T	c.(1108-1110)cGc>cTc	p.R370L		NM_000083.2	NP_000074	P35523	CLCN1_HUMAN	chloride channel, voltage-sensitive 1	370					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|neuronal action potential propagation (GO:0019227)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	adenyl nucleotide binding (GO:0030554)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(4)|central_nervous_system(1)|endometrium(1)|large_intestine(11)|lung(26)|ovary(3)|prostate(2)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	58	Melanoma(164;0.205)					TATCTGCATCGCCAAGTCATG	0.478																																																	0													135.0	120.0	125.0					7																	143028688		2203	4300	6503	SO:0001583	missense	0			Z25884	CCDS5881.1	7q12	2012-09-26	2012-02-23		ENSG00000188037	ENSG00000188037		"""Ion channels / Chloride channels : Voltage-sensitive"""	2019	protein-coding gene	gene with protein product	"""Thomsen disease, autosomal dominant"""	118425	"""chloride channel 1, skeletal muscle"""			1379744	Standard	NM_000083		Approved	CLC1, ClC-1	uc003wcr.1	P35523	OTTHUMG00000152695	ENST00000343257.2:c.1109G>T	7.37:g.143028688G>T	ENSP00000339867:p.Arg370Leu		A4D2H5|Q2M202	Missense_Mutation	SNP	pfam_Cl-channel_volt-gated,pfam_CBS_dom,superfamily_Cl-channel_core,prints_Cl-channel_volt-gated,prints_Cl_channel-1	p.R370L	ENST00000343257.2	37	c.1109	CCDS5881.1	7	.	.	.	.	.	.	.	.	.	.	G	35	5.438327	0.96168	.	.	ENSG00000188037	ENST00000343257	D	0.92099	-2.97	5.12	5.12	0.69794	Chloride channel, core (2);	0.000000	0.85682	D	0.000000	D	0.94683	0.8285	L	0.47016	1.485	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94903	0.8058	10	0.56958	D	0.05	.	18.5517	0.91068	0.0:0.0:1.0:0.0	.	370	P35523	CLCN1_HUMAN	L	370	ENSP00000339867:R370L	ENSP00000339867:R370L	R	+	2	0	CLCN1	142738810	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.243000	0.95416	2.398000	0.81561	0.637000	0.83480	CGC	CLCN1	-	pfam_Cl-channel_volt-gated,superfamily_Cl-channel_core	ENSG00000188037		0.478	CLCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCN1	HGNC	protein_coding	OTTHUMT00000327420.1	-	0.00	69	0	G	NM_000083		143028688	+1	tier1	-	no_errors	ENST00000343257	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	T
CLEC1B	51266	genome.wustl.edu	37	12	10149567	10149567	+	Missense_Mutation	SNP	A	A	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr12:10149567A>G	ENST00000298527.6	-	4	495	c.316T>C	c.(316-318)Tgg>Cgg	p.W106R	CLEC1B_ENST00000348658.4_Missense_Mutation_p.W73R|CLEC1B_ENST00000428126.2_Missense_Mutation_p.W73R	NM_016509.3	NP_057593.3	Q9P126	CLC1B_HUMAN	C-type lectin domain family 1, member B	106					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|platelet formation (GO:0030220)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(12)|stomach(1)|urinary_tract(1)	19						TAATATCTCCAGTTTGTGTCA	0.413																																																	0													152.0	136.0	141.0					12																	10149567		1877	4118	5995	SO:0001583	missense	0			AF124841	CCDS41751.1, CCDS41752.1	12p13.31	2006-04-12				ENSG00000165682		"""C-type lectin domain containing"""	24356	protein-coding gene	gene with protein product		606783				10671229, 11745369	Standard	NM_016509		Approved	CLEC2	uc001qwu.3	Q9P126		ENST00000298527.6:c.316T>C	12.37:g.10149567A>G	ENSP00000298527:p.Trp106Arg		Q6UWX7|Q8NHR6	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.W106R	ENST00000298527.6	37	c.316	CCDS41752.1	12	.	.	.	.	.	.	.	.	.	.	A	15.72	2.918298	0.52546	.	.	ENSG00000165682	ENST00000398937;ENST00000428126;ENST00000298527;ENST00000348658;ENST00000398939	T;T;T;T	0.31247	1.5;1.5;1.5;1.5	4.05	4.05	0.47172	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (1);	0.120124	0.38837	N	0.001545	T	0.57961	0.2089	M	0.88979	2.995	0.34869	D	0.743435	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.72883	-0.4157	10	0.87932	D	0	.	9.2941	0.37804	1.0:0.0:0.0:0.0	.	73;106	Q9P126-2;Q9P126	.;CLC1B_HUMAN	R	13;73;106;73;10	ENSP00000381910:W13R;ENSP00000406338:W73R;ENSP00000298527:W106R;ENSP00000327169:W73R	ENSP00000298527:W106R	W	-	1	0	CLEC1B	10040834	1.000000	0.71417	0.990000	0.47175	0.847000	0.48162	4.135000	0.57997	1.681000	0.50988	0.402000	0.26972	TGG	CLEC1B	-	superfamily_C-type_lectin_fold,smart_C-type_lectin	ENSG00000165682		0.413	CLEC1B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC1B	HGNC	protein_coding	OTTHUMT00000399922.1	-	0.00	101	0	A	NM_016509		10149567	-1	tier1	-	no_errors	ENST00000298527	ensembl	human	known	74_37	missense	34.86	71	38	SNP	0.998	G
CNTN4	152330	genome.wustl.edu	37	3	2777926	2777926	+	Missense_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr3:2777926T>G	ENST00000397461.1	+	4	467	c.83T>G	c.(82-84)tTt>tGt	p.F28C	CNTN4_ENST00000427331.1_Missense_Mutation_p.F28C|CNTN4_ENST00000418658.1_Missense_Mutation_p.F28C	NM_001206955.1	NP_001193884.1	Q8IWV2	CNTN4_HUMAN	contactin 4	28					axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|brain development (GO:0007420)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|neuron cell-cell adhesion (GO:0007158)|neuron projection development (GO:0031175)|regulation of synaptic plasticity (GO:0048167)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(19)|ovary(2)|pancreas(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		GGCCCGATTTTTATTCAAGAA	0.378																																																	0													174.0	165.0	168.0					3																	2777926		1828	4080	5908	SO:0001583	missense	0			AW665944	CCDS2558.1, CCDS43041.1	3p26.3	2013-02-11			ENSG00000144619	ENSG00000144619		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2174	protein-coding gene	gene with protein product		607280				8586965, 12202991	Standard	NM_175607		Approved	BIG-2	uc003bpc.3	Q8IWV2	OTTHUMG00000119031	ENST00000397461.1:c.83T>G	3.37:g.2777926T>G	ENSP00000380602:p.Phe28Cys		B2RAX3|Q8IX14|Q8TC35	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.F28C	ENST00000397461.1	37	c.83	CCDS43041.1	3	.	.	.	.	.	.	.	.	.	.	T	24.6	4.554019	0.86231	.	.	ENSG00000144619	ENST00000422330;ENST00000455083;ENST00000418658;ENST00000397461;ENST00000434053;ENST00000427331	T;T;T;T;T	0.50813	0.73;0.73;0.73;0.73;0.73	6.07	6.07	0.98685	Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.78162	0.4240	H	0.94808	3.585	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.995;0.997	D	0.84499	0.0615	10	0.87932	D	0	.	16.6407	0.85098	0.0:0.0:0.0:1.0	.	28;28	B3KTK4;Q8IWV2	.;CNTN4_HUMAN	C	28;28;28;28;46;28	ENSP00000408594:F28C;ENSP00000396010:F28C;ENSP00000380602:F28C;ENSP00000404085:F46C;ENSP00000413642:F28C	ENSP00000380602:F28C	F	+	2	0	CNTN4	2752926	1.000000	0.71417	0.086000	0.20670	0.976000	0.68499	6.662000	0.74426	2.326000	0.78906	0.533000	0.62120	TTT	CNTN4	-	NULL	ENSG00000144619		0.378	CNTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN4	HGNC	protein_coding	OTTHUMT00000239236.2	-	0.00	131	0	T			2777926	+1	tier1	-	no_errors	ENST00000397461	ensembl	human	known	74_37	missense	20.21	75	19	SNP	0.995	G
CNTN3	5067	genome.wustl.edu	37	3	74414720	74414720	+	Silent	SNP	T	T	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr3:74414720T>C	ENST00000263665.6	-	8	1107	c.1080A>G	c.(1078-1080)ctA>ctG	p.L360L		NM_020872.1	NP_065923.1	Q9P232	CNTN3_HUMAN	contactin 3 (plasmacytoma associated)	360	Ig-like C2-type 4.				cell adhesion (GO:0007155)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(39)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	83		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		ACCTTACCTCTAGCACCAGGG	0.498																																																	0													210.0	205.0	207.0					3																	74414720		2203	4300	6503	SO:0001819	synonymous_variant	0			AB040929	CCDS33790.1	3p12.3	2013-02-11			ENSG00000113805	ENSG00000113805		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2173	protein-coding gene	gene with protein product		601325		PANG		8661054, 8586965	Standard	XM_005264757		Approved	BIG-1	uc003dpm.1	Q9P232	OTTHUMG00000158813	ENST00000263665.6:c.1080A>G	3.37:g.74414720T>C			B9EK50|Q9H039	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.L360	ENST00000263665.6	37	c.1080	CCDS33790.1	3																																																																																			CNTN3	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000113805		0.498	CNTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN3	HGNC	protein_coding	OTTHUMT00000352306.1	-	0.00	90	0	T	NM_020872		74414720	-1	tier1	-	no_errors	ENST00000263665	ensembl	human	known	74_37	silent	20.75	42	11	SNP	0.004	C
COL1A2	1278	genome.wustl.edu	37	7	94049564	94049564	+	Missense_Mutation	SNP	G	G	C	rs72658161|rs72658162		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr7:94049564G>C	ENST00000297268.6	+	35	2570	c.2099G>C	c.(2098-2100)gGt>gCt	p.G700A		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	700			Missing (in OI2). {ECO:0000269|PubMed:1339453}.		blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)		COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	GGGGctgctggtcctgctggt	0.493										HNSCC(75;0.22)																																							0			GRCh37	CM070828	COL1A2	M	rs72658161						123.0	120.0	121.0					7																	94049564		2203	4300	6503	SO:0001583	missense	0			Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.2099G>C	7.37:g.94049564G>C	ENSP00000297268:p.Gly700Ala		P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fib_collagen_C	p.G700A	ENST00000297268.6	37	c.2099	CCDS34682.1	7	.	.	.	.	.	.	.	.	.	.	G	19.91	3.914561	0.72983	.	.	ENSG00000164692	ENST00000297268;ENST00000545487	D	0.99329	-5.75	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	D	0.99667	0.9876	H	0.95917	3.74	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.97859	1.0279	10	0.87932	D	0	.	20.5276	0.99231	0.0:0.0:1.0:0.0	.	700	P08123	CO1A2_HUMAN	A	700;701	ENSP00000297268:G700A	ENSP00000297268:G700A	G	+	2	0	COL1A2	93887500	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	8.891000	0.92485	2.937000	0.99478	0.650000	0.86243	GGT	COL1A2	-	NULL	ENSG00000164692		0.493	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL1A2	HGNC	protein_coding	OTTHUMT00000309045.2	-	0.00	128	0	G	NM_000089		94049564	+1	tier1	-	no_errors	ENST00000297268	ensembl	human	known	74_37	missense	11.58	84	11	SNP	1.000	C
COL6A3	1293	genome.wustl.edu	37	2	238285729	238285729	+	Missense_Mutation	SNP	G	G	A	rs115327470		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:238285729G>A	ENST00000295550.4	-	7	3208	c.2756C>T	c.(2755-2757)gCg>gTg	p.A919V	COL6A3_ENST00000346358.4_Missense_Mutation_p.A719V|COL6A3_ENST00000392003.2_Missense_Mutation_p.A512V|COL6A3_ENST00000353578.4_Missense_Mutation_p.A713V|COL6A3_ENST00000392004.3_Missense_Mutation_p.A713V|COL6A3_ENST00000472056.1_Missense_Mutation_p.A312V|COL6A3_ENST00000409809.1_Missense_Mutation_p.A713V|COL6A3_ENST00000347401.3_Missense_Mutation_p.A718V	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	919	Nonhelical region.|VWFA 5. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		ATAGTCCAGCGCGTAGCCCAG	0.532													G|||	1	0.000199681	0.0	0.0	5008	,	,		22769	0.001		0.0	False		,,,				2504	0.0																0													83.0	72.0	76.0					2																	238285729		2203	4300	6503	SO:0001583	missense	0			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.2756C>T	2.37:g.238285729G>A	ENSP00000295550:p.Ala919Val		A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,smart_VWF_A,smart_Prot_inh_Kunz-m,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.A919V	ENST00000295550.4	37	c.2756	CCDS33412.1	2	.	.	.	.	.	.	.	.	.	.	G	24.7	4.556095	0.86231	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358;ENST00000392004;ENST00000392003	D;D;D;D;D;D;D;D	0.90620	-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7	5.7	5.7	0.88788	von Willebrand factor, type A (3);	0.000000	0.52532	D	0.000065	D	0.96426	0.8834	M	0.90019	3.08	0.58432	D	0.999997	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.978;1.0;0.998;1.0;0.999;0.968	D	0.96293	0.9215	10	0.56958	D	0.05	.	19.8351	0.96655	0.0:0.0:1.0:0.0	.	719;312;512;713;713;919	E9PCV6;E9PFQ6;A8MT30;E9PGQ9;P12111-2;P12111	.;.;.;.;.;CO6A3_HUMAN	V	919;718;713;312;713;719;713;512	ENSP00000295550:A919V;ENSP00000315609:A718V;ENSP00000315873:A713V;ENSP00000418285:A312V;ENSP00000386844:A713V;ENSP00000295546:A719V;ENSP00000375861:A713V;ENSP00000375860:A512V	ENSP00000295550:A919V	A	-	2	0	COL6A3	237950468	1.000000	0.71417	0.603000	0.28903	0.655000	0.38815	9.644000	0.98468	2.687000	0.91594	0.655000	0.94253	GCG	COL6A3	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000163359		0.532	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A3	HGNC	protein_coding	OTTHUMT00000315790.2	-	0.00	57	0	G	NM_004369		238285729	-1	tier1	rs115327470	no_errors	ENST00000295550	ensembl	human	known	74_37	missense	24.00	19	6	SNP	0.960	A
COQ4	51117	genome.wustl.edu	37	9	131094519	131094519	+	Missense_Mutation	SNP	G	G	A	rs200009624		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr9:131094519G>A	ENST00000300452.3	+	5	813	c.490G>A	c.(490-492)Gac>Aac	p.D164N	COQ4_ENST00000461102.1_3'UTR	NM_016035.3	NP_057119			coenzyme Q4											endometrium(4)|large_intestine(1)|lung(4)	9						GGAGGTGCACGACATGCTTCA	0.627																																																	0													118.0	74.0	89.0					9																	131094519		2203	4300	6503	SO:0001583	missense	0			AF151850	CCDS6898.1	9q34.2	2013-10-18	2013-10-18		ENSG00000167113	ENSG00000167113			19693	protein-coding gene	gene with protein product		612898	"""coenzyme Q4 homolog (yeast)"", ""coenzyme Q4 homolog (S. cerevisiae)"""			11469793, 18474229	Standard	NM_016035		Approved	CGI-92	uc004bur.4	Q9Y3A0	OTTHUMG00000020743	ENST00000300452.3:c.490G>A	9.37:g.131094519G>A	ENSP00000300452:p.Asp164Asn			Missense_Mutation	SNP	pfam_Coq4	p.D164N	ENST00000300452.3	37	c.490	CCDS6898.1	9	.	.	.	.	.	.	.	.	.	.	G	36	5.681077	0.96774	.	.	ENSG00000167113	ENST00000300452	T	0.69926	-0.44	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	D	0.87928	0.6301	H	0.95437	3.67	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90900	0.4768	10	0.87932	D	0	-19.2412	18.9583	0.92668	0.0:0.0:1.0:0.0	.	164	Q9Y3A0	COQ4_HUMAN	N	164	ENSP00000300452:D164N	ENSP00000300452:D164N	D	+	1	0	COQ4	130134340	1.000000	0.71417	0.999000	0.59377	0.912000	0.54170	9.209000	0.95087	2.724000	0.93272	0.491000	0.48974	GAC	COQ4	-	pfam_Coq4	ENSG00000167113		0.627	COQ4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COQ4	HGNC	protein_coding	OTTHUMT00000054427.1	-	0.00	63	0	G	NM_016035		131094519	+1	tier1	rs200009624	no_errors	ENST00000300452	ensembl	human	known	74_37	missense	19.44	58	14	SNP	1.000	A
CRB1	23418	genome.wustl.edu	37	1	197390573	197390573	+	Missense_Mutation	SNP	A	A	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr1:197390573A>C	ENST00000367400.3	+	6	1750	c.1615A>C	c.(1615-1617)Agt>Cgt	p.S539R	CRB1_ENST00000538660.1_Missense_Mutation_p.S539R|CRB1_ENST00000535699.1_Missense_Mutation_p.S470R|CRB1_ENST00000367397.1_5'UTR|CRB1_ENST00000543483.1_Missense_Mutation_p.S238R|CRB1_ENST00000544212.1_Missense_Mutation_p.S20R|CRB1_ENST00000367399.2_Missense_Mutation_p.S427R	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	539	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						GGAGCTGCTAAGTGGCTACAT	0.458																																																	0													123.0	122.0	122.0					1																	197390573		2203	4300	6503	SO:0001583	missense	0				CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.1615A>C	1.37:g.197390573A>C	ENSP00000356370:p.Ser539Arg		A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_Laminin_G,pfam_EGF_extracell,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.S539R	ENST00000367400.3	37	c.1615	CCDS1390.1	1	.	.	.	.	.	.	.	.	.	.	A	8.094	0.775094	0.16051	.	.	ENSG00000134376	ENST00000535699;ENST00000538660;ENST00000367400;ENST00000367399;ENST00000543483;ENST00000544212;ENST00000367401	T;T;T;T;T;T	0.79454	-1.27;-1.27;-1.27;-1.27;-1.27;-1.27	5.82	-4.6	0.03390	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	T	0.63838	0.2545	L	0.54323	1.7	0.09310	N	1	P;P;P;B;B	0.39060	0.657;0.478;0.478;0.001;0.381	B;B;B;B;B	0.34873	0.191;0.055;0.122;0.003;0.084	T	0.52786	-0.8529	9	0.20046	T	0.44	.	6.793	0.23709	0.5103:0.1915:0.2981:0.0	.	539;470;427;188;539	B7Z5T2;F5H0L2;P82279-3;P82279-4;P82279	.;.;.;.;CRUM1_HUMAN	R	470;539;539;427;238;20;188	ENSP00000438786:S470R;ENSP00000438091:S539R;ENSP00000356370:S539R;ENSP00000356369:S427R;ENSP00000439579:S238R;ENSP00000444556:S20R	ENSP00000356369:S427R	S	+	1	0	CRB1	195657196	0.001000	0.12720	0.000000	0.03702	0.048000	0.14542	1.168000	0.31859	-1.217000	0.02604	-0.297000	0.09499	AGT	CRB1	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	ENSG00000134376		0.458	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CRB1	HGNC	protein_coding	OTTHUMT00000086565.2	-	0.00	65	0	A	NM_201253		197390573	+1	tier1	-	no_errors	ENST00000367400	ensembl	human	known	74_37	missense	20.90	53	14	SNP	0.000	C
CRMP1	1400	genome.wustl.edu	37	4	5841268	5841268	+	Missense_Mutation	SNP	A	A	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr4:5841268A>C	ENST00000397890.2	-	9	1163	c.949T>G	c.(949-951)Ttg>Gtg	p.L317V	CRMP1_ENST00000324989.7_Missense_Mutation_p.L431V|CRMP1_ENST00000511535.1_5'UTR|CRMP1_ENST00000512574.1_Missense_Mutation_p.L315V	NM_001313.3	NP_001304.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	317					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		AGGGAGGTCAAGTAGTCGGGC	0.642																																																	0													42.0	41.0	42.0					4																	5841268		2202	4299	6501	SO:0001583	missense	0			D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000397890.2:c.949T>G	4.37:g.5841268A>C	ENSP00000380987:p.Leu317Val		A0EJG6|Q13024|Q4W5F1|Q96TC8	Missense_Mutation	SNP	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	p.L431V	ENST00000397890.2	37	c.1291	CCDS43207.1	4	.	.	.	.	.	.	.	.	.	.	A	15.91	2.971555	0.53614	.	.	ENSG00000072832	ENST00000324989;ENST00000397890;ENST00000534845;ENST00000512574	D;D;D	0.96104	-3.91;-3.91;-3.91	3.71	-4.81	0.03180	Amidohydrolase 1 (1);Metal-dependent hydrolase, composite domain (1);	0.000000	0.64402	D	0.000002	D	0.95943	0.8679	M	0.80332	2.49	0.51767	D	0.999937	P;D;D;P	0.63880	0.91;0.993;0.981;0.93	P;P;P;P	0.61800	0.697;0.894;0.894;0.844	D	0.93547	0.6883	10	0.87932	D	0	-16.1967	8.9964	0.36055	0.7249:0.0:0.1568:0.1183	.	431;315;317;254	A0EJG6;E9PD68;Q14194;B3KT07	.;.;DPYL1_HUMAN;.	V	431;317;317;315	ENSP00000321606:L431V;ENSP00000380987:L317V;ENSP00000425742:L315V	ENSP00000321606:L431V	L	-	1	2	CRMP1	5892169	0.993000	0.37304	0.940000	0.37924	0.670000	0.39368	0.155000	0.16362	-1.365000	0.02158	-0.366000	0.07423	TTG	CRMP1	-	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	ENSG00000072832		0.642	CRMP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CRMP1	HGNC	protein_coding	OTTHUMT00000358871.1	-	0.00	193	0	A	NM_001313		5841268	-1	tier1	-	no_errors	ENST00000324989	ensembl	human	known	74_37	missense	52.08	69	75	SNP	0.963	C
CRYM-AS1	400508	genome.wustl.edu	37	16	21328256	21328256	+	lincRNA	SNP	G	G	T	rs374825971		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr16:21328256G>T	ENST00000444326.1	+	0	372							A6NIL9	CRAS1_HUMAN	CRYM antisense RNA 1							integral component of membrane (GO:0016021)		p.R45H(1)									TTGGCAACACGCTCTGTTATT	0.408																																																	1	Substitution - Missense(1)	central_nervous_system(1)											197.0	183.0	187.0					16																	21328256		1870	4117	5987			0					16p12.2	2012-10-12	2012-08-15	2011-08-11	ENSG00000189149	ENSG00000189149		"""Long non-coding RNAs"""	34405	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 169"", ""CRYM antisense RNA 1 (non-protein coding)"""	NCRNA00169			Standard	NR_026675		Approved	FLJ41766	uc010bwr.1	A6NIL9	OTTHUMG00000156701		16.37:g.21328256G>T			B3KVZ2	RNA	SNP	-	NULL	ENST00000444326.1	37	NULL		16																																																																																			CRYM-AS1	-	-	ENSG00000189149		0.408	CRYM-AS1-002	KNOWN	basic	lincRNA	CRYM-AS1	HGNC	lincRNA	OTTHUMT00000345335.1		0.00	53	0	G	NR_026675		21328256	+1			no_errors	ENST00000338573	ensembl	human	known	74_37	rna	5.26	36	2	SNP	0.020	T
CSMD1	64478	genome.wustl.edu	37	8	3565977	3565977	+	Missense_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr8:3565977T>G	ENST00000520002.1	-	7	1523	c.968A>C	c.(967-969)aAg>aCg	p.K323T	CSMD1_ENST00000400186.3_Missense_Mutation_p.K323T|CSMD1_ENST00000542608.1_Missense_Mutation_p.K323T|CSMD1_ENST00000602723.1_Missense_Mutation_p.K323T|CSMD1_ENST00000602557.1_Missense_Mutation_p.K323T|CSMD1_ENST00000539096.1_Missense_Mutation_p.K323T|CSMD1_ENST00000537824.1_Missense_Mutation_p.K323T			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	323						integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GGGCAGCATCTTGACTCCTCT	0.433																																																	0													101.0	100.0	100.0					8																	3565977		1987	4177	6164	SO:0001583	missense	0					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.968A>C	8.37:g.3565977T>G	ENSP00000430733:p.Lys323Thr		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.K323T	ENST00000520002.1	37	c.968		8	.	.	.	.	.	.	.	.	.	.	T	23.9	4.468425	0.84533	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	D;D;D;D;D	0.89123	-2.47;-2.47;-2.47;-2.47;-2.47	5.54	5.54	0.83059	.	.	.	.	.	D	0.91666	0.7366	L	0.55990	1.75	0.37219	D	0.905163	P	0.50528	0.936	P	0.61201	0.885	D	0.92012	0.5619	9	0.33141	T	0.24	.	14.2483	0.66001	0.0:0.0:0.0:1.0	.	323	E5RIG2	.	T	323;323;185;323;323;323	ENSP00000383047:K323T;ENSP00000430733:K323T;ENSP00000441462:K323T;ENSP00000446243:K323T;ENSP00000441675:K323T	ENSP00000320445:K185T	K	-	2	0	CSMD1	3553385	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	6.292000	0.72725	2.087000	0.62958	0.528000	0.53228	AAG	CSMD1	-	NULL	ENSG00000183117		0.433	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	HGNC	protein_coding	OTTHUMT00000374500.2	-	0.00	46	0	T	NM_033225		3565977	-1	tier1	-	no_errors	ENST00000520002	ensembl	human	known	74_37	missense	10.53	51	6	SNP	1.000	G
CSTF2T	23283	genome.wustl.edu	37	10	53458771	53458771	+	Missense_Mutation	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr10:53458771C>A	ENST00000331173.4	-	1	584	c.539G>T	c.(538-540)aGa>aTa	p.R180I	PRKG1_ENST00000401604.2_Intron|PRKG1_ENST00000373985.1_Intron|PRKG1_ENST00000373980.4_Intron	NM_015235.2	NP_056050.1	Q9H0L4	CSTFT_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant	180					mRNA processing (GO:0006397)	intracellular (GO:0005622)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	30				COAD - Colon adenocarcinoma(2;0.00736)|Colorectal(2;0.00898)|all cancers(4;0.0188)|GBM - Glioblastoma multiforme(4;0.0778)|Epithelial(53;0.122)		ATCCATGATTCTCATCACTAC	0.463																																																	0													200.0	180.0	187.0					10																	53458771		2203	4300	6503	SO:0001583	missense	0			AB014589	CCDS7245.1	10q11	2013-02-12			ENSG00000177613	ENSG00000177613		"""RNA binding motif (RRM) containing"""	17086	protein-coding gene	gene with protein product		611968				12408968, 11113135	Standard	NM_015235		Approved	DKFZp434C1013, KIAA0689, CstF-64T	uc001jjp.3	Q9H0L4	OTTHUMG00000018246	ENST00000331173.4:c.539G>T	10.37:g.53458771C>A	ENSP00000332444:p.Arg180Ile		B2RAR9|O75174|Q53HK6|Q7LGE8|Q8N6T1	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.R180I	ENST00000331173.4	37	c.539	CCDS7245.1	10	.	.	.	.	.	.	.	.	.	.	C	21.4	4.136445	0.77662	.	.	ENSG00000177613	ENST00000331173	T	0.25085	1.82	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.56124	0.1964	M	0.86502	2.82	0.80722	D	1	D	0.67145	0.996	D	0.69142	0.962	T	0.62849	-0.6767	10	0.87932	D	0	-15.0556	16.4201	0.83755	0.0:1.0:0.0:0.0	.	180	Q9H0L4	CSTFT_HUMAN	I	180	ENSP00000332444:R180I	ENSP00000332444:R180I	R	-	2	0	CSTF2T	53128777	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.130000	0.77235	2.824000	0.97209	0.655000	0.94253	AGA	CSTF2T	-	NULL	ENSG00000177613		0.463	CSTF2T-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSTF2T	HGNC	protein_coding	OTTHUMT00000048097.1	-	0.00	38	0	C	NM_015235		53458771	-1	tier1	-	no_errors	ENST00000331173	ensembl	human	known	74_37	missense	10.00	26	3	SNP	1.000	A
CUBN	8029	genome.wustl.edu	37	10	16967377	16967377	+	Missense_Mutation	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr10:16967377C>A	ENST00000377833.4	-	43	6574	c.6509G>T	c.(6508-6510)gGa>gTa	p.G2170V		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	2170	CUB 15. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	ACCATTTCCTCCAGGGGGTCC	0.398																																																	0													59.0	61.0	60.0					10																	16967377		2203	4300	6503	SO:0001583	missense	0			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.6509G>T	10.37:g.16967377C>A	ENSP00000367064:p.Gly2170Val		B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	pfam_CUB_dom,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_CUB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_CUB_dom,pfscan_CUB_dom,pfscan_EG-like_dom	p.G2170V	ENST00000377833.4	37	c.6509	CCDS7113.1	10	.	.	.	.	.	.	.	.	.	.	C	15.17	2.755463	0.49362	.	.	ENSG00000107611	ENST00000377833	T	0.28666	1.6	5.02	4.11	0.48088	CUB (5);	0.299519	0.24156	N	0.041039	T	0.48370	0.1496	M	0.73217	2.22	0.80722	D	1	D	0.65815	0.995	D	0.63703	0.917	T	0.39981	-0.9587	10	0.49607	T	0.09	.	9.94	0.41574	0.0:0.7817:0.1417:0.0766	.	2170	O60494	CUBN_HUMAN	V	2170	ENSP00000367064:G2170V	ENSP00000367064:G2170V	G	-	2	0	CUBN	17007383	0.973000	0.33851	0.994000	0.49952	0.754000	0.42855	2.081000	0.41596	2.778000	0.95560	0.655000	0.94253	GGA	CUBN	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000107611		0.398	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUBN	HGNC	protein_coding	OTTHUMT00000047009.1		0.00	115	0	C	NM_001081		16967377	-1			no_errors	ENST00000377833	ensembl	human	known	74_37	missense	5.38	88	5	SNP	0.911	A
CTNNA3	29119	genome.wustl.edu	37	10	69366709	69366709	+	Silent	SNP	A	A	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr10:69366709A>C	ENST00000433211.2	-	3	372	c.198T>G	c.(196-198)acT>acG	p.T66T	CTNNA3_ENST00000373744.4_Silent_p.T66T|CTNNA3_ENST00000545309.1_Silent_p.T66T	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						ATAAATTCCAAGTTGCTTCCT	0.453																																																	0													137.0	136.0	136.0					10																	69366709		2203	4300	6503	SO:0001819	synonymous_variant	0			AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.198T>G	10.37:g.69366709A>C				Silent	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.T66	ENST00000433211.2	37	c.198	CCDS7269.1	10																																																																																			CTNNA3	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin	ENSG00000183230		0.453	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNA3	HGNC	protein_coding	OTTHUMT00000048282.2	-	0.00	93	0	A	NM_013266		69366709	-1	tier1	-	no_errors	ENST00000373744	ensembl	human	known	74_37	silent	15.05	79	14	SNP	0.162	C
CXCL3	2921	genome.wustl.edu	37	4	74902990	74902990	+	Missense_Mutation	SNP	T	T	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr4:74902990T>C	ENST00000296026.4	-	4	390	c.313A>G	c.(313-315)Agc>Ggc	p.S105G	CXCL3_ENST00000511669.1_5'UTR	NM_002090.2	NP_002081.2	P19876	CXCL3_HUMAN	chemokine (C-X-C motif) ligand 3	105					immune response (GO:0006955)|inflammatory response (GO:0006954)|neutrophil chemotaxis (GO:0030593)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)			central_nervous_system(1)|endometrium(1)	2	Breast(15;0.00612)		all cancers(17;0.00273)|Lung(101;0.196)			CAGTTGGTGCTCCCCCTGTGA	0.502																																																	0													166.0	164.0	165.0					4																	74902990		2203	4300	6503	SO:0001583	missense	0			M36821	CCDS34007.1	4q21	2013-02-25	2002-08-22	2002-08-23		ENSG00000163734		"""Endogenous ligands"""	4604	protein-coding gene	gene with protein product		139111	"""GRO3 oncogene"""	GRO3		2217207	Standard	NM_002090		Approved	SCYB3, GROg, MIP-2b, CINC-2b	uc003hhl.3	P19876		ENST00000296026.4:c.313A>G	4.37:g.74902990T>C	ENSP00000296026:p.Ser105Gly		Q4W5H9	Missense_Mutation	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom,prints_Chemokine_CXC	p.S105G	ENST00000296026.4	37	c.313	CCDS34007.1	4	.	.	.	.	.	.	.	.	.	.	T	10.06	1.246419	0.22796	.	.	ENSG00000163734	ENST00000296026	T	0.31247	1.5	3.12	1.95	0.26073	.	1.006340	0.07971	N	0.983996	T	0.32466	0.0830	M	0.74881	2.28	0.09310	N	1	B	0.21309	0.054	B	0.21360	0.034	T	0.35798	-0.9774	10	0.48119	T	0.1	.	4.4724	0.11719	0.0:0.1599:0.0:0.8401	.	105	P19876	CXCL3_HUMAN	G	105	ENSP00000296026:S105G	ENSP00000296026:S105G	S	-	1	0	CXCL3	75121854	0.000000	0.05858	0.040000	0.18447	0.200000	0.23975	0.248000	0.18198	0.606000	0.29965	0.254000	0.18369	AGC	CXCL3	-	NULL	ENSG00000163734		0.502	CXCL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXCL3	HGNC	protein_coding	OTTHUMT00000362721.1		0.00	59	0	T			74902990	-1			no_errors	ENST00000296026	ensembl	human	known	74_37	missense	5.45	52	3	SNP	0.056	C
CXorf67	340602	genome.wustl.edu	37	X	51151007	51151007	+	Missense_Mutation	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chrX:51151007C>A	ENST00000342995.2	+	1	1241	c.1139C>A	c.(1138-1140)gCc>gAc	p.A380D				Q86X51	CX067_HUMAN	chromosome X open reading frame 67	380	Ser-rich.									breast(1)|endometrium(4)|large_intestine(1)|lung(11)|ovary(3)|prostate(1)	21						GAAAGGCTTGCCTTTCAGAGC	0.597																																																	0													64.0	51.0	55.0					X																	51151007		2203	4300	6503	SO:0001583	missense	0			BC046248		Xp11.22	2014-04-30			ENSG00000187690	ENSG00000187690			33738	protein-coding gene	gene with protein product						23959973	Standard	XR_113306		Approved			Q86X51	OTTHUMG00000187481	ENST00000342995.2:c.1139C>A	X.37:g.51151007C>A	ENSP00000342680:p.Ala380Asp			Missense_Mutation	SNP	NULL	p.A380D	ENST00000342995.2	37	c.1139		X	.	.	.	.	.	.	.	.	.	.	c	12.68	2.009397	0.35415	.	.	ENSG00000187690	ENST00000342995	T	0.48522	0.81	3.23	-5.35	0.02697	.	2.877680	0.01893	N	0.038702	T	0.53658	0.1810	.	.	.	0.09310	N	1	D	0.57899	0.981	P	0.50934	0.654	T	0.62927	-0.6750	9	0.56958	D	0.05	-4.0594	13.3684	0.60698	0.0:0.8295:0.0:0.1705	.	380	Q86X51	CX067_HUMAN	D	380	ENSP00000342680:A380D	ENSP00000342680:A380D	A	+	2	0	CXorf67	51167747	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.798000	0.01747	-1.648000	0.01510	-0.347000	0.07816	GCC	CXorf67	-	NULL	ENSG00000187690		0.597	CXorf67-201	KNOWN	basic|appris_principal	protein_coding	CXorf67	HGNC	protein_coding		-	0.00	79	0	C	NM_203407		51151007	+1	tier1	-	no_errors	ENST00000342995	ensembl	human	known	74_37	missense	42.59	31	23	SNP	0.000	A
CYFIP1	23191	genome.wustl.edu	37	15	22946996	22946996	+	Silent	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr15:22946996C>T	ENST00000313077.7	+	13	1394	c.1269C>T	c.(1267-1269)taC>taT	p.Y423Y	CYFIP1_ENST00000560848.1_Silent_p.Y423Y	NM_014608.2	NP_055423.1			cytoplasmic FMR1 interacting protein 1											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(1)|lung(14)|ovary(4)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	40		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		CCGACAAGTACTCCAACAAGG	0.562																																																	0													154.0	131.0	138.0					15																	22946996		2203	4300	6503	SO:0001819	synonymous_variant	0			D38549	CCDS73695.1, CCDS73696.1	15q11	2008-07-18			ENSG00000068793	ENSG00000273749			13759	protein-coding gene	gene with protein product	"""selective hybridizing clone"", ""cytoplasmic FMRP interacting protein 1"""	606322				11438699	Standard	XM_005272543		Approved	KIAA0068, P140SRA-1, SHYC	uc001yus.3	Q7L576	OTTHUMG00000129100	ENST00000313077.7:c.1269C>T	15.37:g.22946996C>T				Silent	SNP	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub,prints_Cytoplasmic_FMR1-int	p.Y423	ENST00000313077.7	37	c.1269	CCDS10009.1	15																																																																																			CYFIP1	-	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub	ENSG00000068793		0.562	CYFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYFIP1	HGNC	protein_coding	OTTHUMT00000251136.2	-	0.00	86	0	C	NM_014608		22946996	+1	tier1	-	no_errors	ENST00000313077	ensembl	human	known	74_37	silent	33.33	38	19	SNP	1.000	T
CYP7B1	9420	genome.wustl.edu	37	8	65509363	65509363	+	Missense_Mutation	SNP	A	A	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr8:65509363A>C	ENST00000310193.3	-	6	1530	c.1357T>G	c.(1357-1359)Ttt>Gtt	p.F453V	CYP7B1_ENST00000523954.1_Intron	NM_004820.3	NP_004811.1	O75881	CP7B1_HUMAN	cytochrome P450, family 7, subfamily B, polypeptide 1	453					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|cholesterol metabolic process (GO:0008203)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|positive regulation of epithelial cell proliferation (GO:0050679)|prostate gland epithelium morphogenesis (GO:0060740)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	25-hydroxycholesterol 7alpha-hydroxylase activity (GO:0033783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxysterol 7-alpha-hydroxylase activity (GO:0008396)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(11)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)				AGTGCAAAAAATCGGCCTGGA	0.353																																																	0													60.0	61.0	61.0					8																	65509363		2203	4299	6502	SO:0001583	missense	0			AF029403	CCDS6180.1	8q21.3	2008-07-04	2003-01-14		ENSG00000172817	ENSG00000172817		"""Cytochrome P450s"""	2652	protein-coding gene	gene with protein product		603711	"""cytochrome P450, subfamily VIIB (oxysterol 7 alpha-hydroxylase), polypeptide 1"", ""spastic paraplegia 5A (autosomal recessive)"""	SPG5A		9802883, 18252231	Standard	NM_004820		Approved		uc003xvj.2	O75881	OTTHUMG00000164387	ENST00000310193.3:c.1357T>G	8.37:g.65509363A>C	ENSP00000310721:p.Phe453Val		B2RN07|Q9UNF5	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I,prints_Cyt_P450	p.F453V	ENST00000310193.3	37	c.1357	CCDS6180.1	8	.	.	.	.	.	.	.	.	.	.	A	17.60	3.431103	0.62844	.	.	ENSG00000172817	ENST00000310193	T	0.67865	-0.29	5.55	4.39	0.52855	.	0.538705	0.22179	N	0.063523	T	0.67524	0.2902	L	0.58510	1.815	0.34138	D	0.66609	P	0.42871	0.792	P	0.46419	0.516	T	0.75271	-0.3376	10	0.44086	T	0.13	-5.1046	11.2938	0.49267	0.9283:0.0:0.0717:0.0	.	453	O75881	CP7B1_HUMAN	V	453	ENSP00000310721:F453V	ENSP00000310721:F453V	F	-	1	0	CYP7B1	65671917	1.000000	0.71417	0.689000	0.30133	0.779000	0.44077	6.271000	0.72569	0.929000	0.37192	0.460000	0.39030	TTT	CYP7B1	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I,prints_Cyt_P450	ENSG00000172817		0.353	CYP7B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP7B1	HGNC	protein_coding	OTTHUMT00000378550.1	-	0.00	152	0	A			65509363	-1	tier1	-	no_errors	ENST00000310193	ensembl	human	known	74_37	missense	35.80	104	58	SNP	0.998	C
DAPK1	1612	genome.wustl.edu	37	9	90220079	90220079	+	Silent	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr9:90220079G>T	ENST00000408954.3	+	3	608	c.273G>T	c.(271-273)ctG>ctT	p.L91L	DAPK1_ENST00000469640.2_Silent_p.L91L|DAPK1_ENST00000358077.5_Silent_p.L91L|DAPK1_ENST00000491893.1_Silent_p.L91L|DAPK1_ENST00000472284.1_Silent_p.L91L	NM_004938.2	NP_004929.2	P53355	DAPK1_HUMAN	death-associated protein kinase 1	91	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72						ACGTCATCCTGATCTTGGAAC	0.617									Chronic Lymphocytic Leukemia, Familial Clustering of																																								0													65.0	64.0	64.0					9																	90220079		2196	4298	6494	SO:0001819	synonymous_variant	0	Familial Cancer Database	Familial CLL	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730		"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831				8530096	Standard	XM_005251757		Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000408954.3:c.273G>T	9.37:g.90220079G>T			B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ankyrin_rpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Death_domain,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Ankyrin_rpt,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_Prot_kinase_dom,prints_Ankyrin_rpt	p.L91	ENST00000408954.3	37	c.273	CCDS43842.1	9																																																																																			DAPK1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000196730		0.617	DAPK1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DAPK1	HGNC	protein_coding	OTTHUMT00000356843.1		0.00	61	0	G	NM_004938		90220079	+1			no_errors	ENST00000469640	ensembl	human	known	74_37	silent	5.41	35	2	SNP	0.859	T
DCLK3	85443	genome.wustl.edu	37	3	36779076	36779076	+	Missense_Mutation	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr3:36779076C>A	ENST00000416516.2	-	2	1565	c.1075G>T	c.(1075-1077)Ggc>Tgc	p.G359C		NM_033403.1	NP_208382.1	Q9C098	DCLK3_HUMAN	doublecortin-like kinase 3	359	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	48						ATGACCCGGCCAGTCTCATAA	0.572																																																	0													83.0	82.0	82.0					3																	36779076		2080	4223	6303	SO:0001583	missense	0			AB051552	CCDS43064.1	3p22.3	2007-04-02	2007-04-02	2007-04-02	ENSG00000163673	ENSG00000163673			19005	protein-coding gene	gene with protein product		613167	"""doublecortin and CaM kinase-like 3"""	DCAMKL3		11214970, 16869982	Standard	NM_033403		Approved	KIAA1765, DCDC3C	uc003cgi.2	Q9C098	OTTHUMG00000155805	ENST00000416516.2:c.1075G>T	3.37:g.36779076C>A	ENSP00000394484:p.Gly359Cys			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.G359C	ENST00000416516.2	37	c.1075	CCDS43064.1	3	.	.	.	.	.	.	.	.	.	.	C	17.63	3.437147	0.62955	.	.	ENSG00000163673	ENST00000416516	T	0.42131	0.98	5.64	5.64	0.86602	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.33438	N	0.004913	T	0.69233	0.3088	M	0.80982	2.52	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.71692	-0.4516	10	0.87932	D	0	.	20.0957	0.97842	0.0:1.0:0.0:0.0	.	359	Q9C098	DCLK3_HUMAN	C	359	ENSP00000394484:G359C	ENSP00000394484:G359C	G	-	1	0	DCLK3	36754080	1.000000	0.71417	0.918000	0.36340	0.077000	0.17291	6.017000	0.70805	2.837000	0.97791	0.655000	0.94253	GGC	DCLK3	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000163673		0.572	DCLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCLK3	HGNC	protein_coding	OTTHUMT00000341727.1	-	0.00	63	0	C	XM_047355		36779076	-1	tier1	-	no_errors	ENST00000416516	ensembl	human	known	74_37	missense	23.08	30	9	SNP	1.000	A
DCBLD2	131566	genome.wustl.edu	37	3	98527011	98527011	+	Silent	SNP	C	C	A	rs34472032		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr3:98527011C>A	ENST00000326840.6	-	13	1946	c.1584G>T	c.(1582-1584)gcG>gcT	p.A528A	DCBLD2_ENST00000326857.9_Silent_p.A528A	NM_080927.3	NP_563615.3	Q96PD2	DCBD2_HUMAN	discoidin, CUB and LCCL domain containing 2	528					cell adhesion (GO:0007155)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of cell growth (GO:0030308)|wound healing (GO:0042060)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)		p.A528A(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|stomach(2)	25						CTGCAGCCAGCGCTACATCTG	0.413																																																	1	Substitution - coding silent(1)	endometrium(1)											79.0	76.0	77.0					3																	98527011		2035	4182	6217	SO:0001819	synonymous_variant	0				CCDS46878.1	3q12.2	2006-04-12			ENSG00000057019	ENSG00000057019			24627	protein-coding gene	gene with protein product		608698				11447234	Standard	NM_080927		Approved	CLCP1, ESDN	uc003dtd.3	Q96PD2	OTTHUMG00000151985	ENST00000326840.6:c.1584G>T	3.37:g.98527011C>A			B7WNL1|D3DN41|Q8N6M4|Q8TDX2	Silent	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_CUB_dom,pfam_LCCL,superfamily_Galactose-bd-like,superfamily_CUB_dom,superfamily_LCCL,smart_CUB_dom,smart_LCCL,smart_Coagulation_fac_5/8-C_type_dom,pfscan_CUB_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_LCCL	p.A528	ENST00000326840.6	37	c.1584	CCDS46878.1	3																																																																																			DCBLD2	-	NULL	ENSG00000057019		0.413	DCBLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCBLD2	HGNC	protein_coding	OTTHUMT00000324675.2		0.00	85	0	C	NM_080927		98527011	-1			no_errors	ENST00000326857	ensembl	human	known	74_37	silent	8.57	32	3	SNP	0.002	A
DCST2	127579	genome.wustl.edu	37	1	155005215	155005215	+	Silent	SNP	G	G	T	rs372382713		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr1:155005215G>T	ENST00000368424.3	-	3	527	c.469C>A	c.(469-471)Cgg>Agg	p.R157R	DCST2_ENST00000295536.5_Silent_p.R157R|DCST1_ENST00000295542.1_5'Flank|DCST1_ENST00000368419.2_5'Flank|DCST1_ENST00000423025.2_5'Flank|DCST1_ENST00000392480.1_5'Flank	NM_144622.2	NP_653223.2	Q5T1A1	DCST2_HUMAN	DC-STAMP domain containing 2	157						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(13)|ovary(3)|prostate(1)|skin(1)	38	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			TTGGTCTTCCGGGCAATAGCT	0.517																																																	0													88.0	83.0	85.0					1																	155005215		2203	4300	6503	SO:0001819	synonymous_variant	0			AK057496	CCDS1082.2	1q22	2008-02-05		2005-08-09	ENSG00000163354	ENSG00000163354			26562	protein-coding gene	gene with protein product							Standard	NM_144622		Approved	FLJ32934	uc001fgm.3	Q5T1A1	OTTHUMG00000037371	ENST00000368424.3:c.469C>A	1.37:g.155005215G>T			Q2M2R2|Q8N810|Q96M03	Silent	SNP	pfam_DC_STAMP-like	p.R157	ENST00000368424.3	37	c.469	CCDS1082.2	1																																																																																			DCST2	-	NULL	ENSG00000163354		0.517	DCST2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DCST2	HGNC	protein_coding	OTTHUMT00000090953.3	-	0.00	67	0	G	NM_144622		155005215	-1	tier1	-	no_errors	ENST00000368424	ensembl	human	known	74_37	silent	5.19	73	4	SNP	0.190	T
DDX11	1663	genome.wustl.edu	37	12	31250907	31250907	+	Silent	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr12:31250907C>A	ENST00000407793.2	+	18	2102	c.1851C>A	c.(1849-1851)gtC>gtA	p.V617V	DDX11_ENST00000545668.1_Silent_p.V617V|DDX11_ENST00000251758.5_3'UTR|DDX11_ENST00000542838.1_Silent_p.V617V|DDX11_ENST00000228264.6_Silent_p.V591V|DDX11_ENST00000539673.1_3'UTR|DDX11_ENST00000350437.4_Silent_p.V617V	NM_030653.3|NM_152438.1	NP_085911.2|NP_689651.1	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11	617					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(11)|large_intestine(5)|lung(23)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	57	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					GGGCAGTGGTCATTGCGGGGG	0.572										Multiple Myeloma(12;0.14)																																							0													58.0	61.0	60.0					12																	31250907		2201	4298	6499	SO:0001819	synonymous_variant	0			U75969	CCDS8721.1, CCDS41767.1, CCDS44856.1, CCDS58224.1	12p11.21	2012-02-23	2012-02-23		ENSG00000013573	ENSG00000013573		"""DEAD-boxes"""	2736	protein-coding gene	gene with protein product	"""CHL1-like helicase homolog (S. cerevisiae)"""	601150	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (S.cerevisiae CHL1-like helicase)"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11"""				Standard	NM_030653		Approved	CHLR1, KRG2, CHL1, ChlR1, WABS	uc001rjv.2	Q96FC9	OTTHUMG00000168435	ENST00000407793.2:c.1851C>A	12.37:g.31250907C>A			Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Silent	SNP	pfam_DEAD_2,superfamily_P-loop_NTPase,smart_Helicase-like_DEXD_c2,smart_ATP-dep_Helicase_C,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3,tigrfam_DNA_helicase_DNA-repair_Rad3	p.V617	ENST00000407793.2	37	c.1851	CCDS44856.1	12																																																																																			DDX11	-	tigrfam_DNA_helicase_DNA-repair_Rad3	ENSG00000013573		0.572	DDX11-202	KNOWN	basic|CCDS	protein_coding	DDX11	HGNC	protein_coding	OTTHUMT00000399728.1	-	0.00	262	0	C	NM_030653		31250907	+1	tier1	-	no_errors	ENST00000407793	ensembl	human	known	74_37	silent	5.26	198	11	SNP	1.000	A
DDX18	8886	genome.wustl.edu	37	2	118572357	118572357	+	Missense_Mutation	SNP	T	T	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:118572357T>C	ENST00000263239.2	+	1	132	c.4T>C	c.(4-6)Tca>Cca	p.S2P		NM_006773.3	NP_006764.3	Q9NVP1	DDX18_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 18	2					ATP catabolic process (GO:0006200)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(4)|large_intestine(3)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						GGGCAGAATGTCACACCTGCC	0.547											OREG0014916	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													80.0	71.0	74.0					2																	118572357		2203	4300	6503	SO:0001583	missense	0			X98743	CCDS2120.1	2q21.2	2008-02-05	2003-06-13		ENSG00000088205	ENSG00000088205		"""DEAD-boxes"""	2741	protein-coding gene	gene with protein product		606355	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 18 (Myc-regulated)"""			8861962	Standard	NM_006773		Approved	MrDb	uc002tlh.1	Q9NVP1	OTTHUMG00000058521	ENST00000263239.2:c.4T>C	2.37:g.118572357T>C	ENSP00000263239:p.Ser2Pro	1489	Q6GTZ9|Q6IAU4|Q92732|Q9BQB7	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.S2P	ENST00000263239.2	37	c.4	CCDS2120.1	2	.	.	.	.	.	.	.	.	.	.	T	12.48	1.951154	0.34471	.	.	ENSG00000088205	ENST00000263239	T	0.02236	4.38	4.61	4.61	0.57282	.	1.324760	0.05335	N	0.528955	T	0.04048	0.0113	M	0.62723	1.935	0.27589	N	0.949337	P	0.42123	0.771	B	0.37943	0.261	T	0.39542	-0.9609	10	0.66056	D	0.02	-15.1881	5.4596	0.16610	0.1716:0.0:0.1787:0.6497	.	2	Q9NVP1	DDX18_HUMAN	P	2	ENSP00000263239:S2P	ENSP00000263239:S2P	S	+	1	0	DDX18	118288827	1.000000	0.71417	1.000000	0.80357	0.376000	0.30014	0.851000	0.27751	1.930000	0.55929	0.533000	0.62120	TCA	DDX18	-	NULL	ENSG00000088205		0.547	DDX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX18	HGNC	protein_coding	OTTHUMT00000129632.3	-	0.00	81	0	T	NM_006773		118572357	+1	tier1	-	no_errors	ENST00000263239	ensembl	human	known	74_37	missense	17.54	47	10	SNP	0.999	C
DDX18	8886	genome.wustl.edu	37	2	118578815	118578816	+	Frame_Shift_Del	DEL	GT	GT	-	rs376178789		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	GT	GT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:118578815_118578816delGT	ENST00000263239.2	+	4	721_722	c.593_594delGT	c.(592-594)ggtfs	p.G198fs	DDX18_ENST00000474694.1_3'UTR	NM_006773.3	NP_006764.3	Q9NVP1	DDX18_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 18	198					ATP catabolic process (GO:0006200)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(4)|large_intestine(3)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						AAAGAAATGGGTTTTACAAACA	0.337																																																	0																																										SO:0001589	frameshift_variant	0			X98743	CCDS2120.1	2q21.2	2008-02-05	2003-06-13		ENSG00000088205	ENSG00000088205		"""DEAD-boxes"""	2741	protein-coding gene	gene with protein product		606355	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 18 (Myc-regulated)"""			8861962	Standard	NM_006773		Approved	MrDb	uc002tlh.1	Q9NVP1	OTTHUMG00000058521	ENST00000263239.2:c.593_594delGT	2.37:g.118578815_118578816delGT	ENSP00000263239:p.Gly198fs		Q6GTZ9|Q6IAU4|Q92732|Q9BQB7	Frame_Shift_Del	DEL	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.G198fs	ENST00000263239.2	37	c.593_594	CCDS2120.1	2																																																																																			DDX18	-	smart_Helicase_ATP-bd	ENSG00000088205		0.337	DDX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX18	HGNC	protein_coding	OTTHUMT00000129632.3		0.00	72	0	GT	NM_006773		118578816	+1	tier1		no_errors	ENST00000263239	ensembl	human	known	74_37	frame_shift_del	27.40	53	20	DEL	1.000:1.000	-
DENND1A	57706	genome.wustl.edu	37	9	126433582	126433582	+	Silent	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr9:126433582G>T	ENST00000373624.2	-	7	642	c.441C>A	c.(439-441)gtC>gtA	p.V147V	DENND1A_ENST00000473039.1_5'UTR|DENND1A_ENST00000373618.1_Silent_p.V115V|DENND1A_ENST00000394219.3_Silent_p.V115V|DENND1A_ENST00000394215.2_Silent_p.V117V|DENND1A_ENST00000373620.3_Silent_p.V147V	NM_020946.1	NP_065997.1	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A	147	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|regulation of Rab protein signal transduction (GO:0032483)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|liver(2)|lung(18)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43						CGCTGAGATGGACAGACACTC	0.433																																																	0													256.0	247.0	250.0					9																	126433582		2203	4300	6503	SO:0001819	synonymous_variant	0			AB046828	CCDS35133.1, CCDS35134.1	9q34.11	2012-10-03	2005-08-17	2005-08-17	ENSG00000119522	ENSG00000119522		"""DENN/MADD domain containing"""	29324	protein-coding gene	gene with protein product		613633	"""KIAA1608"""	KIAA1608		10997877	Standard	XM_005252109		Approved	FLJ21129, FAM31A	uc004bnz.1	Q8TEH3	OTTHUMG00000020643	ENST00000373624.2:c.441C>A	9.37:g.126433582G>T			A8MZA3|B1AM80|B7Z3C8|B7Z669|D3PFD3|Q05C88|Q5VWF0|Q6PJZ5|Q8IVD6|Q9H796	Silent	SNP	pfam_DENN_dom,pfam_dDENN_dom,pfam_uDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.V115	ENST00000373624.2	37	c.345	CCDS35133.1	9																																																																																			DENND1A	-	pfam_DENN_dom,smart_DENN_dom,pfscan_DENN_dom	ENSG00000119522		0.433	DENND1A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DENND1A	HGNC	protein_coding	OTTHUMT00000053997.1	-	0.00	78	0	G	NM_024820		126433582	-1	tier1	-	no_errors	ENST00000394219	ensembl	human	known	74_37	silent	5.63	67	4	SNP	1.000	T
DGKI	9162	genome.wustl.edu	37	7	137128842	137128842	+	Silent	SNP	T	T	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr7:137128842T>C	ENST00000288490.5	-	29	2766	c.2766A>G	c.(2764-2766)ccA>ccG	p.P922P	DGKI_ENST00000453654.2_Silent_p.P591P|DGKI_ENST00000424189.2_Silent_p.P935P|DGKI_ENST00000446122.1_Silent_p.P904P|DGKI_ENST00000494390.1_5'UTR	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	922					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						CTGAAGAGACTGGTGACCTAA	0.299																																																	0													56.0	54.0	55.0					7																	137128842		2201	4300	6501	SO:0001819	synonymous_variant	0			AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.2766A>G	7.37:g.137128842T>C			A4D1Q9|Q9NZ49	Silent	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.P922	ENST00000288490.5	37	c.2766	CCDS5845.1	7																																																																																			DGKI	-	NULL	ENSG00000157680		0.299	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKI	HGNC	protein_coding	OTTHUMT00000341286.3	-	0.00	205	0	T	NM_004717		137128842	-1	tier1	-	no_errors	ENST00000288490	ensembl	human	known	74_37	silent	19.67	145	36	SNP	1.000	C
DGKK	139189	genome.wustl.edu	37	X	50213279	50213279	+	RNA	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chrX:50213279C>T	ENST00000376025.2	-	0	458							Q5KSL6	DGKK_HUMAN	diacylglycerol kinase, kappa						blood coagulation (GO:0007596)|diacylglycerol metabolic process (GO:0046339)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			central_nervous_system(1)|endometrium(12)|kidney(4)|large_intestine(5)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Ovarian(276;0.236)					gctctgggaccgactctaggg	0.677																																																	0													38.0	44.0	42.0					X																	50213279		1851	4077	5928			0			AB183864	CCDS75980.1	Xp11.22	2006-02-08				ENSG00000274588			32395	protein-coding gene	gene with protein product		300837				16210324	Standard	NM_001013742		Approved		uc010njr.2	Q5KSL6			X.37:g.50213279C>T			B2RP91	RNA	SNP	-	NULL	ENST00000376025.2	37	NULL		X																																																																																			DGKK	-	-	ENSG00000204466		0.677	DGKK-001	KNOWN	basic	processed_transcript	DGKK	HGNC	processed_transcript	OTTHUMT00000368187.1	-	0.00	120	0	C	NM_001013742		50213279	-1	tier1	-	no_errors	ENST00000376025	ensembl	human	known	74_37	rna	56.06	29	37	SNP	0.002	T
DHX33	56919	genome.wustl.edu	37	17	5352186	5352186	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr17:5352186G>T	ENST00000225296.3	-	11	1958	c.1758C>A	c.(1756-1758)agC>agA	p.S586R	DHX33_ENST00000433302.3_Missense_Mutation_p.S362R	NM_001199699.1|NM_020162.3	NP_001186628.1|NP_064547.2	Q9H6R0	DHX33_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 33	586					positive regulation of transcription from RNA polymerase I promoter (GO:0045943)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|rDNA binding (GO:0000182)			breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						TCATATTCTTGCTGTTGACAA	0.448																																																	0													141.0	116.0	125.0					17																	5352186		2203	4300	6503	SO:0001583	missense	0			AL359945	CCDS11072.1	17p13	2003-06-13	2003-06-13	2003-06-13	ENSG00000005100	ENSG00000005100		"""DEAH-boxes"""	16718	protein-coding gene	gene with protein product		614405	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 33"""	DDX33			Standard	NM_020162		Approved	FLJ21972, DKFZp762F2011	uc002gca.3	Q9H6R0	OTTHUMG00000102041	ENST00000225296.3:c.1758C>A	17.37:g.5352186G>T	ENSP00000225296:p.Ser586Arg		B4DHF9|Q4G149|Q5CZ73|Q9H5M9	Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_DUF1605,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.S586R	ENST00000225296.3	37	c.1758	CCDS11072.1	17	.	.	.	.	.	.	.	.	.	.	G	12.89	2.072548	0.36566	.	.	ENSG00000005100	ENST00000225296;ENST00000433302	T;T	0.03301	3.98;3.98	5.18	4.21	0.49690	.	0.080268	0.85682	D	0.000000	T	0.07908	0.0198	M	0.79258	2.445	0.54753	D	0.999981	P;B	0.49559	0.925;0.024	P;B	0.46172	0.506;0.025	T	0.27400	-1.0075	10	0.27785	T	0.31	.	9.1356	0.36872	0.1632:0.0:0.8368:0.0	.	362;586	Q05BE5;Q9H6R0	.;DHX33_HUMAN	R	586;362	ENSP00000225296:S586R;ENSP00000413779:S362R	ENSP00000225296:S586R	S	-	3	2	DHX33	5292910	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	6.117000	0.71577	1.430000	0.47334	0.563000	0.77884	AGC	DHX33	-	superfamily_P-loop_NTPase	ENSG00000005100		0.448	DHX33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX33	HGNC	protein_coding	OTTHUMT00000219826.2	-	0.00	41	0	G	NM_020162		5352186	-1	tier1	-	no_errors	ENST00000225296	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	T
DLG2	1740	genome.wustl.edu	37	11	83544658	83544658	+	Splice_Site	SNP	G	G	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr11:83544658G>A	ENST00000532653.1	-	12	1708	c.1406C>T	c.(1405-1407)tCg>tTg	p.S469L	DLG2_ENST00000376104.2_Splice_Site_p.S574L|DLG2_ENST00000376106.3_5'UTR|DLG2_ENST00000543673.1_Splice_Site_p.S574L|DLG2_ENST00000398309.2_Splice_Site_p.S469L|DLG2_ENST00000280241.8_Splice_Site_p.S508L|DLG2_ENST00000524982.1_Splice_Site_p.S469L|DLG2_ENST00000531015.1_Splice_Site_p.S436L|DLG2_ENST00000418306.2_Splice_Site_p.S366L|DLG2_ENST00000398301.2_Splice_Site_p.S508L|DLG2_ENST00000330014.6_Splice_Site_p.S408L|DLG2_ENST00000537455.1_Splice_Site_p.S223L			Q14168	MPP2_HUMAN	discs, large homolog 2 (Drosophila)	211	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(11)|lung(35)|ovary(3)|pancreas(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	71		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				CATACTCACCGATAGGATCTG	0.428																																																	0													102.0	109.0	107.0					11																	83544658		2106	4248	6354	SO:0001630	splice_region_variant	0			U32376	CCDS41696.1, CCDS44690.1, CCDS44691.1, CCDS44692.1, CCDS55782.1, CCDS73357.1	11q21	2012-04-17	2008-12-15		ENSG00000150672	ENSG00000150672		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	2901	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 58"""	603583	"""discs, large homolog 2, chapsyn-110 (Drosophila)"""			8755482, 9806853	Standard	NM_001142702		Approved	PSD-93, PSD93, chapsyn-110, PPP1R58	uc001pak.2	Q15700	OTTHUMG00000134309	ENST00000532653.1:c.1407+1C>T	11.37:g.83544658G>A			B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Missense_Mutation	SNP	pfam_PDZ,pfam_GK/Ca_channel_bsu,pfam_MAGUK_PEST_N,pfam_PDZ_assoc,pfam_L27_1,pfam_SH3_2,pfam_SH3_domain,superfamily_P-loop_NTPase,superfamily_SH3_domain,superfamily_PDZ,smart_PDZ,smart_SH3_domain,smart_GK/Ca_channel_bsu,pirsf_M-assoc_guanylate_kinase,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin-like	p.S574L	ENST00000532653.1	37	c.1721		11	.	.	.	.	.	.	.	.	.	.	G	32	5.117763	0.94385	.	.	ENSG00000150672	ENST00000398309;ENST00000376104;ENST00000418306;ENST00000543673;ENST00000280241;ENST00000330014;ENST00000537455;ENST00000524982;ENST00000532653;ENST00000546021;ENST00000531015;ENST00000398301	T;T;T;T;T;T;T;T;T;T;T	0.52754	0.65;0.65;0.65;0.65;0.65;0.65;0.65;0.65;0.65;0.65;0.65	5.25	5.25	0.73442	PDZ/DHR/GLGF (4);	0.000000	0.64402	D	0.000014	T	0.67353	0.2884	M	0.65320	2	0.80722	D	1	D;D;D;P;D;D;D;D	0.89917	1.0;1.0;1.0;0.954;1.0;1.0;0.999;1.0	D;D;D;P;D;D;D;D	0.91635	0.999;0.984;0.979;0.701;0.995;0.996;0.952;0.999	T	0.66204	-0.5982	9	.	.	.	.	18.8476	0.92213	0.0:0.0:1.0:0.0	.	436;469;469;408;508;574;469;366	E9PIW2;B7Z2T4;E9PN83;B7Z264;Q6ZSU2;Q15700-2;Q15700;Q15700-3	.;.;.;.;.;.;DLG2_HUMAN;.	L	469;574;366;574;508;408;223;469;469;574;436;508	ENSP00000381355:S469L;ENSP00000365272:S574L;ENSP00000402275:S366L;ENSP00000441994:S574L;ENSP00000280241:S508L;ENSP00000381353:S408L;ENSP00000443248:S223L;ENSP00000432894:S469L;ENSP00000435849:S469L;ENSP00000433848:S436L;ENSP00000381346:S508L	.	S	-	2	0	DLG2	83222306	1.000000	0.71417	0.977000	0.42913	0.995000	0.86356	9.444000	0.97578	2.462000	0.83206	0.650000	0.86243	TCG	DLG2	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pirsf_M-assoc_guanylate_kinase,pfscan_PDZ	ENSG00000150672		0.428	DLG2-009	NOVEL	basic|appris_candidate	protein_coding	DLG2	HGNC	protein_coding	OTTHUMT00000259253.2	-	0.00	48	0	G	NM_001364	Missense_Mutation	83544658	-1	tier1	-	no_errors	ENST00000376104	ensembl	human	known	74_37	missense	41.86	25	18	SNP	1.000	A
DNAH11	8701	genome.wustl.edu	37	7	21818598	21818598	+	Missense_Mutation	SNP	T	T	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr7:21818598T>C	ENST00000409508.3	+	57	9390	c.9359T>C	c.(9358-9360)cTt>cCt	p.L3120P	DNAH11_ENST00000328843.6_Missense_Mutation_p.L3127P	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	3127	Stalk. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						AAAGCCAGACTTGCCTCTCAA	0.468									Kartagener syndrome																																								0													81.0	79.0	80.0					7																	21818598		1918	4123	6041	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.9359T>C	7.37:g.21818598T>C	ENSP00000475939:p.Leu3120Pro		Q9UJ82	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.L3127P	ENST00000409508.3	37	c.9380		7	.	.	.	.	.	.	.	.	.	.	T	20.7	4.035715	0.75617	.	.	ENSG00000105877	ENST00000328843	D	0.81908	-1.55	6.03	6.03	0.97812	Dynein heavy chain, coiled coil stalk (1);	0.000000	0.85682	D	0.000000	D	0.91513	0.7320	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92446	0.5966	9	0.87932	D	0	.	16.5582	0.84512	0.0:0.0:0.0:1.0	.	3127	Q96DT5	DYH11_HUMAN	P	3127	ENSP00000330671:L3127P	ENSP00000330671:L3127P	L	+	2	0	DNAH11	21785123	1.000000	0.71417	0.876000	0.34364	0.920000	0.55202	7.698000	0.84413	2.308000	0.77769	0.533000	0.62120	CTT	DNAH11	-	NULL	ENSG00000105877		0.468	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	DNAH11	HGNC	protein_coding	OTTHUMT00000326582.6	-	0.00	77	0	T	NM_003777		21818598	+1	tier1	-	no_errors	ENST00000328843	ensembl	human	known	74_37	missense	16.33	82	16	SNP	0.999	C
DNAH14	127602	genome.wustl.edu	37	1	225576094	225576094	+	Missense_Mutation	SNP	G	G	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr1:225576094G>C	ENST00000445597.2	+	57	9761	c.9761G>C	c.(9760-9762)aGa>aCa	p.R3254T	DNAH14_ENST00000430092.1_Missense_Mutation_p.R4262T|DNAH14_ENST00000439375.2_Missense_Mutation_p.R4262T			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	3254					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						CACGCCTACAGATCTTGTAAG	0.413																																																	0													177.0	137.0	149.0					1																	225576094		692	1591	2283	SO:0001583	missense	0			U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.9761G>C	1.37:g.225576094G>C	ENSP00000409472:p.Arg3254Thr		A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase,superfamily_Tautomerase/MIF_sf,smart_AAA+_ATPase	p.R4262T	ENST00000445597.2	37	c.12785		1	.	.	.	.	.	.	.	.	.	.	G	10.75	1.437347	0.25900	.	.	ENSG00000185842	ENST00000445597;ENST00000430092;ENST00000439375	T;T;T	0.08102	3.13;3.13;3.13	4.8	-0.384	0.12474	.	.	.	.	.	T	0.04272	0.0118	N	0.14661	0.345	0.37684	D	0.923584	B	0.25169	0.119	B	0.21917	0.037	T	0.35724	-0.9777	9	0.62326	D	0.03	.	4.4997	0.11858	0.62:0.0:0.2457:0.1343	.	4262	Q0VDD8-4	.	T	3254;4262;4262	ENSP00000409472:R3254T;ENSP00000414402:R4262T;ENSP00000392061:R4262T	ENSP00000414402:R4262T	R	+	2	0	DNAH14	223642717	0.010000	0.17322	0.822000	0.32727	0.560000	0.35617	-0.418000	0.07080	-0.054000	0.13266	-0.719000	0.03609	AGA	DNAH14	-	pfam_Dynein_heavy_dom	ENSG00000185842		0.413	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	DNAH14	HGNC	protein_coding	OTTHUMT00000331217.3	-	0.00	67	0	G	XM_059166		225576094	+1	tier1	-	no_errors	ENST00000430092	ensembl	human	known	74_37	missense	21.43	55	15	SNP	0.665	C
DOCK1	1793	genome.wustl.edu	37	10	129242502	129242502	+	Missense_Mutation	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr10:129242502C>A	ENST00000280333.6	+	50	5418	c.5309C>A	c.(5308-5310)cCa>cAa	p.P1770Q		NM_001380.3	NP_001371.1	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	1770					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|hematopoietic progenitor cell differentiation (GO:0002244)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|phagocytosis, engulfment (GO:0006911)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			NS(2)|breast(1)|central_nervous_system(7)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(10)|lung(15)|ovary(4)|prostate(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	72		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		ACACCCCCTCCAGTTACACCA	0.587																																																	0													83.0	95.0	91.0					10																	129242502		2092	4211	6303	SO:0001583	missense	0			D50857	CCDS73222.1	10q26.13-q26.3	2009-10-28			ENSG00000150760	ENSG00000150760			2987	protein-coding gene	gene with protein product	"""DOwnstream of CrK"""	601403	"""dedicator of cyto-kinesis 1"""			8657152, 8661160	Standard	XM_006717681		Approved	DOCK180, ced5	uc001ljt.3	Q14185	OTTHUMG00000019249	ENST00000280333.6:c.5309C>A	10.37:g.129242502C>A	ENSP00000280333:p.Pro1770Gln		A9Z1Z5	Missense_Mutation	SNP	pfam_DOCK_C,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_ARM-type_fold,superfamily_Cyt_c-like_dom,smart_SH3_domain,pfscan_SH3_domain	p.P1770Q	ENST00000280333.6	37	c.5309		10	.	.	.	.	.	.	.	.	.	.	C	17.36	3.370862	0.61624	.	.	ENSG00000150760	ENST00000280333	T	0.04406	3.63	4.72	4.72	0.59763	.	0.000000	0.85682	D	0.000000	T	0.19446	0.0467	M	0.63843	1.955	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.78314	0.991;0.991	T	0.00333	-1.1810	10	0.49607	T	0.09	.	17.8963	0.88890	0.0:1.0:0.0:0.0	.	1770;1770	B2RUU3;Q14185	.;DOCK1_HUMAN	Q	1770	ENSP00000280333:P1770Q	ENSP00000280333:P1770Q	P	+	2	0	DOCK1	129132492	1.000000	0.71417	0.936000	0.37596	0.216000	0.24613	7.048000	0.76606	2.456000	0.83038	0.655000	0.94253	CCA	DOCK1	-	NULL	ENSG00000150760		0.587	DOCK1-001	KNOWN	basic|appris_principal	protein_coding	DOCK1	HGNC	protein_coding	OTTHUMT00000050979.2	-	0.00	56	0	C	NM_001380		129242502	+1	tier1	-	no_errors	ENST00000280333	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	A
DOPEY1	23033	genome.wustl.edu	37	6	83839955	83839955	+	Nonsense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr6:83839955G>T	ENST00000349129.2	+	17	2715	c.2455G>T	c.(2455-2457)Gga>Tga	p.G819*	DOPEY1_ENST00000237163.5_Nonsense_Mutation_p.G800*|DOPEY1_ENST00000369739.3_Nonsense_Mutation_p.G810*	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	819					protein transport (GO:0015031)					breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		GGACCTGGTGGGACTGACACA	0.498																																																	0													143.0	133.0	136.0					6																	83839955		2203	4300	6503	SO:0001587	stop_gained	0			AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.2455G>T	6.37:g.83839955G>T	ENSP00000195654:p.Gly819*		Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Nonsense_Mutation	SNP	pfam_Dopey_N,superfamily_ARM-type_fold	p.G819*	ENST00000349129.2	37	c.2455	CCDS4996.1	6	.	.	.	.	.	.	.	.	.	.	G	44	10.881976	0.99483	.	.	ENSG00000083097	ENST00000349129;ENST00000237163;ENST00000369739	.	.	.	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	19.8745	0.96864	0.0:0.0:1.0:0.0	.	.	.	.	X	819;800;800	.	ENSP00000237163:G800X	G	+	1	0	DOPEY1	83896674	1.000000	0.71417	0.985000	0.45067	0.937000	0.57800	9.476000	0.97823	2.704000	0.92352	0.467000	0.42956	GGA	DOPEY1	-	superfamily_ARM-type_fold	ENSG00000083097		0.498	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DOPEY1	HGNC	protein_coding	OTTHUMT00000043785.2	-	0.00	86	0	G	NM_015018		83839955	+1	tier1	-	no_errors	ENST00000349129	ensembl	human	known	74_37	nonsense	6.58	71	5	SNP	1.000	T
DPYS	1807	genome.wustl.edu	37	8	105405184	105405184	+	Missense_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr8:105405184T>G	ENST00000351513.2	-	8	1403	c.1271A>C	c.(1270-1272)aAc>aCc	p.N424T	DPYS_ENST00000521601.1_Intron	NM_001385.2	NP_001376.1	Q14117	DPYS_HUMAN	dihydropyrimidinase	424					beta-alanine metabolic process (GO:0019482)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein homotetramerization (GO:0051289)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymine catabolic process (GO:0006210)|uracil catabolic process (GO:0006212)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|dihydropyrimidinase activity (GO:0004157)|thymine binding (GO:0002059)|uracil binding (GO:0002058)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			AATGTTGAAGTTAACAGCCTG	0.413																																																	0													90.0	95.0	94.0					8																	105405184		2203	4300	6503	SO:0001583	missense	0			D78011	CCDS6302.1	8q22	2004-01-22			ENSG00000147647	ENSG00000147647			3013	protein-coding gene	gene with protein product		613326				8973361	Standard	NM_001385		Approved	DHPase	uc003yly.4	Q14117	OTTHUMG00000164891	ENST00000351513.2:c.1271A>C	8.37:g.105405184T>G	ENSP00000276651:p.Asn424Thr			Missense_Mutation	SNP	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	p.N424T	ENST00000351513.2	37	c.1271	CCDS6302.1	8	.	.	.	.	.	.	.	.	.	.	T	17.93	3.510072	0.64522	.	.	ENSG00000147647	ENST00000351513	T	0.74002	-0.8	6.02	6.02	0.97574	Metal-dependent hydrolase, composite domain (1);	0.146145	0.64402	D	0.000010	T	0.65709	0.2717	N	0.22421	0.69	0.53005	D	0.999968	B	0.16603	0.018	B	0.23275	0.045	T	0.62918	-0.6752	10	0.87932	D	0	-28.9534	16.5494	0.84464	0.0:0.0:0.0:1.0	.	424	Q14117	DPYS_HUMAN	T	424	ENSP00000276651:N424T	ENSP00000276651:N424T	N	-	2	0	DPYS	105474360	1.000000	0.71417	0.989000	0.46669	0.997000	0.91878	7.698000	0.84413	2.299000	0.77371	0.528000	0.53228	AAC	DPYS	-	superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	ENSG00000147647		0.413	DPYS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPYS	HGNC	protein_coding	OTTHUMT00000380814.1	-	0.00	65	0	T	NM_001385		105405184	-1	tier1	-	no_errors	ENST00000351513	ensembl	human	known	74_37	missense	15.07	62	11	SNP	1.000	G
DSP	1832	genome.wustl.edu	37	6	7579556	7579556	+	Silent	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr6:7579556C>A	ENST00000379802.3	+	23	3474	c.3133C>A	c.(3133-3135)Cga>Aga	p.R1045R	DSP_ENST00000418664.2_Silent_p.R1045R	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	1045	Globular 1.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		CAGACTGGCCCGAGATGCCAA	0.433																																																	0													35.0	39.0	38.0					6																	7579556		2203	4300	6503	SO:0001819	synonymous_variant	0			J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.3133C>A	6.37:g.7579556C>A			B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Silent	SNP	pfam_Plectin_repeat,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.R1045	ENST00000379802.3	37	c.3133	CCDS4501.1	6																																																																																			DSP	-	NULL	ENSG00000096696		0.433	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSP	HGNC	protein_coding	OTTHUMT00000039786.2	-	0.00	65	0	C	NM_004415		7579556	+1	tier1	-	no_errors	ENST00000379802	ensembl	human	known	74_37	silent	8.77	52	5	SNP	1.000	A
DYRK1B	9149	genome.wustl.edu	37	19	40316492	40316492	+	Frame_Shift_Del	DEL	G	G	-			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr19:40316492delG	ENST00000593685.1	-	11	2221	c.1753delC	c.(1753-1755)cagfs	p.Q585fs	DYRK1B_ENST00000323039.5_Frame_Shift_Del_p.Q585fs|DYRK1B_ENST00000430012.2_Frame_Shift_Del_p.Q545fs|DYRK1B_ENST00000348817.3_Frame_Shift_Del_p.Q557fs|DYRK1B_ENST00000597639.1_Frame_Shift_Del_p.Q557fs			Q9Y463	DYR1B_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B	585					adipose tissue development (GO:0060612)|myoblast fusion (GO:0007520)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(7)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	24	all_cancers(60;5.79e-06)|all_lung(34;5.2e-08)|Lung NSC(34;6.14e-08)|Ovarian(47;0.06)		Epithelial(26;5.74e-25)|OV - Ovarian serous cystadenocarcinoma(5;3.13e-24)|all cancers(26;8.59e-23)			GCCGGGTGCTGGGGGGCAGGC	0.701																																																	0													11.0	15.0	14.0					19																	40316492		2143	4202	6345	SO:0001589	frameshift_variant	0			Y17999	CCDS12543.1, CCDS12544.1, CCDS46075.1	19q13.2	2012-10-02			ENSG00000105204	ENSG00000105204	2.7.12.1		3092	protein-coding gene	gene with protein product	"""minibrain-related kinase"""	604556				9918863	Standard	XM_005259395		Approved	MIRK	uc002omj.3	Q9Y463		ENST00000593685.1:c.1753delC	19.37:g.40316492delG	ENSP00000469863:p.Gln585fs		O75258|O75788|O75789	Frame_Shift_Del	DEL	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.Q585fs	ENST00000593685.1	37	c.1753	CCDS12543.1	19																																																																																			DYRK1B	-	NULL	ENSG00000105204		0.701	DYRK1B-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DYRK1B	HGNC	protein_coding	OTTHUMT00000462874.2		0.00	9	0	G	NM_004714		40316492	-1			no_errors	ENST00000323039	ensembl	human	known	74_37	frame_shift_del	33.33	4	2	DEL	1.000	0
ENO4	387712	genome.wustl.edu	37	10	118630765	118630765	+	Missense_Mutation	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr10:118630765C>A	ENST00000409522.1	+	3	407	c.352C>A	c.(352-354)Cta>Ata	p.L118I	ENO4_ENST00000341276.5_Missense_Mutation_p.L396I|ENO4_ENST00000369207.2_Missense_Mutation_p.L158I			A6NNW6	ENO4_HUMAN	enolase family member 4	396					glycolytic process (GO:0006096)	phosphopyruvate hydratase complex (GO:0000015)	magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)			lung(1)	1						AAATCTGCATCTAGCTATCAA	0.418																																																	0																																										SO:0001583	missense	0				CCDS73206.1	10q25.3	2012-04-19	2009-12-15	2009-12-15	ENSG00000188316	ENSG00000188316			31670	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 134"""	C10orf134			Standard	NM_001242699		Approved	AC023283.3	uc021pzj.1	A6NNW6	OTTHUMG00000019113	ENST00000409522.1:c.352C>A	10.37:g.118630765C>A	ENSP00000387194:p.Leu118Ile		B8ZZN9	Missense_Mutation	SNP	pfam_Enolase_C,pfam_Enolase_N	p.L396I	ENST00000409522.1	37	c.1186		10	.	.	.	.	.	.	.	.	.	.	C	14.12	2.439541	0.43326	.	.	ENSG00000188316	ENST00000409522;ENST00000341276;ENST00000369207	T;T;T	0.76448	-1.02;0.91;0.91	5.98	1.47	0.22746	.	0.073326	0.56097	D	0.000026	T	0.77718	0.4172	L	0.48362	1.52	0.35520	D	0.801391	D	0.69078	0.997	D	0.64042	0.921	T	0.75679	-0.3234	10	0.20046	T	0.44	-11.3141	6.9946	0.24774	0.0:0.3427:0.0:0.6573	.	118	A6NNW6-2	.	I	118;396;158	ENSP00000387194:L118I;ENSP00000345555:L396I;ENSP00000358208:L158I	ENSP00000345555:L396I	L	+	1	2	ENO4	118620755	0.734000	0.28142	0.121000	0.21740	0.993000	0.82548	1.115000	0.31209	0.384000	0.24942	0.650000	0.86243	CTA	ENO4	-	pfam_Enolase_C	ENSG00000188316		0.418	ENO4-002	PUTATIVE	basic|exp_conf	protein_coding	ENO4	HGNC	protein_coding	OTTHUMT00000331643.1	-	0.00	72	0	C	NM_001242699		118630765	+1	tier1	-	no_errors	ENST00000341276	ensembl	human	known	74_37	missense	9.52	38	4	SNP	0.977	A
ZNF971P	100419895	genome.wustl.edu	37	16	34682188	34682188	+	RNA	SNP	T	T	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr16:34682188T>C	ENST00000568619.1	-	0	291																											GTGTGATTTCTCTGACGTATA	0.383																																																	0																																												0																															16.37:g.34682188T>C				RNA	SNP	-	NULL	ENST00000568619.1	37	NULL		16																																																																																			RP11-80F22.10	-	-	ENSG00000214581		0.383	RP11-80F22.10-002	KNOWN	basic	processed_transcript	ENSG00000214581	Clone_based_vega_gene	pseudogene	OTTHUMT00000431371.1	-	0.00	195	0	T			34682188	-1	tier1	-	no_errors	ENST00000568619	ensembl	human	known	74_37	rna	11.92	133	18	SNP	0.984	C
AC026320.1	0	genome.wustl.edu	37	3	191693742	191693743	+	RNA	DEL	CC	CC	-	rs199865256|rs371584059		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	CC	CC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr3:191693742_191693743delCC	ENST00000401201.1	+	0	0_1																											ctctctctctcCgtgtgtgtgt	0.495																																																	0																																												0																															3.37:g.191693742_191693743delCC				RNA	DEL	-	NULL	ENST00000401201.1	37	NULL		3																																																																																			AC026320.1	-	-	ENSG00000216020		0.495	AC026320.1-201	NOVEL	basic	miRNA	ENSG00000216020	Clone_based_ensembl_gene	miRNA			0.00	10	0	CC			191693743	+1	tier1		no_errors	ENST00000401201	ensembl	human	novel	74_37	rna	40.00	3	2	DEL	0.000:0.000	-
AC010739.1	0	genome.wustl.edu	37	2	41823549	41823549	+	RNA	SNP	T	T	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:41823549T>A	ENST00000408445.1	+	0	24																											GTTGTTCGTAttaggttggtg	0.378																																																	0																																												0																															2.37:g.41823549T>A				RNA	SNP	-	NULL	ENST00000408445.1	37	NULL		2																																																																																			AC010739.1	-	-	ENSG00000221372		0.378	AC010739.1-201	NOVEL	basic	miRNA	ENSG00000221372	Clone_based_ensembl_gene	miRNA		-	0.00	44	0	T			41823549	+1	tier1	-	no_errors	ENST00000408445	ensembl	human	novel	74_37	rna	25.45	41	14	SNP	0.176	A
CSMD3	114788	genome.wustl.edu	37	8	114419790	114419790	+	Intron	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr8:114419790C>T	ENST00000297405.5	-	1	423				CSMD3_ENST00000455883.2_Intron|AC107890.1_ENST00000408683.1_RNA|CSMD3_ENST00000352409.3_Intron	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						tacacacacacatatatatgt	0.388										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							0																																										SO:0001627	intron_variant	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.178+29115G>A	8.37:g.114419790C>T			Q96PZ3	RNA	SNP	-	NULL	ENST00000297405.5	37	NULL	CCDS6315.1	8																																																																																			AC107890.1	-	-	ENSG00000221610		0.388	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000221610	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000347141.1	-	0.00	26	0	C	NM_052900		114419790	-1	tier1	-	no_errors	ENST00000408683	ensembl	human	novel	74_37	rna	38.46	24	15	SNP	0.001	T
LOC105373343	105373343	genome.wustl.edu	37	X	139298801	139298801	+	lincRNA	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chrX:139298801T>G	ENST00000458577.1	-	0	155																											TTGAGAAGAGTTCTTCTTTTC	0.418																																																	0																																												0																															X.37:g.139298801T>G				RNA	SNP	-	NULL	ENST00000458577.1	37	NULL		X																																																																																			AC004070.1	-	-	ENSG00000231110		0.418	AC004070.1-001	KNOWN	basic	lincRNA	ENSG00000231110	Clone_based_vega_gene	lincRNA	OTTHUMT00000058576.1	-	0.00	75	0	T			139298801	-1	tier1	-	no_errors	ENST00000458577	ensembl	human	known	74_37	rna	61.11	21	33	SNP	0.000	G
RP11-782C8.2	0	genome.wustl.edu	37	1	143210699	143210699	+	lincRNA	DEL	A	A	-			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr1:143210699delA	ENST00000412204.2	-	0	371				RP11-782C8.1_ENST00000438000.1_lincRNA																							AAAATATATCAAAAAATTGCA	0.284																																																	0																																												0																															1.37:g.143210699delA				RNA	DEL	-	NULL	ENST00000412204.2	37	NULL		1																																																																																			RP11-782C8.2	-	-	ENSG00000232274		0.284	RP11-782C8.2-004	KNOWN	basic	lincRNA	ENSG00000232274	Clone_based_vega_gene	lincRNA	OTTHUMT00000037567.2		0.00	11	0	A			143210699	-1	tier1		no_errors	ENST00000412204	ensembl	human	known	74_37	rna	18.18	9	2	DEL	0.373	-
PHKG1	5260	genome.wustl.edu	37	7	62694027	62694027	+	RNA	SNP	A	A	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr7:62694027A>C	ENST00000451381.1	-	0	157																											CGGGGGCTGAAGTGCCGCACT	0.617																																																	0																																												0																															7.37:g.62694027A>C				RNA	SNP	-	NULL	ENST00000451381.1	37	NULL		7																																																																																			RP5-905H7.3	-	-	ENSG00000244550		0.617	RP5-905H7.3-001	KNOWN	basic|readthrough_transcript	processed_transcript	ENSG00000244550	Clone_based_vega_gene	processed_transcript	OTTHUMT00000343675.1	-	0.00	15	0	A			62694027	-1	tier1	-	no_errors	ENST00000451381	ensembl	human	known	74_37	rna	51.43	17	18	SNP	1.000	C
PDE10A	10846	genome.wustl.edu	37	6	166355806	166355807	+	Intron	DNP	GC	GC	AT			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G|C	G|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr6:166355806_166355807GC>AT	ENST00000535229.1	-	1	389				AL590482.1_ENST00000516387.1_RNA			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A						blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)			breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	acacatatatGCGCACACACAC	0.356																																					Esophageal Squamous(22;308 615 5753 12038 40624)												0																																										SO:0001627	intron_variant	0			AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	Exception_encountered	6.37:g.166355806_166355807delinsAT			Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	RNA	SNP	-	NULL	ENST00000535229.1	37	NULL		6																																																																																			AL590482.1	-	-	ENSG00000252196		0.356	PDE10A-004	KNOWN	mRNA_end_NF|basic	processed_transcript	ENSG00000252196	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000470299.1		0.00	100|103	0	G|C			166355806|166355807	-1			no_errors	ENST00000516387	ensembl	human	novel	74_37	rna	15.28|16.90	61|59	11|12	SNP	0.000	A|T
TBC1D3P3	653017	genome.wustl.edu	37	17	20451527	20451527	+	lincRNA	DEL	T	T	-			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr17:20451527delT	ENST00000591705.1	+	0	2844																											ATACCTAGTATTTTTTGGGGT	0.537																																																	0																																												0																															17.37:g.20451527delT				RNA	DEL	-	NULL	ENST00000591705.1	37	NULL		17																																																																																			RP11-434D2.3	-	-	ENSG00000267075		0.537	RP11-434D2.3-001	KNOWN	basic	lincRNA	ENSG00000267075	Clone_based_vega_gene	lincRNA	OTTHUMT00000441761.2		0.00	122	0	T			20451527	+1	tier1		no_errors	ENST00000591705	ensembl	human	known	74_37	rna	22.99	67	20	DEL	0.975	-
EPB41L5	57669	genome.wustl.edu	37	2	120861689	120861689	+	Intron	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:120861689G>T	ENST00000263713.5	+	16	1551				EPB41L5_ENST00000452780.1_Intron|EPB41L5_ENST00000443902.2_Intron|EPB41L5_ENST00000443124.1_Missense_Mutation_p.R464M|EPB41L5_ENST00000331393.4_Missense_Mutation_p.R464M	NM_020909.3	NP_065960.2	Q9HCM4	E41L5_HUMAN	erythrocyte membrane protein band 4.1 like 5						actomyosin structure organization (GO:0031032)|apical constriction (GO:0003383)|axial mesoderm morphogenesis (GO:0048319)|cellular response to transforming growth factor beta stimulus (GO:0071560)|ectoderm development (GO:0007398)|embryonic foregut morphogenesis (GO:0048617)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|in utero embryonic development (GO:0001701)|left/right axis specification (GO:0070986)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of protein binding (GO:0032091)|neural plate morphogenesis (GO:0001839)|paraxial mesoderm development (GO:0048339)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein binding (GO:0032092)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of establishment of protein localization (GO:0070201)|somite rostral/caudal axis specification (GO:0032525)|substrate-dependent cell migration, cell attachment to substrate (GO:0006931)|unidimensional cell growth (GO:0009826)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(5)|lung(12)|ovary(1)	26						TGGAACACAAGGGCCTTGCCC	0.517																																																	0																																										SO:0001627	intron_variant	0			AK023019	CCDS2130.1, CCDS54392.1, CCDS54393.1	2q14.2	2009-07-28			ENSG00000115109	ENSG00000115109			19819	protein-coding gene	gene with protein product		611730					Standard	NM_001184937		Approved	KIAA1548, FLJ12957, BE37, YMO1	uc002tmg.3	Q9HCM4	OTTHUMG00000131433	ENST00000263713.5:c.1337+3299G>T	2.37:g.120861689G>T			Q7Z5S1|Q8IZ12|Q9H975	Missense_Mutation	SNP	pfam_FERM_central,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.R464M	ENST00000263713.5	37	c.1391	CCDS2130.1	2	.	.	.	.	.	.	.	.	.	.	G	16.85	3.235688	0.58886	.	.	ENSG00000115109	ENST00000331393;ENST00000443124	D;D	0.82619	-1.63;-1.63	6.02	5.13	0.70059	.	.	.	.	.	T	0.80099	0.4561	.	.	.	0.80722	D	1	P	0.37276	0.589	B	0.41036	0.346	T	0.78819	-0.2054	8	0.42905	T	0.14	.	12.6737	0.56882	0.0761:0.0:0.9239:0.0	.	464	Q9HCM4-2	.	M	464	ENSP00000329687:R464M;ENSP00000393722:R464M	ENSP00000329687:R464M	R	+	2	0	EPB41L5	120578159	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.272000	0.51616	2.857000	0.98124	0.650000	0.86243	AGG	EPB41L5	-	NULL	ENSG00000115109		0.517	EPB41L5-001	KNOWN	basic|CCDS	protein_coding	EPB41L5	HGNC	protein_coding	OTTHUMT00000254230.2	-	0.00	64	0	G	NM_020909		120861689	+1	tier1	-	no_errors	ENST00000331393	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	T
ETS1	2113	genome.wustl.edu	37	11	128356014	128356014	+	Missense_Mutation	SNP	C	C	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr11:128356014C>G	ENST00000319397.6	-	4	740	c.431G>C	c.(430-432)gGa>gCa	p.G144A	ETS1_ENST00000526145.2_Missense_Mutation_p.G144A|ETS1_ENST00000345075.4_Missense_Mutation_p.G144A|ETS1_ENST00000392668.4_Missense_Mutation_p.G188A|ETS1_ENST00000535549.1_Intron|ETS1_ENST00000531611.1_Missense_Mutation_p.G144A	NM_005238.3	NP_005229.1	P14921	ETS1_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog 1	144	Activation domain; required for transcription activation.				angiogenesis involved in wound healing (GO:0060055)|cell motility (GO:0048870)|cellular response to hydrogen peroxide (GO:0070301)|estrous cycle phase (GO:0060206)|female pregnancy (GO:0007565)|hypothalamus development (GO:0021854)|immune response (GO:0006955)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|pituitary gland development (GO:0021983)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of apoptotic process (GO:0042981)|regulation of extracellular matrix disassembly (GO:0010715)|response to antibiotic (GO:0046677)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to laminar fluid shear stress (GO:0034616)|response to mechanical stimulus (GO:0009612)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|pleura(1)|prostate(1)|upper_aerodigestive_tract(3)	35	all_hematologic(175;0.0537)	Lung NSC(97;0.000542)|all_lung(97;0.000665)|Breast(109;0.00765)|all_neural(223;0.0351)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.47e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0174)|LUSC - Lung squamous cell carcinoma(976;0.0815)|Lung(307;0.0833)		TGGGTTGACTCCATTAACTTG	0.398																																																	0													159.0	146.0	151.0					11																	128356014		2201	4297	6498	SO:0001583	missense	0				CCDS8475.1, CCDS44767.1, CCDS53724.1	11q23.3	2013-07-09	2013-07-09		ENSG00000134954	ENSG00000134954			3488	protein-coding gene	gene with protein product	"""Avian erythroblastosis virus E26 (v-ets) oncogene homolog-1"", ""ets protein"""	164720		EWSR2		1522903	Standard	NM_005238		Approved	FLJ10768, ETS-1	uc001qej.2	P14921	OTTHUMG00000165799	ENST00000319397.6:c.431G>C	11.37:g.128356014C>G	ENSP00000324578:p.Gly144Ala		A9UL17|F5GYX9|Q14278|Q16080|Q6N087|Q96AC5	Missense_Mutation	SNP	pfam_Ets_dom,pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,smart_Ets_dom,pirsf_Transform_prot_C-ets,pfscan_Ets_dom,prints_Ets_dom	p.G188A	ENST00000319397.6	37	c.563	CCDS8475.1	11	.	.	.	.	.	.	.	.	.	.	C	15.87	2.960204	0.53400	.	.	ENSG00000134954	ENST00000345075;ENST00000392668;ENST00000531611;ENST00000319397;ENST00000526145	T;T;T;T;T	0.44881	3.12;2.77;0.91;2.78;3.12	5.84	5.84	0.93424	.	0.229124	0.44902	D	0.000407	T	0.28995	0.0720	N	0.22421	0.69	0.80722	D	1	B;B;B	0.29162	0.088;0.235;0.028	B;B;B	0.29077	0.046;0.098;0.016	T	0.08743	-1.0707	10	0.16420	T	0.52	.	13.3995	0.60874	0.0:0.9282:0.0:0.0718	.	144;144;188	P14921;Q96AC5;Q6N087	ETS1_HUMAN;.;.	A	144;188;144;144;144	ENSP00000340485:G144A;ENSP00000376436:G188A;ENSP00000435666:G144A;ENSP00000324578:G144A;ENSP00000433500:G144A	ENSP00000324578:G144A	G	-	2	0	ETS1	127861224	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.768000	0.68858	2.776000	0.95493	0.650000	0.86243	GGA	ETS1	-	pirsf_Transform_prot_C-ets	ENSG00000134954		0.398	ETS1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ETS1	HGNC	protein_coding	OTTHUMT00000386269.2	-	0.00	66	0	C	NM_005238		128356014	-1	tier1	-	no_errors	ENST00000392668	ensembl	human	known	74_37	missense	10.31	87	10	SNP	1.000	G
EVC	2121	genome.wustl.edu	37	4	5758088	5758088	+	Splice_Site	SNP	A	A	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr4:5758088A>G	ENST00000264956.6	+	11	1746	c.1562A>G	c.(1561-1563)cAg>cGg	p.Q521R	EVC_ENST00000382674.2_Splice_Site_p.Q521R|EVC_ENST00000509451.1_Splice_Site_p.Q521R	NM_153717.2	NP_714928.1	P57679	EVC_HUMAN	Ellis van Creveld syndrome	521					cartilage development (GO:0051216)|endochondral bone growth (GO:0003416)|muscle organ development (GO:0007517)|positive regulation of smoothened signaling pathway (GO:0045880)|skeletal system development (GO:0001501)|smoothened signaling pathway (GO:0007224)	ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|stomach(1)	28		Myeloproliferative disorder(84;0.117)				GCACTCTGCCAGGTACATGGC	0.602																																																	0													70.0	62.0	65.0					4																	5758088		2203	4300	6503	SO:0001630	splice_region_variant	0			AF216184	CCDS3383.1	4p16	2008-07-03			ENSG00000072840	ENSG00000072840			3497	protein-coding gene	gene with protein product		604831				10700184	Standard	NM_153717		Approved	DWF-1	uc003gil.1	P57679	OTTHUMG00000090427	ENST00000264956.6:c.1563+1A>G	4.37:g.5758088A>G				Missense_Mutation	SNP	NULL	p.Q521R	ENST00000264956.6	37	c.1562	CCDS3383.1	4	.	.	.	.	.	.	.	.	.	.	A	15.05	2.718581	0.48622	.	.	ENSG00000072840	ENST00000264956;ENST00000382674;ENST00000509451	T;T;T	0.55234	0.53;0.53;0.58	5.12	5.12	0.69794	.	0.067412	0.64402	D	0.000015	T	0.64283	0.2584	M	0.64997	1.995	0.80722	D	1	D	0.54207	0.965	P	0.58660	0.843	T	0.64567	-0.6377	10	0.41790	T	0.15	.	12.8875	0.58053	1.0:0.0:0.0:0.0	.	521	P57679	EVC_HUMAN	R	521	ENSP00000264956:Q521R;ENSP00000372120:Q521R;ENSP00000426774:Q521R	ENSP00000264956:Q521R	Q	+	2	0	EVC	5808989	1.000000	0.71417	1.000000	0.80357	0.022000	0.10575	4.708000	0.61859	1.909000	0.55274	0.528000	0.53228	CAG	EVC	-	NULL	ENSG00000072840		0.602	EVC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVC	HGNC	protein_coding	OTTHUMT00000206859.1	-	0.00	47	0	A		Missense_Mutation	5758088	+1	tier1	-	no_errors	ENST00000264956	ensembl	human	known	74_37	missense	60.53	15	23	SNP	1.000	G
EVL	51466	genome.wustl.edu	37	14	100604201	100604201	+	Intron	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr14:100604201C>A	ENST00000402714.2	+	11	1692				EVL_ENST00000392920.3_Intron|EVL_ENST00000544450.2_Missense_Mutation_p.P390T			Q9UI08	EVL_HUMAN	Enah/Vasp-like						actin filament organization (GO:0007015)|actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ruffle assembly (GO:1900028)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of stress fiber assembly (GO:0051496)|protein homotetramerization (GO:0051289)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)	profilin binding (GO:0005522)|SH3 domain binding (GO:0017124)			cervix(1)|large_intestine(5)|lung(3)|ovary(3)|urinary_tract(2)	14		Melanoma(154;0.152)				GTCCCCCGTCCCGTGACTAAC	0.587																																																	0													53.0	60.0	58.0					14																	100604201		692	1591	2283	SO:0001627	intron_variant	0			AF112209	CCDS9955.1	14q32.2	2014-08-13			ENSG00000196405	ENSG00000196405			20234	protein-coding gene	gene with protein product						10945997, 10993894	Standard	NM_016337		Approved	RNB6	uc001ygu.3	Q9UI08	OTTHUMG00000171530	ENST00000402714.2:c.1088+62C>A	14.37:g.100604201C>A			A8K105|O95884|Q7Z522|Q8TBV1|Q9UF25|Q9UIC2	Missense_Mutation	SNP	pfam_WH1/EVH1,smart_WH1/EVH1,pfscan_WH1/EVH1	p.P390T	ENST00000402714.2	37	c.1168		14	.	.	.	.	.	.	.	.	.	.	C	1.642	-0.516277	0.04200	.	.	ENSG00000196405	ENST00000544450	T	0.70749	-0.51	4.72	2.59	0.31030	.	.	.	.	.	T	0.52191	0.1719	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33548	-0.9864	7	.	.	.	.	7.4203	0.27067	0.1454:0.6893:0.0:0.1653	.	390	B7Z3I5	.	T	390	ENSP00000437904:P390T	.	P	+	1	0	EVL	99673954	0.000000	0.05858	0.003000	0.11579	0.027000	0.11550	0.262000	0.18460	0.941000	0.37499	0.561000	0.74099	CCG	EVL	-	NULL	ENSG00000196405		0.587	EVL-006	KNOWN	basic|appris_candidate	protein_coding	EVL	HGNC	protein_coding	OTTHUMT00000413958.1	-	0.00	41	0	C			100604201	+1	tier1	-	no_errors	ENST00000544450	ensembl	human	putative	74_37	missense	18.75	13	3	SNP	0.002	A
