#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCC5	10057	genome.wustl.edu	37	3	183665251	183665251	+	Missense_Mutation	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr3:183665251G>A	ENST00000334444.6	-	23	3515	c.3275C>T	c.(3274-3276)aCg>aTg	p.T1092M	ABCC5_ENST00000265586.6_Missense_Mutation_p.T1049M	NM_005688.2	NP_005679.2	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 5	1092	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cisplatin(DB00515)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Glutathione(DB00143)|Mercaptopurine(DB01033)|Probenecid(DB01032)|Rifampicin(DB01045)|Sildenafil(DB00203)|Sulfinpyrazone(DB01138)|Zidovudine(DB00495)	CATCGCACACGTAAACAAAAA	0.532																																																	0													52.0	62.0	58.0					3																	183665251		1996	4169	6165	SO:0001583	missense	0			AF104942	CCDS33898.1, CCDS43176.1	3q27	2012-03-14			ENSG00000114770	ENSG00000114770		"""ATP binding cassette transporters / subfamily C"""	56	protein-coding gene	gene with protein product		605251				8894702, 9827529	Standard	XM_005247058		Approved	MRP5, SMRP, EST277145, MOAT-C	uc003fmg.3	O15440	OTTHUMG00000156871	ENST00000334444.6:c.3275C>T	3.37:g.183665251G>A	ENSP00000333926:p.Thr1092Met		B9EIQ2|O14517|Q29ZA9|Q29ZB1|Q86UX3|Q86W30|Q9UN85|Q9UNP5|Q9UQC3	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.T1092M	ENST00000334444.6	37	c.3275	CCDS43176.1	3	.	.	.	.	.	.	.	.	.	.	G	12.62	1.991431	0.35131	.	.	ENSG00000114770	ENST00000334444;ENST00000265586	D;D	0.82803	-1.65;-1.65	5.53	5.53	0.82687	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.138997	0.64402	D	0.000007	T	0.62514	0.2434	N	0.03000	-0.44	0.35197	D	0.773939	B;B	0.17667	0.004;0.023	B;B	0.12156	0.007;0.004	T	0.65446	-0.6166	10	0.33940	T	0.23	-14.9056	9.9651	0.41719	0.0:0.1884:0.6809:0.1307	.	1049;1092	Q86UX3;O15440	.;MRP5_HUMAN	M	1092;1049	ENSP00000333926:T1092M;ENSP00000265586:T1049M	ENSP00000265586:T1049M	T	-	2	0	ABCC5	185147945	1.000000	0.71417	0.998000	0.56505	0.936000	0.57629	3.964000	0.56780	2.607000	0.88179	0.655000	0.94253	ACG	ABCC5	-	pfam_ABC_transptr_TM_dom,superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom	ENSG00000114770		0.532	ABCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC5	HGNC	protein_coding	OTTHUMT00000346350.1		0.00	21	0	G	NM_005688		183665251	-1			no_errors	ENST00000334444	ensembl	human	known	74_37	missense	17.65	14	3	SNP	1.000	A
ABHD17A	81926	genome.wustl.edu	37	19	1877558	1877558	+	Missense_Mutation	SNP	C	C	G			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr19:1877558C>G	ENST00000292577.7	-	4	1089	c.656G>C	c.(655-657)cGc>cCc	p.R219P	ABHD17A_ENST00000250974.9_Missense_Mutation_p.R270P|CTB-31O20.9_ENST00000592720.1_lincRNA|ABHD17A_ENST00000590661.1_Missense_Mutation_p.A188P|CTB-31O20.2_ENST00000565797.1_lincRNA	NM_001130111.1	NP_001123583.1	Q96GS6	AB17A_HUMAN	abhydrolase domain containing 17A	219						extracellular region (GO:0005576)|membrane (GO:0016020)	hydrolase activity (GO:0016787)										GAAGGCGACGCGCATGCCCGA	0.736																																																	0													12.0	16.0	15.0					19																	1877558		2131	4194	6325	SO:0001583	missense	0			BC020512	CCDS32867.1, CCDS45902.1	19p13.3	2013-03-15	2013-03-15	2013-03-15	ENSG00000129968	ENSG00000129968		"""Abhydrolase domain containing"""	28756	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 27"", ""family with sequence similarity 108, member A1"""	C19orf27, FAM108A1		14702039	Standard	NM_031213		Approved	MGC5244	uc002lug.3	Q96GS6	OTTHUMG00000171872	ENST00000292577.7:c.656G>C	19.37:g.1877558C>G	ENSP00000292577:p.Arg219Pro		A8K0G8|D6W5Z9|Q6PJU2|Q8WUH9|Q9BWL0|Q9H7Q9	Missense_Mutation	SNP	pfam_Dienelactn_hydro	p.R270P	ENST00000292577.7	37	c.809	CCDS45902.1	19	.	.	.	.	.	.	.	.	.	.	c	18.97	3.734867	0.69189	.	.	ENSG00000129968	ENST00000250974;ENST00000292577	T;T	0.44881	0.91;0.91	4.36	3.32	0.38043	.	0.225296	0.42053	D	0.000774	T	0.66944	0.2841	M	0.89095	3.005	0.24711	N	0.993206	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.995;0.994;0.999	T	0.61352	-0.7080	10	0.87932	D	0	-19.6593	11.0093	0.47652	0.0:0.9072:0.0:0.0928	.	219;270;219	Q96GS6;Q96GS6-2;Q96GS6-3	F18A1_HUMAN;.;.	P	270;219	ENSP00000250974:R270P;ENSP00000292577:R219P	ENSP00000250974:R270P	R	-	2	0	FAM108A1	1828558	1.000000	0.71417	0.995000	0.50966	0.499000	0.33736	7.711000	0.84669	0.947000	0.37659	0.561000	0.74099	CGC	ABHD17A	-	pfam_Dienelactn_hydro	ENSG00000129968		0.736	ABHD17A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD17A	HGNC	protein_coding	OTTHUMT00000415556.2		0.00	64	0	C	NM_031213		1877558	-1			no_errors	ENST00000250974	ensembl	human	known	74_37	missense	5.80	65	4	SNP	1.000	G
ABHD8	79575	genome.wustl.edu	37	19	17412293	17412293	+	Frame_Shift_Del	DEL	G	G	-			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr19:17412293delG	ENST00000247706.3	-	2	372	c.133delC	c.(133-135)cggfs	p.R45fs	MRPL34_ENST00000594999.1_5'Flank|MRPL34_ENST00000600434.1_Intron|MRPL34_ENST00000595444.1_Intron	NM_024527.4	NP_078803.4	Q96I13	ABHD8_HUMAN	abhydrolase domain containing 8	45							hydrolase activity (GO:0016787)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(5)|urinary_tract(1)	9						TGCTTCACCCGCAGCACGCGG	0.692																																					Ovarian(156;1368 2543 15275 41187)												0													16.0	20.0	18.0					19																	17412293		2197	4289	6486	SO:0001589	frameshift_variant	0			AK021805	CCDS12355.1	19p13.12	2010-12-09			ENSG00000127220	ENSG00000127220		"""Abhydrolase domain containing"""	23759	protein-coding gene	gene with protein product						12477932	Standard	NM_024527		Approved	FLJ11743, MGC14280, MGC2512	uc002ngb.4	Q96I13		ENST00000247706.3:c.133delC	19.37:g.17412293delG	ENSP00000247706:p.Arg45fs		Q9HAE9	Frame_Shift_Del	DEL	pfam_AB_hydrolase_1,prints_AB_hydrolase_1,prints_Epox_hydrolase-like	p.R45fs	ENST00000247706.3	37	c.133	CCDS12355.1	19																																																																																			ABHD8	-	NULL	ENSG00000127220		0.692	ABHD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD8	HGNC	protein_coding	OTTHUMT00000462937.1		0.00	28	0	G	NM_024527		17412293	-1	tier1		no_errors	ENST00000247706	ensembl	human	known	74_37	frame_shift_del	12.50	14	2	DEL	1.000	-
ACSS1	84532	genome.wustl.edu	37	20	25011577	25011577	+	Missense_Mutation	SNP	G	G	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr20:25011577G>C	ENST00000323482.4	-	3	528	c.449C>G	c.(448-450)aCg>aGg	p.T150R	ACSS1_ENST00000432802.2_Missense_Mutation_p.T150R|ACSS1_ENST00000537502.1_Missense_Mutation_p.T67R|ACSS1_ENST00000542618.1_Missense_Mutation_p.T29R	NM_001252675.1|NM_032501.3	NP_001239604.1|NP_115890.2	Q9NUB1	ACS2L_HUMAN	acyl-CoA synthetase short-chain family member 1	150					acetate biosynthetic process (GO:0019413)|acetyl-CoA biosynthetic process (GO:0006085)|acetyl-CoA biosynthetic process from acetate (GO:0019427)|ethanol oxidation (GO:0006069)|propionate biosynthetic process (GO:0019542)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	mitochondrial matrix (GO:0005759)	acetate-CoA ligase activity (GO:0003987)|AMP binding (GO:0016208)|ATP binding (GO:0005524)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	26					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	CAGGCGGCACGTGGTCTCCAG	0.582																																																	0													64.0	53.0	56.0					20																	25011577		2203	4300	6503	SO:0001583	missense	0				CCDS13167.1, CCDS58764.1, CCDS58765.1	20p11.23-p11.21	2012-07-13	2005-09-08	2005-09-08	ENSG00000154930	ENSG00000154930	6.2.1.1	"""Acyl-CoA synthetase family"""	16091	protein-coding gene	gene with protein product		614355	"""acetyl-Coenzyme A synthetase 2 (AMP forming)-like"""	ACAS2L			Standard	NM_032501		Approved	dJ568C11.3, AceCS2L, MGC33843	uc002wub.3	Q9NUB1	OTTHUMG00000032112	ENST00000323482.4:c.449C>G	20.37:g.25011577G>C	ENSP00000316924:p.Thr150Arg		B3KXL2|B4DJZ3|D3DW48|F5H6F4|F8W7Y1|Q5TF42|Q8IV99|Q8N234|Q96JI1|Q96JX6|Q9NU28	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig,tigrfam_Ac_CoA_lig	p.T150R	ENST00000323482.4	37	c.449	CCDS13167.1	20	.	.	.	.	.	.	.	.	.	.	G	27.5	4.840170	0.91117	.	.	ENSG00000154930	ENST00000323482;ENST00000376727;ENST00000537502;ENST00000432802;ENST00000542618	T;T;T;T	0.50548	0.74;0.74;0.74;0.74	5.95	5.95	0.96441	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.75213	0.3819	M	0.89287	3.02	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;0.999;0.997	D;D;D;D	0.79784	0.993;0.986;0.992;0.98	T	0.78892	-0.2025	10	0.87932	D	0	-29.1388	18.9634	0.92685	0.0:0.0:1.0:0.0	.	150;150;150;67	E9PC79;Q9NUB1-2;Q9NUB1;Q6ZV30	.;.;ACS2L_HUMAN;.	R	150;150;67;150;29	ENSP00000316924:T150R;ENSP00000439304:T67R;ENSP00000388793:T150R;ENSP00000437657:T29R	ENSP00000316924:T150R	T	-	2	0	ACSS1	24959577	1.000000	0.71417	0.967000	0.41034	0.980000	0.70556	9.361000	0.97122	2.825000	0.97269	0.655000	0.94253	ACG	ACSS1	-	pfam_AMP-dep_Synth/Lig,tigrfam_Ac_CoA_lig	ENSG00000154930		0.582	ACSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSS1	HGNC	protein_coding	OTTHUMT00000078386.2	-	0.00	25	0	G	NM_032501		25011577	-1	tier1	-	no_errors	ENST00000323482	ensembl	human	known	74_37	missense	20.69	23	6	SNP	1.000	C
ADAM19	8728	genome.wustl.edu	37	5	156957869	156957869	+	Missense_Mutation	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr5:156957869G>A	ENST00000517905.1	-	5	397	c.353C>T	c.(352-354)aCg>aTg	p.T118M	ADAM19_ENST00000394020.1_Missense_Mutation_p.T120M|ADAM19_ENST00000430702.2_De_novo_Start_InFrame|ADAM19_ENST00000257527.4_Missense_Mutation_p.T118M			Q9H013	ADA19_HUMAN	ADAM metallopeptidase domain 19	118					heart development (GO:0007507)|membrane protein ectodomain proteolysis (GO:0006509)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CTCCCTCACCGTGCCGTGGTA	0.542																																																	0													120.0	95.0	103.0					5																	156957869		2203	4300	6503	SO:0001583	missense	0			AF311317	CCDS4338.1	5q33.3	2010-06-24	2010-06-24		ENSG00000135074	ENSG00000135074		"""ADAM metallopeptidase domain containing"""	197	protein-coding gene	gene with protein product	"""meltrin beta"""	603640	"""a disintegrin and metalloproteinase domain 19 (meltrin beta)"""			9806848	Standard	NM_033274		Approved	MLTNB	uc003lwz.4	Q9H013	OTTHUMG00000130242	ENST00000517905.1:c.353C>T	5.37:g.156957869G>A	ENSP00000428654:p.Thr118Met		Q9BZL5|Q9UHP2	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.T120M	ENST00000517905.1	37	c.359		5	.	.	.	.	.	.	.	.	.	.	G	6.385	0.439163	0.12104	.	.	ENSG00000135074	ENST00000257527;ENST00000394020;ENST00000517905	T;T;T	0.07908	3.15;3.15;3.15	5.31	-0.0857	0.13684	.	0.473642	0.21409	N	0.075004	T	0.08447	0.0210	M	0.71036	2.16	0.21105	N	0.999787	B	0.23591	0.088	B	0.17979	0.02	T	0.23619	-1.0183	10	0.36615	T	0.2	.	4.4097	0.11427	0.3748:0.0:0.4765:0.1486	.	118	Q9H013-2	.	M	118;120;118	ENSP00000257527:T118M;ENSP00000377588:T120M;ENSP00000428654:T118M	ENSP00000257527:T118M	T	-	2	0	ADAM19	156890447	0.008000	0.16893	0.135000	0.22099	0.084000	0.17831	0.346000	0.19997	0.028000	0.15324	-0.136000	0.14681	ACG	ADAM19	-	pfam_Peptidase_M12B_N	ENSG00000135074		0.542	ADAM19-003	PUTATIVE	basic	protein_coding	ADAM19	HGNC	protein_coding	OTTHUMT00000373918.1	-	0.00	39	0	G	NM_033274		156957869	-1	tier1	-	no_errors	ENST00000394020	ensembl	human	known	74_37	missense	26.67	22	8	SNP	0.378	A
AGMAT	79814	genome.wustl.edu	37	1	15909825	15909826	+	Frame_Shift_Ins	INS	-	-	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr1:15909825_15909826insC	ENST00000375826.3	-	2	479_480	c.337_338insG	c.(337-339)gccfs	p.A113fs	RP4-680D5.2_ENST00000428945.1_RNA|DNAJC16_ENST00000483270.1_Intron	NM_024758.4	NP_079034.3	Q9BSE5	SPEB_HUMAN	agmatine ureohydrolase (agmatinase)	113					agmatine biosynthetic process (GO:0097055)|cellular nitrogen compound metabolic process (GO:0034641)|polyamine metabolic process (GO:0006595)|putrescine biosynthetic process from arginine (GO:0033388)|small molecule metabolic process (GO:0044281)|spermidine biosynthetic process (GO:0008295)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	agmatinase activity (GO:0008783)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(6)|lung(2)|skin(1)	12		Breast(348;0.000207)|Colorectal(325;0.000258)|Lung NSC(340;0.000359)|all_lung(284;0.000486)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.93e-07)|COAD - Colon adenocarcinoma(227;3.91e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000121)|KIRC - Kidney renal clear cell carcinoma(229;0.00257)|STAD - Stomach adenocarcinoma(313;0.00734)|READ - Rectum adenocarcinoma(331;0.0649)		GAAGGGGAGGGCCCCCGTGCTA	0.54																																					NSCLC(126;1678 1780 25805 43508 49531)												0																																										SO:0001589	frameshift_variant	0			AY057097	CCDS160.1	1p36.13	2009-01-05			ENSG00000116771	ENSG00000116771			18407	protein-coding gene	gene with protein product						11804860, 14648699, 11914032	Standard	NM_024758		Approved	FLJ23384	uc001awv.2	Q9BSE5	OTTHUMG00000002357	ENST00000375826.3:c.338dupG	1.37:g.15909830_15909830dupC	ENSP00000364986:p.Ala113fs		Q5TDH1|Q9H5J3	Frame_Shift_Ins	INS	pfam_Ureohydrolase,prints_Ureohydrolase,tigrfam_Agmatinase-rel	p.A113fs	ENST00000375826.3	37	c.338_337	CCDS160.1	1																																																																																			AGMAT	-	pfam_Ureohydrolase,tigrfam_Agmatinase-rel	ENSG00000116771		0.540	AGMAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGMAT	HGNC	protein_coding	OTTHUMT00000006763.1		0.00	28	0	-	NM_024758		15909826	-1	tier1		no_errors	ENST00000375826	ensembl	human	known	74_37	frame_shift_ins	5.71	33	2	INS	0.991:0.994	C
AGMO	392636	genome.wustl.edu	37	7	15599775	15599775	+	Missense_Mutation	SNP	C	C	T	rs373631505		TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr7:15599775C>T	ENST00000342526.3	-	2	417	c.248G>A	c.(247-249)cGa>cAa	p.R83Q		NM_001004320.1	NP_001004320.1	Q6ZNB7	ALKMO_HUMAN	alkylglycerol monooxygenase	83					ether lipid metabolic process (GO:0046485)|fatty acid biosynthetic process (GO:0006633)|membrane lipid metabolic process (GO:0006643)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glyceryl-ether monooxygenase activity (GO:0050479)|iron ion binding (GO:0005506)			breast(1)|kidney(1)|large_intestine(6)|liver(1)|lung(30)|prostate(1)|skin(2)	42						CCTTGGAAGTCGAGACAGAAC	0.453																																																	0								C	GLN/ARG	2,4404	4.2+/-10.8	0,2,2201	124.0	114.0	118.0		248	-0.1	0.7	7		118	0,8600		0,0,4300	no	missense	AGMO	NM_001004320.1	43	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	benign	83/446	15599775	2,13004	2203	4300	6503	SO:0001583	missense	0				CCDS34604.1	7p21.1	2013-03-04	2011-01-31	2011-01-31	ENSG00000187546	ENSG00000187546	1.14.16.5	"""Fatty acid hydroxylase domain containing"""	33784	protein-coding gene	gene with protein product		613738	"""transmembrane protein 195"""	TMEM195		20643956	Standard	NM_001004320		Approved	FLJ16237	uc003stb.1	Q6ZNB7	OTTHUMG00000152387	ENST00000342526.3:c.248G>A	7.37:g.15599775C>T	ENSP00000341662:p.Arg83Gln		A4D114|A6NCH5	Missense_Mutation	SNP	pfam_Fatty_acid_hydroxylase	p.R83Q	ENST00000342526.3	37	c.248	CCDS34604.1	7	.	.	.	.	.	.	.	.	.	.	C	7.385	0.629604	0.14257	4.54E-4	0.0	ENSG00000187546	ENST00000342526	T	0.28069	1.63	5.9	-0.0971	0.13634	.	0.169304	0.51477	N	0.000085	T	0.13543	0.0328	N	0.16602	0.42	0.38134	D	0.938245	B	0.13145	0.007	B	0.06405	0.002	T	0.37526	-0.9702	10	0.02654	T	1	-15.2044	10.5503	0.45083	0.0:0.6273:0.0:0.3727	.	83	Q6ZNB7	ALKMO_HUMAN	Q	83	ENSP00000341662:R83Q	ENSP00000341662:R83Q	R	-	2	0	AGMO	15566300	0.371000	0.25056	0.728000	0.30774	0.235000	0.25334	0.187000	0.16998	-0.070000	0.12908	0.563000	0.77884	CGA	AGMO	-	NULL	ENSG00000187546		0.453	AGMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGMO	HGNC	protein_coding	OTTHUMT00000326049.2	-	0.00	62	0	C	NM_001004320		15599775	-1	tier1	-	no_errors	ENST00000342526	ensembl	human	known	74_37	missense	20.73	65	17	SNP	0.966	T
AGO3	192669	genome.wustl.edu	37	1	36439083	36439083	+	Missense_Mutation	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr1:36439083C>T	ENST00000373191.4	+	5	978	c.629C>T	c.(628-630)gCc>gTc	p.A210V	AGO3_ENST00000324350.5_Missense_Mutation_p.A210V|AGO3_ENST00000246314.6_Intron|AGO3_ENST00000397828.2_Missense_Mutation_p.A210V	NM_024852.3	NP_079128.2	Q9H9G7	AGO3_HUMAN	argonaute RISC catalytic component 3	210					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of stem cell proliferation (GO:0072091)	cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)										GTTCGGCCTGCCATGTGGAAA	0.458																																																	0													201.0	199.0	200.0					1																	36439083		2203	4300	6503	SO:0001583	missense	0			AB046787	CCDS399.1, CCDS400.1	1p34	2013-06-03	2013-02-15	2013-02-15	ENSG00000126070	ENSG00000126070		"""Argonaute/PIWI family"""	18421	protein-coding gene	gene with protein product	"""argonaute 3"""	607355	"""eukaryotic translation initiation factor 2C, 3"""	EIF2C3		12906857	Standard	NM_024852		Approved	hAGO3, FLJ12765	uc001bzp.3	Q9H9G7	OTTHUMG00000184172	ENST00000373191.4:c.629C>T	1.37:g.36439083C>T	ENSP00000362287:p.Ala210Val		B1ALI0|Q5TA55|Q9H1U6	Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ_dom,pfam_DUF1785,superfamily_RNaseH-like_dom,superfamily_PAZ_dom,smart_PAZ_dom,smart_Piwi,pfscan_PAZ_dom,pfscan_Piwi	p.A210V	ENST00000373191.4	37	c.629	CCDS399.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.661650	0.96734	.	.	ENSG00000126070	ENST00000324350;ENST00000373191;ENST00000397828	T;T;T	0.10099	3.03;2.91;3.03	5.62	5.62	0.85841	Domain of unknown function DUF1785 (1);	0.000000	0.85682	D	0.000000	T	0.19765	0.0475	L	0.47716	1.5	0.80722	D	1	B;P	0.42757	0.425;0.789	P;P	0.47251	0.497;0.542	T	0.00148	-1.1989	10	0.87932	D	0	-32.6947	19.6679	0.95900	0.0:1.0:0.0:0.0	.	210;210	Q9H9G7;Q5TA56	AGO3_HUMAN;.	V	210	ENSP00000317425:A210V;ENSP00000362287:A210V;ENSP00000380928:A210V	ENSP00000317425:A210V	A	+	2	0	EIF2C3	36211670	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.650000	0.89964	0.563000	0.77884	GCC	AGO3	-	pfam_DUF1785	ENSG00000126070		0.458	AGO3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	AGO3	HGNC	protein_coding	OTTHUMT00000019831.4	-	0.00	76	0	C	NM_024852		36439083	+1	tier1	-	no_errors	ENST00000373191	ensembl	human	known	74_37	missense	7.41	50	4	SNP	1.000	T
AKAP4	8852	genome.wustl.edu	37	X	49958695	49958695	+	Silent	SNP	T	T	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chrX:49958695T>C	ENST00000376056.2	-	5	792	c.642A>G	c.(640-642)cgA>cgG	p.R214R	AKAP4_ENST00000376064.3_Silent_p.R214R|AKAP4_ENST00000481402.1_5'UTR|AKAP4_ENST00000376058.2_Intron|AKAP4_ENST00000358526.2_Silent_p.R223R					A kinase (PRKA) anchor protein 4											NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(6)|lung(14)|ovary(1)|skin(4)	41	Ovarian(276;0.236)					GAGAAGATAGTCGGTTGACGT	0.468																																																	0													165.0	147.0	153.0					X																	49958695		2203	4300	6503	SO:0001819	synonymous_variant	0			AF072756	CCDS14329.1, CCDS14330.1	Xp11.2	2009-03-12			ENSG00000147081	ENSG00000147081		"""A-kinase anchor proteins"""	374	protein-coding gene	gene with protein product	"""A-kinase anchor protein 82 kDa"", ""testis-specific gene HI"", ""protein kinase A anchoring protein 4"", ""cancer/testis antigen 99"""	300185				9822690, 9514854	Standard	NM_003886		Approved	p82, hAKAP82, AKAP82, Fsc1, HI, CT99	uc004dow.1	Q5JQC9	OTTHUMG00000021517	ENST00000376056.2:c.642A>G	X.37:g.49958695T>C				Silent	SNP	pfam_AKAP_110_C,pfam_RII_binding_1,smart_AKAP_110	p.R223	ENST00000376056.2	37	c.669	CCDS14330.1	X																																																																																			AKAP4	-	pfam_RII_binding_1,smart_AKAP_110	ENSG00000147081		0.468	AKAP4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP4	HGNC	protein_coding	OTTHUMT00000056552.1	-	0.00	73	0	T	NM_003886		49958695	-1	tier1	-	no_errors	ENST00000358526	ensembl	human	known	74_37	silent	29.11	55	23	SNP	0.297	C
AKAP8L	26993	genome.wustl.edu	37	19	15512282	15512282	+	Silent	SNP	G	G	T	rs372081735		TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr19:15512282G>T	ENST00000397410.5	-	5	625	c.495C>A	c.(493-495)cgC>cgA	p.R165R	AKAP8L_ENST00000595465.2_Silent_p.R104R|AKAP8L_ENST00000595879.1_5'Flank	NM_014371.2	NP_055186.2	Q9ULX6	AKP8L_HUMAN	A kinase (PRKA) anchor protein 8-like	165						cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	DEAD/H-box RNA helicase binding (GO:0017151)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(4)|kidney(2)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	11						GGAACTGGTCGCGGTAGGCAT	0.647																																																	0													56.0	56.0	56.0					19																	15512282		2112	4214	6326	SO:0001819	synonymous_variant	0			BC000713	CCDS46005.1	19p13.12	2013-10-16			ENSG00000011243	ENSG00000011243			29857	protein-coding gene	gene with protein product	"""neighbor of A kinase anchoring protein 95"""	609475				10748171, 10761695	Standard	XM_005259854		Approved	NAKAP95, HAP95	uc002naw.1	Q9ULX6	OTTHUMG00000182446	ENST00000397410.5:c.495C>A	19.37:g.15512282G>T			B4DJ74|B5BU90|O94792|Q96J58|Q9NRQ0|Q9UGM0	Silent	SNP	pfam_AKAP95	p.R165	ENST00000397410.5	37	c.495	CCDS46005.1	19																																																																																			AKAP8L	-	NULL	ENSG00000011243		0.647	AKAP8L-004	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP8L	HGNC	protein_coding	OTTHUMT00000461301.2	-	0.00	30	0	G	NM_014371		15512282	-1	tier1	-	no_errors	ENST00000397410	ensembl	human	known	74_37	silent	13.79	25	4	SNP	0.541	T
ALDH1A1	216	genome.wustl.edu	37	9	75524572	75524572	+	Missense_Mutation	SNP	T	T	G			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr9:75524572T>G	ENST00000297785.3	-	11	1358	c.1304A>C	c.(1303-1305)aAa>aCa	p.K435T		NM_000689.4	NP_000680.2	P00352	AL1A1_HUMAN	aldehyde dehydrogenase 1 family, member A1	435					cellular aldehyde metabolic process (GO:0006081)|ethanol oxidation (GO:0006069)|positive regulation of Ras GTPase activity (GO:0032320)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|androgen binding (GO:0005497)|Ras GTPase activator activity (GO:0005099)|retinal dehydrogenase activity (GO:0001758)			breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)	17					Tretinoin(DB00755)|Vitamin A(DB00162)	ATCAATGTCTTTGGTAAACAC	0.393																																																	0													187.0	166.0	173.0					9																	75524572		2203	4300	6503	SO:0001583	missense	0			K03000	CCDS6644.1	9q21.13	2010-08-05			ENSG00000165092	ENSG00000165092	1.2.1.36, 1.2.1.3	"""Aldehyde dehydrogenases"""	402	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 1"""	100640		PUMB1, ALDH1		1709013	Standard	NM_000689		Approved	RALDH1	uc004ajd.3	P00352	OTTHUMG00000020019	ENST00000297785.3:c.1304A>C	9.37:g.75524572T>G	ENSP00000297785:p.Lys435Thr		O00768|Q5SYR1	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,pfam_Acyl-CoA_reduct_LuxC,superfamily_Ald_DH/histidinol_DH	p.K435T	ENST00000297785.3	37	c.1304	CCDS6644.1	9	.	.	.	.	.	.	.	.	.	.	T	9.544	1.114122	0.20795	.	.	ENSG00000165092	ENST00000297785	T	0.15834	2.39	5.72	3.34	0.38264	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.351127	0.30101	N	0.010418	T	0.10981	0.0268	N	0.12663	0.25	0.80722	D	1	B;B	0.20368	0.001;0.044	B;B	0.29176	0.005;0.099	T	0.11155	-1.0599	10	0.52906	T	0.07	.	10.2908	0.43594	0.0:0.1364:0.0:0.8636	.	356;435	B4DDF8;P00352	.;AL1A1_HUMAN	T	435	ENSP00000297785:K435T	ENSP00000297785:K435T	K	-	2	0	ALDH1A1	74714392	1.000000	0.71417	0.917000	0.36280	0.150000	0.21749	1.034000	0.30204	1.001000	0.39076	0.533000	0.62120	AAA	ALDH1A1	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	ENSG00000165092		0.393	ALDH1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1A1	HGNC	protein_coding	OTTHUMT00000052679.1	-	0.00	36	0	T			75524572	-1	tier1	-	no_errors	ENST00000297785	ensembl	human	known	74_37	missense	54.29	16	19	SNP	0.963	G
ALDH6A1	4329	genome.wustl.edu	37	14	74535675	74535675	+	Missense_Mutation	SNP	A	A	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr14:74535675A>C	ENST00000553458.1	-	7	838	c.740T>G	c.(739-741)tTt>tGt	p.F247C	AC005484.5_ENST00000492026.1_RNA|ALDH6A1_ENST00000556852.1_5'Flank|CCDC176_ENST00000553773.1_Intron|ALDH6A1_ENST00000555126.1_5'UTR|ALDH6A1_ENST00000350259.4_Missense_Mutation_p.F234C	NM_001278593.1|NM_005589.2	NP_001265522.1|NP_005580.1	Q02252	MMSA_HUMAN	aldehyde dehydrogenase 6 family, member A1	247					branched-chain amino acid catabolic process (GO:0009083)|brown fat cell differentiation (GO:0050873)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|thymine catabolic process (GO:0006210)|thymine metabolic process (GO:0019859)|valine catabolic process (GO:0006574)|valine metabolic process (GO:0006573)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	fatty-acyl-CoA binding (GO:0000062)|malonate-semialdehyde dehydrogenase (acetylating) activity (GO:0018478)|methylmalonate-semialdehyde dehydrogenase (acylating) activity (GO:0004491)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(2)|prostate(3)|skin(3)	21				BRCA - Breast invasive adenocarcinoma(234;0.00354)		ATCGCAAATAAAATTTACAGC	0.408																																																	0													50.0	49.0	49.0					14																	74535675		2203	4300	6503	SO:0001583	missense	0			M93405	CCDS9826.1, CCDS61501.1	14q24.3	2014-02-03			ENSG00000119711	ENSG00000119711	1.2.1.27	"""Aldehyde dehydrogenases"""	7179	protein-coding gene	gene with protein product		603178		MMSDH		1527093	Standard	NM_005589		Approved		uc001xpo.3	Q02252	OTTHUMG00000171203	ENST00000553458.1:c.740T>G	14.37:g.74535675A>C	ENSP00000450436:p.Phe247Cys		B2R609|B4DFS8|J3KNU8|Q9UKM8	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH,tigrfam_MeMal-semiAld_DH	p.F247C	ENST00000553458.1	37	c.740	CCDS9826.1	14	.	.	.	.	.	.	.	.	.	.	A	21.1	4.100052	0.76983	.	.	ENSG00000119711	ENST00000553458;ENST00000350259	D;D	0.90844	-2.74;-2.74	5.98	3.6	0.41247	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.045029	0.85682	N	0.000000	D	0.95389	0.8503	M	0.92169	3.28	0.80722	D	1	D;D	0.69078	0.997;0.991	D;D	0.71184	0.972;0.972	D	0.93584	0.6915	10	0.38643	T	0.18	.	9.6114	0.39665	0.7571:0.1244:0.0:0.1184	.	234;247	B4DFS8;Q02252	.;MMSA_HUMAN	C	247;234	ENSP00000450436:F247C;ENSP00000342564:F234C	ENSP00000342564:F247C	F	-	2	0	ALDH6A1	73605428	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	6.262000	0.72514	0.487000	0.27698	0.528000	0.53228	TTT	ALDH6A1	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH,tigrfam_MeMal-semiAld_DH	ENSG00000119711		0.408	ALDH6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH6A1	HGNC	protein_coding	OTTHUMT00000412309.1	-	0.00	63	0	A			74535675	-1	tier1	-	no_errors	ENST00000553458	ensembl	human	known	74_37	missense	10.34	52	6	SNP	1.000	C
AMER1	139285	genome.wustl.edu	37	X	63410422	63410422	+	Nonsense_Mutation	SNP	G	G	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chrX:63410422G>T	ENST00000330258.3	-	2	3017	c.2745C>A	c.(2743-2745)taC>taA	p.Y915*	AMER1_ENST00000374869.3_Intron|AMER1_ENST00000403336.1_Intron	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	915					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)									CAGACTCGAGGTAGCCCTGGA	0.577																																																	67	Whole gene deletion(67)	kidney(65)|ovary(1)|large_intestine(1)											50.0	48.0	49.0					X																	63410422		2034	4172	6206	SO:0001587	stop_gained	0			AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.2745C>A	X.37:g.63410422G>T	ENSP00000329117:p.Tyr915*		A2IB86|Q8N885	Nonsense_Mutation	SNP	pfam_Uncharacterised_FAM123	p.Y915*	ENST00000330258.3	37	c.2745	CCDS14377.2	X	.	.	.	.	.	.	.	.	.	.	G	37	6.336459	0.97485	.	.	ENSG00000184675	ENST00000330258	.	.	.	4.79	-0.0521	0.13824	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-0.6408	5.0288	0.14398	0.365:0.0:0.4955:0.1395	.	.	.	.	X	915	.	.	Y	-	3	2	FAM123B	63327147	0.000000	0.05858	0.019000	0.16419	0.345000	0.29048	0.138000	0.16016	-0.231000	0.09825	0.529000	0.55759	TAC	AMER1	-	NULL	ENSG00000184675		0.577	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AMER1	HGNC	protein_coding	OTTHUMT00000316584.1		0.00	30	0	G	NM_152424		63410422	-1			no_errors	ENST00000330258	ensembl	human	known	74_37	nonsense	7.69	48	4	SNP	0.000	T
AMY2B	280	genome.wustl.edu	37	1	104120136	104120136	+	Missense_Mutation	SNP	C	C	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr1:104120136C>A	ENST00000361355.4	+	10	1742	c.1126C>A	c.(1126-1128)Cca>Aca	p.P376T	AMY2B_ENST00000491397.1_Intron	NM_020978.3	NP_066188.1	P19961	AMY2B_HUMAN	amylase, alpha 2B (pancreatic)	376					carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|kidney(4)|large_intestine(1)|lung(30)|prostate(1)|skin(1)|urinary_tract(1)	46		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		GGTTGGGCCACCAAATAATAA	0.378																																																	0													139.0	146.0	144.0					1																	104120136		2203	4300	6503	SO:0001583	missense	0			M24895	CCDS782.1	1p21	2010-08-02	2006-04-27		ENSG00000240038	ENSG00000240038	3.2.1.1		478	protein-coding gene	gene with protein product		104660	"""amylase, alpha 2B; pancreatic"""	AMY2		8268204	Standard	NM_020978		Approved		uc001duq.3	P19961	OTTHUMG00000011024	ENST00000361355.4:c.1126C>A	1.37:g.104120136C>A	ENSP00000354610:p.Pro376Thr		B3KTI1|B3KXB7|D3DT76|Q9UBH3	Missense_Mutation	SNP	pfam_Glyco_hydro_13_cat_dom,pfam_A-amylase_b_C,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom,smart_A-amylase_b_C,prints_Alpha_amylase	p.P376T	ENST00000361355.4	37	c.1126	CCDS782.1	1	.	.	.	.	.	.	.	.	.	.	C	17.26	3.344831	0.61073	.	.	ENSG00000240038	ENST00000361355	.	.	.	4.65	4.65	0.58169	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycosyl hydrolase, family 13, subfamily, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.85212	0.5645	H	0.96333	3.805	0.80722	D	1	D	0.89917	1.0	D	0.73708	0.981	D	0.88952	0.3387	9	0.46703	T	0.11	.	17.5096	0.87756	0.0:1.0:0.0:0.0	.	376	P19961	AMY2B_HUMAN	T	376	.	ENSP00000354610:P376T	P	+	1	0	AMY2B	103921659	1.000000	0.71417	0.995000	0.50966	0.434000	0.31775	7.605000	0.82844	2.122000	0.65172	0.453000	0.30009	CCA	AMY2B	-	superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom	ENSG00000240038		0.378	AMY2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMY2B	HGNC	protein_coding	OTTHUMT00000030318.1	-	0.00	295	0	C	NM_020978		104120136	+1	tier1	-	no_errors	ENST00000361355	ensembl	human	known	74_37	missense	6.49	317	22	SNP	1.000	A
ANKEF1	63926	genome.wustl.edu	37	20	10032330	10032330	+	Missense_Mutation	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr20:10032330G>A	ENST00000378380.3	+	7	1992	c.1663G>A	c.(1663-1665)Gat>Aat	p.D555N	SNAP25-AS1_ENST00000603542.1_RNA|ANKEF1_ENST00000378392.1_Missense_Mutation_p.D555N|ANKEF1_ENST00000488991.1_3'UTR|SNAP25-AS1_ENST00000421143.2_RNA	NM_198798.1	NP_942093.1	Q9NU02	ANKE1_HUMAN	ankyrin repeat and EF-hand domain containing 1	555							calcium ion binding (GO:0005509)										TAATGCAACAGATAACTTTCT	0.363																																																	0													89.0	83.0	85.0					20																	10032330		2203	4300	6503	SO:0001583	missense	0			AK025322	CCDS13108.1	20p12.2	2013-01-11	2013-01-11	2013-01-11	ENSG00000132623	ENSG00000132623		"""EF-hand domain containing"", ""Ankyrin repeat domain containing"""	15803	protein-coding gene	gene with protein product			"""ankyrin repeat domain 5"""	ANKRD5		17142250	Standard	NM_022096		Approved	FLJ21669, dJ839B4.6	uc002wnp.3	Q9NU02	OTTHUMG00000031860	ENST00000378380.3:c.1663G>A	20.37:g.10032330G>A	ENSP00000367631:p.Asp555Asn		B3KUQ0|Q9H6Y9	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EF_hand_dom,prints_Ankyrin_rpt	p.D555N	ENST00000378380.3	37	c.1663	CCDS13108.1	20	.	.	.	.	.	.	.	.	.	.	G	32	5.148763	0.94603	.	.	ENSG00000132623	ENST00000378392;ENST00000378380	T;T	0.73469	-0.75;-0.75	5.72	5.72	0.89469	Ankyrin repeat-containing domain (4);	0.085017	0.85682	D	0.000000	T	0.80783	0.4689	L	0.27975	0.815	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81540	-0.0886	10	0.59425	D	0.04	-10.4482	20.2504	0.98404	0.0:0.0:1.0:0.0	.	555	Q9NU02	ANKR5_HUMAN	N	555	ENSP00000367644:D555N;ENSP00000367631:D555N	ENSP00000367631:D555N	D	+	1	0	ANKRD5	9980330	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	8.711000	0.91396	2.850000	0.98022	0.650000	0.86243	GAT	ANKEF1	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000132623		0.363	ANKEF1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ANKEF1	HGNC	protein_coding	OTTHUMT00000077968.2	-	0.00	18	0	G	NM_022096		10032330	+1	tier1	-	no_errors	ENST00000378380	ensembl	human	known	74_37	missense	33.33	16	8	SNP	1.000	A
ANKRD46	157567	genome.wustl.edu	37	8	101534997	101534997	+	Missense_Mutation	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr8:101534997G>A	ENST00000520552.1	-	5	634	c.473C>T	c.(472-474)gCc>gTc	p.A158V	ANKRD46_ENST00000519597.1_Missense_Mutation_p.A158V|ANKRD46_ENST00000335659.3_Missense_Mutation_p.A158V|ANKRD46_ENST00000519316.1_Missense_Mutation_p.A105V|ANKRD46_ENST00000520311.1_Missense_Mutation_p.A158V	NM_001270379.1	NP_001257308.1	Q86W74	ANR46_HUMAN	ankyrin repeat domain 46	158						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(4)	7	all_cancers(14;5.07e-05)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000353)|all_lung(17;0.000998)		Epithelial(11;2.61e-11)|all cancers(13;5.03e-09)|OV - Ovarian serous cystadenocarcinoma(57;4.49e-06)|STAD - Stomach adenocarcinoma(118;0.0957)			GCTTTCCATGGCACTGTGGAA	0.458																																																	0													85.0	82.0	83.0					8																	101534997		2203	4300	6503	SO:0001583	missense	0			AB077205	CCDS6287.1, CCDS59109.1	8q22.3	2013-01-10						"""Ankyrin repeat domain containing"""	27229	protein-coding gene	gene with protein product							Standard	NM_001270377		Approved		uc003yjm.4	Q86W74		ENST00000520552.1:c.473C>T	8.37:g.101534997G>A	ENSP00000429015:p.Ala158Val		Q6P9B7	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A158V	ENST00000520552.1	37	c.473	CCDS59109.1	8	.	.	.	.	.	.	.	.	.	.	G	16.01	3.002718	0.54254	.	.	ENSG00000186106	ENST00000520552;ENST00000335659;ENST00000519597;ENST00000520311;ENST00000519316;ENST00000358990	T;T;T;T;T;T	0.46063	0.88;0.91;0.91;0.91;1.37;0.95	6.04	6.04	0.98038	.	0.051950	0.85682	D	0.000000	T	0.39963	0.1098	L	0.36672	1.1	0.58432	D	0.999999	B;B	0.22800	0.016;0.075	B;B	0.19666	0.022;0.026	T	0.11446	-1.0587	10	0.52906	T	0.07	-22.3829	20.5948	0.99439	0.0:0.0:1.0:0.0	.	158;158	Q86W74-2;Q86W74	.;ANR46_HUMAN	V	158;158;158;158;105;158	ENSP00000429015:A158V;ENSP00000335287:A158V;ENSP00000430056:A158V;ENSP00000428388:A158V;ENSP00000430827:A105V;ENSP00000351881:A158V	ENSP00000335287:A158V	A	-	2	0	ANKRD46	101604173	1.000000	0.71417	1.000000	0.80357	0.588000	0.36517	8.053000	0.89449	2.873000	0.98535	0.563000	0.77884	GCC	ANKRD46	-	NULL	ENSG00000186106		0.458	ANKRD46-004	KNOWN	basic|CCDS	protein_coding	ANKRD46	HGNC	protein_coding	OTTHUMT00000379899.1		0.00	22	0	G	NM_198401		101534997	-1			no_errors	ENST00000520552	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	A
APC	324	genome.wustl.edu	37	5	112175496	112175496	+	Missense_Mutation	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr5:112175496C>T	ENST00000457016.1	+	16	4585	c.4205C>T	c.(4204-4206)gCc>gTc	p.A1402V	APC_ENST00000508376.2_Missense_Mutation_p.A1402V|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Missense_Mutation_p.A1402V			P25054	APC_HUMAN	adenomatous polyposis coli	1402	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Y1376fs*41(1)|p.?(1)|p.K1192fs*3(1)|p.I1401fs*2(1)|p.A1402fs*6(1)|p.S1400fs*5(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		CGTTCGATTGCCAGCTCCGTT	0.478		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)		yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	6	Deletion - Frameshift(5)|Unknown(1)	large_intestine(4)|soft_tissue(1)|skin(1)											114.0	106.0	109.0					5																	112175496		2202	4300	6502	SO:0001583	missense	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4205C>T	5.37:g.112175496C>T	ENSP00000413133:p.Ala1402Val		D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	pfam_APC_basic_dom,pfam_EB1-bd,pfam_APC_Cys-rich_rpt,pfam_Armadillo,pfam_APC_dom,pfam_SAMP,pfam_APC_15aa_rpt,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.A1402V	ENST00000457016.1	37	c.4205	CCDS4107.1	5	.	.	.	.	.	.	.	.	.	.	C	26.6	4.756850	0.89843	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	D;D;D	0.90732	-2.72;-2.72;-2.72	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.93657	0.7974	L	0.45137	1.4	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.994	D	0.91778	0.5433	9	.	.	.	-11.4535	20.4898	0.99202	0.0:1.0:0.0:0.0	.	1404;1402	Q4LE70;P25054	.;APC_HUMAN	V	1402	ENSP00000413133:A1402V;ENSP00000257430:A1402V;ENSP00000427089:A1402V	.	A	+	2	0	APC	112203395	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	7.487000	0.81328	2.941000	0.99782	0.655000	0.94253	GCC	APC	-	NULL	ENSG00000134982		0.478	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	APC	HGNC	protein_coding	OTTHUMT00000250738.2		0.00	12	0	C	NM_000038		112175496	+1			no_errors	ENST00000257430	ensembl	human	known	74_37	missense	13.33	13	2	SNP	1.000	T
ARAP3	64411	genome.wustl.edu	37	5	141059875	141059875	+	Missense_Mutation	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr5:141059875C>T	ENST00000239440.4	-	2	244	c.179G>A	c.(178-180)cGc>cAc	p.R60H	ARAP3_ENST00000508305.1_5'UTR	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	60	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						CTGTAGCAGGCGTAGAATGCG	0.647																																																	0													84.0	88.0	86.0					5																	141059875		2203	4300	6503	SO:0001583	missense	0			AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.179G>A	5.37:g.141059875C>T	ENSP00000239440:p.Arg60His		B4DIT1|D3DQE3	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ras-assoc,pfam_SAM_2,pfam_SAM_type1,superfamily_Rho_GTPase_activation_prot,superfamily_SAM/pointed,smart_SAM,smart_Pleckstrin_homology,smart_ArfGAP,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SAM,pfscan_ArfGAP,pfscan_RhoGAP_dom,prints_ArfGAP	p.R60H	ENST00000239440.4	37	c.179	CCDS4266.1	5	.	.	.	.	.	.	.	.	.	.	C	17.15	3.315548	0.60524	.	.	ENSG00000120318	ENST00000239440;ENST00000504448	D;D	0.84873	-1.91;-1.91	4.35	4.35	0.52113	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 2 (1);	0.171905	0.38837	N	0.001541	D	0.85712	0.5760	L	0.33792	1.035	0.80722	D	1	D	0.76494	0.999	D	0.68943	0.961	D	0.85377	0.1117	10	0.56958	D	0.05	.	8.1588	0.31185	0.0:0.8916:0.0:0.1084	.	60	Q8WWN8	ARAP3_HUMAN	H	60	ENSP00000239440:R60H;ENSP00000421148:R60H	ENSP00000239440:R60H	R	-	2	0	ARAP3	141040059	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	1.781000	0.38644	2.268000	0.75426	0.456000	0.33151	CGC	ARAP3	-	pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	ENSG00000120318		0.647	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARAP3	HGNC	protein_coding	OTTHUMT00000251805.1	-	0.00	59	0	C	NM_022481		141059875	-1	tier1	-	no_errors	ENST00000239440	ensembl	human	known	74_37	missense	8.33	44	4	SNP	0.997	T
ATIC	471	genome.wustl.edu	37	2	216184451	216184451	+	Missense_Mutation	SNP	T	T	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr2:216184451T>C	ENST00000236959.9	+	4	613	c.287T>C	c.(286-288)aTa>aCa	p.I96T	ATIC_ENST00000540518.1_Missense_Mutation_p.I37T|ATIC_ENST00000435675.1_Missense_Mutation_p.I95T	NM_004044.6	NP_004035.2	P31939	PUR9_HUMAN	5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase	96					'de novo' IMP biosynthetic process (GO:0006189)|brainstem development (GO:0003360)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|dihydrofolate metabolic process (GO:0046452)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|organ regeneration (GO:0031100)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to inorganic substance (GO:0010035)|small molecule metabolic process (GO:0044281)|tetrahydrofolate biosynthetic process (GO:0046654)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	IMP cyclohydrolase activity (GO:0003937)|phosphoribosylaminoimidazolecarboxamide formyltransferase activity (GO:0004643)|protein homodimerization activity (GO:0042803)		ATIC/ALK(24)	large_intestine(2)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	8		Renal(323;0.229)		Epithelial(149;2.02e-06)|all cancers(144;0.000316)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.0097)	Methotrexate(DB00563)|Pemetrexed(DB00642)|Tetrahydrofolic acid(DB00116)	TTCAATCTTATAAGGTAAAAA	0.338			T	ALK	ALCL																																			Dom	yes		2	2q35	471	5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase		L	0													62.0	64.0	63.0					2																	216184451		2203	4300	6503	SO:0001583	missense	0				CCDS2398.1	2q35	2010-04-27			ENSG00000138363	ENSG00000138363	2.1.2.3, 3.5.4.10		794	protein-coding gene	gene with protein product	"""phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase"""	601731				8567683, 9378707	Standard	NM_004044		Approved	PURH, AICARFT, IMPCHASE	uc002vex.4	P31939	OTTHUMG00000133023	ENST00000236959.9:c.287T>C	2.37:g.216184451T>C	ENSP00000236959:p.Ile96Thr		A8K202|E9PBU3|Q13856|Q53S28	Missense_Mutation	SNP	pfam_AICARFT_IMPCHas,pfam_MGS-like_dom,superfamily_Cytidine_deaminase-like,superfamily_MGS-like_dom,smart_MGS-like_dom,smart_AICARFT_IMPCHas,pirsf_AICARFT_IMPCHas,tigrfam_AICARFT_IMPCHas	p.I96T	ENST00000236959.9	37	c.287	CCDS2398.1	2	.	.	.	.	.	.	.	.	.	.	T	19.11	3.763622	0.69878	.	.	ENSG00000138363	ENST00000236959;ENST00000540518;ENST00000435675;ENST00000413174	D;D;D;D	0.86627	-2.15;-2.15;-2.15;-2.15	5.31	5.31	0.75309	Methylglyoxal synthase-like domain (4);	0.152912	0.64402	D	0.000018	D	0.96071	0.8720	H	0.97214	3.96	0.58432	D	0.999999	P;P	0.46277	0.791;0.875	P;D	0.78314	0.737;0.991	D	0.97392	0.9990	10	0.87932	D	0	-23.3762	15.2348	0.73419	0.0:0.0:0.0:1.0	.	95;96	E9PBU3;P31939	.;PUR9_HUMAN	T	96;37;95;37	ENSP00000236959:I96T;ENSP00000440523:I37T;ENSP00000415935:I95T;ENSP00000402393:I37T	ENSP00000236959:I96T	I	+	2	0	ATIC	215892696	1.000000	0.71417	1.000000	0.80357	0.499000	0.33736	7.093000	0.76937	2.147000	0.66899	0.533000	0.62120	ATA	ATIC	-	pfam_MGS-like_dom,superfamily_MGS-like_dom,smart_MGS-like_dom,pirsf_AICARFT_IMPCHas,tigrfam_AICARFT_IMPCHas	ENSG00000138363		0.338	ATIC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATIC	HGNC	protein_coding	OTTHUMT00000256610.1	-	0.00	42	0	T	NM_004044		216184451	+1	tier1	-	no_errors	ENST00000236959	ensembl	human	known	74_37	missense	20.00	16	4	SNP	1.000	C
ATP2B2	491	genome.wustl.edu	37	3	10491048	10491048	+	Silent	SNP	G	G	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr3:10491048G>T	ENST00000352432.4	-	1	249	c.180C>A	c.(178-180)ctC>ctA	p.L60L	ATP2B2_ENST00000360273.2_Silent_p.L60L|ATP2B2_ENST00000383800.4_Silent_p.L60L|ATP2B2_ENST00000343816.4_Silent_p.L60L|ATP2B2_ENST00000397077.1_Silent_p.L60L			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	60					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						GTGAGGTTTTGAGGCGCCGGC	0.552																																					Ovarian(125;1619 1709 15675 19819 38835)												0													70.0	66.0	67.0					3																	10491048		2203	4300	6503	SO:0001819	synonymous_variant	0			X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.180C>A	3.37:g.10491048G>T			O00766|Q12994|Q16818	Silent	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_plasma,tigrfam_Cation_transp_P_typ_ATPase	p.L60	ENST00000352432.4	37	c.180	CCDS33701.1	3																																																																																			ATP2B2	-	pfam_ATPase_P-typ_cation-transptr_N,smart_ATPase_P-typ_cation-transptr_N	ENSG00000157087		0.552	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	ATP2B2	HGNC	protein_coding	OTTHUMT00000250576.2	-	0.00	41	0	G	NM_001683		10491048	-1	tier1	-	no_errors	ENST00000352432	ensembl	human	known	74_37	silent	7.14	52	4	SNP	1.000	T
AUTS2	26053	genome.wustl.edu	37	7	69755386	69755386	+	Intron	SNP	A	A	G			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr7:69755386A>G	ENST00000342771.4	+	5	981				AUTS2_ENST00000406775.2_Intron|AUTS2_ENST00000403018.2_Silent_p.A231A	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2											breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		GAGAGGAAGCATGTCTTAAAT	0.383																																																	0													198.0	159.0	171.0					7																	69755386		692	1591	2283	SO:0001627	intron_variant	0			AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.661-145352A>G	7.37:g.69755386A>G			A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Silent	SNP	NULL	p.A231	ENST00000342771.4	37	c.693	CCDS5539.1	7																																																																																			AUTS2	-	NULL	ENSG00000158321		0.383	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AUTS2	HGNC	protein_coding	OTTHUMT00000251971.2	-	0.00	66	0	A			69755386	+1	tier1	-	no_errors	ENST00000403018	ensembl	human	known	74_37	silent	15.49	60	11	SNP	0.000	G
BCAS3	54828	genome.wustl.edu	37	17	59115362	59115362	+	Silent	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr17:59115362C>T	ENST00000390652.5	+	19	1951	c.1920C>T	c.(1918-1920)gaC>gaT	p.D640D	BCAS3_ENST00000588462.1_Silent_p.D640D|BCAS3_ENST00000585744.1_Silent_p.D411D|BCAS3_ENST00000589222.1_Silent_p.D625D|BCAS3_ENST00000407086.3_Silent_p.D625D|RP11-264B14.1_ENST00000588604.1_RNA|BCAS3_ENST00000408905.3_Silent_p.D625D|BCAS3_ENST00000588874.1_Silent_p.D396D	NM_001099432.1	NP_001092902.1			breast carcinoma amplified sequence 3											NS(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(24)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			AGATTAGTGACGACACACCAC	0.458																																																	0													139.0	145.0	143.0					17																	59115362		2132	4237	6369	SO:0001819	synonymous_variant	0			AF361219	CCDS11626.1, CCDS45749.1	17q23.2	2013-06-25			ENSG00000141376	ENSG00000141376		"""WD repeat domain containing"""	14347	protein-coding gene	gene with protein product		607470				12378525	Standard	NM_017679		Approved	FLJ20128	uc002iyv.4	Q9H6U6	OTTHUMG00000180064	ENST00000390652.5:c.1920C>T	17.37:g.59115362C>T				Silent	SNP	pfam_BCAS3,pfam_WD40_repeat	p.D640	ENST00000390652.5	37	c.1920	CCDS45749.1	17																																																																																			BCAS3	-	pfam_BCAS3	ENSG00000141376		0.458	BCAS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCAS3	HGNC	protein_coding	OTTHUMT00000449578.1	-	0.00	55	0	C	NM_017679		59115362	+1	tier1	-	no_errors	ENST00000390652	ensembl	human	known	74_37	silent	15.00	50	9	SNP	1.000	T
BMP15	9210	genome.wustl.edu	37	X	50659038	50659038	+	Nonsense_Mutation	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chrX:50659038C>T	ENST00000252677.3	+	2	610	c.610C>T	c.(610-612)Cga>Tga	p.R204*		NM_005448.2	NP_005439.2	O95972	BMP15_HUMAN	bone morphogenetic protein 15	204					female gamete generation (GO:0007292)|granulosa cell development (GO:0060016)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)		p.R204*(2)		NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|skin(1)	26	Ovarian(276;0.236)					CAGGATCCTACGACTCCGTTT	0.438																																																	2	Substitution - Nonsense(2)	large_intestine(1)|lung(1)											143.0	114.0	124.0					X																	50659038		2203	4299	6502	SO:0001587	stop_gained	0			AF082349	CCDS14334.1	Xp11.2	2013-02-06			ENSG00000130385	ENSG00000130385		"""Bone morphogenetic proteins"""	1068	protein-coding gene	gene with protein product		300247				9849956	Standard	NM_005448		Approved	GDF9B	uc011mnw.2	O95972	OTTHUMG00000021525	ENST00000252677.3:c.610C>T	X.37:g.50659038C>T	ENSP00000252677:p.Arg204*		Q17RM6|Q5JST1|Q9UMS1	Nonsense_Mutation	SNP	pfam_TGF-b_C,smart_TGF-b_C,prints_Inhibin_asu	p.R204*	ENST00000252677.3	37	c.610	CCDS14334.1	X	.	.	.	.	.	.	.	.	.	.	c	10.74	1.435110	0.25813	.	.	ENSG00000130385	ENST00000252677	.	.	.	5.52	3.72	0.42706	.	0.992853	0.08201	N	0.982285	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	.	3.8331	0.08882	0.2037:0.6096:0.0:0.1867	.	.	.	.	X	204	.	ENSP00000252677:R204X	R	+	1	2	BMP15	50675778	0.000000	0.05858	0.029000	0.17559	0.009000	0.06853	0.433000	0.21477	1.082000	0.41137	0.556000	0.70494	CGA	BMP15	-	NULL	ENSG00000130385		0.438	BMP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP15	HGNC	protein_coding	OTTHUMT00000056572.1	-	0.00	22	0	C	NM_005448		50659038	+1	tier1	-	no_errors	ENST00000252677	ensembl	human	known	74_37	nonsense	32.14	19	9	SNP	0.009	T
BPIFC	254240	genome.wustl.edu	37	22	32833811	32833811	+	Missense_Mutation	SNP	A	A	G			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr22:32833811A>G	ENST00000397452.1	-	8	793	c.683T>C	c.(682-684)cTg>cCg	p.L228P	BPIFC_ENST00000300399.3_Missense_Mutation_p.L228P|BPIFC_ENST00000534972.1_5'UTR|BPIFC_ENST00000432451.2_Missense_Mutation_p.L42P			Q8NFQ6	BPIFC_HUMAN	BPI fold containing family C	228						extracellular region (GO:0005576)	lipopolysaccharide binding (GO:0001530)|phospholipid binding (GO:0005543)	p.L228Q(1)									GTAATCCAGCAGAGTGTAGTT	0.343																																																	1	Substitution - Missense(1)	lung(1)											92.0	85.0	87.0					22																	32833811		2203	4300	6503	SO:0001583	missense	0			AF465766	CCDS13906.1	22q12.3	2011-08-04	2011-08-01	2011-08-01	ENSG00000184459	ENSG00000184459		"""BPI fold containing"""	16503	protein-coding gene	gene with protein product		614109	"""bactericidal/permeability-increasing protein-like 2"""	BPIL2			Standard	NM_174932		Approved	dJ149A16.7	uc003amn.2	Q8NFQ6	OTTHUMG00000058273	ENST00000397452.1:c.683T>C	22.37:g.32833811A>G	ENSP00000380594:p.Leu228Pro		A2RRF1	Missense_Mutation	SNP	pfam_Lipid-bd_serum_glycop_N,pfam_Lipid-bd_serum_glycop_C,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N,smart_Lipid-bd_serum_glycop_C	p.L228P	ENST00000397452.1	37	c.683	CCDS13906.1	22	.	.	.	.	.	.	.	.	.	.	A	17.94	3.512381	0.64522	.	.	ENSG00000184459	ENST00000397452;ENST00000300399;ENST00000432451	T;T;T	0.04809	3.55;3.55;3.55	5.68	5.68	0.88126	.	0.630111	0.16166	N	0.226515	T	0.10337	0.0253	M	0.68317	2.08	0.80722	D	1	P;P	0.49447	0.859;0.924	P;B	0.46629	0.522;0.34	T	0.13019	-1.0525	10	0.30078	T	0.28	-0.537	12.5975	0.56478	1.0:0.0:0.0:0.0	.	42;228	A2RRF1;Q8NFQ6	.;BPIFC_HUMAN	P	228;228;42	ENSP00000380594:L228P;ENSP00000300399:L228P;ENSP00000408920:L42P	ENSP00000300399:L228P	L	-	2	0	BPIFC	31163811	0.650000	0.27331	0.925000	0.36789	0.866000	0.49608	3.160000	0.50739	2.289000	0.77006	0.533000	0.62120	CTG	BPIFC	-	superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N	ENSG00000184459		0.343	BPIFC-010	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	BPIFC	HGNC	protein_coding	OTTHUMT00000129029.2		0.00	29	0	A	NM_174932		32833811	-1			no_errors	ENST00000300399	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.966	G
MALRD1	340895	genome.wustl.edu	37	10	19678160	19678160	+	Missense_Mutation	SNP	T	T	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr10:19678160T>C	ENST00000454679.2	+	13	2624	c.2624T>C	c.(2623-2625)cTg>cCg	p.L875P				Q5VYJ5	MALR1_HUMAN		875	MAM 5. {ECO:0000255|PROSITE- ProRule:PRU00128}.				cholesterol homeostasis (GO:0042632)|negative regulation of bile acid biosynthetic process (GO:0070858)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				breast(1)|lung(2)	3						TCAGTTAATCTGCATACTGTG	0.363																																																	0																																										SO:0001583	missense	0																														ENST00000454679.2:c.2624T>C	10.37:g.19678160T>C	ENSP00000412763:p.Leu875Pro		B7ZBP2	Missense_Mutation	SNP	pfam_MAM_dom,pfam_LDrepeatLR_classA_rpt,superfamily_ConA-like_lec_gl_sf,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_MAM_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_MAM_dom,prints_LDrepeatLR_classA_rpt,prints_MAM_dom	p.L875P	ENST00000454679.2	37	c.2624		10	.	.	.	.	.	.	.	.	.	.	T	13.18	2.161449	0.38119	.	.	ENSG00000204740	ENST00000377266;ENST00000454679	D;D	0.90324	-2.65;-2.29	5.0	5.0	0.66597	.	.	.	.	.	D	0.91676	0.7369	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.90511	0.4481	5	.	.	.	.	11.2865	0.49224	0.0:0.0:0.0:1.0	.	.	.	.	P	888;875	ENSP00000366477:L888P;ENSP00000412763:L875P	.	L	+	2	0	C10orf112	19718166	0.977000	0.34250	0.925000	0.36789	0.063000	0.16089	2.143000	0.42187	2.238000	0.73509	0.533000	0.62120	CTG	C10orf112	-	NULL	ENSG00000204740		0.363	C10orf112-201	KNOWN	basic|appris_principal	protein_coding	C10orf112	HGNC	protein_coding		-	0.00	23	0	T			19678160	+1	tier1	-	no_errors	ENST00000454679	ensembl	human	known	74_37	missense	15.79	32	6	SNP	0.777	C
C14orf132	56967	genome.wustl.edu	37	14	96552938	96552938	+	5'UTR	SNP	G	G	A	rs575916965		TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr14:96552938G>A	ENST00000555004.1	+	0	295				C14orf132_ENST00000556728.1_3'UTR	NM_001252507.1	NP_001239436.1	Q9NPU4	CN132_HUMAN	chromosome 14 open reading frame 132							integral component of membrane (GO:0016021)											CAATGTCCACGCGGCTGCCAA	0.582													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18519	0.0		0.0	False		,,,				2504	0.0																0																																										SO:0001623	5_prime_UTR_variant	0			AL390130		14q32.2	2012-04-19			ENSG00000227051	ENSG00000227051			20346	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 88"""	C14orf88			Standard	NM_001252507		Approved		uc001yff.4	Q9NPU4	OTTHUMG00000171393	ENST00000555004.1:c.-3944G>A	14.37:g.96552938G>A			B2R7K5	RNA	SNP	-	NULL	ENST00000555004.1	37	NULL		14																																																																																			C14orf132	-	-	ENSG00000227051		0.582	C14orf132-001	KNOWN	basic|appris_principal	protein_coding	C14orf132	HGNC	protein_coding	OTTHUMT00000413259.1	-	0.00	21	0	G	NM_001252507		96552938	+1	tier1	-	no_errors	ENST00000553764	ensembl	human	putative	74_37	rna	47.62	11	10	SNP	1.000	A
C16orf45	89927	genome.wustl.edu	37	16	15680718	15680718	+	3'UTR	DEL	C	C	-	rs35954715	byFrequency	TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr16:15680718delC	ENST00000300006.4	+	0	1006				C16orf45_ENST00000565913.1_3'UTR|C16orf45_ENST00000566490.1_3'UTR|C16orf45_ENST00000452191.2_3'UTR	NM_033201.2	NP_149978.1	Q96MC5	CP045_HUMAN	chromosome 16 open reading frame 45											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)	11						GCCATGGGGACCCCCCCCCAC	0.632													?|CCCCCCCCC|CCCCCCCC|unsure	635	0.126797	0.3956	0.0389	5008	,	,		15182	0.0198		0.0199	False		,,,				2504	0.046																0													9.0	10.0	10.0					16																	15680718		2149	4258	6407	SO:0001624	3_prime_UTR_variant	0			AK057180	CCDS10561.1, CCDS45422.1	16p13.2	2012-10-09			ENSG00000166780	ENSG00000166780			19213	protein-coding gene	gene with protein product							Standard	NM_033201		Approved	FLJ32618	uc002ddo.3	Q96MC5	OTTHUMG00000129883	ENST00000300006.4:c.*32C>-	16.37:g.15680718delC			O00223|O75769|Q8IZ36|Q96H25	RNA	DEL	-	NULL	ENST00000300006.4	37	NULL	CCDS10561.1	16																																																																																			C16orf45	-	-	ENSG00000166780		0.632	C16orf45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf45	HGNC	protein_coding	OTTHUMT00000252130.2		0.00	75	0	C	NM_033201		15680718	+1	tier1		no_errors	ENST00000565913	ensembl	human	known	74_37	rna	12.86	61	9	DEL	0.023	-
C2CD2L	9854	genome.wustl.edu	37	11	118984980	118984980	+	Missense_Mutation	SNP	G	G	A	rs376731505		TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr11:118984980G>A	ENST00000528586.1	+	9	1128	c.1058G>A	c.(1057-1059)cGt>cAt	p.R353H	C2CD2L_ENST00000336702.3_Missense_Mutation_p.R606H			O14523	C2C2L_HUMAN	C2CD2-like	605						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|large_intestine(2)|lung(8)|prostate(1)	13						GAGACAACCCGTTCGGATATT	0.577													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18979	0.0		0.0	False		,,,				2504	0.0																0								G	HIS/ARG	1,4399	4.2+/-10.8	0,1,2199	134.0	135.0	135.0		1817	4.5	1.0	11		135	0,8590		0,0,4295	no	missense	C2CD2L	NM_014807.3	29	0,1,6494	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	606/708	118984980	1,12989	2200	4295	6495	SO:0001583	missense	0			AK025223	CCDS8413.1	11q23.3	2008-04-22	2008-04-22	2008-04-22		ENSG00000172375			29000	protein-coding gene	gene with protein product			"""transmembrane protein 24"""	TMEM24		15289880	Standard	XM_005271738		Approved	KIAA0285	uc001pvn.3	O14523		ENST00000528586.1:c.1058G>A	11.37:g.118984980G>A	ENSP00000433600:p.Arg353His		Q86UT7|Q86V04|Q8N522|Q8TBN4|Q96G10	Missense_Mutation	SNP	superfamily_C2_dom	p.R606H	ENST00000528586.1	37	c.1817		11	.	.	.	.	.	.	.	.	.	.	G	20.2	3.948743	0.73787	2.27E-4	0.0	ENSG00000172375	ENST00000336702;ENST00000528586	T;T	0.51817	0.69;0.69	5.41	4.5	0.54988	.	0.126194	0.56097	D	0.000032	T	0.48390	0.1497	N	0.22421	0.69	0.35245	D	0.778163	D;D	0.89917	1.0;1.0	D;D	0.62955	0.909;0.909	T	0.58685	-0.7593	10	0.41790	T	0.15	-11.8552	9.6045	0.39626	0.1568:0.0:0.8432:0.0	.	605;606	O14523;O14523-2	C2C2L_HUMAN;.	H	606;353	ENSP00000338885:R606H;ENSP00000433600:R353H	ENSP00000338885:R606H	R	+	2	0	C2CD2L	118490190	1.000000	0.71417	0.993000	0.49108	0.988000	0.76386	5.402000	0.66332	1.509000	0.48786	0.655000	0.94253	CGT	C2CD2L	-	NULL	ENSG00000172375		0.577	C2CD2L-003	PUTATIVE	basic|exp_conf	protein_coding	C2CD2L	HGNC	protein_coding	OTTHUMT00000388199.2	-	0.00	47	0	G	NM_014807		118984980	+1	tier1	-	no_errors	ENST00000336702	ensembl	human	known	74_37	missense	23.33	23	7	SNP	0.992	A
ZGRF1	55345	genome.wustl.edu	37	4	113508884	113508884	+	Nonsense_Mutation	SNP	G	G	T	rs201097479		TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr4:113508884G>T	ENST00000505019.1	-	12	3454	c.3329C>A	c.(3328-3330)tCg>tAg	p.S1110*		NM_018392.4	NP_060862.3	Q86YA3	ZGRF1_HUMAN		1110						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(6)|lung(21)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		AATGCTAAACGAAAGAACTGC	0.408																																																	0													36.0	32.0	33.0					4																	113508884		692	1591	2283	SO:0001587	stop_gained	0																														ENST00000505019.1:c.3329C>A	4.37:g.113508884G>T	ENSP00000424737:p.Ser1110*		B3KQX2|B4DSN6|B4DYU8|E9PDE1|G5EA02|Q6ZU11|Q9NSW3|Q9NUJ4	Nonsense_Mutation	SNP	pfam_DUF2439,pfam_Znf_GRF,superfamily_P-loop_NTPase	p.S1110*	ENST00000505019.1	37	c.3329		4	.	.	.	.	.	.	.	.	.	.	G	22.9	4.347100	0.82022	.	.	ENSG00000138658	ENST00000505019	.	.	.	5.95	5.07	0.68467	.	.	.	.	.	.	.	.	.	.	.	0.35947	D	0.833664	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.6099	0.51053	0.0861:0.0:0.9139:0.0	.	.	.	.	X	1110	.	ENSP00000404365:S8X	S	-	2	0	C4orf21	113728333	0.132000	0.22450	0.002000	0.10522	0.016000	0.09150	3.241000	0.51376	1.438000	0.47492	-0.345000	0.07892	TCG	C4orf21	-	NULL	ENSG00000138658		0.408	C4orf21-003	KNOWN	basic|appris_principal	protein_coding	C4orf21	HGNC	protein_coding	OTTHUMT00000256413.1	-	0.00	40	0	G			113508884	-1	tier1	-	no_errors	ENST00000505019	ensembl	human	known	74_37	nonsense	8.51	43	4	SNP	0.008	T
C9orf3	84909	genome.wustl.edu	37	9	97849070	97849070	+	3'UTR	SNP	C	C	T	rs572134268		TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr9:97849070C>T	ENST00000375315.2	+	0	2571				MIR27B_ENST00000385129.1_RNA|MIR23B_ENST00000384832.1_RNA|C9orf3_ENST00000297979.5_3'UTR|MIR3074_ENST00000384885.2_RNA	NM_001193329.1	NP_001180258.1	Q8N6M6	AMPO_HUMAN	chromosome 9 open reading frame 3						leukotriene biosynthetic process (GO:0019370)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(323;0.000275)		CTAAAGCCATCGGCCCACAGC	0.557													C|||	1	0.000199681	0.0	0.0	5008	,	,		18952	0.001		0.0	False		,,,				2504	0.0																0																																										SO:0001624	3_prime_UTR_variant	0			AF043896	CCDS6713.1, CCDS55327.1, CCDS55328.1	9q22	2013-06-27			ENSG00000148120	ENSG00000148120			1361	protein-coding gene	gene with protein product	aminopeptidase O					15687497	Standard	NM_001193329		Approved	C90RF3, FLJ14675, APO, AOPEP, AP-O	uc004ava.3	Q8N6M6	OTTHUMG00000020276	ENST00000375315.2:c.*111C>T	9.37:g.97849070C>T			Q5T9B1|Q5T9B3|Q5T9B4|Q8WUL6|Q96M23|Q96SS1	RNA	SNP	-	NULL	ENST00000375315.2	37	NULL	CCDS55328.1	9																																																																																			C9orf3	-	-	ENSG00000148120		0.557	C9orf3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf3	HGNC	protein_coding		-	0.00	44	0	C	NM_032823		97849070	+1	tier1	-	no_errors	ENST00000463372	ensembl	human	known	74_37	rna	14.63	35	6	SNP	0.869	T
CALCRL	10203	genome.wustl.edu	37	2	188211037	188211037	+	Silent	SNP	A	A	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr2:188211037A>C	ENST00000409998.1	-	16	2041	c.1260T>G	c.(1258-1260)tcT>tcG	p.S420S	CALCRL_ENST00000410068.1_Silent_p.S420S|AC007319.1_ENST00000412276.1_RNA|AC007319.1_ENST00000453517.1_RNA|CALCRL_ENST00000392370.3_Silent_p.S420S			Q16602	CALRL_HUMAN	calcitonin receptor-like	420					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|angiogenesis (GO:0001525)|calcium ion transport (GO:0006816)|cAMP biosynthetic process (GO:0006171)|cellular response to sucrose stimulus (GO:0071329)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|heart development (GO:0007507)|negative regulation of inflammatory response (GO:0050728)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|regulation of muscle contraction (GO:0006937)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	adrenomedullin receptor activity (GO:0001605)|calcitonin gene-related polypeptide receptor activity (GO:0001635)|calcitonin receptor activity (GO:0004948)|G-protein coupled receptor activity (GO:0004930)|protein transporter activity (GO:0008565)			endometrium(1)|large_intestine(7)|lung(21)|ovary(1)|prostate(1)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(96;0.227)			ACACTGTGTAAGACGCACTAC	0.373																																																	0													130.0	121.0	124.0					2																	188211037		2203	4299	6502	SO:0001819	synonymous_variant	0			U17473	CCDS2293.1	2q21.1-q21.3	2012-08-10			ENSG00000064989	ENSG00000064989		"""GPCR / Class B : Calcitonin receptors"""	16709	protein-coding gene	gene with protein product		114190				7818539, 8626685	Standard	NM_005795		Approved	CGRPR, CRLR	uc010frt.4	Q16602	OTTHUMG00000132636	ENST00000409998.1:c.1260T>G	2.37:g.188211037A>C			A8K6G5|A8KAD3|Q53S02|Q53TS5	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GCPR_2_calcitonin_rcpt_fam,prints_GPCR_2_CGRP1_rcpt,prints_GPCR_2_secretin-like,prints_GPCR_2_calcitonin_rcpt	p.S420	ENST00000409998.1	37	c.1260	CCDS2293.1	2																																																																																			CALCRL	-	prints_GPCR_2_CGRP1_rcpt	ENSG00000064989		0.373	CALCRL-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CALCRL	HGNC	protein_coding	OTTHUMT00000334648.1	-	0.00	39	0	A	NM_005795		188211037	-1	tier1	-	no_errors	ENST00000392370	ensembl	human	known	74_37	silent	22.95	47	14	SNP	0.957	C
CASS4	57091	genome.wustl.edu	37	20	55027029	55027029	+	Missense_Mutation	SNP	A	A	G			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr20:55027029A>G	ENST00000360314.3	+	6	1022	c.797A>G	c.(796-798)gAa>gGa	p.E266G	CASS4_ENST00000371336.3_Missense_Mutation_p.E266G|CASS4_ENST00000434344.1_Intron	NM_001164116.1	NP_001157588.1	Q9NQ75	CASS4_HUMAN	Cas scaffolding protein family member 4	266					cell adhesion (GO:0007155)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)			breast(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(4)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	54						TTTGCGGAAGAATCAAGGCCC	0.512																																																	0													66.0	68.0	68.0					20																	55027029		2203	4300	6503	SO:0001583	missense	0			AJ276678	CCDS33492.1, CCDS54475.1	20q13.31	2011-04-13	2008-04-14	2008-04-15	ENSG00000087589	ENSG00000087589		"""Cas scaffolding proteins"""	15878	protein-coding gene	gene with protein product	"""HEF-like protein"", ""HEF1-Efs-p130Cas-like"""		"""chromosome 20 open reading frame 32"""	C20orf32			Standard	NM_020356		Approved	HEFL, HEPL	uc002xxr.2	Q9NQ75	OTTHUMG00000032788	ENST00000360314.3:c.797A>G	20.37:g.55027029A>G	ENSP00000353462:p.Glu266Gly		E1P5Z8|Q5QPD6|Q96K09|Q9BYL5	Missense_Mutation	SNP	pfam_Serine_rich,pfam_CAS_DUF3513,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.E266G	ENST00000360314.3	37	c.797	CCDS33492.1	20	.	.	.	.	.	.	.	.	.	.	A	11.26	1.586205	0.28268	.	.	ENSG00000087589	ENST00000360314;ENST00000371336	T;T	0.13901	2.55;2.55	5.23	1.64	0.23874	.	2.857690	0.00706	N	0.000800	T	0.14527	0.0351	L	0.60455	1.87	0.09310	N	1	P;B;B	0.35077	0.483;0.004;0.003	B;B;B	0.30943	0.122;0.007;0.003	T	0.22977	-1.0201	10	0.23891	T	0.37	-1.0649	4.9962	0.14240	0.6262:0.1451:0.2286:0.0	.	212;266;266	B4DII4;Q9NQ75-2;Q9NQ75	.;.;CASS4_HUMAN	G	266	ENSP00000353462:E266G;ENSP00000360387:E266G	ENSP00000353462:E266G	E	+	2	0	CASS4	54460436	0.470000	0.25854	0.001000	0.08648	0.039000	0.13416	2.316000	0.43761	0.061000	0.16311	0.460000	0.39030	GAA	CASS4	-	NULL	ENSG00000087589		0.512	CASS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASS4	HGNC	protein_coding	OTTHUMT00000079789.2	-	0.00	42	0	A	NM_020356		55027029	+1	tier1	-	no_errors	ENST00000360314	ensembl	human	known	74_37	missense	35.00	26	14	SNP	0.000	G
CCDC114	93233	genome.wustl.edu	37	19	48800586	48800586	+	Missense_Mutation	SNP	G	G	A	rs369825835		TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr19:48800586G>A	ENST00000315396.7	-	14	2342	c.1660C>T	c.(1660-1662)Cgt>Tgt	p.R554C		NM_144577.3	NP_653178.3	Q96M63	CC114_HUMAN	coiled-coil domain containing 114	554					outer dynein arm assembly (GO:0036158)	cilium (GO:0005929)|outer dynein arm (GO:0036157)				cervix(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|stomach(1)	24		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000162)|Epithelial(262;0.0134)|GBM - Glioblastoma multiforme(486;0.0143)		AGAGAGCCACGGTCTCTGCTA	0.647													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16499	0.0		0.0	False		,,,				2504	0.0																0								G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	49.0	52.0	51.0		1660	3.1	0.0	19		51	1,8599	1.2+/-3.3	0,1,4299	no	missense	CCDC114	NM_144577.3	180	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	probably-damaging	554/671	48800586	2,13004	2203	4300	6503	SO:0001583	missense	0			BC025752	CCDS12714.2	19q13.32	2013-02-22			ENSG00000105479	ENSG00000105479			26560	protein-coding gene	gene with protein product		615038				23261302, 23261303	Standard	NM_144577		Approved	FLJ32926, CILD20	uc002pir.2	Q96M63	OTTHUMG00000156161	ENST00000315396.7:c.1660C>T	19.37:g.48800586G>A	ENSP00000318429:p.Arg554Cys		Q6ZRL4|Q96M06|Q9UFG8	Missense_Mutation	SNP	NULL	p.R554C	ENST00000315396.7	37	c.1660	CCDS12714.2	19	.	.	.	.	.	.	.	.	.	.	G	15.46	2.840794	0.51057	2.27E-4	1.16E-4	ENSG00000105479	ENST00000315396	T	0.32272	1.46	3.14	3.14	0.36123	.	.	.	.	.	T	0.34600	0.0903	N	0.14661	0.345	0.09310	N	0.999999	D	0.89917	1.0	D	0.68765	0.96	T	0.11179	-1.0598	9	0.62326	D	0.03	1.0E-4	10.0156	0.42011	0.0:0.0:1.0:0.0	.	554	Q96M63	CC114_HUMAN	C	554	ENSP00000318429:R554C	ENSP00000318429:R554C	R	-	1	0	CCDC114	53492398	0.335000	0.24748	0.018000	0.16275	0.040000	0.13550	3.982000	0.56909	2.038000	0.60285	0.561000	0.74099	CGT	CCDC114	-	NULL	ENSG00000105479		0.647	CCDC114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC114	HGNC	protein_coding	OTTHUMT00000343207.1		0.00	51	0	G	NM_144577		48800586	-1			no_errors	ENST00000315396	ensembl	human	known	74_37	missense	8.16	44	4	SNP	0.158	A
