#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ACPP	55	genome.wustl.edu	37	3	132071602	132071602	+	Missense_Mutation	SNP	T	T	A	rs116804987	byFrequency	TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr3:132071602T>A	ENST00000336375.5	+	9	993	c.903T>A	c.(901-903)gaT>gaA	p.D301E	ACPP_ENST00000475741.1_Missense_Mutation_p.D268E|ACPP_ENST00000351273.7_Missense_Mutation_p.D301E	NM_001099.4	NP_001090.2	P15309	PPAP_HUMAN	acid phosphatase, prostate	301					adenosine metabolic process (GO:0046085)|dephosphorylation (GO:0016311)|nucleotide metabolic process (GO:0009117)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|purine nucleobase metabolic process (GO:0006144)|regulation of sensory perception of pain (GO:0051930)|thiamine metabolic process (GO:0006772)	apical part of cell (GO:0045177)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi cisterna (GO:0031985)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|vesicle membrane (GO:0012506)	5'-nucleotidase activity (GO:0008253)|acid phosphatase activity (GO:0003993)|choline binding (GO:0033265)|identical protein binding (GO:0042802)|lysophosphatidic acid phosphatase activity (GO:0052642)|phosphatase activity (GO:0016791)|thiamine phosphate phosphatase activity (GO:0042131)	p.D301D(2)		NS(1)|breast(1)|endometrium(2)|large_intestine(5)|lung(13)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	27						TGGCGCTAGATGTTTACAACG	0.423																																																	2	Substitution - coding silent(2)	lung(2)											164.0	149.0	154.0					3																	132071602		2203	4300	6503	SO:0001583	missense	0				CCDS3073.1, CCDS46916.1	3q22.1	2012-05-16			ENSG00000014257	ENSG00000014257	3.1.3.2		125	protein-coding gene	gene with protein product		171790					Standard	NM_001099		Approved	ACP3, ACP-3	uc003eop.4	P15309	OTTHUMG00000159650	ENST00000336375.5:c.903T>A	3.37:g.132071602T>A	ENSP00000337471:p.Asp301Glu		D3DNC6|Q5FBY0|Q96KY0|Q96QK9|Q96QM0	Missense_Mutation	SNP	pfam_His_Pase_superF_clade-2	p.D301E	ENST00000336375.5	37	c.903	CCDS3073.1	3	.	.	.	.	.	.	.	.	.	.	T	10.51	1.370296	0.24771	.	.	ENSG00000014257	ENST00000336375;ENST00000475741;ENST00000351273	T;T;T	0.17528	2.27;2.27;2.27	5.83	-4.88	0.03113	.	0.318910	0.31020	N	0.008412	T	0.14270	0.0345	M	0.65975	2.015	0.29680	N	0.841752	B;B;B	0.19200	0.001;0.001;0.034	B;B;B	0.18871	0.002;0.001;0.023	T	0.06391	-1.0829	10	0.52906	T	0.07	.	7.3553	0.26714	0.1086:0.4003:0.0:0.4911	.	301;301;268	P15309;P15309-2;Q5FBY0	PPAP_HUMAN;.;.	E	301;268;301	ENSP00000337471:D301E;ENSP00000417744:D268E;ENSP00000323036:D301E	ENSP00000337471:D301E	D	+	3	2	ACPP	133554292	0.997000	0.39634	0.360000	0.25837	0.002000	0.02628	0.096000	0.15147	-1.178000	0.02741	-1.232000	0.01568	GAT	ACPP	-	pfam_His_Pase_superF_clade-2	ENSG00000014257		0.423	ACPP-001	KNOWN	basic|CCDS	protein_coding	ACPP	HGNC	protein_coding	OTTHUMT00000356699.2	-	0.00	110	0	T	NM_001099		132071602	+1	tier1	-	no_errors	ENST00000351273	ensembl	human	known	74_37	missense	35.48	40	22	SNP	0.966	A
ACSM2B	348158	genome.wustl.edu	37	16	20554273	20554273	+	Missense_Mutation	SNP	G	G	A	rs370065320	byFrequency	TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr16:20554273G>A	ENST00000329697.6	-	12	1640	c.1472C>T	c.(1471-1473)aCg>aTg	p.T491M	ACSM2B_ENST00000567288.1_5'Flank|ACSM2B_ENST00000565322.1_Missense_Mutation_p.T412M|ACSM2B_ENST00000567001.1_Missense_Mutation_p.T491M|ACSM2B_ENST00000565232.1_Missense_Mutation_p.T491M	NM_001105069.1	NP_001098539.1	Q68CK6	ACS2B_HUMAN	acyl-CoA synthetase medium-chain family member 2B	491					fatty acid metabolic process (GO:0006631)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(4)|lung(33)|ovary(1)|prostate(1)|skin(5)	57						GATCACAGCCGTCTCAACCAC	0.557													g|||	2	0.000399361	0.0008	0.0	5008	,	,		19943	0.001		0.0	False		,,,				2504	0.0																0								G	MET/THR,MET/THR	1,4401	2.1+/-5.4	0,1,2200	102.0	98.0	100.0		1472,1472	2.1	0.0	16		100	0,8598		0,0,4299	no	missense,missense	ACSM2B	NM_001105069.1,NM_182617.3	81,81	0,1,6499	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	491/578,491/578	20554273	1,12999	2201	4299	6500	SO:0001583	missense	0			AY160217	CCDS10586.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000066813	ENSG00000066813		"""Acyl-CoA synthetase family"""	30931	protein-coding gene	gene with protein product	"""xenobiotic/medium chain fatty acid:CoA ligase"""	614359	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2		12616642	Standard	NM_182617		Approved	HXMA, HYST1046	uc002dhk.4	Q68CK6	OTTHUMG00000131555	ENST00000329697.6:c.1472C>T	16.37:g.20554273G>A	ENSP00000327453:p.Thr491Met		Q86YT1	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.T491M	ENST00000329697.6	37	c.1472	CCDS10586.1	16	.	.	.	.	.	.	.	.	.	.	G	12.22	1.872350	0.33069	2.27E-4	0.0	ENSG00000066813	ENST00000329697	T	0.58940	0.3	3.1	2.13	0.27403	AMP-dependent synthetase/ligase (1);	0.575751	0.14538	N	0.313470	T	0.67458	0.2895	L	0.52011	1.625	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.75020	0.985;0.985	T	0.66093	-0.6009	10	0.72032	D	0.01	-0.1611	10.0092	0.41975	0.1048:0.0:0.8951:0.0	.	491;491	A8K051;Q68CK6	.;ACS2B_HUMAN	M	491	ENSP00000327453:T491M	ENSP00000327453:T491M	T	-	2	0	ACSM2B	20461774	0.019000	0.18553	0.006000	0.13384	0.289000	0.27227	1.928000	0.40104	0.644000	0.30656	-0.357000	0.07601	ACG	ACSM2B	-	pfam_AMP-dep_Synth/Lig	ENSG00000066813		0.557	ACSM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSM2B	HGNC	protein_coding	OTTHUMT00000254417.2	-	0.00	118	0	G	NM_182617		20554273	-1	tier1	-	no_errors	ENST00000329697	ensembl	human	known	74_37	missense	48.53	35	33	SNP	0.745	A
ACSS3	79611	genome.wustl.edu	37	12	81593157	81593157	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr12:81593157G>T	ENST00000548058.1	+	9	2198	c.1288G>T	c.(1288-1290)Gta>Tta	p.V430L	ACSS3_ENST00000261206.3_Missense_Mutation_p.V429L|ACSS3_ENST00000548324.1_Missense_Mutation_p.V112L			Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	430						mitochondrion (GO:0005739)	acetate-CoA ligase activity (GO:0003987)|ATP binding (GO:0005524)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(7)|liver(3)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	51						ACGATGTGATGTAGAGACCCT	0.348																																																	0													85.0	80.0	81.0					12																	81593157		2203	4300	6503	SO:0001583	missense	0				CCDS9022.1	12q21.31	2014-08-08			ENSG00000111058	ENSG00000111058		"""Acyl-CoA synthetase family"""	24723	protein-coding gene	gene with protein product		614356				17762044	Standard	NM_024560		Approved	FLJ21963	uc001szl.1	Q9H6R3	OTTHUMG00000170179	ENST00000548058.1:c.1288G>T	12.37:g.81593157G>T	ENSP00000449535:p.Val430Leu		Q8NC66	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.V430L	ENST00000548058.1	37	c.1288	CCDS9022.1	12	.	.	.	.	.	.	.	.	.	.	G	15.82	2.946807	0.53186	.	.	ENSG00000111058	ENST00000548058;ENST00000261206;ENST00000548324	T;T;T	0.40756	1.02;1.02;1.02	6.05	3.25	0.37280	AMP-dependent synthetase/ligase (1);	0.116033	0.64402	D	0.000013	T	0.31513	0.0799	L	0.40543	1.245	0.44611	D	0.997582	B;P	0.38617	0.001;0.64	B;B	0.36567	0.004;0.228	T	0.12604	-1.0541	10	0.87932	D	0	-12.3785	7.9522	0.30021	0.1396:0.0:0.7278:0.1325	.	112;430	Q9H6R3-2;Q9H6R3	.;ACSS3_HUMAN	L	430;429;112	ENSP00000449535:V430L;ENSP00000261206:V429L;ENSP00000448965:V112L	ENSP00000261206:V429L	V	+	1	0	ACSS3	80117288	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	2.464000	0.45067	0.891000	0.36235	-0.143000	0.13931	GTA	ACSS3	-	pfam_AMP-dep_Synth/Lig	ENSG00000111058		0.348	ACSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACSS3	HGNC	protein_coding	OTTHUMT00000407794.1	-	0.00	97	0	G	NM_024560		81593157	+1	tier1	-	no_errors	ENST00000548058	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	T
ACTB	60	genome.wustl.edu	37	7	5567412	5567412	+	Frame_Shift_Del	DEL	G	G	-			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr7:5567412delG	ENST00000331789.5	-	6	1286	c.1095delC	c.(1093-1095)tccfs	p.S365fs	AC006483.1_ENST00000579427.1_RNA|ACTB_ENST00000464611.1_5'UTR	NM_001101.3	NP_001092.1	P63261	ACTG_HUMAN	actin, beta	365					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(2)|prostate(2)	8		Ovarian(82;0.0606)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)|OV - Ovarian serous cystadenocarcinoma(56;4.24e-37)		TGGAGGGGCCGGACTCGTCAT	0.547																																																	0													121.0	125.0	124.0					7																	5567412		2203	4300	6503	SO:0001589	frameshift_variant	0			M28424	CCDS5341.1	7p22	2014-09-17			ENSG00000075624	ENSG00000075624			132	protein-coding gene	gene with protein product		102630				1505215	Standard	NM_001101		Approved		uc003sot.4	P60709	OTTHUMG00000023268	ENST00000331789.5:c.1095delC	7.37:g.5567412delG	ENSP00000349960:p.Ser365fs		A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	Frame_Shift_Del	DEL	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.G366fs	ENST00000331789.5	37	c.1095	CCDS5341.1	7																																																																																			ACTB	-	pfam_Actin-related,smart_Actin-related	ENSG00000075624		0.547	ACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTB	HGNC	protein_coding	OTTHUMT00000059589.4		0.00	189	0	G	NM_001101		5567412	-1	tier1		no_errors	ENST00000331789	ensembl	human	known	74_37	frame_shift_del	45.45	90	75	DEL	0.255	-
ACTN4	81	genome.wustl.edu	37	19	39198794	39198794	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr19:39198794C>T	ENST00000252699.2	+	6	686	c.610C>T	c.(610-612)Cgg>Tgg	p.R204W	ACTN4_ENST00000390009.3_Intron|ACTN4_ENST00000424234.2_Intron	NM_004924.4	NP_004915.2	O43707	ACTN4_HUMAN	actinin, alpha 4	204	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament bundle assembly (GO:0051017)|blood coagulation (GO:0007596)|negative regulation of cellular component movement (GO:0051271)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cellular component movement (GO:0051272)|positive regulation of pinocytosis (GO:0048549)|positive regulation of sodium:proton antiporter activity (GO:0032417)|protein localization to tight junction (GO:1902396)|protein transport (GO:0015031)|regulation of apoptotic process (GO:0042981)|response to hypoxia (GO:0001666)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|protein complex (GO:0043234)|pseudopodium (GO:0031143)|ribonucleoprotein complex (GO:0030529)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|nucleoside binding (GO:0001882)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|urinary_tract(3)	30	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CCTGATCCACCGGCACAGACC	0.567																																					Colon(168;199 1940 10254 46213 46384)												0													218.0	146.0	170.0					19																	39198794		2203	4300	6503	SO:0001583	missense	0			D89980	CCDS12518.1	19q13	2013-01-10			ENSG00000130402	ENSG00000130402		"""EF-hand domain containing"""	166	protein-coding gene	gene with protein product		604638	"""focal segmental glomerulosclerosis 1"""	FSGS1		9461087, 10700177	Standard	NM_004924		Approved		uc002oja.2	O43707	OTTHUMG00000137382	ENST00000252699.2:c.610C>T	19.37:g.39198794C>T	ENSP00000252699:p.Arg204Trp		A4K467|D6PXK4|O76048	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_EF-hand_Ca_insen,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.R204W	ENST00000252699.2	37	c.610	CCDS12518.1	19	.	.	.	.	.	.	.	.	.	.	C	24.0	4.487111	0.84854	.	.	ENSG00000130402	ENST00000252699;ENST00000445727	D	0.95205	-3.64	5.08	3.98	0.46160	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	D	0.97813	0.9282	H	0.96208	3.785	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.97442	1.0022	10	0.87932	D	0	.	10.7939	0.46449	0.3147:0.6853:0.0:0.0	.	204;204	E7EV83;O43707	.;ACTN4_HUMAN	W	204	ENSP00000252699:R204W	ENSP00000252699:R204W	R	+	1	2	ACTN4	43890634	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.637000	0.54324	2.804000	0.96469	0.462000	0.41574	CGG	ACTN4	-	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000130402		0.567	ACTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTN4	HGNC	protein_coding	OTTHUMT00000268091.1	-	0.00	56	0	C			39198794	+1	tier1	-	no_errors	ENST00000252699	ensembl	human	known	74_37	missense	22.41	45	13	SNP	1.000	T
ADAMTS16	170690	genome.wustl.edu	37	5	5182272	5182272	+	Missense_Mutation	SNP	A	A	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr5:5182272A>G	ENST00000274181.7	+	4	755	c.617A>G	c.(616-618)aAg>aGg	p.K206R	ADAMTS16_ENST00000511368.1_Missense_Mutation_p.K206R	NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	206					branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						GTACTGTACAAGAGATCCACA	0.582																																																	0													54.0	56.0	56.0					5																	5182272		1949	4148	6097	SO:0001583	missense	0			AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.617A>G	5.37:g.5182272A>G	ENSP00000274181:p.Lys206Arg		C6G490|Q8IVE2	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.K206R	ENST00000274181.7	37	c.617	CCDS43299.1	5	.	.	.	.	.	.	.	.	.	.	A	12.14	1.847249	0.32606	.	.	ENSG00000145536	ENST00000274181;ENST00000511368;ENST00000536857	T;T	0.64438	0.01;-0.1	5.37	4.2	0.49525	.	0.057908	0.64402	D	0.000003	T	0.64227	0.2579	M	0.81341	2.54	0.49915	D	0.999832	B;P;B	0.35575	0.058;0.51;0.258	B;B;B	0.42798	0.017;0.398;0.228	T	0.59674	-0.7410	10	0.07482	T	0.82	.	10.4972	0.44785	0.9221:0.0:0.0779:0.0	.	206;206;206	Q8TE57;Q8TE57-2;Q2XQZ0	ATS16_HUMAN;.;.	R	206	ENSP00000274181:K206R;ENSP00000421631:K206R	ENSP00000274181:K206R	K	+	2	0	ADAMTS16	5235272	1.000000	0.71417	0.998000	0.56505	0.006000	0.05464	4.283000	0.58977	0.866000	0.35629	0.528000	0.53228	AAG	ADAMTS16	-	NULL	ENSG00000145536		0.582	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS16	HGNC	protein_coding	OTTHUMT00000365657.1	-	0.00	35	0	A	NM_139056		5182272	+1	tier1	-	no_errors	ENST00000274181	ensembl	human	known	74_37	missense	26.67	22	8	SNP	1.000	G