EYS	346007	genome.wustl.edu	37	6	65300632	65300632	+	Missense_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr6:65300632T>G	ENST00000370621.3	-	26	5654	c.5128A>C	c.(5128-5130)Act>Cct	p.T1710P	EYS_ENST00000370616.2_Missense_Mutation_p.T1710P|EYS_ENST00000503581.1_Missense_Mutation_p.T1710P			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	1710					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						GGTCCCATAGTTATGCCATAT	0.338																																																	0													29.0	26.0	27.0					6																	65300632		692	1590	2282	SO:0001583	missense	0				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.5128A>C	6.37:g.65300632T>G	ENSP00000359655:p.Thr1710Pro		A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.T1710P	ENST00000370621.3	37	c.5128		6	.	.	.	.	.	.	.	.	.	.	T	7.213	0.595835	0.13875	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	D;D;D	0.84070	-1.8;-1.78;-1.78	5.88	0.436	0.16549	.	.	.	.	.	T	0.41903	0.1179	N	0.08118	0	0.09310	N	1	B;B	0.21071	0.051;0.013	B;B	0.21917	0.037;0.007	T	0.37619	-0.9698	9	0.72032	D	0.01	.	1.6807	0.02831	0.1273:0.1424:0.2643:0.4661	.	1710;1710	Q5T1H1-1;Q5T1H1	.;EYS_HUMAN	P	1710	ENSP00000424243:T1710P;ENSP00000359655:T1710P;ENSP00000359650:T1710P	ENSP00000359650:T1710P	T	-	1	0	EYS	65357353	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	0.234000	0.17930	-0.133000	0.11537	0.482000	0.46254	ACT	EYS	-	NULL	ENSG00000188107		0.338	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3	-	0.00	67	0	T	XM_294050		65300632	-1	tier1	-	no_errors	ENST00000370616	ensembl	human	known	74_37	missense	71.43	14	35	SNP	0.000	G
FAAH	2166	genome.wustl.edu	37	1	46874925	46874925	+	Intron	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr1:46874925G>T	ENST00000243167.8	+	9	1259					NM_001441.2	NP_001432.2	O00519	FAAH1_HUMAN	fatty acid amide hydrolase						fatty acid catabolic process (GO:0009062)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|organelle membrane (GO:0031090)	acylglycerol lipase activity (GO:0047372)|carbon-nitrogen ligase activity, with glutamine as amido-N-donor (GO:0016884)|fatty acid amide hydrolase activity (GO:0017064)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	22	Acute lymphoblastic leukemia(166;0.155)				Propofol(DB00818)|Thiopental(DB00599)	AGGCAGACCTGGGGGAGCAGC	0.592																																																	0																																										SO:0001627	intron_variant	0			U82535	CCDS535.1	1p35-p34	2008-02-05			ENSG00000117480	ENSG00000117480			3553	protein-coding gene	gene with protein product		602935				9122178	Standard	NM_001441		Approved	FAAH-1	uc001cpu.2	O00519	OTTHUMG00000007811	ENST00000243167.8:c.1175+55G>T	1.37:g.46874925G>T			D3DQ19|Q52M86|Q5TDF8	RNA	SNP	-	NULL	ENST00000243167.8	37	NULL	CCDS535.1	1																																																																																			FAAH	-	-	ENSG00000117480		0.592	FAAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAAH	HGNC	protein_coding	OTTHUMT00000021443.1	-	0.00	76	0	G	NM_001441		46874925	+1	tier1	-	no_errors	ENST00000489366	ensembl	human	known	74_37	rna	6.35	59	4	SNP	0.019	T
FAM154B	283726	genome.wustl.edu	37	15	82575376	82575376	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr15:82575376G>T	ENST00000339465.5	+	3	1239	c.1170G>T	c.(1168-1170)aaG>aaT	p.K390N	FAM154B_ENST00000427381.2_Missense_Mutation_p.K375N|FAM154B_ENST00000565501.1_3'UTR	NM_001008226.1	NP_001008227.1	Q658L1	F154B_HUMAN	family with sequence similarity 154, member B	390										autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|skin(2)	19						TCTTCCGCAAGATTATTCCTG	0.383																																																	0													42.0	43.0	43.0					15																	82575376		2200	4296	6496	SO:0001583	missense	0			AL833762	CCDS32310.1	15q25.2	2008-02-21				ENSG00000188659			33727	protein-coding gene	gene with protein product							Standard	XM_005254317		Approved	DKFZp666G057	uc002bgv.3	Q658L1		ENST00000339465.5:c.1170G>T	15.37:g.82575376G>T	ENSP00000340445:p.Lys390Asn		B4E2M2	Missense_Mutation	SNP	NULL	p.K390N	ENST00000339465.5	37	c.1170	CCDS32310.1	15	.	.	.	.	.	.	.	.	.	.	G	12.50	1.957067	0.34565	.	.	ENSG00000188659	ENST00000339465;ENST00000427381	T;T	0.18502	2.44;2.21	3.84	2.9	0.33743	.	0.155049	0.39834	N	0.001241	T	0.29556	0.0737	M	0.67953	2.075	0.38155	D	0.938862	D;D	0.71674	0.998;0.988	P;P	0.57425	0.82;0.601	T	0.12477	-1.0546	10	0.52906	T	0.07	-3.0349	8.9049	0.35517	0.1813:0.0:0.8187:0.0	.	375;390	B4E2M2;Q658L1	.;F154B_HUMAN	N	390;375	ENSP00000340445:K390N;ENSP00000403743:K375N	ENSP00000340445:K390N	K	+	3	2	FAM154B	80362431	0.833000	0.29383	0.376000	0.26042	0.213000	0.24496	2.491000	0.45303	1.878000	0.54408	0.398000	0.26397	AAG	FAM154B	-	NULL	ENSG00000188659		0.383	FAM154B-001	KNOWN	basic|CCDS	protein_coding	FAM154B	HGNC	protein_coding	OTTHUMT00000419644.1	-	0.00	93	0	G	NM_001008226		82575376	+1	tier1	-	no_errors	ENST00000339465	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.855	T
FAM228B	375190	genome.wustl.edu	37	2	24384375	24384375	+	Splice_Site	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:24384375G>T	ENST00000407625.1	+	8	772		c.e8-1		FAM228B_ENST00000420135.2_Splice_Site|RP11-507M3.1_ENST00000584973.1_Intron	NM_001145710.1	NP_001139182.1	P0C875	F228B_HUMAN	family with sequence similarity 228, member B																		TCTTGTTAAAGGTTAAAGGTG	0.353																																																	0													131.0	118.0	122.0					2																	24384375		692	1591	2283	SO:0001630	splice_region_variant	0				CCDS74491.1	2p23.3	2012-07-04			ENSG00000219626	ENSG00000219626			24736	protein-coding gene	gene with protein product							Standard	NM_001145710		Approved		uc010ykl.2	P0C875	OTTHUMG00000151901	ENST00000407625.1:c.687-1G>T	2.37:g.24384375G>T				Splice_Site	SNP	-	e7-1	ENST00000407625.1	37	c.687-1		2	.	.	.	.	.	.	.	.	.	.	G	15.90	2.970172	0.53614	.	.	ENSG00000219626	ENST00000407625;ENST00000420135	.	.	.	3.85	3.85	0.44370	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.5636	0.50792	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AC008073.6	24237879	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	3.793000	0.55484	2.432000	0.82394	0.484000	0.47621	.	FAM228B	-	-	ENSG00000219626		0.353	FAM228B-007	NOVEL	basic|appris_candidate	protein_coding	FAM228B	HGNC	protein_coding	OTTHUMT00000324328.1	-	0.00	75	0	G	NM_001145710	Intron	24384375	+1	tier1	-	no_errors	ENST00000420135	ensembl	human	known	74_37	splice_site	5.26	72	4	SNP	1.000	T
FAM9A	171482	genome.wustl.edu	37	X	8761752	8761752	+	Missense_Mutation	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chrX:8761752C>A	ENST00000543214.1	-	8	1012	c.877G>T	c.(877-879)Gtt>Ttt	p.V293F	FAM9A_ENST00000381003.3_Missense_Mutation_p.V293F	NM_001171186.1	NP_001164657.1	Q8IZU1	FAM9A_HUMAN	family with sequence similarity 9, member A	293						nucleus (GO:0005634)				endometrium(11)|kidney(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	18		Hepatocellular(5;0.219)				CAGCTCCTAACACCTGTAGGT	0.353																																																	0													127.0	110.0	116.0					X																	8761752		2203	4300	6503	SO:0001583	missense	0				CCDS14131.1	Xp22.32	2012-11-29			ENSG00000183304	ENSG00000183304			18403	protein-coding gene	gene with protein product	"""testis expressed 39A"""	300477					Standard	NM_174951		Approved	TEX39A	uc004csg.3	Q8IZU1	OTTHUMG00000021110	ENST00000543214.1:c.877G>T	X.37:g.8761752C>A	ENSP00000440163:p.Val293Phe		B7ZLH5|Q2M2D1	Missense_Mutation	SNP	NULL	p.V293F	ENST00000543214.1	37	c.877	CCDS14131.1	X	.	.	.	.	.	.	.	.	.	.	c	10.32	1.317059	0.23908	.	.	ENSG00000183304	ENST00000381003;ENST00000543214	.	.	.	0.697	0.697	0.18081	.	.	.	.	.	T	0.37320	0.0999	N	0.14661	0.345	0.09310	N	1	D	0.69078	0.997	D	0.71184	0.972	T	0.21075	-1.0256	7	0.87932	D	0	.	.	.	.	.	293	Q8IZU1	FAM9A_HUMAN	F	293	.	ENSP00000370391:V293F	V	-	1	0	FAM9A	8721752	0.879000	0.30193	0.008000	0.14137	0.004000	0.04260	1.205000	0.32308	0.615000	0.30124	0.464000	0.42555	GTT	FAM9A	-	NULL	ENSG00000183304		0.353	FAM9A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM9A	HGNC	protein_coding	OTTHUMT00000055697.1	-	0.00	48	0	C	NM_174951		8761752	-1	tier1	-	no_errors	ENST00000381003	ensembl	human	known	74_37	missense	11.76	30	4	SNP	0.008	A
FAT3	120114	genome.wustl.edu	37	11	92534123	92534123	+	Silent	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr11:92534123C>T	ENST00000298047.6	+	9	7961	c.7944C>T	c.(7942-7944)gcC>gcT	p.A2648A	FAT3_ENST00000409404.2_Silent_p.A2648A|FAT3_ENST00000525166.1_Silent_p.A2498A			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2648	Cadherin 24. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TTTCAGTGGCCGACCTCCTGG	0.463										TCGA Ovarian(4;0.039)																																							0													36.0	34.0	35.0					11																	92534123		1887	4103	5990	SO:0001819	synonymous_variant	0			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.7944C>T	11.37:g.92534123C>T			B5MDB0|Q96AU6	Silent	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.A2648	ENST00000298047.6	37	c.7944		11																																																																																			FAT3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000165323		0.463	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		-	0.00	92	0	C	NM_001008781		92534123	+1	tier1	-	no_errors	ENST00000298047	ensembl	human	known	74_37	silent	25.00	89	30	SNP	0.976	T
FBLN5	10516	genome.wustl.edu	37	14	92347700	92347700	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr14:92347700G>T	ENST00000342058.4	-	9	1518	c.925C>A	c.(925-927)Caa>Aaa	p.Q309K	FBLN5_ENST00000267620.10_Missense_Mutation_p.Q350K|FBLN5_ENST00000556154.1_Missense_Mutation_p.Q314K	NM_006329.3	NP_006320.2	Q9UBX5	FBLN5_HUMAN	fibulin 5	309	EGF-like 6; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell-matrix adhesion (GO:0007160)|elastic fiber assembly (GO:0048251)|extracellular matrix organization (GO:0030198)|protein localization to cell surface (GO:0034394)|regulation of cell growth (GO:0001558)|regulation of removal of superoxide radicals (GO:2000121)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein C-terminus binding (GO:0008022)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(11)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	28		all_cancers(154;0.0722)				AAGCCCCCTTGTAAATTGTAG	0.527																																																	0													108.0	89.0	96.0					14																	92347700		2203	4300	6503	SO:0001583	missense	0			AJ133490	CCDS9898.1	14q31	2014-09-17				ENSG00000140092		"""Fibulins"""	3602	protein-coding gene	gene with protein product		604580				10640802	Standard	NM_006329		Approved	EVEC, UP50, DANCE, ARMD3	uc001xzx.4	Q9UBX5		ENST00000342058.4:c.925C>A	14.37:g.92347700G>T	ENSP00000345008:p.Gln309Lys		O75966|Q6IAL4|Q6UWA3	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,superfamily_TIL_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	p.Q309K	ENST00000342058.4	37	c.925	CCDS9898.1	14	.	.	.	.	.	.	.	.	.	.	G	18.13	3.555438	0.65425	.	.	ENSG00000140092	ENST00000267620;ENST00000342058;ENST00000556154	D;D;D	0.91792	-2.91;-2.91;-2.91	5.5	5.5	0.81552	EGF-like calcium-binding, conserved site (1);	0.123586	0.56097	D	0.000032	D	0.89873	0.6841	L	0.38953	1.18	0.47994	D	0.999564	P;B;B	0.38395	0.629;0.218;0.083	B;B;B	0.41571	0.36;0.056;0.038	D	0.87454	0.2403	10	0.25106	T	0.35	.	19.7664	0.96346	0.0:0.0:1.0:0.0	.	350;314;309	G3XA98;G3V4U0;Q9UBX5	.;.;FBLN5_HUMAN	K	350;309;314	ENSP00000267620:Q350K;ENSP00000345008:Q309K;ENSP00000451982:Q314K	ENSP00000267620:Q406K	Q	-	1	0	FBLN5	91417453	1.000000	0.71417	0.985000	0.45067	0.908000	0.53690	8.009000	0.88606	2.735000	0.93741	0.655000	0.94253	CAA	FBLN5	-	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom	ENSG00000140092		0.527	FBLN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBLN5	HGNC	protein_coding	OTTHUMT00000411787.1	-	0.00	44	0	G			92347700	-1	tier1	-	no_errors	ENST00000342058	ensembl	human	known	74_37	missense	9.09	40	4	SNP	1.000	T
FBRSL1	57666	genome.wustl.edu	37	12	133067335	133067335	+	Missense_Mutation	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr12:133067335C>T	ENST00000434748.2	+	1	1199	c.179C>T	c.(178-180)gCg>gTg	p.A60V	FBRSL1_ENST00000261673.6_Intron	NM_001142641.1	NP_001136113.1	Q9HCM7	FBSL_HUMAN	fibrosin-like 1	60							poly(A) RNA binding (GO:0044822)			central_nervous_system(2)|endometrium(1)|stomach(1)	4						gccgcccccgcgccccgcacc	0.801																																																	0													1.0	1.0	1.0					12																	133067335		333	678	1011	SO:0001583	missense	0				CCDS45010.1	12q24.33	2008-12-09			ENSG00000112787	ENSG00000112787			29308	protein-coding gene	gene with protein product						10997877	Standard	NM_001142641		Approved	KIAA1545	uc001ukf.3	Q9HCM7	OTTHUMG00000167991	ENST00000434748.2:c.179C>T	12.37:g.133067335C>T	ENSP00000396160:p.Ala60Val		Q86XQ1	Missense_Mutation	SNP	prints_AUTS2	p.A60V	ENST00000434748.2	37	c.179	CCDS45010.1	12	.	.	.	.	.	.	.	.	.	.	C	11.33	1.606255	0.28623	.	.	ENSG00000112787	ENST00000434748	T	0.32023	1.47	3.63	2.63	0.31362	.	.	.	.	.	T	0.13884	0.0336	N	0.14661	0.345	0.23132	N	0.998247	P	0.36249	0.545	B	0.17722	0.019	T	0.07966	-1.0745	9	0.28530	T	0.3	.	9.9923	0.41879	0.0:0.791:0.209:0.0	.	60	Q9HCM7	FBSL_HUMAN	V	60	ENSP00000396160:A60V	ENSP00000396160:A60V	A	+	2	0	FBRSL1	131577408	0.996000	0.38824	0.754000	0.31244	0.722000	0.41435	0.264000	0.18497	1.539000	0.49286	0.416000	0.27883	GCG	FBRSL1	-	NULL	ENSG00000112787		0.801	FBRSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBRSL1	HGNC	protein_coding	OTTHUMT00000397404.2		0.00	11	0	C			133067335	+1			no_errors	ENST00000434748	ensembl	human	known	74_37	missense	55.56	8	10	SNP	0.106	T
FBXO6	26270	genome.wustl.edu	37	1	11732055	11732055	+	Missense_Mutation	SNP	C	C	T	rs572904941		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr1:11732055C>T	ENST00000376753.4	+	4	619	c.484C>T	c.(484-486)Cgg>Tgg	p.R162W		NM_018438.5	NP_060908.1	Q9NRD1	FBX6_HUMAN	F-box protein 6	162	FBA. {ECO:0000255|PROSITE- ProRule:PRU00482}.				DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glycoprotein catabolic process (GO:0006516)|proteolysis (GO:0006508)|response to unfolded protein (GO:0006986)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	carbohydrate binding (GO:0030246)|glycoprotein binding (GO:0001948)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|large_intestine(1)|lung(1)|ovary(1)|upper_aerodigestive_tract(2)	6	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.25e-06)|COAD - Colon adenocarcinoma(227;0.000251)|BRCA - Breast invasive adenocarcinoma(304;0.000297)|Kidney(185;0.000747)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0649)		AGACACATTCCGGCCGGACAT	0.577													C|||	1	0.000199681	0.0	0.0014	5008	,	,		20555	0.0		0.0	False		,,,				2504	0.0				NSCLC(54;506 1562 46490 51389)												0													208.0	140.0	163.0					1																	11732055		2203	4300	6503	SO:0001583	missense	0			AF129536	CCDS133.1	1p36.22	2008-05-14	2004-06-15		ENSG00000116663	ENSG00000116663		"""F-boxes /  ""other"""""	13585	protein-coding gene	gene with protein product		605647	"""F-box only protein 6"""			10531035, 10945468	Standard	NM_018438		Approved	FBX6, FBG2, FBS2, Fbx6b	uc001aso.3	Q9NRD1	OTTHUMG00000002229	ENST00000376753.4:c.484C>T	1.37:g.11732055C>T	ENSP00000365944:p.Arg162Trp		B1AK42|B2RC88|Q9UKT3	Missense_Mutation	SNP	pfam_F-box-assoc_dom,pfam_F-box_dom,superfamily_Galactose-bd-like,superfamily_F-box_dom,smart_F-box_dom,pfscan_F-box_dom,pfscan_F-box-assoc_dom	p.R162W	ENST00000376753.4	37	c.484	CCDS133.1	1	.	.	.	.	.	.	.	.	.	.	C	14.06	2.423646	0.43020	.	.	ENSG00000116663	ENST00000376753	T	0.33654	1.4	4.84	1.64	0.23874	Galactose-binding domain-like (1);F-box associated (FBA) domain (2);	0.056910	0.64402	D	0.000001	T	0.59838	0.2223	M	0.84433	2.695	0.33770	D	0.622918	D	0.89917	1.0	D	0.74348	0.983	T	0.73956	-0.3819	10	0.87932	D	0	.	11.7177	0.51663	0.4499:0.5501:0.0:0.0	.	162	Q9NRD1	FBX6_HUMAN	W	162	ENSP00000365944:R162W	ENSP00000365944:R162W	R	+	1	2	FBXO6	11654642	0.662000	0.27439	0.639000	0.29394	0.136000	0.21042	1.037000	0.30241	0.712000	0.32039	-0.268000	0.10319	CGG	FBXO6	-	pfam_F-box-assoc_dom,superfamily_Galactose-bd-like,pfscan_F-box-assoc_dom	ENSG00000116663		0.577	FBXO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO6	HGNC	protein_coding	OTTHUMT00000006332.1	-	0.00	103	0	C	NM_018438		11732055	+1	tier1	-	no_errors	ENST00000376753	ensembl	human	known	74_37	missense	5.69	116	7	SNP	0.618	T
FGF5	2250	genome.wustl.edu	37	4	81207618	81207618	+	Missense_Mutation	SNP	G	G	A	rs201557946		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr4:81207618G>A	ENST00000312465.7	+	3	825	c.599G>A	c.(598-600)cGa>cAa	p.R200Q	FGF5_ENST00000503413.1_3'UTR|FGF5_ENST00000456523.3_3'UTR	NM_004464.3	NP_004455.2	P12034	FGF5_HUMAN	fibroblast growth factor 5	200					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell differentiation (GO:0010001)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|signal transduction involved in regulation of gene expression (GO:0023019)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	fibroblast growth factor receptor binding (GO:0005104)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	22						AAAGCCAAACGAGGGTGCAGC	0.463																																																	0								G	GLN/ARG,	0,4406		0,0,2203	79.0	87.0	84.0		599,	5.8	0.0	4		84	2,8598	2.2+/-6.3	0,2,4298	yes	missense,utr-3	FGF5	NM_004464.3,NM_033143.2	43,	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,	200/269,	81207618	2,13004	2203	4300	6503	SO:0001583	missense	0			M23534	CCDS3586.1, CCDS34021.1	4q21	2014-01-30			ENSG00000138675	ENSG00000138675		"""Endogenous ligands"""	3683	protein-coding gene	gene with protein product		165190				3211147, 2577873	Standard	NM_001291812		Approved		uc003hmd.3	P12034	OTTHUMG00000130288	ENST00000312465.7:c.599G>A	4.37:g.81207618G>A	ENSP00000311697:p.Arg200Gln		B2R554|O75846|Q3Y8M3|Q8NF90	Missense_Mutation	SNP	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam,prints_Fibroblast_GF_fam,prints_IL-1_fam/FGF_fam	p.R200Q	ENST00000312465.7	37	c.599	CCDS34021.1	4	.	.	.	.	.	.	.	.	.	.	G	17.95	3.513278	0.64522	0.0	2.33E-4	ENSG00000138675	ENST00000312465	T	0.69306	-0.39	5.82	5.82	0.92795	.	0.043185	0.85682	D	0.000000	T	0.71829	0.3386	M	0.64080	1.96	0.80722	D	1	P	0.47034	0.889	P	0.45610	0.487	T	0.74881	-0.3513	10	0.72032	D	0.01	.	20.0851	0.97797	0.0:0.0:1.0:0.0	.	200	P12034	FGF5_HUMAN	Q	200	ENSP00000311697:R200Q	ENSP00000311697:R200Q	R	+	2	0	FGF5	81426642	1.000000	0.71417	0.041000	0.18516	0.243000	0.25628	5.827000	0.69300	2.758000	0.94735	0.650000	0.86243	CGA	FGF5	-	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam	ENSG00000138675		0.463	FGF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF5	HGNC	protein_coding	OTTHUMT00000252627.2	-	0.00	62	0	G			81207618	+1	tier1	rs201557946	no_errors	ENST00000312465	ensembl	human	known	74_37	missense	27.03	27	10	SNP	0.405	A
FGB	2244	genome.wustl.edu	37	4	155491731	155491731	+	Missense_Mutation	SNP	A	A	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr4:155491731A>C	ENST00000302068.4	+	8	1468	c.1405A>C	c.(1405-1407)Aat>Cat	p.N469H	FGB_ENST00000509493.1_Missense_Mutation_p.N250H|FGB_ENST00000502545.1_3'UTR	NM_005141.4	NP_005132.2	P02675	FIBB_HUMAN	fibrinogen beta chain	469	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|cellular response to interleukin-1 (GO:0071347)|cellular response to leptin stimulus (GO:0044320)|extracellular matrix organization (GO:0030198)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	chaperone binding (GO:0051087)|structural molecule activity (GO:0005198)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(2)|lung(22)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	AGTATGGATGAATTGGAAGGG	0.473																																					NSCLC(106;1133 1613 21870 46110 52656)												0													201.0	177.0	185.0					4																	155491731		2203	4300	6503	SO:0001583	missense	0				CCDS3786.1	4q28	2014-09-17			ENSG00000171564	ENSG00000171564		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3662	protein-coding gene	gene with protein product		134830	"""fibrinogen, B beta polypeptide"""				Standard	NM_005141		Approved		uc003ioa.4	P02675	OTTHUMG00000150331	ENST00000302068.4:c.1405A>C	4.37:g.155491731A>C	ENSP00000306099:p.Asn469His		A0JLR9|B2R7G3|Q32Q65|Q3KPF2	Missense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C_dom,pfam_Fibrinogen_a/b/g_coil_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	p.N469H	ENST00000302068.4	37	c.1405	CCDS3786.1	4	.	.	.	.	.	.	.	.	.	.	A	26.3	4.724133	0.89298	.	.	ENSG00000171564	ENST00000302068;ENST00000537843;ENST00000509493	T;T	0.76968	-1.06;-1.06	5.48	5.48	0.80851	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 2 (1);	0.000000	0.85682	D	0.000000	T	0.81322	0.4798	N	0.25245	0.725	0.80722	D	1	D;P	0.89917	1.0;0.939	D;P	0.97110	1.0;0.705	D	0.84241	0.0472	10	0.87932	D	0	.	15.868	0.79080	1.0:0.0:0.0:0.0	.	452;469	B4E1D3;P02675	.;FIBB_HUMAN	H	469;452;250	ENSP00000306099:N469H;ENSP00000426757:N250H	ENSP00000306099:N469H	N	+	1	0	FGB	155711181	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.248000	0.95456	2.220000	0.72140	0.533000	0.62120	AAT	FGB	-	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	ENSG00000171564		0.473	FGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGB	HGNC	protein_coding	OTTHUMT00000317595.1	-	0.00	161	0	A	NM_005141		155491731	+1	tier1	-	no_errors	ENST00000302068	ensembl	human	known	74_37	missense	50.45	55	56	SNP	1.000	C
FLG2	388698	genome.wustl.edu	37	1	152324362	152324362	+	Missense_Mutation	SNP	A	A	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr1:152324362A>G	ENST00000388718.5	-	3	5972	c.5900T>C	c.(5899-5901)gTc>gCc	p.V1967A	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	1967					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGTGTGTGAGACCCCTGAGGG	0.522																																																	0													355.0	331.0	339.0					1																	152324362		2203	4300	6503	SO:0001583	missense	0			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.5900T>C	1.37:g.152324362A>G	ENSP00000373370:p.Val1967Ala		Q9H4U1	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.V1967A	ENST00000388718.5	37	c.5900	CCDS30861.1	1	.	.	.	.	.	.	.	.	.	.	a	0.939	-0.710016	0.03230	.	.	ENSG00000143520	ENST00000388718	T	0.03689	3.84	4.23	-8.47	0.00939	.	.	.	.	.	T	0.00637	0.0021	L	0.55481	1.735	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.50423	-0.8830	9	0.08599	T	0.76	4.0714	2.5291	0.04698	0.1216:0.3935:0.2151:0.2697	.	1967	Q5D862	FILA2_HUMAN	A	1967	ENSP00000373370:V1967A	ENSP00000373370:V1967A	V	-	2	0	FLG2	150590986	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-4.326000	0.00252	-3.335000	0.00184	-2.359000	0.00239	GTC	FLG2	-	NULL	ENSG00000143520		0.522	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG2	HGNC	protein_coding	OTTHUMT00000034018.5	-	0.00	137	0	A	NM_001014342		152324362	-1	tier1	-	no_errors	ENST00000388718	ensembl	human	known	74_37	missense	15.32	92	17	SNP	0.000	G
FPGS	2356	genome.wustl.edu	37	9	130571165	130571165	+	Missense_Mutation	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr9:130571165C>T	ENST00000373247.2	+	11	1107	c.1057C>T	c.(1057-1059)Ctc>Ttc	p.L353F	FPGS_ENST00000373245.1_Silent_p.G303G|FPGS_ENST00000460181.1_3'UTR|FPGS_ENST00000393706.2_Missense_Mutation_p.L327F|FPGS_ENST00000373225.3_Missense_Mutation_p.L303F	NM_004957.4	NP_004948.4	Q05932	FOLC_HUMAN	folylpolyglutamate synthase	353					brain development (GO:0007420)|folic acid metabolic process (GO:0046655)|liver development (GO:0001889)|nucleobase-containing compound metabolic process (GO:0006139)|one-carbon metabolic process (GO:0006730)|organ regeneration (GO:0031100)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|tetrahydrofolylpolyglutamate synthase activity (GO:0004326)			endometrium(2)|kidney(1)|lung(3)|ovary(1)	7					Methotrexate(DB00563)|Pralatrexate(DB06813)|Raltitrexed(DB00293)	CCACATGCGGCTCGGTGAGTT	0.562																																																	0													19.0	20.0	20.0					9																	130571165		2182	4274	6456	SO:0001583	missense	0				CCDS35148.1, CCDS35149.1, CCDS75905.1	9q34.11	2013-09-19			ENSG00000136877	ENSG00000136877	6.3.2.17		3824	protein-coding gene	gene with protein product		136510					Standard	NM_004957		Approved		uc004bsg.1	Q05932	OTTHUMG00000020716	ENST00000373247.2:c.1057C>T	9.37:g.130571165C>T	ENSP00000362344:p.Leu353Phe		B3KPW4|B7Z2Z3|F5H0K6|Q5JU19|Q5JU22|Q6P2P6	Missense_Mutation	SNP	superfamily_Mur_ligase_cen,superfamily_Mur_ligase_C,tigrfam_Folylpolyglutamate_synth	p.L353F	ENST00000373247.2	37	c.1057	CCDS35148.1	9	.	.	.	.	.	.	.	.	.	.	C	13.41	2.227394	0.39399	.	.	ENSG00000136877	ENST00000373247;ENST00000393706;ENST00000373225	T;T;T	0.14144	2.94;2.94;2.53	4.79	4.79	0.61399	Mur ligase, central (1);	0.497317	0.23173	N	0.051110	T	0.13543	0.0328	L	0.32530	0.975	0.80722	D	1	B;B	0.23540	0.087;0.087	B;B	0.34652	0.142;0.187	T	0.06698	-1.0812	10	0.52906	T	0.07	-24.6709	9.4884	0.38944	0.0:0.9008:0.0:0.0992	.	327;353	Q05932-4;Q05932	.;FOLC_HUMAN	F	353;327;303	ENSP00000362344:L353F;ENSP00000377309:L327F;ENSP00000362322:L303F	ENSP00000362322:L303F	L	+	1	0	FPGS	129610986	0.027000	0.19231	0.591000	0.28745	0.859000	0.49053	1.325000	0.33724	2.389000	0.81357	0.462000	0.41574	CTC	FPGS	-	tigrfam_Folylpolyglutamate_synth	ENSG00000136877		0.562	FPGS-011	KNOWN	basic|appris_principal|CCDS	protein_coding	FPGS	HGNC	protein_coding	OTTHUMT00000054251.1	-	0.00	61	0	C			130571165	+1	tier1	-	no_errors	ENST00000373247	ensembl	human	known	74_37	missense	66.20	23	47	SNP	0.747	T
FSHR	2492	genome.wustl.edu	37	2	49191063	49191063	+	Silent	SNP	T	T	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:49191063T>C	ENST00000406846.2	-	10	1016	c.897A>G	c.(895-897)caA>caG	p.Q299Q	FSHR_ENST00000346173.3_Silent_p.Q237Q|FSHR_ENST00000304421.4_Silent_p.Q273Q|FSHR_ENST00000541117.1_Silent_p.Q35Q	NM_000145.3	NP_000136.2	P23945	FSHR_HUMAN	follicle stimulating hormone receptor	299					female gamete generation (GO:0007292)|female gonad development (GO:0008585)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor signaling pathway (GO:0007186)|gonad development (GO:0008406)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	follicle-stimulating hormone receptor activity (GO:0004963)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|liver(1)|lung(45)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	73		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)	AATCAACTTCTTGCCTTAAAA	0.388									Gonadal Dysgenesis, 46 XX																																								0													140.0	133.0	135.0					2																	49191063		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database			CCDS1843.1, CCDS1844.1, CCDS1844.2	2p21-p16	2014-09-17			ENSG00000170820	ENSG00000170820		"""GPCR / Class A : Gonadotropin and TSH receptors"""	3969	protein-coding gene	gene with protein product		136435		ODG1		8230163, 8855829	Standard	NM_000145		Approved	FSHRO, LGR1	uc002rww.3	P23945	OTTHUMG00000129259	ENST00000406846.2:c.897A>G	2.37:g.49191063T>C			A8K947|G5CBS7|G5E967|J3KQ00|Q05AH0|Q16225|Q4QRJ3|Q4ZFZ2|Q53RW2	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_GnHR_TM,pfam_LRR-contain_N,pfam_Leu-rich_rpt,smart_LRR-contain_N,pfscan_GPCR_Rhodpsn_7TM,prints_FSH_rcpt,prints_Gphrmn_rcpt_fam,prints_GPCR_Rhodpsn,prints_TSH_rcpt	p.Q299	ENST00000406846.2	37	c.897	CCDS1843.1	2																																																																																			FSHR	-	pfam_GnHR_TM,prints_FSH_rcpt	ENSG00000170820		0.388	FSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSHR	HGNC	protein_coding	OTTHUMT00000251367.2	-	0.00	43	0	T			49191063	-1	tier1	-	no_errors	ENST00000406846	ensembl	human	known	74_37	silent	21.05	29	8	SNP	1.000	C
FXR1	8087	genome.wustl.edu	37	3	180693971	180693971	+	Missense_Mutation	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr3:180693971C>T	ENST00000357559.4	+	17	2141	c.1757C>T	c.(1756-1758)gCt>gTt	p.A586V	FXR1_ENST00000445140.2_3'UTR|FXR1_ENST00000491062.1_3'UTR|FXR1_ENST00000305586.7_Missense_Mutation_p.A501V|FXR1_ENST00000480918.1_Missense_Mutation_p.A573V|FXR1_ENST00000468861.1_3'UTR	NM_001013438.2|NM_005087.3	NP_001013456.1|NP_005078.2	P51114	FXR1_HUMAN	fragile X mental retardation, autosomal homolog 1	586					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|negative regulation of translation (GO:0017148)	costamere (GO:0043034)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysome (GO:0005844)	G-quadruplex RNA binding (GO:0002151)|mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|endometrium(4)|large_intestine(5)|lung(12)|skin(2)	26	all_cancers(143;6.07e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.4e-22)			CCAACTAGTGCTTCTGGCGAT	0.403																																																	0													83.0	77.0	79.0					3																	180693971		2203	4300	6503	SO:0001583	missense	0			M67468	CCDS3238.1, CCDS33894.1, CCDS46965.1	3q28	2014-01-28			ENSG00000114416	ENSG00000114416			4023	protein-coding gene	gene with protein product		600819				7781595, 9642279	Standard	NM_005087		Approved		uc003fkq.3	P51114	OTTHUMG00000158138	ENST00000357559.4:c.1757C>T	3.37:g.180693971C>T	ENSP00000350170:p.Ala586Val		A8K9B8|Q7Z450|Q8N6R8	Missense_Mutation	SNP	pfam_Frag_X_MRP_fam,pfam_KH_dom_type_1,pfam_Agenet-like_dom,superfamily_NA-bd_OB-fold,smart_KH_dom,pfscan_KH_dom_type_1	p.A586V	ENST00000357559.4	37	c.1757	CCDS3238.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.37|11.37	1.619728|1.619728	0.28801|0.28801	.|.	.|.	ENSG00000114416|ENSG00000114416	ENST00000357559;ENST00000305586;ENST00000480918|ENST00000482125	T;T;T|.	0.32023|.	1.66;1.47;1.47|.	4.64|4.64	4.64|4.64	0.57946|0.57946	.|.	0.404179|.	0.25786|.	N|.	0.028311|.	T|T	0.45054|0.45054	0.1323|0.1323	N|N	0.22421|0.22421	0.69|0.69	0.37920|0.37920	D|D	0.931666|0.931666	B;B;B|.	0.02656|.	0.0;0.0;0.0|.	B;B;B|.	0.04013|.	0.001;0.001;0.0|.	T|T	0.43621|0.43621	-0.9380|-0.9380	10|5	0.32370|.	T|.	0.25|.	-32.1113|-32.1113	12.2335|12.2335	0.54500|0.54500	0.0:0.9176:0.0:0.0824|0.0:0.9176:0.0:0.0824	.|.	573;530;586|.	B4DXZ6;E7ERF5;P51114|.	.;.;FXR1_HUMAN|.	V|F	586;501;573|214	ENSP00000350170:A586V;ENSP00000307633:A501V;ENSP00000418097:A573V|.	ENSP00000307633:A501V|.	A|L	+|+	2|1	0|0	FXR1|FXR1	182176665|182176665	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	2.884000|2.884000	0.48562|0.48562	2.428000|2.428000	0.82296|0.82296	0.597000|0.597000	0.82753|0.82753	GCT|CTT	FXR1	-	NULL	ENSG00000114416		0.403	FXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FXR1	HGNC	protein_coding	OTTHUMT00000350265.5	-	0.00	67	0	C			180693971	+1	tier1	-	no_errors	ENST00000357559	ensembl	human	known	74_37	missense	26.32	42	15	SNP	1.000	T
GAB4	128954	genome.wustl.edu	37	22	17488927	17488927	+	Silent	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr22:17488927G>T	ENST00000400588.1	-	1	185	c.78C>A	c.(76-78)ccC>ccA	p.P26P	GAB4_ENST00000523144.1_5'Flank	NM_001037814.1	NP_001032903.1	Q2WGN9	GAB4_HUMAN	GRB2-associated binding protein family, member 4	26								p.P26L(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(24)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44		all_epithelial(15;0.112)|Lung NSC(13;0.248)				GGCCACTTCCGGGCCACGAAG	0.662																																																	1	Substitution - Missense(1)	skin(1)											15.0	19.0	17.0					22																	17488927		2072	4200	6272	SO:0001819	synonymous_variant	0			AK057252	CCDS42976.1	22q11.2	2013-01-10			ENSG00000215568	ENSG00000215568		"""Pleckstrin homology (PH) domain containing"""	18325	protein-coding gene	gene with protein product							Standard	NM_001037814		Approved		uc002zlw.3	Q2WGN9	OTTHUMG00000149992	ENST00000400588.1:c.78C>A	22.37:g.17488927G>T				Silent	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.P26	ENST00000400588.1	37	c.78	CCDS42976.1	22																																																																																			GAB4	-	NULL	ENSG00000215568		0.662	GAB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAB4	HGNC	protein_coding	OTTHUMT00000315426.1		0.00	40	0	G	XM_372882		17488927	-1			no_errors	ENST00000400588	ensembl	human	known	74_37	silent	9.68	27	3	SNP	0.011	T
GGCX	2677	genome.wustl.edu	37	2	85780094	85780094	+	Missense_Mutation	SNP	G	G	A	rs568608275		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:85780094G>A	ENST00000233838.4	-	9	1335	c.1255C>T	c.(1255-1257)Cgc>Tgc	p.R419C	GGCX_ENST00000473665.1_5'UTR|GGCX_ENST00000430215.3_Missense_Mutation_p.R362C	NM_000821.5	NP_000812.2	P38435	VKGC_HUMAN	gamma-glutamyl carboxylase	419					blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	gamma-glutamyl carboxylase activity (GO:0008488)			endometrium(3)|large_intestine(5)|lung(3)|ovary(1)|stomach(1)|urinary_tract(2)	15					Anisindione(DB01125)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Drotrecogin alfa(DB00055)|Menadione(DB00170)|Phylloquinone(DB01022)	TCGCCAGTGCGGCCATCACGG	0.537													G|||	1	0.000199681	0.0	0.0	5008	,	,		20179	0.001		0.0	False		,,,				2504	0.0																0													190.0	177.0	181.0					2																	85780094		2203	4300	6503	SO:0001583	missense	0				CCDS1978.1, CCDS46353.1	2p12	2008-05-21			ENSG00000115486	ENSG00000115486			4247	protein-coding gene	gene with protein product	"""vitamin K-dependent gamma-carboxylase"""	137167				1749935	Standard	NM_000821		Approved	VKCFD1	uc002sps.3	P38435	OTTHUMG00000130173	ENST00000233838.4:c.1255C>T	2.37:g.85780094G>A	ENSP00000233838:p.Arg419Cys		B4DMC5|E9PEE1|Q14415|Q6GU45	Missense_Mutation	SNP	pfam_VKG_COase,superfamily_RmlC_Cupin,smart_HTTM	p.R419C	ENST00000233838.4	37	c.1255	CCDS1978.1	2	.	.	.	.	.	.	.	.	.	.	G	17.55	3.416559	0.62511	.	.	ENSG00000115486	ENST00000233838;ENST00000430215	D;D	0.92199	-2.99;-2.99	5.54	5.54	0.83059	.	0.514767	0.22518	N	0.059007	D	0.89598	0.6761	N	0.19112	0.55	0.33386	D	0.575539	D;P;P	0.56746	0.977;0.938;0.919	P;P;P	0.53062	0.657;0.471;0.717	D	0.91978	0.5592	10	0.56958	D	0.05	-6.9394	11.9907	0.53173	0.0:0.0:0.827:0.173	.	362;258;419	E9PEE1;B4DQW4;P38435	.;.;VKGC_HUMAN	C	419;362	ENSP00000233838:R419C;ENSP00000408045:R362C	ENSP00000233838:R419C	R	-	1	0	GGCX	85633605	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	2.206000	0.42779	2.601000	0.87937	0.655000	0.94253	CGC	GGCX	-	pfam_VKG_COase	ENSG00000115486		0.537	GGCX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GGCX	HGNC	protein_coding	OTTHUMT00000252490.3	-	0.00	85	0	G	NM_000821		85780094	-1	tier1	-	no_errors	ENST00000233838	ensembl	human	known	74_37	missense	15.12	73	13	SNP	1.000	A
GNAS	2778	genome.wustl.edu	37	20	57430180	57430180	+	Missense_Mutation	SNP	C	C	T	rs199549396		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr20:57430180C>T	ENST00000306120.3	+	1	1670	c.1670C>T	c.(1669-1671)tCg>tTg	p.S557L	GNAS_ENST00000371098.2_Intron|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000371099.2_Silent_p.F620F|GNAS_ENST00000313949.7_Intron|GNAS_ENST00000371075.3_Intron|GNAS_ENST00000371100.4_Silent_p.F620F|GNAS_ENST00000371102.4_Silent_p.F620F			P63092	GNAS2_HUMAN	GNAS complex locus	0					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			GGGGCTGCTTCGGTCGATCTG	0.617			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)			Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	0													24.0	29.0	27.0					20																	57430180		1960	4149	6109	SO:0001583	missense	0			M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000306120.3:c.1670C>T	20.37:g.57430180C>T	ENSP00000302237:p.Ser557Leu		A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	NULL	p.S557L	ENST00000306120.3	37	c.1670		20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.29|13.29	2.194405|2.194405	0.38806|0.38806	.|.	.|.	ENSG00000087460|ENSG00000087460	ENST00000450130|ENST00000306120	.|.	.|.	.|.	3.84|3.84	1.88|1.88	0.25563|0.25563	.|.	.|.	.|.	.|.	.|.	T|T	0.39759|0.39759	0.1090|0.1090	.|.	.|.	.|.	0.21527|0.21527	N|N	0.999653|0.999653	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.34453|0.34453	-0.9828|-0.9828	4|5	.|0.72032	.|D	.|0.01	.|.	5.882|5.882	0.18860|0.18860	0.0:0.7526:0.0:0.2474|0.0:0.7526:0.0:0.2474	.|.	.|.	.|.	.|.	W|L	7|557	.|.	.|ENSP00000302237:S557L	R|S	+|+	1|2	2|0	GNAS|GNAS	56863575|56863575	0.342000|0.342000	0.24809|0.24809	0.713000|0.713000	0.30519|0.30519	0.293000|0.293000	0.27360|0.27360	0.029000|0.029000	0.13666|0.13666	0.401000|0.401000	0.25424|0.25424	0.462000|0.462000	0.41574|0.41574	CGG|TCG	GNAS	-	NULL	ENSG00000087460		0.617	GNAS-050	PUTATIVE	basic	protein_coding	GNAS	HGNC	protein_coding	OTTHUMT00000267987.1	-	0.00	86	0	C	NM_000516		57430180	+1	tier1	-	no_errors	ENST00000306120	ensembl	human	putative	74_37	missense	7.87	82	7	SNP	0.081	T
GNG8	94235	genome.wustl.edu	37	19	47137887	47137887	+	Missense_Mutation	SNP	A	A	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr19:47137887A>T	ENST00000300873.4	-	1	55	c.53T>A	c.(52-54)cTg>cAg	p.L18Q		NM_033258.1	NP_150283.1	O14610	GBGT2_HUMAN	guanine nucleotide binding protein (G protein), gamma 8	18					G-protein coupled receptor signaling pathway (GO:0007186)|GTP catabolic process (GO:0006184)|phototransduction (GO:0007602)|synaptic transmission (GO:0007268)	heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	GTPase activity (GO:0003924)|signal transducer activity (GO:0004871)						Ovarian(192;0.0798)|all_neural(266;0.107)		OV - Ovarian serous cystadenocarcinoma(262;0.000322)|all cancers(93;0.000621)|Epithelial(262;0.0171)|GBM - Glioblastoma multiforme(486;0.0325)		CTCCAGCTTCAGCTGTTCCAC	0.652																																					Colon(120;3580 4883)												0													57.0	49.0	52.0					19																	47137887		2203	4300	6503	SO:0001583	missense	0			AF493875	CCDS12687.1	19q13.32	2008-07-10				ENSG00000167414			19664	protein-coding gene	gene with protein product						10819326	Standard	NM_033258		Approved		uc010xyd.2	Q9UK08		ENST00000300873.4:c.53T>A	19.37:g.47137887A>T	ENSP00000300873:p.Leu18Gln		B2R746|D3DTW5	Missense_Mutation	SNP	pfam_G-protein_gamma-like_dom,superfamily_G-protein_gamma-like_dom,smart_G-protein_gamma-like_dom,pfscan_G-protein_gamma-like_dom,prints_Gprotein-gamma	p.L18Q	ENST00000300873.4	37	c.53	CCDS12687.1	19	.	.	.	.	.	.	.	.	.	.	A	27.1	4.804282	0.90623	.	.	ENSG00000167414	ENST00000300873	T	0.55413	0.52	4.65	4.65	0.58169	G-protein gamma domain (5);	0.000000	0.56097	D	0.000038	T	0.66479	0.2793	.	.	.	0.58432	D	0.999996	D	0.61697	0.99	P	0.60286	0.872	T	0.70828	-0.4766	9	0.87932	D	0	-22.8084	10.3886	0.44156	1.0:0.0:0.0:0.0	.	18	Q9UK08	GBG8_HUMAN	Q	18	ENSP00000300873:L18Q	ENSP00000300873:L18Q	L	-	2	0	GNG8	51829727	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.093000	0.64517	1.962000	0.57031	0.379000	0.24179	CTG	GNG8	-	pfam_G-protein_gamma-like_dom,superfamily_G-protein_gamma-like_dom,smart_G-protein_gamma-like_dom,pfscan_G-protein_gamma-like_dom,prints_Gprotein-gamma	ENSG00000167414		0.652	GNG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNG8	HGNC	protein_coding	OTTHUMT00000466587.1	-	0.00	93	0	A			47137887	-1	tier1	-	no_errors	ENST00000300873	ensembl	human	known	74_37	missense	18.52	66	15	SNP	1.000	T
GPD2	2820	genome.wustl.edu	37	2	157406233	157406233	+	Missense_Mutation	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:157406233C>A	ENST00000310454.6	+	7	1147	c.775C>A	c.(775-777)Cag>Aag	p.Q259K	GPD2_ENST00000438166.2_Missense_Mutation_p.Q259K|GPD2_ENST00000409674.1_Missense_Mutation_p.Q259K|GPD2_ENST00000409125.4_Missense_Mutation_p.Q32K|GPD2_ENST00000540309.1_Missense_Mutation_p.Q259K	NM_001083112.2	NP_001076581.2	P43304	GPDM_HUMAN	glycerol-3-phosphate dehydrogenase 2 (mitochondrial)	259					camera-type eye development (GO:0043010)|cellular lipid metabolic process (GO:0044255)|gluconeogenesis (GO:0006094)|glycerol catabolic process (GO:0019563)|glycerol-3-phosphate metabolic process (GO:0006072)|multicellular organism growth (GO:0035264)|small molecule metabolic process (GO:0044281)	glycerol-3-phosphate dehydrogenase complex (GO:0009331)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|glycerol-3-phosphate dehydrogenase activity (GO:0004368)|sn-glycerol-3-phosphate:ubiquinone-8 oxidoreductase activity (GO:0052591)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(1)|stomach(1)	22						GACAGACCCCCAGACAGGGAA	0.547																																																	0													72.0	68.0	69.0					2																	157406233		2203	4300	6503	SO:0001583	missense	0				CCDS2202.1	2q24.1	2013-01-10			ENSG00000115159	ENSG00000115159	1.1.1.8	"""EF-hand domain containing"""	4456	protein-coding gene	gene with protein product		138430					Standard	NM_001083112		Approved		uc002tzd.4	P43304	OTTHUMG00000131951	ENST00000310454.6:c.775C>A	2.37:g.157406233C>A	ENSP00000308610:p.Gln259Lys		A8K4V0|B3KSA9|Q59FR1|Q9HAP9	Missense_Mutation	SNP	pfam_FAD-dep_OxRdtase,pfam_FAD_bind_dom,smart_EF_hand_dom,pfscan_EF_hand_dom,prints_G3P_DH_FAD-dep	p.Q259K	ENST00000310454.6	37	c.775	CCDS2202.1	2	.	.	.	.	.	.	.	.	.	.	C	4.858	0.159543	0.09287	.	.	ENSG00000115159	ENST00000310454;ENST00000409125;ENST00000438166;ENST00000540309;ENST00000409674	T;T;T;T;T	0.55930	0.49;0.75;0.49;1.03;0.49	5.91	-2.61	0.06171	FAD dependent oxidoreductase (1);	0.757271	0.13588	N	0.376834	T	0.23688	0.0573	N	0.02345	-0.59	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.21042	-1.0257	10	0.11182	T	0.66	.	15.7382	0.77863	0.24:0.1547:0.6053:0.0	.	259	P43304	GPDM_HUMAN	K	259;32;259;259;259	ENSP00000308610:Q259K;ENSP00000386484:Q32K;ENSP00000409708:Q259K;ENSP00000440892:Q259K;ENSP00000386425:Q259K	ENSP00000308610:Q259K	Q	+	1	0	GPD2	157114479	0.000000	0.05858	0.002000	0.10522	0.988000	0.76386	-0.709000	0.05030	-0.448000	0.07128	0.650000	0.86243	CAG	GPD2	-	pfam_FAD-dep_OxRdtase	ENSG00000115159		0.547	GPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPD2	HGNC	protein_coding	OTTHUMT00000254910.3	-	0.00	67	0	C			157406233	+1	tier1	-	no_errors	ENST00000310454	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.000	A
GPR162	27239	genome.wustl.edu	37	12	6933275	6933275	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr12:6933275G>T	ENST00000311268.3	+	2	998	c.211G>T	c.(211-213)Gcc>Tcc	p.A71S	GPR162_ENST00000382315.3_Intron|GPR162_ENST00000428545.2_Intron|GPR162_ENST00000541431.1_3'UTR	NM_019858.1	NP_062832.1	Q16538	GP162_HUMAN	G protein-coupled receptor 162	71						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(2)|skin(1)	18						CACCACCTTTGCCGTGGTGCA	0.597																																																	0													92.0	72.0	79.0					12																	6933275		2203	4300	6503	SO:0001583	missense	0			U47928, U47929, U47924, U47925	CCDS8563.1, CCDS44819.1	12p13	2012-08-21						"""GPCR / Class A : Orphans"""	16693	protein-coding gene	gene with protein product						15777626	Standard	NM_014449		Approved	A-2, GRCA	uc001qqw.1	Q16538		ENST00000311268.3:c.211G>T	12.37:g.6933275G>T	ENSP00000311528:p.Ala71Ser		Q16664|Q59EH5|Q66K56	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPR162,prints_GCR_153/162	p.A71S	ENST00000311268.3	37	c.211	CCDS8563.1	12	.	.	.	.	.	.	.	.	.	.	G	6.394	0.440739	0.12104	.	.	ENSG00000250510	ENST00000311268	T	0.38401	1.14	4.28	4.28	0.50868	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.15825	0.0381	N	0.02916	-0.46	0.80722	D	1	P;P	0.36909	0.573;0.573	B;B	0.33568	0.166;0.117	T	0.11792	-1.0573	9	0.33141	T	0.24	.	12.056	0.53536	0.0:0.0:0.8277:0.1723	.	71;71	B7Z3U3;Q16538	.;GP162_HUMAN	S	71	ENSP00000311528:A71S	ENSP00000311528:A71S	A	+	1	0	GPR162	6803536	1.000000	0.71417	0.394000	0.26270	0.089000	0.18198	5.678000	0.68153	2.226000	0.72624	0.491000	0.48974	GCC	GPR162	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GCR_153/162	ENSG00000250510		0.597	GPR162-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR162	HGNC	protein_coding	OTTHUMT00000399478.1	-	0.00	38	0	G	NM_019858		6933275	+1	tier1	-	no_errors	ENST00000311268	ensembl	human	known	74_37	missense	8.89	41	4	SNP	0.940	T
GPR26	2849	genome.wustl.edu	37	10	125434382	125434382	+	Silent	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr10:125434382C>T	ENST00000284674.1	+	2	770	c.717C>T	c.(715-717)gcC>gcT	p.A239A		NM_153442.3	NP_703143.1	Q8NDV2	GPR26_HUMAN	G protein-coupled receptor 26	239					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(3)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	20		Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)				GACAGCGAGCCACCAAGAAGA	0.567																																																	0													190.0	144.0	160.0					10																	125434382		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS7636.1	10q26.2-q26.3	2012-08-21			ENSG00000154478	ENSG00000154478		"""GPCR / Class A : Orphans"""	4481	protein-coding gene	gene with protein product		604847					Standard	NM_153442		Approved		uc001lhh.3	Q8NDV2	OTTHUMG00000019204	ENST00000284674.1:c.717C>T	10.37:g.125434382C>T			Q2M2E2	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.A239	ENST00000284674.1	37	c.717	CCDS7636.1	10																																																																																			GPR26	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000154478		0.567	GPR26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR26	HGNC	protein_coding	OTTHUMT00000050850.1	-	0.00	48	0	C			125434382	+1	tier1	-	no_errors	ENST00000284674	ensembl	human	known	74_37	silent	40.00	21	14	SNP	1.000	T
GPR45	11250	genome.wustl.edu	37	2	105859310	105859310	+	Missense_Mutation	SNP	G	G	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:105859310G>A	ENST00000258456.1	+	1	1111	c.995G>A	c.(994-996)cGc>cAc	p.R332H		NM_007227.3	NP_009158.3	Q9Y5Y3	GPR45_HUMAN	G protein-coupled receptor 45	332						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R332H(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	28						AAAAAATTCCGCGAGGCCTGC	0.557																																																	1	Substitution - Missense(1)	stomach(1)											82.0	87.0	85.0					2																	105859310		2203	4300	6503	SO:0001583	missense	0			AF118266	CCDS2066.1	2q11.1-q12	2012-08-21			ENSG00000135973	ENSG00000135973		"""GPCR / Class A : Orphans"""	4503	protein-coding gene	gene with protein product		604838				10036181	Standard	NM_007227		Approved	PSP24, PSP24A	uc002tco.1	Q9Y5Y3	OTTHUMG00000130805	ENST00000258456.1:c.995G>A	2.37:g.105859310G>A	ENSP00000258456:p.Arg332His		Q6NWS4|Q6NXU6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.R332H	ENST00000258456.1	37	c.995	CCDS2066.1	2	.	.	.	.	.	.	.	.	.	.	G	16.05	3.012829	0.54468	.	.	ENSG00000135973	ENST00000258456	T	0.58358	0.34	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.48059	0.1479	L	0.28115	0.83	0.54753	D	0.999987	P	0.51240	0.943	P	0.47786	0.557	T	0.40924	-0.9537	10	0.33940	T	0.23	-27.9142	17.2936	0.87163	0.0:0.0:1.0:0.0	.	332	Q9Y5Y3	GPR45_HUMAN	H	332	ENSP00000258456:R332H	ENSP00000258456:R332H	R	+	2	0	GPR45	105225742	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	6.545000	0.73883	2.696000	0.92011	0.456000	0.33151	CGC	GPR45	-	pfam_7TM_GPCR_olfarory/Srsx,prints_GPCR_Rhodpsn	ENSG00000135973		0.557	GPR45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR45	HGNC	protein_coding	OTTHUMT00000253348.1	-	0.00	62	0	G	NM_007227		105859310	+1	tier1	-	no_errors	ENST00000258456	ensembl	human	known	74_37	missense	37.50	35	21	SNP	1.000	A
GPR83	10888	genome.wustl.edu	37	11	94113933	94113933	+	Silent	SNP	G	G	A	rs61734489	byFrequency	TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr11:94113933G>A	ENST00000243673.2	-	4	825	c.654C>T	c.(652-654)gaC>gaT	p.D218D	GPR83_ENST00000539203.2_Silent_p.D176D	NM_016540.3	NP_057624.3	Q9NYM4	GPR83_HUMAN	G protein-coupled receptor 83	218					response to glucocorticoid (GO:0051384)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide Y receptor activity (GO:0004983)			NS(1)|breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)	19		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				AGCGCACAATGTCCTCACTGG	0.572																																																	0													55.0	55.0	55.0					11																	94113933		2201	4298	6499	SO:0001819	synonymous_variant	0			AF236081	CCDS8297.1	11q21	2012-08-21	2003-07-30	2003-08-01	ENSG00000123901	ENSG00000123901		"""GPCR / Class A : Orphans"""	4523	protein-coding gene	gene with protein product		605569	"""G protein-coupled receptor 72"""	GPR72		10760605, 11060465	Standard	NM_016540		Approved		uc001pet.2	Q9NYM4	OTTHUMG00000167779	ENST00000243673.2:c.654C>T	11.37:g.94113933G>A			B0M0K5|Q6NWR4|Q9P1Y8	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_NPY_rcpt	p.D218	ENST00000243673.2	37	c.654	CCDS8297.1	11																																																																																			GPR83	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000123901		0.572	GPR83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR83	HGNC	protein_coding	OTTHUMT00000396232.1	-	0.00	29	0	G	NM_016540		94113933	-1	tier1	-	no_errors	ENST00000243673	ensembl	human	known	74_37	silent	26.47	50	18	SNP	0.002	A
GRIA2	2891	genome.wustl.edu	37	4	158234006	158234006	+	Missense_Mutation	SNP	A	A	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr4:158234006A>T	ENST00000264426.9	+	4	924	c.645A>T	c.(643-645)aaA>aaT	p.K215N	GRIA2_ENST00000507898.1_Missense_Mutation_p.K168N|GRIA2_ENST00000393815.2_Missense_Mutation_p.K168N|GRIA2_ENST00000296526.7_Missense_Mutation_p.K215N|GRIA2_ENST00000449365.1_Missense_Mutation_p.K168N	NM_001083619.1	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2	215					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(2)|lung(32)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	79	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	AAAGGGATAAAGTAAACGACA	0.363																																																	0													106.0	110.0	109.0					4																	158234006		2203	4300	6503	SO:0001583	missense	0				CCDS3797.1, CCDS43274.1, CCDS43275.1	4q32.1	2012-08-29			ENSG00000120251	ENSG00000120251		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4572	protein-coding gene	gene with protein product		138247		GLUR2		1311100	Standard	NM_001083619		Approved	GluA2, GLURB	uc003ipl.4	P42262	OTTHUMG00000133836	ENST00000264426.9:c.645A>T	4.37:g.158234006A>T	ENSP00000264426:p.Lys215Asn		A8MT92|I6L997|Q96FP6	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.K215N	ENST00000264426.9	37	c.645	CCDS43274.1	4	.	.	.	.	.	.	.	.	.	.	A	22.1	4.249078	0.80024	.	.	ENSG00000120251	ENST00000507898;ENST00000393815;ENST00000296526;ENST00000264426;ENST00000449365;ENST00000503437	D;D;D;D;D;D	0.82803	-1.65;-1.65;-1.65;-1.65;-1.65;-1.65	5.56	3.18	0.36537	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.84401	0.5464	L	0.36672	1.1	0.80722	D	1	D;D;D	0.71674	0.989;0.978;0.998	P;B;D	0.77557	0.808;0.333;0.99	T	0.82096	-0.0626	10	0.40728	T	0.16	.	9.3731	0.38266	0.8561:0.0:0.1439:0.0	.	215;215;168	P42262;P42262-2;A8MT92	GRIA2_HUMAN;.;.	N	168;168;215;215;168;88	ENSP00000426845:K168N;ENSP00000377403:K168N;ENSP00000296526:K215N;ENSP00000264426:K215N;ENSP00000389837:K168N;ENSP00000426784:K88N	ENSP00000264426:K215N	K	+	3	2	GRIA2	158453456	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	4.982000	0.63825	0.953000	0.37825	-0.371000	0.07208	AAA	GRIA2	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I	ENSG00000120251		0.363	GRIA2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA2	HGNC	protein_coding	OTTHUMT00000258367.2	-	0.00	60	0	A			158234006	+1	tier1	-	no_errors	ENST00000264426	ensembl	human	known	74_37	missense	24.59	46	15	SNP	1.000	T
GRIA2	2891	genome.wustl.edu	37	4	158257857	158257857	+	Missense_Mutation	SNP	C	C	A	rs267600059		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr4:158257857C>A	ENST00000264426.9	+	11	2081	c.1802C>A	c.(1801-1803)tCc>tAc	p.S601Y	GRIA2_ENST00000507898.1_Missense_Mutation_p.S554Y|GRIA2_ENST00000393815.2_Missense_Mutation_p.S554Y|GRIA2_ENST00000296526.7_Missense_Mutation_p.S601Y|GRIA2_ENST00000449365.1_Missense_Mutation_p.S554Y	NM_001083619.1	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2	601					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.S601F(2)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(2)|lung(32)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	79	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	CTCTGGTTTTCCTTGGGTGCC	0.433																																																	2	Substitution - Missense(2)	skin(2)											133.0	136.0	135.0					4																	158257857		2203	4300	6503	SO:0001583	missense	0				CCDS3797.1, CCDS43274.1, CCDS43275.1	4q32.1	2012-08-29			ENSG00000120251	ENSG00000120251		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4572	protein-coding gene	gene with protein product		138247		GLUR2		1311100	Standard	NM_001083619		Approved	GluA2, GLURB	uc003ipl.4	P42262	OTTHUMG00000133836	ENST00000264426.9:c.1802C>A	4.37:g.158257857C>A	ENSP00000264426:p.Ser601Tyr		A8MT92|I6L997|Q96FP6	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.S601Y	ENST00000264426.9	37	c.1802	CCDS43274.1	4	.	.	.	.	.	.	.	.	.	.	C	22.3	4.265908	0.80358	.	.	ENSG00000120251	ENST00000507898;ENST00000393815;ENST00000296526;ENST00000264426;ENST00000449365	T;T;T;T;T	0.29142	1.58;1.58;1.58;1.58;1.58	5.66	5.66	0.87406	Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.65154	0.2664	M	0.89353	3.025	0.80722	D	1	B;D;D	0.76494	0.14;0.999;0.998	B;D;D	0.91635	0.137;0.999;0.996	T	0.70414	-0.4878	10	0.87932	D	0	.	20.1041	0.97884	0.0:1.0:0.0:0.0	.	601;601;554	P42262;P42262-2;A8MT92	GRIA2_HUMAN;.;.	Y	554;554;601;601;554	ENSP00000426845:S554Y;ENSP00000377403:S554Y;ENSP00000296526:S601Y;ENSP00000264426:S601Y;ENSP00000389837:S554Y	ENSP00000264426:S601Y	S	+	2	0	GRIA2	158477307	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.776000	0.85560	2.826000	0.97356	0.655000	0.94253	TCC	GRIA2	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000120251		0.433	GRIA2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA2	HGNC	protein_coding	OTTHUMT00000258367.2		0.00	62	0	C			158257857	+1			no_errors	ENST00000264426	ensembl	human	known	74_37	missense	6.45	29	2	SNP	1.000	A
GRM5	2915	genome.wustl.edu	37	11	88337964	88337964	+	Missense_Mutation	SNP	T	T	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr11:88337964T>C	ENST00000305447.4	-	4	1465	c.1316A>G	c.(1315-1317)gAg>gGg	p.E439G	GRM5_ENST00000418177.2_Missense_Mutation_p.E439G|GRM5_ENST00000455756.2_Missense_Mutation_p.E439G|GRM5_ENST00000393297.1_Missense_Mutation_p.E439G|GRM5_ENST00000305432.5_Missense_Mutation_p.E439G	NM_001143831.2	NP_001137303.1	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5	439					activation of MAPKKK activity (GO:0000185)|cognition (GO:0050890)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|learning (GO:0007612)|locomotory behavior (GO:0007626)|negative regulation of locomotion (GO:0040013)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(1)|breast(5)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(18)|lung(40)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)|Rufinamide(DB06201)	CATCAGGGACTCCAAAAGTTT	0.478																																																	0													71.0	69.0	69.0					11																	88337964		2201	4299	6500	SO:0001583	missense	0			D28538	CCDS8283.1, CCDS44694.1	11q14.3	2014-06-12			ENSG00000168959	ENSG00000168959		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4597	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 86"""	604102				7908515	Standard	NM_001143831		Approved	MGLUR5, GPRC1E, mGlu5, PPP1R86	uc001pcq.3	P41594	OTTHUMG00000134306	ENST00000305447.4:c.1316A>G	11.37:g.88337964T>C	ENSP00000306138:p.Glu439Gly		Q6J164	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_Metabotropic_Glu_rcpt_Homer-bd,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,prints_GPCR_3_mtglu_rcpt_5,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_1,pfscan_GPCR_3_C	p.E439G	ENST00000305447.4	37	c.1316	CCDS44694.1	11	.	.	.	.	.	.	.	.	.	.	T	23.0	4.363269	0.82353	.	.	ENSG00000168959	ENST00000418177;ENST00000455756;ENST00000305432;ENST00000305447;ENST00000393297	D;D;D;D;D	0.84070	-1.8;-1.8;-1.8;-1.8;-1.8	5.77	5.77	0.91146	Extracellular ligand-binding receptor (1);	0.176771	0.64402	D	0.000012	T	0.74306	0.3699	L	0.33293	1	0.58432	D	0.99999	B;B	0.33549	0.417;0.117	B;B	0.28011	0.085;0.044	T	0.72225	-0.4355	9	.	.	.	.	16.0872	0.81065	0.0:0.0:0.0:1.0	.	439;439	P41594-2;P41594	.;GRM5_HUMAN	G	439	ENSP00000402912:E439G;ENSP00000405690:E439G;ENSP00000305905:E439G;ENSP00000306138:E439G;ENSP00000376975:E439G	.	E	-	2	0	GRM5	87977612	1.000000	0.71417	0.995000	0.50966	0.983000	0.72400	8.040000	0.89188	2.207000	0.71202	0.366000	0.22137	GAG	GRM5	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I	ENSG00000168959		0.478	GRM5-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRM5	HGNC	protein_coding	OTTHUMT00000259226.1	-	0.00	94	0	T	NM_000842		88337964	-1	tier1	-	no_errors	ENST00000305447	ensembl	human	known	74_37	missense	10.83	107	13	SNP	0.999	C
GRIA4	2893	genome.wustl.edu	37	11	105623793	105623793	+	Missense_Mutation	SNP	G	G	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr11:105623793G>A	ENST00000530497.1	+	3	334	c.334G>A	c.(334-336)Gcc>Acc	p.A112T	GRIA4_ENST00000393125.2_Missense_Mutation_p.A112T|GRIA4_ENST00000525187.1_Missense_Mutation_p.A112T|GRIA4_ENST00000393127.2_Missense_Mutation_p.A112T|GRIA4_ENST00000282499.5_Missense_Mutation_p.A112T|GRIA4_ENST00000428631.2_Missense_Mutation_p.A112T			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	112					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		ATTCTGCAGCGCCTTACATAT	0.463																																																	0													166.0	138.0	147.0					11																	105623793		2202	4299	6501	SO:0001583	missense	0			U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.334G>A	11.37:g.105623793G>A	ENSP00000435775:p.Ala112Thr		Q86XE8	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.A112T	ENST00000530497.1	37	c.334	CCDS8333.1	11	.	.	.	.	.	.	.	.	.	.	G	14.99	2.700068	0.48307	.	.	ENSG00000152578	ENST00000393125;ENST00000282499;ENST00000393127;ENST00000428631;ENST00000531011;ENST00000530497;ENST00000525187	D;D;D;D;D;D;D	0.82711	-1.64;-1.64;-1.64;-1.64;-1.64;-1.64;-1.64	5.51	5.51	0.81932	Extracellular ligand-binding receptor (1);	0.000000	0.64402	D	0.000004	D	0.84433	0.5471	N	0.13043	0.29	0.80722	D	1	D;D;D;D	0.89917	0.973;1.0;1.0;0.984	B;D;D;P	0.91635	0.435;0.998;0.999;0.65	D	0.83905	0.0292	10	0.30854	T	0.27	.	19.4315	0.94772	0.0:0.0:1.0:0.0	.	112;112;142;112	P48058;G3V164;Q59GL7;Q86XE8	GRIA4_HUMAN;.;.;.	T	112	ENSP00000376833:A112T;ENSP00000282499:A112T;ENSP00000376835:A112T;ENSP00000415551:A112T;ENSP00000432443:A112T;ENSP00000435775:A112T;ENSP00000432180:A112T	ENSP00000282499:A112T	A	+	1	0	GRIA4	105129003	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.600000	0.87896	0.655000	0.94253	GCC	GRIA4	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I	ENSG00000152578		0.463	GRIA4-005	KNOWN	basic|CCDS	protein_coding	GRIA4	HGNC	protein_coding	OTTHUMT00000388593.1	-	0.00	106	0	G			105623793	+1	tier1	-	no_errors	ENST00000282499	ensembl	human	known	74_37	missense	53.28	57	65	SNP	1.000	A
GRXCR1	389207	genome.wustl.edu	37	4	42895288	42895288	+	Missense_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr4:42895288T>G	ENST00000399770.2	+	1	5	c.5T>G	c.(4-6)cTt>cGt	p.L2R	RN7SKP82_ENST00000516786.1_RNA	NM_001080476.2	NP_001073945.1	A8MXD5	GRCR1_HUMAN	glutaredoxin, cysteine rich 1	2					auditory receptor cell differentiation (GO:0042491)|cell redox homeostasis (GO:0045454)|inner ear receptor cell development (GO:0060119)|inner ear receptor stereocilium organization (GO:0060122)|negative regulation of phosphatase activity (GO:0010923)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of sound (GO:0007605)|vestibular receptor cell development (GO:0060118)	kinocilium (GO:0060091)|stereocilium (GO:0032420)	electron carrier activity (GO:0009055)|protein disulfide oxidoreductase activity (GO:0015035)	p.L2H(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(22)|ovary(1)|prostate(2)|skin(1)	32						GTGACCATGCTTAAAAGGGAG	0.488																																																	1	Substitution - Missense(1)	ovary(1)											84.0	89.0	87.0					4																	42895288		2024	4187	6211	SO:0001583	missense	0				CCDS43225.1	4p14	2014-06-12			ENSG00000215203	ENSG00000215203			31673	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 88"""	613283	"""deafness, autosomal recessive 25"""	DFNB25		20137778	Standard	NM_001080476		Approved	PPP1R88	uc003gwt.3	A8MXD5	OTTHUMG00000160434	ENST00000399770.2:c.5T>G	4.37:g.42895288T>G	ENSP00000382670:p.Leu2Arg			Missense_Mutation	SNP	pfam_Glutaredoxin,superfamily_Thioredoxin-like_fold,superfamily_HSP_DnaJ_Cys-rich_dom	p.L2R	ENST00000399770.2	37	c.5	CCDS43225.1	4	.	.	.	.	.	.	.	.	.	.	T	10.43	1.347674	0.24426	.	.	ENSG00000215203	ENST00000399770	T	0.32988	1.43	5.61	5.61	0.85477	.	0.417188	0.21838	U	0.068375	T	0.26122	0.0637	N	0.22421	0.69	0.21499	N	0.999663	B	0.32693	0.38	B	0.35607	0.206	T	0.28332	-1.0047	10	0.66056	D	0.02	-1.9946	15.0009	0.71469	0.0:0.0:0.0:1.0	.	2	A8MXD5	GRCR1_HUMAN	R	2	ENSP00000382670:L2R	ENSP00000382670:L2R	L	+	2	0	GRXCR1	42590045	0.995000	0.38212	0.830000	0.32933	0.006000	0.05464	5.558000	0.67319	2.135000	0.66039	0.528000	0.53228	CTT	GRXCR1	-	NULL	ENSG00000215203		0.488	GRXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRXCR1	HGNC	protein_coding	OTTHUMT00000360576.1		0.00	55	0	T	NM_001080476		42895288	+1			no_errors	ENST00000399770	ensembl	human	known	74_37	missense	5.88	48	3	SNP	0.423	G
GTF3C1	2975	genome.wustl.edu	37	16	27495595	27495595	+	Missense_Mutation	SNP	G	G	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr16:27495595G>A	ENST00000356183.4	-	25	3953	c.3938C>T	c.(3937-3939)tCt>tTt	p.S1313F	GTF3C1_ENST00000561623.1_Missense_Mutation_p.S1313F	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	1313					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						AACGGAATGAGATGTTTTATC	0.498																																																	0													138.0	127.0	131.0					16																	27495595		2197	4300	6497	SO:0001583	missense	0			U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.3938C>T	16.37:g.27495595G>A	ENSP00000348510:p.Ser1313Phe		B2RP21|Q12838|Q6DKN9|Q9Y4W9	Missense_Mutation	SNP	pfam_TFIIIC_Bblock-bd	p.S1313F	ENST00000356183.4	37	c.3938	CCDS32414.1	16	.	.	.	.	.	.	.	.	.	.	G	26.2	4.713850	0.89112	.	.	ENSG00000077235	ENST00000356183;ENST00000388971	T	0.34275	1.37	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.65637	0.2710	M	0.80847	2.515	0.58432	D	0.99999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.67776	-0.5583	10	0.87932	D	0	-19.7417	19.9089	0.97019	0.0:0.0:1.0:0.0	.	1313;1313	Q12789;Q12789-3	TF3C1_HUMAN;.	F	1313;1309	ENSP00000348510:S1313F	ENSP00000348510:S1313F	S	-	2	0	GTF3C1	27403096	1.000000	0.71417	0.599000	0.28851	0.948000	0.59901	9.035000	0.93752	2.793000	0.96121	0.655000	0.94253	TCT	GTF3C1	-	NULL	ENSG00000077235		0.498	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF3C1	HGNC	protein_coding	OTTHUMT00000433856.1	-	0.00	104	0	G	NM_001520		27495595	-1	tier1	-	no_errors	ENST00000356183	ensembl	human	known	74_37	missense	29.67	64	27	SNP	0.995	A
GTSF1L	149699	genome.wustl.edu	37	20	42354942	42354942	+	Silent	SNP	C	C	T	rs375809336		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr20:42354942C>T	ENST00000373003.1	-	1	696	c.393G>A	c.(391-393)acG>acA	p.T131T	GTSF1L_ENST00000373005.2_Silent_p.T106T	NM_001008901.1|NM_176791.3	NP_001008901.1|NP_789761.1	Q9H1H1	GTSFL_HUMAN	gametocyte specific factor 1-like	131							metal ion binding (GO:0046872)	p.T131T(1)		endometrium(1)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	5		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			CTGACTCTTTCGTGTCATTTT	0.478																																																	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)						C	,	1,4405	2.1+/-5.4	0,1,2202	116.0	106.0	109.0		318,393	-4.6	0.0	20		109	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	GTSF1L	NM_001008901.1,NM_176791.3	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	106/124,131/149	42354942	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AK058060	CCDS13323.1, CCDS33471.1	20q13.12	2007-11-27	2007-11-27	2007-11-27	ENSG00000124196	ENSG00000124196			16198	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 65"", ""family with sequence similarity 112, member A"""	C20orf65, FAM112A			Standard	NM_176791		Approved	dJ1028D15.4	uc002xld.3	Q9H1H1	OTTHUMG00000032510	ENST00000373003.1:c.393G>A	20.37:g.42354942C>T			Q5JWH5	Silent	SNP	pfam_TRM13/UPF0224_CHHC_Znf_dom	p.T131	ENST00000373003.1	37	c.393	CCDS13323.1	20																																																																																			GTSF1L	-	NULL	ENSG00000124196		0.478	GTSF1L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GTSF1L	HGNC	protein_coding	OTTHUMT00000079313.1	-	0.00	73	0	C	NM_176791		42354942	-1	tier1	-	no_errors	ENST00000373003	ensembl	human	known	74_37	silent	73.21	15	41	SNP	0.000	T
HAS1	3036	genome.wustl.edu	37	19	52217193	52217193	+	Silent	SNP	G	G	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr19:52217193G>A	ENST00000222115.1	-	5	1258	c.1224C>T	c.(1222-1224)tcC>tcT	p.S408S	HAS1_ENST00000594621.1_3'UTR|HAS1_ENST00000540069.2_Silent_p.S407S|HAS1_ENST00000601714.1_Silent_p.S415S	NM_001523.2	NP_001514.2	Q92839	HYAS1_HUMAN	hyaluronan synthase 1	408					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|negative regulation of fibroblast migration (GO:0010764)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronan synthase activity (GO:0050501)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	40		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00102)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		GGAACAGGCCGGAGACCACCG	0.662																																					NSCLC(132;636 2450 45807 47979)												0																																										SO:0001819	synonymous_variant	0			U59269	CCDS12838.1, CCDS74436.1	19q13.3-q13.4	2013-02-22			ENSG00000105509	ENSG00000105509	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4818	protein-coding gene	gene with protein product		601463		HAS		9169154	Standard	XM_005258834		Approved		uc002pxo.1	Q92839		ENST00000222115.1:c.1224C>T	19.37:g.52217193G>A			Q14470|Q9NS49	Silent	SNP	pfam_Chitin_synth_fng,pfam_Glyco_trans_2	p.S415	ENST00000222115.1	37	c.1245	CCDS12838.1	19																																																																																			HAS1	-	NULL	ENSG00000105509		0.662	HAS1-005	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	HAS1	HGNC	protein_coding	OTTHUMT00000466953.1	-	0.00	57	0	G	NM_001523		52217193	-1	tier1	-	no_errors	ENST00000601714	ensembl	human	known	74_37	silent	10.91	49	6	SNP	0.970	A
HBE1	3046	genome.wustl.edu	37	11	5290789	5290789	+	Silent	SNP	A	A	C	rs202129332		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr11:5290789A>C	ENST00000380237.1	-	4	554	c.210T>G	c.(208-210)acT>acG	p.T70T	HBG2_ENST00000380259.2_Intron|HBE1_ENST00000292896.2_Silent_p.T70T|HBG2_ENST00000380252.1_Intron			P02100	HBE_HUMAN	hemoglobin, epsilon 1	70					blood coagulation (GO:0007596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein heterooligomerization (GO:0051291)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|hemoglobin complex (GO:0005833)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)	p.T70T(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|skin(1)	20		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.34e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTCCAAAGGAAGTCAGCACCT	0.517																																																	1	Substitution - coding silent(1)	large_intestine(1)											133.0	120.0	124.0					11																	5290789		2201	4297	6498	SO:0001819	synonymous_variant	0			BC015537	CCDS7756.1	11p15.5	2012-10-02			ENSG00000213931	ENSG00000213931			4830	protein-coding gene	gene with protein product		142100				2649166	Standard	NM_005330		Approved	HBE	uc001mal.1	P02100	OTTHUMG00000066675	ENST00000380237.1:c.210T>G	11.37:g.5290789A>C			Q6FH44	Silent	SNP	pfam_Globin,superfamily_Globin-like,pfscan_Globin,prints_Haemoglobin_b,prints_Myoglobin	p.T70	ENST00000380237.1	37	c.210	CCDS7756.1	11																																																																																			HBE1	-	pfam_Globin,superfamily_Globin-like,pfscan_Globin,prints_Myoglobin	ENSG00000213931		0.517	HBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HBE1	HGNC	protein_coding	OTTHUMT00000142973.2	-	0.00	125	0	A	NM_005330		5290789	-1	tier1	-	no_errors	ENST00000292896	ensembl	human	known	74_37	silent	35.76	97	54	SNP	0.052	C
HCFC2	29915	genome.wustl.edu	37	12	104492154	104492154	+	Nonsense_Mutation	SNP	A	A	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr12:104492154A>T	ENST00000229330.4	+	13	1878	c.1774A>T	c.(1774-1776)Aaa>Taa	p.K592*	HCFC2_ENST00000550335.1_3'UTR	NM_013320.2	NP_037452.1	Q9Y5Z7	HCFC2_HUMAN	host cell factor C2	592	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	35						GGCCACAGTGAAAGCGGGAGA	0.348																																					Esophageal Squamous(184;1814 2036 4771 6974 15702)												0													43.0	47.0	46.0					12																	104492154		2203	4300	6503	SO:0001587	stop_gained	0			AF117210	CCDS9097.1	12q23.3	2011-03-30			ENSG00000111727	ENSG00000111727			24972	protein-coding gene	gene with protein product		607926				10196288	Standard	NM_013320		Approved	HCF-2	uc001tkj.4	Q9Y5Z7	OTTHUMG00000170175	ENST00000229330.4:c.1774A>T	12.37:g.104492154A>T	ENSP00000229330:p.Lys592*		B2R8Q5|C0H5X3	Nonsense_Mutation	SNP	pfam_Kelch_1,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.K592*	ENST00000229330.4	37	c.1774	CCDS9097.1	12	.	.	.	.	.	.	.	.	.	.	A	38	7.278326	0.98182	.	.	ENSG00000111727	ENST00000229330	.	.	.	5.68	5.68	0.88126	.	0.322825	0.35739	N	0.003003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.5588	15.9325	0.79675	1.0:0.0:0.0:0.0	.	.	.	.	X	592	.	ENSP00000229330:K592X	K	+	1	0	HCFC2	103016284	1.000000	0.71417	0.998000	0.56505	0.808000	0.45660	5.391000	0.66266	2.169000	0.68431	0.528000	0.53228	AAA	HCFC2	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3	ENSG00000111727		0.348	HCFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCFC2	HGNC	protein_coding	OTTHUMT00000407780.1	-	0.00	172	0	A	NM_013320		104492154	+1	tier1	-	no_errors	ENST00000229330	ensembl	human	known	74_37	nonsense	36.02	103	58	SNP	0.993	T
HDX	139324	genome.wustl.edu	37	X	83599322	83599322	+	Silent	SNP	T	T	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chrX:83599322T>C	ENST00000297977.5	-	6	1707	c.1596A>G	c.(1594-1596)gaA>gaG	p.E532E	HDX_ENST00000506585.2_Silent_p.E474E|HDX_ENST00000373177.2_Silent_p.E532E	NM_001177479.1|NM_144657.4	NP_001170950.1|NP_653258.2	Q7Z353	HDX_HUMAN	highly divergent homeobox	532						nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(6)|kidney(2)|large_intestine(12)|liver(1)|lung(19)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						CCTCTCCTACTTCAGGCCCAG	0.448																																					Pancreas(53;231 1169 36156 43751 51139)												0													108.0	97.0	100.0					X																	83599322		2203	4300	6503	SO:0001819	synonymous_variant	0			BX538112	CCDS35342.1, CCDS55456.1	Xq21.1	2012-03-09	2007-07-13	2007-07-13	ENSG00000165259	ENSG00000165259		"""Homeoboxes / POU class"""	26411	protein-coding gene	gene with protein product			"""chromosome X open reading frame 43"""	CXorf43			Standard	NM_144657		Approved	FLJ30678	uc004eek.2	Q7Z353	OTTHUMG00000021926	ENST00000297977.5:c.1596A>G	X.37:g.83599322T>C			A8K1Y5|B7ZL18|Q5JZB4|Q96NK7	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.E532	ENST00000297977.5	37	c.1596	CCDS35342.1	X																																																																																			HDX	-	NULL	ENSG00000165259		0.448	HDX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HDX	HGNC	protein_coding	OTTHUMT00000057379.2	-	0.00	116	0	T	NM_144657		83599322	-1	tier1	-	no_errors	ENST00000297977	ensembl	human	known	74_37	silent	52.38	39	44	SNP	0.919	C
HERC2	8924	genome.wustl.edu	37	15	28451468	28451468	+	Missense_Mutation	SNP	G	G	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr15:28451468G>A	ENST00000261609.7	-	45	7238	c.7130C>T	c.(7129-7131)cCc>cTc	p.P2377L		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GAGGATCATGGGGGGCTGCGG	0.498																																																	0													1.0	1.0	1.0					15																	28451468		415	1340	1755	SO:0001583	missense	0			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.7130C>T	15.37:g.28451468G>A	ENSP00000261609:p.Pro2377Leu			Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_CPH_domain,pfam_Mib_Herc2,pfam_Cyt_B5-like_heme/steroid-bd,pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_RCC1/BLIP-II,superfamily_HECT,superfamily_Galactose-bd-like,superfamily_Cyt_B5-like_heme/steroid-bd,superfamily_UBA-like,superfamily_CUB_dom,smart_Beta-propeller_rpt_TECPR,smart_Znf_ZZ,smart_HECT,pfscan_HECT,pfscan_Znf_ZZ,pfscan_Reg_chr_condens,pfscan_Cyt_B5-like_heme/steroid-bd,prints_Reg_chr_condens	p.P2377L	ENST00000261609.7	37	c.7130	CCDS10021.1	15	.	.	.	.	.	.	.	.	.	.	G	19.39	3.818777	0.71028	.	.	ENSG00000128731	ENST00000261609	T	0.37915	1.17	4.32	4.32	0.51571	.	0.000000	0.85682	D	0.000000	T	0.56558	0.1993	L	0.59436	1.845	0.80722	D	1	D	0.71674	0.998	D	0.73708	0.981	T	0.61307	-0.7089	10	0.66056	D	0.02	.	17.0659	0.86559	0.0:0.0:1.0:0.0	.	2377	O95714	HERC2_HUMAN	L	2377	ENSP00000261609:P2377L	ENSP00000261609:P2377L	P	-	2	0	HERC2	26125063	1.000000	0.71417	0.837000	0.33122	0.944000	0.59088	9.402000	0.97298	2.239000	0.73571	0.449000	0.29647	CCC	HERC2	-	NULL	ENSG00000128731		0.498	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC2	HGNC	protein_coding	OTTHUMT00000251358.2	-	0.00	106	0	G	NM_004667		28451468	-1	tier1	-	no_errors	ENST00000261609	ensembl	human	known	74_37	missense	19.74	61	15	SNP	0.999	A
HHLA2	11148	genome.wustl.edu	37	3	108076930	108076930	+	Missense_Mutation	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr3:108076930C>A	ENST00000357759.5	+	6	1339	c.925C>A	c.(925-927)Ctt>Att	p.L309I	HHLA2_ENST00000491820.1_Missense_Mutation_p.L309I|HHLA2_ENST00000467562.1_Missense_Mutation_p.L245I|HHLA2_ENST00000489514.2_Missense_Mutation_p.L309I|HHLA2_ENST00000467761.1_Missense_Mutation_p.L309I	NM_007072.2	NP_009003.1	Q9UM44	HHLA2_HUMAN	HERV-H LTR-associating 2	309	Ig-like V-type 2.				positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of cytokine production (GO:0001819)|T cell costimulation (GO:0031295)	integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(1)|lung(14)|ovary(1)	18						GGATCTTAATCTTTCAGACAG	0.368																																																	0													118.0	116.0	117.0					3																	108076930		1849	4085	5934	SO:0001583	missense	0			AF126162	CCDS46883.1, CCDS63713.1, CCDS74975.1	3q13.13	2013-01-11			ENSG00000114455	ENSG00000114455		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	4905	protein-coding gene	gene with protein product		604371				10444326	Standard	NM_007072		Approved	B7H7	uc003dwz.3	Q9UM44	OTTHUMG00000159224	ENST00000357759.5:c.925C>A	3.37:g.108076930C>A	ENSP00000350402:p.Leu309Ile		B4DKN2|D3DN60|Q9NWQ6	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_C1-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.L309I	ENST00000357759.5	37	c.925	CCDS46883.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.033|9.033	0.987693|0.987693	0.18966|0.18966	.|.	.|.	ENSG00000114455|ENSG00000114455	ENST00000491820;ENST00000467562;ENST00000357759;ENST00000467761;ENST00000489514|ENST00000482099	T;T;T;T;T|.	0.68025|.	-0.3;-0.3;-0.3;-0.3;-0.3|.	5.21|5.21	1.17|1.17	0.20885|0.20885	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);|.	1.075520|.	0.07505|.	N|.	0.907892|.	T|T	0.28333|0.28333	0.0700|0.0700	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	B;B;B|.	0.23377|.	0.084;0.041;0.041|.	B;B;B|.	0.27170|.	0.077;0.024;0.024|.	T|T	0.24728|0.24728	-1.0152|-1.0152	10|5	0.25106|.	T|.	0.35|.	0.3873|0.3873	9.5327|9.5327	0.39205|0.39205	0.1478:0.3941:0.4581:0.0|0.1478:0.3941:0.4581:0.0	.|.	245;309;309|.	B4DKN2;C9J7D0;Q9UM44|.	.;.;HHLA2_HUMAN|.	I|Y	309;245;309;309;309|211	ENSP00000418284:L309I;ENSP00000418345:L245I;ENSP00000350402:L309I;ENSP00000419207:L309I;ENSP00000417856:L309I|.	ENSP00000350402:L309I|.	L|S	+|+	1|2	0|0	HHLA2|HHLA2	109559620|109559620	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.053000|0.053000	0.15095|0.15095	-0.461000|-0.461000	0.06712|0.06712	-0.012000|-0.012000	0.14223|0.14223	0.650000|0.650000	0.86243|0.86243	CTT|TCT	HHLA2	-	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	ENSG00000114455		0.368	HHLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HHLA2	HGNC	protein_coding	OTTHUMT00000353924.1		0.00	44	0	C	NM_007072		108076930	+1			no_errors	ENST00000357759	ensembl	human	known	74_37	missense	8.33	22	2	SNP	0.000	A
HIC2	23119	genome.wustl.edu	37	22	21799864	21799865	+	Frame_Shift_Ins	INS	-	-	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr22:21799864_21799865insG	ENST00000443632.2	+	2	1052_1053	c.680_681insG	c.(679-684)ctggggfs	p.LG227fs	HIC2_ENST00000407598.2_Frame_Shift_Ins_p.LG227fs|HIC2_ENST00000407464.2_Frame_Shift_Ins_p.LG227fs			Q96JB3	HIC2_HUMAN	hypermethylated in cancer 2	227					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			NS(1)|endometrium(4)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16	Melanoma(16;0.000465)|Ovarian(15;0.00438)|Colorectal(54;0.0968)	Lung SC(17;0.0262)|all_lung(157;0.205)				GAGGCGGGTCTGGGGGGCTGCA	0.663																																					NSCLC(23;437 858 2282 27947 40366)												0																																										SO:0001589	frameshift_variant	0			AB028943	CCDS13789.1	22q11.21	2013-01-09			ENSG00000169635	ENSG00000169635		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	18595	protein-coding gene	gene with protein product		607712				11554746	Standard	NM_015094		Approved	KIAA1020, HRG22, ZBTB30, ZNF907	uc002zur.4	Q96JB3	OTTHUMG00000150781	ENST00000443632.2:c.686dupG	22.37:g.21799870_21799870dupG	ENSP00000387757:p.Leu227fs		Q504T6|Q96KR3|Q9NSM9|Q9UPX9	Frame_Shift_Ins	INS	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.C230fs	ENST00000443632.2	37	c.680_681	CCDS13789.1	22																																																																																			HIC2	-	NULL	ENSG00000169635		0.663	HIC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIC2	HGNC	protein_coding	OTTHUMT00000320061.2		0.00	20	0	0			21799865	+1			no_errors	ENST00000407464	ensembl	human	known	74_37	frame_shift_ins	15.38	11	2	INS	0.684:0.517	G
HLA-DMB	3109	genome.wustl.edu	37	6	32905029	32905029	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr6:32905029G>T	ENST00000418107.2	-	3	804	c.542C>A	c.(541-543)gCc>gAc	p.A181D	AL645941.1_ENST00000390777.1_RNA|HLA-DMB_ENST00000416244.2_Missense_Mutation_p.A181D	NM_002118.4	NP_002109.2	P28068	DMB_HUMAN	major histocompatibility complex, class II, DM beta	181	Beta-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|immune response (GO:0006955)|MHC class II protein complex assembly (GO:0002399)|peptide antigen assembly with MHC class II protein complex (GO:0002503)|positive regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001190)|positive regulation of T cell proliferation (GO:0042102)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)	MHC class II protein complex binding (GO:0023026)			breast(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13						GGGGGTTAAGGCTAAATGGGA	0.562																																																	0													137.0	107.0	117.0					6																	32905029		2203	4300	6503	SO:0001583	missense	0				CCDS4760.1	6p21.3	2014-05-16			ENSG00000242574	ENSG00000242574		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4935	protein-coding gene	gene with protein product		142856				1922365	Standard	NM_002118		Approved	D6S221E, RING7	uc003ocl.2	P28068	OTTHUMG00000031176	ENST00000418107.2:c.542C>A	6.37:g.32905029G>T	ENSP00000398890:p.Ala181Asp		O77936|Q13012|Q29751|Q58ZE2|Q5SNZ8|Q5STC4|Q9XRX2	Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_MHC_II_b_N,pfam_CD80_C2-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N,smart_Ig_C1-set,pfscan_Ig-like_dom	p.A181D	ENST00000418107.2	37	c.542	CCDS4760.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.929|9.929	1.214283|1.214283	0.22289|0.22289	.|.	.|.	ENSG00000242574|ENSG00000242574	ENST00000438510;ENST00000446948;ENST00000418107;ENST00000416244|ENST00000414017	T;T;T|.	0.02837|.	4.14;4.14;4.14|.	4.56|4.56	4.56|4.56	0.56223|0.56223	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);|.	0.112905|.	0.39834|.	N|.	0.001259|.	T|T	0.39145|0.39145	0.1067|0.1067	N|N	0.26042|0.26042	0.785|0.785	0.40230|0.40230	D|D	0.977838|0.977838	B;D;B;B;D|.	0.89917|.	0.285;1.0;0.263;0.156;1.0|.	B;D;B;B;D|.	0.91635|.	0.03;0.999;0.189;0.06;0.999|.	T|T	0.23691|0.23691	-1.0181|-1.0181	10|5	0.87932|.	D|.	0|.	.|.	13.0126|13.0126	0.58739|0.58739	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	181;181;63;70;181|.	E9PD01;A2AAT3;B0V061;B0V062;P28068|.	.;.;.;.;DMB_HUMAN|.	D|R	63;181;181;181|70	ENSP00000390848:A63D;ENSP00000398890:A181D;ENSP00000391010:A181D|.	ENSP00000391010:A181D|.	A|S	-|-	2|3	0|2	HLA-DMB|HLA-DMB	33013007|33013007	0.996000|0.996000	0.38824|0.38824	0.768000|0.768000	0.31515|0.31515	0.105000|0.105000	0.19272|0.19272	3.464000|3.464000	0.53057|0.53057	2.524000|2.524000	0.85096|0.85096	0.494000|0.494000	0.49563|0.49563	GCC|AGC	HLA-DMB	-	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like_dom	ENSG00000242574		0.562	HLA-DMB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-DMB	HGNC	protein_coding	OTTHUMT00000076340.2		0.00	41	0	G	NM_002118		32905029	-1			no_errors	ENST00000418107	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.826	T
HPCAL1	3241	genome.wustl.edu	37	2	10563192	10563192	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:10563192G>T	ENST00000381765.3	+	5	988	c.462G>T	c.(460-462)agG>agT	p.R154S	HPCAL1_ENST00000307845.3_Missense_Mutation_p.R154S	NM_134421.2	NP_602293.1	P37235	HPCL1_HUMAN	hippocalcin-like 1	154	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	9	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.214)		AGATCTTCAGGCAGATGGACA	0.602																																					Pancreas(70;1384 1800 31595 46836)												0													118.0	94.0	102.0					2																	10563192		2203	4300	6503	SO:0001583	missense	0				CCDS1671.1	2p25.1	2013-01-10			ENSG00000115756	ENSG00000115756		"""EF-hand domain containing"""	5145	protein-coding gene	gene with protein product	"""visinin-like protein 3"", ""calcium-binding protein BDR-1"""	600207				8038222, 14739275	Standard	NM_002149		Approved	BDR1, HLP2, VILIP-3	uc031rnq.1	P37235	OTTHUMG00000090451	ENST00000381765.3:c.462G>T	2.37:g.10563192G>T	ENSP00000371184:p.Arg154Ser		Q969S5	Missense_Mutation	SNP	pfam_EF_hand_dom,pfam_SPARC/Testican_Ca-bd-dom,smart_EF_hand_dom,pfscan_EF_hand_dom,prints_Recoverin	p.R154S	ENST00000381765.3	37	c.462	CCDS1671.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.10|11.10	1.538894|1.538894	0.27475|0.27475	.|.	.|.	ENSG00000115756|ENSG00000115756	ENST00000422133|ENST00000307845;ENST00000381765	.|T;T	.|0.72835	.|-0.69;-0.69	4.93|4.93	1.01|1.01	0.19927|0.19927	.|EF-hand-like domain (1);	.|0.219310	.|0.44483	.|D	.|0.000446	T|T	0.56601|0.56601	0.1996|0.1996	L|L	0.43554|0.43554	1.36|1.36	0.51767|0.51767	D|D	0.999933|0.999933	.|B	.|0.13145	.|0.007	.|B	.|0.15484	.|0.013	T|T	0.38866|0.38866	-0.9641|-0.9641	5|10	.|0.20046	.|T	.|0.44	.|.	9.0049|9.0049	0.36106|0.36106	0.4838:0.0:0.5161:0.0|0.4838:0.0:0.5161:0.0	.|.	.|154	.|P37235	.|HPCL1_HUMAN	S|S	67|154	.|ENSP00000310749:R154S;ENSP00000371184:R154S	.|ENSP00000310749:R154S	A|R	+|+	1|3	0|2	HPCAL1|HPCAL1	10480643|10480643	0.999000|0.999000	0.42202|0.42202	0.994000|0.994000	0.49952|0.49952	0.997000|0.997000	0.91878|0.91878	0.761000|0.761000	0.26489|0.26489	-0.104000|-0.104000	0.12154|0.12154	0.655000|0.655000	0.94253|0.94253	GCA|AGG	HPCAL1	-	pfam_EF_hand_dom,pfam_SPARC/Testican_Ca-bd-dom,smart_EF_hand_dom,pfscan_EF_hand_dom	ENSG00000115756		0.602	HPCAL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HPCAL1	HGNC	protein_coding	OTTHUMT00000206898.1	-	0.00	70	0	G	NM_002149		10563192	+1	tier1	-	no_errors	ENST00000307845	ensembl	human	known	74_37	missense	6.67	56	4	SNP	0.980	T
HPS1	3257	genome.wustl.edu	37	10	100185457	100185457	+	Silent	SNP	G	G	C	rs370108188		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr10:100185457G>C	ENST00000325103.6	-	13	1409	c.1176C>G	c.(1174-1176)gcC>gcG	p.A392A	HPS1_ENST00000361490.4_Silent_p.A392A|HPS1_ENST00000467246.1_5'UTR	NM_000195.3	NP_000186.2	Q92902	HPS1_HUMAN	Hermansky-Pudlak syndrome 1	392					blood coagulation (GO:0007596)|eye pigmentation (GO:0048069)|lysosome organization (GO:0007040)|melanocyte differentiation (GO:0030318)|positive regulation of natural killer cell activation (GO:0032816)|retina development in camera-type eye (GO:0060041)|secretion of lysosomal enzymes (GO:0033299)|visual perception (GO:0007601)	BLOC-3 complex (GO:0031085)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	protein dimerization activity (GO:0046983)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(9)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	23		Colorectal(252;0.234)		Epithelial(162;3.87e-12)|all cancers(201;5.63e-10)		ACAGAACCAGGGCCAGGGGCG	0.682									Hermansky-Pudlak syndrome		OREG0020430	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								G		0,4404		0,0,2202	26.0	32.0	30.0		1176	2.0	1.0	10		30	1,8599		0,1,4299	no	coding-synonymous	HPS1	NM_000195.3		0,1,6501	CC,CG,GG		0.0116,0.0,0.0077		392/701	100185457	1,13003	2202	4300	6502	SO:0001819	synonymous_variant	0	Familial Cancer Database	HPS, HPS1-8	U79136	CCDS7475.1, CCDS7476.1	10q23.1-q23.3	2014-06-18		2002-05-01	ENSG00000107521	ENSG00000107521			5163	protein-coding gene	gene with protein product		604982	"""Hermansky-Pudlak syndrome"""	HPS		8541858, 7573033	Standard	NM_182639		Approved		uc021pwv.1	Q92902	OTTHUMG00000018876	ENST00000325103.6:c.1176C>G	10.37:g.100185457G>C		1349	A8MRT2|O15402|O15502|Q5TAA3|Q8WXE5	Silent	SNP	NULL	p.A392	ENST00000325103.6	37	c.1176	CCDS7475.1	10																																																																																			HPS1	-	NULL	ENSG00000107521		0.682	HPS1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	HPS1	HGNC	protein_coding	OTTHUMT00000049776.1	-	0.00	105	0	G	NM_000195, NM_182637, NM_182638, NM_182639		100185457	-1	tier1	-	no_errors	ENST00000325103	ensembl	human	known	74_37	silent	16.67	100	20	SNP	0.995	C
HPS4	89781	genome.wustl.edu	37	22	26860498	26860500	+	In_Frame_Del	DEL	TTC	TTC	-			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	TTC	TTC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr22:26860498_26860500delTTC	ENST00000398145.2	-	11	1712_1714	c.1096_1098delGAA	c.(1096-1098)gaadel	p.E366del	HPS4_ENST00000402105.3_In_Frame_Del_p.E361del|HPS4_ENST00000336873.5_In_Frame_Del_p.E366del|HPS4_ENST00000398141.1_In_Frame_Del_p.E379del|HPS4_ENST00000493455.2_5'Flank	NM_022081.5	NP_071364.4	Q9NQG7	HPS4_HUMAN	Hermansky-Pudlak syndrome 4	366					blood coagulation (GO:0007596)|hemostasis (GO:0007599)|lysosome organization (GO:0007040)|melanocyte differentiation (GO:0030318)|positive regulation of eye pigmentation (GO:0048075)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)	BLOC-3 complex (GO:0031085)|cytoplasm (GO:0005737)|lysosome (GO:0005764)|melanosome (GO:0042470)|membrane (GO:0016020)|platelet dense granule (GO:0042827)	protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(3)|kidney(5)|large_intestine(4)|lung(12)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	32						ACAAGTCGAGTTCTTCTTGGAGA	0.547									Hermansky-Pudlak syndrome																																								0																																										SO:0001651	inframe_deletion	0	Familial Cancer Database	HPS, HPS1-8		CCDS13835.1, CCDS46677.1	22q12.1	2014-09-17			ENSG00000100099	ENSG00000100099			15844	protein-coding gene	gene with protein product		606682				11836498, 12663659	Standard	NM_022081		Approved	KIAA1667, LE	uc003aci.4	Q9NQG7	OTTHUMG00000030459	ENST00000398145.2:c.1096_1098delGAA	22.37:g.26860501_26860503delTTC	ENSP00000381213:p.Glu366del		B1AHQ4|Q5H8V6|Q96LX6|Q9BY93|Q9UH37|Q9UH38	In_Frame_Del	DEL	NULL	p.E379in_frame_del	ENST00000398145.2	37	c.1137_1135	CCDS13835.1	22																																																																																			HPS4	-	NULL	ENSG00000100099		0.547	HPS4-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HPS4	HGNC	protein_coding	OTTHUMT00000320778.1		0.00	43	0	TTC	NM_022081		26860500	-1	tier1		no_errors	ENST00000398141	ensembl	human	known	74_37	in_frame_del	18.18	27	6	DEL	0.000:0.029:0.025	-
HSP90AB1	3326	genome.wustl.edu	37	6	44218921	44218921	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr6:44218921G>T	ENST00000371554.1	+	7	1308	c.1094G>T	c.(1093-1095)aGc>aTc	p.S365I	SLC35B2_ENST00000495706.1_5'Flank|HSP90AB1_ENST00000353801.3_Missense_Mutation_p.S365I|HSP90AB1_ENST00000371646.5_Missense_Mutation_p.S365I			P08238	HS90B_HUMAN	heat shock protein 90kDa alpha (cytosolic), class B member 1	365					axon guidance (GO:0007411)|cellular response to interleukin-4 (GO:0071353)|cellular response to organic cyclic compound (GO:0071407)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|placenta development (GO:0001890)|positive regulation of cell size (GO:0045793)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein binding (GO:0032092)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein folding (GO:0006457)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to salt stress (GO:0009651)|response to unfolded protein (GO:0006986)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP binding (GO:0002135)|dATP binding (GO:0032564)|double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|poly(A) RNA binding (GO:0044822)|TPR domain binding (GO:0030911)|UTP binding (GO:0002134)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(12)|prostate(2)|skin(2)|urinary_tract(2)	33	all_cancers(18;1.7e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			ATCATGGACAGCTGTGATGAG	0.428																																																	0													145.0	144.0	144.0					6																	44218921		2203	4300	6503	SO:0001583	missense	0			AF275719	CCDS4909.1	6p12	2011-09-02	2006-02-24	2006-02-24	ENSG00000096384	ENSG00000096384		"""Heat shock proteins / HSPC"""	5258	protein-coding gene	gene with protein product		140572	"""heat shock 90kD protein 1, beta"", ""heat shock 90kDa protein 1, beta"""	HSPC2, HSPCB		2768249, 16269234	Standard	NM_001271969		Approved		uc031sor.1	P08238	OTTHUMG00000014761	ENST00000371554.1:c.1094G>T	6.37:g.44218921G>T	ENSP00000360609:p.Ser365Ile		B2R5P0|Q5T9W7|Q9NQW0|Q9NTK6	Missense_Mutation	SNP	pfam_Hsp90_fam,pfam_HATPase_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_HATPase_ATP-bd,smart_HATPase_ATP-bd,pirsf_Hsp90_fam,prints_Hsp90_N	p.S365I	ENST00000371554.1	37	c.1094	CCDS4909.1	6	.	.	.	.	.	.	.	.	.	.	G	17.59	3.427403	0.62733	.	.	ENSG00000096384	ENST00000371646;ENST00000353801;ENST00000371565;ENST00000371562;ENST00000371556;ENST00000371554	T;T;T	0.09911	2.93;2.93;2.93	4.9	4.02	0.46733	Ribosomal protein S5 domain 2-type fold (1);	0.063361	0.64402	U	0.000009	T	0.09423	0.0232	L	0.58510	1.815	0.58432	D	0.999994	B;P;B	0.39071	0.176;0.658;0.176	B;B;B	0.44315	0.198;0.446;0.198	T	0.01635	-1.1307	10	0.87932	D	0	-21.2947	13.1604	0.59540	0.0782:0.0:0.9218:0.0	.	327;355;365	B4DMA2;B4DGL0;P08238	.;.;HS90B_HUMAN	I	365;365;3;3;3;365	ENSP00000360709:S365I;ENSP00000325875:S365I;ENSP00000360609:S365I	ENSP00000325875:S365I	S	+	2	0	HSP90AB1	44326899	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.912000	0.56386	1.067000	0.40740	0.585000	0.79938	AGC	HSP90AB1	-	pfam_Hsp90_fam,superfamily_Ribosomal_S5_D2-typ_fold,pirsf_Hsp90_fam	ENSG00000096384		0.428	HSP90AB1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HSP90AB1	HGNC	protein_coding	OTTHUMT00000040730.1	-	0.00	116	0	G	NM_007355		44218921	+1	tier1	-	no_errors	ENST00000353801	ensembl	human	known	74_37	missense	7.29	88	7	SNP	1.000	T