CCDC30	728621	genome.wustl.edu	37	1	42948563	42948563	+	Intron	DEL	A	A	-	rs202122677	byFrequency	TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr1:42948563delA	ENST00000428554.2	+	4	746				CCDC30_ENST00000475614.2_3'UTR			Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30							extracellular vesicular exosome (GO:0070062)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	30						GGAACATGAGAAAAAAAAAAA	0.363													|||unknown(HR)	839	0.167532	0.1573	0.1556	5008	,	,		20659	0.1746		0.1998	False		,,,				2504	0.1493																0																																										SO:0001627	intron_variant	0			AY639646	CCDS30690.1	1p34.2	2009-07-09			ENSG00000186409	ENSG00000186409			26103	protein-coding gene	gene with protein product	"""prefoldin 6-like"""					16710767	Standard	NM_001080850		Approved	FLJ20972, PFD6L, LOC728621	uc009vwk.1	Q5VVM6	OTTHUMG00000007334	ENST00000428554.2:c.-398+76A>-	1.37:g.42948563delA			Q14F06|Q5VVM5	RNA	DEL	-	NULL	ENST00000428554.2	37	NULL	CCDS30690.1	1																																																																																			CCDC30	-	-	ENSG00000186409		0.363	CCDC30-203	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC30	HGNC	protein_coding			0.00	23	0	A	NM_025030		42948563	+1	tier1		no_errors	ENST00000475614	ensembl	human	known	74_37	rna	25.00	9	3	DEL	0.003	-
CCDC53	51019	genome.wustl.edu	37	12	102406899	102406899	+	Missense_Mutation	SNP	G	G	T	rs1801519		TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr12:102406899G>T	ENST00000240079.6	-	7	733	c.572C>A	c.(571-573)tCt>tAt	p.S191Y	CCDC53_ENST00000545679.1_Missense_Mutation_p.S190Y	NM_016053.2	NP_057137.1	Q9Y3C0	CCD53_HUMAN	coiled-coil domain containing 53	191						actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|WASH complex (GO:0071203)				endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	4						ATCACTAAAAGAAGATTCGCT	0.348																																																	0													65.0	58.0	60.0					12																	102406899		1837	4058	5895	SO:0001583	missense	0			AF151874	CCDS44959.1, CCDS73512.1	12q23.3	2014-05-09			ENSG00000120860	ENSG00000120860			24256	protein-coding gene	gene with protein product						10810093, 20498093	Standard	XM_005268939		Approved	CGI-116	uc010svw.2	Q9Y3C0	OTTHUMG00000168187	ENST00000240079.6:c.572C>A	12.37:g.102406899G>T	ENSP00000240079:p.Ser191Tyr		B2RC74|Q53FF0|Q6IAI4|Q96QK0	Missense_Mutation	SNP	pfam_WASH_CCDC53	p.S191Y	ENST00000240079.6	37	c.572	CCDS44959.1	12	.	.	.	.	.	.	.	.	.	.	G	15.82	2.945362	0.53079	.	.	ENSG00000120860	ENST00000240079;ENST00000545679;ENST00000542923	.	.	.	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.80297	0.4597	M	0.79805	2.47	0.58432	D	0.999999	D;D	0.69078	0.997;0.995	D;D	0.80764	0.994;0.986	T	0.81400	-0.0950	9	0.66056	D	0.02	-18.8273	16.1398	0.81515	0.0:0.0:1.0:0.0	.	190;191	F5GZ97;Q9Y3C0	.;CCD53_HUMAN	Y	191;190;104	.	ENSP00000240079:S191Y	S	-	2	0	CCDC53	100931030	1.000000	0.71417	1.000000	0.80357	0.788000	0.44548	4.991000	0.63883	2.880000	0.98712	0.650000	0.86243	TCT	CCDC53	-	NULL	ENSG00000120860		0.348	CCDC53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC53	HGNC	protein_coding	OTTHUMT00000398685.1		0.00	31	0	G	NM_016053		102406899	-1			no_errors	ENST00000240079	ensembl	human	known	74_37	missense	6.45	29	2	SNP	1.000	T
CCDC88C	440193	genome.wustl.edu	37	14	91774800	91774800	+	Silent	SNP	T	T	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr14:91774800T>C	ENST00000389857.6	-	17	2987	c.2901A>G	c.(2899-2901)gcA>gcG	p.A967A		NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	967					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				TTGTTTTTAATGCTGATTCAT	0.408																																																	0													164.0	160.0	161.0					14																	91774800		1912	4134	6046	SO:0001819	synonymous_variant	0				CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.2901A>G	14.37:g.91774800T>C			Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Silent	SNP	pfam_Hook-related_fam,superfamily_Prefoldin,superfamily_Fum_Rdtase/Succ_DH_flav-like_C	p.A967	ENST00000389857.6	37	c.2901	CCDS45151.1	14																																																																																			CCDC88C	-	NULL	ENSG00000015133		0.408	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC88C	HGNC	protein_coding	OTTHUMT00000411650.1	-	0.00	47	0	T	XM_029353		91774800	-1	tier1	-	no_errors	ENST00000389857	ensembl	human	known	74_37	silent	10.77	58	7	SNP	0.037	C
CCNE1	898	genome.wustl.edu	37	19	30312917	30312917	+	Silent	SNP	T	T	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr19:30312917T>C	ENST00000262643.3	+	9	999	c.720T>C	c.(718-720)cgT>cgC	p.R240R	CCNE1_ENST00000357943.5_Silent_p.R197R|CCNE1_ENST00000444983.2_Silent_p.R225R	NM_001238.2	NP_001229.1	P24864	CCNE1_HUMAN	cyclin E1	240					androgen receptor signaling pathway (GO:0030521)|cell division (GO:0051301)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|Wnt signaling pathway (GO:0016055)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)|kinase activity (GO:0016301)|transcription coactivator activity (GO:0003713)			endometrium(1)|kidney(2)|large_intestine(4)|lung(12)|skin(1)	20	all_cancers(1;2.19e-31)|all_epithelial(1;1.49e-30)|all_lung(1;1.37e-11)|Lung NSC(1;2.35e-11)|Ovarian(5;0.000902)|Breast(6;0.0203)|Esophageal squamous(110;0.195)		UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|Epithelial(1;6.85e-98)|all cancers(1;1.38e-94)|OV - Ovarian serous cystadenocarcinoma(1;1.38e-90)|STAD - Stomach adenocarcinoma(5;5.8e-07)|GBM - Glioblastoma multiforme(4;0.0394)|Lung(7;0.092)|LUAD - Lung adenocarcinoma(5;0.115)|BRCA - Breast invasive adenocarcinoma(6;0.183)|COAD - Colon adenocarcinoma(1;0.188)|Colorectal(1;0.202)			TTAAGTGGCGTTTAAGTCCCC	0.443			A		serous ovarian																																			Dom	yes		19	19q12	898	cyclin E1		E	0													189.0	187.0	188.0					19																	30312917		2203	4300	6503	SO:0001819	synonymous_variant	0			M73812	CCDS12419.1	19q12	2014-07-03			ENSG00000105173	ENSG00000105173			1589	protein-coding gene	gene with protein product	"""cyclin Es"", ""cyclin Et"""	123837		CCNE		1833066	Standard	NM_001238		Approved		uc002nsn.3	P24864	OTTHUMG00000177626	ENST00000262643.3:c.720T>C	19.37:g.30312917T>C			A8K684|Q14091|Q8NFG1|Q92501|Q9UD21	Silent	SNP	pfam_Cyclin_N,pfam_Cyclin_C-dom,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_A/B/D/E	p.R240	ENST00000262643.3	37	c.720	CCDS12419.1	19																																																																																			CCNE1	-	pfam_Cyclin_N,superfamily_Cyclin-like,pirsf_Cyclin_A/B/D/E	ENSG00000105173		0.443	CCNE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNE1	HGNC	protein_coding	OTTHUMT00000438138.1	-	0.00	57	0	T	NM_001238		30312917	+1	tier1	-	no_errors	ENST00000262643	ensembl	human	known	74_37	silent	25.00	27	9	SNP	0.019	C
CCT5	22948	genome.wustl.edu	37	5	10262705	10262705	+	Missense_Mutation	SNP	T	T	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr5:10262705T>C	ENST00000280326.4	+	9	1712	c.1292T>C	c.(1291-1293)cTg>cCg	p.L431P	CTD-2256P15.4_ENST00000606194.1_RNA|CCT5_ENST00000515676.1_Missense_Mutation_p.L393P|CCT5_ENST00000506600.1_Missense_Mutation_p.L338P|CCT5_ENST00000503026.1_Missense_Mutation_p.L410P|CCT5_ENST00000515390.1_Missense_Mutation_p.L376P	NM_012073.3	NP_036205.1	P48643	TCPE_HUMAN	chaperonin containing TCP1, subunit 5 (epsilon)	431					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|response to virus (GO:0009615)	cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleolus (GO:0005730)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|G-protein beta-subunit binding (GO:0031681)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(2)	26						TCCTGTGCCCTGGCAGTTAGC	0.542																																																	0													158.0	131.0	140.0					5																	10262705		2203	4300	6503	SO:0001583	missense	0			D43950	CCDS3877.1	5p15.2	2014-09-17			ENSG00000150753	ENSG00000150753		"""Heat Shock Proteins / Chaperonins"""	1618	protein-coding gene	gene with protein product		610150					Standard	NM_012073		Approved	KIAA0098	uc003jeq.3	P48643	OTTHUMG00000131042	ENST00000280326.4:c.1292T>C	5.37:g.10262705T>C	ENSP00000280326:p.Leu431Pro		A8JZY8|A8K2X8|B4DYD8	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom,prints_Chaperone_TCP-1,prints_Chaprnin_Cpn60,tigrfam_Chap_CCT_epsi	p.L431P	ENST00000280326.4	37	c.1292	CCDS3877.1	5	.	.	.	.	.	.	.	.	.	.	T	25.3	4.628308	0.87560	.	.	ENSG00000150753	ENST00000280326;ENST00000503026;ENST00000515390;ENST00000440011;ENST00000515676;ENST00000506600	T;T;T;T;T	0.79033	-1.23;-1.23;-1.23;-1.23;-1.23	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	D	0.91747	0.7390	H	0.96720	3.87	0.80722	D	1	P;P;D;D;D	0.61697	0.889;0.944;0.99;0.99;0.99	D;D;D;D;D	0.77557	0.925;0.963;0.99;0.99;0.99	D	0.94213	0.7460	10	0.72032	D	0.01	-17.9864	14.4046	0.67073	0.0:0.0:0.0:1.0	.	338;376;429;431;431	B4DYD8;E7ENZ3;Q9BU08;A8K2X8;P48643	.;.;.;.;TCPE_HUMAN	P	431;410;376;404;393;338	ENSP00000280326:L431P;ENSP00000423318:L410P;ENSP00000426923:L376P;ENSP00000427297:L393P;ENSP00000423052:L338P	ENSP00000280326:L431P	L	+	2	0	CCT5	10315705	1.000000	0.71417	0.802000	0.32245	0.982000	0.71751	7.587000	0.82613	2.045000	0.60652	0.456000	0.33151	CTG	CCT5	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,tigrfam_Chap_CCT_epsi	ENSG00000150753		0.542	CCT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT5	HGNC	protein_coding	OTTHUMT00000253688.2	-	0.00	90	0	T			10262705	+1	tier1	-	no_errors	ENST00000280326	ensembl	human	known	74_37	missense	6.15	61	4	SNP	0.997	C
CD1D	912	genome.wustl.edu	37	1	158151871	158151871	+	Silent	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr1:158151871C>T	ENST00000368171.3	+	4	877	c.378C>T	c.(376-378)aaC>aaT	p.N126N		NM_001766.3	NP_001757.1	P15813	CD1D_HUMAN	CD1d molecule	126					antigen processing and presentation, endogenous lipid antigen via MHC class Ib (GO:0048006)|detection of bacterium (GO:0016045)|heterotypic cell-cell adhesion (GO:0034113)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of T cell proliferation (GO:0042102)|T cell selection (GO:0045058)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	beta-2-microglobulin binding (GO:0030881)|cell adhesion molecule binding (GO:0050839)|exogenous lipid antigen binding (GO:0030884)|histone binding (GO:0042393)|lipid antigen binding (GO:0030882)|receptor activity (GO:0004872)			endometrium(1)|kidney(2)|large_intestine(2)|lung(19)|ovary(1)|prostate(3)|urinary_tract(2)	30	all_hematologic(112;0.0378)					ACCCTGGGAACGCCTCAAATA	0.493																																																	0													121.0	134.0	129.0					1																	158151871		2203	4300	6503	SO:0001819	synonymous_variant	0			BC027926	CCDS1173.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158473	ENSG00000158473		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1637	protein-coding gene	gene with protein product		188410	"""CD1D antigen, d polypeptide"", ""CD1d antigen"""			2463622	Standard	NM_001766		Approved		uc001frr.3	P15813	OTTHUMG00000022436	ENST00000368171.3:c.378C>T	1.37:g.158151871C>T			D3DVD5|Q5W0J3|Q9UMM3|Q9Y5M4	Silent	SNP	pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like_dom	p.N126	ENST00000368171.3	37	c.378	CCDS1173.1	1																																																																																			CD1D	-	superfamily_MHC_I/II-like_Ag-recog	ENSG00000158473		0.493	CD1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD1D	HGNC	protein_coding	OTTHUMT00000058340.1	-	0.00	38	0	C	NM_001766		158151871	+1	tier1	-	no_errors	ENST00000368171	ensembl	human	known	74_37	silent	18.18	27	6	SNP	0.000	T
CD1E	913	genome.wustl.edu	37	1	158325179	158325179	+	Missense_Mutation	SNP	A	A	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr1:158325179A>T	ENST00000368167.3	+	3	684	c.445A>T	c.(445-447)Agt>Tgt	p.S149C	CD1E_ENST00000368161.3_Missense_Mutation_p.S149C|CD1E_ENST00000368164.3_Intron|CD1E_ENST00000368157.1_Intron|CD1E_ENST00000368163.3_Missense_Mutation_p.S149C|CD1E_ENST00000368154.1_Intron|CD1E_ENST00000368155.3_Intron|CD1E_ENST00000444681.2_Missense_Mutation_p.S50C|CD1E_ENST00000368160.3_Missense_Mutation_p.S149C|CD1E_ENST00000368166.3_Intron|CD1E_ENST00000368165.3_Intron|CD1E_ENST00000368156.1_Intron|CD1E_ENST00000434258.1_Missense_Mutation_p.S147C|CD1E_ENST00000452291.2_Intron	NM_030893.3	NP_112155.2	P15812	CD1E_HUMAN	CD1e molecule	149			S -> N (in allele CD1E*05; dbSNP:rs35116276). {ECO:0000269|PubMed:12144626}.		antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(27)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|urinary_tract(1)	49	all_hematologic(112;0.0378)					AGATTTCCTGAGTTTCCAAGG	0.458																																																	0													100.0	98.0	99.0					1																	158325179		1836	4093	5929	SO:0001583	missense	0			AJ289111	CCDS41417.1, CCDS41418.1, CCDS41419.1, CCDS41420.1, CCDS41421.1, CCDS41422.1, CCDS53387.1, CCDS53388.1, CCDS53389.1, CCDS53390.1, CCDS53384.1, CCDS53385.1, CCDS53386.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158488	ENSG00000158488		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1638	protein-coding gene	gene with protein product		188411	"""CD1E antigen, e polypeptide"", ""CD1e antigen"""			10948205	Standard	NM_001042585		Approved		uc001fse.3	P15812	OTTHUMG00000017515	ENST00000368167.3:c.445A>T	1.37:g.158325179A>T	ENSP00000357149:p.Ser149Cys		B4DZV3|E7EP01|Q5TDJ9|Q5TDK3|Q5TDK4|Q5TDK5|Q5TDK6|Q5TDK8|Q5TDL1|Q712E4|Q712E5|Q712E6|Q712E7|Q712E8|Q712E9|Q712F0|Q712F1|Q712F2|Q712F3|Q712F4|Q712F5|Q96TD0|Q96TD1|Q9UMM1|Q9Y5M3	Missense_Mutation	SNP	pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like_dom	p.S149C	ENST00000368167.3	37	c.445	CCDS41417.1	1	.	.	.	.	.	.	.	.	.	.	A	16.74	3.206804	0.58343	.	.	ENSG00000158488	ENST00000434258;ENST00000444681;ENST00000368167;ENST00000368163;ENST00000368160;ENST00000368161	T;T;T;T;T;T	0.09163	3.01;3.01;3.01;3.01;3.01;3.01	4.53	3.37	0.38596	MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	0.254966	0.28209	N	0.016191	T	0.22627	0.0546	M	0.89534	3.04	0.22796	N	0.998727	D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0;0.999	D;D;D;D;D;D	0.83275	0.945;0.945;0.98;0.945;0.996;0.966	T	0.10428	-1.0630	10	0.87932	D	0	-7.7902	8.1605	0.31196	0.7958:0.2042:0.0:0.0	.	147;50;149;149;149;149	E7ET31;E7EP01;P15812-2;P15812;P15812-3;P15812-4	.;.;.;CD1E_HUMAN;.;.	C	147;50;149;149;149;149	ENSP00000401957:S147C;ENSP00000402906:S50C;ENSP00000357149:S149C;ENSP00000357145:S149C;ENSP00000357142:S149C;ENSP00000357143:S149C	ENSP00000357142:S149C	S	+	1	0	CD1E	156591803	1.000000	0.71417	1.000000	0.80357	0.732000	0.41865	2.394000	0.44450	0.848000	0.35191	0.460000	0.39030	AGT	CD1E	-	superfamily_MHC_I/II-like_Ag-recog	ENSG00000158488		0.458	CD1E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD1E	HGNC	protein_coding	OTTHUMT00000046353.3	-	0.00	28	0	A	NM_030893		158325179	+1	tier1	-	no_errors	ENST00000368167	ensembl	human	known	74_37	missense	16.67	44	9	SNP	1.000	T
CDH17	1015	genome.wustl.edu	37	8	95182682	95182682	+	Missense_Mutation	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr8:95182682G>A	ENST00000027335.3	-	9	1133	c.1009C>T	c.(1009-1011)Cca>Tca	p.P337S	CDH17_ENST00000441892.2_Intron|CDH17_ENST00000450165.2_Missense_Mutation_p.P337S	NM_004063.3	NP_004054.3	Q12864	CAD17_HUMAN	cadherin 17, LI cadherin (liver-intestine)	337	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|oligopeptide transmembrane transport (GO:0035672)|oligopeptide transport (GO:0006857)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)|transporter activity (GO:0005215)			NS(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(4)|stomach(2)	52	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			CATGTAGGTGGATTATCATTA	0.403																																																	0													147.0	139.0	142.0					8																	95182682		2203	4300	6503	SO:0001583	missense	0			X83228	CCDS6260.1	8q22.1	2010-01-26			ENSG00000079112	ENSG00000079112		"""Cadherins / Major cadherins"""	1756	protein-coding gene	gene with protein product		603017				9615235, 10191097	Standard	NM_004063		Approved	HPT-1, cadherin	uc003ygh.2	Q12864	OTTHUMG00000164391	ENST00000027335.3:c.1009C>T	8.37:g.95182682G>A	ENSP00000027335:p.Pro337Ser		Q15336|Q2M2E0	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P337S	ENST00000027335.3	37	c.1009	CCDS6260.1	8	.	.	.	.	.	.	.	.	.	.	G	16.13	3.034984	0.54896	.	.	ENSG00000079112	ENST00000027335;ENST00000450165	T;T	0.59906	0.23;0.23	6.06	6.06	0.98353	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	0.114726	0.39909	N	0.001235	T	0.51686	0.1689	L	0.45470	1.425	0.58432	D	0.999999	B	0.33883	0.43	B	0.29267	0.1	T	0.44406	-0.9330	10	0.23891	T	0.37	-4.2564	19.4112	0.94673	0.0:0.0:1.0:0.0	.	337	Q12864	CAD17_HUMAN	S	337	ENSP00000027335:P337S;ENSP00000401468:P337S	ENSP00000027335:P337S	P	-	1	0	CDH17	95251858	1.000000	0.71417	1.000000	0.80357	0.813000	0.45954	4.997000	0.63921	2.880000	0.98712	0.650000	0.86243	CCA	CDH17	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000079112		0.403	CDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH17	HGNC	protein_coding	OTTHUMT00000378560.1	-	0.00	96	0	G	NM_004063		95182682	-1	tier1	-	no_errors	ENST00000027335	ensembl	human	known	74_37	missense	9.29	125	13	SNP	1.000	A
CDRT1	374286	genome.wustl.edu	37	17	15510949	15510949	+	Missense_Mutation	SNP	C	C	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr17:15510949C>A	ENST00000395906.3	-	6	1170	c.1171G>T	c.(1171-1173)Gtc>Ttc	p.V391F	RP11-385D13.1_ENST00000455584.2_Missense_Mutation_p.V701F	NM_006382.3	NP_006373.2	O95170	CDRT1_HUMAN	CMT1A duplicated region transcript 1	391										endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(2;1.36e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0541)		TCCATCAGGACCTGCTGCGTT	0.468																																																	0													155.0	139.0	145.0					17																	15510949		2203	4300	6503	SO:0001583	missense	0			U65652	CCDS45619.1, CCDS73996.1	17p11	2013-01-10			ENSG00000241322	ENSG00000241322		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	14379	protein-coding gene	gene with protein product		604596	"""F-box and WD repeat domain containing 10 pseudogene 1"", ""F-box and WD-40 domain protein 10 pseudogene 1"""	FBXW10P1		9787083, 11381029	Standard	NM_006382		Approved	HREP, SM25H2, FBXW10B		O95170	OTTHUMG00000059074	ENST00000395906.3:c.1171G>T	17.37:g.15510949C>A	ENSP00000379242:p.Val391Phe		O43848|O95611	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_F-box_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.V391F	ENST00000395906.3	37	c.1171	CCDS45619.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.74|16.74	3.207368|3.207368	0.58343|0.58343	.|.	.|.	ENSG00000251537|ENSG00000251537	ENST00000455584|ENST00000261644;ENST00000395906	.|T	.|0.21932	.|1.98	4.99|4.99	-0.852|-0.852	0.10713|0.10713	.|F-box domain, Skp2-like (1);	.|0.737822	.|0.10945	.|U	.|0.616758	T|T	0.30039|0.30039	0.0752|0.0752	M|M	0.66939|0.66939	2.045|2.045	0.46586|0.46586	D|D	0.999112|0.999112	.|P;D	.|0.54047	.|0.933;0.964	.|B;P	.|0.51101	.|0.441;0.659	T|T	0.38457|0.38457	-0.9660|-0.9660	5|10	.|0.72032	.|D	.|0.01	.|.	8.644|8.644	0.33994|0.33994	0.0:0.5366:0.0:0.4634|0.0:0.5366:0.0:0.4634	.|.	.|391;715	.|O95170;Q59EB2	.|CDRT1_HUMAN;.	S|F	715|421;391	.|ENSP00000379242:V391F	.|ENSP00000261644:V421F	R|V	-|-	3|1	2|0	RP11-385D13.1|RP11-385D13.1	15451674|15451674	0.134000|0.134000	0.22483|0.22483	0.886000|0.886000	0.34754|0.34754	0.937000|0.937000	0.57800|0.57800	0.312000|0.312000	0.19397|0.19397	-0.052000|-0.052000	0.13311|0.13311	0.561000|0.561000	0.74099|0.74099	AGG|GTC	CDRT1	-	superfamily_F-box_dom	ENSG00000241322		0.468	CDRT1-007	KNOWN	basic|appris_principal|CCDS	protein_coding	CDRT1	HGNC	protein_coding	OTTHUMT00000448127.1	-	0.00	207	0	C	NM_006382		15510949	-1	tier1	-	no_errors	ENST00000395906	ensembl	human	known	74_37	missense	15.91	111	21	SNP	0.285	A
CEBPZ	10153	genome.wustl.edu	37	2	37454908	37454908	+	Frame_Shift_Del	DEL	T	T	-			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr2:37454908delT	ENST00000234170.5	-	2	1573	c.1428delA	c.(1426-1428)aaafs	p.K476fs		NM_005760.2	NP_005751.2	Q03701	CEBPZ_HUMAN	CCAAT/enhancer binding protein (C/EBP), zeta	476					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|endometrium(2)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28		all_hematologic(82;0.21)				ATTCAACATCTTTTTTTTTGA	0.368																																																	0													51.0	52.0	52.0					2																	37454908		2203	4300	6503	SO:0001589	frameshift_variant	0			M37197	CCDS1787.1	2p22.3	2008-09-03	2008-09-03		ENSG00000115816	ENSG00000115816			24218	protein-coding gene	gene with protein product		612828				2247079, 12534345	Standard	NM_005760		Approved	CBF2, CTF2	uc002rpz.3	Q03701	OTTHUMG00000100960	ENST00000234170.5:c.1428delA	2.37:g.37454908delT	ENSP00000234170:p.Lys476fs		Q8NE75	Frame_Shift_Del	DEL	pfam_CCAAT-binding_factor,superfamily_ARM-type_fold	p.D477fs	ENST00000234170.5	37	c.1428	CCDS1787.1	2																																																																																			CEBPZ	-	superfamily_ARM-type_fold	ENSG00000115816		0.368	CEBPZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEBPZ	HGNC	protein_coding	OTTHUMT00000218569.2		0.00	55	0	T	NM_005760		37454908	-1	tier1		no_errors	ENST00000234170	ensembl	human	known	74_37	frame_shift_del	10.53	51	6	DEL	1.000	-
CECR7	100130418	genome.wustl.edu	37	22	17525784	17525784	+	lincRNA	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr22:17525784G>A	ENST00000441006.1	+	0	797					NR_015352.1				cat eye syndrome chromosome region, candidate 7 (non-protein coding)																		GAACACAGCCGAAGTGGAATG	0.522																																																	0																																												0			BC043198		22q11.2	2012-10-16	2009-08-21		ENSG00000237438	ENSG00000237438		"""Long non-coding RNAs"""	1845	non-coding RNA	RNA, long non-coding			"""cat eye syndrome chromosome region, candidate 7"""			11381032	Standard	NR_015352		Approved	SAHL1	uc002zlx.1		OTTHUMG00000150027		22.37:g.17525784G>A				RNA	SNP	-	NULL	ENST00000441006.1	37	NULL		22																																																																																			CECR7	-	-	ENSG00000237438		0.522	CECR7-001	KNOWN	basic|exp_conf	lincRNA	CECR7	HGNC	lincRNA	OTTHUMT00000315626.1	-	0.00	46	0	G	NR_015352		17525784	+1	tier1	-	no_errors	ENST00000414401	ensembl	human	known	74_37	rna	25.42	44	15	SNP	0.000	A
CHD3	1107	genome.wustl.edu	37	17	7807298	7807300	+	In_Frame_Del	DEL	GAA	GAA	-			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	GAA	GAA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr17:7807298_7807300delGAA	ENST00000330494.7	+	24	4033_4035	c.3883_3885delGAA	c.(3883-3885)gaadel	p.E1296del	CHD3_ENST00000358181.4_In_Frame_Del_p.E1296del|SCARNA21_ENST00000517026.1_RNA|CHD3_ENST00000380358.4_In_Frame_Del_p.E1355del	NM_001005273.2	NP_001005273.1	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	1296					centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				CGTCGTGCGGGAAGAAGACAAGG	0.527																																																	0																																										SO:0001651	inframe_deletion	0			U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000330494.7:c.3883_3885delGAA	17.37:g.7807301_7807303delGAA	ENSP00000332628:p.Glu1296del		D3DTQ9|E9PG89|Q9Y4I0	In_Frame_Del	DEL	pfam_CHD_C2,pfam_SNF2_N,pfam_DUF1086,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.E1296in_frame_del	ENST00000330494.7	37	c.3883_3885	CCDS32554.1	17																																																																																			CHD3	-	pfam_DUF1087	ENSG00000170004		0.527	CHD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD3	HGNC	protein_coding	OTTHUMT00000318050.1		0.00	32	0	GAA	NM_001005273		7807300	+1	tier1		no_errors	ENST00000330494	ensembl	human	known	74_37	in_frame_del	7.41	25	2	DEL	1.000:1.000:1.000	-
CIT	11113	genome.wustl.edu	37	12	120139670	120139670	+	Missense_Mutation	SNP	G	G	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr12:120139670G>T	ENST00000261833.7	-	41	5324	c.5272C>A	c.(5272-5274)Cag>Aag	p.Q1758K	CIT_ENST00000392521.2_Missense_Mutation_p.Q1800K|CIT_ENST00000537607.1_5'UTR	NM_007174.2	NP_009105.1	O14578	CTRO_HUMAN	citron rho-interacting serine/threonine kinase	1758	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				cytokinesis (GO:0000910)|dendrite development (GO:0016358)|G2/M transition of mitotic cell cycle (GO:0000086)|generation of neurons (GO:0048699)|Golgi organization (GO:0007030)|intracellular signal transduction (GO:0035556)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of actin polymerization or depolymerization (GO:0008064)|spermatogenesis (GO:0007283)	actin cytoskeleton (GO:0015629)|Golgi cisterna (GO:0031985)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|vacuole (GO:0005773)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(6)|endometrium(9)|kidney(4)|large_intestine(15)|liver(1)|lung(29)|ovary(7)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	86	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		AGCGTGTACTGCTTCATGTCG	0.537																																																	0													227.0	218.0	221.0					12																	120139670		2203	4300	6503	SO:0001583	missense	0			AB023166	CCDS9192.1, CCDS55891.1	12q24.23	2014-04-23	2014-04-23		ENSG00000122966	ENSG00000122966			1985	protein-coding gene	gene with protein product	"""serine/threonine kinase 21"""	605629	"""citron (rho-interacting, serine/threonine kinase 21)"""			9792683	Standard	NM_001206999		Approved	KIAA0949, STK21, CRIK	uc001txj.2	O14578	OTTHUMG00000134325	ENST00000261833.7:c.5272C>A	12.37:g.120139670G>T	ENSP00000261833:p.Gln1758Lys		Q2M5E1|Q6XUH8|Q86UQ9|Q9UPZ7	Missense_Mutation	SNP	pfam_Citron,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_HR1_rho-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,pirsf_Citron_Rho-interacting_kinase,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom	p.Q1758K	ENST00000261833.7	37	c.5272	CCDS9192.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	32|32	5.108449|5.108449	0.94292|0.94292	.|.	.|.	ENSG00000122966|ENSG00000122966	ENST00000392521;ENST00000261833|ENST00000392520	T;T|.	0.04234|.	3.67;3.67|.	5.68|5.68	5.68|5.68	0.88126|0.88126	Citron-like (3);|.	0.064498|.	0.64402|.	D|.	0.000006|.	T|T	0.68732|0.68732	0.3033|0.3033	L|L	0.43152|0.43152	1.355|1.355	0.80722|0.80722	D|D	1|1	D;D;P|.	0.69078|.	0.997;0.963;0.672|.	D;D;B|.	0.76071|.	0.987;0.973;0.277|.	T|T	0.63350|0.63350	-0.6657|-0.6657	10|5	0.62326|.	D|.	0.03|.	.|.	19.7849|19.7849	0.96432|0.96432	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1800;1758;1276|.	Q2M5E1;O14578;O14578-3|.	.;CTRO_HUMAN;.|.	K|R	1800;1758|1370	ENSP00000376306:Q1800K;ENSP00000261833:Q1758K|.	ENSP00000261833:Q1758K|.	Q|S	-|-	1|3	0|2	CIT|CIT	118624053|118624053	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.966000|0.966000	0.64601|0.64601	9.869000|9.869000	0.99810|0.99810	2.671000|2.671000	0.90904|0.90904	0.650000|0.650000	0.86243|0.86243	CAG|AGC	CIT	-	pfam_Citron,smart_Citron,pirsf_Citron_Rho-interacting_kinase	ENSG00000122966		0.537	CIT-001	KNOWN	basic|CCDS	protein_coding	CIT	HGNC	protein_coding	OTTHUMT00000259410.4	-	0.00	50	0	G	NM_007174		120139670	-1	tier1	-	no_errors	ENST00000261833	ensembl	human	known	74_37	missense	7.84	46	4	SNP	1.000	T
CIZ1	25792	genome.wustl.edu	37	9	130928628	130928628	+	Missense_Mutation	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr9:130928628C>T	ENST00000393608.1	-	17	2747	c.2545G>A	c.(2545-2547)Gca>Aca	p.A849T	CIZ1_ENST00000357558.5_Missense_Mutation_p.A821T|CIZ1_ENST00000538431.1_Missense_Mutation_p.A875T|CIZ1_ENST00000372954.1_Missense_Mutation_p.A769T|CIZ1_ENST00000476727.2_5'Flank|CIZ1_ENST00000541172.1_Missense_Mutation_p.A748T|CIZ1_ENST00000372938.5_Missense_Mutation_p.A849T|CIZ1_ENST00000325721.8_Missense_Mutation_p.A820T|CIZ1_ENST00000372948.3_Missense_Mutation_p.A793T|CIZ1_ENST00000277465.4_Missense_Mutation_p.A821T	NM_012127.2	NP_036259.2	Q9ULV3	CIZ1_HUMAN	CDKN1A interacting zinc finger protein 1	849					maintenance of protein location in nucleus (GO:0051457)|positive regulation of DNA-dependent DNA replication initiation (GO:0032298)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|liver(1)|lung(9)|ovary(3)|prostate(2)|urinary_tract(2)	35						GCGTTGATTGCGCACCGGCGG	0.632																																																	0													44.0	47.0	46.0					9																	130928628		2177	4271	6448	SO:0001583	missense	0			AB030835	CCDS6894.1, CCDS48033.1, CCDS48034.1, CCDS75910.1	9q34.1	2012-10-05			ENSG00000148337	ENSG00000148337			16744	protein-coding gene	gene with protein product		611420				10529385	Standard	NM_001131015		Approved	LSFR1, ZNF356	uc011mas.2	Q9ULV3	OTTHUMG00000020735	ENST00000393608.1:c.2545G>A	9.37:g.130928628C>T	ENSP00000377232:p.Ala849Thr		A8K9J8|B4E131|B7ZAS8|Q5SYW3|Q5SYW5|Q8WU72|Q9H868|Q9NYM8|Q9UHK4|Q9Y3F9|Q9Y3G0	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like,pfscan_Znf_C2H2_matrin	p.A875T	ENST00000393608.1	37	c.2623	CCDS6894.1	9	.	.	.	.	.	.	.	.	.	.	C	25.5	4.646624	0.87958	.	.	ENSG00000148337	ENST00000372954;ENST00000393608;ENST00000538431;ENST00000357558;ENST00000325721;ENST00000537314;ENST00000541172;ENST00000277465;ENST00000372948;ENST00000372938;ENST00000415526	T;T;T;T;T;T;T;T;T;T	0.50001	0.76;0.95;1.08;1.11;0.94;1.38;1.11;0.77;0.95;1.52	4.45	4.45	0.53987	.	0.000000	0.52532	D	0.000070	T	0.57344	0.2047	L	0.36672	1.1	0.32807	D	0.500926	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;0.999	D;D;D;D;D;D;D	0.85130	0.979;0.997;0.975;0.996;0.993;0.98;0.98	T	0.65207	-0.6224	10	0.66056	D	0.02	-26.737	12.8966	0.58104	0.0:1.0:0.0:0.0	.	875;788;793;769;849;820;821	B7Z3U7;B4E0A3;Q9ULV3-4;Q9ULV3-3;Q9ULV3;Q9ULV3-2;Q5SYW2	.;.;.;.;CIZ1_HUMAN;.;.	T	769;849;875;821;820;788;748;821;793;849;771	ENSP00000362045:A769T;ENSP00000377232:A849T;ENSP00000439244:A875T;ENSP00000350169:A821T;ENSP00000320374:A820T;ENSP00000445057:A748T;ENSP00000277465:A821T;ENSP00000362039:A793T;ENSP00000362029:A849T;ENSP00000398011:A771T	ENSP00000277465:A821T	A	-	1	0	CIZ1	129968449	0.997000	0.39634	0.960000	0.40013	0.942000	0.58702	3.018000	0.49625	2.768000	0.95171	0.561000	0.74099	GCA	CIZ1	-	NULL	ENSG00000148337		0.632	CIZ1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CIZ1	HGNC	protein_coding	OTTHUMT00000054399.1	-	0.00	195	0	C	NM_012127		130928628	-1	tier1	-	no_errors	ENST00000538431	ensembl	human	known	74_37	missense	17.89	202	44	SNP	0.962	T
CLEC4F	165530	genome.wustl.edu	37	2	71046546	71046546	+	Missense_Mutation	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr2:71046546G>A	ENST00000272367.2	-	3	285	c.209C>T	c.(208-210)cCt>cTt	p.P70L	CLEC4F_ENST00000426626.1_Missense_Mutation_p.P70L	NM_001258027.1|NM_173535.2	NP_001244956.1|NP_775806.2	Q8N1N0	CLC4F_HUMAN	C-type lectin domain family 4, member F	70					endocytosis (GO:0006897)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			endometrium(1)|large_intestine(5)|lung(18)|ovary(5)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	37						GGCTTGCACAGGCTTCGGAAC	0.537																																					Colon(107;10 2157 6841 26035)												0													119.0	101.0	107.0					2																	71046546		2203	4300	6503	SO:0001583	missense	0			AK096429	CCDS1910.1	2p13.3	2008-02-05	2005-02-09	2005-02-11	ENSG00000152672	ENSG00000152672		"""C-type lectin domain containing"""	25357	protein-coding gene	gene with protein product			"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 13"""	CLECSF13		8889548, 1846367	Standard	NM_001258027		Approved	FLJ39110, KCLR	uc002shf.3	Q8N1N0	OTTHUMG00000129713	ENST00000272367.2:c.209C>T	2.37:g.71046546G>A	ENSP00000272367:p.Pro70Leu		A4QPA5	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,superfamily_Prefoldin,smart_C-type_lectin,prints_AntifreezeII,pfscan_C-type_lectin	p.P70L	ENST00000272367.2	37	c.209	CCDS1910.1	2	.	.	.	.	.	.	.	.	.	.	G	8.533	0.871356	0.17322	.	.	ENSG00000152672	ENST00000272367;ENST00000426626	T;T	0.01887	4.63;4.58	3.19	1.22	0.21188	.	6.784520	0.00397	N	0.000053	T	0.02970	0.0088	L	0.46157	1.445	0.09310	N	1	B;B	0.30326	0.001;0.276	B;B	0.20577	0.0;0.03	T	0.41305	-0.9516	10	0.56958	D	0.05	.	4.6521	0.12599	0.0:0.1951:0.4817:0.3233	.	70;70	B7ZMM1;Q8N1N0	.;CLC4F_HUMAN	L	70	ENSP00000272367:P70L;ENSP00000390581:P70L	ENSP00000272367:P70L	P	-	2	0	CLEC4F	70900054	0.001000	0.12720	0.000000	0.03702	0.217000	0.24651	0.447000	0.21710	0.297000	0.22615	0.305000	0.20034	CCT	CLEC4F	-	NULL	ENSG00000152672		0.537	CLEC4F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLEC4F	HGNC	protein_coding	OTTHUMT00000251922.1	-	0.00	58	0	G	NM_173535		71046546	-1	tier1	-	no_errors	ENST00000272367	ensembl	human	known	74_37	missense	9.46	66	7	SNP	0.000	A
CLK4	57396	genome.wustl.edu	37	5	178045592	178045592	+	Missense_Mutation	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr5:178045592G>A	ENST00000316308.4	-	3	517	c.349C>T	c.(349-351)Cgc>Tgc	p.R117C	CLK4_ENST00000522749.1_5'UTR|RN7SKP70_ENST00000516655.1_RNA	NM_020666.2	NP_065717.1	Q9HAZ1	CLK4_HUMAN	CDC-like kinase 4	117					protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(2)	21	all_cancers(89;0.000969)|Renal(175;0.000159)|all_epithelial(37;0.000451)|Lung NSC(126;0.00545)|all_lung(126;0.00918)	all_cancers(40;0.0272)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.235)		TGTCTATTGCGCTTCCTTTTA	0.408																																																	0													232.0	219.0	223.0					5																	178045592		2203	4300	6503	SO:0001583	missense	0			AF294429	CCDS4437.1	5q35	2008-05-02			ENSG00000113240	ENSG00000113240		"""CDC-like kinases"""	13659	protein-coding gene	gene with protein product		607969				11170754	Standard	NM_020666		Approved		uc003mjf.1	Q9HAZ1	OTTHUMG00000130893	ENST00000316308.4:c.349C>T	5.37:g.178045592G>A	ENSP00000316948:p.Arg117Cys			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R117C	ENST00000316308.4	37	c.349	CCDS4437.1	5	.	.	.	.	.	.	.	.	.	.	G	17.09	3.300109	0.60195	.	.	ENSG00000113240	ENST00000316308;ENST00000536763	T	0.70516	-0.49	5.85	5.85	0.93711	.	0.906061	0.09790	N	0.755568	T	0.68210	0.2976	L	0.45352	1.415	0.80722	D	1	P;D;D;D;D	0.64830	0.894;0.994;0.968;0.97;0.97	B;B;B;B;B	0.41299	0.231;0.353;0.231;0.27;0.27	T	0.71144	-0.4678	10	0.72032	D	0.01	.	17.6591	0.88187	0.0:0.0:1.0:0.0	.	117;117;117;117;117	B7Z990;B7ZL31;Q4G0Z5;B9EG64;Q9HAZ1	.;.;.;.;CLK4_HUMAN	C	117	ENSP00000316948:R117C	ENSP00000316948:R117C	R	-	1	0	CLK4	177978198	1.000000	0.71417	0.991000	0.47740	0.871000	0.50021	5.445000	0.66594	2.768000	0.95171	0.655000	0.94253	CGC	CLK4	-	NULL	ENSG00000113240		0.408	CLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLK4	HGNC	protein_coding	OTTHUMT00000253479.2	-	0.00	81	0	G			178045592	-1	tier1	-	no_errors	ENST00000316308	ensembl	human	known	74_37	missense	18.03	50	11	SNP	1.000	A
CNST	163882	genome.wustl.edu	37	1	246755187	246755187	+	Missense_Mutation	SNP	T	T	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr1:246755187T>A	ENST00000366513.4	+	2	592	c.323T>A	c.(322-324)aTt>aAt	p.I108N	CNST_ENST00000483271.1_3'UTR|CNST_ENST00000366512.3_Missense_Mutation_p.I108N	NM_152609.2	NP_689822.2	Q6PJW8	CNST_HUMAN	consortin, connexin sorting protein	108					negative regulation of phosphatase activity (GO:0010923)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)	connexin binding (GO:0071253)|phosphatase binding (GO:0019902)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|prostate(1)|urinary_tract(2)	28						GACAAAAAAATTCCTGGAAAA	0.398																																																	0													32.0	33.0	33.0					1																	246755187		2202	4298	6500	SO:0001583	missense	0			AK056563	CCDS1628.1, CCDS44343.1	1q44	2012-04-17	2009-11-03	2009-11-03	ENSG00000162852	ENSG00000162852		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	26486	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 64"""	613439	"""chromosome 1 open reading frame 71"""	C1orf71		19864490	Standard	NM_152609		Approved	FLJ32001, PPP1R64	uc001ibp.3	Q6PJW8	OTTHUMG00000040090	ENST00000366513.4:c.323T>A	1.37:g.246755187T>A	ENSP00000355470:p.Ile108Asn		Q5VSY9|Q5VTM7|Q8IYA9|Q8N3L5|Q8NB09|Q8TEI2|Q96MR5	Missense_Mutation	SNP	NULL	p.I108N	ENST00000366513.4	37	c.323	CCDS1628.1	1	.	.	.	.	.	.	.	.	.	.	T	11.23	1.577605	0.28180	.	.	ENSG00000162852	ENST00000366513;ENST00000366512;ENST00000366511	T;T;T	0.24538	1.85;1.85;1.85	6.17	-8.63	0.00878	.	1.688010	0.02785	N	0.121366	T	0.18923	0.0454	L	0.47716	1.5	0.09310	N	1	B;P	0.37276	0.435;0.589	B;B	0.33042	0.157;0.157	T	0.41998	-0.9477	10	0.59425	D	0.04	-6.3311	8.2408	0.31658	0.1118:0.597:0.114:0.1772	.	108;108	Q6PJW8;Q6PJW8-2	CNST_HUMAN;.	N	108	ENSP00000355470:I108N;ENSP00000355469:I108N;ENSP00000355468:I108N	ENSP00000355468:I108N	I	+	2	0	CNST	244821810	0.000000	0.05858	0.000000	0.03702	0.307000	0.27823	-0.757000	0.04772	-1.000000	0.03438	-0.250000	0.11733	ATT	CNST	-	NULL	ENSG00000162852		0.398	CNST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNST	HGNC	protein_coding	OTTHUMT00000096780.1	-	0.00	25	0	T	NM_152609		246755187	+1	tier1	-	no_errors	ENST00000366513	ensembl	human	known	74_37	missense	24.39	31	10	SNP	0.000	A
COL11A2	1302	genome.wustl.edu	37	6	33138892	33138892	+	Splice_Site	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr6:33138892G>A	ENST00000374708.4	-	43	3365	c.3107C>T	c.(3106-3108)gCg>gTg	p.A1036V	COL11A2_ENST00000374712.1_Splice_Site_p.A1041V|COL11A2_ENST00000341947.2_Splice_Site_p.A1122V|COL11A2_ENST00000395197.1_Splice_Site_p.A1062V|COL11A2_ENST00000477772.1_Intron|COL11A2_ENST00000361917.1_Splice_Site_p.A1015V|COL11A2_ENST00000374714.1_Splice_Site_p.A1096V|COL11A2_ENST00000374713.1_Splice_Site_p.A1075V|COL11A2_ENST00000357486.1_Splice_Site_p.A1101V	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	1122	Triple-helical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						GTCACTCACCGCTGCTCCAGG	0.652																																					Melanoma(1;90 116 3946 5341 17093)												0													16.0	17.0	16.0					6																	33138892		2191	4290	6481	SO:0001630	splice_region_variant	0			U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.3108+1C>T	6.37:g.33138892G>A			A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Laminin_G,smart_Fib_collagen_C	p.A1122V	ENST00000374708.4	37	c.3365	CCDS43452.1	6	.	.	.	.	.	.	.	.	.	.	G	17.95	3.513537	0.64522	.	.	ENSG00000204248	ENST00000374708;ENST00000341947;ENST00000357486;ENST00000374714;ENST00000374713;ENST00000395197;ENST00000374712;ENST00000361917	D;D;D;D;D;D;D;D	0.93426	-3.22;-3.22;-3.22;-3.22;-3.22;-3.22;-3.22;-3.22	4.65	4.65	0.58169	.	0.070349	0.56097	D	0.000040	D	0.88618	0.6485	L	0.28649	0.875	0.58432	D	0.999997	P;P;P	0.51653	0.935;0.935;0.947	B;P;P	0.48921	0.381;0.46;0.595	D	0.89017	0.3432	10	0.42905	T	0.14	.	15.0632	0.71970	0.0:0.0:1.0:0.0	.	1015;1036;1122	P13942-8;P13942-6;P13942	.;.;COBA2_HUMAN	V	1036;1122;1101;1096;1075;1062;1041;1015	ENSP00000363840:A1036V;ENSP00000339915:A1122V;ENSP00000350079:A1101V;ENSP00000363846:A1096V;ENSP00000363845:A1075V;ENSP00000378623:A1062V;ENSP00000363844:A1041V;ENSP00000355123:A1015V	ENSP00000339915:A1122V	A	-	2	0	COL11A2	33246870	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.314000	0.96306	2.400000	0.81607	0.551000	0.68910	GCG	COL11A2	-	pfam_Collagen	ENSG00000204248		0.652	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	COL11A2	HGNC	protein_coding	OTTHUMT00000076032.2	-	0.00	25	0	G		Missense_Mutation	33138892	-1	tier1	-	no_errors	ENST00000341947	ensembl	human	known	74_37	missense	25.00	18	6	SNP	1.000	A
COL5A2	1290	genome.wustl.edu	37	2	189945770	189945770	+	Splice_Site	SNP	C	C	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr2:189945770C>A	ENST00000374866.3	-	13	1127		c.e13-1			NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2						axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)	p.?(1)		NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			CACGAGCTCCCTGGGAGGAAA	0.398																																																	1	Unknown(1)	lung(1)											74.0	84.0	80.0					2																	189945770		2203	4300	6503	SO:0001630	splice_region_variant	0			Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.853-1G>T	2.37:g.189945770C>A			P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Splice_Site	SNP	-	e13-1	ENST00000374866.3	37	c.853-1	CCDS33350.1	2	.	.	.	.	.	.	.	.	.	.	C	16.94	3.261966	0.59431	.	.	ENSG00000204262	ENST00000374866;ENST00000452536	.	.	.	5.26	5.26	0.73747	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.2306	0.65890	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	COL5A2	189654015	1.000000	0.71417	1.000000	0.80357	0.636000	0.38137	5.417000	0.66423	2.732000	0.93576	0.555000	0.69702	.	COL5A2	-	-	ENSG00000204262		0.398	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A2	HGNC	protein_coding	OTTHUMT00000313523.1		0.00	49	0	C	NM_000393	Intron	189945770	-1			no_errors	ENST00000374866	ensembl	human	known	74_37	splice_site	5.00	57	3	SNP	1.000	A
CPO	130749	genome.wustl.edu	37	2	207834128	207834128	+	Missense_Mutation	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr2:207834128G>A	ENST00000272852.3	+	9	1139	c.1093G>A	c.(1093-1095)Ggc>Agc	p.G365S		NM_173077.2	NP_775100.1	Q8IVL8	CBPO_HUMAN	carboxypeptidase O	365						extracellular region (GO:0005576)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	14				LUSC - Lung squamous cell carcinoma(261;0.0744)|Epithelial(149;0.0807)|Lung(261;0.142)		TATGCTGCTGGGCCTGCTGGT	0.567																																																	0													127.0	105.0	113.0					2																	207834128		2203	4300	6503	SO:0001583	missense	0				CCDS2372.1	2q34	2012-02-10			ENSG00000144410	ENSG00000144410			21011	protein-coding gene	gene with protein product	"""metallocarboxypeptidase O"", ""metallocarboxypeptidase C"""	609563				11836249	Standard	NM_173077		Approved		uc002vby.2	Q8IVL8	OTTHUMG00000088987	ENST00000272852.3:c.1093G>A	2.37:g.207834128G>A	ENSP00000272852:p.Gly365Ser		Q2M277|Q7RTW7	Missense_Mutation	SNP	pfam_Peptidase_M14,smart_Peptidase_M14,prints_Peptidase_M14	p.G365S	ENST00000272852.3	37	c.1093	CCDS2372.1	2	.	.	.	.	.	.	.	.	.	.	g	11.37	1.619328	0.28801	.	.	ENSG00000144410	ENST00000272852	T	0.12255	2.7	5.51	-6.96	0.01622	.	1.676860	0.02558	N	0.096366	T	0.06962	0.0177	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.30822	-0.9965	10	0.13108	T	0.6	.	8.696	0.34296	0.4561:0.0:0.4431:0.1008	.	365	Q8IVL8	CBPO_HUMAN	S	365	ENSP00000272852:G365S	ENSP00000272852:G365S	G	+	1	0	CPO	207542373	0.003000	0.15002	0.000000	0.03702	0.003000	0.03518	0.030000	0.13688	-1.533000	0.01745	-1.163000	0.01768	GGC	CPO	-	NULL	ENSG00000144410		0.567	CPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPO	HGNC	protein_coding	OTTHUMT00000202040.2	-	0.00	47	0	G	NM_173077		207834128	+1	tier1	-	no_errors	ENST00000272852	ensembl	human	known	74_37	missense	9.38	58	6	SNP	0.000	A
CR2	1380	genome.wustl.edu	37	1	207648206	207648206	+	Silent	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr1:207648206G>A	ENST00000367058.3	+	13	2373	c.2184G>A	c.(2182-2184)ggG>ggA	p.G728G	CR2_ENST00000458541.2_Silent_p.G701G|CR2_ENST00000367059.3_Silent_p.G728G|CR2_ENST00000367057.3_Silent_p.G787G	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	728	Sushi 12. {ECO:0000255|PROSITE- ProRule:PRU00302}.				B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						TTGTCAATGGGAAGCACACAG	0.428																																																	0													87.0	97.0	93.0					1																	207648206		2202	4300	6502	SO:0001819	synonymous_variant	0			M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.2184G>A	1.37:g.207648206G>A			C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Silent	SNP	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.G787	ENST00000367058.3	37	c.2361	CCDS1478.1	1																																																																																			CR2	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000117322		0.428	CR2-001	KNOWN	basic|CCDS	protein_coding	CR2	HGNC	protein_coding	OTTHUMT00000088274.1		0.00	20	0	G	NM_001877		207648206	+1			no_errors	ENST00000367057	ensembl	human	known	74_37	silent	22.73	17	5	SNP	0.368	A
CRYGEP	200575	genome.wustl.edu	37	2	208977059	208977059	+	RNA	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr2:208977059G>A	ENST00000440809.1	-	0	173									crystallin, gamma E, pseudogene																		CGGCATAGTCGCCGCGGCGCA	0.677																																																	0																																												0			K03007		2q33.3	2012-02-29	2009-12-02	2009-12-02	ENSG00000229150	ENSG00000229150			2412	pseudogene	pseudogene			"""crystallin, gamma E pseudogene 1"""	CRYG5, CCL, CRYGEP1		8004095	Standard	NG_002762		Approved	G2			OTTHUMG00000154792		2.37:g.208977059G>A				RNA	SNP	-	NULL	ENST00000440809.1	37	NULL		2																																																																																			CRYGEP	-	-	ENSG00000229150		0.677	CRYGEP-002	KNOWN	basic	processed_transcript	CRYGEP	HGNC	pseudogene	OTTHUMT00000337069.1	-	0.00	52	0	G			208977059	-1	tier1	-	no_errors	ENST00000440809	ensembl	human	known	74_37	rna	15.66	70	13	SNP	0.958	A
CSMD1	64478	genome.wustl.edu	37	8	2966266	2966266	+	Missense_Mutation	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr8:2966266C>T	ENST00000520002.1	-	45	7171	c.6616G>A	c.(6616-6618)Ggt>Agt	p.G2206S	CSMD1_ENST00000537824.1_Missense_Mutation_p.G2205S|CSMD1_ENST00000602557.1_Missense_Mutation_p.G2206S|CSMD1_ENST00000602723.1_Missense_Mutation_p.G2206S|CSMD1_ENST00000400186.3_Missense_Mutation_p.G2206S|CSMD1_ENST00000542608.1_Missense_Mutation_p.G2205S			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2206	CUB 13. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TGATCGGGACCGTCCCTAGGA	0.453																																																	0													59.0	57.0	58.0					8																	2966266		1873	4119	5992	SO:0001583	missense	0					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.6616G>A	8.37:g.2966266C>T	ENSP00000430733:p.Gly2206Ser		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.G2206S	ENST00000520002.1	37	c.6616		8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.7|22.7	4.330473|4.330473	0.81690|0.81690	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608|ENST00000335551	T;T;T;T|.	0.26373|.	1.74;1.74;1.74;1.74|.	4.67|4.67	4.67|4.67	0.58626|0.58626	CUB (5);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.82972|0.82972	0.5153|0.5153	M|M	0.87269|0.87269	2.87|2.87	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	0.999;0.998;1.0|.	D|D	0.85987|0.85987	0.1486|0.1486	10|5	0.56958|.	D|.	0.05|.	.|.	17.9139|17.9139	0.88943|0.88943	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	2206;2206;2205|.	E5RIG2;Q96PZ7;F5H2I8|.	.;CSMD1_HUMAN;.|.	S|Q	2206;2206;2067;2205;2205|1685	ENSP00000383047:G2206S;ENSP00000430733:G2206S;ENSP00000441462:G2205S;ENSP00000446243:G2205S|.	ENSP00000320445:G2067S|.	G|R	-|-	1|2	0|0	CSMD1|CSMD1	2953673|2953673	1.000000|1.000000	0.71417|0.71417	0.447000|0.447000	0.26932|0.26932	0.493000|0.493000	0.33554|0.33554	7.444000|7.444000	0.80532|0.80532	2.277000|2.277000	0.76020|0.76020	0.478000|0.478000	0.44815|0.44815	GGT|CGG	CSMD1	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000183117		0.453	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	HGNC	protein_coding	OTTHUMT00000374500.2	-	0.00	40	0	C	NM_033225		2966266	-1	tier1	-	no_errors	ENST00000520002	ensembl	human	known	74_37	missense	32.35	23	11	SNP	1.000	T
CSMD2	114784	genome.wustl.edu	37	1	34042918	34042918	+	Silent	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr1:34042918G>A	ENST00000373381.4	-	49	7730	c.7554C>T	c.(7552-7554)agC>agT	p.S2518S		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2520	Sushi 14. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GGATGGCTTCGCTCCACAGGT	0.607																																																	0													72.0	70.0	71.0					1																	34042918		2203	4300	6503	SO:0001819	synonymous_variant	0			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.7554C>T	1.37:g.34042918G>A			B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.S2518	ENST00000373381.4	37	c.7554		1																																																																																			CSMD2	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000121904		0.607	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	CSMD2	HGNC	protein_coding		-	0.00	51	0	G	NM_052896		34042918	-1	tier1	-	no_errors	ENST00000373381	ensembl	human	known	74_37	silent	29.55	31	13	SNP	0.756	A
CSMD3	114788	genome.wustl.edu	37	8	114186075	114186075	+	Silent	SNP	G	G	A	rs151216366		TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr8:114186075G>A	ENST00000297405.5	-	4	829	c.585C>T	c.(583-585)gaC>gaT	p.D195D	CSMD3_ENST00000343508.3_Silent_p.D155D|CSMD3_ENST00000455883.2_Silent_p.D195D|CSMD3_ENST00000519485.1_5'Flank|CSMD3_ENST00000352409.3_Silent_p.D195D	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	195	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TGTCCCCGACGTCGAATCTTG	0.463										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							0								G	,,	0,4406		0,0,2203	120.0	109.0	112.0		585,585,465	-8.5	0.5	8	dbSNP_134	112	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	CSMD3	NM_052900.2,NM_198123.1,NM_198124.1	,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,	195/3539,195/3708,155/3668	114186075	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.585C>T	8.37:g.114186075G>A			Q96PZ3	Silent	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.D195	ENST00000297405.5	37	c.585	CCDS6315.1	8																																																																																			CSMD3	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000164796		0.463	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	-	0.00	46	0	G	NM_052900		114186075	-1	tier1	rs151216366	no_errors	ENST00000297405	ensembl	human	known	74_37	silent	5.48	69	4	SNP	0.124	A
CTSE	1510	genome.wustl.edu	37	1	206331026	206331026	+	Missense_Mutation	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr1:206331026C>T	ENST00000360218.2	+	8	994	c.890C>T	c.(889-891)tCg>tTg	p.S297L	CTSE_ENST00000361052.3_Silent_p.F349F|CTSE_ENST00000432969.2_Missense_Mutation_p.S222L|CTSE_ENST00000358184.2_Silent_p.F344F	NM_148964.2	NP_683865.1	P14091	CATE_HUMAN	cathepsin E	0					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|digestion (GO:0007586)|protein autoprocessing (GO:0016540)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)	p.S297L(1)|p.F344F(1)		endometrium(2)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|skin(3)	16			BRCA - Breast invasive adenocarcinoma(75;0.0754)			CACAGGACTTCGTGGATGGAA	0.557																																																	2	Substitution - Missense(1)|Substitution - coding silent(1)	lung(2)											187.0	183.0	184.0					1																	206331026		2203	4300	6503	SO:0001583	missense	0			BC042537	CCDS73012.1, CCDS73013.1	1q32.1	2008-02-05			ENSG00000196188	ENSG00000196188	3.4.23.5	"""Cathepsins"""	2530	protein-coding gene	gene with protein product		116890				2369841, 2674141	Standard	NM_001910		Approved		uc001hdu.3	P14091	OTTHUMG00000036121	ENST00000360218.2:c.890C>T	1.37:g.206331026C>T	ENSP00000353350:p.Ser297Leu		Q5TZ01|Q5TZ02|Q9NY58|Q9UCE3|Q9UCE4	Missense_Mutation	SNP	pfam_Aspartic_peptidase,pfam_Aspartic_peptidase_N,superfamily_Peptidase_aspartic_dom,prints_Aspartic_peptidase	p.S297L	ENST00000360218.2	37	c.890	CCDS1461.1	1	.	.	.	.	.	.	.	.	.	.	c	9.742	1.165133	0.21538	.	.	ENSG00000196188	ENST00000360218;ENST00000432969	T;T	0.64991	0.55;-0.13	4.98	-9.48	0.00591	.	.	.	.	.	T	0.38639	0.1048	.	.	.	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.01281	0.0;0.0	T	0.32719	-0.9896	8	0.62326	D	0.03	.	2.7003	0.05146	0.1562:0.1927:0.1607:0.4905	.	222;297	B4DNU8;P14091-2	.;.	L	297;222	ENSP00000353350:S297L;ENSP00000394607:S222L	ENSP00000353350:S297L	S	+	2	0	CTSE	204497649	0.000000	0.05858	0.008000	0.14137	0.399000	0.30720	-4.309000	0.00255	-1.870000	0.01139	-0.269000	0.10298	TCG	CTSE	-	NULL	ENSG00000196188		0.557	CTSE-002	KNOWN	basic|CCDS	protein_coding	CTSE	HGNC	protein_coding	OTTHUMT00000087999.1	-	0.00	42	0	C	NM_001910		206331026	+1	tier1	-	no_errors	ENST00000360218	ensembl	human	known	74_37	missense	36.59	26	15	SNP	0.000	T
RTP5	285093	genome.wustl.edu	37	2	242813928	242813928	+	Missense_Mutation	SNP	T	T	C	rs371424823		TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr2:242813928T>C	ENST00000343216.3	+	2	249	c.221T>C	c.(220-222)cTg>cCg	p.L74P		NM_173821.2	NP_776182.2																					CTCTTCCACCTGTGGTGGGAC	0.687																																																	0													10.0	12.0	11.0					2																	242813928		1934	4127	6061	SO:0001583	missense	0																														ENST00000343216.3:c.221T>C	2.37:g.242813928T>C	ENSP00000345374:p.Leu74Pro			Missense_Mutation	SNP	NULL	p.L74P	ENST00000343216.3	37	c.221	CCDS42843.1	2	.	.	.	.	.	.	.	.	.	.	.	12.25	1.880529	0.33255	.	.	ENSG00000188011	ENST00000343216	T	0.24723	1.84	2.77	2.77	0.32553	.	.	.	.	.	T	0.30166	0.0756	N	0.22421	0.69	0.39423	D	0.966944	D	0.71674	0.998	D	0.65874	0.939	T	0.12889	-1.0530	9	0.87932	D	0	-8.1399	7.4275	0.27107	0.0:0.0:0.0:1.0	.	74	Q14D33	CB085_HUMAN	P	74	ENSP00000345374:L74P	ENSP00000345374:L74P	L	+	2	0	C2orf85	242462601	0.550000	0.26489	0.981000	0.43875	0.220000	0.24768	1.428000	0.34892	1.537000	0.49254	0.364000	0.22116	CTG	CXXC11	-	NULL	ENSG00000188011		0.687	CXXC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXXC11	HGNC	protein_coding	OTTHUMT00000322310.1		0.00	71	0	T			242813928	+1			no_errors	ENST00000343216	ensembl	human	known	74_37	missense	5.45	51	3	SNP	0.984	C
CYP4B1	1580	genome.wustl.edu	37	1	47280896	47280896	+	Nonsense_Mutation	SNP	G	G	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr1:47280896G>T	ENST00000271153.4	+	8	1066	c.1030G>T	c.(1030-1032)Gag>Tag	p.E344*	CYP4B1_ENST00000371919.4_Nonsense_Mutation_p.E330*|CYP4B1_ENST00000452782.2_Nonsense_Mutation_p.E182*|CYP4B1_ENST00000371923.4_Nonsense_Mutation_p.E345*			P13584	CP4B1_HUMAN	cytochrome P450, family 4, subfamily B, polypeptide 1	344					biphenyl metabolic process (GO:0018879)|exogenous drug catabolic process (GO:0042738)|fluorene metabolic process (GO:0018917)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|drug binding (GO:0008144)|fluorene oxygenase activity (GO:0018585)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	36	Acute lymphoblastic leukemia(166;0.155)				Midazolam(DB00683)|Phenobarbital(DB01174)|Thiamine(DB00152)	TTGTAGAGAGGAGGTCCGCGA	0.572																																																	0													109.0	90.0	96.0					1																	47280896		2203	4300	6503	SO:0001587	stop_gained	0			BC017758	CCDS542.1, CCDS41328.1	1p33	2013-11-11	2003-01-14		ENSG00000142973	ENSG00000142973		"""Cytochrome P450s"""	2644	protein-coding gene	gene with protein product		124075	"""cytochrome P450, subfamily IVB, polypeptide 1"""				Standard	NM_000779		Approved		uc001cqn.4	P13584	OTTHUMG00000007984	ENST00000271153.4:c.1030G>T	1.37:g.47280896G>T	ENSP00000271153:p.Glu344*		Q1HBI2|Q8TD85|Q8WWF2|Q8WWU9|Q8WWV0	Nonsense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.E345*	ENST00000271153.4	37	c.1033	CCDS542.1	1	.	.	.	.	.	.	.	.	.	.	g	27.2	4.811553	0.90707	.	.	ENSG00000142973	ENST00000371923;ENST00000271153;ENST00000371919;ENST00000452782;ENST00000468637	.	.	.	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.168	0.98156	0.0:0.0:1.0:0.0	.	.	.	.	X	345;344;330;182;181	.	ENSP00000271153:E344X	E	+	1	0	CYP4B1	47053483	1.000000	0.71417	0.996000	0.52242	0.013000	0.08279	7.896000	0.87350	2.782000	0.95742	0.643000	0.83706	GAG	CYP4B1	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I	ENSG00000142973		0.572	CYP4B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CYP4B1	HGNC	protein_coding	OTTHUMT00000021911.1		0.00	28	0	G	NM_000779		47280896	+1			no_errors	ENST00000371923	ensembl	human	known	74_37	nonsense	13.33	39	6	SNP	1.000	T
DDX24	57062	genome.wustl.edu	37	14	94528651	94528651	+	Silent	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr14:94528651G>A	ENST00000330836.5	-	3	1166	c.1035C>T	c.(1033-1035)atC>atT	p.I345I	DDX24_ENST00000555054.1_Silent_p.I302I|DDX24_ENST00000544005.1_Silent_p.I95I	NM_020414.3	NP_065147.1	Q9GZR7	DDX24_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 24	345	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				RNA metabolic process (GO:0016070)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			cervix(3)|endometrium(4)|kidney(4)|large_intestine(5)|lung(3)|ovary(2)|skin(1)|urinary_tract(1)	23		all_cancers(154;0.12)		Epithelial(152;0.114)|all cancers(159;0.19)|COAD - Colon adenocarcinoma(157;0.207)		GTTTCTCCCTGATCAGGGAAG	0.493																																																	0													136.0	130.0	132.0					14																	94528651		2203	4300	6503	SO:0001819	synonymous_variant	0			AF214731	CCDS9918.1	14q32	2013-07-16	2013-07-16			ENSG00000089737		"""DEAD-boxes"""	13266	protein-coding gene	gene with protein product		606181	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 24"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 24"""			10936056, 18289627	Standard	NM_020414		Approved		uc001ycj.3	Q9GZR7		ENST00000330836.5:c.1035C>T	14.37:g.94528651G>A			E7EMJ4|Q4V9L5	Silent	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.I345	ENST00000330836.5	37	c.1035	CCDS9918.1	14																																																																																			DDX24	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000089737		0.493	DDX24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX24	HGNC	protein_coding	OTTHUMT00000412861.1	-	0.00	64	0	G	NM_020414		94528651	-1	tier1	-	no_errors	ENST00000330836	ensembl	human	known	74_37	silent	13.75	69	11	SNP	0.002	A
DIP2C	22982	genome.wustl.edu	37	10	408572	408572	+	Silent	SNP	G	G	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr10:408572G>C	ENST00000280886.6	-	22	2739	c.2652C>G	c.(2650-2652)acC>acG	p.T884T	DIP2C_ENST00000381496.3_3'UTR|DIP2C_ENST00000540204.1_Silent_p.T205T	NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	884						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		TTTTGGGGAGGGTGTTTGCTG	0.463																																																	0													81.0	88.0	86.0					10																	408572		2203	4300	6503	SO:0001819	synonymous_variant	0			BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.2652C>G	10.37:g.408572G>C			B4DPI5|Q5SS78	Silent	SNP	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.T884	ENST00000280886.6	37	c.2652	CCDS7054.1	10																																																																																			DIP2C	-	NULL	ENSG00000151240		0.463	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DIP2C	HGNC	protein_coding	OTTHUMT00000046389.1	-	0.00	42	0	G	NM_014974		408572	-1	tier1	-	no_errors	ENST00000280886	ensembl	human	known	74_37	silent	33.33	36	18	SNP	0.996	C
DNAJA4	55466	genome.wustl.edu	37	15	78572425	78572425	+	Missense_Mutation	SNP	G	G	T	rs535195018		TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr15:78572425G>T	ENST00000394852.3	+	6	1106	c.916G>T	c.(916-918)Gat>Tat	p.D306Y	DNAJA4_ENST00000343789.3_Missense_Mutation_p.D306Y|DNAJA4_ENST00000394855.3_Missense_Mutation_p.D335Y|DNAJA4_ENST00000446172.2_Missense_Mutation_p.D279Y|RP11-762H8.4_ENST00000558192.1_RNA	NM_001130182.1	NP_001123654.1	Q8WW22	DNJA4_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 4	306					negative regulation of inclusion body assembly (GO:0090084)|protein refolding (GO:0042026)|response to heat (GO:0009408)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|unfolded protein binding (GO:0051082)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	8						ATGCGTGCGCGATGAAGGAAT	0.478																																																	0													105.0	91.0	95.0					15																	78572425		2196	4293	6489	SO:0001583	missense	0			AF116663	CCDS10299.2, CCDS45316.1, CCDS45317.1	15q24.1	2011-09-02			ENSG00000140403	ENSG00000140403		"""Heat shock proteins / DNAJ (HSP40)"""	14885	protein-coding gene	gene with protein product						11147971	Standard	NM_018602		Approved	PRO1472	uc002bdi.3	Q8WW22	OTTHUMG00000143733	ENST00000394852.3:c.916G>T	15.37:g.78572425G>T	ENSP00000378321:p.Asp306Tyr		E9PDM9|Q6AW87|Q8N5Z4|Q8N7P2	Missense_Mutation	SNP	pfam_DnaJ_domain,pfam_DnaJ_C,pfam_HSP_DnaJ_Cys-rich_dom,superfamily_DnaJ_domain,superfamily_HSP40/DnaJ_pept-bd,superfamily_HSP_DnaJ_Cys-rich_dom,smart_DnaJ_domain,pfscan_DnaJ_domain,pfscan_HSP_DnaJ_Cys-rich_dom,prints_DnaJ_domain	p.D335Y	ENST00000394852.3	37	c.1003	CCDS45316.1	15	.	.	.	.	.	.	.	.	.	.	G	11.09	1.537287	0.27475	.	.	ENSG00000140403	ENST00000394855;ENST00000343789;ENST00000394852;ENST00000446172	T;T;T;T	0.47177	0.85;0.85;0.85;0.85	5.17	-0.24	0.13047	Chaperone DnaJ, C-terminal (1);HSP40/DnaJ peptide-binding (1);	0.140562	0.64402	D	0.000007	T	0.57814	0.2079	M	0.74389	2.26	0.80722	D	1	P;P;P	0.48834	0.916;0.591;0.537	P;P;B	0.57204	0.815;0.725;0.441	T	0.57670	-0.7771	10	0.87932	D	0	-22.7133	9.0116	0.36144	0.6681:0.0:0.3319:0.0	.	279;306;335	E9PDM9;Q8WW22;Q8WW22-2	.;DNJA4_HUMAN;.	Y	335;306;306;279	ENSP00000378324:D335Y;ENSP00000339581:D306Y;ENSP00000378321:D306Y;ENSP00000413499:D279Y	ENSP00000339581:D306Y	D	+	1	0	DNAJA4	76359480	0.970000	0.33590	0.000000	0.03702	0.001000	0.01503	2.588000	0.46137	-0.310000	0.08766	-0.312000	0.09012	GAT	DNAJA4	-	pfam_DnaJ_C,superfamily_HSP40/DnaJ_pept-bd	ENSG00000140403		0.478	DNAJA4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJA4	HGNC	protein_coding	OTTHUMT00000289801.1		0.00	62	0	G	NM_018602		78572425	+1			no_errors	ENST00000394855	ensembl	human	known	74_37	missense	7.14	26	2	SNP	0.426	T
DPH7	92715	genome.wustl.edu	37	9	140473262	140473262	+	5'UTR	SNP	T	T	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr9:140473262T>C	ENST00000277540.2	-	0	125				DPH7_ENST00000479650.1_5'UTR	NM_138778.2	NP_620133.1	Q9BTV6	DPH7_HUMAN	diphthamide biosynthesis 7						peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)												GAGCCGGCAGTAGAGGCGGGT	0.761																																																	0													5.0	5.0	5.0					9																	140473262		2038	4046	6084	SO:0001623	5_prime_UTR_variant	0			AK075115	CCDS7047.1	9q34.3	2013-06-20	2013-06-20	2013-06-20	ENSG00000148399	ENSG00000148399		"""WD repeat domain containing"""	25199	protein-coding gene	gene with protein product		613210	"""chromosome 9 open reading frame 112"", ""WD repeat domain 85"""	C9orf112, WDR85		23486472	Standard	NM_138778		Approved	FLJ90634, RRT2	uc004cnk.1	Q9BTV6	OTTHUMG00000020991	ENST00000277540.2:c.-33A>G	9.37:g.140473262T>C			Q96AB7	RNA	SNP	-	NULL	ENST00000277540.2	37	NULL	CCDS7047.1	9																																																																																			DPH7	-	-	ENSG00000148399		0.761	DPH7-009	KNOWN	basic|appris_principal|CCDS	protein_coding	DPH7	HGNC	protein_coding	OTTHUMT00000055350.1	-	0.00	44	0	T	NM_138778		140473262	-1	tier1	-	no_errors	ENST00000467768	ensembl	human	known	74_37	rna	53.57	13	15	SNP	0.000	C
DSCC1	79075	genome.wustl.edu	37	8	120847177	120847177	+	Missense_Mutation	SNP	G	G	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr8:120847177G>C	ENST00000313655.4	-	9	1352	c.1138C>G	c.(1138-1140)Caa>Gaa	p.Q380E	TAF2_ENST00000378164.2_5'Flank	NM_024094.2	NP_076999.2	Q9BVC3	DCC1_HUMAN	DNA replication and sister chromatid cohesion 1	380					DNA replication (GO:0006260)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|post-translational protein acetylation (GO:0034421)|regulation of DNA replication (GO:0006275)	chromatin (GO:0000785)|chromosome, centromeric region (GO:0000775)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			NS(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(1)|pancreas(1)	9	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			ACACCATTTTGCATCGAAGAA	0.323																																																	0													83.0	86.0	85.0					8																	120847177		2203	4298	6501	SO:0001583	missense	0				CCDS6330.1	8q24.12	2013-05-24	2013-05-24		ENSG00000136982	ENSG00000136982			24453	protein-coding gene	gene with protein product	"""defective in sister chromatid cohesion homolog 1 (S. cerevisiae)"""	613203	"""defective in sister chromatid cohesion 1 homolog (S. cerevisiae)"""			12766176, 20826785	Standard	NM_024094		Approved	DCC1, hDCC1, MGC5528	uc003yov.3	Q9BVC3	OTTHUMG00000165010	ENST00000313655.4:c.1138C>G	8.37:g.120847177G>C	ENSP00000322180:p.Gln380Glu		Q969N5	Missense_Mutation	SNP	pfam_Sister_chromatid_cohesion_Dcc1	p.Q380E	ENST00000313655.4	37	c.1138	CCDS6330.1	8	.	.	.	.	.	.	.	.	.	.	G	18.38	3.610328	0.66558	.	.	ENSG00000136982	ENST00000313655	T	0.44482	0.92	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.37348	0.1000	L	0.60455	1.87	0.53005	D	0.999961	P	0.35174	0.488	B	0.32928	0.155	T	0.35151	-0.9800	10	0.02654	T	1	-17.3673	18.8521	0.92237	0.0:0.0:1.0:0.0	.	380	Q9BVC3	DCC1_HUMAN	E	380	ENSP00000322180:Q380E	ENSP00000322180:Q380E	Q	-	1	0	DSCC1	120916358	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	7.737000	0.84957	2.538000	0.85594	0.655000	0.94253	CAA	DSCC1	-	NULL	ENSG00000136982		0.323	DSCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCC1	HGNC	protein_coding	OTTHUMT00000381443.1	-	0.00	92	0	G	NM_024094		120847177	-1	tier1	-	no_errors	ENST00000313655	ensembl	human	known	74_37	missense	16.13	78	15	SNP	1.000	C