ADAMTS16	170690	genome.wustl.edu	37	5	5235215	5235215	+	Missense_Mutation	SNP	T	T	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr5:5235215T>G	ENST00000274181.7	+	13	2077	c.1939T>G	c.(1939-1941)Ttc>Gtc	p.F647V	ADAMTS16_ENST00000513709.1_3'UTR	NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	647	Cys-rich.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						CAGTGTTGACTTCCGTGCTGC	0.532																																																	0													78.0	81.0	80.0					5																	5235215		1950	4148	6098	SO:0001583	missense	0			AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.1939T>G	5.37:g.5235215T>G	ENSP00000274181:p.Phe647Val		C6G490|Q8IVE2	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.F647V	ENST00000274181.7	37	c.1939	CCDS43299.1	5	.	.	.	.	.	.	.	.	.	.	T	19.80	3.895652	0.72639	.	.	ENSG00000145536	ENST00000274181;ENST00000536857	T	0.05996	3.36	4.67	4.67	0.58626	.	0.129273	0.53938	D	0.000057	T	0.36690	0.0976	H	0.96833	3.89	0.58432	D	0.999998	P;D	0.71674	0.842;0.998	B;D	0.70016	0.321;0.967	T	0.56469	-0.7974	10	0.87932	D	0	.	13.417	0.60974	0.0:0.0:0.0:1.0	.	647;647	Q8TE57;Q8TE57-2	ATS16_HUMAN;.	V	647	ENSP00000274181:F647V	ENSP00000274181:F647V	F	+	1	0	ADAMTS16	5288215	1.000000	0.71417	0.998000	0.56505	0.520000	0.34377	7.610000	0.82949	1.888000	0.54679	0.533000	0.62120	TTC	ADAMTS16	-	NULL	ENSG00000145536		0.532	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS16	HGNC	protein_coding	OTTHUMT00000365657.1	-	0.00	77	0	T	NM_139056		5235215	+1	tier1	-	no_errors	ENST00000274181	ensembl	human	known	74_37	missense	28.77	52	21	SNP	1.000	G
ADCK5	203054	genome.wustl.edu	37	8	145617535	145617549	+	Splice_Site	DEL	GGGGGTGCAAGGTGA	GGGGGTGCAAGGTGA	-	rs563415390|rs148509143|rs374281647	byFrequency	TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	GGGGGTGCAAGGTGA	GGGGGTGCAAGGTGA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr8:145617535_145617549delGGGGGTGCAAGGTGA	ENST00000308860.6	+	12	1301_1311	c.1257_1267delGGGGGTGCAAGGTGA	c.(1255-1269)ctgggggtgcaaggt>ctgt	p.GVQG420del	CPSF1_ENST00000531727.1_5'Flank|MIR939_ENST00000401314.1_RNA	NM_174922.3	NP_777582.4	Q3MIX3	ADCK5_HUMAN	aarF domain containing kinase 5	420						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	protein serine/threonine kinase activity (GO:0004674)	p.?(2)		endometrium(1)|lung(2)|prostate(2)|skin(1)|stomach(2)	8	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;8.96e-41)|Epithelial(56;4.08e-40)|all cancers(56;4.51e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			CAGCCGCACTGGGGGTGCAAGGTGAGGGGGTGCAA	0.73														3140	0.626997	0.8109	0.562	5008	,	,		8769	0.6577		0.4205	False		,,,				2504	0.6053																2	Unknown(2)	prostate(2)								1836,894		805,226,334						4.5	0.7		dbSNP_120	4	2015,4403		639,737,1833	no	coding-near-splice	ADCK5	NM_174922.3		1444,963,2167	A1A1,A1R,RR		31.3961,32.7473,42.0966				3851,5297				SO:0001630	splice_region_variant	0			BC032402	CCDS34965.1, CCDS34965.2	8q24.3	2004-07-06			ENSG00000173137	ENSG00000173137			21738	protein-coding gene	gene with protein product							Standard	NM_174922		Approved	FLJ35454	uc003zch.3	Q3MIX3	OTTHUMG00000165190	ENST00000308860.6:c.1267+1GGGGGTGCAAGGTGA>-	8.37:g.145617535_145617549delGGGGGTGCAAGGTGA			B3KS46|Q5U4P1|Q6P2S4|Q8N5V3	Frame_Shift_Del	DEL	pfam_UbiB_dom,superfamily_Kinase-like_dom	p.G420fs	ENST00000308860.6	37	c.1257_1267	CCDS34965.1	8																																																																																			ADCK5	-	NULL	ENSG00000173137		0.730	ADCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCK5	HGNC	protein_coding	OTTHUMT00000382556.2		0.00	9	0	GGGGGTGCAAGGTGA	NM_174922	In_Frame_Del	145617549	+1			no_errors	ENST00000308860	ensembl	human	known	74_37	frame_shift_del	25.00	6	2	DEL	0.999:0.998:1.000:0.999:1.000:1.000:1.000:1.000:1.000:1.000:1.000	0
AKAP13	11214	genome.wustl.edu	37	15	86077103	86077103	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr15:86077103G>A	ENST00000394518.2	+	4	565	c.470G>A	c.(469-471)aGt>aAt	p.S157N	AKAP13_ENST00000560302.1_Missense_Mutation_p.S157N|AKAP13_ENST00000361243.2_Missense_Mutation_p.S157N	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	157					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						ACAGATCAGAGTTTGCATGGT	0.413																																					Melanoma(94;603 1453 3280 32295 32951)												0													44.0	44.0	44.0					15																	86077103		2202	4297	6499	SO:0001583	missense	0			M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.470G>A	15.37:g.86077103G>A	ENSP00000378026:p.Ser157Asn		Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain	p.S157N	ENST00000394518.2	37	c.470	CCDS32319.1	15	.	.	.	.	.	.	.	.	.	.	G	13.95	2.391315	0.42410	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540	T;T	0.25749	1.78;1.78	6.07	4.2	0.49525	.	.	.	.	.	T	0.21227	0.0511	L	0.34521	1.04	0.41423	D	0.987817	B;B;P	0.36282	0.309;0.435;0.546	B;B;B	0.39531	0.081;0.167;0.302	T	0.03287	-1.1052	9	0.39692	T	0.17	.	9.6043	0.39624	0.0:0.7769:0.1481:0.075	.	157;157;157	Q12802;Q12802-2;Q12802-5	AKP13_HUMAN;.;.	N	157;157;156;156	ENSP00000354718:S157N;ENSP00000378026:S157N	ENSP00000354718:S157N	S	+	2	0	AKAP13	83878107	0.022000	0.18835	0.823000	0.32752	0.993000	0.82548	2.454000	0.44979	0.900000	0.36469	-0.165000	0.13383	AGT	AKAP13	-	NULL	ENSG00000170776		0.413	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	AKAP13	HGNC	protein_coding	OTTHUMT00000417318.1		0.00	33	0	G	NM_007200		86077103	+1			no_errors	ENST00000361243	ensembl	human	known	74_37	missense	11.54	23	3	SNP	0.520	A
AKAP9	10142	genome.wustl.edu	37	7	91630606	91630606	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr7:91630606C>G	ENST00000359028.2	+	9	1636	c.1411C>G	c.(1411-1413)Cag>Gag	p.Q471E	AKAP9_ENST00000358100.2_Missense_Mutation_p.Q471E|AKAP9_ENST00000356239.3_Missense_Mutation_p.Q459E			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	471	Glu-rich.				G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			ACACATGGCACAGATGGAGGA	0.368			T	BRAF	papillary thyroid																																			Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	0													98.0	105.0	103.0					7																	91630606		2202	4300	6502	SO:0001583	missense	0			AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.1411C>G	7.37:g.91630606C>G	ENSP00000351922:p.Gln471Glu		A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	pfam_PACT_domain,superfamily_Prefoldin,superfamily_YbaB	p.Q471E	ENST00000359028.2	37	c.1411		7	.	.	.	.	.	.	.	.	.	.	C	6.941	0.543429	0.13250	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394565	T;T;T	0.02863	4.13;4.13;4.13	5.76	4.86	0.63082	.	0.192741	0.25750	N	0.028557	T	0.03608	0.0103	L	0.33485	1.01	0.26451	N	0.975602	B;B;B;B	0.25169	0.073;0.119;0.004;0.041	B;B;B;B	0.32090	0.066;0.14;0.009;0.033	T	0.41466	-0.9507	10	0.12430	T	0.62	.	15.3596	0.74460	0.0:0.5791:0.4209:0.0	.	471;459;459;471	Q99996;Q99996-2;Q99996-3;A4D1E4	AKAP9_HUMAN;.;.;.	E	459;471;471;471;471	ENSP00000348573:Q459E;ENSP00000351922:Q471E;ENSP00000350813:Q471E	ENSP00000348573:Q459E	Q	+	1	0	AKAP9	91468542	0.998000	0.40836	1.000000	0.80357	0.102000	0.19082	3.074000	0.50065	1.513000	0.48852	0.650000	0.86243	CAG	AKAP9	-	NULL	ENSG00000127914		0.368	AKAP9-202	KNOWN	basic	protein_coding	AKAP9	HGNC	protein_coding		-	0.00	49	0	C	NM_005751		91630606	+1	tier1	-	no_errors	ENST00000359028	ensembl	human	known	74_37	missense	46.43	30	26	SNP	0.985	G
ANK1	286	genome.wustl.edu	37	8	41573336	41573336	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr8:41573336C>T	ENST00000347528.4	-	14	1519	c.1436G>A	c.(1435-1437)cGc>cAc	p.R479H	ANK1_ENST00000396942.1_Missense_Mutation_p.R479H|ANK1_ENST00000289734.7_Missense_Mutation_p.R479H|ANK1_ENST00000352337.4_Missense_Mutation_p.R479H|ANK1_ENST00000396945.1_Missense_Mutation_p.R479H|ANK1_ENST00000265709.8_Missense_Mutation_p.R512H|ANK1_ENST00000379758.2_Missense_Mutation_p.R479H	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	479	89 kDa domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			GTGGCCGATGCGAGCTGCACA	0.542																																																	0													99.0	89.0	92.0					8																	41573336		2203	4300	6503	SO:0001583	missense	0			M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.1436G>A	8.37:g.41573336C>T	ENSP00000339620:p.Arg479His		A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.R479H	ENST00000347528.4	37	c.1436	CCDS6119.1	8	.	.	.	.	.	.	.	.	.	.	C	35	5.503239	0.96371	.	.	ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820	T;T;T;T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21;-0.21;-0.21;-0.21	6.03	6.03	0.97812	Ankyrin repeat-containing domain (3);	0.055814	0.64402	D	0.000001	T	0.71660	0.3366	N	0.16903	0.455	0.80722	D	1	D;D;P;D;D	0.89917	1.0;0.999;0.883;1.0;1.0	D;D;B;D;D	0.69479	0.947;0.96;0.169;0.932;0.964	T	0.73560	-0.3944	10	0.52906	T	0.07	.	20.17	0.98157	0.0:1.0:0.0:0.0	.	512;479;479;479;479	P16157-21;P16157-4;P16157;P16157-5;P16157-3	.;.;ANK1_HUMAN;.;.	H	479;479;479;479;479;479;512;479	ENSP00000339620:R479H;ENSP00000289734:R479H;ENSP00000369082:R479H;ENSP00000380149:R479H;ENSP00000380147:R479H;ENSP00000309131:R479H;ENSP00000265709:R512H	ENSP00000265709:R512H	R	-	2	0	ANK1	41692493	1.000000	0.71417	0.985000	0.45067	0.927000	0.56198	7.797000	0.85911	2.868000	0.98415	0.555000	0.69702	CGC	ANK1	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000029534		0.542	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANK1	HGNC	protein_coding	OTTHUMT00000317297.1	-	0.00	60	0	C	NM_020475		41573336	-1	tier1	-	no_errors	ENST00000396942	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	T
ANKRD1	27063	genome.wustl.edu	37	10	92675939	92675939	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr10:92675939C>T	ENST00000371697.3	-	6	888	c.640G>A	c.(640-642)Gcc>Acc	p.A214T		NM_014391.2	NP_055206.2	Q15327	ANKR1_HUMAN	ankyrin repeat domain 1 (cardiac muscle)	214					cardiac muscle tissue morphogenesis (GO:0055008)|cellular lipid metabolic process (GO:0044255)|cellular response to drug (GO:0035690)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to muscle stretch (GO:0035994)|sarcomere organization (GO:0045214)|skeletal muscle cell differentiation (GO:0035914)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|I band (GO:0031674)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|p53 binding (GO:0002039)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|titin binding (GO:0031432)|transcription corepressor activity (GO:0003714)			autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(10)|prostate(3)|skin(1)	27		Colorectal(252;0.0475)				TTATCTCGGGCGCTAATTTTT	0.527																																																	0													84.0	81.0	82.0					10																	92675939		2203	4300	6503	SO:0001583	missense	0			X83703	CCDS7412.1	10q23.33	2014-09-17			ENSG00000148677	ENSG00000148677		"""Ankyrin repeat domain containing"""	15819	protein-coding gene	gene with protein product		609599				7730328	Standard	NM_014391		Approved	C-193, ALRP, CARP, CVARP, MCARP	uc001khe.1	Q15327	OTTHUMG00000018734	ENST00000371697.3:c.640G>A	10.37:g.92675939C>T	ENSP00000360762:p.Ala214Thr		Q96LE7	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.A214T	ENST00000371697.3	37	c.640	CCDS7412.1	10	.	.	.	.	.	.	.	.	.	.	C	15.80	2.941171	0.53079	.	.	ENSG00000148677	ENST00000371697	T	0.65364	-0.15	5.35	4.44	0.53790	Ankyrin repeat-containing domain (4);	0.075470	0.56097	D	0.000039	T	0.55768	0.1941	L	0.52573	1.65	0.48135	D	0.999596	B	0.18863	0.031	B	0.21917	0.037	T	0.52555	-0.8560	10	0.30854	T	0.27	.	13.4315	0.61057	0.0:0.9243:0.0:0.0757	.	214	Q15327	ANKR1_HUMAN	T	214	ENSP00000360762:A214T	ENSP00000360762:A214T	A	-	1	0	ANKRD1	92665919	0.868000	0.29978	0.996000	0.52242	0.966000	0.64601	1.646000	0.37249	2.511000	0.84671	0.484000	0.47621	GCC	ANKRD1	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000148677		0.527	ANKRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD1	HGNC	protein_coding	OTTHUMT00000049357.1	-	0.00	112	0	C	NM_014391		92675939	-1	tier1	-	no_errors	ENST00000371697	ensembl	human	known	74_37	missense	9.26	49	5	SNP	0.954	T
ANKRD20A5P	440482	genome.wustl.edu	37	18	14232570	14232570	+	IGR	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr18:14232570C>T								RNU6-316P (41765 upstream) : RP11-757O6.1 (12053 downstream)																							GTGTTAGTATCATCACTGGAG	0.269																																																	0																																										SO:0001628	intergenic_variant	0																															18.37:g.14232570C>T				RNA	SNP	-	NULL		37	NULL		18																																																																																			ANKRD20A5P	-	-	ENSG00000186481	0	0.269					ANKRD20A5P	HGNC			-	0.00	104	0	C			14232570	+1	tier1	-	no_errors	ENST00000577614	ensembl	human	known	74_37	rna	12.90	54	8	SNP	0.929	T
ANKRD32	84250	genome.wustl.edu	37	5	94024337	94024337	+	Missense_Mutation	SNP	A	A	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr5:94024337A>G	ENST00000265140.5	+	17	2667	c.2248A>G	c.(2248-2250)Act>Gct	p.T750A		NM_032290.3	NP_115666.2	Q9BQI6	ANR32_HUMAN	ankyrin repeat domain 32	750						centrosome (GO:0005813)|nucleus (GO:0005634)				NS(1)|breast(2)|endometrium(2)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|skin(1)	13		all_cancers(142;1.51e-09)|all_epithelial(76;4.68e-12)|all_lung(232;5.94e-05)|Ovarian(174;0.000953)|Lung NSC(167;0.00105)|Colorectal(57;0.122)|Lung SC(612;0.152)		all cancers(79;3.88e-18)		GCTGAATGGTACTAAACAAAA	0.433																																																	0													119.0	117.0	118.0					5																	94024337		2203	4300	6503	SO:0001583	missense	0			AL136560	CCDS4071.2	5q15	2013-01-10			ENSG00000133302	ENSG00000133302		"""Ankyrin repeat domain containing"""	25408	protein-coding gene	gene with protein product			"""BRCT domain containing 1"""	BRCTD1			Standard	NM_032290		Approved	DKFZp761C121, DKFZp564C0469	uc003kkr.4	Q9BQI6	OTTHUMG00000121133	ENST00000265140.5:c.2248A>G	5.37:g.94024337A>G	ENSP00000265140:p.Thr750Ala		B4DMG4|Q3B7K4|Q6NSA5|Q6PHW9|Q9Y402	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_BRCT_dom,smart_BRCT_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.T750A	ENST00000265140.5	37	c.2248	CCDS4071.2	5	.	.	.	.	.	.	.	.	.	.	A	0.102	-1.151447	0.01700	.	.	ENSG00000133302	ENST00000265140	T	0.37752	1.18	5.36	3.56	0.40772	.	0.414647	0.25025	N	0.033729	T	0.15305	0.0369	N	0.03608	-0.345	0.24394	N	0.99473	B	0.02656	0.0	B	0.01281	0.0	T	0.22068	-1.0227	10	0.11182	T	0.66	.	11.5698	0.50826	0.1488:0.0:0.8512:0.0	.	750	Q9BQI6	ANR32_HUMAN	A	750	ENSP00000265140:T750A	ENSP00000265140:T750A	T	+	1	0	ANKRD32	94050093	0.995000	0.38212	1.000000	0.80357	0.228000	0.25075	1.927000	0.40094	0.728000	0.32382	-0.472000	0.04984	ACT	ANKRD32	-	NULL	ENSG00000133302		0.433	ANKRD32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD32	HGNC	protein_coding	OTTHUMT00000241610.1	-	0.00	70	0	A	NM_032290		94024337	+1	tier1	-	no_errors	ENST00000265140	ensembl	human	known	74_37	missense	34.33	44	23	SNP	1.000	G