HTR3C	170572	genome.wustl.edu	37	3	183772516	183772516	+	Silent	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr3:183772516C>T	ENST00000318351.1	+	2	109	c.75C>T	c.(73-75)ggC>ggT	p.G25G		NM_130770.2	NP_570126.2	Q8WXA8	5HT3C_HUMAN	5-hydroxytryptamine (serotonin) receptor 3C, ionotropic	25					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(2)	32	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)		Ergoloid mesylate(DB01049)	TAGGAAGAGGCGACGCTTTTA	0.512																																																	0													111.0	106.0	108.0					3																	183772516		2203	4300	6503	SO:0001819	synonymous_variant	0			AF459285	CCDS3250.1	3q27	2012-05-22	2012-02-03		ENSG00000178084	ENSG00000178084		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	24003	protein-coding gene	gene with protein product		610121	"""5-hydroxytryptamine (serotonin) receptor 3, family member C"""			12801637, 15157181	Standard	NM_130770		Approved		uc003fmk.3	Q8WXA8	OTTHUMG00000156862	ENST00000318351.1:c.75C>T	3.37:g.183772516C>T			A2RRR5	Silent	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_Neur_channel	p.G25	ENST00000318351.1	37	c.75	CCDS3250.1	3																																																																																			HTR3C	-	NULL	ENSG00000178084		0.512	HTR3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR3C	HGNC	protein_coding	OTTHUMT00000346296.1		0.00	43	0	C	NM_130770		183772516	+1			no_errors	ENST00000318351	ensembl	human	known	74_37	silent	16.67	20	4	SNP	0.000	T
IFIT3	3437	genome.wustl.edu	37	10	91098459	91098459	+	Missense_Mutation	SNP	T	T	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr10:91098459T>C	ENST00000371818.4	+	2	227	c.47T>C	c.(46-48)cTg>cCg	p.L16P	LIPA_ENST00000487618.1_Intron|IFIT3_ENST00000371811.4_Missense_Mutation_p.L16P|LIPA_ENST00000371837.1_Intron	NM_001549.4	NP_001540.2	O14879	IFIT3_HUMAN	interferon-induced protein with tetratricopeptide repeats 3	16					cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	identical protein binding (GO:0042802)			breast(1)|central_nervous_system(3)|endometrium(1)|large_intestine(4)|lung(3)|skin(2)|urinary_tract(1)	15						CTTCCACAGCTGAAATGCCAT	0.428																																																	0													67.0	67.0	67.0					10																	91098459		2203	4300	6503	SO:0001583	missense	0			U52513	CCDS7402.1, CCDS31241.1	10q23.31	2014-05-22	2004-07-16	2004-07-16	ENSG00000119917	ENSG00000119917		"""Tetratricopeptide (TTC) repeat domain containing"""	5411	protein-coding gene	gene with protein product		604650	"""interferon-induced protein with tetratricopeptide repeats 4"""	IFIT4		9828129, 9391139	Standard	NM_001031683		Approved	ISG60, RIG-G, CIG-49, IFI60, GARG-49, IRG2	uc001kgg.3	O14879	OTTHUMG00000018708	ENST00000371818.4:c.47T>C	10.37:g.91098459T>C	ENSP00000360883:p.Leu16Pro		Q99634|Q9BSK7	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.L16P	ENST00000371818.4	37	c.47	CCDS7402.1	10	.	.	.	.	.	.	.	.	.	.	T	20.5	4.000370	0.74818	.	.	ENSG00000119917	ENST00000371818;ENST00000371811	T;T	0.61627	0.09;0.09	5.38	5.38	0.77491	.	0.000000	0.64402	D	0.000002	T	0.79770	0.4503	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.83919	0.0300	10	0.87932	D	0	-5.8043	15.2797	0.73773	0.0:0.0:0.0:1.0	.	16	O14879	IFIT3_HUMAN	P	16	ENSP00000360883:L16P;ENSP00000360876:L16P	ENSP00000360876:L16P	L	+	2	0	IFIT3	91088439	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	5.783000	0.68982	2.343000	0.79666	0.533000	0.62120	CTG	IFIT3	-	NULL	ENSG00000119917		0.428	IFIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFIT3	HGNC	protein_coding	OTTHUMT00000049294.1	-	0.00	55	0	T	NM_001549		91098459	+1	tier1	-	no_errors	ENST00000371811	ensembl	human	known	74_37	missense	6.35	59	4	SNP	1.000	C
INTS9	55756	genome.wustl.edu	37	8	28716984	28716984	+	Missense_Mutation	SNP	G	G	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr8:28716984G>A	ENST00000521022.1	-	2	187	c.106C>T	c.(106-108)Ctc>Ttc	p.L36F	INTS9_ENST00000397363.4_Intron|INTS9_ENST00000416984.2_Missense_Mutation_p.L36F|INTS9_ENST00000521777.1_Missense_Mutation_p.L12F	NM_018250.3	NP_060720.2	Q9NV88	INT9_HUMAN	integrator complex subunit 9	36					snRNA processing (GO:0016180)	cytoplasm (GO:0005737)|integrator complex (GO:0032039)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|pancreas(2)|prostate(1)|urinary_tract(2)	19		Ovarian(32;0.0439)		KIRC - Kidney renal clear cell carcinoma(542;0.127)|Kidney(114;0.152)		AGGAAATTGAGGGTAGAAGTC	0.428																																																	0													210.0	163.0	179.0					8																	28716984		2203	4300	6503	SO:0001583	missense	0			BC025267	CCDS34873.1, CCDS55215.1, CCDS55216.1	8p21.1	2008-02-05			ENSG00000104299	ENSG00000104299			25592	protein-coding gene	gene with protein product		611352				16239144	Standard	NM_001172562		Approved	FLJ10871, CPSF2L, RC-74	uc011lav.2	Q9NV88	OTTHUMG00000164030	ENST00000521022.1:c.106C>T	8.37:g.28716984G>A	ENSP00000429065:p.Leu36Phe		B7Z560|B7Z6M5|O00224|Q8TB16	Missense_Mutation	SNP	pfam_Beta_Casp	p.L36F	ENST00000521022.1	37	c.106	CCDS34873.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.81|18.81	3.702072|3.702072	0.68501|0.68501	.|.	.|.	ENSG00000104299|ENSG00000104299	ENST00000521022;ENST00000416984;ENST00000521777;ENST00000523436;ENST00000520184|ENST00000524081	T;T;T;T|.	0.52295|.	0.67;0.75;0.7;0.79|.	5.26|5.26	5.26|5.26	0.73747|0.73747	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.57066|0.57066	0.2028|0.2028	L|L	0.27975|0.27975	0.815|0.815	0.80722|0.80722	D|D	1|1	B;B;B|.	0.31893|.	0.345;0.054;0.07|.	B;B;B|.	0.27262|.	0.063;0.072;0.078|.	T|T	0.52215|0.52215	-0.8605|-0.8605	10|5	0.52906|.	T|.	0.07|.	-25.1704|-25.1704	18.8995|18.8995	0.92437|0.92437	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	36;36;36|.	B7Z6M5;G3XAN1;Q9NV88|.	.;.;INT9_HUMAN|.	F|L	36;36;12;36;12|27	ENSP00000429065:L36F;ENSP00000398208:L36F;ENSP00000430943:L12F;ENSP00000427789:L36F|.	ENSP00000398208:L36F|.	L|P	-|-	1|2	0|0	INTS9|INTS9	28772903|28772903	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.928000|0.928000	0.56348|0.56348	8.019000|8.019000	0.88732|0.88732	2.467000|2.467000	0.83353|0.83353	0.563000|0.563000	0.77884|0.77884	CTC|CCT	INTS9	-	NULL	ENSG00000104299		0.428	INTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS9	HGNC	protein_coding	OTTHUMT00000376846.1	-	0.00	121	0	G	NM_018250		28716984	-1	tier1	-	no_errors	ENST00000521022	ensembl	human	known	74_37	missense	32.43	50	24	SNP	1.000	A
ITGA9	3680	genome.wustl.edu	37	3	37792003	37792003	+	Silent	SNP	T	T	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr3:37792003T>C	ENST00000264741.5	+	23	2740	c.2484T>C	c.(2482-2484)tcT>tcC	p.S828S	AC093415.2_ENST00000449586.1_RNA	NM_002207.2	NP_002198.2	Q13797	ITA9_HUMAN	integrin, alpha 9	828					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|neutrophil chemotaxis (GO:0030593)|wound healing (GO:0042060)	basal plasma membrane (GO:0009925)|integrin alpha9-beta1 complex (GO:0034679)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(17)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|urinary_tract(1)	44				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)		TCAGCATCTCTTTCCCTAATC	0.483																																																	0													190.0	164.0	173.0					3																	37792003		2203	4300	6503	SO:0001819	synonymous_variant	0			L24158	CCDS2669.1	3p21.3	2010-03-23			ENSG00000144668	ENSG00000144668		"""Integrins"""	6145	protein-coding gene	gene with protein product	"""integrin, alpha 4-like"""	603963				8245132, 8290272	Standard	NM_002207		Approved	RLC, ITGA4L, ALPHA-RLC	uc003chd.3	Q13797	OTTHUMG00000130815	ENST00000264741.5:c.2484T>C	3.37:g.37792003T>C			Q14638	Silent	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.S828	ENST00000264741.5	37	c.2484	CCDS2669.1	3																																																																																			ITGA9	-	pfam_Integrin_alpha-2	ENSG00000144668		0.483	ITGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA9	HGNC	protein_coding	OTTHUMT00000253361.1	-	0.00	90	0	T	NM_002207		37792003	+1	tier1	-	no_errors	ENST00000264741	ensembl	human	known	74_37	silent	18.75	51	12	SNP	0.030	C
IP6K2	51447	genome.wustl.edu	37	3	48732764	48732764	+	5'UTR	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr3:48732764G>T	ENST00000328631.5	-	0	184				IP6K2_ENST00000436134.1_5'UTR|IP6K2_ENST00000432678.2_5'UTR|IP6K2_ENST00000453202.1_5'UTR|IP6K2_ENST00000450045.1_Silent_p.L41L|IP6K2_ENST00000443964.1_Silent_p.L46L|IP6K2_ENST00000413298.1_5'UTR|IP6K2_ENST00000417896.1_5'UTR|IP6K2_ENST00000449610.1_5'UTR|IP6K2_ENST00000446860.1_Silent_p.L45L|IP6K2_ENST00000431721.2_Silent_p.L42L|IP6K2_ENST00000340879.4_5'UTR	NM_001005909.2|NM_016291.3	NP_001005909.1|NP_057375.2	Q9UHH9	IP6K2_HUMAN	inositol hexakisphosphate kinase 2						cytokine-mediated signaling pathway (GO:0019221)|inositol phosphate metabolic process (GO:0043647)|negative regulation of cell growth (GO:0030308)|phosphate ion transport (GO:0006817)|phosphatidylinositol phosphorylation (GO:0046854)|positive regulation of apoptotic process (GO:0043065)|small molecule metabolic process (GO:0044281)|type I interferon signaling pathway (GO:0060337)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			biliary_tract(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)	15						GGAGGCAGCGGAGTCCAGCGG	0.632																																																	0													14.0	15.0	15.0					3																	48732764		2201	4296	6497	SO:0001623	5_prime_UTR_variant	0			AF177145	CCDS2777.1, CCDS33752.1, CCDS54579.1, CCDS54580.1, CCDS54581.1	3p21.31	2009-01-05	2009-01-05	2008-12-22	ENSG00000068745	ENSG00000068745			17313	protein-coding gene	gene with protein product		606992	"""inositol hexaphosphate kinase 2"""	IHPK2		10574768	Standard	NM_016291		Approved		uc003cup.3	Q9UHH9	OTTHUMG00000133543	ENST00000328631.5:c.-40C>A	3.37:g.48732764G>T			A8K3B1|B4E3G6|G8JLL6|Q6P0N8|Q9BSZ6|Q9BUW3|Q9H4P7|Q9NT63|Q9UFU6	Silent	SNP	NULL	p.L45	ENST00000328631.5	37	c.135	CCDS2777.1	3																																																																																			IP6K2	-	NULL	ENSG00000068745		0.632	IP6K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IP6K2	HGNC	protein_coding	OTTHUMT00000257521.2	-	0.00	28	0	G	NM_016291		48732764	-1	tier1	-	no_errors	ENST00000412795	ensembl	human	known	74_37	silent	19.05	17	4	SNP	0.009	T
ITGB1BP2	26548	genome.wustl.edu	37	X	70524100	70524100	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chrX:70524100G>T	ENST00000373829.3	+	9	776	c.703G>T	c.(703-705)Ggc>Tgc	p.G235C	ITGB1BP2_ENST00000465388.1_3'UTR|ITGB1BP2_ENST00000538820.1_Missense_Mutation_p.G217C	NM_012278.1	NP_036410.1	Q9UKP3	ITBP2_HUMAN	integrin beta 1 binding protein (melusin) 2	235	CS. {ECO:0000255|PROSITE- ProRule:PRU00547}.				muscle organ development (GO:0007517)|signal transduction (GO:0007165)	Z disc (GO:0030018)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|large_intestine(2)|lung(5)|ovary(1)	14	Renal(35;0.156)					GACTGTATATGGCCAGATTCC	0.463																																																	0													141.0	105.0	117.0					X																	70524100		2203	4300	6503	SO:0001583	missense	0			AF140690	CCDS14411.1	Xq12.1-q13	2008-02-05			ENSG00000147166	ENSG00000147166			6154	protein-coding gene	gene with protein product		300332				10506186	Standard	XM_005262255		Approved	CHORDC3	uc004dzr.1	Q9UKP3	OTTHUMG00000021793	ENST00000373829.3:c.703G>T	X.37:g.70524100G>T	ENSP00000362935:p.Gly235Cys		Q32N04|Q549J7	Missense_Mutation	SNP	pfam_CHORD,pfam_CS_dom,superfamily_HSP20-like_chaperone,pfscan_CS_dom	p.G235C	ENST00000373829.3	37	c.703	CCDS14411.1	X	.	.	.	.	.	.	.	.	.	.	G	12.20	1.866506	0.32977	.	.	ENSG00000147166	ENST00000373829;ENST00000538820	T;T	0.13657	2.57;2.57	5.24	5.24	0.73138	CS-like domain (1);CS domain (1);HSP20-like chaperone (1);	0.055748	0.64402	D	0.000002	T	0.25121	0.0610	L	0.33485	1.01	0.42755	D	0.993787	D;D	0.89917	1.0;1.0	D;D	0.74348	0.975;0.983	T	0.00872	-1.1532	10	0.46703	T	0.11	-6.3104	12.7768	0.57453	0.0:0.0:1.0:0.0	.	217;235	Q32N04;Q9UKP3	.;ITBP2_HUMAN	C	235;217	ENSP00000362935:G235C;ENSP00000440289:G217C	ENSP00000362935:G235C	G	+	1	0	ITGB1BP2	70440825	1.000000	0.71417	1.000000	0.80357	0.626000	0.37791	6.497000	0.73674	2.413000	0.81919	0.600000	0.82982	GGC	ITGB1BP2	-	pfam_CS_dom,superfamily_HSP20-like_chaperone,pfscan_CS_dom	ENSG00000147166		0.463	ITGB1BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB1BP2	HGNC	protein_coding	OTTHUMT00000057126.1	-	0.00	93	0	G	NM_012278		70524100	+1	tier1	-	no_errors	ENST00000373829	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	T
ITPK1	3705	genome.wustl.edu	37	14	93412701	93412701	+	Silent	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr14:93412701G>T	ENST00000267615.6	-	10	1049	c.876C>A	c.(874-876)gcC>gcA	p.A292A	ITPK1_ENST00000556603.2_Silent_p.A292A|ITPK1_ENST00000354313.3_Silent_p.A292A|ITPK1_ENST00000555495.1_Silent_p.A173A|ITPK1_ENST00000556954.1_5'UTR			Q13572	ITPK1_HUMAN	inositol-tetrakisphosphate 1-kinase	292	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.				blood coagulation (GO:0007596)|dephosphorylation (GO:0016311)|inositol phosphate metabolic process (GO:0043647)|inositol trisphosphate metabolic process (GO:0032957)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|inositol tetrakisphosphate 1-kinase activity (GO:0047325)|inositol-1,3,4,5,6-pentakisphosphate 1-phosphatase activity (GO:0052825)|inositol-1,3,4,6-tetrakisphosphate 1-phosphatase activity (GO:0052831)|inositol-1,3,4,6-tetrakisphosphate 6-phosphatase activity (GO:0052830)|inositol-1,3,4-trisphosphate 5-kinase activity (GO:0052726)|inositol-1,3,4-trisphosphate 6-kinase activity (GO:0052725)|inositol-3,4,6-trisphosphate 1-kinase activity (GO:0052835)|isomerase activity (GO:0016853)|magnesium ion binding (GO:0000287)			endometrium(1)|large_intestine(3)|lung(6)|ovary(1)	11		all_cancers(154;0.077)|all_epithelial(191;0.247)		Epithelial(152;0.124)|all cancers(159;0.169)		TGTCAATGACGGCGTGCTGCC	0.642																																																	0													129.0	113.0	118.0					14																	93412701		2203	4300	6503	SO:0001819	synonymous_variant	0			U51336	CCDS9907.1, CCDS45157.1	14q32.12	2012-08-16	2011-04-28		ENSG00000100605	ENSG00000100605	2.7.1.134		6177	protein-coding gene	gene with protein product		601838	"""inositol 1,3,4-triphosphate 5/6 kinase"""			8662638, 11042108	Standard	NM_014216		Approved		uc001ybh.3	Q13572	OTTHUMG00000171226	ENST00000267615.6:c.876C>A	14.37:g.93412701G>T			Q9BTL6|Q9H2E7	Silent	SNP	pfam_Inositol_tetrakis-P_1-kinase	p.A292	ENST00000267615.6	37	c.876	CCDS9907.1	14																																																																																			ITPK1	-	pfam_Inositol_tetrakis-P_1-kinase	ENSG00000100605		0.642	ITPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPK1	HGNC	protein_coding	OTTHUMT00000412421.2		0.00	71	0	G	NM_014216		93412701	-1			no_errors	ENST00000267615	ensembl	human	known	74_37	silent	5.56	51	3	SNP	0.003	T
JAKMIP3	282973	genome.wustl.edu	37	10	133930772	133930772	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr10:133930772G>T	ENST00000298622.4	+	2	465	c.327G>T	c.(325-327)aaG>aaT	p.K109N		NM_001105521.2	NP_001098991.1	Q5VZ66	JKIP3_HUMAN	Janus kinase and microtubule interacting protein 3	109						Golgi apparatus (GO:0005794)		p.K109K(1)		breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	31		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		TCAAGATCAAGGACAACGAGA	0.607																																																	1	Substitution - coding silent(1)	lung(1)											59.0	73.0	68.0					10																	133930772		2187	4278	6465	SO:0001583	missense	0			AL832756	CCDS44494.1	10q26.3	2009-04-23	2009-04-23	2008-01-28	ENSG00000188385	ENSG00000188385			23523	protein-coding gene	gene with protein product	"""neuroendocrine long coiled-coil 2"""	611198	"""chromosome 10 open reading frame 39"", ""chromosome 10 open reading frame 14"""	C10orf39, C10orf14		15277531, 17572408	Standard	NM_001105521		Approved	FLJ37857, NECC2, KIAA4091, bA140A10.5	uc001lkx.4	Q5VZ66	OTTHUMG00000150167	ENST00000298622.4:c.327G>T	10.37:g.133930772G>T	ENSP00000298622:p.Lys109Asn		A6PW00|Q69YM6|Q6ZT29	Missense_Mutation	SNP	NULL	p.K109N	ENST00000298622.4	37	c.327	CCDS44494.1	10	.	.	.	.	.	.	.	.	.	.	G	18.82	3.704706	0.68615	.	.	ENSG00000188385	ENST00000298622	T	0.38240	1.15	4.49	3.56	0.40772	.	0.000000	0.85682	D	0.000000	T	0.49012	0.1532	M	0.66297	2.02	0.35312	D	0.783945	D	0.89917	1.0	D	0.85130	0.997	T	0.55392	-0.8148	10	0.21540	T	0.41	-38.2766	5.5224	0.16939	0.3195:0.0:0.6805:0.0	.	109	Q5VZ66	JKIP3_HUMAN	N	109	ENSP00000298622:K109N	ENSP00000298622:K109N	K	+	3	2	JAKMIP3	133780762	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.201000	0.42734	2.345000	0.79718	0.485000	0.47835	AAG	JAKMIP3	-	NULL	ENSG00000188385		0.607	JAKMIP3-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	JAKMIP3	HGNC	protein_coding	OTTHUMT00000051049.3		0.00	45	0	G	NM_194303		133930772	+1			no_errors	ENST00000298622	ensembl	human	known	74_37	missense	5.00	57	3	SNP	1.000	T
KAT6A	7994	genome.wustl.edu	37	8	41790300	41790300	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr8:41790300G>T	ENST00000396930.3	-	18	5981	c.5438C>A	c.(5437-5439)cCc>cAc	p.P1813H	KAT6A_ENST00000265713.2_Missense_Mutation_p.P1813H|KAT6A_ENST00000406337.1_Missense_Mutation_p.P1813H	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	1813					aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										CAAGTTTGGGGGTGGCGTCAT	0.522																																																	0													181.0	174.0	176.0					8																	41790300		2203	4300	6503	SO:0001583	missense	0			U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.5438C>A	8.37:g.41790300G>T	ENSP00000380136:p.Pro1813His		Q76L81	Missense_Mutation	SNP	pfam_MOZ_SAS,pfam_Znf_PHD-finger,superfamily_Acyl_CoA_acyltransferase,superfamily_Znf_FYVE_PHD,smart_Histone_H1/H5_H15,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.P1813H	ENST00000396930.3	37	c.5438	CCDS6124.1	8	.	.	.	.	.	.	.	.	.	.	G	11.90	1.776187	0.31411	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930	T;T;T	0.68765	-0.35;-0.35;-0.35	5.67	4.78	0.61160	.	0.000000	0.64402	D	0.000001	T	0.72078	0.3416	L	0.32530	0.975	0.58432	D	0.999995	D	0.71674	0.998	P	0.60789	0.879	T	0.76184	-0.3052	10	0.87932	D	0	-13.0407	16.8051	0.85625	0.0:0.1286:0.8714:0.0	.	1813	Q92794	KAT6A_HUMAN	H	1813	ENSP00000265713:P1813H;ENSP00000385888:P1813H;ENSP00000380136:P1813H	ENSP00000265713:P1813H	P	-	2	0	KAT6A	41909457	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.611000	0.82962	1.355000	0.45865	0.655000	0.94253	CCC	KAT6A	-	NULL	ENSG00000083168		0.522	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KAT6A	HGNC	protein_coding	OTTHUMT00000318163.1		0.00	46	0	G	NM_006766		41790300	-1			no_errors	ENST00000265713	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	T
KCNIP3	30818	genome.wustl.edu	37	2	96049917	96049918	+	3'UTR	INS	-	-	AC	rs375367798|rs72135616|rs58903840		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:96049917_96049918insAC	ENST00000295225.5	+	0	1026_1027				KCNIP3_ENST00000360990.3_3'UTR|KCNIP3_ENST00000377181.2_3'UTR	NM_013434.4	NP_038462.1	Q9Y2W7	CSEN_HUMAN	Kv channel interacting protein 3, calsenilin						apoptotic process (GO:0006915)|behavioral response to pain (GO:0048266)|intracellular protein transport (GO:0006886)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of neuron apoptotic process (GO:0043523)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	axon terminus (GO:0043679)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sequence-specific DNA binding (GO:0043565)|transcription corepressor activity (GO:0003714)|voltage-gated ion channel activity (GO:0005244)			NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	16				READ - Rectum adenocarcinoma(193;0.13)		AACAGATTGCTacacacacaca	0.53																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF199599	CCDS2013.1, CCDS33245.1	2q21.1	2013-01-10	2006-02-11	2006-02-11	ENSG00000115041	ENSG00000115041		"""EF-hand domain containing"""	15523	protein-coding gene	gene with protein product		604662	"""calsenilin, presenilin-binding protein, EF hand transcription factor"""	CSEN		9771752, 10078534	Standard	NM_013434		Approved	DREAM, KCHIP3, calsenilin	uc002sup.3	Q9Y2W7	OTTHUMG00000130392	ENST00000295225.5:c.*121->AC	2.37:g.96049926_96049927dupAC			H7BY46|Q3YAC3|Q3YAC4|Q53TJ5|Q96T40|Q9UJ84|Q9UJ85	RNA	INS	-	NULL	ENST00000295225.5	37	NULL	CCDS2013.1	2																																																																																			KCNIP3	-	-	ENSG00000115041		0.530	KCNIP3-001	KNOWN	basic|CCDS	protein_coding	KCNIP3	HGNC	protein_coding	OTTHUMT00000252770.1		0.00	8	0	-	NM_013434		96049918	+1	tier1		no_errors	ENST00000377181	ensembl	human	known	74_37	rna	23.08	10	3	INS	0.979:0.000	AC
KIAA0753	9851	genome.wustl.edu	37	17	6502559	6502559	+	Missense_Mutation	SNP	C	C	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr17:6502559C>G	ENST00000361413.3	-	14	2528	c.2170G>C	c.(2170-2172)Gag>Cag	p.E724Q	KIAA0753_ENST00000575027.1_5'UTR|KIAA0753_ENST00000542606.1_Missense_Mutation_p.E425Q|KIAA0753_ENST00000589033.1_Missense_Mutation_p.E180Q|KIAA0753_ENST00000572370.1_Missense_Mutation_p.E425Q|RNA5SP435_ENST00000364044.1_RNA	NM_014804.2	NP_055619.2	Q2KHM9	K0753_HUMAN	KIAA0753	724						centrosome (GO:0005813)|cytoplasm (GO:0005737)				endometrium(4)|large_intestine(11)|lung(5)|prostate(4)	24				COAD - Colon adenocarcinoma(228;0.157)		ACGCATACCTCCTGTGCAGGC	0.353																																																	0													96.0	95.0	95.0					17																	6502559		1996	4166	6162	SO:0001583	missense	0				CCDS42247.1	17p13.1	2014-04-04			ENSG00000198920	ENSG00000198920			29110	protein-coding gene	gene with protein product						24613305	Standard	NM_014804		Approved		uc002gde.4	Q2KHM9	OTTHUMG00000177928	ENST00000361413.3:c.2170G>C	17.37:g.6502559C>G	ENSP00000355250:p.Glu724Gln		A8KA11|B7Z479|O94853|Q05D97|Q2KHN0|Q9UG45	Missense_Mutation	SNP	NULL	p.E724Q	ENST00000361413.3	37	c.2170	CCDS42247.1	17	.	.	.	.	.	.	.	.	.	.	C	9.662	1.144329	0.21205	.	.	ENSG00000198920	ENST00000361413;ENST00000542606;ENST00000542826	T;T	0.09723	3.12;2.95	4.98	-0.834	0.10779	.	0.589501	0.17570	N	0.169514	T	0.04770	0.0129	N	0.14661	0.345	0.18873	N	0.999988	B	0.15930	0.015	B	0.16289	0.015	T	0.39396	-0.9616	10	0.23891	T	0.37	-6.8114	5.1078	0.14793	0.0:0.3058:0.3877:0.3066	.	724	Q2KHM9	K0753_HUMAN	Q	724;425;180	ENSP00000355250:E724Q;ENSP00000444634:E425Q	ENSP00000355250:E724Q	E	-	1	0	KIAA0753	6443283	0.675000	0.27558	0.252000	0.24328	0.177000	0.22998	0.320000	0.19540	0.089000	0.17243	0.563000	0.77884	GAG	KIAA0753	-	NULL	ENSG00000198920		0.353	KIAA0753-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0753	HGNC	protein_coding	OTTHUMT00000439769.3	-	0.00	77	0	C	NM_014804		6502559	-1	tier1	-	no_errors	ENST00000361413	ensembl	human	known	74_37	missense	25.76	49	17	SNP	0.106	G
KIAA1024	23251	genome.wustl.edu	37	15	79749614	79749614	+	Missense_Mutation	SNP	A	A	C	rs370387568		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr15:79749614A>C	ENST00000305428.3	+	2	1200	c.1125A>C	c.(1123-1125)gaA>gaC	p.E375D		NM_015206.2	NP_056021.1	Q9UPX6	K1024_HUMAN	KIAA1024	375						integral component of membrane (GO:0016021)				central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(2)|pancreas(2)|prostate(1)	49						ACACAGAGGAAGTTCCTGACT	0.542																																																	0													59.0	66.0	64.0					15																	79749614		2196	4293	6489	SO:0001583	missense	0			AB028947	CCDS32306.1	15q25.1	2007-12-12				ENSG00000169330			29172	protein-coding gene	gene with protein product						10470851	Standard	NM_015206		Approved		uc002bew.1	Q9UPX6		ENST00000305428.3:c.1125A>C	15.37:g.79749614A>C	ENSP00000307461:p.Glu375Asp		A7MD43	Missense_Mutation	SNP	pfam_UPF0258	p.E375D	ENST00000305428.3	37	c.1125	CCDS32306.1	15	.	.	.	.	.	.	.	.	.	.	A	18.27	3.587294	0.66105	.	.	ENSG00000169330	ENST00000305428	T	0.36157	1.27	5.49	-3.14	0.05250	.	0.128118	0.50627	D	0.000118	T	0.41880	0.1178	M	0.67953	2.075	0.41817	D	0.990009	D	0.55172	0.97	P	0.51833	0.681	T	0.48536	-0.9027	9	.	.	.	.	13.182	0.59660	0.4034:0.0:0.5966:0.0	.	375	Q9UPX6	K1024_HUMAN	D	375	ENSP00000307461:E375D	.	E	+	3	2	KIAA1024	77536669	0.786000	0.28738	0.444000	0.26895	0.992000	0.81027	-0.108000	0.10857	-0.409000	0.07553	0.482000	0.46254	GAA	KIAA1024	-	NULL	ENSG00000169330		0.542	KIAA1024-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1024	HGNC	protein_coding	OTTHUMT00000416718.1	-	0.00	136	0	A	NM_015206		79749614	+1	tier1	-	no_errors	ENST00000305428	ensembl	human	known	74_37	missense	19.40	54	13	SNP	0.985	C
KIAA1109	84162	genome.wustl.edu	37	4	123207913	123207914	+	Nonsense_Mutation	DNP	GG	GG	TT			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr4:123207913_123207914GG>TT	ENST00000264501.4	+	53	9628_9629	c.9255_9256GG>TT	c.(9253-9258)caGGga>caTTga	p.3085_3086QG>H*	KIAA1109_ENST00000455637.1_Nonsense_Mutation_p.3085_3086QG>H*|KIAA1109_ENST00000388738.3_Nonsense_Mutation_p.3085_3086QG>H*			Q2LD37	K1109_HUMAN	KIAA1109	3085					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						ACTATTTACAGGGAAATTATCT	0.327																																																	0																																										SO:0001587	stop_gained	0			AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	Exception_encountered	4.37:g.123207913_123207914delinsTT	ENSP00000264501:p.Q3085_G3086delinsH*		Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation|Nonsense_Mutation	SNP	pfam_Fragile_site-assoc_C	p.Q3085H|p.G3086*	ENST00000264501.4	37	c.9255|c.9256	CCDS43267.1	4																																																																																			KIAA1109	-	NULL	ENSG00000138688		0.327	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1109	HGNC	protein_coding	OTTHUMT00000316415.1	|-	0.00	116|114	0	G	NM_020797		123207913|123207914	+1	|tier1	|-	no_errors	ENST00000264501	ensembl	human	known	74_37	missense|nonsense	5.06|5.19	75|73	4	SNP	0.997|1.000	T
KIAA1614	57710	genome.wustl.edu	37	1	180885503	180885503	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr1:180885503G>T	ENST00000367588.4	+	2	319	c.264G>T	c.(262-264)agG>agT	p.R88S		NM_020950.1	NP_066001.1	Q5VZ46	K1614_HUMAN	KIAA1614	88										NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	33						CCAAGGTGAGGGCTTTGAAGG	0.587																																																	0													62.0	69.0	66.0					1																	180885503		1977	4157	6134	SO:0001583	missense	0			AB046834	CCDS41442.1	1q25.3	2008-02-05			ENSG00000135835	ENSG00000135835			29327	protein-coding gene	gene with protein product							Standard	NM_020950		Approved		uc001gok.2	Q5VZ46	OTTHUMG00000035183	ENST00000367588.4:c.264G>T	1.37:g.180885503G>T	ENSP00000356560:p.Arg88Ser		Q5VZ45|Q9HCF8	Missense_Mutation	SNP	NULL	p.R88S	ENST00000367588.4	37	c.264	CCDS41442.1	1	.	.	.	.	.	.	.	.	.	.	G	19.76	3.887977	0.72410	.	.	ENSG00000135835	ENST00000367588	T	0.04194	3.68	5.08	2.82	0.32997	.	0.157396	0.30244	N	0.010065	T	0.07683	0.0193	N	0.24115	0.695	0.26448	N	0.975657	D	0.69078	0.997	D	0.63283	0.913	T	0.13150	-1.0520	9	0.66056	D	0.02	-15.3902	5.6547	0.17637	0.3157:0.0:0.6843:0.0	.	88	Q5VZ46	K1614_HUMAN	S	88	ENSP00000356560:R88S	ENSP00000356560:R88S	R	+	3	2	KIAA1614	179152126	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	0.369000	0.20416	1.200000	0.43188	0.655000	0.94253	AGG	KIAA1614	-	NULL	ENSG00000135835		0.587	KIAA1614-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1614	HGNC	protein_coding	OTTHUMT00000085151.1	-	0.00	86	0	G	XM_046531		180885503	+1	tier1	-	no_errors	ENST00000367588	ensembl	human	known	74_37	missense	5.81	81	5	SNP	1.000	T
KIF21A	55605	genome.wustl.edu	37	12	39734142	39734142	+	Missense_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr12:39734142T>G	ENST00000361418.5	-	16	2150	c.2135A>C	c.(2134-2136)gAa>gCa	p.E712A	KIF21A_ENST00000395670.3_Missense_Mutation_p.E712A|KIF21A_ENST00000361961.3_Missense_Mutation_p.E699A|KIF21A_ENST00000541463.2_Missense_Mutation_p.E699A|KIF21A_ENST00000544797.2_Missense_Mutation_p.E699A			Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	712					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(41)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	86		Lung NSC(34;0.179)|all_lung(34;0.213)				TTTTGCTTTTTCTTCTGAGTA	0.348																																																	0													79.0	64.0	69.0					12																	39734142		2202	4299	6501	SO:0001583	missense	0			AK000059	CCDS31773.1, CCDS53774.1, CCDS53775.1, CCDS53776.1	12q12	2013-01-10						"""Kinesins"", ""WD repeat domain containing"""	19349	protein-coding gene	gene with protein product		608283	"""fibrosis of the extraocular muscles, congenital, 1"""	FEOM1		10225949	Standard	NM_017641		Approved	FLJ20052	uc001rly.3	Q7Z4S6	OTTHUMG00000169335	ENST00000361418.5:c.2135A>C	12.37:g.39734142T>G	ENSP00000354878:p.Glu712Ala		A8MX28|B0I1R9|B9EGE4|F5H0C3|F5H219|Q2UVF1|Q6UKL9|Q7Z668|Q86WZ5|Q8IVZ8|Q9C0F5|Q9NXU4|Q9Y590	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_WD40_repeat,superfamily_P-loop_NTPase,superfamily_WD40_repeat_dom,superfamily_Prefoldin,superfamily_ARM-type_fold,smart_Kinesin_motor_dom,smart_WD40_repeat,pfscan_Kinesin_motor_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Kinesin_motor_dom	p.E712A	ENST00000361418.5	37	c.2135	CCDS53776.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	26.4|26.4	4.730838|4.730838	0.89390|0.89390	.|.	.|.	ENSG00000139116|ENSG00000139116	ENST00000361961;ENST00000395670;ENST00000341813;ENST00000544797;ENST00000361418;ENST00000541463|ENST00000552961	T;T;T;T;T|.	0.18338|.	2.22;2.22;2.22;2.22;2.22|.	5.22|5.22	5.22|5.22	0.72569|0.72569	.|.	0.000000|.	0.56097|.	D|.	0.000040|.	T|T	0.72342|0.72342	0.3448|0.3448	M|M	0.69248|0.69248	2.105|2.105	0.58432|0.58432	D|D	0.999998|0.999998	P;D;P;D;D|.	0.62365|.	0.925;0.986;0.864;0.988;0.991|.	P;P;P;P;P|.	0.59487|.	0.616;0.737;0.493;0.717;0.858|.	T|T	0.72510|0.72510	-0.4271|-0.4271	10|5	0.51188|.	T|.	0.08|.	.|.	15.1155|15.1155	0.72397|0.72397	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	699;699;712;699;712|.	F5H219;F5H0C3;Q7Z4S6;Q7Z4S6-2;Q7Z4S6-3|.	.;.;KI21A_HUMAN;.;.|.	A|Q	699;712;712;699;712;699|60	ENSP00000354851:E699A;ENSP00000379029:E712A;ENSP00000445606:E699A;ENSP00000354878:E712A;ENSP00000438075:E699A|.	ENSP00000344501:E712A|.	E|K	-|-	2|1	0|0	KIF21A|KIF21A	38020409|38020409	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	7.738000|7.738000	0.84966|0.84966	1.972000|1.972000	0.57404|0.57404	0.533000|0.533000	0.62120|0.62120	GAA|AAA	KIF21A	-	NULL	ENSG00000139116		0.348	KIF21A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF21A	HGNC	protein_coding	OTTHUMT00000403581.1		0.00	21	0	T	NM_017641		39734142	-1			no_errors	ENST00000395670	ensembl	human	known	74_37	missense	33.33	16	8	SNP	1.000	G
KIF26A	26153	genome.wustl.edu	37	14	104638926	104638926	+	Silent	SNP	G	G	T	rs2275595	byFrequency	TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr14:104638926G>T	ENST00000423312.2	+	7	1341	c.1341G>T	c.(1339-1341)tcG>tcT	p.S447S	KIF26A_ENST00000315264.7_Silent_p.S308S	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	447	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		AAGTCTGCTCGGGGACCGTGG	0.642																																																	0													63.0	67.0	66.0					14																	104638926		2085	4208	6293	SO:0001819	synonymous_variant	0			AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.1341G>T	14.37:g.104638926G>T			Q8TAZ7|Q96GK3|Q9UFL3	Silent	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.S447	ENST00000423312.2	37	c.1341	CCDS45171.1	14																																																																																			KIF26A	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000066735		0.642	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIF26A	HGNC	protein_coding	OTTHUMT00000414356.1	-	0.00	60	0	G			104638926	+1	tier1	-	no_errors	ENST00000423312	ensembl	human	known	74_37	silent	7.41	50	4	SNP	0.886	T
KIF26A	26153	genome.wustl.edu	37	14	104641967	104641967	+	Missense_Mutation	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr14:104641967C>A	ENST00000423312.2	+	12	2842	c.2842C>A	c.(2842-2844)Ctg>Atg	p.L948M	KIF26A_ENST00000315264.7_Missense_Mutation_p.L809M	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	948					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		CAGGAGGCCACTGCCCAGCCC	0.667																																																	0													11.0	14.0	13.0					14																	104641967		1906	4066	5972	SO:0001583	missense	0			AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.2842C>A	14.37:g.104641967C>A	ENSP00000388241:p.Leu948Met		Q8TAZ7|Q96GK3|Q9UFL3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.L948M	ENST00000423312.2	37	c.2842	CCDS45171.1	14	.	.	.	.	.	.	.	.	.	.	c	4.908	0.168810	0.09339	.	.	ENSG00000066735	ENST00000423312;ENST00000315264	D;D	0.87887	-2.31;-2.27	3.88	2.97	0.34412	.	.	.	.	.	D	0.84009	0.5378	N	0.12443	0.215	0.26809	N	0.969041	D	0.89917	1.0	D	0.79108	0.992	T	0.72478	-0.4281	9	0.09338	T	0.73	.	10.1596	0.42844	0.0:0.7576:0.0:0.2424	.	948	Q9ULI4	KI26A_HUMAN	M	948;809	ENSP00000388241:L948M;ENSP00000325452:L809M	ENSP00000325452:L809M	L	+	1	2	KIF26A	103711720	0.993000	0.37304	0.018000	0.16275	0.099000	0.18886	1.440000	0.35024	0.245000	0.21373	-1.829000	0.00594	CTG	KIF26A	-	NULL	ENSG00000066735		0.667	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIF26A	HGNC	protein_coding	OTTHUMT00000414356.1	-	0.00	61	0	C			104641967	+1	tier1	-	no_errors	ENST00000423312	ensembl	human	known	74_37	missense	72.73	6	16	SNP	0.046	A
KIF9	64147	genome.wustl.edu	37	3	47281314	47281314	+	Intron	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr3:47281314C>A	ENST00000265529.3	-	18	2605				KIF9_ENST00000335044.2_Intron|KIF9_ENST00000487440.1_5'UTR|KIF9_ENST00000452770.2_Intron|KIF9_ENST00000352910.4_Intron|KIF9_ENST00000444589.2_Intron|KIF9-AS1_ENST00000429315.3_RNA			Q9HAQ2	KIF9_HUMAN	kinesin family member 9						ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|extracellular matrix disassembly (GO:0022617)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle disassembly (GO:1903008)|regulation of podosome assembly (GO:0071801)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|podosome (GO:0002102)|vesicle (GO:0031982)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|protein dimerization activity (GO:0046983)			central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(15)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)	34		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000284)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		AGGAATAAACCAAGTGACATC	0.483																																					Colon(44;962 1147 15977 24541)												0													107.0	98.0	101.0					3																	47281314		2203	4300	6503	SO:0001627	intron_variant	0			AF311212	CCDS2751.1, CCDS2752.1	3p21.31	2008-03-03			ENSG00000088727	ENSG00000088727		"""Kinesins"""	16666	protein-coding gene	gene with protein product		607910				11483511	Standard	NM_022342		Approved	MGC104186	uc003cqx.3	Q9HAQ2	OTTHUMG00000133512	ENST00000265529.3:c.1924+976G>T	3.37:g.47281314C>A			Q86Z28|Q9H8A4	RNA	SNP	-	NULL	ENST00000265529.3	37	NULL	CCDS2752.1	3																																																																																			KIF9-AS1	-	-	ENSG00000227398		0.483	KIF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF9-AS1	HGNC	protein_coding	OTTHUMT00000257475.2	-	0.00	91	0	C			47281314	+1	tier1	-	no_errors	ENST00000429315	ensembl	human	known	74_37	rna	5.26	72	4	SNP	0.004	A
KIF9	64147	genome.wustl.edu	37	3	47307360	47307360	+	Missense_Mutation	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr3:47307360C>T	ENST00000265529.3	-	9	1456	c.776G>A	c.(775-777)gGc>gAc	p.G259D	KIF9_ENST00000335044.2_Missense_Mutation_p.G259D|KIF9_ENST00000487440.1_5'UTR|KIF9_ENST00000452770.2_Missense_Mutation_p.G259D|KIF9_ENST00000352910.4_Missense_Mutation_p.G166D|KIF9_ENST00000444589.2_Missense_Mutation_p.G259D			Q9HAQ2	KIF9_HUMAN	kinesin family member 9	259	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|extracellular matrix disassembly (GO:0022617)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle disassembly (GO:1903008)|regulation of podosome assembly (GO:0071801)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|podosome (GO:0002102)|vesicle (GO:0031982)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|protein dimerization activity (GO:0046983)			central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(15)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)	34		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000284)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		CAGGACTTGGCCCTCAGACTA	0.502																																					Colon(44;962 1147 15977 24541)												0													159.0	141.0	147.0					3																	47307360		2203	4300	6503	SO:0001583	missense	0			AF311212	CCDS2751.1, CCDS2752.1	3p21.31	2008-03-03			ENSG00000088727	ENSG00000088727		"""Kinesins"""	16666	protein-coding gene	gene with protein product		607910				11483511	Standard	NM_022342		Approved	MGC104186	uc003cqx.3	Q9HAQ2	OTTHUMG00000133512	ENST00000265529.3:c.776G>A	3.37:g.47307360C>T	ENSP00000265529:p.Gly259Asp		Q86Z28|Q9H8A4	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.G259D	ENST00000265529.3	37	c.776	CCDS2752.1	3	.	.	.	.	.	.	.	.	.	.	C	26.7	4.760356	0.89932	.	.	ENSG00000088727	ENST00000335044;ENST00000265529;ENST00000444589;ENST00000452770;ENST00000352910	T;T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07;-1.07	5.0	5.0	0.66597	Kinesin, motor domain (4);	0.060422	0.64402	D	0.000005	D	0.86053	0.5841	M	0.78285	2.405	0.51482	D	0.999922	D;D	0.71674	0.988;0.998	P;D	0.69479	0.861;0.964	D	0.87064	0.2155	10	0.87932	D	0	.	10.5916	0.45312	0.0:0.9117:0.0:0.0883	.	259;259	Q9HAQ2-2;Q9HAQ2	.;KIF9_HUMAN	D	259;259;259;259;166	ENSP00000333942:G259D;ENSP00000265529:G259D;ENSP00000414987:G259D;ENSP00000391100:G259D;ENSP00000292334:G166D	ENSP00000265529:G259D	G	-	2	0	KIF9	47282364	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	4.380000	0.59581	2.615000	0.88500	0.650000	0.86243	GGC	KIF9	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000088727		0.502	KIF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF9	HGNC	protein_coding	OTTHUMT00000257475.2		0.00	42	0	C			47307360	-1			no_errors	ENST00000265529	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	T
KLHL1	57626	genome.wustl.edu	37	13	70514283	70514283	+	Nonsense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr13:70514283G>T	ENST00000377844.4	-	4	1662	c.903C>A	c.(901-903)tgC>tgA	p.C301*	KLHL1_ENST00000545028.1_Nonsense_Mutation_p.C108*	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	301					actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		GGAAGTGGCAGCACACTTCCA	0.468																																																	0													73.0	65.0	68.0					13																	70514283		2203	4300	6503	SO:0001587	stop_gained	0			AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.903C>A	13.37:g.70514283G>T	ENSP00000367075:p.Cys301*		A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Nonsense_Mutation	SNP	pfam_Kelch_1,pfam_Kelch_2,pfam_BACK,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pfscan_BTB/POZ-like	p.C301*	ENST00000377844.4	37	c.903	CCDS9445.1	13	.	.	.	.	.	.	.	.	.	.	G	40	8.219296	0.98712	.	.	ENSG00000150361	ENST00000377844;ENST00000545028	.	.	.	5.67	2.97	0.34412	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.9668	0.35881	0.2985:0.0:0.7015:0.0	.	.	.	.	X	301;108	.	ENSP00000367075:C301X	C	-	3	2	KLHL1	69412284	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.408000	0.44574	0.734000	0.32515	0.557000	0.71058	TGC	KLHL1	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	ENSG00000150361		0.468	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL1	HGNC	protein_coding	OTTHUMT00000045231.3	-	0.00	81	0	G	NM_020866		70514283	-1	tier1	-	no_errors	ENST00000377844	ensembl	human	known	74_37	nonsense	6.45	58	4	SNP	1.000	T
KLHL24	54800	genome.wustl.edu	37	3	183396909	183396909	+	Missense_Mutation	SNP	A	A	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr3:183396909A>G	ENST00000454652.2	+	9	2024	c.1638A>G	c.(1636-1638)atA>atG	p.I546M	KLHL24_ENST00000242810.6_Missense_Mutation_p.I546M	NM_017644.3	NP_060114.2	Q6TFL4	KLH24_HUMAN	kelch-like family member 24	546						cell projection (GO:0042995)|cytoplasm (GO:0005737)				NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(10)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;2.88e-10)|Ovarian(172;0.0303)		all cancers(12;1.43e-42)|Epithelial(37;1.73e-36)|OV - Ovarian serous cystadenocarcinoma(80;8.75e-22)			ATGGTAAAATATATATCCTGG	0.378																																																	0													96.0	101.0	100.0					3																	183396909		2203	4300	6503	SO:0001583	missense	0				CCDS3246.1	3q27.1	2013-02-22	2013-02-22		ENSG00000114796	ENSG00000114796		"""Kelch-like"", ""BTB/POZ domain containing"""	25947	protein-coding gene	gene with protein product		611295	"""kelch-like 24 (Drosophila)"""				Standard	XM_005247552		Approved	DRE1, FLJ20059	uc003flv.3	Q6TFL4	OTTHUMG00000156911	ENST00000454652.2:c.1638A>G	3.37:g.183396909A>G	ENSP00000395012:p.Ile546Met		A5PLN8|Q9H620|Q9NXT9	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.I546M	ENST00000454652.2	37	c.1638	CCDS3246.1	3	.	.	.	.	.	.	.	.	.	.	A	20.9	4.062421	0.76187	.	.	ENSG00000114796	ENST00000242810;ENST00000454652	D;D	0.85171	-1.95;-1.95	5.99	2.27	0.28462	Galactose oxidase, beta-propeller (1);	0.141748	0.64402	D	0.000012	D	0.91466	0.7306	M	0.79343	2.45	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.91914	0.5542	10	0.87932	D	0	.	14.7448	0.69483	0.3173:0.6827:0.0:0.0	.	546	Q6TFL4	KLH24_HUMAN	M	546	ENSP00000242810:I546M;ENSP00000395012:I546M	ENSP00000242810:I546M	I	+	3	3	KLHL24	184879603	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.283000	0.65621	0.459000	0.27016	0.482000	0.46254	ATA	KLHL24	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000114796		0.378	KLHL24-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KLHL24	HGNC	protein_coding	OTTHUMT00000346586.2	-	0.00	39	0	A	NM_017644		183396909	+1	tier1	-	no_errors	ENST00000242810	ensembl	human	known	74_37	missense	35.71	18	10	SNP	1.000	G
KNG1	3827	genome.wustl.edu	37	3	186457204	186457204	+	Splice_Site	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr3:186457204G>T	ENST00000265023.4	+	9	1337		c.e9+1		KNG1_ENST00000447445.1_Splice_Site|KNG1_ENST00000287611.2_Splice_Site|RP11-573D15.8_ENST00000354642.2_RNA|RP11-573D15.8_ENST00000599314.1_RNA	NM_001102416.2	NP_001095886.1	P01042	KNG1_HUMAN	kininogen 1						blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|inflammatory response (GO:0006954)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteolysis (GO:0045861)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|smooth muscle contraction (GO:0006939)|vasodilation (GO:0042311)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|heparin binding (GO:0008201)|receptor binding (GO:0005102)|zinc ion binding (GO:0008270)			endometrium(1)|lung(15)|prostate(1)|skin(2)|stomach(2)	21	all_cancers(143;8.96e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.12e-20)	GBM - Glioblastoma multiforme(93;0.0798)		ACTGGGAATGGTATGATTCTA	0.418																																																	0													91.0	85.0	87.0					3																	186457204		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS3281.1, CCDS43183.1, CCDS54695.1	3q27.3	2014-05-15	2004-05-21	2004-05-26	ENSG00000113889	ENSG00000113889		"""Endogenous ligands"""	6383	protein-coding gene	gene with protein product	"""alpha-2-thiol proteinase inhibitor"", ""bradykinin"""	612358	"""kininogen"""	KNG, BDK		1733668	Standard	NM_000893		Approved	BK	uc011bsa.2	P01042	OTTHUMG00000150348	ENST00000265023.4:c.1125+1G>T	3.37:g.186457204G>T			A8K474|B2RCR2|C9JEX1|P01043|Q53EQ0|Q6PAU9|Q7M4P1	Splice_Site	SNP	-	e9+1	ENST00000265023.4	37	c.1125+1	CCDS43183.1	3	.	.	.	.	.	.	.	.	.	.	G	14.08	2.429625	0.43122	.	.	ENSG00000113889	ENST00000287611;ENST00000265023;ENST00000447445;ENST00000432028	.	.	.	4.54	4.54	0.55810	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.1087	0.59261	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KNG1	187939898	1.000000	0.71417	0.987000	0.45799	0.117000	0.20001	3.795000	0.55499	2.811000	0.96726	0.557000	0.71058	.	KNG1	-	-	ENSG00000113889		0.418	KNG1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KNG1	HGNC	protein_coding	OTTHUMT00000317738.1	-	0.00	87	0	G	NM_001102416	Intron	186457204	+1	tier1	-	no_errors	ENST00000265023	ensembl	human	known	74_37	splice_site	6.78	55	4	SNP	0.990	T
KRT6B	3854	genome.wustl.edu	37	12	52841342	52841342	+	Silent	SNP	G	G	A	rs373899186		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr12:52841342G>A	ENST00000252252.3	-	8	1487	c.1440C>T	c.(1438-1440)ggC>ggT	p.G480G		NM_005555.3	NP_005546.2	P04259	K2C6B_HUMAN	keratin 6B	480	Tail.				ectoderm development (GO:0007398)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(19)|ovary(4)|prostate(2)	40				BRCA - Breast invasive adenocarcinoma(357;0.083)		CTTGTCCAACGCCTTCGCCAT	0.562																																																	0								G		0,4406		0,0,2203	148.0	115.0	126.0		1440	-1.2	1.0	12		126	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	KRT6B	NM_005555.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		480/565	52841342	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			BC034535	CCDS8828.1	12q13.13	2013-01-16	2004-08-11		ENSG00000185479	ENSG00000185479		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6444	protein-coding gene	gene with protein product		148042	"""keratin-like 1 (a type II keratin sequence)"""	KRTL1		1713141, 16831889	Standard	NM_005555		Approved		uc001sak.3	P04259	OTTHUMG00000169593	ENST00000252252.3:c.1440C>T	12.37:g.52841342G>A			P48669	Silent	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.G480	ENST00000252252.3	37	c.1440	CCDS8828.1	12																																																																																			KRT6B	-	NULL	ENSG00000185479		0.562	KRT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT6B	HGNC	protein_coding	OTTHUMT00000404969.1	-	0.00	98	0	G	NM_005555		52841342	-1	tier1	-	no_errors	ENST00000252252	ensembl	human	known	74_37	silent	18.05	109	24	SNP	0.951	A
KRT8	3856	genome.wustl.edu	37	12	53292543	53292543	+	Nonsense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr12:53292543G>T	ENST00000552551.1	-	7	1554	c.1122C>A	c.(1120-1122)taC>taA	p.Y374*	KRT8_ENST00000546897.1_Nonsense_Mutation_p.Y374*|KRT8_ENST00000293308.6_Nonsense_Mutation_p.Y374*|KRT8_ENST00000552150.1_Nonsense_Mutation_p.Y402*			P05787	K2C8_HUMAN	keratin 8	374	Coil 2.|Necessary for interaction with PNN.|Rod.				cell differentiation involved in embryonic placenta development (GO:0060706)|extrinsic apoptotic signaling pathway (GO:0097191)|hepatocyte apoptotic process (GO:0097284)|response to hydrostatic pressure (GO:0051599)|response to other organism (GO:0051707)|sarcomere organization (GO:0045214)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	cell-cell junction (GO:0005911)|costamere (GO:0043034)|cytoplasm (GO:0005737)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	scaffold protein binding (GO:0097110)|structural molecule activity (GO:0005198)			endometrium(5)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(357;0.108)	Tenecteplase(DB00031)	TCAGCTCCTGGTACTCACGCA	0.637																																																	0													87.0	87.0	87.0					12																	53292543		2203	4297	6500	SO:0001587	stop_gained	0			BC000654	CCDS8841.1, CCDS58234.1	12q13.13	2013-01-16			ENSG00000170421	ENSG00000170421		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6446	protein-coding gene	gene with protein product		148060				2434381, 1705144, 16831889	Standard	NM_002273		Approved	CARD2, K8, CK8, CYK8, K2C8, KO	uc009zmk.1	P05787	OTTHUMG00000169881	ENST00000552551.1:c.1122C>A	12.37:g.53292543G>T	ENSP00000447566:p.Tyr374*		A8K4H3|B0AZN5|F8VXB4|Q14099|Q14716|Q14717|Q53GJ0|Q6DHW5|Q6GMY0|Q6P4C7|Q96J60	Nonsense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_II,prints_Keratin_I	p.Y374*	ENST00000552551.1	37	c.1122	CCDS8841.1	12	.	.	.	.	.	.	.	.	.	.	G	37	6.314050	0.97467	.	.	ENSG00000170421	ENST00000552551;ENST00000293308;ENST00000546897;ENST00000552150	.	.	.	4.39	4.39	0.52855	.	0.196250	0.45606	D	0.000359	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.3894	0.83528	0.0:0.0:1.0:0.0	.	.	.	.	X	374;374;374;402	.	ENSP00000293308:Y374X	Y	-	3	2	KRT8	51578810	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	3.993000	0.56987	2.375000	0.81037	0.561000	0.74099	TAC	KRT8	-	pfam_IF	ENSG00000170421		0.637	KRT8-001	KNOWN	alternative_5_UTR|overlapping_uORF|basic|appris_principal|CCDS	protein_coding	KRT8	HGNC	protein_coding	OTTHUMT00000406385.1		0.00	84	0	G	NM_002273		53292543	-1			no_errors	ENST00000293308	ensembl	human	known	74_37	nonsense	6.78	55	4	SNP	1.000	T
KSR1	8844	genome.wustl.edu	37	17	25904621	25904621	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr17:25904621G>T	ENST00000319524.6	+	3	476	c.476G>T	c.(475-477)cGt>cTt	p.R159L	KSR1_ENST00000509603.2_Missense_Mutation_p.R159L|KSR1_ENST00000268763.6_Missense_Mutation_p.R22L|KSR1_ENST00000398988.3_Missense_Mutation_p.R22L			Q8IVT5	KSR1_HUMAN	kinase suppressor of ras 1	159					Ras protein signal transduction (GO:0007265)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(12)|prostate(2)|urinary_tract(1)	28	Lung NSC(42;0.00836)		BRCA - Breast invasive adenocarcinoma(3;0.00122)	UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		GAGTGTGGCCGTCTGCAGTAT	0.672																																					Esophageal Squamous(88;1120 1336 6324 10502 16832)												0													35.0	47.0	43.0					17																	25904621		2135	4221	6356	SO:0001583	missense	0			U43586	CCDS58532.1	17q11.2	2012-05-23	2005-12-14	2005-12-14	ENSG00000141068	ENSG00000141068			6465	protein-coding gene	gene with protein product		601132	"""kinase suppressor of ras"""	KSR		8521512	Standard	XM_006722151		Approved	RSU2	uc031qzj.1	Q8IVT5	OTTHUMG00000132051	ENST00000319524.6:c.476G>T	17.37:g.25904621G>T	ENSP00000323178:p.Arg159Leu		F8WEA9|H7BYU0|Q13476	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R159L	ENST00000319524.6	37	c.476		17	.	.	.	.	.	.	.	.	.	.	G	24.6	4.550775	0.86127	.	.	ENSG00000141068	ENST00000319524;ENST00000509603;ENST00000268763;ENST00000398982;ENST00000398985	T;T;T;T	0.35048	7.37;7.37;7.37;1.33	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.63604	0.2525	M	0.80332	2.49	0.54753	D	0.999986	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.69610	-0.5099	10	0.87932	D	0	.	17.3403	0.87293	0.0:0.0:1.0:0.0	.	157;40	Q8IVT5;Q6ZNT2	KSR1_HUMAN;.	L	159;159;22;22;40	ENSP00000323178:R159L;ENSP00000438795:R159L;ENSP00000268763:R22L;ENSP00000381952:R22L	ENSP00000268763:R22L	R	+	2	0	KSR1	22928748	1.000000	0.71417	0.922000	0.36590	0.454000	0.32378	8.883000	0.92426	2.397000	0.81536	0.591000	0.81541	CGT	KSR1	-	NULL	ENSG00000141068		0.672	KSR1-202	KNOWN	basic|appris_candidate_longest	protein_coding	KSR1	HGNC	protein_coding			0.00	39	0	G	NM_014238		25904621	+1			no_errors	ENST00000319524	ensembl	human	known	74_37	missense	10.53	34	4	SNP	0.985	T
L1TD1	54596	genome.wustl.edu	37	1	62676526	62676526	+	Nonsense_Mutation	SNP	G	G	T	rs546879656		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr1:62676526G>T	ENST00000498273.1	+	4	2375	c.2080G>T	c.(2080-2082)Gag>Tag	p.E694*	Y_RNA_ENST00000363304.1_RNA	NM_001164835.1|NM_019079.4	NP_001158307.1|NP_061952.3	Q5T7N2	LITD1_HUMAN	LINE-1 type transposase domain containing 1	694										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	35						aagagatatagaggagagatc	0.328																																																	0													27.0	27.0	27.0					1																	62676526		1669	3022	4691	SO:0001587	stop_gained	0			BC060808	CCDS619.1	1p31.3	2009-01-12			ENSG00000240563	ENSG00000240563			25595	protein-coding gene	gene with protein product						12477932	Standard	NM_001164835		Approved	FLJ10884, ECAT11	uc001dae.4	Q5T7N2	OTTHUMG00000008914	ENST00000498273.1:c.2080G>T	1.37:g.62676526G>T	ENSP00000419901:p.Glu694*		Q8NDA1|Q9NUV8|Q9NV78	Nonsense_Mutation	SNP	pfam_Transposase_22,superfamily_STAT_TF_coiled-coil	p.E694*	ENST00000498273.1	37	c.2080	CCDS619.1	1	.	.	.	.	.	.	.	.	.	.	G	38	6.898081	0.97920	.	.	ENSG00000240563	ENST00000498273	.	.	.	2.86	2.86	0.33363	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	9.3938	0.38390	0.0:0.0:1.0:0.0	.	.	.	.	X	694	.	ENSP00000419901:E694X	E	+	1	0	L1TD1	62449114	0.905000	0.30787	0.627000	0.29227	0.036000	0.12997	2.428000	0.44749	1.944000	0.56390	0.305000	0.20034	GAG	L1TD1	-	pfam_Transposase_22,superfamily_STAT_TF_coiled-coil	ENSG00000240563		0.328	L1TD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	L1TD1	HGNC	protein_coding	OTTHUMT00000024688.1		0.00	35	0	G	NM_019079		62676526	+1			no_errors	ENST00000498273	ensembl	human	known	74_37	nonsense	7.14	39	3	SNP	0.615	T
LEPROTL1	23484	genome.wustl.edu	37	8	29961901	29961901	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr8:29961901G>T	ENST00000321250.8	+	3	293	c.178G>T	c.(178-180)Gat>Tat	p.D60Y	LEPROTL1_ENST00000442880.2_Missense_Mutation_p.D60Y|LEPROTL1_ENST00000523116.1_Missense_Mutation_p.D60Y|LEPROTL1_ENST00000518001.1_5'UTR|LEPROTL1_ENST00000518192.1_Missense_Mutation_p.D83Y	NM_015344.2	NP_056159.2	O95214	LERL1_HUMAN	leptin receptor overlapping transcript-like 1	60						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(3)	5				KIRC - Kidney renal clear cell carcinoma(542;0.094)|Kidney(114;0.113)		GGATGATACAGATGCTATGAG	0.393																																																	0													191.0	170.0	177.0					8																	29961901		2203	4300	6503	SO:0001583	missense	0			AF063605	CCDS6075.1, CCDS47834.1	8p12	2014-09-11			ENSG00000104660	ENSG00000104660			6555	protein-coding gene	gene with protein product		607338				11342119	Standard	NM_015344		Approved	my047, Vps55	uc003xhx.2	O95214	OTTHUMG00000163820	ENST00000321250.8:c.178G>T	8.37:g.29961901G>T	ENSP00000314625:p.Asp60Tyr		E9PHP8|Q9BW48	Missense_Mutation	SNP	pfam_VPS55	p.D60Y	ENST00000321250.8	37	c.178	CCDS6075.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.7|20.7	4.028269|4.028269	0.75390|0.75390	.|.	.|.	ENSG00000104660|ENSG00000104660	ENST00000321250;ENST00000520682;ENST00000442880;ENST00000523116;ENST00000518192|ENST00000519466	.|.	.|.	.|.	5.9|5.9	5.9|5.9	0.94986|0.94986	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.83326|0.83326	0.5230|0.5230	M|M	0.86740|0.86740	2.835|2.835	0.80722|0.80722	D|D	1|1	P;B|.	0.35077|.	0.483;0.416|.	B;B|.	0.39971|.	0.174;0.315|.	D|D	0.84736|0.84736	0.0748|0.0748	9|5	0.87932|.	D|.	0|.	.|.	17.7642|17.7642	0.88473|0.88473	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	60;60|.	E9PHP8;O95214|.	.;LERL1_HUMAN|.	Y|H	60;60;60;60;83|40	.|.	ENSP00000314625:D60Y|.	D|Q	+|+	1|3	0|2	LEPROTL1|LEPROTL1	30081443|30081443	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.384000|9.384000	0.97219|0.97219	2.793000|2.793000	0.96121|0.96121	0.591000|0.591000	0.81541|0.81541	GAT|CAG	LEPROTL1	-	pfam_VPS55	ENSG00000104660		0.393	LEPROTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEPROTL1	HGNC	protein_coding	OTTHUMT00000375771.2	-	0.00	79	0	G			29961901	+1	tier1	-	no_errors	ENST00000523116	ensembl	human	known	74_37	missense	5.97	63	4	SNP	1.000	T
LIMA1	51474	genome.wustl.edu	37	12	50598456	50598456	+	Nonsense_Mutation	SNP	G	G	T	rs370430368		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr12:50598456G>T	ENST00000341247.4	-	6	892	c.743C>A	c.(742-744)tCg>tAg	p.S248*	LIMA1_ENST00000552823.1_Nonsense_Mutation_p.S88*|LIMA1_ENST00000547825.1_5'Flank|LIMA1_ENST00000552008.1_5'UTR|LIMA1_ENST00000394943.3_Nonsense_Mutation_p.S248*|LIMA1_ENST00000552783.1_Nonsense_Mutation_p.S88*|LIMA1_ENST00000552909.1_Nonsense_Mutation_p.S88*	NM_001113546.1|NM_016357.4	NP_001107018.1|NP_057441.1	Q9UHB6	LIMA1_HUMAN	LIM domain and actin binding 1	248					actin filament bundle assembly (GO:0051017)|negative regulation of actin filament depolymerization (GO:0030835)|ruffle organization (GO:0031529)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(2)	44						ATTTTTCTCCGAGTCAAATGT	0.433																																																	0													132.0	121.0	125.0					12																	50598456		2203	4300	6503	SO:0001587	stop_gained	0			AF198454	CCDS8802.1, CCDS44877.1, CCDS55826.1, CCDS58230.1	12q13.12	2006-04-12				ENSG00000050405			24636	protein-coding gene	gene with protein product	"""epithelial protein lost in neoplasm beta"""	608364				10806352, 10618726, 12566430	Standard	NM_016357		Approved	EPLIN	uc001rwk.4	Q9UHB6		ENST00000341247.4:c.743C>A	12.37:g.50598456G>T	ENSP00000340184:p.Ser248*		B2RB09|Q2TAN7|Q59FE8|Q9BVF2|Q9H8J1|Q9HBN5|Q9NX96|Q9NXC3|Q9NXU6|Q9P0H8|Q9UHB5	Nonsense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.S248*	ENST00000341247.4	37	c.743	CCDS8802.1	12	.	.	.	.	.	.	.	.	.	.	G	8.658	0.899902	0.17686	.	.	ENSG00000050405	ENST00000552823;ENST00000394943;ENST00000341247;ENST00000552783;ENST00000552909;ENST00000420992	.	.	.	5.35	-0.752	0.11072	.	1.118860	0.06729	N	0.776418	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.3064	0.37878	0.441:0.0:0.559:0.0	.	.	.	.	X	88;248;248;88;88;167	.	ENSP00000340184:S248X	S	-	2	0	LIMA1	48884723	0.000000	0.05858	0.030000	0.17652	0.140000	0.21249	0.078000	0.14761	-0.118000	0.11851	-0.966000	0.02617	TCG	LIMA1	-	NULL	ENSG00000050405		0.433	LIMA1-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	LIMA1	HGNC	protein_coding	OTTHUMT00000406235.2	-	0.00	38	0	G	NM_016357		50598456	-1	tier1	-	no_errors	ENST00000394943	ensembl	human	known	74_37	nonsense	8.16	44	4	SNP	0.029	T
LINGO2	158038	genome.wustl.edu	37	9	27949357	27949357	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr9:27949357G>T	ENST00000379992.2	-	6	1762	c.1313C>A	c.(1312-1314)cCg>cAg	p.P438Q	LINGO2_ENST00000308675.3_Missense_Mutation_p.P438Q	NM_152570.2	NP_689783.1	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2	438	Ig-like C2-type.					integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	44	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		CACAGGCTGCGGGTCTCCATC	0.517																																																	0													80.0	71.0	74.0					9																	27949357		2203	4300	6503	SO:0001583	missense	0			AL353746	CCDS6524.1	9p21.2	2013-01-11	2007-02-01	2007-02-01	ENSG00000174482	ENSG00000174482		"""Immunoglobulin superfamily / I-set domain containing"""	21207	protein-coding gene	gene with protein product		609793	"""leucine rich repeat neuronal 6C"""	LRRN6C		14686891	Standard	NM_152570		Approved	LERN3	uc003zqu.2	Q7L985	OTTHUMG00000019721	ENST00000379992.2:c.1313C>A	9.37:g.27949357G>T	ENSP00000369328:p.Pro438Gln		A8K4K7|B2RPM5|Q6ZMD0	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Ig_V-set,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.P438Q	ENST00000379992.2	37	c.1313	CCDS6524.1	9	.	.	.	.	.	.	.	.	.	.	G	17.27	3.346837	0.61073	.	.	ENSG00000174482	ENST00000379992;ENST00000308675	D;D	0.97850	-4.57;-4.57	5.82	5.82	0.92795	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.99312	0.9759	H	0.97659	4.05	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98664	1.0685	9	.	.	.	.	20.0989	0.97860	0.0:0.0:1.0:0.0	.	438	Q7L985	LIGO2_HUMAN	Q	438	ENSP00000369328:P438Q;ENSP00000310126:P438Q	.	P	-	2	0	LINGO2	27939357	1.000000	0.71417	0.967000	0.41034	0.926000	0.56050	9.869000	0.99810	2.764000	0.94973	0.650000	0.86243	CCG	LINGO2	-	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000174482		0.517	LINGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINGO2	HGNC	protein_coding	OTTHUMT00000051978.2	-	0.00	66	0	G	NM_152570		27949357	-1	tier1	-	no_errors	ENST00000308675	ensembl	human	known	74_37	missense	6.15	61	4	SNP	1.000	T
LINC01410	103352539	genome.wustl.edu	37	9	66466650	66466650	+	lincRNA	SNP	G	G	C	rs1133399	byFrequency	TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr9:66466650G>C	ENST00000424345.1	+	0	1283																											gctaataaaggactccttaat	0.478																																																	0																																												0																															9.37:g.66466650G>C				RNA	SNP	-	NULL	ENST00000424345.1	37	NULL		9																																																																																			RP11-262H14.1	-	-	ENSG00000238113		0.478	RP11-262H14.1-001	KNOWN	basic	lincRNA	LOC100996870	Clone_based_vega_gene	lincRNA	OTTHUMT00000128851.1	-	0.00	10	0	G			66466650	+1	tier1	rs1133399	no_errors	ENST00000424345	ensembl	human	known	74_37	rna	44.44	5	4	SNP	0.105	C
LOC643733	643733	genome.wustl.edu	37	11	104779414	104779415	+	RNA	INS	-	-	CACA	rs111659193|rs369096286|rs67326622|rs58526794	byFrequency	TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr11:104779414_104779415insCACA	ENST00000532510.1	-	0	17_18																											ATTTTTTGCATcacacacacac	0.351																																																	0																																												0																															11.37:g.104779419_104779422dupCACA				RNA	INS	-	NULL	ENST00000532510.1	37	NULL		11																																																																																			RP11-693N9.2	-	-	ENSG00000235505		0.351	RP11-693N9.2-004	KNOWN	basic	processed_transcript	LOC643733	Clone_based_vega_gene	pseudogene	OTTHUMT00000387738.1		0.00	15	0	-			104779415	-1	tier1		no_errors	ENST00000530264	ensembl	human	known	74_37	rna	15.00	17	3	INS	0.000:0.000	CACA
LOXL3	84695	genome.wustl.edu	37	2	74762444	74762444	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:74762444G>T	ENST00000264094.3	-	9	1625	c.1554C>A	c.(1552-1554)ttC>ttA	p.F518L	LOXL3_ENST00000409249.1_Intron|LOXL3_ENST00000409549.1_Missense_Mutation_p.F462L|LOXL3_ENST00000409986.1_Missense_Mutation_p.F373L|LOXL3_ENST00000393937.2_Missense_Mutation_p.F373L	NM_032603.2	NP_115992.1	P58215	LOXL3_HUMAN	lysyl oxidase-like 3	518	SRCR 4. {ECO:0000255|PROSITE- ProRule:PRU00196}.				epithelial to mesenchymal transition (GO:0001837)|negative regulation of transcription, DNA-templated (GO:0045892)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|nucleus (GO:0005634)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)			endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30						CTCCAGCAGTGAAGCGGGTCC	0.597																																																	0													79.0	64.0	69.0					2																	74762444		2203	4300	6503	SO:0001583	missense	0			AF282619	CCDS1953.1, CCDS74527.1	2p13	2008-05-23			ENSG00000115318	ENSG00000115318			13869	protein-coding gene	gene with protein product		607163				11386757	Standard	NM_032603		Approved		uc002smp.1	P58215	OTTHUMG00000129953	ENST00000264094.3:c.1554C>A	2.37:g.74762444G>T	ENSP00000264094:p.Phe518Leu		D6W5J1|Q2EHP2|Q6IPL7|Q96RS1	Missense_Mutation	SNP	pfam_Lysyl_oxidase,pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR,prints_Lysyl_oxidase,prints_SRCR	p.F518L	ENST00000264094.3	37	c.1554	CCDS1953.1	2	.	.	.	.	.	.	.	.	.	.	G	14.13	2.443015	0.43326	.	.	ENSG00000115318	ENST00000264094;ENST00000393937;ENST00000409549;ENST00000409986	T;T;T;T	0.27256	1.68;1.68;1.68;1.68	4.81	1.01	0.19927	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.052603	0.85682	D	0.000000	T	0.20941	0.0504	L	0.56340	1.77	0.40013	D	0.975315	P;B;P;P	0.43024	0.679;0.01;0.578;0.798	B;B;B;B	0.43680	0.335;0.028;0.309;0.427	T	0.15954	-1.0419	10	0.09338	T	0.73	.	7.0171	0.24895	0.4352:0.0:0.5648:0.0	.	373;462;373;518	B9A025;E7END4;Q6IPL7;P58215	.;.;.;LOXL3_HUMAN	L	518;373;462;373	ENSP00000264094:F518L;ENSP00000377512:F373L;ENSP00000386696:F462L;ENSP00000386545:F373L	ENSP00000264094:F518L	F	-	3	2	LOXL3	74615952	0.983000	0.35010	1.000000	0.80357	0.993000	0.82548	0.227000	0.17795	0.336000	0.23639	0.563000	0.77884	TTC	LOXL3	-	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR	ENSG00000115318		0.597	LOXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOXL3	HGNC	protein_coding	OTTHUMT00000252215.1	-	0.00	57	0	G	NM_032603		74762444	-1	tier1	-	no_errors	ENST00000264094	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	T
LRIG3	121227	genome.wustl.edu	37	12	59272738	59272738	+	Missense_Mutation	SNP	G	G	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr12:59272738G>A	ENST00000320743.3	-	14	2237	c.1951C>T	c.(1951-1953)Cgc>Tgc	p.R651C	LRIG3_ENST00000379141.4_Missense_Mutation_p.R591C	NM_153377.4	NP_700356.2	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like domains 3	651	Ig-like C2-type 2.				otolith morphogenesis (GO:0032474)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)			LRIG3/ROS1(2)	breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(12)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48			GBM - Glioblastoma multiforme(1;1.17e-18)			ACATGCATGCGTCTCTCCCGT	0.582			T	ROS1	NSCLC																																			Dom	yes		12	12q14.1	121227	leucine-rich repeats and immunoglobulin-like domains 3		E	0													128.0	95.0	106.0					12																	59272738		2203	4300	6503	SO:0001583	missense	0			AY505340	CCDS8960.1, CCDS44933.1	12q13.2	2013-01-11				ENSG00000139263		"""Immunoglobulin superfamily / I-set domain containing"""	30991	protein-coding gene	gene with protein product		608870					Standard	NM_153377		Approved	FLJ90440, KIAA3016	uc001sqr.4	Q6UXM1	OTTHUMG00000169940	ENST00000320743.3:c.1951C>T	12.37:g.59272738G>A	ENSP00000326759:p.Arg651Cys		Q6UXL7|Q8NC72	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Immunoglobulin,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R651C	ENST00000320743.3	37	c.1951	CCDS8960.1	12	.	.	.	.	.	.	.	.	.	.	G	24.8	4.568524	0.86439	.	.	ENSG00000139263	ENST00000379141;ENST00000320743	T;T	0.53206	0.63;0.63	5.31	5.31	0.75309	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.37623	N	0.002003	T	0.82042	0.4951	H	0.98525	4.255	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.89418	0.3708	9	.	.	.	.	18.966	0.92697	0.0:0.0:1.0:0.0	.	591;651	Q6UXM1-2;Q6UXM1	.;LRIG3_HUMAN	C	591;651	ENSP00000368436:R591C;ENSP00000326759:R651C	.	R	-	1	0	LRIG3	57559005	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.874000	0.87199	2.479000	0.83701	0.462000	0.41574	CGC	LRIG3	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000139263		0.582	LRIG3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIG3	HGNC	protein_coding	OTTHUMT00000406623.1	-	0.00	57	0	G	NM_153377		59272738	-1	tier1	-	no_errors	ENST00000320743	ensembl	human	known	74_37	missense	11.67	53	7	SNP	1.000	A
LRP1B	53353	genome.wustl.edu	37	2	141739817	141739817	+	Silent	SNP	A	A	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:141739817A>T	ENST00000389484.3	-	18	3770	c.2799T>A	c.(2797-2799)tcT>tcA	p.S933S		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	933	LDL-receptor class A 5. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CATTTCCGCAAGAAAACTGGT	0.418										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												0													116.0	103.0	107.0					2																	141739817		2203	4300	6503	SO:0001819	synonymous_variant	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.2799T>A	2.37:g.141739817A>T			Q8WY29|Q8WY30|Q8WY31	Silent	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.S933	ENST00000389484.3	37	c.2799	CCDS2182.1	2																																																																																			LRP1B	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000168702		0.418	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	-	0.00	70	0	A	NM_018557		141739817	-1	tier1	-	no_errors	ENST00000389484	ensembl	human	known	74_37	silent	23.53	52	16	SNP	1.000	T
LRRC4C	57689	genome.wustl.edu	37	11	40136894	40136894	+	Missense_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr11:40136894T>G	ENST00000278198.2	-	2	2912	c.949A>C	c.(949-951)Aaa>Caa	p.K317Q	LRRC4C_ENST00000530763.1_Missense_Mutation_p.K317Q|LRRC4C_ENST00000527150.1_Missense_Mutation_p.K317Q|LRRC4C_ENST00000528697.1_Missense_Mutation_p.K317Q			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	317	LRRCT.				regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)				NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				GCCATGTCTTTTATCCACCAG	0.488																																																	0													115.0	100.0	105.0					11																	40136894		2203	4300	6503	SO:0001583	missense	0			AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.949A>C	11.37:g.40136894T>G	ENSP00000278198:p.Lys317Gln		A8K0T1|Q7L0N3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.K317Q	ENST00000278198.2	37	c.949	CCDS31464.1	11	.	.	.	.	.	.	.	.	.	.	T	12.05	1.822360	0.32237	.	.	ENSG00000148948	ENST00000278198;ENST00000527150;ENST00000528697;ENST00000530763	T;T;T;T	0.04862	3.54;3.54;3.54;3.54	5.76	5.76	0.90799	Cysteine-rich flanking region, C-terminal (1);	0.047663	0.85682	D	0.000000	T	0.09247	0.0228	L	0.52126	1.63	0.50313	D	0.999868	B	0.15473	0.013	B	0.11329	0.006	T	0.05386	-1.0888	10	0.49607	T	0.09	.	15.2607	0.73621	0.0:0.0:0.0:1.0	.	317	Q9HCJ2	LRC4C_HUMAN	Q	317	ENSP00000278198:K317Q;ENSP00000436976:K317Q;ENSP00000437132:K317Q;ENSP00000434761:K317Q	ENSP00000278198:K317Q	K	-	1	0	LRRC4C	40093470	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.089000	0.64492	2.206000	0.71126	0.533000	0.62120	AAA	LRRC4C	-	NULL	ENSG00000148948		0.488	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LRRC4C	HGNC	protein_coding	OTTHUMT00000389499.1	-	0.00	52	0	T	NM_020929		40136894	-1	tier1	-	no_errors	ENST00000527150	ensembl	human	known	74_37	missense	10.91	49	6	SNP	1.000	G
LRRN3	54674	genome.wustl.edu	37	7	110762847	110762847	+	Silent	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr7:110762847C>A	ENST00000422987.3	+	2	850	c.19C>A	c.(19-21)Cga>Aga	p.R7R	IMMP2L_ENST00000450877.1_Intron|LRRN3_ENST00000451085.1_Silent_p.R7R|IMMP2L_ENST00000452895.1_Intron|LRRN3_ENST00000308478.5_Silent_p.R7R|IMMP2L_ENST00000437687.1_Intron|IMMP2L_ENST00000447215.1_Intron|IMMP2L_ENST00000415362.1_Intron|IMMP2L_ENST00000405709.2_Intron|IMMP2L_ENST00000331762.3_Intron|IMMP2L_ENST00000489381.1_Intron	NM_018334.4	NP_060804.3	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3	7					positive regulation of protein phosphorylation (GO:0001934)	clathrin adaptor complex (GO:0030131)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(15)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		CATGCCACTCCGAATTCATGT	0.423																																																	0													114.0	101.0	105.0					7																	110762847		2203	4300	6503	SO:0001819	synonymous_variant	0			AB060967	CCDS5754.1	7q31.1	2013-02-11			ENSG00000173114	ENSG00000173114		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17200	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 5"""					11549284	Standard	NM_001099660		Approved	NLRR3, FLJ11129, FIGLER5	uc003vfs.4	Q9H3W5	OTTHUMG00000155039	ENST00000422987.3:c.19C>A	7.37:g.110762847C>A			O43377|Q6I9V8|Q8IYQ6	Silent	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_LRR-contain_N,superfamily_Fibronectin_type3,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.R7	ENST00000422987.3	37	c.19	CCDS5754.1	7																																																																																			LRRN3	-	NULL	ENSG00000173114		0.423	LRRN3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LRRN3	HGNC	protein_coding	OTTHUMT00000338171.2	-	0.00	43	0	C	NM_018334		110762847	+1	tier1	-	no_errors	ENST00000308478	ensembl	human	known	74_37	silent	40.54	22	15	SNP	0.974	A
LRSAM1	90678	genome.wustl.edu	37	9	130236144	130236144	+	Silent	SNP	C	C	A	rs376671005		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr9:130236144C>A	ENST00000323301.4	+	10	1288	c.684C>A	c.(682-684)atC>atA	p.I228I	LRSAM1_ENST00000373322.1_Silent_p.I228I|Y_RNA_ENST00000363918.1_RNA|LRSAM1_ENST00000373324.4_Silent_p.I228I|LRSAM1_ENST00000300417.6_Silent_p.I228I	NM_138361.5	NP_612370.3	Q6UWE0	LRSM1_HUMAN	leucine rich repeat and sterile alpha motif containing 1	228					cell death (GO:0008219)|negative regulation of endocytosis (GO:0045806)|protein autoubiquitination (GO:0051865)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|ubiquitin-dependent endocytosis (GO:0070086)|viral budding (GO:0046755)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(2)	16						AAGATGGAATCGAGAACTCTC	0.552																																																	0													106.0	87.0	93.0					9																	130236144		2203	4300	6503	SO:0001819	synonymous_variant	0			AK056203	CCDS6873.1, CCDS55347.1	9q34.13	2014-09-17			ENSG00000148356	ENSG00000148356		"""Sterile alpha motif (SAM) domain containing"""	25135	protein-coding gene	gene with protein product		610933				12975309	Standard	NM_001005373		Approved	FLJ31641	uc004brd.2	Q6UWE0	OTTHUMG00000020701	ENST00000323301.4:c.684C>A	9.37:g.130236144C>A			Q5VVV0|Q8NB40|Q96GT5|Q96MX5|Q96MZ7	Silent	SNP	pfam_Leu-rich_rpt,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,superfamily_PTS_PEP_utilis_N,smart_Leu-rich_rpt_typical-subtyp,smart_SAM,pfscan_SAM,pfscan_Znf_RING	p.I228	ENST00000323301.4	37	c.684	CCDS6873.1	9																																																																																			LRSAM1	-	NULL	ENSG00000148356		0.552	LRSAM1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRSAM1	HGNC	protein_coding	OTTHUMT00000054164.1	-	0.00	47	0	C	NM_138361		130236144	+1	tier1	-	no_errors	ENST00000300417	ensembl	human	known	74_37	silent	19.23	42	10	SNP	0.000	A
MAGEB18	286514	genome.wustl.edu	37	X	26157600	26157600	+	Missense_Mutation	SNP	A	A	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chrX:26157600A>C	ENST00000325250.1	+	2	685	c.498A>C	c.(496-498)gaA>gaC	p.E166D		NM_173699.3	NP_775970	Q96M61	MAGBI_HUMAN	melanoma antigen family B, 18	166	Interaction with LNX1.|MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.					cytoplasm (GO:0005737)		p.E166D(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(17)|skin(2)|stomach(1)|urinary_tract(2)	33						ATTTGAAGGAAGTGGATCCCA	0.433																																																	1	Substitution - Missense(1)	large_intestine(1)											56.0	44.0	48.0					X																	26157600		2202	4300	6502	SO:0001583	missense	0			AK057361	CCDS14216.1	Xp21.3	2008-02-05			ENSG00000176774	ENSG00000176774			28515	protein-coding gene	gene with protein product							Standard	NM_173699		Approved	MGC33889	uc004dbq.2	Q96M61	OTTHUMG00000021282	ENST00000325250.1:c.498A>C	X.37:g.26157600A>C	ENSP00000314543:p.Glu166Asp			Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.E166D	ENST00000325250.1	37	c.498	CCDS14216.1	X	.	.	.	.	.	.	.	.	.	.	A	16.17	3.046638	0.55110	.	.	ENSG00000176774	ENST00000325250	T	0.08720	3.06	4.56	3.41	0.39046	.	0.000000	0.85682	D	0.000000	T	0.29223	0.0727	M	0.91872	3.25	0.30668	N	0.753723	D	0.60575	0.988	D	0.65573	0.936	T	0.32161	-0.9917	10	0.72032	D	0.01	.	6.0174	0.19611	0.886:0.0:0.114:0.0	.	166	Q96M61	MAGBI_HUMAN	D	166	ENSP00000314543:E166D	ENSP00000314543:E166D	E	+	3	2	MAGEB18	26067521	1.000000	0.71417	0.991000	0.47740	0.656000	0.38851	0.947000	0.29082	0.871000	0.35750	0.486000	0.48141	GAA	MAGEB18	-	pfam_MAGE,pfscan_MAGE	ENSG00000176774		0.433	MAGEB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB18	HGNC	protein_coding	OTTHUMT00000056120.1	-	0.00	101	0	A	NM_173699		26157600	+1	tier1	-	no_errors	ENST00000325250	ensembl	human	known	74_37	missense	32.00	33	16	SNP	0.991	C
MAGEB2	4113	genome.wustl.edu	37	X	30236802	30236802	+	Missense_Mutation	SNP	A	A	C	rs370758512		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chrX:30236802A>C	ENST00000378988.4	+	2	206	c.105A>C	c.(103-105)gaA>gaC	p.E35D		NM_002364.4	NP_002355.2	O15479	MAGB2_HUMAN	melanoma antigen family B, 2	35										breast(1)|large_intestine(3)|lung(17)|ovary(1)|skin(1)	23						AAGCAGAGGAAGAAGAGGCCC	0.597																																																	0													37.0	34.0	35.0					X																	30236802		2202	4299	6501	SO:0001583	missense	0			AF015766	CCDS14219.1	Xp21.3	2009-03-17			ENSG00000099399	ENSG00000099399			6809	protein-coding gene	gene with protein product	"""DSS/AHC critical interval MAGE superfamily 6"", ""melanoma-associated antigen B2"", ""cancer/testis antigen family 3, member 2"""	300098				9441743	Standard	NM_002364		Approved	DAM6, MAGE-XP-2, MGC26438, CT3.2	uc004dbz.3	O15479	OTTHUMG00000021319	ENST00000378988.4:c.105A>C	X.37:g.30236802A>C	ENSP00000368273:p.Glu35Asp		O75860	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.E35D	ENST00000378988.4	37	c.105	CCDS14219.1	X	.	.	.	.	.	.	.	.	.	.	A	10.33	1.319332	0.23994	.	.	ENSG00000099399	ENST00000378988	T	0.07567	3.18	3.32	-6.64	0.01801	Melanoma associated antigen, MAGE, N-terminal (1);	1.221250	0.06158	N	0.675381	T	0.09642	0.0237	M	0.74467	2.265	0.09310	N	1	B	0.11235	0.004	B	0.16722	0.016	T	0.36212	-0.9757	10	0.49607	T	0.09	.	4.1081	0.10047	0.1756:0.1403:0.5434:0.1407	.	35	O15479	MAGB2_HUMAN	D	35	ENSP00000368273:E35D	ENSP00000368273:E35D	E	+	3	2	MAGEB2	30146723	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.837000	0.04377	-1.907000	0.01087	0.417000	0.27973	GAA	MAGEB2	-	pfam_Melanoma_ass_antigen_N	ENSG00000099399		0.597	MAGEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB2	HGNC	protein_coding	OTTHUMT00000056157.1	-	0.00	116	0	A	NM_002364		30236802	+1	tier1	-	no_errors	ENST00000378988	ensembl	human	known	74_37	missense	44.87	43	35	SNP	0.000	C
MAN2C1	4123	genome.wustl.edu	37	15	75651747	75651747	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr15:75651747G>T	ENST00000267978.5	-	17	2014	c.1968C>A	c.(1966-1968)agC>agA	p.S656R	MAN2C1_ENST00000565683.1_Missense_Mutation_p.H661N|MAN2C1_ENST00000569482.1_Missense_Mutation_p.S656R|MAN2C1_ENST00000563622.1_Missense_Mutation_p.S557R	NM_006715.3	NP_006706.2	Q9NTJ4	MA2C1_HUMAN	mannosidase, alpha, class 2C, member 1	656					mannose metabolic process (GO:0006013)		alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			central_nervous_system(4)|endometrium(4)|kidney(6)|large_intestine(6)|lung(20)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	44						CATAGCCCATGCTGGGCACTG	0.637																																																	0													25.0	27.0	26.0					15																	75651747		2197	4293	6490	SO:0001583	missense	0			AF044414	CCDS32298.1, CCDS58389.1, CCDS58390.1, CCDS58391.1	15q24.2	2013-09-19			ENSG00000140400	ENSG00000140400	3.2.1.24		6827	protein-coding gene	gene with protein product		154580		MANA1, MANA		1757461, 752528	Standard	NM_006715		Approved		uc002bah.4	Q9NTJ4	OTTHUMG00000172698	ENST00000267978.5:c.1968C>A	15.37:g.75651747G>T	ENSP00000267978:p.Ser656Arg		H3BMX2|H3BQY8|H3BUT6|Q13358|Q68EM8|Q9UL64	Missense_Mutation	SNP	pfam_Glyco_hydro_38_N,pfam_Glyco_hydro_38_C,pfam_Glyco_hydro_38_cen_dom,superfamily_Gal_mutarotase_SF_dom,superfamily_Glyco_hydro/deAcase_b/a-brl,smart_Glyco_hydro_38_cen_dom	p.S656R	ENST00000267978.5	37	c.1968	CCDS32298.1	15	.	.	.	.	.	.	.	.	.	.	G	11.54	1.669297	0.29604	.	.	ENSG00000140400	ENST00000267978	T	0.79247	-1.25	4.95	2.63	0.31362	Glycosyl hydrolases 38, C-terminal (1);Glycoside hydrolase-type carbohydrate-binding (1);	0.085474	0.85682	D	0.000000	D	0.85898	0.5804	M	0.91140	3.18	0.51767	D	0.999936	P;P	0.44734	0.842;0.842	P;P	0.57371	0.819;0.819	D	0.83712	0.0188	10	0.19590	T	0.45	-17.1544	9.0418	0.36322	0.2458:0.0:0.7542:0.0	.	656;656	Q68EM8;Q9NTJ4	.;MA2C1_HUMAN	R	656	ENSP00000267978:S656R	ENSP00000267978:S656R	S	-	3	2	MAN2C1	73438800	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.313000	0.33585	1.199000	0.43173	0.561000	0.74099	AGC	MAN2C1	-	pfam_Glyco_hydro_38_C,superfamily_Gal_mutarotase_SF_dom	ENSG00000140400		0.637	MAN2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN2C1	HGNC	protein_coding	OTTHUMT00000419965.1	-	0.00	74	0	G			75651747	-1	tier1	-	no_errors	ENST00000267978	ensembl	human	known	74_37	missense	8.00	46	4	SNP	1.000	T
MANEA	79694	genome.wustl.edu	37	6	96034471	96034471	+	Silent	SNP	T	T	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr6:96034471T>C	ENST00000358812.4	+	2	290	c.156T>C	c.(154-156)acT>acC	p.T52T	MANEA_ENST00000369293.1_Silent_p.T52T	NM_024641.3	NP_078917.2	Q5SRI9	MANEA_HUMAN	mannosidase, endo-alpha	52					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glycoprotein endo-alpha-1,2-mannosidase activity (GO:0004569)			breast(2)|endometrium(3)|kidney(2)|liver(2)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26		all_cancers(76;1.01e-06)|Acute lymphoblastic leukemia(125;3.58e-09)|all_hematologic(75;1.22e-06)|all_epithelial(107;0.00433)|Colorectal(196;0.0341)		BRCA - Breast invasive adenocarcinoma(108;0.148)		ATCAACGAACTATTCATTTGG	0.343																																																	0													86.0	88.0	87.0					6																	96034471		2203	4298	6501	SO:0001819	synonymous_variant	0			AK022900	CCDS5032.1	6q16.2	2008-02-05			ENSG00000172469	ENSG00000172469			21072	protein-coding gene	gene with protein product		612327					Standard	NM_024641		Approved	FLJ12838, mandaselin	uc003poo.2	Q5SRI9	OTTHUMG00000016296	ENST00000358812.4:c.156T>C	6.37:g.96034471T>C			A6H8M6|Q5SRJ0|Q6MZV0|Q70JE9|Q7Z3V7|Q8WWX5|Q9H9D2	Silent	SNP	superfamily_Glycoside_hydrolase_SF	p.T52	ENST00000358812.4	37	c.156	CCDS5032.1	6																																																																																			MANEA	-	NULL	ENSG00000172469		0.343	MANEA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MANEA	HGNC	protein_coding	OTTHUMT00000043644.1	-	0.00	115	0	T	NM_024641		96034471	+1	tier1	-	no_errors	ENST00000358812	ensembl	human	known	74_37	silent	11.22	87	11	SNP	0.000	C
MAPK1IP1L	93487	genome.wustl.edu	37	14	55529590	55529590	+	Silent	SNP	C	C	A	rs150397932		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr14:55529590C>A	ENST00000395468.4	+	3	450	c.273C>A	c.(271-273)tcC>tcA	p.S91S	MAPK1IP1L_ENST00000554364.1_3'UTR	NM_144578.3	NP_653179.1	Q8NDC0	MISSL_HUMAN	mitogen-activated protein kinase 1 interacting protein 1-like	91	Pro-rich.									endometrium(2)|large_intestine(1)|lung(3)	6						TTCCTCCTTCCGGACCATCAT	0.617																																																	0													61.0	54.0	56.0					14																	55529590		2203	4300	6503	SO:0001819	synonymous_variant	0			AK025580	CCDS32085.1	14q22.1	2008-01-30	2008-01-30	2008-01-16		ENSG00000168175			19840	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 32"", ""mitogen activated protein kinase 1 interacting protein 1-like"""	C14orf32		12011110	Standard	NM_144578		Approved		uc001xbq.1	Q8NDC0		ENST00000395468.4:c.273C>A	14.37:g.55529590C>A			B2RDD8|Q96BG5	Silent	SNP	NULL	p.S91	ENST00000395468.4	37	c.273	CCDS32085.1	14																																																																																			MAPK1IP1L	-	NULL	ENSG00000168175		0.617	MAPK1IP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK1IP1L	HGNC	protein_coding	OTTHUMT00000411302.2	-	0.00	97	0	C	NM_144578		55529590	+1	tier1	-	no_errors	ENST00000395468	ensembl	human	known	74_37	silent	6.82	82	6	SNP	1.000	A
MBOAT1	154141	genome.wustl.edu	37	6	20131397	20131397	+	Silent	SNP	G	G	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr6:20131397G>A	ENST00000324607.7	-	5	617	c.453C>T	c.(451-453)acC>acT	p.T151T	MBOAT1_ENST00000536798.1_Silent_p.T151T|MBOAT1_ENST00000541730.1_Intron	NM_001080480.1	NP_001073949.1	Q6ZNC8	MBOA1_HUMAN	membrane bound O-acyltransferase domain containing 1	151					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity, transferring acyl groups other than amino-acyl groups (GO:0016747)			breast(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(5)	20	all_cancers(95;0.244)|Breast(50;0.0379)|Ovarian(93;0.0473)|all_epithelial(95;0.109)		OV - Ovarian serous cystadenocarcinoma(7;0.00392)|all cancers(50;0.0117)|Epithelial(50;0.0454)			GGAATGCCAAGGTTGTGATCT	0.468																																																	0													152.0	143.0	146.0					6																	20131397		2203	4300	6503	SO:0001819	synonymous_variant	0			AK093994	CCDS34346.1	6p22.3	2013-10-11	2006-06-29	2006-06-29	ENSG00000172197	ENSG00000172197			21579	protein-coding gene	gene with protein product	"""lysophosphatidylethanolamine acyltransferase 1"""	611732	"""O-acyltransferase (membrane bound) domain containing 1"""	OACT1		18287005	Standard	NM_001080480		Approved	MGC44669, dJ434O11.1, LPEAT1	uc003ncx.2	Q6ZNC8	OTTHUMG00000014334	ENST00000324607.7:c.453C>T	6.37:g.20131397G>A			A9EDQ5|B4DL59|B4E3J4|Q86XC2|Q8N9R5	Silent	SNP	pfam_MBOAT_fam	p.T151	ENST00000324607.7	37	c.453	CCDS34346.1	6																																																																																			MBOAT1	-	pfam_MBOAT_fam	ENSG00000172197		0.468	MBOAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBOAT1	HGNC	protein_coding	OTTHUMT00000039980.1	-	0.00	124	0	G			20131397	-1	tier1	-	no_errors	ENST00000324607	ensembl	human	known	74_37	silent	60.71	44	68	SNP	0.996	A
MED12	9968	genome.wustl.edu	37	X	70349016	70349016	+	Frame_Shift_Del	DEL	C	C	-			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chrX:70349016delC	ENST00000374080.3	+	25	3560	c.3528delC	c.(3526-3528)ctcfs	p.L1177fs	MED12_ENST00000333646.6_Frame_Shift_Del_p.L1177fs|MED12_ENST00000374102.1_Frame_Shift_Del_p.L1177fs			Q93074	MED12_HUMAN	mediator complex subunit 12	1177					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					GCCGCATCCTCCTTCACCTTT	0.498			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome				OREG0019857	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																												Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	0													72.0	72.0	72.0					X																	70349016		2015	4156	6171	SO:0001589	frameshift_variant	0			U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.3528delC	X.37:g.70349016delC	ENSP00000363193:p.Leu1177fs	1121	O15410|O75557|Q9UHV6|Q9UND7	Frame_Shift_Del	DEL	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12_catenin-bd,pfam_Mediator_Med12	p.L1177fs	ENST00000374080.3	37	c.3528	CCDS43970.1	X																																																																																			MED12	-	NULL	ENSG00000184634		0.498	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MED12	HGNC	protein_coding	OTTHUMT00000057105.1		0.00	46	0	C	NM_005120		70349016	+1	tier1		no_errors	ENST00000333646	ensembl	human	known	74_37	frame_shift_del	6.90	27	2	DEL	1.000	-
MED13L	23389	genome.wustl.edu	37	12	116421996	116421996	+	Missense_Mutation	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr12:116421996C>T	ENST00000281928.3	-	20	4726	c.4520G>A	c.(4519-4521)cGc>cAc	p.R1507H		NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	1507						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		TAGGTGATGGCGGCAAACTTG	0.418																																																	0													73.0	60.0	64.0					12																	116421996		2203	4300	6503	SO:0001583	missense	0			AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.4520G>A	12.37:g.116421996C>T	ENSP00000281928:p.Arg1507His		A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Missense_Mutation	SNP	pfam_Mediator_Med13,pfam_Mediator_Med13_N_met/fun	p.R1507H	ENST00000281928.3	37	c.4520	CCDS9177.1	12	.	.	.	.	.	.	.	.	.	.	C	18.45	3.625669	0.66901	.	.	ENSG00000123066	ENST00000281928	T	0.59364	0.27	5.43	5.43	0.79202	.	0.052833	0.85682	D	0.000000	T	0.74696	0.3750	M	0.66506	2.035	0.46798	D	0.9992	D	0.76494	0.999	D	0.65987	0.94	T	0.77130	-0.2701	10	0.87932	D	0	.	19.2439	0.93895	0.0:1.0:0.0:0.0	.	1507	Q71F56	MD13L_HUMAN	H	1507	ENSP00000281928:R1507H	ENSP00000281928:R1507H	R	-	2	0	MED13L	114906379	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.920000	0.48844	2.538000	0.85594	0.655000	0.94253	CGC	MED13L	-	NULL	ENSG00000123066		0.418	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED13L	HGNC	protein_coding	OTTHUMT00000403879.3	-	0.00	61	0	C			116421996	-1	tier1	-	no_errors	ENST00000281928	ensembl	human	known	74_37	missense	19.05	51	12	SNP	1.000	T
TMEM132C	92293	genome.wustl.edu	37	12	128778687	128778687	+	Intron	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr12:128778687T>G	ENST00000435159.2	+	1	85				MIR3612_ENST00000579753.1_RNA	NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C							integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						TGGGATCTACTTCCAGTTCAC	0.502																																																	0																																										SO:0001627	intron_variant	0			AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.85+26655T>G	12.37:g.128778687T>G			Q69YX8	RNA	SNP	-	NULL	ENST00000435159.2	37	NULL		12																																																																																			MIR3612	-	-	ENSG00000265635		0.502	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	MIR3612	HGNC	protein_coding		-	0.00	55	0	T	XM_044062		128778687	+1	tier1	-	no_errors	ENST00000579753	ensembl	human	known	74_37	rna	18.37	40	9	SNP	0.000	G
MKNK1	8569	genome.wustl.edu	37	1	47027176	47027176	+	Missense_Mutation	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr1:47027176C>T	ENST00000371946.4	-	12	1265	c.1102G>A	c.(1102-1104)Gtt>Att	p.V368I	MKNK1_ENST00000371944.4_Missense_Mutation_p.V232I|MKNK1_ENST00000428112.2_Missense_Mutation_p.V327I|MKNK1_ENST00000371945.4_Missense_Mutation_p.V327I|MKNK1_ENST00000341183.5_Missense_Mutation_p.V327I|MKNK1-AS1_ENST00000602433.1_RNA	NM_003684.5	NP_003675.2	Q9BUB5	MKNK1_HUMAN	MAP kinase interacting serine/threonine kinase 1	368	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fibroblast growth factor receptor signaling pathway (GO:0008543)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of translation (GO:0006417)|response to salt stress (GO:0009651)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	13	Acute lymphoblastic leukemia(166;0.155)					TGCTGCAGAACTTGGGCGGCG	0.577																																																	0													89.0	78.0	82.0					1																	47027176		2203	4300	6503	SO:0001583	missense	0			AB000409	CCDS538.1, CCDS30705.1, CCDS44134.1	1p33	2008-02-05			ENSG00000079277	ENSG00000079277			7110	protein-coding gene	gene with protein product		606724				9155018	Standard	NM_003684		Approved	MNK1	uc001cqb.4	Q9BUB5	OTTHUMG00000007983	ENST00000371946.4:c.1102G>A	1.37:g.47027176C>T	ENSP00000361014:p.Val368Ile		D3DQ20|D3DQ21|O00312|Q5TC06|Q5TC07|Q6V0N6	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.V368I	ENST00000371946.4	37	c.1102	CCDS538.1	1	.	.	.	.	.	.	.	.	.	.	C	32	5.111912	0.94339	.	.	ENSG00000079277	ENST00000371946;ENST00000371945;ENST00000371944;ENST00000341183;ENST00000428112	T;T;T;T;T	0.20200	2.09;2.09;2.09;2.09;2.09	5.05	5.05	0.67936	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.33411	0.0862	N	0.25144	0.715	0.80722	D	1	P;D;D;D;D	0.76494	0.924;0.972;0.98;0.997;0.999	P;P;P;D;D	0.76071	0.889;0.874;0.789;0.956;0.987	T	0.05869	-1.0859	10	0.44086	T	0.13	-30.386	17.5671	0.87923	0.0:1.0:0.0:0.0	.	232;232;327;327;368	B4DQK5;Q7Z319;Q9BUB5-3;Q9BUB5-2;Q9BUB5	.;.;.;.;MKNK1_HUMAN	I	368;327;232;327;327	ENSP00000361014:V368I;ENSP00000361013:V327I;ENSP00000361012:V232I;ENSP00000339573:V327I;ENSP00000411135:V327I	ENSP00000339573:V327I	V	-	1	0	MKNK1	46799763	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.651000	0.83577	2.638000	0.89438	0.561000	0.74099	GTT	MKNK1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000079277		0.577	MKNK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MKNK1	HGNC	protein_coding	OTTHUMT00000021897.2	-	0.00	51	0	C	NM_003684		47027176	-1	tier1	-	no_errors	ENST00000371946	ensembl	human	known	74_37	missense	22.22	35	10	SNP	1.000	T