DUSP22	56940	genome.wustl.edu	37	6	348942	348942	+	Intron	SNP	G	G	A	rs550684592	byFrequency	TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr6:348942G>A	ENST00000344450.5	+	7	951				DUSP22_ENST00000604971.1_Silent_p.T100T|DUSP22_ENST00000603453.1_Silent_p.T100T|DUSP22_ENST00000419235.2_Silent_p.T203T|DUSP22_ENST00000605315.1_Silent_p.T100T|DUSP22_ENST00000605035.1_3'UTR	NM_020185.3	NP_064570.1	Q9NRW4	DUS22_HUMAN	dual specificity phosphatase 22						apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of JNK cascade (GO:0046330)|protein dephosphorylation (GO:0006470)|regulation of cell proliferation (GO:0042127)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(2)	26	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)		ATTATACGACGGAGACCTAAC	0.617													G|||	3	0.000599042	0.0015	0.0	5008	,	,		37449	0.0		0.0	False		,,,				2504	0.001																0																																										SO:0001627	intron_variant	0			AF165519	CCDS4468.1, CCDS69035.1	6p25.3	2013-09-19			ENSG00000112679	ENSG00000112679		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	16077	protein-coding gene	gene with protein product						9205128, 11717427	Standard	NM_001286555		Approved	MKPX, JSP1, JKAP, VHX	uc003msx.3	Q9NRW4	OTTHUMG00000014113	ENST00000344450.5:c.508+101G>A	6.37:g.348942G>A			B4DK56|Q59GW2|Q5VWR2|Q96AR1	Silent	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Dual-sp_phosphatase_subgr_cat,prints_Atypical_DUSP,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.T203	ENST00000344450.5	37	c.609	CCDS4468.1	6	.	.	.	.	.	.	.	.	.	.	G	0.375	-0.932119	0.02359	.	.	ENSG00000112679	ENST00000419235	.	.	.	4.8	-4.35	0.03656	.	.	.	.	.	T	0.37073	0.0990	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47235	-0.9133	4	.	.	.	.	9.8271	0.40919	0.6667:0.1121:0.2212:0.0	.	.	.	.	R	141	.	.	G	+	1	0	DUSP22	293942	0.074000	0.21230	0.005000	0.12908	0.026000	0.11368	-0.350000	0.07721	-1.385000	0.02101	-0.136000	0.14681	GGA	DUSP22	-	NULL	ENSG00000112679		0.617	DUSP22-001	KNOWN	basic|CCDS	protein_coding	DUSP22	HGNC	protein_coding	OTTHUMT00000039621.1		0.00	24	0	G	NM_020185		348942	+1			no_errors	ENST00000419235	ensembl	human	known	74_37	silent	11.11	24	3	SNP	0.048	A
DZIP3	9666	genome.wustl.edu	37	3	108353773	108353773	+	Missense_Mutation	SNP	G	G	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr3:108353773G>T	ENST00000361582.3	+	10	1102	c.872G>T	c.(871-873)tGc>tTc	p.C291F	DZIP3_ENST00000463306.1_Missense_Mutation_p.C291F	NM_014648.3	NP_055463.1	Q86Y13	DZIP3_HUMAN	DAZ interacting zinc finger protein 3	291					protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(21)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	45						CATAAAATTTGCTGGAAAAAG	0.313																																																	0													70.0	75.0	74.0					3																	108353773		2201	4295	6496	SO:0001583	missense	0			AF279370	CCDS2952.1	3q13.13	2013-05-22	2013-05-22		ENSG00000198919	ENSG00000198919		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30938	protein-coding gene	gene with protein product	"""human RNA-binding ubiquitin ligase of 138 kDa"", ""protein phosphatase 1, regulatory subunit 66"""	608672	"""DAZ interacting protein 3, zinc finger"""			9734811, 12538761	Standard	NM_014648		Approved	hRUL138, PPP1R66	uc003dxd.3	Q86Y13	OTTHUMG00000159232	ENST00000361582.3:c.872G>T	3.37:g.108353773G>T	ENSP00000355028:p.Cys291Phe		B3KN01|O75162|Q6P3R9|Q6PH82|Q86Y14|Q86Y15|Q86Y16|Q8IWI0|Q96RS9	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.C291F	ENST00000361582.3	37	c.872	CCDS2952.1	3	.	.	.	.	.	.	.	.	.	.	g	16.99	3.274390	0.59649	.	.	ENSG00000198919	ENST00000393969;ENST00000361582;ENST00000479138;ENST00000463306	T;T;T	0.40756	1.02;1.02;1.02	5.08	5.08	0.68730	.	0.000000	0.56097	D	0.000024	T	0.49201	0.1543	N	0.19112	0.55	0.41908	D	0.990454	D;P	0.76494	0.999;0.481	D;B	0.83275	0.996;0.355	T	0.54057	-0.8350	10	0.87932	D	0	-9.4169	13.8419	0.63444	0.0:0.0:1.0:0.0	.	291;291	C9J9M8;Q86Y13	.;DZIP3_HUMAN	F	291	ENSP00000355028:C291F;ENSP00000418115:C291F;ENSP00000419981:C291F	ENSP00000355028:C291F	C	+	2	0	DZIP3	109836463	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.216000	0.58540	2.617000	0.88574	0.637000	0.83480	TGC	DZIP3	-	NULL	ENSG00000198919		0.313	DZIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DZIP3	HGNC	protein_coding	OTTHUMT00000353968.1	-	0.00	111	0	G	NM_014648		108353773	+1	tier1	-	no_errors	ENST00000361582	ensembl	human	known	74_37	missense	12.37	85	12	SNP	1.000	T
EFR3B	22979	genome.wustl.edu	37	2	25344587	25344587	+	Missense_Mutation	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr2:25344587C>T	ENST00000403714.3	+	5	592	c.409C>T	c.(409-411)Cgg>Tgg	p.R137W	EFR3B_ENST00000402191.1_Missense_Mutation_p.R102W|EFR3B_ENST00000405108.1_5'UTR|EFR3B_ENST00000401432.3_Missense_Mutation_p.R137W	NM_014971.1	NP_055786.1	Q9Y2G0	EFR3B_HUMAN	EFR3 homolog B (S. cerevisiae)	137										endometrium(1)	1						GTCCTATCACCGGAGCTATGA	0.502																																																	0													213.0	167.0	181.0					2																	25344587		692	1591	2283	SO:0001583	missense	0			AB023170	CCDS46231.1	2p24.1	2008-02-05	2007-11-14	2007-11-14	ENSG00000084710	ENSG00000084710			29155	protein-coding gene	gene with protein product			"""KIAA0953"""	KIAA0953		10231032	Standard	NM_014971		Approved	FLJ37871	uc010eyh.3	Q9Y2G0	OTTHUMG00000151988	ENST00000403714.3:c.409C>T	2.37:g.25344587C>T	ENSP00000384081:p.Arg137Trp		B7WPL8|Q86XU6	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.R137W	ENST00000403714.3	37	c.409	CCDS46231.1	2	.	.	.	.	.	.	.	.	.	.	C	18.44	3.623751	0.66901	.	.	ENSG00000084710	ENST00000401432;ENST00000403714;ENST00000402191;ENST00000545169;ENST00000264719	T;T;T;T	0.65916	-0.18;-0.18;1.96;1.96	4.38	2.48	0.30137	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.78291	0.4260	M	0.83384	2.64	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.79448	-0.1799	10	0.87932	D	0	-27.1134	11.5755	0.50858	0.3504:0.6496:0.0:0.0	.	137;137	Q9Y2G0;Q9Y2G0-3	EFR3B_HUMAN;.	W	137;137;102;102;16	ENSP00000386082:R137W;ENSP00000384081:R137W;ENSP00000385832:R102W;ENSP00000264719:R16W	ENSP00000264719:R16W	R	+	1	2	EFR3B	25198091	1.000000	0.71417	0.625000	0.29200	0.724000	0.41520	2.997000	0.49457	0.417000	0.25871	0.491000	0.48974	CGG	EFR3B	-	superfamily_ARM-type_fold	ENSG00000084710		0.502	EFR3B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EFR3B	HGNC	protein_coding	OTTHUMT00000324808.1	-	0.00	65	0	C	NM_014971		25344587	+1	tier1	-	no_errors	ENST00000403714	ensembl	human	known	74_37	missense	12.96	47	7	SNP	1.000	T
EGR4	1961	genome.wustl.edu	37	2	73519308	73519308	+	Silent	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr2:73519308G>A	ENST00000545030.1	-	2	1121	c.1047C>T	c.(1045-1047)atC>atT	p.I349I	EGR4_ENST00000436467.2_Silent_p.I246I	NM_001965.3	NP_001956.3	Q05215	EGR4_HUMAN	early growth response 4	349	Pro-rich.				cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						CAGGGCAGCTGATGGACAGCA	0.652																																																	0													16.0	19.0	18.0					2																	73519308		2176	4282	6458	SO:0001819	synonymous_variant	0				CCDS1925.2	2p13	2013-01-08			ENSG00000135625	ENSG00000135625		"""Zinc fingers, C2H2-type"""	3241	protein-coding gene	gene with protein product		128992				1584812	Standard	NM_001965		Approved	NGFI-C, PAT133	uc010yrj.2	Q05215	OTTHUMG00000129774	ENST00000545030.1:c.1047C>T	2.37:g.73519308G>A			B2RAE3|G3V1T5|Q2Z1P5	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.I349	ENST00000545030.1	37	c.1047	CCDS1925.2	2																																																																																			EGR4	-	NULL	ENSG00000135625		0.652	EGR4-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EGR4	HGNC	protein_coding		-	0.00	54	0	G	NM_001965		73519308	-1	tier1	-	no_errors	ENST00000545030	ensembl	human	known	74_37	silent	30.43	48	21	SNP	1.000	A
ZNF540	163255	genome.wustl.edu	37	19	38039815	38039815	+	5'Flank	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr19:38039815C>T	ENST00000592533.1	+	0	0				ZNF571-AS1_ENST00000586139.1_RNA|ZNF571-AS1_ENST00000585578.1_RNA|ZNF571-AS1_ENST00000587121.1_RNA|ZNF571-AS1_ENST00000592575.1_RNA|ZNF571-AS1_ENST00000590838.1_RNA|ZNF571-AS1_ENST00000591430.1_RNA|ZNF571-AS1_ENST00000592392.1_RNA|ZNF571-AS1_ENST00000588382.1_RNA|CTD-3064H18.4_ENST00000316807.2_RNA|ZNF571-AS1_ENST00000589802.1_RNA|ZNF571-AS1_ENST00000586013.1_RNA|ZNF571-AS1_ENST00000589750.1_RNA	NM_152606.4	NP_689819.1	Q8NDQ6	ZN540_HUMAN	zinc finger protein 540						negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(13)|lung(8)|skin(1)	28			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CCACCGTTGCCGGGGGACTGG	0.697																																																	0																																										SO:0001631	upstream_gene_variant	0			AL832315	CCDS12506.1, CCDS54258.1	19q13.13	2013-01-08				ENSG00000171817		"""Zinc fingers, C2H2-type"", ""-"""	25331	protein-coding gene	gene with protein product		613903					Standard	NM_152606		Approved	DKFZp547B0714	uc002ogq.4	Q8NDQ6			19.37:g.38039815C>T	Exception_encountered		A0AVS5|A8K371|Q05D58|Q3LIC5|Q6ZN36|Q7Z3C8|Q86T31	RNA	SNP	-	NULL	ENST00000592533.1	37	NULL	CCDS12506.1	19	.	.	.	.	.	.	.	.	.	.	C	9.430	1.085230	0.20390	.	.	ENSG00000180458	ENST00000316807	.	.	.	0.364	0.364	0.16124	.	.	.	.	.	T	0.54967	0.1891	.	.	.	.	.	.	.	.	.	.	.	.	T	0.65146	-0.6239	3	0.87932	D	0	.	.	.	.	.	.	.	.	S	63	.	ENSP00000324876:G63S	G	-	1	0	AC022148.1	42731655	0.139000	0.22563	0.006000	0.13384	0.005000	0.04900	0.212000	0.17497	0.406000	0.25560	0.407000	0.27541	GGC	CTD-3064H18.4	-	-	ENSG00000180458		0.697	ZNF540-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000180458	Clone_based_vega_gene	protein_coding	OTTHUMT00000459481.1	-	0.00	76	0	C	NM_152606		38039815	-1	tier1	-	no_errors	ENST00000316807	ensembl	human	known	74_37	rna	21.21	52	14	SNP	0.006	T
ZNF540	163255	genome.wustl.edu	37	19	38039849	38039849	+	5'Flank	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr19:38039849G>A	ENST00000592533.1	+	0	0				ZNF571-AS1_ENST00000586139.1_RNA|ZNF571-AS1_ENST00000585578.1_RNA|ZNF571-AS1_ENST00000587121.1_RNA|ZNF571-AS1_ENST00000592575.1_RNA|ZNF571-AS1_ENST00000590838.1_RNA|ZNF571-AS1_ENST00000591430.1_RNA|ZNF571-AS1_ENST00000592392.1_RNA|ZNF571-AS1_ENST00000588382.1_RNA|CTD-3064H18.4_ENST00000316807.2_RNA|ZNF571-AS1_ENST00000589802.1_RNA|ZNF571-AS1_ENST00000586013.1_RNA|ZNF571-AS1_ENST00000589750.1_RNA	NM_152606.4	NP_689819.1	Q8NDQ6	ZN540_HUMAN	zinc finger protein 540						negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(13)|lung(8)|skin(1)	28			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GCCCCCAGGCGTCTGTGGCAG	0.687																																																	0																																										SO:0001631	upstream_gene_variant	0			AL832315	CCDS12506.1, CCDS54258.1	19q13.13	2013-01-08				ENSG00000171817		"""Zinc fingers, C2H2-type"", ""-"""	25331	protein-coding gene	gene with protein product		613903					Standard	NM_152606		Approved	DKFZp547B0714	uc002ogq.4	Q8NDQ6			19.37:g.38039849G>A	Exception_encountered		A0AVS5|A8K371|Q05D58|Q3LIC5|Q6ZN36|Q7Z3C8|Q86T31	RNA	SNP	-	NULL	ENST00000592533.1	37	NULL	CCDS12506.1	19																																																																																			CTD-3064H18.4	-	-	ENSG00000180458		0.687	ZNF540-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000180458	Clone_based_vega_gene	protein_coding	OTTHUMT00000459481.1		0.00	53	0	G	NM_152606		38039849	-1			no_errors	ENST00000316807	ensembl	human	known	74_37	rna	8.51	43	4	SNP	0.005	A
EID2B	126272	genome.wustl.edu	37	19	40022958	40022958	+	Nonstop_Mutation	SNP	C	C	G			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr19:40022958C>G	ENST00000326282.4	-	1	536	c.485G>C	c.(484-486)tGa>tCa	p.*162S	EID2B_ENST00000601837.1_Intron|CTB-60E11.9_ENST00000594676.1_RNA	NM_152361.1	NP_689574.1			EP300 interacting inhibitor of differentiation 2B											endometrium(1)|lung(1)|urinary_tract(1)	3	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;8.61e-26)|all cancers(26;2.76e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			ACAGCCGACTCAGTCGGCCAG	0.557																																																	0													32.0	30.0	31.0					19																	40022958		2201	4299	6500	SO:0001578	stop_lost	0			AK096263	CCDS12539.1	19q13.2	2008-02-05				ENSG00000176401			26796	protein-coding gene	gene with protein product						15970276	Standard	NM_152361		Approved	EID-3, FLJ38944	uc002olz.1	Q96D98		ENST00000326282.4:c.485G>C	19.37:g.40022958C>G				Nonstop_Mutation	SNP	NULL	p.*162S	ENST00000326282.4	37	c.485	CCDS12539.1	19	.	.	.	.	.	.	.	.	.	.	C	11.87	1.767224	0.31320	.	.	ENSG00000176401	ENST00000326282	.	.	.	2.28	1.21	0.21127	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.7572	0.08589	0.0:0.7332:0.0:0.2668	.	.	.	.	S	162	.	.	X	-	2	2	EID2B	44714798	0.075000	0.21258	0.172000	0.22920	0.836000	0.47400	0.082000	0.14847	0.465000	0.27167	0.460000	0.39030	TGA	EID2B	-	NULL	ENSG00000176401		0.557	EID2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EID2B	HGNC	protein_coding	OTTHUMT00000464961.1	-	0.00	33	0	C	NM_152361		40022958	-1	tier1	-	no_errors	ENST00000326282	ensembl	human	known	74_37	nonstop	30.30	23	10	SNP	0.215	G
ERLIN2	11160	genome.wustl.edu	37	8	37593499	37593499	+	5'Flank	SNP	G	G	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr8:37593499G>C	ENST00000276461.5	+	0	0				ERLIN2_ENST00000335171.6_5'Flank|ERLIN2_ENST00000519638.1_5'Flank|ERLIN2_ENST00000518586.1_5'Flank|ERLIN2_ENST00000397228.2_5'Flank|ERLIN2_ENST00000523887.1_5'Flank|RP11-863K10.2_ENST00000523507.1_RNA|RP11-863K10.7_ENST00000330539.1_Missense_Mutation_p.P173A|ERLIN2_ENST00000523107.1_5'Flank	NM_007175.6	NP_009106.1	O94905	ERLN2_HUMAN	ER lipid raft associated 2						cell death (GO:0008219)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)				NS(1)|large_intestine(1)|lung(5)	7		Lung NSC(58;0.174)	BRCA - Breast invasive adenocarcinoma(5;6.14e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			AAAAAAAAAggccgcgcatgg	0.463																																																	0																																										SO:0001631	upstream_gene_variant	0			AY358108	CCDS6095.1, CCDS34879.1	8p11.2	2012-11-23	2007-01-26	2007-01-26	ENSG00000147475	ENSG00000147475			1356	protein-coding gene	gene with protein product		611605	"""chromosome 8 open reading frame 2"", ""SPFH domain family, member 2"""	C8orf2, SPFH2, Erlin-2		10449903, 15897872, 16835267	Standard	NM_007175		Approved	NET32, SPG18	uc003xke.4	O94905	OTTHUMG00000164005		8.37:g.37593499G>C	Exception_encountered		A0JLQ1|A8K5S9|B4DM38|D3DSW0|Q6NW21|Q86VS6|Q86W49	Missense_Mutation	SNP	NULL	p.P173A	ENST00000276461.5	37	c.517	CCDS6095.1	8	.	.	.	.	.	.	.	.	.	.	G	4.323	0.059235	0.08339	.	.	ENSG00000183154	ENST00000330539	T	0.05786	3.39	0.225	0.225	0.15325	.	.	.	.	.	T	0.06325	0.0163	.	.	.	.	.	.	D	0.55385	0.971	B	0.42188	0.379	T	0.29912	-0.9996	6	0.72032	D	0.01	.	.	.	.	.	173	B7WP66	.	A	173	ENSP00000328874:P173A	ENSP00000328874:P173A	P	-	1	0	RP11-863K10.7	37712657	.	.	0.004000	0.12327	0.026000	0.11368	.	.	0.300000	0.22699	0.305000	0.20034	CCT	RP11-863K10.7	-	NULL	ENSG00000183154		0.463	ERLIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000183154	Clone_based_vega_gene	protein_coding	OTTHUMT00000376712.2	-	0.00	24	0	G	NM_007175		37593499	-1	tier1	-	no_errors	ENST00000330539	ensembl	human	putative	74_37	missense	14.81	23	4	SNP	0.004	C
RP11-754I20.1	0	genome.wustl.edu	37	14	19117128	19117128	+	RNA	SNP	G	G	T	rs141168980		TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr14:19117128G>T	ENST00000553170.1	+	0	283				RNU6-458P_ENST00000384179.1_RNA																							ATAAGGAAAAGAAGTGAGCAA	0.299																																																	0																																												0																															14.37:g.19117128G>T				RNA	SNP	-	NULL	ENST00000553170.1	37	NULL		14																																																																																			RP11-754I20.1	-	-	ENSG00000215398		0.299	RP11-754I20.1-002	KNOWN	basic	processed_transcript	ENSG00000215398	Clone_based_vega_gene	pseudogene	OTTHUMT00000408394.1	-	0.00	257	0	G			19117128	+1	tier1	-	no_errors	ENST00000553170	ensembl	human	known	74_37	rna	8.77	208	20	SNP	0.002	T
SRGAP2-AS1	100873165	genome.wustl.edu	37	1	121138853	121138853	+	lincRNA	SNP	G	G	A	rs184767318		TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr1:121138853G>A	ENST00000417218.1	+	0	240				RP11-343N15.1_ENST00000437515.1_lincRNA																							GCCGAGGGGTGCTCCTGGTCC	0.692																																																	0																																												0																															1.37:g.121138853G>A				RNA	SNP	-	NULL	ENST00000417218.1	37	NULL		1																																																																																			AL592494.5	-	-	ENSG00000227082		0.692	AL592494.5-001	KNOWN	basic	lincRNA	ENSG00000227082	Clone_based_vega_gene	lincRNA	OTTHUMT00000036739.1	-	0.00	16	0	G			121138853	+1	tier1	rs184767318	no_errors	ENST00000417218	ensembl	human	known	74_37	rna	33.33	14	7	SNP	0.951	A
LNPEP	4012	genome.wustl.edu	37	5	96271507	96271507	+	5'UTR	SNP	G	G	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr5:96271507G>T	ENST00000231368.5	+	0	340				LNPEP_ENST00000395784.1_Intron|CTD-2260A17.2_ENST00000501338.1_5'UTR	NM_005575.2	NP_005566.2	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase						antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-cell signaling (GO:0007267)|female pregnancy (GO:0007565)|membrane organization (GO:0061024)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|early endosome lumen (GO:0031905)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	34		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)		CTCCACATTTGTTGAGTGACT	0.682																																																	0																																										SO:0001623	5_prime_UTR_variant	0			D50810	CCDS4087.1, CCDS43346.1	5q15	2011-07-25			ENSG00000113441	ENSG00000113441	3.4.11.3		6656	protein-coding gene	gene with protein product	"""cystinyl aminopeptidase"", ""placental leucine aminopeptidase"""	151300				8550619	Standard	NM_175920		Approved	CAP, PLAP, P-LAP	uc003kmw.1	Q9UIQ6	OTTHUMG00000128719	ENST00000231368.5:c.-353G>T	5.37:g.96271507G>T			O00769|Q15145|Q59H76|Q9TNQ2|Q9TNQ3|Q9UIQ7	RNA	SNP	-	NULL	ENST00000231368.5	37	NULL	CCDS4087.1	5																																																																																			CTD-2260A17.2	-	-	ENSG00000247121		0.682	LNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000247121	Clone_based_vega_gene	protein_coding	OTTHUMT00000250624.1	-	0.00	33	0	G	NM_005575		96271507	-1	tier1	-	no_errors	ENST00000501338	ensembl	human	known	74_37	rna	21.43	11	3	SNP	0.000	T
ACOT6	641372	genome.wustl.edu	37	14	74083691	74083691	+	5'UTR	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr14:74083691C>T	ENST00000381139.1	+	0	144				RP3-414A15.10_ENST00000555011.1_RNA|RP3-414A15.10_ENST00000555500.1_RNA	NM_001037162.1	NP_001032239.1	Q3I5F7	ACOT6_HUMAN	acyl-CoA thioesterase 6							cytosol (GO:0005829)	carboxylic ester hydrolase activity (GO:0052689)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|urinary_tract(1)	7				BRCA - Breast invasive adenocarcinoma(234;0.00331)		TGATGTTCTCCAGGCAGGGGG	0.507																																																	0																																										SO:0001623	5_prime_UTR_variant	0			DQ082756, BF109853	CCDS32118.1	14q24.3	2011-02-16			ENSG00000205669	ENSG00000205669		"""Acyl CoA thioesterases"""	33159	protein-coding gene	gene with protein product		614267	"""chromosome 14 open reading frame 42"""	C14orf42		16940157	Standard	NM_001037162		Approved		uc001xop.3	Q3I5F7		ENST00000381139.1:c.-188C>T	14.37:g.74083691C>T				RNA	SNP	-	NULL	ENST00000381139.1	37	NULL	CCDS32118.1	14																																																																																			RP3-414A15.10	-	-	ENSG00000258603		0.507	ACOT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000258603	Clone_based_vega_gene	protein_coding	OTTHUMT00000414437.1	-	0.00	58	0	C	NM_001037162		74083691	-1	tier1	-	no_errors	ENST00000555011	ensembl	human	known	74_37	rna	20.00	43	11	SNP	0.604	T
PDXDC1	23042	genome.wustl.edu	37	16	15208399	15208399	+	Intron	SNP	A	A	G			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr16:15208399A>G	ENST00000535621.2	+	17	1587				NPIPP1_ENST00000534799.2_RNA|RP11-1186N24.5_ENST00000605794.1_RNA			Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain containing 1						carboxylic acid metabolic process (GO:0019752)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)	carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(10)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CAGTCCCACGATGACGATGGT	0.378																																																	0																																										SO:0001627	intron_variant	0			AK025504, BX647809	CCDS32393.1, CCDS66954.1, CCDS66957.1, CCDS73830.1, CCDS73831.1	16p13.11	2008-02-05							28995	protein-coding gene	gene with protein product		614244					Standard	XM_005255173		Approved	KIAA0251	uc002dda.4	Q6P996	OTTHUMG00000166304	ENST00000535621.2:c.1400-24337A>G	16.37:g.15208399A>G			B4DR55|B4DSL3|E7EMH5|E7EPL4|H3BNZ1|O00236|Q4F6X7|Q6PID7|Q86YF1|Q8N4Q9|Q8TBS5	RNA	SNP	-	NULL	ENST00000535621.2	37	NULL		16	.	.	.	.	.	.	.	.	.	.	.	0.050	-1.253996	0.01457	.	.	ENSG00000188599	ENST00000534799	.	.	.	0.765	-1.53	0.08611	.	.	.	.	.	T	0.20495	0.0493	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.17107	-1.0380	4	.	.	.	.	1.9233	0.03312	0.4049:0.299:0.0:0.2961	.	.	.	.	T	73	.	.	I	-	2	0	NPIPP1	15115900	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	-1.259000	0.02861	-2.200000	0.00747	-3.002000	0.00076	ATC	RP11-1186N24.5	-	-	ENSG00000270580		0.378	PDXDC1-016	PUTATIVE	basic	protein_coding	ENSG00000270580	Clone_based_vega_gene	protein_coding	OTTHUMT00000422421.1	-	0.00	205	0	A	NM_015027		15208399	-1	tier1	-	no_errors	ENST00000340301	ensembl	human	known	74_37	rna	16.57	141	28	SNP	0.000	G
ETNK1	55500	genome.wustl.edu	37	12	22824229	22824229	+	Nonsense_Mutation	SNP	G	G	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr12:22824229G>T	ENST00000266517.4	+	5	1080	c.991G>T	c.(991-993)Gaa>Taa	p.E331*		NM_018638.4	NP_061108.2	Q9HBU6	EKI1_HUMAN	ethanolamine kinase 1	331					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|ethanolamine kinase activity (GO:0004305)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						CATTGATTATGAATATTCTGG	0.294																																					Esophageal Squamous(42;87 913 3224 6226 43339)												0													157.0	171.0	166.0					12																	22824229		2203	4299	6502	SO:0001587	stop_gained	0			BC006111	CCDS8698.1, CCDS41760.1	12p12.2	2004-07-09			ENSG00000139163	ENSG00000139163			24649	protein-coding gene	gene with protein product		609858				11912161, 11044454	Standard	XM_005253420		Approved	EKI1, EKI	uc001rft.3	Q9HBU6	OTTHUMG00000169008	ENST00000266517.4:c.991G>T	12.37:g.22824229G>T	ENSP00000266517:p.Glu331*		G5E969	Nonsense_Mutation	SNP	pfam_Aminoglycoside_PTrfase,pfam_DUF227,superfamily_Kinase-like_dom	p.E331*	ENST00000266517.4	37	c.991	CCDS8698.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	37|37	6.584499|6.584499	0.97684|0.97684	.|.	.|.	ENSG00000139163|ENSG00000139163	ENST00000266517;ENST00000381409|ENST00000538218	.|.	.|.	.|.	5.23|5.23	5.23|5.23	0.72850|0.72850	.|.	0.147689|.	0.49305|.	D|.	0.000154|.	.|T	.|0.73345	.|0.3575	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.72469	.|-0.4284	.|4	0.87932|.	D|.	0|.	-3.2158|-3.2158	17.031|17.031	0.86461|0.86461	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|I	331|321	.|.	ENSP00000266517:E331X|.	E|M	+|+	1|3	0|0	ETNK1|ETNK1	22715496|22715496	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	8.721000|8.721000	0.91446|0.91446	2.463000|2.463000	0.83235|0.83235	0.454000|0.454000	0.30748|0.30748	GAA|ATG	ETNK1	-	pfam_Aminoglycoside_PTrfase,pfam_DUF227,superfamily_Kinase-like_dom	ENSG00000139163		0.294	ETNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETNK1	HGNC	protein_coding	OTTHUMT00000401926.2		0.00	31	0	G	NM_018638		22824229	+1			no_errors	ENST00000266517	ensembl	human	known	74_37	nonsense	7.41	25	2	SNP	1.000	T
EXO1	9156	genome.wustl.edu	37	1	242035465	242035465	+	Missense_Mutation	SNP	C	C	T	rs531242519		TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr1:242035465C>T	ENST00000366548.3	+	12	1992	c.1399C>T	c.(1399-1401)Cct>Tct	p.P467S	EXO1_ENST00000348581.5_Missense_Mutation_p.P467S|EXO1_ENST00000518483.1_Missense_Mutation_p.P467S	NM_130398.3	NP_569082.2	Q9UQ84	EXO1_HUMAN	exonuclease 1	467	Interaction with MLH1.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|isotype switching (GO:0045190)|meiotic nuclear division (GO:0007126)|mismatch repair (GO:0006298)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	5'-3' exodeoxyribonuclease activity (GO:0035312)|5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|double-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0051908)|exonuclease activity (GO:0004527)|flap endonuclease activity (GO:0048256)|metal ion binding (GO:0046872)|RNA-DNA hybrid ribonuclease activity (GO:0004523)|single-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0045145)|structure-specific DNA binding (GO:0043566)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(3)|lung(29)|ovary(2)|skin(1)|stomach(2)|urinary_tract(2)	45	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)			GGTAAATGGACCTACTAACAA	0.373								Editing and processing nucleases																																									0													81.0	81.0	81.0					1																	242035465		2203	4300	6503	SO:0001583	missense	0			AF042282	CCDS1620.1, CCDS44336.1	1q42-q43	2008-07-18			ENSG00000174371	ENSG00000174371			3511	protein-coding gene	gene with protein product	"""rad2 nuclease family member, homolog of S. cerevisiae exonuclease 1"""	606063				9685493, 9788596	Standard	NM_003686		Approved	HEX1, hExoI	uc001hzh.3	Q9UQ84	OTTHUMG00000039965	ENST00000366548.3:c.1399C>T	1.37:g.242035465C>T	ENSP00000355506:p.Pro467Ser		O60545|O75214|O75466|Q5T396|Q96IJ1|Q9UG38|Q9UNW0	Missense_Mutation	SNP	pfam_XPG-I_dom,pfam_XPG_DNA_repair_N,superfamily_5-3_exonuclease_C,smart_XPG_DNA_repair_N,smart_XPG-I_dom,smart_HhH2,prints_XPG/Rad2	p.P467S	ENST00000366548.3	37	c.1399	CCDS1620.1	1	.	.	.	.	.	.	.	.	.	.	C	0.004	-2.257274	0.00265	.	.	ENSG00000174371	ENST00000366548;ENST00000348581;ENST00000518483	T;T;T	0.27720	1.65;1.65;1.65	5.85	2.05	0.26809	.	1.174390	0.06013	N	0.649835	T	0.15912	0.0383	N	0.12182	0.205	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.06405	0.001;0.002;0.001	T	0.17501	-1.0367	10	0.02654	T	1	-29.8508	9.003	0.36094	0.5184:0.3693:0.0:0.1124	.	466;467;467	A8K5H6;Q9UQ84-4;Q9UQ84	.;.;EXO1_HUMAN	S	467	ENSP00000355506:P467S;ENSP00000311873:P467S;ENSP00000430251:P467S	ENSP00000311873:P467S	P	+	1	0	EXO1	240102088	0.008000	0.16893	0.014000	0.15608	0.007000	0.05969	0.988000	0.29616	0.466000	0.27193	-1.051000	0.02340	CCT	EXO1	-	NULL	ENSG00000174371		0.373	EXO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EXO1	HGNC	protein_coding	OTTHUMT00000096405.1	-	0.00	59	0	C	NM_006027		242035465	+1	tier1	-	no_errors	ENST00000348581	ensembl	human	known	74_37	missense	19.51	33	8	SNP	0.000	T
FAM193A	8603	genome.wustl.edu	37	4	2692599	2692599	+	Frame_Shift_Del	DEL	C	C	-			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr4:2692599delC	ENST00000324666.5	+	13	2183	c.1832delC	c.(1831-1833)gccfs	p.A611fs	FAM193A_ENST00000502458.1_Frame_Shift_Del_p.A633fs|FAM193A_ENST00000545951.1_Frame_Shift_Del_p.A611fs|FAM193A_ENST00000505311.1_Frame_Shift_Del_p.A611fs|FAM193A_ENST00000382839.3_Frame_Shift_Del_p.A611fs	NM_001256666.1	NP_001243595.1	P78312	F193A_HUMAN	family with sequence similarity 193, member A	611										NS(2)|breast(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(12)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	40						GTTGTCATGGCCACGTCATCA	0.453																																																	0													106.0	99.0	101.0					4																	2692599		2203	4300	6503	SO:0001589	frameshift_variant	0			AB000459	CCDS33943.1, CCDS58874.1, CCDS58875.1, CCDS58876.1	4p16.3	2009-09-04	2009-09-04	2009-09-04					16822	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 8"""	C4orf8		9734812	Standard	NR_046335		Approved	RES4-22	uc010ick.3	P78312		ENST00000324666.5:c.1832delC	4.37:g.2692599delC	ENSP00000324587:p.Ala611fs		B7ZM85|B9EGR0|E9PFA1|O43607|P78311|P78313|Q9UEG8	Frame_Shift_Del	DEL	NULL	p.T612fs	ENST00000324666.5	37	c.1832	CCDS58875.1	4																																																																																			FAM193A	-	NULL	ENSG00000125386		0.453	FAM193A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM193A	HGNC	protein_coding	OTTHUMT00000360903.1		0.00	18	0	C	NM_003704		2692599	+1	tier1		no_errors	ENST00000324666	ensembl	human	known	74_37	frame_shift_del	18.18	27	6	DEL	1.000	-
FAM193A	8603	genome.wustl.edu	37	4	2664632	2664632	+	Missense_Mutation	SNP	T	T	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr4:2664632T>C	ENST00000324666.5	+	9	1291	c.940T>C	c.(940-942)Tat>Cat	p.Y314H	FAM193A_ENST00000502458.1_Missense_Mutation_p.Y336H|FAM193A_ENST00000545951.1_Missense_Mutation_p.Y314H|FAM193A_ENST00000505311.1_Missense_Mutation_p.Y314H|FAM193A_ENST00000382839.3_Missense_Mutation_p.Y314H	NM_001256666.1	NP_001243595.1	P78312	F193A_HUMAN	family with sequence similarity 193, member A	314										NS(2)|breast(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(12)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	40						ATTGAGTAATTATGATGATAC	0.453																																																	0													173.0	169.0	170.0					4																	2664632		2203	4300	6503	SO:0001583	missense	0			AB000459	CCDS33943.1, CCDS58874.1, CCDS58875.1, CCDS58876.1	4p16.3	2009-09-04	2009-09-04	2009-09-04					16822	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 8"""	C4orf8		9734812	Standard	NR_046335		Approved	RES4-22	uc010ick.3	P78312		ENST00000324666.5:c.940T>C	4.37:g.2664632T>C	ENSP00000324587:p.Tyr314His		B7ZM85|B9EGR0|E9PFA1|O43607|P78311|P78313|Q9UEG8	Missense_Mutation	SNP	NULL	p.Y314H	ENST00000324666.5	37	c.940	CCDS58875.1	4	.	.	.	.	.	.	.	.	.	.	T	17.38	3.374136	0.61735	.	.	ENSG00000125386	ENST00000382839;ENST00000324666;ENST00000545951;ENST00000502458;ENST00000513350	T;T;T;T;T	0.45668	0.91;1.3;0.89;0.9;0.89	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.61974	0.2390	L	0.56769	1.78	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.999;0.998;0.999	T	0.64424	-0.6411	10	0.87932	D	0	-26.0487	15.5887	0.76506	0.0:0.0:0.0:1.0	.	314;336;314;336;314	B9EGR0;E9PFA1;P78312;B7ZM85;P78312-2	.;.;F193A_HUMAN;.;.	H	314;314;314;336;168	ENSP00000372290:Y314H;ENSP00000324587:Y314H;ENSP00000443617:Y314H;ENSP00000427505:Y336H;ENSP00000427260:Y168H	ENSP00000324587:Y314H	Y	+	1	0	FAM193A	2634430	1.000000	0.71417	0.981000	0.43875	0.167000	0.22549	7.142000	0.77339	2.275000	0.75901	0.528000	0.53228	TAT	FAM193A	-	NULL	ENSG00000125386		0.453	FAM193A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM193A	HGNC	protein_coding	OTTHUMT00000360903.1		0.00	37	0	T	NM_003704		2664632	+1			no_errors	ENST00000324666	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	C
FAM65A	79567	genome.wustl.edu	37	16	67579416	67579416	+	Missense_Mutation	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr16:67579416G>A	ENST00000379312.3	+	18	3302	c.3181G>A	c.(3181-3183)Gtg>Atg	p.V1061M	CTD-2012K14.3_ENST00000563083.1_RNA|FAM65A_ENST00000540839.3_Missense_Mutation_p.V1076M|FAM65A_ENST00000042381.4_Missense_Mutation_p.V1057M|CTD-2012K14.4_ENST00000564717.1_RNA|FAM65A_ENST00000428437.2_Missense_Mutation_p.V1071M|FAM65A_ENST00000422602.2_Missense_Mutation_p.V1077M	NM_001193522.1|NM_024519.3	NP_001180451.1|NP_078795.2	Q6ZS17	FA65A_HUMAN	family with sequence similarity 65, member A	1061						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)		GGAGGCCTACGTGACTGAGAC	0.627																																																	0													57.0	63.0	61.0					16																	67579416		2198	4300	6498	SO:0001583	missense	0			AK127792	CCDS10840.1, CCDS54026.1, CCDS54027.1, CCDS54028.1	16q22.1	2008-02-05			ENSG00000039523	ENSG00000039523			25836	protein-coding gene	gene with protein product						11572484	Standard	NM_001193522		Approved	FLJ13725	uc010vjp.2	Q6ZS17	OTTHUMG00000137536	ENST00000379312.3:c.3181G>A	16.37:g.67579416G>A	ENSP00000368614:p.Val1061Met		B4DEQ9|B4DIM2|E9PBS3|Q4G0A4|Q7Z5R7|Q8NDA4|Q96J39|Q96PV8|Q9H8D9	Missense_Mutation	SNP	superfamily_ARM-type_fold,superfamily_HR1_rho-bd	p.V1077M	ENST00000379312.3	37	c.3229	CCDS54028.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.08|16.08	3.020510|3.020510	0.54576|0.54576	.|.	.|.	ENSG00000039523|ENSG00000039523	ENST00000428437|ENST00000379312;ENST00000042381;ENST00000422602;ENST00000540839	.|T;T;T	.|0.77358	.|-1.09;-1.09;-1.09	5.48|5.48	5.48|5.48	0.80851|0.80851	.|.	.|0.255793	.|0.39909	.|N	.|0.001236	T|T	0.64702|0.64702	0.2622|0.2622	L|L	0.29908|0.29908	0.895|0.895	0.28594|0.28594	N|N	0.909508|0.909508	.|P;P;P	.|0.49862	.|0.929;0.929;0.929	.|B;B;B	.|0.41036	.|0.346;0.346;0.346	T|T	0.67019|0.67019	-0.5776|-0.5776	5|10	.|0.72032	.|D	.|0.01	-13.4534|-13.4534	7.1475|7.1475	0.25591|0.25591	0.2062:0.0:0.7938:0.0|0.2062:0.0:0.7938:0.0	.|.	.|1071;1077;1061	.|B4DIM2;E9PBS3;Q6ZS17	.|.;.;FA65A_HUMAN	H|M	1050|1061;1057;1077;1071	.|ENSP00000368614:V1061M;ENSP00000042381:V1057M;ENSP00000400099:V1077M	.|ENSP00000042381:V1057M	R|V	+|+	2|1	0|0	FAM65A|FAM65A	66136917|66136917	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.891000|0.891000	0.51852|0.51852	1.553000|1.553000	0.36255|0.36255	2.589000|2.589000	0.87451|0.87451	0.655000|0.655000	0.94253|0.94253	CGT|GTG	FAM65A	-	NULL	ENSG00000039523		0.627	FAM65A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM65A	HGNC	protein_coding	OTTHUMT00000268866.3		0.00	24	0	G	NM_024519		67579416	+1			no_errors	ENST00000422602	ensembl	human	known	74_37	missense	9.38	29	3	SNP	1.000	A
FBN1	2200	genome.wustl.edu	37	15	48773943	48773943	+	Silent	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr15:48773943G>A	ENST00000316623.5	-	32	4328	c.3873C>T	c.(3871-3873)tgC>tgT	p.C1291C		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	1291	EGF-like 21; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		TCCCACTTAGGCAGATATTTG	0.393																																																	0													138.0	139.0	139.0					15																	48773943		2198	4296	6494	SO:0001819	synonymous_variant	0			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.3873C>T	15.37:g.48773943G>A			B2RUU0|D2JYH6|Q15972|Q75N87	Silent	SNP	pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pirsf_FBN,pfscan_EG-like_dom	p.C1291	ENST00000316623.5	37	c.3873	CCDS32232.1	15																																																																																			FBN1	-	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_FBN,pfscan_EG-like_dom	ENSG00000166147		0.393	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN1	HGNC	protein_coding	OTTHUMT00000417355.1	-	0.00	47	0	G			48773943	-1	tier1	-	no_errors	ENST00000316623	ensembl	human	known	74_37	silent	16.13	26	5	SNP	1.000	A
FTH1P3	2498	genome.wustl.edu	37	5	17354524	17354524	+	lincRNA	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr5:17354524G>A	ENST00000511821.1	+	0	383				FTH1P10_ENST00000401830.3_RNA																							AGGTGGACGCGGTCGTCATGG	0.677																																																	0																																												0																															5.37:g.17354524G>A				RNA	SNP	-	NULL	ENST00000511821.1	37	NULL		5																																																																																			FTH1P10	-	-	ENSG00000223361		0.677	CTD-2139B15.2-001	KNOWN	basic	lincRNA	FTH1P10	HGNC	lincRNA	OTTHUMT00000366261.1	-	0.00	75	0	G			17354524	-1	tier1	-	no_errors	ENST00000401830	ensembl	human	known	74_37	rna	11.54	45	6	SNP	0.008	A
FUCA2	2519	genome.wustl.edu	37	6	143828513	143828513	+	Missense_Mutation	SNP	T	T	G			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr6:143828513T>G	ENST00000002165.6	-	2	328	c.273A>C	c.(271-273)aaA>aaC	p.K91N	RP1-20N2.6_ENST00000591189.1_RNA|RP1-20N2.6_ENST00000593045.1_RNA|FUCA2_ENST00000438118.2_Missense_Mutation_p.K91N|FUCA2_ENST00000367585.1_5'UTR|RP1-20N2.6_ENST00000591892.1_RNA|RP1-20N2.6_ENST00000589563.1_RNA|RP1-20N2.6_ENST00000590703.1_RNA|RP1-20N2.6_ENST00000415586.1_RNA|RP1-20N2.6_ENST00000593175.1_RNA|RP1-20N2.6_ENST00000589489.1_RNA	NM_032020.4	NP_114409.2	Q9BTY2	FUCO2_HUMAN	fucosidase, alpha-L- 2, plasma	91					fucose metabolic process (GO:0006004)|glycoside catabolic process (GO:0016139)|regulation of entry of bacterium into host cell (GO:2000535)|response to bacterium (GO:0009617)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-L-fucosidase activity (GO:0004560)|fucose binding (GO:0042806)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				OV - Ovarian serous cystadenocarcinoma(155;7.45e-06)|GBM - Glioblastoma multiforme(68;0.0142)		GGTAATTATCTTTCATAAATT	0.363																																																	0													106.0	119.0	114.0					6																	143828513		2203	4300	6503	SO:0001583	missense	0			BC003060	CCDS5200.1	6q24	2012-10-02			ENSG00000001036	ENSG00000001036	3.2.1.51		4008	protein-coding gene	gene with protein product		136820				6590153	Standard	NM_032020		Approved	MGC1314, dJ20N2.5	uc003qjm.3	Q9BTY2	OTTHUMG00000015728	ENST00000002165.6:c.273A>C	6.37:g.143828513T>G	ENSP00000002165:p.Lys91Asn		E9PEB6|Q7Z6V1|Q7Z6Y2|Q8NBK4	Missense_Mutation	SNP	pfam_Glyco_hydro_29,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_29,pirsf_Glyco_hydro_29_sub,prints_Glyco_hydro_29_sub	p.K91N	ENST00000002165.6	37	c.273	CCDS5200.1	6	.	.	.	.	.	.	.	.	.	.	T	2.161	-0.392173	0.04932	.	.	ENSG00000001036	ENST00000002165;ENST00000438118;ENST00000367585	T;T;T	0.56611	0.45;0.45;0.45	5.21	-1.49	0.08718	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.362336	0.34362	N	0.004039	T	0.16599	0.0399	L	0.49126	1.545	0.22001	N	0.999426	B	0.18013	0.025	B	0.21151	0.033	T	0.16394	-1.0404	10	0.27785	T	0.31	-7.933	1.9917	0.03448	0.1081:0.2981:0.2316:0.3622	.	91	Q9BTY2	FUCO2_HUMAN	N	91	ENSP00000002165:K91N;ENSP00000394151:K91N;ENSP00000356557:K91N	ENSP00000002165:K91N	K	-	3	2	FUCA2	143870206	0.003000	0.15002	0.071000	0.20095	0.090000	0.18270	-0.068000	0.11561	-0.123000	0.11745	0.533000	0.62120	AAA	FUCA2	-	pfam_Glyco_hydro_29,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_29,pirsf_Glyco_hydro_29_sub,prints_Glyco_hydro_29_sub	ENSG00000001036		0.363	FUCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUCA2	HGNC	protein_coding	OTTHUMT00000042521.2	-	0.00	64	0	T	NM_032020		143828513	-1	tier1	-	no_errors	ENST00000002165	ensembl	human	known	74_37	missense	24.32	56	18	SNP	0.041	G
GAP43	2596	genome.wustl.edu	37	3	115342544	115342544	+	Missense_Mutation	SNP	G	G	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr3:115342544G>T	ENST00000305124.6	+	1	374	c.8G>T	c.(7-9)tGc>tTc	p.C3F	GAP43_ENST00000393780.3_5'UTR	NM_002045.3	NP_002036.1	P17677	NEUM_HUMAN	growth associated protein 43	3	Important for membrane binding.				axon choice point recognition (GO:0016198)|cell fate commitment (GO:0045165)|glial cell differentiation (GO:0010001)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of filopodium assembly (GO:0051489)|regulation of growth (GO:0040008)|response to wounding (GO:0009611)|tissue regeneration (GO:0042246)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|plasma membrane (GO:0005886)|synapse (GO:0045202)				endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	32				GBM - Glioblastoma multiforme(114;0.164)		ACCATGCTGTGCTGTATGAGA	0.448																																																	0													209.0	192.0	197.0					3																	115342544		2203	4300	6503	SO:0001583	missense	0				CCDS33830.1, CCDS46890.1	3q13.31	2013-09-19			ENSG00000172020	ENSG00000172020			4140	protein-coding gene	gene with protein product	"""neuron growth-associated protein 43"", ""neuromodulin"", ""nerve growth-related peptide GAP43"", ""axonal membrane protein GAP-43"", ""protein F1"", ""calmodulin-binding protein P-57"", ""neural phosphoprotein B-50"""	162060				3272162, 8231732	Standard	NM_002045		Approved	B-50, PP46	uc003ebr.2	P17677	OTTHUMG00000133758	ENST00000305124.6:c.8G>T	3.37:g.115342544G>T	ENSP00000305010:p.Cys3Phe		A8K0Y4	Missense_Mutation	SNP	pfam_Neuromodulin_C,pfam_Neuromodulin_gap-junction_N,pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Neuromodulin	p.C3F	ENST00000305124.6	37	c.8	CCDS33830.1	3	.	.	.	.	.	.	.	.	.	.	G	13.30	2.194718	0.38806	.	.	ENSG00000172020	ENST00000305124	T	0.43294	0.95	4.33	4.33	0.51752	Neuromodulin gap junction N-terminal (1);	.	.	.	.	T	0.54046	0.1834	L	0.32530	0.975	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	T	0.56189	-0.8020	9	0.48119	T	0.1	.	16.9916	0.86355	0.0:0.0:1.0:0.0	.	3	P17677	NEUM_HUMAN	F	3	ENSP00000305010:C3F	ENSP00000305010:C3F	C	+	2	0	GAP43	116825234	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.118000	0.89577	2.235000	0.73313	0.557000	0.71058	TGC	GAP43	-	pfam_Neuromodulin_gap-junction_N,prints_Neuromodulin	ENSG00000172020		0.448	GAP43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAP43	HGNC	protein_coding	OTTHUMT00000258216.2		0.00	38	0	G	NM_002045		115342544	+1			no_errors	ENST00000305124	ensembl	human	known	74_37	missense	8.33	22	2	SNP	1.000	T
GART	2618	genome.wustl.edu	37	21	34876758	34876758	+	Silent	SNP	G	G	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr21:34876758G>T	ENST00000381831.3	-	21	3065	c.2802C>A	c.(2800-2802)acC>acA	p.T934T	GART_ENST00000381839.3_Silent_p.T934T|GART_ENST00000381815.4_Silent_p.T934T|GART_ENST00000543717.1_Silent_p.T486T	NM_001136005.1	NP_001129477.1	P22102	PUR2_HUMAN	phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase	934	GART.				'de novo' IMP biosynthetic process (GO:0006189)|brainstem development (GO:0003360)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|glycine metabolic process (GO:0006544)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to inorganic substance (GO:0010035)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)|tetrahydrofolate biosynthetic process (GO:0046654)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|phosphoribosylamine-glycine ligase activity (GO:0004637)|phosphoribosylformylglycinamidine cyclo-ligase activity (GO:0004641)|phosphoribosylglycinamide formyltransferase activity (GO:0004644)			NS(2)|breast(1)|endometrium(3)|large_intestine(3)|lung(13)|ovary(3)|prostate(5)|urinary_tract(1)	31					Pemetrexed(DB00642)	CTGTGACTCCGGTTTCCAGGG	0.403																																																	0													102.0	103.0	103.0					21																	34876758		2203	4300	6503	SO:0001819	synonymous_variant	0			M32082	CCDS13627.1, CCDS13628.1	21q22.11	2012-10-02			ENSG00000159131	ENSG00000159131	2.1.2.2, 6.3.3.1, 6.3.4.13		4163	protein-coding gene	gene with protein product		138440		PRGS, PGFT		2050105	Standard	NM_001136005		Approved		uc002yrx.3	P22102	OTTHUMG00000065628	ENST00000381831.3:c.2802C>A	21.37:g.34876758G>T			A8K945|A8KA32|D3DSF3|D3DSF4|O14659|Q52M77	Silent	SNP	pfam_PRibGlycinamid_synth_ATP-grasp,pfam_Formyl_transf_N,pfam_PRibGlycinamide_synth_N,pfam_AIR_synth_C_dom,pfam_PRibGlycinamide_synth_C-dom,pfam_AIR_synth_N_dom,pfam_ATP-grasp_carboxylate-amine,pfam_CbamoylP_synth_lsu-like_ATP-bd,superfamily_Formyl_transf_N,superfamily_AIR_synth_C_dom,superfamily_PurM_N-like,superfamily_PreATP-grasp_dom,superfamily_Rudment_hybrid_motif,pfscan_ATP-grasp,tigrfam_PRibGlycinamide_synth,tigrfam_PurM_cligase,tigrfam_PurN_trans	p.T934	ENST00000381831.3	37	c.2802	CCDS13627.1	21																																																																																			GART	-	pfam_Formyl_transf_N,superfamily_Formyl_transf_N,tigrfam_PurN_trans	ENSG00000159131		0.403	GART-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GART	HGNC	protein_coding	OTTHUMT00000140626.3		0.00	23	0	G	NM_000819		34876758	-1			no_errors	ENST00000381815	ensembl	human	known	74_37	silent	5.26	36	2	SNP	0.004	T
GATAD2A	54815	genome.wustl.edu	37	19	19603235	19603235	+	Silent	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr19:19603235C>T	ENST00000360315.3	+	3	702	c.390C>T	c.(388-390)acC>acT	p.T130T	GATAD2A_ENST00000404158.1_Silent_p.T130T|GATAD2A_ENST00000429563.2_Intron|GATAD2A_ENST00000252577.5_Silent_p.T130T|GATAD2A_ENST00000358713.3_Silent_p.T130T|GATAD2A_ENST00000473184.1_3'UTR|GATAD2A_ENST00000537887.1_Intron	NM_017660.3	NP_060130.3	Q86YP4	P66A_HUMAN	GATA zinc finger domain containing 2A	130					anterior neuropore closure (GO:0021506)|blood vessel development (GO:0001568)|DNA methylation (GO:0006306)|embryonic body morphogenesis (GO:0010172)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|neural fold formation (GO:0001842)|programmed cell death (GO:0012501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|NuRD complex (GO:0016581)	protein binding, bridging (GO:0030674)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	13						AGACTAGCACCGAGGCCCTCA	0.642																																																	0													53.0	51.0	52.0					19																	19603235		1568	3582	5150	SO:0001819	synonymous_variant	0			AL390164	CCDS12402.2	19p13.11	2013-01-25			ENSG00000167491	ENSG00000167491		"""GATA zinc finger domain containing"""	29989	protein-coding gene	gene with protein product	"""p66 alpha"""	614997				12183469	Standard	NM_017660		Approved	p66alpha	uc010xqt.2	Q86YP4	OTTHUMG00000152541	ENST00000360315.3:c.390C>T	19.37:g.19603235C>T			B5MC40|Q7L3J2|Q96F28|Q9NPU2|Q9NXS1	Silent	SNP	pfam_Znf_GATA,pfscan_Znf_GATA	p.T130	ENST00000360315.3	37	c.390	CCDS12402.2	19																																																																																			GATAD2A	-	NULL	ENSG00000167491		0.642	GATAD2A-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATAD2A	HGNC	protein_coding	OTTHUMT00000326671.4	-	0.00	36	0	C	NM_017660		19603235	+1	tier1	-	no_errors	ENST00000358713	ensembl	human	known	74_37	silent	37.50	15	9	SNP	0.063	T
GCG	2641	genome.wustl.edu	37	2	163002170	163002170	+	Missense_Mutation	SNP	C	C	T	rs35920035		TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr2:163002170C>T	ENST00000418842.2	-	4	526	c.272G>A	c.(271-273)cGt>cAt	p.R91H	GCG_ENST00000375497.3_Missense_Mutation_p.R91H	NM_002054.4	NP_002045.1	P01275	GLUC_HUMAN	glucagon	91		Cleavage; by PCSK1.			adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|negative regulation of execution phase of apoptosis (GO:1900118)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|protein kinase A signaling (GO:0010737)|regulation of insulin secretion (GO:0050796)|response to starvation (GO:0042594)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|secretory granule lumen (GO:0034774)	glucagon receptor binding (GO:0031769)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|large_intestine(3)|lung(9)	14						TTCATCGTGACGTTTGGCAAT	0.413																																																	0								C	HIS/ARG	0,3784		0,0,1892	221.0	217.0	218.0		272	3.9	1.0	2	dbSNP_126	218	2,8234		0,2,4116	yes	missense	GCG	NM_002054.3	29	0,2,6008	TT,TC,CC		0.0243,0.0,0.0166	probably-damaging	91/181	163002170	2,12018	1892	4118	6010	SO:0001583	missense	0				CCDS46439.1	2q36-q37	2013-02-26			ENSG00000115263	ENSG00000115263		"""Endogenous ligands"""	4191	protein-coding gene	gene with protein product	"""glicentin-related polypeptide"", ""glucagon-like peptide 1"", ""glucagon-like peptide 2"", ""preproglucagon"""	138030				2753890, 3725587	Standard	NM_002054		Approved	GLP1, GLP2, GRPP	uc002ucc.4	P01275	OTTHUMG00000153892	ENST00000418842.2:c.272G>A	2.37:g.163002170C>T	ENSP00000387662:p.Arg91His		A6NN65|Q53TP6	Missense_Mutation	SNP	pfam_Glucagon_GIP_secretin_VIP,smart_Glucagon_GIP_secretin_VIP,prints_Glucagon_GIP_secretin_VIP	p.R91H	ENST00000418842.2	37	c.272	CCDS46439.1	2	.	.	.	.	.	.	.	.	.	.	C	14.45	2.537857	0.45176	0.0	2.43E-4	ENSG00000115263	ENST00000418842;ENST00000375497	T;T	0.47528	0.84;0.84	4.79	3.91	0.45181	.	0.307444	0.31897	N	0.006888	T	0.35856	0.0946	L	0.31664	0.95	0.80722	D	1	B	0.28208	0.203	B	0.22386	0.039	T	0.28744	-1.0034	10	0.87932	D	0	-12.0758	13.13	0.59375	0.0:0.9216:0.0:0.0784	rs35920035	91	P01275	GLUC_HUMAN	H	91	ENSP00000387662:R91H;ENSP00000364647:R91H	ENSP00000364647:R91H	R	-	2	0	GCG	162710416	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.192000	0.65115	1.141000	0.42275	0.591000	0.81541	CGT	GCG	-	NULL	ENSG00000115263		0.413	GCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCG	HGNC	protein_coding	OTTHUMT00000332860.1	-	0.00	43	0	C	NM_002054		163002170	-1	tier1	rs35920035	no_errors	ENST00000375497	ensembl	human	known	74_37	missense	20.41	39	10	SNP	1.000	T
GNAS	2778	genome.wustl.edu	37	20	57428459	57428459	+	Missense_Mutation	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr20:57428459G>A	ENST00000371100.4	+	1	691	c.139G>A	c.(139-141)Gaa>Aaa	p.E47K	GNAS-AS1_ENST00000424094.2_RNA|GNAS_ENST00000371099.2_Missense_Mutation_p.E47K|GNAS_ENST00000371075.3_Intron|GNAS_ENST00000306120.3_5'Flank|GNAS-AS1_ENST00000598163.1_RNA|GNAS_ENST00000371102.4_Missense_Mutation_p.E47K|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000371098.2_Intron|GNAS_ENST00000313949.7_Intron	NM_001077490.1|NM_080425.2	NP_001070958.1|NP_536350.2	P63092	GNAS2_HUMAN	GNAS complex locus	0					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			TAGCCCAGCCGAAGAGATGGA	0.642			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)			Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	0													13.0	15.0	15.0					20																	57428459		1867	4090	5957	SO:0001583	missense	0			M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371100.4:c.139G>A	20.37:g.57428459G>A	ENSP00000360141:p.Glu47Lys		A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_S,prints_Gprotein_alpha_su	p.E47K	ENST00000371100.4	37	c.139	CCDS46622.1	20	.	.	.	.	.	.	.	.	.	.	G	17.35	3.368028	0.61513	.	.	ENSG00000087460	ENST00000371099;ENST00000371100;ENST00000371102	D;D	0.92647	-3.08;-3.06	4.56	3.51	0.40186	.	.	.	.	.	D	0.91965	0.7455	L	0.57536	1.79	0.80722	D	1	D	0.71674	0.998	P	0.52793	0.709	D	0.91558	0.5262	9	0.66056	D	0.02	.	9.8153	0.40849	0.0:0.2098:0.7902:0.0	.	47	Q5JWF2	GNAS1_HUMAN	K	47	ENSP00000360141:E47K;ENSP00000360143:E47K	ENSP00000360140:E47K	E	+	1	0	GNAS	56861854	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.831000	0.27476	2.469000	0.83416	0.563000	0.77884	GAA	GNAS	-	NULL	ENSG00000087460		0.642	GNAS-001	PUTATIVE	basic|CCDS	protein_coding	GNAS	HGNC	protein_coding	OTTHUMT00000080417.3	-	0.00	16	0	G	NM_000516		57428459	+1	tier1	-	no_errors	ENST00000371100	ensembl	human	putative	74_37	missense	33.33	12	6	SNP	1.000	A
GTF2IRD2P1	401375	genome.wustl.edu	37	7	72658020	72658020	+	RNA	SNP	T	T	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr7:72658020T>A	ENST00000425256.1	-	0	1891									GTF2I repeat domain containing 2 pseudogene 1																		agccacttaatctccgtgtag	0.517																																																	0																																												0			AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72658020T>A				RNA	SNP	-	NULL	ENST00000425256.1	37	NULL		7																																																																																			GTF2IRD2P1	-	-	ENSG00000214544		0.517	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	GTF2IRD2P1	HGNC	pseudogene	OTTHUMT00000345921.1	-	0.00	41	0	T	NR_002164		72658020	-1	tier1	-	no_errors	ENST00000425256	ensembl	human	known	74_37	rna	12.82	34	5	SNP	0.866	A
HARS2	23438	genome.wustl.edu	37	5	140075409	140075409	+	Missense_Mutation	SNP	G	G	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr5:140075409G>T	ENST00000230771.3	+	6	835	c.612G>T	c.(610-612)caG>caT	p.Q204H	HARS2_ENST00000432671.2_Missense_Mutation_p.Q90H|HARS2_ENST00000437649.2_Missense_Mutation_p.Q130H|HARS2_ENST00000448069.2_Missense_Mutation_p.Q65H|HARS2_ENST00000435019.2_Missense_Mutation_p.Q164H|HARS2_ENST00000508522.1_Missense_Mutation_p.Q179H	NM_012208.2	NP_036340.1	P49590	SYHM_HUMAN	histidyl-tRNA synthetase 2, mitochondrial	204					gene expression (GO:0010467)|histidyl-tRNA aminoacylation (GO:0006427)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|histidine-tRNA ligase activity (GO:0004821)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(3)|large_intestine(5)|lung(10)	19			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGGATTGCAGTTGGGAGACT	0.453																																																	0													148.0	146.0	146.0					5																	140075409		2203	4300	6503	SO:0001583	missense	0			U18937	CCDS4238.1, CCDS64267.1	5q31.3	2012-07-20	2012-07-20	2007-02-23	ENSG00000112855	ENSG00000112855	6.1.1.21	"""Aminoacyl tRNA synthetases / Class II"""	4817	protein-coding gene	gene with protein product	"""histidine tRNA ligase 2, mitochondrial (putative)"""	600783	"""histidyl-tRNA synthetase-like"""	HARSL		7755634, 21464306	Standard	NM_012208		Approved	HO3, HARSR	uc003lgx.3	P49590	OTTHUMG00000129500	ENST00000230771.3:c.612G>T	5.37:g.140075409G>T	ENSP00000230771:p.Gln204His		B4DDY8	Missense_Mutation	SNP	pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Anticodon-bd,superfamily_Anticodon-bd,pirsf_HisRS/HisZ,pfscan_aa-tRNA-synth_II,tigrfam_His-tRNA-ligase	p.Q204H	ENST00000230771.3	37	c.612	CCDS4238.1	5	.	.	.	.	.	.	.	.	.	.	g	11.63	1.695974	0.30052	.	.	ENSG00000112855	ENST00000230771;ENST00000435019;ENST00000437649;ENST00000432671;ENST00000508522;ENST00000448069;ENST00000427675	T;T;T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01;-0.01;-0.01	6.17	1.36	0.22044	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (G/ H/ P/ S), conserved domain (1);	0.273077	0.42053	N	0.000766	T	0.54647	0.1871	M	0.69185	2.1	0.41657	D	0.989162	B;B;B;B;B;B	0.21309	0.003;0.054;0.045;0.013;0.013;0.013	B;B;B;B;B;B	0.30316	0.03;0.114;0.111;0.049;0.049;0.072	T	0.49808	-0.8900	10	0.52906	T	0.07	-19.2134	2.6953	0.05133	0.2893:0.1082:0.4914:0.1111	.	90;65;130;179;204;204	E9PD60;B4DQ67;E9PG66;B4DDY8;B2R7G6;P49590	.;.;.;.;.;SYHM_HUMAN	H	204;164;130;90;179;65;76	ENSP00000230771:Q204H;ENSP00000412887:Q164H;ENSP00000411708:Q130H;ENSP00000415007:Q90H;ENSP00000423616:Q179H;ENSP00000407105:Q65H	ENSP00000230771:Q204H	Q	+	3	2	HARS2	140055593	0.009000	0.17119	0.999000	0.59377	0.876000	0.50452	-0.065000	0.11617	0.181000	0.19994	0.655000	0.94253	CAG	HARS2	-	pfam_aa-tRNA-synt_IIb_cons-dom,pirsf_HisRS/HisZ,pfscan_aa-tRNA-synth_II,tigrfam_His-tRNA-ligase	ENSG00000112855		0.453	HARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HARS2	HGNC	protein_coding	OTTHUMT00000251670.2		0.00	71	0	G	NM_012208		140075409	+1			no_errors	ENST00000230771	ensembl	human	known	74_37	missense	8.16	45	4	SNP	0.876	T
HCK	3055	genome.wustl.edu	37	20	30671802	30671802	+	Missense_Mutation	SNP	G	G	A	rs202001086		TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr20:30671802G>A	ENST00000520553.1	+	7	821	c.575G>A	c.(574-576)cGa>cAa	p.R192Q	HCK_ENST00000375862.2_Missense_Mutation_p.R212Q|HCK_ENST00000538448.1_Missense_Mutation_p.R192Q|HCK_ENST00000375852.2_Missense_Mutation_p.R213Q|HCK_ENST00000534862.1_Missense_Mutation_p.R193Q|HCK_ENST00000518730.1_Missense_Mutation_p.R191Q	NM_001172129.1|NM_001172130.1|NM_001172131.1|NM_002110.3	NP_001165600.1|NP_001165601.1|NP_001165602.1|NP_002101.2	P08631	HCK_HUMAN	HCK proto-oncogene, Src family tyrosine kinase	213	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|innate immune response-activating signal transduction (GO:0002758)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte degranulation (GO:0043299)|leukocyte migration involved in immune response (GO:0002522)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|mesoderm development (GO:0007498)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell proliferation (GO:0008284)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|regulation of defense response to virus by virus (GO:0050690)|regulation of inflammatory response (GO:0050727)|regulation of phagocytosis (GO:0050764)|regulation of podosome assembly (GO:0071801)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|respiratory burst after phagocytosis (GO:0045728)|viral process (GO:0016032)	caveola (GO:0005901)|cell projection (GO:0042995)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|nucleus (GO:0005634)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			NS(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(4)	36			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)		Bosutinib(DB06616)	ATATCCCCCCGAAGCACCTTC	0.582													G|||	1	0.000199681	0.0	0.0	5008	,	,		20093	0.0		0.001	False		,,,				2504	0.0																0													58.0	57.0	58.0					20																	30671802		2203	4300	6503	SO:0001583	missense	0			AK026432	CCDS33460.1, CCDS54453.1, CCDS54455.1, CCDS54456.1	20q11-q12	2014-06-25	2014-06-25		ENSG00000101336	ENSG00000101336		"""SH2 domain containing"""	4840	protein-coding gene	gene with protein product		142370	"""hemopoietic cell kinase"""			3496523	Standard	NM_002110		Approved	JTK9	uc002wxh.3	P08631	OTTHUMG00000032204	ENST00000520553.1:c.575G>A	20.37:g.30671802G>A	ENSP00000429848:p.Arg192Gln		A8K1I1|B4DQB6|E1P5M2|Q29RX1|Q2VPE2|Q504R5|Q5T7K1|Q5T7K2|Q96CC0|Q9H5Y5|Q9NUA4|Q9UMJ5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_SH3_domain	p.R213Q	ENST00000520553.1	37	c.638	CCDS54455.1	20	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	17.27	3.348172	0.61183	.	.	ENSG00000101336	ENST00000534862;ENST00000538448;ENST00000375862;ENST00000520553;ENST00000518730;ENST00000375852	D;D;D;D;D;D	0.88975	-2.45;-2.45;-2.45;-2.45;-2.45;-2.45	5.0	3.07	0.35406	SH2 motif (4);	0.139188	0.49305	D	0.000156	D	0.85881	0.5800	L	0.54323	1.7	0.33918	D	0.640537	P;P	0.50528	0.822;0.936	B;B	0.43301	0.291;0.415	D	0.88657	0.3186	10	0.87932	D	0	.	10.6826	0.45823	0.1545:0.0:0.8455:0.0	.	191;213	P08631-3;P08631	.;HCK_HUMAN	Q	193;192;212;192;191;213	ENSP00000444986:R193Q;ENSP00000441169:R192Q;ENSP00000365022:R212Q;ENSP00000429848:R192Q;ENSP00000427757:R191Q;ENSP00000365012:R213Q	ENSP00000365012:R213Q	R	+	2	0	HCK	30135463	0.826000	0.29277	0.541000	0.28102	0.376000	0.30014	3.981000	0.56902	0.725000	0.32318	0.555000	0.69702	CGA	HCK	-	pfam_SH2,smart_SH2,pfscan_SH2	ENSG00000101336		0.582	HCK-006	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	HCK	HGNC	protein_coding	OTTHUMT00000375751.1		0.00	17	0	G			30671802	+1			no_errors	ENST00000375852	ensembl	human	known	74_37	missense	17.65	14	3	SNP	0.565	A
HECW1	23072	genome.wustl.edu	37	7	43503287	43503287	+	Missense_Mutation	SNP	A	A	G			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr7:43503287A>G	ENST00000395891.2	+	14	3285	c.2680A>G	c.(2680-2682)Aca>Gca	p.T894A	HECW1_ENST00000453890.1_Missense_Mutation_p.T860A	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	894					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						AACCATTGCAACAGAGAGGTC	0.502																																																	0													72.0	78.0	76.0					7																	43503287		1906	4118	6024	SO:0001583	missense	0			AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.2680A>G	7.37:g.43503287A>G	ENSP00000379228:p.Thr894Ala		A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	pfam_HECT,pfam_WW_dom,pfam_C2_dom,superfamily_HECT,superfamily_WW_dom,superfamily_C2_dom,smart_C2_dom,smart_WW_dom,smart_HECT,pfscan_HECT,pfscan_C2_dom,pfscan_WW_dom	p.T894A	ENST00000395891.2	37	c.2680	CCDS5469.2	7	.	.	.	.	.	.	.	.	.	.	A	16.92	3.255093	0.59321	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	D;D	0.84660	-1.88;-1.88	5.2	4.05	0.47172	.	3.819830	0.01746	U	0.029660	T	0.79997	0.4543	L	0.34521	1.04	0.58432	D	0.999999	P;B	0.43287	0.802;0.215	B;B	0.38616	0.277;0.146	T	0.62868	-0.6763	10	0.15066	T	0.55	.	10.9174	0.47144	0.9258:0.0:0.0742:0.0	.	860;894	B4DH42;Q76N89	.;HECW1_HUMAN	A	894;860;894	ENSP00000379228:T894A;ENSP00000407774:T860A	ENSP00000265522:T894A	T	+	1	0	HECW1	43469812	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.175000	0.71949	0.825000	0.34637	0.482000	0.46254	ACA	HECW1	-	NULL	ENSG00000002746		0.502	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW1	HGNC	protein_coding	OTTHUMT00000250893.2		0.00	42	0	A	NM_015052		43503287	+1			no_errors	ENST00000395891	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	G
HMCN1	83872	genome.wustl.edu	37	1	186086741	186086741	+	Missense_Mutation	SNP	G	G	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr1:186086741G>C	ENST00000271588.4	+	77	12063	c.11834G>C	c.(11833-11835)aGa>aCa	p.R3945T	HMCN1_ENST00000367492.2_Missense_Mutation_p.R3945T	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3945	Ig-like C2-type 38.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GATGGCTATAGAATTCTGTCC	0.428																																																	0													94.0	93.0	93.0					1																	186086741		2203	4300	6503	SO:0001583	missense	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.11834G>C	1.37:g.186086741G>C	ENSP00000271588:p.Arg3945Thr		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd_dom,pfam_Thrombospondin_1_rpt,superfamily_GFP,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.R3945T	ENST00000271588.4	37	c.11834	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	G	13.69	2.311000	0.40895	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.67865	-0.29;-0.29	5.65	4.69	0.59074	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.179778	0.64402	D	0.000012	T	0.66247	0.2770	N	0.16098	0.37	0.40465	D	0.980287	D	0.71674	0.998	D	0.79784	0.993	T	0.61217	-0.7107	10	0.13853	T	0.58	.	16.0774	0.80976	0.0:0.1339:0.8661:0.0	.	3945	Q96RW7	HMCN1_HUMAN	T	3945	ENSP00000271588:R3945T;ENSP00000356462:R3945T	ENSP00000271588:R3945T	R	+	2	0	HMCN1	184353364	1.000000	0.71417	0.993000	0.49108	0.996000	0.88848	3.121000	0.50438	2.655000	0.90218	0.655000	0.94253	AGA	HMCN1	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000143341		0.428	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	-	0.00	33	0	G	NM_031935		186086741	+1	tier1	-	no_errors	ENST00000271588	ensembl	human	known	74_37	missense	46.15	49	42	SNP	1.000	C
HMHA1	23526	genome.wustl.edu	37	19	1073196	1073196	+	Missense_Mutation	SNP	C	C	G			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr19:1073196C>G	ENST00000313093.2	+	3	701	c.470C>G	c.(469-471)gCt>gGt	p.A157G	HMHA1_ENST00000539243.2_Missense_Mutation_p.A173G|HMHA1_ENST00000543365.1_Missense_Mutation_p.A40G|HMHA1_ENST00000592335.1_Missense_Mutation_p.L38V|HMHA1_ENST00000586866.1_Missense_Mutation_p.A161G|HMHA1_ENST00000536472.1_5'UTR|HMHA1_ENST00000590214.1_Missense_Mutation_p.A184G	NM_012292.3	NP_036424.2	Q92619	HMHA1_HUMAN	histocompatibility (minor) HA-1	157					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(7)|ovary(1)|prostate(2)	16		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGGGTGAGGCTCTGCGTGTC	0.647																																																	0													59.0	59.0	59.0					19																	1073196		2203	4300	6503	SO:0001583	missense	0			D86976	CCDS32863.1, CCDS58637.1, CCDS74242.1, CCDS74243.1	19p13.3	2011-09-07				ENSG00000180448		"""Rho GTPase activating proteins"""	17102	protein-coding gene	gene with protein product		601155				9820596, 9039502	Standard	NM_012292		Approved	KIAA0223, HA-1, ARHGAP45	uc010xgd.2	Q92619		ENST00000313093.2:c.470C>G	19.37:g.1073196C>G	ENSP00000316772:p.Ala157Gly		B4DTS4|F6QP70|Q6P189|Q7LE26|Q86WS1|Q8HX84|Q9GJN9|Q9GJP0|Q9GJP1|Q9MY24	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_FCH_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom	p.A157G	ENST00000313093.2	37	c.470	CCDS32863.1	19	.	.	.	.	.	.	.	.	.	.	C	10.19	1.281733	0.23392	.	.	ENSG00000180448	ENST00000539243;ENST00000313093;ENST00000544746;ENST00000412039;ENST00000543365	T;T;T	0.22539	2.01;2.03;1.95	4.16	1.5	0.22942	.	0.292492	0.31601	N	0.007361	T	0.21186	0.0510	L	0.47716	1.5	0.80722	D	1	B;P;B	0.46142	0.01;0.873;0.007	B;P;B	0.44811	0.006;0.461;0.003	T	0.04495	-1.0947	10	0.87932	D	0	-10.1789	10.278	0.43521	0.0:0.7879:0.0:0.2121	.	173;40;157	F6QP70;F5H1R4;Q92619	.;.;HMHA1_HUMAN	G	173;157;157;151;40	ENSP00000439601:A173G;ENSP00000316772:A157G;ENSP00000438979:A40G	ENSP00000316772:A157G	A	+	2	0	HMHA1	1024196	0.992000	0.36948	0.911000	0.35937	0.080000	0.17528	2.623000	0.46435	0.721000	0.32231	0.491000	0.48974	GCT	HMHA1	-	NULL	ENSG00000180448		0.647	HMHA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HMHA1	HGNC	protein_coding	OTTHUMT00000458026.1	-	0.00	39	0	C			1073196	+1	tier1	-	no_errors	ENST00000313093	ensembl	human	known	74_37	missense	21.05	30	8	SNP	0.994	G
IGSF10	285313	genome.wustl.edu	37	3	151163489	151163489	+	Missense_Mutation	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr3:151163489G>A	ENST00000282466.3	-	4	4279	c.4280C>T	c.(4279-4281)gCa>gTa	p.A1427V		NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	1427					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CTGAGTACTTGCTTGGGCTAG	0.403																																																	0													172.0	163.0	166.0					3																	151163489		2203	4300	6503	SO:0001583	missense	0			AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.4280C>T	3.37:g.151163489G>A	ENSP00000282466:p.Ala1427Val		Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.A1427V	ENST00000282466.3	37	c.4280	CCDS3160.1	3	.	.	.	.	.	.	.	.	.	.	G	9.792	1.178219	0.21787	.	.	ENSG00000152580	ENST00000282466;ENST00000544042	T	0.67865	-0.29	5.32	-1.04	0.10068	.	1.001480	0.08057	N	0.997566	T	0.35770	0.0943	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.22941	-1.0202	10	0.13470	T	0.59	.	5.4812	0.16725	0.361:0.0:0.3855:0.2535	.	1427	Q6WRI0	IGS10_HUMAN	V	1427;54	ENSP00000282466:A1427V	ENSP00000282466:A1427V	A	-	2	0	IGSF10	152646179	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.121000	0.10643	0.324000	0.23333	-0.300000	0.09419	GCA	IGSF10	-	NULL	ENSG00000152580		0.403	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF10	HGNC	protein_coding	OTTHUMT00000357782.1		0.00	107	0	G	NM_178822		151163489	-1			no_errors	ENST00000282466	ensembl	human	known	74_37	missense	5.05	94	5	SNP	0.000	A
IRX1	79192	genome.wustl.edu	37	5	3600242	3600242	+	Missense_Mutation	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr5:3600242G>A	ENST00000302006.3	+	2	1232	c.1180G>A	c.(1180-1182)Gtt>Att	p.V394I	CTD-2012M11.3_ENST00000559410.1_RNA	NM_024337.3	NP_077313.3	P78414	IRX1_HUMAN	iroquois homeobox 1	394					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			biliary_tract(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|pancreas(1)|prostate(5)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						CTTCCTGGGCGTTGGCGCTCC	0.657																																																	0													48.0	47.0	47.0					5																	3600242		2202	4300	6502	SO:0001583	missense	0			U90307	CCDS34132.1	5p15.33	2011-12-16	2007-07-13		ENSG00000170549	ENSG00000170549		"""Homeoboxes / TALE class"""	14358	protein-coding gene	gene with protein product		606197					Standard	NM_024337		Approved	IRX-5	uc003jde.3	P78414	OTTHUMG00000161632	ENST00000302006.3:c.1180G>A	5.37:g.3600242G>A	ENSP00000305244:p.Val394Ile		Q7Z2F8|Q8N312	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,smart_Iroquois_homeo,pfscan_Homeobox_dom	p.V394I	ENST00000302006.3	37	c.1180	CCDS34132.1	5	.	.	.	.	.	.	.	.	.	.	G	13.14	2.149723	0.37923	.	.	ENSG00000170549	ENST00000302006	T	0.59502	0.26	4.17	4.17	0.49024	.	0.145888	0.44285	D	0.000476	T	0.70395	0.3219	L	0.57536	1.79	0.52099	D	0.999947	D	0.76494	0.999	D	0.72982	0.979	T	0.67711	-0.5600	10	0.22706	T	0.39	.	16.4849	0.84182	0.0:0.0:1.0:0.0	.	394	P78414	IRX1_HUMAN	I	394	ENSP00000305244:V394I	ENSP00000305244:V394I	V	+	1	0	IRX1	3653242	1.000000	0.71417	0.818000	0.32626	0.004000	0.04260	7.072000	0.76777	1.834000	0.53371	0.467000	0.42956	GTT	IRX1	-	NULL	ENSG00000170549		0.657	IRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRX1	HGNC	protein_coding	OTTHUMT00000365546.1		0.00	17	0	G	NM_024337		3600242	+1			no_errors	ENST00000302006	ensembl	human	known	74_37	missense	35.29	11	6	SNP	1.000	A