KB-7G2.8	0	genome.wustl.edu	37	22	17156473	17156473	+	lincRNA	SNP	A	A	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr22:17156473A>C	ENST00000423580.2	-	0	1750				ANKRD62P1-PARP4P3_ENST00000338526.6_RNA																							CTGAGAAAGAATCTGAATGTG	0.403																																																	0																																												0																															22.37:g.17156473A>C				RNA	SNP	-	NULL	ENST00000423580.2	37	NULL		22																																																																																			ANKRD62P1-PARP4P3	-	-	ENSG00000189295		0.403	KB-7G2.8-001	KNOWN	basic|readthrough_transcript	processed_transcript	ANKRD62P1-PARP4P3	HGNC	lincRNA	OTTHUMT00000418976.1	-	0.00	87	0	A			17156473	-1	tier1	-	no_errors	ENST00000338526	ensembl	human	known	74_37	rna	36.36	21	12	SNP	0.255	C
ANO4	121601	genome.wustl.edu	37	12	101510523	101510523	+	Silent	SNP	T	T	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr12:101510523T>C	ENST00000392977.3	+	25	2727	c.2517T>C	c.(2515-2517)tcT>tcC	p.S839S	ANO4_ENST00000299222.9_Silent_p.S359S|ANO4_ENST00000550015.1_Silent_p.S359S|ANO4_ENST00000392979.3_Silent_p.S804S			Q32M45	ANO4_HUMAN	anoctamin 4	839					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						AGAACCGATCTGAGCCTGAAT	0.512										HNSCC(74;0.22)																																							0													250.0	224.0	233.0					12																	101510523		2203	4300	6503	SO:0001819	synonymous_variant	0			AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.2517T>C	12.37:g.101510523T>C			Q8NAJ0|Q8NB39|Q8NB53	Silent	SNP	pfam_Anoctamin	p.S839	ENST00000392977.3	37	c.2517		12																																																																																			ANO4	-	pfam_Anoctamin	ENSG00000151572		0.512	ANO4-002	KNOWN	basic	protein_coding	ANO4	HGNC	protein_coding	OTTHUMT00000409295.1	-	0.00	95	0	T	NM_178826		101510523	+1	tier1	-	no_errors	ENST00000392977	ensembl	human	known	74_37	silent	27.69	47	18	SNP	0.996	C
AP5B1	91056	genome.wustl.edu	37	11	65546066	65546066	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr11:65546066G>A	ENST00000532090.2	-	2	2108	c.1898C>T	c.(1897-1899)cCc>cTc	p.P633L		NM_138368.4	NP_612377.4	Q2VPB7	AP5B1_HUMAN	adaptor-related protein complex 5, beta 1 subunit	633					endosomal transport (GO:0016197)|protein transport (GO:0015031)	AP-type membrane coat adaptor complex (GO:0030119)|lysosomal membrane (GO:0005765)				lung(1)	1						GGCAAGCGAGGGGCCCAGGGC	0.677																																																	0													8.0	11.0	10.0					11																	65546066		2050	4177	6227	SO:0001583	missense	0			JQ313135	CCDS58146.1	11q13.1	2012-02-29			ENSG00000254470	ENSG00000254470			25104	protein-coding gene	gene with protein product		614367				22022230	Standard	NM_138368		Approved	PP1030, AP-5, DKFZp761E198	uc031qbm.1	Q2VPB7	OTTHUMG00000166593	ENST00000532090.2:c.1898C>T	11.37:g.65546066G>A	ENSP00000454303:p.Pro633Leu		A1L0S6|H6WUK2|Q0D2Q2|Q8N3J7|Q8WYH6	Missense_Mutation	SNP	NULL	p.P633L	ENST00000532090.2	37	c.1898	CCDS58146.1	11																																																																																			AP5B1	-	NULL	ENSG00000254470		0.677	AP5B1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	AP5B1	HGNC	protein_coding	OTTHUMT00000390636.2	-	0.00	52	0	G	NM_138368		65546066	-1	tier1	-	no_errors	ENST00000532090	ensembl	human	novel	74_37	missense	28.26	33	13	SNP	0.998	A
APOA5	116519	genome.wustl.edu	37	11	116661515	116661515	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr11:116661515C>T	ENST00000227665.4	-	3	464	c.430G>A	c.(430-432)Gtg>Atg	p.V144M	ZNF259_ENST00000227322.3_5'Flank|APOA5_ENST00000542499.1_Missense_Mutation_p.V144M			Q6Q788	APOA5_HUMAN	apolipoprotein A-V	144					acylglycerol homeostasis (GO:0055090)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|organ regeneration (GO:0031100)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipid catabolic process (GO:0050996)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|tissue regeneration (GO:0042246)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|triglyceride metabolic process (GO:0006641)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)	chylomicron (GO:0042627)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|high-density lipoprotein particle (GO:0034364)|very-low-density lipoprotein particle (GO:0034361)	enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|heparin binding (GO:0008201)|lipase activator activity (GO:0060229)|lipase binding (GO:0035473)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|lipoprotein particle receptor binding (GO:0070325)|low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylcholine binding (GO:0031210)|phospholipid binding (GO:0005543)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(8)|urinary_tract(1)	14	all_hematologic(175;0.0487)	all_cancers(61;3.31e-09)|all_epithelial(67;8.03e-06)|Breast(348;0.0126)|Melanoma(852;0.0153)|Acute lymphoblastic leukemia(157;0.0257)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0433)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;4.93e-06)|all cancers(92;0.000123)|OV - Ovarian serous cystadenocarcinoma(223;0.149)		AGCTCCTGCACGCGCAGGGCC	0.647																																																	0													64.0	61.0	62.0					11																	116661515		2201	4296	6497	SO:0001583	missense	0			AF202889	CCDS8376.2	11q23	2013-01-24			ENSG00000110243	ENSG00000110243		"""Apolipoproteins"""	17288	protein-coding gene	gene with protein product		606368				11588264, 11577099	Standard	NM_001166598		Approved	RAP3, APOA-V	uc009yzf.3	Q6Q788	OTTHUMG00000046116	ENST00000227665.4:c.430G>A	11.37:g.116661515C>T	ENSP00000227665:p.Val144Met		B0YIV9|Q3MIK6|Q6UWK9|Q9UBJ3	Missense_Mutation	SNP	pfam_ApoA1_A4_E	p.V144M	ENST00000227665.4	37	c.430	CCDS8376.2	11	.	.	.	.	.	.	.	.	.	.	C	11.06	1.528866	0.27387	.	.	ENSG00000110243	ENST00000227665;ENST00000542499;ENST00000433069	T;T;T	0.74632	-0.86;-0.86;-0.86	4.98	3.14	0.36123	Apolipoprotein/apolipophorin (1);	0.879965	0.09676	N	0.770369	T	0.73171	0.3553	M	0.73962	2.25	0.09310	N	1	B;B	0.25904	0.137;0.069	B;B	0.27608	0.081;0.036	T	0.60337	-0.7283	10	0.33141	T	0.24	-2.9271	9.4133	0.38505	0.0:0.8346:0.0:0.1654	.	141;144	B0YIW1;Q6Q788	.;APOA5_HUMAN	M	144	ENSP00000227665:V144M;ENSP00000445002:V144M;ENSP00000399701:V144M	ENSP00000227665:V144M	V	-	1	0	APOA5	116166725	0.000000	0.05858	0.008000	0.14137	0.871000	0.50021	0.791000	0.26915	0.700000	0.31782	-0.143000	0.13931	GTG	APOA5	-	pfam_ApoA1_A4_E	ENSG00000110243		0.647	APOA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOA5	HGNC	protein_coding	OTTHUMT00000106285.2	-	0.00	76	0	C			116661515	-1	tier1	-	no_errors	ENST00000227665	ensembl	human	known	74_37	missense	33.33	34	17	SNP	0.002	T
AR	367	genome.wustl.edu	37	X	66905924	66905924	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chrX:66905924C>G	ENST00000374690.3	+	3	2365	c.1841C>G	c.(1840-1842)tCt>tGt	p.S614C	AR_ENST00000513847.1_3'UTR|AR_ENST00000504326.1_Missense_Mutation_p.S614C|AR_ENST00000396043.2_Missense_Mutation_p.S82C|AR_ENST00000396044.3_Missense_Mutation_p.S614C	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	613	Interaction with HIPK3. {ECO:0000250}.|Interaction with LPXN.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	AATTGTCCATCTTGTCGTCTT	0.438									Androgen Insensitivity Syndrome																																								0													130.0	111.0	117.0					X																	66905924		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.1841C>G	X.37:g.66905924C>G	ENSP00000363822:p.Ser614Cys		A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	pfam_Andrgn_rcpt,pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Andrgn_rcpt,prints_Znf_hrmn_rcpt	p.S614C	ENST00000374690.3	37	c.1841	CCDS14387.1	X	.	.	.	.	.	.	.	.	.	.	C	23.8	4.453745	0.84209	.	.	ENSG00000169083	ENST00000544984;ENST00000374690;ENST00000504326;ENST00000396044;ENST00000396043	D;D;D;D	0.97352	-4.35;-4.35;-4.35;-4.35	5.42	5.42	0.78866	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (4);	0.000000	0.85682	D	0.000000	D	0.98251	0.9421	M	0.77103	2.36	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;0.998;1.0;0.986	D	0.99120	1.0849	10	0.87932	D	0	.	15.3078	0.74008	0.0:1.0:0.0:0.0	.	614;614;82;613	E7EVX6;D3YPQ2;F1D8N5;P10275	.;.;.;ANDR_HUMAN	C	424;614;614;614;82	ENSP00000363822:S614C;ENSP00000421155:S614C;ENSP00000379359:S614C;ENSP00000379358:S82C	ENSP00000363822:S614C	S	+	2	0	AR	66822649	0.999000	0.42202	1.000000	0.80357	0.985000	0.73830	7.193000	0.77780	2.499000	0.84300	0.594000	0.82650	TCT	AR	-	pfam_Znf_hrmn_rcpt,smart_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt,prints_Znf_hrmn_rcpt	ENSG00000169083		0.438	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AR	HGNC	protein_coding	OTTHUMT00000057007.1	-	0.00	96	0	C	NM_000044		66905924	+1	tier1	-	no_errors	ENST00000374690	ensembl	human	known	74_37	missense	58.21	27	39	SNP	1.000	G
ASB14	142686	genome.wustl.edu	37	3	57317227	57317227	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr3:57317227C>T	ENST00000389601.3	-	7	833	c.713G>A	c.(712-714)cGg>cAg	p.R238Q	ASB14_ENST00000487349.1_Missense_Mutation_p.R237Q	NM_130387.5	NP_569058.1	A6NK59	ASB14_HUMAN	ankyrin repeat and SOCS box containing 14	238					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					central_nervous_system(1)|large_intestine(1)|lung(1)|skin(2)	5				KIRC - Kidney renal clear cell carcinoma(284;0.011)|Kidney(284;0.0127)		CTTGCCTTTCCGCAGTAACAT	0.453																																																	0													81.0	71.0	74.0					3																	57317227		692	1591	2283	SO:0001583	missense	0			AF403032	CCDS46856.1, CCDS46856.2	3p21.1	2013-01-10	2011-01-25			ENSG00000239388		"""Ankyrin repeat domain containing"""	19766	protein-coding gene	gene with protein product			"""ankyrin repeat and SOCS box-containing 14"""			12076535	Standard	NM_130387		Approved	DKFZp313L0121	uc021wzs.1	A6NK59		ENST00000389601.3:c.713G>A	3.37:g.57317227C>T	ENSP00000374252:p.Arg238Gln		C9JX97|Q8WXK2|Q92816	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C,prints_Ankyrin_rpt	p.R238Q	ENST00000389601.3	37	c.713		3	.	.	.	.	.	.	.	.	.	.	C	2.671	-0.277618	0.05679	.	.	ENSG00000239388	ENST00000487349;ENST00000389601;ENST00000438870	T;T	0.63580	-0.05;-0.05	5.97	3.62	0.41486	.	.	.	.	.	T	0.35335	0.0928	N	0.02775	-0.495	0.20196	N	0.999923	B	0.06786	0.001	B	0.08055	0.003	T	0.16867	-1.0388	9	0.15952	T	0.53	.	11.2116	0.48802	0.0:0.1388:0.0:0.8612	.	237	C9JX97	.	Q	237;238;73	ENSP00000419199:R237Q;ENSP00000374252:R238Q	ENSP00000374252:R238Q	R	-	2	0	ASB14	57292267	0.889000	0.30405	0.997000	0.53966	0.372000	0.29890	0.616000	0.24344	0.518000	0.28383	-1.084000	0.02203	CGG	ASB14	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000239388		0.453	ASB14-201	KNOWN	basic	protein_coding	ASB14	HGNC	protein_coding		-	0.00	58	0	C			57317227	-1	tier1	-	no_errors	ENST00000389601	ensembl	human	known	74_37	missense	6.67	56	4	SNP	0.864	T
ATAD3B	83858	genome.wustl.edu	37	1	1417530	1417530	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:1417530G>A	ENST00000308647.7	+	6	643	c.527G>A	c.(526-528)cGg>cAg	p.R176Q	ATAD3B_ENST00000378736.3_3'UTR|ATAD3B_ENST00000378741.3_Missense_Mutation_p.R8Q	NM_031921.4	NP_114127.3	Q5T9A4	ATD3B_HUMAN	ATPase family, AAA domain containing 3B	176						mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)			endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(2)|urinary_tract(1)	10	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		ACCGTGGAGCGGGAGATGGAG	0.682																																																	0													17.0	21.0	20.0					1																	1417530		2194	4290	6484	SO:0001583	missense	0			AL834179	CCDS30.1	1p36.33	2010-04-21		2007-02-08	ENSG00000160072	ENSG00000160072		"""ATPases / AAA-type"""	24007	protein-coding gene	gene with protein product		612317				10574462	Standard	XM_005244806		Approved	TOB3, KIAA1273	uc001afv.3	Q5T9A4	OTTHUMG00000000577	ENST00000308647.7:c.527G>A	1.37:g.1417530G>A	ENSP00000311766:p.Arg176Gln		A8K3H1|Q6ZRB5|Q9BUK4|Q9ULE7	Missense_Mutation	SNP	pfam_DUF3523,pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.R176Q	ENST00000308647.7	37	c.527	CCDS30.1	1	.	.	.	.	.	.	.	.	.	.	.	9.481	1.098284	0.20552	.	.	ENSG00000160072	ENST00000378741;ENST00000308647;ENST00000378736	T	0.17691	2.26	2.38	1.44	0.22558	ATPase family AAA domain-containing protein 3, domain of unknown function DUF3523 (1);	0.062753	0.64402	D	0.000004	T	0.09642	0.0237	L	0.36672	1.1	0.35688	D	0.814629	B;P;B	0.39920	0.092;0.695;0.112	B;B;B	0.35278	0.013;0.199;0.041	T	0.34153	-0.9840	10	0.19147	T	0.46	.	5.7085	0.17921	0.2694:0.0:0.7306:0.0	.	130;97;176	Q5T9A4-3;G3V1I6;Q5T9A4	.;.;ATD3B_HUMAN	Q	8;176;8	ENSP00000311766:R176Q	ENSP00000311766:R176Q	R	+	2	0	ATAD3B	1407393	1.000000	0.71417	0.984000	0.44739	0.452000	0.32318	5.511000	0.67024	0.334000	0.23590	0.194000	0.17425	CGG	ATAD3B	-	pfam_DUF3523	ENSG00000160072		0.682	ATAD3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD3B	HGNC	protein_coding	OTTHUMT00000001369.2	-	0.00	95	0	G	NM_031921		1417530	+1	tier1	-	no_errors	ENST00000308647	ensembl	human	known	74_37	missense	28.79	47	19	SNP	0.996	A