MLLT10	8028	genome.wustl.edu	37	10	22015231	22015231	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr10:22015231G>T	ENST00000307729.7	+	15	2115	c.1937G>T	c.(1936-1938)aGa>aTa	p.R646I	MLLT10_ENST00000446906.2_Missense_Mutation_p.R646I|MLLT10_ENST00000377072.3_Missense_Mutation_p.R662I|MLLT10_ENST00000377059.3_Missense_Mutation_p.R646I			P55197	AF10_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10	646	DNA-binding.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6						TATGGCAATAGATCAAATTCA	0.338			T	"""MLL, PICALM, CDK6"""	AL																																			Dom	yes		10	10p12	8028	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 (AF10)"""		L	0													168.0	182.0	178.0					10																	22015231		2203	4299	6502	SO:0001583	missense	0			U13948	CCDS7135.1, CCDS55706.1, CCDS55707.1, CCDS55708.1	10p12	2013-01-28	2001-11-28		ENSG00000078403	ENSG00000078403		"""Zinc fingers, PHD-type"""	16063	protein-coding gene	gene with protein product		602409	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 10"""			7888665	Standard	NM_004641		Approved	AF10	uc021pny.1	P55197	OTTHUMG00000017799	ENST00000307729.7:c.1937G>T	10.37:g.22015231G>T	ENSP00000307411:p.Arg646Ile		B1ANA8|Q5JT37|Q5VX90|Q66K63	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.R646I	ENST00000307729.7	37	c.1937	CCDS55708.1	10	.	.	.	.	.	.	.	.	.	.	G	18.10	3.547801	0.65311	.	.	ENSG00000078403	ENST00000377072;ENST00000446906;ENST00000307729;ENST00000396529;ENST00000377059;ENST00000438473;ENST00000538639	T;T;T;T	0.09723	2.95;2.95;2.95;2.95	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.30103	0.0754	L	0.59436	1.845	0.38788	D	0.954923	D;D;P;D	0.76494	0.999;0.998;0.845;0.998	D;D;B;D	0.83275	0.996;0.991;0.169;0.991	T	0.01587	-1.1318	10	0.72032	D	0.01	.	15.1199	0.72434	0.0:0.1402:0.8597:0.0	.	341;646;646;662	Q5HYC6;E9PBP4;Q5VX90;P55197	.;.;.;AF10_HUMAN	I	662;646;646;481;646;305;304	ENSP00000366272:R662I;ENSP00000401406:R646I;ENSP00000307411:R646I;ENSP00000366258:R646I	ENSP00000307411:R646I	R	+	2	0	MLLT10	22055237	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.566000	0.82347	2.655000	0.90218	0.650000	0.86243	AGA	MLLT10	-	NULL	ENSG00000078403		0.338	MLLT10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLLT10	HGNC	protein_coding	OTTHUMT00000047136.1	-	0.00	65	0	G			22015231	+1	tier1	-	no_errors	ENST00000307729	ensembl	human	known	74_37	missense	9.09	40	4	SNP	1.000	T
MMP20	9313	genome.wustl.edu	37	11	102479749	102479749	+	Missense_Mutation	SNP	T	T	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr11:102479749T>C	ENST00000260228.2	-	5	742	c.730A>G	c.(730-732)Atg>Gtg	p.M244V	RP11-817J15.2_ENST00000544115.1_RNA|MMP20_ENST00000544938.1_5'Flank|RP11-817J15.2_ENST00000542119.1_RNA	NM_004771.3	NP_004762.2	Q9NPA2	MMP25_HUMAN	matrix metallopeptidase 20	251					hard palate development (GO:0060022)|inflammatory response (GO:0006954)|proteolysis (GO:0006508)	anchored component of membrane (GO:0031225)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(4)|large_intestine(3)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_cancers(8;8.95e-05)|all_epithelial(12;0.00227)|Lung NSC(15;0.139)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0216)|Lung(13;0.0711)|all cancers(10;0.0889)|LUSC - Lung squamous cell carcinoma(19;0.13)	BRCA - Breast invasive adenocarcinoma(274;0.0161)	Marimastat(DB00786)	GTTGGGTACATCAGTGCTGAT	0.438																																																	0													132.0	120.0	124.0					11																	102479749		2203	4299	6502	SO:0001583	missense	0			Y12779	CCDS8318.1	11q22.3	2008-05-22	2008-05-22			ENSG00000137674			7167	protein-coding gene	gene with protein product	"""enamelysin"""	604629	"""matrix metalloproteinase 20 (enamelysin)"""			9398237	Standard	NM_004771		Approved		uc001phc.3	O60882		ENST00000260228.2:c.730A>G	11.37:g.102479749T>C	ENSP00000260228:p.Met244Val		D3DUA8|Q9H3Q0	Missense_Mutation	SNP	pirsf_Pept_M10A_Metazoans,pfam_Pept_M10_metallopeptidase,pfam_Hemopexin-like_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,prints_Pept_M10A	p.M244V	ENST00000260228.2	37	c.730	CCDS8318.1	11	.	.	.	.	.	.	.	.	.	.	T	23.7	4.450213	0.84101	.	.	ENSG00000137674	ENST00000260228	D	0.81739	-1.53	5.38	5.38	0.77491	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.93782	0.8012	H	0.98333	4.205	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	D	0.96035	0.9020	10	0.87932	D	0	.	15.2365	0.73436	0.0:0.0:0.0:1.0	.	244	O60882	MMP20_HUMAN	V	244	ENSP00000260228:M244V	ENSP00000260228:M244V	M	-	1	0	MMP20	101984959	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.585000	0.82584	2.254000	0.74563	0.533000	0.62120	ATG	MMP20	-	pirsf_Pept_M10A_Metazoans,pfam_Pept_M10_metallopeptidase,smart_Peptidase_Metallo,prints_Pept_M10A	ENSG00000137674		0.438	MMP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP20	HGNC	protein_coding	OTTHUMT00000398012.1	-	0.00	75	0	T			102479749	-1	tier1	-	no_errors	ENST00000260228	ensembl	human	known	74_37	missense	29.46	79	33	SNP	1.000	C
MOGAT1	116255	genome.wustl.edu	37	2	223554148	223554148	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:223554148G>T	ENST00000446656.3	+	3	438	c.438G>T	c.(436-438)tgG>tgT	p.W146C		NM_058165.2	NP_477513.2	Q96PD6	MOGT1_HUMAN	monoacylglycerol O-acyltransferase 1	146					diacylglycerol biosynthetic process (GO:0006651)|glycerol metabolic process (GO:0006071)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	2-acylglycerol O-acyltransferase activity (GO:0003846)|diacylglycerol O-acyltransferase activity (GO:0004144)			breast(1)|cervix(1)|endometrium(1)|lung(5)|urinary_tract(1)	9		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;2.06e-07)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0105)		TGCCACTTTGGTTCTGGTGTC	0.443																																					Ovarian(93;205 1446 2385 11581 25911)												0													190.0	174.0	179.0					2																	223554148		1967	4152	6119	SO:0001583	missense	0			AF384163	CCDS46524.1	2q36.2	2006-10-06	2004-05-28	2004-05-28	ENSG00000124003	ENSG00000124003			18210	protein-coding gene	gene with protein product		610268	"""diacylglycerol O-acyltransferase 2 like 1"""	DGAT2L1		14970677	Standard	NM_058165		Approved	DGAT2L, MGAT1	uc010fws.1	Q96PD6	OTTHUMG00000153394	ENST00000446656.3:c.438G>T	2.37:g.223554148G>T	ENSP00000406674:p.Trp146Cys		Q6IEE5	Missense_Mutation	SNP	pfam_DAGAT	p.W146C	ENST00000446656.3	37	c.438	CCDS46524.1	2	.	.	.	.	.	.	.	.	.	.	G	11.69	1.712808	0.30413	.	.	ENSG00000124003	ENST00000446656	T	0.13420	2.59	5.34	4.45	0.53987	.	0.167182	0.43919	D	0.000506	T	0.22360	0.0539	M	0.69823	2.125	0.80722	D	1	B	0.21309	0.054	B	0.32211	0.142	T	0.03384	-1.1042	10	0.38643	T	0.18	-4.1398	16.1276	0.81406	0.0:0.1337:0.8663:0.0	.	146	Q96PD6	MOGT1_HUMAN	C	146	ENSP00000406674:W146C	ENSP00000406674:W146C	W	+	3	0	MOGAT1	223262392	1.000000	0.71417	0.534000	0.28014	0.019000	0.09904	9.125000	0.94402	1.470000	0.48102	0.655000	0.94253	TGG	MOGAT1	-	pfam_DAGAT	ENSG00000124003		0.443	MOGAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOGAT1	HGNC	protein_coding	OTTHUMT00000331010.3		0.00	37	0	G	NM_058165		223554148	+1			no_errors	ENST00000446656	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	T
MRVI1	10335	genome.wustl.edu	37	11	10650359	10650359	+	Silent	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr11:10650359G>T	ENST00000436272.1	-	5	642	c.564C>A	c.(562-564)ctC>ctA	p.L188L	MRVI1_ENST00000531107.1_Silent_p.L188L|MRVI1_ENST00000534266.2_5'UTR|MRVI1_ENST00000532037.1_5'Flank|MRVI1_ENST00000541483.1_Silent_p.L197L|MRVI1_ENST00000424001.1_5'UTR|MRVI1_ENST00000552103.1_Silent_p.L106L|MRVI1_ENST00000547195.1_Silent_p.L106L|MRVI1_ENST00000558540.1_5'UTR|MRVI1_ENST00000421747.1_Silent_p.L188L|MRVI1_ENST00000423302.2_Silent_p.L197L|MRVI1_ENST00000527509.2_Silent_p.L106L|MRVI1_ENST00000545852.1_5'UTR			Q9Y6F6	MRVI1_HUMAN	murine retrovirus integration site 1 homolog	188					blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|relaxation of vascular smooth muscle (GO:0060087)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)	22				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		CGCTGGGGCTGAGGTTCGGGG	0.567																																																	0													42.0	55.0	51.0					11																	10650359		2034	4190	6224	SO:0001819	synonymous_variant	0			AF081249	CCDS44538.1, CCDS44539.1, CCDS44540.1, CCDS44538.2, CCDS55745.1, CCDS55746.1	11p15.4	2014-09-11			ENSG00000072952	ENSG00000072952			7237	protein-coding gene	gene with protein product	"""inositol 1,4,5-triphosphate-associated cGMP kinase substrate"", ""IP3R-associated cGMP kinase substrate"""	604673				10321731	Standard	NM_001098579		Approved	JAW1L, IRAG	uc010rcb.1	Q9Y6F6	OTTHUMG00000165773	ENST00000436272.1:c.564C>A	11.37:g.10650359G>T			B7Z3T4|B7Z6I2|B7Z9A3|E9PQY6|F5H6A1|J3KQZ7|Q17S00|Q9UNY1	Silent	SNP	pfam_MRVI1	p.L188	ENST00000436272.1	37	c.564		11																																																																																			MRVI1	-	NULL	ENSG00000072952		0.567	MRVI1-203	KNOWN	basic	protein_coding	MRVI1	HGNC	protein_coding		-	0.00	67	0	G	NM_001098579		10650359	-1	tier1	-	no_errors	ENST00000421747	ensembl	human	known	74_37	silent	30.09	79	34	SNP	0.998	T
MRGPRX1	259249	genome.wustl.edu	37	11	18955913	18955913	+	Missense_Mutation	SNP	G	G	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr11:18955913G>A	ENST00000302797.3	-	1	643	c.419C>T	c.(418-420)gCg>gTg	p.A140V	MRGPRX1_ENST00000526914.1_5'UTR|RP11-583F24.8_ENST00000528646.1_RNA	NM_147199.3	NP_671732.3	Q96LB2	MRGX1_HUMAN	MAS-related GPR, member X1	140					acute-phase response (GO:0006953)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(12)|pancreas(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						ACACACCACCGCTGACAGGTG	0.617																																																	0													89.0	77.0	81.0					11																	18955913		2194	4285	6479	SO:0001583	missense	0				CCDS7846.1	11p15.1	2013-10-10			ENSG00000170255	ENSG00000170255		"""GPCR / Class A : Orphans"""	17962	protein-coding gene	gene with protein product		607227				11551509	Standard	NM_147199		Approved	MRGX1	uc001mpg.3	Q96LB2	OTTHUMG00000162655	ENST00000302797.3:c.419C>T	11.37:g.18955913G>A	ENSP00000305766:p.Ala140Val		Q4V9L2|Q8TDD8|Q8TDD9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.A140V	ENST00000302797.3	37	c.419	CCDS7846.1	11	.	.	.	.	.	.	.	.	.	.	.	8.356	0.832074	0.16820	.	.	ENSG00000170255	ENST00000302797	T	0.36157	1.27	2.28	0.276	0.15663	GPCR, rhodopsin-like superfamily (1);	0.178502	0.39615	N	0.001310	T	0.35128	0.0921	M	0.74647	2.275	0.09310	N	1	B	0.29085	0.232	B	0.30572	0.117	T	0.26643	-1.0097	10	0.42905	T	0.14	.	8.91	0.35548	0.2469:0.0:0.7531:0.0	.	140	Q96LB2	MRGX1_HUMAN	V	140	ENSP00000305766:A140V	ENSP00000305766:A140V	A	-	2	0	MRGPRX1	18912489	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	-1.069000	0.03444	-0.205000	0.10219	-1.579000	0.00862	GCG	MRGPRX1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000170255		0.617	MRGPRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRGPRX1	HGNC	protein_coding	OTTHUMT00000369913.1	-	0.00	45	0	G	NM_147199		18955913	-1	tier1	-	no_errors	ENST00000302797	ensembl	human	known	74_37	missense	50.00	30	30	SNP	0.003	A
MT-CO1	4512	genome.wustl.edu	37	M	5533	5533	+	5'Flank	SNP	A	A	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chrM:5533A>G	ENST00000361624.2	+	0	0				MT-TW_ENST00000387382.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-ATP8_ENST00000361851.1_5'Flank|MT-TY_ENST00000387409.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TM_ENST00000387377.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TD_ENST00000387419.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I						aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						GTTAAATACAGACCAAGAGCC	0.438																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395			M.37:g.5533A>G	Exception_encountered		Q34770	RNA	SNP	-	NULL	ENST00000361624.2	37	NULL		MT																																																																																			MT-TW	-	-	ENSG00000210117		0.438	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-TW	HGNC	protein_coding		-	0.00	351	0	A	YP_003024028		5533	+1	tier1	-	no_errors	ENST00000387382	ensembl	human	known	74_37	rna	77.78	62	217	SNP	NULL	G
MTAP	4507	genome.wustl.edu	37	9	21816771	21816771	+	Splice_Site	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr9:21816771G>T	ENST00000460874.2	+	3	455	c.230G>T	c.(229-231)aGg>aTg	p.R77M	MTAP_ENST00000380172.4_Splice_Site_p.R60M|MTAP_ENST00000427788.2_3'UTR|RP11-145E5.5_ENST00000404796.2_Splice_Site_p.R60M|MTAP_ENST00000580900.1_Splice_Site_p.R60M					methylthioadenosine phosphorylase									p.0(1)|p.0?(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|lung(3)|pancreas(1)	10		all_cancers(5;0)|Hepatocellular(5;0.00162)|Colorectal(97;0.173)		GBM - Glioblastoma multiforme(3;0)|Lung(24;2.24e-57)|LUSC - Lung squamous cell carcinoma(38;1.97e-36)|STAD - Stomach adenocarcinoma(4;3.26e-05)|OV - Ovarian serous cystadenocarcinoma(39;0.00931)|COAD - Colon adenocarcinoma(8;0.15)		CTCCTTGCAAGGTATGGTATT	0.313																																																	2	Whole gene deletion(2)	lung(2)											213.0	207.0	209.0					9																	21816771		2203	4300	6503	SO:0001630	splice_region_variant	0			AB062485	CCDS6509.1	9p21	2013-05-29			ENSG00000099810	ENSG00000099810	2.4.2.28		7413	protein-coding gene	gene with protein product	"""S-methyl-5'-thioadenosine phosphorylase"""	156540				11126361	Standard	NM_002451		Approved	MSAP, c86fus	uc003zph.3	Q13126	OTTHUMG00000019690	ENST00000460874.2:c.230+1G>T	9.37:g.21816771G>T				Missense_Mutation	SNP	pfam_Nucleoside_phosphorylase_d,tigrfam_MTAP	p.R60M	ENST00000460874.2	37	c.179		9	.	.	.	.	.	.	.	.	.	.	G	24.9	4.583051	0.86748	.	.	ENSG00000099810	ENST00000380172	T	0.48201	0.82	5.44	5.44	0.79542	Purine phosphorylase, family 2, conserved site (1);Nucleoside phosphorylase domain (1);	0.081637	0.85682	D	0.000000	T	0.79106	0.4390	H	0.95402	3.665	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.994;0.999	D	0.85213	0.1022	10	0.87932	D	0	-16.6468	18.3922	0.90487	0.0:0.0:1.0:0.0	.	77;60;60	B4DUC8;F2Z2F3;Q13126	.;.;MTAP_HUMAN	M	60	ENSP00000369519:R60M	ENSP00000369519:R60M	R	+	2	0	MTAP	21806771	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	8.399000	0.90197	2.711000	0.92665	0.561000	0.74099	AGG	MTAP	-	pfam_Nucleoside_phosphorylase_d,tigrfam_MTAP	ENSG00000099810		0.313	MTAP-003	PUTATIVE	basic|exp_conf	protein_coding	MTAP	HGNC	protein_coding	OTTHUMT00000051929.2	-	0.00	96	0	G	NM_002451	Missense_Mutation	21816771	+1	tier1	-	no_errors	ENST00000380172	ensembl	human	known	74_37	missense	6.33	74	5	SNP	1.000	T
MTUS2	23281	genome.wustl.edu	37	13	29600077	29600077	+	Missense_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr13:29600077T>G	ENST00000431530.3	+	1	1330	c.1272T>G	c.(1270-1272)atT>atG	p.I424M		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	414						cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						CTGGCAAAATTTCACCATGTG	0.507																																																	0													36.0	37.0	37.0					13																	29600077		1918	4139	6057	SO:0001583	missense	0			AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.1272T>G	13.37:g.29600077T>G	ENSP00000392057:p.Ile424Met		A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Missense_Mutation	SNP	NULL	p.I424M	ENST00000431530.3	37	c.1272	CCDS45022.1	13	.	.	.	.	.	.	.	.	.	.	t	10.66	1.413648	0.25465	.	.	ENSG00000132938	ENST00000431530	T	0.12255	2.7	5.64	-11.3	0.00108	.	2.209180	0.01863	N	0.036732	T	0.07052	0.0179	N	0.22421	0.69	0.09310	N	1	B	0.21225	0.053	B	0.12837	0.008	T	0.09378	-1.0677	9	.	.	.	.	7.2843	0.26328	0.0817:0.258:0.5234:0.1369	.	414	Q5JR59	MTUS2_HUMAN	M	424	ENSP00000392057:I424M	.	I	+	3	3	MTUS2	28498077	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.943000	0.03917	-2.379000	0.00595	0.533000	0.62120	ATT	MTUS2	-	NULL	ENSG00000132938		0.507	MTUS2-002	KNOWN	basic|CCDS	protein_coding	MTUS2	HGNC	protein_coding	OTTHUMT00000044336.3	-	0.00	60	0	T	XM_166270		29600077	+1	tier1	-	no_errors	ENST00000431530	ensembl	human	known	74_37	missense	31.82	30	14	SNP	0.000	G
MUC15	143662	genome.wustl.edu	37	11	26584732	26584732	+	Missense_Mutation	SNP	A	A	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr11:26584732A>C	ENST00000455601.2	-	3	893	c.775T>G	c.(775-777)Ttg>Gtg	p.L259V	MUC15_ENST00000436318.2_Missense_Mutation_p.L286V|MUC15_ENST00000281268.8_Intron|MUC15_ENST00000529533.1_Missense_Mutation_p.L286V|ANO3_ENST00000256737.3_Intron|ANO3_ENST00000531568.1_Intron|ANO3_ENST00000525139.1_Intron|MUC15_ENST00000527569.1_Intron|ANO3_ENST00000529242.1_3'UTR|ANO3_ENST00000537978.1_Intron	NM_145650.3	NP_663625.2	Q8N387	MUC15_HUMAN	mucin 15, cell surface associated	259					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	25						CCACACAACAAGTAGCCCACA	0.388																																																	0													116.0	119.0	118.0					11																	26584732		2203	4300	6503	SO:0001583	missense	0			AJ417818	CCDS7859.1, CCDS44556.1, CCDS44557.1	11p14.3	2007-01-17	2006-03-14					"""Mucins"""	14956	protein-coding gene	gene with protein product		608566				12047385	Standard	NM_145650		Approved		uc001mqw.3	Q8N387		ENST00000455601.2:c.775T>G	11.37:g.26584732A>C	ENSP00000397339:p.Leu259Val		B3KY00|E9PII6|F8W945|Q6UWS3|Q8IXI8|Q8WW41	Missense_Mutation	SNP	NULL	p.L286V	ENST00000455601.2	37	c.856	CCDS7859.1	11	.	.	.	.	.	.	.	.	.	.	A	18.46	3.628694	0.67015	.	.	ENSG00000169550	ENST00000455601;ENST00000436318;ENST00000529533	T;T;T	0.36699	1.28;1.24;1.24	4.39	-1.48	0.08745	.	0.195208	0.22261	N	0.062409	T	0.19967	0.0480	L	0.29908	0.895	0.80722	D	1	B;B	0.30709	0.291;0.291	B;B	0.26693	0.072;0.072	T	0.02837	-1.1104	10	0.66056	D	0.02	-13.8504	5.5668	0.17175	0.5608:0.1374:0.3018:0.0	.	259;286	Q8N387;E9PII6	MUC15_HUMAN;.	V	259;286;286	ENSP00000397339:L259V;ENSP00000416753:L286V;ENSP00000431983:L286V	ENSP00000416753:L286V	L	-	1	2	MUC15	26541308	1.000000	0.71417	0.920000	0.36463	0.989000	0.77384	1.388000	0.34442	-0.193000	0.10415	-0.478000	0.04885	TTG	MUC15	-	NULL	ENSG00000169550		0.388	MUC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC15	HGNC	protein_coding	OTTHUMT00000387866.1	-	0.00	147	0	A	NM_145650		26584732	-1	tier1	-	no_errors	ENST00000436318	ensembl	human	known	74_37	missense	37.67	91	55	SNP	0.962	C
MUC16	94025	genome.wustl.edu	37	19	9066060	9066060	+	Missense_Mutation	SNP	A	A	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr19:9066060A>C	ENST00000397910.4	-	3	21589	c.21386T>G	c.(21385-21387)cTt>cGt	p.L7129R		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	7131	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGAGGTGAGAAGTGAAGTCAC	0.512																																																	0													202.0	186.0	191.0					19																	9066060		2058	4206	6264	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.21386T>G	19.37:g.9066060A>C	ENSP00000381008:p.Leu7129Arg		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.L7129R	ENST00000397910.4	37	c.21386	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	a	3.614	-0.078957	0.07141	.	.	ENSG00000181143	ENST00000397910	T	0.24908	1.83	2.53	0.073	0.14389	.	.	.	.	.	T	0.18635	0.0447	L	0.42245	1.32	.	.	.	B	0.22541	0.071	B	0.23574	0.047	T	0.28235	-1.0050	8	0.87932	D	0	.	2.707	0.05165	0.5517:0.269:0.1793:0.0	.	7129	B5ME49	.	R	7129	ENSP00000381008:L7129R	ENSP00000381008:L7129R	L	-	2	0	MUC16	8927060	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.733000	0.00803	-0.048000	0.13401	0.329000	0.21502	CTT	MUC16	-	NULL	ENSG00000181143		0.512	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	108	0	A	NM_024690		9066060	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	15.31	83	15	SNP	0.000	C
MUC16	94025	genome.wustl.edu	37	19	9068876	9068876	+	Missense_Mutation	SNP	A	A	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr19:9068876A>C	ENST00000397910.4	-	3	18773	c.18570T>G	c.(18568-18570)gaT>gaG	p.D6190E		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	6192	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AATCTACAAAATCCTGAGTTC	0.473																																																	0													89.0	93.0	92.0					19																	9068876		2078	4220	6298	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.18570T>G	19.37:g.9068876A>C	ENSP00000381008:p.Asp6190Glu		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.D6190E	ENST00000397910.4	37	c.18570	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	a	1.510	-0.549786	0.03996	.	.	ENSG00000181143	ENST00000397910	T	0.20332	2.08	1.05	-2.1	0.07210	.	.	.	.	.	T	0.06371	0.0164	N	0.03608	-0.345	.	.	.	P	0.34977	0.478	B	0.25987	0.065	T	0.19647	-1.0299	8	0.87932	D	0	.	2.2392	0.04016	0.3906:0.0:0.3632:0.2461	.	6190	B5ME49	.	E	6190	ENSP00000381008:D6190E	ENSP00000381008:D6190E	D	-	3	2	MUC16	8929876	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.500000	0.06405	-1.487000	0.01849	-1.014000	0.02459	GAT	MUC16	-	NULL	ENSG00000181143		0.473	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	151	0	A	NM_024690		9068876	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	15.62	108	20	SNP	0.000	C
MUC16	94025	genome.wustl.edu	37	19	9070065	9070065	+	Missense_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr19:9070065T>G	ENST00000397910.4	-	3	17584	c.17381A>C	c.(17380-17382)aAc>aCc	p.N5794T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	5796	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGTCACAGTGTTGATCTCCTC	0.463																																																	0													159.0	152.0	154.0					19																	9070065		1988	4169	6157	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.17381A>C	19.37:g.9070065T>G	ENSP00000381008:p.Asn5794Thr		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.N5794T	ENST00000397910.4	37	c.17381	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	t	1.793	-0.478987	0.04414	.	.	ENSG00000181143	ENST00000397910	T	0.02498	4.27	1.68	0.596	0.17496	.	.	.	.	.	T	0.01835	0.0058	N	0.14661	0.345	.	.	.	B	0.24426	0.103	B	0.17722	0.019	T	0.40175	-0.9577	8	0.87932	D	0	.	3.7402	0.08527	0.0:0.7386:0.0:0.2614	.	5794	B5ME49	.	T	5794	ENSP00000381008:N5794T	ENSP00000381008:N5794T	N	-	2	0	MUC16	8931065	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-3.287000	0.00526	0.263000	0.21812	-0.499000	0.04595	AAC	MUC16	-	NULL	ENSG00000181143		0.463	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	72	0	T	NM_024690		9070065	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	53.57	26	30	SNP	0.000	G
MUC16	94025	genome.wustl.edu	37	19	9072974	9072974	+	Silent	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr19:9072974C>T	ENST00000397910.4	-	3	14675	c.14472G>A	c.(14470-14472)acG>acA	p.T4824T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	4826	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGGAAGGATGCGTTGTCTCTA	0.443																																																	0													165.0	154.0	158.0					19																	9072974		2080	4211	6291	SO:0001819	synonymous_variant	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.14472G>A	19.37:g.9072974C>T			Q6ZQW5|Q96RK2	Silent	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.T4824	ENST00000397910.4	37	c.14472	CCDS54212.1	19																																																																																			MUC16	-	NULL	ENSG00000181143		0.443	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	80	0	C	NM_024690		9072974	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	silent	20.00	63	16	SNP	0.000	T
MUC16	94025	genome.wustl.edu	37	19	9089788	9089788	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr19:9089788G>T	ENST00000397910.4	-	1	2230	c.2027C>A	c.(2026-2028)tCt>tAt	p.S676Y		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	676	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.S676Y(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GATGACAGAAGAAACCATTGT	0.527																																																	2	Substitution - Missense(2)	large_intestine(2)											118.0	117.0	117.0					19																	9089788		2041	4206	6247	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.2027C>A	19.37:g.9089788G>T	ENSP00000381008:p.Ser676Tyr		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.S676Y	ENST00000397910.4	37	c.2027	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	2.258	-0.369886	0.05069	.	.	ENSG00000181143	ENST00000397910	T	0.02737	4.18	1.56	1.56	0.23342	.	.	.	.	.	T	0.03263	0.0095	N	0.08118	0	.	.	.	D	0.58268	0.982	P	0.56163	0.793	T	0.43829	-0.9367	8	0.87932	D	0	.	6.5643	0.22503	0.0:0.0:1.0:0.0	.	676	B5ME49	.	Y	676	ENSP00000381008:S676Y	ENSP00000381008:S676Y	S	-	2	0	MUC16	8950788	0.010000	0.17322	0.002000	0.10522	0.019000	0.09904	2.242000	0.43106	1.175000	0.42826	0.205000	0.17691	TCT	MUC16	-	NULL	ENSG00000181143		0.527	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1		0.00	41	0	G	NM_024690		9089788	-1			no_errors	ENST00000397910	ensembl	human	known	74_37	missense	8.82	31	3	SNP	0.003	T
MUC19	283463	genome.wustl.edu	37	12	40925448	40925448	+	3'UTR	SNP	A	A	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr12:40925448A>C	ENST00000474954.1	+	0	3718				MUC19_ENST00000454784.4_Intron			Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						CCTCCTACAAAACTTAGTGAA	0.368																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000474954.1:c.*3715A>C	12.37:g.40925448A>C			Q8NA85	RNA	SNP	-	NULL	ENST00000474954.1	37	NULL		12																																																																																			MUC19	-	-	ENSG00000205592		0.368	MUC19-006	KNOWN	basic	processed_transcript	MUC19	HGNC	protein_coding	OTTHUMT00000134360.1	-	0.00	34	0	A	XM_003403524		40925448	+1	tier1	-	no_errors	ENST00000474954	ensembl	human	known	74_37	rna	44.44	20	16	SNP	0.000	C
MUC19	283463	genome.wustl.edu	37	12	40925451	40925451	+	3'UTR	SNP	T	T	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr12:40925451T>C	ENST00000474954.1	+	0	3721				MUC19_ENST00000454784.4_Intron			Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						CCTACAAAACTTAGTGAAAAC	0.368																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000474954.1:c.*3718T>C	12.37:g.40925451T>C			Q8NA85	RNA	SNP	-	NULL	ENST00000474954.1	37	NULL		12																																																																																			MUC19	-	-	ENSG00000205592		0.368	MUC19-006	KNOWN	basic	processed_transcript	MUC19	HGNC	protein_coding	OTTHUMT00000134360.1	-	0.00	33	0	T	XM_003403524		40925451	+1	tier1	-	no_errors	ENST00000474954	ensembl	human	known	74_37	rna	45.95	20	17	SNP	0.002	C
MXRA5	25878	genome.wustl.edu	37	X	3241800	3241800	+	Missense_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chrX:3241800T>G	ENST00000217939.6	-	5	2080	c.1926A>C	c.(1924-1926)caA>caC	p.Q642H		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	642	Ig-like C2-type 2.					extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				TGTCACTGACTTGGACCTTTG	0.448																																																	0													109.0	96.0	101.0					X																	3241800		2203	4300	6503	SO:0001583	missense	0			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.1926A>C	X.37:g.3241800T>G	ENSP00000217939:p.Gln642His		Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.Q642H	ENST00000217939.6	37	c.1926	CCDS14124.1	X	.	.	.	.	.	.	.	.	.	.	t	5.465	0.270852	0.10349	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.01725	4.67	3.63	-0.291	0.12843	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.410761	0.17707	U	0.164717	T	0.01627	0.0052	L	0.49513	1.565	0.09310	N	1	B	0.25272	0.122	B	0.27262	0.078	T	0.47636	-0.9102	10	0.21540	T	0.41	.	0.7537	0.00995	0.2055:0.268:0.1249:0.4017	.	642	Q9NR99	MXRA5_HUMAN	H	642	ENSP00000217939:Q642H	ENSP00000217939:Q642H	Q	-	3	2	MXRA5	3251800	0.005000	0.15991	0.000000	0.03702	0.028000	0.11728	-0.041000	0.12084	-0.486000	0.06744	0.430000	0.28490	CAA	MXRA5	-	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000101825		0.448	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXRA5	HGNC	protein_coding	OTTHUMT00000055655.2	-	0.00	89	0	T	NM_015419		3241800	-1	tier1	-	no_errors	ENST00000217939	ensembl	human	known	74_37	missense	31.82	45	21	SNP	0.000	G
MYO1E	4643	genome.wustl.edu	37	15	59506906	59506906	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr15:59506906G>T	ENST00000288235.4	-	11	1520	c.1121C>A	c.(1120-1122)gCc>gAc	p.A374D	AC092756.1_ENST00000401164.1_RNA|RNU4-80P_ENST00000363200.1_RNA	NM_004998.3	NP_004989.2	Q12965	MYO1E_HUMAN	myosin IE	374	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(6)|lung(10)|pancreas(2)|prostate(1)|urinary_tract(1)	33				all cancers(107;0.207)		TTTCTCCATGGCTTTATTGAT	0.423																																																	0													178.0	167.0	170.0					15																	59506906		2190	4290	6480	SO:0001583	missense	0			U14391	CCDS32254.1	15q21-q22	2011-09-27				ENSG00000157483		"""Myosins / Myosin superfamily : Class I"""	7599	protein-coding gene	gene with protein product	"""myosin-IC"""	601479				8884266	Standard	NM_004998		Approved	MYO1C, HuncM-IC, MGC104638	uc002aga.4	Q12965		ENST00000288235.4:c.1121C>A	15.37:g.59506906G>T	ENSP00000288235:p.Ala374Asp		Q14778	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,pfam_SH3_domain,pfam_SH3_2,superfamily_P-loop_NTPase,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_SH3_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_SH3_domain,prints_Myosin_head_motor_dom,prints_SH3_domain	p.A374D	ENST00000288235.4	37	c.1121	CCDS32254.1	15	.	.	.	.	.	.	.	.	.	.	G	32	5.144844	0.94603	.	.	ENSG00000157483	ENST00000288235	D	0.88431	-2.38	5.66	5.66	0.87406	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.95680	0.8595	M	0.88450	2.955	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.95726	0.8770	10	0.87932	D	0	.	20.1253	0.97977	0.0:0.0:1.0:0.0	.	374	Q12965	MYO1E_HUMAN	D	374	ENSP00000288235:A374D	ENSP00000288235:A374D	A	-	2	0	MYO1E	57294198	1.000000	0.71417	0.985000	0.45067	0.959000	0.62525	9.869000	0.99810	2.832000	0.97577	0.655000	0.94253	GCC	MYO1E	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000157483		0.423	MYO1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO1E	HGNC	protein_coding	OTTHUMT00000416024.1	-	0.00	55	0	G	NM_004998		59506906	-1	tier1	-	no_errors	ENST00000288235	ensembl	human	known	74_37	missense	12.12	29	4	SNP	1.000	T
MYO7A	4647	genome.wustl.edu	37	11	76874015	76874015	+	Silent	SNP	C	C	T	rs373108550		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr11:76874015C>T	ENST00000409709.3	+	14	1943	c.1671C>T	c.(1669-1671)atC>atT	p.I557I	MYO7A_ENST00000409619.2_Silent_p.I546I|MYO7A_ENST00000458637.2_Silent_p.I557I|MYO7A_ENST00000409893.1_Silent_p.I557I	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	557	Myosin motor.				actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						TTGCAGGCATCGTCTACTATG	0.557																																																	0								C	,,	0,4072		0,0,2036	195.0	208.0	204.0		1671,1671,1671	-9.4	0.0	11		204	1,8363		0,1,4181	no	coding-synonymous,coding-synonymous,coding-synonymous	MYO7A	NM_000260.3,NM_001127179.2,NM_001127180.1	,,	0,1,6217	TT,TC,CC		0.012,0.0,0.0080	,,	557/2216,557/1179,557/2176	76874015	1,12435	2036	4182	6218	SO:0001819	synonymous_variant	0			U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.1671C>T	11.37:g.76874015C>T			B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_FERM_central,pfam_FERM_N,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_Band_41_domain,smart_SH3_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_SH3_domain,prints_Myosin_head_motor_dom	p.I557	ENST00000409709.3	37	c.1671	CCDS53683.1	11																																																																																			MYO7A	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000137474		0.557	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	MYO7A	HGNC	protein_coding	OTTHUMT00000328133.1	-	0.00	97	0	C	NM_000260		76874015	+1	tier1	-	no_errors	ENST00000409709	ensembl	human	known	74_37	silent	41.76	53	38	SNP	0.366	T
MYT1L	23040	genome.wustl.edu	37	2	1844867	1844867	+	Intron	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:1844867C>A	ENST00000399161.2	-	20	3522				MYT1L_ENST00000407844.1_Intron|MYT1L_ENST00000471668.1_5'UTR|MYT1L_ENST00000428368.2_Intron	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like						cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		ttagtagagacggggtttcac	0.502																																																	0																																										SO:0001627	intron_variant	0			AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.2775-252G>T	2.37:g.1844867C>A			A7E2C7|B2RP54|Q6IQ17|Q9UPP6	RNA	SNP	-	NULL	ENST00000399161.2	37	NULL		2																																																																																			MYT1L	-	-	ENSG00000186487		0.502	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	MYT1L	HGNC	protein_coding	OTTHUMT00000322493.1	-	0.00	8	0	C	NM_015025		1844867	-1	tier1	-	no_errors	ENST00000471668	ensembl	human	known	74_37	rna	66.67	2	4	SNP	0.238	A
NAA25	80018	genome.wustl.edu	37	12	112528595	112528595	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr12:112528595G>T	ENST00000261745.4	-	3	466	c.218C>A	c.(217-219)gCc>gAc	p.A73D		NM_024953.3	NP_079229.2	Q14CX7	NAA25_HUMAN	N(alpha)-acetyltransferase 25, NatB auxiliary subunit	73						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(1)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	46						GGGTTCAAGGGCTGCCACCTC	0.423																																																	0													157.0	141.0	146.0					12																	112528595		2203	4300	6503	SO:0001583	missense	0			AB054990	CCDS9159.1	12q24.13	2013-10-11	2010-01-14	2010-01-14		ENSG00000111300		"""N(alpha)-acetyltransferase subunits"""	25783	protein-coding gene	gene with protein product		612755	"""chromosome 12 open reading frame 30"""	C12orf30		19660095	Standard	NM_024953		Approved	FLJ13089	uc001ttm.3	Q14CX7	OTTHUMG00000169638	ENST00000261745.4:c.218C>A	12.37:g.112528595G>T	ENSP00000261745:p.Ala73Asp		A0JLU7|Q6MZH1|Q7Z4N6|Q9H911	Missense_Mutation	SNP	pfam_N-acetylTrfase_B_cplx_non-cat,pfscan_TPR-contain_dom	p.A73D	ENST00000261745.4	37	c.218	CCDS9159.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.39|12.39	1.924694|1.924694	0.34002|0.34002	.|.	.|.	ENSG00000111300|ENSG00000111300	ENST00000261745|ENST00000547133	T|.	0.38240|.	1.15|.	5.4|5.4	4.51|4.51	0.55191|0.55191	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);|.	0.191847|.	0.45867|.	D|.	0.000337|.	T|T	0.50735|0.50735	0.1633|0.1633	N|N	0.24115|0.24115	0.695|0.695	0.45621|0.45621	D|D	0.998553|0.998553	B;P|.	0.38335|.	0.09;0.627|.	B;B|.	0.35240|.	0.042;0.198|.	T|T	0.44997|0.44997	-0.9291|-0.9291	10|5	0.14656|.	T|.	0.56|.	-2.8497|-2.8497	14.3068|14.3068	0.66389|0.66389	0.0715:0.0:0.9285:0.0|0.0715:0.0:0.9285:0.0	.|.	73;73|.	A8K8X0;Q14CX7|.	.;NAA25_HUMAN|.	D|R	73|34	ENSP00000261745:A73D|.	ENSP00000261745:A73D|.	A|S	-|-	2|3	0|2	NAA25|NAA25	111012978|111012978	0.999000|0.999000	0.42202|0.42202	0.998000|0.998000	0.56505|0.56505	0.998000|0.998000	0.95712|0.95712	3.671000|3.671000	0.54576|0.54576	1.269000|1.269000	0.44280|0.44280	0.650000|0.650000	0.86243|0.86243	GCC|AGC	NAA25	-	pfscan_TPR-contain_dom	ENSG00000111300		0.423	NAA25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAA25	HGNC	protein_coding	OTTHUMT00000405205.1	-	0.00	90	0	G	NM_024953		112528595	-1	tier1	-	no_errors	ENST00000261745	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	T
NAP1L2	4674	genome.wustl.edu	37	X	72433666	72433666	+	Missense_Mutation	SNP	C	C	G	rs369450592		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chrX:72433666C>G	ENST00000373517.3	-	1	1018	c.663G>C	c.(661-663)gaG>gaC	p.E221D	NAP1L2_ENST00000536638.1_Missense_Mutation_p.E79D	NM_021963.3	NP_068798.1	Q9ULW6	NP1L2_HUMAN	nucleosome assembly protein 1-like 2	221	Glu-rich (acidic).				nucleosome assembly (GO:0006334)|positive regulation of histone H3-K14 acetylation (GO:0071442)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of neuron differentiation (GO:0045666)|regulation of stem cell division (GO:2000035)	nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(12)|skin(3)	29	Renal(35;0.156)					CAATGTCGtcctcctcctcct	0.423																																																	0													70.0	53.0	59.0					X																	72433666		2203	4300	6503	SO:0001583	missense	0			AF136178	CCDS14423.1	Xq13	2008-02-05			ENSG00000186462	ENSG00000186462			7638	protein-coding gene	gene with protein product		300026				8789438	Standard	NM_021963		Approved	BPX, MGC26243	uc004ebi.3	Q9ULW6	OTTHUMG00000021827	ENST00000373517.3:c.663G>C	X.37:g.72433666C>G	ENSP00000362616:p.Glu221Asp		B2RE61|B4E161|Q8TAN6	Missense_Mutation	SNP	pfam_NAP_family	p.E221D	ENST00000373517.3	37	c.663	CCDS14423.1	X	.	.	.	.	.	.	.	.	.	.	c	0	-2.795761	0.00076	.	.	ENSG00000186462	ENST00000373517;ENST00000536638	T;T	0.41758	0.99;0.99	3.01	-6.01	0.02199	.	0.520850	0.19966	N	0.102105	T	0.12390	0.0301	N	0.05199	-0.095	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.15009	-1.0452	10	0.13853	T	0.58	-0.04	1.4412	0.02354	0.1311:0.3096:0.3551:0.2042	.	221	Q9ULW6	NP1L2_HUMAN	D	221;79	ENSP00000362616:E221D;ENSP00000441555:E79D	ENSP00000362616:E221D	E	-	3	2	NAP1L2	72350391	0.010000	0.17322	0.000000	0.03702	0.000000	0.00434	-0.444000	0.06854	-3.379000	0.00175	-1.908000	0.00523	GAG	NAP1L2	-	pfam_NAP_family	ENSG00000186462		0.423	NAP1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAP1L2	HGNC	protein_coding	OTTHUMT00000057225.1		0.00	75	0	C	NM_021963		72433666	-1			no_errors	ENST00000373517	ensembl	human	known	74_37	missense	13.79	25	4	SNP	0.000	G
NAP1L3	4675	genome.wustl.edu	37	X	92926799	92926799	+	Missense_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chrX:92926799T>G	ENST00000373079.3	-	1	1768	c.1505A>C	c.(1504-1506)aAg>aCg	p.K502T	FAM133A_ENST00000332647.4_5'Flank|FAM133A_ENST00000538690.1_5'Flank|NAP1L3_ENST00000475430.2_Missense_Mutation_p.K495T|FAM133A_ENST00000322139.4_5'Flank|FAM133A_ENST00000355813.5_5'Flank	NM_004538.5	NP_004529.2	Q99457	NP1L3_HUMAN	nucleosome assembly protein 1-like 3	502					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	34						TCTGTATTTCTTGTTTCCATA	0.318																																																	0													64.0	57.0	59.0					X																	92926799		2202	4298	6500	SO:0001583	missense	0				CCDS14465.1	Xq21.3-q22	2008-08-01			ENSG00000186310	ENSG00000186310			7639	protein-coding gene	gene with protein product		300117				8976385	Standard	NM_004538		Approved	MB20, NPL3, MGC26312	uc004efq.3	Q99457	OTTHUMG00000021974	ENST00000373079.3:c.1505A>C	X.37:g.92926799T>G	ENSP00000362171:p.Lys502Thr		B2RCM0|O60788	Missense_Mutation	SNP	pfam_NAP_family	p.K502T	ENST00000373079.3	37	c.1505	CCDS14465.1	X	.	.	.	.	.	.	.	.	.	.	T	0.147	-1.096056	0.01843	.	.	ENSG00000186310	ENST00000373079;ENST00000543136	T	0.34275	1.37	3.54	0.78	0.18556	.	0.186806	0.44285	D	0.000462	T	0.16342	0.0393	N	0.08118	0	0.09310	N	1	B	0.16166	0.016	B	0.15870	0.014	T	0.15925	-1.0420	10	0.72032	D	0.01	.	6.1562	0.20338	0.0:0.5045:0.0:0.4955	.	502	Q99457	NP1L3_HUMAN	T	502;495	ENSP00000362171:K502T	ENSP00000362171:K502T	K	-	2	0	NAP1L3	92813455	0.014000	0.17966	0.000000	0.03702	0.042000	0.13812	0.203000	0.17315	0.041000	0.15688	-1.204000	0.01649	AAG	NAP1L3	-	NULL	ENSG00000186310		0.318	NAP1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAP1L3	HGNC	protein_coding	OTTHUMT00000057449.1	-	0.00	81	0	T	NM_004538		92926799	-1	tier1	-	no_errors	ENST00000373079	ensembl	human	known	74_37	missense	58.82	14	20	SNP	0.003	G
NCOA1	8648	genome.wustl.edu	37	2	24974952	24974952	+	Missense_Mutation	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:24974952C>A	ENST00000406961.1	+	20	4460	c.3808C>A	c.(3808-3810)Caa>Aaa	p.Q1270K	NCOA1_ENST00000395856.3_Missense_Mutation_p.Q1270K|NCOA1_ENST00000538539.1_Missense_Mutation_p.Q1270K|NCOA1_ENST00000405141.1_Missense_Mutation_p.Q1270K|NCOA1_ENST00000348332.3_Missense_Mutation_p.Q1270K|NCOA1_ENST00000288599.5_Missense_Mutation_p.Q1270K|NCOA1_ENST00000407230.1_Missense_Mutation_p.Q1119K			Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1	1270					androgen receptor signaling pathway (GO:0030521)|cellular lipid metabolic process (GO:0044255)|cellular response to hormone stimulus (GO:0032870)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|estrous cycle phase (GO:0060206)|hippocampus development (GO:0021766)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|labyrinthine layer morphogenesis (GO:0060713)|lactation (GO:0007595)|male gonad development (GO:0008584)|male mating behavior (GO:0060179)|ovulation cycle (GO:0042698)|positive regulation of apoptotic process (GO:0043065)|positive regulation of female receptivity (GO:0045925)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by galactose (GO:0000435)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular response to drug (GO:2001038)|response to estradiol (GO:0032355)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription coactivator activity (GO:0001105)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)		PAX3/NCOA1(8)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(26)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	53	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCTTCTCCAGCAAACTCCACC	0.532			T	PAX3	alveolar rhadomyosarcoma																																			Dom	yes		2	2p23	8648	nuclear receptor coactivator 1		M	0													72.0	67.0	69.0					2																	24974952		2203	4300	6503	SO:0001583	missense	0			U40396	CCDS1712.1, CCDS1713.1, CCDS42660.1	2p23	2011-07-01			ENSG00000084676	ENSG00000084676		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7668	protein-coding gene	gene with protein product		602691				7481822, 9575154	Standard	XM_005264625		Approved	SRC1, F-SRC-1, NCoA-1, KAT13A, RIP160, bHLHe74	uc002rfk.3	Q15788	OTTHUMG00000125523	ENST00000406961.1:c.3808C>A	2.37:g.24974952C>A	ENSP00000385216:p.Gln1270Lys		O00150|O43792|O43793|Q13071|Q13420|Q2T9G5|Q53SX3|Q6GVI5|Q7KYV3	Missense_Mutation	SNP	pfam_DUF1518,pfam_SRC-1,pfam_Nuc_rcpt_coact_Ncoa-typ,pfam_PAS_fold,superfamily_PAS,superfamily_Nuc_rcpt_coact,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,pirsf_Nuclear_rcpt_coactivator,pfscan_PAS,pfscan_bHLH_dom	p.Q1270K	ENST00000406961.1	37	c.3808	CCDS1712.1	2	.	.	.	.	.	.	.	.	.	.	C	16.98	3.270964	0.59540	.	.	ENSG00000084676	ENST00000406961;ENST00000405141;ENST00000407230;ENST00000538539;ENST00000348332;ENST00000288599;ENST00000395856	T;T;T;T;T;T;T	0.02890	4.19;4.17;4.12;4.17;4.19;4.17;4.19	5.14	5.14	0.70334	.	0.192967	0.45126	D	0.000398	T	0.03695	0.0105	L	0.52573	1.65	0.47341	D	0.999395	B;B;B;B;B	0.33694	0.421;0.341;0.231;0.341;0.231	B;B;B;B;B	0.25140	0.039;0.058;0.039;0.058;0.026	T	0.44128	-0.9348	10	0.52906	T	0.07	.	12.772	0.57426	0.0:0.9201:0.0:0.0799	.	1270;1270;1270;1270;1119	A8K1V4;Q15788-3;Q15788;Q15788-2;B5MCN7	.;.;NCOA1_HUMAN;.;.	K	1270;1270;1119;1270;1270;1270;1270	ENSP00000385216:Q1270K;ENSP00000385097:Q1270K;ENSP00000385195:Q1119K;ENSP00000444039:Q1270K;ENSP00000320940:Q1270K;ENSP00000288599:Q1270K;ENSP00000379197:Q1270K	ENSP00000288599:Q1270K	Q	+	1	0	NCOA1	24828456	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	2.368000	0.44222	2.653000	0.90120	0.585000	0.79938	CAA	NCOA1	-	pirsf_Nuclear_rcpt_coactivator	ENSG00000084676		0.532	NCOA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCOA1	HGNC	protein_coding	OTTHUMT00000246852.3	-	0.00	70	0	C	NM_147223		24974952	+1	tier1	-	no_errors	ENST00000348332	ensembl	human	known	74_37	missense	21.05	30	8	SNP	1.000	A
NFXL1	152518	genome.wustl.edu	37	4	47877280	47877280	+	Missense_Mutation	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr4:47877280C>A	ENST00000507489.1	-	18	2286	c.2110G>T	c.(2110-2112)Ggg>Tgg	p.G704W	NFXL1_ENST00000381538.3_Missense_Mutation_p.G704W	NM_001278624.1	NP_001265553.1	Q6ZNB6	NFXL1_HUMAN	nuclear transcription factor, X-box binding-like 1	704						integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(4)	27						TTGGAGCACCCTTCCTCACAA	0.433																																																	0													88.0	71.0	77.0					4																	47877280		2203	4300	6503	SO:0001583	missense	0			AY134856	CCDS3478.2	4p12	2008-02-05			ENSG00000170448	ENSG00000170448			18726	protein-coding gene	gene with protein product	"""ovarian zinc finger protein"""						Standard	NM_152995		Approved	HOZFP	uc003gxp.3	Q6ZNB6	OTTHUMG00000128621	ENST00000507489.1:c.2110G>T	4.37:g.47877280C>A	ENSP00000422037:p.Gly704Trp		B1Q2K1|Q86VG1|Q8WVH1	Missense_Mutation	SNP	pfam_Znf_NFX1,smart_Znf_NFX1,pfscan_Znf_RING	p.G704W	ENST00000507489.1	37	c.2110	CCDS3478.2	4	.	.	.	.	.	.	.	.	.	.	C	19.53	3.845499	0.71603	.	.	ENSG00000170448	ENST00000381538;ENST00000507489	T;T	0.29655	1.56;1.56	5.84	4.1	0.47936	.	0.145962	0.46145	D	0.000315	T	0.50000	0.1590	M	0.70595	2.14	0.80722	D	1	D	0.67145	0.996	P	0.61397	0.888	T	0.55560	-0.8122	10	0.72032	D	0.01	-11.553	13.0204	0.58784	0.0:0.867:0.0:0.133	.	704	Q6ZNB6	NFXL1_HUMAN	W	704	ENSP00000370949:G704W;ENSP00000422037:G704W	ENSP00000370949:G704W	G	-	1	0	NFXL1	47572037	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.589000	0.61006	1.478000	0.48253	0.484000	0.47621	GGG	NFXL1	-	NULL	ENSG00000170448		0.433	NFXL1-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NFXL1	HGNC	protein_coding	OTTHUMT00000361636.1	-	0.00	112	0	C	NM_152995		47877280	-1	tier1	-	no_errors	ENST00000381538	ensembl	human	known	74_37	missense	5.13	74	4	SNP	1.000	A
NIPBL	25836	genome.wustl.edu	37	5	36970987	36970987	+	Nonsense_Mutation	SNP	C	C	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr5:36970987C>G	ENST00000282516.8	+	7	1119	c.620C>G	c.(619-621)tCa>tGa	p.S207*	NIPBL_ENST00000504430.1_3'UTR|NIPBL_ENST00000448238.2_Nonsense_Mutation_p.S207*	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	207					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			GCATCGGTATCAAGTCCCATT	0.308																																																	0													82.0	77.0	78.0					5																	36970987		2203	4300	6503	SO:0001587	stop_gained	0			AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.620C>G	5.37:g.36970987C>G	ENSP00000282516:p.Ser207*		Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Nonsense_Mutation	SNP	superfamily_ARM-type_fold	p.S207*	ENST00000282516.8	37	c.620	CCDS3920.1	5	.	.	.	.	.	.	.	.	.	.	C	41	8.651244	0.98901	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	.	.	.	5.34	5.34	0.76211	.	0.341470	0.28317	N	0.015792	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	.	18.1669	0.89731	0.0:1.0:0.0:0.0	.	.	.	.	X	207	.	ENSP00000282516:S207X	S	+	2	0	NIPBL	37006744	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.312000	0.78968	2.664000	0.90586	0.655000	0.94253	TCA	NIPBL	-	NULL	ENSG00000164190		0.308	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPBL	HGNC	protein_coding	OTTHUMT00000207582.1	-	0.00	94	0	C	NM_015384		36970987	+1	tier1	-	no_errors	ENST00000282516	ensembl	human	known	74_37	nonsense	11.25	71	9	SNP	1.000	G
NKX2-2	4821	genome.wustl.edu	37	20	21492085	21492085	+	3'UTR	SNP	T	T	A	rs553704906	byFrequency	TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr20:21492085T>A	ENST00000377142.4	-	0	1654				NKX2-2-AS1_ENST00000549659.1_RNA	NM_002509.3	NP_002500.1	O95096	NKX22_HUMAN	NK2 homeobox 2						astrocyte differentiation (GO:0048708)|brain development (GO:0007420)|digestive tract development (GO:0048565)|endocrine pancreas development (GO:0031018)|negative regulation of neuron differentiation (GO:0045665)|neuron fate specification (GO:0048665)|oligodendrocyte development (GO:0014003)|optic nerve development (GO:0021554)|pancreatic A cell fate commitment (GO:0003326)|pancreatic PP cell fate commitment (GO:0003329)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)|spinal cord oligodendrocyte cell fate specification (GO:0021530)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell fate commitment (GO:0003327)|ventral spinal cord interneuron fate determination (GO:0060580)	nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|core promoter proximal region DNA binding (GO:0001159)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21						TATTTTTTTTTAAAAAAAGGA	0.328													T|||	30	0.00599042	0.0174	0.0014	5008	,	,		10950	0.0		0.005	False		,,,				2504	0.001																0																																										SO:0001624	3_prime_UTR_variant	0			AF019415	CCDS13145.1	20p11.22	2012-03-09	2007-07-09	2002-10-04	ENSG00000125820	ENSG00000125820		"""Homeoboxes / ANTP class : NKL subclass"""	7835	protein-coding gene	gene with protein product		604612	"""NK-2 (Drosophila) homolog B"", ""NK2 transcription factor related, locus 2 (Drosophila)"""	NKX2B		9703340, 1346742	Standard	NM_002509		Approved	NKX2.2	uc002wsi.3	O95096	OTTHUMG00000170524	ENST00000377142.4:c.*476A>T	20.37:g.21492085T>A				RNA	SNP	-	NULL	ENST00000377142.4	37	NULL	CCDS13145.1	20																																																																																			NKX2-2-AS1	-	-	ENSG00000258197		0.328	NKX2-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKX2-2-AS1	HGNC	protein_coding	OTTHUMT00000078278.9	-	0.00	82	0	T			21492085	+1	tier1	-	no_errors	ENST00000549659	ensembl	human	known	74_37	rna	64.10	28	50	SNP	0.686	A
NKAIN4	128414	genome.wustl.edu	37	20	61880181	61880181	+	Missense_Mutation	SNP	C	C	A	rs565172154		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr20:61880181C>A	ENST00000370316.3	-	3	348	c.259G>T	c.(259-261)Ggt>Tgt	p.G87C	NKAIN4_ENST00000370307.2_Missense_Mutation_p.G25C|NKAIN4_ENST00000466885.1_5'Flank|NKAIN4_ENST00000370313.1_Missense_Mutation_p.G25C	NM_152864.3	NP_690603.3	Q8IVV8	NKAI4_HUMAN	Na+/K+ transporting ATPase interacting 4	87						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|lung(1)|ovary(1)	4	all_cancers(38;2.72e-09)					AAGAGGCCACCGACTTCCAGG	0.607																																																	0													64.0	49.0	54.0					20																	61880181		2202	4299	6501	SO:0001583	missense	0			BC041812	CCDS13514.1	20q13.33	2007-10-04	2007-10-04	2007-10-04	ENSG00000101198	ENSG00000101198		"""Na+/K+ transporting ATPase interacting"""	16191	protein-coding gene	gene with protein product		612873	"""chromosome 20 open reading frame 58"""	C20orf58		17606467	Standard	NM_152864		Approved	bA261N11.2, FAM77A	uc002yek.3	Q8IVV8	OTTHUMG00000032959	ENST00000370316.3:c.259G>T	20.37:g.61880181C>A	ENSP00000359340:p.Gly87Cys		Q4VXQ6|Q9BQU8|Q9BQU9	Missense_Mutation	SNP	pfam_Na/K-Atpase_Interacting	p.G87C	ENST00000370316.3	37	c.259	CCDS13514.1	20	.	.	.	.	.	.	.	.	.	.	C	13.96	2.392911	0.42410	.	.	ENSG00000101198	ENST00000370313;ENST00000370316;ENST00000370307;ENST00000370317	T;T;T;T	0.39056	1.1;1.1;1.1;1.1	3.38	3.38	0.38709	.	0.000000	0.85682	U	0.000000	T	0.60405	0.2266	M	0.76574	2.34	0.53688	D	0.999979	D;D	0.63880	0.986;0.993	P;P	0.61940	0.821;0.896	T	0.66508	-0.5906	10	0.56958	D	0.05	-11.6382	14.3544	0.66727	0.0:1.0:0.0:0.0	.	25;87	A6NNM2;Q8IVV8	.;NKAI4_HUMAN	C	25;87;25;17	ENSP00000359336:G25C;ENSP00000359340:G87C;ENSP00000359330:G25C;ENSP00000359341:G17C	ENSP00000359330:G25C	G	-	1	0	NKAIN4	61350626	1.000000	0.71417	0.963000	0.40424	0.048000	0.14542	4.734000	0.62043	1.425000	0.47237	0.205000	0.17691	GGT	NKAIN4	-	pfam_Na/K-Atpase_Interacting	ENSG00000101198		0.607	NKAIN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKAIN4	HGNC	protein_coding	OTTHUMT00000080117.3		0.00	42	0	C	NM_152864		61880181	-1			no_errors	ENST00000370316	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	A
NLGN3	54413	genome.wustl.edu	37	X	70386974	70386974	+	Silent	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chrX:70386974C>T	ENST00000358741.3	+	7	1330	c.1027C>T	c.(1027-1029)Ctg>Ttg	p.L343L	NLGN3_ENST00000374051.3_Silent_p.L323L|NLGN3_ENST00000476589.1_3'UTR|NLGN3_ENST00000536169.1_Silent_p.L303L	NM_181303.1	NP_851820.1	Q9NZ94	NLGN3_HUMAN	neuroligin 3	343					adult behavior (GO:0030534)|axon extension (GO:0048675)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|oligodendrocyte differentiation (GO:0048709)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor-mediated endocytosis (GO:0006898)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term synaptic potentiation (GO:1900271)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|regulation of terminal button organization (GO:2000331)|rhythmic synaptic transmission (GO:0060024)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|visual learning (GO:0008542)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			biliary_tract(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	37	Renal(35;0.156)					CTGTAATGTGCTGGACACCGT	0.572																																					Esophageal Squamous(103;760 1488 16849 22250 40351)												0													123.0	94.0	103.0					X																	70386974		2203	4300	6503	SO:0001819	synonymous_variant	0			AB040913	CCDS14407.1, CCDS55441.1, CCDS55442.1	Xq13.1	2008-08-01			ENSG00000196338	ENSG00000196338			14289	protein-coding gene	gene with protein product		300336				10767552, 10819331	Standard	NM_181303		Approved	HNL3, KIAA1480, ASPGX1, AUTSX1	uc004dzd.2	Q9NZ94	OTTHUMG00000021790	ENST00000358741.3:c.1027C>T	X.37:g.70386974C>T			B2RBK1|D2X2H6|D3DVV0|D3DVV1|Q86V51|Q8NCD0|Q9NZ95|Q9NZ96|Q9NZ97|Q9P248	Silent	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Neuroligin	p.L343	ENST00000358741.3	37	c.1027	CCDS55441.1	X																																																																																			NLGN3	-	pfam_CarbesteraseB	ENSG00000196338		0.572	NLGN3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NLGN3	HGNC	protein_coding	OTTHUMT00000057121.1	-	0.00	59	0	C	NM_018977		70386974	+1	tier1	-	no_errors	ENST00000358741	ensembl	human	known	74_37	silent	12.90	27	4	SNP	1.000	T
NOD2	64127	genome.wustl.edu	37	16	50744810	50744811	+	Missense_Mutation	DNP	CC	CC	AT			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr16:50744810_50744811CC>AT	ENST00000300589.2	+	4	1093_1094	c.988_989CC>AT	c.(988-990)CCa>ATa	p.P330I	RP11-327F22.6_ENST00000602304.1_RNA|NOD2_ENST00000526417.2_3'UTR	NM_022162.1	NP_071445.1	Q9HC29	NOD2_HUMAN	nucleotide-binding oligomerization domain containing 2	330	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of MAPK activity (GO:0000187)|activation of MAPK activity involved in innate immune response (GO:0035419)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to peptidoglycan (GO:0071224)|cytokine production involved in immune response (GO:0002367)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|detection of muramyl dipeptide (GO:0032498)|immunoglobulin production involved in immunoglobulin mediated immune response (GO:0002381)|innate immune response (GO:0045087)|innate immune response in mucosa (GO:0002227)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|macrophage inflammatory protein-1 alpha production (GO:0071608)|maintenance of gastrointestinal epithelium (GO:0030277)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of inflammatory response to antigenic stimulus (GO:0002862)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-18 production (GO:0032701)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of macrophage apoptotic process (GO:2000110)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell mediated immunity (GO:0002710)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of tumor necrosis factor production (GO:0032720)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of B cell activation (GO:0050871)|positive regulation of biosynthetic process of antibacterial peptides active against Gram-positive bacteria (GO:0006965)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of dendritic cell cytokine production (GO:0002732)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gamma-delta T cell activation (GO:0046645)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of prostaglandin-E synthase activity (GO:2000363)|positive regulation of prostaglandin-endoperoxide synthase activity (GO:0060585)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type 2 immune response (GO:0002830)|protein oligomerization (GO:0051259)|regulation of inflammatory response (GO:0050727)|regulation of neutrophil chemotaxis (GO:0090022)|response to exogenous dsRNA (GO:0043330)|response to lipopolysaccharide (GO:0032496)|response to muramyl dipeptide (GO:0032495)|response to nutrient (GO:0007584)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|enzyme binding (GO:0019899)|muramyl dipeptide binding (GO:0032500)|peptidoglycan binding (GO:0042834)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(30)|ovary(3)|skin(3)	52		all_cancers(37;0.0156)				CTTTGTCTTCCCATTCAGCTGC	0.579																																																	0																																										SO:0001583	missense	0			AF178930	CCDS10746.1	16q12	2014-09-17	2006-12-08	2006-12-08	ENSG00000167207	ENSG00000167207		"""Nucleotide-binding domain and leucine rich repeat containing"""	5331	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 2"", ""NOD-like receptor C2"", ""NLR family, CARD domain containing 2"""	605956	"""caspase recruitment domain family, member 15"""	IBD1, CARD15		7809109, 8587604	Standard	XM_005256084		Approved	BLAU, CD, PSORAS1, CLR16.3, NLRC2	uc002egm.1	Q9HC29	OTTHUMG00000133171	Exception_encountered	16.37:g.50744810_50744811delinsAT	ENSP00000300589:p.Pro330Ile		E2JEQ6|Q96RH5|Q96RH6|Q96RH8	Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_CARD	p.P330T|p.P330L	ENST00000300589.2	37	c.988|c.989	CCDS10746.1	16																																																																																			NOD2	-	superfamily_P-loop_NTPase,pfscan_NACHT_NTPase	ENSG00000167207		0.579	NOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOD2	HGNC	protein_coding	OTTHUMT00000256876.2	-	0.00	21|22	0	C	NM_022162		50744810|50744811	+1	tier1	-	no_errors	ENST00000300589	ensembl	human	known	74_37	missense	44.00	14	11	SNP	1.000|0.999	A|T
NOL4	8715	genome.wustl.edu	37	18	31801983	31801983	+	Intron	SNP	C	C	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr18:31801983C>G	ENST00000261592.5	-	1	562				NOL4_ENST00000269185.4_Intron|NOL4_ENST00000590846.1_5'Flank|NOL4_ENST00000589544.1_Intron|NOL4_ENST00000538587.1_Splice_Site|NOL4_ENST00000535475.1_Splice_Site|RP11-379L18.1_ENST00000587528.1_RNA	NM_001198546.1|NM_003787.4	NP_001185475.1|NP_003778.2	O94818	NOL4_HUMAN	nucleolar protein 4							nucleolus (GO:0005730)	RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	51						CGAGTACCCACCGTGGCATGA	0.527																																																	0																																										SO:0001627	intron_variant	0			AB017800	CCDS11907.2, CCDS56058.1, CCDS56059.1, CCDS59308.1	18q12	2010-05-04			ENSG00000101746	ENSG00000101746			7870	protein-coding gene	gene with protein product	"""cancer/testis antigen 125"""	603577				9813152	Standard	NM_003787		Approved	NOLP, HRIHFB2255, CT125	uc010dmi.3	O94818	OTTHUMG00000132291	ENST00000261592.5:c.264+970G>C	18.37:g.31801983C>G			B4DSQ0|B7Z3Z7|F5H1E3|Q6IBS2|Q9BWF1	Splice_Site	SNP	-	e1+1	ENST00000261592.5	37	c.42+1	CCDS11907.2	18	.	.	.	.	.	.	.	.	.	.	C	14.33	2.501743	0.44455	.	.	ENSG00000101746	ENST00000538587	.	.	.	5.51	4.58	0.56647	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.5499	0.33444	0.171:0.6638:0.1651:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NOL4	30055981	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	0.830000	0.27462	2.605000	0.88082	0.655000	0.94253	.	NOL4	-	-	ENSG00000101746		0.527	NOL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOL4	HGNC	protein_coding	OTTHUMT00000255386.1	-	0.00	68	0	C	NM_003787		31801983	-1	tier1	-	no_errors	ENST00000538587	ensembl	human	known	74_37	splice_site	56.82	19	25	SNP	0.995	G
NOTCH2NL	388677	genome.wustl.edu	37	1	145290819	145290819	+	3'UTR	SNP	G	G	A	rs4659318	byFrequency	TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr1:145290819G>A	ENST00000344859.3	+	0	1118				NBPF10_ENST00000369339.3_Intron|NBPF10_ENST00000369338.1_5'Flank|NOTCH2NL_ENST00000479995.2_3'UTR|RP11-458D21.5_ENST00000468030.1_Intron|NBPF10_ENST00000342960.5_5'Flank			Q7Z3S9	NT2NL_HUMAN	notch 2 N-terminal like						cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|Notch signaling pathway (GO:0007219)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	27						ATGGAATTGCGCAGTGCATGG	0.527																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS72880.1	1q21.2	2010-06-24	2010-06-24		ENSG00000213240	ENSG00000213240			31862	protein-coding gene	gene with protein product			"""Notch homolog 2 (Drosophila) N-terminal like"""			14673143	Standard	NM_203458		Approved	N2N	uc001emn.4	Q7Z3S9	OTTHUMG00000013754	ENST00000344859.3:c.*63G>A	1.37:g.145290819G>A			Q5BKT8|Q5VTG9|Q5XG84|Q6P192|Q8NC23|Q8WUQ9|Q96FY1	RNA	SNP	-	NULL	ENST00000344859.3	37	NULL		1																																																																																			NOTCH2NL	-	-	ENSG00000213240		0.527	NOTCH2NL-001	KNOWN	basic|appris_candidate	protein_coding	NOTCH2NL	HGNC	protein_coding	OTTHUMT00000038544.1	-	0.00	18	0	G	NM_203458		145290819	+1	tier1	rs4659318	no_errors	ENST00000479995	ensembl	human	known	74_37	rna	25.81	23	8	SNP	0.001	A
NOTCH3	4854	genome.wustl.edu	37	19	15288458	15288458	+	Missense_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr19:15288458T>G	ENST00000263388.2	-	24	4356	c.4281A>C	c.(4279-4281)caA>caC	p.Q1427H		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1427					forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			GCGCCTCGCATTGCCGCCAGG	0.721																																																	0													4.0	5.0	5.0					19																	15288458		1997	3993	5990	SO:0001583	missense	0			U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.4281A>C	19.37:g.15288458T>G	ENSP00000263388:p.Gln1427His		Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	pirsf_Notch,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,pfam_Ankyrin_rpt,pfam_Notch_dom,pfam_Notch_NODP_dom,pfam_Notch_NOD_dom,pfam_EGF_extracell,pfam_DUF3454_notch,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_3,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.Q1427H	ENST00000263388.2	37	c.4281	CCDS12326.1	19	.	.	.	.	.	.	.	.	.	.	t	19.68	3.873689	0.72180	.	.	ENSG00000074181	ENST00000263388	D	0.91631	-2.88	4.66	1.24	0.21308	Notch domain (4);	.	.	.	.	D	0.89781	0.6814	L	0.34521	1.04	0.34254	D	0.679097	D	0.58620	0.983	P	0.57425	0.82	D	0.87712	0.2567	9	0.45353	T	0.12	.	5.0285	0.14398	0.0:0.5131:0.1452:0.3417	.	1427	Q9UM47	NOTC3_HUMAN	H	1427	ENSP00000263388:Q1427H	ENSP00000263388:Q1427H	Q	-	3	2	NOTCH3	15149458	0.970000	0.33590	1.000000	0.80357	0.911000	0.54048	0.238000	0.18004	0.391000	0.25143	-0.741000	0.03529	CAA	NOTCH3	-	pirsf_Notch,pfam_Notch_dom,superfamily_Notch_dom,smart_Notch_dom,pfscan_Notch_dom	ENSG00000074181		0.721	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH3	HGNC	protein_coding	OTTHUMT00000465714.1	-	0.00	32	0	T	NM_000435		15288458	-1	tier1	-	no_errors	ENST00000263388	ensembl	human	known	74_37	missense	14.71	29	5	SNP	0.997	G
NPM1	4869	genome.wustl.edu	37	5	170834716	170834716	+	Missense_Mutation	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr5:170834716C>A	ENST00000296930.5	+	10	1085	c.784C>A	c.(784-786)Ccc>Acc	p.P262T	NPM1_ENST00000351986.6_Missense_Mutation_p.P233T|NPM1_ENST00000517671.1_Missense_Mutation_p.P262T	NM_002520.6	NP_002511.1	P06748	NPM_HUMAN	nucleophosmin (nucleolar phosphoprotein B23, numatrin)	262	Required for nucleolar localization.				cell aging (GO:0007569)|CENP-A containing nucleosome assembly (GO:0034080)|centrosome cycle (GO:0007098)|DNA repair (GO:0006281)|intracellular protein transport (GO:0006886)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of centrosome duplication (GO:0010826)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|nucleocytoplasmic transport (GO:0006913)|nucleosome assembly (GO:0006334)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of translation (GO:0045727)|protein localization (GO:0008104)|protein oligomerization (GO:0051259)|regulation of centriole replication (GO:0046599)|regulation of eIF2 alpha phosphorylation by dsRNA (GO:0060735)|regulation of endodeoxyribonuclease activity (GO:0032071)|regulation of endoribonuclease activity (GO:0060699)|response to stress (GO:0006950)|ribosome assembly (GO:0042255)|signal transduction (GO:0007165)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle pole centrosome (GO:0031616)	histone binding (GO:0042393)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)|ribosomal large subunit binding (GO:0043023)|ribosomal small subunit binding (GO:0043024)|RNA binding (GO:0003723)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|unfolded protein binding (GO:0051082)		NPM1/ALK(632)	central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(4261)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	4269	Renal(175;0.000159)|Lung NSC(126;0.00576)|all_lung(126;0.00963)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TGGTTCTCTTCCCAAAGTGGA	0.378			"""T, F """	"""ALK, RARA, MLF1"""	"""NHL, APL, AML"""																																			Dom	yes		5	5q35	4869	"""nucleophosmin (nucleolar phosphoprotein B23, numatrin)"""		L	0													113.0	115.0	114.0					5																	170834716		2203	4300	6503	SO:0001583	missense	0			M26697	CCDS4376.1, CCDS4377.1, CCDS43399.1	5q35.1	2014-09-17			ENSG00000181163	ENSG00000181163			7910	protein-coding gene	gene with protein product	"""nucleolar phosphoprotein B23"", ""numatrin"", ""nucleophosmin/nucleoplasmin family, member 1"""	164040				8471164, 8122112	Standard	NM_002520		Approved	B23, NPM	uc003mbi.3	P06748	OTTHUMG00000130465	ENST00000296930.5:c.784C>A	5.37:g.170834716C>A	ENSP00000296930:p.Pro262Thr		A8K3N7|B5BU00|D3DQL6|P08693|Q12826|Q13440|Q13441|Q14115|Q5EU94|Q5EU95|Q5EU96|Q5EU97|Q5EU98|Q5EU99|Q6V962|Q8WTW5|Q96AT6|Q96DC4|Q96EA5|Q9BYG9|Q9UDJ7	Missense_Mutation	SNP	superfamily_Nucleoplasmin_core_dom	p.P262T	ENST00000296930.5	37	c.784	CCDS4376.1	5	.	.	.	.	.	.	.	.	.	.	C	19.69	3.875453	0.72180	.	.	ENSG00000181163	ENST00000517671;ENST00000296930;ENST00000351986	T;T;T	0.73363	-0.74;-0.74;-0.56	4.87	4.87	0.63330	.	0.000000	0.85682	U	0.000000	D	0.87974	0.6313	M	0.90705	3.14	0.80722	D	1	D;D	0.67145	0.996;0.996	D;P	0.67103	0.949;0.901	D	0.90649	0.4581	10	0.87932	D	0	.	16.185	0.81946	0.0:1.0:0.0:0.0	.	233;262	P06748-2;P06748	.;NPM_HUMAN	T	262;262;233	ENSP00000428755:P262T;ENSP00000296930:P262T;ENSP00000341168:P233T	ENSP00000296930:P262T	P	+	1	0	NPM1	170767321	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.708000	0.61859	2.404000	0.81709	0.655000	0.94253	CCC	NPM1	-	NULL	ENSG00000181163		0.378	NPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPM1	HGNC	protein_coding	OTTHUMT00000252858.2	-	0.00	69	0	C	NM_002520		170834716	+1	tier1	-	no_errors	ENST00000296930	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	A
NR3C2	4306	genome.wustl.edu	37	4	149356317	149356317	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr4:149356317G>T	ENST00000358102.3	-	2	2058	c.1696C>A	c.(1696-1698)Ctg>Atg	p.L566M	NR3C2_ENST00000511528.1_Missense_Mutation_p.L566M|NR3C2_ENST00000512865.1_Missense_Mutation_p.L566M|NR3C2_ENST00000344721.4_Missense_Mutation_p.L566M|NR3C2_ENST00000355292.3_Missense_Mutation_p.L566M	NM_000901.4|NM_001166104.1	NP_000892.2|NP_001159576.1	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	566	Modulating.				gene expression (GO:0010467)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|receptor complex (GO:0043235)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Drospirenone(DB01395)|Eplerenone(DB00700)|Felodipine(DB01023)|Fludrocortisone(DB00687)|Fluticasone Propionate(DB00588)|Nimodipine(DB00393)|Progesterone(DB00396)|Spironolactone(DB00421)	CTAGACGACAGGTCGCCGTGT	0.413																																					Melanoma(27;428 957 40335 51025 51111)												0													117.0	119.0	118.0					4																	149356317		2203	4300	6503	SO:0001583	missense	0			M16801	CCDS3772.1, CCDS54811.1	4q31	2013-01-16			ENSG00000151623	ENSG00000151623		"""Nuclear hormone receptors"""	7979	protein-coding gene	gene with protein product		600983		MLR		2558856	Standard	NM_000901		Approved	MR	uc003ilj.4	P08235	OTTHUMG00000161455	ENST00000358102.3:c.1696C>A	4.37:g.149356317G>T	ENSP00000350815:p.Leu566Met		B0ZBF5|B0ZBF7|Q2NKL1|Q96KQ8|Q96KQ9	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.L566M	ENST00000358102.3	37	c.1696	CCDS3772.1	4	.	.	.	.	.	.	.	.	.	.	G	6.248	0.413854	0.11812	.	.	ENSG00000151623	ENST00000344721;ENST00000355292;ENST00000358102;ENST00000512865;ENST00000544252;ENST00000342437;ENST00000511528	D;D;D;D;D;D	0.90788	-2.73;-2.73;-2.73;-2.37;-2.37;-2.73	5.51	0.935	0.19483	.	0.275770	0.30949	N	0.008542	D	0.86904	0.6045	N	0.14661	0.345	0.35649	D	0.811589	P;D	0.64830	0.647;0.994	B;P	0.62089	0.146;0.898	D	0.84479	0.0604	9	.	.	.	.	8.6162	0.33833	0.2837:0.1174:0.5989:0.0	.	566;566	B0ZBF5;B0ZBF6	.;.	M	566	ENSP00000341390:L566M;ENSP00000347441:L566M;ENSP00000350815:L566M;ENSP00000423510:L566M;ENSP00000343907:L566M;ENSP00000421481:L566M	.	L	-	1	2	NR3C2	149575767	0.999000	0.42202	0.978000	0.43139	0.933000	0.57130	0.517000	0.22832	0.049000	0.15920	0.655000	0.94253	CTG	NR3C2	-	NULL	ENSG00000151623		0.413	NR3C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NR3C2	HGNC	protein_coding	OTTHUMT00000364986.1	-	0.00	79	0	G			149356317	-1	tier1	-	no_errors	ENST00000355292	ensembl	human	known	74_37	missense	8.16	45	4	SNP	0.961	T
NSMAF	8439	genome.wustl.edu	37	8	59513816	59513816	+	Intron	SNP	A	A	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr8:59513816A>C	ENST00000038176.3	-	16	1493				NSMAF_ENST00000427130.2_Intron|NSMAF_ENST00000519858.1_5'UTR	NM_003580.3	NP_003571.2	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation associated factor						ceramide metabolic process (GO:0006672)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	receptor signaling protein activity (GO:0005057)|sphingomyelin phosphodiesterase activator activity (GO:0016230)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	38		all_lung(136;0.174)|Lung NSC(129;0.2)				AAGTGTTAAAAATGATAAGCA	0.318																																																	0													48.0	46.0	47.0					8																	59513816		2203	4300	6503	SO:0001627	intron_variant	0			X96586	CCDS6173.1, CCDS47864.1	8q12-q13	2013-01-10			ENSG00000035681	ENSG00000035681		"""WD repeat domain containing"""	8017	protein-coding gene	gene with protein product		603043				8808629, 10640829	Standard	NM_003580		Approved	FAN	uc011lee.2	Q92636	OTTHUMG00000164352	ENST00000038176.3:c.1280+27T>G	8.37:g.59513816A>C			B4DFB0|E9PCH0|Q8IW26	RNA	SNP	-	NULL	ENST00000038176.3	37	NULL	CCDS6173.1	8																																																																																			NSMAF	-	-	ENSG00000035681		0.318	NSMAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSMAF	HGNC	protein_coding	OTTHUMT00000378384.1	-	0.00	106	0	A	NM_003580		59513816	-1	tier1	-	no_errors	ENST00000519858	ensembl	human	known	74_37	rna	15.45	104	19	SNP	0.009	C
NUP210L	91181	genome.wustl.edu	37	1	154076545	154076545	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr1:154076545G>T	ENST00000368559.3	-	13	1833	c.1762C>A	c.(1762-1764)Cat>Aat	p.H588N	NUP210L_ENST00000271854.3_Missense_Mutation_p.H588N|MIR5698_ENST00000577643.1_RNA	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	588					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			AAGGATAAATGAGAGCAGTCT	0.368																																																	0													145.0	133.0	137.0					1																	154076545		1865	4100	5965	SO:0001583	missense	0			AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.1762C>A	1.37:g.154076545G>T	ENSP00000357547:p.His588Asn		E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Missense_Mutation	SNP	pfam_Big_2,superfamily_Invasin/intimin_cell_adhesion,smart_Big_2	p.H588N	ENST00000368559.3	37	c.1762	CCDS41399.1	1	.	.	.	.	.	.	.	.	.	.	G	12.06	1.825148	0.32237	.	.	ENSG00000143552	ENST00000368559;ENST00000271854	T;T	0.05855	3.38;3.38	4.7	4.7	0.59300	.	0.212784	0.32918	N	0.005487	T	0.02119	0.0066	L	0.36672	1.1	0.34441	D	0.699661	P;P	0.45569	0.608;0.861	B;B	0.35182	0.129;0.197	T	0.55231	-0.8173	10	0.15952	T	0.53	-21.8531	15.5711	0.76337	0.0:0.0:1.0:0.0	.	588;588	E7EP56;Q5VU65	.;P210L_HUMAN	N	588	ENSP00000357547:H588N;ENSP00000271854:H588N	ENSP00000271854:H588N	H	-	1	0	NUP210L	152343169	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.693000	0.54735	2.439000	0.82584	0.555000	0.69702	CAT	NUP210L	-	NULL	ENSG00000143552		0.368	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP210L	HGNC	protein_coding	OTTHUMT00000087270.3	-	0.00	52	0	G	NM_207308		154076545	-1	tier1	-	no_errors	ENST00000368559	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	T
OLFM1	10439	genome.wustl.edu	37	9	137968997	137968998	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	CA	CA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr9:137968997_137968998delCA	ENST00000371799.4	+	2	721_722	c.436_437delCA	c.(436-438)cacfs	p.H146fs	OLFM1_ENST00000252854.4_Intron|OLFM1_ENST00000277415.11_Intron			Q99784	NOE1_HUMAN	olfactomedin 1	0					negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of neuron migration (GO:2001223)|nervous system development (GO:0007399)|protein oligomerization (GO:0051259)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(2)	21		Myeloproliferative disorder(178;0.0333)		Epithelial(140;5.49e-08)|OV - Ovarian serous cystadenocarcinoma(145;9.68e-08)|all cancers(34;1.88e-07)		CATTCATGTGcacacacacaca	0.554																																																	0																																										SO:0001589	frameshift_variant	0			AF035301	CCDS6986.1, CCDS6987.1, CCDS65183.1, CCDS65184.1	9q34.3	2014-01-20			ENSG00000130558	ENSG00000130558			17187	protein-coding gene	gene with protein product	"""pancortin"""	605366				9039501	Standard	NM_006334		Approved	NOE1, OlfA, AMY, NOELIN	uc004cfl.4	Q99784	OTTHUMG00000020897	ENST00000371799.4:c.436_437delCA	9.37:g.137969007_137969008delCA	ENSP00000360864:p.His146fs		Q53XZ8|Q6IMJ4|Q6IMJ5|Q8N8R0|Q969S7|Q99452	Frame_Shift_Del	DEL	NULL	p.T149fs	ENST00000371799.4	37	c.436_437		9																																																																																			OLFM1	-	NULL	ENSG00000130558		0.554	OLFM1-006	PUTATIVE	basic|exp_conf	protein_coding	OLFM1	HGNC	protein_coding	OTTHUMT00000054976.1		0.00	29	0	CA	NM_014279		137968998	+1	tier1		no_errors	ENST00000371799	ensembl	human	putative	74_37	frame_shift_del	14.81	23	4	DEL	0.009:0.030	-
OR10R2	343406	genome.wustl.edu	37	1	158450337	158450337	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr1:158450337G>T	ENST00000368152.1	+	1	670	c.670G>T	c.(670-672)Gtt>Ttt	p.V224F	RP11-144L1.4_ENST00000426251.1_RNA|RP11-144L1.4_ENST00000419738.1_RNA	NM_001004472.1	NP_001004472.1	Q8NGX6	O10R2_HUMAN	olfactory receptor, family 10, subfamily R, member 2	224						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V224F(2)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(26)|pancreas(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	41	all_hematologic(112;0.0378)					CATTTGTGGAGTTCTTGTACT	0.423																																																	2	Substitution - Missense(2)	lung(2)											153.0	139.0	144.0					1																	158450337		2203	4300	6503	SO:0001583	missense	0			AB065640	CCDS30898.1	1q23.1	2012-08-09			ENSG00000198965	ENSG00000198965		"""GPCR / Class A : Olfactory receptors"""	14820	protein-coding gene	gene with protein product							Standard	NM_001004472		Approved	OR10R2Q	uc010pik.2	Q8NGX6	OTTHUMG00000019632	ENST00000368152.1:c.670G>T	1.37:g.158450337G>T	ENSP00000357134:p.Val224Phe		Q5VWM8|Q6IFS1|Q96R61	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V224F	ENST00000368152.1	37	c.670	CCDS30898.1	1	.	.	.	.	.	.	.	.	.	.	g	14.36	2.511594	0.44660	.	.	ENSG00000198965	ENST00000368152	T	0.39592	1.07	4.37	3.46	0.39613	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.37571	0.1008	L	0.43701	1.375	0.09310	N	1	D	0.60575	0.988	D	0.69654	0.965	T	0.12760	-1.0535	9	0.62326	D	0.03	.	8.3543	0.32321	0.1919:0.0:0.8081:0.0	.	224	Q8NGX6	O10R2_HUMAN	F	224	ENSP00000357134:V224F	ENSP00000357134:V224F	V	+	1	0	OR10R2	156716961	0.000000	0.05858	0.118000	0.21660	0.987000	0.75469	-0.247000	0.08866	1.024000	0.39682	0.655000	0.94253	GTT	OR10R2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000198965		0.423	OR10R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10R2	HGNC	protein_coding	OTTHUMT00000051847.2	-	0.00	75	0	G	NM_001004472		158450337	+1	tier1	-	no_errors	ENST00000368152	ensembl	human	known	74_37	missense	12.77	41	6	SNP	0.007	T
OR14A2	388761	genome.wustl.edu	37	1	247887222	247887222	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr1:247887222G>T	ENST00000366485.1	-	1	123	c.124C>A	c.(124-126)Ctc>Atc	p.L42I	RP11-634B7.5_ENST00000426444.1_RNA|RP11-634B7.4_ENST00000449298.1_RNA			Q96R54	O14A2_HUMAN	olfactory receptor, family 14, subfamily A, member 2	42						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										GTAATGATGAGAAGGTTACTC	0.423																																																	0																																										SO:0001583	missense	0			AB065620		1q44	2013-01-16	2008-04-02	2008-04-02	ENSG00000241128	ENSG00000241128		"""GPCR / Class A : Olfactory receptors"""	15024	other	unknown			"""olfactory receptor, family 5, subfamily AX, member 1 pseudogene"", ""olfactory receptor, family 5, subfamily AX, member 1"""	OR5AX1P, OR5AX1			Standard	NG_002409		Approved			Q96R54	OTTHUMG00000040207	ENST00000366485.1:c.124C>A	1.37:g.247887222G>T	ENSP00000355441:p.Leu42Ile			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L42I	ENST00000366485.1	37	c.124		1	.	.	.	.	.	.	.	.	.	.	G	7.036	0.561652	0.13498	.	.	ENSG00000241128	ENST00000366485	T	0.00354	7.93	3.05	0.993	0.19825	.	0.154830	0.29868	N	0.010991	T	0.00271	0.0008	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.43637	-0.9379	7	0.59425	D	0.04	.	6.4155	0.21714	0.0:0.1789:0.4546:0.3665	.	.	.	.	I	42	ENSP00000355441:L42I	ENSP00000355441:L42I	L	-	1	0	OR14A2	245953845	0.000000	0.05858	0.006000	0.13384	0.044000	0.14063	-1.456000	0.02377	0.112000	0.17975	-0.309000	0.09137	CTC	OR14A2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000241128		0.423	OR14A2-001	KNOWN	basic|appris_principal	protein_coding	OR14A2	HGNC	protein_coding	OTTHUMT00000096864.1	-	0.00	111	0	G	NG_002409		247887222	-1	tier1	-	no_errors	ENST00000366485	ensembl	human	known	74_37	missense	21.11	71	19	SNP	0.000	T
OR2M4	26245	genome.wustl.edu	37	1	248402855	248402855	+	Missense_Mutation	SNP	T	T	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr1:248402855T>C	ENST00000306687.1	+	1	625	c.625T>C	c.(625-627)Ttt>Ctt	p.F209L		NM_017504.1	NP_059974.1	Q96R27	OR2M4_HUMAN	olfactory receptor, family 2, subfamily M, member 4	209					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F209I(1)		NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(27)|skin(3)|upper_aerodigestive_tract(2)	50	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			AATGCTAATCTTTCCAGTTTC	0.448																																																	1	Substitution - Missense(1)	skin(1)											122.0	117.0	119.0					1																	248402855		2203	4300	6503	SO:0001583	missense	0			X64992	CCDS31108.1	1q44	2012-08-09			ENSG00000171180	ENSG00000171180		"""GPCR / Class A : Olfactory receptors"""	8270	protein-coding gene	gene with protein product						1370859, 9119360	Standard	NM_017504		Approved	HTPCRX18, TPCR100, HSHTPCRX18, OST710	uc010pzh.2	Q96R27	OTTHUMG00000040456	ENST00000306687.1:c.625T>C	1.37:g.248402855T>C	ENSP00000306688:p.Phe209Leu		Q15611|Q8NG82	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F209L	ENST00000306687.1	37	c.625	CCDS31108.1	1	.	.	.	.	.	.	.	.	.	.	t	0.003	-2.490890	0.00161	.	.	ENSG00000171180	ENST00000306687	T	0.31510	1.49	3.34	-2.47	0.06442	GPCR, rhodopsin-like superfamily (1);	0.989051	0.08203	N	0.982037	T	0.11196	0.0273	N	0.02420	-0.555	0.09310	N	1	B	0.06786	0.001	B	0.15870	0.014	T	0.39292	-0.9621	10	0.10636	T	0.68	.	10.4118	0.44299	0.0:0.4495:0.0:0.5505	.	209	Q96R27	OR2M4_HUMAN	L	209	ENSP00000306688:F209L	ENSP00000306688:F209L	F	+	1	0	OR2M4	246469478	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-1.665000	0.01965	-1.122000	0.02945	-1.446000	0.01064	TTT	OR2M4	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000171180		0.448	OR2M4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2M4	HGNC	protein_coding	OTTHUMT00000097352.1	-	0.00	59	0	T	NM_017504		248402855	+1	tier1	-	no_errors	ENST00000306687	ensembl	human	known	74_37	missense	38.71	19	12	SNP	0.000	C
OR2T5	401993	genome.wustl.edu	37	1	248652080	248652080	+	Missense_Mutation	SNP	A	A	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr1:248652080A>T	ENST00000366473.2	+	1	196	c.191A>T	c.(190-192)tAc>tTc	p.Y64F		NM_001004697.1	NP_001004697.1	Q6IEZ7	OR2T5_HUMAN	olfactory receptor, family 2, subfamily T, member 5	64						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|ovary(2)|pancreas(1)|skin(2)	9	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AGCCCCATGTACTTTTTCATC	0.488																																																	0													20.0	47.0	38.0					1																	248652080		2051	4275	6326	SO:0001583	missense	0			BK004465	CCDS31118.1	1q44	2012-08-09			ENSG00000203661	ENSG00000203661		"""GPCR / Class A : Olfactory receptors"""	15017	protein-coding gene	gene with protein product							Standard	NM_001004697		Approved		uc001iem.1	Q6IEZ7	OTTHUMG00000040481	ENST00000366473.2:c.191A>T	1.37:g.248652080A>T	ENSP00000355429:p.Tyr64Phe			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Y64F	ENST00000366473.2	37	c.191	CCDS31118.1	1	.	.	.	.	.	.	.	.	.	.	a	13.65	2.300776	0.40694	.	.	ENSG00000203661	ENST00000366473	T	0.14391	2.51	2.64	2.64	0.31445	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42682	D	0.000661	T	0.36496	0.0969	M	0.84219	2.685	0.30965	N	0.723235	D	0.89917	1.0	D	0.91635	0.999	T	0.41556	-0.9502	10	0.87932	D	0	.	9.8671	0.41150	1.0:0.0:0.0:0.0	.	64	Q6IEZ7	OR2T5_HUMAN	F	64	ENSP00000355429:Y64F	ENSP00000355429:Y64F	Y	+	2	0	OR2T5	246718703	1.000000	0.71417	0.996000	0.52242	0.364000	0.29643	3.259000	0.51515	1.006000	0.39211	0.338000	0.21704	TAC	OR2T5	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000203661		0.488	OR2T5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T5	HGNC	protein_coding	OTTHUMT00000097422.1	-	0.00	59	0	A	NM_001004697		248652080	+1	tier1	-	no_errors	ENST00000366473	ensembl	human	known	74_37	missense	11.29	54	7	SNP	1.000	T
OR2W1	26692	genome.wustl.edu	37	6	29012868	29012868	+	Nonsense_Mutation	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr6:29012868C>A	ENST00000377175.1	-	1	149	c.85G>T	c.(85-87)Gga>Tga	p.G29*		NM_030903.3	NP_112165.1	Q9Y3N9	OR2W1_HUMAN	olfactory receptor, family 2, subfamily W, member 1	29						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|skin(1)	23						GCGACAACTCCTGACAGGATC	0.398																																																	0													117.0	127.0	123.0					6																	29012868		1486	2696	4182	SO:0001587	stop_gained	0			AL035402	CCDS4656.1	6p22.1	2012-08-09			ENSG00000204704	ENSG00000204704		"""GPCR / Class A : Olfactory receptors"""	8281	protein-coding gene	gene with protein product							Standard	NM_030903		Approved	hs6M1-15	uc003nlw.2	Q9Y3N9	OTTHUMG00000031048	ENST00000377175.1:c.85G>T	6.37:g.29012868C>A	ENSP00000366380:p.Gly29*		B0S7Y5|Q5JNZ1|Q6IEU0|Q96R17|Q9GZL0|Q9GZL1	Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G29*	ENST00000377175.1	37	c.85	CCDS4656.1	6	.	.	.	.	.	.	.	.	.	.	C	20.2	3.952996	0.73902	.	.	ENSG00000204704	ENST00000377175	.	.	.	3.92	3.92	0.45320	.	0.000000	0.49916	D	0.000138	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	13.8372	0.63417	0.0:1.0:0.0:0.0	.	.	.	.	X	29	.	ENSP00000366380:G29X	G	-	1	0	OR2W1	29120847	0.000000	0.05858	1.000000	0.80357	0.522000	0.34438	0.073000	0.14640	2.171000	0.68590	0.585000	0.79938	GGA	OR2W1	-	pfam_7TM_GPCR_serpentine_rcpt_Srv,prints_GPCR_Rhodpsn	ENSG00000204704		0.398	OR2W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2W1	HGNC	protein_coding	OTTHUMT00000076053.2		0.00	88	0	C			29012868	-1			no_errors	ENST00000377175	ensembl	human	known	74_37	nonsense	6.45	58	4	SNP	1.000	A
OR4A5	81318	genome.wustl.edu	37	11	51411715	51411715	+	Missense_Mutation	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr11:51411715C>A	ENST00000319760.6	-	1	733	c.681G>T	c.(679-681)caG>caT	p.Q227H		NM_001005272.3	NP_001005272.3	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A, member 5	227						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(28)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	49		all_lung(304;0.236)				CCCTCTTTTCCTGACTGTAAG	0.413																																																	0													63.0	63.0	63.0					11																	51411715		2201	4295	6496	SO:0001583	missense	0			AB065506	CCDS73289.1	11p11.12	2012-08-09			ENSG00000221840	ENSG00000221840		"""GPCR / Class A : Olfactory receptors"""	15162	protein-coding gene	gene with protein product							Standard	NM_001005272		Approved		uc001nhi.2	Q8NH83	OTTHUMG00000166764	ENST00000319760.6:c.681G>T	11.37:g.51411715C>A	ENSP00000367664:p.Gln227His		Q6IF84	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Q227H	ENST00000319760.6	37	c.681	CCDS31497.1	11	.	.	.	.	.	.	.	.	.	.	.	0.010	-1.768850	0.00645	.	.	ENSG00000221840	ENST00000319760	T	0.00137	8.68	1.93	-0.819	0.10829	GPCR, rhodopsin-like superfamily (1);	0.817698	0.10207	N	0.702501	T	0.00073	0.0002	N	0.05124	-0.11	0.09310	N	1	B	0.13145	0.007	B	0.24394	0.053	T	0.12372	-1.0550	10	0.54805	T	0.06	.	2.4132	0.04430	0.23:0.4025:0.0:0.3675	.	227	Q8NH83	OR4A5_HUMAN	H	227	ENSP00000367664:Q227H	ENSP00000367664:Q227H	Q	-	3	2	OR4A5	51268291	0.000000	0.05858	0.765000	0.31456	0.051000	0.14879	-3.100000	0.00604	-0.190000	0.10465	0.162000	0.16502	CAG	OR4A5	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000221840		0.413	OR4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A5	HGNC	protein_coding	OTTHUMT00000391399.1	-	0.00	66	0	C	NM_001005272		51411715	-1	tier1	-	no_errors	ENST00000319760	ensembl	human	known	74_37	missense	25.37	50	17	SNP	0.013	A
OR4C15	81309	genome.wustl.edu	37	11	55322517	55322517	+	Silent	SNP	T	T	C	rs145900465		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr11:55322517T>C	ENST00000314644.2	+	1	735	c.735T>C	c.(733-735)acT>acC	p.T245T		NM_001001920.1	NP_001001920.1	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C, member 15	191						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(31)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(5)	56						GCACTGATACTCACATCTTTG	0.438										HNSCC(20;0.049)																																							0													150.0	99.0	117.0					11																	55322517		2201	4296	6497	SO:0001819	synonymous_variant	0			BK004319	CCDS31501.1	11q11	2012-08-09			ENSG00000181939	ENSG00000181939		"""GPCR / Class A : Olfactory receptors"""	15171	protein-coding gene	gene with protein product							Standard	NM_001001920		Approved		uc010rig.2	Q8NGM1	OTTHUMG00000166714	ENST00000314644.2:c.735T>C	11.37:g.55322517T>C			Q6IFE2	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T245	ENST00000314644.2	37	c.735	CCDS31501.1	11																																																																																			OR4C15	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000181939		0.438	OR4C15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C15	HGNC	protein_coding	OTTHUMT00000391164.1	-	0.00	54	0	T	NM_001001920		55322517	+1	tier1	-	no_errors	ENST00000314644	ensembl	human	known	74_37	silent	16.67	55	11	SNP	0.005	C
OR4C16	219428	genome.wustl.edu	37	11	55340227	55340227	+	Missense_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr11:55340227T>G	ENST00000314634.3	+	1	624	c.624T>G	c.(622-624)agT>agG	p.S208R		NM_001004701.2	NP_001004701.2	Q8NGL9	OR4CG_HUMAN	olfactory receptor, family 4, subfamily C, member 16 (gene/pseudogene)	208						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(28)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41		all_epithelial(135;0.0748)				GTGCAGTGAGTTATGTCATGC	0.433																																																	0													117.0	101.0	106.0					11																	55340227		2201	4296	6497	SO:0001583	missense	0			AB065773	CCDS31502.1	11q11	2013-10-10	2013-10-10		ENSG00000181935	ENSG00000181935		"""GPCR / Class A : Olfactory receptors"""	15172	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily C, member 16"""				Standard	NM_001004701		Approved		uc010rih.2	Q8NGL9	OTTHUMG00000165198	ENST00000314634.3:c.624T>G	11.37:g.55340227T>G	ENSP00000324913:p.Ser208Arg		Q6IEV8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S208R	ENST00000314634.3	37	c.624	CCDS31502.1	11	.	.	.	.	.	.	.	.	.	.	T	12.14	1.847993	0.32699	.	.	ENSG00000181935	ENST00000314634	T	0.38240	1.15	4.98	2.63	0.31362	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.64483	0.2602	H	0.94658	3.565	0.09310	N	1	D	0.55605	0.972	D	0.70227	0.968	T	0.57382	-0.7821	10	0.49607	T	0.09	.	7.8365	0.29374	0.0:0.1752:0.0:0.8248	.	208	Q8NGL9	OR4CG_HUMAN	R	208	ENSP00000324913:S208R	ENSP00000324913:S208R	S	+	3	2	OR4C16	55096803	0.000000	0.05858	0.439000	0.26833	0.231000	0.25187	-2.073000	0.01376	0.376000	0.24707	0.448000	0.29417	AGT	OR4C16	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000181935		0.433	OR4C16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C16	HGNC	protein_coding	OTTHUMT00000382627.1	-	0.00	81	0	T	NM_001004701		55340227	+1	tier1	-	no_errors	ENST00000314634	ensembl	human	known	74_37	missense	14.14	85	14	SNP	0.134	G
OR4C11	219429	genome.wustl.edu	37	11	55371675	55371675	+	Missense_Mutation	SNP	A	A	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr11:55371675A>C	ENST00000302231.4	-	1	199	c.175T>G	c.(175-177)Ttc>Gtc	p.F59V		NM_001004700.2	NP_001004700.2	Q6IEV9	OR4CB_HUMAN	olfactory receptor, family 4, subfamily C, member 11	59						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(1)|large_intestine(5)|lung(23)|ovary(1)|prostate(1)|skin(1)	33						AATAGAAAGAAGTACATGGGG	0.383																																																	0													76.0	73.0	74.0					11																	55371675		2178	4000	6178	SO:0001583	missense	0			AB065774	CCDS31503.1	11q11	2012-08-09		2004-03-10	ENSG00000172188	ENSG00000172188		"""GPCR / Class A : Olfactory receptors"""	15167	protein-coding gene	gene with protein product				OR4C11P			Standard	NM_001004700		Approved		uc010rii.2	Q6IEV9	OTTHUMG00000165290	ENST00000302231.4:c.175T>G	11.37:g.55371675A>C	ENSP00000306651:p.Phe59Val		B9EIL4|Q8NGL8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F59V	ENST00000302231.4	37	c.175	CCDS31503.1	11	.	.	.	.	.	.	.	.	.	.	A	8.960	0.970412	0.18659	.	.	ENSG00000172188	ENST00000302231	T	0.01871	4.59	4.34	4.34	0.51931	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	U	0.000095	T	0.06600	0.0169	M	0.93939	3.475	0.27310	N	0.957332	B	0.32350	0.366	B	0.25614	0.062	T	0.07673	-1.0760	10	0.87932	D	0	.	11.7877	0.52051	1.0:0.0:0.0:0.0	.	59	Q6IEV9	OR4CB_HUMAN	V	59	ENSP00000306651:F59V	ENSP00000306651:F59V	F	-	1	0	OR4C11	55128251	0.218000	0.23608	1.000000	0.80357	0.074000	0.17049	1.174000	0.31932	1.962000	0.57031	0.391000	0.25812	TTC	OR4C11	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000172188		0.383	OR4C11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C11	HGNC	protein_coding	OTTHUMT00000383268.1	-	0.00	154	0	A	NM_001004700		55371675	-1	tier1	-	no_errors	ENST00000302231	ensembl	human	known	74_37	missense	34.52	129	68	SNP	1.000	C