IVL	3713	genome.wustl.edu	37	1	152882818	152882818	+	Missense_Mutation	SNP	A	A	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr1:152882818A>T	ENST00000368764.3	+	2	609	c.545A>T	c.(544-546)cAg>cTg	p.Q182L	IVL_ENST00000392667.2_Missense_Mutation_p.Q36L			P07476	INVO_HUMAN	involucrin	182	39 X 10 AA approximate tandem repeats of [LP]-[EKG]-[LHVYQEK]-[PLSQE]-[EQDV]- [QHEKRGA]-Q-[EMVQLP]-[GKLE]-[QHVNLD].				isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			caggaggggcagctggagctc	0.662																																																	0													11.0	12.0	12.0					1																	152882818		2196	4286	6482	SO:0001583	missense	0			BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.545A>T	1.37:g.152882818A>T	ENSP00000357753:p.Gln182Leu		Q5T7P4	Missense_Mutation	SNP	pfam_Involucrin_N,pfam_Involucrin_rpt	p.Q182L	ENST00000368764.3	37	c.545	CCDS1030.1	1	.	.	.	.	.	.	.	.	.	.	A	12.25	1.882555	0.33255	.	.	ENSG00000163207	ENST00000368764;ENST00000392667	T;T	0.11604	2.98;2.76	3.89	1.33	0.21861	.	.	.	.	.	T	0.05044	0.0135	L	0.53249	1.67	0.09310	N	1	P	0.46395	0.877	P	0.47430	0.547	T	0.31779	-0.9931	9	0.32370	T	0.25	.	5.4295	0.16446	0.6456:0.1807:0.0:0.1737	.	182	P07476	INVO_HUMAN	L	182;36	ENSP00000357753:Q182L;ENSP00000376435:Q36L	ENSP00000357753:Q182L	Q	+	2	0	IVL	151149442	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.458000	0.06737	0.027000	0.15297	0.358000	0.22013	CAG	IVL	-	pfam_Involucrin_rpt	ENSG00000163207		0.662	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IVL	HGNC	protein_coding	OTTHUMT00000034664.1	-	0.00	50	0	A	NM_005547		152882818	+1	tier1	-	no_errors	ENST00000368764	ensembl	human	known	74_37	missense	9.20	79	8	SNP	0.264	T
JAKMIP1	152789	genome.wustl.edu	37	4	6037791	6037791	+	Missense_Mutation	SNP	T	T	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr4:6037791T>C	ENST00000409021.3	-	19	2668	c.2219A>G	c.(2218-2220)cAg>cGg	p.Q740R	JAKMIP1_ENST00000409371.3_Missense_Mutation_p.Q555R	NM_001099433.1	NP_001092903.1	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein 1	97					cognition (GO:0050890)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|microtubule (GO:0005874)|ribonucleoprotein complex (GO:0030529)	GABA receptor binding (GO:0050811)|RNA binding (GO:0003723)			NS(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CCCCGGCTCCTGCTGCAGCGC	0.637																																																	0													9.0	11.0	10.0					4																	6037791		2002	4120	6122	SO:0001583	missense	0			AK056126	CCDS3385.1, CCDS47005.1	4p16.1	2013-10-11	2009-08-13		ENSG00000152969	ENSG00000152969			26460	protein-coding gene	gene with protein product		611195				18941173	Standard	NM_144720		Approved	MARLIN1, JAMIP1, Gababrbp, FLJ31564	uc010idb.1	Q96N16	OTTHUMG00000125491	ENST00000409021.3:c.2219A>G	4.37:g.6037791T>C	ENSP00000386711:p.Gln740Arg		A6H2J2|A6H2J3|A6H2J4|A6H2J5|A8MTK6|B4DHZ8|B8ZZR7|D3DVT0|Q86Y69|Q8N7G3	Missense_Mutation	SNP	NULL	p.Q740R	ENST00000409021.3	37	c.2219	CCDS47005.1	4	.	.	.	.	.	.	.	.	.	.	T	18.97	3.735268	0.69189	.	.	ENSG00000152969	ENST00000409021;ENST00000409371	T;T	0.33865	1.81;1.39	4.79	3.62	0.41486	.	0.000000	0.42172	U	0.000747	T	0.24314	0.0589	.	.	.	0.80722	D	1	B;B	0.10296	0.002;0.003	B;B	0.12156	0.006;0.007	T	0.04737	-1.0930	9	0.23891	T	0.37	.	9.3546	0.38159	0.0:0.0846:0.0:0.9154	.	555;740	Q96N16-5;Q96N16-2	.;.	R	740;555	ENSP00000386711:Q740R;ENSP00000387042:Q555R	ENSP00000386711:Q740R	Q	-	2	0	JAKMIP1	6088692	1.000000	0.71417	0.998000	0.56505	0.785000	0.44390	4.679000	0.61649	0.706000	0.31912	0.358000	0.22013	CAG	JAKMIP1	-	NULL	ENSG00000152969		0.637	JAKMIP1-003	KNOWN	basic|CCDS	protein_coding	JAKMIP1	HGNC	protein_coding	OTTHUMT00000329747.1	-	0.00	61	0	T	NM_144720		6037791	-1	tier1	-	no_errors	ENST00000409021	ensembl	human	known	74_37	missense	10.42	43	5	SNP	1.000	C
KBTBD6	89890	genome.wustl.edu	37	13	41705091	41705091	+	Silent	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr13:41705091G>A	ENST00000379485.1	-	1	1791	c.1557C>T	c.(1555-1557)tgC>tgT	p.C519C	KBTBD6_ENST00000499385.2_Silent_p.C453C	NM_152903.4	NP_690867.3	Q86V97	KBTB6_HUMAN	kelch repeat and BTB (POZ) domain containing 6	519								p.C519C(1)		NS(1)|breast(1)|endometrium(8)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(4)|urinary_tract(4)	43		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;4.08e-09)|Epithelial(112;4.74e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000131)|GBM - Glioblastoma multiforme(144;0.000876)|BRCA - Breast invasive adenocarcinoma(63;0.0673)		CATTGAAGACGCAGGCTTCCT	0.443																																																	1	Substitution - coding silent(1)	large_intestine(1)											96.0	92.0	94.0					13																	41705091		2203	4300	6503	SO:0001819	synonymous_variant	0			AK056633	CCDS9376.1	13q13.3	2013-01-08			ENSG00000165572	ENSG00000165572		"""BTB/POZ domain containing"""	25340	protein-coding gene	gene with protein product						12477932	Standard	NM_152903		Approved	DKFZp547E1912	uc001uxu.1	Q86V97	OTTHUMG00000016786	ENST00000379485.1:c.1557C>T	13.37:g.41705091G>A			Q5T6Y8|Q8N8L0|Q8NDM5|Q96MP6	Silent	SNP	pfam_BTB_POZ,pfam_BACK,pfam_Kelch_1,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pfscan_BTB/POZ-like	p.C519	ENST00000379485.1	37	c.1557	CCDS9376.1	13																																																																																			KBTBD6	-	NULL	ENSG00000165572		0.443	KBTBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KBTBD6	HGNC	protein_coding	OTTHUMT00000044657.1		0.00	32	0	G	NM_152903		41705091	-1			no_errors	ENST00000379485	ensembl	human	known	74_37	silent	6.45	29	2	SNP	0.993	A
KCNAB2	8514	genome.wustl.edu	37	1	6156793	6156793	+	Missense_Mutation	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr1:6156793G>A	ENST00000164247.1	+	14	1466	c.902G>A	c.(901-903)tGc>tAc	p.C301Y	KCNAB2_ENST00000378111.1_Intron|KCNAB2_ENST00000602612.1_Missense_Mutation_p.C301Y|KCNAB2_ENST00000458166.2_Missense_Mutation_p.C234Y|KCNAB2_ENST00000378087.3_Intron|KCNAB2_ENST00000378092.1_Missense_Mutation_p.C287Y|KCNAB2_ENST00000352527.1_Missense_Mutation_p.C287Y|KCNAB2_ENST00000341524.1_Missense_Mutation_p.C301Y|KCNAB2_ENST00000378097.1_Missense_Mutation_p.C301Y|KCNAB2_ENST00000378083.3_Missense_Mutation_p.C349Y	NM_001199860.1	NP_001186789.1	Q13303	KCAB2_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 2	301					hematopoietic progenitor cell differentiation (GO:0002244)|protein heterooligomerization (GO:0051291)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			large_intestine(1)|lung(4)|skin(3)	8	Ovarian(185;0.0634)	all_cancers(23;5.85e-39)|all_epithelial(116;4.88e-22)|all_lung(118;4.21e-08)|Lung NSC(185;9.77e-07)|all_hematologic(16;2.78e-06)|all_neural(13;3.18e-06)|Acute lymphoblastic leukemia(12;0.000272)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00106)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)		Epithelial(90;6.9e-37)|GBM - Glioblastoma multiforme(13;8.8e-31)|OV - Ovarian serous cystadenocarcinoma(86;1.45e-19)|Colorectal(212;2.46e-07)|COAD - Colon adenocarcinoma(227;2.07e-05)|Kidney(185;7.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00131)|BRCA - Breast invasive adenocarcinoma(365;0.00133)|STAD - Stomach adenocarcinoma(132;0.00391)|READ - Rectum adenocarcinoma(331;0.0649)		CGCCTGGGCTGCACCCTGCCC	0.677																																																	0													16.0	18.0	17.0					1																	6156793		2183	4279	6462	SO:0001583	missense	0			U33429	CCDS55.1, CCDS56.1, CCDS55570.1, CCDS55571.1	1p36.3	2008-02-05			ENSG00000069424	ENSG00000069424		"""Potassium channels"", ""Aldo-keto reductases"""	6229	protein-coding gene	gene with protein product		601142				8838324	Standard	NM_003636		Approved	AKR6A5, KCNA2B, HKvbeta2.1, HKvbeta2.2	uc001aly.2	Q13303	OTTHUMG00000000795	ENST00000164247.1:c.902G>A	1.37:g.6156793G>A	ENSP00000164247:p.Cys301Tyr		A0AVM9|A8K1A4|B0AZR7|O43659|Q5TG82|Q5TG83|Q6ZNE4|Q99411	Missense_Mutation	SNP	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_K_chnl_volt-dep_bsu_KCNAB1,prints_K_chnl_volt-dep_bsu_KCNAB2,prints_K_chnl_volt-dep_bsu_KCNAB-rel,prints_K_chnl_volt-dep_bsu_KCNAB3,tigrfam_K_chnl_volt-dep_bsu_KCNAB	p.C349Y	ENST00000164247.1	37	c.1046	CCDS55.1	1	.	.	.	.	.	.	.	.	.	.	G	31	5.073212	0.94000	.	.	ENSG00000069424	ENST00000378097;ENST00000378092;ENST00000341524;ENST00000352527;ENST00000164247;ENST00000378083;ENST00000458166	T;T;T;T;T;T;T	0.24908	1.83;1.83;1.83;1.83;1.83;1.83;1.83	5.26	5.26	0.73747	NADP-dependent oxidoreductase domain (3);	0.000000	0.85682	D	0.000000	T	0.56352	0.1979	M	0.83118	2.625	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.987	D;D;D;P	0.87578	0.998;0.993;0.994;0.771	T	0.60136	-0.7322	10	0.56958	D	0.05	-45.9681	18.2262	0.89917	0.0:0.0:1.0:0.0	.	349;287;301;301	Q13303-3;Q13303-2;Q13303;Q2YD85	.;.;KCAB2_HUMAN;.	Y	301;287;301;287;301;349;234	ENSP00000367337:C301Y;ENSP00000367332:C287Y;ENSP00000340824:C301Y;ENSP00000318772:C287Y;ENSP00000164247:C301Y;ENSP00000367323:C349Y;ENSP00000396167:C234Y	ENSP00000164247:C301Y	C	+	2	0	KCNAB2	6079380	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.645000	0.98471	2.640000	0.89533	0.655000	0.94253	TGC	KCNAB2	-	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,tigrfam_K_chnl_volt-dep_bsu_KCNAB	ENSG00000069424		0.677	KCNAB2-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	KCNAB2	HGNC	protein_coding	OTTHUMT00000002114.3		0.00	22	0	G	NM_172130		6156793	+1			no_errors	ENST00000378083	ensembl	human	known	74_37	missense	11.76	30	4	SNP	1.000	A
KCNC3	3748	genome.wustl.edu	37	19	50831847	50831847	+	Missense_Mutation	SNP	G	G	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr19:50831847G>T	ENST00000477616.1	-	1	787	c.493C>A	c.(493-495)Ccc>Acc	p.P165T	KCNC3_ENST00000376959.2_Missense_Mutation_p.P165T|NR1H2_ENST00000542413.1_5'Flank|KCNC3_ENST00000391818.2_Intron|KCNC3_ENST00000474951.1_Intron	NM_004977.2	NP_004968.2	Q14003	KCNC3_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 3	165					cell death (GO:0008219)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	axolemma (GO:0030673)|axon terminus (GO:0043679)|dendrite membrane (GO:0032590)|neuromuscular junction (GO:0031594)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			endometrium(2)|large_intestine(4)|lung(5)|pancreas(1)|skin(1)	13		all_neural(266;0.057)|Ovarian(192;0.208)		OV - Ovarian serous cystadenocarcinoma(262;0.00283)|GBM - Glioblastoma multiforme(134;0.0181)	Dalfampridine(DB06637)	TCAAACAGGGGCCCGCACACG	0.657																																					Melanoma(91;1496 2324 50908)												0													28.0	33.0	32.0					19																	50831847		2203	4296	6499	SO:0001583	missense	0			AB208930	CCDS12793.1	19q13.33	2014-09-17			ENSG00000131398	ENSG00000131398		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6235	protein-coding gene	gene with protein product		176264	"""spinocerebellar ataxia 13"""	SCA13		1740329, 8111118, 16382104	Standard	NM_004977		Approved	Kv3.3	uc002pru.1	Q14003	OTTHUMG00000044580	ENST00000477616.1:c.493C>A	19.37:g.50831847G>T	ENSP00000434241:p.Pro165Thr			Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,pfam_K_chnl_volt-dep_Kv3_ID,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv3.3,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv	p.P165T	ENST00000477616.1	37	c.493	CCDS12793.1	19	.	.	.	.	.	.	.	.	.	.	g	15.02	2.708080	0.48412	.	.	ENSG00000131398	ENST00000376959;ENST00000477616	T;T	0.75704	-0.96;-0.96	2.31	2.31	0.28768	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.64402	U	0.000016	T	0.80308	0.4599	L	0.55990	1.75	0.80722	D	1	D	0.67145	0.996	D	0.69824	0.966	T	0.81284	-0.1002	10	0.87932	D	0	.	10.3868	0.44145	0.0:0.0:1.0:0.0	.	165	Q14003	KCNC3_HUMAN	T	165	ENSP00000366158:P165T;ENSP00000434241:P165T	ENSP00000366158:P165T	P	-	1	0	KCNC3	55523659	1.000000	0.71417	1.000000	0.80357	0.712000	0.41017	6.552000	0.73914	1.327000	0.45338	0.177000	0.17058	CCC	KCNC3	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl_volt-dep_Kv3	ENSG00000131398		0.657	KCNC3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNC3	HGNC	protein_coding	OTTHUMT00000314288.2		0.00	79	0	G	NM_004977		50831847	-1			no_errors	ENST00000477616	ensembl	human	known	74_37	missense	5.19	73	4	SNP	1.000	T
KCNN3	3782	genome.wustl.edu	37	1	154842241	154842241	+	Missense_Mutation	SNP	T	T	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr1:154842241T>A	ENST00000271915.4	-	1	515	c.200A>T	c.(199-201)cAg>cTg	p.Q67L	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	67	Gln-rich.				potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	ctgctgctgctgaagctgcgg	0.701																																																	0													6.0	5.0	5.0					1																	154842241		1902	3781	5683	SO:0001583	missense	0			AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.200A>T	1.37:g.154842241T>A	ENSP00000271915:p.Gln67Leu		B1ANX0|O43517|Q86VF9|Q8WXG7	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_SK,pfam_CaM-bd_dom,pfam_2pore_dom_K_chnl_dom,superfamily_CaM-bd_dom,prints_K_chnl_Ca-activ_SK	p.Q67L	ENST00000271915.4	37	c.200	CCDS30880.1	1	.	.	.	.	.	.	.	.	.	.	T	10.25	1.297656	0.23650	.	.	ENSG00000143603	ENST00000271915;ENST00000539103	T	0.58940	0.3	4.75	2.32	0.28847	.	0.807289	0.10421	N	0.676712	T	0.21631	0.0521	N	0.19112	0.55	0.80722	D	1	B;B	0.29432	0.023;0.244	B;B	0.24006	0.021;0.05	T	0.06588	-1.0818	10	0.30078	T	0.28	-5.2094	10.2095	0.43132	0.0:0.0:0.3164:0.6836	.	73;72	Q6JXY2;Q9UGI6	.;KCNN3_HUMAN	L	67;162	ENSP00000271915:Q67L	ENSP00000271915:Q67L	Q	-	2	0	KCNN3	153108865	0.992000	0.36948	0.947000	0.38551	0.975000	0.68041	0.617000	0.24359	0.280000	0.22209	0.460000	0.39030	CAG	KCNN3	-	NULL	ENSG00000143603		0.701	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	KCNN3	HGNC	protein_coding	OTTHUMT00000090688.3		0.00	66	0	T	NM_002249		154842241	-1			no_errors	ENST00000271915	ensembl	human	novel	74_37	missense	5.56	117	7	SNP	0.941	A
KCNN4	3783	genome.wustl.edu	37	19	44271780	44271780	+	Missense_Mutation	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr19:44271780G>A	ENST00000262888.3	-	8	1594	c.1199C>T	c.(1198-1200)gCg>gTg	p.A400V		NM_002250.2	NP_002241.1	O15554	KCNN4_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4	400					calcium ion transport (GO:0006816)|cell volume homeostasis (GO:0006884)|defense response (GO:0006952)|immune system process (GO:0002376)|phospholipid translocation (GO:0045332)|positive regulation of protein secretion (GO:0050714)|positive regulation of T cell receptor signaling pathway (GO:0050862)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|saliva secretion (GO:0046541)|stabilization of membrane potential (GO:0030322)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|Intermediate conductance calcium-activated potassium channel activity (GO:0022894)|protein phosphatase binding (GO:0019903)			biliary_tract(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	15		Prostate(69;0.0352)			Clotrimazole(DB00257)|Enflurane(DB00228)|Halothane(DB01159)|Miconazole(DB01110)|Procaine(DB00721)|Quinine(DB00468)	CAGCTTCCCCGCCAGCGTGTC	0.607																																																	0													75.0	73.0	74.0					19																	44271780		2203	4300	6503	SO:0001583	missense	0			AF022797	CCDS12630.1	19q13.2	2012-07-05				ENSG00000104783		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6293	protein-coding gene	gene with protein product		602754				9380751, 9407042, 16382103	Standard	NM_002250		Approved	KCa3.1, hSK4, hKCa4, hIKCa1	uc002oxl.3	O15554		ENST00000262888.3:c.1199C>T	19.37:g.44271780G>A	ENSP00000262888:p.Ala400Val		Q53XR4	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_SK,pfam_CaM-bd_dom,pfam_2pore_dom_K_chnl_dom,superfamily_CaM-bd_dom	p.A400V	ENST00000262888.3	37	c.1199	CCDS12630.1	19	.	.	.	.	.	.	.	.	.	.	G	11.42	1.632543	0.29068	.	.	ENSG00000104783	ENST00000262888;ENST00000407385	D	0.99856	-7.21	3.87	2.8	0.32819	.	0.391333	0.24894	N	0.034754	D	0.98943	0.9641	L	0.44542	1.39	0.34569	D	0.713263	B;B	0.32128	0.118;0.357	B;B	0.24541	0.016;0.054	D	0.99987	1.3514	10	0.72032	D	0.01	-5.3834	6.7514	0.23489	0.0:0.198:0.5977:0.2042	.	294;400	D1MQ10;O15554	.;KCNN4_HUMAN	V	400;268	ENSP00000262888:A400V	ENSP00000262888:A400V	A	-	2	0	KCNN4	48963620	1.000000	0.71417	0.752000	0.31206	0.345000	0.29048	3.559000	0.53756	1.173000	0.42796	0.650000	0.86243	GCG	KCNN4	-	NULL	ENSG00000104783		0.607	KCNN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNN4	HGNC	protein_coding	OTTHUMT00000463598.1	-	0.00	28	0	G	NM_002250		44271780	-1	tier1	-	no_errors	ENST00000262888	ensembl	human	known	74_37	missense	29.79	33	14	SNP	0.896	A
ICE1	23379	genome.wustl.edu	37	5	5457453	5457453	+	Missense_Mutation	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr5:5457453G>A	ENST00000296564.7	+	12	922	c.700G>A	c.(700-702)Gcc>Acc	p.A234T		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		234					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						AGAAAAACCTGCCAAAGCAAT	0.428																																																	0													35.0	35.0	35.0					5																	5457453		1965	4159	6124	SO:0001583	missense	0																														ENST00000296564.7:c.700G>A	5.37:g.5457453G>A	ENSP00000296564:p.Ala234Thr		Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	superfamily_Vitellinogen_superhlx	p.A234T	ENST00000296564.7	37	c.700	CCDS47187.1	5	.	.	.	.	.	.	.	.	.	.	G	8.491	0.862052	0.17178	.	.	ENSG00000164151	ENST00000296564	T	0.10382	2.88	5.14	2.34	0.29019	.	0.508601	0.19914	N	0.103230	T	0.06325	0.0163	N	0.19112	0.55	0.22330	N	0.999196	B	0.25563	0.129	B	0.27715	0.082	T	0.36720	-0.9736	10	0.33141	T	0.24	-3.7942	5.072	0.14611	0.1775:0.0:0.6579:0.1645	.	234	Q9Y2F5	K0947_HUMAN	T	234	ENSP00000296564:A234T	ENSP00000296564:A234T	A	+	1	0	KIAA0947	5510453	0.990000	0.36364	0.537000	0.28052	0.102000	0.19082	1.158000	0.31737	0.182000	0.20032	-0.320000	0.08662	GCC	KIAA0947	-	NULL	ENSG00000164151		0.428	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0947	HGNC	protein_coding	OTTHUMT00000365575.1		0.00	29	0	G			5457453	+1			no_errors	ENST00000296564	ensembl	human	known	74_37	missense	7.69	36	3	SNP	0.975	A
ICE1	23379	genome.wustl.edu	37	5	5464411	5464411	+	Missense_Mutation	SNP	C	C	T	rs61736810	byFrequency	TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr5:5464411C>T	ENST00000296564.7	+	13	5186	c.4964C>T	c.(4963-4965)tCg>tTg	p.S1655L		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		1655	Pro-rich.				positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						CCACTGATATCGAGTTCTAGT	0.567													C|||	46	0.0091853	0.0325	0.0043	5008	,	,		17794	0.0		0.0	False		,,,				2504	0.0																0								C	LEU/SER	114,3996		1,112,1942	185.0	193.0	191.0		4964	5.0	0.0	5	dbSNP_129	191	2,8398		0,2,4198	yes	missense	KIAA0947	NM_015325.1	145	1,114,6140	TT,TC,CC		0.0238,2.7737,0.9273	benign	1655/2267	5464411	116,12394	2055	4200	6255	SO:0001583	missense	0																														ENST00000296564.7:c.4964C>T	5.37:g.5464411C>T	ENSP00000296564:p.Ser1655Leu		Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	superfamily_Vitellinogen_superhlx	p.S1655L	ENST00000296564.7	37	c.4964	CCDS47187.1	5	17	0.007783882783882784	15	0.03048780487804878	2	0.0055248618784530384	0	0.0	0	0.0	C	19.15	3.772123	0.69992	0.027737	2.38E-4	ENSG00000164151	ENST00000296564	T	0.14516	2.5	4.96	4.96	0.65561	.	.	.	.	.	T	0.08537	0.0212	L	0.36672	1.1	0.09310	N	1	D	0.76494	0.999	P	0.55824	0.785	T	0.02294	-1.1181	9	0.59425	D	0.04	-1.3045	15.6902	0.77446	0.0:1.0:0.0:0.0	rs61736810	1655	Q9Y2F5	K0947_HUMAN	L	1655	ENSP00000296564:S1655L	ENSP00000296564:S1655L	S	+	2	0	KIAA0947	5517411	0.137000	0.22531	0.005000	0.12908	0.629000	0.37895	3.245000	0.51407	2.282000	0.76494	0.460000	0.39030	TCG	KIAA0947	-	NULL	ENSG00000164151		0.567	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0947	HGNC	protein_coding	OTTHUMT00000365575.1		0.00	17	0	C			5464411	+1			no_errors	ENST00000296564	ensembl	human	known	74_37	missense	9.52	19	2	SNP	0.054	T
KIAA1147	57189	genome.wustl.edu	37	7	141364844	141364844	+	Missense_Mutation	SNP	C	C	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr7:141364844C>A	ENST00000536163.1	-	7	962	c.963G>T	c.(961-963)gaG>gaT	p.E321D	RP5-894A10.6_ENST00000602609.1_RNA|KIAA1147_ENST00000482493.1_Missense_Mutation_p.E217D	NM_001080392.1	NP_001073861.1	A4D1U4	LCHN_HUMAN	KIAA1147	321										breast(3)|endometrium(4)|kidney(2)|large_intestine(1)|ovary(1)|skin(1)	12	Melanoma(164;0.0171)					CGAATATCTTCTCTGTGGTGC	0.587																																																	0													63.0	64.0	64.0					7																	141364844		1957	4164	6121	SO:0001583	missense	0			AB032973	CCDS47726.1	7q34	2012-10-04			ENSG00000257093	ENSG00000257093			29472	protein-coding gene	gene with protein product							Standard	NM_001080392		Approved	LCHN	uc003vwk.3	A4D1U4	OTTHUMG00000157539	ENST00000536163.1:c.963G>T	7.37:g.141364844C>A	ENSP00000445768:p.Glu321Asp		Q9ULS3	Missense_Mutation	SNP	pfam_DUF2347	p.E321D	ENST00000536163.1	37	c.963	CCDS47726.1	7	.	.	.	.	.	.	.	.	.	.	C	26.3	4.725804	0.89298	.	.	ENSG00000257093	ENST00000536163;ENST00000482493	.	.	.	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.51753	0.1693	N	0.25332	0.735	0.49299	D	0.999771	D	0.54397	0.966	P	0.61874	0.895	T	0.41016	-0.9532	9	0.12103	T	0.63	-30.0951	10.7	0.45922	0.0:0.9038:0.0:0.0962	.	321	A4D1U4	LCHN_HUMAN	D	321;217	.	ENSP00000297761:E321D	E	-	3	2	KIAA1147	141011313	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	4.249000	0.58766	2.359000	0.80004	0.561000	0.74099	GAG	KIAA1147	-	pfam_DUF2347	ENSG00000257093		0.587	KIAA1147-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1147	HGNC	protein_coding	OTTHUMT00000349104.1	-	0.00	42	0	C			141364844	-1	tier1	-	no_errors	ENST00000536163	ensembl	human	known	74_37	missense	48.89	23	22	SNP	1.000	A
KIF1C	10749	genome.wustl.edu	37	17	4908250	4908250	+	Missense_Mutation	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr17:4908250C>T	ENST00000320785.5	+	13	1477	c.1120C>T	c.(1120-1122)Cgg>Tgg	p.R374W		NM_006612.5	NP_006603.2	O43896	KIF1C_HUMAN	kinesin family member 1C	374					ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(4)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|skin(1)|urinary_tract(3)	30						AGCCCGGCTGCGGGAACTGCT	0.612																																					Melanoma(96;1023 1447 10250 19259 33730)												0													109.0	117.0	115.0					17																	4908250		2203	4300	6503	SO:0001583	missense	0			U91329	CCDS11065.1	17p13.2	2014-03-03			ENSG00000129250	ENSG00000129250		"""Kinesins"""	6317	protein-coding gene	gene with protein product		603060	"""spastic ataxia 2 (autosomal recessive)"""	SAX2		9685376, 24319291, 24482476	Standard	NM_006612		Approved	SPAX2, SPG58	uc002gan.2	O43896	OTTHUMG00000099451	ENST00000320785.5:c.1120C>T	17.37:g.4908250C>T	ENSP00000320821:p.Arg374Trp		D3DTL6|O75186|Q5U618	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R374W	ENST00000320785.5	37	c.1120	CCDS11065.1	17	.	.	.	.	.	.	.	.	.	.	C	23.7	4.450566	0.84101	.	.	ENSG00000129250	ENST00000320785	T	0.76578	-1.03	4.82	4.82	0.62117	.	.	.	.	.	D	0.85080	0.5615	M	0.84082	2.675	0.52099	D	0.999948	D	0.76494	0.999	P	0.57620	0.824	D	0.86716	0.1939	9	0.87932	D	0	.	10.8012	0.46489	0.1888:0.8112:0.0:0.0	.	374	O43896	KIF1C_HUMAN	W	374	ENSP00000320821:R374W	ENSP00000320821:R374W	R	+	1	2	KIF1C	4848974	0.995000	0.38212	0.997000	0.53966	0.970000	0.65996	3.334000	0.52097	2.671000	0.90904	0.655000	0.94253	CGG	KIF1C	-	NULL	ENSG00000129250		0.612	KIF1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF1C	HGNC	protein_coding	OTTHUMT00000216916.1	-	0.00	50	0	C			4908250	+1	tier1	-	no_errors	ENST00000320785	ensembl	human	known	74_37	missense	12.50	28	4	SNP	1.000	T
KIF20B	9585	genome.wustl.edu	37	10	91497155	91497155	+	Missense_Mutation	SNP	G	G	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr10:91497155G>T	ENST00000371728.3	+	20	2622	c.2557G>T	c.(2557-2559)Gtt>Ttt	p.V853F	KIF20B_ENST00000416354.1_Missense_Mutation_p.V883F|KIF20B_ENST00000394289.2_Missense_Mutation_p.V853F|KIF20B_ENST00000260753.4_Missense_Mutation_p.V813F|KIF20B_ENST00000478929.1_3'UTR	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	853					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						GTCTATCCATGTTAGTTCAGC	0.318																																																	0													37.0	42.0	40.0					10																	91497155		2192	4291	6483	SO:0001583	missense	0			L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.2557G>T	10.37:g.91497155G>T	ENSP00000360793:p.Val853Phe		A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.V883F	ENST00000371728.3	37	c.2647		10	.	.	.	.	.	.	.	.	.	.	G	9.593	1.126554	0.20959	.	.	ENSG00000138182	ENST00000260753;ENST00000416354;ENST00000394289;ENST00000371728	T;T;T;T	0.71222	-0.39;-0.55;-0.45;-0.38	5.67	-5.01	0.02991	.	2.173650	0.01773	N	0.031279	T	0.60209	0.2251	L	0.54323	1.7	0.09310	N	1	P;B	0.37864	0.61;0.002	B;B	0.33690	0.168;0.003	T	0.55121	-0.8190	10	0.54805	T	0.06	1.8265	4.6311	0.12502	0.5264:0.0954:0.2819:0.0963	.	853;813	Q96Q89;Q96Q89-3	KI20B_HUMAN;.	F	813;883;853;853	ENSP00000260753:V813F;ENSP00000411545:V883F;ENSP00000377830:V853F;ENSP00000360793:V853F	ENSP00000260753:V813F	V	+	1	0	KIF20B	91487135	0.000000	0.05858	0.000000	0.03702	0.773000	0.43773	0.150000	0.16263	-0.865000	0.04073	0.484000	0.47621	GTT	KIF20B	-	NULL	ENSG00000138182		0.318	KIF20B-003	KNOWN	basic	protein_coding	KIF20B	HGNC	protein_coding	OTTHUMT00000049330.1	-	0.00	76	0	G	NM_016195		91497155	+1	tier1	-	no_errors	ENST00000416354	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.000	T
KRT85	3891	genome.wustl.edu	37	12	52755284	52755284	+	Splice_Site	SNP	T	T	G			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr12:52755284T>G	ENST00000257901.3	-	8	1374		c.e8-2		KRT85_ENST00000544265.1_Splice_Site	NM_002283.3	NP_002274.1	P78386	KRT85_HUMAN	keratin 85						epidermis development (GO:0008544)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(7)|liver(1)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	36	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		TCACACAGCCTATGGAGAAAG	0.453																																																	0													163.0	152.0	156.0					12																	52755284		2203	4300	6503	SO:0001630	splice_region_variant	0			X99140	CCDS8824.1, CCDS73472.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000135443	ENSG00000135443		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6462	protein-coding gene	gene with protein product	"""hard keratin type II"""	602767	"""keratin, hair, basic, 5"""	KRTHB5		9084137, 16831889	Standard	NM_002283		Approved	Hb-5	uc001sag.3	P78386	OTTHUMG00000169633	ENST00000257901.3:c.1299-2A>C	12.37:g.52755284T>G			Q9NSB1	Splice_Site	SNP	-	e8-2	ENST00000257901.3	37	c.1299-2	CCDS8824.1	12	.	.	.	.	.	.	.	.	.	.	T	16.22	3.061998	0.55432	.	.	ENSG00000135443	ENST00000257901;ENST00000544265	.	.	.	5.06	5.06	0.68205	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.7727	0.57429	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	KRT85	51041551	1.000000	0.71417	0.894000	0.35097	0.773000	0.43773	4.802000	0.62539	1.915000	0.55452	0.459000	0.35465	.	KRT85	-	-	ENSG00000135443		0.453	KRT85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT85	HGNC	protein_coding	OTTHUMT00000405184.1	-	0.00	47	0	T	NM_002283	Intron	52755284	-1	tier1	-	no_errors	ENST00000257901	ensembl	human	known	74_37	splice_site	23.08	30	9	SNP	0.970	G
LATS2	26524	genome.wustl.edu	37	13	21555733	21555733	+	Missense_Mutation	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr13:21555733G>A	ENST00000382592.4	-	6	2942	c.2537C>T	c.(2536-2538)tCt>tTt	p.S846F	LATS2_ENST00000542899.1_Missense_Mutation_p.S846F	NM_014572.2	NP_055387.2			large tumor suppressor kinase 2											breast(4)|central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(2)	45		all_cancers(29;4.74e-22)|all_epithelial(30;1.45e-18)|all_lung(29;4.69e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000781)|Epithelial(112;0.00144)|OV - Ovarian serous cystadenocarcinoma(117;0.0183)|Lung(94;0.0375)|LUSC - Lung squamous cell carcinoma(192;0.104)		CCGACAGTTAGACACATCATC	0.542																																																	0													62.0	56.0	58.0					13																	21555733		2203	4300	6503	SO:0001583	missense	0			AB028019	CCDS9294.1	13q11-q12	2013-04-25	2013-04-25		ENSG00000150457	ENSG00000150457			6515	protein-coding gene	gene with protein product		604861	"""LATS (large tumor suppressor, Drosophila) homolog 2"", ""LATS, large tumor suppressor, homolog 2 (Drosophila)"""			10673337	Standard	NM_014572		Approved		uc001unr.4	Q9NRM7	OTTHUMG00000016531	ENST00000382592.4:c.2537C>T	13.37:g.21555733G>A	ENSP00000372035:p.Ser846Phe			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom	p.S846F	ENST00000382592.4	37	c.2537	CCDS9294.1	13	.	.	.	.	.	.	.	.	.	.	G	16.01	3.002114	0.54254	.	.	ENSG00000150457	ENST00000382592;ENST00000542899	T;T	0.60797	0.16;0.16	5.69	5.69	0.88448	Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.084640	0.51477	D	0.000096	T	0.55561	0.1928	L	0.45137	1.4	0.80722	D	1	B	0.33345	0.409	B	0.34489	0.184	T	0.57613	-0.7781	10	0.66056	D	0.02	.	19.8632	0.96793	0.0:0.0:1.0:0.0	.	846	Q9NRM7	LATS2_HUMAN	F	846	ENSP00000372035:S846F;ENSP00000441817:S846F	ENSP00000372035:S846F	S	-	2	0	LATS2	20453733	1.000000	0.71417	0.167000	0.22817	0.644000	0.38419	7.817000	0.86213	2.713000	0.92767	0.644000	0.83932	TCT	LATS2	-	superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000150457		0.542	LATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LATS2	HGNC	protein_coding	OTTHUMT00000044102.1	-	0.00	32	0	G			21555733	-1	tier1	-	no_errors	ENST00000382592	ensembl	human	known	74_37	missense	45.83	13	11	SNP	0.998	A
LCE1D	353134	genome.wustl.edu	37	1	152770547	152770547	+	Missense_Mutation	SNP	A	A	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr1:152770547A>C	ENST00000326233.6	+	2	320	c.277A>C	c.(277-279)Agc>Cgc	p.S93R		NM_178352.2	NP_848129.1	Q5T752	LCE1D_HUMAN	late cornified envelope 1D	93	Cys-rich.				cellular response to calcium ion (GO:0071277)|cognition (GO:0050890)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)				large_intestine(1)	1	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGACTGCTGCAGCCAGCCCTC	0.672																																																	0													31.0	29.0	30.0					1																	152770547		2017	3761	5778	SO:0001583	missense	0				CCDS1025.1	1q21.3	2008-02-05			ENSG00000172155	ENSG00000172155		"""Late cornified envelopes"""	29465	protein-coding gene	gene with protein product		612606				11698679	Standard	NM_178352		Approved	LEP4	uc009wnp.3	Q5T752	OTTHUMG00000012444	ENST00000326233.6:c.277A>C	1.37:g.152770547A>C	ENSP00000316737:p.Ser93Arg			Missense_Mutation	SNP	NULL	p.S93R	ENST00000326233.6	37	c.277	CCDS1025.1	1	.	.	.	.	.	.	.	.	.	.	A	10.67	1.415003	0.25552	.	.	ENSG00000172155	ENST00000326233	T	0.03831	3.79	4.52	-2.19	0.07015	.	0.172281	0.28214	N	0.016163	T	0.01592	0.0051	L	0.56769	1.78	0.20873	N	0.999834	B	0.11235	0.004	B	0.08055	0.003	T	0.40098	-0.9581	10	0.87932	D	0	.	5.0532	0.14520	0.3734:0.1893:0.4373:0.0	.	93	Q5T752	LCE1D_HUMAN	R	93	ENSP00000316737:S93R	ENSP00000316737:S93R	S	+	1	0	LCE1D	151037171	0.930000	0.31532	0.975000	0.42487	0.861000	0.49209	1.046000	0.30354	-0.047000	0.13423	0.454000	0.30748	AGC	LCE1D	-	NULL	ENSG00000172155		0.672	LCE1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE1D	HGNC	protein_coding	OTTHUMT00000034657.2	-	0.00	66	0	A	NM_178352		152770547	+1	tier1	-	no_errors	ENST00000326233	ensembl	human	known	74_37	missense	8.26	100	9	SNP	0.765	C
LCP1	3936	genome.wustl.edu	37	13	46708338	46708338	+	Missense_Mutation	SNP	T	T	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr13:46708338T>C	ENST00000398576.2	-	17	1938	c.1550A>G	c.(1549-1551)aAt>aGt	p.N517S	LCP1_ENST00000435666.2_Missense_Mutation_p.N86S|LCP1_ENST00000323076.2_Missense_Mutation_p.N517S			P13796	PLSL_HUMAN	lymphocyte cytosolic protein 1 (L-plastin)	517	Actin-binding 2.|CH 4. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|organ regeneration (GO:0031100)|protein kinase A signaling (GO:0010737)|regulation of intracellular protein transport (GO:0033157)|T cell activation involved in immune response (GO:0002286)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|actin filament bundle (GO:0032432)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)			breast(2)|kidney(1)|large_intestine(6)|lung(18)|ovary(4)|prostate(2)|skin(1)	34		Lung NSC(96;1.27e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.39e-05)		AATGTCATCATTGACCTTCTG	0.358			T	BCL6	NHL																																			Dom	yes		13	13q14.1-q14.3	3936	lymphocyte cytosolic protein 1 (L-plastin)		L	0													133.0	111.0	119.0					13																	46708338		2203	4300	6503	SO:0001583	missense	0			M22300	CCDS9403.1	13q14.3	2013-01-10			ENSG00000136167	ENSG00000136167		"""EF-hand domain containing"""	6528	protein-coding gene	gene with protein product	"""plastin 2"""	153430				2111166	Standard	NM_002298		Approved	PLS2, CP64, L-PLASTIN, LC64P	uc001vba.4	P13796	OTTHUMG00000016864	ENST00000398576.2:c.1550A>G	13.37:g.46708338T>C	ENSP00000381581:p.Asn517Ser		B2R613|B4DUA0|Q5TBN4	Missense_Mutation	SNP	pfam_CH-domain,pfam_EF_hand_dom,pfam_CAMSAP_CH,superfamily_CH-domain,smart_EF_hand_dom,smart_CH-domain,pfscan_CH-domain,pfscan_EF_hand_dom	p.N517S	ENST00000398576.2	37	c.1550	CCDS9403.1	13	.	.	.	.	.	.	.	.	.	.	T	0.703	-0.790043	0.02884	.	.	ENSG00000136167	ENST00000323076;ENST00000398576;ENST00000435666	D;D;D	0.95307	-3.67;-3.67;-3.67	5.93	5.93	0.95920	Calponin homology domain (4);	0.303036	0.39274	N	0.001418	D	0.85414	0.5691	N	0.03050	-0.425	0.38798	D	0.955134	B;B	0.02656	0.0;0.0	B;B	0.12837	0.001;0.008	T	0.82208	-0.0571	10	0.15066	T	0.55	-21.4676	15.5755	0.76380	0.0:0.0:0.0:1.0	.	86;517	B4DUA0;P13796	.;PLSL_HUMAN	S	517;517;86	ENSP00000315757:N517S;ENSP00000381581:N517S;ENSP00000405134:N86S	ENSP00000315757:N517S	N	-	2	0	LCP1	45606339	1.000000	0.71417	0.999000	0.59377	0.099000	0.18886	3.328000	0.52052	2.281000	0.76405	0.533000	0.62120	AAT	LCP1	-	superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000136167		0.358	LCP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	LCP1	HGNC	protein_coding	OTTHUMT00000044800.3		0.00	26	0	T	NM_002298		46708338	-1			no_errors	ENST00000323076	ensembl	human	known	74_37	missense	8.11	34	3	SNP	0.960	C
MIR9-2	407047	genome.wustl.edu	37	5	87969079	87969079	+	RNA	DEL	A	A	-			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr5:87969079delA	ENST00000510274.1	+	0	0																											ACCAAGGAGTAAAAAAAAAGC	0.498																																																	0																																												0																															5.37:g.87969079delA				RNA	DEL	-	NULL	ENST00000510274.1	37	NULL		5																																																																																			LINC00461	-	-	ENSG00000245526		0.498	CTC-467M3.1-001	KNOWN	basic	antisense	LINC00461	HGNC	antisense	OTTHUMT00000369794.1		0.00	45	0	A			87969079	-1	tier1		no_errors	ENST00000505030	ensembl	human	known	74_37	rna	6.45	29	2	DEL	0.276	-
LPHN3	23284	genome.wustl.edu	37	4	62758482	62758482	+	Missense_Mutation	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr4:62758482G>A	ENST00000514591.1	+	9	1714	c.1385G>A	c.(1384-1386)aGa>aAa	p.R462K	LPHN3_ENST00000508693.1_Missense_Mutation_p.R530K|LPHN3_ENST00000509896.1_Missense_Mutation_p.R530K|LPHN3_ENST00000512091.2_Missense_Mutation_p.R462K|LPHN3_ENST00000506700.1_Missense_Mutation_p.R462K|LPHN3_ENST00000514996.1_Missense_Mutation_p.R462K|LPHN3_ENST00000514157.1_Missense_Mutation_p.R462K|LPHN3_ENST00000506720.1_Missense_Mutation_p.R530K|LPHN3_ENST00000504896.1_Missense_Mutation_p.R462K|LPHN3_ENST00000545650.1_Missense_Mutation_p.R462K|LPHN3_ENST00000506746.1_Missense_Mutation_p.R530K|LPHN3_ENST00000507625.1_Missense_Mutation_p.R530K|LPHN3_ENST00000508946.1_Missense_Mutation_p.R462K|LPHN3_ENST00000507164.1_Missense_Mutation_p.R530K|LPHN3_ENST00000511324.1_Missense_Mutation_p.R530K			Q9HAR2	LPHN3_HUMAN	latrophilin 3	462					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						GTGTCAGGAAGAAGAAACCGG	0.542																																																	0													122.0	118.0	119.0					4																	62758482		2024	4171	6195	SO:0001583	missense	0			AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.1385G>A	4.37:g.62758482G>A	ENSP00000422533:p.Arg462Lys		E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	pfam_GPCR_2_latrophilin_rcpt_C,pfam_Olfac-like,pfam_DUF3497,pfam_GPCR_2_secretin-like,pfam_Lectin_gal-bd_dom,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,smart_Olfac-like,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_Lectin_gal-bd_dom,pfscan_Olfac-like,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_latrophilin,prints_GPCR_2_secretin-like	p.R530K	ENST00000514591.1	37	c.1589	CCDS54768.1	4	.	.	.	.	.	.	.	.	.	.	G	13.45	2.241536	0.39598	.	.	ENSG00000150471	ENST00000512091;ENST00000514591;ENST00000509896;ENST00000511324;ENST00000506700;ENST00000534975;ENST00000545650;ENST00000295349;ENST00000280009;ENST00000507164;ENST00000508693;ENST00000507625;ENST00000514157;ENST00000504896;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17;-0.17;-0.17;-0.17;-0.17;-0.17;-0.17;-0.17;-0.17;-0.17;-0.17;-0.17	5.83	5.83	0.93111	.	0.131761	0.51477	D	0.000083	T	0.47783	0.1464	N	0.24115	0.695	0.40621	D	0.981769	B;B	0.31817	0.118;0.341	B;B	0.27500	0.017;0.08	T	0.48281	-0.9049	10	0.38643	T	0.18	.	14.7	0.69150	0.0:0.1445:0.8555:0.0	.	462;462	E9PE04;Q9HAR2-2	.;.	K	462;462;530;530;462;462;462;462;462;530;530;530;462;462;462;530;530;462	ENSP00000423388:R462K;ENSP00000422533:R462K;ENSP00000423787:R530K;ENSP00000425033:R530K;ENSP00000424120:R462K;ENSP00000439831:R462K;ENSP00000421476:R530K;ENSP00000424030:R530K;ENSP00000421372:R530K;ENSP00000425201:R462K;ENSP00000423434:R462K;ENSP00000421627:R462K;ENSP00000420931:R530K;ENSP00000425884:R530K;ENSP00000424258:R462K	ENSP00000280009:R462K	R	+	2	0	LPHN3	62441077	1.000000	0.71417	0.990000	0.47175	0.662000	0.39071	4.126000	0.57937	2.763000	0.94921	0.563000	0.77884	AGA	LPHN3	-	NULL	ENSG00000150471		0.542	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	LPHN3	HGNC	protein_coding	OTTHUMT00000361765.1	-	0.00	37	0	G			62758482	+1	tier1	-	no_errors	ENST00000507625	ensembl	human	known	74_37	missense	22.73	17	5	SNP	1.000	A
LRP1B	53353	genome.wustl.edu	37	2	141079546	141079546	+	Missense_Mutation	SNP	T	T	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr2:141079546T>C	ENST00000389484.3	-	82	13597	c.12626A>G	c.(12625-12627)gAt>gGt	p.D4209G		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	4209					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CAGGCTGTCATCATTGCAGGT	0.363										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												0													77.0	84.0	81.0					2																	141079546		2203	4300	6503	SO:0001583	missense	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.12626A>G	2.37:g.141079546T>C	ENSP00000374135:p.Asp4209Gly		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.D4209G	ENST00000389484.3	37	c.12626	CCDS2182.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	19.31|19.31	3.803469|3.803469	0.70682|0.70682	.|.	.|.	ENSG00000168702|ENSG00000168702	ENST00000389484;ENST00000544579|ENST00000437977	D|.	0.90385|.	-2.66|.	5.19|5.19	5.19|5.19	0.71726|0.71726	Growth factor, receptor (1);|.	0.063063|.	0.64402|.	D|.	0.000009|.	T|T	0.74619|0.74619	0.3740|0.3740	M|M	0.76170|0.76170	2.325|2.325	0.50039|0.50039	D|D	0.999849|0.999849	P|.	0.40000|.	0.698|.	B|.	0.39617|.	0.305|.	T|T	0.75766|0.75766	-0.3202|-0.3202	10|5	0.23302|.	T|.	0.38|.	.|.	15.3496|15.3496	0.74373|0.74373	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	4209|.	Q9NZR2|.	LRP1B_HUMAN|.	G|V	4209;4147|441	ENSP00000374135:D4209G|.	ENSP00000374135:D4209G|.	D|M	-|-	2|1	0|0	LRP1B|LRP1B	140796016|140796016	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.302000|7.302000	0.78861|0.78861	2.075000|2.075000	0.62263|0.62263	0.528000|0.528000	0.53228|0.53228	GAT|ATG	LRP1B	-	superfamily_Growth_fac_rcpt_N_dom	ENSG00000168702		0.363	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	-	0.00	39	0	T	NM_018557		141079546	-1	tier1	-	no_errors	ENST00000389484	ensembl	human	known	74_37	missense	20.00	36	9	SNP	1.000	C
LRRIQ3	127255	genome.wustl.edu	37	1	74621378	74621378	+	Intron	SNP	T	T	G			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr1:74621378T>G	ENST00000395089.1	-	3	707				LRRIQ3_ENST00000354431.4_Intron|LRRIQ3_ENST00000370909.2_Intron|LRRIQ3_ENST00000468759.1_Intron			A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3											NS(2)|breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(13)|liver(1)|lung(27)|ovary(3)|prostate(1)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(5)	73						CTTCACCTTCTTATTTCAATA	0.264																																																	0													30.0	29.0	29.0					1																	74621378		1774	4017	5791	SO:0001627	intron_variant	0			BX647210	CCDS41350.1	1p31.1	2008-06-12	2008-06-12	2008-06-12	ENSG00000162620	ENSG00000162620			28318	protein-coding gene	gene with protein product			"""leucine rich repeat containing 44"""	LRRC44		12477932	Standard	NM_001105659		Approved	MGC22773	uc001dfy.4	A6PVS8	OTTHUMG00000009508	ENST00000395089.1:c.707+38A>C	1.37:g.74621378T>G			A6PVS9|Q6P5P7|Q6ZMV4|Q8WUE0	RNA	SNP	-	NULL	ENST00000395089.1	37	NULL	CCDS41350.1	1																																																																																			LRRIQ3	-	-	ENSG00000162620		0.264	LRRIQ3-008	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRIQ3	HGNC	protein_coding	OTTHUMT00000316539.1	-	0.00	108	0	T	NM_145258		74621378	-1	tier1	-	no_errors	ENST00000495179	ensembl	human	putative	74_37	rna	19.44	86	21	SNP	0.000	G
LYST	1130	genome.wustl.edu	37	1	235972611	235972611	+	Nonsense_Mutation	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr1:235972611G>A	ENST00000389794.3	-	5	1681	c.1507C>T	c.(1507-1509)Cga>Tga	p.R503*	LYST_ENST00000536965.1_Nonsense_Mutation_p.R503*|LYST_ENST00000389793.2_Nonsense_Mutation_p.R503*			Q99698	LYST_HUMAN	lysosomal trafficking regulator	503					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TATTCACATCGTCTGTGCCTT	0.373																																																	0													113.0	112.0	113.0					1																	235972611		2203	4300	6503	SO:0001587	stop_gained	0			U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.1507C>T	1.37:g.235972611G>A	ENSP00000374444:p.Arg503*		O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Nonsense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R503*	ENST00000389794.3	37	c.1507	CCDS31062.1	1	.	.	.	.	.	.	.	.	.	.	G	40	8.449797	0.98815	.	.	ENSG00000143669	ENST00000389794;ENST00000389793;ENST00000536965	.	.	.	5.46	4.51	0.55191	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.3479	0.60584	0.0:0.0:0.7163:0.2837	.	.	.	.	X	503	.	ENSP00000374443:R503X	R	-	1	2	LYST	234039234	1.000000	0.71417	0.675000	0.29917	0.945000	0.59286	6.274000	0.72587	2.547000	0.85894	0.650000	0.86243	CGA	LYST	-	superfamily_ARM-type_fold	ENSG00000143669		0.373	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYST	HGNC	protein_coding	OTTHUMT00000097533.5	-	0.00	29	0	G			235972611	-1	tier1	-	no_errors	ENST00000389793	ensembl	human	known	74_37	nonsense	18.18	27	6	SNP	0.986	A
MAN1B1	11253	genome.wustl.edu	37	9	139998207	139998207	+	Intron	SNP	G	G	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr9:139998207G>C	ENST00000371589.4	+	8	1327				MAN1B1_ENST00000474902.1_Intron|MAN1B1_ENST00000540391.1_3'UTR	NM_016219.4	NP_057303.2	Q9UKM7	MA1B1_HUMAN	mannosidase, alpha, class 1B, member 1						cellular protein metabolic process (GO:0044267)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum quality control compartment (GO:0044322)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			autonomic_ganglia(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(2)	14	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;3.08e-05)|Epithelial(140;0.000513)		CGTGCAGGTCGGTGGTGTTAC	0.537																																																	0																																										SO:0001627	intron_variant	0			AF145732	CCDS7029.1	9q34.3	2014-05-27			ENSG00000177239	ENSG00000177239			6823	protein-coding gene	gene with protein product	"""endoplasmic reticulum alpha-mannosidase 1"", ""alpha 1,2-mannosidase"", ""endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase 1"", ""ER alpha 1,2-mannosidase"", ""Man9GlcNAc2-specific processing alpha-mannosidase"""	604346				10409699, 10521544	Standard	NM_016219		Approved	MANA-ER, MRT15	uc004cld.3	Q9UKM7	OTTHUMG00000020978	ENST00000371589.4:c.1254+2083G>C	9.37:g.139998207G>C			Q5VSG3|Q9BRS9|Q9Y5K7	RNA	SNP	-	NULL	ENST00000371589.4	37	NULL	CCDS7029.1	9																																																																																			MAN1B1	-	-	ENSG00000177239		0.537	MAN1B1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN1B1	HGNC	protein_coding	OTTHUMT00000055294.2	-	0.00	182	0	G	NM_016219		139998207	+1	tier1	-	no_errors	ENST00000540391	ensembl	human	known	74_37	rna	9.09	147	15	SNP	0.102	C
MAN2B2	23324	genome.wustl.edu	37	4	6612647	6612647	+	Missense_Mutation	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr4:6612647G>A	ENST00000285599.3	+	14	2336	c.2300G>A	c.(2299-2301)gGc>gAc	p.G767D	MAN2B2_ENST00000504248.1_Missense_Mutation_p.G716D	NM_015274.1	NP_056089.1	Q9Y2E5	MA2B2_HUMAN	mannosidase, alpha, class 2B, member 2	767					mannose metabolic process (GO:0006013)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			breast(2)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	30						ATGGAGGATGGCAAAAGCAGG	0.582																																																	0													159.0	140.0	146.0					4																	6612647		2203	4300	6503	SO:0001583	missense	0			BC033307	CCDS33951.1	4p16.2	2005-11-09			ENSG00000013288	ENSG00000013288			29623	protein-coding gene	gene with protein product	"""core-specific lysosomal alpha-1,6-Mannosidase"""					10231032, 16115860	Standard	XR_241647		Approved	KIAA0935	uc003gjf.1	Q9Y2E5	OTTHUMG00000160073	ENST00000285599.3:c.2300G>A	4.37:g.6612647G>A	ENSP00000285599:p.Gly767Asp		Q66MP2|Q86T67	Missense_Mutation	SNP	pfam_Glyco_hydro_38_N,pfam_Glyco_hydro_38_C,pfam_Glyco_hydro_38_cen_dom,superfamily_Gal_mutarotase_SF_dom,superfamily_Glyco_hydro/deAcase_b/a-brl,smart_Glyco_hydro_38_cen_dom	p.G767D	ENST00000285599.3	37	c.2300	CCDS33951.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.004|0.004	-2.274010|-2.274010	0.00257|0.00257	.|.	.|.	ENSG00000013288|ENSG00000013288	ENST00000505907|ENST00000285599;ENST00000504248	.|T;T	.|0.78924	.|-1.22;-1.22	4.88|4.88	-7.56|-7.56	0.01322|0.01322	.|Glycosyl hydrolases 38, C-terminal (1);Glycoside hydrolase-type carbohydrate-binding (1);	.|1.431980	.|0.03989	.|N	.|0.294582	T|T	0.48466|0.48466	0.1501|0.1501	N|N	0.03608|0.03608	-0.345|-0.345	0.09310|0.09310	N|N	1|1	.|B;B;B	.|0.02656	.|0.0;0.0;0.0	.|B;B;B	.|0.08055	.|0.003;0.003;0.001	T|T	0.55736|0.55736	-0.8094|-0.8094	5|10	.|0.02654	.|T	.|1	-1.3199|-1.3199	10.5378|10.5378	0.45016|0.45016	0.7013:0.1011:0.1976:0.0|0.7013:0.1011:0.1976:0.0	.|.	.|716;767;767	.|E9PCD7;Q9Y2E5;Q9Y2E5-2	.|.;MA2B2_HUMAN;.	T|D	766|767;716	.|ENSP00000285599:G767D;ENSP00000423129:G716D	.|ENSP00000285599:G767D	A|G	+|+	1|2	0|0	MAN2B2|MAN2B2	6663548|6663548	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.010000|0.010000	0.07245|0.07245	-0.097000|-0.097000	0.11042|0.11042	-1.773000|-1.773000	0.01290|0.01290	-1.149000|-1.149000	0.01842|0.01842	GCA|GGC	MAN2B2	-	pfam_Glyco_hydro_38_C,superfamily_Gal_mutarotase_SF_dom	ENSG00000013288		0.582	MAN2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN2B2	HGNC	protein_coding	OTTHUMT00000359106.2	-	0.00	58	0	G	NM_015274		6612647	+1	tier1	-	no_errors	ENST00000285599	ensembl	human	known	74_37	missense	7.69	48	4	SNP	0.000	A
MAP1S	55201	genome.wustl.edu	37	19	17844182	17844182	+	Missense_Mutation	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr19:17844182G>A	ENST00000324096.4	+	6	3120	c.2969G>A	c.(2968-2970)cGg>cAg	p.R990Q	CTD-3149D2.4_ENST00000595363.1_RNA|MAP1S_ENST00000544059.2_Missense_Mutation_p.R964Q	NM_018174.4	NP_060644.4	Q66K74	MAP1S_HUMAN	microtubule-associated protein 1S	990	Necessary for association with actin. {ECO:0000250}.|Necessary for interaction with RASSF1 isoform A and isoform C.|Necessary for the mitochondrial aggregation and genome destruction.				apoptotic DNA fragmentation (GO:0006309)|brain development (GO:0007420)|execution phase of apoptosis (GO:0097194)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|nervous system development (GO:0007399)|neuron projection morphogenesis (GO:0048812)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	actin filament binding (GO:0051015)|beta-tubulin binding (GO:0048487)|DNA binding (GO:0003677)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	25						GAAGGCATGCGGGCCGTCCTG	0.647																																																	0													40.0	30.0	33.0					19																	17844182		2203	4299	6502	SO:0001583	missense	0			BC067115	CCDS32954.1	19p13.12	2008-02-05	2006-07-04	2006-07-04		ENSG00000130479			15715	protein-coding gene	gene with protein product		607573	"""chromosome 19 open reading frame 5"", ""VCY2 interacting protein 1"", ""BPY2 interacting protein 1"""	C19orf5, VCY2IP1, BPY2IP1		11827465, 15528209, 16297881, 14627543	Standard	NM_018174		Approved	FLJ10669, MAP8	uc002nhe.1	Q66K74		ENST00000324096.4:c.2969G>A	19.37:g.17844182G>A	ENSP00000325313:p.Arg990Gln		B4DH53|Q27QB1|Q6NXF1|Q8N3L8|Q8N3W5|Q8NI88|Q96H94|Q96IT4|Q96SP8|Q9BRC6|Q9H928|Q9NVK7	Missense_Mutation	SNP	NULL	p.R990Q	ENST00000324096.4	37	c.2969	CCDS32954.1	19	.	.	.	.	.	.	.	.	.	.	G	15.57	2.872617	0.51695	.	.	ENSG00000130479	ENST00000324096;ENST00000544059	T;T	0.20332	2.08;2.08	4.38	2.21	0.28008	.	0.145189	0.30483	N	0.009531	T	0.31702	0.0805	M	0.65975	2.015	0.32383	N	0.554321	D;P	0.69078	0.997;0.941	P;B	0.54924	0.764;0.407	T	0.45101	-0.9284	10	0.72032	D	0.01	-25.9577	7.963	0.30083	0.2088:0.0:0.7912:0.0	.	964;990	B4DH53;Q66K74	.;MAP1S_HUMAN	Q	990;964	ENSP00000325313:R990Q;ENSP00000439243:R964Q	ENSP00000325313:R990Q	R	+	2	0	MAP1S	17705182	0.994000	0.37717	0.130000	0.21974	0.002000	0.02628	2.522000	0.45572	0.809000	0.34255	-0.150000	0.13652	CGG	MAP1S	-	NULL	ENSG00000130479		0.647	MAP1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP1S	HGNC	protein_coding	OTTHUMT00000466027.1	-	0.00	58	0	G	NM_018174		17844182	+1	tier1	-	no_errors	ENST00000324096	ensembl	human	known	74_37	missense	23.08	40	12	SNP	0.994	A
MAP3K10	4294	genome.wustl.edu	37	19	40721128	40721128	+	Missense_Mutation	SNP	C	C	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr19:40721128C>A	ENST00000253055.3	+	10	3082	c.2794C>A	c.(2794-2796)Ctg>Atg	p.L932M		NM_002446.3	NP_002437.2	Q02779	M3K10_HUMAN	mitogen-activated protein kinase kinase kinase 10	932					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|JNK cascade (GO:0007254)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|protein autophosphorylation (GO:0046777)|signal transduction (GO:0007165)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|bHLH transcription factor binding (GO:0043425)|JUN kinase kinase kinase activity (GO:0004706)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription corepressor activity (GO:0003714)			NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	24						GCCCACACTGCTGGACATGGA	0.687																																																	0													9.0	8.0	8.0					19																	40721128		2158	4248	6406	SO:0001583	missense	0			X90846	CCDS12549.1	19q13.2	2014-08-12			ENSG00000130758		2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6849	protein-coding gene	gene with protein product	"""MKN28 kinase"", ""mixed lineage kinase 2"", ""MKN28 derived nonreceptor_type serine/threonine kinase"""	600137		MLK2		8536694, 7731697	Standard	NM_002446		Approved	MST, MEKK10	uc002ona.3	Q02779	OTTHUMG00000182591	ENST00000253055.3:c.2794C>A	19.37:g.40721128C>A	ENSP00000253055:p.Leu932Met		Q12761|Q14871	Missense_Mutation	SNP	pirsf_MAPKKK9/10/11,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH3_2,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,pfscan_SH3_domain,pfscan_Prot_kinase_dom	p.L932M	ENST00000253055.3	37	c.2794	CCDS12549.1	19	.	.	.	.	.	.	.	.	.	.	C	10.03	1.239040	0.22711	.	.	ENSG00000130758	ENST00000253055	D	0.83837	-1.77	4.36	3.31	0.37934	.	0.067733	0.64402	D	0.000012	T	0.75369	0.3840	L	0.40543	1.245	0.37010	D	0.895707	B	0.25772	0.134	B	0.20577	0.03	T	0.76258	-0.3025	10	0.62326	D	0.03	.	11.9797	0.53113	0.0:0.8234:0.1766:0.0	.	932	Q02779	M3K10_HUMAN	M	932	ENSP00000253055:L932M	ENSP00000253055:L932M	L	+	1	2	MAP3K10	45412968	1.000000	0.71417	0.797000	0.32132	0.306000	0.27790	1.911000	0.39937	1.042000	0.40150	0.561000	0.74099	CTG	MAP3K10	-	pirsf_MAPKKK9/10/11	ENSG00000130758		0.687	MAP3K10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP3K10	HGNC	protein_coding	OTTHUMT00000462552.1	-	0.00	26	0	C	NM_002446		40721128	+1	tier1	-	no_errors	ENST00000253055	ensembl	human	known	74_37	missense	28.57	25	10	SNP	1.000	A
MAT2B	27430	genome.wustl.edu	37	5	162940917	162940917	+	Missense_Mutation	SNP	G	G	A	rs544029890		TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr5:162940917G>A	ENST00000321757.6	+	4	582	c.443G>A	c.(442-444)aGa>aAa	p.R148K	MAT2B_ENST00000280969.5_Missense_Mutation_p.R137K|MAT2B_ENST00000518095.1_Missense_Mutation_p.R148K	NM_013283.3	NP_037415.1	Q9NZL9	MAT2B_HUMAN	methionine adenosyltransferase II, beta	148					cellular nitrogen compound metabolic process (GO:0034641)|extracellular polysaccharide biosynthetic process (GO:0045226)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|regulation of catalytic activity (GO:0050790)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|methionine adenosyltransferase complex (GO:0048269)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dTDP-4-dehydrorhamnose reductase activity (GO:0008831)|enzyme binding (GO:0019899)|methionine adenosyltransferase regulator activity (GO:0048270)			endometrium(3)|large_intestine(4)|lung(6)|upper_aerodigestive_tract(1)	14	Renal(175;0.000281)	Medulloblastoma(196;0.0208)|all_neural(177;0.0765)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.027)|OV - Ovarian serous cystadenocarcinoma(192;0.0406)|Epithelial(171;0.0797)	L-Methionine(DB00134)	CCACCTTACAGAGAGGAAGAC	0.363													G|||	1	0.000199681	0.0	0.0	5008	,	,		14147	0.001		0.0	False		,,,				2504	0.0																0													91.0	88.0	89.0					5																	162940917		2203	4300	6503	SO:0001583	missense	0			AF182814	CCDS4364.1, CCDS4365.1	5q34-q35	2011-09-14			ENSG00000038274	ENSG00000038274		"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	6905	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 23E, member 1"""	605527				9055605, 10644686, 19027726	Standard	NM_182796		Approved	MATIIbeta, SDR23E1	uc003lzk.4	Q9NZL9	OTTHUMG00000130379	ENST00000321757.6:c.443G>A	5.37:g.162940917G>A	ENSP00000325425:p.Arg148Lys		B2R5Y6|Q1WAI7|Q27J92|Q3LIE8|Q567T7|Q6NYC7|Q9BS89|Q9H3E1|Q9UJ54	Missense_Mutation	SNP	pfam_dTDP_dehydrorham_reduct,pfam_Epimerase_deHydtase,pfam_Polysac_CapD-like,pfam_3Beta_OHSteriod_DH/Estase	p.R148K	ENST00000321757.6	37	c.443	CCDS4365.1	5	.	.	.	.	.	.	.	.	.	.	G	9.804	1.181336	0.21787	.	.	ENSG00000038274	ENST00000280969;ENST00000321757;ENST00000421814;ENST00000518095;ENST00000415433	T;T;T;T	0.40476	1.03;1.03;1.03;1.03	5.66	3.68	0.42216	NAD(P)-binding domain (1);	0.327603	0.36555	N	0.002537	T	0.21347	0.0514	N	0.17248	0.465	0.19300	N	0.999973	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.21586	-1.0241	10	0.05833	T	0.94	.	9.5455	0.39277	0.1001:0.3638:0.5361:0.0	.	148;148;137	Q9NZL9-3;Q9NZL9;Q9NZL9-2	.;MAT2B_HUMAN;.	K	137;148;83;148;42	ENSP00000280969:R137K;ENSP00000325425:R148K;ENSP00000397371:R83K;ENSP00000428046:R148K	ENSP00000280969:R137K	R	+	2	0	MAT2B	162873495	1.000000	0.71417	0.937000	0.37676	0.976000	0.68499	3.143000	0.50608	1.274000	0.44362	0.655000	0.94253	AGA	MAT2B	-	pfam_dTDP_dehydrorham_reduct,pfam_Epimerase_deHydtase,pfam_3Beta_OHSteriod_DH/Estase	ENSG00000038274		0.363	MAT2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MAT2B	HGNC	protein_coding	OTTHUMT00000252749.2	-	0.00	39	0	G	NM_013283		162940917	+1	tier1	-	no_errors	ENST00000321757	ensembl	human	known	74_37	missense	31.58	13	6	SNP	0.531	A
MCHR1	2847	genome.wustl.edu	37	22	41077867	41077867	+	Nonsense_Mutation	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr22:41077867C>T	ENST00000249016.4	+	2	1900	c.1204C>T	c.(1204-1206)Cag>Tag	p.Q402*	MCHR1_ENST00000498400.1_3'UTR|MCHR1_ENST00000381433.2_Nonsense_Mutation_p.Q276*	NM_005297.3	NP_005288.3	Q99705	MCHR1_HUMAN	melanin-concentrating hormone receptor 1	402					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway (GO:0007186)|generation of precursor metabolites and energy (GO:0006091)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	integral component of plasma membrane (GO:0005887)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|hormone binding (GO:0042562)|melanin-concentrating hormone receptor activity (GO:0030273)|neuropeptide receptor activity (GO:0008188)			endometrium(5)|large_intestine(7)|lung(6)|pancreas(1)|urinary_tract(1)	20						AGCCCAGGGGCAGCTTCGCGC	0.597																																																	0													74.0	64.0	68.0					22																	41077867		2203	4300	6503	SO:0001587	stop_gained	0				CCDS14004.1	22q13.3	2014-06-05	2006-02-15	2006-02-15	ENSG00000128285	ENSG00000128285		"""GPCR / Class A : MCH receptors"""	4479	protein-coding gene	gene with protein product		601751	"""G protein-coupled receptor 24"""	GPR24			Standard	XM_005261581		Approved	SLC1, MCH1R	uc003ayz.3	Q99705	OTTHUMG00000150256	ENST00000249016.4:c.1204C>T	22.37:g.41077867C>T	ENSP00000249016:p.Gln402*		B2RBX6|Q5R3J1|Q96S47|Q9BV08	Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_MCH1_rcpt,prints_MCH_rcpt,prints_GPCR_Rhodpsn	p.Q402*	ENST00000249016.4	37	c.1204	CCDS14004.1	22	.	.	.	.	.	.	.	.	.	.	C	26.9	4.784851	0.90282	.	.	ENSG00000128285	ENST00000249016;ENST00000381433	.	.	.	5.4	5.4	0.78164	.	0.501614	0.21726	N	0.070044	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	.	15.0416	0.71796	0.0:1.0:0.0:0.0	.	.	.	.	X	402;276	.	ENSP00000249016:Q402X	Q	+	1	0	MCHR1	39407813	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	1.158000	0.31737	2.698000	0.92095	0.655000	0.94253	CAG	MCHR1	-	prints_MCH1_rcpt	ENSG00000128285		0.597	MCHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCHR1	HGNC	protein_coding	OTTHUMT00000317142.1		0.00	19	0	C	NM_005297		41077867	+1			no_errors	ENST00000249016	ensembl	human	known	74_37	nonsense	9.09	30	3	SNP	1.000	T
MFSD12	126321	genome.wustl.edu	37	19	3547313	3547313	+	Missense_Mutation	SNP	G	G	T	rs558048226	byFrequency	TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr19:3547313G>T	ENST00000355415.2	-	6	1149	c.980C>A	c.(979-981)tCc>tAc	p.S327Y	MFSD12_ENST00000389395.3_Missense_Mutation_p.S327Y|AC005786.7_ENST00000589360.1_RNA|MFSD12_ENST00000398558.4_Missense_Mutation_p.S327Y|MFSD12_ENST00000591878.1_5'Flank	NM_174983.3	NP_778148.2	Q6NUT3	MFS12_HUMAN	major facilitator superfamily domain containing 12	327					transport (GO:0006810)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)				cervix(1)|endometrium(2)|lung(4)|urinary_tract(2)	9						GAGGAAGGAGGACAAGAAGCC	0.632																																																	0													69.0	76.0	74.0					19																	3547313		2062	4190	6252	SO:0001583	missense	0			AF218008	CCDS42465.1, CCDS74256.1	19p13.3	2012-03-09	2011-11-24	2011-11-24	ENSG00000161091	ENSG00000161091			28299	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 28"""	C19orf28		12477932	Standard	NM_174983		Approved	MGC20700, PP3501	uc002lxw.3	Q6NUT3		ENST00000355415.2:c.980C>A	19.37:g.3547313G>T	ENSP00000347583:p.Ser327Tyr		A8MXP7|D6W615|E9PAJ8|Q8N459	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.S327Y	ENST00000355415.2	37	c.980	CCDS42465.1	19	.	.	.	.	.	.	.	.	.	.	G	17.69	3.452448	0.63290	.	.	ENSG00000161091	ENST00000389395;ENST00000398558;ENST00000355415	D;D;D	0.81579	-1.51;-1.51;-1.51	5.11	5.11	0.69529	Major facilitator superfamily domain, general substrate transporter (1);	0.105878	0.64402	D	0.000003	D	0.89643	0.6774	M	0.80028	2.48	0.52501	D	0.999951	P;D;D	0.69078	0.939;0.996;0.997	P;D;D	0.71184	0.842;0.916;0.972	D	0.89788	0.3966	10	0.45353	T	0.12	-46.8636	17.5211	0.87787	0.0:0.0:1.0:0.0	.	327;318;327	Q6NUT3;Q6NUT3-2;A8MXP7	CS028_HUMAN;.;.	Y	327	ENSP00000374046:S327Y;ENSP00000381566:S327Y;ENSP00000347583:S327Y	ENSP00000347583:S327Y	S	-	2	0	C19orf28	3498313	1.000000	0.71417	0.644000	0.29465	0.541000	0.35023	5.752000	0.68728	2.367000	0.80283	0.555000	0.69702	TCC	MFSD12	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	ENSG00000161091		0.632	MFSD12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MFSD12	HGNC	protein_coding	OTTHUMT00000452949.2	-	0.00	63	0	G	NM_174983		3547313	-1	tier1	-	no_errors	ENST00000398558	ensembl	human	known	74_37	missense	12.73	48	7	SNP	1.000	T
MID2	11043	genome.wustl.edu	37	X	107148759	107148759	+	Missense_Mutation	SNP	C	C	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chrX:107148759C>A	ENST00000262843.6	+	5	1524	c.976C>A	c.(976-978)Ctt>Att	p.L326I	MID2_ENST00000443968.2_Missense_Mutation_p.L326I|RP6-191P20.4_ENST00000430140.1_RNA	NM_012216.3|NM_052817.2	NP_036348.2|NP_438112.2	Q9UJV3	TRIM1_HUMAN	midline 2	326					innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein localization to microtubule (GO:0035372)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	ligase activity (GO:0016874)|microtubule binding (GO:0008017)|phosphoprotein binding (GO:0051219)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)	19						CCGCCAGTGTCTTGAACGGTC	0.403																																																	0													159.0	140.0	146.0					X																	107148759		2203	4300	6503	SO:0001583	missense	0				CCDS14532.2, CCDS14533.2	Xq22.1-q22.2	2013-02-11			ENSG00000080561	ENSG00000080561		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	7096	protein-coding gene	gene with protein product		300204				10400986	Standard	NM_012216		Approved	FXY2, TRIM1, RNF60	uc004enl.3	Q9UJV3	OTTHUMG00000022171	ENST00000262843.6:c.976C>A	X.37:g.107148759C>A	ENSP00000262843:p.Leu326Ile		A6NEL8|A6PVI5|Q5JYF5|Q8WWK1|Q9UJR9	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Fibronectin_type3,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.L326I	ENST00000262843.6	37	c.976	CCDS14532.2	X	.	.	.	.	.	.	.	.	.	.	C	12.21	1.869826	0.33069	.	.	ENSG00000080561	ENST00000262843;ENST00000443968	T;T	0.67345	-0.23;-0.26	5.79	5.79	0.91817	B-box, C-terminal (1);	0.129706	0.53938	D	0.000049	T	0.49592	0.1566	N	0.11064	0.09	0.58432	D	0.999997	B;B	0.23058	0.079;0.016	B;B	0.23150	0.027;0.044	T	0.45205	-0.9277	10	0.32370	T	0.25	.	16.2334	0.82358	0.0:1.0:0.0:0.0	.	326;326	Q9UJV3;Q9UJV3-2	TRIM1_HUMAN;.	I	326	ENSP00000262843:L326I;ENSP00000413976:L326I	ENSP00000262843:L326I	L	+	1	0	MID2	107035415	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.483000	0.35497	2.438000	0.82558	0.600000	0.82982	CTT	MID2	-	smart_Bbox_C	ENSG00000080561		0.403	MID2-001	KNOWN	basic|CCDS	protein_coding	MID2	HGNC	protein_coding	OTTHUMT00000057852.2		0.00	31	0	C	NM_012216		107148759	+1			no_errors	ENST00000262843	ensembl	human	known	74_37	missense	5.88	48	3	SNP	1.000	A
MT-CO1	4512	genome.wustl.edu	37	M	3019	3019	+	5'Flank	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chrM:3019G>A	ENST00000361624.2	+	0	0				MT-TM_ENST00000387377.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-ND2_ENST00000361453.3_5'Flank|MT-RNR1_ENST00000389680.2_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TF_ENST00000387314.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TA_ENST00000387392.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I						aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						CCCGATGGTGCAGCCGCTATT	0.443																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395			M.37:g.3019G>A	Exception_encountered		Q34770	RNA	SNP	-	NULL	ENST00000361624.2	37	NULL		MT																																																																																			MT-RNR2	-	-	ENSG00000210082		0.443	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR2	HGNC	protein_coding		-	0.00	35	0	G	YP_003024028		3019	+1	tier1	-	no_errors	ENST00000387347	ensembl	human	known	74_37	rna	48.15	28	26	SNP	NULL	A
MT-CO1	4512	genome.wustl.edu	37	M	5791	5791	+	5'Flank	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chrM:5791G>A	ENST00000361624.2	+	0	0				MT-TD_ENST00000387419.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-ATP8_ENST00000361851.1_5'Flank|MT-TM_ENST00000387377.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TL1_ENST00000386347.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TY_ENST00000387409.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-TA_ENST00000387392.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I						aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						GCTGCTTCTTCGAATTTGCAA	0.468																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395			M.37:g.5791G>A	Exception_encountered		Q34770	RNA	SNP	-	NULL	ENST00000361624.2	37	NULL		MT																																																																																			MT-TC	-	-	ENSG00000210140		0.468	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-TC	HGNC	protein_coding		-	0.00	129	0	G	YP_003024028		5791	-1	tier1	-	no_errors	ENST00000387405	ensembl	human	known	74_37	rna	72.03	66	170	SNP	NULL	A
MTTP	4547	genome.wustl.edu	37	4	100521876	100521876	+	Silent	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr4:100521876C>T	ENST00000265517.5	+	9	1425	c.1222C>T	c.(1222-1224)Ctg>Ttg	p.L408L	MTTP_ENST00000511045.1_Silent_p.L435L|MTTP_ENST00000457717.1_Silent_p.L408L|RP11-766F14.1_ENST00000508578.1_RNA			P55157	MTP_HUMAN	microsomal triglyceride transfer protein	408	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|protein lipidation (GO:0006497)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|microvillus membrane (GO:0031528)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(14)|lung(19)|ovary(4)|prostate(5)|skin(1)|urinary_tract(1)	57				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)|Lomitapide(DB08827)	TGAAGAACTCCTGAGAGCCCT	0.358																																																	0													54.0	56.0	56.0					4																	100521876		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS3651.1, CCDS75169.1	4q24	2008-02-05	2005-11-04	2005-11-04	ENSG00000138823	ENSG00000138823			7467	protein-coding gene	gene with protein product		157147	"""microsomal triglyceride transfer protein (large polypeptide, 88kD)"", ""microsomal triglyceride transfer protein (large polypeptide, 88kDa)"""	MTP		8111381	Standard	XM_005263025		Approved	ABL	uc003hvc.4	P55157	OTTHUMG00000131023	ENST00000265517.5:c.1222C>T	4.37:g.100521876C>T			A8K428|Q08AM4|Q6P5T3	Silent	SNP	pfam_Lipid_transpt_N,superfamily_Vitellinogen_superhlx,superfamily_Lipid_transp_b-sht_shell,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.L408	ENST00000265517.5	37	c.1222	CCDS3651.1	4																																																																																			MTTP	-	pfam_Lipid_transpt_N,superfamily_Vitellinogen_superhlx,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	ENSG00000138823		0.358	MTTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTTP	HGNC	protein_coding	OTTHUMT00000253662.3	-	0.00	43	0	C			100521876	+1	tier1	-	no_errors	ENST00000265517	ensembl	human	known	74_37	silent	20.00	32	8	SNP	1.000	T