ATF7IP	55729	genome.wustl.edu	37	12	14609565	14609565	+	Missense_Mutation	SNP	A	A	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr12:14609565A>C	ENST00000540793.1	+	6	2221	c.2066A>C	c.(2065-2067)tAc>tCc	p.Y689S	ATF7IP_ENST00000543189.1_Missense_Mutation_p.Y688S|ATF7IP_ENST00000541654.1_3'UTR|ATF7IP_ENST00000544627.1_Missense_Mutation_p.Y697S|ATF7IP_ENST00000536444.1_Missense_Mutation_p.Y688S|ATF7IP_ENST00000261168.4_Missense_Mutation_p.Y689S			Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting protein	689	Interaction with SETDB1.				DNA methylation (GO:0006306)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045898)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)				cervix(1)|endometrium(7)|kidney(5)|large_intestine(10)|liver(2)|lung(22)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	54						AACATGTCTTACAGGTGAGAA	0.343																																																	0													93.0	83.0	86.0					12																	14609565		2203	4300	6503	SO:0001583	missense	0			AJ242978	CCDS8663.1, CCDS66326.1, CCDS66327.1, CCDS73449.1	12p13.1	2005-11-18				ENSG00000171681			20092	protein-coding gene	gene with protein product		613644				10976766, 10777215	Standard	XM_005253424		Approved	FLJ10688, p621	uc001rbw.3	Q6VMQ6		ENST00000540793.1:c.2066A>C	12.37:g.14609565A>C	ENSP00000444589:p.Tyr689Ser		F5GX74|G3V1U0|Q4G0T9|Q6P3T3|Q86XW5|Q9NVJ9|Q9NWC2|Q9Y4X8	Missense_Mutation	SNP	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.Y689S	ENST00000540793.1	37	c.2066	CCDS8663.1	12	.	.	.	.	.	.	.	.	.	.	A	16.26	3.073394	0.55646	.	.	ENSG00000171681	ENST00000261168;ENST00000543189;ENST00000536444;ENST00000544627;ENST00000540793	T;T;T;T;T	0.18657	2.2;2.2;2.2;2.2;2.2	5.75	5.75	0.90469	.	0.000000	0.64402	D	0.000013	T	0.45135	0.1327	M	0.61703	1.905	0.54753	D	0.999983	D;D;D;D;D;D	0.89917	1.0;1.0;0.991;0.981;1.0;1.0	D;D;P;P;D;D	0.91635	0.973;0.999;0.73;0.64;0.999;0.999	T	0.38693	-0.9649	10	0.87932	D	0	-7.2987	15.5278	0.75925	1.0:0.0:0.0:0.0	.	697;688;688;689;688;300	B4E2A2;B4DRL6;G3V1U0;Q6VMQ6;Q6VMQ6-2;B3KQF8	.;.;.;MCAF1_HUMAN;.;.	S	689;688;688;697;689	ENSP00000261168:Y689S;ENSP00000443179:Y688S;ENSP00000445955:Y688S;ENSP00000440440:Y697S;ENSP00000444589:Y689S	ENSP00000261168:Y689S	Y	+	2	0	ATF7IP	14500832	1.000000	0.71417	0.996000	0.52242	0.220000	0.24768	4.020000	0.57189	2.320000	0.78422	0.528000	0.53228	TAC	ATF7IP	-	NULL	ENSG00000171681		0.343	ATF7IP-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATF7IP	HGNC	protein_coding	OTTHUMT00000401400.1	-	0.00	58	0	A	NM_018179		14609565	+1	tier1	-	no_errors	ENST00000261168	ensembl	human	known	74_37	missense	34.55	36	19	SNP	1.000	C
ATP2B3	492	genome.wustl.edu	37	X	152845533	152845533	+	Missense_Mutation	SNP	T	T	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chrX:152845533T>G	ENST00000349466.2	+	21	3766	c.3440T>G	c.(3439-3441)tTt>tGt	p.F1147C	ATP2B3_ENST00000359149.3_3'UTR|ATP2B3_ENST00000263519.4_Missense_Mutation_p.F1147C|ATP2B3_ENST00000370186.1_3'UTR|ATP2B3_ENST00000370181.2_3'UTR			Q16720	AT2B3_HUMAN	ATPase, Ca++ transporting, plasma membrane 3	1147					blood coagulation (GO:0007596)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(2)|breast(5)|endometrium(7)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(3)	50	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ACGCCCGAGTTTCTGATCAAT	0.597																																																	0													173.0	153.0	160.0					X																	152845533		2203	4300	6503	SO:0001583	missense	0			U60414	CCDS14722.1, CCDS35440.1	Xq28	2014-07-18			ENSG00000067842	ENSG00000067842	3.6.3.8	"""ATPases / P-type"""	816	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 3"", ""cilia and flagella associated protein 39"""	300014	"""spinocerebellar ataxia, X-linked 1"", ""cerebellar ataxia 2 (X-linked)"""	SCAX1, CLA2		8187550, 22912398	Standard	NM_021949		Approved	PMCA3, CFAP39	uc004fht.1	Q16720	OTTHUMG00000024202	ENST00000349466.2:c.3440T>G	X.37:g.152845533T>G	ENSP00000343886:p.Phe1147Cys		B7WNR8|B7WNY5|Q12995|Q16858	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_plasma,tigrfam_Cation_transp_P_typ_ATPase	p.F1147C	ENST00000349466.2	37	c.3440	CCDS35440.1	X	.	.	.	.	.	.	.	.	.	.	t	21.8	4.205087	0.79127	.	.	ENSG00000067842	ENST00000349466;ENST00000263519	T;T	0.78707	-1.2;-1.2	5.02	5.02	0.67125	.	0.067516	0.64402	D	0.000014	D	0.87752	0.6256	M	0.83384	2.64	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.72625	0.978;0.971	D	0.88960	0.3393	10	0.59425	D	0.04	-13.5646	12.7904	0.57530	0.0:0.0:0.0:1.0	.	1133;1147	Q16720-4;Q16720	.;AT2B3_HUMAN	C	1147	ENSP00000343886:F1147C;ENSP00000263519:F1147C	ENSP00000263519:F1147C	F	+	2	0	ATP2B3	152498727	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	5.948000	0.70249	1.658000	0.50742	0.427000	0.28365	TTT	ATP2B3	-	pfam_ATP_Ca_trans_C	ENSG00000067842		0.597	ATP2B3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP2B3	HGNC	protein_coding	OTTHUMT00000060957.1	-	0.00	46	0	T	NM_021949		152845533	+1	tier1	-	no_errors	ENST00000263519	ensembl	human	known	74_37	missense	75.00	7	21	SNP	1.000	G
ATRNL1	26033	genome.wustl.edu	37	10	117040912	117040912	+	Silent	SNP	T	T	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr10:117040912T>C	ENST00000355044.3	+	14	2274	c.2148T>C	c.(2146-2148)tgT>tgC	p.C716C		NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	716	PSI 3.				G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		AGCAGATTTGTAACAAACTTA	0.363																																																	0													92.0	87.0	89.0					10																	117040912		2203	4300	6503	SO:0001819	synonymous_variant	0			AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.2148T>C	10.37:g.117040912T>C			O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Silent	SNP	pfam_Kelch_1,pfam_Kelch_2,pfam_Plexin_repeat,pfam_CUB_dom,pfam_EGF_extracell,superfamily_C-type_lectin_fold,superfamily_CUB_dom,superfamily_Plexin-like_fold,smart_EG-like_dom,smart_CUB_dom,smart_Plexin-like_fold,smart_C-type_lectin,smart_EGF_laminin,pfscan_CUB_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_C-type_lectin	p.C716	ENST00000355044.3	37	c.2148	CCDS7592.1	10																																																																																			ATRNL1	-	smart_Plexin-like_fold	ENSG00000107518		0.363	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATRNL1	HGNC	protein_coding	OTTHUMT00000050507.3	-	0.00	68	0	T	XM_049349		117040912	+1	tier1	-	no_errors	ENST00000355044	ensembl	human	known	74_37	silent	29.63	38	16	SNP	1.000	C
AWAT1	158833	genome.wustl.edu	37	X	69455948	69455948	+	Missense_Mutation	SNP	T	T	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chrX:69455948T>G	ENST00000374521.3	+	3	255	c.214T>G	c.(214-216)Tgg>Ggg	p.W72G	AWAT1_ENST00000480702.1_3'UTR	NM_001013579.2	NP_001013597.1	Q58HT5	AWAT1_HUMAN	acyl-CoA wax alcohol acyltransferase 1	72					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	long-chain-alcohol O-fatty-acyltransferase activity (GO:0047196)			breast(2)|central_nervous_system(1)|large_intestine(4)|lung(3)|ovary(4)|skin(1)	15						GGTAAGGAACTGGTGTGTCTG	0.507																																																	0													165.0	137.0	147.0					X																	69455948		2203	4300	6503	SO:0001583	missense	0			BC039181	CCDS35321.1	Xq13.1	2010-01-25	2009-02-23	2009-02-23	ENSG00000204195	ENSG00000204195			23252	protein-coding gene	gene with protein product		300924	"""diacylglycerol O-acyltransferase 2-like 3"""	DGAT2L3		14970677, 15671038	Standard	NM_001013579		Approved		uc004dxy.3	Q58HT5	OTTHUMG00000021773	ENST00000374521.3:c.214T>G	X.37:g.69455948T>G	ENSP00000363645:p.Trp72Gly		Q5JT21|Q6IEE4	Missense_Mutation	SNP	pfam_DAGAT	p.W72G	ENST00000374521.3	37	c.214	CCDS35321.1	X	.	.	.	.	.	.	.	.	.	.	t	15.88	2.963925	0.53507	.	.	ENSG00000204195	ENST00000374521	T	0.14144	2.53	5.25	5.25	0.73442	.	0.000000	0.64402	D	0.000004	T	0.40094	0.1103	M	0.85630	2.765	0.48511	D	0.999664	D	0.89917	1.0	D	0.91635	0.999	T	0.36286	-0.9754	10	0.56958	D	0.05	-7.1385	11.487	0.50358	0.0:0.0:0.0:1.0	.	72	Q58HT5	AWAT1_HUMAN	G	72	ENSP00000363645:W72G	ENSP00000363645:W72G	W	+	1	0	AWAT1	69372673	1.000000	0.71417	1.000000	0.80357	0.820000	0.46376	7.144000	0.77357	1.942000	0.56320	0.478000	0.44815	TGG	AWAT1	-	pfam_DAGAT	ENSG00000204195		0.507	AWAT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AWAT1	HGNC	protein_coding	OTTHUMT00000057066.3	-	0.00	60	0	T	NM_001013579		69455948	+1	tier1	-	no_errors	ENST00000374521	ensembl	human	known	74_37	missense	62.50	24	40	SNP	1.000	G
BAI1	575	genome.wustl.edu	37	8	143562931	143562931	+	Silent	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr8:143562931G>A	ENST00000517894.1	+	11	2883	c.1989G>A	c.(1987-1989)tcG>tcA	p.S663S	BAI1_ENST00000323289.5_Silent_p.S663S			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	663					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					AGGGGGTCTCGGAGGTCATCC	0.612																																																	0													26.0	30.0	29.0					8																	143562931		2026	4169	6195	SO:0001819	synonymous_variant	0			AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.1989G>A	8.37:g.143562931G>A				Silent	SNP	pfam_GPCR_2_secretin-like,pfam_Thrombospondin_1_rpt,pfam_DUF3497,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like	p.S663	ENST00000517894.1	37	c.1989		8																																																																																			BAI1	-	pfam_DUF3497	ENSG00000181790		0.612	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	BAI1	HGNC	protein_coding	OTTHUMT00000379963.3	-	0.00	90	0	G	NM_001702		143562931	+1	tier1	-	no_errors	ENST00000323289	ensembl	human	known	74_37	silent	25.44	85	29	SNP	0.035	A
BAI2	576	genome.wustl.edu	37	1	32221809	32221809	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:32221809C>T	ENST00000373658.3	-	4	970	c.629G>A	c.(628-630)cGc>cAc	p.R210H	MIR4254_ENST00000581063.1_RNA|BAI2_ENST00000398542.1_Missense_Mutation_p.R198H|BAI2_ENST00000373655.2_Missense_Mutation_p.R210H|BAI2_ENST00000257070.4_Missense_Mutation_p.R210H|BAI2_ENST00000398547.1_Missense_Mutation_p.R198H|BAI2_ENST00000398538.1_Missense_Mutation_p.R198H|BAI2_ENST00000527361.1_Missense_Mutation_p.R210H|BAI2_ENST00000398556.3_Missense_Mutation_p.R213H	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	210					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		GCCGGCAGCGCGGCCACACTC	0.647																																																	0													25.0	32.0	30.0					1																	32221809		2200	4299	6499	SO:0001583	missense	0			AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.629G>A	1.37:g.32221809C>T	ENSP00000362762:p.Arg210His		B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.R210H	ENST00000373658.3	37	c.629	CCDS346.2	1	.	.	.	.	.	.	.	.	.	.	C	13.72	2.321283	0.41096	.	.	ENSG00000121753	ENST00000398556;ENST00000398547;ENST00000373658;ENST00000373655;ENST00000398542;ENST00000257070;ENST00000527361;ENST00000398538;ENST00000420125;ENST00000533175	T;T;T;T;T;T;T;T;T;T	0.46451	1.5;1.7;0.92;0.92;1.86;0.87;0.87;0.94;1.47;1.34	5.2	4.27	0.50696	.	0.000000	0.42682	D	0.000678	T	0.26521	0.0648	N	0.02539	-0.55	0.80722	D	1	D;P;B;B;P;B	0.71674	0.998;0.698;0.422;0.44;0.698;0.297	P;B;B;B;B;B	0.54140	0.743;0.097;0.042;0.031;0.105;0.019	T	0.08330	-1.0727	10	0.48119	T	0.1	.	7.6223	0.28191	0.1657:0.7488:0.0:0.0854	.	198;210;198;198;210;210	A2A3C3;O60241-4;O60241-3;A2A3C1;O60241-2;O60241	.;.;.;.;.;BAI2_HUMAN	H	213;198;210;210;198;210;210;198;203;244	ENSP00000381564:R213H;ENSP00000381555:R198H;ENSP00000362762:R210H;ENSP00000362759:R210H;ENSP00000381550:R198H;ENSP00000257070:R210H;ENSP00000435397:R210H;ENSP00000381548:R198H;ENSP00000410921:R203H;ENSP00000437219:R244H	ENSP00000257070:R210H	R	-	2	0	BAI2	31994396	0.844000	0.29557	0.962000	0.40283	0.979000	0.70002	1.624000	0.37018	2.598000	0.87819	0.462000	0.41574	CGC	BAI2	-	NULL	ENSG00000121753		0.647	BAI2-015	KNOWN	basic|CCDS	protein_coding	BAI2	HGNC	protein_coding	OTTHUMT00000381838.1	-	0.00	9	0	C	NM_001703		32221809	-1	tier1	-	no_errors	ENST00000373658	ensembl	human	known	74_37	missense	53.85	6	7	SNP	0.978	T
BBOX1	8424	genome.wustl.edu	37	11	27077102	27077102	+	Missense_Mutation	SNP	A	A	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr11:27077102A>G	ENST00000529202.1	+	2	464	c.125A>G	c.(124-126)gAt>gGt	p.D42G	BBOX1_ENST00000528583.1_Missense_Mutation_p.D42G|RP11-1L12.3_ENST00000526061.1_RNA|BBOX1_ENST00000525090.1_Missense_Mutation_p.D42G|BBOX1_ENST00000263182.3_Missense_Mutation_p.D42G|BBOX1_ENST00000527505.1_3'UTR			O75936	BODG_HUMAN	butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1	42					carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	gamma-butyrobetaine dioxygenase activity (GO:0008336)|iron ion binding (GO:0005506)|zinc ion binding (GO:0008270)			breast(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	23					Succinic acid(DB00139)|Vitamin C(DB00126)	CCGTGCTCTGATTGCTACCTG	0.443																																																	0													100.0	92.0	95.0					11																	27077102		2202	4299	6501	SO:0001583	missense	0			AF082868	CCDS7862.1	11p	2008-02-01			ENSG00000129151	ENSG00000129151	1.14.11.1		964	protein-coding gene	gene with protein product		603312		BBOX		9753662	Standard	XM_005253159		Approved	gamma-BBH, G-BBH, BBH	uc001mre.1	O75936	OTTHUMG00000166121	ENST00000529202.1:c.125A>G	11.37:g.27077102A>G	ENSP00000435781:p.Asp42Gly		B2R8L7|D3DQZ1|Q6IBJ2	Missense_Mutation	SNP	pfam_Taurine_dOase,pfam_DUF971,tigrfam_2-oxoglut_dOase	p.D42G	ENST00000529202.1	37	c.125	CCDS7862.1	11	.	.	.	.	.	.	.	.	.	.	A	9.871	1.198855	0.22121	.	.	ENSG00000129151	ENST00000529202;ENST00000533566;ENST00000263182;ENST00000528583;ENST00000525090	D;D;D;D	0.82893	-1.66;-1.66;-1.66;-1.66	5.94	3.24	0.37175	Domain of unknown function, DUF971 (1);	0.545614	0.21172	N	0.078972	T	0.76666	0.4019	L	0.52759	1.655	0.09310	N	1	B	0.24317	0.101	B	0.31191	0.125	T	0.63157	-0.6700	10	0.28530	T	0.3	.	7.4091	0.27007	0.7662:0.1481:0.0857:0.0	.	42	O75936	BODG_HUMAN	G	42	ENSP00000435781:D42G;ENSP00000263182:D42G;ENSP00000434918:D42G;ENSP00000433772:D42G	ENSP00000263182:D42G	D	+	2	0	BBOX1	27033678	0.000000	0.05858	0.009000	0.14445	0.919000	0.55068	0.977000	0.29475	1.031000	0.39867	0.482000	0.46254	GAT	BBOX1	-	pfam_DUF971,tigrfam_2-oxoglut_dOase	ENSG00000129151		0.443	BBOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BBOX1	HGNC	protein_coding	OTTHUMT00000387946.1	-	0.00	58	0	A	NM_003986		27077102	+1	tier1	-	no_errors	ENST00000263182	ensembl	human	known	74_37	missense	22.22	35	10	SNP	0.000	G