OR4M2	390538	genome.wustl.edu	37	15	22368647	22368647	+	Missense_Mutation	SNP	A	A	C	rs540449594		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr15:22368647A>C	ENST00000332663.2	+	1	170	c.72A>C	c.(70-72)caA>caC	p.Q24H	RP11-69H14.6_ENST00000558896.1_RNA	NM_001004719.2	NP_001004719.2	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M, member 2	24						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(38)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	63		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		CAGAGGTCCAACTAGTCCTAT	0.383																																																	0													294.0	260.0	271.0					15																	22368647		2203	4300	6503	SO:0001583	missense	0			AC060768	CCDS32172.1	15q11.2	2013-09-23			ENSG00000182974	ENSG00000182974		"""GPCR / Class A : Olfactory receptors"""	15373	protein-coding gene	gene with protein product							Standard	NM_001004719		Approved		uc010tzu.2	Q8NGB6	OTTHUMG00000171738	ENST00000332663.2:c.72A>C	15.37:g.22368647A>C	ENSP00000329467:p.Gln24His		B9EH16|Q6IEY2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Q24H	ENST00000332663.2	37	c.72	CCDS32172.1	15	.	.	.	.	.	.	.	.	.	.	.	12.69	2.012263	0.35511	.	.	ENSG00000182974	ENST00000332663	T	0.00601	6.29	2.5	1.34	0.21922	.	0.000000	0.45361	D	0.000376	T	0.02012	0.0063	M	0.80422	2.495	0.29984	N	0.817431	D	0.89917	1.0	D	0.91635	0.999	T	0.20438	-1.0275	10	0.72032	D	0.01	-6.2959	5.1627	0.15070	0.8309:0.0:0.1691:0.0	.	24	Q8NGB6	OR4M2_HUMAN	H	24	ENSP00000329467:Q24H	ENSP00000329467:Q24H	Q	+	3	2	OR4M2	19870011	0.000000	0.05858	0.983000	0.44433	0.578000	0.36192	-0.723000	0.04952	0.233000	0.21120	0.368000	0.22195	CAA	OR4M2	-	NULL	ENSG00000182974		0.383	OR4M2-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	OR4M2	HGNC	protein_coding	OTTHUMT00000414921.1	-	0.00	314	0	A			22368647	+1	tier1	-	no_errors	ENST00000332663	ensembl	human	putative	74_37	missense	6.64	211	15	SNP	1.000	C
OR51B2	79345	genome.wustl.edu	37	11	5344869	5344869	+	Missense_Mutation	SNP	A	A	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr11:5344869A>G	ENST00000328813.2	-	1	713	c.659T>C	c.(658-660)cTt>cCt	p.L220P	HBG2_ENST00000380259.2_Intron|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380252.1_Intron	NM_033180.4	NP_149420.4	Q9Y5P1	O51B2_HUMAN	olfactory receptor, family 51, subfamily B, member 2	220						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|biliary_tract(1)|central_nervous_system(1)|large_intestine(6)|lung(21)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	35		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GACAGTATTAAGAATTAGAAT	0.373																																																	0													59.0	59.0	59.0					11																	5344869		2200	4297	6497	SO:0001583	missense	0			AF399503	CCDS31377.1	11p15.4	2012-08-09			ENSG00000184881	ENSG00000184881		"""GPCR / Class A : Olfactory receptors"""	14703	protein-coding gene	gene with protein product				OR51B1P			Standard	NM_033180		Approved		uc001mao.1	Q9Y5P1	OTTHUMG00000066682	ENST00000328813.2:c.659T>C	11.37:g.5344869A>G	ENSP00000327540:p.Leu220Pro		Q96RD4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L220P	ENST00000328813.2	37	c.659	CCDS31377.1	11	.	.	.	.	.	.	.	.	.	.	A	9.560	1.118276	0.20877	.	.	ENSG00000184881	ENST00000328813	T	0.00249	8.44	4.28	3.14	0.36123	GPCR, rhodopsin-like superfamily (1);	0.226124	0.22221	U	0.062946	T	0.00440	0.0014	H	0.94582	3.555	0.09310	N	0.999998	B	0.32604	0.377	B	0.41202	0.35	T	0.06770	-1.0808	10	0.87932	D	0	.	8.9618	0.35851	0.9097:0.0:0.0903:0.0	.	220	Q9Y5P1	O51B2_HUMAN	P	220	ENSP00000327540:L220P	ENSP00000327540:L220P	L	-	2	0	OR51B2	5301445	0.014000	0.17966	0.623000	0.29173	0.564000	0.35744	2.800000	0.47900	0.701000	0.31803	0.524000	0.50904	CTT	OR51B2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000184881		0.373	OR51B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51B2	HGNC	protein_coding	OTTHUMT00000142983.1	-	0.00	68	0	A	NM_033180		5344869	-1	tier1	-	no_errors	ENST00000328813	ensembl	human	known	74_37	missense	20.83	57	15	SNP	0.007	G
OR4P4	81300	genome.wustl.edu	37	11	55406092	55406092	+	Missense_Mutation	SNP	A	A	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr11:55406092A>G	ENST00000314612.2	+	1	259	c.259A>G	c.(259-261)Aga>Gga	p.R87G		NM_001004124.1	NP_001004124.1	Q8NGL7	OR4P4_HUMAN	olfactory receptor, family 4, subfamily P, member 4	87						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|central_nervous_system(1)|kidney(4)|large_intestine(4)|lung(28)|ovary(1)|upper_aerodigestive_tract(1)	40						ACTGGCAGAAAGAAAGACCAT	0.423																																																	0													134.0	115.0	122.0					11																	55406092		2179	4023	6202	SO:0001583	missense	0			AB065775	CCDS31504.1	11q11	2012-08-09			ENSG00000181927	ENSG00000181927		"""GPCR / Class A : Olfactory receptors"""	15180	protein-coding gene	gene with protein product				OR4P3P			Standard	NM_001004124		Approved		uc010rij.2	Q8NGL7	OTTHUMG00000165300	ENST00000314612.2:c.259A>G	11.37:g.55406092A>G	ENSP00000324831:p.Arg87Gly			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R87G	ENST00000314612.2	37	c.259	CCDS31504.1	11	.	.	.	.	.	.	.	.	.	.	A	3.454	-0.111466	0.06881	.	.	ENSG00000181927	ENST00000314612	T	0.03035	4.07	5.09	5.09	0.68999	GPCR, rhodopsin-like superfamily (1);	0.325531	0.22424	N	0.060245	T	0.03220	0.0094	N	0.25245	0.725	0.09310	N	1	B	0.14805	0.011	B	0.13407	0.009	T	0.36311	-0.9753	10	0.51188	T	0.08	-5.1314	8.5552	0.33476	0.9121:0.0:0.0879:0.0	.	87	Q8NGL7	OR4P4_HUMAN	G	87	ENSP00000324831:R87G	ENSP00000324831:R87G	R	+	1	2	OR4P4	55162668	0.000000	0.05858	0.003000	0.11579	0.001000	0.01503	-0.079000	0.11357	1.932000	0.55993	0.509000	0.49947	AGA	OR4P4	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000181927		0.423	OR4P4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4P4	HGNC	protein_coding	OTTHUMT00000383356.1	-	0.00	86	0	A	NM_001004124		55406092	+1	tier1	-	no_errors	ENST00000314612	ensembl	human	known	74_37	missense	27.27	56	21	SNP	0.000	G
OR5D18	219438	genome.wustl.edu	37	11	55587529	55587529	+	Missense_Mutation	SNP	T	T	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr11:55587529T>A	ENST00000333976.4	+	1	444	c.424T>A	c.(424-426)Tgc>Agc	p.C142S		NM_001001952.1	NP_001001952.1	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D, member 18	142						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(3)|large_intestine(6)|lung(33)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		all_epithelial(135;0.208)				CCAGAAACTCTGCGTGCTGCT	0.468																																																	0													184.0	174.0	177.0					11																	55587529		2200	4296	6496	SO:0001583	missense	0			AB065781	CCDS31510.1	11q11	2012-08-09			ENSG00000186119	ENSG00000186119		"""GPCR / Class A : Olfactory receptors"""	15285	protein-coding gene	gene with protein product							Standard	NM_001001952		Approved		uc010rin.2	Q8NGL1	OTTHUMG00000166811	ENST00000333976.4:c.424T>A	11.37:g.55587529T>A	ENSP00000335025:p.Cys142Ser		Q6IF67|Q6IFD3|Q96RB3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.C142S	ENST00000333976.4	37	c.424	CCDS31510.1	11	.	.	.	.	.	.	.	.	.	.	.	13.52	2.260743	0.39995	.	.	ENSG00000186119	ENST00000333976	T	0.00231	8.49	4.84	1.12	0.20585	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42682	D	0.000677	T	0.00384	0.0012	M	0.84948	2.725	0.09310	N	1	P	0.50066	0.931	P	0.55508	0.777	T	0.44375	-0.9332	10	0.72032	D	0.01	-30.8745	4.7274	0.12948	0.1399:0.1599:0.0:0.7003	.	142	Q8NGL1	OR5DI_HUMAN	S	142	ENSP00000335025:C142S	ENSP00000335025:C142S	C	+	1	0	OR5D18	55344105	0.002000	0.14202	0.000000	0.03702	0.469000	0.32828	0.738000	0.26158	0.018000	0.15052	0.457000	0.33378	TGC	OR5D18	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000186119		0.468	OR5D18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5D18	HGNC	protein_coding	OTTHUMT00000391515.1	-	0.00	64	0	T	NM_001001952		55587529	+1	tier1	-	no_errors	ENST00000333976	ensembl	human	known	74_37	missense	40.00	51	34	SNP	0.005	A
OR5D16	390144	genome.wustl.edu	37	11	55606285	55606285	+	Missense_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr11:55606285T>G	ENST00000378396.1	+	1	58	c.58T>G	c.(58-60)Tca>Gca	p.S20A		NM_001005496.1	NP_001005496.1	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D, member 16	20						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(4)|lung(26)|ovary(5)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_epithelial(135;0.208)				CTTGGGCTTCTCAGATTACCT	0.413																																																	0													102.0	93.0	96.0					11																	55606285		2201	4296	6497	SO:0001583	missense	0			AB065783	CCDS31512.1	11q11	2012-08-09			ENSG00000205029	ENSG00000205029		"""GPCR / Class A : Olfactory receptors"""	15283	protein-coding gene	gene with protein product							Standard	NM_001005496		Approved		uc010rio.2	Q8NGK9	OTTHUMG00000154233	ENST00000378396.1:c.58T>G	11.37:g.55606285T>G	ENSP00000367649:p.Ser20Ala		Q6IF65|Q96RB4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S20A	ENST00000378396.1	37	c.58	CCDS31512.1	11	.	.	.	.	.	.	.	.	.	.	.	13.88	2.369092	0.42003	.	.	ENSG00000205029	ENST00000378396	T	0.00424	7.45	4.15	1.48	0.22813	.	.	.	.	.	T	0.00637	0.0021	M	0.73319	2.225	0.23036	N	0.998395	B	0.31769	0.339	P	0.47015	0.534	T	0.33445	-0.9868	9	0.52906	T	0.07	-9.3149	6.1863	0.20500	0.1594:0.0:0.1656:0.675	.	20	Q8NGK9	OR5DG_HUMAN	A	20	ENSP00000367649:S20A	ENSP00000367649:S20A	S	+	1	0	OR5D16	55362861	0.000000	0.05858	0.734000	0.30879	0.895000	0.52256	-0.493000	0.06459	0.581000	0.29539	0.433000	0.28618	TCA	OR5D16	-	NULL	ENSG00000205029		0.413	OR5D16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5D16	HGNC	protein_coding	OTTHUMT00000334506.1	-	0.00	97	0	T	NM_001005496		55606285	+1	tier1	-	no_errors	ENST00000378396	ensembl	human	known	74_37	missense	42.24	67	49	SNP	0.998	G
OR6B1	135946	genome.wustl.edu	37	7	143701314	143701314	+	Silent	SNP	T	T	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr7:143701314T>C	ENST00000408922.2	+	1	293	c.225T>C	c.(223-225)tcT>tcC	p.S75S		NM_001005281.1	NP_001005281.1	O95007	OR6B1_HUMAN	olfactory receptor, family 6, subfamily B, member 1	75						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|large_intestine(3)|lung(15)|ovary(2)|skin(2)|urinary_tract(1)	27	Melanoma(164;0.0783)					GGTACATCTCTGTGACTGTGC	0.448																																																	0													142.0	142.0	142.0					7																	143701314		2104	4262	6366	SO:0001819	synonymous_variant	0				CCDS43667.1	7q33-q35	2012-08-09			ENSG00000221813	ENSG00000221813		"""GPCR / Class A : Olfactory receptors"""	8354	protein-coding gene	gene with protein product							Standard	NM_001005281		Approved	OR7-3	uc003wdt.1	O95007	OTTHUMG00000157765	ENST00000408922.2:c.225T>C	7.37:g.143701314T>C			A4D2G2|B9EH47|Q6IFP6|Q96R38	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S75	ENST00000408922.2	37	c.225	CCDS43667.1	7																																																																																			OR6B1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000221813		0.448	OR6B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6B1	HGNC	protein_coding	OTTHUMT00000349566.1	-	0.00	79	0	T			143701314	+1	tier1	-	no_errors	ENST00000408922	ensembl	human	known	74_37	silent	15.38	77	14	SNP	0.017	C
OTOGL	283310	genome.wustl.edu	37	12	80663922	80663922	+	Missense_Mutation	SNP	A	A	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr12:80663922A>C	ENST00000547103.1	+	22	2485	c.2479A>C	c.(2479-2481)Acg>Ccg	p.T827P	OTOGL_ENST00000458043.2_Missense_Mutation_p.T827P			Q3ZCN5	OTOGL_HUMAN	otogelin-like	827					L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						TGAATTAGCAACGCCCTCTGC	0.383											OREG0011204|OREG0022007	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)|type=TRANSCRIPTION FACTOR BINDING SITE|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip); Conservation found by scanning with a motif model																																					0													102.0	99.0	100.0					12																	80663922		1928	4133	6061	SO:0001583	missense	0			AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.2479A>C	12.37:g.80663922A>C	ENSP00000447211:p.Thr827Pro	1200	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_AbfB,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C	p.T827P	ENST00000547103.1	37	c.2479		12	.	.	.	.	.	.	.	.	.	.	A	1.995	-0.430831	0.04669	.	.	ENSG00000165899	ENST00000547103;ENST00000458043	T;T	0.16597	2.33;2.33	5.36	2.78	0.32641	.	.	.	.	.	T	0.18635	0.0447	L	0.31294	0.92	0.34575	D	0.713876	.	.	.	.	.	.	T	0.28713	-1.0035	7	0.45353	T	0.12	.	12.27	0.54700	0.6793:0.3207:0.0:0.0	.	.	.	.	P	827	ENSP00000447211:T827P;ENSP00000400895:T827P	ENSP00000400895:T827P	T	+	1	0	OTOGL	79188053	0.998000	0.40836	1.000000	0.80357	0.998000	0.95712	2.173000	0.42472	0.951000	0.37770	0.528000	0.53228	ACG	OTOGL	-	smart_VWC_out	ENSG00000165899		0.383	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	OTOGL	HGNC	protein_coding	OTTHUMT00000407438.1	-	0.00	90	0	A	NM_173591		80663922	+1	tier1	-	no_errors	ENST00000458043	ensembl	human	known	74_37	missense	13.92	67	11	SNP	0.999	C
P2RY10	27334	genome.wustl.edu	37	X	78216928	78216928	+	Missense_Mutation	SNP	T	T	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chrX:78216928T>A	ENST00000171757.2	+	4	1191	c.911T>A	c.(910-912)cTt>cAt	p.L304H	P2RY10_ENST00000544091.1_Missense_Mutation_p.L304H	NM_014499.2	NP_055314.1	O00398	P2Y10_HUMAN	purinergic receptor P2Y, G-protein coupled, 10	304						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(22)|ovary(3)|skin(2)	42						GATCCAATTCTTTATTACTTT	0.488																																																	0													179.0	165.0	170.0					X																	78216928		2203	4300	6503	SO:0001583	missense	0			AF000545	CCDS14442.1	Xq21.1	2012-08-23			ENSG00000078589	ENSG00000078589		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	19906	protein-coding gene	gene with protein product		300529				11004484, 9755289	Standard	NM_014499		Approved	P2Y10	uc004edf.3	O00398	OTTHUMG00000021896	ENST00000171757.2:c.911T>A	X.37:g.78216928T>A	ENSP00000171757:p.Leu304His		D3DTE5|Q4VBN7|Q86V16	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.L304H	ENST00000171757.2	37	c.911	CCDS14442.1	X	.	.	.	.	.	.	.	.	.	.	T	19.60	3.858399	0.71834	.	.	ENSG00000078589	ENST00000544091;ENST00000171757	T;T	0.44482	0.92;0.92	4.99	4.99	0.66335	GPCR, rhodopsin-like superfamily (1);	0.422461	0.23116	N	0.051754	T	0.64994	0.2649	M	0.82823	2.61	0.48632	D	0.999689	D	0.67145	0.996	D	0.67231	0.95	T	0.70572	-0.4835	10	0.87932	D	0	.	12.5703	0.56332	0.0:0.0:0.0:1.0	.	304	O00398	P2Y10_HUMAN	H	304	ENSP00000443138:L304H;ENSP00000171757:L304H	ENSP00000171757:L304H	L	+	2	0	P2RY10	78103584	1.000000	0.71417	0.960000	0.40013	0.994000	0.84299	7.627000	0.83176	1.850000	0.53721	0.483000	0.47432	CTT	P2RY10	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000078589		0.488	P2RY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RY10	HGNC	protein_coding	OTTHUMT00000057323.1	-	0.00	56	0	T			78216928	+1	tier1	-	no_errors	ENST00000171757	ensembl	human	known	74_37	missense	22.22	28	8	SNP	0.995	A
P2RY13	53829	genome.wustl.edu	37	3	151046374	151046374	+	Missense_Mutation	SNP	G	G	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr3:151046374G>A	ENST00000325602.5	-	2	489	c.470C>T	c.(469-471)cCt>cTt	p.P157L	MED12L_ENST00000491549.1_Intron|MED12L_ENST00000474524.1_Intron|MED12L_ENST00000273432.4_Intron	NM_176894.2	NP_795713.2	Q9BPV8	P2Y13_HUMAN	purinergic receptor P2Y, G-protein coupled, 13	157					negative regulation of adenylate cyclase activity (GO:0007194)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			biliary_tract(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	14			LUSC - Lung squamous cell carcinoma(72;0.0189)|Lung(72;0.0278)			TGCAAAAACAGGTTTTTTTAG	0.403																																																	0													39.0	41.0	40.0					3																	151046374		2202	4300	6502	SO:0001583	missense	0			AF295368	CCDS3158.2	3q24	2012-08-08	2004-07-12	2004-07-14	ENSG00000181631	ENSG00000181631		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	4537	protein-coding gene	gene with protein product		606380	"""G protein-coupled receptor 86"""	GPR94, GPR86		11273702, 11574155	Standard	NM_176894		Approved	FKSG77, P2Y13	uc003eyv.2	Q9BPV8	OTTHUMG00000155745	ENST00000325602.5:c.470C>T	3.37:g.151046374G>A	ENSP00000320376:p.Pro157Leu		B2R827|Q05C50|Q6DKN4|Q8IUT5|Q8TDU7|Q9BY61	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,prints_P2Y13_rcpt,prints_GPCR_Rhodpsn,prints_P2Y14_rcpt,pfscan_GPCR_Rhodpsn_7TM	p.P157L	ENST00000325602.5	37	c.470	CCDS3158.2	3	.	.	.	.	.	.	.	.	.	.	G	0.542	-0.853269	0.02630	.	.	ENSG00000181631	ENST00000325602	T	0.72835	-0.69	5.45	5.45	0.79879	GPCR, rhodopsin-like superfamily (1);	0.357282	0.28476	N	0.015216	T	0.44307	0.1287	N	0.04132	-0.27	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.17623	-1.0363	10	0.25106	T	0.35	-3.6589	7.1437	0.25570	0.207:0.0:0.793:0.0	.	157	Q9BPV8	P2Y13_HUMAN	L	157	ENSP00000320376:P157L	ENSP00000320376:P157L	P	-	2	0	P2RY13	152529064	0.772000	0.28567	0.008000	0.14137	0.004000	0.04260	5.774000	0.68906	2.567000	0.86603	0.558000	0.71614	CCT	P2RY13	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,prints_P2Y14_rcpt,pfscan_GPCR_Rhodpsn_7TM	ENSG00000181631		0.403	P2RY13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RY13	HGNC	protein_coding	OTTHUMT00000341468.1	-	0.00	26	0	G	NM_023914		151046374	-1	tier1	-	no_errors	ENST00000325602	ensembl	human	known	74_37	missense	35.00	13	7	SNP	0.036	A
P4HA2	8974	genome.wustl.edu	37	5	131530679	131530679	+	Missense_Mutation	SNP	C	C	A	rs201287088		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr5:131530679C>A	ENST00000401867.1	-	15	2045	c.1477G>T	c.(1477-1479)Ggg>Tgg	p.G493W	P4HA2_ENST00000379100.2_Missense_Mutation_p.G491W|P4HA2-AS1_ENST00000417667.1_RNA|P4HA2_ENST00000166534.4_Missense_Mutation_p.G493W|P4HA2_ENST00000360568.3_Missense_Mutation_p.G491W|P4HA2_ENST00000379104.2_Missense_Mutation_p.G493W|P4HA2_ENST00000379086.1_Missense_Mutation_p.G491W			O15460	P4HA2_HUMAN	prolyl 4-hydroxylase, alpha polypeptide II	493	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|procollagen-proline 4-dioxygenase complex (GO:0016222)	electron carrier activity (GO:0009055)|iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|procollagen-proline 4-dioxygenase activity (GO:0004656)			breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24		all_cancers(142;0.103)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Proline(DB00172)|Succinic acid(DB00139)	TCACCTTCCCCGCTCCGCAAG	0.542																																					Esophageal Squamous(68;117 1135 17362 19256 34242)												0													198.0	159.0	172.0					5																	131530679		2203	4300	6503	SO:0001583	missense	0			U90441	CCDS4151.1, CCDS34230.1	5q31	2008-12-09	2008-12-09		ENSG00000072682	ENSG00000072682	1.14.11.2		8547	protein-coding gene	gene with protein product	"""4-PH alpha 2"", ""collagen prolyl 4-hydroxylase alpha(II)"""	600608	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide II"""			9211872, 9149945	Standard	NM_001142598		Approved	C-P4Halpha(II)	uc003kwl.3	O15460	OTTHUMG00000059647	ENST00000401867.1:c.1477G>T	5.37:g.131530679C>A	ENSP00000384999:p.Gly493Trp		D3DQ85|D3DQ86|Q8WWN0	Missense_Mutation	SNP	pfam_Pro_4_hyd_alph_N,pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.G493W	ENST00000401867.1	37	c.1477	CCDS4151.1	5	.	.	.	.	.	.	.	.	.	.	C	31	5.068422	0.93950	.	.	ENSG00000072682	ENST00000401867;ENST00000379086;ENST00000166534;ENST00000360568;ENST00000379104;ENST00000379100	T;T;T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24;-1.24;-1.24	5.96	5.96	0.96718	Oxoglutarate/iron-dependent oxygenase (2);Prolyl 4-hydroxylase, alpha subunit (1);	0.000000	0.85682	D	0.000000	D	0.93556	0.7943	H	0.98646	4.29	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95265	0.8372	10	0.87932	D	0	-4.5313	20.4008	0.98991	0.0:1.0:0.0:0.0	.	493;491	O15460;O15460-2	P4HA2_HUMAN;.	W	493;491;493;491;493;491	ENSP00000384999:G493W;ENSP00000368379:G491W;ENSP00000166534:G493W;ENSP00000353772:G491W;ENSP00000368398:G493W;ENSP00000368394:G491W	ENSP00000166534:G493W	G	-	1	0	P4HA2	131558578	1.000000	0.71417	0.958000	0.39756	0.947000	0.59692	7.487000	0.81328	2.826000	0.97356	0.655000	0.94253	GGG	P4HA2	-	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	ENSG00000072682		0.542	P4HA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	P4HA2	HGNC	protein_coding	OTTHUMT00000132653.4	-	0.00	76	0	C	NM_004199		131530679	-1	tier1	-	no_errors	ENST00000166534	ensembl	human	known	74_37	missense	6.35	59	4	SNP	1.000	A
PAX6	5080	genome.wustl.edu	37	11	31827048	31827048	+	Intron	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr11:31827048G>T	ENST00000379132.3	-	3	291				PAX6_ENST00000379115.4_Intron|PAX6_ENST00000379107.2_Intron|PAX6_ENST00000379111.2_Intron|PAX6_ENST00000379123.5_Intron|PAX6_ENST00000379129.2_Intron|PAX6_ENST00000533156.1_5'UTR|PAX6_ENST00000241001.8_Intron|PAX6_ENST00000419022.1_Intron			P26367	PAX6_HUMAN	paired box 6						astrocyte differentiation (GO:0048708)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|cerebral cortex regionalization (GO:0021796)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|cornea development in camera-type eye (GO:0061303)|dorsal/ventral axis specification (GO:0009950)|embryonic camera-type eye morphogenesis (GO:0048596)|eye development (GO:0001654)|eye photoreceptor cell development (GO:0042462)|forebrain anterior/posterior pattern specification (GO:0021797)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain-midbrain boundary formation (GO:0021905)|glucose homeostasis (GO:0042593)|hindbrain development (GO:0030902)|iris morphogenesis (GO:0061072)|keratinocyte differentiation (GO:0030216)|lacrimal gland development (GO:0032808)|lens development in camera-type eye (GO:0002088)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|neuron migration (GO:0001764)|oligodendrocyte cell fate specification (GO:0021778)|organ morphogenesis (GO:0009887)|pancreatic A cell development (GO:0003322)|pituitary gland development (GO:0021983)|positive regulation of cell fate specification (GO:0042660)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of gene expression (GO:0010628)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to organelle (GO:0033365)|protein ubiquitination (GO:0016567)|regulation of cell migration (GO:0030334)|regulation of timing of cell differentiation (GO:0048505)|regulation of transcription from RNA polymerase II promoter involved in somatic motor neuron fate commitment (GO:0021918)|regulation of transcription from RNA polymerase II promoter involved in spinal cord motor neuron fate specification (GO:0021912)|regulation of transcription from RNA polymerase II promoter involved in ventral spinal cord interneuron specification (GO:0021913)|response to wounding (GO:0009611)|retina development in camera-type eye (GO:0060041)|salivary gland morphogenesis (GO:0007435)|signal transduction involved in regulation of gene expression (GO:0023019)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell differentiation (GO:0003309)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|histone acetyltransferase binding (GO:0035035)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)	35	Lung SC(675;0.225)					TGGAAGACCCGGGCCTTTCCA	0.627									Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation																																								0																																										SO:0001627	intron_variant	0	Familial Cancer Database	WAGR syndrome	AY707088	CCDS31451.1, CCDS31452.1	11p13	2014-09-17	2007-07-12		ENSG00000007372	ENSG00000007372		"""Paired boxes"", ""Homeoboxes / PRD class"""	8620	protein-coding gene	gene with protein product	"""aniridia, keratitis"""	607108	"""paired box gene 6 (aniridia, keratitis)"""	AN2		1302030	Standard	NM_001127612		Approved	D11S812E, AN, WAGR	uc021qfm.1	P26367	OTTHUMG00000041447	ENST00000379132.3:c.10+901C>A	11.37:g.31827048G>T			Q6N006|Q99413	RNA	SNP	-	NULL	ENST00000379132.3	37	NULL	CCDS31451.1	11																																																																																			PAX6	-	-	ENSG00000007372		0.627	PAX6-008	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	PAX6	HGNC	protein_coding	OTTHUMT00000099293.4	-	0.00	65	0	G	NM_001604		31827048	-1	tier1	-	no_errors	ENST00000533156	ensembl	human	known	74_37	rna	12.50	63	9	SNP	0.004	T
PCDH11X	27328	genome.wustl.edu	37	X	91134101	91134101	+	Silent	SNP	T	T	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chrX:91134101T>C	ENST00000373094.1	+	2	3707	c.2862T>C	c.(2860-2862)acT>acC	p.T954T	PCDH11X_ENST00000406881.1_Silent_p.T954T|PCDH11X_ENST00000504220.2_Silent_p.T954T|PCDH11X_ENST00000373097.1_Silent_p.T954T|PCDH11X_ENST00000395337.2_Silent_p.T954T|PCDH11X_ENST00000373088.1_Silent_p.T954T|PCDH11X_ENST00000361724.1_Silent_p.T954T|PCDH11X_ENST00000298274.8_Silent_p.T954T|PCDH11X_ENST00000361655.2_Silent_p.T954T	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	954					homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						AGCCTGAAACTCCCCTGAATT	0.502																																					NSCLC(38;925 1092 2571 38200 45895)												0													221.0	187.0	198.0					X																	91134101		2203	4300	6503	SO:0001819	synonymous_variant	0			AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.2862T>C	X.37:g.91134101T>C			A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Silent	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T954	ENST00000373094.1	37	c.2862	CCDS14461.1	X																																																																																			PCDH11X	-	pfam_Protocadherin	ENSG00000102290		0.502	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH11X	HGNC	protein_coding	OTTHUMT00000057436.1	-	0.00	107	0	T	NM_032969		91134101	+1	tier1	-	no_errors	ENST00000373094	ensembl	human	known	74_37	silent	52.94	24	27	SNP	0.975	C
PCDH15	65217	genome.wustl.edu	37	10	55892660	55892660	+	Missense_Mutation	SNP	A	A	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr10:55892660A>C	ENST00000320301.6	-	15	2286	c.1892T>G	c.(1891-1893)gTt>gGt	p.V631G	PCDH15_ENST00000361849.3_Missense_Mutation_p.V631G|PCDH15_ENST00000373965.2_Missense_Mutation_p.V638G|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000395446.1_Missense_Mutation_p.V631G|PCDH15_ENST00000373957.3_Missense_Mutation_p.V609G|PCDH15_ENST00000395445.1_Missense_Mutation_p.V638G|PCDH15_ENST00000373955.1_Missense_Mutation_p.V631G|PCDH15_ENST00000437009.1_Intron|PCDH15_ENST00000409834.1_Missense_Mutation_p.V242G|PCDH15_ENST00000395430.1_Missense_Mutation_p.V631G|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000395438.1_Missense_Mutation_p.V631G|PCDH15_ENST00000414778.1_Missense_Mutation_p.V636G|PCDH15_ENST00000395432.2_Missense_Mutation_p.V594G|PCDH15_ENST00000395433.1_Missense_Mutation_p.V609G	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	631	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				AACAGCACCAACCCTCATGGC	0.398										HNSCC(58;0.16)																																							0													114.0	93.0	100.0					10																	55892660		2203	4300	6503	SO:0001583	missense	0			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.1892T>G	10.37:g.55892660A>C	ENSP00000322604:p.Val631Gly		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V631G	ENST00000320301.6	37	c.1892	CCDS7248.1	10	.	.	.	.	.	.	.	.	.	.	A	16.90	3.249665	0.59212	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000409834;ENST00000395445;ENST00000395446;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000373957;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000373955	T;T;T;T;T;T;T;T;T;T;T;T;T	0.54675	0.56;0.56;0.56;0.56;0.56;1.02;0.56;0.56;0.56;0.56;0.56;0.56;0.56	5.67	5.67	0.87782	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.68128	0.2967	M	0.80616	2.505	0.80722	D	1	B;P;P;P;P;B;B;P;P;B;B;B;P;P	0.42337	0.452;0.607;0.607;0.607;0.776;0.452;0.29;0.741;0.741;0.29;0.174;0.144;0.464;0.776	P;P;P;P;P;P;B;P;P;B;B;B;B;P	0.51297	0.574;0.471;0.471;0.471;0.574;0.574;0.333;0.464;0.665;0.405;0.201;0.171;0.262;0.653	T	0.72821	-0.4177	9	0.87932	D	0	.	15.19	0.73035	1.0:0.0:0.0:0.0	.	609;631;631;636;594;631;631;638;638;631;636;631;609;631	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1-3;A2A3D8;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	G	638;636;631;631;242;638;631;594;631;609;609;631;631;636;631	ENSP00000363076:V638G;ENSP00000410304:V636G;ENSP00000378826:V631G;ENSP00000386693:V242G;ENSP00000378832:V638G;ENSP00000378833:V631G;ENSP00000378820:V594G;ENSP00000354950:V631G;ENSP00000378821:V609G;ENSP00000363068:V609G;ENSP00000322604:V631G;ENSP00000378818:V631G;ENSP00000363066:V631G	ENSP00000322604:V631G	V	-	2	0	PCDH15	55562666	0.992000	0.36948	1.000000	0.80357	0.994000	0.84299	3.036000	0.49767	2.289000	0.77006	0.482000	0.46254	GTT	PCDH15	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000150275		0.398	PCDH15-001	KNOWN	basic|CCDS	protein_coding	PCDH15	HGNC	protein_coding	OTTHUMT00000048121.2	-	0.00	108	0	A	NM_033056		55892660	-1	tier1	-	no_errors	ENST00000320301	ensembl	human	known	74_37	missense	33.33	64	32	SNP	1.000	C
PCDH9	5101	genome.wustl.edu	37	13	66878787	66878787	+	Nonstop_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr13:66878787T>G	ENST00000377865.2	-	4	3848	c.3714A>C	c.(3712-3714)taA>taC	p.*1238Y	PCDH9_ENST00000328454.5_Nonstop_Mutation_p.*1204Y|PCDH9_ENST00000456367.1_Nonstop_Mutation_p.*1204Y|PCDH9_ENST00000544246.1_Nonstop_Mutation_p.*1238Y|PCDH9-AS1_ENST00000430861.1_RNA			Q9HC56	PCDH9_HUMAN	protocadherin 9	0					forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		TAGCCTTTTCTTAGAGTTGGT	0.423																																																	0													91.0	92.0	91.0					13																	66878787		2203	4300	6503	SO:0001578	stop_lost	0			AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.3714A>C	13.37:g.66878787T>G			A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Nonstop_Mutation	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.*1238Y	ENST00000377865.2	37	c.3714	CCDS9444.1	13	.	.	.	.	.	.	.	.	.	.	T	18.73	3.685946	0.68157	.	.	ENSG00000184226	ENST00000544246;ENST00000377865;ENST00000456367;ENST00000328454	.	.	.	6.05	6.05	0.98169	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5932	0.84781	0.0:0.0:0.0:1.0	.	.	.	.	Y	1238;1238;1204;1204	.	.	X	-	3	2	PCDH9	65776788	1.000000	0.71417	0.811000	0.32455	0.934000	0.57294	7.375000	0.79646	2.320000	0.78422	0.528000	0.53228	TAA	PCDH9	-	NULL	ENSG00000184226		0.423	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH9	HGNC	protein_coding	OTTHUMT00000276387.1	-	0.00	85	0	T	NM_203487		66878787	-1	tier1	-	no_errors	ENST00000377865	ensembl	human	known	74_37	nonstop	32.88	49	24	SNP	1.000	G
PCDHA4	56144	genome.wustl.edu	37	5	140188386	140188386	+	Silent	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr5:140188386C>T	ENST00000530339.1	+	1	1614	c.1614C>T	c.(1612-1614)cgC>cgT	p.R538R	PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000356878.4_Silent_p.R538R|PCDHA3_ENST00000522353.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000512229.2_Silent_p.R538R|PCDHA1_ENST00000394633.3_Intron	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	538	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGACCGCTCGCGATGCCGGCG	0.657																																																	0													60.0	67.0	65.0					5																	140188386		2203	4299	6502	SO:0001819	synonymous_variant	0			AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.1614C>T	5.37:g.140188386C>T			O75285|Q2M253	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.R538	ENST00000530339.1	37	c.1614	CCDS54916.1	5																																																																																			PCDHA4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	ENSG00000204967		0.657	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA4	HGNC	protein_coding	OTTHUMT00000372864.2	-	0.00	135	0	C	NM_018907		140188386	+1	tier1	-	no_errors	ENST00000530339	ensembl	human	known	74_37	silent	17.50	99	21	SNP	0.457	T
PCDHB10	56126	genome.wustl.edu	37	5	140573676	140573676	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr5:140573676G>T	ENST00000239446.4	+	1	1735	c.1551G>T	c.(1549-1551)agG>agT	p.R517S		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	517	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCGCCCTCAGGTCGCTGGACT	0.706																																																	0													101.0	118.0	112.0					5																	140573676		2203	4297	6500	SO:0001583	missense	0			AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.1551G>T	5.37:g.140573676G>T	ENSP00000239446:p.Arg517Ser		Q96T99	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R517S	ENST00000239446.4	37	c.1551	CCDS4252.1	5	.	.	.	.	.	.	.	.	.	.	g	12.08	1.830506	0.32329	.	.	ENSG00000120324	ENST00000239446	T	0.01584	4.75	3.53	1.64	0.23874	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.02807	0.0084	M	0.71581	2.175	0.09310	N	1	B	0.24092	0.097	B	0.32211	0.142	T	0.46884	-0.9159	9	0.66056	D	0.02	.	0.3344	0.00323	0.2408:0.2227:0.31:0.2265	.	517	Q9UN67	PCDBA_HUMAN	S	517	ENSP00000239446:R517S	ENSP00000239446:R517S	R	+	3	2	PCDHB10	140553860	0.000000	0.05858	0.005000	0.12908	0.959000	0.62525	-2.039000	0.01418	0.800000	0.34041	0.549000	0.68633	AGG	PCDHB10	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000120324		0.706	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB10	HGNC	protein_coding	OTTHUMT00000251821.1	-	0.00	409	0	G	NM_018930		140573676	+1	tier1	-	no_errors	ENST00000239446	ensembl	human	known	74_37	missense	48.48	153	144	SNP	0.000	T
PCDHGB7	56099	genome.wustl.edu	37	5	140798758	140798758	+	Silent	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr5:140798758C>T	ENST00000398594.2	+	1	1332	c.1332C>T	c.(1330-1332)gaC>gaT	p.D444D	PCDHGB2_ENST00000522605.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA11_ENST00000518882.1_5'Flank|PCDHGB1_ENST00000523390.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA11_ENST00000398587.2_5'Flank	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	444	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACATTACTGACGTCAATGACA	0.572																																																	0													60.0	69.0	66.0					5																	140798758		2150	4236	6386	SO:0001819	synonymous_variant	0			AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.1332C>T	5.37:g.140798758C>T			Q9UN63	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D444	ENST00000398594.2	37	c.1332	CCDS47293.1	5																																																																																			PCDHGB7	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000254122		0.572	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB7	HGNC	protein_coding	OTTHUMT00000376973.1	-	0.00	51	0	C	NM_018927		140798758	+1	tier1	-	no_errors	ENST00000398594	ensembl	human	known	74_37	silent	11.36	39	5	SNP	0.453	T
PDHA2	5161	genome.wustl.edu	37	4	96761436	96761436	+	Missense_Mutation	SNP	A	A	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr4:96761436A>C	ENST00000295266.4	+	1	198	c.135A>C	c.(133-135)gaA>gaC	p.E45D		NM_005390.4	NP_005381.1	P29803	ODPAT_HUMAN	pyruvate dehydrogenase (lipoamide) alpha 2	45					glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(23)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	46		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)		ATCTGTTGGAAGAGGGTCCCC	0.493																																																	0													58.0	58.0	58.0					4																	96761436		2203	4300	6503	SO:0001583	missense	0				CCDS3644.1	4q22-q23	2009-11-09			ENSG00000163114	ENSG00000163114	1.2.4.1		8807	protein-coding gene	gene with protein product		179061		PDHAL			Standard	NM_005390		Approved		uc003htr.4	P29803	OTTHUMG00000130990	ENST00000295266.4:c.135A>C	4.37:g.96761436A>C	ENSP00000295266:p.Glu45Asp		B2R9Q3|Q0VDI5|Q4VC02|Q6NXQ1	Missense_Mutation	SNP	pfam_DH_E1,tigrfam_Pyrv_DH_E1_asu_subgrp-y	p.E45D	ENST00000295266.4	37	c.135	CCDS3644.1	4	.	.	.	.	.	.	.	.	.	.	A	3.858	-0.030401	0.07543	.	.	ENSG00000163114	ENST00000295266	D	0.97404	-4.37	4.64	-9.28	0.00656	.	0.223995	0.45126	N	0.000391	D	0.91277	0.7250	L	0.50847	1.595	0.27257	N	0.958721	B	0.02656	0.0	B	0.04013	0.001	T	0.77466	-0.2577	10	0.11794	T	0.64	-8.4472	8.7879	0.34832	0.4892:0.2602:0.2506:0.0	.	45	P29803	ODPAT_HUMAN	D	45	ENSP00000295266:E45D	ENSP00000295266:E45D	E	+	3	2	PDHA2	96980459	0.000000	0.05858	0.076000	0.20297	0.038000	0.13279	-2.185000	0.01252	-2.730000	0.00384	-1.486000	0.00981	GAA	PDHA2	-	NULL	ENSG00000163114		0.493	PDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDHA2	HGNC	protein_coding	OTTHUMT00000253608.1	-	0.00	79	0	A			96761436	+1	tier1	-	no_errors	ENST00000295266	ensembl	human	known	74_37	missense	46.88	17	15	SNP	0.034	C
PDE5A	8654	genome.wustl.edu	37	4	120528192	120528192	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr4:120528192G>T	ENST00000354960.3	-	2	732	c.413C>A	c.(412-414)cCt>cAt	p.P138H	PDE5A_ENST00000264805.5_Missense_Mutation_p.P96H|PDE5A_ENST00000394439.1_Missense_Mutation_p.P86H	NM_001083.3	NP_001074.2	O76074	PDE5A_HUMAN	phosphodiesterase 5A, cGMP-specific	138					blood coagulation (GO:0007596)|cGMP catabolic process (GO:0046069)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of oocyte development (GO:0060282)|relaxation of cardiac muscle (GO:0055119)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|kidney(3)|large_intestine(8)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	27					Avanafil(DB06237)|Caffeine(DB00201)|Dipyridamole(DB00975)|Pentoxifylline(DB00806)|Sildenafil(DB00203)|Tadalafil(DB00820)|Theophylline(DB00277)|Udenafil(DB06267)|Vardenafil(DB00862)	AAACCTTGGAGGGGTTAGAGG	0.448																																																	0													112.0	106.0	108.0					4																	120528192		2203	4300	6503	SO:0001583	missense	0			D89094	CCDS3713.1, CCDS34055.1	4q27	2008-05-15			ENSG00000138735	ENSG00000138735	3.1.4.17	"""Phosphodiesterases"""	8784	protein-coding gene	gene with protein product		603310				9714779, 9642111	Standard	NM_033437		Approved		uc003idh.3	O76074	OTTHUMG00000132971	ENST00000354960.3:c.413C>A	4.37:g.120528192G>T	ENSP00000347046:p.Pro138His		A0AV69|A8K2C4|O75026|O75887|Q86UI0|Q86V66|Q9Y6Z6	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.P138H	ENST00000354960.3	37	c.413	CCDS3713.1	4	.	.	.	.	.	.	.	.	.	.	G	13.63	2.295751	0.40594	.	.	ENSG00000138735	ENST00000354960;ENST00000394439;ENST00000264805;ENST00000420633	T;T;T;T	0.07800	3.16;3.16;3.16;3.16	5.64	4.8	0.61643	.	0.971555	0.08510	N	0.935075	T	0.14657	0.0354	L	0.59436	1.845	0.33265	D	0.560209	B;B	0.29590	0.0;0.25	B;B	0.33392	0.004;0.163	T	0.10847	-1.0612	10	0.44086	T	0.13	.	14.5739	0.68232	0.0701:0.0:0.9299:0.0	.	138;96	O76074;O76074-2	PDE5A_HUMAN;.	H	138;86;96;86	ENSP00000347046:P138H;ENSP00000377957:P86H;ENSP00000264805:P96H;ENSP00000416309:P86H	ENSP00000264805:P96H	P	-	2	0	PDE5A	120747640	0.999000	0.42202	0.520000	0.27837	0.927000	0.56198	5.094000	0.64523	1.387000	0.46486	0.655000	0.94253	CCT	PDE5A	-	NULL	ENSG00000138735		0.448	PDE5A-001	KNOWN	basic|CCDS	protein_coding	PDE5A	HGNC	protein_coding	OTTHUMT00000256529.1	-	0.00	114	0	G	NM_001083		120528192	-1	tier1	-	no_errors	ENST00000354960	ensembl	human	known	74_37	missense	5.97	63	4	SNP	0.718	T
PER3	8863	genome.wustl.edu	37	1	7896001	7896001	+	Nonsense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr1:7896001G>T	ENST00000361923.2	+	19	3542	c.3367G>T	c.(3367-3369)Gag>Tag	p.E1123*	PER3_ENST00000377532.3_Nonsense_Mutation_p.E1132*	NM_016831.1	NP_058515.1	P56645	PER3_HUMAN	period circadian clock 3	1123	CRY binding domain. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(4)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	39	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		CCAGGTACCTGAGAGGTAAGA	0.413																																																	0													54.0	52.0	52.0					1																	7896001		2203	4300	6503	SO:0001587	stop_gained	0			BC026102	CCDS89.1, CCDS72695.1	1p36.23	2012-12-13	2012-12-13		ENSG00000049246	ENSG00000049246			8847	protein-coding gene	gene with protein product		603427	"""period (Drosophila) homolog 3"", ""period homolog 3 (Drosophila)"""			9427249	Standard	XM_005263520		Approved		uc001aoo.3	P56645	OTTHUMG00000001216	ENST00000361923.2:c.3367G>T	1.37:g.7896001G>T	ENSP00000355031:p.Glu1123*		Q5H8X4|Q5H8X5|Q969K6|Q96S77|Q96S78|Q9C0J3|Q9NSP9|Q9UGU8	Nonsense_Mutation	SNP	pfam_Period_circadian-like_C,pfam_PAS_fold_3,pfam_PAS_fold,superfamily_PAS,smart_PAS,pfscan_PAS	p.E1123*	ENST00000361923.2	37	c.3367	CCDS89.1	1	.	.	.	.	.	.	.	.	.	.	G	43	10.440732	0.99405	.	.	ENSG00000049246	ENST00000377532;ENST00000361923;ENST00000539773	.	.	.	3.98	3.98	0.46160	.	0.567345	0.18267	N	0.146423	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	.	9.5418	0.39257	0.1031:0.0:0.8969:0.0	.	.	.	.	X	1132;1123;316	.	ENSP00000355031:E1123X	E	+	1	0	PER3	7818588	0.265000	0.24102	0.899000	0.35326	0.991000	0.79684	0.807000	0.27140	2.052000	0.61016	0.557000	0.71058	GAG	PER3	-	pfam_Period_circadian-like_C	ENSG00000049246		0.413	PER3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PER3	HGNC	protein_coding	OTTHUMT00000003607.1	-	0.00	74	0	G	NM_016831		7896001	+1	tier1	-	no_errors	ENST00000361923	ensembl	human	known	74_37	nonsense	6.90	54	4	SNP	0.890	T
PFKFB3	5209	genome.wustl.edu	37	10	6262656	6262656	+	Missense_Mutation	SNP	G	G	A	rs140784797		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr10:6262656G>A	ENST00000379775.4	+	8	989	c.659G>A	c.(658-660)cGg>cAg	p.R220Q	PFKFB3_ENST00000536985.1_3'UTR|PFKFB3_ENST00000379785.1_Missense_Mutation_p.R220Q|PFKFB3_ENST00000540253.1_Missense_Mutation_p.R234Q|PFKFB3_ENST00000379789.4_Missense_Mutation_p.R200Q|PFKFB3_ENST00000317350.4_Missense_Mutation_p.R220Q|PFKFB3_ENST00000360521.2_Missense_Mutation_p.R220Q|PFKFB3_ENST00000379782.3_Missense_Mutation_p.R220Q	NM_004566.3	NP_004557.1	Q16875	F263_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3	220	6-phosphofructo-2-kinase.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|liver(2)|lung(10)|ovary(3)|upper_aerodigestive_tract(1)	22						GACGTGGGCCGGAGGTTCCTG	0.617																																																	0								G	GLN/ARG,GLN/ARG	0,4406		0,0,2203	167.0	128.0	141.0		599,659	4.1	1.0	10	dbSNP_134	141	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	PFKFB3	NM_001145443.1,NM_004566.3	43,43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	200/501,220/521	6262656	1,13005	2203	4300	6503	SO:0001583	missense	0				CCDS7078.1, CCDS44353.1, CCDS60479.1	10p15.1	2008-05-14			ENSG00000170525	ENSG00000170525			8874	protein-coding gene	gene with protein product		605319				9146922, 10072580	Standard	NM_004566		Approved		uc001ije.3	Q16875	OTTHUMG00000017621	ENST00000379775.4:c.659G>A	10.37:g.6262656G>A	ENSP00000369100:p.Arg220Gln		B7Z955|O43622|O75902|Q5VX15|Q5VX18|Q5VX19	Missense_Mutation	SNP	pfam_6Phosfructo_kin,pfam_His_Pase_superF_clade-1,pfam_Chromatin_KTI12,superfamily_P-loop_NTPase,smart_His_Pase_superF_clade-1,pirsf_Bifunct_6PFK/fruc_bisP_Ptase,prints_6Pfruct_kin	p.R234Q	ENST00000379775.4	37	c.701	CCDS7078.1	10	.	.	.	.	.	.	.	.	.	.	G	14.83	2.652772	0.47362	0.0	1.16E-4	ENSG00000170525	ENST00000379789;ENST00000540253;ENST00000317350;ENST00000379785;ENST00000379782;ENST00000360521;ENST00000379775;ENST00000358499	.	.	.	5.93	4.07	0.47477	6-phosphofructo-2-kinase (1);	0.171997	0.52532	D	0.000068	T	0.35595	0.0937	N	0.17379	0.485	0.80722	D	1	B;B;B;B	0.26041	0.14;0.024;0.065;0.116	B;B;B;B	0.17433	0.018;0.002;0.012;0.004	T	0.17048	-1.0382	9	0.07325	T	0.83	-7.2582	12.7155	0.57113	0.1342:0.0:0.8658:0.0	.	234;220;220;200	B7Z955;Q16875-2;Q16875;Q5VX15	.;.;F263_HUMAN;.	Q	200;234;220;220;220;220;220;220	.	ENSP00000369105:R220Q	R	+	2	0	PFKFB3	6302662	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	5.554000	0.67294	1.512000	0.48834	0.561000	0.74099	CGG	PFKFB3	-	pfam_6Phosfructo_kin,superfamily_P-loop_NTPase,pirsf_Bifunct_6PFK/fruc_bisP_Ptase	ENSG00000170525		0.617	PFKFB3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PFKFB3	HGNC	protein_coding	OTTHUMT00000046647.1	-	0.00	57	0	G			6262656	+1	tier1	rs140784797	no_errors	ENST00000540253	ensembl	human	known	74_37	missense	43.64	31	24	SNP	0.998	A
PGRMC1	10857	genome.wustl.edu	37	X	118374351	118374351	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chrX:118374351G>T	ENST00000217971.7	+	2	519	c.408G>T	c.(406-408)aaG>aaT	p.K136N	PGRMC1_ENST00000535419.1_Intron	NM_006667.3	NP_006658.1	O00264	PGRC1_HUMAN	progesterone receptor membrane component 1	136	Cytochrome b5 heme-binding.				axon guidance (GO:0007411)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)	heme binding (GO:0020037)|steroid binding (GO:0005496)			lung(6)	6					Dextromethorphan(DB00514)|Nortriptyline(DB00540)	AAGCACTGAAGGATGAGTACG	0.478																																																	0													148.0	134.0	139.0					X																	118374351		2203	4300	6503	SO:0001583	missense	0				CCDS14576.1, CCDS65313.1	Xq22-q24	2005-11-29			ENSG00000101856	ENSG00000101856			16090	protein-coding gene	gene with protein product		300435				9705155	Standard	NM_006667		Approved	HPR6.6	uc004erb.3	O00264	OTTHUMG00000022268	ENST00000217971.7:c.408G>T	X.37:g.118374351G>T	ENSP00000217971:p.Lys136Asn		B7Z1L3|Q9UGJ9	Missense_Mutation	SNP	pfam_Cyt_B5-like_heme/steroid-bd,superfamily_Cyt_B5-like_heme/steroid-bd	p.K136N	ENST00000217971.7	37	c.408	CCDS14576.1	X	.	.	.	.	.	.	.	.	.	.	.	14.13	2.443707	0.43429	.	.	ENSG00000101856	ENST00000217971	T	0.78126	-1.15	4.98	2.91	0.33838	Cytochrome b5 (3);	0.049294	0.85682	D	0.000000	T	0.70378	0.3217	L	0.61387	1.9	0.80722	D	1	B	0.27140	0.169	B	0.27608	0.081	T	0.64753	-0.6333	10	0.36615	T	0.2	-45.1961	6.6089	0.22741	0.3776:0.0:0.6224:0.0	.	136	O00264	PGRC1_HUMAN	N	136	ENSP00000217971:K136N	ENSP00000217971:K136N	K	+	3	2	PGRMC1	118258379	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.736000	0.38187	0.893000	0.36288	0.509000	0.49947	AAG	PGRMC1	-	pfam_Cyt_B5-like_heme/steroid-bd,superfamily_Cyt_B5-like_heme/steroid-bd	ENSG00000101856		0.478	PGRMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGRMC1	HGNC	protein_coding	OTTHUMT00000058024.1	-	0.00	69	0	G	NM_006667		118374351	+1	tier1	-	no_errors	ENST00000217971	ensembl	human	known	74_37	missense	8.20	56	5	SNP	1.000	T
PHLPP1	23239	genome.wustl.edu	37	18	60562282	60562282	+	Missense_Mutation	SNP	A	A	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr18:60562282A>G	ENST00000262719.5	+	5	2339	c.2105A>G	c.(2104-2106)cAt>cGt	p.H702R	PHLPP1_ENST00000400316.4_Missense_Mutation_p.H190R			O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein phosphatase 1	702					apoptotic process (GO:0006915)|entrainment of circadian clock (GO:0009649)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			endometrium(2)|kidney(2)|lung(13)	17						TCCAATAATCATTTAGGGGAC	0.438																																																	0													57.0	55.0	56.0					18																	60562282		1869	4102	5971	SO:0001583	missense	0			AB011178	CCDS45881.1, CCDS45881.2	18q21.32	2013-01-11	2009-05-26	2009-05-26	ENSG00000081913	ENSG00000081913		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	20610	protein-coding gene	gene with protein product		609396	"""pleckstrin homology domain containing, family E (with leucine rich repeats) member 1"", ""PH domain and leucine rich repeat protein phosphatase"""	PLEKHE1, PHLPP		10570941, 15808505	Standard	NM_194449		Approved	KIAA0606, SCOP	uc021ule.1	O60346	OTTHUMG00000150629	ENST00000262719.5:c.2105A>G	18.37:g.60562282A>G	ENSP00000262719:p.His702Arg		A1A4F5|Q641Q7|Q6P4C4|Q6PJI6|Q86TN6|Q96FK2|Q9NUY1	Missense_Mutation	SNP	pfam_PP2C-like_dom,pfam_Leu-rich_rpt,superfamily_PP2C-like_dom,smart_Leu-rich_rpt_typical-subtyp,smart_PP2C-like_dom,pfscan_Pleckstrin_homology	p.H702R	ENST00000262719.5	37	c.2105	CCDS45881.2	18	.	.	.	.	.	.	.	.	.	.	A	13.07	2.126614	0.37533	.	.	ENSG00000081913	ENST00000400316;ENST00000262719	T;T	0.22945	1.93;1.93	5.81	4.66	0.58398	.	.	.	.	.	T	0.10252	0.0251	N	0.03948	-0.315	0.38486	D	0.947848	P	0.44521	0.837	B	0.41135	0.348	T	0.16305	-1.0407	9	0.02654	T	1	-11.498	11.5355	0.50634	0.9306:0.0:0.0694:0.0	.	702	O60346	PHLP1_HUMAN	R	190;702	ENSP00000383170:H190R;ENSP00000262719:H702R	ENSP00000262719:H702R	H	+	2	0	PHLPP1	58713262	0.987000	0.35691	0.998000	0.56505	0.996000	0.88848	2.287000	0.43505	1.046000	0.40249	0.533000	0.62120	CAT	PHLPP1	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000081913		0.438	PHLPP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PHLPP1	HGNC	protein_coding	OTTHUMT00000319249.2	-	0.00	110	0	A	NM_194449		60562282	+1	tier1	-	no_errors	ENST00000262719	ensembl	human	known	74_37	missense	27.66	34	13	SNP	0.997	G
PIFO	128344	genome.wustl.edu	37	1	111889664	111889664	+	Missense_Mutation	SNP	T	T	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr1:111889664T>A	ENST00000369738.4	+	2	517	c.152T>A	c.(151-153)tTt>tAt	p.F51Y	PIFO_ENST00000369737.4_Missense_Mutation_p.F51Y|PIFO_ENST00000484512.1_3'UTR	NM_181643.4	NP_857594.2	Q8TCI5	PIFO_HUMAN	primary cilia formation	51					cell projection organization (GO:0030030)|positive regulation of kinase activity (GO:0033674)|regulation of cell projection organization (GO:0031344)	ciliary basal body (GO:0036064)|cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	beta-tubulin binding (GO:0048487)|gamma-tubulin binding (GO:0043015)|kinesin binding (GO:0019894)|protein kinase binding (GO:0019901)|Rab GTPase binding (GO:0017137)										GGGTGTTATTTTTCAGATGTG	0.463																																																	0													63.0	63.0	63.0					1																	111889664		2203	4300	6503	SO:0001583	missense	0			BC050319	CCDS833.1, CCDS72836.1	1p13.2	2012-10-10	2012-10-10	2012-10-10	ENSG00000173947	ENSG00000173947			27009	protein-coding gene	gene with protein product		614234	"""chromosome 1 open reading frame 88"""	C1orf88		20643351	Standard	XM_005270472		Approved	FLJ23853, pitchfork	uc001eaw.2	Q8TCI5	OTTHUMG00000011168	ENST00000369738.4:c.152T>A	1.37:g.111889664T>A	ENSP00000358753:p.Phe51Tyr		D9J0A2|D9J0A3|Q4G0K4|Q52LJ6|Q5T5D5|Q5T5D6|Q8N310	Missense_Mutation	SNP	NULL	p.F51Y	ENST00000369738.4	37	c.152	CCDS833.1	1	.	.	.	.	.	.	.	.	.	.	T	0.006	-2.117214	0.00349	.	.	ENSG00000173947	ENST00000369738;ENST00000369737	T;T	0.22743	1.94;1.98	4.82	0.849	0.18972	.	2.042440	0.01577	N	0.020898	T	0.02119	0.0066	N	0.08118	0	0.09310	N	1	B;B;B	0.29531	0.247;0.003;0.037	B;B;B	0.31495	0.131;0.002;0.058	T	0.20605	-1.0270	10	0.02654	T	1	1.8507	2.7636	0.05314	0.2148:0.4087:0.0:0.3765	.	51;51;51	Q8TCI5-2;Q8TCI5-3;Q8TCI5	.;.;PIFO_HUMAN	Y	51	ENSP00000358753:F51Y;ENSP00000358752:F51Y	ENSP00000358752:F51Y	F	+	2	0	C1orf88	111691187	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	0.520000	0.22878	-0.022000	0.13986	0.459000	0.35465	TTT	PIFO	-	NULL	ENSG00000173947		0.463	PIFO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIFO	HGNC	protein_coding	OTTHUMT00000030718.1	-	0.00	51	0	T	NM_181643		111889664	+1	tier1	-	no_errors	ENST00000369738	ensembl	human	known	74_37	missense	11.11	32	4	SNP	0.000	A
PIWIL1	9271	genome.wustl.edu	37	12	130833852	130833852	+	Missense_Mutation	SNP	A	A	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr12:130833852A>G	ENST00000245255.3	+	8	1075	c.803A>G	c.(802-804)gAc>gGc	p.D268G		NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	268					gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)			breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		CTCTGCACTGACGTTAGCCAT	0.413																																																	0													129.0	119.0	122.0					12																	130833852		2203	4300	6503	SO:0001583	missense	0			AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.803A>G	12.37:g.130833852A>G	ENSP00000245255:p.Asp268Gly		A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ_dom,pfam_GAGE,superfamily_RNaseH-like_dom,superfamily_PAZ_dom,smart_PAZ_dom,smart_Piwi,pfscan_PAZ_dom,pfscan_Piwi	p.D268G	ENST00000245255.3	37	c.803	CCDS9268.1	12	.	.	.	.	.	.	.	.	.	.	A	21.7	4.186016	0.78789	.	.	ENSG00000125207	ENST00000245255	T	0.27557	1.66	5.85	5.85	0.93711	Argonaute/Dicer protein, PAZ (1);	0.000000	0.85682	D	0.000000	T	0.62563	0.2438	M	0.89163	3.01	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.79784	0.99;0.993	T	0.70357	-0.4894	10	0.87932	D	0	-17.1502	15.4187	0.74995	1.0:0.0:0.0:0.0	.	268;268	Q96J94;Q96J94-2	PIWL1_HUMAN;.	G	268	ENSP00000245255:D268G	ENSP00000245255:D268G	D	+	2	0	PIWIL1	129399805	1.000000	0.71417	0.798000	0.32154	0.458000	0.32498	9.299000	0.96137	2.222000	0.72286	0.533000	0.62120	GAC	PIWIL1	-	superfamily_PAZ_dom	ENSG00000125207		0.413	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIWIL1	HGNC	protein_coding	OTTHUMT00000399510.1	-	0.00	109	0	A			130833852	+1	tier1	-	no_errors	ENST00000245255	ensembl	human	known	74_37	missense	19.19	80	19	SNP	1.000	G
PJA1	64219	genome.wustl.edu	37	X	68382727	68382727	+	Missense_Mutation	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chrX:68382727C>T	ENST00000361478.1	-	2	732	c.355G>A	c.(355-357)Gac>Aac	p.D119N	PJA1_ENST00000374571.4_Missense_Mutation_p.D64N|PJA1_ENST00000374584.3_Intron|PJA1_ENST00000477231.1_5'UTR|PJA1_ENST00000374583.1_Missense_Mutation_p.D119N	NM_001032396.2|NM_022368.4|NM_145119.3	NP_001027568.1|NP_071763.2|NP_660095.1	Q8NG27	PJA1_HUMAN	praja ring finger 1, E3 ubiquitin protein ligase	119					protein catabolic process (GO:0030163)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(5)|lung(12)|ovary(1)	21						CCATAAGAGTCAATATGTCCA	0.493																																																	0													68.0	65.0	66.0					X																	68382727		2203	4300	6503	SO:0001583	missense	0			AK021892	CCDS14392.1, CCDS14393.1, CCDS35316.1	Xq13.1	2013-01-09	2012-02-23		ENSG00000181191	ENSG00000181191		"""RING-type (C3HC4) zinc fingers"""	16648	protein-coding gene	gene with protein product		300420	"""praja 1"", ""praja ring finger 1"""			12036302	Standard	NM_001032396		Approved	FLJ11830, RNF70	uc004dxh.3	Q8NG27	OTTHUMG00000021753	ENST00000361478.1:c.355G>A	X.37:g.68382727C>T	ENSP00000355014:p.Asp119Asn		A2A322|Q5JUT8|Q5JUT9|Q8NG28|Q9HAC1	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.D119N	ENST00000361478.1	37	c.355	CCDS14393.1	X	.	.	.	.	.	.	.	.	.	.	C	16.43	3.120476	0.56613	.	.	ENSG00000181191	ENST00000396010;ENST00000374583;ENST00000361478;ENST00000374571	T;T;T	0.14144	2.53;2.53;2.53	3.25	3.25	0.37280	.	0.000000	0.46758	U	0.000273	T	0.16428	0.0395	M	0.62723	1.935	0.36855	D	0.888124	P	0.40970	0.734	B	0.39617	0.305	T	0.21381	-1.0247	10	0.87932	D	0	-13.6198	11.8051	0.52150	0.0:1.0:0.0:0.0	.	119	Q8NG27	PJA1_HUMAN	N	64;119;119;64	ENSP00000363711:D119N;ENSP00000355014:D119N;ENSP00000363699:D64N	ENSP00000355014:D119N	D	-	1	0	PJA1	68299452	1.000000	0.71417	0.973000	0.42090	0.977000	0.68977	4.890000	0.63178	1.925000	0.55765	0.534000	0.68092	GAC	PJA1	-	NULL	ENSG00000181191		0.493	PJA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PJA1	HGNC	protein_coding	OTTHUMT00000057031.2	-	0.00	91	0	C	NM_145119		68382727	-1	tier1	-	no_errors	ENST00000361478	ensembl	human	known	74_37	missense	23.08	50	15	SNP	1.000	T
PKHD1L1	93035	genome.wustl.edu	37	8	110406647	110406647	+	Missense_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr8:110406647T>G	ENST00000378402.5	+	10	848	c.744T>G	c.(742-744)agT>agG	p.S248R		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	248	IPT/TIG 2.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TTAACAGGAGTTTTCCACAGA	0.294										HNSCC(38;0.096)																																							0													44.0	39.0	40.0					8																	110406647		1761	4008	5769	SO:0001583	missense	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.744T>G	8.37:g.110406647T>G	ENSP00000367655:p.Ser248Arg		Q567P2|Q9UF27	Missense_Mutation	SNP	pfam_IPT,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT,smart_PA14,smart_PbH1	p.S248R	ENST00000378402.5	37	c.744	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	T	18.64	3.668104	0.67814	.	.	ENSG00000205038	ENST00000378402	T	0.80214	-1.35	5.71	0.614	0.17603	Cell surface receptor IPT/TIG (2);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.86518	0.5952	M	0.81341	2.54	0.36729	D	0.881627	D	0.61697	0.99	D	0.65773	0.938	D	0.86096	0.1553	10	0.51188	T	0.08	.	9.0394	0.36307	0.0:0.303:0.0:0.697	.	248	Q86WI1	PKHL1_HUMAN	R	248	ENSP00000367655:S248R	ENSP00000367655:S248R	S	+	3	2	PKHD1L1	110475823	1.000000	0.71417	0.989000	0.46669	0.905000	0.53344	1.177000	0.31969	0.116000	0.18110	0.533000	0.62120	AGT	PKHD1L1	-	pfam_IPT,smart_IPT	ENSG00000205038		0.294	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	-	0.00	38	0	T	NM_177531		110406647	+1	tier1	-	no_errors	ENST00000378402	ensembl	human	known	74_37	missense	40.32	37	25	SNP	1.000	G
PLA2R1	22925	genome.wustl.edu	37	2	160806227	160806227	+	Missense_Mutation	SNP	C	C	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:160806227C>G	ENST00000283243.7	-	25	3807	c.3601G>C	c.(3601-3603)Gag>Cag	p.E1201Q	PLA2R1_ENST00000392771.1_Missense_Mutation_p.E1201Q	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	1201	C-type lectin 7. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)		PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						GAGGACTCCTCATCTTTCCAA	0.488																																																	0													95.0	90.0	92.0					2																	160806227		2203	4300	6503	SO:0001583	missense	0			U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.3601G>C	2.37:g.160806227C>G	ENSP00000283243:p.Glu1201Gln		B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_FN_type2_col-bd,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin	p.E1201Q	ENST00000283243.7	37	c.3601	CCDS33309.1	2	.	.	.	.	.	.	.	.	.	.	C	17.40	3.379579	0.61845	.	.	ENSG00000153246	ENST00000283243;ENST00000392771	T;T	0.54866	0.55;0.55	5.8	5.8	0.92144	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.233245	0.36268	N	0.002697	T	0.56819	0.2011	L	0.55103	1.725	0.38796	D	0.955099	B;P;P	0.37663	0.146;0.604;0.549	B;B;P	0.46049	0.35;0.433;0.502	T	0.58031	-0.7708	10	0.41790	T	0.15	.	13.2885	0.60258	0.0:0.928:0.0:0.072	.	1201;1201;1201	B7ZML4;Q13018-2;Q13018	.;.;PLA2R_HUMAN	Q	1201	ENSP00000283243:E1201Q;ENSP00000376524:E1201Q	ENSP00000283243:E1201Q	E	-	1	0	PLA2R1	160514473	0.994000	0.37717	0.746000	0.31095	0.501000	0.33797	3.331000	0.52075	2.744000	0.94065	0.655000	0.94253	GAG	PLA2R1	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000153246		0.488	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2R1	HGNC	protein_coding	OTTHUMT00000333820.1	-	0.00	91	0	C			160806227	-1	tier1	-	no_errors	ENST00000283243	ensembl	human	known	74_37	missense	34.38	42	22	SNP	0.995	G
PLXNA2	5362	genome.wustl.edu	37	1	208391187	208391187	+	Silent	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr1:208391187C>T	ENST00000367033.3	-	2	838	c.81G>A	c.(79-81)ctG>ctA	p.L27L		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	27					axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		GGGGGGCCAGCAGCACCCAGA	0.667																																																	0													43.0	47.0	46.0					1																	208391187		2203	4300	6503	SO:0001819	synonymous_variant	0			X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.81G>A	1.37:g.208391187C>T			A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Silent	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semap_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.L27	ENST00000367033.3	37	c.81	CCDS31013.1	1																																																																																			PLXNA2	-	pfscan_Semap_dom	ENSG00000076356		0.667	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA2	HGNC	protein_coding	OTTHUMT00000088932.6	-	0.00	38	0	C	NM_025179		208391187	-1	tier1	-	no_errors	ENST00000367033	ensembl	human	known	74_37	silent	48.28	15	14	SNP	1.000	T
POLQ	10721	genome.wustl.edu	37	3	121208592	121208592	+	Silent	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr3:121208592C>T	ENST00000264233.5	-	16	3314	c.3186G>A	c.(3184-3186)gcG>gcA	p.A1062A		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	1062					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)	p.A1197A(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		GGATTCTACACGCTCCAGAGT	0.418								DNA polymerases (catalytic subunits)																													Pancreas(152;907 1925 26081 31236 36904)												1	Substitution - coding silent(1)	endometrium(1)											61.0	69.0	66.0					3																	121208592		2202	4300	6502	SO:0001819	synonymous_variant	0			AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.3186G>A	3.37:g.121208592C>T			O95160|Q6VMB5	Silent	SNP	pfam_DNA-dir_DNA_pol_A_palm_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_RNaseH-like_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_DNA-dir_DNA_pol_A_palm_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_DNA_polymerase_A	p.A1062	ENST00000264233.5	37	c.3186	CCDS33833.1	3																																																																																			POLQ	-	NULL	ENSG00000051341		0.418	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLQ	HGNC	protein_coding	OTTHUMT00000355097.1	-	0.00	62	0	C	NM_199420		121208592	-1	tier1	-	no_errors	ENST00000264233	ensembl	human	known	74_37	silent	6.56	57	4	SNP	0.000	T
PRB2	653247	genome.wustl.edu	37	12	11546190	11546190	+	Silent	SNP	A	A	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr12:11546190A>G	ENST00000389362.4	-	3	857	c.822T>C	c.(820-822)ccT>ccC	p.P274P	PRB2_ENST00000545829.1_5'Flank|PRB1_ENST00000546254.1_Intron	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	274	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-P-Q-G-[GD]-[NKS]-[KSQ]- [PRS]-[QRS] [GPS]-[PSAR]-[PSR].		S -> P (may abrogate glycosylation at N- 272; dbSNP:rs10845349). {ECO:0000269|PubMed:16541075, ECO:0000269|PubMed:8554050}.			extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			GGGGACCTTGAGGTTTGTTGC	0.612																																																	0													22.0	44.0	37.0					12																	11546190		1936	3878	5814	SO:0001819	synonymous_variant	0			K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.822T>C	12.37:g.11546190A>G			O00599|P02811|P04281	Silent	SNP	NULL	p.P274	ENST00000389362.4	37	c.822	CCDS41757.2	12																																																																																			PRB2	-	NULL	ENSG00000121335		0.612	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRB2	HGNC	protein_coding	OTTHUMT00000346925.2	-	0.00	81	0	A	NM_006248		11546190	-1	tier1	-	no_errors	ENST00000389362	ensembl	human	known	74_37	silent	14.29	84	14	SNP	0.000	G
PRKCB	5579	genome.wustl.edu	37	16	23847616	23847616	+	Silent	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr16:23847616C>T	ENST00000321728.7	+	1	295	c.120C>T	c.(118-120)acC>acT	p.T40T	PRKCB_ENST00000303531.7_Silent_p.T40T|PRKCB_ENST00000498058.1_Silent_p.T40T	NM_212535.2	NP_997700.1	P05771	KPCB_HUMAN	protein kinase C, beta	40					apoptotic process (GO:0006915)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|histone H3-T6 phosphorylation (GO:0035408)|intracellular signal transduction (GO:0035556)|lipoprotein transport (GO:0042953)|negative regulation of glucose transport (GO:0010829)|negative regulation of insulin receptor signaling pathway (GO:0046627)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|histone kinase activity (H3-T6 specific) (GO:0035403)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			central_nervous_system(3)|large_intestine(1)|lung(2)|ovary(3)	9					Tamoxifen(DB00675)|Vitamin E(DB00163)	ACAAATTCACCGCCCGCTTCT	0.687																																																	0													96.0	85.0	89.0					16																	23847616		2197	4300	6497	SO:0001819	synonymous_variant	0			M13975	CCDS10618.1, CCDS10619.1	16p12	2009-07-10	2008-08-18	2008-08-18	ENSG00000166501	ENSG00000166501	2.7.11.1		9395	protein-coding gene	gene with protein product		176970	"""protein kinase C, beta 1"""	PRKCB2, PKCB, PRKCB1		3658678	Standard	NM_002738		Approved		uc002dme.3	P05771	OTTHUMG00000131615	ENST00000321728.7:c.120C>T	16.37:g.23847616C>T			C5IFJ8|D3DWF5|O43744|P05127|Q15138|Q93060|Q9UE49|Q9UE50|Q9UEH8|Q9UJ30|Q9UJ33	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_C2_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Protein_kinase_C_a/b/g,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd,prints_C2_dom	p.T40	ENST00000321728.7	37	c.120	CCDS10618.1	16																																																																																			PRKCB	-	pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,pirsf_Protein_kinase_C_a/b/g,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_DAG/PE-bd	ENSG00000166501		0.687	PRKCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCB	HGNC	protein_coding	OTTHUMT00000254504.2	-	0.00	47	0	C	NM_212535		23847616	+1	tier1	-	no_errors	ENST00000303531	ensembl	human	known	74_37	silent	15.79	32	6	SNP	1.000	T
PRKD1	5587	genome.wustl.edu	37	14	30068927	30068927	+	Nonsense_Mutation	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr14:30068927C>A	ENST00000331968.5	-	14	2231	c.2002G>T	c.(2002-2004)Gaa>Taa	p.E668*	PRKD1_ENST00000415220.2_Nonsense_Mutation_p.E676*	NM_002742.2	NP_002733.2	Q15139	KPCD1_HUMAN	protein kinase D1	668	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to oxidative stress (GO:0034599)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|negative regulation of cell death (GO:0060548)|negative regulation of endocytosis (GO:0045806)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autophosphorylation (GO:0046777)|regulation of integrin-mediated signaling pathway (GO:2001044)|regulation of keratinocyte proliferation (GO:0010837)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|lung(32)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	78	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		AAGATCATTTCCAGCATGTCT	0.378																																																	0													117.0	115.0	115.0					14																	30068927		2203	4300	6503	SO:0001587	stop_gained	0				CCDS9637.1	14q11	2013-01-10	2004-10-28	2004-10-30	ENSG00000184304	ENSG00000184304	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	9407	protein-coding gene	gene with protein product		605435	"""protein kinase C, mu"""	PRKCM		8119958, 10965134	Standard	NM_002742		Approved	PKCM, PKD, PKC-mu	uc001wqh.3	Q15139	OTTHUMG00000140203	ENST00000331968.5:c.2002G>T	14.37:g.30068927C>A	ENSP00000333568:p.Glu668*		A6NL64|B2RAF6	Nonsense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd	p.E668*	ENST00000331968.5	37	c.2002	CCDS9637.1	14	.	.	.	.	.	.	.	.	.	.	C	40	8.316834	0.98757	.	.	ENSG00000184304	ENST00000331968;ENST00000415220	.	.	.	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-24.2698	20.3932	0.98965	0.0:1.0:0.0:0.0	.	.	.	.	X	668;676	.	ENSP00000333568:E668X	E	-	1	0	PRKD1	29138678	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.776000	0.85560	2.824000	0.97209	0.655000	0.94253	GAA	PRKD1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000184304		0.378	PRKD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRKD1	HGNC	protein_coding	OTTHUMT00000276611.2	-	0.00	72	0	C	NM_002742		30068927	-1	tier1	-	no_errors	ENST00000331968	ensembl	human	known	74_37	nonsense	8.16	45	4	SNP	1.000	A
PRKG1	5592	genome.wustl.edu	37	10	54048563	54048563	+	Missense_Mutation	SNP	A	A	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr10:54048563A>C	ENST00000401604.2	+	15	1936	c.1742A>C	c.(1741-1743)aAg>aCg	p.K581T	PRKG1-AS1_ENST00000452247.2_RNA|PRKG1_ENST00000373985.1_Missense_Mutation_p.K569T|PRKG1_ENST00000373980.4_Missense_Mutation_p.K596T|PRKG1_ENST00000373975.2_Missense_Mutation_p.K299T|PRKG1-AS1_ENST00000426785.2_RNA			Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I	581	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|dendrite development (GO:0016358)|forebrain development (GO:0030900)|negative regulation of platelet aggregation (GO:0090331)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|regulation of GTPase activity (GO:0043087)|relaxation of vascular smooth muscle (GO:0060087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	53		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		GAATTTCCAAAGAAGATTGCC	0.338																																																	0													78.0	80.0	79.0					10																	54048563		2203	4300	6503	SO:0001583	missense	0				CCDS7244.1	10q11.2	2009-07-10			ENSG00000185532	ENSG00000185532	2.7.11.1		9414	protein-coding gene	gene with protein product		176894		PRKGR1B, PRKG1B		2792381, 1544322	Standard	NM_001098512		Approved	PGK, PKG	uc001jjo.3	Q13976	OTTHUMG00000018248	ENST00000401604.2:c.1742A>C	10.37:g.54048563A>C	ENSP00000384200:p.Lys581Thr		A5YM56|B3KSF3|E2PU10|P14619|Q5JP05|Q5JSJ6|Q6P5T7	Missense_Mutation	SNP	pirsf_cGMP-dependent_protein_kinase,pfam_Prot_kinase_dom,pfam_cNMP-bd_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,prints_cGMP_dep_kinase,prints_cAMP/cGMP_kin,pfscan_cNMP-bd_dom,pfscan_Prot_kinase_dom	p.K596T	ENST00000401604.2	37	c.1787	CCDS44399.1	10	.	.	.	.	.	.	.	.	.	.	A	21.9	4.215166	0.79352	.	.	ENSG00000185532	ENST00000401604;ENST00000373985;ENST00000373980;ENST00000332193;ENST00000373975	T;T;T	0.08282	3.11;3.11;3.11	5.26	5.26	0.73747	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.12433	0.0302	L	0.33189	0.99	0.80722	D	1	B;P;P	0.45474	0.032;0.859;0.768	B;P;B	0.48815	0.026;0.591;0.42	T	0.02320	-1.1177	10	0.52906	T	0.07	-11.9431	14.8289	0.70132	1.0:0.0:0.0:0.0	.	299;596;581	B3KSF3;Q13976-2;Q13976	.;.;KGP1_HUMAN	T	581;569;596;299;193	ENSP00000384200:K581T;ENSP00000363097:K569T;ENSP00000363092:K596T	ENSP00000327642:K299T	K	+	2	0	PRKG1	53718569	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	1.978000	0.57642	0.533000	0.62120	AAG	PRKG1	-	pirsf_cGMP-dependent_protein_kinase,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000185532		0.338	PRKG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKG1	HGNC	protein_coding		-	0.00	104	0	A			54048563	+1	tier1	-	no_errors	ENST00000373980	ensembl	human	known	74_37	missense	18.85	99	23	SNP	1.000	C
PRRX1	5396	genome.wustl.edu	37	1	170705262	170705262	+	Missense_Mutation	SNP	G	G	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr1:170705262G>C	ENST00000239461.6	+	4	986	c.673G>C	c.(673-675)Gcc>Ccc	p.A225P	PRRX1_ENST00000476867.2_3'UTR|PRRX1_ENST00000367760.3_3'UTR	NM_022716.2	NP_073207.1	P54821	PRRX1_HUMAN	paired related homeobox 1	225					artery morphogenesis (GO:0048844)|cartilage development (GO:0051216)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic limb morphogenesis (GO:0030326)|inner ear morphogenesis (GO:0042472)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|palate development (GO:0060021)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smoothened signaling pathway (GO:0045880)	nucleolus (GO:0005730)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			large_intestine(2)|ovary(1)	3	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					CAACAGCATTGCCAACCTGAG	0.468																																																	0													143.0	144.0	144.0					1																	170705262		2203	4300	6503	SO:0001583	missense	0			M95929	CCDS1290.1, CCDS1291.1	1q24.3	2011-06-20	2003-11-12	2003-11-14	ENSG00000116132	ENSG00000116132		"""Homeoboxes / PRD class"""	9142	protein-coding gene	gene with protein product		167420	"""paired mesoderm homeo box 1"""	PMX1		1509260	Standard	NM_006902		Approved	PHOX1	uc001ghf.3	P54821	OTTHUMG00000035231	ENST00000239461.6:c.673G>C	1.37:g.170705262G>C	ENSP00000239461:p.Ala225Pro		B5BUM7|O60807	Missense_Mutation	SNP	pfam_Homeobox_dom,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_OAR_dom,pfscan_Homeobox_dom	p.A225P	ENST00000239461.6	37	c.673	CCDS1290.1	1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.886038	0.91814	.	.	ENSG00000116132	ENST00000239461;ENST00000476867	D;D	0.98684	-5.07;-5.07	6.06	6.06	0.98353	Paired-like homeodomain protein, OAR (2);	0.000000	0.85682	D	0.000000	D	0.98286	0.9432	L	0.36672	1.1	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	D	0.97685	1.0175	10	0.30078	T	0.28	.	19.192	0.93671	0.0:0.0:1.0:0.0	.	225	P54821	PRRX1_HUMAN	P	225;70	ENSP00000239461:A225P;ENSP00000451225:A70P	ENSP00000356734:A225P	A	+	1	0	PRRX1	168971886	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.233000	0.95337	2.871000	0.98454	0.655000	0.94253	GCC	PRRX1	-	pfam_OAR_dom,pfscan_OAR_dom	ENSG00000116132		0.468	PRRX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRX1	HGNC	protein_coding	OTTHUMT00000085236.3	-	0.00	65	0	G	NM_006902		170705262	+1	tier1	-	no_errors	ENST00000239461	ensembl	human	known	74_37	missense	16.67	35	7	SNP	1.000	C
PTPRC	5788	genome.wustl.edu	37	1	198723495	198723495	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr1:198723495G>T	ENST00000367376.2	+	32	3772	c.3601G>T	c.(3601-3603)Gct>Tct	p.A1201S	PTPRC_ENST00000352140.3_Missense_Mutation_p.A1153S|PTPRC_ENST00000348564.6_Missense_Mutation_p.A1042S|PTPRC_ENST00000594404.1_Missense_Mutation_p.A1040S|PTPRC_ENST00000442510.2_Missense_Mutation_p.A1203S	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	1201	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.A1201S(1)		breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						AGTGGTAAAAGCTCTACGCAA	0.388																																																	1	Substitution - Missense(1)	kidney(1)											128.0	127.0	127.0					1																	198723495		2203	4300	6503	SO:0001583	missense	0			Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.3601G>T	1.37:g.198723495G>T	ENSP00000356346:p.Ala1201Ser		A8K7W6|Q16614|Q9H0Y6	Missense_Mutation	SNP	pirsf_Leukocyte_common_ag,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Leukocyte_common_ag,pfam_PTP_recept_N,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.A1203S	ENST00000367376.2	37	c.3607		1	.	.	.	.	.	.	.	.	.	.	G	2.753	-0.259619	0.05791	.	.	ENSG00000081237	ENST00000367376;ENST00000352140;ENST00000442510;ENST00000348564	D	0.82893	-1.66	6.02	3.69	0.42338	Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);	0.307027	0.23698	N	0.045443	T	0.60248	0.2254	N	0.02916	-0.46	0.27843	N	0.941048	B;B;B	0.10296	0.003;0.003;0.003	B;B;B	0.15052	0.012;0.012;0.012	T	0.42699	-0.9436	10	0.02654	T	1	.	14.0661	0.64831	0.0:0.0:0.477:0.523	.	1042;1153;1201	B1ALS3;E9PC28;P08575	.;.;PTPRC_HUMAN	S	1203;1153;1201;1040	ENSP00000193532:A1153S	ENSP00000306782:A1040S	A	+	1	0	PTPRC	196990118	1.000000	0.71417	0.918000	0.36340	0.950000	0.60333	1.432000	0.34936	0.518000	0.28383	-1.075000	0.02238	GCT	PTPRC	-	pirsf_Leukocyte_common_ag,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000081237		0.388	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	PTPRC	HGNC	protein_coding		-	0.00	72	0	G			198723495	+1	tier1	-	no_errors	ENST00000442510	ensembl	human	known	74_37	missense	8.16	45	4	SNP	0.999	T
PTPRD	5789	genome.wustl.edu	37	9	8486088	8486088	+	Missense_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr9:8486088T>G	ENST00000381196.4	-	25	3272	c.2729A>C	c.(2728-2730)gAg>gCg	p.E910A	PTPRD_ENST00000540109.1_Missense_Mutation_p.E910A|PTPRD_ENST00000356435.5_Missense_Mutation_p.E910A|PTPRD_ENST00000397606.3_Intron|PTPRD_ENST00000397611.3_Intron|PTPRD_ENST00000537002.1_Intron|PTPRD_ENST00000360074.4_Missense_Mutation_p.E897A|PTPRD_ENST00000358503.5_Missense_Mutation_p.E888A|PTPRD_ENST00000355233.5_Intron|PTPRD_ENST00000486161.1_Intron|PTPRD_ENST00000471274.1_5'UTR|PTPRD_ENST00000397617.3_Intron	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	910	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		AATGGAAATCTCCTTCACCAT	0.488										TSP Lung(15;0.13)																																							0													114.0	106.0	109.0					9																	8486088		2203	4300	6503	SO:0001583	missense	0			X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.2729A>C	9.37:g.8486088T>G	ENSP00000370593:p.Glu910Ala		B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom,prints_Tyr_Pase_rcpt/non-rcpt	p.E910A	ENST00000381196.4	37	c.2729	CCDS43786.1	9	.	.	.	.	.	.	.	.	.	.	T	13.15	2.151842	0.38021	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000540109	T;T;T;T;T	0.53640	0.61;0.61;0.61;0.61;0.61	5.68	5.68	0.88126	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.56156	0.1966	L	0.60845	1.875	0.80722	D	1	B;D;B	0.57257	0.166;0.979;0.017	B;P;B	0.51777	0.056;0.679;0.015	T	0.55988	-0.8053	9	.	.	.	.	15.9354	0.79698	0.0:0.0:0.0:1.0	.	897;910;910	G3XAE2;Q2HXI4;P23468	.;.;PTPRD_HUMAN	A	910;910;897;888;910	ENSP00000370593:E910A;ENSP00000348812:E910A;ENSP00000353187:E897A;ENSP00000351293:E888A;ENSP00000438164:E910A	.	E	-	2	0	PTPRD	8476088	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.289000	0.72696	2.182000	0.69389	0.533000	0.62120	GAG	PTPRD	-	pfscan_Fibronectin_type3	ENSG00000153707		0.488	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRD	HGNC	protein_coding	OTTHUMT00000055395.3	-	0.00	144	0	T			8486088	-1	tier1	-	no_errors	ENST00000356435	ensembl	human	known	74_37	missense	18.25	109	25	SNP	1.000	G
PVRL3	25945	genome.wustl.edu	37	3	110830860	110830860	+	Intron	DEL	T	T	-			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr3:110830860delT	ENST00000485303.1	+	2	435				PVRL3_ENST00000493615.1_Intron|PVRL3_ENST00000488016.1_Intron|PVRL3_ENST00000319792.3_Intron	NM_001243286.1|NM_015480.2	NP_001230215.1|NP_056295.1	Q9NQS3	PVRL3_HUMAN	poliovirus receptor-related 3						adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|fertilization (GO:0009566)|homophilic cell adhesion (GO:0007156)|lens morphogenesis in camera-type eye (GO:0002089)|retina morphogenesis in camera-type eye (GO:0060042)|single organismal cell-cell adhesion (GO:0016337)	apical junction complex (GO:0043296)|cell-cell adherens junction (GO:0005913)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	cell adhesion molecule binding (GO:0050839)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(3)	19						ATTGTAGTACTTTTTTTTCCT	0.403																																																	0										20,4138		0,20,2059	20.0	20.0	20.0			-4.9	0.0	3		20	30,8174		0,30,4072	no	intron	PVRL3	NM_015480.2		0,50,6131	A1A1,A1R,RR		0.3657,0.481,0.4045			110830860	50,12312	2159	4280	6439	SO:0001627	intron_variant	0			AF282874	CCDS2957.1, CCDS58842.1, CCDS58843.1	3q13	2013-01-29			ENSG00000177707	ENSG00000177707		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17664	protein-coding gene	gene with protein product		607147				11024295	Standard	NM_015480		Approved	nectin-3, PPR3, PVRR3, DKFZP566B0846, CDw113, CD113	uc003dxt.2	Q9NQS3	OTTHUMG00000159239	ENST00000485303.1:c.161-17T>-	3.37:g.110830860delT			E9PFR0|Q6NVZ3|Q8NC05|Q8WVU4|Q9BVA9|Q9Y412	RNA	DEL	-	NULL	ENST00000485303.1	37	NULL	CCDS2957.1	3																																																																																			PVRL3	-	-	ENSG00000177707		0.403	PVRL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PVRL3	HGNC	protein_coding	OTTHUMT00000354045.1		0.00	59	0	T	NM_015480		110830860	+1	tier1		no_errors	ENST00000478327	ensembl	human	putative	74_37	rna	9.09	30	3	DEL	0.000	-
PWAR6	100506965	genome.wustl.edu	37	15	25277567	25277567	+	lincRNA	SNP	T	T	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr15:25277567T>A	ENST00000552334.1	+	0	548				RP11-701H24.10_ENST00000552781.1_RNA|RP11-701H24.3_ENST00000546615.1_lincRNA					Prader Willi/Angelman region RNA 6																		GTAGTGATACTTttacttatt	0.418																																																	0																																												0			BC043194, AK096584		15q11.2	2014-03-28	2013-09-11		ENSG00000257151	ENSG00000257151		"""Long non-coding RNAs"""	49129	non-coding RNA	RNA, long non-coding							Standard			Approved	HBT8, PAR-6			OTTHUMG00000170276		15.37:g.25277567T>A				RNA	SNP	-	NULL	ENST00000552334.1	37	NULL		15																																																																																			PWAR6	-	-	ENSG00000257151		0.418	PWAR6-001	KNOWN	basic	lincRNA	PWAR6	HGNC	lincRNA	OTTHUMT00000408286.1		0.00	31	0	T			25277567	+1			no_errors	ENST00000552334	ensembl	human	known	74_37	rna	26.09	17	6	SNP	0.001	A
PXDN	7837	genome.wustl.edu	37	2	1652145	1652145	+	Missense_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:1652145T>G	ENST00000252804.4	-	17	3457	c.3407A>C	c.(3406-3408)aAc>aCc	p.N1136T		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	1136					extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		GAGCTCCGTGTTCAGCAGCTG	0.652																																																	0													46.0	56.0	53.0					2																	1652145		2065	4221	6286	SO:0001583	missense	0			AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.3407A>C	2.37:g.1652145T>G	ENSP00000252804:p.Asn1136Thr		A8QM65|D6W4Y0|Q4KMG2	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_VWF_C,pfam_Leu-rich_rpt,superfamily_Haem_peroxidase,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_VWF_C,prints_Haem_peroxidase_animal_subgr,pfscan_VWF_C,pfscan_Haem_peroxidase_animal,pfscan_Ig-like_dom	p.N1136T	ENST00000252804.4	37	c.3407	CCDS46221.1	2	.	.	.	.	.	.	.	.	.	.	T	23.6	4.431226	0.83776	.	.	ENSG00000130508	ENST00000252804	T	0.66280	-0.2	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.67088	0.2856	L	0.31371	0.925	0.80722	D	1	D	0.57899	0.981	D	0.66084	0.941	T	0.63462	-0.6632	10	0.23302	T	0.38	-57.6139	15.6164	0.76769	0.0:0.0:0.0:1.0	.	1136	Q92626	PXDN_HUMAN	T	1136	ENSP00000252804:N1136T	ENSP00000252804:N1136T	N	-	2	0	PXDN	1631152	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.954000	0.87848	2.092000	0.63282	0.529000	0.55759	AAC	PXDN	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal	ENSG00000130508		0.652	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDN	HGNC	protein_coding	OTTHUMT00000322505.1	-	0.00	78	0	T	XM_056455		1652145	-1	tier1	-	no_errors	ENST00000252804	ensembl	human	known	74_37	missense	45.71	38	32	SNP	1.000	G
QTRT1	81890	genome.wustl.edu	37	19	10823829	10823829	+	Silent	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr19:10823829G>T	ENST00000250237.5	+	10	1105	c.1095G>T	c.(1093-1095)gtG>gtT	p.V365V		NM_031209.2	NP_112486.1	Q9BXR0	TGT_HUMAN	queuine tRNA-ribosyltransferase 1	365					queuosine biosynthetic process (GO:0008616)|tRNA modification (GO:0006400)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|queuine tRNA-ribosyltransferase activity (GO:0008479)			large_intestine(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	12			Epithelial(33;1.55e-05)|all cancers(31;3.42e-05)			CCAGCATCGTGGAGAAGCGCT	0.687																																																	0													62.0	60.0	60.0					19																	10823829		2203	4300	6503	SO:0001819	synonymous_variant	0			AF302783	CCDS12248.1	19p13.3	2014-06-11	2008-07-31		ENSG00000213339	ENSG00000213339	2.4.2.29		23797	protein-coding gene	gene with protein product	"""tRNA-guanine transglycosylase"""	609615				20354154	Standard	NM_031209		Approved	TGT	uc002mpr.3	Q9BXR0		ENST00000250237.5:c.1095G>T	19.37:g.10823829G>T			B4DFM7|Q96BQ4|Q9BXQ9	Silent	SNP	pfam_tRNA_ribo_trans-like,superfamily_tRNA_ribo_trans-like,tigrfam_Queuine_tRNA-ribosylTrfase,tigrfam_tRNA_ribo_trans-like	p.V365	ENST00000250237.5	37	c.1095	CCDS12248.1	19																																																																																			QTRT1	-	pfam_tRNA_ribo_trans-like,superfamily_tRNA_ribo_trans-like,tigrfam_Queuine_tRNA-ribosylTrfase,tigrfam_tRNA_ribo_trans-like	ENSG00000213339		0.687	QTRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QTRT1	HGNC	protein_coding	OTTHUMT00000452086.1		0.00	28	0	G	NM_031209		10823829	+1			no_errors	ENST00000250237	ensembl	human	known	74_37	silent	10.26	35	4	SNP	0.992	T
RALGAPB	57148	genome.wustl.edu	37	20	37186956	37186956	+	Missense_Mutation	SNP	C	C	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr20:37186956C>G	ENST00000262879.6	+	23	3675	c.3391C>G	c.(3391-3393)Cta>Gta	p.L1131V	RALGAPB_ENST00000397038.1_Missense_Mutation_p.L909V|RALGAPB_ENST00000397040.1_Missense_Mutation_p.L1131V|RALGAPB_ENST00000397042.3_Missense_Mutation_p.L1127V			Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit (non-catalytic)	1131					activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)|Ral protein signal transduction (GO:0032484)|regulation of exocyst localization (GO:0060178)		protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(29)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						AAATAGTCGTCTACCTCCTCA	0.373																																																	0													219.0	199.0	206.0					20																	37186956		2203	4300	6503	SO:0001583	missense	0			AB033045	CCDS13305.1, CCDS63272.1	20q11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000170471	ENSG00000170471			29221	protein-coding gene	gene with protein product			"""KIAA1219"""	KIAA1219		19520869	Standard	XM_005260462		Approved	DKFZp781M2411, RalGAPbeta	uc002xiw.3	Q86X10	OTTHUMG00000140270	ENST00000262879.6:c.3391C>G	20.37:g.37186956C>G	ENSP00000262879:p.Leu1131Val		A2A2E8|A2A2E9|Q5TG31|Q8N3D1|Q8WWC0|Q9H3X8|Q9UJR1|Q9ULK1|Q9Y3G9	Missense_Mutation	SNP	superfamily_ARM-type_fold,pfscan_Rap_GAP_dom	p.L1131V	ENST00000262879.6	37	c.3391	CCDS13305.1	20	.	.	.	.	.	.	.	.	.	.	C	15.15	2.746822	0.49257	.	.	ENSG00000170471	ENST00000262879;ENST00000397042;ENST00000397038;ENST00000397040;ENST00000438490	D;D;D;D;D	0.94457	-3.43;-3.43;-3.43;-3.43;-3.43	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	D	0.96191	0.8758	L	0.51422	1.61	0.80722	D	1	D;D	0.56035	0.974;0.974	D;D	0.70487	0.969;0.969	D	0.94575	0.7774	10	0.30078	T	0.28	.	19.8339	0.96646	0.0:1.0:0.0:0.0	.	1127;1131	A2A2E9;Q86X10	.;RLGPB_HUMAN	V	1131;1127;909;1131;959	ENSP00000262879:L1131V;ENSP00000380235:L1127V;ENSP00000380231:L909V;ENSP00000380233:L1131V;ENSP00000416646:L959V	ENSP00000262879:L1131V	L	+	1	2	RALGAPB	36620370	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.345000	0.59360	2.751000	0.94390	0.655000	0.94253	CTA	RALGAPB	-	NULL	ENSG00000170471		0.373	RALGAPB-001	KNOWN	basic|CCDS	protein_coding	RALGAPB	HGNC	protein_coding	OTTHUMT00000079191.1	-	0.00	107	0	C	NM_020336		37186956	+1	tier1	-	no_errors	ENST00000262879	ensembl	human	known	74_37	missense	68.47	34	76	SNP	1.000	G
RASGRF1	5923	genome.wustl.edu	37	15	79317718	79317718	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr15:79317718G>T	ENST00000419573.3	-	10	1754	c.1480C>A	c.(1480-1482)Ctg>Atg	p.L494M	RASGRF1_ENST00000560334.1_5'UTR|RASGRF1_ENST00000558480.2_Missense_Mutation_p.L494M	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	494	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						TTAGAAAACAGGAAGCACTGT	0.567																																																	0													79.0	78.0	78.0					15																	79317718		2196	4293	6489	SO:0001583	missense	0			M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.1480C>A	15.37:g.79317718G>T	ENSP00000405963:p.Leu494Met		F8VPA5|H0YKF2|J3KQP9|Q16027	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_Ras_GEF_dom,superfamily_DH-domain,smart_Pleckstrin_homology,smart_DH-domain,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_DH-domain,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.L494M	ENST00000419573.3	37	c.1480	CCDS10309.1	15	.	.	.	.	.	.	.	.	.	.	G	18.44	3.625032	0.66901	.	.	ENSG00000058335	ENST00000419573;ENST00000394741	T	0.70516	-0.49	4.36	2.41	0.29592	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.64402	D	0.000005	T	0.78654	0.4317	M	0.72479	2.2	0.80722	D	1	D;D;D;D	0.76494	0.998;0.998;0.998;0.999	D;D;D;D	0.70016	0.964;0.927;0.927;0.967	T	0.77975	-0.2385	10	0.87932	D	0	.	6.4749	0.22031	0.307:0.0:0.6929:0.0	.	494;494;494;494	A8K270;Q8IUU5;Q13972;F8VPA5	.;.;RGRF1_HUMAN;.	M	494	ENSP00000405963:L494M	ENSP00000378224:L494M	L	-	1	2	RASGRF1	77104773	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.872000	0.56085	1.031000	0.39867	0.585000	0.79938	CTG	RASGRF1	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000058335		0.567	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	RASGRF1	HGNC	protein_coding	OTTHUMT00000291371.3	-	0.00	78	0	G	NM_002891		79317718	-1	tier1	-	no_errors	ENST00000419573	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	T
RASGRP4	115727	genome.wustl.edu	37	19	38912693	38912693	+	Missense_Mutation	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr19:38912693C>A	ENST00000587738.1	-	2	194	c.124G>T	c.(124-126)Gtc>Ttc	p.V42F	RASGRP4_ENST00000587753.1_Missense_Mutation_p.V42F|RASGRP4_ENST00000293062.9_Missense_Mutation_p.V42F|RASGRP4_ENST00000426920.2_Missense_Mutation_p.V42F|RASGRP4_ENST00000433821.2_Missense_Mutation_p.V42F|RASGRP4_ENST00000454404.2_Missense_Mutation_p.V42F|RASGRP4_ENST00000586305.1_Missense_Mutation_p.V42F			Q8TDF6	GRP4_HUMAN	RAS guanyl releasing protein 4	42					activation of phospholipase C activity (GO:0007202)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|myeloid cell differentiation (GO:0030099)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|response to extracellular stimulus (GO:0009991)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|GTP-dependent protein binding (GO:0030742)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			cervix(1)|kidney(1)|large_intestine(4)|lung(12)|pancreas(1)|prostate(3)|skin(1)	23	all_cancers(60;4.21e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GAAGCCATGACCTTGCTGATT	0.612																																																	0													41.0	48.0	46.0					19																	38912693		2029	4189	6218	SO:0001583	missense	0			AY048119	CCDS46068.1, CCDS54262.1, CCDS54263.1, CCDS54264.1	19q13.1	2013-01-10						"""EF-hand domain containing"""	18958	protein-coding gene	gene with protein product		607320				11956218	Standard	NM_170604		Approved		uc021uub.1	Q8TDF6		ENST00000587738.1:c.124G>T	19.37:g.38912693C>A	ENSP00000465772:p.Val42Phe		A6H8M4|C0LTP2|C0LTP3|C0LTP4|C0LTP5|C0LTP7|C9J416|C9JHZ1|Q8N858|Q96QN5|Q96QN6|Q96QN7	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_EF_hand_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N,prints_DAG/PE-bd	p.V42F	ENST00000587738.1	37	c.124	CCDS46068.1	19	.	.	.	.	.	.	.	.	.	.	C	14.58	2.576934	0.45902	.	.	ENSG00000171777	ENST00000433821;ENST00000293062;ENST00000426920;ENST00000405332;ENST00000454404	T;T;T;T	0.33438	1.41;1.41;1.41;1.41	4.2	3.16	0.36331	Ras guanine nucleotide exchange factor, domain (1);	0.365415	0.23437	N	0.048184	T	0.22859	0.0552	L	0.33485	1.01	0.34170	D	0.669704	P;P;B;P;B;B;P	0.50710	0.745;0.622;0.23;0.938;0.23;0.016;0.938	B;B;B;P;B;B;P	0.47470	0.303;0.169;0.082;0.548;0.053;0.013;0.548	T	0.15350	-1.0440	10	0.02654	T	1	-21.4442	10.1188	0.42607	0.0:0.8999:0.0:0.1001	.	42;42;42;42;42;42;42	C0LTP5;C0LTP7;C0LTP2;C0LTP4;C0LTP3;Q8TDF6-2;Q8TDF6	.;.;.;.;.;.;GRP4_HUMAN	F	42	ENSP00000411878:V42F;ENSP00000293062:V42F;ENSP00000445966:V42F;ENSP00000416463:V42F	ENSP00000293062:V42F	V	-	1	0	RASGRP4	43604533	0.998000	0.40836	1.000000	0.80357	0.994000	0.84299	1.460000	0.35244	1.128000	0.42052	0.563000	0.77884	GTC	RASGRP4	-	superfamily_Ras_GEF_dom	ENSG00000171777		0.612	RASGRP4-013	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	RASGRP4	HGNC	protein_coding	OTTHUMT00000460540.1		0.00	65	0	C	NM_170604		38912693	-1			no_errors	ENST00000587738	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	A