MTTP	4547	genome.wustl.edu	37	4	100521881	100521881	+	Missense_Mutation	SNP	A	A	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr4:100521881A>C	ENST00000265517.5	+	9	1430	c.1227A>C	c.(1225-1227)agA>agC	p.R409S	MTTP_ENST00000511045.1_Missense_Mutation_p.R436S|MTTP_ENST00000457717.1_Missense_Mutation_p.R409S|RP11-766F14.1_ENST00000508578.1_RNA			P55157	MTP_HUMAN	microsomal triglyceride transfer protein	409	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|protein lipidation (GO:0006497)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|microvillus membrane (GO:0031528)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(14)|lung(19)|ovary(4)|prostate(5)|skin(1)|urinary_tract(1)	57				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)|Lomitapide(DB08827)	AACTCCTGAGAGCCCTCATTG	0.363																																																	0													50.0	53.0	52.0					4																	100521881		2203	4300	6503	SO:0001583	missense	0				CCDS3651.1, CCDS75169.1	4q24	2008-02-05	2005-11-04	2005-11-04	ENSG00000138823	ENSG00000138823			7467	protein-coding gene	gene with protein product		157147	"""microsomal triglyceride transfer protein (large polypeptide, 88kD)"", ""microsomal triglyceride transfer protein (large polypeptide, 88kDa)"""	MTP		8111381	Standard	XM_005263025		Approved	ABL	uc003hvc.4	P55157	OTTHUMG00000131023	ENST00000265517.5:c.1227A>C	4.37:g.100521881A>C	ENSP00000265517:p.Arg409Ser		A8K428|Q08AM4|Q6P5T3	Missense_Mutation	SNP	pfam_Lipid_transpt_N,superfamily_Vitellinogen_superhlx,superfamily_Lipid_transp_b-sht_shell,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.R409S	ENST00000265517.5	37	c.1227	CCDS3651.1	4	.	.	.	.	.	.	.	.	.	.	A	11.76	1.733731	0.30684	.	.	ENSG00000138823	ENST00000511045;ENST00000457717;ENST00000265517;ENST00000538053	T;T;T	0.69175	-0.38;-0.38;-0.38	4.86	3.68	0.42216	Lipid transport protein, N-terminal (3);Vitellinogen, superhelical (2);	0.438358	0.26224	N	0.025615	T	0.57066	0.2028	L	0.48362	1.52	0.34478	D	0.703603	B;B	0.13145	0.007;0.002	B;B	0.18561	0.022;0.01	T	0.59247	-0.7490	10	0.30078	T	0.28	-39.2633	10.3807	0.44110	0.9224:0.0:0.0776:0.0	.	436;409	E9PBP6;P55157	.;MTP_HUMAN	S	436;409;409;409	ENSP00000427679:R436S;ENSP00000400821:R409S;ENSP00000265517:R409S	ENSP00000265517:R409S	R	+	3	2	MTTP	100740904	1.000000	0.71417	0.964000	0.40570	0.932000	0.56968	2.820000	0.48057	0.698000	0.31739	0.533000	0.62120	AGA	MTTP	-	pfam_Lipid_transpt_N,superfamily_Vitellinogen_superhlx,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	ENSG00000138823		0.363	MTTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTTP	HGNC	protein_coding	OTTHUMT00000253662.3	-	0.00	41	0	A			100521881	+1	tier1	-	no_errors	ENST00000265517	ensembl	human	known	74_37	missense	19.51	33	8	SNP	0.954	C
MUC16	94025	genome.wustl.edu	37	19	9090305	9090305	+	Frame_Shift_Del	DEL	C	C	-			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr19:9090305delC	ENST00000397910.4	-	1	1713	c.1510delG	c.(1510-1512)gacfs	p.D504fs		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	504	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTCAGGATGTCAGAGCTCCCG	0.552																																																	0													101.0	98.0	99.0					19																	9090305		2090	4229	6319	SO:0001589	frameshift_variant	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.1510delG	19.37:g.9090305delC	ENSP00000381008:p.Asp504fs		Q6ZQW5|Q96RK2	Frame_Shift_Del	DEL	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.D504fs	ENST00000397910.4	37	c.1510	CCDS54212.1	19																																																																																			MUC16	-	NULL	ENSG00000181143		0.552	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1		0.00	66	0	C	NM_024690		9090305	-1	tier1		no_errors	ENST00000397910	ensembl	human	known	74_37	frame_shift_del	20.75	42	11	DEL	0.006	-
MUC17	140453	genome.wustl.edu	37	7	100677376	100677376	+	Silent	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr7:100677376C>T	ENST00000306151.4	+	3	2743	c.2679C>T	c.(2677-2679)agC>agT	p.S893S		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	893	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TTGACACCAGCACACCTGTGA	0.493																																																	0													296.0	290.0	292.0					7																	100677376		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.2679C>T	7.37:g.100677376C>T			O14761|Q685J2|Q8TDH7	Silent	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.S893	ENST00000306151.4	37	c.2679	CCDS34711.1	7																																																																																			MUC17	-	NULL	ENSG00000169876		0.493	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	-	0.00	87	0	C	NM_001040105		100677376	+1	tier1	-	no_errors	ENST00000306151	ensembl	human	known	74_37	silent	10.13	71	8	SNP	0.003	T
MYH11	4629	genome.wustl.edu	37	16	15844130	15844130	+	Silent	SNP	G	G	A	rs530466304		TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr16:15844130G>A	ENST00000300036.5	-	16	2032	c.1923C>T	c.(1921-1923)agC>agT	p.S641S	MYH11_ENST00000396324.3_Silent_p.S648S|MYH11_ENST00000576790.2_Silent_p.S641S|MYH11_ENST00000452625.2_Silent_p.S648S	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	641	Myosin motor.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						TCTTGGAGGCGCTGGGCAGCG	0.637			T	CBFB	AML								G|||	1	0.000199681	0.0	0.0	5008	,	,		18013	0.0		0.0	False		,,,				2504	0.001							Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	0													119.0	87.0	97.0					16																	15844130		2197	4300	6497	SO:0001819	synonymous_variant	0			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.1923C>T	16.37:g.15844130G>A			D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.S648	ENST00000300036.5	37	c.1944	CCDS10565.1	16																																																																																			MYH11	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000133392		0.637	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH11	HGNC	protein_coding	OTTHUMT00000252192.2		0.00	37	0	G	NM_001040113		15844130	-1			no_errors	ENST00000396324	ensembl	human	known	74_37	silent	5.26	36	2	SNP	0.670	A
MYH2	4620	genome.wustl.edu	37	17	10427169	10427169	+	Silent	SNP	C	C	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr17:10427169C>A	ENST00000245503.5	-	36	5592	c.5208G>T	c.(5206-5208)ctG>ctT	p.L1736L	MYH2_ENST00000397183.2_Silent_p.L1736L|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA|MYH2_ENST00000532183.2_Intron|RP11-799N11.1_ENST00000399342.2_RNA	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	1736					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						TATCTGTCTCCAGCTTCTTCT	0.408																																																	0													148.0	131.0	136.0					17																	10427169		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.5208G>T	17.37:g.10427169C>A			A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_Ribosomal_L29,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.L1736	ENST00000245503.5	37	c.5208	CCDS11156.1	17																																																																																			MYH2	-	pfam_Myosin_tail	ENSG00000125414		0.408	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH2	HGNC	protein_coding	OTTHUMT00000252726.3	-	0.00	75	0	C	NM_017534		10427169	-1	tier1	-	no_errors	ENST00000245503	ensembl	human	known	74_37	silent	23.91	35	11	SNP	1.000	A
MYH6	4624	genome.wustl.edu	37	14	23865919	23865919	+	Missense_Mutation	SNP	T	T	G			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr14:23865919T>G	ENST00000356287.3	-	18	2305	c.2276A>C	c.(2275-2277)aAg>aCg	p.K759T	MYH6_ENST00000405093.3_Missense_Mutation_p.K759T			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	759	Actin-binding.|Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)			breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		GTGGCCAAACTTGTACTGGTT	0.547																																																	0													123.0	107.0	112.0					14																	23865919		2203	4300	6503	SO:0001583	missense	0			D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.2276A>C	14.37:g.23865919T>G	ENSP00000348634:p.Lys759Thr		A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.K759T	ENST00000356287.3	37	c.2276	CCDS9600.1	14	.	.	.	.	.	.	.	.	.	.	t	17.39	3.376632	0.61735	.	.	ENSG00000197616	ENST00000405093;ENST00000356287	D;D	0.87729	-2.29;-2.29	4.46	4.46	0.54185	Myosin head, motor domain (2);	.	.	.	.	D	0.93141	0.7816	M	0.91090	3.175	0.51767	D	0.999938	P	0.48503	0.911	P	0.54965	0.765	D	0.94602	0.7797	9	0.87932	D	0	.	14.0449	0.64700	0.0:0.0:0.0:1.0	.	759	P13533	MYH6_HUMAN	T	759	ENSP00000386041:K759T;ENSP00000348634:K759T	ENSP00000348634:K759T	K	-	2	0	MYH6	22935759	0.999000	0.42202	1.000000	0.80357	0.998000	0.95712	1.638000	0.37165	1.792000	0.52537	0.528000	0.53228	AAG	MYH6	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000197616		0.547	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH6	HGNC	protein_coding	OTTHUMT00000071796.3	-	0.00	41	0	T			23865919	-1	tier1	-	no_errors	ENST00000356287	ensembl	human	known	74_37	missense	24.53	40	13	SNP	1.000	G
MYOCD	93649	genome.wustl.edu	37	17	12647692	12647694	+	In_Frame_Del	DEL	CAG	CAG	-	rs536181176	byFrequency	TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	CAG	CAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr17:12647692_12647694delCAG	ENST00000343344.4	+	8	910_912	c.910_912delCAG	c.(910-912)cagdel	p.Q310del	MYOCD_ENST00000425538.1_In_Frame_Del_p.Q310del|AC005358.1_ENST00000609971.1_In_Frame_Del_p.Q214del|MYOCD_ENST00000395988.1_3'UTR			Q8IZQ8	MYCD_HUMAN	myocardin	310	Gln-rich.				cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		AATCCTCAGCcagcagcagcagc	0.596														27	0.00539137	0.0098	0.0029	5008	,	,		19180	0.001		0.001	False		,,,				2504	0.0102																0									,,	189,4075		0,189,1943					,,	3.1	1.0			38	472,7780		2,468,3656	no	coding,coding,coding	MYOCD	NM_153604.2,NM_001146313.1,NM_001146312.1	,,	2,657,5599	A1A1,A1R,RR		5.7198,4.4325,5.2812	,,	,,		661,11855				SO:0001651	inframe_deletion	0			AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.910_912delCAG	17.37:g.12647701_12647703delCAG	ENSP00000341835:p.Gln310del		Q5UBU5|Q8N7Q1	In_Frame_Del	DEL	pfam_RPEL_repeat,pfam_SAP_dom,smart_RPEL_repeat,smart_SAP_dom,pfscan_RPEL_repeat,pfscan_SAP_dom	p.Q307in_frame_del	ENST00000343344.4	37	c.910_912	CCDS11163.1	17																																																																																			MYOCD	-	NULL	ENSG00000141052		0.596	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOCD	HGNC	protein_coding	OTTHUMT00000129950.1		0.00	37	0	CAG	NM_153604		12647694	+1	tier1		no_errors	ENST00000425538	ensembl	human	known	74_37	in_frame_del	14.29	18	3	DEL	1.000:1.000:1.000	-
NCOA1	8648	genome.wustl.edu	37	2	24914428	24914428	+	Missense_Mutation	SNP	C	C	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr2:24914428C>A	ENST00000406961.1	+	9	1263	c.611C>A	c.(610-612)cCa>cAa	p.P204Q	NCOA1_ENST00000538539.1_Missense_Mutation_p.P204Q|NCOA1_ENST00000405141.1_Missense_Mutation_p.P204Q|NCOA1_ENST00000348332.3_Missense_Mutation_p.P204Q|NCOA1_ENST00000395856.3_Missense_Mutation_p.P204Q|NCOA1_ENST00000288599.5_Missense_Mutation_p.P204Q|NCOA1_ENST00000407230.1_Missense_Mutation_p.P53Q			Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1	204					androgen receptor signaling pathway (GO:0030521)|cellular lipid metabolic process (GO:0044255)|cellular response to hormone stimulus (GO:0032870)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|estrous cycle phase (GO:0060206)|hippocampus development (GO:0021766)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|labyrinthine layer morphogenesis (GO:0060713)|lactation (GO:0007595)|male gonad development (GO:0008584)|male mating behavior (GO:0060179)|ovulation cycle (GO:0042698)|positive regulation of apoptotic process (GO:0043065)|positive regulation of female receptivity (GO:0045925)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by galactose (GO:0000435)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular response to drug (GO:2001038)|response to estradiol (GO:0032355)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription coactivator activity (GO:0001105)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)	p.P204Q(2)	PAX3/NCOA1(8)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(26)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	53	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATTCACCCTCCAGATGAGCCA	0.443			T	PAX3	alveolar rhadomyosarcoma																																			Dom	yes		2	2p23	8648	nuclear receptor coactivator 1		M	2	Substitution - Missense(2)	lung(2)											147.0	136.0	140.0					2																	24914428		2203	4300	6503	SO:0001583	missense	0			U40396	CCDS1712.1, CCDS1713.1, CCDS42660.1	2p23	2011-07-01			ENSG00000084676	ENSG00000084676		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7668	protein-coding gene	gene with protein product		602691				7481822, 9575154	Standard	XM_005264625		Approved	SRC1, F-SRC-1, NCoA-1, KAT13A, RIP160, bHLHe74	uc002rfk.3	Q15788	OTTHUMG00000125523	ENST00000406961.1:c.611C>A	2.37:g.24914428C>A	ENSP00000385216:p.Pro204Gln		O00150|O43792|O43793|Q13071|Q13420|Q2T9G5|Q53SX3|Q6GVI5|Q7KYV3	Missense_Mutation	SNP	pfam_DUF1518,pfam_SRC-1,pfam_Nuc_rcpt_coact_Ncoa-typ,pfam_PAS_fold,superfamily_PAS,superfamily_Nuc_rcpt_coact,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,pirsf_Nuclear_rcpt_coactivator,pfscan_PAS,pfscan_bHLH_dom	p.P204Q	ENST00000406961.1	37	c.611	CCDS1712.1	2	.	.	.	.	.	.	.	.	.	.	C	24.2	4.508163	0.85282	.	.	ENSG00000084676	ENST00000406961;ENST00000405141;ENST00000407230;ENST00000538539;ENST00000348332;ENST00000288599;ENST00000395856	T;T;T;T;T;T;T	0.02177	4.57;4.57;4.41;4.57;4.57;4.57;4.57	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.11922	0.0290	M	0.66939	2.045	0.80722	D	1	D;B;P;D	0.89917	1.0;0.44;0.698;0.979	D;B;P;P	0.85130	0.997;0.357;0.629;0.822	T	0.11494	-1.0585	10	0.24483	T	0.36	.	19.8132	0.96556	0.0:1.0:0.0:0.0	.	204;204;204;53	Q15788-3;Q15788;Q15788-2;B5MCN7	.;NCOA1_HUMAN;.;.	Q	204;204;53;204;204;204;204	ENSP00000385216:P204Q;ENSP00000385097:P204Q;ENSP00000385195:P53Q;ENSP00000444039:P204Q;ENSP00000320940:P204Q;ENSP00000288599:P204Q;ENSP00000379197:P204Q	ENSP00000288599:P204Q	P	+	2	0	NCOA1	24767932	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.983000	0.56916	2.785000	0.95823	0.655000	0.94253	CCA	NCOA1	-	pirsf_Nuclear_rcpt_coactivator	ENSG00000084676		0.443	NCOA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCOA1	HGNC	protein_coding	OTTHUMT00000246852.3		0.00	29	0	C	NM_147223		24914428	+1			no_errors	ENST00000348332	ensembl	human	known	74_37	missense	5.08	56	3	SNP	1.000	A
NAGK	55577	genome.wustl.edu	37	2	71305470	71305470	+	Missense_Mutation	SNP	G	G	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr2:71305470G>T	ENST00000244204.6	+	10	929	c.867G>T	c.(865-867)caG>caT	p.Q289H	NAGK_ENST00000443938.2_Missense_Mutation_p.Q285H|NAGK_ENST00000418807.3_Missense_Mutation_p.Q238H|NAGK_ENST00000455662.2_Missense_Mutation_p.Q335H|NAGK_ENST00000443872.2_Missense_Mutation_p.Q141H			Q9UJ70	NAGK_HUMAN	N-acetylglucosamine kinase	289					carbohydrate phosphorylation (GO:0046835)|N-acetylglucosamine metabolic process (GO:0006044)|N-acetylmannosamine metabolic process (GO:0006051)|N-acetylneuraminate catabolic process (GO:0019262)	extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|N-acetylglucosamine kinase activity (GO:0045127)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(7)|urinary_tract(1)	18					N-Acetyl-D-glucosamine(DB00141)	CGCTGACCCAGGGCAGAGAGA	0.577																																																	0													91.0	76.0	81.0					2																	71305470		2203	4300	6503	SO:0001583	missense	0			AJ242910	CCDS33220.1, CCDS33220.2	2p24.3-p24.1	2008-02-05			ENSG00000124357	ENSG00000124357	2.7.1.59		17174	protein-coding gene	gene with protein product		606828				10824116	Standard	NM_017567		Approved	GNK	uc002shp.4	Q9UJ70	OTTHUMG00000153239	ENST00000244204.6:c.867G>T	2.37:g.71305470G>T	ENSP00000244204:p.Gln289His		B4DLZ5|Q53HD5|Q6IA84|Q9BS29|Q9BVP0|Q9NV37	Missense_Mutation	SNP	pfam_ATPase_BadF	p.Q238H	ENST00000244204.6	37	c.714		2	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	15.37|15.37|15.37	2.812708|2.812708|2.812708	0.50527|0.50527|0.50527	.|.|.	.|.|.	ENSG00000124357|ENSG00000124357|ENSG00000124357	ENST00000524537|ENST00000244204;ENST00000455662;ENST00000418807|ENST00000443938	.|T;T;T|.	.|0.46451|.	.|1.46;1.43;0.87|.	4.82|4.82|4.82	1.07|1.07|1.07	0.20283|0.20283|0.20283	.|.|.	.|1.941960|.	.|0.01773|.	.|N|.	.|0.031264|.	T|T|T	0.16896|0.16896|0.16896	0.0406|0.0406|0.0406	N|N|N	0.08118|0.08118|0.08118	0|0|0	0.22489|0.22489|0.22489	N|N|N	0.999053|0.999053|0.999053	.|B|.	.|0.27700|.	.|0.186|.	.|B|.	.|0.23018|.	.|0.043|.	T|T|T	0.29181|0.29181|0.29181	-1.0020|-1.0020|-1.0020	5|10|5	.|0.48119|.	.|T|.	.|0.1|.	-22.8818|-22.8818|-22.8818	7.193|7.193|7.193	0.25837|0.25837|0.25837	0.4674:0.0:0.5326:0.0|0.4674:0.0:0.5326:0.0|0.4674:0.0:0.5326:0.0	.|.|.	.|289|.	.|Q9UJ70|.	.|NAGK_HUMAN|.	W|H|M	54|289;335;238|307	.|ENSP00000244204:Q289H;ENSP00000389087:Q335H;ENSP00000396070:Q238H|.	.|ENSP00000244204:Q289H|.	G|Q|R	+|+|+	1|3|2	0|2|0	NAGK|NAGK|NAGK	71158978|71158978|71158978	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.896000|0.896000|0.896000	0.35187|0.35187|0.35187	0.957000|0.957000|0.957000	0.61999|0.61999|0.61999	1.505000|1.505000|1.505000	0.35736|0.35736|0.35736	0.014000|0.014000|0.014000	0.14944|0.14944|0.14944	0.563000|0.563000|0.563000	0.77884|0.77884|0.77884	GGG|CAG|AGG	NAGK	-	NULL	ENSG00000124357		0.577	NAGK-032	NOVEL	basic|appris_candidate_longest	protein_coding	NAGK	HGNC	protein_coding	OTTHUMT00000471889.1	-	0.00	64	0	G			71305470	+1	tier1	-	no_errors	ENST00000418807	ensembl	human	putative	74_37	missense	5.63	67	4	SNP	0.627	T
NDUFA4	4697	genome.wustl.edu	37	7	10973276	10973276	+	Missense_Mutation	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr7:10973276C>T	ENST00000339600.5	-	4	431	c.233G>A	c.(232-234)cGt>cAt	p.R78H		NM_002489.3	NP_002480.1	O00483	NDUA4_HUMAN	NDUFA4, mitochondrial complex associated	78					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrial respiratory chain complex IV (GO:0005751)|mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)|protein complex binding (GO:0032403)			large_intestine(2)|lung(1)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.177)		GAAATCTGGACGTTCCTTCTT	0.363																																																	0													55.0	52.0	53.0					7																	10973276		2203	4300	6503	SO:0001583	missense	0			U94586	CCDS5357.1	7p21.3	2014-07-30	2014-07-30		ENSG00000189043	ENSG00000189043			7687	protein-coding gene	gene with protein product	"""complex I 9kDa subunit"", ""NADH-ubiquinone oxidoreductase MLRQ subunit"""	603833	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4 (9kD, MLRQ)"", ""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa"""			9352085	Standard	NM_002489		Approved	MLRQ, CI-9k	uc003srx.2	O00483	OTTHUMG00000023880	ENST00000339600.5:c.233G>A	7.37:g.10973276C>T	ENSP00000339720:p.Arg78His		A4D109|Q6FHN5	Missense_Mutation	SNP	NULL	p.R78H	ENST00000339600.5	37	c.233	CCDS5357.1	7	.	.	.	.	.	.	.	.	.	.	C	15.30	2.791481	0.50102	.	.	ENSG00000189043	ENST00000339600	T	0.77489	-1.1	5.02	4.13	0.48395	.	0.332255	0.32518	N	0.005992	T	0.69196	0.3084	.	.	.	0.32961	D	0.521012	B	0.12013	0.005	B	0.12156	0.007	T	0.72934	-0.4141	9	0.51188	T	0.08	-11.3435	12.0217	0.53348	0.1729:0.8271:0.0:0.0	.	78	O00483	NDUA4_HUMAN	H	78	ENSP00000339720:R78H	ENSP00000339720:R78H	R	-	2	0	NDUFA4	10939801	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	5.286000	0.65639	1.332000	0.45431	0.650000	0.86243	CGT	NDUFA4	-	NULL	ENSG00000189043		0.363	NDUFA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFA4	HGNC	protein_coding	OTTHUMT00000207507.3	-	0.00	40	0	C	NM_002489		10973276	-1	tier1	-	no_errors	ENST00000339600	ensembl	human	known	74_37	missense	22.50	31	9	SNP	1.000	T
NDUFV2	4729	genome.wustl.edu	37	18	9122614	9122614	+	Missense_Mutation	SNP	G	G	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr18:9122614G>T	ENST00000318388.6	+	5	518	c.404G>T	c.(403-405)tGc>tTc	p.C135F	NDUFV2_ENST00000400033.1_Missense_Mutation_p.C138F|RP11-143J12.2_ENST00000583081.1_RNA|RP11-21J18.1_ENST00000579126.1_RNA|NDUFV2_ENST00000465096.1_3'UTR|RP11-143J12.2_ENST00000582375.1_RNA	NM_021074.4	NP_066552.2	P19404	NDUV2_HUMAN	NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa	135					cardiac muscle tissue development (GO:0048738)|cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|nervous system development (GO:0007399)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|lung(4)|ovary(1)|stomach(1)	7						ATTCAGGTCTGCACTACTACA	0.383																																																	0													122.0	108.0	113.0					18																	9122614		2203	4300	6503	SO:0001583	missense	0			X84421	CCDS11842.1	18p11.22	2011-07-04	2002-08-29		ENSG00000178127	ENSG00000178127	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7717	protein-coding gene	gene with protein product	"""complex I 24kDa subunit"", ""NADH dehydrogenase [ubiquinone] flavoprotein 2, mitochondrial"""	600532	"""NADH dehydrogenase (ubiquinone) flavoprotein 2 (24kD)"""			9763677, 7607668	Standard	NM_021074		Approved	CI-24k	uc002knu.3	P19404	OTTHUMG00000131593	ENST00000318388.6:c.404G>T	18.37:g.9122614G>T	ENSP00000327268:p.Cys135Phe		Q9BV41	Missense_Mutation	SNP	pfam_NuoE_like,superfamily_Thioredoxin-like_fold,tigrfam_NuoE_like	p.C135F	ENST00000318388.6	37	c.404	CCDS11842.1	18	.	.	.	.	.	.	.	.	.	.	G	28.5	4.929720	0.92389	.	.	ENSG00000178127	ENST00000318388;ENST00000400033	T;T	0.78246	-1.12;-1.16	5.93	5.93	0.95920	Thioredoxin-like fold (2);	0.000000	0.85682	D	0.000000	D	0.94611	0.8263	H	0.99783	4.775	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96704	0.9520	10	0.87932	D	0	-8.0618	20.3397	0.98756	0.0:0.0:1.0:0.0	.	135	P19404	NDUV2_HUMAN	F	135;138	ENSP00000327268:C135F;ENSP00000382908:C138F	ENSP00000327268:C135F	C	+	2	0	NDUFV2	9112614	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.623000	0.98386	2.803000	0.96430	0.585000	0.79938	TGC	NDUFV2	-	pfam_NuoE_like,superfamily_Thioredoxin-like_fold,tigrfam_NuoE_like	ENSG00000178127		0.383	NDUFV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFV2	HGNC	protein_coding	OTTHUMT00000254475.2		0.00	81	0	G	NM_021074		9122614	+1			no_errors	ENST00000318388	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	T
NFAT5	10725	genome.wustl.edu	37	16	69681398	69681398	+	Missense_Mutation	SNP	G	G	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr16:69681398G>T	ENST00000354436.2	+	3	985	c.667G>T	c.(667-669)Gat>Tat	p.D223Y	NFAT5_ENST00000393742.2_Missense_Mutation_p.D147Y|NFAT5_ENST00000432919.1_Missense_Mutation_p.D241Y|NFAT5_ENST00000566899.1_Missense_Mutation_p.D147Y|NFAT5_ENST00000349945.1_Missense_Mutation_p.D147Y|NFAT5_ENST00000567239.1_Missense_Mutation_p.D241Y	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive	223					cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						ATCTAATATGGATATATTTGA	0.443																																																	0													68.0	69.0	69.0					16																	69681398		2198	4300	6498	SO:0001583	missense	0			AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.667G>T	16.37:g.69681398G>T	ENSP00000346420:p.Asp223Tyr		A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	Missense_Mutation	SNP	pfam_RHD,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT,pfscan_RHD,prints_NFAT	p.D241Y	ENST00000354436.2	37	c.721	CCDS10881.1	16	.	.	.	.	.	.	.	.	.	.	G	18.93	3.727057	0.69074	.	.	ENSG00000102908	ENST00000432919;ENST00000426654;ENST00000349945;ENST00000354436;ENST00000393742	T;T;T;T	0.63417	0.14;0.2;-0.04;0.2	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.72827	0.3509	L	0.32530	0.975	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.991	T	0.75348	-0.3349	10	0.87932	D	0	-2.9564	19.5215	0.95187	0.0:0.0:1.0:0.0	.	241;223;241	A2RRB4;O94916;E9PHR7	.;NFAT5_HUMAN;.	Y	241;241;147;223;147	ENSP00000396538:D241Y;ENSP00000338806:D147Y;ENSP00000346420:D223Y;ENSP00000377343:D147Y	ENSP00000338806:D147Y	D	+	1	0	NFAT5	68238899	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.834000	0.99428	2.597000	0.87782	0.650000	0.86243	GAT	NFAT5	-	NULL	ENSG00000102908		0.443	NFAT5-001	KNOWN	basic|CCDS	protein_coding	NFAT5	HGNC	protein_coding	OTTHUMT00000268952.2		0.00	34	0	G	NM_138714		69681398	+1			no_errors	ENST00000432919	ensembl	human	known	74_37	missense	11.11	16	2	SNP	1.000	T
NLRP8	126205	genome.wustl.edu	37	19	56466078	56466078	+	Silent	SNP	C	C	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr19:56466078C>A	ENST00000291971.3	+	3	725	c.654C>A	c.(652-654)atC>atA	p.I218I	NLRP8_ENST00000590542.1_Silent_p.I218I	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	218	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		GAAAAACAATCCTGGCCAAAA	0.527																																																	0													91.0	73.0	79.0					19																	56466078		2203	4300	6503	SO:0001819	synonymous_variant	0			AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.654C>A	19.37:g.56466078C>A			Q7RTR4	Silent	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.I218	ENST00000291971.3	37	c.654	CCDS12937.1	19																																																																																			NLRP8	-	superfamily_P-loop_NTPase,pfscan_NACHT_NTPase	ENSG00000179709		0.527	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP8	HGNC	protein_coding	OTTHUMT00000457462.1	-	0.00	51	0	C	NM_176811		56466078	+1	tier1	-	no_errors	ENST00000291971	ensembl	human	known	74_37	silent	17.02	39	8	SNP	0.233	A
NOMO1	23420	genome.wustl.edu	37	16	14972668	14972668	+	Missense_Mutation	SNP	G	G	A	rs369439386		TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr16:14972668G>A	ENST00000287667.7	+	23	2905	c.2734G>A	c.(2734-2736)Ggc>Agc	p.G912S		NM_014287.3	NP_055102.3	Q15155	NOMO1_HUMAN	NODAL modulator 1	912						integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)			endometrium(6)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|skin(2)	30						CCAGGACAACGGCATTCTGAC	0.537																																																	0								G	SER/GLY	2,4390		0,2,2194	115.0	119.0	118.0		2734	3.2	1.0	16		118	0,8598		0,0,4299	no	missense	NOMO1	NM_014287.3	56	0,2,6493	AA,AG,GG		0.0,0.0455,0.0154	probably-damaging	912/1223	14972668	2,12988	2196	4299	6495	SO:0001583	missense	0			X57398	CCDS10556.1	16p13.11	2008-02-05			ENSG00000103512	ENSG00000103512			30060	protein-coding gene	gene with protein product		609157				1310294, 15257293	Standard	NM_014287		Approved	PM5	uc002dcv.3	Q15155	OTTHUMG00000090541	ENST00000287667.7:c.2734G>A	16.37:g.14972668G>A	ENSP00000287667:p.Gly912Ser		P78421|Q8IW21|Q96DG0	Missense_Mutation	SNP	pfam_DUF2012,superfamily_CarboxyPept-like_regulatory,superfamily_Carb-bd-like_fold,superfamily_Collagen-bd_Cna_B-typ_dom	p.G912S	ENST00000287667.7	37	c.2734	CCDS10556.1	16	.	.	.	.	.	.	.	.	.	.	.	23.8	4.464403	0.84425	4.55E-4	0.0	ENSG00000103512	ENST00000287667;ENST00000456867;ENST00000536948	T	0.15952	2.38	3.19	3.19	0.36642	Carbohydrate-binding-like fold (1);	0.000000	0.85682	D	0.000000	T	0.43853	0.1266	M	0.85197	2.74	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.52548	-0.8561	10	0.87932	D	0	-19.0234	12.2724	0.54714	0.0:0.0:1.0:0.0	.	912	Q15155	NOMO1_HUMAN	S	912;912;745	ENSP00000287667:G912S	ENSP00000287667:G912S	G	+	1	0	NOMO1	14880169	1.000000	0.71417	0.998000	0.56505	0.899000	0.52679	9.378000	0.97191	1.785000	0.52413	0.398000	0.26397	GGC	NOMO1	-	superfamily_Carb-bd-like_fold	ENSG00000103512		0.537	NOMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOMO1	HGNC	protein_coding	OTTHUMT00000207065.1	-	0.00	217	0	G			14972668	+1	tier1	-	no_errors	ENST00000287667	ensembl	human	known	74_37	missense	13.94	179	29	SNP	1.000	A
NPBWR2	2832	genome.wustl.edu	37	20	62737466	62737466	+	Missense_Mutation	SNP	C	C	T	rs139565347	byFrequency	TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr20:62737466C>T	ENST00000369768.1	-	1	1058	c.719G>A	c.(718-720)cGg>cAg	p.R240Q		NM_005286.2	NP_005277.2	P48146	NPBW2_HUMAN	neuropeptides B/W receptor 2	240					G-protein coupled receptor signaling pathway (GO:0007186)|opioid receptor signaling pathway (GO:0038003)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|opioid receptor activity (GO:0004985)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	all_cancers(38;2.58e-11)|all_epithelial(29;6.4e-13)|Lung NSC(23;1.25e-09)|all_lung(23;4.21e-09)					CCGCACGGCCCGCAGCCTGCG	0.662													C|||	2	0.000399361	0.0015	0.0	5008	,	,		16749	0.0		0.0	False		,,,				2504	0.0																0								C	GLN/ARG	3,4393	4.2+/-10.8	0,3,2195	44.0	40.0	41.0		719	-1.9	0.0	20	dbSNP_134	41	0,8586		0,0,4293	no	missense	NPBWR2	NM_005286.2	43	0,3,6488	TT,TC,CC		0.0,0.0682,0.0231	probably-damaging	240/334	62737466	3,12979	2198	4293	6491	SO:0001583	missense	0			U22492	CCDS13557.1	20q13.3	2012-08-08	2006-02-15	2006-02-15	ENSG00000125522	ENSG00000125522		"""GPCR / Class A : Neuropeptide receptors : W/B"""	4530	protein-coding gene	gene with protein product		600731	"""G protein-coupled receptor 8"""	GPR8		12401809	Standard	NM_005286		Approved		uc011abt.2	P48146	OTTHUMG00000033032	ENST00000369768.1:c.719G>A	20.37:g.62737466C>T	ENSP00000358783:p.Arg240Gln		Q6NWQ6|Q9H4K3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_Neuropept_B/W_rcpt,prints_GPCR_Rhodpsn,prints_Somatstn_rcpt,prints_Opioid_rcpt,prints_NPY_rcpt	p.R240Q	ENST00000369768.1	37	c.719	CCDS13557.1	20	.	.	.	.	.	.	.	.	.	.	C	13.48	2.250343	0.39797	6.82E-4	0.0	ENSG00000125522	ENST00000369768	T	0.42131	0.98	4.01	-1.94	0.07571	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	U	0.000001	T	0.48750	0.1517	M	0.70842	2.15	0.21386	N	0.9997	D	0.71674	0.998	P	0.58873	0.847	T	0.46721	-0.9171	10	0.72032	D	0.01	.	4.6894	0.12772	0.1379:0.5275:0.0:0.3346	.	240	P48146	NPBW2_HUMAN	Q	240	ENSP00000358783:R240Q	ENSP00000358783:R240Q	R	-	2	0	NPBWR2	62207910	0.001000	0.12720	0.000000	0.03702	0.011000	0.07611	1.184000	0.32053	-0.901000	0.03891	-0.339000	0.08088	CGG	NPBWR2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_Neuropept_B/W_rcpt,prints_Somatstn_rcpt	ENSG00000125522		0.662	NPBWR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPBWR2	HGNC	protein_coding	OTTHUMT00000080300.1	-	0.00	20	0	C	NM_005286		62737466	-1	tier1	rs139565347	no_errors	ENST00000369768	ensembl	human	known	74_37	missense	21.74	18	5	SNP	0.363	T
NRG3	10718	genome.wustl.edu	37	10	84718755	84718755	+	Missense_Mutation	SNP	A	A	G			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr10:84718755A>G	ENST00000404547.1	+	6	1208	c.1208A>G	c.(1207-1209)aAa>aGa	p.K403R	NRG3_ENST00000372142.2_Missense_Mutation_p.K182R|NRG3_ENST00000537893.1_Missense_Mutation_p.K53R|NRG3_ENST00000556918.1_Missense_Mutation_p.K233R|NRG3_ENST00000372141.2_Missense_Mutation_p.K403R|NRG3_ENST00000404576.2_Missense_Mutation_p.K207R|NRG3_ENST00000545131.1_Missense_Mutation_p.K53R			P56975	NRG3_HUMAN	neuregulin 3	403					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|intracellular signal transduction (GO:0035556)|mammary placode formation (GO:0060596)|pattern specification process (GO:0007389)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	growth factor activity (GO:0008083)|receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(41)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	69				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		CAAAATGGTAAAAGCTACAGT	0.408																																																	0													113.0	96.0	102.0					10																	84718755		2203	4300	6503	SO:0001583	missense	0			AK098823	CCDS31233.1, CCDS53547.1	10q22-q23	2003-09-09			ENSG00000185737	ENSG00000185737			7999	protein-coding gene	gene with protein product		605533				9275162	Standard	NM_001010848		Approved		uc001kco.2	P56975	OTTHUMG00000018626	ENST00000404547.1:c.1208A>G	10.37:g.84718755A>G	ENSP00000384796:p.Lys403Arg		A4D7U1|Q0PEH2|Q5VYH3	Missense_Mutation	SNP	pfscan_EG-like_dom	p.K403R	ENST00000404547.1	37	c.1208	CCDS31233.1	10	.	.	.	.	.	.	.	.	.	.	A	17.71	3.456526	0.63401	.	.	ENSG00000185737	ENST00000372141;ENST00000404547;ENST00000537287;ENST00000372142;ENST00000404576;ENST00000556918;ENST00000545131;ENST00000537893	T;T;T;T;T;T;T	0.52754	1.36;1.34;0.65;0.65;0.65;0.65;0.65	5.4	4.24	0.50183	.	0.140352	0.43919	D	0.000514	T	0.38026	0.1025	N	0.26042	0.785	0.41530	D	0.988458	P;B;P;P	0.48162	0.906;0.211;0.59;0.906	P;B;B;P	0.46543	0.52;0.066;0.423;0.52	T	0.07868	-1.0750	10	0.25751	T	0.34	-14.4126	10.5709	0.45200	0.8376:0.1624:0.0:0.0	.	402;403;182;403	B9EGV5;P56975;P56975-3;P56975-4	.;NRG3_HUMAN;.;.	R	403;403;402;182;207;233;53;53	ENSP00000361214:K403R;ENSP00000384796:K403R;ENSP00000361215:K182R;ENSP00000385804:K207R;ENSP00000451376:K233R;ENSP00000441201:K53R;ENSP00000440377:K53R	ENSP00000361214:K403R	K	+	2	0	NRG3	84708735	1.000000	0.71417	0.937000	0.37676	0.996000	0.88848	4.576000	0.60915	0.853000	0.35312	0.482000	0.46254	AAA	NRG3	-	NULL	ENSG00000185737		0.408	NRG3-005	KNOWN	basic|CCDS	protein_coding	NRG3	HGNC	protein_coding	OTTHUMT00000412262.1		0.00	40	0	A	XM_166086		84718755	+1			no_errors	ENST00000404547	ensembl	human	known	74_37	missense	11.54	23	3	SNP	1.000	G
NT5DC2	64943	genome.wustl.edu	37	3	52563311	52563311	+	Missense_Mutation	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr3:52563311G>A	ENST00000307076.4	-	2	561	c.161C>T	c.(160-162)gCa>gTa	p.A54V	NT5DC2_ENST00000490681.1_5'UTR|NT5DC2_ENST00000307092.4_Missense_Mutation_p.A20V|NT5DC2_ENST00000459839.1_Missense_Mutation_p.A91V|NT5DC2_ENST00000422318.2_Missense_Mutation_p.A91V	NM_022908.2	NP_075059.1	Q9H857	NT5D2_HUMAN	5'-nucleotidase domain containing 2	54							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			endometrium(1)|lung(3)|prostate(1)|stomach(1)	6				BRCA - Breast invasive adenocarcinoma(193;1.7e-05)|Kidney(197;0.00177)|KIRC - Kidney renal clear cell carcinoma(197;0.002)|OV - Ovarian serous cystadenocarcinoma(275;0.0476)		GTAGATGGCTGCTGGGTTCAG	0.597																																																	0													173.0	146.0	155.0					3																	52563311		2203	4300	6503	SO:0001583	missense	0			AF131781	CCDS2858.1, CCDS46843.1	3p21.1	2006-02-03			ENSG00000168268	ENSG00000168268			25717	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_022908		Approved	FLJ12442	uc003den.3	Q9H857	OTTHUMG00000158626	ENST00000307076.4:c.161C>T	3.37:g.52563311G>A	ENSP00000302468:p.Ala54Val		C9JTZ6|E9PAL9|O95888|Q96C80|Q9H9Z8	Missense_Mutation	SNP	pfam_HAD-SF_hydro_IG_5-nucl,superfamily_HAD-like_dom,pirsf_Pur_nucleotidase,tigrfam_HAD-SF_hydro_IG_5-nucl	p.A91V	ENST00000307076.4	37	c.272	CCDS2858.1	3	.	.	.	.	.	.	.	.	.	.	G	16.50	3.141841	0.57044	.	.	ENSG00000168268	ENST00000307092;ENST00000307076;ENST00000422318;ENST00000459839	T;T;T;T	0.21932	1.98;1.98;1.98;1.98	5.38	4.47	0.54385	HAD-like domain (1);	0.296681	0.37809	N	0.001933	T	0.10680	0.0261	N	0.08118	0	0.32169	N	0.581933	B;B;B	0.34103	0.243;0.417;0.437	B;B;B	0.30716	0.119;0.093;0.09	T	0.10474	-1.0628	10	0.31617	T	0.26	-12.5184	13.2128	0.59834	0.0:0.0:0.7138:0.2862	.	91;54;91	C9JTZ6;Q9H857;E9PAL9	.;NT5D2_HUMAN;.	V	20;54;91;91	ENSP00000306017:A20V;ENSP00000302468:A54V;ENSP00000406933:A91V;ENSP00000419547:A91V	ENSP00000302468:A54V	A	-	2	0	NT5DC2	52538351	1.000000	0.71417	0.994000	0.49952	0.992000	0.81027	5.294000	0.65687	2.512000	0.84698	0.555000	0.69702	GCA	NT5DC2	-	superfamily_HAD-like_dom,pirsf_Pur_nucleotidase	ENSG00000168268		0.597	NT5DC2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NT5DC2	HGNC	protein_coding	OTTHUMT00000351509.1	-	0.00	65	0	G	NM_022908		52563311	-1	tier1	-	no_errors	ENST00000422318	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.663	A
NUFIP1	26747	genome.wustl.edu	37	13	45523878	45523878	+	Missense_Mutation	SNP	C	C	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr13:45523878C>A	ENST00000379161.4	-	8	1163	c.1117G>T	c.(1117-1119)Ggg>Tgg	p.G373W		NM_012345.2	NP_036477.2	Q9UHK0	NUFP1_HUMAN	nuclear fragile X mental retardation protein interacting protein 1	373					box C/D snoRNP assembly (GO:0000492)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|RNA processing (GO:0006396)	cytosolic ribosome (GO:0022626)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|pre-snoRNP complex (GO:0070761)|presynaptic active zone (GO:0048786)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)			breast(2)|cervix(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(4)|skin(3)	18		Lung NSC(96;8.23e-05)|Breast(139;0.00378)|Prostate(109;0.0107)|all_hematologic(4;0.014)|Lung SC(185;0.0262)|Hepatocellular(98;0.0524)|Acute lymphoblastic leukemia(4;0.143)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000306)|BRCA - Breast invasive adenocarcinoma(63;0.125)		CTCTCTGACCCTGAAAGACTG	0.443																																																	0													238.0	204.0	216.0					13																	45523878		2203	4300	6503	SO:0001583	missense	0			AF159548	CCDS9393.1	13q14	2008-02-05			ENSG00000083635	ENSG00000083635			8057	protein-coding gene	gene with protein product		604354				10556305, 10894927	Standard	NM_012345		Approved	NUFIP	uc001uzp.2	Q9UHK0	OTTHUMG00000016842	ENST00000379161.4:c.1117G>T	13.37:g.45523878C>A	ENSP00000368459:p.Gly373Trp		Q8WVM5|Q96SG1	Missense_Mutation	SNP	pfam_NUFIP1_cons_dom,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G373W	ENST00000379161.4	37	c.1117	CCDS9393.1	13	.	.	.	.	.	.	.	.	.	.	C	22.4	4.279157	0.80692	.	.	ENSG00000083635	ENST00000379161	T	0.48836	0.8	5.9	5.9	0.94986	.	0.375268	0.31772	N	0.007090	T	0.69124	0.3076	M	0.75447	2.3	0.34625	D	0.719027	D	0.89917	1.0	D	0.83275	0.996	T	0.77702	-0.2489	10	0.66056	D	0.02	.	15.8208	0.78644	0.0:1.0:0.0:0.0	.	373	Q9UHK0	NUFP1_HUMAN	W	373	ENSP00000368459:G373W	ENSP00000368459:G373W	G	-	1	0	NUFIP1	44421878	0.687000	0.27671	0.984000	0.44739	0.956000	0.61745	4.398000	0.59697	2.808000	0.96608	0.632000	0.83419	GGG	NUFIP1	-	NULL	ENSG00000083635		0.443	NUFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUFIP1	HGNC	protein_coding	OTTHUMT00000044755.2	-	0.00	85	0	C	NM_012345		45523878	-1	tier1	-	no_errors	ENST00000379161	ensembl	human	known	74_37	missense	5.13	74	4	SNP	0.991	A
ONECUT2	9480	genome.wustl.edu	37	18	55143876	55143876	+	Missense_Mutation	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr18:55143876G>A	ENST00000491143.2	+	2	1468	c.1436G>A	c.(1435-1437)cGc>cAc	p.R479H		NM_004852.2	NP_004843.2	O95948	ONEC2_HUMAN	one cut homeobox 2	479					cell fate commitment (GO:0045165)|cilium assembly (GO:0042384)|endocrine pancreas development (GO:0031018)|epithelial cell development (GO:0002064)|liver development (GO:0001889)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ morphogenesis (GO:0009887)|peripheral nervous system neuron development (GO:0048935)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|lung(4)|ovary(2)|skin(1)	15		Colorectal(73;0.234)		READ - Rectum adenocarcinoma(59;0.227)|Colorectal(16;0.245)		AACGCCCGGCGCCGCAGCCTG	0.582																																																	0													39.0	45.0	43.0					18																	55143876		2076	4236	6312	SO:0001583	missense	0			Y18198	CCDS42440.1	18q21.31	2012-03-09	2007-07-16		ENSG00000119547	ENSG00000119547		"""Homeoboxes / CUT class"""	8139	protein-coding gene	gene with protein product		604894	"""one cut domain, family member 2"""			9915796	Standard	NM_004852		Approved	OC-2	uc002lgo.3	O95948	OTTHUMG00000159776	ENST00000491143.2:c.1436G>A	18.37:g.55143876G>A	ENSP00000419185:p.Arg479His			Missense_Mutation	SNP	pfam_Hmoeo_CUT,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Hmoeo_CUT	p.R479H	ENST00000491143.2	37	c.1436	CCDS42440.1	18	.	.	.	.	.	.	.	.	.	.	G	33	5.223394	0.95139	.	.	ENSG00000119547	ENST00000491143;ENST00000262095	.	.	.	6.02	6.02	0.97574	Homeobox (3);Homeodomain-like (1);	0.000000	0.64402	D	0.000002	D	0.87370	0.6160	M	0.93241	3.395	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	D	0.89423	0.3711	9	0.87932	D	0	-21.0285	20.1323	0.98003	0.0:0.0:1.0:0.0	.	479	O95948	ONEC2_HUMAN	H	460;479	.	ENSP00000262095:R479H	R	+	2	0	ONECUT2	53294874	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.857000	0.98124	0.650000	0.86243	CGC	ONECUT2	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	ENSG00000119547		0.582	ONECUT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ONECUT2	HGNC	protein_coding	OTTHUMT00000357264.3	-	0.00	40	0	G			55143876	+1	tier1	-	no_errors	ENST00000491143	ensembl	human	known	74_37	missense	38.46	16	10	SNP	1.000	A
OR11H12	440153	genome.wustl.edu	37	14	19377837	19377837	+	Missense_Mutation	SNP	T	T	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr14:19377837T>A	ENST00000550708.1	+	1	316	c.244T>A	c.(244-246)Tcc>Acc	p.S82T		NM_001013354.1|NM_001197287.1	NP_001013372.1|NP_001184216.1	B2RN74	O11HC_HUMAN	olfactory receptor, family 11, subfamily H, member 12	82						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	22	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		GGGAAATTTCTCCTTTTTAGA	0.418																																																	0													43.0	51.0	48.0					14																	19377837		1972	4086	6058	SO:0001583	missense	0				CCDS32017.1	14q11.2	2013-01-25			ENSG00000257115	ENSG00000257115		"""GPCR / Class A : Olfactory receptors"""	30738	protein-coding gene	gene with protein product							Standard	NM_001013354		Approved		uc010tkp.2	B2RN74	OTTHUMG00000170298	ENST00000550708.1:c.244T>A	14.37:g.19377837T>A	ENSP00000449002:p.Ser82Thr			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S82T	ENST00000550708.1	37	c.244	CCDS32017.1	14	.	.	.	.	.	.	.	.	.	.	t	13.61	2.287665	0.40494	.	.	ENSG00000257115	ENST00000550708	T	0.11930	2.73	0.585	0.585	0.17428	GPCR, rhodopsin-like superfamily (1);	0.171384	0.27447	N	0.019339	T	0.44117	0.1278	H	0.97564	4.03	0.21604	N	0.999625	D	0.89917	1.0	D	0.75020	0.985	T	0.56469	-0.7974	9	0.87932	D	0	.	5.5303	0.16980	0.0:1.0E-4:0.0:0.9999	.	82	B2RN74	O11HC_HUMAN	T	82	ENSP00000449002:S82T	ENSP00000449002:S82T	S	+	1	0	CR383656.1	18447837	0.218000	0.23608	0.997000	0.53966	0.278000	0.26855	2.662000	0.46766	0.518000	0.28383	0.055000	0.15244	TCC	OR11H12	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000257115		0.418	OR11H12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR11H12	HGNC	protein_coding	OTTHUMT00000408402.1		0.00	61	0	T	NM_001013354		19377837	+1			no_errors	ENST00000550708	ensembl	human	known	74_37	missense	6.58	71	5	SNP	0.273	A
OR1I1	126370	genome.wustl.edu	37	19	15198107	15198107	+	Silent	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr19:15198107C>T	ENST00000209540.2	+	1	317	c.231C>T	c.(229-231)acC>acT	p.T77T		NM_001004713.1	NP_001004713.1	O60431	OR1I1_HUMAN	olfactory receptor, family 1, subfamily I, member 1	77						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T77T(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(3)|ovary(2)|stomach(2)	20						CCTCCACCACCGTCCCCAAGA	0.542																																																	1	Substitution - coding silent(1)	kidney(1)											233.0	156.0	182.0					19																	15198107		2203	4300	6503	SO:0001819	synonymous_variant	0			AC004794	CCDS32937.1	19p13.1	2012-08-09				ENSG00000094661		"""GPCR / Class A : Olfactory receptors"""	8207	protein-coding gene	gene with protein product							Standard	NM_001004713		Approved	OR1I1P, OR19-20, OR1I1Q	uc010xoe.2	O60431		ENST00000209540.2:c.231C>T	19.37:g.15198107C>T			Q96R92	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T77	ENST00000209540.2	37	c.231	CCDS32937.1	19																																																																																			OR1I1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000094661		0.542	OR1I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1I1	HGNC	protein_coding	OTTHUMT00000465665.1		0.00	36	0	C			15198107	+1			no_errors	ENST00000209540	ensembl	human	known	74_37	silent	5.00	38	2	SNP	0.895	T
OR2AJ1	127608	genome.wustl.edu	37	1	248097885	248097885	+	Missense_Mutation	SNP	A	A	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr1:248097885A>C	ENST00000318244.3	+	1	815	c.815A>C	c.(814-816)aAg>aCg	p.K272T	OR2L13_ENST00000366478.2_5'Flank			Q8NGZ0	O2AJ1_HUMAN	olfactory receptor, family 2, subfamily AJ, member 1	272						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			lung(1)|pancreas(1)	2						GGCCAGGATAAGTTCCTGGCA	0.413																																																	0																																										SO:0001583	missense	0					1q44	2013-03-27	2004-03-04	2004-03-05	ENSG00000177275	ENSG00000177275		"""GPCR / Class A : Olfactory receptors"""	15001	other	unknown			"""olfactory receptor, family 2, subfamily AJ, member 1 pseudogene"""	OR2AJ1P			Standard	NG_004652		Approved	OR2AJ1Q		Q8NGZ0	OTTHUMG00000040206	ENST00000318244.3:c.815A>C	1.37:g.248097885A>C	ENSP00000325078:p.Lys272Thr			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.K272T	ENST00000318244.3	37	c.815		1	.	.	.	.	.	.	.	.	.	.	A	13.79	2.342267	0.41498	.	.	ENSG00000177275	ENST00000318244	T	0.00183	8.6	3.89	1.4	0.22301	.	0.224683	0.22272	U	0.062255	T	0.00178	0.0005	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.35574	-0.9783	7	0.72032	D	0.01	.	5.0113	0.14313	0.5227:0.1624:0.0:0.3149	.	.	.	.	T	272	ENSP00000325078:K272T	ENSP00000325078:K272T	K	+	2	0	OR2AJ1	246164508	0.000000	0.05858	0.078000	0.20375	0.992000	0.81027	0.037000	0.13840	0.067000	0.16545	0.477000	0.44152	AAG	OR2AJ1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000177275		0.413	OR2AJ1-001	KNOWN	basic|appris_principal	protein_coding	OR2AJ1	HGNC	protein_coding	OTTHUMT00000096863.1	-	0.00	35	0	A	NG_004652		248097885	+1	tier1	-	no_errors	ENST00000318244	ensembl	human	known	74_37	missense	16.67	60	12	SNP	0.000	C
OR2L2	26246	genome.wustl.edu	37	1	248202030	248202030	+	Missense_Mutation	SNP	A	A	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr1:248202030A>C	ENST00000366479.2	+	1	557	c.461A>C	c.(460-462)aAc>aCc	p.N154T	OR2L13_ENST00000366478.2_Intron	NM_001004686.2	NP_001004686.1	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L, member 2	154						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(28)|ovary(1)|skin(4)|urinary_tract(1)	42	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			AGCTCTATCAACTCTTGTGCT	0.428																																																	0													194.0	174.0	181.0					1																	248202030		2203	4300	6503	SO:0001583	missense	0			X64978	CCDS31103.1	1q44	2012-08-09			ENSG00000203663	ENSG00000203663		"""GPCR / Class A : Olfactory receptors"""	8266	protein-coding gene	gene with protein product				OR2L4P, OR2L12		1370859	Standard	NM_001004686		Approved	HTPCRH07, HSHTPCRH07	uc001idw.3	Q8NH16	OTTHUMG00000040214	ENST00000366479.2:c.461A>C	1.37:g.248202030A>C	ENSP00000355435:p.Asn154Thr		Q2M3T5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.N154T	ENST00000366479.2	37	c.461	CCDS31103.1	1	.	.	.	.	.	.	.	.	.	.	.	12.14	1.849160	0.32699	.	.	ENSG00000203663	ENST00000366479	T	0.36699	1.24	1.9	0.477	0.16784	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35525	U	0.003146	T	0.38161	0.1030	M	0.66378	2.025	0.09310	N	1	P	0.37370	0.592	P	0.44422	0.449	T	0.29761	-1.0001	10	0.87932	D	0	.	6.4146	0.21710	0.7825:0.0:0.0:0.2175	.	154	Q8NH16	OR2L2_HUMAN	T	154	ENSP00000355435:N154T	ENSP00000355435:N154T	N	+	2	0	OR2L2	246268653	0.000000	0.05858	0.101000	0.21167	0.063000	0.16089	-0.621000	0.05559	0.746000	0.32786	0.163000	0.16589	AAC	OR2L2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000203663		0.428	OR2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2L2	HGNC	protein_coding	OTTHUMT00000096871.1	-	0.00	105	0	A	NM_001004686		248202030	+1	tier1	-	no_errors	ENST00000366479	ensembl	human	known	74_37	missense	7.10	170	13	SNP	0.049	C
OR56B1	387748	genome.wustl.edu	37	11	5758475	5758475	+	Silent	SNP	A	A	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr11:5758475A>T	ENST00000317121.3	+	1	795	c.729A>T	c.(727-729)gcA>gcT	p.A243A	TRIM5_ENST00000380027.1_Intron	NM_001005180.2	NP_001005180.1	Q8NGI3	O56B1_HUMAN	olfactory receptor, family 56, subfamily B, member 1	243						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(1)|skin(1)	13		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.086)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.184)		CTGAAGCTGCAGCCAAGGCCC	0.418																																																	0													143.0	137.0	139.0					11																	5758475		2201	4297	6498	SO:0001819	synonymous_variant	0			BK004386	CCDS31395.1	11p15.4	2012-08-09		2004-03-10	ENSG00000181023	ENSG00000181023		"""GPCR / Class A : Olfactory receptors"""	15245	protein-coding gene	gene with protein product				OR56B1P			Standard	NM_001005180		Approved		uc001mbt.2	Q8NGI3	OTTHUMG00000066891	ENST00000317121.3:c.729A>T	11.37:g.5758475A>T			B2RNY6|B3KV42|Q6IF76	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.A243	ENST00000317121.3	37	c.729	CCDS31395.1	11																																																																																			OR56B1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000181023		0.418	OR56B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR56B1	HGNC	protein_coding	OTTHUMT00000143354.1	-	0.00	61	0	A	NM_001005180		5758475	+1	tier1	-	no_errors	ENST00000317121	ensembl	human	known	74_37	silent	12.24	43	6	SNP	0.021	T
OR6A2	8590	genome.wustl.edu	37	11	6815962	6815962	+	Silent	SNP	A	A	G			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr11:6815962A>G	ENST00000332601.3	-	1	1166	c.978T>C	c.(976-978)aaT>aaC	p.N326N		NM_003696.2	NP_003687.2	O95222	OR6A2_HUMAN	olfactory receptor, family 6, subfamily A, member 2	326					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(4)|pancreas(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	29		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		CCTTCTATACATTTCTGCTAG	0.458																																																	0													102.0	103.0	103.0					11																	6815962		2201	4296	6497	SO:0001819	synonymous_variant	0			AB065822	CCDS7772.1	11p15.4	2012-08-09		2004-03-10	ENSG00000184933	ENSG00000184933		"""GPCR / Class A : Olfactory receptors"""	15301	protein-coding gene	gene with protein product		608495		OR6A2P, OR6A1			Standard	NM_003696		Approved	OR11-55	uc001mes.1	O95222	OTTHUMG00000165736	ENST00000332601.3:c.978T>C	11.37:g.6815962A>G			Q3MJC7|Q6IF35|Q9H206	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.N326	ENST00000332601.3	37	c.978	CCDS7772.1	11																																																																																			OR6A2	-	NULL	ENSG00000184933		0.458	OR6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6A2	HGNC	protein_coding	OTTHUMT00000385981.1	-	0.00	88	0	A	NM_003696		6815962	-1	tier1	-	no_errors	ENST00000332601	ensembl	human	known	74_37	silent	17.57	61	13	SNP	0.001	G
PAPPA	5069	genome.wustl.edu	37	9	119109489	119109489	+	Splice_Site	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr9:119109489G>A	ENST00000328252.3	+	15	4333		c.e15+1		PAPPA_ENST00000534838.1_Splice_Site	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1						cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						CAATTGAAAGGTATCAAGAAC	0.537																																																	0													123.0	92.0	103.0					9																	119109489		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.3964+1G>A	9.37:g.119109489G>A			B1AMF9|Q08371|Q68G52|Q9UDK7	Splice_Site	SNP	-	e15+1	ENST00000328252.3	37	c.3964+1	CCDS6813.1	9	.	.	.	.	.	.	.	.	.	.	G	22.5	4.293974	0.81025	.	.	ENSG00000182752	ENST00000328252;ENST00000534838	.	.	.	5.86	5.86	0.93980	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1865	0.98220	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PAPPA	118149310	1.000000	0.71417	1.000000	0.80357	0.647000	0.38526	9.827000	0.99397	2.775000	0.95449	0.655000	0.94253	.	PAPPA	-	-	ENSG00000182752		0.537	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA	HGNC	protein_coding	OTTHUMT00000055546.1		0.00	29	0	G	NM_002581	Intron	119109489	+1			no_errors	ENST00000328252	ensembl	human	known	74_37	splice_site	6.25	30	2	SNP	1.000	A
PATE1	160065	genome.wustl.edu	37	11	125616207	125616207	+	Missense_Mutation	SNP	A	A	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr11:125616207A>C	ENST00000305738.5	+	1	20	c.8A>C	c.(7-9)aAg>aCg	p.K3T	PATE1_ENST00000437148.2_Missense_Mutation_p.K3T	NM_138294.2	NP_612151.1	Q8WXA2	PATE1_HUMAN	prostate and testis expressed 1	3						extracellular region (GO:0005576)				large_intestine(1)|lung(5)	6						aaaatggacaagtccctcttg	0.532																																																	0													184.0	163.0	170.0					11																	125616207		2201	4299	6500	SO:0001583	missense	0			AF462605	CCDS8464.1	11q24.2	2008-12-17				ENSG00000171053		"""PATE family"""	24664	protein-coding gene	gene with protein product	"""expressed in prostate and testis"""	606861				11880645, 15798027	Standard	NM_138294		Approved	PATE	uc001qct.3	Q8WXA2		ENST00000305738.5:c.8A>C	11.37:g.125616207A>C	ENSP00000307164:p.Lys3Thr		Q3KNX2	Missense_Mutation	SNP	NULL	p.K3T	ENST00000305738.5	37	c.8	CCDS8464.1	11	.	.	.	.	.	.	.	.	.	.	A	5.151	0.213470	0.09757	.	.	ENSG00000171053	ENST00000305738;ENST00000437148	T;T	0.23950	1.88;1.88	3.94	-4.05	0.03998	.	0.609535	0.13703	N	0.368718	T	0.14313	0.0346	N	0.19112	0.55	0.09310	N	0.999995	B;P	0.35348	0.194;0.496	B;B	0.38264	0.107;0.269	T	0.18429	-1.0337	10	0.87932	D	0	-0.1923	6.7208	0.23328	0.3294:0.1671:0.5035:0.0	.	3;3	Q8WXA2-2;Q8WXA2	.;PATE1_HUMAN	T	3	ENSP00000307164:K3T;ENSP00000396056:K3T	ENSP00000307164:K3T	K	+	2	0	PATE1	125121417	0.046000	0.20272	0.006000	0.13384	0.069000	0.16628	-0.195000	0.09546	-0.908000	0.03857	-1.054000	0.02325	AAG	PATE1	-	NULL	ENSG00000171053		0.532	PATE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PATE1	HGNC	protein_coding	OTTHUMT00000386726.2	-	0.00	39	0	A	NM_138294		125616207	+1	tier1	-	no_errors	ENST00000305738	ensembl	human	known	74_37	missense	27.27	32	12	SNP	0.007	C
PBLD	64081	genome.wustl.edu	37	10	70043993	70043993	+	Missense_Mutation	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr10:70043993C>T	ENST00000358769.2	-	10	1010	c.808G>A	c.(808-810)Gga>Aga	p.G270R	PBLD_ENST00000336578.1_Missense_Mutation_p.G237R|PBLD_ENST00000309049.4_Missense_Mutation_p.G270R	NM_022129.3	NP_071412.2	P30039	PBLD_HUMAN	phenazine biosynthesis-like protein domain containing	270					biosynthetic process (GO:0009058)|maintenance of gastrointestinal epithelium (GO:0030277)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein import into nucleus (GO:0060392)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	isomerase activity (GO:0016853)			endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	21						TCAACCCTTCCGTCTGGACGA	0.468																																																	0													201.0	166.0	178.0					10																	70043993		2203	4300	6503	SO:0001583	missense	0			AK027673	CCDS7277.2, CCDS44413.1	10q21.3	2006-11-27			ENSG00000108187	ENSG00000108187			23301	protein-coding gene	gene with protein product	MAWD binding protein	612189				11355021	Standard	XM_005270028		Approved	MAWBP, MAWDBP, FLJ14767	uc001jns.1	P30039	OTTHUMG00000073949	ENST00000358769.2:c.808G>A	10.37:g.70043993C>T	ENSP00000351619:p.Gly270Arg		A8MZJ3|C9JIM0|Q9HCC2	Missense_Mutation	SNP	pfam_Phenazine_PhzF,pirsf_Phenazine_PhzF,tigrfam_Phenazine_PhzF	p.G270R	ENST00000358769.2	37	c.808	CCDS7277.2	10	.	.	.	.	.	.	.	.	.	.	C	18.18	3.566130	0.65651	.	.	ENSG00000108187	ENST00000336578;ENST00000358769;ENST00000309049	T;T;T	0.35421	1.31;1.31;1.31	6.03	4.04	0.47022	.	0.291393	0.31199	N	0.008065	T	0.35941	0.0949	L	0.55834	1.745	0.58432	D	0.999995	P	0.41232	0.743	B	0.39971	0.315	T	0.21999	-1.0229	10	0.39692	T	0.17	-4.7373	14.432	0.67257	0.0:0.7202:0.2798:0.0	.	270	P30039	PBLD_HUMAN	R	237;270;270	ENSP00000338041:G237R;ENSP00000351619:G270R;ENSP00000308466:G270R	ENSP00000308466:G270R	G	-	1	0	PBLD	69713999	0.909000	0.30893	0.010000	0.14722	0.005000	0.04900	2.240000	0.43088	1.517000	0.48917	0.655000	0.94253	GGA	PBLD	-	pfam_Phenazine_PhzF,pirsf_Phenazine_PhzF	ENSG00000108187		0.468	PBLD-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PBLD	HGNC	protein_coding	OTTHUMT00000048314.1		0.00	35	0	C	NM_022129		70043993	-1			no_errors	ENST00000309049	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.569	T
PCDHA4	56144	genome.wustl.edu	37	5	140186794	140186794	+	Missense_Mutation	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr5:140186794G>A	ENST00000530339.1	+	1	22	c.22G>A	c.(22-24)Ggc>Agc	p.G8S	PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000356878.4_Missense_Mutation_p.G8S|PCDHA4_ENST00000512229.2_Missense_Mutation_p.G8S|PCDHA3_ENST00000522353.2_Intron	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	8					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGGGGAAGCGGCCAGGAATC	0.502																																																	0													79.0	90.0	86.0					5																	140186794		2203	4300	6503	SO:0001583	missense	0			AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.22G>A	5.37:g.140186794G>A	ENSP00000435300:p.Gly8Ser		O75285|Q2M253	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.G8S	ENST00000530339.1	37	c.22	CCDS54916.1	5	.	.	.	.	.	.	.	.	.	.	g	15.50	2.853089	0.51270	.	.	ENSG00000204967	ENST00000512229;ENST00000356878;ENST00000530339	T;T;T	0.50277	0.79;0.77;0.75	4.55	1.63	0.23807	.	0.358505	0.20187	U	0.097390	T	0.22742	0.0549	N	0.17674	0.51	0.09310	N	1	B;B;B	0.24768	0.05;0.029;0.111	B;B;B	0.18561	0.022;0.006;0.011	T	0.10543	-1.0625	10	0.16420	T	0.52	.	1.6432	0.02756	0.1868:0.1665:0.4751:0.1716	.	8;8;8	Q9UN74-2;Q9UN74;D6RA20	.;PCDA4_HUMAN;.	S	8	ENSP00000423470:G8S;ENSP00000349344:G8S;ENSP00000435300:G8S	ENSP00000349344:G8S	G	+	1	0	PCDHA4	140166978	0.000000	0.05858	0.005000	0.12908	0.543000	0.35085	-0.695000	0.05109	0.097000	0.17492	0.467000	0.42956	GGC	PCDHA4	-	NULL	ENSG00000204967		0.502	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA4	HGNC	protein_coding	OTTHUMT00000372864.2	-	0.00	48	0	G	NM_018907		140186794	+1	tier1	-	no_errors	ENST00000530339	ensembl	human	known	74_37	missense	13.89	31	5	SNP	0.020	A
PCDHB4	56131	genome.wustl.edu	37	5	140502955	140502955	+	Missense_Mutation	SNP	G	G	A	rs142630785		TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr5:140502955G>A	ENST00000194152.1	+	1	1375	c.1375G>A	c.(1375-1377)Gtc>Atc	p.V459I	AC005754.8_ENST00000606030.1_lincRNA	NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	459	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CACCCTGTTCGTCCGCGAGAA	0.632																																																	0													67.0	67.0	67.0					5																	140502955		2203	4297	6500	SO:0001583	missense	0			AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.1375G>A	5.37:g.140502955G>A	ENSP00000194152:p.Val459Ile		Q4V761	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V459I	ENST00000194152.1	37	c.1375	CCDS4246.1	5	.	.	.	.	.	.	.	.	.	.	G	9.668	1.145999	0.21288	.	.	ENSG00000081818	ENST00000194152	T	0.53857	0.6	4.1	1.02	0.19986	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.35068	0.0919	N	0.21142	0.635	0.09310	N	1	P	0.36789	0.57	B	0.40199	0.322	T	0.17806	-1.0357	9	0.23302	T	0.38	.	4.7803	0.13199	0.0827:0.2687:0.5113:0.1374	.	459	Q9Y5E5	PCDB4_HUMAN	I	459	ENSP00000194152:V459I	ENSP00000194152:V459I	V	+	1	0	PCDHB4	140483139	0.094000	0.21725	0.374000	0.26016	0.679000	0.39708	0.383000	0.20651	0.489000	0.27749	0.650000	0.86243	GTC	PCDHB4	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin	ENSG00000081818		0.632	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB4	HGNC	protein_coding	OTTHUMT00000251812.2	-	0.00	137	0	G	NM_018938		140502955	+1	tier1	rs142630785	no_errors	ENST00000194152	ensembl	human	known	74_37	missense	20.21	75	19	SNP	0.039	A
PCDHB7	56129	genome.wustl.edu	37	5	140554213	140554213	+	Silent	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr5:140554213C>T	ENST00000231137.3	+	1	1971	c.1797C>T	c.(1795-1797)aaC>aaT	p.N599N		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	599	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGGGCCAGAACGCCTGGCTGT	0.711																																																	0													23.0	34.0	31.0					5																	140554213		1935	3974	5909	SO:0001819	synonymous_variant	0			AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.1797C>T	5.37:g.140554213C>T			A1L3Y8	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.N599	ENST00000231137.3	37	c.1797	CCDS4249.1	5																																																																																			PCDHB7	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000113212		0.711	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB7	HGNC	protein_coding	OTTHUMT00000251803.2	-	0.00	174	0	C	NM_018940		140554213	+1	tier1	-	no_errors	ENST00000231137	ensembl	human	known	74_37	silent	20.30	106	27	SNP	1.000	T
PCDHGA3	56112	genome.wustl.edu	37	5	140723816	140723816	+	Silent	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr5:140723816G>A	ENST00000253812.6	+	1	216	c.216G>A	c.(214-216)acG>acA	p.T72T	PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	72	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGGTAGGACGCAGCTTTTCT	0.597											OREG0016855	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													65.0	76.0	73.0					5																	140723816		2177	4290	6467	SO:0001819	synonymous_variant	0			AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.216G>A	5.37:g.140723816G>A		1658	Q9Y5D4	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T72	ENST00000253812.6	37	c.216	CCDS47290.1	5																																																																																			PCDHGA3	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000254245		0.597	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA3	HGNC	protein_coding	OTTHUMT00000377017.1	-	0.00	47	0	G	NM_018916		140723816	+1	tier1	-	no_errors	ENST00000253812	ensembl	human	known	74_37	silent	16.67	30	6	SNP	0.368	A
PCGF5	84333	genome.wustl.edu	37	10	92982738	92982738	+	Missense_Mutation	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr10:92982738C>T	ENST00000336126.5	+	2	342	c.110C>T	c.(109-111)aCa>aTa	p.T37I	PCGF5_ENST00000371687.2_Missense_Mutation_p.T37I|PCGF5_ENST00000490164.1_3'UTR|PCGF5_ENST00000543648.1_Missense_Mutation_p.T37I	NM_001257101.1|NM_032373.4	NP_001244030.1|NP_115749.2	Q86SE9	PCGF5_HUMAN	polycomb group ring finger 5	37					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)	zinc ion binding (GO:0008270)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)	12						TGCCTCCATACATGTAAGTAT	0.308																																					Colon(178;732 2696 46441 50370)												0													116.0	118.0	117.0					10																	92982738		2203	4300	6503	SO:0001583	missense	0			AL832003	CCDS7413.1	10q23.33	2013-01-09	2005-01-17	2005-01-19	ENSG00000180628	ENSG00000180628		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	28264	protein-coding gene	gene with protein product			"""ring finger protein (C3HC4 type) 159"""	RNF159		8076819	Standard	NM_001256549		Approved	MGC16202	uc001khh.4	Q86SE9	OTTHUMG00000018740	ENST00000336126.5:c.110C>T	10.37:g.92982738C>T	ENSP00000337500:p.Thr37Ile		B7Z892|D3DR33|Q6PK47|Q86TD0	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.T37I	ENST00000336126.5	37	c.110	CCDS7413.1	10	.	.	.	.	.	.	.	.	.	.	C	22.7	4.320837	0.81469	.	.	ENSG00000180628	ENST00000543648;ENST00000371687;ENST00000336126	T;T;T	0.56275	2.18;0.47;2.18	5.72	5.72	0.89469	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type, conserved site (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.096778	0.64402	D	0.000001	T	0.61652	0.2364	L	0.53780	1.695	0.80722	D	1	D	0.56521	0.976	P	0.51806	0.68	T	0.58142	-0.7688	9	.	.	.	-7.7371	19.8891	0.96923	0.0:1.0:0.0:0.0	.	37	Q86SE9	PCGF5_HUMAN	I	37	ENSP00000445704:T37I;ENSP00000360752:T37I;ENSP00000337500:T37I	.	T	+	2	0	PCGF5	92972718	1.000000	0.71417	0.999000	0.59377	0.696000	0.40369	7.228000	0.78079	2.689000	0.91719	0.655000	0.94253	ACA	PCGF5	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	ENSG00000180628		0.308	PCGF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCGF5	HGNC	protein_coding	OTTHUMT00000049363.1	-	0.00	38	0	C	NM_032373		92982738	+1	tier1	-	no_errors	ENST00000336126	ensembl	human	known	74_37	missense	12.77	41	6	SNP	1.000	T
PEX2	5828	genome.wustl.edu	37	8	77895549	77895549	+	Missense_Mutation	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr8:77895549C>T	ENST00000419564.2	-	4	1330	c.866G>A	c.(865-867)aGt>aAt	p.S289N	PEX2_ENST00000522527.1_Missense_Mutation_p.S289N|PEX2_ENST00000357039.4_Missense_Mutation_p.S289N|PEX2_ENST00000520103.1_Missense_Mutation_p.S289N	NM_001172087.1	NP_001165558.1	P28328	PEX2_HUMAN	peroxisomal biogenesis factor 2	289					bile acid biosynthetic process (GO:0006699)|cholesterol homeostasis (GO:0042632)|fatty acid beta-oxidation (GO:0006635)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|peroxisome organization (GO:0007031)|protein destabilization (GO:0031648)|protein import into peroxisome matrix (GO:0016558)|regulation of cholesterol biosynthetic process (GO:0045540)|very long-chain fatty acid metabolic process (GO:0000038)	Cdc73/Paf1 complex (GO:0016593)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	14						TGGCTGCAGACTGTGTACTTC	0.368																																																	0													89.0	92.0	91.0					8																	77895549		2203	4300	6503	SO:0001583	missense	0			M86852	CCDS6221.1	8q21.11	2010-02-09	2010-01-25	2010-01-25		ENSG00000164751		"""RING-type (C3HC4) zinc fingers"""	9717	protein-coding gene	gene with protein product	"""Zellweger syndrome"", ""peroxin 2"""	170993	"""peroxisomal membrane protein 3 (35kD, Zellweger syndrome)"", ""peroxisomal membrane protein 3, 35kDa"""	PXMP3		1546315, 8858157	Standard	NM_000318		Approved	PMP35, PAF-1, RNF72, ZWS3	uc022awf.1	P28328		ENST00000419564.2:c.866G>A	8.37:g.77895549C>T	ENSP00000400984:p.Ser289Asn		Q567S6|Q9BW41	Missense_Mutation	SNP	pfam_Pex_N,smart_Znf_RING,pfscan_Znf_RING	p.S289N	ENST00000419564.2	37	c.866	CCDS6221.1	8	.	.	.	.	.	.	.	.	.	.	C	6.811	0.518634	0.13005	.	.	ENSG00000164751	ENST00000357039;ENST00000419564;ENST00000520103;ENST00000522527	T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3	5.35	2.57	0.30868	Zinc finger, RING/FYVE/PHD-type (1);	0.379631	0.33161	N	0.005219	T	0.43523	0.1251	N	0.13299	0.325	0.29250	N	0.872035	B	0.06786	0.001	B	0.04013	0.001	T	0.27157	-1.0082	10	0.20046	T	0.44	-10.1927	8.4977	0.33138	0.0:0.6361:0.0:0.3639	.	289	P28328	PEX2_HUMAN	N	289	ENSP00000349543:S289N;ENSP00000400984:S289N;ENSP00000428590:S289N;ENSP00000428638:S289N	ENSP00000349543:S289N	S	-	2	0	PEX2	78058104	0.860000	0.29831	0.927000	0.36925	0.975000	0.68041	0.531000	0.23052	0.843000	0.35070	0.557000	0.71058	AGT	PEX2	-	NULL	ENSG00000164751		0.368	PEX2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX2	HGNC	protein_coding	OTTHUMT00000379122.1	-	0.00	39	0	C	NM_000318		77895549	-1	tier1	-	no_errors	ENST00000357039	ensembl	human	known	74_37	missense	39.62	32	21	SNP	0.792	T