BCAT1	586	genome.wustl.edu	37	12	24987645	24987645	+	Intron	SNP	A	A	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr12:24987645A>T	ENST00000261192.7	-	8	1430				BCAT1_ENST00000538118.1_Intron|RP11-625L16.3_ENST00000545410.1_RNA|BCAT1_ENST00000342945.5_Intron|BCAT1_ENST00000544418.1_5'UTR|BCAT1_ENST00000539282.1_Intron|BCAT1_ENST00000539780.1_Intron	NM_001178091.1|NM_005504.6	NP_001171562.1|NP_005495.2	P54687	BCAT1_HUMAN	branched chain amino-acid transaminase 1, cytosolic						branched-chain amino acid biosynthetic process (GO:0009082)|branched-chain amino acid catabolic process (GO:0009083)|cell proliferation (GO:0008283)|cellular nitrogen compound metabolic process (GO:0034641)|G1/S transition of mitotic cell cycle (GO:0000082)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	branched-chain-amino-acid transaminase activity (GO:0004084)|L-isoleucine transaminase activity (GO:0052656)|L-leucine transaminase activity (GO:0052654)|L-valine transaminase activity (GO:0052655)			breast(1)|large_intestine(1)|lung(3)|prostate(2)	7	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Ovarian(17;0.107)|Colorectal(261;0.196)				Gabapentin(DB00996)|L-Isoleucine(DB00167)|L-Leucine(DB00149)|L-Valine(DB00161)	TGAAAGTTTCAATTTCTCTCA	0.308																																																	0													2.0	2.0	2.0					12																	24987645		677	1527	2204	SO:0001627	intron_variant	0				CCDS44845.1, CCDS53760.1, CCDS53761.1, CCDS53762.1, CCDS53763.1	12p12.1	2012-10-02	2010-05-07		ENSG00000060982	ENSG00000060982	2.6.1.42		976	protein-coding gene	gene with protein product		113520	"""branched chain aminotransferase 1, cytosolic"""	BCT1		9165094	Standard	NM_005504		Approved		uc010six.2	P54687	OTTHUMG00000169053	ENST00000261192.7:c.903+1799T>A	12.37:g.24987645A>T			B3KY27|B7Z2M5|B7Z5L0|F5H5E4|Q68DQ7|Q96MY9	RNA	SNP	-	NULL	ENST00000261192.7	37	NULL	CCDS44845.1	12																																																																																			BCAT1	-	-	ENSG00000060982		0.308	BCAT1-001	KNOWN	upstream_uORF|basic|appris_candidate_longest|CCDS	protein_coding	BCAT1	HGNC	protein_coding	OTTHUMT00000402080.1	-	0.00	37	0	A	NM_005504		24987645	-1	tier1	-	no_errors	ENST00000544418	ensembl	human	known	74_37	rna	15.79	16	3	SNP	0.000	T
BICC1	80114	genome.wustl.edu	37	10	60560031	60560031	+	Silent	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr10:60560031G>A	ENST00000373886.3	+	13	1807	c.1803G>A	c.(1801-1803)ccG>ccA	p.P601P	BICC1_ENST00000263103.1_Silent_p.P227P	NM_001080512.1	NP_001073981.1	Q9H694	BICC1_HUMAN	BicC family RNA binding protein 1	601					multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)	cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	44						ACGGGGATCCGTCCATCCAGA	0.408																																																	0													49.0	46.0	47.0					10																	60560031		2203	4300	6503	SO:0001819	synonymous_variant	0			AK026129	CCDS31206.1	10q21.3	2014-09-17	2014-02-03		ENSG00000122870	ENSG00000122870		"""Sterile alpha motif (SAM) domain containing"""	19351	protein-coding gene	gene with protein product		614295	"""bicaudal C homolog 1 (Drosophila)"""				Standard	XM_005270166		Approved		uc001jki.1	Q9H694	OTTHUMG00000018271	ENST00000373886.3:c.1803G>A	10.37:g.60560031G>A				Silent	SNP	pfam_KH_dom_type_1,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_KH_dom,smart_SAM,pfscan_SAM,pfscan_KH_dom_type_1	p.P601	ENST00000373886.3	37	c.1803	CCDS31206.1	10																																																																																			BICC1	-	NULL	ENSG00000122870		0.408	BICC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BICC1	HGNC	protein_coding	OTTHUMT00000048150.2	-	0.00	109	0	G	NM_025044		60560031	+1	tier1	-	no_errors	ENST00000373886	ensembl	human	known	74_37	silent	30.49	57	25	SNP	0.996	A
BMX	660	genome.wustl.edu	37	X	15543485	15543485	+	Nonsense_Mutation	SNP	C	C	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chrX:15543485C>A	ENST00000357607.2	+	8	1015	c.827C>A	c.(826-828)tCa>tAa	p.S276*	BMX_ENST00000348343.6_Nonsense_Mutation_p.S276*|BMX_ENST00000342014.6_Nonsense_Mutation_p.S276*			P51813	BMX_HUMAN	BMX non-receptor tyrosine kinase	276					apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to stress (GO:0006950)|signal transduction (GO:0007165)	cytosol (GO:0005829)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|signal transducer activity (GO:0004871)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(14)|ovary(2)|urinary_tract(3)	30	Hepatocellular(33;0.183)					TCAAAGATTTCATGGTAAATC	0.353																																																	0													109.0	98.0	102.0					X																	15543485		2203	4300	6503	SO:0001587	stop_gained	0			AF045459	CCDS14168.1	Xp22.2	2013-05-14			ENSG00000102010	ENSG00000102010		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1079	protein-coding gene	gene with protein product	"""BTK-like on X chromosome"""	300101				7970727	Standard	NM_203281		Approved	ETK, PSCTK3	uc004cwx.4	P51813	OTTHUMG00000021180	ENST00000357607.2:c.827C>A	X.37:g.15543485C>A	ENSP00000350224:p.Ser276*		A6NIH9|O60564|Q12871	Nonsense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_Pleckstrin_homology,pfam_Znf_Btk_motif,superfamily_Kinase-like_dom,smart_Pleckstrin_homology,smart_Znf_Btk_motif,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_Znf_Btk_motif,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_Znf_Btk_motif	p.S276*	ENST00000357607.2	37	c.827	CCDS14168.1	X	.	.	.	.	.	.	.	.	.	.	C	39	7.393451	0.98255	.	.	ENSG00000102010	ENST00000357607;ENST00000348343;ENST00000342014	.	.	.	4.66	4.66	0.58398	.	0.607939	0.14121	N	0.340043	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.8926	0.52638	0.0:1.0:0.0:0.0	.	.	.	.	X	276	.	ENSP00000340082:S276X	S	+	2	0	BMX	15453406	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	3.233000	0.51311	2.290000	0.77057	0.600000	0.82982	TCA	BMX	-	NULL	ENSG00000102010		0.353	BMX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	BMX	HGNC	protein_coding	OTTHUMT00000055877.1	-	0.00	35	0	C	NM_001721		15543485	+1	tier1	-	no_errors	ENST00000342014	ensembl	human	known	74_37	nonsense	13.04	20	3	SNP	1.000	A
BNC1	646	genome.wustl.edu	37	15	83933444	83933444	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr15:83933444C>G	ENST00000345382.2	-	4	644	c.559G>C	c.(559-561)Gag>Cag	p.E187Q	RP11-382A20.4_ENST00000565495.1_RNA|BNC1_ENST00000569704.1_Missense_Mutation_p.E180Q	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	187					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						TCTTCTTTCTCTTGAATTGCC	0.473																																																	0													213.0	194.0	200.0					15																	83933444		2203	4300	6503	SO:0001583	missense	0			L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.559G>C	15.37:g.83933444C>G	ENSP00000307041:p.Glu187Gln		Q15840	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E187Q	ENST00000345382.2	37	c.559	CCDS10324.1	15	.	.	.	.	.	.	.	.	.	.	C	15.72	2.915633	0.52546	.	.	ENSG00000169594	ENST00000345382;ENST00000541809	T	0.03951	3.75	5.82	4.91	0.64330	.	0.050568	0.85682	D	0.000000	T	0.17195	0.0413	L	0.57536	1.79	0.51233	D	0.99991	P;D	0.89917	0.897;1.0	P;D	0.66716	0.518;0.946	T	0.00308	-1.1829	10	0.72032	D	0.01	-31.8216	14.9417	0.70997	0.0:0.9313:0.0:0.0687	.	180;187	F5GY04;Q01954	.;BNC1_HUMAN	Q	187;180	ENSP00000307041:E187Q	ENSP00000307041:E187Q	E	-	1	0	BNC1	81724448	1.000000	0.71417	0.950000	0.38849	0.832000	0.47134	7.728000	0.84847	1.473000	0.48159	-0.140000	0.14226	GAG	BNC1	-	NULL	ENSG00000169594		0.473	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BNC1	HGNC	protein_coding	OTTHUMT00000304006.1	-	0.00	54	0	C	NM_001717		83933444	-1	tier1	-	no_errors	ENST00000345382	ensembl	human	known	74_37	missense	28.57	35	14	SNP	1.000	G
BNIP3P1	319138	genome.wustl.edu	37	14	28734268	28734268	+	RNA	SNP	G	G	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr14:28734268G>T	ENST00000550043.1	+	0	673									BCL2/adenovirus E1B 19kDa interacting protein 3 pseudogene 1																		CATCTCTGCTGCTCTCTCATT	0.498																																																	0																																												0					14q12	2014-02-04	2011-03-18	2011-03-18	ENSG00000197358	ENSG00000197358			19922	pseudogene	pseudogene			"""BCL2/adenovirus E1B 19kDa interacting protein 3 pseudogene"""	BNIP3P			Standard	NG_002516		Approved				OTTHUMG00000170378		14.37:g.28734268G>T				RNA	SNP	-	NULL	ENST00000550043.1	37	NULL		14																																																																																			BNIP3P1	-	-	ENSG00000197358		0.498	BNIP3P1-002	KNOWN	basic	processed_transcript	BNIP3P1	HGNC	pseudogene	OTTHUMT00000408770.1	-	0.00	86	0	G			28734268	+1	tier1	-	no_errors	ENST00000550043	ensembl	human	known	74_37	rna	28.17	51	20	SNP	0.979	T
BOD1	91272	genome.wustl.edu	37	5	173043312	173043312	+	Missense_Mutation	SNP	G	G	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr5:173043312G>C	ENST00000311086.4	-	1	351	c.128C>G	c.(127-129)tCg>tGg	p.S43W	BOD1_ENST00000471339.1_5'UTR|BOD1_ENST00000480951.1_Missense_Mutation_p.S43W|BOD1_ENST00000285908.5_Missense_Mutation_p.S43W	NM_138369.2	NP_612378.1	Q96IK1	BOD1_HUMAN	biorientation of chromosomes in cell division 1	43					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|kinetochore (GO:0000776)				endometrium(1)|large_intestine(2)|lung(2)|ovary(2)	7						GGGAGGCAGCGAGGCCGGGTT	0.726																																																	0													2.0	3.0	3.0					5																	173043312		1767	3756	5523	SO:0001583	missense	0			AY303777	CCDS4389.1, CCDS54951.1	5q35.2	2013-10-11	2009-03-04	2009-03-04	ENSG00000145919	ENSG00000145919			25114	protein-coding gene	gene with protein product	"""biorientation defective 1"""		"""family with sequence similarity 44, member B"""	FAM44B		17938248	Standard	NM_138369		Approved		uc003mcq.2	Q96IK1	OTTHUMG00000130540	ENST00000311086.4:c.128C>G	5.37:g.173043312G>C	ENSP00000309644:p.Ser43Trp		B4DXH8|Q9BTW1	Missense_Mutation	SNP	NULL	p.S43W	ENST00000311086.4	37	c.128	CCDS4389.1	5	.	.	.	.	.	.	.	.	.	.	G	18.24	3.579184	0.65878	.	.	ENSG00000145919	ENST00000311086;ENST00000285908;ENST00000477985;ENST00000480951	T;T	0.26957	1.7;1.7	4.21	4.21	0.49690	.	0.449713	0.24172	N	0.040898	T	0.36303	0.0962	N	0.19112	0.55	0.58432	D	0.999996	D;D	0.76494	0.999;0.999	D;D	0.72338	0.977;0.937	T	0.39563	-0.9608	10	0.87932	D	0	-1.9858	16.3621	0.83271	0.0:0.0:1.0:0.0	.	43;43	Q96IK1-2;Q96IK1	.;BOD1_HUMAN	W	43;43;17;43	ENSP00000309644:S43W;ENSP00000285908:S43W	ENSP00000285908:S43W	S	-	2	0	BOD1	172975918	0.994000	0.37717	1.000000	0.80357	0.946000	0.59487	4.188000	0.58351	2.158000	0.67659	0.563000	0.77884	TCG	BOD1	-	NULL	ENSG00000145919		0.726	BOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1	HGNC	protein_coding	OTTHUMT00000252963.1	-	0.00	18	0	G	NM_138369		173043312	-1	tier1	-	no_errors	ENST00000311086	ensembl	human	known	74_37	missense	31.58	13	6	SNP	1.000	C
BORA	79866	genome.wustl.edu	37	13	73305435	73305435	+	Missense_Mutation	SNP	G	G	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr13:73305435G>C	ENST00000390667.5	+	3	267	c.170G>C	c.(169-171)aGa>aCa	p.R57T	BORA_ENST00000464754.1_3'UTR|BORA_ENST00000377815.3_Intron	NM_024808.2	NP_079084.2	Q6PGQ7	BORA_HUMAN	bora, aurora kinase A activator	57					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of mitosis (GO:0007088)|regulation of mitotic spindle organization (GO:0060236)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)	protein kinase binding (GO:0019901)										GGGAAATTTAGATGGTCTATT	0.323																																																	0													102.0	94.0	96.0					13																	73305435		1809	4079	5888	SO:0001583	missense	0			BC025367	CCDS9446.1, CCDS66560.1, CCDS9446.2, CCDS73583.1	13q22.1	2013-08-13	2011-08-09	2011-08-09	ENSG00000136122	ENSG00000136122			24724	protein-coding gene	gene with protein product		610510	"""chromosome 13 open reading frame 34"""	C13orf34		16890155, 18378770, 18566290, 19487276	Standard	NM_001286746		Approved	FLJ22624	uc001viv.1	Q6PGQ7	OTTHUMG00000017068	ENST00000390667.5:c.170G>C	13.37:g.73305435G>C	ENSP00000375082:p.Arg57Thr		B4DQ30|Q5W0P3|Q5W0P4|Q86YC6|Q96IW9|Q9H640	Missense_Mutation	SNP	prints_Aurora_borealis_protien	p.R57T	ENST00000390667.5	37	c.170	CCDS9446.1	13	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.1|21.1	4.102380|4.102380	0.76983|0.76983	.|.	.|.	ENSG00000136122|ENSG00000136122	ENST00000390667|ENST00000377814	T|.	0.35236|.	1.32|.	5.48|5.48	5.48|5.48	0.80851|0.80851	.|.	0.131922|.	0.64402|.	D|.	0.000001|.	T|.	0.71169|.	0.3308|.	L|L	0.54323|0.54323	1.7|1.7	0.80722|0.80722	D|D	1|1	D;D|.	0.62365|.	0.991;0.991|.	P;P|.	0.60541|.	0.876;0.876|.	T|.	0.67241|.	-0.5720|.	10|.	0.62326|.	D|.	0.03|.	-24.4438|-24.4438	18.4912|18.4912	0.90848|0.90848	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	57;57|.	A8K631;Q6PGQ7|.	.;BORA_HUMAN|.	T|Y	57|34	ENSP00000375082:R57T|.	ENSP00000375082:R57T|.	R|X	+|+	2|3	0|2	BORA|BORA	72203436|72203436	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	5.281000|5.281000	0.65609|0.65609	2.730000|2.730000	0.93505|0.93505	0.650000|0.650000	0.86243|0.86243	AGA|TAG	BORA	-	prints_Aurora_borealis_protien	ENSG00000136122		0.323	BORA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BORA	HGNC	protein_coding	OTTHUMT00000045245.3	-	0.00	65	0	G	NM_024808		73305435	+1	tier1	-	no_errors	ENST00000390667	ensembl	human	known	74_37	missense	36.67	38	22	SNP	1.000	C
BRD8	10902	genome.wustl.edu	37	5	137476531	137476531	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr5:137476531C>G	ENST00000254900.5	-	26	3849	c.3478G>C	c.(3478-3480)Ggt>Cgt	p.G1160R	NME5_ENST00000265191.2_5'Flank	NM_139199.1	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8	1160	Bromo 2. {ECO:0000255|PROSITE- ProRule:PRU00035}.				cell surface receptor signaling pathway (GO:0007166)|chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|intracellular receptor signaling pathway (GO:0030522)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(3)|urinary_tract(1)	35			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			CGAATCCGACCCTTAGAGAGA	0.433																																																	0													261.0	257.0	258.0					5																	137476531		2203	4300	6503	SO:0001583	missense	0			AF016270	CCDS4198.1, CCDS34241.1, CCDS54907.1	5q31	2008-02-05			ENSG00000112983	ENSG00000112983			19874	protein-coding gene	gene with protein product		602848				8611617, 9368056	Standard	NM_001164326		Approved	SMAP, p120	uc003lcf.1	Q9H0E9	OTTHUMG00000129204	ENST00000254900.5:c.3478G>C	5.37:g.137476531C>G	ENSP00000254900:p.Gly1160Arg		O43178|Q15355|Q58AB0|Q59GN0|Q969M9	Missense_Mutation	SNP	pfam_Bromodomain,superfamily_Bromodomain,superfamily_Peptidase_M20_dimer,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.G1160R	ENST00000254900.5	37	c.3478	CCDS4198.1	5	.	.	.	.	.	.	.	.	.	.	C	29.9	5.048516	0.93740	.	.	ENSG00000112983	ENST00000254900;ENST00000427976	T;T	0.33865	1.39;1.39	5.96	5.96	0.96718	Bromodomain (5);	0.000000	0.48767	D	0.000161	T	0.59905	0.2228	M	0.66506	2.035	0.80722	D	1	D	0.61080	0.989	D	0.71870	0.975	T	0.52771	-0.8531	10	0.38643	T	0.18	-10.2484	19.4101	0.94667	0.0:1.0:0.0:0.0	.	1160	Q9H0E9	BRD8_HUMAN	R	1160;266	ENSP00000254900:G1160R;ENSP00000392646:G266R	ENSP00000254900:G1160R	G	-	1	0	BRD8	137504430	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	6.090000	0.71397	2.832000	0.97577	0.655000	0.94253	GGT	BRD8	-	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain	ENSG00000112983		0.433	BRD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRD8	HGNC	protein_coding	OTTHUMT00000251282.3	-	0.00	49	0	C	NM_006696		137476531	-1	tier1	-	no_errors	ENST00000254900	ensembl	human	known	74_37	missense	34.88	28	15	SNP	1.000	G