RBMXL2	27288	genome.wustl.edu	37	11	7111080	7111080	+	Silent	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr11:7111080C>T	ENST00000306904.5	+	1	916	c.729C>T	c.(727-729)taC>taT	p.Y243Y		NM_014469.4	NP_055284.3	O75526	RMXL2_HUMAN	RNA binding motif protein, X-linked-like 2	243	Arg/Gly/Pro-rich.					nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15				Epithelial(150;5.14e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		ACCGCGATTACGGCCACTCCA	0.647																																																	0													23.0	25.0	25.0					11																	7111080		2193	4286	6479	SO:0001819	synonymous_variant	0			AF069682	CCDS7777.1	11p15	2013-07-16				ENSG00000170748		"""RNA binding motif (RRM) containing"""	17886	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G T"""	605444				10958650	Standard	NM_014469		Approved	HNRNPG-T, HNRPGT	uc001mfc.2	O75526		ENST00000306904.5:c.729C>T	11.37:g.7111080C>T			Q6PEZ2|Q9NQU0	Silent	SNP	pfam_RRM_dom,pfam_RBM1CTR,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	p.Y243	ENST00000306904.5	37	c.729	CCDS7777.1	11																																																																																			RBMXL2	-	NULL	ENSG00000170748		0.647	RBMXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL2	HGNC	protein_coding	OTTHUMT00000384552.1	-	0.00	32	0	C	NM_014469		7111080	+1	tier1	-	no_errors	ENST00000306904	ensembl	human	known	74_37	silent	36.11	23	13	SNP	1.000	T
RECQL5	9400	genome.wustl.edu	37	17	73625473	73625473	+	Missense_Mutation	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr17:73625473C>T	ENST00000317905.5	-	16	2189	c.2030G>A	c.(2029-2031)cGg>cAg	p.R677Q	RECQL5_ENST00000443199.2_5'UTR|RECQL5_ENST00000423245.2_Missense_Mutation_p.R650Q	NM_004259.6	NP_004250.4	O94762	RECQ5_HUMAN	RecQ protein-like 5	677	Interaction with RAD51.				chromosome separation (GO:0051304)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|mitotic nuclear division (GO:0007067)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA helicase activity (GO:0003678)|nucleic acid binding (GO:0003676)|RNA polymerase II core binding (GO:0000993)			breast(1)|cervix(3)|endometrium(3)|kidney(7)|large_intestine(7)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	36	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			CTCCCTGATCCGAGTTGTCTC	0.657								Other identified genes with known or suspected DNA repair function																																									0													21.0	23.0	22.0					17																	73625473		1883	4082	5965	SO:0001583	missense	0			AB006533	CCDS32735.1, CCDS42380.1, CCDS45777.1	17q25	2014-03-07	2014-03-07	2014-03-07	ENSG00000108469	ENSG00000108469			9950	protein-coding gene	gene with protein product	"""RecQ protein 5"""	603781				9878247	Standard	NM_004259		Approved	RecQ5, FLJ90603	uc010dgl.3	O94762		ENST00000317905.5:c.2030G>A	17.37:g.73625473C>T	ENSP00000317636:p.Arg677Gln		Q9H0B1|Q9P1W7|Q9UNC8	Missense_Mutation	SNP	pfam_RecQ_helicase-like_5,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.R677Q	ENST00000317905.5	37	c.2030	CCDS42380.1	17	.	.	.	.	.	.	.	.	.	.	C	10.46	1.356507	0.24598	.	.	ENSG00000108469	ENST00000443199;ENST00000423245;ENST00000317905	T	0.48522	0.81	4.96	-9.91	0.00458	RecQ helicase-like 5 (2);	2.612280	0.00775	N	0.001237	T	0.17492	0.0420	N	0.04508	-0.205	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.19224	-1.0312	10	0.11182	T	0.66	2.9789	2.9236	0.05777	0.2354:0.0828:0.1675:0.5143	.	677;650	O94762;Q6P4G0	RECQ5_HUMAN;.	Q	272;677;677	ENSP00000317636:R677Q	ENSP00000317636:R677Q	R	-	2	0	RECQL5	71137068	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.856000	0.00729	-3.175000	0.00224	-1.036000	0.02392	CGG	RECQL5	-	pfam_RecQ_helicase-like_5	ENSG00000108469		0.657	RECQL5-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	RECQL5	HGNC	protein_coding	OTTHUMT00000448207.1	-	0.00	14	0	C	NM_004259		73625473	-1	tier1	-	no_errors	ENST00000317905	ensembl	human	known	74_37	missense	61.11	7	11	SNP	0.000	T
REV3L	5980	genome.wustl.edu	37	6	111695260	111695260	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr6:111695260G>T	ENST00000358835.3	-	14	4752	c.4298C>A	c.(4297-4299)gCg>gAg	p.A1433E	REV3L_ENST00000368805.1_Missense_Mutation_p.A1433E|REV3L_ENST00000435970.1_Missense_Mutation_p.A1355E|REV3L_ENST00000368802.3_Missense_Mutation_p.A1433E			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	1433					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		TGACTGTTCCGCTATGCACAC	0.413								DNA polymerases (catalytic subunits)																																									0													163.0	143.0	150.0					6																	111695260		2203	4300	6503	SO:0001583	missense	0			AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.4298C>A	6.37:g.111695260G>T	ENSP00000351697:p.Ala1433Glu		O43214|Q5TC33	Missense_Mutation	SNP	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B	p.A1433E	ENST00000358835.3	37	c.4298	CCDS5091.2	6	.	.	.	.	.	.	.	.	.	.	G	11.52	1.662450	0.29515	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970	T;T;T;T	0.01495	4.92;4.92;4.92;4.83	6.03	5.15	0.70609	Ribonuclease H-like (1);	4.375660	0.00890	N	0.002223	T	0.01061	0.0035	L	0.34521	1.04	0.28434	N	0.917132	P	0.41524	0.753	B	0.33846	0.171	T	0.56733	-0.7930	10	0.62326	D	0.03	-2.0587	17.2338	0.86992	0.0:0.1258:0.8742:0.0	.	1433	O60673	DPOLZ_HUMAN	E	1433;1433;1433;1355	ENSP00000357792:A1433E;ENSP00000357795:A1433E;ENSP00000351697:A1433E;ENSP00000402003:A1355E	ENSP00000351697:A1433E	A	-	2	0	REV3L	111801953	1.000000	0.71417	0.977000	0.42913	0.645000	0.38454	3.808000	0.55598	1.515000	0.48885	0.557000	0.71058	GCG	REV3L	-	superfamily_RNaseH-like_dom	ENSG00000009413		0.413	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	REV3L	HGNC	protein_coding	OTTHUMT00000043695.1		0.00	81	0	G	NM_002912		111695260	-1			no_errors	ENST00000358835	ensembl	human	known	74_37	missense	6.38	44	3	SNP	0.988	T
RIC8B	55188	genome.wustl.edu	37	12	107254098	107254098	+	Silent	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr12:107254098G>T	ENST00000392839.2	+	8	1465	c.1359G>T	c.(1357-1359)gcG>gcT	p.A453A	RIC8B_ENST00000392837.4_Silent_p.A453A|RIC8B_ENST00000355478.2_Silent_p.A413A|RIC8B_ENST00000549643.1_5'UTR	NM_018157.2	NP_060627.2	Q9NVN3	RIC8B_HUMAN	RIC8 guanine nucleotide exchange factor B	453					regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	G-protein alpha-subunit binding (GO:0001965)|guanyl-nucleotide exchange factor activity (GO:0005085)			kidney(2)|large_intestine(5)|lung(10)|ovary(1)|urinary_tract(1)	19						GACTGTTGGCGGCCAGGGGCC	0.458																																																	0													84.0	81.0	82.0					12																	107254098		2203	4300	6503	SO:0001819	synonymous_variant	0			AK128102	CCDS9109.2	12q23.3	2013-08-05	2013-08-05		ENSG00000111785	ENSG00000111785			25555	protein-coding gene	gene with protein product		609147	"""resistance to inhibitors of cholinesterase 8 homolog B (C. elegans)"""				Standard	XM_005268998		Approved	FLJ10620, hSyn, RIC8	uc001tlx.3	Q9NVN3	OTTHUMG00000144188	ENST00000392839.2:c.1359G>T	12.37:g.107254098G>T			A2RTZ0|Q4G103|Q6ZRN4|Q86WD3	Silent	SNP	pfam_Gua_nucleotide_exch_fac_Ric8,superfamily_ARM-type_fold,prints_Synembryn	p.A453	ENST00000392839.2	37	c.1359	CCDS9109.2	12																																																																																			RIC8B	-	pfam_Gua_nucleotide_exch_fac_Ric8,prints_Synembryn	ENSG00000111785		0.458	RIC8B-006	KNOWN	basic|exp_conf|CCDS	protein_coding	RIC8B	HGNC	protein_coding	OTTHUMT00000291398.2	-	0.00	64	0	G	NM_018157		107254098	+1	tier1	-	no_errors	ENST00000392837	ensembl	human	known	74_37	silent	7.02	53	4	SNP	0.997	T
RIMBP2	23504	genome.wustl.edu	37	12	130927081	130927081	+	Silent	SNP	G	G	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr12:130927081G>A	ENST00000261655.4	-	8	928	c.765C>T	c.(763-765)tcC>tcT	p.S255S	RIMBP2_ENST00000535703.1_Silent_p.S163S|RIMBP2_ENST00000536002.1_Silent_p.S163S	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	255					negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		GGCCGATGCCGGAATGGTTGA	0.597																																																	0													193.0	179.0	184.0					12																	130927081		2203	4300	6503	SO:0001819	synonymous_variant	0			AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.765C>T	12.37:g.130927081G>A			Q96ID2	Silent	SNP	pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_Fibronectin_type3,smart_SH3_domain,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_SH3_domain,prints_SH3_domain	p.S255	ENST00000261655.4	37	c.765	CCDS31925.1	12																																																																																			RIMBP2	-	NULL	ENSG00000060709		0.597	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMBP2	HGNC	protein_coding	OTTHUMT00000399520.1	-	0.00	86	0	G	NM_015347		130927081	-1	tier1	-	no_errors	ENST00000261655	ensembl	human	known	74_37	silent	6.58	71	5	SNP	0.000	A
RIN3	79890	genome.wustl.edu	37	14	93125514	93125514	+	Missense_Mutation	SNP	G	G	T	rs150023914	byFrequency	TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr14:93125514G>T	ENST00000216487.7	+	7	2194	c.2035G>T	c.(2035-2037)Gta>Tta	p.V679L	RIN3_ENST00000418924.2_3'UTR	NM_024832.3	NP_079108.3	Q8TB24	RIN3_HUMAN	Ras and Rab interactor 3	679	Interaction with RAB5B.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)	GTPase activator activity (GO:0005096)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			endometrium(4)|kidney(2)|large_intestine(7)|lung(19)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	36		all_cancers(154;0.0701)				AGAAGCAATTGTAGAGTCTGC	0.537																																																	0													288.0	300.0	296.0					14																	93125514		2203	4300	6503	SO:0001583	missense	0			BC025248	CCDS32144.1	14q32.13	2008-08-29				ENSG00000100599			18751	protein-coding gene	gene with protein product		610223				11733506	Standard	NM_024832		Approved	FLJ22439	uc001yap.3	Q8TB24		ENST00000216487.7:c.2035G>T	14.37:g.93125514G>T	ENSP00000216487:p.Val679Leu		Q76LB3|Q8NF30|Q8TEE8|Q8WYP4|Q9H6A5|Q9HAG1	Missense_Mutation	SNP	pfam_VPS9,smart_SH2,smart_VPS9_subgr,pfscan_Ras-assoc,pfscan_SH2,pfscan_VPS9	p.V679L	ENST00000216487.7	37	c.2035	CCDS32144.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.787|5.787	0.329572|0.329572	0.10956|0.10956	.|.	.|.	ENSG00000100599|ENSG00000100599	ENST00000556418|ENST00000216487;ENST00000428147	.|T	.|0.27557	.|1.66	5.84|5.84	5.84|5.84	0.93424|0.93424	.|.	.|0.213952	.|0.38272	.|N	.|0.001758	T|T	0.15869|0.15869	0.0382|0.0382	N|N	0.16743|0.16743	0.435|0.435	0.80722|0.80722	D|D	1|1	.|B;P;P;P	.|0.40360	.|0.14;0.615;0.615;0.714	.|B;B;B;B	.|0.34242	.|0.174;0.1;0.159;0.178	T|T	0.07654|0.07654	-1.0761|-1.0761	5|10	.|0.06099	.|T	.|0.92	-32.0639|-32.0639	14.3034|14.3034	0.66368|0.66368	0.0707:0.0:0.9293:0.0|0.0707:0.0:0.9293:0.0	.|.	.|679;725;604;679	.|Q8TB24-4;Q86U22;Q6ZRC2;Q8TB24	.|.;.;.;RIN3_HUMAN	F|L	195|679;603	.|ENSP00000216487:V679L	.|ENSP00000216487:V679L	C|V	+|+	2|1	0|0	RIN3|RIN3	92195267|92195267	1.000000|1.000000	0.71417|0.71417	0.987000|0.987000	0.45799|0.45799	0.973000|0.973000	0.67179|0.67179	3.018000|3.018000	0.49625|0.49625	2.768000|2.768000	0.95171|0.95171	0.561000|0.561000	0.74099|0.74099	TGT|GTA	RIN3	-	NULL	ENSG00000100599		0.537	RIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIN3	HGNC	protein_coding	OTTHUMT00000412269.1	-	0.00	51	0	G			93125514	+1	tier1	-	no_errors	ENST00000216487	ensembl	human	known	74_37	missense	16.13	26	5	SNP	0.956	T
RLN1	6013	genome.wustl.edu	37	9	5339673	5339673	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr9:5339673G>T	ENST00000223862.1	-	1	200	c.74C>A	c.(73-75)gCc>gAc	p.A25D	RLN1_ENST00000223858.4_Missense_Mutation_p.A25D|RLN1_ENST00000487557.2_5'Flank	NM_006911.2	NP_008842.1	P04808	REL1_HUMAN	relaxin 1	25					female pregnancy (GO:0007565)|signal transduction (GO:0007165)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			large_intestine(1)|lung(4)	5	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.02)|Lung(218;0.0984)		CTTCCATTTGGCCGCGACTGC	0.517																																																	0													62.0	70.0	67.0					9																	5339673		2195	4299	6494	SO:0001583	missense	0				CCDS6462.1	9p24.1	2013-02-26	2004-11-15		ENSG00000107018	ENSG00000107018		"""Endogenous ligands"""	10026	protein-coding gene	gene with protein product	"""prorelaxin H1"""	179730	"""relaxin 1 (H1)"""				Standard	NM_006911		Approved	H1	uc003zjb.2	P04808	OTTHUMG00000019495	ENST00000223862.1:c.74C>A	9.37:g.5339673G>T	ENSP00000223862:p.Ala25Asp		Q99936|Q9UQJ1	Missense_Mutation	SNP	pfam_Insulin-like,superfamily_Insulin-like,smart_Insulin-like,prints_Relaxin,prints_Insulin_family	p.A25D	ENST00000223862.1	37	c.74	CCDS6462.1	9	.	.	.	.	.	.	.	.	.	.	T	4.639	0.118870	0.08881	.	.	ENSG00000107018	ENST00000223862;ENST00000223858	T;T	0.18960	2.26;2.18	1.6	-1.88	0.07713	Insulin-like (1);	18.332700	0.00950	N	0.002943	T	0.09069	0.0224	N	0.04508	-0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.22173	-1.0224	10	0.10902	T	0.67	.	5.9636	0.19313	0.0:0.0:0.4474:0.5526	.	25	P04808	REL1_HUMAN	D	25	ENSP00000223862:A25D;ENSP00000223858:A25D	ENSP00000223858:A25D	A	-	2	0	RLN1	5329673	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.648000	0.01995	-0.415000	0.07484	0.532000	0.56150	GCC	RLN1	-	superfamily_Insulin-like	ENSG00000107018		0.517	RLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RLN1	HGNC	protein_coding	OTTHUMT00000051617.1		0.00	65	0	G			5339673	-1			no_errors	ENST00000223862	ensembl	human	known	74_37	missense	5.88	64	4	SNP	0.000	T
RMDN1	51115	genome.wustl.edu	37	8	87498834	87498834	+	Missense_Mutation	SNP	G	G	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr8:87498834G>A	ENST00000406452.3	-	4	533	c.374C>T	c.(373-375)tCa>tTa	p.S125L	CPNE3_ENST00000198765.4_Intron|RMDN1_ENST00000430676.2_Missense_Mutation_p.S125L|RMDN1_ENST00000519966.1_Missense_Mutation_p.S125L|RMDN1_ENST00000523911.1_Missense_Mutation_p.S81L	NM_016033.2	NP_057117.2	Q96DB5	RMD1_HUMAN	regulator of microtubule dynamics 1	125						microtubule (GO:0005874)|mitochondrion (GO:0005739)		p.S125L(1)									TACATCACGTGATGCCCGTGC	0.368																																																	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											120.0	107.0	111.0					8																	87498834		2203	4300	6503	SO:0001583	missense	0			AK000672	CCDS34918.1, CCDS69509.1, CCDS69510.1	8q21.3	2013-01-11	2013-01-11	2013-01-11	ENSG00000176623	ENSG00000176623			24285	protein-coding gene	gene with protein product		611871	"""family with sequence similarity 82, member B"""	FAM82B		10810093	Standard	NM_016033		Approved	CGI-90, FLJ20665, RMD1	uc003ydu.3	Q96DB5	OTTHUMG00000163692	ENST00000406452.3:c.374C>T	8.37:g.87498834G>A	ENSP00000385927:p.Ser125Leu		A9UMZ8|B4DNF5|B4DZW6|B5MC61|C9JSC6|E7EVI2|Q9Y398	Missense_Mutation	SNP	NULL	p.S125L	ENST00000406452.3	37	c.374	CCDS34918.1	8	.	.	.	.	.	.	.	.	.	.	G	14.89	2.670265	0.47677	.	.	ENSG00000176623	ENST00000406452;ENST00000523911;ENST00000519966;ENST00000430676;ENST00000521045	T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96	5.88	5.88	0.94601	Tetratricopeptide-like helical (1);	0.219319	0.40064	N	0.001190	T	0.36963	0.0986	L	0.50847	1.595	0.80722	D	1	B;B;B	0.23990	0.095;0.002;0.003	B;B;B	0.24848	0.056;0.003;0.007	T	0.13019	-1.0525	10	0.11485	T	0.65	-13.39	14.3958	0.67010	0.0701:0.0:0.9299:0.0	.	125;125;125	B4DZW6;E7EVI2;Q96DB5	.;.;RMD1_HUMAN	L	125;81;125;125;81	ENSP00000385927:S125L;ENSP00000429899:S81L;ENSP00000428661:S125L;ENSP00000409661:S125L;ENSP00000428743:S81L	ENSP00000385927:S125L	S	-	2	0	FAM82B	87567950	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.838000	0.62803	2.779000	0.95612	0.650000	0.86243	TCA	RMDN1	-	NULL	ENSG00000176623		0.368	RMDN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RMDN1	HGNC	protein_coding	OTTHUMT00000374770.2	-	0.00	73	0	G	NM_016033		87498834	-1	tier1	-	no_errors	ENST00000406452	ensembl	human	known	74_37	missense	11.58	84	11	SNP	1.000	A
LAMA1	284217	genome.wustl.edu	37	18	6972873	6972873	+	Intron	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr18:6972873G>T	ENST00000389658.3	-	47	6868				RN7SL537P_ENST00000584392.1_RNA	NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1						axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				atttttagtagagacaagagt	0.532																																																	0																																										SO:0001627	intron_variant	0			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.6774+182C>A	18.37:g.6972873G>T				RNA	SNP	-	NULL	ENST00000389658.3	37	NULL	CCDS32787.1	18																																																																																			RN7SL537P	-	-	ENSG00000265890		0.532	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RN7SL537P	HGNC	protein_coding	OTTHUMT00000257369.1	-	0.00	18	0	G	NM_005559		6972873	-1	tier1	-	no_errors	ENST00000584392	ensembl	human	known	74_37	rna	62.50	3	5	SNP	0.007	T
RNF213	57674	genome.wustl.edu	37	17	78341825	78341825	+	Missense_Mutation	SNP	G	G	A	rs397514563		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr17:78341825G>A	ENST00000582970.1	+	44	12180	c.12037G>A	c.(12037-12039)Gac>Aac	p.D4013N	CTD-2047H16.4_ENST00000572151.1_RNA|RNF213_ENST00000508628.2_Missense_Mutation_p.D4062N|RNF213_ENST00000336301.6_Missense_Mutation_p.D2086N|CTD-2047H16.4_ENST00000575034.1_RNA	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	4013			D -> N (variant detected in cases of Moyamoya disease in Caucasian populations). {ECO:0000269|PubMed:21799892}.		ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			TCTGCCCTGCGACCACGTGCA	0.562																																																	0													149.0	143.0	145.0					17																	78341825		2203	4300	6503	SO:0001583	missense	0			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.12037G>A	17.37:g.78341825G>A	ENSP00000464087:p.Asp4013Asn		C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	superfamily_P-loop_NTPase,smart_AAA+_ATPase,smart_Znf_RING,pfscan_Znf_RING	p.D4013N	ENST00000582970.1	37	c.12037	CCDS58606.1	17	.	.	.	.	.	.	.	.	.	.	G	16.19	3.052252	0.55218	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T;T	0.25912	1.77;2.33	4.67	4.67	0.58626	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.413735	0.26503	N	0.024003	T	0.21227	0.0511	L	0.31664	0.95	0.30154	N	0.802756	D;P	0.56287	0.975;0.473	P;B	0.45753	0.492;0.095	T	0.06463	-1.0825	10	0.45353	T	0.12	.	9.8622	0.41120	0.102:0.0:0.898:0.0	.	4062;2086	C9JCP4;Q63HN8	.;RN213_HUMAN	N	4013;4062;2086	ENSP00000425956:D4013N;ENSP00000338218:D2086N	ENSP00000338218:D2086N	D	+	1	0	RNF213	75956420	1.000000	0.71417	0.955000	0.39395	0.690000	0.40134	3.227000	0.51262	2.419000	0.82065	0.655000	0.94253	GAC	RNF213	-	smart_Znf_RING,pfscan_Znf_RING	ENSG00000173821		0.562	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	HGNC	protein_coding	OTTHUMT00000443298.1	-	0.00	37	0	G	NM_020914		78341825	+1	tier1	-	no_errors	ENST00000582970	ensembl	human	known	74_37	missense	16.00	42	8	SNP	1.000	A
RSPH6A	81492	genome.wustl.edu	37	19	46317874	46317874	+	Silent	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr19:46317874G>T	ENST00000221538.3	-	1	703	c.561C>A	c.(559-561)gcC>gcA	p.A187A	SYMPK_ENST00000598155.1_5'Flank|RSPH6A_ENST00000597055.1_Silent_p.A187A	NM_030785.3	NP_110412.1	Q9H0K4	RSH6A_HUMAN	radial spoke head 6 homolog A (Chlamydomonas)	187						intracellular (GO:0005622)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	32						CAGGCACCTGGGCACTGTAGT	0.617																																																	0													41.0	41.0	41.0					19																	46317874		2203	4300	6503	SO:0001819	synonymous_variant	0			AL136761	CCDS12675.1	19q13.3	2010-02-17	2009-11-18	2009-11-18	ENSG00000104941	ENSG00000104941			14241	protein-coding gene	gene with protein product		607548	"""radial spokehead-like 1"""	RSHL1		11237735	Standard	NM_030785		Approved	RSP4, RSP6, RSPH4B	uc002pdm.3	Q9H0K4		ENST00000221538.3:c.561C>A	19.37:g.46317874G>T			Q53FE2|Q6PEZ9	Silent	SNP	pfam_Radial_spoke	p.A187	ENST00000221538.3	37	c.561	CCDS12675.1	19																																																																																			RSPH6A	-	NULL	ENSG00000104941		0.617	RSPH6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPH6A	HGNC	protein_coding	OTTHUMT00000461657.1	-	0.00	118	0	G			46317874	-1	tier1	-	no_errors	ENST00000221538	ensembl	human	known	74_37	silent	15.57	103	19	SNP	0.000	T
RTN1	6252	genome.wustl.edu	37	14	60193978	60193978	+	Missense_Mutation	SNP	G	G	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr14:60193978G>A	ENST00000267484.5	-	3	1759	c.1424C>T	c.(1423-1425)tCg>tTg	p.S475L		NM_021136.2	NP_066959.1	Q16799	RTN1_HUMAN	reticulon 1	475					neuron differentiation (GO:0030182)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)				central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(30)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		CTCCGAGGCCGAGGAGGCGTC	0.697																																																	0													7.0	8.0	8.0					14																	60193978		2155	4208	6363	SO:0001583	missense	0			L10333	CCDS9740.1, CCDS9741.1	14q21-q22	2008-08-29			ENSG00000139970	ENSG00000139970			10467	protein-coding gene	gene with protein product		600865	"""neuroendocrine-specific protein"""	NSP		8275708	Standard	NM_206852		Approved		uc001xen.1	Q16799	OTTHUMG00000028947	ENST00000267484.5:c.1424C>T	14.37:g.60193978G>A	ENSP00000267484:p.Ser475Leu		Q16800|Q16801|Q5BKZ4|Q9BQ59	Missense_Mutation	SNP	pfam_Reticulon,pfscan_Reticulon	p.S475L	ENST00000267484.5	37	c.1424	CCDS9740.1	14	.	.	.	.	.	.	.	.	.	.	G	22.0	4.236605	0.79800	.	.	ENSG00000139970	ENST00000432103;ENST00000267484;ENST00000433623	T	0.36520	1.25	5.37	4.48	0.54585	.	0.000000	0.45606	D	0.000343	T	0.57577	0.2063	M	0.68952	2.095	0.58432	D	0.999999	D	0.89917	1.0	D	0.80764	0.994	T	0.62120	-0.6921	10	0.87932	D	0	.	14.0062	0.64465	0.0733:0.0:0.9267:0.0	.	475	Q16799	RTN1_HUMAN	L	55;475;401	ENSP00000267484:S475L	ENSP00000267484:S475L	S	-	2	0	RTN1	59263731	1.000000	0.71417	0.961000	0.40146	0.734000	0.41952	9.257000	0.95545	1.273000	0.44346	-0.136000	0.14681	TCG	RTN1	-	NULL	ENSG00000139970		0.697	RTN1-001	KNOWN	basic|CCDS	protein_coding	RTN1	HGNC	protein_coding	OTTHUMT00000072278.2	-	0.00	46	0	G			60193978	-1	tier1	-	no_errors	ENST00000267484	ensembl	human	known	74_37	missense	70.45	13	31	SNP	0.998	A
RYR3	6263	genome.wustl.edu	37	15	34080575	34080575	+	Missense_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr15:34080575T>G	ENST00000389232.4	+	67	9816	c.9746T>G	c.(9745-9747)cTc>cGc	p.L3249R	RYR3_ENST00000415757.3_Missense_Mutation_p.L3249R	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	3249					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GAGGCAGAACTCCTCATCCTG	0.557																																																	0													87.0	94.0	92.0					15																	34080575		2047	4199	6246	SO:0001583	missense	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.9746T>G	15.37:g.34080575T>G	ENSP00000373884:p.Leu3249Arg		O15175|Q15412	Missense_Mutation	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.L3249R	ENST00000389232.4	37	c.9746	CCDS45210.1	15	.	.	.	.	.	.	.	.	.	.	T	14.74	2.624583	0.46840	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.97066	-4.23;-4.23	4.4	4.4	0.53042	.	0.000000	0.64402	D	0.000002	D	0.97294	0.9115	L	0.49350	1.555	0.52099	D	0.999941	D;D	0.89917	0.999;1.0	D;D	0.91635	0.974;0.999	D	0.97210	0.9870	10	0.66056	D	0.02	.	10.2861	0.43568	0.0:0.0:0.1656:0.8344	.	3249;3249	Q15413-2;Q15413	.;RYR3_HUMAN	R	3249	ENSP00000373884:L3249R;ENSP00000399610:L3249R	ENSP00000354735:L3249R	L	+	2	0	RYR3	31867867	1.000000	0.71417	0.987000	0.45799	0.268000	0.26511	5.990000	0.70595	1.980000	0.57719	0.533000	0.62120	CTC	RYR3	-	superfamily_ARM-type_fold	ENSG00000198838		0.557	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	-	0.00	74	0	T			34080575	+1	tier1	-	no_errors	ENST00000389232	ensembl	human	known	74_37	missense	20.75	41	11	SNP	0.999	G
SCN10A	6336	genome.wustl.edu	37	3	38748813	38748813	+	Missense_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr3:38748813T>G	ENST00000449082.2	-	25	4342	c.4343A>C	c.(4342-4344)aAg>aCg	p.K1448T		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	1448					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	GGAGCCCAACTTCTTCATGGC	0.532																																																	0													138.0	144.0	142.0					3																	38748813		2203	4300	6503	SO:0001583	missense	0			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.4343A>C	3.37:g.38748813T>G	ENSP00000390600:p.Lys1448Thr		A6NDQ1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_asu,prints_PKD_2	p.K1448T	ENST00000449082.2	37	c.4343	CCDS33736.1	3	.	.	.	.	.	.	.	.	.	.	T	21.2	4.118875	0.77323	.	.	ENSG00000185313	ENST00000449082	D	0.96104	-3.91	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	D	0.97807	0.9280	M	0.93283	3.4	0.45791	D	0.998674	D	0.71674	0.998	P	0.62740	0.906	D	0.98413	1.0573	10	0.87932	D	0	.	10.9645	0.47403	0.0:0.0754:0.0:0.9245	.	1448	Q9Y5Y9	SCNAA_HUMAN	T	1448	ENSP00000390600:K1448T	ENSP00000390600:K1448T	K	-	2	0	SCN10A	38723817	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.080000	0.71299	2.113000	0.64589	0.533000	0.62120	AAG	SCN10A	-	NULL	ENSG00000185313		0.532	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN10A	HGNC	protein_coding	OTTHUMT00000109745.3	-	0.00	84	0	T	NM_006514		38748813	-1	tier1	-	no_errors	ENST00000449082	ensembl	human	known	74_37	missense	34.04	31	16	SNP	1.000	G
SCN9A	6335	genome.wustl.edu	37	2	167085307	167085307	+	Missense_Mutation	SNP	C	C	A	rs200566017		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:167085307C>A	ENST00000409435.1	-	21	4099	c.4100G>T	c.(4099-4101)cGt>cTt	p.R1367L	SCN9A_ENST00000375387.4_Missense_Mutation_p.R1368L|SCN9A_ENST00000303354.6_Missense_Mutation_p.R1368L|SCN9A_ENST00000409672.1_Missense_Mutation_p.R1356L|AC010127.3_ENST00000447809.2_RNA			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	1367					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)	p.R1356H(1)|p.R1356L(1)		NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ACATTCGGAACGATTTGGAAC	0.398																																																	2	Substitution - Missense(2)	lung(1)|prostate(1)											230.0	231.0	231.0					2																	167085307		2007	4200	6207	SO:0001583	missense	0			X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.4100G>T	2.37:g.167085307C>A	ENSP00000386330:p.Arg1367Leu		A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2	p.R1368L	ENST00000409435.1	37	c.4103	CCDS46441.1	2	.	.	.	.	.	.	.	.	.	.	C	12.20	1.866532	0.32977	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435	D;D;D;D	0.95949	-3.83;-3.86;-3.86;-3.86	5.23	-0.341	0.12639	.	1.282520	0.05251	N	0.514045	D	0.91865	0.7425	L	0.52206	1.635	0.09310	N	1	B	0.09022	0.002	B	0.17722	0.019	T	0.78773	-0.2073	10	0.27082	T	0.32	.	4.0104	0.09619	0.1811:0.2568:0.0:0.5621	.	1356	E7EUN6	.	L	1356;1368;1368;1367	ENSP00000386306:R1356L;ENSP00000364536:R1368L;ENSP00000304748:R1368L;ENSP00000386330:R1367L	ENSP00000304748:R1368L	R	-	2	0	SCN9A	166793553	0.002000	0.14202	0.001000	0.08648	0.727000	0.41649	1.311000	0.33562	0.233000	0.21120	0.557000	0.71058	CGT	SCN9A	-	pfam_Ion_trans_dom	ENSG00000169432		0.398	SCN9A-004	KNOWN	basic|CCDS	protein_coding	SCN9A	HGNC	protein_coding	OTTHUMT00000333639.1	-	0.00	109	0	C	NM_002977		167085307	-1	tier1	-	no_errors	ENST00000303354	ensembl	human	known	74_37	missense	20.83	76	20	SNP	0.003	A
SCN9A	6335	genome.wustl.edu	37	2	167129052	167129052	+	Missense_Mutation	SNP	A	A	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:167129052A>C	ENST00000409435.1	-	16	3207	c.3208T>G	c.(3208-3210)Ttg>Gtg	p.L1070V	SCN9A_ENST00000375387.4_Missense_Mutation_p.L1071V|SCN9A_ENST00000303354.6_Missense_Mutation_p.L1071V|SCN9A_ENST00000409672.1_Missense_Mutation_p.L1059V|AC010127.3_ENST00000447809.2_RNA			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	1070					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TCTTCCATCAAGTGTTTGTCC	0.408																																																	0													121.0	116.0	117.0					2																	167129052		1941	4144	6085	SO:0001583	missense	0			X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.3208T>G	2.37:g.167129052A>C	ENSP00000386330:p.Leu1070Val		A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2	p.L1071V	ENST00000409435.1	37	c.3211	CCDS46441.1	2	.	.	.	.	.	.	.	.	.	.	A	0.904	-0.721365	0.03182	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435	D;D;D;D	0.83591	-1.74;-1.74;-1.74;-1.74	5.42	-0.798	0.10905	.	0.625784	0.13552	N	0.379397	T	0.52661	0.1748	N	0.04880	-0.145	0.20703	N	0.999869	B	0.02656	0.0	B	0.11329	0.006	T	0.46373	-0.9196	10	0.02654	T	1	.	0.3572	0.00358	0.3664:0.1331:0.1725:0.328	.	1059	E7EUN6	.	V	1059;1071;1071;1070	ENSP00000386306:L1059V;ENSP00000364536:L1071V;ENSP00000304748:L1071V;ENSP00000386330:L1070V	ENSP00000304748:L1071V	L	-	1	2	SCN9A	166837298	0.153000	0.22777	0.965000	0.40720	0.757000	0.42996	0.231000	0.17872	0.093000	0.17368	0.533000	0.62120	TTG	SCN9A	-	pfam_Na_trans_assoc	ENSG00000169432		0.408	SCN9A-004	KNOWN	basic|CCDS	protein_coding	SCN9A	HGNC	protein_coding	OTTHUMT00000333639.1	-	0.00	112	0	A	NM_002977		167129052	-1	tier1	-	no_errors	ENST00000303354	ensembl	human	known	74_37	missense	30.43	64	28	SNP	0.797	C
SCNN1A	6337	genome.wustl.edu	37	12	6457893	6457893	+	Splice_Site	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr12:6457893C>A	ENST00000228916.2	-	12	1727	c.1629G>T	c.(1627-1629)acG>acT	p.T543T	SCNN1A_ENST00000396966.2_3'UTR|SCNN1A_ENST00000540037.1_Splice_Site_p.T243T|SCNN1A_ENST00000358945.3_Splice_Site_p.T565T|SCNN1A_ENST00000360168.3_Splice_Site_p.T602T|SCNN1A_ENST00000543768.1_Splice_Site_p.T566T	NM_001038.5	NP_001029.1	P37088	SCNNA_HUMAN	sodium channel, non-voltage-gated 1 alpha subunit	543					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ciliary membrane (GO:0060170)|cortical actin cytoskeleton (GO:0030864)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|WW domain binding (GO:0050699)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(2)|lung(6)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	27					Amiloride(DB00594)|Triamterene(DB00384)	CACGACCTACCGTGACAGAGG	0.542																																																	0													128.0	115.0	119.0					12																	6457893		2203	4300	6503	SO:0001630	splice_region_variant	0			Z92978	CCDS8543.1, CCDS53738.1, CCDS53739.1	12p13	2012-02-28	2012-02-28		ENSG00000111319	ENSG00000111319		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10599	protein-coding gene	gene with protein product		600228	"""sodium channel, nonvoltage-gated 1 alpha"", ""sodium channel, non-voltage-gated 1 alpha"""	SCNN1		7896277	Standard	NM_001038		Approved	ENaCalpha	uc001qnw.3	P37088	OTTHUMG00000168268	ENST00000228916.2:c.1629+1G>T	12.37:g.6457893C>A			A5X2U9|B4E2Q5|C5HTZ0|O43271|Q6GSQ6|Q9UM64	Silent	SNP	pfam_Na+channel_ASC,prints_Na+channel_ASC,tigrfam_EnaC	p.T565	ENST00000228916.2	37	c.1695	CCDS8543.1	12																																																																																			SCNN1A	-	pfam_Na+channel_ASC,prints_Na+channel_ASC	ENSG00000111319		0.542	SCNN1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SCNN1A	HGNC	protein_coding	OTTHUMT00000399055.1		0.00	52	0	C		Silent	6457893	-1			no_errors	ENST00000358945	ensembl	human	known	74_37	silent	6.78	54	4	SNP	1.000	A
SCRIB	23513	genome.wustl.edu	37	8	144891096	144891096	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr8:144891096G>T	ENST00000320476.3	-	15	1804	c.1798C>A	c.(1798-1800)Cag>Aag	p.Q600K	SCRIB_ENST00000377533.3_Missense_Mutation_p.Q519K|SCRIB_ENST00000356994.2_Missense_Mutation_p.Q600K	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein	600	Sufficient for targeting to adherens junction and to inhibit cell proliferation.				activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)				NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			ATGAGCCGCTGCCTCCCGCCT	0.652																																					Pancreas(51;966 1133 10533 14576 29674)												0													73.0	75.0	74.0					8																	144891096		2203	4300	6503	SO:0001583	missense	0			AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154	ENST00000320476.3:c.1798C>A	8.37:g.144891096G>T	ENSP00000322938:p.Gln600Lys		Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	Missense_Mutation	SNP	pfam_PDZ,pfam_Leu-rich_rpt,superfamily_PDZ,smart_Leu-rich_rpt_typical-subtyp,smart_PDZ,pfscan_PDZ	p.Q600K	ENST00000320476.3	37	c.1798	CCDS6411.1	8	.	.	.	.	.	.	.	.	.	.	g	21.2	4.106686	0.77096	.	.	ENSG00000180900	ENST00000356994;ENST00000320476;ENST00000377533	T;T;T	0.37235	1.43;1.41;1.21	4.79	4.79	0.61399	.	.	.	.	.	T	0.56381	0.1981	M	0.65498	2.005	0.47094	D	0.999312	D;P	0.64830	0.994;0.811	D;B	0.70227	0.968;0.425	T	0.52079	-0.8623	9	0.22706	T	0.39	.	16.8367	0.85958	0.0:0.0:1.0:0.0	.	600;600	Q14160;Q14160-3	SCRIB_HUMAN;.	K	600;600;519	ENSP00000349486:Q600K;ENSP00000322938:Q600K;ENSP00000366756:Q519K	ENSP00000322938:Q600K	Q	-	1	0	SCRIB	144963084	1.000000	0.71417	0.802000	0.32245	0.890000	0.51754	7.389000	0.79806	2.225000	0.72522	0.401000	0.26515	CAG	SCRIB	-	NULL	ENSG00000180900		0.652	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SCRIB	HGNC	protein_coding	OTTHUMT00000382215.1		0.00	28	0	G	NM_015356		144891096	-1			no_errors	ENST00000320476	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	T
SEPT10	151011	genome.wustl.edu	37	2	110342897	110342897	+	Splice_Site	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:110342897C>A	ENST00000397712.2	-	4	597	c.219G>T	c.(217-219)ggG>ggT	p.G73G	SEPT10_ENST00000545389.1_Intron|SEPT10_ENST00000437928.1_Splice_Site_p.G58G|SEPT10_ENST00000415095.1_Splice_Site_p.G73G|SEPT10_ENST00000334001.6_Intron|SEPT10_ENST00000397714.2_Splice_Site_p.G50G|SEPT10_ENST00000356688.4_Splice_Site_p.G73G	NM_144710.3	NP_653311.1	Q9P0V9	SEP10_HUMAN	septin 10	73	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)	septin complex (GO:0031105)	GTP binding (GO:0005525)			breast(2)|endometrium(3)|large_intestine(4)|lung(8)|prostate(1)	18						TTCCAGTTTCCCCTGAAACAC	0.333																																																	0													89.0	85.0	86.0					2																	110342897		1847	4093	5940	SO:0001630	splice_region_variant	0			AF146760	CCDS42726.1, CCDS46383.1	2q13	2013-01-21			ENSG00000186522	ENSG00000186522		"""Septins"""	14349	protein-coding gene	gene with protein product	"""sept1-like"""	611737				12711328	Standard	NM_144710		Approved	FLJ11619	uc002tew.4	Q9P0V9	OTTHUMG00000154957	ENST00000397712.2:c.218-1G>T	2.37:g.110342897C>A			B3KRQ9|Q86VP5|Q9HAH6	Silent	SNP	pfam_Cell_div_GTP-bd,superfamily_P-loop_NTPase,pirsf_Septin	p.G73	ENST00000397712.2	37	c.219	CCDS46383.1	2																																																																																			SEPT10	-	pfam_Cell_div_GTP-bd,superfamily_P-loop_NTPase,pirsf_Septin	ENSG00000186522		0.333	SEPT10-001	KNOWN	basic|CCDS	protein_coding	SEPT10	HGNC	protein_coding	OTTHUMT00000337804.1	-	0.00	17	0	C	NM_144710	Silent	110342897	-1	tier1	-	no_errors	ENST00000397712	ensembl	human	known	74_37	silent	18.18	18	4	SNP	0.998	A
SETBP1	26040	genome.wustl.edu	37	18	42281579	42281579	+	Missense_Mutation	SNP	G	G	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr18:42281579G>C	ENST00000282030.5	+	2	564	c.268G>C	c.(268-270)Gaa>Caa	p.E90Q	SETBP1_ENST00000426838.4_Missense_Mutation_p.E90Q	NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	90						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		GGAAGAGCAGGAATTTTCTAT	0.498									Schinzel-Giedion syndrome																																								0													111.0	104.0	106.0					18																	42281579		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.268G>C	18.37:g.42281579G>C	ENSP00000282030:p.Glu90Gln		A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	smart_AT_hook_DNA-bd_motif	p.E90Q	ENST00000282030.5	37	c.268	CCDS11923.2	18	.	.	.	.	.	.	.	.	.	.	G	20.3	3.964797	0.74131	.	.	ENSG00000152217	ENST00000426838;ENST00000282030;ENST00000552979	T	0.68025	-0.3	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.73102	0.3544	L	0.31065	0.9	0.46774	D	0.999197	P;D	0.89917	0.926;1.0	P;D	0.80764	0.853;0.994	T	0.66248	-0.5971	10	0.16896	T	0.51	.	19.8326	0.96642	0.0:0.0:1.0:0.0	.	90;90	Q9Y6X0;Q9Y6X0-2	SETBP_HUMAN;.	Q	90	ENSP00000282030:E90Q	ENSP00000282030:E90Q	E	+	1	0	SETBP1	40535577	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.810000	0.86072	2.686000	0.91538	0.591000	0.81541	GAA	SETBP1	-	NULL	ENSG00000152217		0.498	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETBP1	HGNC	protein_coding	OTTHUMT00000255854.4	-	0.00	55	0	G	NM_001130110		42281579	+1	tier1	-	no_errors	ENST00000282030	ensembl	human	known	74_37	missense	20.00	24	6	SNP	1.000	C
SLC11A1	6556	genome.wustl.edu	37	2	219255998	219255998	+	Silent	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:219255998C>T	ENST00000233202.6	+	10	1372	c.1032C>T	c.(1030-1032)gaC>gaT	p.D344D	SLC11A1_ENST00000539932.1_Silent_p.D226D	NM_000578.3	NP_000569.3	P49279	NRAM1_HUMAN	solute carrier family 11 (proton-coupled divalent metal ion transporter), member 1	344					activation of protein kinase activity (GO:0032147)|antigen processing and presentation of peptide antigen (GO:0048002)|cadmium ion transmembrane transport (GO:0070574)|cellular cadmium ion homeostasis (GO:0006876)|cellular iron ion homeostasis (GO:0006879)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|defense response to protozoan (GO:0042832)|divalent metal ion export (GO:0070839)|inflammatory response (GO:0006954)|interaction with host (GO:0051701)|interleukin-2 production (GO:0032623)|interleukin-3 production (GO:0032632)|iron ion homeostasis (GO:0055072)|iron ion transport (GO:0006826)|L-arginine import (GO:0043091)|macrophage activation (GO:0042116)|manganese ion transport (GO:0006828)|MHC class II biosynthetic process (GO:0045342)|mRNA stabilization (GO:0048255)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of cytokine production (GO:0001818)|nitrite transport (GO:0015707)|phagocytosis (GO:0006909)|phagosome maturation (GO:0090382)|positive regulation of cytokine production (GO:0001819)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of gene expression (GO:0010628)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of phagocytosis (GO:0050766)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein import into nucleus, translocation (GO:0000060)|respiratory burst (GO:0045730)|response to bacterium (GO:0009617)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)|T cell cytokine production (GO:0002369)|T cell proliferation involved in immune response (GO:0002309)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)|wound healing (GO:0042060)	cell outer membrane (GO:0009279)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|late endosome membrane (GO:0031902)|lysosome (GO:0005764)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|tertiary granule membrane (GO:0070821)	manganese ion transmembrane transporter activity (GO:0005384)|metal ion:proton antiporter activity (GO:0051139)|protein homodimerization activity (GO:0042803)|transition metal ion transmembrane transporter activity (GO:0046915)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	19		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000195)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGGCCGTGGACATTTACCAGG	0.642																																																	0													62.0	53.0	56.0					2																	219255998		2203	4300	6503	SO:0001819	synonymous_variant	0			D38171	CCDS2415.1	2q35	2013-07-18	2013-07-18		ENSG00000018280	ENSG00000018280		"""Solute carriers"""	10907	protein-coding gene	gene with protein product	"""natural resistance-associated macrophage protein 1"""	600266		LSH, NRAMP, NRAMP1		7964458, 7980580	Standard	NM_000578		Approved		uc002vhv.3	P49279	OTTHUMG00000086747	ENST00000233202.6:c.1032C>T	2.37:g.219255998C>T			C0H5Y3	Silent	SNP	pfam_NRAMP-like,prints_NRAMP-like,tigrfam_NRAMP-like	p.D344	ENST00000233202.6	37	c.1032	CCDS2415.1	2																																																																																			SLC11A1	-	pfam_NRAMP-like,tigrfam_NRAMP-like	ENSG00000018280		0.642	SLC11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC11A1	HGNC	protein_coding	OTTHUMT00000195076.2	-	0.00	87	0	C	NM_000578		219255998	+1	tier1	-	no_errors	ENST00000233202	ensembl	human	known	74_37	silent	37.04	68	40	SNP	1.000	T
SLC1A2	6506	genome.wustl.edu	37	11	35314032	35314032	+	Missense_Mutation	SNP	C	C	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr11:35314032C>G	ENST00000278379.3	-	7	1175	c.893G>C	c.(892-894)gGa>gCa	p.G298A	SLC1A2_ENST00000395750.1_Missense_Mutation_p.G289A|SLC1A2_ENST00000395753.1_Missense_Mutation_p.G289A|SLC1A2_ENST00000606205.1_Missense_Mutation_p.G298A	NM_004171.3	NP_004162.2	P43004	EAA2_HUMAN	solute carrier family 1 (glial high affinity glutamate transporter), member 2	298					adult behavior (GO:0030534)|cellular response to extracellular stimulus (GO:0031668)|D-aspartate import (GO:0070779)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|multicellular organism growth (GO:0035264)|multicellular organismal aging (GO:0010259)|positive regulation of glucose import (GO:0046326)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to wounding (GO:0009611)|synaptic transmission (GO:0007268)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)|visual behavior (GO:0007632)	axolemma (GO:0030673)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glutamate:sodium symporter activity (GO:0015501)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(1)|urinary_tract(1)	24	all_lung(20;0.211)|all_epithelial(35;0.234)	all_hematologic(20;0.109)	STAD - Stomach adenocarcinoma(6;0.00731)			AATGATCTTTCCACAGATCAG	0.478																																					NSCLC(100;1273 1575 12993 16869 47409)|Ovarian(164;45 1946 8965 30452 48454)												0													131.0	112.0	118.0					11																	35314032		2202	4298	6500	SO:0001583	missense	0			AB209444	CCDS31459.1, CCDS55756.1	11p13-p12	2013-05-22			ENSG00000110436	ENSG00000110436		"""Solute carriers"""	10940	protein-coding gene	gene with protein product		600300				1448170	Standard	NM_004171		Approved	GLT-1, EAAT2	uc001mwd.3	P43004	OTTHUMG00000044391	ENST00000278379.3:c.893G>C	11.37:g.35314032C>G	ENSP00000278379:p.Gly298Ala		B4DQE9|Q14417|Q541G6|U3KQQ4	Missense_Mutation	SNP	pfam_Na-dicarboxylate_symporter,prints_Na-dicarboxylate_symporter	p.G298A	ENST00000278379.3	37	c.893	CCDS31459.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.5|22.5	4.302611|4.302611	0.81136|0.81136	.|.	.|.	ENSG00000110436|ENSG00000110436	ENST00000531628|ENST00000278379;ENST00000395750;ENST00000395753	.|T;T;T	.|0.57595	.|0.39;0.39;0.39	5.49|5.49	5.49|5.49	0.81192|0.81192	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.63988|0.63988	0.2558|0.2558	L|L	0.48986|0.48986	1.54|1.54	0.80722|0.80722	D|D	1|1	.|P;P	.|0.45827	.|0.838;0.867	.|P;P	.|0.55303	.|0.557;0.773	T|T	0.59451|0.59451	-0.7452|-0.7452	5|10	.|0.36615	.|T	.|0.2	-13.4639|-13.4639	19.3676|19.3676	0.94469|0.94469	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|298;298	.|B4DQE9;P43004	.|.;EAA2_HUMAN	Q|A	16|298;289;289	.|ENSP00000278379:G298A;ENSP00000379099:G289A;ENSP00000379102:G289A	.|ENSP00000278379:G298A	E|G	-|-	1|2	0|0	SLC1A2|SLC1A2	35270608|35270608	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.974000|0.974000	0.67602|0.67602	7.818000|7.818000	0.86416|0.86416	2.572000|2.572000	0.86782|0.86782	0.655000|0.655000	0.94253|0.94253	GAA|GGA	SLC1A2	-	pfam_Na-dicarboxylate_symporter,prints_Na-dicarboxylate_symporter	ENSG00000110436		0.478	SLC1A2-001	KNOWN	basic|CCDS	protein_coding	SLC1A2	HGNC	protein_coding	OTTHUMT00000258181.1	-	0.00	42	0	C	NM_004171		35314032	-1	tier1	-	no_errors	ENST00000278379	ensembl	human	known	74_37	missense	7.58	61	5	SNP	1.000	G
SLC26A7	115111	genome.wustl.edu	37	8	92410322	92410322	+	3'UTR	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr8:92410322T>G	ENST00000276609.3	+	0	5207				SLC26A7_ENST00000520249.1_3'UTR	NM_001282356.1|NM_052832.2	NP_001269285.1|NP_439897.1			solute carrier family 26 (anion exchanger), member 7											breast(1)|cervix(1)|endometrium(4)|large_intestine(10)|lung(26)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	50			BRCA - Breast invasive adenocarcinoma(11;0.00802)			TTGTACTAACTCAGCATGTAA	0.239																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF331521	CCDS6254.1, CCDS6255.1, CCDS75765.1	8q23	2013-07-18	2013-07-18		ENSG00000147606	ENSG00000147606		"""Solute carriers"""	14467	protein-coding gene	gene with protein product		608479	"""solute carrier family 26, member 7"""			11834742, 11829495, 16524946	Standard	NM_134266		Approved	SUT2	uc003yez.3	Q8TE54	OTTHUMG00000164062	ENST00000276609.3:c.*2997T>G	8.37:g.92410322T>G				RNA	SNP	-	NULL	ENST00000276609.3	37	NULL	CCDS6254.1	8																																																																																			SLC26A7	-	-	ENSG00000147606		0.239	SLC26A7-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC26A7	HGNC	protein_coding	OTTHUMT00000377011.1	-	0.00	81	0	T			92410322	+1	tier1	-	no_errors	ENST00000520249	ensembl	human	known	74_37	rna	21.77	112	32	SNP	0.996	G
SLC2A12	154091	genome.wustl.edu	37	6	134350159	134350159	+	Silent	SNP	C	C	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr6:134350159C>G	ENST00000275230.5	-	2	959	c.804G>C	c.(802-804)ctG>ctC	p.L268L		NM_145176.2	NP_660159.1	Q8TD20	GTR12_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 12	268					glucose transport (GO:0015758)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			NS(1)|breast(1)|large_intestine(6)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	17	Breast(56;0.214)|Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0101)|GBM - Glioblastoma multiforme(68;0.0123)		TTGAACGAAACAGATCCCAAA	0.388																																					Melanoma(122;1663 1672 14489 35294 41228)												0													88.0	84.0	86.0					6																	134350159		2203	4300	6503	SO:0001819	synonymous_variant	0			AL035699	CCDS5169.1	6q23.2	2013-05-22			ENSG00000146411	ENSG00000146411		"""Solute carriers"""	18067	protein-coding gene	gene with protein product		610372				11780753, 11832379	Standard	XM_006715349		Approved	GLUT12, GLUT8	uc003qem.1	Q8TD20	OTTHUMG00000015611	ENST00000275230.5:c.804G>C	6.37:g.134350159C>G			B3KV17|Q7Z6U3|Q96MR8	Silent	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,prints_Sugar/inositol_transpt	p.L268	ENST00000275230.5	37	c.804	CCDS5169.1	6																																																																																			SLC2A12	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000146411		0.388	SLC2A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A12	HGNC	protein_coding	OTTHUMT00000042302.1	-	0.00	86	0	C			134350159	-1	tier1	-	no_errors	ENST00000275230	ensembl	human	known	74_37	silent	38.71	35	24	SNP	1.000	G
SLC35F3	148641	genome.wustl.edu	37	1	234458986	234458986	+	Silent	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr1:234458986C>T	ENST00000366617.3	+	7	1491	c.1263C>T	c.(1261-1263)cgC>cgT	p.R421R	SLC35F3_ENST00000366618.3_Silent_p.R490R			Q8IY50	S35F3_HUMAN	solute carrier family 35, member F3	421					thiamine transport (GO:0015888)	integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|urinary_tract(1)	32	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)			CCTTCGCCCGCTAACACCACT	0.562											OREG0014330	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													41.0	38.0	39.0					1																	234458986		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS1600.1, CCDS73050.1	1q42.3	2013-05-22			ENSG00000183780	ENSG00000183780		"""Solute carriers"""	23616	protein-coding gene	gene with protein product							Standard	XM_005273070		Approved	FLJ37712	uc001hvy.1	Q8IY50	OTTHUMG00000037929	ENST00000366617.3:c.1263C>T	1.37:g.234458986C>T		2373	Q5TDD6|Q8N9C9	Silent	SNP	pfam_DMT,pfam_Tpt_PEP_trans_dom,pfam_SLC35_F1/F2/F6	p.R421	ENST00000366617.3	37	c.1263		1																																																																																			SLC35F3	-	NULL	ENSG00000183780		0.562	SLC35F3-002	KNOWN	basic|appris_candidate	protein_coding	SLC35F3	HGNC	protein_coding	OTTHUMT00000128322.1	-	0.00	27	0	C	NM_173508		234458986	+1	tier1	-	no_errors	ENST00000366617	ensembl	human	known	74_37	silent	30.77	18	8	SNP	1.000	T
SLC39A14	23516	genome.wustl.edu	37	8	22262237	22262237	+	Missense_Mutation	SNP	T	T	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr8:22262237T>A	ENST00000381237.1	+	2	133	c.14T>A	c.(13-15)cTg>cAg	p.L5Q	SLC39A14_ENST00000240095.6_Missense_Mutation_p.L5Q|SLC39A14_ENST00000289952.5_Missense_Mutation_p.L5Q|SLC39A14_ENST00000359741.5_Missense_Mutation_p.L5Q	NM_001128431.2	NP_001121903.1	Q15043	S39AE_HUMAN	solute carrier family 39 (zinc transporter), member 14	5					cellular zinc ion homeostasis (GO:0006882)|transmembrane transport (GO:0055085)|zinc ion transmembrane import (GO:0071578)|zinc ion transmembrane transport (GO:0071577)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ferrous iron transmembrane transporter activity (GO:0015093)|zinc ion transmembrane transporter activity (GO:0005385)			NS(1)|endometrium(4)|large_intestine(2)|lung(4)|prostate(1)	12				Colorectal(74;0.019)|COAD - Colon adenocarcinoma(73;0.0731)		AAGCTGCTGCTGCTGCACCCG	0.617																																																	0													65.0	82.0	76.0					8																	22262237		2197	4300	6497	SO:0001583	missense	0			D31887	CCDS6030.1, CCDS47822.1, CCDS47823.1	8p21.2	2013-05-22			ENSG00000104635	ENSG00000104635		"""Solute carriers"""	20858	protein-coding gene	gene with protein product		608736	"""solute carrier family 39 (metal ion transporter), member 14"""			12659941	Standard	NM_015359		Approved	KIAA0062, NET34, ZIP14	uc011kzh.2	Q15043	OTTHUMG00000097791	ENST00000381237.1:c.14T>A	8.37:g.22262237T>A	ENSP00000370635:p.Leu5Gln		A6NH98|B4DIW3|B6EU88|D3DSR4|Q6ZME8|Q96BB3	Missense_Mutation	SNP	pfam_ZIP	p.L5Q	ENST00000381237.1	37	c.14	CCDS47823.1	8	.	.	.	.	.	.	.	.	.	.	-	13.53	2.263353	0.39995	.	.	ENSG00000104635	ENST00000359741;ENST00000520644;ENST00000240095;ENST00000381237;ENST00000289952;ENST00000524285;ENST00000520832;ENST00000519960;ENST00000522881;ENST00000517552	T;T;T;T;T;T;T;T;T;T	0.68181	-0.28;0.82;-0.31;-0.28;-0.28;0.82;0.63;0.82;0.82;0.82	.	.	.	.	1.107740	0.07078	N	0.836571	T	0.72716	0.3495	L	0.44542	1.39	0.09310	N	1	D;D;D	0.65815	0.991;0.984;0.995	D;D;D	0.78314	0.991;0.979;0.979	T	0.60372	-0.7276	8	0.87932	D	0	0.0011	.	.	.	.	5;5;5	Q15043-2;Q15043;B6EU88	.;S39AE_HUMAN;.	Q	5	ENSP00000352779:L5Q;ENSP00000428789:L5Q;ENSP00000240095:L5Q;ENSP00000370635:L5Q;ENSP00000289952:L5Q;ENSP00000430315:L5Q;ENSP00000428905:L5Q;ENSP00000430629:L5Q;ENSP00000429328:L5Q;ENSP00000430564:L5Q	ENSP00000240095:L5Q	L	+	2	0	SLC39A14	22318182	0.001000	0.12720	0.037000	0.18230	0.679000	0.39708	0.000000	0.12993	0.000000	0.14550	0.000000	0.15137	CTG	SLC39A14	-	NULL	ENSG00000104635		0.617	SLC39A14-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC39A14	HGNC	protein_coding	OTTHUMT00000215039.2		0.00	17	0	T	XM_046677		22262237	+1			no_errors	ENST00000359741	ensembl	human	known	74_37	missense	15.38	21	4	SNP	0.087	A
SLC39A14	23516	genome.wustl.edu	37	8	22275169	22275169	+	Missense_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr8:22275169T>G	ENST00000381237.1	+	8	1272	c.1153T>G	c.(1153-1155)Ttt>Gtt	p.F385V	SLC39A14_ENST00000240095.6_Missense_Mutation_p.F385V|SLC39A14_ENST00000289952.5_Missense_Mutation_p.F385V|SLC39A14_ENST00000359741.5_Missense_Mutation_p.F385V	NM_001128431.2	NP_001121903.1	Q15043	S39AE_HUMAN	solute carrier family 39 (zinc transporter), member 14	385					cellular zinc ion homeostasis (GO:0006882)|transmembrane transport (GO:0055085)|zinc ion transmembrane import (GO:0071578)|zinc ion transmembrane transport (GO:0071577)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ferrous iron transmembrane transporter activity (GO:0015093)|zinc ion transmembrane transporter activity (GO:0005385)			NS(1)|endometrium(4)|large_intestine(2)|lung(4)|prostate(1)	12				Colorectal(74;0.019)|COAD - Colon adenocarcinoma(73;0.0731)		TGTAGGAGACTTTGTCATCCT	0.532																																																	0													164.0	127.0	140.0					8																	22275169		2203	4300	6503	SO:0001583	missense	0			D31887	CCDS6030.1, CCDS47822.1, CCDS47823.1	8p21.2	2013-05-22			ENSG00000104635	ENSG00000104635		"""Solute carriers"""	20858	protein-coding gene	gene with protein product		608736	"""solute carrier family 39 (metal ion transporter), member 14"""			12659941	Standard	NM_015359		Approved	KIAA0062, NET34, ZIP14	uc011kzh.2	Q15043	OTTHUMG00000097791	ENST00000381237.1:c.1153T>G	8.37:g.22275169T>G	ENSP00000370635:p.Phe385Val		A6NH98|B4DIW3|B6EU88|D3DSR4|Q6ZME8|Q96BB3	Missense_Mutation	SNP	pfam_ZIP	p.F385V	ENST00000381237.1	37	c.1153	CCDS47823.1	8	.	.	.	.	.	.	.	.	.	.	T	24.4	4.528625	0.85706	.	.	ENSG00000104635	ENST00000359741;ENST00000240095;ENST00000381237;ENST00000289952	T;T;T;T	0.51574	0.7;0.7;0.7;0.7	6.17	6.17	0.99709	.	0.048258	0.85682	D	0.000000	T	0.66046	0.2750	M	0.69463	2.115	0.80722	D	1	D;P;P	0.54964	0.969;0.927;0.927	D;P;P	0.63793	0.918;0.842;0.842	T	0.67688	-0.5606	10	0.62326	D	0.03	-28.8676	15.8048	0.78491	0.0:0.0:0.0:1.0	.	385;385;385	Q15043-2;Q15043;B6EU88	.;S39AE_HUMAN;.	V	385	ENSP00000352779:F385V;ENSP00000240095:F385V;ENSP00000370635:F385V;ENSP00000289952:F385V	ENSP00000240095:F385V	F	+	1	0	SLC39A14	22331114	1.000000	0.71417	0.998000	0.56505	0.557000	0.35523	7.933000	0.87642	2.371000	0.80710	0.533000	0.62120	TTT	SLC39A14	-	pfam_ZIP	ENSG00000104635		0.532	SLC39A14-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC39A14	HGNC	protein_coding	OTTHUMT00000215039.2	-	0.00	46	0	T	XM_046677		22275169	+1	tier1	-	no_errors	ENST00000359741	ensembl	human	known	74_37	missense	23.94	54	17	SNP	1.000	G
SLC39A6	25800	genome.wustl.edu	37	18	33706858	33706858	+	Missense_Mutation	SNP	G	G	T	rs369589683		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr18:33706858G>T	ENST00000590986.1	-	2	402	c.113C>A	c.(112-114)cCg>cAg	p.P38Q	SLC39A6_ENST00000440549.2_Intron|ELP2_ENST00000358232.6_5'Flank|ELP2_ENST00000351393.6_5'Flank|SLC39A6_ENST00000269187.5_Missense_Mutation_p.P38Q			Q13433	S39A6_HUMAN	solute carrier family 39 (zinc transporter), member 6	38					cellular zinc ion homeostasis (GO:0006882)|transmembrane transport (GO:0055085)|zinc ion transmembrane import (GO:0071578)|zinc ion transmembrane transport (GO:0071577)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|lamellipodium membrane (GO:0031258)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	41						TTCCCAATTCGGACTAATTTT	0.413																																																	0													106.0	100.0	102.0					18																	33706858		1846	4092	5938	SO:0001583	missense	0			U41060	CCDS42428.1, CCDS45854.1	18q12.2	2013-05-22				ENSG00000141424		"""Solute carriers"""	18607	protein-coding gene	gene with protein product		608731	"""solute carrier family 39 (metal ion transporter), member 6"""			12659941, 12839489	Standard	NM_012319		Approved	LIV-1	uc010dmy.3	Q13433		ENST00000590986.1:c.113C>A	18.37:g.33706858G>T	ENSP00000465915:p.Pro38Gln		B4DR49|B4E224|Q8IXR3|Q96HP5	Missense_Mutation	SNP	pfam_ZIP	p.P38Q	ENST00000590986.1	37	c.113	CCDS42428.1	18	.	.	.	.	.	.	.	.	.	.	G	11.15	1.552686	0.27739	.	.	ENSG00000141424	ENST00000269187	T	0.22134	1.97	5.78	3.98	0.46160	.	0.820528	0.11355	N	0.572581	T	0.16769	0.0403	L	0.39898	1.24	0.09310	N	0.999999	B	0.29716	0.255	B	0.30943	0.122	T	0.28332	-1.0047	10	0.35671	T	0.21	0.9091	4.8873	0.13710	0.0801:0.1482:0.6184:0.1533	.	38	Q13433	S39A6_HUMAN	Q	38	ENSP00000269187:P38Q	ENSP00000269187:P38Q	P	-	2	0	SLC39A6	31960856	0.027000	0.19231	0.007000	0.13788	0.833000	0.47200	0.623000	0.24447	0.773000	0.33404	0.561000	0.74099	CCG	SLC39A6	-	NULL	ENSG00000141424		0.413	SLC39A6-004	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	SLC39A6	HGNC	protein_coding	OTTHUMT00000444136.1		0.00	74	0	G			33706858	-1			no_errors	ENST00000269187	ensembl	human	known	74_37	missense	10.53	17	2	SNP	0.010	T
SLC44A5	204962	genome.wustl.edu	37	1	75684212	75684212	+	Nonsense_Mutation	SNP	G	G	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr1:75684212G>A	ENST00000370855.5	-	17	1605	c.1492C>T	c.(1492-1494)Cga>Tga	p.R498*	SLC44A5_ENST00000370859.3_Nonsense_Mutation_p.R498*|SLC44A5_ENST00000535611.1_Nonsense_Mutation_p.R368*	NM_152697.4	NP_689910.2	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5	498					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				kidney(1)|large_intestine(13)|lung(35)|ovary(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61						AGTGGATATCGTGGGATGTCA	0.428																																																	0													166.0	155.0	159.0					1																	75684212		2203	4300	6503	SO:0001587	stop_gained	0			BC034580	CCDS667.1, CCDS44164.1	1p31.1	2013-05-22			ENSG00000137968	ENSG00000137968		"""Solute carriers"""	28524	protein-coding gene	gene with protein product						15715662	Standard	NM_152697		Approved	MGC34032, CTL5	uc001dgu.3	Q8NCS7	OTTHUMG00000009721	ENST00000370855.5:c.1492C>T	1.37:g.75684212G>A	ENSP00000359892:p.Arg498*		B5MCU3|Q4G0K0|Q8NA44|Q8NB86	Nonsense_Mutation	SNP	pfam_Choline_transptr-like	p.R498*	ENST00000370855.5	37	c.1492	CCDS667.1	1	.	.	.	.	.	.	.	.	.	.	G	36	5.869669	0.97049	.	.	ENSG00000137968	ENST00000370859;ENST00000536707;ENST00000370855;ENST00000535611;ENST00000535790	.	.	.	5.6	2.68	0.31781	.	0.392641	0.30584	N	0.009320	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	-2.0654	3.1286	0.06415	0.2097:0.1205:0.546:0.1238	.	.	.	.	X	498;537;498;368;491	.	ENSP00000359892:R498X	R	-	1	2	SLC44A5	75456800	0.081000	0.21417	0.937000	0.37676	0.351000	0.29236	-0.048000	0.11944	0.850000	0.35239	0.655000	0.94253	CGA	SLC44A5	-	pfam_Choline_transptr-like	ENSG00000137968		0.428	SLC44A5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC44A5	HGNC	protein_coding	OTTHUMT00000026921.1	-	0.00	95	0	G	NM_152697		75684212	-1	tier1	-	no_errors	ENST00000370855	ensembl	human	known	74_37	nonsense	19.75	65	16	SNP	0.922	A
SLC45A4	57210	genome.wustl.edu	37	8	142231845	142231845	+	Nonsense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr8:142231845G>T	ENST00000024061.3	-	2	415	c.108C>A	c.(106-108)taC>taA	p.Y36*	SLC45A4_ENST00000519067.1_Nonsense_Mutation_p.Y36*|SLC45A4_ENST00000517878.1_Nonsense_Mutation_p.Y87*|SLC45A4_ENST00000433583.2_Nonsense_Mutation_p.Y29*	NM_001080431.1	NP_001073900.1	Q5BKX6	S45A4_HUMAN	solute carrier family 45, member 4						transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31	all_cancers(97;1.52e-15)|all_epithelial(106;2.92e-14)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			AGGTGAGGCTGTAGTACTGCT	0.672																																																	0													92.0	75.0	81.0					8																	142231845		2203	4300	6503	SO:0001587	stop_gained	0			AB032952	CCDS34948.1, CCDS69550.1, CCDS75795.1	8q24.3	2013-05-22						"""Solute carriers"""	29196	protein-coding gene	gene with protein product							Standard	NM_001080431		Approved	KIAA1126	uc003ywd.1	Q5BKX6		ENST00000024061.3:c.108C>A	8.37:g.142231845G>T	ENSP00000024061:p.Tyr36*		Q6ZRI2|Q9ULU3	Nonsense_Mutation	SNP	superfamily_MFS_dom_general_subst_transpt	p.Y87*	ENST00000024061.3	37	c.261	CCDS34948.1	8	.	.	.	.	.	.	.	.	.	.	G	39	7.404918	0.98262	.	.	ENSG00000022567	ENST00000519067;ENST00000517878;ENST00000433583;ENST00000024061;ENST00000519986	.	.	.	5.49	2.7	0.31948	.	0.053571	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-41.6621	10.9256	0.47189	0.1996:0.0:0.8004:0.0	.	.	.	.	X	36;87;29;36;18	.	ENSP00000024061:Y36X	Y	-	3	2	SLC45A4	142301027	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.406000	0.59748	1.325000	0.45301	0.407000	0.27541	TAC	SLC45A4	-	superfamily_MFS_dom_general_subst_transpt	ENSG00000022567		0.672	SLC45A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC45A4	HGNC	protein_coding	OTTHUMT00000378571.3	-	0.00	58	0	G	XM_050325		142231845	-1	tier1	-	no_errors	ENST00000517878	ensembl	human	known	74_37	nonsense	5.56	68	4	SNP	1.000	T
SLC6A19	340024	genome.wustl.edu	37	5	1212600	1212600	+	Splice_Site	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr5:1212600G>T	ENST00000304460.10	+	4	719		c.e4+1			NM_001003841.2	NP_001003841.1	Q695T7	S6A19_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 19						amino acid transport (GO:0006865)|ion transport (GO:0006811)|response to nutrient (GO:0007584)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|neutral amino acid transmembrane transporter activity (GO:0015175)	p.?(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(25)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			CACCGGGAAGGTACTGCATGG	0.687																																																	1	Unknown(1)	upper_aerodigestive_tract(1)											61.0	60.0	61.0					5																	1212600		2203	4300	6503	SO:0001630	splice_region_variant	0			AK096054	CCDS34130.1	5p15	2013-07-19			ENSG00000174358	ENSG00000174358		"""Solute carriers"""	27960	protein-coding gene	gene with protein product	"""Hartnup disease"""	608893					Standard	NM_001003841		Approved		uc003jbw.4	Q695T7	OTTHUMG00000161636	ENST00000304460.10:c.663+1G>T	5.37:g.1212600G>T			A8K446	Splice_Site	SNP	-	e4+1	ENST00000304460.10	37	c.663+1	CCDS34130.1	5	.	.	.	.	.	.	.	.	.	.	G	15.39	2.820624	0.50633	.	.	ENSG00000174358	ENST00000304460	.	.	.	5.2	5.2	0.72013	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0871	0.93209	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC6A19	1265600	1.000000	0.71417	0.992000	0.48379	0.421000	0.31385	9.518000	0.98022	2.586000	0.87340	0.491000	0.48974	.	SLC6A19	-	-	ENSG00000174358		0.687	SLC6A19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A19	HGNC	protein_coding	OTTHUMT00000365557.1		0.00	29	0	G	XM_291120	Intron	1212600	+1			no_errors	ENST00000304460	ensembl	human	known	74_37	splice_site	5.00	38	2	SNP	1.000	T
SLC9A4	389015	genome.wustl.edu	37	2	103121842	103121842	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:103121842G>T	ENST00000295269.4	+	4	1567	c.1110G>T	c.(1108-1110)atG>atT	p.M370I		NM_001011552.3	NP_001011552.2	Q6AI14	SL9A4_HUMAN	solute carrier family 9, subfamily A (NHE4, cation proton antiporter 4), member 4	370					epithelial cell development (GO:0002064)|gastric acid secretion (GO:0001696)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						TCATCTTCATGGGTGTGTCCA	0.512																																																	0													186.0	149.0	161.0					2																	103121842		2203	4300	6503	SO:0001583	missense	0				CCDS33264.1	2q12.1	2013-05-22	2012-03-22		ENSG00000180251	ENSG00000180251		"""Solute carriers"""	11077	protein-coding gene	gene with protein product		600531	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 4"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 4"""			8199403	Standard	NM_001011552		Approved	NHE4	uc002tbz.4	Q6AI14	OTTHUMG00000153093	ENST00000295269.4:c.1110G>T	2.37:g.103121842G>T	ENSP00000295269:p.Met370Ile		Q69YK0	Missense_Mutation	SNP	pfam_Cation/H_exchanger,prints_NaH_exchanger,prints_Na/H_exchanger_2,tigrfam_NaH_exchanger	p.M370I	ENST00000295269.4	37	c.1110	CCDS33264.1	2	.	.	.	.	.	.	.	.	.	.	G	33	5.198561	0.94997	.	.	ENSG00000180251	ENST00000295269	T	0.13307	2.6	5.51	5.51	0.81932	Cation/H+ exchanger (1);	0.044428	0.85682	D	0.000000	T	0.15478	0.0373	L	0.31804	0.96	0.80722	D	1	B	0.30973	0.302	B	0.34346	0.18	T	0.04347	-1.0958	10	0.66056	D	0.02	.	19.7817	0.96418	0.0:0.0:1.0:0.0	.	370	Q6AI14	SL9A4_HUMAN	I	370	ENSP00000295269:M370I	ENSP00000295269:M370I	M	+	3	0	SLC9A4	102488274	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	3.125000	0.50469	2.756000	0.94617	0.585000	0.79938	ATG	SLC9A4	-	pfam_Cation/H_exchanger,tigrfam_NaH_exchanger	ENSG00000180251		0.512	SLC9A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A4	HGNC	protein_coding	OTTHUMT00000329498.1	-	0.00	62	0	G	NM_001011552.3		103121842	+1	tier1	-	no_errors	ENST00000295269	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	T
SLITRK3	22865	genome.wustl.edu	37	3	164906795	164906795	+	Missense_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr3:164906795T>G	ENST00000475390.1	-	2	2267	c.1824A>C	c.(1822-1824)gaA>gaC	p.E608D	SLITRK3_ENST00000241274.3_Missense_Mutation_p.E608D			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	608	LRRCT 2.				axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						GGCAAAGAACTTCCAGCTCAA	0.547										HNSCC(40;0.11)																																							0													60.0	56.0	57.0					3																	164906795		2203	4300	6503	SO:0001583	missense	0			AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.1824A>C	3.37:g.164906795T>G	ENSP00000420091:p.Glu608Asp		Q1RMY6	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.E608D	ENST00000475390.1	37	c.1824	CCDS3197.1	3	.	.	.	.	.	.	.	.	.	.	T	10.14	1.269810	0.23221	.	.	ENSG00000121871	ENST00000475390;ENST00000241274	T;T	0.52295	0.67;0.67	5.76	3.25	0.37280	Cysteine-rich flanking region, C-terminal (1);	0.000000	0.38959	N	0.001505	T	0.40522	0.1120	L	0.43757	1.38	0.36023	D	0.838887	P	0.49961	0.93	P	0.48627	0.584	T	0.44862	-0.9300	10	0.34782	T	0.22	-10.2303	3.6104	0.08058	0.124:0.069:0.2579:0.5491	.	608	O94933	SLIK3_HUMAN	D	608	ENSP00000420091:E608D;ENSP00000241274:E608D	ENSP00000241274:E608D	E	-	3	2	SLITRK3	166389489	0.953000	0.32496	1.000000	0.80357	0.909000	0.53808	0.792000	0.26929	0.463000	0.27118	0.533000	0.62120	GAA	SLITRK3	-	smart_Cys-rich_flank_reg_C	ENSG00000121871		0.547	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLITRK3	HGNC	protein_coding	OTTHUMT00000350126.1	-	0.00	53	0	T	NM_014926		164906795	-1	tier1	-	no_errors	ENST00000241274	ensembl	human	known	74_37	missense	25.00	18	6	SNP	1.000	G
SMEK2	57223	genome.wustl.edu	37	2	55792177	55792177	+	Splice_Site	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:55792177C>T	ENST00000345102.5	-	14	2237	c.1936G>A	c.(1936-1938)Gaa>Aaa	p.E646K	SMEK2_ENST00000272313.5_Splice_Site_p.E561K|SMEK2_ENST00000407823.3_Splice_Site_p.E614K|SNORA12_ENST00000390873.1_RNA	NM_001122964.1	NP_001116436	Q5MIZ7	P4R3B_HUMAN	SMEK homolog 2, suppressor of mek1 (Dictyostelium)	646					positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)				kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	16			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			TTGATATCTTCCTGTATAAGC	0.269																																																	0													48.0	45.0	46.0					2																	55792177		2198	4292	6490	SO:0001630	splice_region_variant	0			AB037808	CCDS1855.1, CCDS46289.1, CCDS62913.1	2p16.1	2008-09-15			ENSG00000138041				29267	protein-coding gene	gene with protein product		610352				16085932, 18614045	Standard	NM_001122964		Approved	PSY2, FLFL2, KIAA1387, FLJ31474	uc002rzc.3	Q5MIZ7	OTTHUMG00000129336	ENST00000345102.5:c.1936-1G>A	2.37:g.55792177C>T			Q6P9B0|Q86XB8|Q9BQJ0|Q9BRK2|Q9H913|Q9P2G0	Missense_Mutation	SNP	pfam_DUF625,superfamily_ARM-type_fold	p.E561K	ENST00000345102.5	37	c.1681	CCDS46289.1	2	.	.	.	.	.	.	.	.	.	.	C	32	5.191990	0.94923	.	.	ENSG00000138041	ENST00000272313;ENST00000407823;ENST00000345102	T;T;D	0.93763	1.62;-0.09;-3.28	5.38	5.38	0.77491	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.97056	0.9038	M	0.85542	2.76	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.999;1.0;0.999;0.979	D;D;D;D;D	0.83275	0.996;0.971;0.994;0.967;0.923	D	0.97277	0.9915	10	0.59425	D	0.04	-12.2001	18.7169	0.91679	0.0:1.0:0.0:0.0	.	614;646;561;646;80	Q5MIZ7-2;Q5MIZ7;Q5MIZ7-3;B4DKA9;Q5MIZ7-5	.;P4R3B_HUMAN;.;.;.	K	561;614;646	ENSP00000272313:E561K;ENSP00000385912:E614K;ENSP00000339769:E646K	ENSP00000272313:E561K	E	-	1	0	SMEK2	55645681	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.817000	0.86213	2.517000	0.84864	0.655000	0.94253	GAA	SMEK2	-	superfamily_ARM-type_fold	ENSG00000138041		0.269	SMEK2-002	NOVEL	basic|CCDS	protein_coding	SMEK2	HGNC	protein_coding	OTTHUMT00000251483.1		0.00	51	0	C	NM_020463	Missense_Mutation	55792177	-1			no_errors	ENST00000272313	ensembl	human	known	74_37	missense	20.83	38	10	SNP	1.000	T
RCC1	1104	genome.wustl.edu	37	1	28833920	28833920	+	Intron	SNP	T	T	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr1:28833920T>C	ENST00000373833.6	+	2	28				SNHG3_ENST00000364938.1_RNA|SNORA73B_ENST00000363217.1_RNA|RCC1_ENST00000398958.2_Intron			P18754	RCC1_HUMAN	regulator of chromosome condensation 1						chromosome segregation (GO:0007059)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|positive regulation of Ran GTPase activity (GO:0032853)|regulation of mitosis (GO:0007088)|spindle assembly (GO:0051225)|viral process (GO:0016032)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|nucleosomal DNA binding (GO:0031492)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)			breast(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)	14		Colorectal(325;3.46e-05)|Lung NSC(340;0.000318)|all_lung(284;0.000434)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.00989)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)|Medulloblastoma(700;0.123)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|KIRC - Kidney renal clear cell carcinoma(1967;0.0101)|BRCA - Breast invasive adenocarcinoma(304;0.022)|READ - Rectum adenocarcinoma(331;0.0649)		ccgggctctgtccaagtggcg	0.502																																																	0													187.0	175.0	178.0					1																	28833920		876	1991	2867	SO:0001627	intron_variant	0			X12654	CCDS323.1, CCDS41295.1	1p35.3	2008-08-18	2005-05-09	2005-05-09	ENSG00000180198	ENSG00000180198			1913	protein-coding gene	gene with protein product		179710	"""chromosome condensation 1"""	CHC1		7851910	Standard	NM_001048199		Approved		uc001bqf.2	P18754	OTTHUMG00000003645	ENST00000373833.6:c.-257-720T>C	1.37:g.28833920T>C			Q16269|Q6NT97	RNA	SNP	-	NULL	ENST00000373833.6	37	NULL	CCDS323.1	1																																																																																			SNHG3	-	-	ENSG00000242125		0.502	RCC1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SNHG3	HGNC	protein_coding	OTTHUMT00000010323.3		0.00	73	0	T	NM_001269		28833920	+1			no_errors	ENST00000364938	ensembl	human	known	74_37	rna	7.69	72	6	SNP	0.998	C
TBRG4	9238	genome.wustl.edu	37	7	45144531	45144531	+	Intron	SNP	A	A	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr7:45144531A>C	ENST00000258770.3	-	4	857				TBRG4_ENST00000471142.1_5'Flank|TBRG4_ENST00000361278.3_Intron|SNORA5C_ENST00000364902.1_RNA|TBRG4_ENST00000494076.1_Intron|SNORA5A_ENST00000384111.1_RNA|TBRG4_ENST00000395655.4_Intron|SNORA5B_ENST00000363786.1_RNA	NM_004749.3	NP_004740.2	Q969Z0	TBRG4_HUMAN	transforming growth factor beta regulator 4						cell cycle arrest (GO:0007050)|cellular respiration (GO:0045333)|positive regulation of cell proliferation (GO:0008284)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			cervix(1)|endometrium(3)|large_intestine(2)|lung(8)|skin(1)|stomach(2)	17						ACTTATCCCCAGGTCCCAGGG	0.607																																																	0													64.0	63.0	63.0					7																	45144531		876	1991	2867	SO:0001627	intron_variant	0			AB023165	CCDS5501.1, CCDS5502.1	7p13	2006-07-07			ENSG00000136270	ENSG00000136270			17443	protein-coding gene	gene with protein product	"""FAST kinase domains 4"", ""cell cycle progression 2 protein"""	611325				9383053	Standard	NM_004749		Approved	Cpr2, KIAA0948, H_TD2522F11.8, FASTKD4	uc011kcd.3	Q969Z0	OTTHUMG00000129247	ENST00000258770.3:c.736-223T>G	7.37:g.45144531A>C			A4D2L2|A4D2L3|D3DVL5|D3DVL6|O14710|Q53GI8|Q8NDM4|Q9BUC6|Q9Y2F6	RNA	SNP	-	NULL	ENST00000258770.3	37	NULL	CCDS5501.1	7																																																																																			SNORA5C	-	-	ENSG00000201772		0.607	TBRG4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SNORA5C	HGNC	protein_coding	OTTHUMT00000251351.1	-	0.00	76	0	A	NM_030900		45144531	-1	tier1	-	no_errors	ENST00000364902	ensembl	human	known	74_37	rna	6.06	62	4	SNP	0.081	C
SNRNP200	23020	genome.wustl.edu	37	2	96952155	96952155	+	Silent	SNP	G	G	T	rs144934076		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:96952155G>T	ENST00000323853.5	-	29	3974	c.3897C>A	c.(3895-3897)acC>acA	p.T1299T	SNRNP200_ENST00000349783.5_Intron	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	1299					ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						CCAAAAGTTCGGTTGGAGGGG	0.507																																																	0													82.0	94.0	90.0					2																	96952155		2203	4300	6503	SO:0001819	synonymous_variant	0			AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.3897C>A	2.37:g.96952155G>T			O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Silent	SNP	pfam_Sec63-dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Sec63-dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.T1299	ENST00000323853.5	37	c.3897	CCDS2020.1	2																																																																																			SNRNP200	-	superfamily_P-loop_NTPase	ENSG00000144028		0.507	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNRNP200	HGNC	protein_coding	OTTHUMT00000252846.2		0.00	57	0	G	NM_014014		96952155	-1			no_errors	ENST00000323853	ensembl	human	known	74_37	silent	6.90	54	4	SNP	0.130	T
SNRPN	6638	genome.wustl.edu	37	15	25219561	25219561	+	5'UTR	SNP	A	A	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr15:25219561A>C	ENST00000400100.1	+	0	851				SNRPN_ENST00000444203.2_5'UTR|SNRPN_ENST00000554227.2_5'UTR|SNRPN_ENST00000400098.1_5'UTR|SNRPN_ENST00000553597.1_3'UTR|SNRPN_ENST00000400097.1_5'UTR|SNRPN_ENST00000577565.1_5'UTR|SNURF_ENST00000338094.6_3'UTR|SNURF_ENST00000551312.2_Intron|SNRPN_ENST00000346403.6_5'UTR|SNRPN_ENST00000390687.4_5'UTR	NM_022807.2	NP_073718.1	P63162	RSMN_HUMAN	small nuclear ribonucleoprotein polypeptide N						response to hormone (GO:0009725)|RNA splicing (GO:0008380)	small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U2 snRNP (GO:0005686)	RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(14)|ovary(1)|skin(2)	24		all_cancers(20;9.33e-22)|Breast(32;0.000625)		all cancers(64;3.38e-08)|Epithelial(43;3.45e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000207)|GBM - Glioblastoma multiforme(186;0.125)		AGAAGCATCAAGTTTTAACTG	0.438									Prader-Willi syndrome																																								0													168.0	156.0	160.0					15																	25219561		1893	4131	6024	SO:0001623	5_prime_UTR_variant	0	Familial Cancer Database	Prader-Labhart-Willi syndrome	L80005	CCDS10017.1	15q11.2	2013-07-16			ENSG00000128739	ENSG00000128739			11164	protein-coding gene	gene with protein product	"""tissue-specific splicing protein"", ""SM protein N"", ""small nuclear ribonucleoprotein N"""	182279	"""Prader-Willi syndrome chromosome region"""	PWCR		1533223	Standard	NM_022805		Approved	SMN, SM-D, HCERN3, SNRNP-N, SNURF-SNRPN, RT-LI	uc001ywt.1	P63162	OTTHUMG00000129180	ENST00000400100.1:c.-40A>C	15.37:g.25219561A>C			B3KVR1|P14648|P17135|Q0D2Q5	RNA	SNP	-	NULL	ENST00000400100.1	37	NULL	CCDS10017.1	15																																																																																			SNRPN	-	-	ENSG00000128739		0.438	SNRPN-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SNRPN	HGNC	protein_coding	OTTHUMT00000413849.10	-	0.00	151	0	A	NM_003097		25219561	+1	tier1	-	no_errors	ENST00000553597	ensembl	human	known	74_37	rna	33.04	77	38	SNP	0.000	C
SNTG2	54221	genome.wustl.edu	37	2	1371218	1371218	+	Missense_Mutation	SNP	T	T	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:1371218T>C	ENST00000308624.5	+	17	1721	c.1592T>C	c.(1591-1593)cTt>cCt	p.L531P	SNTG2_ENST00000407292.1_Missense_Mutation_p.L404P	NM_018968.3	NP_061841.2	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	531					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|syntrophin complex (GO:0016013)	PDZ domain binding (GO:0030165)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		AGTCAGAGTCTTGCCAGAAAA	0.468																																																	0													56.0	54.0	54.0					2																	1371218		692	1591	2283	SO:0001583	missense	0			AJ003029	CCDS46220.1	2p25	2008-05-23			ENSG00000172554	ENSG00000172554			13741	protein-coding gene	gene with protein product		608715				10747910	Standard	NM_018968		Approved	SYN5, G2SYN	uc002qwq.3	Q9NY99	OTTHUMG00000151370	ENST00000308624.5:c.1592T>C	2.37:g.1371218T>C	ENSP00000311837:p.Leu531Pro		Q05AH5	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.L531P	ENST00000308624.5	37	c.1592	CCDS46220.1	2	.	.	.	.	.	.	.	.	.	.	T	10.33	1.319030	0.23994	.	.	ENSG00000172554	ENST00000308624;ENST00000407292	T;T	0.70045	1.09;-0.45	4.91	4.91	0.64330	.	0.694481	0.14466	N	0.317877	T	0.65154	0.2664	L	0.40543	1.245	0.19575	N	0.999966	D;P	0.56035	0.974;0.924	P;P	0.51135	0.66;0.459	T	0.56697	-0.7936	10	0.45353	T	0.12	.	9.6238	0.39739	0.1559:0.0:0.0:0.8441	.	404;531	Q9NY99-2;Q9NY99	.;SNTG2_HUMAN	P	531;404	ENSP00000311837:L531P;ENSP00000385020:L404P	ENSP00000311837:L531P	L	+	2	0	SNTG2	1350225	0.723000	0.28027	0.005000	0.12908	0.030000	0.12068	4.035000	0.57297	1.824000	0.53156	0.533000	0.62120	CTT	SNTG2	-	NULL	ENSG00000172554		0.468	SNTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNTG2	HGNC	protein_coding	OTTHUMT00000322454.1	-	0.00	52	0	T	NM_018968		1371218	+1	tier1	-	no_errors	ENST00000308624	ensembl	human	known	74_37	missense	37.14	22	13	SNP	0.042	C
SNX4	8723	genome.wustl.edu	37	3	125170227	125170227	+	Silent	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr3:125170227G>T	ENST00000251775.4	-	13	1251	c.1227C>A	c.(1225-1227)cgC>cgA	p.R409R	SNX4_ENST00000536067.1_Silent_p.R264R	NM_003794.2	NP_003785.1	O95219	SNX4_HUMAN	sorting nexin 4	409					endocytic recycling (GO:0032456)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|early endosome membrane (GO:0031901)|membrane (GO:0016020)|protein complex (GO:0043234)	epidermal growth factor receptor binding (GO:0005154)|insulin receptor binding (GO:0005158)|leptin receptor binding (GO:1990460)|phosphatidylinositol binding (GO:0035091)|transferrin receptor binding (GO:1990459)			breast(2)|central_nervous_system(1)|lung(6)|ovary(1)|skin(1)	11						GTTCTTTGAAGCGTTCAATAT	0.343																																																	0													188.0	185.0	186.0					3																	125170227		2203	4300	6503	SO:0001819	synonymous_variant	0			AF065485	CCDS3032.1	3q21.2	2014-02-12			ENSG00000114520	ENSG00000114520		"""Sorting nexins"""	11175	protein-coding gene	gene with protein product		605931				9819414	Standard	NM_003794		Approved	ATG24B	uc003eib.4	O95219	OTTHUMG00000159575	ENST00000251775.4:c.1227C>A	3.37:g.125170227G>T			B3KMH0|B4DQV4|D3DNA3	Silent	SNP	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.R409	ENST00000251775.4	37	c.1227	CCDS3032.1	3																																																																																			SNX4	-	NULL	ENSG00000114520		0.343	SNX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX4	HGNC	protein_coding	OTTHUMT00000356299.1		0.00	81	0	G	NM_003794		125170227	-1			no_errors	ENST00000251775	ensembl	human	known	74_37	silent	5.41	70	4	SNP	1.000	T
SORBS1	10580	genome.wustl.edu	37	10	97116139	97116139	+	Frame_Shift_Del	DEL	C	C	-			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr10:97116139delC	ENST00000607232.1	-	18	2319	c.2153delG	c.(2152-2154)ggcfs	p.G718fs	SORBS1_ENST00000371239.1_Intron|SORBS1_ENST00000306402.6_Intron|SORBS1_ENST00000371245.3_Intron|SORBS1_ENST00000371227.4_Intron|SORBS1_ENST00000361941.3_Intron|SORBS1_ENST00000371246.2_Intron|SORBS1_ENST00000474353.2_Intron|SORBS1_ENST00000353505.5_Intron|SORBS1_ENST00000371241.1_Intron|SORBS1_ENST00000371249.2_Intron|SORBS1_ENST00000393949.1_Intron|SORBS1_ENST00000371247.2_Intron|SORBS1_ENST00000354106.3_Intron|SORBS1_ENST00000277982.5_Intron|SORBS1_ENST00000347291.4_Intron					sorbin and SH3 domain containing 1											NS(1)|breast(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(19)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		GGTCAGGCTGCCCCGGGACAG	0.602																																																	0																																										SO:0001589	frameshift_variant	0			AF136381	CCDS7442.1, CCDS31252.1, CCDS31253.1, CCDS31254.1, CCDS31255.1, CCDS31256.1, CCDS73169.1	10q23.33	2011-07-25	2002-05-08		ENSG00000095637	ENSG00000095637			14565	protein-coding gene	gene with protein product	"""c-Cbl-associated protein"""	605264	"""SH3-domain protein 5 (ponsin)"""	SH3D5		10085297, 11001060	Standard	XM_005269405		Approved	FLJ12406, CAP, sh3p12, ponsin, KIAA1296	uc001kkp.3	Q9BX66	OTTHUMG00000018812	ENST00000607232.1:c.2153delG	10.37:g.97116139delC	ENSP00000475901:p.Gly718fs			Frame_Shift_Del	DEL	pfam_SH3_domain,pfam_SH3_2,pfam_Sorb,superfamily_SH3_domain,smart_Sorb,smart_SH3_domain,pfscan_Sorb,pfscan_SH3_domain,prints_p67phox,prints_SH3_domain	p.G718fs	ENST00000607232.1	37	c.2153		10																																																																																			SORBS1	-	NULL	ENSG00000095637		0.602	SORBS1-017	KNOWN	not_organism_supported|basic	protein_coding	SORBS1	HGNC	protein_coding	OTTHUMT00000468280.1		0.00	55	0	C			97116139	-1	tier1		no_errors	ENST00000607232	ensembl	human	known	74_37	frame_shift_del	5.00	38	2	DEL	0.001	-
SORCS3	22986	genome.wustl.edu	37	10	106960984	106960984	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr10:106960984G>T	ENST00000369701.3	+	16	2461	c.2234G>T	c.(2233-2235)tGt>tTt	p.C745F	SORCS3_ENST00000369699.4_Missense_Mutation_p.C31F	NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	745					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		TCAGAACCCTGTGTCTGTGCC	0.517																																					NSCLC(116;1497 1690 7108 13108 14106)												0													138.0	121.0	127.0					10																	106960984		2203	4300	6503	SO:0001583	missense	0			AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.2234G>T	10.37:g.106960984G>T	ENSP00000358715:p.Cys745Phe		Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	pfam_PKD_dom,superfamily_PKD_dom,smart_VPS10,pfscan_PKD_dom	p.C745F	ENST00000369701.3	37	c.2234	CCDS7558.1	10	.	.	.	.	.	.	.	.	.	.	G	26.1	4.707881	0.89018	.	.	ENSG00000156395	ENST00000369701;ENST00000369699	T;T	0.66460	0.83;-0.21	5.78	5.78	0.91487	VPS10 (1);	0.000000	0.85682	D	0.000000	D	0.87410	0.6170	M	0.93898	3.47	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89840	0.4002	9	.	.	.	.	20.0215	0.97504	0.0:0.0:1.0:0.0	.	745	Q9UPU3	SORC3_HUMAN	F	745;31	ENSP00000358715:C745F;ENSP00000358713:C31F	.	C	+	2	0	SORCS3	106950974	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	9.269000	0.95684	2.735000	0.93741	0.650000	0.86243	TGT	SORCS3	-	smart_VPS10	ENSG00000156395		0.517	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORCS3	HGNC	protein_coding	OTTHUMT00000050221.1	-	0.00	82	0	G	NM_014978		106960984	+1	tier1	-	no_errors	ENST00000369701	ensembl	human	known	74_37	missense	15.94	58	11	SNP	1.000	T
SORCS3	22986	genome.wustl.edu	37	10	107016622	107016622	+	Missense_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr10:107016622T>G	ENST00000369701.3	+	25	3610	c.3383T>G	c.(3382-3384)cTt>cGt	p.L1128R		NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	1128					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		TCAGCCATGCTTATGCTATTA	0.433																																					NSCLC(116;1497 1690 7108 13108 14106)												0													171.0	145.0	154.0					10																	107016622		2203	4300	6503	SO:0001583	missense	0			AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.3383T>G	10.37:g.107016622T>G	ENSP00000358715:p.Leu1128Arg		Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	pfam_PKD_dom,superfamily_PKD_dom,smart_VPS10,pfscan_PKD_dom	p.L1128R	ENST00000369701.3	37	c.3383	CCDS7558.1	10	.	.	.	.	.	.	.	.	.	.	T	22.8	4.341329	0.81911	.	.	ENSG00000156395	ENST00000369701	T	0.18338	2.22	5.93	4.81	0.61882	.	0.160324	0.41097	D	0.000941	T	0.35008	0.0917	L	0.55481	1.735	0.51482	D	0.999924	D	0.89917	1.0	D	0.83275	0.996	T	0.02450	-1.1157	9	.	.	.	.	11.9097	0.52733	0.0:0.0674:0.0:0.9326	.	1128	Q9UPU3	SORC3_HUMAN	R	1128	ENSP00000358715:L1128R	.	L	+	2	0	SORCS3	107006612	1.000000	0.71417	0.993000	0.49108	0.995000	0.86356	7.606000	0.82863	1.089000	0.41292	0.533000	0.62120	CTT	SORCS3	-	NULL	ENSG00000156395		0.433	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORCS3	HGNC	protein_coding	OTTHUMT00000050221.1	-	0.00	93	0	T	NM_014978		107016622	+1	tier1	-	no_errors	ENST00000369701	ensembl	human	known	74_37	missense	31.25	44	20	SNP	1.000	G
SPG20	23111	genome.wustl.edu	37	13	36900758	36900758	+	Missense_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr13:36900758T>G	ENST00000451493.1	-	5	1459	c.1242A>C	c.(1240-1242)aaA>aaC	p.K414N	SPG20_ENST00000494062.2_Missense_Mutation_p.K414N|SPG20_ENST00000495510.1_5'UTR|SPG20_ENST00000355182.4_Missense_Mutation_p.K414N|SPG20_ENST00000438666.2_Missense_Mutation_p.K414N	NM_001142295.1	NP_001135767.1	Q8N0X7	SPG20_HUMAN	spastic paraplegia 20 (Troyer syndrome)	414					abscission (GO:0009838)|adipose tissue development (GO:0060612)|cell death (GO:0008219)|cell division (GO:0051301)|lipid particle organization (GO:0034389)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of collateral sprouting in absence of injury (GO:0048698)|neuromuscular process (GO:0050905)|regulation of mitochondrial membrane potential (GO:0051881)	cytoplasm (GO:0005737)|lipid particle (GO:0005811)|midbody (GO:0030496)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	27		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;2.42e-08)|Epithelial(112;1.58e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00128)|BRCA - Breast invasive adenocarcinoma(63;0.0125)|GBM - Glioblastoma multiforme(144;0.026)		CAGGTAATTCTTTTGGCTTTT	0.353																																																	0													102.0	90.0	94.0					13																	36900758		2203	4300	6503	SO:0001583	missense	0			AB011182	CCDS9356.1	13q13.1	2008-07-04	2007-04-23		ENSG00000133104	ENSG00000133104			18514	protein-coding gene	gene with protein product	"""spartin"""	607111				6022528, 12134148	Standard	NM_001142294		Approved	KIAA0610, TAHCCP1	uc001uvm.3	Q8N0X7	OTTHUMG00000016730	ENST00000451493.1:c.1242A>C	13.37:g.36900758T>G	ENSP00000414147:p.Lys414Asn		O60349|Q86Y67|Q9H1T2|Q9H1T3	Missense_Mutation	SNP	pfam_Senescence/spartin,pfam_MIT,smart_MIT	p.K414N	ENST00000451493.1	37	c.1242	CCDS9356.1	13	.	.	.	.	.	.	.	.	.	.	T	15.28	2.787107	0.49997	.	.	ENSG00000133104	ENST00000438666;ENST00000355182;ENST00000451493;ENST00000423217	D;D;D	0.89939	-2.59;-2.59;-2.59	5.49	0.571	0.17352	.	0.374960	0.29100	N	0.013148	D	0.87857	0.6283	L	0.61218	1.895	0.42971	D	0.994438	D;P;D	0.56746	0.977;0.938;0.96	P;P;P	0.49451	0.611;0.502;0.611	D	0.85140	0.0980	10	0.51188	T	0.08	-10.6744	9.5341	0.39211	0.0:0.4423:0.0:0.5577	.	414;414;414	A8K6Q9;B3KMI3;Q8N0X7	.;.;SPG20_HUMAN	N	414	ENSP00000406061:K414N;ENSP00000347314:K414N;ENSP00000414147:K414N	ENSP00000347314:K414N	K	-	3	2	SPG20	35798758	0.982000	0.34865	0.932000	0.37286	0.909000	0.53808	0.124000	0.15728	0.152000	0.19188	0.460000	0.39030	AAA	SPG20	-	NULL	ENSG00000133104		0.353	SPG20-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SPG20	HGNC	protein_coding	OTTHUMT00000044494.2	-	0.00	72	0	T			36900758	-1	tier1	-	no_errors	ENST00000355182	ensembl	human	known	74_37	missense	12.50	70	10	SNP	0.994	G
SPRYD7	57213	genome.wustl.edu	37	13	50502175	50502175	+	Missense_Mutation	SNP	C	C	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr13:50502175C>G	ENST00000361840.3	-	3	374	c.270G>C	c.(268-270)caG>caC	p.Q90H	SPRYD7_ENST00000492258.1_5'Flank|SPRYD7_ENST00000378195.2_Missense_Mutation_p.Q51H	NM_020456.2	NP_065189.1	Q5W111	SPRY7_HUMAN	SPRY domain containing 7	90	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.									haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(2)	6						CAAGAGGAATCTGATTCAAGT	0.413																																																	0													141.0	130.0	134.0					13																	50502175		2203	4300	6503	SO:0001583	missense	0			AF055016	CCDS9422.1, CCDS45046.1	13q14.3	2011-05-25	2011-05-25	2011-05-25	ENSG00000123178	ENSG00000123178			14297	protein-coding gene	gene with protein product		607866	"""chromosome 13 open reading frame 1"""	C13orf1		11306461, 11771308	Standard	NM_020456		Approved	CLLD6	uc001vdl.2	Q5W111	OTTHUMG00000016924	ENST00000361840.3:c.270G>C	13.37:g.50502175C>G	ENSP00000354774:p.Gln90His		A8K3G1|O60648|Q8TBG8|Q96T69	Missense_Mutation	SNP	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	p.Q90H	ENST00000361840.3	37	c.270	CCDS9422.1	13	.	.	.	.	.	.	.	.	.	.	C	18.34	3.602470	0.66445	.	.	ENSG00000123178	ENST00000361840;ENST00000378195	T;T	0.61158	0.13;0.13	5.32	5.32	0.75619	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.85682	D	0.000000	T	0.64305	0.2586	L	0.58101	1.795	0.54753	D	0.999988	D;D;D	0.62365	0.991;0.991;0.985	P;P;P	0.56163	0.781;0.793;0.781	T	0.65602	-0.6128	10	0.54805	T	0.06	-8.4264	9.7036	0.40203	0.0:0.8396:0.0:0.1604	.	90;51;90	B2RE68;Q5W111-2;Q5W111	.;.;SPRY7_HUMAN	H	90;51	ENSP00000354774:Q90H;ENSP00000367437:Q51H	ENSP00000354774:Q90H	Q	-	3	2	SPRYD7	49400176	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.009000	0.49552	2.661000	0.90470	0.655000	0.94253	CAG	SPRYD7	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000123178		0.413	SPRYD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRYD7	HGNC	protein_coding	OTTHUMT00000044942.2	-	0.00	103	0	C	NM_020456		50502175	-1	tier1	-	no_errors	ENST00000361840	ensembl	human	known	74_37	missense	22.33	80	23	SNP	1.000	G