PGBD3	267004	genome.wustl.edu	37	10	50724765	50724767	+	In_Frame_Del	DEL	TGG	TGG	-			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	TGG	TGG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr10:50724765_50724767delTGG	ENST00000374127.3	-	2	595_597	c.394_396delCCA	c.(394-396)ccadel	p.P132del	ERCC6_ENST00000355832.5_Intron|ERCC6-PGBD3_ENST00000515869.1_In_Frame_Del_p.P600del|PGBD3_ENST00000508005.2_In_Frame_Del_p.P132del|ERCC6-PGBD3_ENST00000447839.2_In_Frame_Del_p.P600del|PGBD3_ENST00000603152.1_In_Frame_Del_p.P600del	NM_170753.2	NP_736609.2	Q8N328	PGBD3_HUMAN	piggyBac transposable element derived 3	132										breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|lung(16)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	33						AGAAATCGTTTGGTGGTGCTGTA	0.409																																																	0																																										SO:0001651	inframe_deletion	0			AK074682	CCDS7230.1	10q11	2011-03-24			ENSG00000243251	ENSG00000243251			19400	protein-coding gene	gene with protein product							Standard	NM_170753		Approved	FLJ90201		Q8N328	OTTHUMG00000018193	ENST00000374127.3:c.394_396delCCA	10.37:g.50724768_50724770delTGG	ENSP00000363242:p.Pro132del		B3KQC4|Q5W0M0|Q6PIH0	In_Frame_Del	DEL	NULL	p.P600in_frame_del	ENST00000374127.3	37	c.1800_1798	CCDS7230.1	10																																																																																			PGBD3	-	NULL	ENSG00000243251		0.409	PGBD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PGBD3	HGNC	protein_coding	OTTHUMT00000047988.1		0.00	67	0	TGG			50724767	-1	tier1		no_errors	ENST00000603152	ensembl	human	known	74_37	in_frame_del	16.18	57	11	DEL	1.000:0.999:0.998	-
PI15	51050	genome.wustl.edu	37	8	75737501	75737501	+	Missense_Mutation	SNP	C	C	G			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr8:75737501C>G	ENST00000260113.2	+	2	196	c.17C>G	c.(16-18)gCc>gGc	p.A6G	RP11-758M4.4_ENST00000518128.1_RNA|RP11-758M4.4_ENST00000523860.1_RNA|PI15_ENST00000523773.1_Missense_Mutation_p.A6G	NM_015886.3	NP_056970.1	O43692	PI15_HUMAN	peptidase inhibitor 15	6						extracellular vesicular exosome (GO:0070062)	peptidase inhibitor activity (GO:0030414)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|skin(1)	30	Breast(64;0.137)		BRCA - Breast invasive adenocarcinoma(89;0.104)|Epithelial(68;0.118)			GCAATCTCTGCCGTCAGCAGT	0.453																																																	0													272.0	278.0	276.0					8																	75737501		2203	4300	6503	SO:0001583	missense	0			D45027	CCDS6218.1	8q13.3	2005-08-17	2005-08-17		ENSG00000137558	ENSG00000137558			8946	protein-coding gene	gene with protein product		607076	"""protease inhibitor 15"""			8882727, 9473672	Standard	XM_005251255		Approved	P25TI	uc003yal.3	O43692	OTTHUMG00000164528	ENST00000260113.2:c.17C>G	8.37:g.75737501C>G	ENSP00000260113:p.Ala6Gly		Q68CY1	Missense_Mutation	SNP	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1,prints_Allrgn_V5/Tpx1	p.A6G	ENST00000260113.2	37	c.17	CCDS6218.1	8	.	.	.	.	.	.	.	.	.	.	C	12.94	2.087009	0.36855	.	.	ENSG00000137558	ENST00000260113;ENST00000523773	T;T	0.08807	3.05;3.05	4.77	4.77	0.60923	.	0.199054	0.41500	D	0.000873	T	0.08268	0.0206	N	0.22421	0.69	0.28784	N	0.89967	B	0.17038	0.02	B	0.17433	0.018	T	0.12863	-1.0531	10	0.49607	T	0.09	.	18.3479	0.90328	0.0:1.0:0.0:0.0	.	6	O43692	PI15_HUMAN	G	6	ENSP00000260113:A6G;ENSP00000428567:A6G	ENSP00000260113:A6G	A	+	2	0	PI15	75900056	0.979000	0.34478	0.934000	0.37439	0.861000	0.49209	2.270000	0.43355	2.652000	0.90054	0.561000	0.74099	GCC	PI15	-	NULL	ENSG00000137558		0.453	PI15-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PI15	HGNC	protein_coding	OTTHUMT00000379115.1		0.00	25	0	C	NM_015886		75737501	+1			no_errors	ENST00000260113	ensembl	human	known	74_37	missense	5.41	35	2	SNP	0.965	G
PIK3CD	5293	genome.wustl.edu	37	1	9783211	9783211	+	Frame_Shift_Del	DEL	G	G	-			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr1:9783211delG	ENST00000377346.4	+	20	2650	c.2455delG	c.(2455-2457)gggfs	p.G819fs	PIK3CD_ENST00000361110.2_Frame_Shift_Del_p.G843fs|PIK3CD_ENST00000536656.1_Frame_Shift_Del_p.G843fs	NM_005026.3	NP_005017.3	O00329	PK3CD_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta	819	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|B cell chemotaxis (GO:0035754)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|cytokine production (GO:0001816)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell chemotaxis (GO:0002551)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|natural killer cell activation (GO:0030101)|natural killer cell chemotaxis (GO:0035747)|natural killer cell differentiation (GO:0001779)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|respiratory burst involved in defense response (GO:0002679)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|mast cell granule (GO:0042629)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)			central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(12)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31	all_lung(157;0.222)	all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0231)|Colorectal(212;7.52e-08)|COAD - Colon adenocarcinoma(227;1.78e-05)|Kidney(185;0.000322)|KIRC - Kidney renal clear cell carcinoma(229;0.00114)|BRCA - Breast invasive adenocarcinoma(304;0.0021)|STAD - Stomach adenocarcinoma(132;0.00395)|READ - Rectum adenocarcinoma(331;0.0419)	Caffeine(DB00201)	CCTCCCCACCGGGGACCGCAC	0.602																																																	0													136.0	137.0	136.0					1																	9783211		2203	4300	6503	SO:0001589	frameshift_variant	0				CCDS104.1	1p36.2	2014-09-17	2012-07-13		ENSG00000171608	ENSG00000171608	2.7.1.153		8977	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase, catalytic, delta polypeptide"", ""phosphoinositide-3-kinase C"""	602839	"""phosphoinositide-3-kinase, catalytic, delta polypeptide"""			9113989, 9455486	Standard	NM_005026		Approved	p110D	uc001aqb.4	O00329	OTTHUMG00000001450	ENST00000377346.4:c.2455delG	1.37:g.9783211delG	ENSP00000366563:p.Gly819fs		A6NCG0|G1FFP1|O15445|Q5SR49	Frame_Shift_Del	DEL	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,pfam_PI3K_Ras-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_dom,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.D844fs	ENST00000377346.4	37	c.2527	CCDS104.1	1																																																																																			PIK3CD	-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000171608		0.602	PIK3CD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3CD	HGNC	protein_coding	OTTHUMT00000004235.1		0.00	31	0	G	NM_005026		9783211	+1	tier1		no_errors	ENST00000536656	ensembl	human	known	74_37	frame_shift_del	6.25	30	2	DEL	0.999	-
PJA2	9867	genome.wustl.edu	37	5	108704338	108704338	+	Missense_Mutation	SNP	C	C	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr5:108704338C>A	ENST00000361189.2	-	5	1632	c.1393G>T	c.(1393-1395)Gat>Tat	p.D465Y	PJA2_ENST00000361557.3_Missense_Mutation_p.D465Y	NM_014819.4	NP_055634.3	O43164	PJA2_HUMAN	praja ring finger 2, E3 ubiquitin protein ligase	465					long-term memory (GO:0007616)|protein ubiquitination (GO:0016567)|regulation of protein kinase A signaling (GO:0010738)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ligase activity (GO:0016874)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	21		all_cancers(142;4.4e-06)|all_epithelial(76;8.17e-08)|Prostate(80;0.00676)|Lung NSC(167;0.0436)|Ovarian(225;0.0443)|all_lung(232;0.053)|Colorectal(57;0.0946)|Breast(839;0.151)		OV - Ovarian serous cystadenocarcinoma(64;3.46e-10)|Epithelial(69;6.02e-09)|COAD - Colon adenocarcinoma(37;0.224)		TCATTCTCATCTTTTCCTGGC	0.423																																																	0													170.0	171.0	170.0					5																	108704338		2202	4300	6502	SO:0001583	missense	0			AB007898	CCDS4099.1	5q22.1	2013-01-09	2012-02-23	2003-06-05	ENSG00000198961	ENSG00000198961		"""RING-type (C3HC4) zinc fingers"""	17481	protein-coding gene	gene with protein product			"""ring finger protein 131"", ""praja ring finger 2"""	RNF131			Standard	NM_014819		Approved	KIAA0438, Neurodap1	uc003kos.4	O43164	OTTHUMG00000128750	ENST00000361189.2:c.1393G>T	5.37:g.108704338C>A	ENSP00000354775:p.Asp465Tyr		A8K6U4|D3DSZ5|Q68D49|Q8N1G5	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.D465Y	ENST00000361189.2	37	c.1393	CCDS4099.1	5	.	.	.	.	.	.	.	.	.	.	C	18.51	3.639339	0.67244	.	.	ENSG00000198961	ENST00000361189;ENST00000361557	T;T	0.05996	3.36;3.36	5.39	5.39	0.77823	.	0.143821	0.48286	D	0.000184	T	0.20333	0.0489	L	0.53249	1.67	0.46458	D	0.999051	D	0.89917	1.0	D	0.72982	0.979	T	0.00014	-1.2403	10	0.87932	D	0	-31.3992	14.7387	0.69437	0.0:0.8564:0.1436:0.0	.	465	O43164	PJA2_HUMAN	Y	465	ENSP00000354775:D465Y;ENSP00000355284:D465Y	ENSP00000354775:D465Y	D	-	1	0	PJA2	108732237	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.501000	0.53325	2.809000	0.96659	0.467000	0.42956	GAT	PJA2	-	NULL	ENSG00000198961		0.423	PJA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PJA2	HGNC	protein_coding	OTTHUMT00000250663.1		0.00	42	0	C	NM_014819		108704338	-1			no_errors	ENST00000361189	ensembl	human	known	74_37	missense	5.88	32	2	SNP	1.000	A
PKDREJ	10343	genome.wustl.edu	37	22	46654703	46654703	+	Missense_Mutation	SNP	G	G	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr22:46654703G>C	ENST00000253255.5	-	1	4516	c.4517C>G	c.(4516-4518)cCc>cGc	p.P1506R		NM_006071.1	NP_006062.1	Q9NTG1	PKDRE_HUMAN	polycystin (PKD) family receptor for egg jelly	1506					acrosome reaction (GO:0007340)|calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|neuropeptide signaling pathway (GO:0007218)|regulation of acrosome reaction (GO:0060046)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			NS(2)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(4)|kidney(5)|large_intestine(21)|lung(16)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	73		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		TGGAAGCCTGGGCTTTCCTTT	0.507																																																	0													197.0	197.0	197.0					22																	46654703		2203	4300	6503	SO:0001583	missense	0			AF116458	CCDS14073.1	22q13.31	2013-07-31	2013-07-31		ENSG00000130943	ENSG00000130943			9015	protein-coding gene	gene with protein product		604670	"""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly, sea urchin homolog)-like"", ""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly homolog, sea urchin)-like"", ""polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea urchin)"""			9949214, 10591208	Standard	NM_006071		Approved		uc003bhh.3	Q9NTG1	OTTHUMG00000150493	ENST00000253255.5:c.4517C>G	22.37:g.46654703G>C	ENSP00000253255:p.Pro1506Arg		B1AJY3|O95850	Missense_Mutation	SNP	pfam_PKD1_2_channel,pfam_PKD/REJ-like,pfam_PLAT/LH2_dom,pfam_Ion_trans_dom,superfamily_Lipase_LipOase,smart_GPS_dom,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom,pfscan_REJ-like,prints_PKD_2	p.P1506R	ENST00000253255.5	37	c.4517	CCDS14073.1	22	.	.	.	.	.	.	.	.	.	.	G	7.505	0.653466	0.14580	.	.	ENSG00000130943	ENST00000253255	T	0.35236	1.32	4.87	4.87	0.63330	.	4.392830	0.00610	N	0.000405	T	0.38427	0.1040	L	0.44542	1.39	0.09310	N	1	D	0.54964	0.969	P	0.45037	0.467	T	0.31696	-0.9934	10	0.10377	T	0.69	-2.8966	12.3435	0.55107	0.0:0.0:0.8319:0.1681	.	1506	Q9NTG1	PKDRE_HUMAN	R	1506	ENSP00000253255:P1506R	ENSP00000253255:P1506R	P	-	2	0	PKDREJ	45033367	0.001000	0.12720	0.008000	0.14137	0.023000	0.10783	0.584000	0.23864	2.416000	0.81992	0.484000	0.47621	CCC	PKDREJ	-	NULL	ENSG00000130943		0.507	PKDREJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKDREJ	HGNC	protein_coding	OTTHUMT00000318466.1		0.00	58	0	G	NM_006071		46654703	-1			no_errors	ENST00000253255	ensembl	human	known	74_37	missense	17.78	37	8	SNP	0.008	C
PLD1	5337	genome.wustl.edu	37	3	171455451	171455452	+	Splice_Site	INS	-	-	A	rs545683379|rs71178233		TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr3:171455451_171455452insA	ENST00000351298.4	-	3	287		c.e3-2		PLD1_ENST00000356327.5_Splice_Site|PLD1_ENST00000340989.4_Splice_Site|PLD1_ENST00000342215.6_Splice_Site	NM_002662.4	NP_002653.1	Q13393	PLD1_HUMAN	phospholipase D1, phosphatidylcholine-specific						chemotaxis (GO:0006935)|defense response to Gram-positive bacterium (GO:0050830)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|lung(27)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	63	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	GGATATACACTAAAAAAAAAAG	0.327																																					NSCLC(149;2174 3517 34058)												0																																										SO:0001630	splice_region_variant	0			U38545	CCDS3216.1, CCDS46957.1	3q26	2013-01-10	2006-02-17		ENSG00000075651	ENSG00000075651	3.1.4.4	"""Pleckstrin homology (PH) domain containing"""	9067	protein-coding gene	gene with protein product	"""choline phosphatase 1"""	602382				9858822, 8530346	Standard	NM_002662		Approved		uc003fhs.3	Q13393	OTTHUMG00000156947	ENST00000351298.4:c.161-2->T	3.37:g.171455461_171455461dupA				Splice_Site	INS	-	e2-2	ENST00000351298.4	37	c.161-3_161-2	CCDS3216.1	3																																																																																			PLD1	-	-	ENSG00000075651		0.327	PLD1-001	KNOWN	basic|CCDS	protein_coding	PLD1	HGNC	protein_coding	OTTHUMT00000346730.2		0.00	20	0	-	NM_002662	Intron	171455452	-1	tier1		no_errors	ENST00000351298	ensembl	human	known	74_37	splice_site_ins	15.00	17	3	INS	0.999:0.901	A
PML	5371	genome.wustl.edu	37	15	74335500	74335500	+	Intron	DEL	C	C	-			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr15:74335500delC	ENST00000268058.3	+	8	1957				PML_ENST00000565898.1_Intron|PML_ENST00000569965.1_3'UTR|PML_ENST00000395135.3_Frame_Shift_Del_p.Y627fs|PML_ENST00000359928.4_3'UTR|PML_ENST00000564428.1_Frame_Shift_Del_p.Y579fs	NM_033238.2	NP_150241.2	P29590	PML_HUMAN	promyelocytic leukemia						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to interleukin-4 (GO:0071353)|cellular senescence (GO:0090398)|circadian regulation of gene expression (GO:0032922)|common-partner SMAD protein phosphorylation (GO:0007182)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|entrainment of circadian clock by photoperiod (GO:0043153)|extrinsic apoptotic signaling pathway (GO:0097191)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|maintenance of protein location in nucleus (GO:0051457)|myeloid cell differentiation (GO:0030099)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation in response to oxidative stress (GO:0032938)|negative regulation of viral release from host cell (GO:1902187)|PML body organization (GO:0030578)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of histone deacetylation (GO:0031065)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)|regulation of calcium ion transport into cytosol (GO:0010522)|regulation of circadian rhythm (GO:0042752)|regulation of double-strand break repair (GO:2000779)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of protein phosphorylation (GO:0001932)|regulation of transcription, DNA-templated (GO:0006355)|response to cytokine (GO:0034097)|response to gamma radiation (GO:0010332)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|retinoic acid receptor signaling pathway (GO:0048384)|SMAD protein import into nucleus (GO:0007184)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extrinsic component of endoplasmic reticulum membrane (GO:0042406)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	cobalt ion binding (GO:0050897)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|SUMO binding (GO:0032183)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	31						CCTGGGGCTACCCCCACCCCT	0.537			T	"""RARA, PAX5"""	"""APL, ALL"""																																			Dom	yes		15	15q22	5371	promyelocytic leukemia		L	0													72.0	70.0	71.0					15																	74335500		2198	4297	6495	SO:0001627	intron_variant	0			AB208950	CCDS10255.1, CCDS10256.1, CCDS10257.1, CCDS10258.1, CCDS45297.1, CCDS45298.1, CCDS45299.1, CCDS45300.1, CCDS58386.1	15q24.1	2011-04-21			ENSG00000140464	ENSG00000140464		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9113	protein-coding gene	gene with protein product		102578					Standard	NM_033244		Approved	MYL, TRIM19, RNF71	uc002awv.3	P29590	OTTHUMG00000137607	ENST00000268058.3:c.1861+20C>-	15.37:g.74335500delC			E9PBR7|P29591|P29592|P29593|Q00755|Q15959|Q59FP9|Q8WUA0|Q96S41|Q9BPW2|Q9BWP7|Q9BZX6|Q9BZX7|Q9BZX8|Q9BZX9|Q9BZY0|Q9BZY2|Q9BZY3	Frame_Shift_Del	DEL	pfam_DUF3583,pfam_Znf_B-box,smart_Znf_RING,smart_Znf_B-box,pfscan_Znf_B-box,pfscan_Znf_RING	p.H629fs	ENST00000268058.3	37	c.1881	CCDS10255.1	15																																																																																			PML	-	NULL	ENSG00000140464		0.537	PML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PML	HGNC	protein_coding	OTTHUMT00000269021.3		0.00	29	0	C	NM_002675		74335500	+1	tier1		no_errors	ENST00000395135	ensembl	human	known	74_37	frame_shift_del	9.52	19	2	DEL	0.002	-
POM121L2	94026	genome.wustl.edu	37	6	27279511	27279511	+	Frame_Shift_Del	DEL	A	A	-			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr6:27279511delA	ENST00000444565.1	-	1	438	c.439delT	c.(439-441)tctfs	p.S147fs	POM121L2_ENST00000377451.2_Frame_Shift_Del_p.S147fs	NM_033482.3	NP_258443.2	Q96KW2	P12L2_HUMAN	POM121 transmembrane nucleoporin-like 2	147										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	7						AGCTCCTCAGAGGGCGGGAGT	0.537																																																	0													60.0	52.0	55.0					6																	27279511		692	1591	2283	SO:0001589	frameshift_variant	0			AL021808	CCDS59497.1	6p21.3	2012-03-13	2012-03-13		ENSG00000158553	ENSG00000158553			13973	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 2 (rat)"", ""POM121 membrane glycoprotein-like 2"""				Standard	NM_033482		Approved	POM121-L	uc011dku.1	Q96KW2	OTTHUMG00000014475	ENST00000444565.1:c.439delT	6.37:g.27279511delA	ENSP00000392726:p.Ser147fs		C9J1I7	Frame_Shift_Del	DEL	NULL	p.S147fs	ENST00000444565.1	37	c.439	CCDS59497.1	6																																																																																			POM121L2	-	NULL	ENSG00000158553		0.537	POM121L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POM121L2	HGNC	protein_coding	OTTHUMT00000040143.2		0.00	31	0	A	NM_033482		27279511	-1	tier1		no_errors	ENST00000444565	ensembl	human	known	74_37	frame_shift_del	6.67	28	2	DEL	0.004	-
PNLDC1	154197	genome.wustl.edu	37	6	160239687	160239687	+	Splice_Site	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr6:160239687G>A	ENST00000610273.1	+	16	1395		c.e16+1		PNLDC1_ENST00000392167.3_Splice_Site	NM_001271862.1|NM_173516.1	NP_001258791.1|NP_775787.1	Q8NA58	PNDC1_HUMAN	poly(A)-specific ribonuclease (PARN)-like domain containing 1							integral component of membrane (GO:0016021)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	31		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;1.55e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		CCCAAAGATCGTGAGTAGATC	0.582																																																	0													59.0	57.0	58.0					6																	160239687		2203	4300	6503	SO:0001630	splice_region_variant	0			AK097559	CCDS5271.1, CCDS5271.2, CCDS64561.1	6q25.3	2008-02-05			ENSG00000146453	ENSG00000146453			21185	protein-coding gene	gene with protein product							Standard	NM_001271862		Approved	FLJ40240, dJ195P10.2	uc003qsy.2	Q8NA58	OTTHUMG00000015941	ENST00000610273.1:c.1224+1G>A	6.37:g.160239687G>A			Q5TAP7|Q8N7X5	Splice_Site	SNP	-	e15+1	ENST00000610273.1	37	c.1224+1	CCDS5271.1	6	.	.	.	.	.	.	.	.	.	.	G	11.85	1.762856	0.31228	.	.	ENSG00000146453	ENST00000275275;ENST00000392167	.	.	.	5.36	5.36	0.76844	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.6111	0.88053	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PNLDC1	160159677	1.000000	0.71417	0.652000	0.29579	0.047000	0.14425	6.065000	0.71176	2.662000	0.90505	0.561000	0.74099	.	PNLDC1	-	-	ENSG00000146453		0.582	PNLDC1-201	KNOWN	basic|CCDS	protein_coding	PNLDC1	HGNC	protein_coding			0.00	15	0	G	NM_173516	Intron	160239687	+1			no_errors	ENST00000610273	ensembl	human	known	74_37	splice_site	19.05	17	4	SNP	1.000	A
POTEF	728378	genome.wustl.edu	37	2	130832862	130832862	+	Missense_Mutation	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr2:130832862C>T	ENST00000409914.2	-	17	2582	c.2183G>A	c.(2182-2184)cGg>cAg	p.R728Q	POTEF_ENST00000357462.5_Missense_Mutation_p.R728Q	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	728	Actin-like.				retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						GAAGACAGCCCGGGGGGCATC	0.602																																																	0													5.0	6.0	5.0					2																	130832862		1500	3347	4847	SO:0001583	missense	0			EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.2183G>A	2.37:g.130832862C>T	ENSP00000386786:p.Arg728Gln		A6NC34	Missense_Mutation	SNP	pfam_Actin-related,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Actin-related,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Actin-related	p.R728Q	ENST00000409914.2	37	c.2183	CCDS46409.1	2	.	.	.	.	.	.	.	.	.	.	.	16.70	3.196820	0.58126	.	.	ENSG00000196604	ENST00000357462;ENST00000409914	D;D	0.94862	-3.54;-3.54	.	.	.	.	.	.	.	.	D	0.95095	0.8411	M	0.79805	2.47	0.80722	D	1	D	0.56035	0.974	P	0.55749	0.783	D	0.92581	0.6074	8	0.87932	D	0	.	5.9051	0.18992	0.0:0.9992:0.0:8.0E-4	.	728	A5A3E0	POTEF_HUMAN	Q	728	ENSP00000350052:R728Q;ENSP00000386786:R728Q	ENSP00000350052:R728Q	R	-	2	0	POTEF	130549332	1.000000	0.71417	0.038000	0.18304	0.038000	0.13279	3.715000	0.54897	0.119000	0.18210	0.121000	0.15741	CGG	POTEF	-	pfam_Actin-related,smart_Actin-related,prints_Actin-related	ENSG00000196604		0.602	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEF	HGNC	protein_coding	OTTHUMT00000331889.2	-	0.00	95	0	C	NM_001099771		130832862	-1	tier1	-	no_errors	ENST00000357462	ensembl	human	known	74_37	missense	21.84	68	19	SNP	1.000	T
PPP2R5C	5527	genome.wustl.edu	37	14	102375978	102375978	+	Missense_Mutation	SNP	C	C	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr14:102375978C>A	ENST00000334743.5	+	11	1252	c.1204C>A	c.(1204-1206)Caa>Aaa	p.Q402K	PPP2R5C_ENST00000328724.5_Missense_Mutation_p.Q457K|PPP2R5C_ENST00000422945.2_Missense_Mutation_p.Q433K|PPP2R5C_ENST00000445439.3_Missense_Mutation_p.Q402K|PPP2R5C_ENST00000350249.3_Missense_Mutation_p.Q402K	NM_002719.3	NP_002710.2	Q13362	2A5G_HUMAN	protein phosphatase 2, regulatory subunit B', gamma	402					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of cell proliferation (GO:0008285)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	chromosome, centromeric region (GO:0000775)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20						GGAGATGAACCAAAAGCTATT	0.418																																																	0													140.0	134.0	136.0					14																	102375978		2203	4300	6503	SO:0001583	missense	0			L42375	CCDS9964.1, CCDS9965.1, CCDS45163.1, CCDS53911.1, CCDS53912.1	14q32.31	2010-06-18	2010-04-14		ENSG00000078304	ENSG00000078304		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9311	protein-coding gene	gene with protein product		601645	"""protein phosphatase 2, regulatory subunit B (B56), gamma isoform"", ""protein phosphatase 2, regulatory subunit B', gamma isoform"""			7592815	Standard	NM_002719		Approved	B56G, PR61G	uc001ykk.3	Q13362		ENST00000334743.5:c.1204C>A	14.37:g.102375978C>A	ENSP00000333905:p.Gln402Lys		B4DYJ8|B5BUA5|F5GWP3|Q14391|Q15060|Q15174|Q6ZN33	Missense_Mutation	SNP	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56	p.Q433K	ENST00000334743.5	37	c.1297	CCDS9964.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.78|18.78	3.696363|3.696363	0.68386|0.68386	.|.	.|.	ENSG00000078304|ENSG00000078304	ENST00000334756|ENST00000422945;ENST00000328724;ENST00000557268;ENST00000350249;ENST00000445439;ENST00000334743	.|T;T;T;T;T	.|0.45668	.|0.89;0.92;0.9;0.95;0.89	5.25|5.25	5.25|5.25	0.73442|0.73442	.|Armadillo-type fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.61400|0.61400	0.2344|0.2344	M|M	0.85041|0.85041	2.73|2.73	0.80722|0.80722	D|D	1|1	B|P;D;P;B;P	0.22414|0.60575	0.069|0.863;0.988;0.888;0.28;0.869	B|B;P;B;B;P	0.18561|0.57152	0.022|0.16;0.814;0.248;0.074;0.513	T|T	0.62473|0.62473	-0.6847|-0.6847	8|10	0.87932|0.09338	D|T	0|0.73	-18.338|-18.338	18.8514|18.8514	0.92232|0.92232	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	257|433;402;402;402;457	E9PHN5|F5GWP3;Q13362-3;Q13362;Q13362-2;Q6ZN33	.|.;.;2A5G_HUMAN;.;.	Q|K	257|433;457;431;402;402;402	.|ENSP00000412324:Q433K;ENSP00000329009:Q457K;ENSP00000450931:Q431K;ENSP00000262239:Q402K;ENSP00000333905:Q402K	ENSP00000334891:P257Q|ENSP00000329009:Q457K	P|Q	+|+	2|1	0|0	PPP2R5C|PPP2R5C	101445731|101445731	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.788000|7.788000	0.85771|0.85771	2.428000|2.428000	0.82296|0.82296	0.655000|0.655000	0.94253|0.94253	CCA|CAA	PPP2R5C	-	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56	ENSG00000078304		0.418	PPP2R5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R5C	HGNC	protein_coding	OTTHUMT00000414373.2	-	0.00	59	0	C	NM_002719		102375978	+1	tier1	-	no_errors	ENST00000422945	ensembl	human	known	74_37	missense	6.35	58	4	SNP	1.000	A
PRAMEF11	440560	genome.wustl.edu	37	1	12887426	12887426	+	Missense_Mutation	SNP	T	T	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr1:12887426T>C	ENST00000535591.1	-	3	626	c.431A>G	c.(430-432)aAg>aGg	p.K144R		NM_001146344.1	NP_001139816.1	O60813	PRA11_HUMAN	PRAME family member 11	144					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|lung(7)|pancreas(2)|skin(4)|urinary_tract(1)	27						AATTTTCAGCTTCTTACAGCA	0.453																																																	0																																										SO:0001583	missense	0			AL049680	CCDS53268.1	1p36.21	2013-01-17			ENSG00000204513	ENSG00000239810		"""-"""	14086	protein-coding gene	gene with protein product							Standard	XM_006710645		Approved		uc001auk.2	O60813	OTTHUMG00000001929	ENST00000535591.1:c.431A>G	1.37:g.12887426T>C	ENSP00000439551:p.Lys144Arg			Missense_Mutation	SNP	NULL	p.K144R	ENST00000535591.1	37	c.431	CCDS53268.1	1	.	.	.	.	.	.	.	.	.	.	.	12.51	1.958719	0.34565	.	.	ENSG00000204513	ENST00000535591;ENST00000331684;ENST00000437584	T;T	0.16743	2.32;2.32	1.48	0.276	0.15663	.	0.818727	0.11252	N	0.583507	T	0.32585	0.0834	M	0.88181	2.935	0.09310	N	1	D	0.53745	0.962	P	0.53313	0.723	T	0.17837	-1.0356	10	0.72032	D	0.01	.	3.3731	0.07228	0.0:0.2396:0.0:0.7604	.	144	O60813	PRA11_HUMAN	R	144;185;144	ENSP00000439551:K144R;ENSP00000391839:K144R	ENSP00000328783:K185R	K	-	2	0	PRAMEF11	12810013	0.000000	0.05858	0.003000	0.11579	0.129000	0.20672	-0.790000	0.04604	0.063000	0.16370	0.329000	0.21502	AAG	PRAMEF11	-	NULL	ENSG00000204513		0.453	PRAMEF11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF11	HGNC	protein_coding		-	0.00	238	0	T	XM_496341		12887426	-1	tier1	-	no_errors	ENST00000535591	ensembl	human	known	74_37	missense	14.57	170	29	SNP	0.004	C
PRB2	653247	genome.wustl.edu	37	12	11546376	11546376	+	Silent	SNP	A	A	G	rs557500313	byFrequency	TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr12:11546376A>G	ENST00000389362.4	-	3	671	c.636T>C	c.(634-636)ccT>ccC	p.P212P	PRB1_ENST00000546254.1_Intron|PRB2_ENST00000545829.1_5'Flank	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	212	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-P-Q-G-[GD]-[NKS]-[KSQ]- [PRS]-[QRS] [GPS]-[PSAR]-[PSR].					extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			GGGGACCTTGAGGTTTGTTGC	0.607													g|||	2	0.000399361	0.0	0.0029	5008	,	,		18707	0.0		0.0	False		,,,				2504	0.0																0													70.0	91.0	84.0					12																	11546376		2055	4138	6193	SO:0001819	synonymous_variant	0			K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.636T>C	12.37:g.11546376A>G			O00599|P02811|P04281	Silent	SNP	NULL	p.P212	ENST00000389362.4	37	c.636	CCDS41757.2	12																																																																																			PRB2	-	NULL	ENSG00000121335		0.607	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRB2	HGNC	protein_coding	OTTHUMT00000346925.2	-	0.00	104	0	A	NM_006248		11546376	-1	tier1	-	no_errors	ENST00000389362	ensembl	human	known	74_37	silent	19.47	90	22	SNP	0.021	G
PREX2	80243	genome.wustl.edu	37	8	69005844	69005844	+	Missense_Mutation	SNP	A	A	G			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr8:69005844A>G	ENST00000288368.4	+	21	2532	c.2255A>G	c.(2254-2256)gAt>gGt	p.D752G	PREX2_ENST00000529398.1_3'UTR|RP11-403D15.2_ENST00000526901.1_RNA	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	752	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						TTCCAGCAAGATTCCATACAA	0.428																																																	0													105.0	106.0	106.0					8																	69005844		2203	4300	6503	SO:0001583	missense	0			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.2255A>G	8.37:g.69005844A>G	ENSP00000288368:p.Asp752Gly		B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.D752G	ENST00000288368.4	37	c.2255	CCDS6201.1	8	.	.	.	.	.	.	.	.	.	.	A	11.47	1.649394	0.29336	.	.	ENSG00000046889	ENST00000288368;ENST00000396539;ENST00000354677	T	0.25085	1.82	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.21387	0.0515	N	0.08118	0	0.80722	D	1	D;B;P	0.61697	0.99;0.0;0.848	P;B;P	0.56216	0.794;0.001;0.519	T	0.03933	-1.0991	10	0.02654	T	1	.	15.898	0.79350	1.0:0.0:0.0:0.0	.	752;752;752	Q70Z35-2;Q70Z35;Q70Z35-3	.;PREX2_HUMAN;.	G	752	ENSP00000288368:D752G	ENSP00000288368:D752G	D	+	2	0	PREX2	69168398	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.515000	0.90548	2.150000	0.67090	0.528000	0.53228	GAT	PREX2	-	NULL	ENSG00000046889		0.428	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREX2	HGNC	protein_coding	OTTHUMT00000378620.1	-	0.00	58	0	A	NM_025170		69005844	+1	tier1	-	no_errors	ENST00000288368	ensembl	human	known	74_37	missense	11.49	77	10	SNP	1.000	G
PRG4	10216	genome.wustl.edu	37	1	186275465	186275465	+	Missense_Mutation	SNP	A	A	G			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr1:186275465A>G	ENST00000445192.2	+	7	659	c.614A>G	c.(613-615)aAg>aGg	p.K205R	PRG4_ENST00000367484.3_Missense_Mutation_p.K164R|PRG4_ENST00000367486.3_Missense_Mutation_p.K162R|PRG4_ENST00000367483.4_Missense_Mutation_p.K164R|PRG4_ENST00000367485.4_Missense_Mutation_p.K112R	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	205					cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						GATAACAAGAAGAACAGAACT	0.343																																																	0													102.0	108.0	106.0					1																	186275465		2203	4300	6503	SO:0001583	missense	0			U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.614A>G	1.37:g.186275465A>G	ENSP00000399679:p.Lys205Arg		Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Missense_Mutation	SNP	pfam_Somatomedin_B_dom,pfam_Hemopexin-like_repeat,superfamily_Hemopexin-like_dom,smart_Somatomedin_B_dom,smart_Hemopexin-like_repeat,prints_Somatomedin_B_chordata,pfscan_Somatomedin_B_dom	p.K205R	ENST00000445192.2	37	c.614	CCDS1369.1	1	.	.	.	.	.	.	.	.	.	.	A	9.096	1.002966	0.19121	.	.	ENSG00000116690	ENST00000367486;ENST00000367484;ENST00000533951;ENST00000367482;ENST00000367483;ENST00000367485;ENST00000445192	T;T;T;T;T;T	0.52057	2.99;3.28;0.68;3.16;3.31;3.27	4.07	4.07	0.47477	.	0.146164	0.30762	U	0.008921	T	0.59183	0.2175	M	0.64997	1.995	0.20821	N	0.999844	D;D;D;D	0.76494	0.999;0.999;0.996;0.999	D;D;D;D	0.74023	0.982;0.982;0.914;0.982	T	0.49753	-0.8906	10	0.18710	T	0.47	-0.8643	9.7402	0.40413	1.0:0.0:0.0:0.0	.	71;112;205;164	Q92954-4;Q92954-3;Q92954;Q92954-2	.;.;PRG4_HUMAN;.	R	162;164;114;71;164;112;205	ENSP00000356456:K162R;ENSP00000356454:K164R;ENSP00000431330:K114R;ENSP00000356453:K164R;ENSP00000356455:K112R;ENSP00000399679:K205R	ENSP00000356452:K71R	K	+	2	0	PRG4	184542088	0.996000	0.38824	0.977000	0.42913	0.392000	0.30506	3.189000	0.50965	1.626000	0.50381	0.383000	0.25322	AAG	PRG4	-	NULL	ENSG00000116690		0.343	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRG4	HGNC	protein_coding	OTTHUMT00000086346.1	-	0.00	35	0	A	NM_005807		186275465	+1	tier1	-	no_errors	ENST00000445192	ensembl	human	known	74_37	missense	9.35	97	10	SNP	1.000	G
PROSER1	80209	genome.wustl.edu	37	13	39587523	39587523	+	Silent	SNP	T	T	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr13:39587523T>C	ENST00000352251.3	-	11	2699	c.1866A>G	c.(1864-1866)ccA>ccG	p.P622P	PROSER1_ENST00000350125.3_Silent_p.P600P|PROSER1_ENST00000484434.3_Intron	NM_025138.4	NP_079414.3	Q86XN7	PRSR1_HUMAN	proline and serine rich 1	622	Ser-rich.																CAGAATGAGATGGACCTTTGA	0.488																																																	0													152.0	159.0	156.0					13																	39587523		2203	4300	6503	SO:0001819	synonymous_variant	0			AK022723	CCDS9368.2	13q13.2	2011-08-09	2011-08-09	2011-08-09	ENSG00000120685	ENSG00000120685			20291	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 23"""	C13orf23			Standard	NM_025138		Approved	bA50D16.2, FLJ12661	uc001uwy.4	Q86XN7	OTTHUMG00000016764	ENST00000352251.3:c.1866A>G	13.37:g.39587523T>C			A6NJ97|Q6P2S2|Q7Z3X5|Q8N3D2|Q8N3P1|Q9H9M1	Silent	SNP	NULL	p.P622	ENST00000352251.3	37	c.1866	CCDS9368.2	13																																																																																			PROSER1	-	NULL	ENSG00000120685		0.488	PROSER1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PROSER1	HGNC	protein_coding	OTTHUMT00000044607.5	-	0.00	65	0	T	NM_025138		39587523	-1	tier1	-	no_errors	ENST00000352251	ensembl	human	known	74_37	silent	15.79	64	12	SNP	0.506	C
PTPN13	5783	genome.wustl.edu	37	4	87672182	87672182	+	Nonsense_Mutation	SNP	C	C	G			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr4:87672182C>G	ENST00000411767.2	+	19	3134	c.3071C>G	c.(3070-3072)tCa>tGa	p.S1024*	PTPN13_ENST00000427191.2_Nonsense_Mutation_p.S1024*|PTPN13_ENST00000316707.6_Intron|PTPN13_ENST00000436978.1_Nonsense_Mutation_p.S1024*|PTPN13_ENST00000511467.1_Nonsense_Mutation_p.S1024*			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	1024					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		CTCTTCAGTTCAAAGTCTGTT	0.368																																																	0													61.0	59.0	59.0					4																	87672182		1831	4070	5901	SO:0001587	stop_gained	0				CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.3071C>G	4.37:g.87672182C>G	ENSP00000407249:p.Ser1024*		B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Nonsense_Mutation	SNP	pirsf_Tyr_Pase_non-rcpt_typ-13,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_PDZ,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_FERM_central,superfamily_PDZ,superfamily_PAZ_dom,smart_KIND,smart_Band_41_domain,smart_PDZ,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam,pfscan_FERM_domain,pfscan_PDZ,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.S1024*	ENST00000411767.2	37	c.3071	CCDS47094.1	4	.	.	.	.	.	.	.	.	.	.	C	45	11.822618	0.99607	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000411767;ENST00000511467;ENST00000357349	.	.	.	6.01	6.01	0.97437	.	0.000000	0.42294	D	0.000738	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	20.5211	0.99222	0.0:1.0:0.0:0.0	.	.	.	.	X	1024;1024;1024;1024;992	.	ENSP00000349909:S992X	S	+	2	0	PTPN13	87891206	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	4.128000	0.57951	2.861000	0.98227	0.650000	0.86243	TCA	PTPN13	-	pirsf_Tyr_Pase_non-rcpt_typ-13	ENSG00000163629		0.368	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPN13	HGNC	protein_coding	OTTHUMT00000363191.1	-	0.00	41	0	C			87672182	+1	tier1	-	no_errors	ENST00000436978	ensembl	human	known	74_37	nonsense	23.53	26	8	SNP	1.000	G
PTPRS	5802	genome.wustl.edu	37	19	5238931	5238931	+	Splice_Site	DEL	G	G	-			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr19:5238931delG	ENST00000587303.1	-	12	1947	c.1848delC	c.(1846-1848)tcc>tc	p.S616fs	PTPRS_ENST00000592099.1_Splice_Site_p.S603fs|PTPRS_ENST00000348075.2_Splice_Site_p.S603fs|PTPRS_ENST00000353284.2_Splice_Site_p.S603fs|PTPRS_ENST00000357368.4_Splice_Site_p.S616fs|PTPRS_ENST00000588552.1_5'UTR|PTPRS_ENST00000262963.6_Splice_Site_p.S612fs|PTPRS_ENST00000372412.4_Splice_Site_p.S617fs|PTPRS_ENST00000588012.1_Splice_Site_p.S603fs			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S	616	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	GACACCTACTGGACTGCAGCG	0.736																																																	0													25.0	27.0	26.0					19																	5238931		2200	4277	6477	SO:0001630	splice_region_variant	0			U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.1849+1C>-	19.37:g.5238931delG			O75255|O75870|Q15718|Q16341|Q2M3R7	Frame_Shift_Del	DEL	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom	p.K618fs	ENST00000587303.1	37	c.1851	CCDS45930.1	19																																																																																			PTPRS	-	superfamily_Fibronectin_type3	ENSG00000105426		0.736	PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRS	HGNC	protein_coding	OTTHUMT00000450762.2		0.00	11	0	G		Frame_Shift_Del	5238931	-1	tier1		no_errors	ENST00000372412	ensembl	human	known	74_37	frame_shift_del	33.33	4	2	DEL	1.000	-
PTPRT	11122	genome.wustl.edu	37	20	40944500	40944500	+	Missense_Mutation	SNP	A	A	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr20:40944500A>C	ENST00000373187.1	-	12	2001	c.2002T>G	c.(2002-2004)Ttg>Gtg	p.L668V	PTPRT_ENST00000373190.1_Missense_Mutation_p.L668V|PTPRT_ENST00000373184.1_Missense_Mutation_p.L668V|PTPRT_ENST00000373193.3_Missense_Mutation_p.L668V|PTPRT_ENST00000373198.4_Missense_Mutation_p.L668V|PTPRT_ENST00000373201.1_Missense_Mutation_p.L668V|PTPRT_ENST00000356100.2_Missense_Mutation_p.L668V			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	668	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				GCAGGCTTCAACTCAGCAGCA	0.517																																																	0													129.0	129.0	129.0					20																	40944500		2011	4158	6169	SO:0001583	missense	0			AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.2002T>G	20.37:g.40944500A>C	ENSP00000362283:p.Leu668Val		A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.L668V	ENST00000373187.1	37	c.2002	CCDS42874.1	20	.	.	.	.	.	.	.	.	.	.	A	18.40	3.615477	0.66672	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	T;T;T;T;T;T;T	0.37915	1.17;1.17;1.17;1.19;1.23;1.18;1.18	5.57	-1.88	0.07713	.	0.000000	0.64402	D	0.000001	T	0.40347	0.1113	M	0.70595	2.14	0.47476	D	0.999434	P;P	0.41524	0.753;0.638	P;B	0.44811	0.461;0.175	T	0.48547	-0.9026	10	0.72032	D	0.01	.	12.7576	0.57345	0.4075:0.0:0.5925:0.0	.	668;668	O14522-1;O14522	.;PTPRT_HUMAN	V	668	ENSP00000362286:L668V;ENSP00000362283:L668V;ENSP00000362289:L668V;ENSP00000348408:L668V;ENSP00000362294:L668V;ENSP00000362280:L668V;ENSP00000362297:L668V	ENSP00000348408:L668V	L	-	1	2	PTPRT	40377914	0.033000	0.19621	0.401000	0.26359	0.994000	0.84299	0.049000	0.14099	-0.392000	0.07751	0.460000	0.39030	TTG	PTPRT	-	NULL	ENSG00000196090		0.517	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRT	HGNC	protein_coding	OTTHUMT00000080315.1	-	0.00	51	0	A			40944500	-1	tier1	-	no_errors	ENST00000373198	ensembl	human	known	74_37	missense	43.10	33	25	SNP	0.707	C
PTX4	390667	genome.wustl.edu	37	16	1537919	1537919	+	Missense_Mutation	SNP	T	T	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr16:1537919T>C	ENST00000447419.2	-	2	219	c.194A>G	c.(193-195)aAc>aGc	p.N65S	PTX4_ENST00000440447.2_Missense_Mutation_p.N65S|PTX4_ENST00000293922.1_Missense_Mutation_p.N60S			Q96A99	PTX4_HUMAN	pentraxin 4, long	65						extracellular region (GO:0005576)	metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17						CACGTTGTAGTTGCTGGCGAT	0.637																																																	0													105.0	103.0	103.0					16																	1537919		2179	4269	6448	SO:0001583	missense	0				CCDS32362.1	16p13.3	2011-01-06	2010-03-30	2010-03-30	ENSG00000251692	ENSG00000251692			14171	protein-coding gene	gene with protein product		613442	"""chromosome 16 open reading frame 38"""	C16orf38			Standard	NM_001013658		Approved		uc010uvf.2	Q96A99		ENST00000447419.2:c.194A>G	16.37:g.1537919T>C	ENSP00000445277:p.Asn65Ser			Missense_Mutation	SNP	pfam_Pentaxin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,prints_Pentaxin	p.N65S	ENST00000447419.2	37	c.194		16	.	.	.	.	.	.	.	.	.	.	T	8.027	0.760957	0.15914	.	.	ENSG00000251692	ENST00000447419;ENST00000293922	T;T	0.22539	1.97;1.95	5.41	1.77	0.24775	.	0.558331	0.17705	N	0.164783	T	0.16257	0.0391	L	0.52573	1.65	0.34065	D	0.657739	B	0.30851	0.297	B	0.31751	0.135	T	0.16247	-1.0409	10	0.33141	T	0.24	.	3.6886	0.08338	0.1601:0.178:0.0:0.6619	.	60	Q96A99-2	.	S	65;60	ENSP00000445277:N65S;ENSP00000293922:N60S	ENSP00000293922:N60S	N	-	2	0	PTX4	1477920	0.989000	0.36119	0.263000	0.24496	0.120000	0.20174	0.966000	0.29331	0.021000	0.15133	0.460000	0.39030	AAC	PTX4	-	NULL	ENSG00000251692		0.637	PTX4-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	PTX4	HGNC	protein_coding	OTTHUMT00000432526.1	-	0.00	47	0	T	NM_001013658		1537919	-1	tier1	-	no_errors	ENST00000447419	ensembl	human	known	74_37	missense	41.18	20	14	SNP	0.760	C
QTRT1	81890	genome.wustl.edu	37	19	10823277	10823277	+	Silent	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr19:10823277C>T	ENST00000250237.5	+	7	844	c.834C>T	c.(832-834)ttC>ttT	p.F278F		NM_031209.2	NP_112486.1	Q9BXR0	TGT_HUMAN	queuine tRNA-ribosyltransferase 1	278					queuosine biosynthetic process (GO:0008616)|tRNA modification (GO:0006400)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|queuine tRNA-ribosyltransferase activity (GO:0008479)			large_intestine(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	12			Epithelial(33;1.55e-05)|all cancers(31;3.42e-05)			GTGACATGTTCGACTGCGTCT	0.637																																																	0													136.0	126.0	129.0					19																	10823277		2203	4300	6503	SO:0001819	synonymous_variant	0			AF302783	CCDS12248.1	19p13.3	2014-06-11	2008-07-31		ENSG00000213339	ENSG00000213339	2.4.2.29		23797	protein-coding gene	gene with protein product	"""tRNA-guanine transglycosylase"""	609615				20354154	Standard	NM_031209		Approved	TGT	uc002mpr.3	Q9BXR0		ENST00000250237.5:c.834C>T	19.37:g.10823277C>T			B4DFM7|Q96BQ4|Q9BXQ9	Silent	SNP	pfam_tRNA_ribo_trans-like,superfamily_tRNA_ribo_trans-like,tigrfam_Queuine_tRNA-ribosylTrfase,tigrfam_tRNA_ribo_trans-like	p.F278	ENST00000250237.5	37	c.834	CCDS12248.1	19																																																																																			QTRT1	-	pfam_tRNA_ribo_trans-like,superfamily_tRNA_ribo_trans-like,tigrfam_Queuine_tRNA-ribosylTrfase,tigrfam_tRNA_ribo_trans-like	ENSG00000213339		0.637	QTRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QTRT1	HGNC	protein_coding	OTTHUMT00000452086.1	-	0.00	40	0	C	NM_031209		10823277	+1	tier1	-	no_errors	ENST00000250237	ensembl	human	known	74_37	silent	37.50	20	12	SNP	1.000	T
RABGAP1	23637	genome.wustl.edu	37	9	125752361	125752361	+	Silent	SNP	C	C	T	rs146982162		TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr9:125752361C>T	ENST00000373647.4	+	6	926	c.792C>T	c.(790-792)gcC>gcT	p.A264A		NM_012197.3	NP_036329.3	Q9Y3P9	RBGP1_HUMAN	RAB GTPase activating protein 1	264	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				cell cycle (GO:0007049)|positive regulation of GTPase activity (GO:0043547)|regulation of GTP catabolic process (GO:0033124)	centrosome (GO:0005813)|cytosol (GO:0005829)|microtubule associated complex (GO:0005875)	DNA binding (GO:0003677)|GTPase activator activity (GO:0005096)|Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)|tubulin binding (GO:0015631)			breast(3)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|prostate(4)|stomach(3)|upper_aerodigestive_tract(1)	41						ACAGTTTTGCCACTGCCTTCC	0.448													C|||	1	0.000199681	0.0	0.0	5008	,	,		17141	0.001		0.0	False		,,,				2504	0.0																0													114.0	109.0	111.0					9																	125752361		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ011679	CCDS6848.2	9q34.11	2013-07-09			ENSG00000011454	ENSG00000011454			17155	protein-coding gene	gene with protein product	"""rab6 GTPase activating protein (GAP and centrosome-associated)"", ""TBC1 domain family, member 11"""	615882				10202141	Standard	NM_012197		Approved	GAPCenA, TBC1D11	uc011lzh.2	Q9Y3P9	OTTHUMG00000020633	ENST00000373647.4:c.792C>T	9.37:g.125752361C>T			B9A6L2|Q05CW2|Q6ZMY1|Q9HA28|Q9P0E2|Q9UG67	Silent	SNP	pfam_Rab-GTPase-TBC_dom,pfam_Kinesin-like,pfam_PTB/PI_dom,superfamily_Rab-GTPase-TBC_dom,smart_PTB/PI_dom,smart_Rab-GTPase-TBC_dom,pfscan_PTB/PI_dom,pfscan_Rab-GTPase-TBC_dom	p.A264	ENST00000373647.4	37	c.792	CCDS6848.2	9																																																																																			RABGAP1	-	pfam_PTB/PI_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom	ENSG00000011454		0.448	RABGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABGAP1	HGNC	protein_coding	OTTHUMT00000053976.3		0.00	41	0	C	NM_012197		125752361	+1			no_errors	ENST00000373647	ensembl	human	known	74_37	silent	8.57	32	3	SNP	1.000	T
RELN	5649	genome.wustl.edu	37	7	103243923	103243923	+	Missense_Mutation	SNP	T	T	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr7:103243923T>C	ENST00000428762.1	-	24	3320	c.3161A>G	c.(3160-3162)tAc>tGc	p.Y1054C	RELN_ENST00000424685.2_Missense_Mutation_p.Y1054C|RELN_ENST00000343529.5_Missense_Mutation_p.Y1054C	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	1054	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		AGTGCCTTGGTACCCCTGGTC	0.522																																					NSCLC(146;835 1944 15585 22231 52158)												0													77.0	74.0	75.0					7																	103243923		2203	4300	6503	SO:0001583	missense	0				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.3161A>G	7.37:g.103243923T>C	ENSP00000392423:p.Tyr1054Cys		A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	pfam_EGF_extracell,pfam_Reeler_dom,pfam_BNR_rpt,superfamily_Sialidases,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Reeler_dom	p.Y1054C	ENST00000428762.1	37	c.3161	CCDS47680.1	7	.	.	.	.	.	.	.	.	.	.	T	17.64	3.440894	0.63067	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.44482	0.92;0.92;0.92	5.45	4.22	0.49857	EGF, extracellular (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.062933	0.64402	D	0.000007	T	0.66519	0.2797	H	0.95260	3.645	0.39455	D	0.967474	D;D	0.56287	0.975;0.975	P;P	0.55345	0.774;0.594	T	0.77368	-0.2614	10	0.72032	D	0.01	.	10.7171	0.46019	0.2176:0.0:0.0:0.7824	.	1054;1054	P78509-2;P78509	.;RELN_HUMAN	C	1054	ENSP00000392423:Y1054C;ENSP00000345694:Y1054C;ENSP00000388446:Y1054C	ENSP00000345694:Y1054C	Y	-	2	0	RELN	103031159	1.000000	0.71417	0.973000	0.42090	0.958000	0.62258	2.519000	0.45546	2.064000	0.61679	0.533000	0.62120	TAC	RELN	-	pfam_EGF_extracell,superfamily_Growth_fac_rcpt_N_dom,superfamily_Sialidases,smart_EG-like_dom	ENSG00000189056		0.522	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	HGNC	protein_coding	OTTHUMT00000348148.1	-	0.00	43	0	T	NM_005045		103243923	-1	tier1	-	no_errors	ENST00000424685	ensembl	human	known	74_37	missense	26.53	36	13	SNP	0.998	C
RGS12	6002	genome.wustl.edu	37	4	3319104	3319104	+	Missense_Mutation	SNP	C	C	G			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr4:3319104C>G	ENST00000344733.5	+	2	2111	c.1207C>G	c.(1207-1209)Cgc>Ggc	p.R403G	RGS12_ENST00000336727.3_Missense_Mutation_p.R403G|RGS12_ENST00000543385.1_Missense_Mutation_p.R403G|RGS12_ENST00000382788.3_Missense_Mutation_p.R403G	NM_198229.2	NP_937872.1	O14924	RGS12_HUMAN	regulator of G-protein signaling 12	403					positive regulation of GTPase activity (GO:0043547)|regulation of catalytic activity (GO:0050790)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|GTPase regulator activity (GO:0030695)|receptor signaling protein activity (GO:0005057)			autonomic_ganglia(1)|breast(4)|endometrium(3)|kidney(2)|large_intestine(9)|lung(16)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CATGCGGGCCCGCGCCTTTCT	0.607																																																	0													60.0	63.0	62.0					4																	3319104		2203	4300	6503	SO:0001583	missense	0			AF035152	CCDS3366.1, CCDS3367.1, CCDS3368.1	4p16.3	2008-02-05	2007-08-14		ENSG00000159788	ENSG00000159788		"""Regulators of G-protein signaling"""	9994	protein-coding gene	gene with protein product		602512	"""regulator of G-protein signalling 12"""			9651375	Standard	NM_198229		Approved		uc003ggw.3	O14924	OTTHUMG00000090277	ENST00000344733.5:c.1207C>G	4.37:g.3319104C>G	ENSP00000339381:p.Arg403Gly		B1AQ30|B1AQ31|B1AQ32|B7Z764|E7EMN9|O14922|O14923|O43510|O75338|Q147X0|Q8WX95	Missense_Mutation	SNP	pfam_Raf-like_ras-bd,pfam_RGS_dom,pfam_PDZ,pfam_GoLoco_motif,superfamily_Regulat_G_prot_signal_superfam,superfamily_PDZ,smart_PDZ,smart_PTB/PI_dom,smart_Regulat_G_prot_signal_superfam,smart_Raf-like_ras-bd,smart_GoLoco_motif,pfscan_GoLoco_motif,pfscan_PDZ,pfscan_PTB/PI_dom,pfscan_Raf-like_ras-bd,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.R403G	ENST00000344733.5	37	c.1207	CCDS3366.1	4	.	.	.	.	.	.	.	.	.	.	C	17.50	3.404738	0.62288	.	.	ENSG00000159788	ENST00000543385;ENST00000344733;ENST00000336727;ENST00000382788	T;T;T;T	0.35048	1.33;1.44;1.44;1.44	4.73	4.73	0.59995	.	0.000000	0.85682	D	0.000000	T	0.52468	0.1736	M	0.62154	1.92	0.80722	D	1	P;D;D	0.67145	0.938;0.989;0.996	P;P;D	0.64877	0.676;0.754;0.93	T	0.55392	-0.8148	10	0.72032	D	0.01	-30.6435	10.7841	0.46395	0.3072:0.6928:0.0:0.0	.	403;403;403	Q8WX97;O14924;O14924-4	.;RGS12_HUMAN;.	G	403	ENSP00000440566:R403G;ENSP00000339381:R403G;ENSP00000338509:R403G;ENSP00000372238:R403G	ENSP00000338509:R403G	R	+	1	0	RGS12	3288902	0.999000	0.42202	1.000000	0.80357	0.968000	0.65278	2.970000	0.49240	2.171000	0.68590	0.491000	0.48974	CGC	RGS12	-	NULL	ENSG00000159788		0.607	RGS12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RGS12	HGNC	protein_coding	OTTHUMT00000206602.1		0.00	33	0	C	NM_002926		3319104	+1			no_errors	ENST00000344733	ensembl	human	known	74_37	missense	9.09	40	4	SNP	1.000	G
RP1	6101	genome.wustl.edu	37	8	55533956	55533956	+	Missense_Mutation	SNP	G	G	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr8:55533956G>T	ENST00000220676.1	+	2	578	c.430G>T	c.(430-432)Gtc>Ttc	p.V144F		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	144					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			CCCCGTAGCCGTCGCTGCTCC	0.697																																					Colon(91;1014 1389 7634 14542 40420)												0													32.0	37.0	36.0					8																	55533956		2202	4299	6501	SO:0001583	missense	0			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.430G>T	8.37:g.55533956G>T	ENSP00000220676:p.Val144Phe			Missense_Mutation	SNP	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.V144F	ENST00000220676.1	37	c.430	CCDS6160.1	8	.	.	.	.	.	.	.	.	.	.	G	12.70	2.017402	0.35606	.	.	ENSG00000104237	ENST00000220676	T	0.21932	1.98	4.67	2.86	0.33363	.	1.717000	0.03092	N	0.159907	T	0.08313	0.0207	N	0.02539	-0.55	0.09310	N	1	P	0.36438	0.553	B	0.28465	0.09	T	0.23119	-1.0197	10	0.21540	T	0.41	2.7566	6.5289	0.22316	0.1034:0.2002:0.6964:0.0	.	144	P56715	RP1_HUMAN	F	144	ENSP00000220676:V144F	ENSP00000220676:V144F	V	+	1	0	RP1	55696509	0.000000	0.05858	0.002000	0.10522	0.023000	0.10783	-0.306000	0.08178	0.522000	0.28464	0.650000	0.86243	GTC	RP1	-	NULL	ENSG00000104237		0.697	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1	HGNC	protein_coding	OTTHUMT00000378532.2		0.00	26	0	G	NM_006269		55533956	+1			no_errors	ENST00000220676	ensembl	human	known	74_37	missense	7.89	34	3	SNP	0.008	T
RIMS2	9699	genome.wustl.edu	37	8	105257145	105257145	+	Splice_Site	SNP	A	A	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr8:105257145A>C	ENST00000436393.2	+	24	3631	c.3390A>C	c.(3388-3390)gaA>gaC	p.E1130D	RIMS2_ENST00000262231.10_Splice_Site_p.K951N|RIMS2_ENST00000406091.3_Splice_Site_p.K1112N|RIMS2_ENST00000339750.2_Splice_Site_p.E48D|RIMS2_ENST00000507740.1_Splice_Site_p.K926N			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1174					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TCTCTGCAGAAGCAGGAGGTA	0.443										HNSCC(12;0.0054)																																							0													106.0	107.0	107.0					8																	105257145		1861	4107	5968	SO:0001630	splice_region_variant	0			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.3389-1A>C	8.37:g.105257145A>C			B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ,pfscan_Znf_FYVE-typ,pfscan_Znf_FYVE-rel	p.K1112N	ENST00000436393.2	37	c.3336		8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.86|12.86	2.063117|2.063117	0.36373|0.36373	.|.	.|.	ENSG00000176406|ENSG00000176406	ENST00000408894;ENST00000436393;ENST00000523362;ENST00000339750|ENST00000329869;ENST00000406091;ENST00000402998;ENST00000262231;ENST00000507740	T;T;T;T|T;T;T	0.19532|0.15834	2.14;2.64;2.19;2.17|2.7;2.39;2.39	5.05|5.05	1.46|1.46	0.22682|0.22682	.|.	.|.	.|.	.|.	.|.	T|T	0.16685|0.16685	0.0401|0.0401	N|N	0.04508|0.04508	-0.205|-0.205	0.45108|0.45108	D|D	0.998125|0.998125	D|B;B;D	0.58620|0.61080	0.983|0.002;0.001;0.989	P|B;B;D	0.52758|0.72625	0.708|0.004;0.001;0.978	T|T	0.08659|0.08659	-1.0711|-1.0711	9|9	0.26408|0.44086	T|T	0.33|0.13	.|.	9.0632|9.0632	0.36447|0.36447	0.7079:0.0:0.2921:0.0|0.7079:0.0:0.2921:0.0	.|.	1130|951;926;1112	D6RA03|Q9UQ26-1;Q9UQ26-3;F8WD47	.|.;.;.	D|N	1119;1130;48;48|1149;1112;1174;951;926	ENSP00000386228:E1119D;ENSP00000390665:E1130D;ENSP00000428478:E48D;ENSP00000342051:E48D|ENSP00000384892:K1112N;ENSP00000262231:K951N;ENSP00000423559:K926N	ENSP00000342051:E48D|ENSP00000262231:K951N	E|K	+|+	3|3	2|2	RIMS2|RIMS2	105326321|105326321	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.994000|0.994000	0.84299|0.84299	3.242000|3.242000	0.51384|0.51384	0.106000|0.106000	0.17784|0.17784	0.528000|0.528000	0.53228|0.53228	GAA|AAA	RIMS2	-	NULL	ENSG00000176406		0.443	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	RIMS2	HGNC	protein_coding	OTTHUMT00000367217.1		0.00	18	0	A	NM_001100117	Missense_Mutation	105257145	+1			no_errors	ENST00000406091	ensembl	human	known	74_37	missense	9.52	19	2	SNP	1.000	C
RSPH6A	81492	genome.wustl.edu	37	19	46305522	46305522	+	Splice_Site	SNP	C	C	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr19:46305522C>A	ENST00000221538.3	-	4	1796	c.1654G>T	c.(1654-1656)Ggc>Tgc	p.G552C	RSPH6A_ENST00000597055.1_Splice_Site_p.G552C|RSPH6A_ENST00000600188.1_Splice_Site_p.G288C	NM_030785.3	NP_110412.1	Q9H0K4	RSH6A_HUMAN	radial spoke head 6 homolog A (Chlamydomonas)	552	Glu-rich.					intracellular (GO:0005622)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	32						GTGCAGCGGCCCTGGGGGTGG	0.642																																																	0													36.0	25.0	29.0					19																	46305522		2201	4293	6494	SO:0001630	splice_region_variant	0			AL136761	CCDS12675.1	19q13.3	2010-02-17	2009-11-18	2009-11-18	ENSG00000104941	ENSG00000104941			14241	protein-coding gene	gene with protein product		607548	"""radial spokehead-like 1"""	RSHL1		11237735	Standard	NM_030785		Approved	RSP4, RSP6, RSPH4B	uc002pdm.3	Q9H0K4		ENST00000221538.3:c.1654-1G>T	19.37:g.46305522C>A			Q53FE2|Q6PEZ9	Missense_Mutation	SNP	pfam_Radial_spoke	p.G552C	ENST00000221538.3	37	c.1654	CCDS12675.1	19	.	.	.	.	.	.	.	.	.	.	C	21.4	4.150022	0.78001	.	.	ENSG00000104941	ENST00000221538	T	0.72051	-0.62	4.27	4.27	0.50696	.	0.000000	0.85682	D	0.000000	D	0.86443	0.5934	M	0.92169	3.28	0.52099	D	0.999947	D	0.89917	1.0	D	0.97110	1.0	D	0.88794	0.3280	10	0.87932	D	0	7.5978	12.542	0.56177	0.0:1.0:0.0:0.0	.	552	Q9H0K4	RSH6A_HUMAN	C	552	ENSP00000221538:G552C	ENSP00000221538:G552C	G	-	1	0	RSPH6A	50997362	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	6.052000	0.71080	2.678000	0.91216	0.456000	0.33151	GGC	RSPH6A	-	pfam_Radial_spoke	ENSG00000104941		0.642	RSPH6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPH6A	HGNC	protein_coding	OTTHUMT00000461657.1		0.00	30	0	C		Missense_Mutation	46305522	-1			no_errors	ENST00000221538	ensembl	human	known	74_37	missense	18.18	18	4	SNP	1.000	A
SACS	26278	genome.wustl.edu	37	13	23910865	23910865	+	Missense_Mutation	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr13:23910865C>T	ENST00000382292.3	-	9	7423	c.7150G>A	c.(7150-7152)Gaa>Aaa	p.E2384K	SACS_ENST00000402364.1_Missense_Mutation_p.E1634K|SACS_ENST00000382298.3_Missense_Mutation_p.E2384K			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	2384					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		TCAAAAAGTTCGCGGAAATTA	0.358																																																	0													34.0	36.0	35.0					13																	23910865		2203	4299	6502	SO:0001583	missense	0			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.7150G>A	13.37:g.23910865C>T	ENSP00000371729:p.Glu2384Lys		O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	pfam_HEPN,pfam_Ubiquitin_dom,superfamily_HATPase_ATP-bd,superfamily_DnaJ_domain,smart_HEPN,pfscan_HEPN,pfscan_DnaJ_domain,pfscan_Ubiquitin_supergroup	p.E2384K	ENST00000382292.3	37	c.7150	CCDS9300.2	13	.	.	.	.	.	.	.	.	.	.	C	14.61	2.586799	0.46110	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.93953	-3.32;-3.32;-3.32	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	D	0.91030	0.7178	M	0.63428	1.95	0.51012	D	0.999902	P	0.35401	0.499	B	0.29524	0.103	D	0.88923	0.3367	10	0.11794	T	0.64	.	20.1379	0.98040	0.0:1.0:0.0:0.0	.	2384	Q9NZJ4	SACS_HUMAN	K	2384;1634;2384	ENSP00000371729:E2384K;ENSP00000385844:E1634K;ENSP00000371735:E2384K	ENSP00000371729:E2384K	E	-	1	0	SACS	22808865	1.000000	0.71417	0.997000	0.53966	0.009000	0.06853	7.487000	0.81328	2.779000	0.95612	0.655000	0.94253	GAA	SACS	-	NULL	ENSG00000151835		0.358	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SACS	HGNC	protein_coding	OTTHUMT00000044148.3		0.00	37	0	C	NM_014363		23910865	-1			no_errors	ENST00000382292	ensembl	human	known	74_37	missense	6.98	40	3	SNP	1.000	T
SARS	6301	genome.wustl.edu	37	1	109773544	109773544	+	Silent	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr1:109773544C>T	ENST00000234677.2	+	5	567	c.492C>T	c.(490-492)gtC>gtT	p.V164V	SARS_ENST00000369923.4_Silent_p.V164V	NM_006513.3	NP_006504.2	P49591	SYSC_HUMAN	seryl-tRNA synthetase	164					gene expression (GO:0010467)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)|seryl-tRNA aminoacylation (GO:0006434)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)|tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|RNA binding (GO:0003723)|serine-tRNA ligase activity (GO:0004828)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	17		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0301)|Lung(183;0.0677)|COAD - Colon adenocarcinoma(174;0.116)|Epithelial(280;0.233)	L-Serine(DB00133)	ATTGTACAGTCAGGAAGAAGT	0.448																																																	0													168.0	163.0	165.0					1																	109773544		2203	4300	6503	SO:0001819	synonymous_variant	0			BC009390	CCDS795.1	1p13.3	2011-07-01			ENSG00000031698	ENSG00000031698	6.1.1.11	"""Aminoacyl tRNA synthetases / Class II"""	10537	protein-coding gene	gene with protein product	"""serine tRNA ligase 1, cytoplasmic"""	607529				9431993	Standard	NM_006513		Approved	SERS	uc001dwu.2	P49591	OTTHUMG00000011726	ENST00000234677.2:c.492C>T	1.37:g.109773544C>T			B2R6Y9|Q5T5C8|Q9NSE3	Silent	SNP	pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Ser-tRNA-synth_1_N,superfamily_tRNA-bd_arm,pirsf_Ser-tRNA-ligase_type_1,pfscan_aa-tRNA-synth_II,prints_Ser-tRNA-ligase_type_1,tigrfam_Ser-tRNA-ligase_type_1	p.V164	ENST00000234677.2	37	c.492	CCDS795.1	1																																																																																			SARS	-	pirsf_Ser-tRNA-ligase_type_1,tigrfam_Ser-tRNA-ligase_type_1	ENSG00000031698		0.448	SARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SARS	HGNC	protein_coding	OTTHUMT00000032394.2	-	0.00	96	0	C	NM_006513		109773544	+1	tier1	-	no_errors	ENST00000369923	ensembl	human	known	74_37	silent	16.67	80	16	SNP	0.996	T
SATB2	23314	genome.wustl.edu	37	2	200245168	200245168	+	Missense_Mutation	SNP	A	A	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr2:200245168A>C	ENST00000417098.1	-	5	1332	c.516T>G	c.(514-516)caT>caG	p.H172Q	SATB2_ENST00000428695.1_Intron|SATB2_ENST00000260926.5_Missense_Mutation_p.H172Q|SATB2_ENST00000443023.1_Missense_Mutation_p.H113Q|SATB2_ENST00000484124.1_5'UTR|SATB2_ENST00000457245.1_Missense_Mutation_p.H172Q	NM_001172509.1	NP_001165980.1	Q9UPW6	SATB2_HUMAN	SATB homeobox 2	172					cartilage development (GO:0051216)|cellular response to organic substance (GO:0071310)|chromatin remodeling (GO:0006338)|embryonic pattern specification (GO:0009880)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|osteoblast development (GO:0002076)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(40)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						GGACTGTGGCATGGTTCCACT	0.483																																					Colon(30;262 767 11040 24421 36230)												0													131.0	110.0	117.0					2																	200245168		2203	4300	6503	SO:0001583	missense	0			AB028957	CCDS2327.1	2q33.1	2011-06-20	2007-02-15		ENSG00000119042	ENSG00000119042		"""Homeoboxes / CUT class"""	21637	protein-coding gene	gene with protein product		608148	"""SATB family member 2"""				Standard	NM_015265		Approved	KIAA1034, FLJ21474	uc002uva.2	Q9UPW6	OTTHUMG00000132767	ENST00000417098.1:c.516T>G	2.37:g.200245168A>C	ENSP00000401112:p.His172Gln		A8K5Z8|Q3ZB87|Q4V763	Missense_Mutation	SNP	pfam_Hmoeo_CUT,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Hmoeo_CUT	p.H172Q	ENST00000417098.1	37	c.516	CCDS2327.1	2	.	.	.	.	.	.	.	.	.	.	A	22.4	4.286993	0.80803	.	.	ENSG00000119042	ENST00000417098;ENST00000443023;ENST00000260926;ENST00000457245	T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05	5.67	-6.35	0.01975	.	0.000000	0.85682	D	0.000000	T	0.79149	0.4397	L	0.53249	1.67	0.39871	D	0.973504	D	0.59357	0.985	P	0.61477	0.889	T	0.80400	-0.1398	10	0.35671	T	0.21	-19.3835	14.8619	0.70387	0.4635:0.0:0.5365:0.0	.	172	Q9UPW6	SATB2_HUMAN	Q	172;113;172;172	ENSP00000401112:H172Q;ENSP00000388764:H113Q;ENSP00000260926:H172Q;ENSP00000405420:H172Q	ENSP00000260926:H172Q	H	-	3	2	SATB2	199953413	0.016000	0.18221	0.902000	0.35471	0.989000	0.77384	-0.615000	0.05597	-1.218000	0.02601	-0.464000	0.05259	CAT	SATB2	-	superfamily_Lambda_DNA-bd_dom	ENSG00000119042		0.483	SATB2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SATB2	HGNC	protein_coding	OTTHUMT00000256140.1	-	0.00	61	0	A	NM_015265		200245168	-1	tier1	-	no_errors	ENST00000260926	ensembl	human	known	74_37	missense	55.67	43	54	SNP	0.929	C
SBF1	6305	genome.wustl.edu	37	22	50893823	50893823	+	Nonsense_Mutation	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr22:50893823G>A	ENST00000390679.3	-	32	4490	c.4306C>T	c.(4306-4308)Cag>Tag	p.Q1436*	SBF1_ENST00000476293.1_5'Flank|SBF1_ENST00000348911.6_Nonsense_Mutation_p.Q1437*|SBF1_ENST00000380817.3_Nonsense_Mutation_p.Q1462*			O95248	MTMR5_HUMAN	SET binding factor 1	1436	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				cell death (GO:0008219)|positive regulation of Rab GTPase activity (GO:0032851)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(8)|large_intestine(3)|lung(18)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	43		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)		GAGAGCAGCTGCACCAAGGAT	0.672																																																	0													32.0	42.0	39.0					22																	50893823		2199	4288	6487	SO:0001587	stop_gained	0			U93181	CCDS14091.1, CCDS14091.2	22q13.33	2013-01-10			ENSG00000100241	ENSG00000100241		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	10542	protein-coding gene	gene with protein product	"""myotubularin related 5"", ""DENN/MADD domain containing 7A"""	603560				9537414, 9736772	Standard	NM_002972		Approved	MTMR5, DENND7A	uc003blh.3	O95248	OTTHUMG00000150204	ENST00000390679.3:c.4306C>T	22.37:g.50893823G>A	ENSP00000375097:p.Gln1436*		A6PVG9|O60228|Q5JXD8|Q5PPM2|Q96GR9|Q9UGB8	Nonsense_Mutation	SNP	pfam_SBF2,pfam_DENN_dom,pfam_uDENN_dom,pfam_Myotubularin-like_Pase_dom,pfam_dDENN_dom,pfam_GRAM,pfam_Pleckstrin_homology,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,smart_GRAM,smart_Pleckstrin_homology,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom,pfscan_Pleckstrin_homology	p.Q1462*	ENST00000390679.3	37	c.4384		22	.	.	.	.	.	.	.	.	.	.	G	47	13.070636	0.99717	.	.	ENSG00000100241	ENST00000380817;ENST00000348911;ENST00000337034;ENST00000390679	.	.	.	4.12	4.12	0.48240	.	0.130014	0.53938	D	0.000055	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	16.5077	0.84277	0.0:0.0:1.0:0.0	.	.	.	.	X	1462;1437;1472;1436	.	ENSP00000336522:Q1472X	Q	-	1	0	SBF1	49240689	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	9.364000	0.97136	2.294000	0.77228	0.563000	0.77884	CAG	SBF1	-	NULL	ENSG00000100241		0.672	SBF1-201	KNOWN	basic	protein_coding	SBF1	HGNC	protein_coding			0.00	88	0	G			50893823	-1			no_errors	ENST00000380817	ensembl	human	known	74_37	nonsense	6.35	59	4	SNP	1.000	A