LMNTD2	256329	genome.wustl.edu	37	11	558686	558686	+	Nonsense_Mutation	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr11:558686C>T	ENST00000329451.3	-	3	301	c.239G>A	c.(238-240)tGg>tAg	p.W80*	RP11-496I9.1_ENST00000527620.1_RNA|RASSF7_ENST00000397583.3_5'Flank|RASSF7_ENST00000397582.3_5'Flank|RP11-496I9.1_ENST00000527113.1_RNA|RASSF7_ENST00000431809.1_5'Flank|RASSF7_ENST00000344375.4_5'Flank|RASSF7_ENST00000454668.2_5'Flank	NM_173573.2	NP_775844.2	Q8IXW0	LMTD2_HUMAN		80										NS(1)|breast(1)|central_nervous_system(1)|lung(4)|pancreas(1)	8		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.18e-28)|Epithelial(43;6.93e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.97e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CTGGATGGCCCACCGCAAGGC	0.662																																																	0													24.0	26.0	25.0					11																	558686		2198	4294	6492	SO:0001587	stop_gained	0																														ENST00000329451.3:c.239G>A	11.37:g.558686C>T	ENSP00000331167:p.Trp80*			Nonsense_Mutation	SNP	pfam_Lamin_tail_dom	p.W80*	ENST00000329451.3	37	c.239	CCDS7701.1	11	.	.	.	.	.	.	.	.	.	.	C	20.2	3.951705	0.73787	.	.	ENSG00000185522	ENST00000329451;ENST00000441853;ENST00000486629	.	.	.	3.85	1.82	0.25136	.	0.411423	0.18247	N	0.147073	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-25.0944	5.3513	0.16038	0.0:0.6721:0.208:0.1199	.	.	.	.	X	80;87;90	.	ENSP00000331167:W80X	W	-	2	0	C11orf35	548686	0.580000	0.26733	0.875000	0.34327	0.513000	0.34164	1.176000	0.31957	0.792000	0.33850	0.462000	0.41574	TGG	C11orf35	-	NULL	ENSG00000185522		0.662	C11orf35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf35	HGNC	protein_coding	OTTHUMT00000254973.2	-	0.00	61	0	C			558686	-1	tier1	-	no_errors	ENST00000329451	ensembl	human	known	74_37	nonsense	39.13	28	18	SNP	0.907	T
C12orf66	144577	genome.wustl.edu	37	12	64609724	64609724	+	Missense_Mutation	SNP	G	G	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr12:64609724G>C	ENST00000398055.3	-	2	308	c.255C>G	c.(253-255)agC>agG	p.S85R	C12orf66_ENST00000544871.1_Missense_Mutation_p.S32R|C12orf66_ENST00000311915.8_Missense_Mutation_p.S85R	NM_152440.4	NP_689653	Q96MD2	CL066_HUMAN	chromosome 12 open reading frame 66	85										central_nervous_system(1)|large_intestine(1)|lung(2)|ovary(1)	5						AATCCTTCCTGCTGAAGAAAG	0.502																																																	0													42.0	45.0	44.0					12																	64609724		1973	4150	6123	SO:0001583	missense	0				CCDS41803.1, CCDS73490.1	12q14.2	2008-08-08			ENSG00000174206	ENSG00000174206			26517	protein-coding gene	gene with protein product						12477932	Standard	NM_152440		Approved	FLJ32549	uc001srw.4	Q96MD2	OTTHUMG00000168763	ENST00000398055.3:c.255C>G	12.37:g.64609724G>C	ENSP00000381132:p.Ser85Arg		C9JX54|Q8IYA0	Missense_Mutation	SNP	pfam_DUF2003	p.S85R	ENST00000398055.3	37	c.255	CCDS41803.1	12	.	.	.	.	.	.	.	.	.	.	G	7.708	0.694614	0.15039	.	.	ENSG00000174206	ENST00000311915;ENST00000544871;ENST00000398055	T;T;T	0.39406	1.08;1.08;1.08	5.73	4.83	0.62350	.	0.075977	0.85682	N	0.000000	T	0.35098	0.0920	L	0.39397	1.21	0.80722	D	1	B;P	0.38551	0.0;0.636	B;B	0.35813	0.002;0.211	T	0.07770	-1.0755	9	.	.	.	-16.1247	16.052	0.80772	0.0:0.0:0.8646:0.1354	.	32;85	F5H2Q3;Q96MD2	.;CL066_HUMAN	R	85;32;85	ENSP00000311486:S85R;ENSP00000445481:S32R;ENSP00000381132:S85R	.	S	-	3	2	C12orf66	62895991	1.000000	0.71417	0.998000	0.56505	0.958000	0.62258	5.337000	0.65941	1.402000	0.46780	0.491000	0.48974	AGC	C12orf66	-	pfam_DUF2003	ENSG00000174206		0.502	C12orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf66	HGNC	protein_coding	OTTHUMT00000400921.1	-	0.00	55	0	G	NM_152440		64609724	-1	tier1	-	no_errors	ENST00000398055	ensembl	human	known	74_37	missense	25.00	27	9	SNP	1.000	C
C14orf166	51637	genome.wustl.edu	37	14	52465219	52465219	+	Missense_Mutation	SNP	A	A	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr14:52465219A>T	ENST00000261700.3	+	4	459	c.294A>T	c.(292-294)aaA>aaT	p.K98N	C14orf166_ENST00000556760.1_Missense_Mutation_p.K98N	NM_016039.2	NP_057123.1	Q9Y224	CN166_HUMAN	chromosome 14 open reading frame 166	98					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|RNA transport (GO:0050658)|transcription, DNA-templated (GO:0006351)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|tRNA-splicing ligase complex (GO:0072669)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA polymerase II core binding (GO:0000993)			endometrium(1)|large_intestine(3)|lung(2)	6	Breast(41;0.0639)|all_epithelial(31;0.101)					TAGCTGAAAAATACAAGGATT	0.303																																																	0													85.0	89.0	88.0					14																	52465219		2201	4293	6494	SO:0001583	missense	0			AF151857	CCDS9705.1	14q22.1	2014-05-29			ENSG00000087302	ENSG00000087302			23169	protein-coding gene	gene with protein product	"""RLL motif containing 1"""	610858				10810093, 24608264	Standard	NM_016039		Approved	CGI-99, RLLM1, CLE, CLE7, LCRP369	uc010aod.3	Q9Y224	OTTHUMG00000152332	ENST00000261700.3:c.294A>T	14.37:g.52465219A>T	ENSP00000261700:p.Lys98Asn			Missense_Mutation	SNP	pfam_UPF0568	p.K98N	ENST00000261700.3	37	c.294	CCDS9705.1	14	.	.	.	.	.	.	.	.	.	.	A	19.19	3.779410	0.70107	.	.	ENSG00000087302	ENST00000261700;ENST00000556760;ENST00000553362	.	.	.	6.03	0.629	0.17687	.	0.000000	0.85682	D	0.000000	T	0.69405	0.3107	M	0.69823	2.125	0.58432	D	0.999999	D	0.89917	1.0	D	0.77004	0.989	T	0.66056	-0.6018	9	0.40728	T	0.16	.	10.2899	0.43590	0.5831:0.0:0.4169:0.0	.	98	Q9Y224	CN166_HUMAN	N	98;98;35	.	ENSP00000261700:K98N	K	+	3	2	C14orf166	51534969	0.951000	0.32395	0.999000	0.59377	0.993000	0.82548	-0.021000	0.12504	0.081000	0.16988	0.533000	0.62120	AAA	C14orf166	-	pfam_UPF0568	ENSG00000087302		0.303	C14orf166-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf166	HGNC	protein_coding	OTTHUMT00000276887.1	-	0.00	53	0	A	NM_016039		52465219	+1	tier1	-	no_errors	ENST00000261700	ensembl	human	known	74_37	missense	20.59	27	7	SNP	0.998	T
C16orf47	388289	genome.wustl.edu	37	16	73177678	73177678	+	Start_Codon_SNP	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr16:73177678C>T	ENST00000358463.2	-	2	190	c.3G>A	c.(1-3)atG>atA	p.M1I		NM_207385.1	NP_997268.1	Q6ZP98	CP047_HUMAN	chromosome 16 open reading frame 47	1																	AGCTGGACACCATCCAATAGC	0.433																																																	0													62.0	55.0	57.0					16																	73177678		692	1591	2283	SO:0001582	initiator_codon_variant	0			AK129695		16q22.3	2012-10-09			ENSG00000197445	ENSG00000197445			28329	protein-coding gene	gene with protein product							Standard	NM_207385		Approved	FLJ26184		Q6ZP98	OTTHUMG00000137600	ENST00000358463.2:c.3G>A	16.37:g.73177678C>T	ENSP00000351248:p.Met1Ile			Missense_Mutation	SNP	NULL	p.M1I	ENST00000358463.2	37	c.3		16	.	.	.	.	.	.	.	.	.	.	C	0.057	-1.232971	0.01505	.	.	ENSG00000197445	ENST00000358463	.	.	.	4.99	0.766	0.18476	.	0.242965	0.22093	U	0.064736	T	0.61464	0.2349	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61019	-0.7147	6	0.87932	D	0	.	7.0521	0.25079	0.0:0.6123:0.0:0.3877	.	.	.	.	I	1	.	ENSP00000351248:M1I	M	-	3	0	C16orf47	71735179	0.004000	0.15560	0.807000	0.32361	0.044000	0.14063	0.056000	0.14256	0.294000	0.22547	-0.140000	0.14226	ATG	C16orf47	-	NULL	ENSG00000197445		0.433	C16orf47-001	KNOWN	basic|appris_principal|exp_conf	protein_coding	C16orf47	HGNC	protein_coding	OTTHUMT00000269009.1	-	0.00	82	0	C		Missense_Mutation	73177678	-1	tier1	-	no_errors	ENST00000358463	ensembl	human	known	74_37	missense	14.71	29	5	SNP	0.140	T
C1orf86	199990	genome.wustl.edu	37	1	2117606	2117606	+	Silent	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:2117606G>A	ENST00000400919.3	-	7	1113	c.45C>T	c.(43-45)ggC>ggT	p.G15G	RP11-181G12.2_ENST00000444529.1_RNA|RP11-181G12.2_ENST00000536678.1_RNA|RP11-181G12.2_ENST00000333854.2_RNA	NM_001282671.1	NP_001269600.1	Q6NZ36	FAP20_HUMAN	chromosome 1 open reading frame 86	0					cellular response to DNA damage stimulus (GO:0006974)|interstrand cross-link repair (GO:0036297)|translesion synthesis (GO:0019985)	cell junction (GO:0030054)|chromosome (GO:0005694)|Fanconi anaemia nuclear complex (GO:0043240)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|metal ion binding (GO:0046872)|polyubiquitin binding (GO:0031593)|ubiquitin binding (GO:0043130)			central_nervous_system(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4	all_cancers(77;0.000134)|all_epithelial(69;4.45e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;1.14e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.09e-37)|OV - Ovarian serous cystadenocarcinoma(86;1.5e-23)|GBM - Glioblastoma multiforme(42;1.61e-08)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00437)|STAD - Stomach adenocarcinoma(132;0.0134)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)		TGTGGAAATTGCCACGCAGCC	0.652																																																	0																																										SO:0001819	synonymous_variant	0			AK126870	CCDS38.2, CCDS57965.1, CCDS72686.1, CCDS72687.1	1p36.33	2013-05-22			ENSG00000162585	ENSG00000162585			26428	protein-coding gene	gene with protein product		615183				14702039	Standard	NM_182533		Approved	FLJ31031, FAAP20	uc031pkt.1	Q6NZ36	OTTHUMG00000001404	ENST00000400919.3:c.45C>T	1.37:g.2117606G>A			A6PW39|A6PW40|A6PW41|A8MQT6|F2Z2L4|Q6ZT64|Q71M24|Q96ND7	Silent	SNP	NULL	p.G15	ENST00000400919.3	37	c.45		1																																																																																			C1orf86	-	NULL	ENSG00000162585		0.652	C1orf86-202	KNOWN	basic	protein_coding	C1orf86	HGNC	protein_coding		-	0.00	63	0	G	NM_182533		2117606	-1	tier1	-	no_errors	ENST00000400919	ensembl	human	known	74_37	silent	23.08	50	15	SNP	0.309	A
CACNA1A	773	genome.wustl.edu	37	19	13410024	13410024	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr19:13410024G>A	ENST00000360228.5	-	19	2422	c.2423C>T	c.(2422-2424)aCg>aTg	p.T808M	CACNA1A_ENST00000573710.2_Missense_Mutation_p.T809M	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	809					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)	p.T809M(3)|p.T808M(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	CAGGTGCCGCGTGTAGGCAGC	0.642																																																	4	Substitution - Missense(4)	prostate(4)											47.0	54.0	52.0					19																	13410024		2037	4162	6199	SO:0001583	missense	0			U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.2423C>T	19.37:g.13410024G>A	ENSP00000353362:p.Thr808Met		J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_P/Q_a1su	p.T808M	ENST00000360228.5	37	c.2423	CCDS45998.1	19	.	.	.	.	.	.	.	.	.	.	G	1.662	-0.511323	0.04231	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	D	0.95918	-3.85	3.99	1.56	0.23342	.	1.904990	0.03030	N	0.151895	D	0.91157	0.7215	N	0.24115	0.695	0.09310	N	1	P;P;P	0.46064	0.474;0.872;0.798	B;B;B	0.37480	0.058;0.251;0.128	D	0.84855	0.0816	10	0.72032	D	0.01	.	10.4736	0.44652	0.0:0.5243:0.4756:0.0	.	809;812;808	O00555;E9PD31;Q9NS88	CAC1A_HUMAN;.;.	M	808;812;809;809	ENSP00000353362:T808M	ENSP00000317661:T809M	T	-	2	0	CACNA1A	13271024	0.167000	0.22975	0.052000	0.19188	0.010000	0.07245	1.666000	0.37460	0.847000	0.35167	0.555000	0.69702	ACG	CACNA1A	-	NULL	ENSG00000141837		0.642	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1A	HGNC	protein_coding	OTTHUMT00000104062.2	-	0.00	115	0	G	NM_000068		13410024	-1	tier1	-	no_errors	ENST00000360228	ensembl	human	known	74_37	missense	21.92	57	16	SNP	0.252	A
C5AR2	27202	genome.wustl.edu	37	19	47844342	47844342	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr19:47844342C>T	ENST00000595464.1	+	2	504	c.286C>T	c.(286-288)Cgt>Tgt	p.R96C	C5AR2_ENST00000600626.1_Missense_Mutation_p.R96C|C5AR2_ENST00000257267.2_Missense_Mutation_p.R96C	NM_001271749.1	NP_001258678.1	Q9P296	C5AR2_HUMAN	complement component 5a receptor 2	96					chemotaxis (GO:0006935)|inflammatory response (GO:0006954)|negative regulation of interleukin-6 secretion (GO:1900165)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of interleukin-8 secretion (GO:2000482)	apical part of cell (GO:0045177)|basal plasma membrane (GO:0009925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C5a anaphylatoxin receptor activity (GO:0004944)										GCCCATTGCCCGTGGAGGCCA	0.662																																																	0													93.0	87.0	89.0					19																	47844342		2203	4300	6503	SO:0001583	missense	0			AB038237	CCDS12699.1	19q13.33	2013-01-28	2013-01-28	2013-01-28		ENSG00000134830		"""GPCR / Class A : Complement component receptors"""	4527	protein-coding gene	gene with protein product		609949	"""G protein-coupled receptor 77"""	GPR77		11165367	Standard	NM_018485		Approved	C5L2	uc010ela.1	Q9P296		ENST00000595464.1:c.286C>T	19.37:g.47844342C>T	ENSP00000472620:p.Arg96Cys		B2RA09	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Anaphtx_C5AR1/C5AR2	p.R96C	ENST00000595464.1	37	c.286	CCDS12699.1	19	.	.	.	.	.	.	.	.	.	.	C	11.48	1.650838	0.29336	.	.	ENSG00000134830	ENST00000257267	T	0.71698	-0.59	4.22	-0.73	0.11154	GPCR, rhodopsin-like superfamily (1);	0.982101	0.08314	U	0.964896	T	0.70710	0.3255	L	0.57536	1.79	0.09310	N	1	D	0.60160	0.987	P	0.52909	0.713	T	0.59311	-0.7478	10	0.62326	D	0.03	.	4.0878	0.09955	0.1618:0.5331:0.0:0.3051	.	96	Q9P296	C5ARL_HUMAN	C	96	ENSP00000257267:R96C	ENSP00000257267:R96C	R	+	1	0	GPR77	52536182	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.261000	0.08694	-0.215000	0.10063	-0.521000	0.04368	CGT	C5AR2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000134830		0.662	C5AR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5AR2	HGNC	protein_coding	OTTHUMT00000466926.1	-	0.00	21	0	C	NM_018485		47844342	+1	tier1	-	no_errors	ENST00000257267	ensembl	human	known	74_37	missense	38.46	8	5	SNP	0.002	T