SRC	6714	genome.wustl.edu	37	20	36030930	36030930	+	Silent	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr20:36030930C>T	ENST00000373578.2	+	12	1558	c.1209C>T	c.(1207-1209)tgC>tgT	p.C403C	SRC_ENST00000373567.2_Silent_p.C403C|SRC_ENST00000445403.1_Silent_p.C403C|SRC_ENST00000358208.4_Silent_p.C403C|SRC_ENST00000373558.2_Silent_p.C409C|SRC_ENST00000360723.4_Silent_p.C409C|SRC_ENST00000477066.1_3'UTR	NM_198291.1	NP_938033.1	P12931	SRC_HUMAN	SRC proto-oncogene, non-receptor tyrosine kinase	403	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|bone resorption (GO:0045453)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cellular response to progesterone stimulus (GO:0071393)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|membrane organization (GO:0061024)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of mitochondrial depolarization (GO:0051902)|negative regulation of protein homooligomerization (GO:0032463)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oogenesis (GO:0048477)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of integrin activation (GO:0033625)|positive regulation of podosome assembly (GO:0071803)|positive regulation of protein kinase B signaling (GO:0051897)|progesterone receptor signaling pathway (GO:0050847)|protein autophosphorylation (GO:0046777)|Ras protein signal transduction (GO:0007265)|regulation of bone resorption (GO:0045124)|regulation of caveolin-mediated endocytosis (GO:2001286)|regulation of cell-cell adhesion (GO:0022407)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of epithelial cell migration (GO:0010632)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of protein binding (GO:0043393)|regulation of vascular permeability (GO:0043114)|response to interleukin-1 (GO:0070555)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|stress fiber assembly (GO:0043149)|T cell costimulation (GO:0031295)|transforming growth factor beta receptor signaling pathway (GO:0007179)|uterus development (GO:0060065)|viral process (GO:0016032)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|ephrin receptor binding (GO:0046875)|growth factor receptor binding (GO:0070851)|heme binding (GO:0020037)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphoprotein binding (GO:0051219)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(16)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	30		Myeloproliferative disorder(115;0.00878)			Bosutinib(DB06616)|Dasatinib(DB01254)|Ponatinib(DB08901)	ACCTGGTGTGCAAAGTGGCGG	0.622																																																	0													66.0	59.0	61.0					20																	36030930		2203	4300	6503	SO:0001819	synonymous_variant	0			AF077754	CCDS13294.1	20q12-q13	2014-06-25	2014-06-25		ENSG00000197122	ENSG00000197122		"""SH2 domain containing"""	11283	protein-coding gene	gene with protein product		190090	"""v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog"""	SRC1		2582238	Standard	NM_005417		Approved	ASV, c-src	uc002xgy.3	P12931	OTTHUMG00000032417	ENST00000373578.2:c.1209C>T	20.37:g.36030930C>T			E1P5V4|Q76P87|Q86VB9|Q9H5A8	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_SH3_domain	p.C409	ENST00000373578.2	37	c.1227	CCDS13294.1	20																																																																																			SRC	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000197122		0.622	SRC-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	SRC	HGNC	protein_coding	OTTHUMT00000268142.1		0.00	35	0	C	NM_005417		36030930	+1			no_errors	ENST00000360723	ensembl	human	known	74_37	silent	9.09	39	4	SNP	1.000	T
SRPK2	6733	genome.wustl.edu	37	7	104758331	104758331	+	Missense_Mutation	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr7:104758331C>T	ENST00000393651.3	-	16	2141	c.2054G>A	c.(2053-2055)cGa>cAa	p.R685Q	SRPK2_ENST00000493638.1_5'Flank|SRPK2_ENST00000489828.1_Missense_Mutation_p.R674Q|SRPK2_ENST00000357311.3_Missense_Mutation_p.R674Q	NM_182692.1	NP_872634.1			SRSF protein kinase 2											NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|kidney(11)|large_intestine(6)|lung(4)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	35						AGCTGAGGCTCGTTTTTCTGG	0.443																																																	0													73.0	71.0	72.0					7																	104758331		2203	4300	6503	SO:0001583	missense	0			U88666	CCDS5735.1, CCDS34724.1	7q22-q31.1	2010-06-23	2010-06-23		ENSG00000135250	ENSG00000135250			11306	protein-coding gene	gene with protein product	"""SR protein kinase 2"", ""serine/arginine-rich splicing factor kinase 2"""	602980	"""SFRS protein kinase 2"""			8208298, 9472028	Standard	NM_182692		Approved	SFRSK2	uc003vcv.4	P78362	OTTHUMG00000157405	ENST00000393651.3:c.2054G>A	7.37:g.104758331C>T	ENSP00000377262:p.Arg685Gln			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R685Q	ENST00000393651.3	37	c.2054	CCDS34724.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.7|28.7	4.940541|4.940541	0.92526|0.92526	.|.	.|.	ENSG00000135250|ENSG00000135250	ENST00000474770|ENST00000393651;ENST00000357311;ENST00000489828	.|T;T;T	.|0.71461	.|-0.57;-0.57;-0.57	5.96|5.96	5.96|5.96	0.96718|0.96718	.|Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.92381|0.92381	0.7582|0.7582	H|H	0.99719|0.99719	4.725|4.725	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|1.0;0.997	D|D	0.95175|0.95175	0.8294|0.8294	5|10	.|0.87932	.|D	.|0	-8.2898|-8.2898	20.4008|20.4008	0.98991|0.98991	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|685;674	.|P78362-2;P78362	.|.;SRPK2_HUMAN	K|Q	190|685;674;674	.|ENSP00000377262:R685Q;ENSP00000349863:R674Q;ENSP00000419791:R674Q	.|ENSP00000349863:R674Q	E|R	-|-	1|2	0|0	SRPK2|SRPK2	104545567|104545567	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.818000|7.818000	0.86416|0.86416	2.826000|2.826000	0.97356|0.97356	0.655000|0.655000	0.94253|0.94253	GAG|CGA	SRPK2	-	pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	ENSG00000135250		0.443	SRPK2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SRPK2	HGNC	protein_coding	OTTHUMT00000348723.1		0.00	46	0	C	NM_182691		104758331	-1			no_errors	ENST00000393651	ensembl	human	known	74_37	missense	8.51	43	4	SNP	1.000	T
SSFA2	6744	genome.wustl.edu	37	2	182786988	182786988	+	Missense_Mutation	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:182786988C>A	ENST00000431877.2	+	16	3703	c.3524C>A	c.(3523-3525)tCt>tAt	p.S1175Y	SSFA2_ENST00000409001.1_Missense_Mutation_p.S1153Y|SSFA2_ENST00000409136.1_Missense_Mutation_p.S684Y|SSFA2_ENST00000467172.2_3'UTR|SSFA2_ENST00000320370.7_Missense_Mutation_p.S1175Y|SSFA2_ENST00000428267.2_Missense_Mutation_p.S1000Y	NM_001130445.1	NP_001123917.1	P28290	SSFA2_HUMAN	sperm specific antigen 2	1175						cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(18)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	38			OV - Ovarian serous cystadenocarcinoma(117;0.0856)			TTGGAAAGTTCTGAGGAAGTT	0.502																																																	0													92.0	98.0	96.0					2																	182786988		2203	4300	6503	SO:0001583	missense	0			M61199	CCDS2284.1, CCDS46467.1, CCDS74611.1	2q32.1	2012-02-01			ENSG00000138434	ENSG00000138434			11319	protein-coding gene	gene with protein product	"""cleavage signal-1 protein"", ""KRAS-induced actin-interacting protein"", ""sperm associated antigen 13"""	118990				1555770	Standard	XM_005246812		Approved	CS-1, SPAG13, KRAP, KIAA1927	uc002uoh.3	P28290	OTTHUMG00000132584	ENST00000431877.2:c.3524C>A	2.37:g.182786988C>A	ENSP00000388731:p.Ser1175Tyr		A8K6T0|Q68DA6|Q7Z7L2|Q8N1L3|Q8N263|Q8N7H2|Q8NEN5|Q96E36|Q96PW1	Missense_Mutation	SNP	NULL	p.S1175Y	ENST00000431877.2	37	c.3524	CCDS46467.1	2	.	.	.	.	.	.	.	.	.	.	C	19.14	3.770760	0.69992	.	.	ENSG00000138434	ENST00000431877;ENST00000320370;ENST00000409001;ENST00000428267;ENST00000409136;ENST00000451836	T;T;T;T;T	0.17528	2.54;2.27;2.53;2.53;2.32	5.95	5.08	0.68730	.	0.492809	0.22879	N	0.054539	T	0.42154	0.1190	M	0.70595	2.14	0.35988	D	0.836509	D;D;D;D;D	0.89917	1.0;1.0;0.999;0.999;0.999	D;D;D;D;D	0.87578	0.998;0.998;0.996;0.996;0.996	T	0.54846	-0.8232	10	0.59425	D	0.04	-6.0904	15.135	0.72558	0.1416:0.8584:0.0:0.0	.	1000;684;1153;1175;1175	E7END2;E7EUL7;E9PHV5;P28290;P28290-3	.;.;.;SSFA2_HUMAN;.	Y	1175;1175;1153;1000;684;120	ENSP00000388731:S1175Y;ENSP00000314669:S1175Y;ENSP00000387319:S1153Y;ENSP00000409867:S1000Y;ENSP00000386916:S684Y	ENSP00000314669:S1175Y	S	+	2	0	SSFA2	182495233	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	0.997000	0.29731	1.542000	0.49330	-0.122000	0.15005	TCT	SSFA2	-	NULL	ENSG00000138434		0.502	SSFA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SSFA2	HGNC	protein_coding	OTTHUMT00000255793.2	-	0.00	65	0	C	NM_006751		182786988	+1	tier1	-	no_errors	ENST00000431877	ensembl	human	known	74_37	missense	6.45	58	4	SNP	1.000	A
ST6GALNAC5	81849	genome.wustl.edu	37	1	77334454	77334454	+	Intron	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr1:77334454G>T	ENST00000477717.1	+	2	496				ST6GALNAC5_ENST00000496845.1_3'UTR	NM_030965.1	NP_112227.1	Q9BVH7	SIA7E_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5						glycosphingolipid biosynthetic process (GO:0006688)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	18						CAGCCCGCTCGCCACTCAGCC	0.716																																																	0													3.0	3.0	3.0					1																	77334454		1310	2491	3801	SO:0001627	intron_variant	0				CCDS673.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000117069	ENSG00000117069		"""Sialyltransferases"""	19342	protein-coding gene	gene with protein product		610134	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) E"""	SIAT7E		10521438, 10601645	Standard	NM_030965		Approved	MGC3184, ST6GalNAcV	uc001dhi.3	Q9BVH7	OTTHUMG00000009687	ENST00000477717.1:c.261+27G>T	1.37:g.77334454G>T			B1AK82	RNA	SNP	-	NULL	ENST00000477717.1	37	NULL	CCDS673.1	1																																																																																			ST6GALNAC5	-	-	ENSG00000117069		0.716	ST6GALNAC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ST6GALNAC5	HGNC	protein_coding	OTTHUMT00000026692.2	-	0.00	25	0	G	NM_030965		77334454	+1	tier1	-	no_errors	ENST00000496845	ensembl	human	putative	74_37	rna	23.53	13	4	SNP	0.001	T
STAB1	23166	genome.wustl.edu	37	3	52544253	52544253	+	Splice_Site	SNP	T	T	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr3:52544253T>C	ENST00000321725.6	+	24	2704		c.e24+2			NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1						cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		TCAGAGAATGTCAGTCCCCTT	0.577																																																	0													104.0	97.0	99.0					3																	52544253		2203	4300	6503	SO:0001630	splice_region_variant	0			AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.2628+2T>C	3.37:g.52544253T>C			A7E297|Q8IUH0|Q8IUH1|Q93072	Splice_Site	SNP	-	e24+2	ENST00000321725.6	37	c.2628+2	CCDS33768.1	3	.	.	.	.	.	.	.	.	.	.	T	15.84	2.952386	0.53293	.	.	ENSG00000010327	ENST00000321725	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3515	0.74393	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	STAB1	52519293	1.000000	0.71417	0.999000	0.59377	0.351000	0.29236	4.668000	0.61568	2.109000	0.64355	0.533000	0.62120	.	STAB1	-	-	ENSG00000010327		0.577	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAB1	HGNC	protein_coding	OTTHUMT00000351380.2	-	0.00	74	0	T	NM_015136	Intron	52544253	+1	tier1	-	no_errors	ENST00000321725	ensembl	human	known	74_37	splice_site	37.50	35	21	SNP	1.000	C
STAG1	10274	genome.wustl.edu	37	3	136221520	136221520	+	Missense_Mutation	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr3:136221520C>A	ENST00000383202.2	-	8	1034	c.778G>T	c.(778-780)Ggg>Tgg	p.G260W	STAG1_ENST00000434713.2_Missense_Mutation_p.G34W|STAG1_ENST00000236698.5_Missense_Mutation_p.G260W	NM_005862.2	NP_005853.2	Q8WVM7	STAG1_HUMAN	stromal antigen 1	260					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58						GCTCTCTTCCCAATCATTTTA	0.388																																																	0													170.0	161.0	164.0					3																	136221520		2203	4300	6503	SO:0001583	missense	0			Z75330	CCDS3090.1	3q22.2-q22.3	2011-08-12			ENSG00000118007	ENSG00000118007			11354	protein-coding gene	gene with protein product		604358				9305759	Standard	XM_006713471		Approved	SA-1, SCC3A	uc003era.1	Q8WVM7	OTTHUMG00000159798	ENST00000383202.2:c.778G>T	3.37:g.136221520C>A	ENSP00000372689:p.Gly260Trp		O00539|Q6P275	Missense_Mutation	SNP	pfam_STAG,superfamily_ARM-type_fold	p.G260W	ENST00000383202.2	37	c.778	CCDS3090.1	3	.	.	.	.	.	.	.	.	.	.	C	31	5.074432	0.94000	.	.	ENSG00000118007	ENST00000383202;ENST00000236698;ENST00000434713	T;T;T	0.44083	0.93;0.93;0.93	5.67	5.67	0.87782	STAG (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.66626	0.2808	M	0.72894	2.215	0.80722	D	1	P;D;P	0.71674	0.93;0.998;0.93	D;D;D	0.83275	0.945;0.996;0.945	T	0.68017	-0.5520	10	0.72032	D	0.01	.	19.7542	0.96283	0.0:1.0:0.0:0.0	.	277;260;260	Q4LE48;Q6P275;Q8WVM7	.;.;STAG1_HUMAN	W	260;260;34	ENSP00000372689:G260W;ENSP00000236698:G260W;ENSP00000404396:G34W	ENSP00000236698:G260W	G	-	1	0	STAG1	137704210	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.786000	0.85741	2.677000	0.91161	0.491000	0.48974	GGG	STAG1	-	pfam_STAG,superfamily_ARM-type_fold	ENSG00000118007		0.388	STAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAG1	HGNC	protein_coding	OTTHUMT00000357366.1		0.00	71	0	C	NM_005862		136221520	-1			no_errors	ENST00000383202	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	A
STAT2	6773	genome.wustl.edu	37	12	56737903	56737903	+	Nonsense_Mutation	SNP	G	G	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr12:56737903G>A	ENST00000314128.4	-	23	2142	c.2119C>T	c.(2119-2121)Caa>Taa	p.Q707*	STAT2_ENST00000557235.1_Nonsense_Mutation_p.Q703*|STAT2_ENST00000556539.1_5'UTR			P52630	STAT2_HUMAN	signal transducer and activator of transcription 2, 113kDa	707					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|skin(3)	31						agcGGTTGTTGCAGTTCATCC	0.517																																																	0													14.0	13.0	13.0					12																	56737903		2173	4255	6428	SO:0001587	stop_gained	0			BC051284	CCDS8917.1, CCDS55836.1	12q13.2	2013-02-14	2002-08-29			ENSG00000170581		"""SH2 domain containing"""	11363	protein-coding gene	gene with protein product		600556	"""signal transducer and activator of transcription 2, 113kD"""			7885841	Standard	NM_005419		Approved	STAT113	uc001slc.3	P52630		ENST00000314128.4:c.2119C>T	12.37:g.56737903G>A	ENSP00000315768:p.Gln707*		B4DLC7|G3V2M6|Q16430|Q16431|Q9UDL4	Nonsense_Mutation	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_STAT2_C,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,smart_SH2,pfscan_SH2	p.Q707*	ENST00000314128.4	37	c.2119	CCDS8917.1	12	.	.	.	.	.	.	.	.	.	.	G	22.6	4.311034	0.81358	.	.	ENSG00000170581	ENST00000314128;ENST00000557235	.	.	.	4.16	4.16	0.48862	.	0.607202	0.13866	N	0.357328	.	.	.	.	.	.	0.53688	D	0.999979	.	.	.	.	.	.	.	.	.	.	0.08179	T	0.78	-1.6462	12.2472	0.54576	0.0:0.0:1.0:0.0	.	.	.	.	X	707;703	.	ENSP00000315768:Q707X	Q	-	1	0	STAT2	55024170	0.938000	0.31826	0.243000	0.24186	0.171000	0.22731	2.576000	0.46033	2.606000	0.88127	0.561000	0.74099	CAA	STAT2	-	NULL	ENSG00000170581		0.517	STAT2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STAT2	HGNC	protein_coding	OTTHUMT00000410277.1	-	0.00	90	0	G	NM_005419		56737903	-1	tier1	-	no_errors	ENST00000314128	ensembl	human	known	74_37	nonsense	5.49	86	5	SNP	0.260	A
STAU2	27067	genome.wustl.edu	37	8	74650579	74650579	+	5'UTR	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr8:74650579C>T	ENST00000521419.1	-	0	111				STAU2_ENST00000517542.1_Intron|STAU2_ENST00000522695.1_5'Flank|STAU2_ENST00000522962.1_5'UTR|RP11-463D19.2_ENST00000358757.5_3'UTR|STAU2_ENST00000524300.1_5'UTR|STAU2_ENST00000521210.1_5'UTR|STAU2_ENST00000519961.1_5'UTR|STAU2_ENST00000521451.1_Intron|STAU2_ENST00000523558.1_Intron|STAU2_ENST00000521727.1_Intron|STAU2_ENST00000524104.1_5'UTR|STAU2_ENST00000522509.1_5'UTR|STAU2_ENST00000355780.5_5'UTR			Q9NUL3	STAU2_HUMAN	staufen double-stranded RNA binding protein 2						transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)	19	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)			CTCACGGCTCCAAAAACTGGA	0.348																																																	0													93.0	81.0	85.0					8																	74650579		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			Y19062	CCDS6214.1, CCDS55244.1, CCDS55245.1, CCDS55246.1, CCDS55247.1, CCDS55248.1	8q21.11	2013-06-05	2013-06-05		ENSG00000040341	ENSG00000040341			11371	protein-coding gene	gene with protein product		605920	"""staufen (Drosophila, RNA-binding protein) homolog 2"", ""staufen, RNA binding protein, homolog 2 (Drosophila)"""			10585778	Standard	NM_014393		Approved	39K2	uc003xzm.3	Q9NUL3	OTTHUMG00000164499	ENST00000521419.1:c.-196G>A	8.37:g.74650579C>T			B7Z1I6|B7Z292|B7Z8B4|E7ER74|E9PEI3|E9PF26|E9PF50|Q6AHY7|Q96HM0|Q96HM1|Q9NVI5|Q9UGG6	RNA	SNP	-	NULL	ENST00000521419.1	37	NULL		8																																																																																			STAU2	-	-	ENSG00000040341		0.348	STAU2-013	PUTATIVE	basic|exp_conf	protein_coding	STAU2	HGNC	protein_coding	OTTHUMT00000379012.2	-	0.00	64	0	C	NM_001164380		74650579	-1	tier1	-	no_errors	ENST00000519818	ensembl	human	known	74_37	rna	30.65	43	19	SNP	1.000	T
STK36	27148	genome.wustl.edu	37	2	219563818	219563818	+	Missense_Mutation	SNP	G	G	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:219563818G>C	ENST00000295709.3	+	26	3830	c.3551G>C	c.(3550-3552)gGt>gCt	p.G1184A	STK36_ENST00000440309.1_Missense_Mutation_p.G1184A|STK36_ENST00000392106.2_Missense_Mutation_p.G1163A|STK36_ENST00000392105.3_Missense_Mutation_p.G1163A	NM_015690.4	NP_056505.2			serine/threonine kinase 36											biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(20)|ovary(4)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	52		Renal(207;0.0915)		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)		TACCAGGCTGGTCCTCTGGGA	0.607																																																	0													44.0	43.0	43.0					2																	219563818		2203	4300	6503	SO:0001583	missense	0			AB033104	CCDS2421.1, CCDS58750.1	2q35	2010-06-25	2010-06-25		ENSG00000163482	ENSG00000163482			17209	protein-coding gene	gene with protein product	"""fused homolog (Drosophila)"""	607652	"""serine/threonine kinase 36 (fused homolog, Drosophila)"""			10806483	Standard	NM_001243313		Approved	KIAA1278, FU	uc002viu.3	Q9NRP7	OTTHUMG00000133079	ENST00000295709.3:c.3551G>C	2.37:g.219563818G>C	ENSP00000295709:p.Gly1184Ala			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.G1184A	ENST00000295709.3	37	c.3551	CCDS2421.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.66|13.66	2.303700|2.303700	0.40795|0.40795	.|.	.|.	ENSG00000163482|ENSG00000163482	ENST00000295709;ENST00000392106;ENST00000392105;ENST00000440309|ENST00000431040	T;T;T;T|.	0.64085|.	0.79;0.79;-0.08;0.79|.	5.38|5.38	5.38|5.38	0.77491|0.77491	Armadillo-like helical (1);Armadillo-type fold (1);|.	0.000000|.	0.46442|.	D|.	0.000296|.	T|T	0.55529|0.55529	0.1926|0.1926	N|N	0.25789|0.25789	0.76|0.76	0.37377|0.37377	D|D	0.911863|0.911863	D;D;P|.	0.63046|.	0.992;0.99;0.816|.	P;P;B|.	0.58077|.	0.832;0.797;0.1|.	T|T	0.55186|0.55186	-0.8180|-0.8180	10|5	0.31617|.	T|.	0.26|.	-13.1079|-13.1079	17.5023|17.5023	0.87735|0.87735	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1163;1163;1184|.	A8MU99;Q9NRP7-2;Q9NRP7|.	.;.;STK36_HUMAN|.	A|L	1184;1163;1163;1184|377	ENSP00000295709:G1184A;ENSP00000375955:G1163A;ENSP00000375954:G1163A;ENSP00000394095:G1184A|.	ENSP00000295709:G1184A|.	G|V	+|+	2|1	0|0	STK36|STK36	219272062|219272062	0.998000|0.998000	0.40836|0.40836	1.000000|1.000000	0.80357|0.80357	0.182000|0.182000	0.23217|0.23217	3.253000|3.253000	0.51469|0.51469	2.793000|2.793000	0.96121|0.96121	0.655000|0.655000	0.94253|0.94253	GGT|GTC	STK36	-	superfamily_ARM-type_fold	ENSG00000163482		0.607	STK36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK36	HGNC	protein_coding	OTTHUMT00000256723.2	-	0.00	21	0	G			219563818	+1	tier1	-	no_errors	ENST00000295709	ensembl	human	known	74_37	missense	16.67	20	4	SNP	1.000	C
STYK1	55359	genome.wustl.edu	37	12	10772778	10772778	+	Missense_Mutation	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr12:10772778C>T	ENST00000075503.3	-	11	1754	c.1234G>A	c.(1234-1236)Gtg>Atg	p.V412M		NM_018423.2	NP_060893.2	Q6J9G0	STYK1_HUMAN	serine/threonine/tyrosine kinase 1	412						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|liver(1)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	26						AGGCTCTCCACTCTGATGCCG	0.463										HNSCC(73;0.22)																																							0													159.0	153.0	155.0					12																	10772778		2203	4300	6503	SO:0001583	missense	0			AF251059	CCDS8629.1	12p13.2	2005-01-21							18889	protein-coding gene	gene with protein product		611433				12841579	Standard	NM_018423		Approved	SuRTK106, DKFZp761P1010, NOK	uc001qys.2	Q6J9G0		ENST00000075503.3:c.1234G>A	12.37:g.10772778C>T	ENSP00000075503:p.Val412Met		B2R9T2|Q52LR3|Q9BXY2|Q9NSH1	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.V412M	ENST00000075503.3	37	c.1234	CCDS8629.1	12	.	.	.	.	.	.	.	.	.	.	C	7.433	0.639055	0.14386	.	.	ENSG00000060140	ENST00000075503	T	0.78707	-1.2	4.96	-0.123	0.13527	.	1.573530	0.03609	N	0.234618	T	0.63319	0.2501	L	0.34521	1.04	0.09310	N	1	B	0.16396	0.017	B	0.09377	0.004	T	0.29058	-1.0024	10	0.22706	T	0.39	-0.2746	1.2194	0.01921	0.1449:0.3802:0.1415:0.3334	.	412	Q6J9G0	STYK1_HUMAN	M	412	ENSP00000075503:V412M	ENSP00000075503:V412M	V	-	1	0	STYK1	10664045	0.000000	0.05858	0.007000	0.13788	0.723000	0.41478	-0.181000	0.09740	-0.354000	0.08212	0.563000	0.77884	GTG	STYK1	-	NULL	ENSG00000060140		0.463	STYK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STYK1	HGNC	protein_coding	OTTHUMT00000399622.1	-	0.00	53	0	C	NM_018423		10772778	-1	tier1	-	no_errors	ENST00000075503	ensembl	human	known	74_37	missense	32.56	29	14	SNP	0.000	T
SULT1A1	6817	genome.wustl.edu	37	16	28620135	28620135	+	Silent	SNP	G	G	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr16:28620135G>A	ENST00000395607.1	-	2	315	c.42C>T	c.(40-42)taC>taT	p.Y14Y	SULT1A1_ENST00000395609.1_Silent_p.Y14Y|SULT1A1_ENST00000350842.4_Intron|SULT1A1_ENST00000569554.1_Silent_p.Y14Y|SULT1A1_ENST00000314752.7_Silent_p.Y14Y	NM_177530.2|NM_177534.2	NP_803566.1|NP_803878.1	P50225	ST1A1_HUMAN	sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1	14					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|amine metabolic process (GO:0009308)|catecholamine metabolic process (GO:0006584)|estrogen metabolic process (GO:0008210)|flavonoid metabolic process (GO:0009812)|small molecule metabolic process (GO:0044281)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	aryl sulfotransferase activity (GO:0004062)|flavonol 3-sulfotransferase activity (GO:0047894)|steroid sulfotransferase activity (GO:0050294)|sulfotransferase activity (GO:0008146)			endometrium(2)|kidney(7)|large_intestine(2)|lung(2)|ovary(1)|stomach(2)	16					Acetaminophen(DB00316)|Tamoxifen(DB00675)	CCCCCTTCACGTACTCCAGTG	0.627																																																	0													41.0	42.0	42.0					16																	28620135		2196	4294	6490	SO:0001819	synonymous_variant	0			U52852	CCDS10637.1, CCDS32420.1	16p12.1	2008-02-05			ENSG00000196502	ENSG00000196502	2.8.2.1	"""Sulfotransferases, cytosolic"""	11453	protein-coding gene	gene with protein product		171150		STP, STP1		8288252, 8912648	Standard	NM_177534		Approved	P-PST	uc002dqj.3	P50225	OTTHUMG00000131765	ENST00000395607.1:c.42C>T	16.37:g.28620135G>A			Q2NL71|Q86U58|Q92818|Q9BVU6|Q9UGG7	Missense_Mutation	SNP	NULL	p.R62C	ENST00000395607.1	37	c.184	CCDS32420.1	16																																																																																			SULT1A1	-	NULL	ENSG00000196502		0.627	SULT1A1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SULT1A1	HGNC	protein_coding	OTTHUMT00000254694.2	-	0.00	175	0	G	NM_001055		28620135	-1	tier1	-	no_errors	ENST00000563493	ensembl	human	known	74_37	missense	15.43	137	25	SNP	0.008	A
SUZ12	23512	genome.wustl.edu	37	17	30320963	30320963	+	Missense_Mutation	SNP	G	G	A	rs371166327		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr17:30320963G>A	ENST00000322652.5	+	12	1602	c.1373G>A	c.(1372-1374)cGc>cAc	p.R458H	SUZ12_ENST00000580398.1_Missense_Mutation_p.R435H	NM_015355.2	NP_056170.2	Q15022	SUZ12_HUMAN	SUZ12 polycomb repressive complex 2 subunit	458					histone ubiquitination (GO:0016574)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|metal ion binding (GO:0046872)|methylated histone binding (GO:0035064)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)	p.R458H(1)	SSH2/SUZ12(2)|JAZF1/SUZ12(133)	breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|lung(5)|skin(1)	21		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.041)|Ovarian(249;0.182)|Breast(31;0.231)				CTGAACTGCCGCAAACTTTAT	0.323			T	JAZF1	endometrial stromal tumours								.|||	0	0.0	0.0	0.0	5008	,	,		14901	0.0		0.0	False		,,,				2504	0.0							Dom	yes		17	17q11.2	23512	suppressor of zeste 12 homolog (Drosophila)		M	1	Substitution - Missense(1)	lung(1)											99.0	93.0	95.0					17																	30320963		2203	4300	6503	SO:0001583	missense	0			D63881	CCDS11270.1	17q21	2013-06-05	2013-06-05		ENSG00000178691	ENSG00000178691		"""Zinc fingers, C2H2-type"""	17101	protein-coding gene	gene with protein product		606245	"""suppressor of zeste 12 homolog (Drosophila)"""			8590280, 11371647, 18784248	Standard	NM_015355		Approved	JJAZ1, KIAA0160, CHET9	uc002hgs.2	Q15022	OTTHUMG00000132813	ENST00000322652.5:c.1373G>A	17.37:g.30320963G>A	ENSP00000316578:p.Arg458His		Q96BD9	Missense_Mutation	SNP	pfam_Polycomb_protein_VEFS-Box	p.R458H	ENST00000322652.5	37	c.1373	CCDS11270.1	17	.	.	.	.	.	.	.	.	.	.	g	13.88	2.369628	0.42003	.	.	ENSG00000178691	ENST00000322652	T	0.46063	0.88	5.38	2.24	0.28232	Zinc finger, C2H2-like (1);	0.097634	0.64402	D	0.000001	T	0.38904	0.1058	L	0.47716	1.5	0.42572	D	0.993189	D;B	0.61697	0.99;0.002	P;B	0.48270	0.572;0.001	T	0.16364	-1.0405	10	0.41790	T	0.15	-0.247	9.0131	0.36153	0.1357:0.121:0.7433:0.0	.	458;458	A8K1U9;Q15022	.;SUZ12_HUMAN	H	458	ENSP00000316578:R458H	ENSP00000316578:R458H	R	+	2	0	SUZ12	27345076	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	9.764000	0.98949	0.651000	0.30788	0.644000	0.83932	CGC	SUZ12	-	NULL	ENSG00000178691		0.323	SUZ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUZ12	HGNC	protein_coding	OTTHUMT00000256260.2		0.00	72	0	G	NM_015355		30320963	+1			no_errors	ENST00000322652	ensembl	human	known	74_37	missense	5.56	51	3	SNP	1.000	A
SYN2	6854	genome.wustl.edu	37	3	12225335	12225335	+	RNA	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr3:12225335C>T	ENST00000432424.2	+	0	2004							Q92777	SYN2_HUMAN	synapsin II						neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)			breast(5)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	18						AAAAGAAAACCCAACTCCTCT	0.468																																																	0																																												0				CCDS74900.1, CCDS74901.1	3p25.2	2013-09-20			ENSG00000157152	ENSG00000157152			11495	protein-coding gene	gene with protein product		600755				8530057	Standard	XM_006713311		Approved	SYNII, SYNIIa, SYNIIb	uc003bwm.3	Q92777	OTTHUMG00000155335		3.37:g.12225335C>T			A8MY98	RNA	SNP	-	NULL	ENST00000432424.2	37	NULL		3																																																																																			SYN2	-	-	ENSG00000157152		0.468	SYN2-002	KNOWN	basic	processed_transcript	SYN2	HGNC	processed_transcript	OTTHUMT00000339528.3	-	0.00	19	0	C	NM_133625		12225335	+1	tier1	-	no_errors	ENST00000425297	ensembl	human	known	74_37	rna	26.09	17	6	SNP	0.033	T
SYNE1	23345	genome.wustl.edu	37	6	152545633	152545633	+	Missense_Mutation	SNP	A	A	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr6:152545633A>C	ENST00000367255.5	-	117	22119	c.21518T>G	c.(21517-21519)cTt>cGt	p.L7173R	SYNE1_ENST00000341594.5_Missense_Mutation_p.L6785R|SYNE1_ENST00000423061.1_Missense_Mutation_p.L7102R|SYNE1_ENST00000265368.4_Missense_Mutation_p.L7173R|SYNE1_ENST00000356820.4_Missense_Mutation_p.L1697R|SYNE1_ENST00000448038.1_Missense_Mutation_p.L7102R	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	7173					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CCTTACCTGAAGATTGTCCAC	0.383										HNSCC(10;0.0054)																																							0													88.0	83.0	84.0					6																	152545633		2203	4300	6503	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.21518T>G	6.37:g.152545633A>C	ENSP00000356224:p.Leu7173Arg		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.L7173R	ENST00000367255.5	37	c.21518	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	A	24.8	4.567175	0.86439	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820;ENST00000367251	T;T;T;T;T;T;T	0.53206	0.63;0.63;0.63;0.63;0.63;0.63;0.63	5.73	5.73	0.89815	.	0.000000	0.52532	D	0.000079	T	0.64494	0.2603	M	0.77103	2.36	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.69228	-0.5200	10	0.66056	D	0.02	.	16.3123	0.82883	1.0:0.0:0.0:0.0	.	7173;7173;7102;7102	Q8NF91;E7EQI5;Q8NF91-4;E9PEL9	SYNE1_HUMAN;.;.;.	R	7173;7102;7173;7102;6785;1697;95	ENSP00000356224:L7173R;ENSP00000396024:L7102R;ENSP00000265368:L7173R;ENSP00000390975:L7102R;ENSP00000341887:L6785R;ENSP00000349276:L1697R;ENSP00000356220:L95R	ENSP00000265368:L7173R	L	-	2	0	SYNE1	152587326	1.000000	0.71417	0.984000	0.44739	0.923000	0.55619	8.910000	0.92685	2.308000	0.77769	0.533000	0.62120	CTT	SYNE1	-	pfam_Spectrin_repeat,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin	ENSG00000131018		0.383	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	-	0.00	82	0	A	NM_182961		152545633	-1	tier1	-	no_errors	ENST00000265368	ensembl	human	known	74_37	missense	21.92	57	16	SNP	1.000	C
SYNE1	23345	genome.wustl.edu	37	6	152552690	152552690	+	Missense_Mutation	SNP	C	C	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr6:152552690C>G	ENST00000367255.5	-	114	21476	c.20875G>C	c.(20875-20877)Gac>Cac	p.D6959H	SYNE1_ENST00000341594.5_Missense_Mutation_p.D6571H|SYNE1_ENST00000423061.1_Missense_Mutation_p.D6888H|SYNE1_ENST00000265368.4_Missense_Mutation_p.D6959H|SYNE1_ENST00000356820.4_Missense_Mutation_p.D1483H|SYNE1_ENST00000448038.1_Missense_Mutation_p.D6888H	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6959					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CAGTTAATGTCTATCTTAAAA	0.343										HNSCC(10;0.0054)																																							0													62.0	58.0	59.0					6																	152552690		2203	4300	6503	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.20875G>C	6.37:g.152552690C>G	ENSP00000356224:p.Asp6959His		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.D6959H	ENST00000367255.5	37	c.20875	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	C	27.4	4.827299	0.90955	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820	T;T;T;T;T;T	0.60920	0.24;0.24;0.15;0.24;0.39;2.28	6.03	6.03	0.97812	.	0.000000	0.64402	D	0.000004	T	0.74627	0.3741	M	0.73962	2.25	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.75062	-0.3450	10	0.72032	D	0.01	.	20.5666	0.99351	0.0:1.0:0.0:0.0	.	6959;6959;6888	Q8NF91;E7EQI5;Q8NF91-4	SYNE1_HUMAN;.;.	H	6959;6888;6959;6888;6571;1483	ENSP00000356224:D6959H;ENSP00000396024:D6888H;ENSP00000265368:D6959H;ENSP00000390975:D6888H;ENSP00000341887:D6571H;ENSP00000349276:D1483H	ENSP00000265368:D6959H	D	-	1	0	SYNE1	152594383	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.090000	0.71397	2.854000	0.98071	0.655000	0.94253	GAC	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin	ENSG00000131018		0.343	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	-	0.00	66	0	C	NM_182961		152552690	-1	tier1	-	no_errors	ENST00000265368	ensembl	human	known	74_37	missense	20.34	47	12	SNP	1.000	G
SYNE1	23345	genome.wustl.edu	37	6	152639329	152639329	+	Missense_Mutation	SNP	A	A	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr6:152639329A>C	ENST00000367255.5	-	86	17060	c.16459T>G	c.(16459-16461)Ttg>Gtg	p.L5487V	SYNE1_ENST00000341594.5_Intron|SYNE1_ENST00000423061.1_Missense_Mutation_p.L5416V|SYNE1_ENST00000265368.4_Missense_Mutation_p.L5487V|SYNE1_ENST00000356820.4_Missense_Mutation_p.L11V|SYNE1_ENST00000448038.1_Missense_Mutation_p.L5416V	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5487					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTCTGTTCCAAGAATTTCTGT	0.433										HNSCC(10;0.0054)																																							0													175.0	155.0	162.0					6																	152639329		2203	4300	6503	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.16459T>G	6.37:g.152639329A>C	ENSP00000356224:p.Leu5487Val		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.L5487V	ENST00000367255.5	37	c.16459	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	A	9.637	1.137873	0.21123	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000356820	T;T;T;T;T	0.36878	1.23;1.23;1.23;1.23;1.23	5.66	4.45	0.53987	.	0.377447	0.22827	N	0.055149	T	0.03739	0.0106	N	0.01874	-0.695	0.19300	N	0.999971	B;B;B;B	0.06786	0.0;0.0;0.0;0.001	B;B;B;B	0.04013	0.0;0.0;0.0;0.001	T	0.38650	-0.9651	10	0.11485	T	0.65	.	6.1609	0.20364	0.588:0.2097:0.0:0.2023	.	5487;5487;5487;5416	Q8NF91-7;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	V	5487;5416;5487;5416;11	ENSP00000356224:L5487V;ENSP00000396024:L5416V;ENSP00000265368:L5487V;ENSP00000390975:L5416V;ENSP00000349276:L11V	ENSP00000265368:L5487V	L	-	1	2	SYNE1	152681022	1.000000	0.71417	0.892000	0.35008	0.627000	0.37826	1.091000	0.30915	2.156000	0.67533	0.533000	0.62120	TTG	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin	ENSG00000131018		0.433	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	-	0.00	71	0	A	NM_182961		152639329	-1	tier1	-	no_errors	ENST00000265368	ensembl	human	known	74_37	missense	52.83	25	28	SNP	0.983	C
SYTL2	54843	genome.wustl.edu	37	11	85438059	85438059	+	Intron	SNP	T	T	A	rs568355733		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr11:85438059T>A	ENST00000528231.1	-	7	1737				SYTL2_ENST00000524452.1_Intron|SYTL2_ENST00000389960.4_Intron|SYTL2_ENST00000316356.4_Intron|SYTL2_ENST00000525423.1_De_novo_Start_InFrame|SYTL2_ENST00000354566.3_5'Flank|SYTL2_ENST00000527523.1_Intron|SYTL2_ENST00000359152.5_Missense_Mutation_p.K338M	NM_001162951.1|NM_001162953.1	NP_001156423.1|NP_001156425.1	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2						exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of mucus secretion (GO:0070257)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|exocytic vesicle (GO:0070382)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|melanosome (GO:0042470)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)|phosphatase binding (GO:0019902)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(22)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		CACTTGGTTCTTGGGAACCTC	0.458																																																	0																																										SO:0001627	intron_variant	0			AJ303364	CCDS31649.1, CCDS31652.1, CCDS41698.1, CCDS53687.1, CCDS53688.1, CCDS53689.1	11q14.1	2014-06-13			ENSG00000137501	ENSG00000137501			15585	protein-coding gene	gene with protein product	"""chromosome 11 synaptotagmin"", ""breast cancer-associated antigen SGA-72M"", ""protein phosphatase 1, regulatory subunit 151"""	612880				10997877	Standard	XM_005274057		Approved	FLJ20163, FLJ21219, KIAA1597, exophilin-4, CHR11SYT, SLP2, SGA72M, MGC102768, PPP1R151	uc001pbb.3	Q9HCH5	OTTHUMG00000166977	ENST00000528231.1:c.1459+879A>T	11.37:g.85438059T>A			B3KRS3|B4DJT5|B4DKW3|B4DQ26|B7SA85|B7ZLX6|B7ZLX7|Q2YDA7|Q6TV07|Q6ZN59|Q6ZVC5|Q8ND34|Q96BJ2|Q9H768|Q9NXM1	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.K338M	ENST00000528231.1	37	c.1013	CCDS53688.1	11	.	.	.	.	.	.	.	.	.	.	T	15.75	2.924511	0.52653	.	.	ENSG00000137501	ENST00000359152	T	0.33654	1.4	5.93	3.5	0.40072	.	1.145240	0.06434	N	0.724733	T	0.28732	0.0712	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.20075	-1.0286	6	.	.	.	-0.1597	6.6593	0.23004	0.1391:0.0779:0.0:0.783	.	.	.	.	M	338	ENSP00000352065:K338M	.	K	-	2	0	SYTL2	85115707	0.002000	0.14202	0.809000	0.32408	0.833000	0.47200	0.241000	0.18065	2.263000	0.75096	0.533000	0.62120	AAG	SYTL2	-	NULL	ENSG00000137501		0.458	SYTL2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	SYTL2	HGNC	protein_coding	OTTHUMT00000392192.1	-	0.00	62	0	T	NM_206927		85438059	-1	tier1	-	no_errors	ENST00000359152	ensembl	human	known	74_37	missense	10.00	81	9	SNP	0.074	A
TAF1	6872	genome.wustl.edu	37	X	70749636	70749636	+	3'UTR	SNP	G	G	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chrX:70749636G>A	ENST00000461764.1	+	0	1266							P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa						cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				GAGTCTCTTCGTCTCATCTCC	0.443																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000461764.1:c.*1263G>A	X.37:g.70749636G>A			A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	RNA	SNP	-	NULL	ENST00000461764.1	37	NULL		X																																																																																			TAF1	-	-	ENSG00000147133		0.443	TAF1-021	KNOWN	mRNA_end_NF|basic	processed_transcript	TAF1	HGNC	protein_coding	OTTHUMT00000081821.1	-	0.00	60	0	G	NM_004606		70749636	+1	tier1	-	no_errors	ENST00000461764	ensembl	human	known	74_37	rna	39.02	25	16	SNP	0.016	A
TAF9B	51616	genome.wustl.edu	37	X	77387169	77387169	+	Missense_Mutation	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chrX:77387169C>T	ENST00000341864.5	-	7	788	c.694G>A	c.(694-696)Gcc>Acc	p.A232T		NM_015975.4	NP_057059.2	Q9HBM6	TAF9B_HUMAN	TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa	232					DNA-templated transcription, initiation (GO:0006352)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell growth (GO:0030307)|programmed cell death (GO:0012501)|protein stabilization (GO:0050821)|response to organic cyclic compound (GO:0014070)	transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	14						GCTTCATTGGCTGTGTTCTGT	0.363																																																	0													232.0	198.0	209.0					X																	77387169		2203	4296	6499	SO:0001583	missense	0			AF220509	CCDS35340.1	Xq13.1-q21.1	2010-08-16	2006-01-04	2006-01-04	ENSG00000187325	ENSG00000187325			17306	protein-coding gene	gene with protein product		300754	"""TAF9-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa"""	TAF9L		15899866	Standard	XM_005262142		Approved	TAFII31L, DN-7, DN7, TFIID-31	uc004eda.3	Q9HBM6	OTTHUMG00000021887	ENST00000341864.5:c.694G>A	X.37:g.77387169C>T	ENSP00000339917:p.Ala232Thr		B2RUZ9|Q9Y2S3	Missense_Mutation	SNP	pfam_TFIID-31,superfamily_Histone-fold	p.A232T	ENST00000341864.5	37	c.694	CCDS35340.1	X	.	.	.	.	.	.	.	.	.	.	C	3.716	-0.058618	0.07317	.	.	ENSG00000187325	ENST00000341864	T	0.16324	2.35	4.2	1.23	0.21249	.	1.119980	0.06740	N	0.778234	T	0.13372	0.0324	L	0.43923	1.385	0.09310	N	1	B	0.20261	0.043	B	0.14578	0.011	T	0.37197	-0.9716	10	0.24483	T	0.36	-0.021	3.6985	0.08374	0.0:0.4235:0.209:0.3675	.	232	Q9HBM6	TAF9B_HUMAN	T	232	ENSP00000339917:A232T	ENSP00000339917:A232T	A	-	1	0	TAF9B	77273825	0.000000	0.05858	0.195000	0.23364	0.008000	0.06430	-0.546000	0.06062	0.271000	0.22005	0.544000	0.68410	GCC	TAF9B	-	NULL	ENSG00000187325		0.363	TAF9B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF9B	HGNC	protein_coding	OTTHUMT00000057308.1	-	0.00	120	0	C	NM_015975		77387169	-1	tier1	-	no_errors	ENST00000341864	ensembl	human	known	74_37	missense	7.69	47	4	SNP	0.001	T
TANC1	85461	genome.wustl.edu	37	2	160035291	160035291	+	Silent	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:160035291C>A	ENST00000263635.6	+	14	2364	c.2127C>A	c.(2125-2127)ctC>ctA	p.L709L	TANC1_ENST00000454300.1_Silent_p.L603L	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	709					dendritic spine maintenance (GO:0097062)|myoblast fusion (GO:0007520)|visual learning (GO:0008542)	axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(4)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(25)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	77						ACCTCAAGCTCACCCTGGACC	0.557																																																	0													66.0	69.0	68.0					2																	160035291		2029	4174	6203	SO:0001819	synonymous_variant	0			AB051515	CCDS42766.1	2q24.2	2013-01-11			ENSG00000115183	ENSG00000115183		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29364	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	611397				15673434	Standard	NM_033394		Approved	KIAA1728, ROLSB	uc002uag.3	Q9C0D5	OTTHUMG00000153945	ENST00000263635.6:c.2127C>A	2.37:g.160035291C>A			C9JD88|Q49AI8	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_P-loop_NTPase,smart_Ankyrin_rpt,smart_TPR_repeat,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_Ankyrin_rpt	p.L709	ENST00000263635.6	37	c.2127	CCDS42766.1	2																																																																																			TANC1	-	NULL	ENSG00000115183		0.557	TANC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TANC1	HGNC	protein_coding	OTTHUMT00000333135.1		0.00	74	0	C			160035291	+1			no_errors	ENST00000263635	ensembl	human	known	74_37	silent	6.15	61	4	SNP	1.000	A
TAS2R46	259292	genome.wustl.edu	37	12	11214770	11214770	+	Missense_Mutation	SNP	A	A	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr12:11214770A>T	ENST00000533467.1	-	1	123	c.124T>A	c.(124-126)Tct>Act	p.S42T	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176887.2	NP_795368.2	P59540	T2R46_HUMAN	taste receptor, type 2, member 46	42					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		TCAGCAAAAGAGATCTTTTGT	0.368																																																	0													55.0	53.0	54.0					12																	11214770		1959	4215	6174	SO:0001583	missense	0			AF494227	CCDS53748.1	12p13.2	2012-08-22				ENSG00000226761		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18877	protein-coding gene	gene with protein product		612774				12379855	Standard	NM_176887		Approved	T2R54	uc001qzp.1	P59540		ENST00000533467.1:c.124T>A	12.37:g.11214770A>T	ENSP00000436450:p.Ser42Thr		P59548|Q645X6	Missense_Mutation	SNP	pfam_TAS2_rcpt	p.S42T	ENST00000533467.1	37	c.124	CCDS53748.1	12	.	.	.	.	.	.	.	.	.	.	A	12.53	1.966695	0.34659	.	.	ENSG00000226761	ENST00000533467	T	0.35236	1.32	2.54	1.27	0.21489	.	.	.	.	.	T	0.57198	0.2037	M	0.89353	3.025	0.09310	N	1	D	0.60575	0.988	D	0.63877	0.919	T	0.45116	-0.9283	9	0.66056	D	0.02	.	4.8315	0.13443	0.7272:0.0:0.0:0.2728	.	42	P59540	T2R46_HUMAN	T	42	ENSP00000436450:S42T	ENSP00000436450:S42T	S	-	1	0	TAS2R46	11106037	0.000000	0.05858	0.001000	0.08648	0.067000	0.16453	0.165000	0.16564	0.192000	0.20272	0.163000	0.16589	TCT	TAS2R46	-	pfam_TAS2_rcpt	ENSG00000226761		0.368	TAS2R46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R46	HGNC	protein_coding	OTTHUMT00000383559.1	-	0.00	139	0	A	NM_176887		11214770	-1	tier1	-	no_errors	ENST00000533467	ensembl	human	known	74_37	missense	12.50	97	14	SNP	0.001	T
TAS2R60	338398	genome.wustl.edu	37	7	143140865	143140865	+	Missense_Mutation	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr7:143140865C>A	ENST00000332690.1	+	1	320	c.320C>A	c.(319-321)aCc>aAc	p.T107N	EPHA1-AS1_ENST00000429289.1_RNA	NM_177437.1	NP_803186.1	P59551	T2R60_HUMAN	taste receptor, type 2, member 60	107					sensory perception of bitter taste (GO:0050913)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|kidney(1)|large_intestine(2)|lung(17)|prostate(1)|skin(7)|urinary_tract(2)	31	Melanoma(164;0.172)					AATGCTGCCACCTTATGGTCC	0.478																																																	0													179.0	158.0	165.0					7																	143140865		2203	4300	6503	SO:0001583	missense	0			AY114094	CCDS5885.1	7q35	2014-07-10			ENSG00000185899	ENSG00000185899		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	20639	protein-coding gene	gene with protein product		613968				12584440	Standard	NM_177437		Approved	T2R60	uc011ktg.2	P59551	OTTHUMG00000154891	ENST00000332690.1:c.320C>A	7.37:g.143140865C>A	ENSP00000327724:p.Thr107Asn		A4D2G8|Q645W8|Q7RTR7	Missense_Mutation	SNP	pfam_TAS2_rcpt	p.T107N	ENST00000332690.1	37	c.320	CCDS5885.1	7	.	.	.	.	.	.	.	.	.	.	C	11.96	1.794074	0.31777	.	.	ENSG00000185899	ENST00000332690	T	0.37411	1.2	5.59	4.71	0.59529	.	0.378221	0.22565	U	0.058412	T	0.51126	0.1656	L	0.51422	1.61	0.09310	N	1	D	0.89917	1.0	D	0.80764	0.994	T	0.40021	-0.9585	10	0.49607	T	0.09	.	10.5942	0.45327	0.0:0.9114:0.0:0.0886	.	107	P59551	T2R60_HUMAN	N	107	ENSP00000327724:T107N	ENSP00000327724:T107N	T	+	2	0	TAS2R60	142850987	0.001000	0.12720	0.024000	0.17045	0.025000	0.11179	0.495000	0.22483	1.369000	0.46134	0.655000	0.94253	ACC	TAS2R60	-	pfam_TAS2_rcpt	ENSG00000185899		0.478	TAS2R60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R60	HGNC	protein_coding	OTTHUMT00000337541.1	-	0.00	28	0	C			143140865	+1	tier1	-	no_errors	ENST00000332690	ensembl	human	known	74_37	missense	43.75	27	21	SNP	0.036	A
TBX6	6911	genome.wustl.edu	37	16	30100078	30100078	+	Missense_Mutation	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr16:30100078C>T	ENST00000395224.2	-	5	763	c.704G>A	c.(703-705)gGc>gAc	p.G235D	TBX6_ENST00000553607.1_Missense_Mutation_p.G235D|TBX6_ENST00000279386.2_Missense_Mutation_p.G235D	NM_004608.3	NP_004599.2	O95947	TBX6_HUMAN	T-box 6	235					anatomical structure morphogenesis (GO:0009653)|cell fate specification (GO:0001708)|mesoderm development (GO:0007498)|mesoderm formation (GO:0001707)|negative regulation of neuron maturation (GO:0014043)|negative regulation of neuron projection development (GO:0010977)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction involved in regulation of gene expression (GO:0023019)|somite rostral/caudal axis specification (GO:0032525)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)	9						GGAGGCCATGCCCCCCCAGTG	0.627																																																	0													108.0	114.0	112.0					16																	30100078		2197	4300	6497	SO:0001583	missense	0			AJ007989	CCDS10670.1	16p11.2	2008-02-05			ENSG00000149922	ENSG00000149922		"""T-boxes"""	11605	protein-coding gene	gene with protein product		602427				9888994, 9933572	Standard	NM_004608		Approved		uc010veh.2	O95947	OTTHUMG00000132115	ENST00000395224.2:c.704G>A	16.37:g.30100078C>T	ENSP00000378650:p.Gly235Asp		Q8TAS4|Q9HA44	Missense_Mutation	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box,prints_TF_Brachyury	p.G235D	ENST00000395224.2	37	c.704	CCDS10670.1	16	.	.	.	.	.	.	.	.	.	.	C	15.80	2.938892	0.52972	.	.	ENSG00000149922	ENST00000395224;ENST00000279386;ENST00000553607	D;D;D	0.89415	-2.51;-2.51;-2.51	5.95	5.95	0.96441	p53-like transcription factor, DNA-binding (1);	0.059990	0.64402	D	0.000002	D	0.89329	0.6684	N	0.19112	0.55	0.49687	D	0.999816	D;D	0.69078	0.997;0.994	D;P	0.65233	0.933;0.878	D	0.86117	0.1566	10	0.18710	T	0.47	.	19.1503	0.93485	0.0:1.0:0.0:0.0	.	235;235	O95947;Q9HA44	TBX6_HUMAN;.	D	235	ENSP00000378650:G235D;ENSP00000279386:G235D;ENSP00000461223:G235D	ENSP00000279386:G235D	G	-	2	0	TBX6	30007579	0.352000	0.24895	0.992000	0.48379	0.579000	0.36224	1.369000	0.34227	2.826000	0.97356	0.563000	0.77884	GGC	TBX6	-	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box	ENSG00000149922		0.627	TBX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBX6	HGNC	protein_coding	OTTHUMT00000255157.2		0.00	44	0	C	NM_004608, NM_080758		30100078	-1			no_errors	ENST00000279386	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.996	T
TCEAL2	140597	genome.wustl.edu	37	X	101381341	101381341	+	Intron	SNP	G	G	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chrX:101381341G>A	ENST00000372780.1	+	2	119				TCEAL2_ENST00000476749.1_3'UTR|TCEAL2_ENST00000329035.2_Intron	NM_080390.3	NP_525129.1	Q9H3H9	TCAL2_HUMAN	transcription elongation factor A (SII)-like 2						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|biliary_tract(1)|breast(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)	11						CTGTCTGTCCGCAGGTCTGCG	0.622																																																	0																																										SO:0001627	intron_variant	0			AF325115	CCDS14496.1	Xq22.1-q22.3	2014-03-21			ENSG00000184905	ENSG00000184905			29818	protein-coding gene	gene with protein product						16221301	Standard	NM_080390		Approved	my048, MY0876G05, WEX1	uc004eip.3	Q9H3H9	OTTHUMG00000022048	ENST00000372780.1:c.-100-4G>A	X.37:g.101381341G>A			B2R5C7	RNA	SNP	-	NULL	ENST00000372780.1	37	NULL	CCDS14496.1	X																																																																																			TCEAL2	-	-	ENSG00000184905		0.622	TCEAL2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEAL2	HGNC	protein_coding	OTTHUMT00000057605.1	-	0.00	53	0	G	NM_080390		101381341	+1	tier1	-	no_errors	ENST00000476749	ensembl	human	known	74_37	rna	6.90	53	4	SNP	0.849	A
TDH	157739	genome.wustl.edu	37	8	11213740	11213740	+	RNA	SNP	G	G	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr8:11213740G>C	ENST00000534302.1	+	0	298									L-threonine dehydrogenase (pseudogene)																		AATTCCAGCAGATGCTAACTT	0.517																																																	0																																												0			AJ301562		8p23.1	2013-09-26	2013-09-26		ENSG00000154316	ENSG00000154316		"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	15547	pseudogene	pseudogene	"""short chain dehydrogenase/reductase family 14E, member 1 (pseudogene)"""	615174	"""L-threonine dehydrogenase"""			11896452, 12361482, 19027726	Standard	NR_001578		Approved	FLJ25033, SDR14E1P	uc003wtq.1	Q8IZJ6	OTTHUMG00000165365		8.37:g.11213740G>C				RNA	SNP	-	NULL	ENST00000534302.1	37	NULL		8																																																																																			TDH	-	-	ENSG00000154316		0.517	TDH-002	KNOWN	basic	processed_transcript	TDH	HGNC	pseudogene	OTTHUMT00000385807.1	-	0.00	45	0	G	NM_152566		11213740	+1	tier1	-	no_errors	ENST00000525246	ensembl	human	known	74_37	rna	33.33	32	16	SNP	0.945	C
TDRD12	91646	genome.wustl.edu	37	19	33246913	33246913	+	Missense_Mutation	SNP	G	G	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr19:33246913G>C	ENST00000444215.2	+	7	918	c.598G>C	c.(598-600)Gat>Cat	p.D200H	TDRD12_ENST00000421545.2_Missense_Mutation_p.D200H			Q587J7	TDR12_HUMAN	tudor domain containing 12	200					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			NS(1)|breast(1)|endometrium(3)|lung(2)|prostate(1)|skin(1)	9	Esophageal squamous(110;0.137)					TGTTAATGATGATCTTGTTGC	0.289																																																	0													108.0	92.0	97.0					19																	33246913		692	1589	2281	SO:0001583	missense	0			AK023134	CCDS46038.1	19q13.11	2013-01-23				ENSG00000173809		"""Tudor domain containing"""	25044	protein-coding gene	gene with protein product						11441184	Standard	NM_001110822		Approved	ECAT8, FLJ13072	uc002ntq.2	Q587J7		ENST00000444215.2:c.598G>C	19.37:g.33246913G>C	ENSP00000416248:p.Asp200His			Missense_Mutation	SNP	pfam_Tudor,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase	p.D200H	ENST00000444215.2	37	c.598		19	.	.	.	.	.	.	.	.	.	.	G	19.06	3.753760	0.69648	.	.	ENSG00000173809	ENST00000444215;ENST00000421545	T	0.28666	1.6	5.36	5.36	0.76844	.	0.135580	0.50627	D	0.000104	T	0.53384	0.1793	M	0.73962	2.25	0.41283	D	0.986926	D;D	0.89917	1.0;0.999	D;D	0.79108	0.992;0.927	T	0.46512	-0.9186	10	0.15499	T	0.54	-21.8302	16.3624	0.83273	0.0:0.0:1.0:0.0	.	200;200	E9PAY0;Q587J7	.;TDR12_HUMAN	H	200	ENSP00000416248:D200H	ENSP00000390621:D200H	D	+	1	0	TDRD12	37938753	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.388000	0.66249	2.673000	0.90976	0.561000	0.74099	GAT	TDRD12	-	NULL	ENSG00000173809		0.289	TDRD12-001	KNOWN	basic|appris_principal	protein_coding	TDRD12	HGNC	protein_coding	OTTHUMT00000435933.1		0.00	40	0	G	NM_001015890		33246913	+1			no_errors	ENST00000444215	ensembl	human	known	74_37	missense	7.32	38	3	SNP	1.000	C
TECRL	253017	genome.wustl.edu	37	4	65275053	65275053	+	Missense_Mutation	SNP	T	T	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr4:65275053T>C	ENST00000381210.3	-	1	127	c.17A>G	c.(16-18)aAg>aGg	p.K6R	TECRL_ENST00000507440.1_Missense_Mutation_p.K6R	NM_001010874.4	NP_001010874.2	Q5HYJ1	TECRL_HUMAN	trans-2,3-enoyl-CoA reductase-like	6					lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)			endometrium(2)|kidney(5)|large_intestine(7)|lung(30)|prostate(1)|skin(1)|stomach(1)	47						AGCGAGGGACTTGTGCCTTTT	0.398																																																	0													114.0	113.0	114.0					4																	65275053		2203	4300	6503	SO:0001583	missense	0			AL833108	CCDS33990.1	4q13.1	2009-07-21			ENSG00000205678	ENSG00000205678			27365	protein-coding gene	gene with protein product	"""glycoprotein, synaptic 2-like"""					12477932	Standard	NM_001010874		Approved	GPSN2L, SRD5A2L2, DKFZp313D0829, DKFZp313B2333, TERL	uc003hcv.3	Q5HYJ1	OTTHUMG00000160680	ENST00000381210.3:c.17A>G	4.37:g.65275053T>C	ENSP00000370607:p.Lys6Arg			Missense_Mutation	SNP	pfam_3-oxo-5_a-steroid_4-DH_C,pfscan_3-oxo-5_a-steroid_4-DH_C	p.K6R	ENST00000381210.3	37	c.17	CCDS33990.1	4	.	.	.	.	.	.	.	.	.	.	T	10.22	1.290089	0.23478	.	.	ENSG00000205678	ENST00000507440;ENST00000381210;ENST00000509536	T;T;T	0.44083	0.93;0.93;0.93	4.98	3.79	0.43588	.	0.185369	0.37715	N	0.001968	T	0.38799	0.1054	M	0.68317	2.08	0.24930	N	0.991928	B;B	0.10296	0.003;0.0	B;B	0.14023	0.01;0.001	T	0.36744	-0.9735	10	0.51188	T	0.08	-5.4001	7.4427	0.27192	0.0:0.1084:0.0:0.8916	.	6;6	Q6IN47;Q5HYJ1	.;TECRL_HUMAN	R	6	ENSP00000426043:K6R;ENSP00000370607:K6R;ENSP00000422497:K6R	ENSP00000370607:K6R	K	-	2	0	TECRL	64957648	0.839000	0.29477	0.968000	0.41197	0.376000	0.30014	0.573000	0.23699	0.838000	0.34948	0.528000	0.53228	AAG	TECRL	-	NULL	ENSG00000205678		0.398	TECRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TECRL	HGNC	protein_coding	OTTHUMT00000361705.4	-	0.00	112	0	T	NM_001010874		65275053	-1	tier1	-	no_errors	ENST00000381210	ensembl	human	known	74_37	missense	32.26	62	30	SNP	0.982	C
TENM3	55714	genome.wustl.edu	37	4	183674674	183674674	+	Nonsense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr4:183674674G>T	ENST00000511685.1	+	21	4057	c.3934G>T	c.(3934-3936)Gga>Tga	p.G1312*	TENM3_ENST00000406950.2_Nonsense_Mutation_p.G1312*|TENM3_ENST00000502950.1_3'UTR			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	1312					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										TGACCAAAATGGAATCATATC	0.383																																																	0													111.0	110.0	110.0					4																	183674674		1922	4138	6060	SO:0001587	stop_gained	0			AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.3934G>T	4.37:g.183674674G>T	ENSP00000424226:p.Gly1312*		Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Nonsense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Cyt_c-like_dom,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.G1312*	ENST00000511685.1	37	c.3934	CCDS47165.1	4	.	.	.	.	.	.	.	.	.	.	G	41	8.961511	0.99018	.	.	ENSG00000218336	ENST00000511685;ENST00000406950	.	.	.	5.65	5.65	0.86999	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	19.9142	0.97043	0.0:0.0:1.0:0.0	.	.	.	.	X	1312	.	ENSP00000385276:G1312X	G	+	1	0	ODZ3	183911668	1.000000	0.71417	1.000000	0.80357	0.351000	0.29236	9.657000	0.98554	2.941000	0.99782	0.655000	0.94253	GGA	TENM3	-	NULL	ENSG00000218336		0.383	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM3	HGNC	protein_coding	OTTHUMT00000361734.1	-	0.00	118	0	G			183674674	+1	tier1	-	no_errors	ENST00000406950	ensembl	human	known	74_37	nonsense	37.33	47	28	SNP	1.000	T
TET1	80312	genome.wustl.edu	37	10	70333166	70333166	+	Missense_Mutation	SNP	A	A	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr10:70333166A>C	ENST00000373644.4	+	2	1280	c.1071A>C	c.(1069-1071)gaA>gaC	p.E357D		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	357					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						ATCAACAGGAAGTTTCTGATA	0.498																																																	0													132.0	139.0	136.0					10																	70333166		2203	4300	6503	SO:0001583	missense	0			AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.1071A>C	10.37:g.70333166A>C	ENSP00000362748:p.Glu357Asp		Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	pfam_Znf_CXXC,pfscan_Znf_CXXC	p.E357D	ENST00000373644.4	37	c.1071	CCDS7281.1	10	.	.	.	.	.	.	.	.	.	.	A	9.992	1.231053	0.22626	.	.	ENSG00000138336	ENST00000373644	T	0.06933	3.24	4.92	-0.0723	0.13740	.	1.162350	0.06426	N	0.723190	T	0.05777	0.0151	N	0.24115	0.695	0.09310	N	1	B	0.14805	0.011	B	0.11329	0.006	T	0.43278	-0.9401	10	0.38643	T	0.18	.	3.8407	0.08912	0.5101:0.1901:0.2998:0.0	.	357	Q8NFU7	TET1_HUMAN	D	357	ENSP00000362748:E357D	ENSP00000362748:E357D	E	+	3	2	TET1	70003172	0.001000	0.12720	0.085000	0.20634	0.945000	0.59286	0.333000	0.19768	0.078000	0.16900	0.460000	0.39030	GAA	TET1	-	NULL	ENSG00000138336		0.498	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TET1	HGNC	protein_coding	OTTHUMT00000048354.1	-	0.00	75	0	A	NM_030625		70333166	+1	tier1	-	no_errors	ENST00000373644	ensembl	human	known	74_37	missense	38.33	37	23	SNP	0.024	C
TEX14	56155	genome.wustl.edu	37	17	56661931	56661931	+	Missense_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr17:56661931T>G	ENST00000240361.8	-	19	3204	c.3119A>C	c.(3118-3120)gAg>gCg	p.E1040A	TEX14_ENST00000389934.3_Missense_Mutation_p.E1034A|TEX14_ENST00000349033.5_Missense_Mutation_p.E1034A			Q8IWB6	TEX14_HUMAN	testis expressed 14	1040					attachment of spindle microtubules to kinetochore (GO:0008608)|intercellular bridge organization (GO:0043063)|male meiosis (GO:0007140)|mitotic sister chromatid separation (GO:0051306)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)	cell (GO:0005623)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|midbody (GO:0030496)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)			breast(6)|endometrium(5)|kidney(3)|large_intestine(22)|liver(1)|lung(24)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	81	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CTCTGGTTGCTCCTTTTGTCT	0.438																																																	0													204.0	171.0	182.0					17																	56661931		2203	4300	6503	SO:0001583	missense	0			AF285601	CCDS32692.1, CCDS32693.1, CCDS56042.1	17q22	2013-09-20	2007-03-13		ENSG00000121101	ENSG00000121101			11737	protein-coding gene	gene with protein product	"""cancer/testis antigen 113"""	605792	"""testis expressed sequence 14"""			11279525, 12711554	Standard	NM_031272		Approved	CT113	uc010dcz.2	Q8IWB6	OTTHUMG00000179245	ENST00000240361.8:c.3119A>C	17.37:g.56661931T>G	ENSP00000240361:p.Glu1040Ala		A6NH19|Q7RTP3|Q8ND97|Q9BXT9	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom	p.E1040A	ENST00000240361.8	37	c.3119	CCDS56042.1	17	.	.	.	.	.	.	.	.	.	.	T	10.80	1.453198	0.26161	.	.	ENSG00000121101	ENST00000240361;ENST00000389934;ENST00000349033	D;D;D	0.82433	-1.61;-1.61;-1.57	4.62	3.53	0.40419	.	0.491185	0.20149	N	0.098212	D	0.85204	0.5643	M	0.62723	1.935	0.09310	N	1	B;D;B	0.56746	0.143;0.977;0.223	B;P;B	0.55871	0.041;0.786;0.09	T	0.76356	-0.2989	10	0.72032	D	0.01	-0.4761	7.7478	0.28879	0.1864:0.0:0.0:0.8136	.	1040;1034;1034	Q8IWB6;Q8IWB6-3;Q8IWB6-2	TEX14_HUMAN;.;.	A	1040;1034;1034	ENSP00000240361:E1040A;ENSP00000374584:E1034A;ENSP00000268910:E1034A	ENSP00000240361:E1040A	E	-	2	0	TEX14	54016930	0.038000	0.19896	0.003000	0.11579	0.029000	0.11900	2.181000	0.42547	0.712000	0.32039	0.374000	0.22700	GAG	TEX14	-	NULL	ENSG00000121101		0.438	TEX14-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TEX14	HGNC	protein_coding	OTTHUMT00000445446.1		0.00	32	0	T			56661931	-1			no_errors	ENST00000240361	ensembl	human	known	74_37	missense	8.11	34	3	SNP	0.006	G
TGDS	23483	genome.wustl.edu	37	13	95229644	95229644	+	Missense_Mutation	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr13:95229644C>T	ENST00000261296.5	-	10	985	c.865G>A	c.(865-867)Gtt>Att	p.V289I	TGDS_ENST00000498294.1_5'Flank	NM_014305.2	NP_055120.1	O95455	TGDS_HUMAN	TDP-glucose 4,6-dehydratase	289					nucleotide-sugar metabolic process (GO:0009225)		coenzyme binding (GO:0050662)|dTDP-glucose 4,6-dehydratase activity (GO:0008460)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	8	all_neural(89;0.0684)|Medulloblastoma(90;0.163)					ACATAATCAACCCAATTTTCC	0.308																																																	0													109.0	118.0	115.0					13																	95229644		2203	4290	6493	SO:0001583	missense	0			AF048686	CCDS9471.1	13q32.1	2012-02-22			ENSG00000088451	ENSG00000088451	4.2.1.46	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	20324	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 2E, member 1"""					19027726	Standard	NM_014305		Approved	TDPGD, SDR2E1	uc001vlw.3	O95455	OTTHUMG00000046308	ENST00000261296.5:c.865G>A	13.37:g.95229644C>T	ENSP00000261296:p.Val289Ile		Q05DQ3|Q2TU31|Q5T3Z2|Q9H1T9	Missense_Mutation	SNP	pfam_Epimerase_deHydtase,pfam_3Beta_OHSteriod_DH/Estase,pfam_dTDP_dehydrorham_reduct,pfam_Polysac_CapD-like,pfam_Male_sterile_NAD-bd	p.V289I	ENST00000261296.5	37	c.865	CCDS9471.1	13	.	.	.	.	.	.	.	.	.	.	C	5.274	0.236006	0.10023	.	.	ENSG00000088451	ENST00000261296	D	0.87256	-2.23	6.06	6.06	0.98353	.	0.256822	0.39687	N	0.001288	T	0.62708	0.2450	N	0.01417	-0.88	0.34425	D	0.697884	B	0.02656	0.0	B	0.04013	0.001	T	0.64504	-0.6392	10	0.02654	T	1	.	9.4483	0.38710	0.0:0.883:0.0:0.117	.	289	O95455	TGDS_HUMAN	I	289	ENSP00000261296:V289I	ENSP00000261296:V289I	V	-	1	0	TGDS	94027645	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.716000	0.37981	2.871000	0.98454	0.655000	0.94253	GTT	TGDS	-	pfam_dTDP_dehydrorham_reduct	ENSG00000088451		0.308	TGDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGDS	HGNC	protein_coding	OTTHUMT00000106904.2	-	0.00	127	0	C	NM_014305		95229644	-1	tier1	-	no_errors	ENST00000261296	ensembl	human	known	74_37	missense	19.82	89	22	SNP	1.000	T
THRA	7067	genome.wustl.edu	37	17	38244559	38244559	+	Missense_Mutation	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr17:38244559C>T	ENST00000264637.4	+	8	1368	c.788C>T	c.(787-789)gCg>gTg	p.A263V	THRA_ENST00000450525.2_Missense_Mutation_p.A263V|THRA_ENST00000584985.1_Missense_Mutation_p.A263V|THRA_ENST00000546243.1_Missense_Mutation_p.A263V|THRA_ENST00000394121.4_Missense_Mutation_p.A263V	NM_003250.5	NP_003241.2	P10827	THA_HUMAN	thyroid hormone receptor, alpha	263	Ligand-binding.				cartilage condensation (GO:0001502)|cytoplasmic sequestering of transcription factor (GO:0042994)|erythrocyte differentiation (GO:0030218)|female courtship behavior (GO:0008050)|gene expression (GO:0010467)|hormone-mediated signaling pathway (GO:0009755)|learning or memory (GO:0007611)|negative regulation of DNA-templated transcription, initiation (GO:2000143)|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0017055)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of female receptivity (GO:0045925)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart contraction (GO:0008016)|regulation of lipid catabolic process (GO:0050994)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of thyroid hormone mediated signaling pathway (GO:0002155)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cold (GO:0009409)|thyroid gland development (GO:0030878)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Type I pneumocyte differentiation (GO:0060509)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|steroid receptor RNA activator RNA binding (GO:0002153)|TBP-class protein binding (GO:0017025)|thyroid hormone binding (GO:0070324)|thyroid hormone receptor activity (GO:0004887)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(3)|large_intestine(2)|lung(4)|prostate(1)	11	Colorectal(19;0.000442)	Myeloproliferative disorder(1115;0.0255)			Dextrothyroxine(DB00509)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	TCCCTGCGGGCGGCTGTCCGC	0.632																																																	0													92.0	79.0	84.0					17																	38244559		2203	4300	6503	SO:0001583	missense	0			J03239	CCDS11360.1, CCDS42316.1, CCDS58546.1	17q21.1	2013-01-16	2011-05-19		ENSG00000126351	ENSG00000126351		"""Nuclear hormone receptors"""	11796	protein-coding gene	gene with protein product		190120	"""thyroid hormone receptor, alpha (avian erythroblastic leukemia viral (v-erb-a) oncogene homolog)"", ""thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian)"""	THRA1, THRA2, ERBA1		6323162, 6589608	Standard	NM_003250		Approved	EAR-7.1/EAR-7.2, THRA3, AR7, ERBA, NR1A1	uc002htw.3	P10827	OTTHUMG00000133332	ENST00000264637.4:c.788C>T	17.37:g.38244559C>T	ENSP00000264637:p.Ala263Val		A8K3B5|P21205|Q8N6A1|Q96H73	Missense_Mutation	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_ThyrH_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.A263V	ENST00000264637.4	37	c.788	CCDS11360.1	17	.	.	.	.	.	.	.	.	.	.	c	26.8	4.775220	0.90108	.	.	ENSG00000126351	ENST00000394121;ENST00000264637;ENST00000450525;ENST00000546243	D;D;D;D	0.96651	-4.08;-4.08;-4.08;-4.08	4.97	4.97	0.65823	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.95878	0.8658	L	0.45470	1.425	0.80722	D	1	D;D;D	0.65815	0.973;0.979;0.995	B;P;B	0.51866	0.424;0.682;0.358	D	0.95642	0.8699	10	0.45353	T	0.12	.	17.0857	0.86611	0.0:1.0:0.0:0.0	.	263;263;263	P10827-3;P10827;Q6FH41	.;THA_HUMAN;.	V	263	ENSP00000377679:A263V;ENSP00000264637:A263V;ENSP00000395641:A263V;ENSP00000443972:A263V	ENSP00000264637:A263V	A	+	2	0	THRA	35498085	1.000000	0.71417	0.990000	0.47175	0.997000	0.91878	7.733000	0.84916	2.304000	0.77564	0.486000	0.48141	GCG	THRA	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_ThyrH_rcpt	ENSG00000126351		0.632	THRA-001	KNOWN	basic|CCDS	protein_coding	THRA	HGNC	protein_coding	OTTHUMT00000257160.2		0.00	56	0	C			38244559	+1			no_errors	ENST00000264637	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	T
TIAM1	7074	genome.wustl.edu	37	21	32508251	32508251	+	Splice_Site	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr21:32508251C>A	ENST00000286827.3	-	24	4354	c.3883G>T	c.(3883-3885)Gtc>Ttc	p.V1295F	TIAM1_ENST00000541036.1_Splice_Site_p.V1235F	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	1295	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						TGATACACACCGAATGCTGCC	0.448																																																	0													104.0	99.0	101.0					21																	32508251		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.3883+1G>T	21.37:g.32508251C>A			B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Raf-like_ras-bd,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_Pleckstrin_homology,smart_Raf-like_ras-bd,smart_PDZ,smart_DH-domain,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_Raf-like_ras-bd,pfscan_DH-domain	p.V1295F	ENST00000286827.3	37	c.3883	CCDS13609.1	21	.	.	.	.	.	.	.	.	.	.	C	20.7	4.034953	0.75617	.	.	ENSG00000156299	ENST00000286827;ENST00000541036	T;T	0.59364	0.27;0.3	5.25	5.25	0.73442	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.000000	0.85682	D	0.000000	T	0.76758	0.4032	M	0.76328	2.33	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	T	0.77186	-0.2680	9	.	.	.	.	18.8713	0.92315	0.0:1.0:0.0:0.0	.	1235;1235;1295	F5GZ53;B7ZLR6;Q13009	.;.;TIAM1_HUMAN	F	1295;1235	ENSP00000286827:V1295F;ENSP00000441570:V1235F	.	V	-	1	0	TIAM1	31430122	1.000000	0.71417	1.000000	0.80357	0.187000	0.23431	7.773000	0.85462	2.449000	0.82847	0.655000	0.94253	GTC	TIAM1	-	smart_Pleckstrin_homology	ENSG00000156299		0.448	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIAM1	HGNC	protein_coding	OTTHUMT00000192552.1	-	0.00	92	0	C	NM_003253	Missense_Mutation	32508251	-1	tier1	-	no_errors	ENST00000286827	ensembl	human	known	74_37	missense	5.49	86	5	SNP	1.000	A
TIMP3	7078	genome.wustl.edu	37	22	33253282	33253282	+	Missense_Mutation	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr22:33253282C>T	ENST00000266085.6	+	3	552	c.251C>T	c.(250-252)aCg>aTg	p.T84M	SYN3_ENST00000332840.5_Intron|SYN3_ENST00000358763.2_Intron	NM_000362.4	NP_000353.1	P35625	TIMP3_HUMAN	TIMP metallopeptidase inhibitor 3	84	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				cellular response to organic substance (GO:0071310)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|metalloendopeptidase inhibitor activity (GO:0008191)			endometrium(2)|large_intestine(3)|lung(1)|urinary_tract(1)	7						TACATCCATACGGAAGCTTCC	0.507																																																	0													159.0	129.0	139.0					22																	33253282		2203	4300	6503	SO:0001583	missense	0				CCDS13911.1	22q12.3	2013-01-08	2008-07-31		ENSG00000100234	ENSG00000100234			11822	protein-coding gene	gene with protein product		188826	"""tissue inhibitor of metalloproteinase 3 (Sorsby fundus dystrophy, pseudoinflammatory)"""	SFD		8188246, 12652295	Standard	NM_000362		Approved		uc003anb.3	P35625	OTTHUMG00000030784	ENST00000266085.6:c.251C>T	22.37:g.33253282C>T	ENSP00000266085:p.Thr84Met		B2RBY9|Q5THV4|Q9UC74|Q9UGS2	Missense_Mutation	SNP	pfam_Prot_inh_TIMP,superfamily_TIMP-like_OB-fold,smart_Prot_inh_TIMP,pfscan_Netrin_domain	p.T84M	ENST00000266085.6	37	c.251	CCDS13911.1	22	.	.	.	.	.	.	.	.	.	.	C	26.8	4.774166	0.90108	.	.	ENSG00000100234	ENST00000266085;ENST00000538671;ENST00000382049	D	0.96522	-4.04	5.62	5.62	0.85841	Tissue inhibitor of metalloproteinases-like, OB-fold (1);Netrin domain (1);	0.000000	0.85682	D	0.000000	D	0.98541	0.9513	M	0.90759	3.145	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99305	1.0902	10	0.87932	D	0	-13.4889	19.6488	0.95793	0.0:1.0:0.0:0.0	.	84	P35625	TIMP3_HUMAN	M	84;18;84	ENSP00000266085:T84M	ENSP00000266085:T84M	T	+	2	0	TIMP3	31583282	1.000000	0.71417	0.980000	0.43619	0.931000	0.56810	7.270000	0.78493	2.637000	0.89404	0.561000	0.74099	ACG	TIMP3	-	pfam_Prot_inh_TIMP,superfamily_TIMP-like_OB-fold,smart_Prot_inh_TIMP,pfscan_Netrin_domain	ENSG00000100234		0.507	TIMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIMP3	HGNC	protein_coding	OTTHUMT00000075672.2	-	0.00	77	0	C	NM_000362		33253282	+1	tier1	-	no_errors	ENST00000266085	ensembl	human	known	74_37	missense	25.49	38	13	SNP	1.000	T
TLR4	7099	genome.wustl.edu	37	9	120475898	120475898	+	Missense_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr9:120475898T>G	ENST00000355622.6	+	3	1593	c.1492T>G	c.(1492-1494)Ttg>Gtg	p.L498V	TLR4_ENST00000472304.1_3'UTR|TLR4_ENST00000394487.4_Missense_Mutation_p.L458V	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	498					activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	GCTGAGAAACTTGACCTTCCT	0.448																																																	0													79.0	77.0	78.0					9																	120475898		2203	4300	6503	SO:0001583	missense	0			U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.1492T>G	9.37:g.120475898T>G	ENSP00000363089:p.Leu498Val		A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	pirsf_Toll-like_receptor,pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.L498V	ENST00000355622.6	37	c.1492	CCDS6818.1	9	.	.	.	.	.	.	.	.	.	.	T	14.06	2.421589	0.43020	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	T;T	0.05081	3.5;3.5	5.72	3.39	0.38822	.	0.000000	0.52532	D	0.000067	T	0.19127	0.0459	M	0.76433	2.335	0.41262	D	0.986783	D	0.89917	1.0	D	0.97110	1.0	T	0.00809	-1.1557	10	0.87932	D	0	.	4.5719	0.12214	0.0:0.4523:0.0:0.5477	.	498	O00206	TLR4_HUMAN	V	458;498	ENSP00000377997:L458V;ENSP00000363089:L498V	ENSP00000363089:L498V	L	+	1	2	TLR4	119515719	0.885000	0.30320	0.310000	0.25168	0.162000	0.22319	1.253000	0.32886	1.006000	0.39211	0.528000	0.53228	TTG	TLR4	-	pirsf_Toll-like_receptor,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000136869		0.448	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR4	HGNC	protein_coding	OTTHUMT00000055549.3	-	0.00	54	0	T	NM_138554		120475898	+1	tier1	-	no_errors	ENST00000355622	ensembl	human	known	74_37	missense	64.29	20	36	SNP	0.773	G
TMEM205	374882	genome.wustl.edu	37	19	11456212	11456212	+	Missense_Mutation	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr19:11456212C>A	ENST00000354882.5	-	1	510	c.84G>T	c.(82-84)tgG>tgT	p.W28C	TMEM205_ENST00000593256.2_Missense_Mutation_p.W28C|TMEM205_ENST00000588560.1_Missense_Mutation_p.W28C|TMEM205_ENST00000589555.1_Missense_Mutation_p.W28C|CCDC159_ENST00000587100.1_Intron|CCDC159_ENST00000458408.1_5'Flank|TMEM205_ENST00000586590.1_Missense_Mutation_p.W28C|RAB3D_ENST00000589655.1_Intron|TMEM205_ENST00000587948.1_Missense_Mutation_p.W28C|TMEM205_ENST00000586956.1_Missense_Mutation_p.W28C|TMEM205_ENST00000447337.1_Missense_Mutation_p.W28C|TMEM205_ENST00000586218.1_Intron|CCDC159_ENST00000588790.1_Intron			Q6UW68	TM205_HUMAN	transmembrane protein 205	28						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				endometrium(1)|lung(1)	2						CGAAGGTCACCCACATTTGCA	0.567																																																	0													129.0	97.0	108.0					19																	11456212		2203	4300	6503	SO:0001583	missense	0			AK127147	CCDS32909.1	19p13.2	2008-01-09				ENSG00000105518			29631	protein-coding gene	gene with protein product		613771				12975309	Standard	NM_198536		Approved	UNQ501, MBC3205	uc002mrb.2	Q6UW68		ENST00000354882.5:c.84G>T	19.37:g.11456212C>A	ENSP00000346954:p.Trp28Cys			Missense_Mutation	SNP	NULL	p.W28C	ENST00000354882.5	37	c.84	CCDS32909.1	19	.	.	.	.	.	.	.	.	.	.	C	28.3	4.905718	0.92107	.	.	ENSG00000105518	ENST00000354882;ENST00000447337	.	.	.	5.71	5.71	0.89125	.	0.000000	0.85682	U	0.000000	D	0.85639	0.5743	M	0.90309	3.105	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.88041	0.2781	9	0.87932	D	0	-8.6736	18.6264	0.91340	0.0:1.0:0.0:0.0	.	28	Q6UW68	TM205_HUMAN	C	28	.	ENSP00000346954:W28C	W	-	3	0	TMEM205	11317212	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.606000	0.74159	2.691000	0.91804	0.561000	0.74099	TGG	TMEM205	-	NULL	ENSG00000105518		0.567	TMEM205-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TMEM205	HGNC	protein_coding	OTTHUMT00000458743.1		0.00	67	0	C	NM_198536		11456212	-1			no_errors	ENST00000354882	ensembl	human	known	74_37	missense	5.15	92	5	SNP	1.000	A
TPD52L1	7164	genome.wustl.edu	37	6	125583983	125583983	+	Missense_Mutation	SNP	A	A	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr6:125583983A>G	ENST00000534000.1	+	7	786	c.490A>G	c.(490-492)Aaa>Gaa	p.K164E	TPD52L1_ENST00000368402.5_Silent_p.R143R|TPD52L1_ENST00000532429.1_Missense_Mutation_p.K135E|TPD52L1_ENST00000392482.2_Silent_p.R101R|TPD52L1_ENST00000530868.1_3'UTR|TPD52L1_ENST00000528193.1_3'UTR|TPD52L1_ENST00000527711.1_Missense_Mutation_p.K151E|TPD52L1_ENST00000368388.2_Silent_p.R130R|TPD52L1_ENST00000524679.1_Silent_p.R101R|TPD52L1_ENST00000304877.13_Missense_Mutation_p.K169E|TPD52L1_ENST00000534199.1_Silent_p.R101R|HDDC2_ENST00000608456.1_Intron	NM_003287.2	NP_003278.1	Q16890	TPD53_HUMAN	tumor protein D52-like 1	164					G2/M transition of mitotic cell cycle (GO:0000086)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAP kinase activity (GO:0043406)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(2)|large_intestine(2)|prostate(1)	5			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0265)		ATTTCAGACGAAAGTAGGCGG	0.463																																																	0													77.0	71.0	73.0					6																	125583983		2203	4300	6503	SO:0001583	missense	0			U44427	CCDS5130.1, CCDS34527.1, CCDS34528.1, CCDS43502.1, CCDS75513.1, CCDS75514.1	6q22-q23	2008-07-29			ENSG00000111907	ENSG00000111907			12006	protein-coding gene	gene with protein product		604069				8812487, 16112108	Standard	NM_003287		Approved	D53, hD53	uc003pzu.1	Q16890	OTTHUMG00000015505	ENST00000534000.1:c.490A>G	6.37:g.125583983A>G	ENSP00000434142:p.Lys164Glu		A8K757|A8K772|A8MUD2|A8MUJ7|A8MW70|F6V707|O43397|Q5TC99|Q5TDQ0|Q9BUQ6|Q9C054	Missense_Mutation	SNP	pfam_TPD52	p.K164E	ENST00000534000.1	37	c.490	CCDS5130.1	6	.	.	.	.	.	.	.	.	.	.	A	24.3	4.514856	0.85389	.	.	ENSG00000111907	ENST00000304877;ENST00000534000;ENST00000527711;ENST00000532429;ENST00000392484	T;T;T;T	0.28255	1.62;1.62;1.62;1.62	5.8	5.8	0.92144	.	0.044613	0.85682	D	0.000000	T	0.48352	0.1495	.	.	.	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.55309	-0.8161	9	0.87932	D	0	-21.8727	13.6691	0.62414	1.0:0.0:0.0:0.0	.	164	Q16890	TPD53_HUMAN	E	169;164;151;135;164	ENSP00000306285:K169E;ENSP00000434142:K164E;ENSP00000436953:K151E;ENSP00000435447:K135E	ENSP00000306285:K169E	K	+	1	0	TPD52L1	125625682	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	5.716000	0.68437	2.221000	0.72209	0.528000	0.53228	AAA	TPD52L1	-	pfam_TPD52	ENSG00000111907		0.463	TPD52L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPD52L1	HGNC	protein_coding	OTTHUMT00000042065.2	-	0.00	76	0	A			125583983	+1	tier1	-	no_errors	ENST00000534000	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	G
TPO	7173	genome.wustl.edu	37	2	1499922	1499922	+	Missense_Mutation	SNP	G	G	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:1499922G>A	ENST00000345913.4	+	12	2259	c.2168G>A	c.(2167-2169)aGc>aAc	p.S723N	TPO_ENST00000346956.3_Missense_Mutation_p.S723N|TPO_ENST00000337415.3_Missense_Mutation_p.S723N|TPO_ENST00000382201.3_Missense_Mutation_p.S666N|TPO_ENST00000382198.1_Missense_Mutation_p.S550N|TPO_ENST00000497517.2_Intron|TPO_ENST00000349624.3_Missense_Mutation_p.S550N|TPO_ENST00000329066.4_Missense_Mutation_p.S723N	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	723					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	TCTTGTGACAGCATCACTGGC	0.542																																																	0													59.0	60.0	60.0					2																	1499922		2203	4300	6503	SO:0001583	missense	0				CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.2168G>A	2.37:g.1499922G>A	ENSP00000318820:p.Ser723Asn		P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_EGF-like_Ca-bd_dom,superfamily_Haem_peroxidase,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Sushi_SCR_CCP,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	p.S723N	ENST00000345913.4	37	c.2168	CCDS1643.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.007|0.007	-1.936454|-1.936454	0.00484|0.00484	.|.	.|.	ENSG00000115705|ENSG00000115705	ENST00000446278|ENST00000337415;ENST00000345913;ENST00000346956;ENST00000349624;ENST00000329066;ENST00000382201;ENST00000382198;ENST00000422464;ENST00000469607	.|T;T;T;T;T;T;T;T;T	.|0.72942	.|-0.7;-0.7;-0.7;-0.7;-0.7;-0.7;-0.7;-0.7;-0.7	4.39|4.39	0.631|0.631	0.17699|0.17699	.|.	.|1.223500	.|0.05298	.|N	.|0.522394	T|T	0.45696|0.45696	0.1355|0.1355	N|N	0.05306|0.05306	-0.075|-0.075	0.09310|0.09310	N|N	1|1	.|B;B;B;B	.|0.17852	.|0.001;0.024;0.001;0.001	.|B;B;B;B	.|0.22386	.|0.002;0.039;0.002;0.001	T|T	0.35475|0.35475	-0.9787|-0.9787	5|10	.|0.02654	.|T	.|1	-4.5111|-4.5111	7.7797|7.7797	0.29058|0.29058	0.63:0.0:0.37:0.0|0.63:0.0:0.37:0.0	.|.	.|723;550;666;723	.|P07202-4;P07202-5;P07202-2;P07202	.|.;.;.;PERT_HUMAN	T|N	198|723;723;723;550;723;666;550;652;197	.|ENSP00000337263:S723N;ENSP00000318820:S723N;ENSP00000263886:S723N;ENSP00000332044:S550N;ENSP00000329869:S723N;ENSP00000371636:S666N;ENSP00000371633:S550N;ENSP00000405788:S652N;ENSP00000419461:S197N	.|ENSP00000329869:S723N	A|S	+|+	1|2	0|0	TPO|TPO	1478929|1478929	0.000000|0.000000	0.05858|0.05858	0.002000|0.002000	0.10522|0.10522	0.002000|0.002000	0.02628|0.02628	0.503000|0.503000	0.22610|0.22610	-0.065000|-0.065000	0.13021|0.13021	-0.367000|-0.367000	0.07326|0.07326	GCA|AGC	TPO	-	superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal	ENSG00000115705		0.542	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPO	HGNC	protein_coding	OTTHUMT00000206594.2		0.00	66	0	G	NM_000547		1499922	+1			no_errors	ENST00000329066	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.002	A
TRAF5	7188	genome.wustl.edu	37	1	211542735	211542735	+	Intron	SNP	A	A	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr1:211542735A>G	ENST00000261464.5	+	9	843				TRAF5_ENST00000427925.2_Intron|TRAF5_ENST00000336184.2_Intron|TRAF5_ENST00000367004.3_Intron	NM_001033910.2	NP_001029082.1	O00463	TRAF5_HUMAN	TNF receptor-associated factor 5						apoptotic process (GO:0006915)|positive regulation of cell proliferation (GO:0008284)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	CD40 receptor complex (GO:0035631)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)	signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				OV - Ovarian serous cystadenocarcinoma(81;0.00946)|all cancers(67;0.0808)|Epithelial(68;0.144)		TGCATATTTTAACTATATGCA	0.299																																																	0																																										SO:0001627	intron_variant	0			AB000509	CCDS1497.1	1q32	2008-02-05			ENSG00000082512	ENSG00000082512		"""RING-type (C3HC4) zinc fingers"""	12035	protein-coding gene	gene with protein product		602356				9126477	Standard	NM_001033910		Approved	RNF84	uc001hii.3	O00463	OTTHUMG00000036997	ENST00000261464.5:c.790-59A>G	1.37:g.211542735A>G			B4DIS9|B4E0A2|Q6FHY1	RNA	SNP	-	NULL	ENST00000261464.5	37	NULL	CCDS1497.1	1																																																																																			TRAF5	-	-	ENSG00000082512		0.299	TRAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAF5	HGNC	protein_coding	OTTHUMT00000089825.1	-	0.00	36	0	A	NM_004619		211542735	+1	tier1	-	no_errors	ENST00000473385	ensembl	human	known	74_37	rna	50.00	19	19	SNP	0.652	G
TRAM1	23471	genome.wustl.edu	37	8	71495456	71495456	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr8:71495456G>T	ENST00000262213.2	-	10	1163	c.994C>A	c.(994-996)Cca>Aca	p.P332T	TRAM1_ENST00000521425.1_Missense_Mutation_p.P246T|TRAM1_ENST00000521049.1_5'Flank|TRAM1_ENST00000536748.1_Missense_Mutation_p.P301T	NM_014294.5	NP_055109.1	Q15629	TRAM1_HUMAN	translocation associated membrane protein 1	332					cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.P332S(1)		endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)	17			Epithelial(68;0.00679)|all cancers(69;0.0324)|OV - Ovarian serous cystadenocarcinoma(28;0.0509)			TTCACAGCTGGTGCCTGAAAA	0.398																																					Ovarian(85;984 1334 5116 12432 40638)												1	Substitution - Missense(1)	lung(1)											133.0	121.0	125.0					8																	71495456		2203	4300	6503	SO:0001583	missense	0			X63679	CCDS6207.1	8q13.1	2004-01-22			ENSG00000067167	ENSG00000067167			20568	protein-coding gene	gene with protein product		605190				1315422	Standard	NM_014294		Approved	TRAM, TRAMP	uc003xyo.2	Q15629	OTTHUMG00000164428	ENST00000262213.2:c.994C>A	8.37:g.71495456G>T	ENSP00000262213:p.Pro332Thr		B4E0K2	Missense_Mutation	SNP	pfam_TRAM1,pfam_TLC-dom,smart_TLC-dom,pirsf_Translocation_assoc_membrane,pfscan_TLC-dom	p.P332T	ENST00000262213.2	37	c.994	CCDS6207.1	8	.	.	.	.	.	.	.	.	.	.	G	11.44	1.640470	0.29157	.	.	ENSG00000067167	ENST00000521425;ENST00000262213;ENST00000536748	T;T;T	0.40225	1.04;1.62;1.62	5.21	4.33	0.51752	.	0.708670	0.14133	N	0.339261	T	0.29126	0.0724	L	0.29908	0.895	0.36007	D	0.837824	B	0.06786	0.001	B	0.08055	0.003	T	0.20438	-1.0275	10	0.19147	T	0.46	.	9.4144	0.38512	0.0747:0.1452:0.7801:0.0	.	332	Q15629	TRAM1_HUMAN	T	246;332;301	ENSP00000428052:P246T;ENSP00000262213:P332T;ENSP00000439359:P301T	ENSP00000262213:P332T	P	-	1	0	TRAM1	71658010	1.000000	0.71417	0.981000	0.43875	0.959000	0.62525	6.500000	0.73687	1.415000	0.47037	0.655000	0.94253	CCA	TRAM1	-	pirsf_Translocation_assoc_membrane	ENSG00000067167		0.398	TRAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAM1	HGNC	protein_coding	OTTHUMT00000378738.1		0.00	55	0	G	NM_014294		71495456	-1			no_errors	ENST00000262213	ensembl	human	known	74_37	missense	5.45	51	3	SNP	0.998	T
TRAM1L1	133022	genome.wustl.edu	37	4	118005646	118005646	+	Missense_Mutation	SNP	A	A	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr4:118005646A>G	ENST00000310754.4	-	1	1090	c.904T>C	c.(904-906)Tcg>Ccg	p.S302P		NM_152402.2	NP_689615.2	Q8N609	TR1L1_HUMAN	translocation associated membrane protein 1-like 1	302	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22						CAACTGGACGACAGAACAGCA	0.453																																																	0													119.0	109.0	112.0					4																	118005646		2203	4300	6503	SO:0001583	missense	0			AK074617	CCDS3707.1	4q26	2008-02-05			ENSG00000174599	ENSG00000174599			28371	protein-coding gene	gene with protein product						12477932	Standard	NM_152402		Approved	MGC26568	uc003ibv.4	Q8N609	OTTHUMG00000132956	ENST00000310754.4:c.904T>C	4.37:g.118005646A>G	ENSP00000309402:p.Ser302Pro		Q8N2L7	Missense_Mutation	SNP	pfam_TRAM1,pfam_TLC-dom,smart_TLC-dom,pirsf_Translocation_assoc_membrane,pfscan_TLC-dom	p.S302P	ENST00000310754.4	37	c.904	CCDS3707.1	4	.	.	.	.	.	.	.	.	.	.	A	12.16	1.854536	0.32791	.	.	ENSG00000174599	ENST00000310754	D	0.85171	-1.95	3.74	2.51	0.30379	TRAM/LAG1/CLN8 homology domain (3);	0.111598	0.64402	D	0.000012	D	0.84460	0.5477	L	0.48642	1.525	0.31136	N	0.707154	P	0.41624	0.757	P	0.53102	0.718	T	0.81145	-0.1066	10	0.40728	T	0.16	-24.3637	7.1094	0.25382	0.7697:0.2303:0.0:0.0	.	302	Q8N609	TR1L1_HUMAN	P	302	ENSP00000309402:S302P	ENSP00000309402:S302P	S	-	1	0	TRAM1L1	118225094	1.000000	0.71417	0.336000	0.25522	0.412000	0.31113	1.966000	0.40481	0.753000	0.32945	0.528000	0.53228	TCG	TRAM1L1	-	pfam_TLC-dom,smart_TLC-dom,pirsf_Translocation_assoc_membrane,pfscan_TLC-dom	ENSG00000174599		0.453	TRAM1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAM1L1	HGNC	protein_coding	OTTHUMT00000256513.1	-	0.00	61	0	A	NM_152402		118005646	-1	tier1	-	no_errors	ENST00000310754	ensembl	human	known	74_37	missense	63.89	13	23	SNP	0.839	G
TRHDE	29953	genome.wustl.edu	37	12	72956794	72956794	+	Silent	SNP	T	T	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr12:72956794T>C	ENST00000261180.4	+	9	1977	c.1881T>C	c.(1879-1881)acT>acC	p.T627T	TRHDE_ENST00000549138.1_3'UTR	NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	627					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						GTGCTAAAACTAAAGCACTTA	0.294																																																	0													83.0	88.0	86.0					12																	72956794		2203	4295	6498	SO:0001819	synonymous_variant	0			AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.1881T>C	12.37:g.72956794T>C			A5PL19|Q6UWJ4	Silent	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.T627	ENST00000261180.4	37	c.1881	CCDS9004.1	12																																																																																			TRHDE	-	NULL	ENSG00000072657		0.294	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRHDE	HGNC	protein_coding	OTTHUMT00000405380.1	-	0.00	82	0	T	NM_013381		72956794	+1	tier1	-	no_errors	ENST00000261180	ensembl	human	known	74_37	silent	40.30	40	27	SNP	1.000	C
TRIM22	10346	genome.wustl.edu	37	11	5717484	5717484	+	Missense_Mutation	SNP	G	G	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr11:5717484G>A	ENST00000379965.3	+	2	299	c.22G>A	c.(22-24)Gac>Aac	p.D8N	TRIM5_ENST00000380027.1_Intron	NM_001199573.1|NM_006074.4	NP_001186502.1|NP_006065.2	Q8IYM9	TRI22_HUMAN	tripartite motif containing 22	8					defense response to virus (GO:0051607)|immune response (GO:0006955)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein trimerization (GO:0070206)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			kidney(3)|large_intestine(8)|lung(9)|prostate(1)|stomach(2)	23		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;7.54e-09)|BRCA - Breast invasive adenocarcinoma(625;0.14)		AGTAAAGGTAGACATAGAGAA	0.512																																					GBM(104;491 2336 5222)												0													80.0	86.0	84.0					11																	5717484		2201	4297	6498	SO:0001583	missense	0			X82200	CCDS41612.1	11p15	2013-01-09	2011-01-25		ENSG00000132274	ENSG00000132274		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16379	protein-coding gene	gene with protein product		606559	"""tripartite motif-containing 22"""			11331580, 11096452	Standard	NM_006074		Approved	STAF50, GPSTAF50, RNF94	uc001mbr.3	Q8IYM9	OTTHUMG00000066904	ENST00000379965.3:c.22G>A	11.37:g.5717484G>A	ENSP00000369299:p.Asp8Asn		Q05CQ0|Q15521	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.D8N	ENST00000379965.3	37	c.22	CCDS41612.1	11	.	.	.	.	.	.	.	.	.	.	G	2.288	-0.363192	0.05103	.	.	ENSG00000132274	ENST00000379965;ENST00000425490;ENST00000454828;ENST00000414641;ENST00000455293	D;D;D;D	0.84146	-1.81;-1.81;-1.81;-1.81	4.82	1.06	0.20224	Zinc finger, RING/FYVE/PHD-type (1);	.	.	.	.	T	0.61602	0.2360	N	0.03194	-0.395	0.09310	N	1	B;B;B	0.15719	0.001;0.014;0.001	B;B;B	0.16722	0.0;0.016;0.003	T	0.50499	-0.8821	9	0.02654	T	1	.	7.3684	0.26787	0.6895:0.0:0.3105:0.0	.	8;8;8	C9JWC5;Q8IYM9-2;Q8IYM9	.;.;TRI22_HUMAN	N	8	ENSP00000369299:D8N;ENSP00000400417:D8N;ENSP00000393250:D8N;ENSP00000396849:D8N	ENSP00000369299:D8N	D	+	1	0	TRIM22	5674060	0.000000	0.05858	0.000000	0.03702	0.259000	0.26198	-0.549000	0.06041	-0.003000	0.14444	0.467000	0.42956	GAC	TRIM22	-	NULL	ENSG00000132274		0.512	TRIM22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM22	HGNC	protein_coding	OTTHUMT00000143387.2	-	0.00	71	0	G	NM_006074		5717484	+1	tier1	-	no_errors	ENST00000379965	ensembl	human	known	74_37	missense	39.02	49	32	SNP	0.000	A
TRIM58	25893	genome.wustl.edu	37	1	248039702	248039702	+	Missense_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr1:248039702T>G	ENST00000366481.3	+	6	1420	c.1372T>G	c.(1372-1374)Ttg>Gtg	p.L458V	OR2W3_ENST00000537741.1_Intron	NM_015431.3	NP_056246.3	Q8NG06	TRI58_HUMAN	tripartite motif containing 58	458	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(39)|ovary(4)|pancreas(1)|skin(7)|stomach(1)	63	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			TCCTCTTATCTTGCCACCCAC	0.418																																																	0													123.0	117.0	119.0					1																	248039702		2203	4300	6503	SO:0001583	missense	0			AF327057	CCDS1636.1	1q44	2013-01-09	2011-01-25		ENSG00000162722	ENSG00000162722		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	24150	protein-coding gene	gene with protein product			"""tripartite motif-containing 58"""				Standard	NM_015431		Approved	BIA2	uc001ido.3	Q8NG06	OTTHUMG00000040203	ENST00000366481.3:c.1372T>G	1.37:g.248039702T>G	ENSP00000355437:p.Leu458Val		Q6B0H9	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.L458V	ENST00000366481.3	37	c.1372	CCDS1636.1	1	.	.	.	.	.	.	.	.	.	.	T	14.82	2.649326	0.47362	.	.	ENSG00000162722	ENST00000366481	T	0.62788	0.0	4.05	-4.25	0.03766	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);	0.000000	0.44483	D	0.000446	T	0.65365	0.2684	L	0.41961	1.31	0.09310	N	1	D	0.65815	0.995	D	0.68039	0.955	T	0.64803	-0.6321	10	0.66056	D	0.02	.	12.5611	0.56281	0.0:0.702:0.0:0.298	.	458	Q8NG06	TRI58_HUMAN	V	458	ENSP00000355437:L458V	ENSP00000355437:L458V	L	+	1	2	TRIM58	246106325	0.001000	0.12720	0.000000	0.03702	0.065000	0.16274	-0.245000	0.08890	-0.888000	0.03956	0.528000	0.53228	TTG	TRIM58	-	superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000162722		0.418	TRIM58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM58	HGNC	protein_coding	OTTHUMT00000096860.1	-	0.00	69	0	T	NM_015431		248039702	+1	tier1	-	no_errors	ENST00000366481	ensembl	human	known	74_37	missense	38.24	42	26	SNP	0.000	G
TRIM66	9866	genome.wustl.edu	37	11	8669569	8669569	+	Missense_Mutation	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr11:8669569C>A	ENST00000299550.6	-	5	549	c.355G>T	c.(355-357)Gtg>Ttg	p.V119L	TRIM66_ENST00000402157.2_Missense_Mutation_p.V117L|TRIM66_ENST00000531498.1_5'UTR	NM_014818.1	NP_055633.1	O15016	TRI66_HUMAN	tripartite motif containing 66	119						aggresome (GO:0016235)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|kidney(1)|lung(1)|skin(2)	9						TTATGTGCCACCTGTGTAGTC	0.493																																																	0													239.0	210.0	219.0					11																	8669569		692	1591	2283	SO:0001583	missense	0			AB002296		11p15.4	2013-01-28	2011-01-25		ENSG00000166436	ENSG00000166436		"""Tripartite motif containing / Tripartite motif containing"", ""Zinc fingers, PHD-type"""	29005	protein-coding gene	gene with protein product		612000	"""chromosome 11 open reading frame 29"", ""tripartite motif-containing 66"""	C11orf29		9205841	Standard	NM_014818		Approved	KIAA0298, TIF1D	uc010rbo.2	O15016	OTTHUMG00000150481	ENST00000299550.6:c.355G>T	11.37:g.8669569C>A	ENSP00000299550:p.Val119Leu		Q9BQQ4	Missense_Mutation	SNP	pfam_Bromodomain,pfam_Znf_B-box,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_B-box,smart_Znf_PHD,smart_Bbox_C,smart_Bromodomain,pfscan_Znf_B-box,pfscan_Znf_PHD-finger,pfscan_Bromodomain	p.V119L	ENST00000299550.6	37	c.355		11	.	.	.	.	.	.	.	.	.	.	C	21.9	4.219392	0.79464	.	.	ENSG00000166436	ENST00000299550;ENST00000402157	T;T	0.66995	-0.24;-0.16	5.66	5.66	0.87406	B-box, C-terminal (1);	0.089076	0.43747	D	0.000535	T	0.68604	0.3019	N	0.17872	0.535	0.43782	D	0.996318	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.991	T	0.60224	-0.7305	10	0.05833	T	0.94	-9.8615	19.756	0.96291	0.0:1.0:0.0:0.0	.	119;117	O15016;B5MCJ9	TRI66_HUMAN;.	L	119;117	ENSP00000299550:V119L;ENSP00000384876:V117L	ENSP00000299550:V119L	V	-	1	0	TRIM66	8626145	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.234000	0.51320	2.665000	0.90641	0.655000	0.94253	GTG	TRIM66	-	smart_Bbox_C	ENSG00000166436		0.493	TRIM66-201	KNOWN	basic|appris_candidate	protein_coding	TRIM66	HGNC	protein_coding		-	0.00	63	0	C	XM_084529		8669569	-1	tier1	-	no_errors	ENST00000299550	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	A