SCGB1A1	7356	genome.wustl.edu	37	11	62190554	62190554	+	Silent	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr11:62190554G>A	ENST00000278282.2	+	3	328	c.267G>A	c.(265-267)ctG>ctA	p.L89L	SCGB1A1_ENST00000534397.1_Silent_p.L54L|CTD-2531D15.4_ENST00000528983.1_RNA	NM_003357.4	NP_003348.1	P11684	UTER_HUMAN	secretoglobin, family 1A, member 1 (uteroglobin)	89					embryo implantation (GO:0007566)|female pregnancy (GO:0007565)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-13 production (GO:0032696)|negative regulation of interleukin-4 production (GO:0032713)|negative regulation of interleukin-5 production (GO:0032714)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of inflammatory response (GO:0050727)|regulation of mRNA stability (GO:0043488)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to fibroblast growth factor (GO:0071774)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to silicon dioxide (GO:0034021)|response to xenobiotic stimulus (GO:0009410)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nuclear envelope (GO:0005635)|rough endoplasmic reticulum (GO:0005791)|secretory granule (GO:0030141)	phospholipase A2 inhibitor activity (GO:0019834)			lung(1)	1						AAAGCTCACTGTGTAATTAGC	0.438																																																	0													162.0	160.0	161.0					11																	62190554		2202	4299	6501	SO:0001819	synonymous_variant	0				CCDS8020.1	11q12.3	2011-12-14	2002-03-22	2002-03-22	ENSG00000149021	ENSG00000149021		"""Secretoglobins"""	12523	protein-coding gene	gene with protein product	"""Uteroglobin (Clara-cell specific 10-kD protein)"""	192020	"""uteroglobin"""	UGB		1284526, 22155607	Standard	NM_003357		Approved	CC10, CCSP, CC16	uc001ntj.3	P11684	OTTHUMG00000167526	ENST00000278282.2:c.267G>A	11.37:g.62190554G>A			B2R5F2|Q6FHH3|Q9UCM2|Q9UCM4	Silent	SNP	pfam_Secretoglobin,superfamily_Secretoglobin,smart_Secretoglobin,prints_Uteroglobin	p.L89	ENST00000278282.2	37	c.267	CCDS8020.1	11																																																																																			SCGB1A1	-	pfam_Secretoglobin,superfamily_Secretoglobin,smart_Secretoglobin,prints_Uteroglobin	ENSG00000149021		0.438	SCGB1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCGB1A1	HGNC	protein_coding	OTTHUMT00000394925.1		0.00	60	0	G	NM_003357		62190554	+1			no_errors	ENST00000278282	ensembl	human	known	74_37	silent	8.57	32	3	SNP	0.264	A
SCN9A	6335	genome.wustl.edu	37	2	167089906	167089906	+	Missense_Mutation	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr2:167089906G>A	ENST00000409435.1	-	20	3867	c.3868C>T	c.(3868-3870)Cgg>Tgg	p.R1290W	SCN9A_ENST00000375387.4_Missense_Mutation_p.R1291W|SCN9A_ENST00000303354.6_Missense_Mutation_p.R1291W|AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000409672.1_Missense_Mutation_p.R1279W			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	1290					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CTCAGTGTCCGAAGGGATTTA	0.338																																																	0													48.0	48.0	48.0					2																	167089906		1911	4176	6087	SO:0001583	missense	0			X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.3868C>T	2.37:g.167089906G>A	ENSP00000386330:p.Arg1290Trp		A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2	p.R1291W	ENST00000409435.1	37	c.3871	CCDS46441.1	2	.	.	.	.	.	.	.	.	.	.	G	22.9	4.345477	0.82022	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435	D;D;D;D	0.98633	-5.04;-5.04;-5.04;-5.04	5.83	5.83	0.93111	.	0.000000	0.64402	D	0.000019	D	0.99645	0.9869	H	0.99966	5.095	0.58432	D	0.999996	D	0.89917	1.0	D	0.97110	1.0	D	0.97205	0.9867	10	0.87932	D	0	.	14.9028	0.70692	0.0:0.0:0.8568:0.1432	.	1279	E7EUN6	.	W	1279;1291;1291;1290	ENSP00000386306:R1279W;ENSP00000364536:R1291W;ENSP00000304748:R1291W;ENSP00000386330:R1290W	ENSP00000304748:R1291W	R	-	1	2	SCN9A	166798152	0.975000	0.34042	1.000000	0.80357	0.988000	0.76386	1.420000	0.34804	2.759000	0.94783	0.650000	0.86243	CGG	SCN9A	-	pfam_Ion_trans_dom	ENSG00000169432		0.338	SCN9A-004	KNOWN	basic|CCDS	protein_coding	SCN9A	HGNC	protein_coding	OTTHUMT00000333639.1	-	0.00	75	0	G	NM_002977		167089906	-1	tier1	-	no_errors	ENST00000303354	ensembl	human	known	74_37	missense	14.81	68	12	SNP	0.996	A
SEMA3G	56920	genome.wustl.edu	37	3	52478966	52478966	+	Frame_Shift_Del	DEL	G	G	-			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr3:52478966delG	ENST00000231721.2	-	1	77	c.78delC	c.(76-78)cccfs	p.P26fs		NM_020163.1	NP_064548.1	Q9NS98	SEM3G_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G	26					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	receptor activity (GO:0004872)			kidney(1)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)	18				BRCA - Breast invasive adenocarcinoma(193;1.69e-05)|Kidney(197;0.00173)|KIRC - Kidney renal clear cell carcinoma(197;0.00196)|OV - Ovarian serous cystadenocarcinoma(275;0.0333)		CACTGGGGCCGGGGCTGGGGC	0.677																																																	0													9.0	14.0	12.0					3																	52478966		1929	3837	5766	SO:0001589	frameshift_variant	0				CCDS2856.1	3p21.1	2013-01-11			ENSG00000010319	ENSG00000010319		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30400	protein-coding gene	gene with protein product						11214971	Standard	XM_005265327		Approved	FLJ00014, sem2	uc003dea.1	Q9NS98	OTTHUMG00000158570	ENST00000231721.2:c.78delC	3.37:g.52478966delG	ENSP00000231721:p.Pro26fs		Q7L9D9|Q9H7Q3	Frame_Shift_Del	DEL	pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,pfscan_Semap_dom,pfscan_Ig-like_dom	p.G27fs	ENST00000231721.2	37	c.78	CCDS2856.1	3																																																																																			SEMA3G	-	NULL	ENSG00000010319		0.677	SEMA3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3G	HGNC	protein_coding	OTTHUMT00000351354.1		0.00	20	0	G	NM_020163		52478966	-1	tier1		no_errors	ENST00000231721	ensembl	human	known	74_37	frame_shift_del	7.69	24	2	DEL	0.000	-
SH2D3C	10044	genome.wustl.edu	37	9	130501134	130501134	+	Missense_Mutation	SNP	C	C	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr9:130501134C>A	ENST00000314830.8	-	12	2587	c.2474G>T	c.(2473-2475)gGc>gTc	p.G825V	SH2D3C_ENST00000373276.3_Missense_Mutation_p.G757V|SH2D3C_ENST00000420366.1_Missense_Mutation_p.G667V|SH2D3C_ENST00000373274.3_Missense_Mutation_p.G665V|SH2D3C_ENST00000373277.4_Missense_Mutation_p.G668V|SH2D3C_ENST00000429553.1_Missense_Mutation_p.G471V	NM_170600.2	NP_733745.1	Q8N5H7	SH2D3_HUMAN	SH2 domain containing 3C	825	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				JNK cascade (GO:0007254)|positive regulation of signal transduction (GO:0009967)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						ACCCTGACTGCCCCAGAGAAG	0.652																																																	0													47.0	40.0	42.0					9																	130501134		2199	4298	6497	SO:0001583	missense	0			AF124251	CCDS6877.1, CCDS6878.1, CCDS48026.1, CCDS48028.1, CCDS59145.1	9q33.1-q33.3	2013-02-14	2002-01-14		ENSG00000095370	ENSG00000095370		"""SH2 domain containing"""	16884	protein-coding gene	gene with protein product		604722	"""SH2 domain-containing 3C"""			10187783	Standard	NM_170600		Approved	NSP3	uc004bsc.3	Q8N5H7	OTTHUMG00000020717	ENST00000314830.8:c.2474G>T	9.37:g.130501134C>A	ENSP00000317817:p.Gly825Val		A8K5S8|E9PG48|Q5HYE5|Q5JU31|Q6UY42|Q8N6X3|Q9Y2X5	Missense_Mutation	SNP	pfam_SH2,pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_SH2,smart_RasGRF_CDC25,pfscan_SH2,pfscan_RasGRF_CDC25	p.G825V	ENST00000314830.8	37	c.2474	CCDS6877.1	9	.	.	.	.	.	.	.	.	.	.	C	28.9	4.957371	0.92726	.	.	ENSG00000095370	ENST00000373277;ENST00000420366;ENST00000373276;ENST00000373274;ENST00000429553;ENST00000314830	T;T;T;T;T;T	0.61274	0.97;0.98;0.57;1.03;0.12;0.7	5.76	5.76	0.90799	Guanine-nucleotide dissociation stimulator CDC25 (2);	0.043285	0.85682	D	0.000000	T	0.80031	0.4549	M	0.85777	2.775	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	T	0.82428	-0.0462	10	0.87932	D	0	-21.3276	18.9497	0.92637	0.0:1.0:0.0:0.0	.	665;825;757;668;667	E9PG48;Q8N5H7;E7EUN5;Q8N5H7-2;Q8N5H7-5	.;SH2D3_HUMAN;.;.;.	V	668;667;757;665;471;825	ENSP00000362374:G668V;ENSP00000388536:G667V;ENSP00000362373:G757V;ENSP00000362371:G665V;ENSP00000394632:G471V;ENSP00000317817:G825V	ENSP00000317817:G825V	G	-	2	0	SH2D3C	129540955	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.773000	0.85462	2.713000	0.92767	0.655000	0.94253	GGC	SH2D3C	-	smart_RasGRF_CDC25,pfscan_RasGRF_CDC25	ENSG00000095370		0.652	SH2D3C-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SH2D3C	HGNC	protein_coding	OTTHUMT00000054264.1	-	0.00	29	0	C	NM_005489		130501134	-1	tier1	-	no_errors	ENST00000314830	ensembl	human	known	74_37	missense	11.11	32	4	SNP	1.000	A
SETX	23064	genome.wustl.edu	37	9	135203054	135203054	+	Missense_Mutation	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr9:135203054G>A	ENST00000224140.5	-	10	4113	c.3931C>T	c.(3931-3933)Cgt>Tgt	p.R1311C	SETX_ENST00000372169.2_Missense_Mutation_p.R1311C|SETX_ENST00000393220.1_Missense_Mutation_p.R1311C	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	1311					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		CCATGATCACGTAATTGAGCT	0.413																																																	0													70.0	70.0	70.0					9																	135203054		2203	4300	6503	SO:0001583	missense	0			AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.3931C>T	9.37:g.135203054G>A	ENSP00000224140:p.Arg1311Cys		A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.R1311C	ENST00000224140.5	37	c.3931	CCDS6947.1	9	.	.	.	.	.	.	.	.	.	.	G	15.75	2.924706	0.52653	.	.	ENSG00000107290	ENST00000224140;ENST00000372169;ENST00000393220	D;D;D	0.94497	-3.41;-3.44;-3.11	5.47	5.47	0.80525	.	0.473828	0.21758	N	0.069577	D	0.97028	0.9029	M	0.71581	2.175	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.97468	1.0039	10	0.87932	D	0	.	18.3556	0.90356	0.0:0.0:1.0:0.0	.	1311;1311;1311	Q7Z333-3;Q7Z333;Q7Z333-4	.;SETX_HUMAN;.	C	1311	ENSP00000224140:R1311C;ENSP00000361242:R1311C;ENSP00000376913:R1311C	ENSP00000224140:R1311C	R	-	1	0	SETX	134192875	1.000000	0.71417	0.963000	0.40424	0.348000	0.29142	4.630000	0.61297	2.567000	0.86603	0.650000	0.86243	CGT	SETX	-	NULL	ENSG00000107290		0.413	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETX	HGNC	protein_coding	OTTHUMT00000054774.3	-	0.00	55	0	G	NM_015046		135203054	-1	tier1	-	no_errors	ENST00000372169	ensembl	human	known	74_37	missense	36.51	40	23	SNP	0.990	A
SIAE	54414	genome.wustl.edu	37	11	124539377	124539377	+	Missense_Mutation	SNP	C	C	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr11:124539377C>A	ENST00000263593.3	-	2	280	c.108G>T	c.(106-108)atG>atT	p.M36I	SIAE_ENST00000545756.1_Start_Codon_SNP_p.M1I|SIAE_ENST00000525730.1_5'UTR			Q9HAT2	SIAE_HUMAN	sialic acid acetylesterase	36					carbohydrate metabolic process (GO:0005975)|regulation of immune system process (GO:0002682)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	sialate O-acetylesterase activity (GO:0001681)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(2)	15	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.63e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0243)		TCTGCAGCACCATATCATTAT	0.478											OREG0021460	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													108.0	98.0	102.0					11																	124539377		2201	4299	6500	SO:0001583	missense	0			AF300796	CCDS8449.1, CCDS55795.1	11q24	2005-12-15	2005-12-15	2005-12-15		ENSG00000110013			18187	protein-coding gene	gene with protein product	"""sialic acid-specific acetylesterase II"""	610079	"""Ysg2 homolog (mouse)"""	YSG2		10464298	Standard	NM_001199922		Approved	CSE-C, MGC87009, LSE	uc001qan.3	Q9HAT2		ENST00000263593.3:c.108G>T	11.37:g.124539377C>A	ENSP00000263593:p.Met36Ile	1535	B3KPB0|Q8IUT9|Q9HAU7|Q9NT71	Missense_Mutation	SNP	pfam_DUF303_acetylest	p.M36I	ENST00000263593.3	37	c.108	CCDS8449.1	11	.	.	.	.	.	.	.	.	.	.	C	16.81	3.224612	0.58668	.	.	ENSG00000110013	ENST00000263593;ENST00000545756	D;D	0.92699	-2.63;-3.09	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	D	0.96870	0.8978	M	0.91038	3.17	0.80722	D	1	D;P	0.69078	0.997;0.89	D;P	0.74674	0.984;0.569	D	0.97459	1.0033	10	0.87932	D	0	-8.5039	17.7773	0.88513	0.0:1.0:0.0:0.0	.	1;36	Q9HAT2-2;Q9HAT2	.;SIAE_HUMAN	I	36;1	ENSP00000263593:M36I;ENSP00000437877:M1I	ENSP00000263593:M36I	M	-	3	0	SIAE	124044587	1.000000	0.71417	1.000000	0.80357	0.690000	0.40134	4.742000	0.62103	2.738000	0.93877	0.655000	0.94253	ATG	SIAE	-	NULL	ENSG00000110013		0.478	SIAE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIAE	HGNC	protein_coding	OTTHUMT00000387070.1	-	0.00	38	0	C	NM_170601		124539377	-1	tier1	-	no_errors	ENST00000263593	ensembl	human	known	74_37	missense	12.50	28	4	SNP	1.000	A
SIDT1	54847	genome.wustl.edu	37	3	113327302	113327302	+	Missense_Mutation	SNP	G	G	A	rs144146634		TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr3:113327302G>A	ENST00000264852.4	+	17	2365	c.1639G>A	c.(1639-1641)Gct>Act	p.A547T	SIDT1_ENST00000393830.3_Missense_Mutation_p.A547T|SIDT1_ENST00000463226.1_3'UTR	NM_017699.2	NP_060169.2	Q9NXL6	SIDT1_HUMAN	SID1 transmembrane family, member 1	547					dsRNA transport (GO:0033227)	integral component of membrane (GO:0016021)	RNA transmembrane transporter activity (GO:0051033)			breast(1)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|liver(2)|lung(15)|ovary(3)|pancreas(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50						TCTCTTCTACGCTATGGGCAT	0.423																																																	0								G	THR/ALA	0,4406		0,0,2203	222.0	208.0	213.0		1639	5.8	1.0	3	dbSNP_134	213	1,8599	1.2+/-3.3	0,1,4299	no	missense	SIDT1	NM_017699.2	58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	547/828	113327302	1,13005	2203	4300	6503	SO:0001583	missense	0			AK000181	CCDS2974.1	3q13.31	2009-11-26			ENSG00000072858	ENSG00000072858			25967	protein-coding gene	gene with protein product		606816					Standard	NM_017699		Approved	FLJ20174, SID-1	uc003eak.3	Q9NXL6	OTTHUMG00000159299	ENST00000264852.4:c.1639G>A	3.37:g.113327302G>A	ENSP00000264852:p.Ala547Thr		Q17RR4	Missense_Mutation	SNP	NULL	p.A547T	ENST00000264852.4	37	c.1639	CCDS2974.1	3	.	.	.	.	.	.	.	.	.	.	G	24.7	4.559567	0.86335	0.0	1.16E-4	ENSG00000072858	ENST00000264852;ENST00000393830	T;T	0.31247	1.5;1.5	5.8	5.8	0.92144	.	0.000000	0.64402	D	0.000005	T	0.32436	0.0829	L	0.47190	1.495	0.53688	D	0.999979	P;P	0.49447	0.907;0.924	B;P	0.45856	0.362;0.495	T	0.01702	-1.1292	10	0.34782	T	0.22	-11.8929	13.2717	0.60164	0.0721:0.0:0.9279:0.0	.	547;547	Q9NXL6-2;Q9NXL6	.;SIDT1_HUMAN	T	547	ENSP00000264852:A547T;ENSP00000377416:A547T	ENSP00000264852:A547T	A	+	1	0	SIDT1	114809992	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	6.610000	0.74178	2.740000	0.93945	0.650000	0.86243	GCT	SIDT1	-	NULL	ENSG00000072858		0.423	SIDT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIDT1	HGNC	protein_coding	OTTHUMT00000317564.1	-	0.00	90	0	G	NM_017699		113327302	+1	tier1	-	no_errors	ENST00000393830	ensembl	human	known	74_37	missense	18.18	81	18	SNP	1.000	A
SIPA1L3	23094	genome.wustl.edu	37	19	38610361	38610361	+	Missense_Mutation	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr19:38610361C>T	ENST00000222345.6	+	9	3216	c.2707C>T	c.(2707-2709)Cgc>Tgc	p.R903C		NM_015073.1	NP_055888.1	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like 3	903					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of small GTPase mediated signal transduction (GO:0051056)	extracellular space (GO:0005615)	GTPase activator activity (GO:0005096)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(22)|ovary(2)|prostate(4)|skin(3)	59			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			CCTGGACTTACGCACCAAGGA	0.552																																																	0													114.0	128.0	123.0					19																	38610361		2202	4300	6502	SO:0001583	missense	0			AB011117	CCDS33007.1	19q13.13	2008-02-05			ENSG00000105738	ENSG00000105738			23801	protein-coding gene	gene with protein product							Standard	XM_005258671		Approved	KIAA0545	uc002ohk.3	O60292	OTTHUMG00000073727	ENST00000222345.6:c.2707C>T	19.37:g.38610361C>T	ENSP00000222345:p.Arg903Cys		Q2TV87	Missense_Mutation	SNP	pfam_DUF3401,pfam_Rap_GAP_dom,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP_dom	p.R903C	ENST00000222345.6	37	c.2707	CCDS33007.1	19	.	.	.	.	.	.	.	.	.	.	C	14.55	2.569558	0.45798	.	.	ENSG00000105738	ENST00000222345	T	0.76060	-0.99	5.75	5.75	0.90469	.	0.240594	0.44688	D	0.000436	T	0.60038	0.2238	N	0.17474	0.49	0.46542	D	0.99909	B	0.24576	0.106	B	0.15052	0.012	T	0.57528	-0.7796	10	0.44086	T	0.13	-28.7885	14.9433	0.71012	0.0:0.8565:0.1435:0.0	.	903	O60292	SI1L3_HUMAN	C	903	ENSP00000222345:R903C	ENSP00000222345:R903C	R	+	1	0	SIPA1L3	43302201	0.001000	0.12720	0.968000	0.41197	0.967000	0.64934	1.130000	0.31393	2.725000	0.93324	0.655000	0.94253	CGC	SIPA1L3	-	NULL	ENSG00000105738		0.552	SIPA1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIPA1L3	HGNC	protein_coding	OTTHUMT00000156294.2	-	0.00	81	0	C	XM_032278		38610361	+1	tier1	-	no_errors	ENST00000222345	ensembl	human	known	74_37	missense	5.56	67	4	SNP	0.955	T
SLA	6503	genome.wustl.edu	37	8	134057315	134057315	+	Missense_Mutation	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr8:134057315C>T	ENST00000338087.5	-	7	1217	c.398G>A	c.(397-399)cGc>cAc	p.R133H	SLA_ENST00000395352.3_Missense_Mutation_p.R150H|SLA_ENST00000427060.2_Missense_Mutation_p.R173H|TG_ENST00000377869.1_Intron|TG_ENST00000220616.4_Intron|SLA_ENST00000517648.1_Intron|TG_ENST00000519543.1_Intron|TG_ENST00000542445.1_Intron|SLA_ENST00000524345.1_Missense_Mutation_p.R25H	NM_001045556.2	NP_001039021.1	Q13239	SLAP1_HUMAN	Src-like-adaptor	133	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				positive regulation of signal transduction (GO:0009967)	endosome (GO:0005768)	SH3/SH2 adaptor activity (GO:0005070)	p.R133H(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(1)|lung(6)|prostate(1)|skin(1)	17	all_epithelial(106;3.51e-21)|Lung NSC(106;4.24e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0279)|Breast(495;0.037)	BRCA - Breast invasive adenocarcinoma(115;0.000701)			ACGGAAAATGCGGTAATGCTT	0.537																																																	1	Substitution - Missense(1)	large_intestine(1)											176.0	142.0	154.0					8																	134057315		2203	4300	6503	SO:0001583	missense	0				CCDS6370.1, CCDS47922.1, CCDS47923.1, CCDS64977.1, CCDS64978.1	8q24.22	2013-09-19	2001-11-28		ENSG00000155926	ENSG00000155926		"""SH2 domain containing"""	10902	protein-coding gene	gene with protein product		601099	"""Src-like-adapter"""			8825655, 11179692	Standard	NM_001045556		Approved	SLA1	uc011ljd.2	Q13239	OTTHUMG00000164439	ENST00000338087.5:c.398G>A	8.37:g.134057315C>T	ENSP00000337548:p.Arg133His		B7Z4J2|B7Z4L6|Q6FI01|Q9UMQ8	Missense_Mutation	SNP	pfam_SH2,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,pfscan_SH2,pfscan_SH3_domain,prints_SH2	p.R173H	ENST00000338087.5	37	c.518	CCDS6370.1	8	.	.	.	.	.	.	.	.	.	.	C	33	5.222711	0.95139	.	.	ENSG00000155926	ENST00000338087;ENST00000427060;ENST00000395352;ENST00000524345;ENST00000522119	T;T;T;T;D	0.93488	1.34;1.34;1.34;1.34;-3.23	5.77	5.77	0.91146	SH2 motif (5);	0.046432	0.85682	D	0.000000	D	0.96491	0.8855	M	0.76574	2.34	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.77004	0.989;0.989;0.989	D	0.96652	0.9482	10	0.87932	D	0	-29.5587	17.4758	0.87658	0.0:1.0:0.0:0.0	.	133;133;133	Q6FI01;Q5TZW1;Q13239	.;.;SLAP1_HUMAN	H	133;173;150;25;133	ENSP00000337548:R133H;ENSP00000394049:R173H;ENSP00000378759:R150H;ENSP00000427928:R25H;ENSP00000430596:R133H	ENSP00000337548:R133H	R	-	2	0	SLA	134126497	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.137000	0.77295	2.737000	0.93849	0.561000	0.74099	CGC	SLA	-	pfam_SH2,smart_SH2,pfscan_SH2,prints_SH2	ENSG00000155926		0.537	SLA-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SLA	HGNC	protein_coding	OTTHUMT00000378771.1		0.00	30	0	C			134057315	-1			no_errors	ENST00000427060	ensembl	human	known	74_37	missense	6.25	30	2	SNP	1.000	T
SLC12A7	10723	genome.wustl.edu	37	5	1078124	1078125	+	Splice_Site	INS	-	-	GCAG	rs369273236|rs369196468|rs200032397	byFrequency	TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr5:1078124_1078125insGCAG	ENST00000264930.5	-	12	1498		c.e12-2			NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7						cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	TCCCCGAACCTgcaggcaggcg	0.673														58	0.0115815	0.0159	0.0144	5008	,	,		15824	0.0		0.0209	False		,,,				2504	0.0061																0										94,3970		14,66,1952						3.5	1.0			11	265,7685		24,217,3734	no	splice-3	SLC12A7	NM_006598.2		38,283,5686	A1A1,A1R,RR		3.3333,2.313,2.9882				359,11655				SO:0001630	splice_region_variant	0			AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.1455-2->CTGC	5.37:g.1078129_1078132dupGCAG			A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Splice_Site	INS	-	e12-2	ENST00000264930.5	37	c.1455-3_1455-2	CCDS34129.1	5																																																																																			SLC12A7	-	-	ENSG00000113504		0.673	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	SLC12A7	HGNC	protein_coding	OTTHUMT00000366446.2		0.00	8	0	-	NM_006598	Intron	1078125	-1	tier1		no_errors	ENST00000264930	ensembl	human	known	74_37	splice_site_ins	33.33	4	2	INS	1.000:0.971	GCAG
SLC17A4	10050	genome.wustl.edu	37	6	25776845	25776845	+	Missense_Mutation	SNP	C	C	T	rs368361659		TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr6:25776845C>T	ENST00000377905.4	+	9	1129	c.1010C>T	c.(1009-1011)cCg>cTg	p.P337L	SLC17A4_ENST00000439485.2_Missense_Mutation_p.P107L|SLC17A4_ENST00000397076.2_Missense_Mutation_p.P107L	NM_005495.2	NP_005486.1	Q9Y2C5	S17A4_HUMAN	solute carrier family 17, member 4	337					phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)	p.P337R(1)|p.P337Q(1)		breast(4)|endometrium(1)|kidney(4)|large_intestine(3)|lung(21)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						TCTGCCTTGCCGTTTGTTGTT	0.507																																																	2	Substitution - Missense(2)	upper_aerodigestive_tract(1)|lung(1)						C	LEU/PRO	0,4406		0,0,2203	281.0	264.0	270.0		1010	3.8	0.6	6		270	1,8599	1.2+/-3.3	0,1,4299	no	missense	SLC17A4	NM_005495.2	98	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	337/498	25776845	1,13005	2203	4300	6503	SO:0001583	missense	0			AB020527	CCDS4564.1, CCDS75411.1	6p22.2	2013-07-18	2013-07-18		ENSG00000146039	ENSG00000146039		"""Solute carriers"""	10932	protein-coding gene	gene with protein product		604216	"""solute carrier family 17 (sodium phosphate), member 4"""			10319585	Standard	NM_005495		Approved	KIAA2138	uc003nfe.3	Q9Y2C5	OTTHUMG00000014410	ENST00000377905.4:c.1010C>T	6.37:g.25776845C>T	ENSP00000367137:p.Pro337Leu		B4DDV9|E7EPE8|E7EU17|Q32MB7|Q32MB8	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.P337L	ENST00000377905.4	37	c.1010	CCDS4564.1	6	.	.	.	.	.	.	.	.	.	.	C	19.90	3.912191	0.72983	0.0	1.16E-4	ENSG00000146039	ENST00000377905;ENST00000439485;ENST00000397076	T;T;T	0.57907	0.41;0.44;0.37	5.63	3.75	0.43078	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.405156	0.21226	N	0.078063	T	0.64103	0.2568	M	0.89658	3.05	0.54753	D	0.999988	P;D;D	0.71674	0.895;0.998;0.973	B;P;D	0.63113	0.299;0.867;0.911	T	0.69243	-0.5196	10	0.66056	D	0.02	.	8.5883	0.33670	0.0:0.8318:0.0:0.1682	.	107;107;337	E7EPE8;E7EU17;Q9Y2C5	.;.;S17A4_HUMAN	L	337;107;107	ENSP00000367137:P337L;ENSP00000391345:P107L;ENSP00000380266:P107L	ENSP00000367137:P337L	P	+	2	0	SLC17A4	25884824	0.985000	0.35326	0.579000	0.28588	0.949000	0.60115	2.671000	0.46842	0.761000	0.33130	0.655000	0.94253	CCG	SLC17A4	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000146039		0.507	SLC17A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A4	HGNC	protein_coding	OTTHUMT00000040068.1	-	0.00	35	0	C			25776845	+1	tier1	-	no_errors	ENST00000377905	ensembl	human	known	74_37	missense	23.53	26	8	SNP	0.957	T
SLC22A3	6581	genome.wustl.edu	37	6	160829877	160829877	+	Missense_Mutation	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr6:160829877G>A	ENST00000275300.2	+	4	933	c.781G>A	c.(781-783)Gcc>Acc	p.A261T	SLC22A3_ENST00000392145.1_Missense_Mutation_p.A261T	NM_021977.3	NP_068812.1	O75751	S22A3_HUMAN	solute carrier family 22 (organic cation transporter), member 3	261					dopamine transport (GO:0015872)|drug transmembrane transport (GO:0006855)|histamine uptake (GO:0051615)|organic cation transport (GO:0015695)|quaternary ammonium group transport (GO:0015697)|regulation of appetite (GO:0032098)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dopamine transmembrane transporter activity (GO:0005329)|organic cation transmembrane transporter activity (GO:0015101)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|toxin transporter activity (GO:0019534)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		Breast(66;0.00028)|Ovarian(120;0.0308)|Prostate(117;0.218)		OV - Ovarian serous cystadenocarcinoma(65;9.47e-17)|BRCA - Breast invasive adenocarcinoma(81;9.75e-06)	Adefovir Dipivoxil(DB00718)|Amphetamine(DB00182)|Choline(DB00122)|Cimetidine(DB00501)|Clonidine(DB00575)|Colchicine(DB01394)|Desipramine(DB01151)|Dopamine(DB00988)|Estradiol(DB00783)|Guanidine(DB00536)|Histamine Phosphate(DB00667)|Imipramine(DB00458)|Irinotecan(DB00762)|Lamivudine(DB00709)|Melphalan(DB01042)|Metformin(DB00331)|Methamphetamine(DB01577)|Nicotine(DB00184)|Norepinephrine(DB00368)|Oxaliplatin(DB00526)|Phenoxybenzamine(DB00925)|Prazosin(DB00457)|Procainamide(DB01035)|Progesterone(DB00396)|Testosterone(DB00624)|Vincristine(DB00541)	CCCTGGAATTGCCTACTTCAT	0.423																																																	0													144.0	133.0	136.0					6																	160829877		2203	4300	6503	SO:0001583	missense	0			AF078749	CCDS5277.1	6q25.3	2013-07-18	2013-07-18		ENSG00000146477	ENSG00000146477		"""Solute carriers"""	10967	protein-coding gene	gene with protein product		604842	"""solute carrier family 22 (extraneuronal monoamine transporter), member 3"""			9632645, 9933568	Standard	NM_021977		Approved	OCT3, EMT	uc003qti.4	O75751	OTTHUMG00000015953	ENST00000275300.2:c.781G>A	6.37:g.160829877G>A	ENSP00000275300:p.Ala261Thr		Q5SYN6|Q9UP02	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	p.A261T	ENST00000275300.2	37	c.781	CCDS5277.1	6	.	.	.	.	.	.	.	.	.	.	G	35	5.519367	0.96416	.	.	ENSG00000146477	ENST00000275300;ENST00000392145	T;T	0.61274	0.12;0.12	5.71	5.71	0.89125	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.64402	D	0.000001	T	0.80314	0.4600	M	0.93854	3.465	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.83494	0.0071	10	0.52906	T	0.07	.	18.1132	0.89542	0.0:0.0:1.0:0.0	.	261	O75751	S22A3_HUMAN	T	261	ENSP00000275300:A261T;ENSP00000375989:A261T	ENSP00000275300:A261T	A	+	1	0	SLC22A3	160749867	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.128000	0.94424	2.720000	0.93068	0.650000	0.86243	GCC	SLC22A3	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	ENSG00000146477		0.423	SLC22A3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SLC22A3	HGNC	protein_coding	OTTHUMT00000042953.1	-	0.00	49	0	G	NM_021977		160829877	+1	tier1	-	no_errors	ENST00000392145	ensembl	human	known	74_37	missense	5.48	69	4	SNP	1.000	A
SLC6A12	6539	genome.wustl.edu	37	12	311938	311938	+	Missense_Mutation	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr12:311938G>A	ENST00000428720.1	-	5	1201	c.458C>T	c.(457-459)cCc>cTc	p.P153L	RP11-283I3.2_ENST00000539568.1_RNA|SLC6A12_ENST00000359674.4_Missense_Mutation_p.P153L|SLC6A12_ENST00000538272.1_5'UTR|SLC6A12_ENST00000397296.2_Missense_Mutation_p.P153L|SLC6A12_ENST00000536824.1_Missense_Mutation_p.P153L|SLC6A12_ENST00000424061.2_Missense_Mutation_p.P153L	NM_001122848.2	NP_001116320.1	P48065	S6A12_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 12	153					amino acid transport (GO:0006865)|cellular hyperosmotic response (GO:0071474)|cellular water homeostasis (GO:0009992)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|response to organic substance (GO:0010033)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(8)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0172)|all_epithelial(11;0.0283)|all_lung(10;0.0392)|Lung NSC(10;0.0567)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00227)			GGTCGTCCAGGGCAGCTCAGA	0.517																																																	0													112.0	99.0	103.0					12																	311938		2203	4300	6503	SO:0001583	missense	0			L42300	CCDS8501.1	12p13	2013-07-19	2013-07-19		ENSG00000111181	ENSG00000111181		"""Solute carriers"""	11045	protein-coding gene	gene with protein product	"""betaine/GABA transporter-1"""	603080	"""solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12"""			7589472	Standard	NM_003044		Approved	BGT-1	uc009zdh.2	P48065	OTTHUMG00000090309	ENST00000428720.1:c.458C>T	12.37:g.311938G>A	ENSP00000388184:p.Pro153Leu		A0AV52|B2R992|D3DUN8	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_betaine	p.P153L	ENST00000428720.1	37	c.458	CCDS8501.1	12	.	.	.	.	.	.	.	.	.	.	G	34	5.371068	0.95923	.	.	ENSG00000111181	ENST00000359674;ENST00000397296;ENST00000428720;ENST00000424061;ENST00000536824	T;T;T;T;T	0.80033	-1.33;-1.33;-1.33;-1.33;-1.33	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	D	0.94098	0.8108	H	0.97940	4.11	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95968	0.8967	10	0.72032	D	0.01	.	19.3444	0.94357	0.0:0.0:1.0:0.0	.	153	P48065	S6A12_HUMAN	L	153	ENSP00000352702:P153L;ENSP00000380464:P153L;ENSP00000388184:P153L;ENSP00000399136:P153L;ENSP00000444268:P153L	ENSP00000352702:P153L	P	-	2	0	SLC6A12	182199	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.860000	0.99555	2.564000	0.86499	0.563000	0.77884	CCC	SLC6A12	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport	ENSG00000111181		0.517	SLC6A12-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A12	HGNC	protein_coding	OTTHUMT00000206671.2	-	0.00	63	0	G	NM_003044		311938	-1	tier1	-	no_errors	ENST00000359674	ensembl	human	known	74_37	missense	25.42	44	15	SNP	1.000	A
SLC6A19	340024	genome.wustl.edu	37	5	1213683	1213683	+	Missense_Mutation	SNP	C	C	G			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr5:1213683C>G	ENST00000304460.10	+	5	825	c.769C>G	c.(769-771)Ccc>Gcc	p.P257A		NM_001003841.2	NP_001003841.1	Q695T7	S6A19_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 19	257					amino acid transport (GO:0006865)|ion transport (GO:0006811)|response to nutrient (GO:0007584)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|neutral amino acid transmembrane transporter activity (GO:0015175)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(25)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			CCTCTTCACGCCCAACGTAAG	0.652																																																	0													97.0	64.0	75.0					5																	1213683		2203	4299	6502	SO:0001583	missense	0			AK096054	CCDS34130.1	5p15	2013-07-19			ENSG00000174358	ENSG00000174358		"""Solute carriers"""	27960	protein-coding gene	gene with protein product	"""Hartnup disease"""	608893					Standard	NM_001003841		Approved		uc003jbw.4	Q695T7	OTTHUMG00000161636	ENST00000304460.10:c.769C>G	5.37:g.1213683C>G	ENSP00000305302:p.Pro257Ala		A8K446	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_orphan	p.P257A	ENST00000304460.10	37	c.769	CCDS34130.1	5	.	.	.	.	.	.	.	.	.	.	c	17.30	3.353899	0.61293	.	.	ENSG00000174358	ENST00000304460	T	0.80566	-1.39	4.87	4.87	0.63330	.	0.105669	0.64402	D	0.000003	D	0.91825	0.7413	M	0.92507	3.315	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	D	0.93881	0.7171	10	0.87932	D	0	.	16.214	0.82191	0.0:1.0:0.0:0.0	.	257	Q695T7	S6A19_HUMAN	A	257	ENSP00000305302:P257A	ENSP00000305302:P257A	P	+	1	0	SLC6A19	1266683	1.000000	0.71417	0.943000	0.38184	0.086000	0.17979	7.279000	0.78599	2.263000	0.75096	0.466000	0.42574	CCC	SLC6A19	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport	ENSG00000174358		0.652	SLC6A19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A19	HGNC	protein_coding	OTTHUMT00000365557.1	-	0.00	72	0	C	XM_291120		1213683	+1	tier1	-	no_errors	ENST00000304460	ensembl	human	known	74_37	missense	18.31	58	13	SNP	1.000	G
SLC6A3	6531	genome.wustl.edu	37	5	1416295	1416295	+	Missense_Mutation	SNP	G	G	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr5:1416295G>T	ENST00000270349.9	-	7	1076	c.949C>A	c.(949-951)Cag>Aag	p.Q317K	SLC6A3_ENST00000453492.2_Missense_Mutation_p.Q317K	NM_001044.4	NP_001035.1	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 3	317					adenohypophysis development (GO:0021984)|aging (GO:0007568)|cation transmembrane transport (GO:0098655)|cell death (GO:0008219)|dopamine biosynthetic process (GO:0042416)|dopamine catabolic process (GO:0042420)|dopamine transport (GO:0015872)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|neurotransmitter biosynthetic process (GO:0042136)|positive regulation of multicellular organism growth (GO:0040018)|prepulse inhibition (GO:0060134)|regulation of dopamine metabolic process (GO:0042053)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to iron ion (GO:0010039)|response to nicotine (GO:0035094)|sensory perception of smell (GO:0007608)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine transmembrane transporter activity (GO:0005329)|dopamine:sodium symporter activity (GO:0005330)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)			breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(19)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Benzatropine(DB00245)|Benzphetamine(DB00865)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Cocaine(DB00907)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Diphenylpyraline(DB01146)|Dopamine(DB00988)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fencamfamine(DB01463)|Imipramine(DB00458)|Ioflupane I 123(DB08824)|Lisdexamfetamine(DB01255)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Mirtazapine(DB00370)|Modafinil(DB00745)|Nefazodone(DB01149)|Pethidine(DB00454)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Trimipramine(DB00726)|Venlafaxine(DB00285)	AAGCACACCTGGGTGGCCGCG	0.622																																																	0													75.0	68.0	70.0					5																	1416295		2203	4300	6503	SO:0001583	missense	0				CCDS3863.1	5p15.3	2013-07-19	2013-07-19		ENSG00000142319	ENSG00000142319		"""Solute carriers"""	11049	protein-coding gene	gene with protein product	"""dopamine transporter"""	126455	"""solute carrier family 6 (neurotransmitter transporter, dopamine), member 3"", ""dopamine transporter 1"""	DAT1		1406597	Standard	NM_001044		Approved	DAT	uc003jck.3	Q01959	OTTHUMG00000131016	ENST00000270349.9:c.949C>A	5.37:g.1416295G>T	ENSP00000270349:p.Gln317Lys		A2RUN4|Q14996	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_dopamine	p.Q317K	ENST00000270349.9	37	c.949	CCDS3863.1	5	.	.	.	.	.	.	.	.	.	.	G	22.0	4.230987	0.79688	.	.	ENSG00000142319	ENST00000270349;ENST00000453492;ENST00000513308	D;D;D	0.81579	-1.51;-1.51;-1.51	3.88	3.88	0.44766	.	0.128561	0.53938	D	0.000052	D	0.93874	0.8040	H	0.99487	4.59	0.54753	D	0.999986	D	0.71674	0.998	D	0.74023	0.982	D	0.96021	0.9009	10	0.87932	D	0	.	13.7023	0.62616	0.0:0.0:1.0:0.0	.	317	Q01959	SC6A3_HUMAN	K	317;317;243	ENSP00000270349:Q317K;ENSP00000399806:Q317K;ENSP00000429101:Q243K	ENSP00000270349:Q317K	Q	-	1	0	SLC6A3	1469295	1.000000	0.71417	1.000000	0.80357	0.700000	0.40528	8.814000	0.91968	1.891000	0.54761	0.561000	0.74099	CAG	SLC6A3	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport	ENSG00000142319		0.622	SLC6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A3	HGNC	protein_coding	OTTHUMT00000253650.3	-	0.00	33	0	G	NM_001044		1416295	-1	tier1	-	no_errors	ENST00000270349	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	T
SLITRK5	26050	genome.wustl.edu	37	13	88327918	88327918	+	Frame_Shift_Del	DEL	T	T	-			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr13:88327918delT	ENST00000325089.6	+	2	494	c.275delT	c.(274-276)cttfs	p.L93fs	SLITRK5_ENST00000400028.3_Intron	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	93					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					TCCGGAAACCTTTTGAACCGT	0.468																																																	0													162.0	168.0	166.0					13																	88327918		2203	4300	6503	SO:0001589	frameshift_variant	0			AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.275delT	13.37:g.88327918delT	ENSP00000366283:p.Leu93fs		B3KNB8|B4DSH5|Q5VT81	Frame_Shift_Del	DEL	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.L93fs	ENST00000325089.6	37	c.275	CCDS9465.1	13																																																																																			SLITRK5	-	NULL	ENSG00000165300		0.468	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK5	HGNC	protein_coding	OTTHUMT00000045416.3		0.00	23	0	T			88327918	+1	tier1		no_errors	ENST00000325089	ensembl	human	known	74_37	frame_shift_del	5.56	34	2	DEL	1.000	-
RPL30	6156	genome.wustl.edu	37	8	99054503	99054504	+	Intron	INS	-	-	T	rs534352583|rs367741409	byFrequency	TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr8:99054503_99054504insT	ENST00000521291.1	-	3	445				RPL30_ENST00000287038.3_Intron|RPL30_ENST00000396070.2_Intron|KB-1208A12.3_ENST00000501016.2_RNA|RPL30_ENST00000523172.1_Intron|RPL30_ENST00000518164.1_Intron|SNORA72_ENST00000384339.1_RNA			P62888	RL30_HUMAN	ribosomal protein L30						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			kidney(2)|lung(4)|skin(1)	7	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.192)			TTTTTTGGCACTTTTTTTTTTC	0.312																																																	0																																										SO:0001627	intron_variant	0				CCDS34928.1	8q22	2013-05-09			ENSG00000156482	ENSG00000156482		"""L ribosomal proteins"""	10333	protein-coding gene	gene with protein product		180467				1577483	Standard	NM_000989		Approved	L30	uc003yif.3	P62888	OTTHUMG00000164796	ENST00000521291.1:c.298+368->A	8.37:g.99054513_99054513dupT			B2R591|P04645|Q502Z6	RNA	INS	-	NULL	ENST00000521291.1	37	NULL	CCDS34928.1	8																																																																																			KB-1208A12.3	-	-	ENSG00000245970		0.312	RPL30-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SNORA72	Clone_based_vega_gene	protein_coding	OTTHUMT00000380450.1		0.00	41	0	-			99054504	+1	tier1		no_errors	ENST00000501016	ensembl	human	known	74_37	rna	13.64	38	6	INS	0.000:0.001	T
SNTG2	54221	genome.wustl.edu	37	2	1371122	1371122	+	Missense_Mutation	SNP	A	A	G			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr2:1371122A>G	ENST00000308624.5	+	17	1625	c.1496A>G	c.(1495-1497)gAg>gGg	p.E499G	SNTG2_ENST00000407292.1_Missense_Mutation_p.E372G	NM_018968.3	NP_061841.2	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	499					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|syntrophin complex (GO:0016013)	PDZ domain binding (GO:0030165)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		CAGGAACTCGAGTTCCAGGAC	0.473																																																	0													23.0	21.0	21.0					2																	1371122		692	1591	2283	SO:0001583	missense	0			AJ003029	CCDS46220.1	2p25	2008-05-23			ENSG00000172554	ENSG00000172554			13741	protein-coding gene	gene with protein product		608715				10747910	Standard	NM_018968		Approved	SYN5, G2SYN	uc002qwq.3	Q9NY99	OTTHUMG00000151370	ENST00000308624.5:c.1496A>G	2.37:g.1371122A>G	ENSP00000311837:p.Glu499Gly		Q05AH5	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.E499G	ENST00000308624.5	37	c.1496	CCDS46220.1	2	.	.	.	.	.	.	.	.	.	.	A	15.12	2.739132	0.49045	.	.	ENSG00000172554	ENST00000308624;ENST00000407292	T;T	0.77358	-1.09;-1.09	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	D	0.86986	0.6065	M	0.79258	2.445	0.80722	D	1	D;D	0.76494	0.999;0.993	D;P	0.69479	0.964;0.722	D	0.88255	0.2919	10	0.56958	D	0.05	.	14.2285	0.65875	1.0:0.0:0.0:0.0	.	372;499	Q9NY99-2;Q9NY99	.;SNTG2_HUMAN	G	499;372	ENSP00000311837:E499G;ENSP00000385020:E372G	ENSP00000311837:E499G	E	+	2	0	SNTG2	1350129	1.000000	0.71417	0.982000	0.44146	0.030000	0.12068	8.006000	0.88564	1.824000	0.53156	0.533000	0.62120	GAG	SNTG2	-	NULL	ENSG00000172554		0.473	SNTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNTG2	HGNC	protein_coding	OTTHUMT00000322454.1	-	0.00	66	0	A	NM_018968		1371122	+1	tier1	-	no_errors	ENST00000308624	ensembl	human	known	74_37	missense	17.74	51	11	SNP	1.000	G
SRMS	6725	genome.wustl.edu	37	20	62172557	62172557	+	Missense_Mutation	SNP	C	C	G			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr20:62172557C>G	ENST00000217188.1	-	7	1312	c.1272G>C	c.(1270-1272)caG>caC	p.Q424H		NM_080823.2	NP_543013.1	Q9H3Y6	SRMS_HUMAN	src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites	424	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				peptidyl-tyrosine autophosphorylation (GO:0038083)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|prostate(2)|stomach(1)	19	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)			CATAGGGACACTGGCCATAGG	0.632																																																	0													61.0	64.0	63.0					20																	62172557		2202	4300	6502	SO:0001583	missense	0				CCDS13525.1	20q13.33	2013-02-14	2003-08-22		ENSG00000125508	ENSG00000125508		"""SH2 domain containing"""	11298	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 148"""	C20orf148		7935409	Standard	NM_080823		Approved	SRM, dJ697K14.1	uc002yfi.1	Q9H3Y6	OTTHUMG00000032977	ENST00000217188.1:c.1272G>C	20.37:g.62172557C>G	ENSP00000217188:p.Gln424His			Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.Q424H	ENST00000217188.1	37	c.1272	CCDS13525.1	20	.	.	.	.	.	.	.	.	.	.	C	18.77	3.694348	0.68386	.	.	ENSG00000125508	ENST00000217188	D	0.83075	-1.68	4.98	4.02	0.46733	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.117297	0.38605	N	0.001628	D	0.87728	0.6250	L	0.54323	1.7	0.33428	D	0.580772	D	0.61080	0.989	D	0.65684	0.937	D	0.91540	0.5249	10	0.87932	D	0	.	13.5995	0.62011	0.0:0.9223:0.0:0.0776	.	424	Q9H3Y6	SRMS_HUMAN	H	424	ENSP00000217188:Q424H	ENSP00000217188:Q424H	Q	-	3	2	SRMS	61643001	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	0.877000	0.28106	1.220000	0.43490	0.655000	0.94253	CAG	SRMS	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	ENSG00000125508		0.632	SRMS-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	SRMS	HGNC	protein_coding	OTTHUMT00000080148.1	-	0.00	43	0	C	NM_080823		62172557	-1	tier1	-	no_errors	ENST00000217188	ensembl	human	known	74_37	missense	17.31	43	9	SNP	1.000	G
SRP68	6730	genome.wustl.edu	37	17	74035522	74035522	+	3'UTR	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr17:74035522G>A	ENST00000307877.2	-	0	2310				SRP68_ENST00000602720.1_3'UTR|SRP68_ENST00000539137.1_3'UTR|SRP68_ENST00000542536.2_5'UTR	NM_014230.3	NP_055045.2	Q9UHB9	SRP68_HUMAN	signal recognition particle 68kDa						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)|ribosome (GO:0005840)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|endoplasmic reticulum signal peptide binding (GO:0030942)|poly(A) RNA binding (GO:0044822)|signal recognition particle binding (GO:0005047)			NS(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(5)|lung(4)|ovary(2)|prostate(3)	23						AGCTCACAGGGCACCAGACAG	0.542																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF195951	CCDS11738.1, CCDS58600.1, CCDS58601.1	17q25.1	2010-04-30	2002-08-29		ENSG00000167881	ENSG00000167881			11302	protein-coding gene	gene with protein product		604858	"""signal recognition particle 68kD"""			10618370	Standard	NM_014230		Approved		uc002jqk.2	Q9UHB9		ENST00000307877.2:c.*265C>T	17.37:g.74035522G>A			B3KUU5|B3KWY7|G3V1U4|Q8NCJ4|Q8WUK2	RNA	SNP	-	NULL	ENST00000307877.2	37	NULL	CCDS11738.1	17																																																																																			SRP68	-	-	ENSG00000167881		0.542	SRP68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRP68	HGNC	protein_coding	OTTHUMT00000449487.1	-	0.00	24	0	G	NM_014230		74035522	-1	tier1	-	no_errors	ENST00000542536	ensembl	human	known	74_37	rna	25.00	18	6	SNP	0.000	A
ST6GALNAC3	256435	genome.wustl.edu	37	1	76877737	76877737	+	Silent	SNP	A	A	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr1:76877737A>C	ENST00000328299.3	+	3	406	c.258A>C	c.(256-258)tcA>tcC	p.S86S	ST6GALNAC3_ENST00000464140.1_3'UTR	NM_152996.2	NP_694541.2	Q8NDV1	SIA7C_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3	86					glycoprotein metabolic process (GO:0009100)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide metabolic process (GO:0006677)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sialyltransferase activity (GO:0008373)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|ovary(3)|prostate(1)|skin(2)	36						TGTCAAACTCAGGTCAGATGG	0.428																																																	0													111.0	98.0	102.0					1																	76877737		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS672.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000184005	ENSG00000184005		"""Sialyltransferases"""	19343	protein-coding gene	gene with protein product	"""ST6GALNAC III"""	610133	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) C"""	SIAT7C			Standard	NM_152996		Approved		uc001dhh.2	Q8NDV1	OTTHUMG00000009615	ENST00000328299.3:c.258A>C	1.37:g.76877737A>C			Q6PCE0|Q6UX29|Q8N259	Silent	SNP	pfam_Glyco_trans_29	p.S86	ENST00000328299.3	37	c.258	CCDS672.1	1																																																																																			ST6GALNAC3	-	pfam_Glyco_trans_29	ENSG00000184005		0.428	ST6GALNAC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST6GALNAC3	HGNC	protein_coding	OTTHUMT00000026501.1	-	0.00	60	0	A	NM_152996		76877737	+1	tier1	-	no_errors	ENST00000328299	ensembl	human	known	74_37	silent	11.48	54	7	SNP	0.561	C
STEAP3	55240	genome.wustl.edu	37	2	120005349	120005349	+	Missense_Mutation	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr2:120005349C>T	ENST00000354888.5	+	4	1091	c.587C>T	c.(586-588)gCg>gTg	p.A196V	STEAP3_ENST00000425223.2_Missense_Mutation_p.A196V|STEAP3-AS1_ENST00000454260.1_RNA|STEAP3_ENST00000409811.1_Missense_Mutation_p.A196V|STEAP3_ENST00000393110.2_Missense_Mutation_p.A206V|STEAP3_ENST00000393108.2_Missense_Mutation_p.A196V|STEAP3_ENST00000450943.2_Missense_Mutation_p.A196V|STEAP3_ENST00000393106.2_Missense_Mutation_p.A196V|STEAP3_ENST00000393107.2_Missense_Mutation_p.A196V	NM_182915.2	NP_878919.2	Q658P3	STEA3_HUMAN	STEAP family member 3, metalloreductase	196					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cellular iron ion homeostasis (GO:0006879)|copper ion import (GO:0015677)|exosomal secretion (GO:1990182)|ferric iron import into cell (GO:0097461)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902167)|protein secretion (GO:0009306)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	17						GGATCCCTGGCGTCAGCCTGG	0.677																																																	0													47.0	47.0	47.0					2																	120005349		2203	4300	6503	SO:0001583	missense	0			AY029585	CCDS2125.1, CCDS42738.1	2q14.2	2011-09-30	2011-09-30		ENSG00000115107	ENSG00000115107			24592	protein-coding gene	gene with protein product		609671				12606722	Standard	NM_182915		Approved	TSAP6, dudlin-2, STMP3	uc002tlr.3	Q658P3	OTTHUMG00000131402	ENST00000354888.5:c.587C>T	2.37:g.120005349C>T	ENSP00000346961:p.Ala196Val		A8K6E3|Q4VBR2|Q4ZG36|Q53SQ8|Q7Z389|Q86SF6|Q8NEW6|Q8TDP3|Q8TF03|Q9NVB5	Missense_Mutation	SNP	pfam_Fe3_Rdtase_TM_dom	p.A206V	ENST00000354888.5	37	c.617	CCDS2125.1	2	.	.	.	.	.	.	.	.	.	.	C	3.340	-0.134735	0.06711	.	.	ENSG00000115107	ENST00000393108;ENST00000354888;ENST00000450943;ENST00000393110;ENST00000393106;ENST00000409811;ENST00000393107;ENST00000425223	T;T;T;T;T;T;T;T	0.19669	2.13;2.13;2.13;2.13;2.13;2.13;2.13;2.13	4.68	-0.713	0.11223	NAD(P)-binding domain (1);	0.497742	0.20146	N	0.098261	T	0.12390	0.0301	L	0.35723	1.085	0.09310	N	1	B;B;B	0.20887	0.049;0.023;0.001	B;B;B	0.10450	0.005;0.004;0.0	T	0.24048	-1.0171	9	.	.	.	-10.3592	6.1682	0.20402	0.0:0.4355:0.1303:0.4342	.	196;206;196	B8ZZX6;Q658P3-2;Q658P3	.;.;STEA3_HUMAN	V	196;196;196;206;196;196;196;196	ENSP00000376820:A196V;ENSP00000346961:A196V;ENSP00000396873:A196V;ENSP00000376822:A206V;ENSP00000376818:A196V;ENSP00000386510:A196V;ENSP00000376819:A196V;ENSP00000396214:A196V	.	A	+	2	0	STEAP3	119721819	0.100000	0.21855	0.074000	0.20217	0.097000	0.18754	0.625000	0.24477	-0.028000	0.13850	-0.259000	0.10710	GCG	STEAP3	-	NULL	ENSG00000115107		0.677	STEAP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	STEAP3	HGNC	protein_coding	OTTHUMT00000254193.1	-	0.00	32	0	C	NM_018234		120005349	+1	tier1	-	no_errors	ENST00000393110	ensembl	human	known	74_37	missense	21.21	26	7	SNP	0.009	T
SVEP1	79987	genome.wustl.edu	37	9	113312185	113312185	+	Missense_Mutation	SNP	T	T	G			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr9:113312185T>G	ENST00000401783.2	-	2	1067	c.731A>C	c.(730-732)tAc>tCc	p.Y244S	SVEP1_ENST00000374469.1_Missense_Mutation_p.Y221S|SVEP1_ENST00000374461.1_Missense_Mutation_p.Y221S|SVEP1_ENST00000302728.8_Missense_Mutation_p.Y244S|SVEP1_ENST00000467821.1_5'UTR	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	244	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						GTGTAGCAGGTAACAGTGCTC	0.463																																																	0													88.0	83.0	85.0					9																	113312185		1944	4140	6084	SO:0001583	missense	0			AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.731A>C	9.37:g.113312185T>G	ENSP00000384917:p.Tyr244Ser		Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_EG-like_dom,pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_Hyalin,pfam_VWF_A,pfam_Pentaxin,pfam_EGF_extracell,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Growth_fac_rcpt_N_dom,smart_VWF_A,smart_Sushi_SCR_CCP,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Pentaxin,pfscan_EG-like_dom,pfscan_Hyalin,pfscan_Sushi_SCR_CCP,pfscan_VWF_A,prints_Pentaxin	p.Y244S	ENST00000401783.2	37	c.731	CCDS48004.1	9	.	.	.	.	.	.	.	.	.	.	T	18.55	3.647698	0.67358	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000302728;ENST00000374461	T;T;T;T	0.78924	-1.22;-1.22;-1.22;-1.22	5.38	1.1	0.20463	von Willebrand factor, type A (3);	0.127269	0.56097	D	0.000039	D	0.84479	0.5481	M	0.80616	2.505	0.34298	D	0.68397	D;D;D	0.55385	0.971;0.971;0.963	P;P;P	0.59424	0.857;0.784;0.678	D	0.87466	0.2411	10	0.87932	D	0	.	10.9604	0.47383	0.4381:0.0:0.0:0.5619	.	244;244;244	E9PBN8;Q4LDE5;Q4LDE5-2	.;SVEP1_HUMAN;.	S	244;221;244;221	ENSP00000384917:Y244S;ENSP00000363593:Y221S;ENSP00000304118:Y244S;ENSP00000363585:Y221S	ENSP00000304118:Y244S	Y	-	2	0	SVEP1	112352006	1.000000	0.71417	0.990000	0.47175	0.996000	0.88848	1.498000	0.35660	-0.035000	0.13691	0.460000	0.39030	TAC	SVEP1	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000165124		0.463	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SVEP1	HGNC	protein_coding		-	0.00	26	0	T			113312185	-1	tier1	-	no_errors	ENST00000401783	ensembl	human	known	74_37	missense	20.41	39	10	SNP	1.000	G
SYCP1	6847	genome.wustl.edu	37	1	115537600	115537601	+	Frame_Shift_Ins	INS	-	-	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr1:115537600_115537601insA	ENST00000369522.3	+	32	3131_3132	c.2891_2892insA	c.(2890-2895)agaaaafs	p.RK964fs	SYCP1_ENST00000477590.1_3'UTR|SYCP1_ENST00000369518.1_Frame_Shift_Ins_p.RK964fs	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	964	Arg/Lys-rich (basic).				chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)		RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		AAAATGGATAGAAAAAAAAAAC	0.356																																																	0																																										SO:0001589	frameshift_variant	0			D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.2901dupA	1.37:g.115537610_115537610dupA	ENSP00000358535:p.Arg964fs		O14963|Q5VXJ6	Frame_Shift_Ins	INS	pfam_SCP-1	p.K968fs	ENST00000369522.3	37	c.2891_2892	CCDS879.1	1																																																																																			SYCP1	-	NULL	ENSG00000198765		0.356	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP1	HGNC	protein_coding	OTTHUMT00000033386.1		0.00	41	0	-	NM_003176		115537601	+1	tier1		no_errors	ENST00000369518	ensembl	human	known	74_37	frame_shift_ins	15.22	39	7	INS	1.000:1.000	A
TAOK3	51347	genome.wustl.edu	37	12	118681288	118681288	+	Missense_Mutation	SNP	A	A	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr12:118681288A>C	ENST00000392533.3	-	5	716	c.226T>G	c.(226-228)Tta>Gta	p.L76V	TAOK3_ENST00000419821.2_Missense_Mutation_p.L76V	NM_016281.3	NP_057365.3	Q9H2K8	TAOK3_HUMAN	TAO kinase 3	76	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|MAPK cascade (GO:0000165)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of JNK cascade (GO:0046329)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			central_nervous_system(1)|lung(5)|skin(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AATTGTCGTAAAAATTTAACT	0.303																																																	0													62.0	60.0	61.0					12																	118681288		2202	4296	6498	SO:0001583	missense	0			AF135158	CCDS9188.1	12q	2007-08-03				ENSG00000135090			18133	protein-coding gene	gene with protein product						10559204, 10924369	Standard	NM_016281		Approved	JIK, DPK, MAP3K18	uc001twy.4	Q9H2K8		ENST00000392533.3:c.226T>G	12.37:g.118681288A>C	ENSP00000376317:p.Leu76Val		Q658N1|Q8IUM4|Q9HC79|Q9NZM9|Q9UHG7	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.L76V	ENST00000392533.3	37	c.226	CCDS9188.1	12	.	.	.	.	.	.	.	.	.	.	A	18.60	3.658600	0.67586	.	.	ENSG00000135090	ENST00000419821;ENST00000392533;ENST00000535570;ENST00000541186	T;T;T;T	0.34667	1.35;1.35;1.35;1.35	5.05	3.92	0.45320	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000007	T	0.49508	0.1561	L	0.58969	1.84	0.80722	D	1	D	0.71674	0.998	D	0.73708	0.981	T	0.49707	-0.8911	10	0.87932	D	0	.	5.2648	0.15593	0.647:0.0:0.353:0.0	.	76	Q9H2K8	TAOK3_HUMAN	V	76	ENSP00000416374:L76V;ENSP00000376317:L76V;ENSP00000443465:L76V;ENSP00000438820:L76V	ENSP00000376317:L76V	L	-	1	2	TAOK3	117165671	0.999000	0.42202	0.998000	0.56505	0.977000	0.68977	0.816000	0.27267	0.959000	0.37980	0.533000	0.62120	TTA	TAOK3	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000135090		0.303	TAOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAOK3	HGNC	protein_coding	OTTHUMT00000401456.2	-	0.00	102	0	A	NM_016281		118681288	-1	tier1	-	no_errors	ENST00000392533	ensembl	human	known	74_37	missense	18.95	77	18	SNP	1.000	C
TBL3	10607	genome.wustl.edu	37	16	2024421	2024421	+	Silent	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr16:2024421C>T	ENST00000568546.1	+	4	362	c.234C>T	c.(232-234)aaC>aaT	p.N78N		NM_006453.2	NP_006444.2	Q12788	TBL3_HUMAN	transducin (beta)-like 3	78					G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|intracellular signal transduction (GO:0035556)|rRNA processing (GO:0006364)	nucleolus (GO:0005730)|nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)|receptor signaling protein activity (GO:0005057)			breast(1)|endometrium(2)|kidney(4)|lung(7)|ovary(1)|prostate(2)|skin(1)	18						GCCCTGACAACGAGGTATGTG	0.627																																					Melanoma(118;616 1651 35077 38081 48633)												0													130.0	133.0	132.0					16																	2024421		2198	4300	6498	SO:0001819	synonymous_variant	0			U02609	CCDS10453.1	16p13.3	2013-01-10			ENSG00000183751	ENSG00000183751		"""WD repeat domain containing"""	11587	protein-coding gene	gene with protein product		605915				8307582	Standard	NM_006453		Approved	SAZD, UTP13	uc002cnu.1	Q12788	OTTHUMG00000128710	ENST00000568546.1:c.234C>T	16.37:g.2024421C>T			Q59GD6|Q8IVB7|Q96A78	Silent	SNP	pfam_WD40_repeat,pfam_SSU_processome_Utp13,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.N78	ENST00000568546.1	37	c.234	CCDS10453.1	16																																																																																			TBL3	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000183751		0.627	TBL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBL3	HGNC	protein_coding	OTTHUMT00000250615.3	-	0.00	58	0	C	NM_006453		2024421	+1	tier1	-	no_errors	ENST00000568546	ensembl	human	known	74_37	silent	21.28	37	10	SNP	0.983	T
TAT	6898	genome.wustl.edu	37	16	71602142	71602142	+	Nonsense_Mutation	SNP	C	C	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr16:71602142C>A	ENST00000355962.4	-	12	1403	c.1270G>T	c.(1270-1272)Gag>Tag	p.E424*	RP11-432I5.1_ENST00000561529.1_RNA	NM_000353.2	NP_000344.1	P17735	ATTY_HUMAN	tyrosine aminotransferase	424					2-oxoglutarate metabolic process (GO:0006103)|biosynthetic process (GO:0009058)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate metabolic process (GO:0006536)|L-phenylalanine catabolic process (GO:0006559)|response to glucocorticoid (GO:0051384)|response to mercury ion (GO:0046689)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|L-phenylalanine:2-oxoglutarate aminotransferase activity (GO:0080130)|L-tyrosine:2-oxoglutarate aminotransferase activity (GO:0004838)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(3)	29		Ovarian(137;0.125)		Kidney(780;0.0157)	L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)	ATCATCACCTCGGGGACTGTG	0.517																																					Melanoma(198;542 2142 10292 21661 50033)|Esophageal Squamous(48;487 1013 5572 44395 52594)												0													72.0	59.0	63.0					16																	71602142		2198	4300	6498	SO:0001587	stop_gained	0				CCDS10903.1	16q22.1	2012-10-02			ENSG00000198650	ENSG00000198650	2.6.1.5		11573	protein-coding gene	gene with protein product		613018					Standard	NM_000353		Approved		uc002fap.2	P17735	OTTHUMG00000137590	ENST00000355962.4:c.1270G>T	16.37:g.71602142C>A	ENSP00000348234:p.Glu424*		B2R8I1|D3DWS2	Nonsense_Mutation	SNP	pfam_Aminotransferase_I/II,pfam_Tyr_aminoTrfase_ubiquitination,pfam_ArAA_b-elim_lyase/Thr_aldolase,pfam_Aminotrans_V/Cys_dSase,pfam_DegT/StrS_aminotransferase,superfamily_PyrdxlP-dep_Trfase,pirsf_Tyrosine_transaminase,tigrfam_Tyrosine_aminoTrfase,tigrfam_TyrNic_aminoTrfase	p.E424*	ENST00000355962.4	37	c.1270	CCDS10903.1	16	.	.	.	.	.	.	.	.	.	.	C	22.5	4.294261	0.81025	.	.	ENSG00000198650	ENST00000355962	.	.	.	6.17	1.81	0.25067	.	0.232475	0.50627	D	0.000118	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	-4.5016	14.1553	0.65413	0.0:0.7895:0.0:0.2105	.	.	.	.	X	424	.	ENSP00000348234:E424X	E	-	1	0	TAT	70159643	0.542000	0.26426	0.043000	0.18650	0.524000	0.34500	1.209000	0.32357	-0.095000	0.12351	-0.797000	0.03246	GAG	TAT	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase,pirsf_Tyrosine_transaminase,tigrfam_Tyrosine_aminoTrfase,tigrfam_TyrNic_aminoTrfase	ENSG00000198650		0.517	TAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAT	HGNC	protein_coding	OTTHUMT00000268989.1	-	0.00	45	0	C			71602142	-1	tier1	-	no_errors	ENST00000355962	ensembl	human	known	74_37	nonsense	18.18	18	4	SNP	0.605	A
TDH	157739	genome.wustl.edu	37	8	11219167	11219167	+	RNA	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr8:11219167G>A	ENST00000534302.1	+	0	496									L-threonine dehydrogenase (pseudogene)																		CCTGGATGTCGCTGCGGAACA	0.458																																																	0																																												0			AJ301562		8p23.1	2013-09-26	2013-09-26		ENSG00000154316	ENSG00000154316		"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	15547	pseudogene	pseudogene	"""short chain dehydrogenase/reductase family 14E, member 1 (pseudogene)"""	615174	"""L-threonine dehydrogenase"""			11896452, 12361482, 19027726	Standard	NR_001578		Approved	FLJ25033, SDR14E1P	uc003wtq.1	Q8IZJ6	OTTHUMG00000165365		8.37:g.11219167G>A				RNA	SNP	-	NULL	ENST00000534302.1	37	NULL		8																																																																																			TDH	-	-	ENSG00000154316		0.458	TDH-002	KNOWN	basic	processed_transcript	TDH	HGNC	pseudogene	OTTHUMT00000385807.1		0.00	77	0	G	NM_152566		11219167	+1			no_errors	ENST00000525246	ensembl	human	known	74_37	rna	5.06	75	4	SNP	1.000	A
C8orf12	83656	genome.wustl.edu	37	8	11223103	11223103	+	5'Flank	SNP	C	C	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr8:11223103C>A	ENST00000284481.3	+	0	0				TDH_ENST00000534302.1_RNA					chromosome 8 open reading frame 12																		GGATGGTTGGCCGATGAACTT	0.448																																																	0																																										SO:0001631	upstream_gene_variant	0			AJ301563		8p23.1	2013-01-15			ENSG00000184608	ENSG00000184608			15548	other	unknown							Standard	NR_026814		Approved			Q96KT0	OTTHUMG00000165366		8.37:g.11223103C>A	Exception_encountered			RNA	SNP	-	NULL	ENST00000284481.3	37	NULL		8																																																																																			TDH	-	-	ENSG00000154316		0.448	C8orf12-201	KNOWN	basic|appris_principal	protein_coding	TDH	HGNC	protein_coding		-	0.00	31	0	C	NR_026814		11223103	+1	tier1	-	no_errors	ENST00000525246	ensembl	human	known	74_37	rna	27.50	29	11	SNP	1.000	A
TDRD9	122402	genome.wustl.edu	37	14	104497480	104497480	+	Missense_Mutation	SNP	G	G	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr14:104497480G>T	ENST00000409874.4	+	29	3366	c.3318G>T	c.(3316-3318)aaG>aaT	p.K1106N	TDRD9_ENST00000339063.5_Intron	NM_153046.2	NP_694591.2	Q8NDG6	TDRD9_HUMAN	tudor domain containing 9	1106					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|piP-body (GO:0071547)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0768)				TCTTTTCCAAGTCAGTAGAAA	0.373																																																	0													115.0	99.0	104.0					14																	104497480		692	1591	2283	SO:0001583	missense	0			AK093483	CCDS9987.2	14q32.33	2013-01-23	2004-04-01	2004-04-02	ENSG00000156414	ENSG00000156414		"""Tudor domain containing"""	20122	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 75"""	C14orf75			Standard	NM_153046		Approved	DKFZp434N0820, FLJ36164, NET54	uc001yom.4	Q8NDG6	OTTHUMG00000152876	ENST00000409874.4:c.3318G>T	14.37:g.104497480G>T	ENSP00000387303:p.Lys1106Asn		A1A4S7|Q6ZU54|Q8N7T3|Q8N827|Q8N9V5|Q96AS9	Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_Tudor,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,smart_Tudor,pfscan_Tudor,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.K1106N	ENST00000409874.4	37	c.3318	CCDS9987.2	14	.	.	.	.	.	.	.	.	.	.	G	12.99	2.102134	0.37048	.	.	ENSG00000156414	ENST00000409874	T	0.03580	3.88	6.05	-3.49	0.04724	.	.	.	.	.	T	0.03434	0.0099	L	0.43701	1.375	0.29835	N	0.829729	B	0.06786	0.001	B	0.06405	0.002	T	0.38499	-0.9658	9	0.27082	T	0.32	.	8.6792	0.34198	0.3327:0.2033:0.4639:0.0	.	1106	Q8NDG6	TDRD9_HUMAN	N	1106	ENSP00000387303:K1106N	ENSP00000387303:K1106N	K	+	3	2	TDRD9	103567233	0.000000	0.05858	0.616000	0.29078	0.731000	0.41821	-1.462000	0.02364	-0.453000	0.07076	-0.302000	0.09304	AAG	TDRD9	-	NULL	ENSG00000156414		0.373	TDRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TDRD9	HGNC	protein_coding	OTTHUMT00000328325.3	-	0.00	44	0	G	NM_153046		104497480	+1	tier1	-	no_errors	ENST00000409874	ensembl	human	known	74_37	missense	5.71	66	4	SNP	0.013	T
TIE1	7075	genome.wustl.edu	37	1	43774548	43774548	+	Intron	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr1:43774548G>A	ENST00000372476.3	+	8	1121				TIE1_ENST00000433781.2_Intron|TIE1_ENST00000538015.1_Missense_Mutation_p.R350K|TIE1_ENST00000441333.2_Intron	NM_001253357.1|NM_005424.4	NP_001240286.1|NP_005415.1	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and EGF-like domains 1						angiogenesis (GO:0001525)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|peptidyl-tyrosine phosphorylation (GO:0018108)|plasma membrane fusion (GO:0045026)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(8)|lung(28)|ovary(3)|prostate(2)|salivary_gland(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	70	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TCAGGCTGGAGGGACTGGGTA	0.577																																																	0																																										SO:0001627	intron_variant	0			BC038239	CCDS482.1	1p34-p33	2013-02-11	2004-12-13	2004-12-14	ENSG00000066056	ENSG00000066056	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11809	protein-coding gene	gene with protein product		600222	"""tyrosine kinase with immunoglobulin and epidermal growth factor homology domains 1"""	TIE		1312667	Standard	NM_005424		Approved	JTK14	uc001ciu.3	P35590	OTTHUMG00000007282	ENST00000372476.3:c.1043-109G>A	1.37:g.43774548G>A			B5A949|B5A950	Missense_Mutation	SNP	smart_EG-like_dom,pfscan_EG-like_dom	p.R350K	ENST00000372476.3	37	c.1049	CCDS482.1	1	.	.	.	.	.	.	.	.	.	.	G	9.847	1.192586	0.21954	.	.	ENSG00000066056	ENST00000538015	T	0.33438	1.41	4.01	3.09	0.35607	.	.	.	.	.	T	0.12178	0.0296	.	.	.	0.19775	N	0.999953	.	.	.	.	.	.	T	0.25572	-1.0128	6	0.06099	T	0.92	.	8.3114	0.32073	0.116:0.0:0.884:0.0	.	.	.	.	K	350	ENSP00000440063:R350K	ENSP00000440063:R350K	R	+	2	0	TIE1	43547135	0.006000	0.16342	0.034000	0.17996	0.103000	0.19146	1.577000	0.36515	0.981000	0.38548	0.563000	0.77884	AGG	TIE1	-	NULL	ENSG00000066056		0.577	TIE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIE1	HGNC	protein_coding	OTTHUMT00000019011.1	-	0.00	16	0	G	NM_005424		43774548	+1	tier1	-	no_errors	ENST00000538015	ensembl	human	known	74_37	missense	25.00	12	4	SNP	0.041	A
TMCC3	57458	genome.wustl.edu	37	12	94972297	94972297	+	Missense_Mutation	SNP	C	C	A	rs369750943		TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr12:94972297C>A	ENST00000261226.4	-	3	1135	c.1004G>T	c.(1003-1005)cGa>cTa	p.R335L	TMCC3_ENST00000551457.1_Missense_Mutation_p.R304L	NM_020698.2	NP_065749	Q9ULS5	TMCC3_HUMAN	transmembrane and coiled-coil domain family 3	335						integral component of membrane (GO:0016021)				NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	29						GTCCTCCAGTCGCTCATACCT	0.532																																																	0													65.0	52.0	56.0					12																	94972297		2203	4300	6503	SO:0001583	missense	0			AB032971	CCDS31877.1, CCDS73506.1	12q22	2005-01-21	2005-07-13			ENSG00000057704		"""Transmembrane and coiled-coil domain containing"""	29199	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 3"""			10574461	Standard	XM_005269039		Approved	KIAA1145	uc001tdj.2	Q9ULS5	OTTHUMG00000170225	ENST00000261226.4:c.1004G>T	12.37:g.94972297C>A	ENSP00000261226:p.Arg335Leu		Q8IWB2	Missense_Mutation	SNP	pfam_Predicted_TM_coiled-coil_2	p.R335L	ENST00000261226.4	37	c.1004	CCDS31877.1	12	.	.	.	.	.	.	.	.	.	.	C	24.9	4.576549	0.86645	.	.	ENSG00000057704	ENST00000261226;ENST00000551457	T;T	0.47869	0.83;0.83	5.79	5.79	0.91817	.	0.050054	0.85682	D	0.000000	T	0.68988	0.3061	M	0.73372	2.23	0.53688	D	0.99997	D	0.76494	0.999	D	0.71656	0.974	T	0.65772	-0.6087	10	0.40728	T	0.16	-17.718	20.0407	0.97588	0.0:1.0:0.0:0.0	.	335	Q9ULS5	TMCC3_HUMAN	L	335;304	ENSP00000261226:R335L;ENSP00000449888:R304L	ENSP00000261226:R335L	R	-	2	0	TMCC3	93496428	0.993000	0.37304	0.996000	0.52242	0.945000	0.59286	2.702000	0.47102	2.746000	0.94184	0.561000	0.74099	CGA	TMCC3	-	pfam_Predicted_TM_coiled-coil_2	ENSG00000057704		0.532	TMCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCC3	HGNC	protein_coding	OTTHUMT00000408113.1	-	0.00	30	0	C	NM_020698		94972297	-1	tier1	-	no_errors	ENST00000261226	ensembl	human	known	74_37	missense	15.00	17	3	SNP	1.000	A