CFAP58	159686	genome.wustl.edu	37	10	106125647	106125647	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr10:106125647C>A	ENST00000369704.3	+	5	807	c.673C>A	c.(673-675)Ctc>Atc	p.L225I	CCDC147_ENST00000312902.5_5'UTR	NM_001008723.1	NP_001008723.1	Q5T655	CC147_HUMAN		225						extracellular space (GO:0005615)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	52		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)		AGAGAAAGAGCTCAAGCAGAT	0.498																																																	0													67.0	70.0	69.0					10																	106125647		2203	4300	6503	SO:0001583	missense	0																														ENST00000369704.3:c.673C>A	10.37:g.106125647C>A	ENSP00000358718:p.Leu225Ile		D3DRA6|Q8NA27	Missense_Mutation	SNP	superfamily_Homeodomain-like	p.L225I	ENST00000369704.3	37	c.673	CCDS31282.1	10	.	.	.	.	.	.	.	.	.	.	C	17.51	3.408210	0.62399	.	.	ENSG00000120051	ENST00000369704	T	0.35236	1.32	5.97	4.1	0.47936	.	0.188649	0.46145	D	0.000306	T	0.37461	0.1004	L	0.49126	1.545	0.80722	D	1	P	0.45396	0.857	P	0.46796	0.527	T	0.02437	-1.1159	10	0.23302	T	0.38	-8.9924	13.1472	0.59470	0.0:0.8837:0.0:0.1163	.	225	Q5T655	CC147_HUMAN	I	225	ENSP00000358718:L225I	ENSP00000358718:L225I	L	+	1	0	CCDC147	106115637	1.000000	0.71417	1.000000	0.80357	0.691000	0.40173	1.627000	0.37050	2.828000	0.97474	0.655000	0.94253	CTC	CCDC147	-	NULL	ENSG00000120051		0.498	CCDC147-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC147	HGNC	protein_coding	OTTHUMT00000050216.1	-	0.00	61	0	C			106125647	+1	tier1	-	no_errors	ENST00000369704	ensembl	human	known	74_37	missense	22.58	24	7	SNP	1.000	A
CCDC24	149473	genome.wustl.edu	37	1	44461126	44461126	+	Intron	SNP	G	G	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:44461126G>T	ENST00000372318.3	+	7	723				CCDC24_ENST00000479055.1_Intron|SLC6A9_ENST00000372307.3_Intron|SLC6A9_ENST00000372306.3_Intron	NM_152499.1	NP_689712.1	Q8N4L8	CCD24_HUMAN	coiled-coil domain containing 24											endometrium(3)|large_intestine(2)|lung(3)|stomach(1)	9	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0821)				TCTTCCGCAAGGCTGGTATTC	0.592																																																	0																																										SO:0001627	intron_variant	0				CCDS507.1	1p34.1	2008-02-05			ENSG00000159214	ENSG00000159214			28688	protein-coding gene	gene with protein product						12477932	Standard	NM_152499		Approved	MGC45441	uc001clj.3	Q8N4L8	OTTHUMG00000008299	ENST00000372318.3:c.553-147G>T	1.37:g.44461126G>T			Q6RWT2	RNA	SNP	-	NULL	ENST00000372318.3	37	NULL	CCDS507.1	1																																																																																			CCDC24	-	-	ENSG00000159214		0.592	CCDC24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC24	HGNC	protein_coding	OTTHUMT00000022865.1	-	0.00	12	0	G	NM_152499		44461126	+1	tier1	-	no_errors	ENST00000472562	ensembl	human	known	74_37	rna	31.25	11	5	SNP	0.000	T
CCDC54	84692	genome.wustl.edu	37	3	107097242	107097242	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr3:107097242G>A	ENST00000261058.1	+	1	1055	c.808G>A	c.(808-810)Gaa>Aaa	p.E270K		NM_032600.2	NP_115989.1	Q8NEL0	CCD54_HUMAN	coiled-coil domain containing 54	270										NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	19						CAAGTTAGAAGAATTCATCCA	0.428																																																	0													83.0	93.0	90.0					3																	107097242		2203	4300	6503	SO:0001583	missense	0			AF367469	CCDS2949.1	3q13.12	2013-10-11			ENSG00000138483	ENSG00000138483			30703	protein-coding gene	gene with protein product	"""sperm protein 17"""					15257753	Standard	NM_032600		Approved	NYD-SP17, FLJ25362, SP17	uc003dwi.1	Q8NEL0	OTTHUMG00000159169	ENST00000261058.1:c.808G>A	3.37:g.107097242G>A	ENSP00000261058:p.Glu270Lys		Q96A43	Missense_Mutation	SNP	NULL	p.E270K	ENST00000261058.1	37	c.808	CCDS2949.1	3	.	.	.	.	.	.	.	.	.	.	G	17.48	3.399163	0.62177	.	.	ENSG00000138483	ENST00000261058	T	0.60797	0.16	5.09	3.29	0.37713	.	0.446258	0.18909	N	0.127814	T	0.53850	0.1822	M	0.66939	2.045	0.20975	N	0.999813	B	0.22683	0.073	B	0.25884	0.064	T	0.53201	-0.8472	10	0.87932	D	0	-0.0018	7.9568	0.30047	0.1925:0.0:0.8075:0.0	.	270	Q8NEL0	CCD54_HUMAN	K	270	ENSP00000261058:E270K	ENSP00000261058:E270K	E	+	1	0	CCDC54	108579932	0.982000	0.34865	0.094000	0.20943	0.975000	0.68041	1.403000	0.34612	0.539000	0.28788	0.460000	0.39030	GAA	CCDC54	-	NULL	ENSG00000138483		0.428	CCDC54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC54	HGNC	protein_coding	OTTHUMT00000353651.1	-	0.00	81	0	G	NM_032600		107097242	+1	tier1	-	no_errors	ENST00000261058	ensembl	human	known	74_37	missense	29.69	45	19	SNP	0.487	A
CD1A	909	genome.wustl.edu	37	1	158227471	158227471	+	Splice_Site	SNP	T	T	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:158227471T>C	ENST00000289429.5	+	6	1508	c.975T>C	c.(973-975)tgT>tgC	p.C325C		NM_001763.2	NP_001754.2	P06126	CD1A_HUMAN	CD1a molecule	325					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)				NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(14)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	32	all_hematologic(112;0.0378)				Antithymocyte globulin(DB00098)	TCTCATCCAGTTTCTGTTAAG	0.512																																																	0													190.0	165.0	174.0					1																	158227471		2203	4300	6503	SO:0001630	splice_region_variant	0			M28825	CCDS1174.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158477	ENSG00000158477		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1634	protein-coding gene	gene with protein product		188370	"""CD1A antigen, a polypeptide"", ""CD1a antigen"""	CD1		2447586, 2784820	Standard	NM_001763		Approved		uc001frt.3	P06126	OTTHUMG00000017512	ENST00000289429.5:c.975-1T>C	1.37:g.158227471T>C			D3DVD7|Q13962|Q5TDJ8|Q9UMM4|Q9Y5M5	Silent	SNP	pfam_Ig_C1-set,pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like_dom	p.C325	ENST00000289429.5	37	c.975	CCDS1174.1	1																																																																																			CD1A	-	NULL	ENSG00000158477		0.512	CD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD1A	HGNC	protein_coding	OTTHUMT00000046349.2	-	0.00	56	0	T	NM_001763	Silent	158227471	+1	tier1	-	no_errors	ENST00000289429	ensembl	human	known	74_37	silent	19.61	41	10	SNP	0.000	C
CDH18	1016	genome.wustl.edu	37	5	19747272	19747272	+	Missense_Mutation	SNP	A	A	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr5:19747272A>C	ENST00000507958.1	-	6	1292	c.302T>G	c.(301-303)tTt>tGt	p.F101C	CDH18_ENST00000511273.1_Missense_Mutation_p.F101C|CDH18_ENST00000274170.4_Missense_Mutation_p.F101C|CDH18_ENST00000502796.1_Missense_Mutation_p.F101C|CDH18_ENST00000506372.1_Missense_Mutation_p.F101C|CDH18_ENST00000382275.1_Missense_Mutation_p.F101C			Q13634	CAD18_HUMAN	cadherin 18, type 2	101	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					GTCAATGATAAATATAGTCCC	0.428																																																	0													174.0	156.0	162.0					5																	19747272		2203	4300	6503	SO:0001583	missense	0			U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.302T>G	5.37:g.19747272A>C	ENSP00000425093:p.Phe101Cys		A8K0I2|B4DHG6|Q8N5Z2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.F101C	ENST00000507958.1	37	c.302	CCDS3889.1	5	.	.	.	.	.	.	.	.	.	.	A	23.1	4.379401	0.82682	.	.	ENSG00000145526	ENST00000382275;ENST00000507958;ENST00000542864;ENST00000274170;ENST00000506372;ENST00000502796;ENST00000515257;ENST00000511273	T;T;T;T;T;T;T	0.72282	-0.64;-0.64;-0.64;-0.64;-0.64;-0.64;-0.64	5.34	5.34	0.76211	Cadherin (5);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.91002	0.7170	H	0.99368	4.535	0.58432	D	0.999994	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94528	0.7733	9	.	.	.	.	14.1522	0.65392	1.0:0.0:0.0:0.0	.	101;101	B4DHG6;Q13634	.;CAD18_HUMAN	C	101;101;101;101;101;101;47;101	ENSP00000371710:F101C;ENSP00000425093:F101C;ENSP00000274170:F101C;ENSP00000424931:F101C;ENSP00000422138:F101C;ENSP00000427383:F47C;ENSP00000425854:F101C	.	F	-	2	0	CDH18	19783029	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.870000	0.92336	2.024000	0.59613	0.482000	0.46254	TTT	CDH18	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000145526		0.428	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CDH18	HGNC	protein_coding	OTTHUMT00000366747.1	-	0.00	55	0	A	NM_004934		19747272	-1	tier1	-	no_errors	ENST00000274170	ensembl	human	known	74_37	missense	20.69	23	6	SNP	1.000	C
CEL	1056	genome.wustl.edu	37	9	135940527	135940527	+	Silent	SNP	C	C	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr9:135940527C>A	ENST00000372080.4	+	4	466	c.450C>A	c.(448-450)ggC>ggA	p.G150G	CEL_ENST00000351304.7_Silent_p.G147G	NM_001807.3	NP_001798.2	P19835	CEL_HUMAN	carboxyl ester lipase	147					cholesterol catabolic process (GO:0006707)|fatty acid catabolic process (GO:0009062)|intestinal cholesterol absorption (GO:0030299)|intestinal lipid catabolic process (GO:0044258)|lipid digestion (GO:0044241)|lipid metabolic process (GO:0006629)|pancreatic juice secretion (GO:0030157)|protein esterification (GO:0018350)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	acylglycerol lipase activity (GO:0047372)|catalytic activity (GO:0003824)|heparin binding (GO:0008201)|hydrolase activity (GO:0016787)|sterol esterase activity (GO:0004771)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|pancreas(2)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;1.03e-40)|Epithelial(140;3.58e-37)|GBM - Glioblastoma multiforme(294;0.00164)|READ - Rectum adenocarcinoma(205;0.196)		TGTATGACGGCGAGGAGATCG	0.607																																																	0													176.0	188.0	184.0					9																	135940527		2095	4217	6312	SO:0001819	synonymous_variant	0			M54994	CCDS43896.1	9q34.3	2013-03-13	2013-03-13		ENSG00000170835	ENSG00000170835	3.1.1.3, 3.1.1.13		1848	protein-coding gene	gene with protein product	"""bile salt-stimulated lipase"""	114840				1676983	Standard	NM_001807		Approved	BSSL, MODY8	uc010naa.2	P19835	OTTHUMG00000020855	ENST00000372080.4:c.450C>A	9.37:g.135940527C>A			Q16398|Q5T7U7|Q9UCH1|Q9UP41	Silent	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3	p.G150	ENST00000372080.4	37	c.450	CCDS43896.1	9																																																																																			CEL	-	pfam_CarbesteraseB,pfam_AB_hydrolase_3	ENSG00000170835		0.607	CEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEL	HGNC	protein_coding	OTTHUMT00000054823.1		0.00	60	0	C			135940527	+1			no_errors	ENST00000372080	ensembl	human	known	74_37	silent	5.71	33	2	SNP	0.993	A
CELSR3	1951	genome.wustl.edu	37	3	48694699	48694699	+	Silent	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr3:48694699C>T	ENST00000164024.4	-	2	4111	c.3831G>A	c.(3829-3831)gtG>gtA	p.V1277V	CELSR3_ENST00000544264.1_Silent_p.V1277V	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	1277					axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		TCTCAAGGCGCACGGTCAGGC	0.677																																																	0													35.0	31.0	32.0					3																	48694699		2200	4299	6499	SO:0001819	synonymous_variant	0			AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.3831G>A	3.37:g.48694699C>T			O75092	Silent	SNP	pfam_Cadherin,pfam_GPCR_2_secretin-like,pfam_Laminin_G,pfam_DUF3497,pfam_EG-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.V1277	ENST00000164024.4	37	c.3831	CCDS2775.1	3																																																																																			CELSR3	-	NULL	ENSG00000008300		0.677	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR3	HGNC	protein_coding	OTTHUMT00000257523.1	-	0.00	27	0	C	NM_001407		48694699	-1	tier1	-	no_errors	ENST00000544264	ensembl	human	known	74_37	silent	27.27	16	6	SNP	1.000	T
CEP170	9859	genome.wustl.edu	37	1	243349275	243349275	+	Missense_Mutation	SNP	T	T	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:243349275T>G	ENST00000366542.1	-	10	1423	c.1372A>C	c.(1372-1374)Act>Cct	p.T458P	CEP170_ENST00000366543.1_Intron|CEP170_ENST00000366544.1_Intron	NM_014812.2	NP_055627.2	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa	458						centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear membrane (GO:0031965)				NS(1)|breast(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	62	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			AATAATGCAGTTTGTAGGAAG	0.443																																																	0													80.0	74.0	76.0					1																	243349275		1858	4097	5955	SO:0001583	missense	0			AB022657	CCDS44337.1, CCDS44338.1, CCDS44339.1	1q44	2014-02-20	2006-01-12	2006-01-12	ENSG00000143702	ENSG00000143702			28920	protein-coding gene	gene with protein product	"""KARP 1 binding protein"", ""XRCC5 binding protein"""	613023	"""KIAA0470"""	KIAA0470		15616186	Standard	NM_014812		Approved	KAB, FAM68A	uc021plo.1	Q5SW79	OTTHUMG00000039862	ENST00000366542.1:c.1372A>C	1.37:g.243349275T>G	ENSP00000355500:p.Thr458Pro		O75058|Q5SW77|Q5SW78|Q7LGA9|Q86W31|Q9UQ08|Q9UQ09	Missense_Mutation	SNP	pfam_FHA_dom,superfamily_SMAD_FHA_domain,superfamily_Fibronectin_type3,smart_FHA_dom,pfscan_FHA_dom	p.T458P	ENST00000366542.1	37	c.1372	CCDS44339.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.27|15.27	2.783349|2.783349	0.49891|0.49891	.|.	.|.	ENSG00000143702|ENSG00000143702	ENST00000336415|ENST00000366542;ENST00000424081	.|T	.|0.54675	.|0.56	5.3|5.3	1.58|1.58	0.23477|0.23477	.|.	.|0.296611	.|0.35970	.|N	.|0.002878	T|T	0.35508|0.35508	0.0934|0.0934	L|L	0.34521|0.34521	1.04|1.04	0.80722|0.80722	D|D	1|1	.|P	.|0.39326	.|0.668	.|B	.|0.38712	.|0.28	T|T	0.04128|0.04128	-1.0975|-1.0975	5|10	.|0.27785	.|T	.|0.31	-4.6937|-4.6937	6.1834|6.1834	0.20484|0.20484	0.0:0.2154:0.1273:0.6573|0.0:0.2154:0.1273:0.6573	.|.	.|458	.|Q5SW79	.|CE170_HUMAN	N|P	421|458;356	.|ENSP00000355500:T458P	.|ENSP00000355500:T458P	K|T	-|-	3|1	2|0	CEP170|CEP170	241415898|241415898	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	1.656000|1.656000	0.37355|0.37355	0.313000|0.313000	0.23062|0.23062	0.477000|0.477000	0.44152|0.44152	AAA|ACT	CEP170	-	NULL	ENSG00000143702		0.443	CEP170-003	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	CEP170	HGNC	protein_coding	OTTHUMT00000096178.2	-	0.00	208	0	T	NM_014812		243349275	-1	tier1	-	no_errors	ENST00000366542	ensembl	human	known	74_37	missense	17.69	121	26	SNP	0.999	G