TRIOBP	11078	genome.wustl.edu	37	22	38155470	38155470	+	Intron	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr22:38155470G>T	ENST00000406386.3	+	17	6579				TRIOBP_ENST00000403663.2_Intron|TRIOBP_ENST00000407319.2_Missense_Mutation_p.S411I	NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein						actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					aggccactgagctctgagagg	0.567																																																	0													107.0	104.0	105.0					22																	38155470		2203	4300	6503	SO:0001627	intron_variant	0			AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.6324+199G>T	22.37:g.38155470G>T			B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.S411I	ENST00000406386.3	37	c.1232	CCDS43015.1	22	.	.	.	.	.	.	.	.	.	.	G	16.39	3.110176	0.56398	.	.	ENSG00000100106	ENST00000407319	.	.	.	5.16	5.16	0.70880	.	.	.	.	.	T	0.37785	0.1016	N	0.08118	0	0.80722	D	1	P	0.42039	0.769	B	0.42343	0.384	T	0.46498	-0.9187	8	0.87932	D	0	.	14.889	0.70594	0.0:0.0:1.0:0.0	.	411	F2Z2W0	.	I	411	.	ENSP00000383913:S411I	S	+	2	0	TRIOBP	36485416	0.999000	0.42202	0.999000	0.59377	0.994000	0.84299	4.270000	0.58896	2.784000	0.95788	0.643000	0.83706	AGC	TRIOBP	-	NULL	ENSG00000100106		0.567	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIOBP	HGNC	protein_coding	OTTHUMT00000319439.2		0.00	35	0	G			38155470	+1			no_errors	ENST00000407319	ensembl	human	known	74_37	missense	9.68	28	3	SNP	1.000	T
TRMT10C	54931	genome.wustl.edu	37	3	101283646	101283646	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr3:101283646G>T	ENST00000309922.6	+	2	175	c.21G>T	c.(19-21)atG>atT	p.M7I		NM_017819.2	NP_060289.2	Q7L0Y3	MRRP1_HUMAN	tRNA methyltransferase 10 homolog C (S. cerevisiae)	7					mitochondrial RNA 5'-end processing (GO:0000964)|tRNA processing (GO:0008033)	mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)	p.M7I(1)									TCCTCAAAATGAGTGTTAGTG	0.328																																																	1	Substitution - Missense(1)	lung(1)											163.0	155.0	157.0					3																	101283646		1807	4072	5879	SO:0001583	missense	0			AK000439	CCDS43122.1	3q12.3	2012-06-28	2012-06-28	2012-06-28	ENSG00000174173	ENSG00000174173			26022	protein-coding gene	gene with protein product	"""mitochondrial RNase P subunit 1"""	615423	"""RNA (guanine-9-) methyltransferase domain containing 1"""	RG9MTD1		18984158	Standard	NM_017819		Approved	FLJ20432, MRPP1	uc003duz.4	Q7L0Y3	OTTHUMG00000159114	ENST00000309922.6:c.21G>T	3.37:g.101283646G>T	ENSP00000312356:p.Met7Ile		Q9NRG5|Q9NX54|Q9Y596	Missense_Mutation	SNP	pfam_tRNA_m1G_MeTrfase	p.M7I	ENST00000309922.6	37	c.21	CCDS43122.1	3	.	.	.	.	.	.	.	.	.	.	G	12.73	2.026915	0.35797	.	.	ENSG00000174173	ENST00000309922;ENST00000495642	T;T	0.24538	2.48;1.85	6.04	6.04	0.98038	.	1.203180	0.05772	N	0.607004	T	0.45175	0.1329	N	0.24115	0.695	0.35583	D	0.806439	D	0.69078	0.997	D	0.73380	0.98	T	0.41680	-0.9495	10	0.87932	D	0	-12.6492	18.383	0.90457	0.0:0.0:1.0:0.0	.	7	Q7L0Y3	MRRP1_HUMAN	I	7	ENSP00000312356:M7I;ENSP00000419389:M7I	ENSP00000312356:M7I	M	+	3	0	RG9MTD1	102766336	1.000000	0.71417	1.000000	0.80357	0.402000	0.30811	4.446000	0.60014	2.873000	0.98535	0.563000	0.77884	ATG	TRMT10C	-	NULL	ENSG00000174173		0.328	TRMT10C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRMT10C	HGNC	protein_coding	OTTHUMT00000353400.2		0.00	67	0	G	NM_017819		101283646	+1			no_errors	ENST00000309922	ensembl	human	known	74_37	missense	7.50	37	3	SNP	1.000	T
TRPM1	4308	genome.wustl.edu	37	15	31339406	31339406	+	Missense_Mutation	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr15:31339406C>T	ENST00000256552.6	-	15	1819	c.1672G>A	c.(1672-1674)Gtg>Atg	p.V558M	TRPM1_ENST00000397795.2_Missense_Mutation_p.V536M|TRPM1_ENST00000542188.1_Missense_Mutation_p.V575M	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1											NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		TACTCCAGCACGAGCCCGATG	0.512																																																	0													99.0	99.0	99.0					15																	31339406		1996	4162	6158	SO:0001583	missense	0			AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.1672G>A	15.37:g.31339406C>T	ENSP00000256552:p.Val558Met			Missense_Mutation	SNP	pfam_Ion_trans_dom	p.V575M	ENST00000256552.6	37	c.1723	CCDS58346.1	15	.	.	.	.	.	.	.	.	.	.	C	24.5	4.538833	0.85917	.	.	ENSG00000134160	ENST00000397795;ENST00000542188;ENST00000256552;ENST00000397793	T;T;T	0.59638	0.26;0.25;0.28	5.48	4.55	0.56014	.	0.063075	0.64402	D	0.000006	T	0.78027	0.4219	M	0.83223	2.63	0.58432	D	0.999994	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.82329	-0.0511	10	0.87932	D	0	-20.181	16.0599	0.80832	0.0:0.8655:0.1345:0.0	.	530;536	Q7Z4N2-3;Q7Z4N2	.;TRPM1_HUMAN	M	536;575;558;536	ENSP00000380897:V536M;ENSP00000437849:V575M;ENSP00000256552:V558M	ENSP00000256552:V558M	V	-	1	0	TRPM1	29126698	1.000000	0.71417	0.876000	0.34364	0.903000	0.53119	4.885000	0.63142	1.263000	0.44181	0.637000	0.83480	GTG	TRPM1	-	NULL	ENSG00000134160		0.512	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	TRPM1	HGNC	protein_coding	OTTHUMT00000417166.2	-	0.00	119	0	C	NM_002420		31339406	-1	tier1	-	no_errors	ENST00000542188	ensembl	human	known	74_37	missense	28.95	54	22	SNP	0.999	T
TRPV3	162514	genome.wustl.edu	37	17	3436156	3436156	+	Missense_Mutation	SNP	G	G	A	rs200272068		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr17:3436156G>A	ENST00000576742.1	-	8	1181	c.860C>T	c.(859-861)aCg>aTg	p.T287M	TRPV3_ENST00000301365.4_Missense_Mutation_p.T287M|TRPV3_ENST00000572519.1_Missense_Mutation_p.T287M	NM_001258205.1|NM_145068.3	NP_001245134.1|NP_659505.1	Q8NET8	TRPV3_HUMAN	transient receptor potential cation channel, subfamily V, member 3	287					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|negative regulation of hair cycle (GO:0042636)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium channel activity (GO:0005262)	p.T287K(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(12)|ovary(5)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	35					Menthol(DB00825)	GGTGATGTCCGTCTGCTCGTG	0.607																																																	1	Substitution - Missense(1)	lung(1)											178.0	124.0	142.0					17																	3436156		2203	4300	6503	SO:0001583	missense	0			AF514998	CCDS11029.1, CCDS58500.1	17p13.3	2013-01-10			ENSG00000167723	ENSG00000167723		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18084	protein-coding gene	gene with protein product		607066				12016205, 12077606, 16382100	Standard	NM_001258205		Approved	VRL3	uc002fvr.3	Q8NET8	OTTHUMG00000090695	ENST00000576742.1:c.860C>T	17.37:g.3436156G>A	ENSP00000461518:p.Thr287Met		Q8NDW7|Q8NET9|Q8NFH2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPV1-4_channel	p.T287M	ENST00000576742.1	37	c.860	CCDS11029.1	17	.	.	.	.	.	.	.	.	.	.	G	17.65	3.441095	0.63067	.	.	ENSG00000167723	ENST00000381913;ENST00000301365;ENST00000430263	T	0.53423	0.62	5.05	5.05	0.67936	Ankyrin repeat-containing domain (3);	0.000000	0.64402	D	0.000001	T	0.62097	0.2400	L	0.44542	1.39	0.51767	D	0.999935	D;D;D;D;D;D;D	0.89917	0.987;0.994;1.0;0.994;1.0;1.0;1.0	P;P;D;P;D;D;D	0.69824	0.707;0.806;0.95;0.871;0.966;0.95;0.917	T	0.65125	-0.6244	10	0.87932	D	0	-10.7238	17.7676	0.88483	0.0:0.0:1.0:0.0	.	271;271;287;271;287;287;287	E7EV24;B7ZKP9;Q2M3L1;B7ZKP6;Q8NET8-3;Q8NET8;Q8NET8-2	.;.;.;.;.;TRPV3_HUMAN;.	M	287;287;271	ENSP00000301365:T287M	ENSP00000301365:T287M	T	-	2	0	TRPV3	3382906	1.000000	0.71417	0.996000	0.52242	0.004000	0.04260	9.330000	0.96422	2.501000	0.84356	0.561000	0.74099	ACG	TRPV3	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPV1-4_channel	ENSG00000167723		0.607	TRPV3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TRPV3	HGNC	protein_coding	OTTHUMT00000207379.2	-	0.00	37	0	G	NM_145068		3436156	-1	tier1	rs200272068	no_errors	ENST00000301365	ensembl	human	known	74_37	missense	44.00	14	11	SNP	0.998	A
TTI2	80185	genome.wustl.edu	37	8	33361280	33361280	+	Silent	SNP	C	C	A	rs17850186	byFrequency	TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr8:33361280C>A	ENST00000431156.2	-	5	1719	c.1101G>T	c.(1099-1101)ccG>ccT	p.P367P	TTI2_ENST00000519356.1_5'UTR|TTI2_ENST00000520636.1_Silent_p.P336P|TTI2_ENST00000360742.5_Silent_p.P367P	NM_001102401.2	NP_001095871.1	Q6NXR4	TTI2_HUMAN	TELO2 interacting protein 2	367																	TCACGAAAGCCGGCAGGTTTC	0.527																																																	0													33.0	31.0	32.0					8																	33361280		2203	4300	6503	SO:0001819	synonymous_variant	0			AK026916	CCDS6090.1	8p12	2011-11-10	2011-11-10	2011-09-22		ENSG00000129696			26262	protein-coding gene	gene with protein product		614426	"""chromosome 8 open reading frame 41"", ""Tel2 interacting protein 2 homolog (S. pombe)"""	C8orf41		20801936, 20810650	Standard	NM_025115		Approved	FLJ23263	uc003xjm.5	Q6NXR4		ENST00000431156.2:c.1101G>T	8.37:g.33361280C>A			D3DSV7|Q96IM2|Q9H5N4	Silent	SNP	pfam_DUF2454,superfamily_ARM-type_fold	p.P367	ENST00000431156.2	37	c.1101	CCDS6090.1	8																																																																																			TTI2	-	pfam_DUF2454,superfamily_ARM-type_fold	ENSG00000129696		0.527	TTI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTI2	HGNC	protein_coding	OTTHUMT00000376555.1		0.00	37	0	C	NM_025115		33361280	-1			no_errors	ENST00000360742	ensembl	human	known	74_37	silent	5.56	34	2	SNP	0.865	A
TTN	7273	genome.wustl.edu	37	2	179439329	179439329	+	Missense_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:179439329T>G	ENST00000591111.1	-	276	66831	c.66607A>C	c.(66607-66609)Aca>Cca	p.T22203P	TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.T14971P|RP11-171I2.5_ENST00000604215.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.T23844P|TTN_ENST00000342992.6_Missense_Mutation_p.T21276P|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.T14904P|TTN_ENST00000460472.2_Missense_Mutation_p.T14779P|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA			Q8WZ42	TITIN_HUMAN	titin	22203	Fibronectin type-III 61. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAGCTAATTGTCATTGAATCC	0.453																																																	0													101.0	95.0	97.0					2																	179439329		1900	4134	6034	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.66607A>C	2.37:g.179439329T>G	ENSP00000465570:p.Thr22203Pro		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.T21276P	ENST00000591111.1	37	c.63826		2	.	.	.	.	.	.	.	.	.	.	T	9.883	1.202075	0.22121	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.59502	0.26;0.26;0.26;0.26	5.7	5.7	0.88788	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.77903	0.4200	M	0.93283	3.4	0.45962	D	0.998781	D;D;D;D	0.54397	0.966;0.966;0.966;0.966	P;P;P;P	0.57679	0.69;0.69;0.825;0.825	D	0.83606	0.0131	9	0.87932	D	0	.	11.8693	0.52511	0.0:0.0703:0.0:0.9297	.	14779;14904;14971;22203	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	P	21276;14779;14971;14904;14777	ENSP00000343764:T21276P;ENSP00000434586:T14779P;ENSP00000340554:T14971P;ENSP00000352154:T14904P	ENSP00000340554:T14971P	T	-	1	0	TTN	179147575	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.244000	0.58728	2.179000	0.69175	0.528000	0.53228	ACA	TTN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.453	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	73	0	T	NM_133378		179439329	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	32.35	45	22	SNP	1.000	G
TTN	7273	genome.wustl.edu	37	2	179442443	179442443	+	Missense_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:179442443T>G	ENST00000591111.1	-	273	64011	c.63787A>C	c.(63787-63789)Act>Cct	p.T21263P	TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.T14031P|RP11-171I2.5_ENST00000604215.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.T22904P|TTN_ENST00000342992.6_Missense_Mutation_p.T20336P|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.T13964P|TTN_ENST00000460472.2_Missense_Mutation_p.T13839P|RP11-171I2.2_ENST00000603521.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA			Q8WZ42	TITIN_HUMAN	titin	21263	Fibronectin type-III 54. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACAAGGTCAGTTACAGTAAAG	0.393																																																	0													163.0	146.0	152.0					2																	179442443		1933	4129	6062	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.63787A>C	2.37:g.179442443T>G	ENSP00000465570:p.Thr21263Pro		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.T20336P	ENST00000591111.1	37	c.61006		2	.	.	.	.	.	.	.	.	.	.	T	12.52	1.961275	0.34565	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.59083	0.29;0.29;0.29;0.29	5.68	5.68	0.88126	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.63094	0.2482	M	0.78344	2.41	0.46061	D	0.998841	B;B;B;B	0.20550	0.046;0.046;0.046;0.046	B;B;B;B	0.26094	0.066;0.066;0.066;0.066	T	0.64028	-0.6503	9	0.87932	D	0	.	15.9266	0.79621	0.0:0.0:0.0:1.0	.	13839;13964;14031;21263	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	P	20336;13839;14031;13964;13837	ENSP00000343764:T20336P;ENSP00000434586:T13839P;ENSP00000340554:T14031P;ENSP00000352154:T13964P	ENSP00000340554:T14031P	T	-	1	0	TTN	179150689	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.259000	0.72494	2.179000	0.69175	0.477000	0.44152	ACT	TTN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.393	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	34	0	T	NM_133378		179442443	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	29.03	22	9	SNP	1.000	G
TTN	7273	genome.wustl.edu	37	2	179598063	179598063	+	Missense_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:179598063T>G	ENST00000591111.1	-	52	15230	c.15006A>C	c.(15004-15006)aaA>aaC	p.K5002N	TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.K5319N|TTN_ENST00000342992.6_Missense_Mutation_p.K4075N|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000582847.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12381	Ig-like 30.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGAATAAAATTTGAGCTGGG	0.438																																																	0													89.0	86.0	87.0					2																	179598063		1837	4097	5934	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.15006A>C	2.37:g.179598063T>G	ENSP00000465570:p.Lys5002Asn		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.K4075N	ENST00000591111.1	37	c.12225		2	.	.	.	.	.	.	.	.	.	.	T	11.51	1.660294	0.29515	.	.	ENSG00000155657	ENST00000342992	T	0.67523	-0.27	5.86	1.76	0.24704	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.76898	0.4052	M	0.71296	2.17	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	T	0.75997	-0.3120	9	0.87932	D	0	.	8.9554	0.35814	0.0:0.3561:0.0:0.6439	.	5002	Q8WZ42	TITIN_HUMAN	N	4075	ENSP00000343764:K4075N	ENSP00000343764:K4075N	K	-	3	2	TTN	179306308	0.995000	0.38212	1.000000	0.80357	0.972000	0.66771	0.318000	0.19504	0.464000	0.27142	0.533000	0.62120	AAA	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000155657		0.438	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	75	0	T	NM_133378		179598063	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	21.28	37	10	SNP	1.000	G
TTN	7273	genome.wustl.edu	37	2	179590564	179590564	+	Missense_Mutation	SNP	C	C	A	rs139549363		TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:179590564C>A	ENST00000591111.1	-	68	19758	c.19534G>T	c.(19534-19536)Ggt>Tgt	p.G6512C	RP11-171I2.1_ENST00000590024.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.G6829C|TTN_ENST00000342992.6_Missense_Mutation_p.G5585C|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin	12113	Ig-like 46.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGTATTCACCGATGTCTGAA	0.393																																																	0													166.0	156.0	159.0					2																	179590564		1884	4145	6029	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.19534G>T	2.37:g.179590564C>A	ENSP00000465570:p.Gly6512Cys		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.G5585C	ENST00000591111.1	37	c.16753		2	.	.	.	.	.	.	.	.	.	.	C	15.34	2.805956	0.50421	.	.	ENSG00000155657	ENST00000342992	T	0.81415	-1.49	5.87	5.87	0.94306	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.95092	0.8410	H	0.99590	4.645	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96531	0.9393	9	0.87932	D	0	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	6512	Q8WZ42	TITIN_HUMAN	C	5585	ENSP00000343764:G5585C	ENSP00000343764:G5585C	G	-	1	0	TTN	179298809	1.000000	0.71417	0.982000	0.44146	0.979000	0.70002	7.668000	0.83897	2.941000	0.99782	0.655000	0.94253	GGT	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000155657		0.393	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1		0.00	70	0	C	NM_133378		179590564	-1			no_errors	ENST00000342992	ensembl	human	known	74_37	missense	5.08	56	3	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179599578	179599578	+	Missense_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:179599578T>G	ENST00000591111.1	-	49	14346	c.14122A>C	c.(14122-14124)Agt>Cgt	p.S4708R	TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.S5025R|TTN_ENST00000342992.6_Missense_Mutation_p.S3781R|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000582847.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12088	Ig-like 27.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACTGTGTTACTTTCACTGAGT	0.403																																																	0													87.0	82.0	83.0					2																	179599578		1869	4100	5969	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.14122A>C	2.37:g.179599578T>G	ENSP00000465570:p.Ser4708Arg		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.S3781R	ENST00000591111.1	37	c.11341		2	.	.	.	.	.	.	.	.	.	.	T	11.74	1.728568	0.30593	.	.	ENSG00000155657	ENST00000342992	T	0.49432	0.78	5.89	5.89	0.94794	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.66127	0.2758	M	0.68728	2.09	0.80722	D	1	D	0.64830	0.994	D	0.63703	0.917	T	0.69316	-0.5177	9	0.87932	D	0	.	16.3127	0.82898	0.0:0.0:0.0:1.0	.	4708	Q8WZ42	TITIN_HUMAN	R	3781	ENSP00000343764:S3781R	ENSP00000343764:S3781R	S	-	1	0	TTN	179307823	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.869000	0.56062	2.246000	0.74042	0.533000	0.62120	AGT	TTN	-	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	ENSG00000155657		0.403	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	55	0	T	NM_133378		179599578	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	33.33	40	20	SNP	1.000	G
UBE3B	89910	genome.wustl.edu	37	12	109959273	109959273	+	Missense_Mutation	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr12:109959273C>A	ENST00000342494.3	+	21	2876	c.2281C>A	c.(2281-2283)Ccc>Acc	p.P761T	UBE3B_ENST00000434735.2_Missense_Mutation_p.P761T	NM_130466.3	NP_569733.2	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B	761	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(3)|endometrium(6)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|urinary_tract(2)	45						GAGGCTGTACCCCTCACCCAC	0.522																																																	0													98.0	85.0	90.0					12																	109959273		2203	4300	6503	SO:0001583	missense	0			BC032301	CCDS9129.1, CCDS58277.1	12q24.12	2004-03-02			ENSG00000151148	ENSG00000151148			13478	protein-coding gene	gene with protein product		608047					Standard	NM_130466		Approved		uc001toq.4	Q7Z3V4	OTTHUMG00000169254	ENST00000342494.3:c.2281C>A	12.37:g.109959273C>A	ENSP00000340596:p.Pro761Thr		A5D8Z3|Q05BX9|Q659F7|Q7Z7Q1|Q9BXZ4	Missense_Mutation	SNP	pfam_HECT,pfam_IQ_motif_EF-hand-BS,superfamily_HECT,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,smart_HECT,pfscan_HECT,pfscan_IQ_motif_EF-hand-BS	p.P761T	ENST00000342494.3	37	c.2281	CCDS9129.1	12	.	.	.	.	.	.	.	.	.	.	C	32	5.148821	0.94603	.	.	ENSG00000151148	ENST00000434735;ENST00000539599;ENST00000342494;ENST00000539584;ENST00000538070	T;T;T	0.60171	0.21;0.21;0.21	5.18	5.18	0.71444	HECT (4);	0.000000	0.85682	D	0.000000	D	0.82554	0.5062	M	0.93241	3.395	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87028	0.2133	10	0.87932	D	0	-22.9212	17.86	0.88778	0.0:1.0:0.0:0.0	.	761	Q7Z3V4	UBE3B_HUMAN	T	761;761;761;188;56	ENSP00000391529:P761T;ENSP00000443131:P761T;ENSP00000340596:P761T	ENSP00000340596:P761T	P	+	1	0	UBE3B	108443656	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	7.273000	0.78527	2.684000	0.91462	0.655000	0.94253	CCC	UBE3B	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000151148		0.522	UBE3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE3B	HGNC	protein_coding	OTTHUMT00000403119.1	-	0.00	106	0	C	NM_183415		109959273	+1	tier1	-	no_errors	ENST00000342494	ensembl	human	known	74_37	missense	5.38	88	5	SNP	1.000	A
UBTF	7343	genome.wustl.edu	37	17	42288694	42288694	+	Missense_Mutation	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr17:42288694C>A	ENST00000302904.4	-	11	1545	c.1053G>T	c.(1051-1053)aaG>aaT	p.K351N	UBTF_ENST00000529383.1_Missense_Mutation_p.K351N|UBTF_ENST00000343638.5_Missense_Mutation_p.K314N|UBTF_ENST00000393606.3_Missense_Mutation_p.K314N|UBTF_ENST00000436088.1_Missense_Mutation_p.K351N|CTB-175E5.7_ENST00000586560.1_RNA|UBTF_ENST00000526094.1_Missense_Mutation_p.K314N|UBTF_ENST00000527034.1_Missense_Mutation_p.K314N|UBTF_ENST00000533177.1_Missense_Mutation_p.K314N			P17480	UBF1_HUMAN	upstream binding transcription factor, RNA polymerase I	351					chromatin silencing at rDNA (GO:0000183)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.K351N(1)		breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(9)|lung(10)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.114)		CGTAATCTTTCTTTTTCTGGG	0.577																																																	1	Substitution - Missense(1)	large_intestine(1)											70.0	62.0	64.0					17																	42288694		2203	4300	6503	SO:0001583	missense	0			BC042297	CCDS11480.1, CCDS42346.1	17q21.31	2014-03-25			ENSG00000108312	ENSG00000108312			12511	protein-coding gene	gene with protein product		600673				9126496	Standard	NM_001076683		Approved	UBF, NOR-90, UBF1, UBF2	uc010czs.3	P17480	OTTHUMG00000167585	ENST00000302904.4:c.1053G>T	17.37:g.42288694C>A	ENSP00000302640:p.Lys351Asn		A8K6R8	Missense_Mutation	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,superfamily_ARM-type_fold,smart_HMG_box_dom,pfscan_HMG_box_dom	p.K351N	ENST00000302904.4	37	c.1053	CCDS11480.1	17	.	.	.	.	.	.	.	.	.	.	c	20.8	4.051183	0.75960	.	.	ENSG00000108312	ENST00000343638;ENST00000302904;ENST00000527034;ENST00000533177;ENST00000436088;ENST00000393606;ENST00000526094;ENST00000529383	T;T;T;T;T;T;T;T	0.26660	1.72;1.72;1.72;1.72;1.72;1.72;1.72;1.72	4.34	3.36	0.38483	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.000000	0.85682	D	0.000000	T	0.46580	0.1400	M	0.70842	2.15	0.48762	D	0.999705	D;P;D	0.89917	1.0;0.589;1.0	D;B;D	0.87578	0.998;0.437;0.997	T	0.39761	-0.9598	10	0.45353	T	0.12	-30.0218	11.7069	0.51601	0.0:0.9064:0.0:0.0936	.	314;314;351	E9PKP7;P17480-2;P17480	.;.;UBF1_HUMAN	N	314;351;314;314;351;314;314;351	ENSP00000345297:K314N;ENSP00000302640:K351N;ENSP00000431539:K314N;ENSP00000437180:K314N;ENSP00000390669:K351N;ENSP00000377231:K314N;ENSP00000432925:K314N;ENSP00000435708:K351N	ENSP00000302640:K351N	K	-	3	2	UBTF	39644220	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.517000	0.53443	2.408000	0.81797	0.491000	0.48974	AAG	UBTF	-	pfam_HMG_box_dom,superfamily_HMG_box_dom,superfamily_ARM-type_fold,smart_HMG_box_dom,pfscan_HMG_box_dom	ENSG00000108312		0.577	UBTF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UBTF	HGNC	protein_coding	OTTHUMT00000395205.1		0.00	65	0	C	NM_014233		42288694	-1			no_errors	ENST00000302904	ensembl	human	known	74_37	missense	5.77	49	3	SNP	1.000	A
UMODL1	89766	genome.wustl.edu	37	21	43531545	43531545	+	Intron	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr21:43531545C>T	ENST00000408910.2	+	12	1899				C21orf128_ENST00000329015.2_5'Flank|UMODL1_ENST00000400427.1_Missense_Mutation_p.P666L|UMODL1_ENST00000400424.2_Intron|UMODL1_ENST00000408989.2_Missense_Mutation_p.P738L	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1						adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						ACCTCCTCCCCGAAGGCTACT	0.662																																					Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)												0													46.0	48.0	47.0					21																	43531545		1957	4144	6101	SO:0001627	intron_variant	0				CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.1900-71C>T	21.37:g.43531545C>T			C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Missense_Mutation	SNP	pfam_ZP_dom,pfam_SEA_dom,pfam_EGF-like_Ca-bd_dom,pfam_EMI_domain,pfam_WAP-type_4-diS_core,superfamily_Fibronectin_type3,superfamily_WAP-type_4-diS_core,smart_WAP-type_4-diS_core,smart_EGF-like_Ca-bd_dom,smart_Fibronectin_type3,smart_ZP_dom,pfscan_EG-like_dom,pfscan_EMI_domain,pfscan_Fibronectin_type3,pfscan_ZP_dom,prints_ZP_dom	p.P738L	ENST00000408910.2	37	c.2213	CCDS42936.1	21	.	.	.	.	.	.	.	.	.	.	C	12.66	2.004328	0.35320	.	.	ENSG00000177398	ENST00000400427;ENST00000408989	T;T	0.76316	-1.01;-0.99	3.56	2.66	0.31614	.	.	.	.	.	T	0.57829	0.2080	N	0.14661	0.345	0.09310	N	1	P	0.50710	0.938	B	0.38296	0.27	T	0.50857	-0.8778	9	0.62326	D	0.03	-0.1206	7.4591	0.27285	0.0:0.8681:0.0:0.1319	.	738	Q5DID0-2	.	L	666;738	ENSP00000383279:P666L;ENSP00000386126:P738L	ENSP00000383279:P666L	P	+	2	0	UMODL1	42404614	0.005000	0.15991	0.002000	0.10522	0.005000	0.04900	2.160000	0.42348	0.785000	0.33685	0.655000	0.94253	CCG	UMODL1	-	NULL	ENSG00000177398		0.662	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UMODL1	HGNC	protein_coding	OTTHUMT00000195292.2	-	0.00	82	0	C			43531545	+1	tier1	-	no_errors	ENST00000408989	ensembl	human	known	74_37	missense	23.88	51	16	SNP	0.002	T
UNC13B	10497	genome.wustl.edu	37	9	35396880	35396880	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr9:35396880G>T	ENST00000378495.3	+	27	3453	c.3231G>T	c.(3229-3231)gaG>gaT	p.E1077D	UNC13B_ENST00000396787.1_Missense_Mutation_p.E1089D|UNC13B_ENST00000481299.1_3'UTR|UNC13B_ENST00000378496.4_Missense_Mutation_p.E1077D	NM_006377.3	NP_006368.3	O14795	UN13B_HUMAN	unc-13 homolog B (C. elegans)	1077	MHD1. {ECO:0000255|PROSITE- ProRule:PRU00587}.				apoptotic process (GO:0006915)|excretion (GO:0007588)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synaptic vesicle priming (GO:0010808)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|terminal bouton (GO:0043195)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(16)|liver(2)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			ATGAGAATGAGGATGTATCCC	0.562																																																	0													229.0	211.0	217.0					9																	35396880		2203	4300	6503	SO:0001583	missense	0			AF020202	CCDS6579.1	9p13.3	2008-05-15	2003-10-17	2003-10-17	ENSG00000198722	ENSG00000198722			12566	protein-coding gene	gene with protein product		605836	"""unc-13-like (C. elegans)"""	UNC13		9607201	Standard	NM_006377		Approved	hmunc13, Unc13h2	uc003zwq.3	O14795	OTTHUMG00000019856	ENST00000378495.3:c.3231G>T	9.37:g.35396880G>T	ENSP00000367756:p.Glu1077Asp		Q5VYM8	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.E1077D	ENST00000378495.3	37	c.3231	CCDS6579.1	9	.	.	.	.	.	.	.	.	.	.	G	15.54	2.864757	0.51482	.	.	ENSG00000198722	ENST00000396787;ENST00000378495;ENST00000378496;ENST00000535471	D;D;D	0.83755	-1.63;-1.57;-1.76	5.25	-2.62	0.06152	Munc13 homology 1 (1);	0.000000	0.85682	D	0.000000	T	0.71753	0.3377	L	0.45470	1.425	0.49798	D	0.999827	B;B	0.34161	0.439;0.101	B;B	0.32762	0.152;0.038	T	0.60835	-0.7184	10	0.13853	T	0.58	-23.1689	12.6819	0.56926	0.5494:0.0:0.4506:0.0	.	1077;1077	F8W8M9;O14795	.;UN13B_HUMAN	D	1089;1077;1077;664	ENSP00000380006:E1089D;ENSP00000367756:E1077D;ENSP00000367757:E1077D	ENSP00000367756:E1077D	E	+	3	2	UNC13B	35386880	0.994000	0.37717	0.972000	0.41901	0.982000	0.71751	0.301000	0.19174	-0.583000	0.05921	-0.251000	0.11542	GAG	UNC13B	-	NULL	ENSG00000198722		0.562	UNC13B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC13B	HGNC	protein_coding	OTTHUMT00000052296.1	-	0.00	101	0	G	NM_006377		35396880	+1	tier1	-	no_errors	ENST00000378496	ensembl	human	known	74_37	missense	6.67	69	5	SNP	0.989	T
UNC13C	440279	genome.wustl.edu	37	15	54306737	54306737	+	Missense_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr15:54306737T>G	ENST00000260323.11	+	1	1637	c.1637T>G	c.(1636-1638)cTt>cGt	p.L546R	UNC13C_ENST00000537900.1_Missense_Mutation_p.L546R|UNC13C_ENST00000545554.1_Missense_Mutation_p.L546R	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	546					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		ACTGCTAAACTTAGTCGTTCT	0.388																																																	0													56.0	55.0	55.0					15																	54306737		1843	4106	5949	SO:0001583	missense	0			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.1637T>G	15.37:g.54306737T>G	ENSP00000260323:p.Leu546Arg		Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_dom,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.L546R	ENST00000260323.11	37	c.1637	CCDS45264.1	15	.	.	.	.	.	.	.	.	.	.	T	16.41	3.116317	0.56505	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	D;D;D	0.85861	-2.04;-2.03;-2.04	5.17	5.17	0.71159	.	.	.	.	.	D	0.87406	0.6169	L	0.27053	0.805	0.54753	D	0.999981	D	0.76494	0.999	D	0.83275	0.996	D	0.89117	0.3500	9	0.87932	D	0	.	14.3313	0.66559	0.0:0.0:0.0:1.0	.	546	Q8NB66	UN13C_HUMAN	R	546	ENSP00000260323:L546R;ENSP00000438156:L546R;ENSP00000442569:L546R	ENSP00000260323:L546R	L	+	2	0	UNC13C	52094029	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.522000	0.81844	2.168000	0.68352	0.533000	0.62120	CTT	UNC13C	-	NULL	ENSG00000137766		0.388	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	HGNC	protein_coding	OTTHUMT00000419028.3	-	0.00	38	0	T	NM_173166		54306737	+1	tier1	-	no_errors	ENST00000260323	ensembl	human	known	74_37	missense	32.00	17	8	SNP	1.000	G
UNC5D	137970	genome.wustl.edu	37	8	35583736	35583736	+	Missense_Mutation	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr8:35583736C>T	ENST00000404895.2	+	10	1698	c.1370C>T	c.(1369-1371)cCc>cTc	p.P457L	UNC5D_ENST00000453357.2_Missense_Mutation_p.P452L|UNC5D_ENST00000416672.1_Missense_Mutation_p.P462L|UNC5D_ENST00000420357.1_Missense_Mutation_p.P390L|UNC5D_ENST00000449677.1_Missense_Mutation_p.P33L|UNC5D_ENST00000287272.2_Missense_Mutation_p.P388L	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	457					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		TACAGCGGACCCATCTGTCTG	0.498																																																	0													65.0	64.0	64.0					8																	35583736		2203	4300	6503	SO:0001583	missense	0			AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.1370C>T	8.37:g.35583736C>T	ENSP00000385143:p.Pro457Leu		Q8WYP7	Missense_Mutation	SNP	pfam_ZU5,pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,pfam_Death_domain,pfam_Immunoglobulin,superfamily_DEATH-like_dom,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death_domain,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like_dom	p.P457L	ENST00000404895.2	37	c.1370	CCDS6093.2	8	.	.	.	.	.	.	.	.	.	.	C	33	5.270221	0.95429	.	.	ENSG00000156687	ENST00000404895;ENST00000420357;ENST00000287272;ENST00000416672;ENST00000453357;ENST00000449677	T;T;T;T;T;T	0.59638	0.29;0.71;0.9;0.28;0.25;1.87	6.04	6.04	0.98038	.	0.092812	0.85682	D	0.000000	T	0.78916	0.4359	M	0.76838	2.35	0.80722	D	1	D;D;D;D	0.89917	1.0;0.99;0.994;0.99	D;P;P;P	0.85130	0.997;0.588;0.766;0.588	T	0.79366	-0.1833	10	0.87932	D	0	-21.7998	20.5948	0.99439	0.0:1.0:0.0:0.0	.	33;462;452;457	E9PDS8;C9J2B6;Q6UXZ4-2;Q6UXZ4	.;.;.;UNC5D_HUMAN	L	457;390;388;462;452;33	ENSP00000385143:P457L;ENSP00000392739:P390L;ENSP00000287272:P388L;ENSP00000412652:P462L;ENSP00000394303:P452L;ENSP00000397211:P33L	ENSP00000287272:P388L	P	+	2	0	UNC5D	35703278	1.000000	0.71417	0.999000	0.59377	0.963000	0.63663	7.487000	0.81328	2.873000	0.98535	0.563000	0.77884	CCC	UNC5D	-	NULL	ENSG00000156687		0.498	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC5D	HGNC	protein_coding	OTTHUMT00000347586.2	-	0.00	93	0	C			35583736	+1	tier1	-	no_errors	ENST00000404895	ensembl	human	known	74_37	missense	17.50	66	14	SNP	1.000	T
USP35	57558	genome.wustl.edu	37	11	77920009	77920009	+	Splice_Site	SNP	G	G	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr11:77920009G>A	ENST00000529308.1	+	9	1853	c.1592G>A	c.(1591-1593)cGg>cAg	p.R531Q	USP35_ENST00000526425.1_Splice_Site_p.R262Q|USP35_ENST00000441408.2_Splice_Site_p.R117Q|USP35_ENST00000530535.1_Intron|USP35_ENST00000530267.1_Splice_Site_p.R99Q	NM_020798.2	NP_065849.1	Q9P2H5	UBP35_HUMAN	ubiquitin specific peptidase 35	531	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(3)|urinary_tract(1)	23	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.04e-25)			CTGCTGGATCGGTAAGGGGGC	0.602																																																	0													44.0	46.0	45.0					11																	77920009		2054	4201	6255	SO:0001630	splice_region_variant	0			AB037793	CCDS41693.1	11q13.4	2008-02-05	2005-08-08			ENSG00000118369		"""Ubiquitin-specific peptidases"""	20061	protein-coding gene	gene with protein product			"""ubiquitin specific protease 35"""			12838346	Standard	NM_020798		Approved	KIAA1372	uc021qny.1	Q9P2H5		ENST00000529308.1:c.1592+1G>A	11.37:g.77920009G>A				Missense_Mutation	SNP	pfam_Peptidase_C19/C67,superfamily_ARM-type_fold,pfscan_Peptidase_C19/C67	p.R531Q	ENST00000529308.1	37	c.1592	CCDS41693.1	11	.	.	.	.	.	.	.	.	.	.	G	19.98	3.927524	0.73327	.	.	ENSG00000118369	ENST00000530267;ENST00000528910;ENST00000529308;ENST00000441408;ENST00000526425	T;T;T;T;T	0.27402	1.67;1.67;1.67;1.67;1.67	4.36	4.36	0.52297	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.46758	D	0.000271	T	0.45836	0.1362	L	0.32530	0.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.49113	-0.8973	10	0.66056	D	0.02	-16.414	17.0788	0.86593	0.0:0.0:1.0:0.0	.	531;117	Q9P2H5;E7EWV7	UBP35_HUMAN;.	Q	99;287;531;117;262	ENSP00000435468:R99Q;ENSP00000436001:R287Q;ENSP00000431876:R531Q;ENSP00000400825:R117Q;ENSP00000434942:R262Q	ENSP00000400825:R117Q	R	+	2	0	USP35	77597657	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	9.263000	0.95617	2.266000	0.75297	0.591000	0.81541	CGG	USP35	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000118369		0.602	USP35-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP35	HGNC	protein_coding	OTTHUMT00000390026.1	-	0.00	31	0	G	XM_290527	Missense_Mutation	77920009	+1	tier1	-	no_errors	ENST00000529308	ensembl	human	known	74_37	missense	19.44	29	7	SNP	1.000	A
VCP	7415	genome.wustl.edu	37	9	35060387	35060387	+	Missense_Mutation	SNP	T	T	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr9:35060387T>C	ENST00000358901.6	-	13	2513	c.1618A>G	c.(1618-1620)Atc>Gtc	p.I540V		NM_007126.3	NP_009057.1	P55072	TERA_HUMAN	valosin containing protein	540					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|aggresome assembly (GO:0070842)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|establishment of protein localization (GO:0045184)|positive regulation of Lys63-specific deubiquitinase activity (GO:1903007)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein K63-linked deubiquitination (GO:1903006)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|retrograde protein transport, ER to cytosol (GO:0030970)|translesion synthesis (GO:0019985)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Hrd1p ubiquitin ligase complex (GO:0000836)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|proteasome complex (GO:0000502)|site of double-strand break (GO:0035861)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|deubiquitinase activator activity (GO:0035800)|lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|protein domain specific binding (GO:0019904)|protein phosphatase binding (GO:0019903)|ubiquitin-specific protease binding (GO:1990381)			breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			TTGATGGAGATGAAGTTGGCC	0.493																																																	0													89.0	81.0	84.0					9																	35060387		2203	4300	6503	SO:0001583	missense	0			AC004472	CCDS6573.1	9p13.3	2014-09-17	2011-01-25		ENSG00000165280	ENSG00000165280		"""ATPases / AAA-type"""	12666	protein-coding gene	gene with protein product		601023	"""valosin-containing protein"""			8595912, 7553851	Standard	NM_007126		Approved	IBMPFD, p97	uc003zvy.2	P55072	OTTHUMG00000019855	ENST00000358901.6:c.1618A>G	9.37:g.35060387T>C	ENSP00000351777:p.Ile540Val		B2R5T8|Q0V924|Q2TAI5|Q969G7|Q9UCD5	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_CDC4_N-term_subdom,pfam_DNA_helicase_Holl-junc_RuvB_N,pfam_Cdc48_dom2,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-2,pfam_Vps4_C,superfamily_P-loop_NTPase,superfamily_Asp_de-COase-like_dom,smart_AAA+_ATPase,tigrfam_AAA_ATPase_CDC48	p.I540V	ENST00000358901.6	37	c.1618	CCDS6573.1	9	.	.	.	.	.	.	.	.	.	.	T	15.78	2.933617	0.52866	.	.	ENSG00000165280	ENST00000358901	D	0.92699	-3.09	5.85	4.69	0.59074	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.90225	0.6944	L	0.53617	1.68	0.80722	D	1	B	0.16166	0.016	B	0.28011	0.085	D	0.86482	0.1792	10	0.59425	D	0.04	-5.8519	12.3585	0.55188	0.1265:0.0:0.0:0.8735	.	540	P55072	TERA_HUMAN	V	540	ENSP00000351777:I540V	ENSP00000351777:I540V	I	-	1	0	VCP	35050387	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	8.040000	0.89188	1.007000	0.39238	0.533000	0.62120	ATC	VCP	-	pfam_ATPase_AAA_core,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_AAA+_ATPase,tigrfam_AAA_ATPase_CDC48	ENSG00000165280		0.493	VCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VCP	HGNC	protein_coding	OTTHUMT00000052290.1	-	0.00	69	0	T	NM_007126		35060387	-1	tier1	-	no_errors	ENST00000358901	ensembl	human	known	74_37	missense	14.55	47	8	SNP	1.000	C
VWDE	221806	genome.wustl.edu	37	7	12380034	12380034	+	Missense_Mutation	SNP	T	T	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr7:12380034T>C	ENST00000275358.3	-	24	4468	c.4280A>G	c.(4279-4281)gAc>gGc	p.D1427G		NM_001135924.1	NP_001129396.1	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains	1427	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.					extracellular region (GO:0005576)				breast(4)|endometrium(2)|kidney(1)|skin(1)	8						GCAGACAGGGTCGCACAAAGC	0.373																																																	0													86.0	65.0	71.0					7																	12380034		692	1591	2283	SO:0001583	missense	0				CCDS47544.1	7p21.3	2008-09-23			ENSG00000146530	ENSG00000146530			21897	protein-coding gene	gene with protein product						14702039, 16303743	Standard	NM_001135924		Approved	FLJ14712	uc003ssj.2	Q8N2E2	OTTHUMG00000152315	ENST00000275358.3:c.4280A>G	7.37:g.12380034T>C	ENSP00000275358:p.Asp1427Gly		B7ZM77|Q96SQ3	Missense_Mutation	SNP	pfam_EGF_extracell,pfam_VWF_type-D,superfamily_Cadherin-like,smart_VWF_type-D,smart_EG-like_dom,pfscan_EG-like_dom	p.D1427G	ENST00000275358.3	37	c.4280	CCDS47544.1	7	.	.	.	.	.	.	.	.	.	.	T	13.45	2.240458	0.39598	.	.	ENSG00000146530	ENST00000275358;ENST00000536307	T	0.03212	4.01	4.73	4.73	0.59995	EGF, extracellular (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.310019	0.34046	N	0.004320	T	0.06050	0.0157	L	0.59436	1.845	0.24216	N	0.995456	P	0.44734	0.842	B	0.40165	0.321	T	0.29610	-1.0006	10	0.36615	T	0.2	.	14.3559	0.66738	0.0:0.0:0.0:1.0	.	1427	Q8N2E2	VWDE_HUMAN	G	1427;881	ENSP00000275358:D1427G	ENSP00000275358:D1427G	D	-	2	0	VWDE	12346559	0.992000	0.36948	0.996000	0.52242	0.944000	0.59088	3.734000	0.55037	1.974000	0.57490	0.477000	0.44152	GAC	VWDE	-	pfam_EGF_extracell,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000146530		0.373	VWDE-001	NOVEL	basic|appris_principal|CCDS	protein_coding	VWDE	HGNC	protein_coding	OTTHUMT00000325870.3	-	0.00	84	0	T	XM_371878		12380034	-1	tier1	-	no_errors	ENST00000275358	ensembl	human	novel	74_37	missense	13.64	95	15	SNP	0.998	C
WBP2NL	164684	genome.wustl.edu	37	22	42397570	42397570	+	Intron	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr22:42397570C>A	ENST00000328823.9	+	1	93				WBP2NL_ENST00000461730.1_3'UTR	NM_152613.2	NP_689826.2	Q6ICG8	WBP2L_HUMAN	WBP2 N-terminal like						egg activation (GO:0007343)|male pronucleus assembly (GO:0035039)|meiotic nuclear division (GO:0007126)	perinuclear theca (GO:0033011)	WW domain binding (GO:0050699)			breast(2)|large_intestine(3)|lung(5)|ovary(3)|prostate(1)	14						TGGGCAAAATCAAGAGGGTAC	0.507																																																	0																																										SO:0001627	intron_variant	0			BC022546	CCDS14029.1	22q13.2	2007-07-18			ENSG00000183066	ENSG00000183066			28389	protein-coding gene	gene with protein product	"""postacrosomal sheath WW domain-binding protein"""	610981				17289678	Standard	NM_152613		Approved	FLJ26145, MGC26816, PAWP	uc003bbt.3	Q6ICG8	OTTHUMG00000151270	ENST00000328823.9:c.62+2686C>A	22.37:g.42397570C>A			A3KFF7|A8MSG5|B3KXX4|Q8TBF0|Q8TBF3	RNA	SNP	-	NULL	ENST00000328823.9	37	NULL	CCDS14029.1	22																																																																																			WBP2NL	-	-	ENSG00000183066		0.507	WBP2NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBP2NL	HGNC	protein_coding	OTTHUMT00000322037.1	-	0.00	31	0	C	NM_152613		42397570	+1	tier1	-	no_errors	ENST00000461730	ensembl	human	known	74_37	rna	13.04	20	3	SNP	1.000	A
WDR17	116966	genome.wustl.edu	37	4	177056320	177056320	+	Missense_Mutation	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr4:177056320C>A	ENST00000280190.4	+	9	1388	c.1232C>A	c.(1231-1233)aCa>aAa	p.T411K	WDR17_ENST00000508596.1_Missense_Mutation_p.T387K|WDR17_ENST00000393643.2_Missense_Mutation_p.T387K|WDR17_ENST00000507824.2_Missense_Mutation_p.T394K			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	411										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		CTTTTAGCAACAGCTTCATTT	0.368																																																	0													117.0	119.0	118.0					4																	177056320		2203	4300	6503	SO:0001583	missense	0			AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.1232C>A	4.37:g.177056320C>A	ENSP00000280190:p.Thr411Lys		E7EQX0|Q0QD35	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.T411K	ENST00000280190.4	37	c.1232	CCDS3825.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.124931|5.124931	0.94429|0.94429	.|.	.|.	ENSG00000150627|ENSG00000150627	ENST00000505894|ENST00000508596;ENST00000393643;ENST00000280190;ENST00000507824	.|T;T;T	.|0.68181	.|-0.31;-0.31;-0.31	5.5|5.5	5.5|5.5	0.81552|0.81552	.|WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (2);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.87184|0.87184	0.6114|0.6114	M|M	0.93594|0.93594	3.435|3.435	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.91635	.|0.999;0.999	D|D	0.90169|0.90169	0.4234|0.4234	5|10	.|0.87932	.|D	.|0	-23.7651|-23.7651	19.3911|19.3911	0.94583|0.94583	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|387;411	.|E7EQX0;Q8IZU2	.|.;WDR17_HUMAN	K|K	160|387;387;411;394	.|ENSP00000422763:T387K;ENSP00000377258:T387K;ENSP00000280190:T411K	.|ENSP00000280190:T411K	Q|T	+|+	1|2	0|0	WDR17|WDR17	177293314|177293314	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	7.380000|7.380000	0.79704|0.79704	2.595000|2.595000	0.87683|0.87683	0.650000|0.650000	0.86243|0.86243	CAG|ACA	WDR17	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	ENSG00000150627		0.368	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR17	HGNC	protein_coding	OTTHUMT00000362334.2	-	0.00	82	0	C			177056320	+1	tier1	-	no_errors	ENST00000280190	ensembl	human	known	74_37	missense	63.64	12	21	SNP	1.000	A
WFDC1	58189	genome.wustl.edu	37	16	84353120	84353120	+	Missense_Mutation	SNP	G	G	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr16:84353120G>A	ENST00000219454.5	+	4	831	c.505G>A	c.(505-507)Gac>Aac	p.D169N	WFDC1_ENST00000568638.1_Missense_Mutation_p.D169N	NM_001282466.1|NM_001282467.1	NP_001269395.1|NP_001269396.1	Q9HC57	WFDC1_HUMAN	WAP four-disulfide core domain 1	169					negative regulation of cell growth (GO:0030308)|negative regulation of epithelial cell proliferation (GO:0050680)|response to drug (GO:0042493)|response to estradiol (GO:0032355)	extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)	9						GAGCCCAGGTGACGTGGCCGA	0.667																																																	0													86.0	67.0	73.0					16																	84353120		2200	4300	6500	SO:0001583	missense	0			AF302109	CCDS10946.1	16q24.1	2013-01-21			ENSG00000103175	ENSG00000103175		"""WAP four-disulfide core domain containing"""	15466	protein-coding gene	gene with protein product		605322				10967136	Standard	NM_021197		Approved	PS20	uc002fhw.3	Q9HC57	OTTHUMG00000137641	ENST00000219454.5:c.505G>A	16.37:g.84353120G>A	ENSP00000219454:p.Asp169Asn		D3DUL7|Q8NC27|Q9HAU1	Missense_Mutation	SNP	pfam_WAP-type_4-diS_core,superfamily_WAP-type_4-diS_core,smart_WAP-type_4-diS_core	p.D169N	ENST00000219454.5	37	c.505	CCDS10946.1	16	.	.	.	.	.	.	.	.	.	.	G	5.127	0.209095	0.09757	.	.	ENSG00000103175	ENST00000219454	T	0.30182	1.54	4.43	3.4	0.38934	.	0.053246	0.64402	D	0.000001	T	0.11281	0.0275	N	0.11201	0.11	0.39290	D	0.964726	B	0.32467	0.372	B	0.25614	0.062	T	0.12734	-1.0536	10	0.17832	T	0.49	-42.2978	4.3686	0.11237	0.2887:0.0:0.7113:0.0	.	169	Q9HC57	WFDC1_HUMAN	N	169	ENSP00000219454:D169N	ENSP00000219454:D169N	D	+	1	0	WFDC1	82910621	0.998000	0.40836	0.030000	0.17652	0.212000	0.24457	3.578000	0.53892	2.295000	0.77249	0.555000	0.69702	GAC	WFDC1	-	NULL	ENSG00000103175		0.667	WFDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WFDC1	HGNC	protein_coding	OTTHUMT00000269083.2	-	0.00	73	0	G			84353120	+1	tier1	-	no_errors	ENST00000219454	ensembl	human	known	74_37	missense	18.60	35	8	SNP	0.827	A
XDH	7498	genome.wustl.edu	37	2	31560520	31560520	+	Missense_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:31560520T>G	ENST00000379416.3	-	35	3986	c.3938A>C	c.(3937-3939)aAg>aCg	p.K1313T		NM_000379.3	NP_000370.2	P47989	XDH_HUMAN	xanthine dehydrogenase	1313					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|lactation (GO:0007595)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of gene expression (GO:0010629)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|negative regulation of vasculogenesis (GO:2001213)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)|xanthine catabolic process (GO:0009115)	cytosol (GO:0005829)|extracellular space (GO:0005615)|peroxisome (GO:0005777)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|protein homodimerization activity (GO:0042803)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)|xanthine oxidase activity (GO:0004855)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(31)|ovary(1)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(1)	74	Acute lymphoblastic leukemia(172;0.155)				Aldesleukin(DB00041)|Allopurinol(DB00437)|Azathioprine(DB00993)|Carboplatin(DB00958)|Carvedilol(DB01136)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|L-Carnitine(DB00583)|Menadione(DB00170)|Mercaptopurine(DB01033)|Nitrofural(DB00336)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Spermine(DB00127)|Trifluoperazine(DB00831)	GGTGGTGAACTTGTCCACGCA	0.587																																					Colon(66;682 1445 30109 40147)												0													137.0	120.0	126.0					2																	31560520		2203	4300	6503	SO:0001583	missense	0			D11456	CCDS1775.1	2p23.1	2009-07-10	2003-03-20		ENSG00000158125	ENSG00000158125	1.17.1.4		12805	protein-coding gene	gene with protein product		607633	"""xanthene dehydrogenase"""			8224915	Standard	NM_000379		Approved	XOR, XO	uc002rnv.1	P47989	OTTHUMG00000099385	ENST00000379416.3:c.3938A>C	2.37:g.31560520T>G	ENSP00000368727:p.Lys1313Thr		Q16681|Q16712|Q4PJ16	Missense_Mutation	SNP	pfam_AldOxase/xan_DH_Mopterin-bd,pfam_Mopterin_DH_FAD-bd,pfam_Ald_Oxase/Xan_DH_a/b,pfam_2Fe-2S-bd,pfam_CO_DH_flav_C,pfam_2Fe-2S_ferredoxin-type,superfamily_AldOxase/xan_DH_Mopterin-bd,superfamily_FAD-bd_2,superfamily_Ald_Oxase/Xan_DH_a/b,superfamily_2Fe-2S-bd,superfamily_CO_DH_flav_C,superfamily_2Fe-2S_ferredoxin-type,pirsf_Ald_Oxase/xanthine_DH,pfscan_2Fe-2S_ferredoxin-type,tigrfam_Xanthine_DH_ssu	p.K1313T	ENST00000379416.3	37	c.3938	CCDS1775.1	2	.	.	.	.	.	.	.	.	.	.	T	10.39	1.337589	0.24253	.	.	ENSG00000158125	ENST00000379416	T	0.62105	0.05	6.08	2.49	0.30216	Aldehyde oxidase/xanthine dehydrogenase, molybdopterin binding (2);	1.006310	0.07970	N	0.983903	T	0.52693	0.1750	L	0.42744	1.35	0.20307	N	0.999911	B	0.02656	0.0	B	0.04013	0.001	T	0.43081	-0.9413	10	0.49607	T	0.09	.	6.241	0.20791	0.1338:0.199:0.0:0.6673	.	1313	P47989	XDH_HUMAN	T	1313	ENSP00000368727:K1313T	ENSP00000368727:K1313T	K	-	2	0	XDH	31414024	0.110000	0.22057	0.982000	0.44146	0.560000	0.35617	0.718000	0.25866	0.180000	0.19960	-1.139000	0.01908	AAG	XDH	-	superfamily_AldOxase/xan_DH_Mopterin-bd,pirsf_Ald_Oxase/xanthine_DH	ENSG00000158125		0.587	XDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XDH	HGNC	protein_coding	OTTHUMT00000216840.1	-	0.00	44	0	T	NM_000379		31560520	-1	tier1	-	no_errors	ENST00000379416	ensembl	human	known	74_37	missense	16.67	40	8	SNP	0.699	G
XIRP2	129446	genome.wustl.edu	37	2	168115487	168115487	+	Missense_Mutation	SNP	A	A	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:168115487A>C	ENST00000409728.1	+	11	2619	c.2530A>C	c.(2530-2532)Agt>Cgt	p.S844R	XIRP2_ENST00000409605.1_Missense_Mutation_p.S589R|XIRP2_ENST00000409195.1_3'UTR|XIRP2_ENST00000409043.1_Missense_Mutation_p.S811R|XIRP2_ENST00000295237.9_3'UTR|XIRP2_ENST00000409756.2_Missense_Mutation_p.S811R|XIRP2_ENST00000420519.1_Missense_Mutation_p.S844R|XIRP2_ENST00000409273.1_3'UTR	NM_001199143.1	NP_001186072.1	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	0					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						AAAGGGGGGAAGTTCAATCAT	0.433																																																	0													29.0	28.0	28.0					2																	168115487		1843	4101	5944	SO:0001583	missense	0			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409728.1:c.2530A>C	2.37:g.168115487A>C	ENSP00000386619:p.Ser844Arg		A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.S844R	ENST00000409728.1	37	c.2530	CCDS56143.1	2	.	.	.	.	.	.	.	.	.	.	A	3.723	-0.057234	0.07317	.	.	ENSG00000163092	ENST00000409043;ENST00000409728;ENST00000409756;ENST00000420519;ENST00000409605	T;T;T;T;T	0.79033	-1.23;-1.23;-1.23;-1.23;-1.23	5.67	3.14	0.36123	.	.	.	.	.	T	0.66237	0.2769	.	.	.	0.20307	N	0.999911	B;B	0.10296	0.001;0.003	B;B	0.09377	0.004;0.004	T	0.57075	-0.7873	8	0.62326	D	0.03	.	5.7167	0.17964	0.7681:0.0:0.0883:0.1437	.	811;844	A4UGR9-4;A4UGR9-6	.;.	R	811;844;811;844;589	ENSP00000386454:S811R;ENSP00000386619:S844R;ENSP00000386724:S811R;ENSP00000415541:S844R;ENSP00000386981:S589R	ENSP00000386454:S811R	S	+	1	0	XIRP2	167823733	0.022000	0.18835	0.004000	0.12327	0.027000	0.11550	2.297000	0.43593	0.344000	0.23847	0.459000	0.35465	AGT	XIRP2	-	NULL	ENSG00000163092		0.433	XIRP2-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333552.1	-	0.00	81	0	A	NM_152381		168115487	+1	tier1	-	no_errors	ENST00000420519	ensembl	human	known	74_37	missense	44.93	38	31	SNP	0.018	C
XIRP2	129446	genome.wustl.edu	37	2	168115550	168115550	+	Missense_Mutation	SNP	A	A	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:168115550A>C	ENST00000409728.1	+	11	2682	c.2593A>C	c.(2593-2595)Aat>Cat	p.N865H	XIRP2_ENST00000409605.1_Missense_Mutation_p.N610H|XIRP2_ENST00000409195.1_3'UTR|XIRP2_ENST00000409043.1_Missense_Mutation_p.N832H|XIRP2_ENST00000295237.9_3'UTR|XIRP2_ENST00000409756.2_Missense_Mutation_p.N832H|XIRP2_ENST00000420519.1_Missense_Mutation_p.N865H|XIRP2_ENST00000409273.1_3'UTR	NM_001199143.1	NP_001186072.1	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	0					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						AAAGAGCAAAAATTTACACTT	0.343																																																	0													26.0	26.0	26.0					2																	168115550		1816	4077	5893	SO:0001583	missense	0			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409728.1:c.2593A>C	2.37:g.168115550A>C	ENSP00000386619:p.Asn865His		A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.N865H	ENST00000409728.1	37	c.2593	CCDS56143.1	2	.	.	.	.	.	.	.	.	.	.	A	11.39	1.626049	0.28978	.	.	ENSG00000163092	ENST00000409043;ENST00000409728;ENST00000409756;ENST00000420519;ENST00000409605	T;T;T;T;T	0.79352	-1.25;-1.25;-1.25;-1.25;-1.26	5.67	4.5	0.54988	.	.	.	.	.	T	0.71550	0.3353	.	.	.	0.80722	D	1	B;B	0.24368	0.102;0.102	B;B	0.24155	0.051;0.051	T	0.68667	-0.5348	8	0.72032	D	0.01	.	11.6646	0.51366	0.8517:0.1483:0.0:0.0	.	832;865	A4UGR9-4;A4UGR9-6	.;.	H	832;865;832;865;610	ENSP00000386454:N832H;ENSP00000386619:N865H;ENSP00000386724:N832H;ENSP00000415541:N865H;ENSP00000386981:N610H	ENSP00000386454:N832H	N	+	1	0	XIRP2	167823796	0.992000	0.36948	0.433000	0.26760	0.240000	0.25518	2.940000	0.49003	0.961000	0.38030	-0.466000	0.05196	AAT	XIRP2	-	NULL	ENSG00000163092		0.343	XIRP2-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333552.1	-	0.00	148	0	A	NM_152381		168115550	+1	tier1	-	no_errors	ENST00000420519	ensembl	human	known	74_37	missense	15.13	101	18	SNP	0.916	C
ZEB2	9839	genome.wustl.edu	37	2	145255323	145255323	+	Intron	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:145255323T>G	ENST00000558170.2	-	2	1258				ZEB2_ENST00000303660.4_Intron|ZEB2_ENST00000539609.3_Intron|ZEB2_ENST00000409487.3_Intron	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2						cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		TCTGACAATCTTGATGACCCT	0.378																																					Melanoma(33;1235 1264 5755 16332)												0																																										SO:0001627	intron_variant	0			AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.73+19521A>C	2.37:g.145255323T>G			A0JP09|B7Z2P2|F5H814|Q9UED1	RNA	SNP	-	NULL	ENST00000558170.2	37	NULL	CCDS2186.1	2																																																																																			ZEB2	-	-	ENSG00000169554		0.378	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZEB2	HGNC	protein_coding	OTTHUMT00000254778.5	-	0.00	135	0	T	NM_014795		145255323	-1	tier1	-	no_errors	ENST00000434448	ensembl	human	known	74_37	rna	38.26	70	44	SNP	0.000	G
ZAK	51776	genome.wustl.edu	37	2	173955912	173955912	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr2:173955912G>T	ENST00000375213.3	+	2	231	c.153G>T	c.(151-153)gaG>gaT	p.E51D	MLTK_ENST00000539448.1_Missense_Mutation_p.E51D|MLTK_ENST00000338983.3_Missense_Mutation_p.E51D|MLTK_ENST00000409176.2_Missense_Mutation_p.E51D|MLTK_ENST00000431503.2_Intron	NM_016653.2	NP_057737.2	Q9NYL2	MLTK_HUMAN		51	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell death (GO:0008219)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|DNA damage checkpoint (GO:0000077)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|response to radiation (GO:0009314)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)										TCAAAATAGAGAAAGAGGTAA	0.443																																																	0													68.0	68.0	68.0					2																	173955912		2203	4300	6503	SO:0001583	missense	0																														ENST00000375213.3:c.153G>T	2.37:g.173955912G>T	ENSP00000364361:p.Glu51Asp		B3KPG2|Q53SX1|Q580W8|Q59GY5|Q86YW8|Q9HCC4|Q9HCC5|Q9HDD2|Q9NYE9	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SAM_type1,pfam_SAM_2,superfamily_Kinase-like_dom,superfamily_SAM/pointed,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pfscan_SAM,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E51D	ENST00000375213.3	37	c.153	CCDS42777.1	2	.	.	.	.	.	.	.	.	.	.	G	21.1	4.097873	0.76870	.	.	ENSG00000091436	ENST00000539448;ENST00000409176;ENST00000338983;ENST00000375213;ENST00000422149	D;D;D;D;D	0.82803	-1.65;-1.65;-1.65;-1.65;-1.65	5.66	5.66	0.87406	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.045211	0.85682	D	0.000000	D	0.85517	0.5715	L	0.41710	1.295	0.80722	D	1	B;P;B;D	0.67145	0.233;0.924;0.275;0.996	B;P;B;D	0.76071	0.065;0.52;0.107;0.987	D	0.83724	0.0194	10	0.37606	T	0.19	.	9.9216	0.41468	0.1555:0.0:0.8445:0.0	.	51;51;51;51	Q9NYL2-2;Q9NYL2;D4Q8H0;Q9NYL2-3	.;MLTK_HUMAN;.;.	D	51	ENSP00000439414:E51D;ENSP00000387259:E51D;ENSP00000340257:E51D;ENSP00000364361:E51D;ENSP00000411923:E51D	ENSP00000340257:E51D	E	+	3	2	AC013461.1	173664158	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.604000	0.54081	2.675000	0.91044	0.655000	0.94253	GAG	MLTK	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000091436		0.443	MLTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZAK	Uniprot_gn	protein_coding	OTTHUMT00000255401.1	-	0.00	82	0	G			173955912	+1	tier1	-	no_errors	ENST00000375213	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	T
ZFHX3	463	genome.wustl.edu	37	16	72830565	72830565	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr16:72830565G>T	ENST00000268489.5	-	9	6688	c.6016C>A	c.(6016-6018)Cat>Aat	p.H2006N	ZFHX3_ENST00000397992.5_Missense_Mutation_p.H1092N	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	2006					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				TAATTCTGATGAACGTGCTCT	0.478																																																	0													102.0	103.0	102.0					16																	72830565		2198	4300	6498	SO:0001583	missense	0			D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.6016C>A	16.37:g.72830565G>T	ENSP00000268489:p.His2006Asn		D3DWS8|O15101|Q13719	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.H2006N	ENST00000268489.5	37	c.6016	CCDS10908.1	16	.	.	.	.	.	.	.	.	.	.	G	13.89	2.372913	0.42105	.	.	ENSG00000140836	ENST00000268489;ENST00000397992	T;T	0.41758	0.99;1.59	5.75	5.75	0.90469	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.51477	D	0.000089	T	0.64527	0.2606	M	0.64997	1.995	0.80722	D	1	D	0.69078	0.997	D	0.73380	0.98	T	0.64980	-0.6279	10	0.72032	D	0.01	.	19.9449	0.97179	0.0:0.0:1.0:0.0	.	2006	Q15911	ZFHX3_HUMAN	N	2006;1092	ENSP00000268489:H2006N;ENSP00000438926:H1092N	ENSP00000268489:H2006N	H	-	1	0	ZFHX3	71388066	1.000000	0.71417	0.993000	0.49108	0.702000	0.40608	9.793000	0.99091	2.696000	0.92011	0.655000	0.94253	CAT	ZFHX3	-	superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000140836		0.478	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFHX3	HGNC	protein_coding	OTTHUMT00000269008.1	-	0.00	102	0	G	NM_006885		72830565	-1	tier1	-	no_errors	ENST00000268489	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	T
ZIC4	84107	genome.wustl.edu	37	3	147105131	147105131	+	3'UTR	SNP	A	A	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr3:147105131A>G	ENST00000383075.3	-	0	3032				ZIC4-AS1_ENST00000462168.1_RNA|ZIC4_ENST00000525172.2_3'UTR|ZIC4_ENST00000472749.2_5'UTR|ZIC4_ENST00000425731.3_3'UTR	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4							nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						AACGGGGCAGAGGGAGTTTGA	0.378																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.*1515T>C	3.37:g.147105131A>G			A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	RNA	SNP	-	NULL	ENST00000383075.3	37	NULL	CCDS43160.1	3																																																																																			ZIC4-AS1	-	-	ENSG00000241202		0.378	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIC4-AS1	HGNC	protein_coding	OTTHUMT00000355504.1	-	0.00	92	0	A			147105131	+1	tier1	-	no_errors	ENST00000462168	ensembl	human	known	74_37	rna	32.50	27	13	SNP	1.000	G
ZKSCAN3	80317	genome.wustl.edu	37	6	28327544	28327544	+	Missense_Mutation	SNP	C	C	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr6:28327544C>A	ENST00000377255.3	+	3	478	c.181C>A	c.(181-183)Cgc>Agc	p.R61S	ZKSCAN3_ENST00000252211.2_Missense_Mutation_p.R61S|ZKSCAN3_ENST00000341464.5_Intron	NM_001242894.1	NP_001229823.1	Q9BRR0	ZKSC3_HUMAN	zinc finger with KRAB and SCAN domains 3	61	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				autophagy (GO:0006914)|lysosome organization (GO:0007040)|negative regulation of autophagy (GO:0010507)|negative regulation of cellular senescence (GO:2000773)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(4)|large_intestine(3)|lung(8)|pancreas(1)|skin(2)|stomach(2)|urinary_tract(1)	21						TGCAGGCCCCCGCGAGGCGCT	0.652																																																	0													46.0	54.0	51.0					6																	28327544		2203	4300	6503	SO:0001583	missense	0			U71601	CCDS4650.1, CCDS56408.1	6p22.1	2013-01-09	2007-02-20	2007-02-20		ENSG00000189298		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13853	protein-coding gene	gene with protein product		612791	"""zinc finger protein 306"", ""zinc finger protein 309"""	ZNF306, ZNF309		10520746, 22531714	Standard	NM_024493		Approved	Zfp47, ZF47, ZSCAN35	uc003nle.4	Q9BRR0	OTTHUMG00000014521	ENST00000377255.3:c.181C>A	6.37:g.28327544C>A	ENSP00000366465:p.Arg61Ser		B2R8W2|B3KVC0|H7BXX1|Q5VXH3|Q92972|Q9H4T3	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.R61S	ENST00000377255.3	37	c.181	CCDS4650.1	6	.	.	.	.	.	.	.	.	.	.	.	17.31	3.357628	0.61293	.	.	ENSG00000189298	ENST00000252211;ENST00000454413;ENST00000377255	T;T	0.04862	3.54;3.54	3.71	2.81	0.32909	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	.	.	.	.	T	0.21509	0.0518	M	0.93854	3.465	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	T	0.15150	-1.0447	9	0.87932	D	0	.	11.5305	0.50607	0.1814:0.8186:0.0:0.0	.	61	Q9BRR0	ZKSC3_HUMAN	S	61	ENSP00000252211:R61S;ENSP00000366465:R61S	ENSP00000252211:R61S	R	+	1	0	ZKSCAN3	28435523	0.035000	0.19736	0.703000	0.30354	0.793000	0.44817	0.830000	0.27462	0.873000	0.35799	0.460000	0.39030	CGC	ZKSCAN3	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN	ENSG00000189298		0.652	ZKSCAN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZKSCAN3	HGNC	protein_coding	OTTHUMT00000040189.3	-	0.00	81	0	C	NM_024493		28327544	+1	tier1	-	no_errors	ENST00000252211	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.908	A
ZNF208	7757	genome.wustl.edu	37	19	22155029	22155029	+	Missense_Mutation	SNP	T	T	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr19:22155029T>A	ENST00000397126.4	-	4	2955	c.2807A>T	c.(2806-2808)aAg>aTg	p.K936M	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	936					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.K836T(2)|p.K936T(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				ATGAGTTTTCTTATGTTTACT	0.368																																																	3	Substitution - Missense(3)	large_intestine(3)											47.0	49.0	49.0					19																	22155029		2029	4198	6227	SO:0001583	missense	0			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.2807A>T	19.37:g.22155029T>A	ENSP00000380315:p.Lys936Met			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K936M	ENST00000397126.4	37	c.2807	CCDS54240.1	19	.	.	.	.	.	.	.	.	.	.	T	9.212	1.031120	0.19590	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.04454	3.62	2.9	-1.15	0.09709	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.11707	0.0285	.	.	.	0.09310	N	1	D	0.76494	0.999	D	0.77557	0.99	T	0.16453	-1.0402	8	0.36615	T	0.2	.	3.2147	0.06695	0.1745:0.2242:0.0:0.6013	.	836	O43345	ZN208_HUMAN	M	936;836	ENSP00000380315:K936M	ENSP00000380315:K936M	K	-	2	0	ZNF208	21946869	0.000000	0.05858	0.000000	0.03702	0.067000	0.16453	0.104000	0.15313	-0.885000	0.03971	0.240000	0.17902	AAG	ZNF208	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000160321		0.368	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	HGNC	protein_coding	OTTHUMT00000464302.1	-	0.00	59	0	T	NM_007153		22155029	-1	tier1	-	no_errors	ENST00000397126	ensembl	human	novel	74_37	missense	13.64	38	6	SNP	0.002	A
ZNF208	7757	genome.wustl.edu	37	19	22156121	22156121	+	Missense_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr19:22156121T>G	ENST00000397126.4	-	4	1863	c.1715A>C	c.(1714-1716)aAg>aCg	p.K572T	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	572					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				ATGAATTTTCTTATGATAACT	0.343																																																	0													24.0	25.0	25.0					19																	22156121		1942	4123	6065	SO:0001583	missense	0			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.1715A>C	19.37:g.22156121T>G	ENSP00000380315:p.Lys572Thr			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K572T	ENST00000397126.4	37	c.1715	CCDS54240.1	19	.	.	.	.	.	.	.	.	.	.	T	12.50	1.956776	0.34565	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.17854	2.25	2.82	1.76	0.24704	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.33527	0.0866	.	.	.	0.09310	N	1	D	0.89917	1.0	D	0.78314	0.991	T	0.09640	-1.0665	8	0.51188	T	0.08	.	5.3547	0.16055	0.0:0.2667:0.0:0.7333	.	472	O43345	ZN208_HUMAN	T	572;472	ENSP00000380315:K572T	ENSP00000380315:K572T	K	-	2	0	ZNF208	21947961	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.593000	0.05740	0.062000	0.16340	0.254000	0.18369	AAG	ZNF208	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000160321		0.343	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	HGNC	protein_coding	OTTHUMT00000464302.1	-	0.00	69	0	T	NM_007153		22156121	-1	tier1	-	no_errors	ENST00000397126	ensembl	human	novel	74_37	missense	41.30	27	19	SNP	0.001	G
ZNF281	23528	genome.wustl.edu	37	1	200378072	200378072	+	Silent	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr1:200378072G>T	ENST00000294740.3	-	2	886	c.762C>A	c.(760-762)ctC>ctA	p.L254L	ZNF281_ENST00000367353.1_Silent_p.L254L|ZNF281_ENST00000367352.3_Silent_p.L218L	NM_001281293.1|NM_001281294.1|NM_012482.4	NP_001268222.1|NP_001268223.1|NP_036614.1	Q9Y2X9	ZN281_HUMAN	zinc finger protein 281	254					embryonic body morphogenesis (GO:0010172)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|stem cell differentiation (GO:0048863)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|endometrium(3)|kidney(3)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	27						GACTTGGGGAGAGGATGGCAC	0.483																																																	0													129.0	120.0	123.0					1																	200378072		2203	4300	6503	SO:0001819	synonymous_variant	0			AF125158	CCDS1402.1, CCDS60384.1	1q32.1	2012-08-08			ENSG00000162702	ENSG00000162702		"""Zinc fingers, C2H2-type"""	13075	protein-coding gene	gene with protein product						10448078	Standard	NM_012482		Approved	ZBP-99	uc001gve.3	Q9Y2X9	OTTHUMG00000035724	ENST00000294740.3:c.762C>A	1.37:g.200378072G>T			A6NF48|B3KMX2|Q5RKW5|Q9NY92	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L254	ENST00000294740.3	37	c.762	CCDS1402.1	1																																																																																			ZNF281	-	NULL	ENSG00000162702		0.483	ZNF281-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF281	HGNC	protein_coding	OTTHUMT00000086879.2	-	0.00	46	0	G	NM_012482		200378072	-1	tier1	-	no_errors	ENST00000294740	ensembl	human	known	74_37	silent	11.76	30	4	SNP	0.987	T
ZNF33A	7581	genome.wustl.edu	37	10	38344667	38344667	+	Missense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr10:38344667G>T	ENST00000458705.2	+	5	1770	c.1612G>T	c.(1612-1614)Gac>Tac	p.D538Y	ZNF33A_ENST00000432900.2_Missense_Mutation_p.D545Y|ZNF33A_ENST00000469037.2_Intron|ZNF33A_ENST00000374618.3_Missense_Mutation_p.D539Y|ZNF33A_ENST00000307441.9_Missense_Mutation_p.D538Y			Q06730	ZN33A_HUMAN	zinc finger protein 33A	538					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(2)|large_intestine(8)|liver(2)|lung(27)|ovary(2)|prostate(1)|skin(2)	46						CTTGAAGTCAGACCTCACAGT	0.423																																																	0													104.0	104.0	104.0					10																	38344667		2203	4300	6503	SO:0001583	missense	0			D31763	CCDS31182.1, CCDS60514.1, CCDS73088.1, CCDS73089.1	10p11.2	2013-01-08	2005-03-18		ENSG00000189180	ENSG00000189180		"""Zinc fingers, C2H2-type"", ""-"""	13096	protein-coding gene	gene with protein product	"""zinc finger and ZAK associated protein with KRAB domain"""	194521	"""zinc finger protein 33a (KOX 31)"", ""zinc finger protein 11A"""	ZNF33, ZNF11A		2014798, 8464732	Standard	NM_006974		Approved	KOX5, KOX31, KIAA0065, FLJ23404, ZZAPK	uc031pui.1	Q06730	OTTHUMG00000017983	ENST00000458705.2:c.1612G>T	10.37:g.38344667G>T	ENSP00000387713:p.Asp538Tyr		A8K9X9|B4E0M8|F6TH33|F8WAJ5|P17013|Q5VZ86	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D545Y	ENST00000458705.2	37	c.1633	CCDS31182.1	10	.	.	.	.	.	.	.	.	.	.	G	4.115	0.019449	0.08006	.	.	ENSG00000189180	ENST00000374618;ENST00000432900;ENST00000458705;ENST00000307441	T;T;T;T	0.07444	3.19;3.19;3.19;3.19	1.68	0.446	0.16602	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.35903	N	0.002906	T	0.08758	0.0217	L	0.31294	0.92	0.09310	N	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.68353	0.927;0.957;0.929	T	0.30621	-0.9972	10	0.02654	T	1	.	2.6382	0.04964	0.2197:0.3148:0.4655:0.0	.	545;538;539	F6TH33;Q06730;F8WAJ5	.;ZN33A_HUMAN;.	Y	539;545;538;538	ENSP00000363747:D539Y;ENSP00000402467:D545Y;ENSP00000387713:D538Y;ENSP00000304268:D538Y	ENSP00000304268:D538Y	D	+	1	0	ZNF33A	38384673	0.000000	0.05858	0.992000	0.48379	0.602000	0.36980	-1.940000	0.01543	0.897000	0.36392	0.305000	0.20034	GAC	ZNF33A	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000189180		0.423	ZNF33A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF33A	HGNC	protein_coding	OTTHUMT00000047614.1		0.00	76	0	G	NM_006974		38344667	+1			no_errors	ENST00000432900	ensembl	human	known	74_37	missense	6.12	46	3	SNP	0.000	T
ZNF469	84627	genome.wustl.edu	37	16	88498472	88498472	+	Missense_Mutation	SNP	C	C	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr16:88498472C>T	ENST00000437464.1	+	2	4510	c.4510C>T	c.(4510-4512)Cgg>Tgg	p.R1504W	ZNF469_ENST00000565624.1_Missense_Mutation_p.R1532W	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	1504	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						TCCCCCTGAACGGACAGTGGT	0.567																																																	0													99.0	74.0	82.0					16																	88498472		692	1591	2283	SO:0001583	missense	0			AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.4510C>T	16.37:g.88498472C>T	ENSP00000402343:p.Arg1504Trp			Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R1504W	ENST00000437464.1	37	c.4510	CCDS45544.1	16	.	.	.	.	.	.	.	.	.	.	C	10.31	1.315670	0.23908	.	.	ENSG00000225614	ENST00000437464	T	0.06687	3.27	4.48	-1.45	0.08828	.	.	.	.	.	T	0.02807	0.0084	N	0.08118	0	0.09310	N	1	P	0.44260	0.83	B	0.29942	0.109	T	0.39961	-0.9588	9	0.66056	D	0.02	.	5.0266	0.14389	0.2744:0.3147:0.4109:0.0	.	1504	Q96JG9	ZN469_HUMAN	W	1504	ENSP00000402343:R1504W	ENSP00000402343:R1504W	R	+	1	2	ZNF469	87025973	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.148000	0.16224	-0.609000	0.05724	-0.311000	0.09066	CGG	ZNF469	-	NULL	ENSG00000225614		0.567	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF469	HGNC	protein_coding		-	0.00	54	0	C	NG_012236		88498472	+1	tier1	-	no_errors	ENST00000437464	ensembl	human	known	74_37	missense	23.81	32	10	SNP	0.001	T
ZNF486	90649	genome.wustl.edu	37	19	20278155	20278155	+	Missense_Mutation	SNP	A	A	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr19:20278155A>G	ENST00000335117.8	+	1	73	c.16A>G	c.(16-18)Aga>Gga	p.R6G	ZNF486_ENST00000597083.1_Missense_Mutation_p.R6G|CTC-260E6.6_ENST00000586657.1_RNA|CTC-260E6.6_ENST00000593655.1_RNA	NM_052852.3	NP_443084.2	Q96H40	ZN486_HUMAN	zinc finger protein 486	6					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	11						GGGACCCCTTAGAAGCCTAGA	0.582																																																	0													60.0	64.0	63.0					19																	20278155		2201	4300	6501	SO:0001583	missense	0			BC008936	CCDS46029.1	19p12	2014-02-13	2003-12-16	2003-12-17	ENSG00000256229	ENSG00000256229		"""Zinc fingers, C2H2-type"", ""-"""	20807	protein-coding gene	gene with protein product			"""KRAB domain only 2"""	KRBO2			Standard	NM_052852		Approved	MGC2396	uc002nou.3	Q96H40	OTTHUMG00000179731	ENST00000335117.8:c.16A>G	19.37:g.20278155A>G	ENSP00000335042:p.Arg6Gly		Q0VG00	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R6G	ENST00000335117.8	37	c.16	CCDS46029.1	19	.	.	.	.	.	.	.	.	.	.	-	0.011	-1.705187	0.00719	.	.	ENSG00000256229	ENST00000545779;ENST00000335117	T	0.05319	3.46	0.461	-0.922	0.10468	Krueppel-associated box (1);	.	.	.	.	T	0.02193	0.0068	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44772	-0.9306	8	0.06625	T	0.88	.	.	.	.	.	6	Q96H40	ZN486_HUMAN	G	45;6	ENSP00000335042:R6G	ENSP00000335042:R6G	R	+	1	2	ZNF486	20139155	0.002000	0.14202	0.000000	0.03702	0.004000	0.04260	-0.448000	0.06820	-1.196000	0.02676	-0.788000	0.03338	AGA	ZNF486	-	superfamily_Krueppel-associated_box	ENSG00000256229		0.582	ZNF486-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF486	HGNC	protein_coding	OTTHUMT00000447843.2	-	0.00	97	0	A	NM_052852		20278155	+1	tier1	-	no_errors	ENST00000335117	ensembl	human	known	74_37	missense	39.25	65	42	SNP	0.001	G
ZNF486	90649	genome.wustl.edu	37	19	20308122	20308122	+	Missense_Mutation	SNP	A	A	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr19:20308122A>C	ENST00000335117.8	+	4	660	c.603A>C	c.(601-603)aaA>aaC	p.K201N	CTC-260E6.6_ENST00000585498.1_RNA|CTC-260E6.6_ENST00000586657.1_RNA|CTC-260E6.6_ENST00000593655.1_RNA	NM_052852.3	NP_443084.2	Q96H40	ZN486_HUMAN	zinc finger protein 486	201					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	11						CTACACATAAAAAAATTGATA	0.348																																																	0													34.0	38.0	37.0					19																	20308122		2103	4249	6352	SO:0001583	missense	0			BC008936	CCDS46029.1	19p12	2014-02-13	2003-12-16	2003-12-17	ENSG00000256229	ENSG00000256229		"""Zinc fingers, C2H2-type"", ""-"""	20807	protein-coding gene	gene with protein product			"""KRAB domain only 2"""	KRBO2			Standard	NM_052852		Approved	MGC2396	uc002nou.3	Q96H40	OTTHUMG00000179731	ENST00000335117.8:c.603A>C	19.37:g.20308122A>C	ENSP00000335042:p.Lys201Asn		Q0VG00	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K201N	ENST00000335117.8	37	c.603	CCDS46029.1	19	.	.	.	.	.	.	.	.	.	.	a	9.291	1.050572	0.19827	.	.	ENSG00000256229	ENST00000545779;ENST00000335117	T	0.18657	2.2	0.85	-1.7	0.08159	Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.27027	0.0662	L	0.41961	1.31	0.21445	N	0.999689	D	0.57571	0.98	P	0.62740	0.906	T	0.16958	-1.0385	9	0.66056	D	0.02	.	2.0183	0.03503	0.2882:0.0:0.2683:0.4435	.	201	Q96H40	ZN486_HUMAN	N	240;201	ENSP00000335042:K201N	ENSP00000335042:K201N	K	+	3	2	ZNF486	20169122	0.000000	0.05858	0.030000	0.17652	0.029000	0.11900	-0.275000	0.08525	-1.290000	0.02372	-1.322000	0.01289	AAA	ZNF486	-	NULL	ENSG00000256229		0.348	ZNF486-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF486	HGNC	protein_coding	OTTHUMT00000447843.2	-	0.00	72	0	A	NM_052852		20308122	+1	tier1	-	no_errors	ENST00000335117	ensembl	human	known	74_37	missense	26.74	63	23	SNP	0.655	C
ZNF521	25925	genome.wustl.edu	37	18	22806995	22806995	+	Missense_Mutation	SNP	A	A	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr18:22806995A>G	ENST00000361524.3	-	4	1035	c.887T>C	c.(886-888)cTc>cCc	p.L296P	ZNF521_ENST00000538137.2_Missense_Mutation_p.L296P|ZNF521_ENST00000579111.1_5'Flank|ZNF521_ENST00000584787.1_Missense_Mutation_p.L76P	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	296					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					GTGGTTCATGAGGGAGGTCTC	0.537			T	PAX5	ALL																																			Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	0													104.0	100.0	102.0					18																	22806995		2203	4300	6503	SO:0001583	missense	0			AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.887T>C	18.37:g.22806995A>G	ENSP00000354794:p.Leu296Pro		A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L296P	ENST00000361524.3	37	c.887	CCDS32806.1	18	.	.	.	.	.	.	.	.	.	.	A	10.38	1.335358	0.24253	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T	0.42513	0.97;0.97	6.02	6.02	0.97574	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.74906	0.3778	H	0.94582	3.555	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82559	-0.0397	10	0.87932	D	0	-23.9073	16.5446	0.84426	1.0:0.0:0.0:0.0	.	296	Q96K83	ZN521_HUMAN	P	296;330;296	ENSP00000354794:L296P;ENSP00000382352:L296P	ENSP00000354794:L296P	L	-	2	0	ZNF521	21060993	1.000000	0.71417	0.884000	0.34674	0.997000	0.91878	8.962000	0.93254	2.311000	0.77944	0.533000	0.62120	CTC	ZNF521	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198795		0.537	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	ZNF521	HGNC	protein_coding	OTTHUMT00000446781.2	-	0.00	100	0	A	NM_015461		22806995	-1	tier1	-	no_errors	ENST00000361524	ensembl	human	known	74_37	missense	40.62	38	26	SNP	0.996	G
ZNF585B	92285	genome.wustl.edu	37	19	37677166	37677166	+	Missense_Mutation	SNP	A	A	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr19:37677166A>C	ENST00000532828.2	-	5	1524	c.1273T>G	c.(1273-1275)Ttg>Gtg	p.L425V	ZNF585B_ENST00000527838.1_3'UTR|ZNF585B_ENST00000531805.1_Missense_Mutation_p.L370V|CTC-454I21.3_ENST00000585860.2_Intron|ZNF585B_ENST00000312908.5_Missense_Mutation_p.L13V	NM_152279.3	NP_689492.3	Q52M93	Z585B_HUMAN	zinc finger protein 585B	425					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|endometrium(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TGTGTAATCAAGTGTGCCTTC	0.398																																					Melanoma(93;882 1454 18863 28917 48427)												0													110.0	107.0	108.0					19																	37677166		2203	4300	6503	SO:0001583	missense	0			AK027834	CCDS12500.1	19q13.13	2013-01-08				ENSG00000245680		"""Zinc fingers, C2H2-type"", ""-"""	30948	protein-coding gene	gene with protein product						12477932	Standard	NM_152279		Approved	FLJ14928, SZFP41	uc002ofq.3	Q52M93		ENST00000532828.2:c.1273T>G	19.37:g.37677166A>C	ENSP00000433773:p.Leu425Val		Q8IZD3|Q96JW6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L425V	ENST00000532828.2	37	c.1273	CCDS12500.1	19	.	.	.	.	.	.	.	.	.	.	A	10.55	1.380252	0.24944	.	.	ENSG00000245680	ENST00000531805;ENST00000532828;ENST00000312908	T;T;T	0.52983	0.64;0.64;0.64	2.47	-1.19	0.09585	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.30252	N	0.010045	T	0.60301	0.2258	M	0.86343	2.81	0.09310	N	1	P;P	0.52061	0.95;0.86	P;P	0.56648	0.607;0.803	T	0.55373	-0.8151	10	0.72032	D	0.01	.	7.414	0.27034	0.6469:0.0:0.3531:0.0	.	370;425	E9PQH3;Q52M93	.;Z585B_HUMAN	V	370;425;13	ENSP00000436774:L370V;ENSP00000433773:L425V;ENSP00000442139:L13V	ENSP00000442139:L13V	L	-	1	2	ZNF585B	42369006	0.000000	0.05858	0.012000	0.15200	0.488000	0.33401	-0.880000	0.04183	-0.191000	0.10448	0.374000	0.22700	TTG	ZNF585B	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000245680		0.398	ZNF585B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF585B	HGNC	protein_coding	OTTHUMT00000388272.2	-	0.00	79	0	A	NM_152279		37677166	-1	tier1	-	no_errors	ENST00000532828	ensembl	human	known	74_37	missense	23.61	55	17	SNP	0.001	C
ZNF679	168417	genome.wustl.edu	37	7	63721262	63721262	+	Nonsense_Mutation	SNP	G	G	T			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr7:63721262G>T	ENST00000421025.1	+	4	486	c.217G>T	c.(217-219)Gag>Tag	p.E73*	ZNF679_ENST00000255746.4_Nonsense_Mutation_p.E73*	NM_001159524.1|NM_153363.2	NP_001152996.1|NP_699194.2	Q8IYX0	ZN679_HUMAN	zinc finger protein 679	73	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|lung(11)|skin(1)|stomach(1)	18						GCAAAATAAAGAGCCTTGGAA	0.378																																																	0													121.0	109.0	113.0					7																	63721262		692	1591	2283	SO:0001587	stop_gained	0			BC033523	CCDS47592.1	7q11.21	2013-01-08			ENSG00000197123	ENSG00000197123		"""Zinc fingers, C2H2-type"", ""-"""	28650	protein-coding gene	gene with protein product	"""hypothetical protein MGC42415"""					12477932	Standard	NM_153363		Approved	MGC42415	uc003tsx.3	Q8IYX0	OTTHUMG00000156486	ENST00000421025.1:c.217G>T	7.37:g.63721262G>T	ENSP00000416809:p.Glu73*			Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E73*	ENST00000421025.1	37	c.217	CCDS47592.1	7	.	.	.	.	.	.	.	.	.	.	G	8.575	0.880954	0.17467	.	.	ENSG00000197123	ENST00000421025;ENST00000255746	.	.	.	0.235	0.235	0.15431	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	.	.	.	.	.	.	.	X	73	.	ENSP00000255746:E73X	E	+	1	0	ZNF679	63358697	0.303000	0.24463	0.027000	0.17364	0.031000	0.12232	1.500000	0.35682	0.308000	0.22923	0.313000	0.20887	GAG	ZNF679	-	smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000197123		0.378	ZNF679-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF679	HGNC	protein_coding	OTTHUMT00000344317.2	-	0.00	162	0	G	NM_153363		63721262	+1	tier1	-	no_errors	ENST00000255746	ensembl	human	known	74_37	nonsense	33.08	89	44	SNP	0.035	T
ZNF697	90874	genome.wustl.edu	37	1	120165646	120165646	+	Silent	SNP	G	G	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr1:120165646G>A	ENST00000421812.2	-	3	1439	c.1320C>T	c.(1318-1320)cgC>cgT	p.R440R		NM_001080470.1	NP_001073939.1	Q5TEC3	ZN697_HUMAN	zinc finger protein 697	440					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			ovary(2)	2	all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0266)		Lung(183;0.011)|LUSC - Lung squamous cell carcinoma(189;0.0577)		TCCCGCACTCGCGGCACACGT	0.667																																																	0													15.0	17.0	17.0					1																	120165646		2183	4288	6471	SO:0001819	synonymous_variant	0			AK027019, BC033126	CCDS44202.1	1p12	2013-01-08			ENSG00000143067	ENSG00000143067		"""Zinc fingers, C2H2-type"""	32034	protein-coding gene	gene with protein product							Standard	NM_001080470		Approved	MGC45731	uc001ehy.1	Q5TEC3	OTTHUMG00000012962	ENST00000421812.2:c.1320C>T	1.37:g.120165646G>A			Q96IT2	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R440	ENST00000421812.2	37	c.1320	CCDS44202.1	1																																																																																			ZNF697	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000143067		0.667	ZNF697-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF697	HGNC	protein_coding	OTTHUMT00000036349.3	-	0.00	36	0	G	XM_371286		120165646	-1	tier1	-	no_errors	ENST00000421812	ensembl	human	known	74_37	silent	38.46	24	15	SNP	0.995	A
ZNF737	100129842	genome.wustl.edu	37	19	20727762	20727762	+	Missense_Mutation	SNP	T	T	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr19:20727762T>G	ENST00000427401.4	-	4	1341	c.1247A>C	c.(1246-1248)aAg>aCg	p.K416T		NM_001159293.1	NP_001152765.1	O75373	ZN737_HUMAN	zinc finger protein 737	416					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|lung(7)|ovary(1)|stomach(1)|urinary_tract(1)	13						ATGGATTATCTTATGTGTAGT	0.403																																																	0													183.0	179.0	180.0					19																	20727762		692	1591	2283	SO:0001583	missense	0			BC015765	CCDS54238.1	19p12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	32468	protein-coding gene	gene with protein product		603984					Standard	NM_001159293		Approved	ZNF102	uc002npa.3	O75373		ENST00000427401.4:c.1247A>C	19.37:g.20727762T>G	ENSP00000395733:p.Lys416Thr		C9JHM3	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K416T	ENST00000427401.4	37	c.1247	CCDS54238.1	19	.	.	.	.	.	.	.	.	.	.	N	6.511	0.462461	0.12342	.	.	ENSG00000237440	ENST00000427401	T	0.17854	2.25	0.801	0.801	0.18679	.	.	.	.	.	T	0.21509	0.0518	L	0.28192	0.835	0.09310	N	0.999999	D	0.67145	0.996	D	0.70227	0.968	T	0.12372	-1.0550	9	0.87932	D	0	.	2.8131	0.05447	0.4122:0.0:0.0:0.5878	.	416	C9JHM3	.	T	416	ENSP00000395733:K416T	ENSP00000395733:K416T	K	-	2	0	ZNF737	20519602	0.000000	0.05858	0.241000	0.24154	0.241000	0.25554	-0.167000	0.09940	0.147000	0.19030	0.145000	0.16022	AAG	ZNF737	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000237440		0.403	ZNF737-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF737	HGNC	protein_coding	OTTHUMT00000447844.2	-	0.00	46	0	T	NM_145289		20727762	-1	tier1	-	no_errors	ENST00000427401	ensembl	human	known	74_37	missense	19.72	57	14	SNP	0.530	G
ZNF804B	219578	genome.wustl.edu	37	7	88964841	88964841	+	Missense_Mutation	SNP	A	A	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr7:88964841A>C	ENST00000333190.4	+	4	3154	c.2545A>C	c.(2545-2547)Act>Cct	p.T849P		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	849							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			TTGCCAGGGAACTCAGCACGA	0.383										HNSCC(36;0.09)																																							0													61.0	60.0	60.0					7																	88964841		2202	4298	6500	SO:0001583	missense	0			AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.2545A>C	7.37:g.88964841A>C	ENSP00000329638:p.Thr849Pro		B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz	p.T849P	ENST00000333190.4	37	c.2545	CCDS5613.1	7	.	.	.	.	.	.	.	.	.	.	A	1.400	-0.578312	0.03854	.	.	ENSG00000182348	ENST00000333190	T	0.04809	3.55	5.19	-1.32	0.09201	.	0.724907	0.13136	N	0.411029	T	0.01421	0.0046	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45644	-0.9247	10	0.27785	T	0.31	-0.2294	0.0849	0.00035	0.2679:0.1944:0.2459:0.2918	.	849	A4D1E1	Z804B_HUMAN	P	849	ENSP00000329638:T849P	ENSP00000329638:T849P	T	+	1	0	ZNF804B	88802777	0.000000	0.05858	0.019000	0.16419	0.021000	0.10359	0.319000	0.19522	0.052000	0.16007	-1.046000	0.02355	ACT	ZNF804B	-	NULL	ENSG00000182348		0.383	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804B	HGNC	protein_coding	OTTHUMT00000253683.2	-	0.00	94	0	A	NM_181646		88964841	+1	tier1	-	no_errors	ENST00000333190	ensembl	human	known	74_37	missense	17.98	73	16	SNP	0.000	C
ZNF804B	219578	genome.wustl.edu	37	7	88965052	88965052	+	Missense_Mutation	SNP	A	A	G			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr7:88965052A>G	ENST00000333190.4	+	4	3365	c.2756A>G	c.(2755-2757)gAg>gGg	p.E919G		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	919							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			GCAGAAGGAGAGAGGACCCCT	0.423										HNSCC(36;0.09)																																							0													100.0	106.0	104.0					7																	88965052		2203	4300	6503	SO:0001583	missense	0			AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.2756A>G	7.37:g.88965052A>G	ENSP00000329638:p.Glu919Gly		B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz	p.E919G	ENST00000333190.4	37	c.2756	CCDS5613.1	7	.	.	.	.	.	.	.	.	.	.	A	12.88	2.071276	0.36566	.	.	ENSG00000182348	ENST00000333190	T	0.06371	3.31	5.34	4.2	0.49525	.	0.452101	0.22827	N	0.055150	T	0.06142	0.0159	L	0.32530	0.975	0.09310	N	1	B	0.18461	0.028	B	0.14023	0.01	T	0.27640	-1.0068	10	0.66056	D	0.02	-0.9433	9.8952	0.41314	0.8583:0.0:0.1417:0.0	.	919	A4D1E1	Z804B_HUMAN	G	919	ENSP00000329638:E919G	ENSP00000329638:E919G	E	+	2	0	ZNF804B	88802988	1.000000	0.71417	0.017000	0.16124	0.004000	0.04260	4.416000	0.59815	1.059000	0.40554	-0.250000	0.11733	GAG	ZNF804B	-	NULL	ENSG00000182348		0.423	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804B	HGNC	protein_coding	OTTHUMT00000253683.2	-	0.00	113	0	A	NM_181646		88965052	+1	tier1	-	no_errors	ENST00000333190	ensembl	human	known	74_37	missense	16.52	96	19	SNP	0.009	G
ZNF90	7643	genome.wustl.edu	37	19	20188888	20188888	+	5'UTR	SNP	G	G	A			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr19:20188888G>A	ENST00000418063.2	+	0	59				ZNF90_ENST00000474284.1_3'UTR	NM_007138.1	NP_009069.1	Q03938	ZNF90_HUMAN	zinc finger protein 90						transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|lung(2)|ovary(1)|skin(1)	5						CTGTGGCCCTGTGACCTGCAG	0.577																																																	0													37.0	37.0	37.0					19																	20188888		692	1591	2283	SO:0001623	5_prime_UTR_variant	0			M61870	CCDS46028.1	19p12	2013-01-08	2006-02-01		ENSG00000213988	ENSG00000213988		"""Zinc fingers, C2H2-type"", ""-"""	13165	protein-coding gene	gene with protein product		603973	"""zinc finger protein 90 (HTF9)"""			8467795	Standard	NM_007138		Approved	HTF9	uc002nor.2	Q03938	OTTHUMG00000158057	ENST00000418063.2:c.-54G>A	19.37:g.20188888G>A			B9EH87	RNA	SNP	-	NULL	ENST00000418063.2	37	NULL	CCDS46028.1	19																																																																																			ZNF90	-	-	ENSG00000213988		0.577	ZNF90-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF90	HGNC	protein_coding	OTTHUMT00000350101.1	-	0.00	107	0	G	NM_007138		20188888	+1	tier1	-	no_errors	ENST00000474284	ensembl	human	known	74_37	rna	17.86	92	20	SNP	0.004	A
ZNF98	148198	genome.wustl.edu	37	19	22575670	22575670	+	Missense_Mutation	SNP	T	T	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr19:22575670T>C	ENST00000357774.5	-	4	488	c.367A>G	c.(367-369)Aga>Gga	p.R123G		NM_001098626.1	NP_001092096.1	A6NK75	ZNF98_HUMAN	zinc finger protein 98	123					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				CAGTATTTTCTTAACTGTAAA	0.333																																																	0													64.0	55.0	58.0					19																	22575670		1981	4191	6172	SO:0001583	missense	0				CCDS46031.1	19p12	2014-02-14	2010-04-20	2008-06-12	ENSG00000197360	ENSG00000197360		"""Zinc fingers, C2H2-type"", ""-"""	13174	protein-coding gene	gene with protein product	"""zinc finger protein 739"""	603980					Standard	NM_001098626		Approved	ZNF739, F7175	uc002nqt.2	A6NK75	OTTHUMG00000182940	ENST00000357774.5:c.367A>G	19.37:g.22575670T>C	ENSP00000350418:p.Arg123Gly			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R123G	ENST00000357774.5	37	c.367	CCDS46031.1	19	.	.	.	.	.	.	.	.	.	.	.	4.251	0.045638	0.08196	.	.	ENSG00000197360	ENST00000357774	T	0.07114	3.22	0.916	-1.37	0.09056	.	.	.	.	.	T	0.10035	0.0246	M	0.79343	2.45	0.09310	N	1	B	0.18863	0.031	B	0.19946	0.027	T	0.35574	-0.9783	9	0.39692	T	0.17	.	3.5855	0.07969	0.3347:0.0:0.0:0.6653	.	123	A6NK75	ZNF98_HUMAN	G	123	ENSP00000350418:R123G	ENSP00000350418:R123G	R	-	1	2	ZNF98	22367510	0.000000	0.05858	0.038000	0.18304	0.037000	0.13140	-0.758000	0.04766	0.257000	0.21650	0.254000	0.18369	AGA	ZNF98	-	NULL	ENSG00000197360		0.333	ZNF98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF98	HGNC	protein_coding	OTTHUMT00000464398.1	-	0.00	133	0	T	NM_001098626		22575670	-1	tier1	-	no_errors	ENST00000357774	ensembl	human	known	74_37	missense	10.81	99	12	SNP	0.080	C
ZNF880	400713	genome.wustl.edu	37	19	52887527	52887527	+	Silent	SNP	A	A	C			TCGA-RE-A7BO-01A-11D-A33E-09	TCGA-RE-A7BO-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fe65b7bb-a8ad-4182-a07f-2bc2b663558d	d9272e43-4e83-410c-b3fb-13ec8360c195	g.chr19:52887527A>C	ENST00000422689.2	+	4	709	c.694A>C	c.(694-696)Aga>Cga	p.R232R		NM_001145434.1	NP_001138906.1	Q6PDB4	ZN880_HUMAN	zinc finger protein 880	232					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	10						ACAACATCAAAGAATTCATAC	0.388																																																	0													37.0	35.0	36.0					19																	52887527		1568	3582	5150	SO:0001819	synonymous_variant	0			BC058819	CCDS46164.1	19q13.41	2013-01-08			ENSG00000221923	ENSG00000221923		"""Zinc fingers, C2H2-type"", ""-"""	37249	protein-coding gene	gene with protein product							Standard	NM_001145434		Approved		uc002pzc.3	Q6PDB4	OTTHUMG00000167972	ENST00000422689.2:c.694A>C	19.37:g.52887527A>C			B4DNA6	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R232	ENST00000422689.2	37	c.694	CCDS46164.1	19																																																																																			ZNF880	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000221923		0.388	ZNF880-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF880	HGNC	protein_coding	OTTHUMT00000397374.1	-	0.00	80	0	A	NM_001145434		52887527	+1	tier1	-	no_errors	ENST00000422689	ensembl	human	known	74_37	silent	56.25	35	45	SNP	0.004	C