TMCO3	55002	genome.wustl.edu	37	13	114149957	114149957	+	Missense_Mutation	SNP	C	C	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr13:114149957C>A	ENST00000434316.2	+	2	420	c.61C>A	c.(61-63)Cag>Aag	p.Q21K	TMCO3_ENST00000375391.1_Missense_Mutation_p.Q21K|TMCO3_ENST00000474393.1_3'UTR	NM_017905.4	NP_060375.4	Q6UWJ1	TMCO3_HUMAN	transmembrane and coiled-coil domains 3	21						integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)			NS(1)|endometrium(4)|large_intestine(9)|liver(1)|lung(8)|prostate(1)|stomach(1)	25	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0145)|all_epithelial(44;0.00286)|all_lung(25;0.0273)|Breast(118;0.0411)|Lung NSC(25;0.0983)	all cancers(43;0.0317)			CTGGGCGGTGCAGGCTGTGGA	0.652																																																	0													78.0	72.0	74.0					13																	114149957		2203	4300	6503	SO:0001583	missense	0			BC012564	CCDS9537.1	13q34	2008-02-05	2005-07-22	2005-07-22	ENSG00000150403	ENSG00000150403			20329	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 11"""	C13orf11			Standard	NM_017905		Approved	FLJ20623	uc001vtu.4	Q6UWJ1	OTTHUMG00000017389	ENST00000434316.2:c.61C>A	13.37:g.114149957C>A	ENSP00000389399:p.Gln21Lys		Q5JSB1|Q6NUN1|Q8NG29|Q8TCI6|Q96EA6|Q9NWT2	Missense_Mutation	SNP	pfam_Cation/H_exchanger	p.Q21K	ENST00000434316.2	37	c.61	CCDS9537.1	13	.	.	.	.	.	.	.	.	.	.	C	4.049	0.006751	0.07866	.	.	ENSG00000150403	ENST00000434316;ENST00000375391	T	0.28255	1.62	5.59	-5.45	0.02616	.	1.454830	0.03777	N	0.260718	T	0.10035	0.0246	N	0.03608	-0.345	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.11329	0.006;0.001	T	0.28299	-1.0048	10	0.06099	T	0.92	-11.4639	4.75	0.13056	0.2314:0.2606:0.4242:0.0837	.	21;21	Q6UWJ1;Q6UWJ1-2	TMCO3_HUMAN;.	K	21	ENSP00000389399:Q21K	ENSP00000364540:Q21K	Q	+	1	0	TMCO3	113197958	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.533000	0.06157	-0.537000	0.06290	0.650000	0.86243	CAG	TMCO3	-	NULL	ENSG00000150403		0.652	TMCO3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCO3	HGNC	protein_coding	OTTHUMT00000045931.3		0.00	32	0	C	NM_017905		114149957	+1			no_errors	ENST00000434316	ensembl	human	known	74_37	missense	6.06	31	2	SNP	0.000	A
TMEM109	79073	genome.wustl.edu	37	11	60689319	60689319	+	Silent	SNP	C	C	G			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr11:60689319C>G	ENST00000227525.3	+	4	817	c.414C>G	c.(412-414)gcC>gcG	p.A138A	TMEM132A_ENST00000453848.2_5'Flank|TMEM132A_ENST00000005286.4_5'Flank|TMEM109_ENST00000536171.1_Silent_p.A138A|RP11-881M11.4_ENST00000543907.1_RNA	NM_024092.2	NP_076997.1	Q9BVC6	TM109_HUMAN	transmembrane protein 109	138					cellular response to gamma radiation (GO:0071480)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of cell death (GO:0060548)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)				central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(1)|ovary(1)|skin(1)	8						GAGCAGGGGCCCTGGTCGTCT	0.632																																																	0													107.0	111.0	110.0					11																	60689319		2203	4299	6502	SO:0001819	synonymous_variant	0				CCDS7996.1	11q12.2	2005-12-22				ENSG00000110108			28771	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_024092		Approved	MGC5508	uc001nqg.3	Q9BVC6		ENST00000227525.3:c.414C>G	11.37:g.60689319C>G				Silent	SNP	NULL	p.A138	ENST00000227525.3	37	c.414	CCDS7996.1	11																																																																																			TMEM109	-	NULL	ENSG00000110108		0.632	TMEM109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM109	HGNC	protein_coding	OTTHUMT00000396343.1	-	0.00	142	0	C	NM_024092		60689319	+1	tier1	-	no_errors	ENST00000227525	ensembl	human	known	74_37	silent	17.74	102	22	SNP	1.000	G
TMEM132D	121256	genome.wustl.edu	37	12	129566504	129566504	+	Missense_Mutation	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr12:129566504C>T	ENST00000422113.2	-	7	2049	c.1723G>A	c.(1723-1725)Gcc>Acc	p.A575T	TMEM132D_ENST00000389441.4_Missense_Mutation_p.A113T	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	575					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		CGCACCATGGCGTGCTGGTAC	0.657																																																	0													47.0	49.0	48.0					12																	129566504		2203	4300	6503	SO:0001583	missense	0			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.1723G>A	12.37:g.129566504C>T	ENSP00000408581:p.Ala575Thr		Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	NULL	p.A575T	ENST00000422113.2	37	c.1723	CCDS9266.1	12	.	.	.	.	.	.	.	.	.	.	C	26.0	4.698878	0.88830	.	.	ENSG00000151952	ENST00000389441;ENST00000422113	T;T	0.19394	2.15;2.15	4.72	4.72	0.59763	.	0.000000	0.64402	D	0.000003	T	0.48447	0.1500	M	0.83312	2.635	0.80722	D	1	D;D	0.76494	0.999;0.988	D;P	0.63381	0.914;0.704	T	0.55405	-0.8146	9	.	.	.	-45.5966	17.6741	0.88225	0.0:1.0:0.0:0.0	.	575;113	Q14C87;Q14C87-2	T132D_HUMAN;.	T	113;575	ENSP00000374092:A113T;ENSP00000408581:A575T	.	A	-	1	0	TMEM132D	128132457	1.000000	0.71417	0.923000	0.36655	0.938000	0.57974	4.763000	0.62257	2.149000	0.67028	0.561000	0.74099	GCC	TMEM132D	-	NULL	ENSG00000151952		0.657	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132D	HGNC	protein_coding	OTTHUMT00000399592.1	-	0.00	58	0	C	NM_133448		129566504	-1	tier1	-	no_errors	ENST00000422113	ensembl	human	known	74_37	missense	15.38	33	6	SNP	0.999	T
TMEM8C	389827	genome.wustl.edu	37	9	136389832	136389832	+	Splice_Site	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr9:136389832C>T	ENST00000339996.3	-	1	236	c.135G>A	c.(133-135)gcG>gcA	p.A45A	TMEM8C_ENST00000413714.1_Intron	NM_001080483.2	NP_001073952.1	A6NI61	TMM8C_HUMAN	transmembrane protein 8C	45					muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|plasma membrane fusion (GO:0045026)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|large_intestine(2)|lung(4)	8						CCAGACTCACCGCCACGAAGA	0.612																																																	0													81.0	65.0	70.0					9																	136389832		2203	4300	6503	SO:0001630	splice_region_variant	0			BX324209	CCDS35170.1	9q34.2	2009-06-19		2009-06-19	ENSG00000187616	ENSG00000187616			33778	protein-coding gene	gene with protein product	"""transmembrane protein 226"""	615345					Standard	NM_001080483		Approved	TMEM226	uc011mdk.2	A6NI61	OTTHUMG00000131685	ENST00000339996.3:c.135+1G>A	9.37:g.136389832C>T				Silent	SNP	pfam_DUF3522	p.A45	ENST00000339996.3	37	c.135	CCDS35170.1	9																																																																																			TMEM8C	-	pfam_DUF3522	ENSG00000187616		0.612	TMEM8C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM8C	HGNC	protein_coding	OTTHUMT00000356200.2	-	0.00	45	0	C	NM_001080483	Silent	136389832	-1	tier1	-	no_errors	ENST00000339996	ensembl	human	known	74_37	silent	14.00	43	7	SNP	1.000	T
TNFSF12	8742	genome.wustl.edu	37	17	7452775	7452775	+	Intron	DEL	C	C	-			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr17:7452775delC	ENST00000293825.6	+	2	422				TNFSF12_ENST00000557233.1_Intron|TNFSF12-TNFSF13_ENST00000293826.4_Intron	NM_003809.2	NP_003800.1	O43508	TNF12_HUMAN	tumor necrosis factor (ligand) superfamily, member 12						angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|endothelial cell migration (GO:0043542)|immune response (GO:0006955)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)	cytokine activity (GO:0005125)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|large_intestine(5)|prostate(2)	11		Prostate(122;0.157)				GGGTGACGCTCCCTCCTTCCC	0.706																																																	0													26.0	25.0	26.0					17																	7452775		2160	4240	6400	SO:0001627	intron_variant	0			AF030099	CCDS11109.1	17p13.1	2008-02-01			ENSG00000239697	ENSG00000239697		"""Tumor necrosis factor (ligand) superfamily"""	11927	protein-coding gene	gene with protein product		602695				9405449, 9560343	Standard	NM_003809		Approved	TWEAK, DR3LG, APO3L		O43508	OTTHUMG00000108148	ENST00000293825.6:c.160-16C>-	17.37:g.7452775delC			Q8IZK7|Q8WUZ7	RNA	DEL	-	NULL	ENST00000293825.6	37	NULL	CCDS11109.1	17																																																																																			TNFSF12	-	-	ENSG00000239697		0.706	TNFSF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFSF12	HGNC	protein_coding	OTTHUMT00000226951.2		0.00	74	0	C	NM_003809		7452775	+1	tier1		no_errors	ENST00000462619	ensembl	human	known	74_37	rna	20.29	55	14	DEL	0.997	-
TNR	7143	genome.wustl.edu	37	1	175299280	175299280	+	Silent	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr1:175299280G>A	ENST00000367674.2	-	21	4431	c.3723C>T	c.(3721-3723)taC>taT	p.Y1241Y	RP3-518E13.2_ENST00000569593.1_RNA|TNR_ENST00000263525.2_Silent_p.Y1241Y			Q92752	TENR_HUMAN	tenascin R	1241	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					AGAACCTGTCGTAGGAGGCGA	0.587																																																	0													82.0	69.0	74.0					1																	175299280		2203	4300	6503	SO:0001819	synonymous_variant	0			X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.3723C>T	1.37:g.175299280G>A			C9J563|Q15568|Q5R3G0	Silent	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_Fibronectin_type3	p.Y1241	ENST00000367674.2	37	c.3723	CCDS1318.1	1																																																																																			TNR	-	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	ENSG00000116147		0.587	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNR	HGNC	protein_coding	OTTHUMT00000084414.4		0.00	21	0	G	NM_003285		175299280	-1			no_errors	ENST00000263525	ensembl	human	known	74_37	silent	11.11	32	4	SNP	0.983	A
TP53	7157	genome.wustl.edu	37	17	7577538	7577538	+	Missense_Mutation	SNP	C	C	T	rs11540652		TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr17:7577538C>T	ENST00000269305.4	-	7	932	c.743G>A	c.(742-744)cGg>cAg	p.R248Q	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.R248Q|TP53_ENST00000445888.2_Missense_Mutation_p.R248Q|TP53_ENST00000455263.2_Missense_Mutation_p.R248Q|TP53_ENST00000413465.2_Missense_Mutation_p.R248Q|TP53_ENST00000420246.2_Missense_Mutation_p.R248Q	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248Q(580)|p.R248L(75)|p.R248P(19)|p.R155Q(18)|p.0?(8)|p.?(5)|p.R155L(3)|p.R155P(2)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.M246_P250delMNRRP(2)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*96(1)|p.R248fs*>39(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GATGGGCCTCCGGTTCATGCC	0.572	R248Q(BL41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CA46_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(EM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HCC1143_BREAST)|R248Q(HCC70_BREAST)|R248Q(HEC1A_ENDOMETRIUM)|R248Q(HS683_CENTRAL_NERVOUS_SYSTEM)|R248Q(HSC4_UPPER_AERODIGESTIVE_TRACT)|R248Q(KASUMI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYSE150_OESOPHAGUS)|R248Q(MOLM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NAMALWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NB4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIH211_LUNG)|R248Q(NCIN87_STOMACH)|R248Q(NIHOVCAR3_OVARY)|R248Q(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(P12ICHIKAWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PANC0203_PANCREAS)|R248Q(PC14_LUNG)|R248Q(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(RT112_URINARY_TRACT)|R248Q(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SF295_CENTRAL_NERVOUS_SYSTEM)|R248Q(SKUT1_SOFT_TISSUE)|R248Q(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SW1463_LARGE_INTESTINE)|R248Q(WSUDLCL2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	725	Substitution - Missense(698)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(2)|Complex - compound substitution(1)	large_intestine(138)|breast(83)|haematopoietic_and_lymphoid_tissue(74)|lung(71)|upper_aerodigestive_tract(63)|central_nervous_system(46)|oesophagus(37)|urinary_tract(37)|ovary(36)|stomach(35)|endometrium(23)|skin(18)|prostate(11)|bone(10)|biliary_tract(9)|liver(9)|pancreas(7)|vulva(3)|kidney(3)|cervix(3)|peritoneum(2)|thyroid(2)|soft_tissue(1)|pituitary(1)|adrenal_gland(1)|small_intestine(1)|thymus(1)	GRCh37	CM920675	TP53	M	rs11540652	C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	0,4406		0,0,2203	152.0	112.0	126.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	743,743,743,743,347,347,347	3.7	1.0	17	dbSNP_120	126	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	43,43,43,43,43,43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	248/394,248/394,248/347,248/342,116/262,116/210,116/215	7577538	1,13005	2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.743G>A	17.37:g.7577538C>T	ENSP00000269305:p.Arg248Gln		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R248Q	ENST00000269305.4	37	c.743	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	27.3	4.822907	0.90873	0.0	1.16E-4	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99864	-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28	4.62	3.65	0.41850	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99840	0.9927	M	0.88640	2.97	0.58432	A	0.999994	D;D;D;D;D;D	0.89917	1.0;0.994;1.0;1.0;1.0;1.0	D;P;D;D;D;D	0.91635	0.996;0.882;0.999;0.995;0.996;0.995	D	0.96819	0.9602	9	0.72032	D	0.01	-9.5643	10.6687	0.45745	0.0:0.9059:0.0:0.0941	rs11540652;rs11540652	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	Q	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248Q;ENSP00000352610:R248Q;ENSP00000269305:R248Q;ENSP00000398846:R248Q;ENSP00000391127:R248Q;ENSP00000391478:R248Q;ENSP00000425104:R116Q;ENSP00000423862:R155Q	ENSP00000269305:R248Q	R	-	2	0	TP53	7518263	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	5.884000	0.69729	1.305000	0.44909	0.462000	0.41574	CGG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	68	0	C	NM_000546		7577538	-1	tier1	rs11540652	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	41.07	33	23	SNP	1.000	T
TP53I13	90313	genome.wustl.edu	37	17	27899268	27899268	+	Missense_Mutation	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr17:27899268C>T	ENST00000301057.7	+	6	737	c.622C>T	c.(622-624)Cgg>Tgg	p.R208W	RP11-68I3.4_ENST00000579050.1_RNA|RP11-68I3.2_ENST00000581474.1_RNA	NM_138349.2	NP_612358.3	Q8NBR0	P5I13_HUMAN	tumor protein p53 inducible protein 13	208						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|kidney(1)|lung(1)|urinary_tract(1)	4				READ - Rectum adenocarcinoma(3;0.236)		GCGGAGGCTGCGGGCTGCCCT	0.662																																																	0													19.0	23.0	22.0					17																	27899268		2029	4166	6195	SO:0001583	missense	0			AK075341	CCDS42289.1	17q11.2	2006-01-16				ENSG00000167543			25102	protein-coding gene	gene with protein product						14767535	Standard	NM_138349		Approved	DSCP1	uc002hee.3	Q8NBR0		ENST00000301057.7:c.622C>T	17.37:g.27899268C>T	ENSP00000301057:p.Arg208Trp		Q7L5U3	Missense_Mutation	SNP	NULL	p.R208W	ENST00000301057.7	37	c.622	CCDS42289.1	17	.	.	.	.	.	.	.	.	.	.	C	25.4	4.632122	0.87660	.	.	ENSG00000167543	ENST00000301057	.	.	.	3.94	3.94	0.45596	.	0.080371	0.42420	D	0.000714	T	0.72203	0.3431	M	0.70595	2.14	0.37805	D	0.927853	D	0.89917	1.0	D	0.81914	0.995	T	0.77869	-0.2427	9	0.72032	D	0.01	-18.6767	11.6787	0.51444	0.0:1.0:0.0:0.0	.	208	Q8NBR0	P5I13_HUMAN	W	208	.	ENSP00000301057:R208W	R	+	1	2	TP53I13	24923394	0.951000	0.32395	0.996000	0.52242	0.361000	0.29550	3.740000	0.55082	2.199000	0.70637	0.462000	0.41574	CGG	TP53I13	-	NULL	ENSG00000167543		0.662	TP53I13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53I13	HGNC	protein_coding	OTTHUMT00000447804.2	-	0.00	48	0	C	NM_138349		27899268	+1	tier1	-	no_errors	ENST00000301057	ensembl	human	known	74_37	missense	9.76	37	4	SNP	0.994	T
TRA2B	6434	genome.wustl.edu	37	3	185637260	185637262	+	In_Frame_Del	DEL	TCC	TCC	-			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	TCC	TCC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr3:185637260_185637262delTCC	ENST00000453386.2	-	7	1020_1022	c.745_747delGGA	c.(745-747)ggadel	p.G249del	TRA2B_ENST00000382191.4_In_Frame_Del_p.G149del	NM_004593.2	NP_004584.1	P62995	TRA2B_HUMAN	transformer 2 beta homolog (Drosophila)	249	Arg/Ser-rich (RS2 domain).				mRNA splicing, via spliceosome (GO:0000398)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing, via transesterification reactions (GO:0000375)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|kidney(1)|large_intestine(6)|lung(4)|ovary(3)|prostate(1)|urinary_tract(1)	18						CAGCTCTCCAtcctcctcctcct	0.404																																																	0																																										SO:0001651	inframe_deletion	0			AF057159	CCDS33905.1, CCDS58872.1	3q26.2-q27	2014-06-13	2009-02-27	2009-02-27	ENSG00000136527	ENSG00000136527		"""RNA binding motif (RRM) containing"""	10781	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 156"""	602719	"""splicing factor, arginine/serine-rich 10 (transformer 2 homolog, Drosophila)"""	SFRS10		9790768	Standard	NM_004593		Approved	Htra2-beta, PPP1R156	uc003fpv.3	P62995	OTTHUMG00000156641	ENST00000453386.2:c.745_747delGGA	3.37:g.185637269_185637271delTCC	ENSP00000416959:p.Gly249del		B4DVK2|D3DNU3|O15449|Q15815|Q64283	In_Frame_Del	DEL	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.G249in_frame_del	ENST00000453386.2	37	c.747_745	CCDS33905.1	3																																																																																			TRA2B	-	NULL	ENSG00000136527		0.404	TRA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRA2B	HGNC	protein_coding	OTTHUMT00000344984.1		0.00	60	0	TCC	NM_004593		185637262	-1	tier1		no_errors	ENST00000453386	ensembl	human	known	74_37	in_frame_del	8.11	34	3	DEL	1.000:1.000:1.000	-
TRAM1L1	133022	genome.wustl.edu	37	4	118005745	118005745	+	Missense_Mutation	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr4:118005745C>T	ENST00000310754.4	-	1	991	c.805G>A	c.(805-807)Gta>Ata	p.V269I		NM_152402.2	NP_689615.2	Q8N609	TR1L1_HUMAN	translocation associated membrane protein 1-like 1	269	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22						ACAGTGAGTACGGAAACAATT	0.438																																																	0													72.0	68.0	69.0					4																	118005745		2203	4300	6503	SO:0001583	missense	0			AK074617	CCDS3707.1	4q26	2008-02-05			ENSG00000174599	ENSG00000174599			28371	protein-coding gene	gene with protein product						12477932	Standard	NM_152402		Approved	MGC26568	uc003ibv.4	Q8N609	OTTHUMG00000132956	ENST00000310754.4:c.805G>A	4.37:g.118005745C>T	ENSP00000309402:p.Val269Ile		Q8N2L7	Missense_Mutation	SNP	pfam_TRAM1,pfam_TLC-dom,smart_TLC-dom,pirsf_Translocation_assoc_membrane,pfscan_TLC-dom	p.V269I	ENST00000310754.4	37	c.805	CCDS3707.1	4	.	.	.	.	.	.	.	.	.	.	C	5.756	0.323818	0.10900	.	.	ENSG00000174599	ENST00000310754	D	0.84298	-1.83	3.75	-0.175	0.13315	TRAM/LAG1/CLN8 homology domain (3);	0.270936	0.35067	N	0.003473	T	0.81795	0.4898	M	0.68317	2.08	0.23693	N	0.997097	B	0.28801	0.223	B	0.34301	0.179	T	0.73610	-0.3928	10	0.59425	D	0.04	-22.4129	8.2496	0.31708	0.4351:0.4237:0.1412:0.0	.	269	Q8N609	TR1L1_HUMAN	I	269	ENSP00000309402:V269I	ENSP00000309402:V269I	V	-	1	0	TRAM1L1	118225193	0.390000	0.25213	0.000000	0.03702	0.019000	0.09904	0.973000	0.29422	-0.074000	0.12820	0.655000	0.94253	GTA	TRAM1L1	-	pfam_TLC-dom,smart_TLC-dom,pirsf_Translocation_assoc_membrane,pfscan_TLC-dom	ENSG00000174599		0.438	TRAM1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAM1L1	HGNC	protein_coding	OTTHUMT00000256513.1	-	0.00	20	0	C	NM_152402		118005745	-1	tier1	-	no_errors	ENST00000310754	ensembl	human	known	74_37	missense	15.15	28	5	SNP	0.008	T
TRIM5	85363	genome.wustl.edu	37	11	5686747	5686747	+	Intron	SNP	G	G	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr11:5686747G>T	ENST00000380034.3	-	8	1152				TRIM5_ENST00000483835.1_Intron|TRIM5_ENST00000380027.1_Intron|TRIM5_ENST00000396853.4_Intron|TRIM5_ENST00000396847.3_Missense_Mutation_p.P345H|TRIM5_ENST00000396855.3_Intron|TRIM5_ENST00000305836.5_Intron	NM_033034.2|NM_033092.2	NP_149023.2|NP_149083.2	Q9C035	TRIM5_HUMAN	tripartite motif containing 5						activation of innate immune response (GO:0002218)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein K63-linked ubiquitination (GO:0070534)|protein trimerization (GO:0070206)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|signaling pattern recognition receptor activity (GO:0008329)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)|Lung NSC(207;0.138)|all_lung(207;0.221)		Epithelial(150;7.21e-09)|BRCA - Breast invasive adenocarcinoma(625;0.139)		TTATAAGGAGGGGTAAGTTAT	0.299											OREG0003727	type=REGULATORY REGION|Gene=AK074363|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0													74.0	80.0	78.0					11																	5686747		2185	4297	6482	SO:0001627	intron_variant	0			AF220025	CCDS31392.1, CCDS31393.1, CCDS31394.1	11p15	2014-06-03	2011-01-25		ENSG00000132256	ENSG00000132256		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16276	protein-coding gene	gene with protein product	"""tripartite motif protein TRIM5"", ""tripartite motif protein TRIM"""	608487	"""tripartite motif-containing 5"""			11331580	Standard	NM_033034		Approved	RNF88, TRIM5alpha	uc001mbm.2	Q9C035	OTTHUMG00000066893	ENST00000380034.3:c.896-122C>A	11.37:g.5686747G>T		628	A6NGQ1|A8WFA8|D3DQS8|D3DQS9|G3GJY1|Q2MLV4|Q2MLV8|Q2MLV9|Q2MLW1|Q2MLW3|Q2MLW4|Q2MLW6|Q2MLW7|Q2MLX1|Q2MLX2|Q2MLX3|Q2MLX5|Q2MLY3|Q2MLY4|Q2V6Q6|Q6GX26|Q8WU46|Q96SR5|Q9C031|Q9C032|Q9C033|Q9C034	Missense_Mutation	SNP	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_Znf_B-box,pfscan_Znf_B-box,pfscan_Znf_RING	p.P345H	ENST00000380034.3	37	c.1034	CCDS31393.1	11	.	.	.	.	.	.	.	.	.	.	G	4.947	0.175924	0.09443	.	.	ENSG00000132256	ENST00000396847	T	0.69561	-0.41	3.52	-3.42	0.04825	.	.	.	.	.	T	0.62708	0.2450	.	.	.	0.09310	N	1	D	0.63046	0.992	P	0.51385	0.668	T	0.56884	-0.7905	8	0.87932	D	0	.	4.0617	0.09841	0.3135:0.3793:0.3072:0.0	.	345	Q9C035-3	.	H	345	ENSP00000380058:P345H	ENSP00000380058:P345H	P	-	2	0	TRIM5	5643323	0.000000	0.05858	0.001000	0.08648	0.105000	0.19272	-0.005000	0.12855	-0.510000	0.06523	0.563000	0.77884	CCC	TRIM5	-	NULL	ENSG00000132256		0.299	TRIM5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIM5	HGNC	protein_coding	OTTHUMT00000143360.3	-	0.00	55	0	G	NM_033034		5686747	-1	tier1	-	no_errors	ENST00000396847	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.001	T
TRIM49B	283116	genome.wustl.edu	37	11	49059118	49059118	+	Missense_Mutation	SNP	A	A	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr11:49059118A>C	ENST00000332682.7	+	7	976	c.948A>C	c.(946-948)caA>caC	p.Q316H		NM_001206626.1	NP_001193555.1	A6NDI0	TR49B_HUMAN	tripartite motif containing 49B	316	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			lung(8)	8						GTGACCATCAAGATGTACCCT	0.413																																																	0																																										SO:0001583	missense	0				CCDS55762.1	11p11.12	2014-02-17			ENSG00000182053	ENSG00000182053		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	42955	protein-coding gene	gene with protein product							Standard	NM_001206626		Approved		uc021qix.1	A6NDI0		ENST00000332682.7:c.948A>C	11.37:g.49059118A>C	ENSP00000330216:p.Gln316His			Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.Q316H	ENST00000332682.7	37	c.948	CCDS55762.1	11	.	.	.	.	.	.	.	.	.	.	A	3.072	-0.190807	0.06299	.	.	ENSG00000182053	ENST00000332682	T	0.64803	-0.12	0.407	0.407	0.16371	.	.	.	.	.	T	0.65575	0.2704	M	0.75264	2.295	0.09310	N	1	.	.	.	.	.	.	T	0.57213	-0.7850	6	0.44086	T	0.13	.	.	.	.	.	.	.	.	H	316	ENSP00000330216:Q316H	ENSP00000330216:Q316H	Q	+	3	2	AC084851.1	49015694	0.068000	0.21057	0.009000	0.14445	0.008000	0.06430	0.347000	0.20014	0.374000	0.24650	0.155000	0.16302	CAA	TRIM49B	-	superfamily_ConA-like_lec_gl_sf,pfscan_B30.2/SPRY	ENSG00000182053		0.413	TRIM49B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM49B	HGNC	protein_coding		-	0.00	193	0	A			49059118	+1	tier1	-	no_errors	ENST00000332682	ensembl	human	known	74_37	missense	19.07	157	37	SNP	0.079	C
TRIM51	84767	genome.wustl.edu	37	11	55657514	55657514	+	Splice_Site	SNP	A	A	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr11:55657514A>T	ENST00000449290.2	+	6	950	c.858A>T	c.(856-858)agA>agT	p.R286S	TRIM51_ENST00000244891.3_Splice_Site_p.R143S	NM_032681.3	NP_116070.2	Q9BSJ1	TRI51_HUMAN	tripartite motif-containing 51	286	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)										GTGGATTCAGAGGTGAGTGTC	0.478																																																	0													47.0	43.0	44.0					11																	55657514		2201	4295	6496	SO:0001630	splice_region_variant	0			BC005014		11p11	2013-01-09	2012-05-18	2012-05-18	ENSG00000124900	ENSG00000124900		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19023	protein-coding gene	gene with protein product			"""SPRY domain containing 5"""	SPRYD5			Standard	NM_032681		Approved	TRIM51A	uc010rip.2	Q9BSJ1	OTTHUMG00000156437	ENST00000449290.2:c.859+1A>T	11.37:g.55657514A>T			A6NMG2	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.R286S	ENST00000449290.2	37	c.858		11	.	.	.	.	.	.	.	.	.	.	.	7.839	0.721422	0.15372	.	.	ENSG00000124900	ENST00000449290;ENST00000244891	T;T	0.07327	3.2;3.2	.	.	.	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	.	.	.	.	T	0.08179	0.0204	L	0.55017	1.72	0.09310	N	1	B	0.26708	0.157	B	0.25884	0.064	T	0.32508	-0.9904	7	0.37606	T	0.19	.	.	.	.	.	286	Q9BSJ1	SPRY5_HUMAN	S	286;143	ENSP00000395086:R286S;ENSP00000244891:R143S	ENSP00000244891:R143S	R	+	3	2	SPRYD5	55414090	0.369000	0.25039	0.046000	0.18839	0.316000	0.28119	0.679000	0.25291	0.138000	0.18790	0.136000	0.15936	AGA	TRIM51	-	superfamily_ConA-like_lec_gl_sf,pfscan_B30.2/SPRY,prints_Butyrophylin	ENSG00000124900		0.478	TRIM51-004	KNOWN	basic|appris_principal	protein_coding	TRIM51	HGNC	protein_coding	OTTHUMT00000391522.1	-	0.00	93	0	A	NM_032681	Missense_Mutation	55657514	+1	tier1	-	no_errors	ENST00000449290	ensembl	human	known	74_37	missense	14.58	82	14	SNP	0.053	T
TROVE2	6738	genome.wustl.edu	37	1	193053996	193053997	+	3'UTR	INS	-	-	A	rs201693727|rs78476132|rs549404223		TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr1:193053996_193053997insA	ENST00000367446.3	+	0	1962_1963				TROVE2_ENST00000400968.2_3'UTR|TROVE2_ENST00000367444.3_Intron|TROVE2_ENST00000367441.1_3'UTR|TROVE2_ENST00000432079.1_3'UTR|TROVE2_ENST00000367443.1_Intron|TROVE2_ENST00000460715.2_3'UTR|TROVE2_ENST00000367445.3_Intron	NM_004600.5	NP_004591.2	P10155	RO60_HUMAN	TROVE domain family, member 2						cilium morphogenesis (GO:0060271)|immune system development (GO:0002520)|response to UV (GO:0009411)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	metal ion binding (GO:0046872)|RNA binding (GO:0003723)|U2 snRNA binding (GO:0030620)			biliary_tract(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|urinary_tract(1)	21						TTACCTTACTGAAAAAAAAAAA	0.361																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC036658	CCDS41449.1, CCDS1379.1, CCDS41450.1, CCDS41450.2, CCDS53451.1	1q31	2014-08-06	2005-06-14	2005-06-14	ENSG00000116747	ENSG00000116747			11313	protein-coding gene	gene with protein product		600063	"""Sjogren syndrome antigen A2 (60kDa, ribonucleoprotein autoantigen SS-A/Ro)"""	SSA2		8188321	Standard	NM_001042369		Approved	Ro60	uc001gss.3	P10155	OTTHUMG00000035675	ENST00000367446.3:c.*136->A	1.37:g.193054007_193054007dupA			B2RBB9|Q5LJ98|Q5LJ99|Q5LJA0|Q86WL3|Q86WL4|Q92787|Q9H1W6	RNA	INS	-	NULL	ENST00000367446.3	37	NULL	CCDS1379.1	1																																																																																			TROVE2	-	-	ENSG00000116747		0.361	TROVE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TROVE2	HGNC	protein_coding	OTTHUMT00000086688.1		0.00	24	0	-	NM_004600		193053997	+1	tier1		no_errors	ENST00000460715	ensembl	human	known	74_37	rna	20.00	16	4	INS	0.000:0.000	A
TTF1	7270	genome.wustl.edu	37	9	135271877	135271877	+	Missense_Mutation	SNP	C	C	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr9:135271877C>A	ENST00000334270.2	-	5	1838	c.1799G>T	c.(1798-1800)tGg>tTg	p.W600L		NM_001205296.1|NM_007344.3	NP_001192225.1|NP_031370.2	Q15361	TTF1_HUMAN	transcription termination factor, RNA polymerase I	600					chromatin remodeling (GO:0006338)|DNA-templated transcription, termination (GO:0006353)|gene expression (GO:0010467)|negative regulation of DNA replication (GO:0008156)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)		TATAAGTTTCCAGGGCCGGGC	0.413																																																	0													107.0	99.0	101.0					9																	135271877		2203	4300	6503	SO:0001583	missense	0			BC050734	CCDS6948.1, CCDS75925.1	9q34.3	2008-02-05			ENSG00000125482	ENSG00000125482			12397	protein-coding gene	gene with protein product		600777				7597036	Standard	NM_007344		Approved		uc004cbl.3	Q15361	OTTHUMG00000020836	ENST00000334270.2:c.1799G>T	9.37:g.135271877C>A	ENSP00000333920:p.Trp600Leu		A1L160|Q4VXF3|Q58EY2|Q6P5T5	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.W600L	ENST00000334270.2	37	c.1799	CCDS6948.1	9	.	.	.	.	.	.	.	.	.	.	C	11.63	1.696376	0.30052	.	.	ENSG00000125482	ENST00000334270;ENST00000245588	T	0.09163	3.01	5.34	5.34	0.76211	.	0.340804	0.27773	N	0.017910	T	0.09158	0.0226	L	0.44542	1.39	0.30239	N	0.79517	B	0.32573	0.376	B	0.26770	0.073	T	0.10405	-1.0631	10	0.09084	T	0.74	.	14.6238	0.68605	0.0:1.0:0.0:0.0	.	600	Q15361	TTF1_HUMAN	L	600	ENSP00000333920:W600L	ENSP00000245588:W600L	W	-	2	0	TTF1	134261698	1.000000	0.71417	1.000000	0.80357	0.459000	0.32528	4.695000	0.61767	2.522000	0.85027	0.650000	0.86243	TGG	TTF1	-	NULL	ENSG00000125482		0.413	TTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTF1	HGNC	protein_coding	OTTHUMT00000054784.2	-	0.00	82	0	C	NM_007344		135271877	-1	tier1	-	no_errors	ENST00000334270	ensembl	human	known	74_37	missense	5.80	65	4	SNP	1.000	A
UBL4A	8266	genome.wustl.edu	37	X	153714147	153714147	+	Missense_Mutation	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chrX:153714147G>A	ENST00000369660.4	-	3	411	c.326C>T	c.(325-327)gCg>gTg	p.A109V	UBL4A_ENST00000477777.1_5'UTR|UBL4A_ENST00000369653.4_Missense_Mutation_p.A109V	NM_014235.3	NP_055050.1	P11441	UBL4A_HUMAN	ubiquitin-like 4A	109					cellular protein modification process (GO:0006464)|tail-anchored membrane protein insertion into ER membrane (GO:0071816)|transport (GO:0006810)	BAT3 complex (GO:0071818)|cytosol (GO:0005829)	small conjugating protein ligase activity (GO:0019787)	p.A109V(1)		endometrium(5)|lung(1)|urinary_tract(1)	7	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GGCATCTGCCGCACTGAAGTG	0.622																																					Esophageal Squamous(74;88 1215 11149 34177 46777)												1	Substitution - Missense(1)	endometrium(1)											86.0	91.0	89.0					X																	153714147		2203	4300	6503	SO:0001583	missense	0			J03589	CCDS14754.1	Xq28	2010-08-05	2005-09-27	2005-09-27	ENSG00000102178	ENSG00000102178			12505	protein-coding gene	gene with protein product		312070	"""ubiquitin-like 4"""	UBL4		2829204, 16872915	Standard	NM_014235		Approved	GDX, DXS254E, GET5, MDY2, TMA24	uc004flo.3	P11441	OTTHUMG00000013370	ENST00000369660.4:c.326C>T	X.37:g.153714147G>A	ENSP00000358674:p.Ala109Val		Q5HY80	Missense_Mutation	SNP	pfam_Ubiquitin_dom,pfam_Rad60/SUMO_like,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup,prints_Ubiquitin	p.A109V	ENST00000369660.4	37	c.326	CCDS14754.1	X	.	.	.	.	.	.	.	.	.	.	G	13.93	2.383184	0.42207	.	.	ENSG00000102178	ENST00000369660;ENST00000369653	T;T	0.46063	0.94;0.88	4.76	3.61	0.41365	.	0.379891	0.29046	N	0.013318	T	0.27419	0.0673	L	0.33485	1.01	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.15235	-1.0444	10	0.40728	T	0.16	-6.0642	4.5941	0.12322	0.1559:0.204:0.6401:0.0	.	109	P11441	UBL4A_HUMAN	V	109	ENSP00000358674:A109V;ENSP00000358667:A109V	ENSP00000358667:A109V	A	-	2	0	UBL4A	153367341	0.023000	0.18921	0.003000	0.11579	0.976000	0.68499	1.836000	0.39191	0.839000	0.34971	0.529000	0.55759	GCG	UBL4A	-	NULL	ENSG00000102178		0.622	UBL4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBL4A	HGNC	protein_coding	OTTHUMT00000037238.2	-	0.00	40	0	G	NM_014235		153714147	-1	tier1	-	no_errors	ENST00000369660	ensembl	human	known	74_37	missense	9.52	38	4	SNP	0.002	A
UNC80	285175	genome.wustl.edu	37	2	210678324	210678324	+	Missense_Mutation	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr2:210678324C>T	ENST00000439458.1	+	8	1039	c.959C>T	c.(958-960)cCg>cTg	p.P320L	UNC80_ENST00000272845.6_Missense_Mutation_p.P320L	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	320					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						GTGATACCTCCGTGCCAAAGG	0.512																																																	0													148.0	121.0	129.0					2																	210678324		692	1591	2283	SO:0001583	missense	0			AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.959C>T	2.37:g.210678324C>T	ENSP00000391088:p.Pro320Leu		B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	NULL	p.P320L	ENST00000439458.1	37	c.959	CCDS46504.1	2	.	.	.	.	.	.	.	.	.	.	C	8.195	0.796771	0.16327	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.30182	1.54;1.55	5.58	4.7	0.59300	.	.	.	.	.	T	0.26011	0.0634	L	0.38531	1.155	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.03103	-1.1072	9	0.41790	T	0.15	-5.3487	13.8652	0.63583	0.0:0.927:0.0:0.073	.	320	Q8N2C7	UNC80_HUMAN	L	320	ENSP00000391088:P320L;ENSP00000272845:P320L	ENSP00000272845:P320L	P	+	2	0	UNC80	210386569	0.959000	0.32827	0.995000	0.50966	0.458000	0.32498	2.086000	0.41643	2.638000	0.89438	0.467000	0.42956	CCG	UNC80	-	NULL	ENSG00000144406		0.512	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC80	HGNC	protein_coding		-	0.00	52	0	C	NM_182587		210678324	+1	tier1	-	no_errors	ENST00000439458	ensembl	human	known	74_37	missense	17.65	28	6	SNP	0.976	T
WDR70	55100	genome.wustl.edu	37	5	37443453	37443453	+	Missense_Mutation	SNP	G	G	A	rs112033041		TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr5:37443453G>A	ENST00000265107.4	+	7	821	c.665G>A	c.(664-666)cGa>cAa	p.R222Q	WDR70_ENST00000504564.1_Missense_Mutation_p.R222Q	NM_018034.2	NP_060504.1	Q9NW82	WDR70_HUMAN	WD repeat domain 70	222							enzyme binding (GO:0019899)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_lung(31;0.000285)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			AAGGCATTTCGATCCCTTCAG	0.423																																																	0													175.0	151.0	159.0					5																	37443453		2203	4300	6503	SO:0001583	missense	0			BC009648	CCDS34147.1	5p13.2	2013-01-09			ENSG00000082068	ENSG00000082068		"""WD repeat domain containing"""	25495	protein-coding gene	gene with protein product						12477932	Standard	NM_018034		Approved	FLJ10233	uc003jkv.3	Q9NW82	OTTHUMG00000162263	ENST00000265107.4:c.665G>A	5.37:g.37443453G>A	ENSP00000265107:p.Arg222Gln		Q9H053	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R222Q	ENST00000265107.4	37	c.665	CCDS34147.1	5	.	.	.	.	.	.	.	.	.	.	g	24.8	4.570683	0.86542	.	.	ENSG00000082068	ENST00000265107;ENST00000504564	T;D	0.89270	-0.53;-2.49	4.91	4.04	0.47022	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.132141	0.49305	D	0.000148	D	0.94722	0.8297	M	0.88310	2.945	0.58432	D	0.999998	D;D	0.89917	1.0;0.999	D;P	0.76575	0.988;0.886	D	0.94830	0.7995	10	0.51188	T	0.08	-1.9515	13.7419	0.62853	0.075:0.0:0.925:0.0	.	222;222	D6RIW8;Q9NW82	.;WDR70_HUMAN	Q	222	ENSP00000265107:R222Q;ENSP00000425841:R222Q	ENSP00000265107:R222Q	R	+	2	0	WDR70	37479210	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	7.610000	0.82949	1.216000	0.43427	-0.320000	0.08662	CGA	WDR70	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000082068		0.423	WDR70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR70	HGNC	protein_coding	OTTHUMT00000368294.1		0.00	63	0	G	NM_018034		37443453	+1			no_errors	ENST00000265107	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	A
VCAN	1462	genome.wustl.edu	37	5	82836373	82836373	+	Silent	SNP	C	C	T	rs77870162	byFrequency	TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr5:82836373C>T	ENST00000265077.3	+	8	8116	c.7551C>T	c.(7549-7551)gaC>gaT	p.D2517D	VCAN_ENST00000342785.4_Intron|VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000512590.2_Intron|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000502527.2_Intron|VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000343200.5_Silent_p.D1530D	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	2517	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	GGTCCACAGACGGTAGTTTCC	0.433													C|||	5	0.000998403	0.0008	0.0029	5008	,	,		19682	0.001		0.001	False		,,,				2504	0.0																0								C	,,,	4,4402	8.1+/-20.4	0,4,2199	59.0	59.0	59.0		,4590,,7551	-2.3	0.3	5	dbSNP_131	59	14,8586	10.5+/-38.8	0,14,4286	no	intron,coding-synonymous,intron,coding-synonymous	VCAN	NM_001126336.2,NM_001164097.1,NM_001164098.1,NM_004385.4	,,,	0,18,6485	TT,TC,CC		0.1628,0.0908,0.1384	,,,	,1530/2410,,2517/3397	82836373	18,12988	2203	4300	6503	SO:0001819	synonymous_variant	0			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.7551C>T	5.37:g.82836373C>T			P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Silent	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_EG-like_dom,pfam_Sushi_SCR_CCP,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_Ig_sub,smart_Link,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like_dom,prints_Link	p.D2517	ENST00000265077.3	37	c.7551	CCDS4060.1	5																																																																																			VCAN	-	NULL	ENSG00000038427		0.433	VCAN-001	KNOWN	basic|CCDS	protein_coding	VCAN	HGNC	protein_coding	OTTHUMT00000254092.3		0.00	21	0	C	NM_004385		82836373	+1			no_errors	ENST00000265077	ensembl	human	known	74_37	silent	17.65	14	3	SNP	0.246	T
WNT7B	7477	genome.wustl.edu	37	22	46327149	46327149	+	Silent	SNP	G	G	A	rs368229070		TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr22:46327149G>A	ENST00000339464.4	-	3	773	c.399C>T	c.(397-399)tgC>tgT	p.C133C	WNT7B_ENST00000410058.1_Silent_p.C133C|WNT7B_ENST00000410089.1_Silent_p.C117C|WNT7B_ENST00000409496.3_Silent_p.C137C	NM_058238.2	NP_478679.1	P56706	WNT7B_HUMAN	wingless-type MMTV integration site family, member 7B	133					activation of JUN kinase activity (GO:0007257)|anatomical structure regression (GO:0060033)|apoptotic process involved in patterning of blood vessels (GO:1902262)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular metabolic process (GO:0044237)|cellular response to retinoic acid (GO:0071300)|central nervous system vasculogenesis (GO:0022009)|chorio-allantoic fusion (GO:0060710)|developmental growth involved in morphogenesis (GO:0060560)|embryonic organ development (GO:0048568)|embryonic placenta morphogenesis (GO:0060669)|establishment or maintenance of polarity of embryonic epithelium (GO:0016332)|fibroblast proliferation (GO:0048144)|forebrain regionalization (GO:0021871)|homeostatic process (GO:0042592)|in utero embryonic development (GO:0001701)|inner medullary collecting duct development (GO:0072061)|lens fiber cell development (GO:0070307)|lobar bronchus development (GO:0060482)|lung development (GO:0030324)|lung epithelium development (GO:0060428)|lung morphogenesis (GO:0060425)|lung-associated mesenchyme development (GO:0060484)|mammary gland epithelium development (GO:0061180)|metanephric collecting duct development (GO:0072205)|metanephric epithelium development (GO:0072207)|metanephric loop of Henle development (GO:0072236)|metanephros morphogenesis (GO:0003338)|negative regulation of smoothened signaling pathway (GO:0045879)|neuron differentiation (GO:0030182)|neuron projection morphogenesis (GO:0048812)|odontogenesis of dentin-containing tooth (GO:0042475)|outer medullary collecting duct development (GO:0072060)|oxygen homeostasis (GO:0032364)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of cell projection size (GO:0032536)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|response to glucocorticoid (GO:0051384)|smooth muscle cell differentiation (GO:0051145)|stem cell proliferation (GO:0072089)|synapse organization (GO:0050808)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	19		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|LUAD - Lung adenocarcinoma(64;0.247)		TCTCGCGGTCGCAGCCGCAGT	0.687																																																	0								G		1,4405	2.1+/-5.4	0,1,2202	43.0	41.0	42.0		399	-3.8	1.0	22		42	0,8600		0,0,4300	no	coding-synonymous	WNT7B	NM_058238.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		133/350	46327149	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AF416743	CCDS33667.1	22q13	2013-02-28			ENSG00000188064	ENSG00000188064		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12787	protein-coding gene	gene with protein product		601967				8168088, 9284940, 11562755	Standard	NM_058238		Approved		uc003bgo.2	P56706	OTTHUMG00000154636	ENST00000339464.4:c.399C>T	22.37:g.46327149G>A			B8A596|Q96Q12	Silent	SNP	pfam_Wnt,smart_Wnt,prints_Wnt,prints_Wnt7	p.C133	ENST00000339464.4	37	c.399	CCDS33667.1	22																																																																																			WNT7B	-	pfam_Wnt,smart_Wnt,prints_Wnt	ENSG00000188064		0.687	WNT7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT7B	HGNC	protein_coding	OTTHUMT00000336418.1	-	0.00	45	0	G	NM_058238		46327149	-1	tier1	-	no_errors	ENST00000339464	ensembl	human	known	74_37	silent	36.73	31	18	SNP	0.994	A
WT1-AS	51352	genome.wustl.edu	37	11	32461227	32461227	+	RNA	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr11:32461227C>T	ENST00000395900.1	+	0	2105				WT1-AS_ENST00000494911.1_RNA|WT1-AS_ENST00000478367.1_RNA|WT1-AS_ENST00000525436.1_RNA|WT1-AS_ENST00000426618.2_RNA|WT1-AS_ENST00000459866.1_RNA|WT1-AS_ENST00000442957.1_RNA	NR_023920.1		Q06250	WIT1_HUMAN	WT1 antisense RNA											endometrium(1)|large_intestine(2)|lung(2)|prostate(1)	6						TGCCTGGAGCCGCTGGGGTTA	0.587																																																	0																																												0			BC002734		11p13	2012-10-19	2012-08-15	2012-01-25	ENSG00000183242	ENSG00000183242		"""Long non-coding RNAs"", ""-"""	18135	non-coding RNA	RNA, long non-coding	"""Wilms tumor associated protein"""	607899	"""Wilms tumor upstream neighbor 1"", ""WT1 antisense RNA (non-protein coding)"""	WIT1		2173145, 8406502, 17210670	Standard	NR_120546		Approved	WIT-1, WT1AS, WT1-AS1	uc010red.2	Q06250	OTTHUMG00000039557		11.37:g.32461227C>T			Q4KMY0|Q96A27	RNA	SNP	-	NULL	ENST00000395900.1	37	NULL		11																																																																																			WT1-AS	-	-	ENSG00000183242		0.587	WT1-AS-001	KNOWN	basic	antisense	WT1-AS	HGNC	antisense	OTTHUMT00000095437.1	-	0.00	51	0	C	NR_023920		32461227	+1	tier1	-	no_errors	ENST00000395900	ensembl	human	known	74_37	rna	20.00	36	9	SNP	0.000	T
WWTR1	25937	genome.wustl.edu	37	3	149260151	149260151	+	Nonsense_Mutation	SNP	G	G	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr3:149260151G>A	ENST00000465804.1	-	5	998	c.742C>T	c.(742-744)Cga>Tga	p.R248*	WWTR1_ENST00000467467.1_Nonsense_Mutation_p.R248*|WWTR1_ENST00000360632.3_Nonsense_Mutation_p.R248*	NM_001168278.1	NP_001161750.1	Q9GZV5	WWTR1_HUMAN	WW domain containing transcription regulator 1	248					cilium morphogenesis (GO:0060271)|gene expression (GO:0010467)|glomerulus development (GO:0032835)|hippo signaling (GO:0035329)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoblast differentiation (GO:0001649)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of SMAD protein import into nucleus (GO:0060390)|regulation of transcription, DNA-templated (GO:0006355)|stem cell division (GO:0017145)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.R248*(1)		breast(5)|cervix(1)|endometrium(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)	23			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			TGGCGCATTCGAATCCTTTCT	0.567			T	CAMTA1	epitheliod hemangioendothelioma																																			Dom	yes		3	3q23-q24	607392	WW domain containing transcription regulator 1		M	1	Substitution - Nonsense(1)	large_intestine(1)											127.0	112.0	117.0					3																	149260151		2203	4300	6503	SO:0001587	stop_gained	0			AK022036	CCDS3144.1	3q23-q24	2004-12-03			ENSG00000018408	ENSG00000018408			24042	protein-coding gene	gene with protein product		607392				11118213, 15096513	Standard	NM_015472		Approved	TAZ, DKFZp586I1419	uc021xfm.1	Q9GZV5	OTTHUMG00000159614	ENST00000465804.1:c.742C>T	3.37:g.149260151G>A	ENSP00000419465:p.Arg248*		D3DNH7|Q8N3P2|Q9Y3W6	Nonsense_Mutation	SNP	pfam_WW_dom,superfamily_WW_dom,smart_WW_dom,pfscan_WW_dom	p.R248*	ENST00000465804.1	37	c.742	CCDS3144.1	3	.	.	.	.	.	.	.	.	.	.	G	37	6.559674	0.97663	.	.	ENSG00000018408	ENST00000465804;ENST00000360632;ENST00000467467;ENST00000472417	.	.	.	5.26	-6.86	0.01676	.	0.132373	0.43919	D	0.000515	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.4219	23.0233	0.99978	0.0:0.0:0.1691:0.8309	.	.	.	.	X	248;248;248;106	.	ENSP00000353847:R248X	R	-	1	2	WWTR1	150742841	0.002000	0.14202	0.011000	0.14972	0.995000	0.86356	-1.029000	0.03585	-1.698000	0.01418	-0.274000	0.10170	CGA	WWTR1	-	NULL	ENSG00000018408		0.567	WWTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WWTR1	HGNC	protein_coding	OTTHUMT00000356498.1		0.00	70	0	G	NM_015472		149260151	-1			no_errors	ENST00000360632	ensembl	human	known	74_37	nonsense	5.00	38	2	SNP	0.024	A
XPR1	9213	genome.wustl.edu	37	1	180843176	180843176	+	Intron	SNP	C	C	G			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr1:180843176C>G	ENST00000367590.4	+	13	2006				XPR1_ENST00000367589.3_Intron	NM_004736.3	NP_004727.2	Q9UBH6	XPR1_HUMAN	xenotropic and polytropic retrovirus receptor 1						G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|virus receptor activity (GO:0001618)			breast(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	35						TACTTGAAAACCTTTAATTTT	0.343																																																	0																																										SO:0001627	intron_variant	0			AF099082	CCDS1340.1, CCDS44284.1	1q25.1	2013-07-18	2010-04-23		ENSG00000143324	ENSG00000143324			12827	protein-coding gene	gene with protein product		605237	"""xenotropic and polytropic retrovirus receptor"""			9990033	Standard	NM_004736		Approved	SYG1, X3	uc001goi.3	Q9UBH6	OTTHUMG00000035116	ENST00000367590.4:c.1808+98C>G	1.37:g.180843176C>G			O95719|Q7L8K9|Q8IW20|Q9NT19|Q9UFB9	RNA	SNP	-	NULL	ENST00000367590.4	37	NULL	CCDS1340.1	1																																																																																			XPR1	-	-	ENSG00000143324		0.343	XPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPR1	HGNC	protein_coding	OTTHUMT00000084996.2	-	0.00	15	0	C	NM_004736		180843176	+1	tier1	-	no_errors	ENST00000498177	ensembl	human	known	74_37	rna	61.11	7	11	SNP	0.001	G
ZFHX4	79776	genome.wustl.edu	37	8	77775556	77775556	+	Missense_Mutation	SNP	C	C	G			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr8:77775556C>G	ENST00000521891.2	+	11	10054	c.9606C>G	c.(9604-9606)atC>atG	p.I3202M	ZFHX4_ENST00000050961.6_Missense_Mutation_p.I3153M|ZFHX4_ENST00000518282.1_Missense_Mutation_p.I3176M|ZFHX4_ENST00000455469.2_Missense_Mutation_p.I3157M	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	3153					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TGAAAAAAATCAAAGAGGAGG	0.433										HNSCC(33;0.089)																																							0													90.0	88.0	89.0					8																	77775556		1873	4120	5993	SO:0001583	missense	0				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.9606C>G	8.37:g.77775556C>G	ENSP00000430497:p.Ile3202Met		G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.I3202M	ENST00000521891.2	37	c.9606	CCDS47878.2	8	.	.	.	.	.	.	.	.	.	.	C	8.714	0.912677	0.17907	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.49432	0.78;0.83;0.8;0.8	4.71	4.71	0.59529	.	0.000000	0.43110	U	0.000601	T	0.39226	0.1070	L	0.40543	1.245	0.30693	N	0.751075	B	0.15141	0.012	B	0.16289	0.015	T	0.39643	-0.9604	10	0.45353	T	0.12	.	12.6386	0.56696	0.0:0.9201:0.0:0.0799	.	3157	Q86UP3-4	.	M	3202;3186;3157;3153;3176	ENSP00000430497:I3202M;ENSP00000399605:I3157M;ENSP00000050961:I3153M;ENSP00000430848:I3176M	ENSP00000050961:I3153M	I	+	3	3	ZFHX4	77938111	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.934000	0.40163	2.601000	0.87937	0.561000	0.74099	ATC	ZFHX4	-	NULL	ENSG00000091656		0.433	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2	-	0.00	26	0	C	NM_024721		77775556	+1	tier1	-	no_errors	ENST00000521891	ensembl	human	known	74_37	missense	20.00	28	7	SNP	1.000	G
ZIC4	84107	genome.wustl.edu	37	3	147108838	147108838	+	Missense_Mutation	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr3:147108838C>T	ENST00000383075.3	-	4	1396	c.884G>A	c.(883-885)aGc>aAc	p.S295N	ZIC4_ENST00000525172.2_Missense_Mutation_p.S345N|ZIC4_ENST00000473123.1_Missense_Mutation_p.S295N|ZIC4_ENST00000472749.2_5'UTR|ZIC4_ENST00000484399.1_Missense_Mutation_p.S295N|ZIC4_ENST00000491672.1_Missense_Mutation_p.S89N|ZIC4_ENST00000425731.3_Missense_Mutation_p.S333N	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4	295						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						GTAGCCAGAGCTGGGCGGCGG	0.687																																																	0													33.0	41.0	38.0					3																	147108838		2180	4284	6464	SO:0001583	missense	0			AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.884G>A	3.37:g.147108838C>T	ENSP00000372553:p.Ser295Asn		A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S345N	ENST00000383075.3	37	c.1034	CCDS43160.1	3	.	.	.	.	.	.	.	.	.	.	C	34	5.389584	0.95988	.	.	ENSG00000174963	ENST00000383075;ENST00000425731;ENST00000525172;ENST00000484399;ENST00000473123;ENST00000491672	T;T;T;T;T;T	0.12879	2.7;2.64;2.64;2.7;2.7;2.75	5.05	5.05	0.67936	.	0.000000	0.56097	D	0.000037	T	0.20495	0.0493	M	0.75085	2.285	0.43088	D	0.994756	P;B	0.37824	0.609;0.209	B;B	0.33690	0.168;0.097	T	0.29579	-1.0007	9	0.56958	D	0.05	.	18.4032	0.90525	0.0:1.0:0.0:0.0	.	345;295	B7Z2L2;Q8N9L1	.;ZIC4_HUMAN	N	295;333;345;295;295;89	ENSP00000372553:S295N;ENSP00000397695:S333N;ENSP00000435509:S345N;ENSP00000417855:S295N;ENSP00000420775:S295N;ENSP00000418277:S89N	ENSP00000372553:S295N	S	-	2	0	ZIC4	148591528	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.758000	0.62220	2.337000	0.79520	0.462000	0.41574	AGC	ZIC4	-	NULL	ENSG00000174963		0.687	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIC4	HGNC	protein_coding	OTTHUMT00000355504.1	-	0.00	56	0	C			147108838	-1	tier1	-	no_errors	ENST00000525172	ensembl	human	known	74_37	missense	7.46	62	5	SNP	1.000	T
ZNF107	51427	genome.wustl.edu	37	7	64167902	64167902	+	Missense_Mutation	SNP	C	C	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr7:64167902C>A	ENST00000395391.1	+	4	2595	c.1220C>A	c.(1219-1221)tCt>tAt	p.S407Y	ZNF107_ENST00000423627.1_Missense_Mutation_p.S407Y|ZNF107_ENST00000344930.3_Missense_Mutation_p.S407Y			Q9UII5	ZN107_HUMAN	zinc finger protein 107	407					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(18)|ovary(1)|stomach(1)	37		Lung NSC(55;0.00948)|all_lung(88;0.0249)				AAAATTTATTCTGGAGAGAAA	0.338																																																	0													39.0	44.0	42.0					7																	64167902		2199	4299	6498	SO:0001583	missense	0			AB027251	CCDS5527.1, CCDS75605.1, CCDS75606.1	7q11.2	2013-01-08	2007-06-26			ENSG00000196247		"""Zinc fingers, C2H2-type"""	12887	protein-coding gene	gene with protein product		603989	"""zinc finger protein 588"", ""zinc finger protein 107 (Y8)"""	ZNF588		8467795	Standard	NM_016220		Approved	ZFD25, smap-7	uc003tte.3	Q9UII5		ENST00000395391.1:c.1220C>A	7.37:g.64167902C>A	ENSP00000378789:p.Ser407Tyr			Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S407Y	ENST00000395391.1	37	c.1220	CCDS5527.1	7	.	.	.	.	.	.	.	.	.	.	.	20.1	3.937722	0.73557	.	.	ENSG00000196247	ENST00000344930;ENST00000423627;ENST00000395391	T;T;T	0.19938	2.11;2.11;2.11	1.27	1.27	0.21489	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.25306	0.0615	M	0.85710	2.77	0.23107	N	0.998282	B	0.32829	0.386	B	0.28139	0.086	T	0.14896	-1.0456	8	.	.	.	.	7.9559	0.30042	0.0:1.0:0.0:0.0	.	407	Q9UII5	ZN107_HUMAN	Y	407	ENSP00000343443:S407Y;ENSP00000400037:S407Y;ENSP00000378789:S407Y	.	S	+	2	0	ZNF107	63805337	0.001000	0.12720	0.562000	0.28370	0.852000	0.48524	1.012000	0.29924	0.635000	0.30488	0.313000	0.20887	TCT	ZNF107	-	pfscan_Znf_C2H2	ENSG00000196247		0.338	ZNF107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF107	HGNC	protein_coding	OTTHUMT00000251593.1		0.00	37	0	C	NM_016220		64167902	+1			no_errors	ENST00000344930	ensembl	human	known	74_37	missense	6.25	30	2	SNP	1.000	A
ZNF385D	79750	genome.wustl.edu	37	3	21467136	21467136	+	Missense_Mutation	SNP	C	C	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr3:21467136C>A	ENST00000281523.2	-	6	1218	c.700G>T	c.(700-702)Gcc>Tcc	p.A234S		NM_024697.2	NP_078973.1	Q9H6B1	Z385D_HUMAN	zinc finger protein 385D	234						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(1)|prostate(1)|skin(4)	46						CCATTCCGGGCTTCTAACATG	0.458																																																	0													92.0	86.0	88.0					3																	21467136		2203	4300	6503	SO:0001583	missense	0			BC007212	CCDS2636.1	3p24.3	2012-10-05	2007-12-06	2007-12-06	ENSG00000151789	ENSG00000151789			26191	protein-coding gene	gene with protein product			"""zinc finger protein 659"""	ZNF659		12477932	Standard	NM_024697		Approved	FLJ22419	uc003cce.3	Q9H6B1	OTTHUMG00000130484	ENST00000281523.2:c.700G>T	3.37:g.21467136C>A	ENSP00000281523:p.Ala234Ser			Missense_Mutation	SNP	pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like	p.A234S	ENST00000281523.2	37	c.700	CCDS2636.1	3	.	.	.	.	.	.	.	.	.	.	C	35	5.594654	0.96602	.	.	ENSG00000151789	ENST00000281523	T	0.44083	0.93	5.46	5.46	0.80206	Zinc finger, U1-type (1);	0.000000	0.85682	D	0.000000	T	0.63686	0.2532	M	0.68952	2.095	0.58432	D	0.999998	D	0.76494	0.999	D	0.73708	0.981	T	0.57854	-0.7739	10	0.31617	T	0.26	-9.4399	19.6421	0.95762	0.0:1.0:0.0:0.0	.	234	Q9H6B1	Z385D_HUMAN	S	234	ENSP00000281523:A234S	ENSP00000281523:A234S	A	-	1	0	ZNF385D	21442140	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.742000	0.85008	2.709000	0.92574	0.563000	0.77884	GCC	ZNF385D	-	smart_Znf_U1	ENSG00000151789		0.458	ZNF385D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF385D	HGNC	protein_coding	OTTHUMT00000252884.1	-	0.00	58	0	C	NM_024697		21467136	-1	tier1	-	no_errors	ENST00000281523	ensembl	human	known	74_37	missense	17.31	43	9	SNP	1.000	A
ZNF507	22847	genome.wustl.edu	37	19	32845530	32845530	+	Silent	SNP	A	A	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr19:32845530A>C	ENST00000311921.4	+	2	1986	c.1794A>C	c.(1792-1794)acA>acC	p.T598T	ZNF507_ENST00000355898.5_Silent_p.T598T|ZNF507_ENST00000544431.1_Silent_p.T598T	NM_001136156.1|NM_014910.4	NP_001129628.1|NP_055725.2	Q8TCN5	ZN507_HUMAN	zinc finger protein 507	598					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	31	Esophageal squamous(110;0.162)					GAGAAAGGACAGACCAAAACG	0.483																																																	0													81.0	75.0	77.0					19																	32845530		2203	4300	6503	SO:0001819	synonymous_variant	0			AB029007	CCDS32985.1	19q13.12	2008-02-05				ENSG00000168813		"""Zinc fingers, C2H2-type"""	23783	protein-coding gene	gene with protein product							Standard	NM_014910		Approved	KIAA1084	uc002ntd.3	Q8TCN5		ENST00000311921.4:c.1794A>C	19.37:g.32845530A>C			A8K911|Q2TBF1|Q6MZU0|Q9UPR8	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T598	ENST00000311921.4	37	c.1794	CCDS32985.1	19																																																																																			ZNF507	-	NULL	ENSG00000168813		0.483	ZNF507-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF507	HGNC	protein_coding	OTTHUMT00000450301.3	-	0.00	16	0	A	NM_014910		32845530	+1	tier1	-	no_errors	ENST00000311921	ensembl	human	known	74_37	silent	20.83	19	5	SNP	0.997	C
ZNF513	130557	genome.wustl.edu	37	2	27600837	27600837	+	Missense_Mutation	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr2:27600837C>T	ENST00000323703.6	-	4	1399	c.1201G>A	c.(1201-1203)Gat>Aat	p.D401N	ZNF513_ENST00000407879.1_Missense_Mutation_p.D339N|ZNF513_ENST00000491924.1_5'UTR	NM_144631.5	NP_653232.3	Q8N8E2	ZN513_HUMAN	zinc finger protein 513	401					regulation of transcription, DNA-templated (GO:0006355)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)			endometrium(5)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)	17	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTCAGGTTATCCAGATGAGCA	0.587																																																	0													121.0	133.0	129.0					2																	27600837		2203	4300	6503	SO:0001583	missense	0			AL833946	CCDS1751.1, CCDS56114.1	2p23.3	2014-01-28			ENSG00000163795	ENSG00000163795		"""Zinc fingers, C2H2-type"""	26498	protein-coding gene	gene with protein product		613598				12477932	Standard	NM_001201459		Approved	FLJ32203, RP58	uc002rkk.3	Q8N8E2	OTTHUMG00000097783	ENST00000323703.6:c.1201G>A	2.37:g.27600837C>T	ENSP00000318373:p.Asp401Asn		A8K3S5|B7WP71|Q3ZCU1|Q68CJ1|Q86UZ3|Q8NDL8|Q96ML3	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D401N	ENST00000323703.6	37	c.1201	CCDS1751.1	2	.	.	.	.	.	.	.	.	.	.	C	15.77	2.931101	0.52866	.	.	ENSG00000163795	ENST00000323703;ENST00000407879	T;T	0.07688	3.17;3.17	5.05	5.05	0.67936	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.51477	D	0.000093	T	0.07999	0.0200	N	0.11154	0.105	0.48571	D	0.999676	P	0.44816	0.844	P	0.45099	0.469	T	0.31779	-0.9931	10	0.72032	D	0.01	-9.4173	17.1408	0.86752	0.0:1.0:0.0:0.0	.	401	Q8N8E2	ZN513_HUMAN	N	401;339	ENSP00000318373:D401N;ENSP00000384874:D339N	ENSP00000318373:D401N	D	-	1	0	ZNF513	27454341	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	3.814000	0.55643	2.633000	0.89246	0.561000	0.74099	GAT	ZNF513	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000163795		0.587	ZNF513-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF513	HGNC	protein_coding	OTTHUMT00000215026.2		0.00	53	0	C	NM_144631		27600837	-1			no_errors	ENST00000323703	ensembl	human	known	74_37	missense	6.25	45	3	SNP	1.000	T
ZNF521	25925	genome.wustl.edu	37	18	22805855	22805855	+	Missense_Mutation	SNP	T	T	A			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr18:22805855T>A	ENST00000361524.3	-	4	2175	c.2027A>T	c.(2026-2028)cAa>cTa	p.Q676L	ZNF521_ENST00000584787.1_Missense_Mutation_p.Q456L|ZNF521_ENST00000579111.1_5'Flank|ZNF521_ENST00000538137.2_Missense_Mutation_p.Q676L	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	676					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					CAAGGATTCTTGGTTGGGGAA	0.423			T	PAX5	ALL																																			Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	0													173.0	161.0	165.0					18																	22805855		2203	4300	6503	SO:0001583	missense	0			AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.2027A>T	18.37:g.22805855T>A	ENSP00000354794:p.Gln676Leu		A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q676L	ENST00000361524.3	37	c.2027	CCDS32806.1	18	.	.	.	.	.	.	.	.	.	.	T	10.74	1.436438	0.25813	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T;T	0.77489	0.67;-1.1;0.67	5.87	5.87	0.94306	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);	0.000000	0.85682	D	0.000000	T	0.81341	0.4802	L	0.28694	0.88	0.54753	D	0.999984	D	0.71674	0.998	D	0.75484	0.986	T	0.78117	-0.2329	10	0.22706	T	0.39	-26.1159	16.5764	0.84681	0.0:0.0:0.0:1.0	.	676	Q96K83	ZN521_HUMAN	L	676;710;676	ENSP00000354794:Q676L;ENSP00000440768:Q710L;ENSP00000382352:Q676L	ENSP00000354794:Q676L	Q	-	2	0	ZNF521	21059853	1.000000	0.71417	0.958000	0.39756	0.995000	0.86356	7.655000	0.83696	2.371000	0.80710	0.533000	0.62120	CAA	ZNF521	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198795		0.423	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	ZNF521	HGNC	protein_coding	OTTHUMT00000446781.2	-	0.00	13	0	T	NM_015461		22805855	-1	tier1	-	no_errors	ENST00000361524	ensembl	human	known	74_37	missense	26.67	11	4	SNP	0.999	A
ZNF585B	92285	genome.wustl.edu	37	19	37676372	37676372	+	Silent	SNP	A	A	C			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr19:37676372A>C	ENST00000532828.2	-	5	2318	c.2067T>G	c.(2065-2067)ccT>ccG	p.P689P	ZNF585B_ENST00000312908.5_Silent_p.P277P|ZNF585B_ENST00000531805.1_Silent_p.P634P|ZNF585B_ENST00000527838.1_3'UTR|CTC-454I21.3_ENST00000585860.2_Intron	NM_152279.3	NP_689492.3	Q52M93	Z585B_HUMAN	zinc finger protein 585B	689					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|endometrium(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TGCACTCATAAGGTTTCTCTC	0.438																																					Melanoma(93;882 1454 18863 28917 48427)												0													39.0	39.0	39.0					19																	37676372		2202	4280	6482	SO:0001819	synonymous_variant	0			AK027834	CCDS12500.1	19q13.13	2013-01-08				ENSG00000245680		"""Zinc fingers, C2H2-type"", ""-"""	30948	protein-coding gene	gene with protein product						12477932	Standard	NM_152279		Approved	FLJ14928, SZFP41	uc002ofq.3	Q52M93		ENST00000532828.2:c.2067T>G	19.37:g.37676372A>C			Q8IZD3|Q96JW6	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P689	ENST00000532828.2	37	c.2067	CCDS12500.1	19																																																																																			ZNF585B	-	pfscan_Znf_C2H2	ENSG00000245680		0.438	ZNF585B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF585B	HGNC	protein_coding	OTTHUMT00000388272.2		0.00	49	0	A	NM_152279		37676372	-1			no_errors	ENST00000532828	ensembl	human	known	74_37	silent	19.15	38	9	SNP	0.035	C
ZNF721	170960	genome.wustl.edu	37	4	436778	436778	+	Missense_Mutation	SNP	C	C	G			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr4:436778C>G	ENST00000338977.5	-	2	1490	c.1442G>C	c.(1441-1443)aGg>aCg	p.R481T	ZNF721_ENST00000506646.1_Intron|ZNF721_ENST00000511833.2_Missense_Mutation_p.R493T|ZNF721_ENST00000507078.1_Intron|ABCA11P_ENST00000451020.2_RNA			Q8TF20	ZN721_HUMAN	zinc finger protein 721	481					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(15)|lung(6)|ovary(1)|skin(1)|stomach(5)|urinary_tract(1)	33						AGTATGAATCCTCTTATGTTT	0.373																																																	0													77.0	83.0	81.0					4																	436778		2073	4237	6310	SO:0001583	missense	0			AK092362	CCDS46991.1	4p16.3	2013-01-08			ENSG00000182903	ENSG00000182903		"""Zinc fingers, C2H2-type"", ""-"""	29425	protein-coding gene	gene with protein product						11853319	Standard	NM_133474		Approved	KIAA1982	uc003gag.4	Q8TF20		ENST00000338977.5:c.1442G>C	4.37:g.436778C>G	ENSP00000340524:p.Arg481Thr		Q69YG7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R493T	ENST00000338977.5	37	c.1478		4	.	.	.	.	.	.	.	.	.	.	C	10.98	1.505847	0.26949	.	.	ENSG00000182903	ENST00000338977;ENST00000511833	T;T	0.25414	1.8;1.8	0.71	0.71	0.18157	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.39358	0.1075	L	0.58510	1.815	0.09310	N	1	D;D;D	0.71674	0.998;0.995;0.993	D;D;D	0.78314	0.991;0.987;0.977	T	0.13176	-1.0519	9	0.66056	D	0.02	.	3.8304	0.08871	0.4222:0.5778:1.0E-4:0.0	.	481;493;493	Q8TF20;D9N162;Q8TF20-2	ZN721_HUMAN;.;.	T	481;493	ENSP00000340524:R481T;ENSP00000428878:R493T	ENSP00000340524:R481T	R	-	2	0	ZNF721	426778	0.000000	0.05858	0.002000	0.10522	0.021000	0.10359	-1.463000	0.02361	0.677000	0.31305	0.194000	0.17425	AGG	ZNF721	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000182903		0.373	ZNF721-001	KNOWN	basic|appris_candidate	protein_coding	ZNF721	HGNC	protein_coding	OTTHUMT00000357939.1	-	0.00	74	0	C	NM_133474		436778	-1	tier1	-	no_errors	ENST00000511833	ensembl	human	known	74_37	missense	21.28	74	20	SNP	0.180	G
ZNF750	79755	genome.wustl.edu	37	17	80789208	80789208	+	Missense_Mutation	SNP	C	C	T			TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr17:80789208C>T	ENST00000269394.3	-	2	1956	c.1123G>A	c.(1123-1125)Gtc>Atc	p.V375I	TBCD_ENST00000397466.2_Intron|ZNF750_ENST00000572562.1_5'UTR|TBCD_ENST00000539345.2_Intron|TBCD_ENST00000355528.4_Intron	NM_024702.2	NP_078978.2	Q32MQ0	ZN750_HUMAN	zinc finger protein 750	375					cell differentiation (GO:0030154)|epidermis development (GO:0008544)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	31	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0514)|all_epithelial(8;0.0748)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.149)			TCGAACTCGACGTGTTTTCTG	0.567																																																	0													95.0	102.0	100.0					17																	80789208		2203	4300	6503	SO:0001583	missense	0			AK023903	CCDS11819.1	17q25.3	2008-05-02				ENSG00000141579			25843	protein-coding gene	gene with protein product		610226				16751772	Standard	NM_024702		Approved	FLJ13841, Zfp750	uc002kga.3	Q32MQ0		ENST00000269394.3:c.1123G>A	17.37:g.80789208C>T	ENSP00000269394:p.Val375Ile		Q9H899	Missense_Mutation	SNP	NULL	p.V375I	ENST00000269394.3	37	c.1123	CCDS11819.1	17	.	.	.	.	.	.	.	.	.	.	C	1.347	-0.592409	0.03799	.	.	ENSG00000141579	ENST00000269394	T	0.13778	2.56	4.62	-0.538	0.11868	.	0.576484	0.16236	N	0.223377	T	0.03178	0.0093	N	0.01352	-0.895	0.09310	N	0.999998	B	0.06786	0.001	B	0.04013	0.001	T	0.43228	-0.9404	9	.	.	.	-2.454	4.2917	0.10881	0.0:0.3169:0.3548:0.3282	.	375	Q32MQ0	ZN750_HUMAN	I	375	ENSP00000269394:V375I	.	V	-	1	0	ZNF750	78382497	0.001000	0.12720	0.001000	0.08648	0.192000	0.23643	-0.109000	0.10840	-0.074000	0.12820	-0.339000	0.08088	GTC	ZNF750	-	NULL	ENSG00000141579		0.567	ZNF750-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF750	HGNC	protein_coding	OTTHUMT00000439074.2	-	0.00	44	0	C	NM_024702		80789208	-1	tier1	-	no_errors	ENST00000269394	ensembl	human	known	74_37	missense	18.42	31	7	SNP	0.000	T
ZNF844	284391	genome.wustl.edu	37	19	12186633	12186633	+	Missense_Mutation	SNP	C	C	A	rs202098662		TCGA-S8-A6BV-01A-21D-A31U-09	TCGA-S8-A6BV-10A-01D-A31U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	68330017-cad8-4064-86c3-f414b8a9abf2	4f02c2c2-9922-41d1-9709-a96b47bf869f	g.chr19:12186633C>A	ENST00000439326.3	+	4	873	c.698C>A	c.(697-699)gCc>gAc	p.A233D	ZNF844_ENST00000441304.2_3'UTR	NM_001136501.1	NP_001129973.1	Q08AG5	ZN844_HUMAN	zinc finger protein 844	233					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(1)|prostate(1)	10						TGTGGTAAAGCCTTTAGTTAT	0.388																																																	0													42.0	39.0	40.0					19																	12186633		692	1591	2283	SO:0001583	missense	0			AL832297	CCDS45985.1	19p13.2	2013-01-08			ENSG00000223547	ENSG00000223547		"""Zinc fingers, C2H2-type"", ""-"""	25932	protein-coding gene	gene with protein product							Standard	NM_001136501		Approved	FLJ14959	uc002mtb.2	Q08AG5	OTTHUMG00000156405	ENST00000439326.3:c.698C>A	19.37:g.12186633C>A	ENSP00000392024:p.Ala233Asp		Q5JPI8	Missense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A233D	ENST00000439326.3	37	c.698	CCDS45985.1	19	.	.	.	.	.	.	.	.	.	.	C	15.87	2.961144	0.53400	.	.	ENSG00000223547	ENST00000439326;ENST00000541708;ENST00000535505;ENST00000550826	T;T	0.20069	2.1;2.52	2.5	2.5	0.30297	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.36166	0.0957	L	0.55481	1.735	0.09310	N	1	D	0.63880	0.993	P	0.60345	0.873	T	0.10132	-1.0643	9	0.72032	D	0.01	.	12.0813	0.53671	0.0:1.0:0.0:0.0	.	233	Q08AG5	ZN844_HUMAN	D	233;233;208;76	ENSP00000392024:A233D;ENSP00000448588:A76D	ENSP00000392024:A233D	A	+	2	0	ZNF844	12047633	0.000000	0.05858	0.006000	0.13384	0.572000	0.35998	-2.871000	0.00720	1.381000	0.46364	0.205000	0.17691	GCC	ZNF844	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000223547		0.388	ZNF844-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF844	HGNC	protein_coding	OTTHUMT00000344086.2	-	0.00	62	0	C			12186633	+1	tier1	-	no_errors	ENST00000439326	ensembl	human	known	74_37	missense	7.69	60	5	SNP	0.004	A