CHAMP1	283489	genome.wustl.edu	37	13	115091442	115091444	+	In_Frame_Del	DEL	TAT	TAT	-			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	TAT	TAT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr13:115091442_115091444delTAT	ENST00000361283.1	+	3	2434_2436	c.2125_2127delTAT	c.(2125-2127)tatdel	p.Y710del		NM_001164144.1|NM_001164145.1|NM_032436.2	NP_001157616.1|NP_001157617.1|NP_115812.1	Q96JM3	CHAP1_HUMAN	chromosome alignment maintaining phosphoprotein 1	710	Mediates localization to the chromosome and the spindle and negatively regulates chromosome alignment.				attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation (GO:0051315)|protein localization to kinetochore (GO:0034501)|protein localization to microtubule (GO:0035372)|sister chromatid biorientation (GO:0031134)	condensed chromosome (GO:0000793)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)										AAAAGGAAAGTATTATTGCAAAA	0.355																																																	0																																										SO:0001651	inframe_deletion	0			AK074894	CCDS9545.1	13q34	2013-01-07	2011-10-07	2011-10-07	ENSG00000198824	ENSG00000198824		"""Zinc fingers, C2H2-type"""	20311	protein-coding gene	gene with protein product	"""chromosome alignment-maintaining phosphoprotein"""		"""chromosome 13 open reading frame 8"", ""zinc finger protein 828"""	C13orf8, ZNF828		21063390	Standard	NM_032436		Approved	CAMP, CHAMP	uc010ahb.3	Q96JM3	OTTHUMG00000017404	ENST00000361283.1:c.2125_2127delTAT	13.37:g.115091445_115091447delTAT	ENSP00000354730:p.Tyr710del		B3KU06|Q6P181|Q8NC88|Q9BST0	In_Frame_Del	DEL	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Y710in_frame_del	ENST00000361283.1	37	c.2125_2127	CCDS9545.1	13																																																																																			CHAMP1	-	smart_Znf_C2H2-like	ENSG00000198824		0.355	CHAMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHAMP1	HGNC	protein_coding	OTTHUMT00000045977.2		0.00	112	0	TAT	NM_032436		115091444	+1	tier1		no_errors	ENST00000361283	ensembl	human	known	74_37	in_frame_del	27.14	51	19	DEL	1.000:1.000:1.000	-
CHAT	1103	genome.wustl.edu	37	10	50835702	50835702	+	Missense_Mutation	SNP	G	G	T	rs370202834		TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr10:50835702G>T	ENST00000337653.2	+	7	1135	c.982G>T	c.(982-984)Gat>Tat	p.D328Y	CHAT_ENST00000351556.3_Missense_Mutation_p.D210Y|CHAT_ENST00000395559.2_Missense_Mutation_p.D210Y|CHAT_ENST00000395562.2_Missense_Mutation_p.D246Y|CHAT_ENST00000455728.2_Missense_Mutation_p.D210Y|CHAT_ENST00000339797.1_Missense_Mutation_p.D210Y	NM_001142929.1|NM_020549.4	NP_001136401.1|NP_065574	P28329	CLAT_HUMAN	choline O-acetyltransferase	328					adult walking behavior (GO:0007628)|dendrite development (GO:0016358)|establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|rhythmic behavior (GO:0007622)|rhythmic excitation (GO:0043179)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	choline O-acetyltransferase activity (GO:0004102)			central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(11)|lung(34)|prostate(3)|urinary_tract(1)	56		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)|Nicotine(DB00184)	CAGTGAGGGGGATCTGTTCAC	0.517																																																	0													209.0	176.0	187.0					10																	50835702		2203	4300	6503	SO:0001583	missense	0			AF305907	CCDS7232.1, CCDS7233.1, CCDS44389.1	10q11.2	2010-05-11	2010-05-11		ENSG00000070748	ENSG00000070748	2.3.1.6		1912	protein-coding gene	gene with protein product		118490	"""choline acetyltransferase"""			1840566	Standard	NM_020984		Approved		uc001jhz.2	P28329	OTTHUMG00000018198	ENST00000337653.2:c.982G>T	10.37:g.50835702G>T	ENSP00000337103:p.Asp328Tyr		A2BDF4|A2BDF5|Q16488|Q9BQ23|Q9BQ35|Q9BQE1	Missense_Mutation	SNP	pfam_Carn_acyl_trans	p.D328Y	ENST00000337653.2	37	c.982	CCDS7232.1	10	.	.	.	.	.	.	.	.	.	.	G	27.6	4.849181	0.91277	.	.	ENSG00000070748	ENST00000339797;ENST00000351556;ENST00000395559;ENST00000337653;ENST00000395562;ENST00000455728	D;D;D;D;D;D	0.90069	-2.61;-2.61;-2.61;-2.61;-2.61;-2.61	5.64	5.64	0.86602	.	0.092527	0.64402	D	0.000001	D	0.95310	0.8478	M	0.86178	2.8	0.80722	D	1	D;D	0.89917	0.993;1.0	D;D	0.91635	0.923;0.999	D	0.95497	0.8574	10	0.87932	D	0	-17.7339	19.6873	0.95984	0.0:0.0:1.0:0.0	.	210;328	F8W8I2;P28329	.;CLAT_HUMAN	Y	210;210;210;328;246;210	ENSP00000343486:D210Y;ENSP00000345878:D210Y;ENSP00000378926:D210Y;ENSP00000337103:D328Y;ENSP00000378929:D246Y;ENSP00000390521:D210Y	ENSP00000337103:D328Y	D	+	1	0	CHAT	50505708	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.462000	0.97649	2.647000	0.89833	0.579000	0.79373	GAT	CHAT	-	pfam_Carn_acyl_trans	ENSG00000070748		0.517	CHAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHAT	HGNC	protein_coding	OTTHUMT00000047997.1	-	0.00	78	0	G	NM_020549		50835702	+1	tier1	-	no_errors	ENST00000337653	ensembl	human	known	74_37	missense	28.33	43	17	SNP	1.000	T
CHRNB1	1140	genome.wustl.edu	37	17	7360019	7360019	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr17:7360019C>A	ENST00000306071.2	+	11	1550	c.1483C>A	c.(1483-1485)Ccc>Acc	p.P495T	CHRNB1_ENST00000575379.1_Missense_Mutation_p.P31T|CHRNB1_ENST00000536404.2_Missense_Mutation_p.P423T|CHRNB1_ENST00000576360.1_Missense_Mutation_p.P374T	NM_000747.2	NP_000738.2	P11230	ACHB_HUMAN	cholinergic receptor, nicotinic, beta 1 (muscle)	495					behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|neurological system process (GO:0050877)|neuromuscular synaptic transmission (GO:0007274)|postsynaptic membrane organization (GO:0001941)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)|channel activity (GO:0015267)|ligand-gated ion channel activity (GO:0015276)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|ovary(3)	23		Prostate(122;0.157)			Galantamine(DB00674)	GTACCACTTGCCCCCTCCAGA	0.557																																																	0													121.0	95.0	104.0					17																	7360019		2203	4300	6503	SO:0001583	missense	0			X14830	CCDS11106.1	17p13.1	2012-02-11	2006-02-01		ENSG00000170175	ENSG00000170175		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1961	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 1 (muscle)"""	100710	"""cholinergic receptor, nicotinic, beta polypeptide 1 (muscle)"""	CHRNB			Standard	NM_000747		Approved		uc002ghb.3	P11230	OTTHUMG00000108139	ENST00000306071.2:c.1483C>A	17.37:g.7360019C>A	ENSP00000304290:p.Pro495Thr		B7Z5H1|Q8IZ46|Q96FB8	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.P495T	ENST00000306071.2	37	c.1483	CCDS11106.1	17	.	.	.	.	.	.	.	.	.	.	c	13.82	2.351976	0.41700	.	.	ENSG00000170175	ENST00000306071;ENST00000536404	T;T	0.77877	-1.12;-1.13	5.69	5.69	0.88448	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.113080	0.64402	D	0.000011	T	0.57110	0.2031	N	0.12182	0.205	0.42572	D	0.993181	B	0.30870	0.298	B	0.25884	0.064	T	0.59380	-0.7465	10	0.05721	T	0.95	.	15.3307	0.74208	0.0:1.0:0.0:0.0	.	495	P11230	ACHB_HUMAN	T	495;423	ENSP00000304290:P495T;ENSP00000439209:P423T	ENSP00000304290:P495T	P	+	1	0	CHRNB1	7300743	0.994000	0.37717	1.000000	0.80357	0.966000	0.64601	3.661000	0.54503	2.691000	0.91804	0.550000	0.68814	CCC	CHRNB1	-	superfamily_Neurotrans-gated_channel_TM	ENSG00000170175		0.557	CHRNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNB1	HGNC	protein_coding	OTTHUMT00000226942.3	-	0.00	146	0	C			7360019	+1	tier1	-	no_errors	ENST00000306071	ensembl	human	known	74_37	missense	30.48	73	32	SNP	1.000	A
CNTN5	53942	genome.wustl.edu	37	11	99931958	99931958	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr11:99931958T>C	ENST00000524871.1	+	10	1285	c.995T>C	c.(994-996)aTc>aCc	p.I332T	CNTN5_ENST00000527185.1_Missense_Mutation_p.I332T|CNTN5_ENST00000418526.2_Missense_Mutation_p.I258T|CNTN5_ENST00000528682.1_Missense_Mutation_p.I332T|CNTN5_ENST00000279463.3_Missense_Mutation_p.I332T	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	332	Ig-like C2-type 3.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		GTTCCAACAATCACATGGATG	0.418																																																	0													177.0	164.0	168.0					11																	99931958		1922	4135	6057	SO:0001583	missense	0			AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.995T>C	11.37:g.99931958T>C	ENSP00000435637:p.Ile332Thr		A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.I332T	ENST00000524871.1	37	c.995	CCDS53696.1	11	.	.	.	.	.	.	.	.	.	.	T	19.30	3.801424	0.70682	.	.	ENSG00000149972	ENST00000527185;ENST00000528682;ENST00000524871;ENST00000418526;ENST00000279463	T;T;T;T;T	0.72282	-0.64;-0.64;-0.64;-0.64;-0.64	5.33	5.33	0.75918	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.85314	0.5668	M	0.85859	2.78	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.87862	0.2665	10	0.87932	D	0	.	14.7647	0.69629	0.0:0.0:0.0:1.0	.	332;258;332	E9PKE8;O94779-2;O94779	.;.;CNTN5_HUMAN	T	332;332;332;258;332	ENSP00000433575:I332T;ENSP00000436185:I332T;ENSP00000435637:I332T;ENSP00000393229:I258T;ENSP00000279463:I332T	ENSP00000279463:I332T	I	+	2	0	CNTN5	99437168	1.000000	0.71417	1.000000	0.80357	0.705000	0.40729	7.997000	0.88414	2.140000	0.66376	0.477000	0.44152	ATC	CNTN5	-	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000149972		0.418	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNTN5	HGNC	protein_coding	OTTHUMT00000395148.2	-	0.00	104	0	T	NM_014361		99931958	+1	tier1	-	no_errors	ENST00000279463	ensembl	human	known	74_37	missense	32.93	54	27	SNP	1.000	C
COL27A1	85301	genome.wustl.edu	37	9	116918267	116918269	+	In_Frame_Del	DEL	GCG	GCG	-			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	GCG	GCG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr9:116918267_116918269delGCG	ENST00000356083.3	+	1	428_430	c.37_39delGCG	c.(37-39)gcgdel	p.A18del		NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1	18					extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						ccgaggcacagcggcggcggcgg	0.768																																																	0										52,1722		7,38,842						1.8	1.0			10	106,4640		11,84,2278	no	coding	COL27A1	NM_032888.2		18,122,3120	A1A1,A1R,RR		2.2335,2.9312,2.4233				158,6362				SO:0001651	inframe_deletion	0			AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.37_39delGCG	9.37:g.116918276_116918278delGCG	ENSP00000348385:p.Ala18del		Q66K43|Q96JF7	In_Frame_Del	DEL	pfam_Collagen,pfam_Fib_collagen_C,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_Fib_collagen_C	p.A16in_frame_del	ENST00000356083.3	37	c.37_39	CCDS6802.1	9																																																																																			COL27A1	-	NULL	ENSG00000196739		0.768	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL27A1	HGNC	protein_coding	OTTHUMT00000053763.1		0.00	16	0	GCG	NM_032888		116918269	+1	tier1		no_errors	ENST00000356083	ensembl	human	known	74_37	in_frame_del	33.33	4	2	DEL	1.000:1.000:0.993	-
COL5A1	1289	genome.wustl.edu	37	9	137708901	137708901	+	Silent	SNP	T	T	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr9:137708901T>G	ENST00000371817.3	+	53	4566	c.4152T>G	c.(4150-4152)ggT>ggG	p.G1384G		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	1384	Triple-helical region.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		GTGAACCAGGTCCATCGGGGC	0.552																																																	0													108.0	102.0	104.0					9																	137708901		2203	4300	6503	SO:0001819	synonymous_variant	0			D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.4152T>G	9.37:g.137708901T>G			Q15094|Q5SUX4	Silent	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Laminin_G,smart_Fib_collagen_C	p.G1384	ENST00000371817.3	37	c.4152	CCDS6982.1	9																																																																																			COL5A1	-	NULL	ENSG00000130635		0.552	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A1	HGNC	protein_coding	OTTHUMT00000054954.2	-	0.00	73	0	T	NM_000093		137708901	+1	tier1	-	no_errors	ENST00000371817	ensembl	human	known	74_37	silent	21.43	44	12	SNP	0.096	G
CORO1B	57175	genome.wustl.edu	37	11	67207669	67207669	+	Silent	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr11:67207669C>T	ENST00000341356.5	-	8	1037	c.927G>A	c.(925-927)acG>acA	p.T309T	CORO1B_ENST00000539724.1_5'UTR|CORO1B_ENST00000393893.1_Silent_p.T309T|PTPRCAP_ENST00000326294.3_5'Flank	NM_020441.2	NP_065174.1	Q9BR76	COR1B_HUMAN	coronin, actin binding protein, 1B	309					actin cytoskeleton organization (GO:0030036)|actin filament branching (GO:0090135)|actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|endothelial cell chemotaxis (GO:0035767)|negative regulation of Arp2/3 complex-mediated actin nucleation (GO:0034316)|positive regulation of lamellipodium morphogenesis (GO:2000394)|protein localization to cell leading edge (GO:1902463)|ruffle organization (GO:0031529)|wound healing (GO:0042060)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)|Arp2/3 complex binding (GO:0071933)|identical protein binding (GO:0042802)			cervix(1)|endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	13			BRCA - Breast invasive adenocarcinoma(15;3.26e-06)			TGCTGGTGAACGTGTTCAGGA	0.642																																																	0													80.0	81.0	81.0					11																	67207669		2200	4295	6495	SO:0001819	synonymous_variant	0			AK000860	CCDS8164.1	11q13.1	2013-01-10	2001-11-28		ENSG00000172725	ENSG00000172725		"""Coronins"", ""WD repeat domain containing"""	2253	protein-coding gene	gene with protein product		609849	"""coronin, actin-binding protein, 1B"""			9778037	Standard	NM_001018070		Approved	coronin-2	uc001olk.1	Q9BR76	OTTHUMG00000167775	ENST00000341356.5:c.927G>A	11.37:g.67207669C>T			B2RD45	Silent	SNP	pfam_DUF1900,pfam_DUF1899,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T309	ENST00000341356.5	37	c.927	CCDS8164.1	11																																																																																			CORO1B	-	pfam_DUF1900	ENSG00000172725		0.642	CORO1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CORO1B	HGNC	protein_coding	OTTHUMT00000396220.1		0.00	58	0	C	NM_020441		67207669	-1			no_errors	ENST00000341356	ensembl	human	known	74_37	silent	8.11	34	3	SNP	0.001	T
CPSF3L	54973	genome.wustl.edu	37	1	1250292	1250292	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:1250292G>A	ENST00000435064.1	-	7	696	c.614C>T	c.(613-615)aCg>aTg	p.T205M	CPSF3L_ENST00000540437.1_Missense_Mutation_p.T211M|CPSF3L_ENST00000545578.1_Missense_Mutation_p.T176M|CPSF3L_ENST00000421495.2_De_novo_Start_OutOfFrame|CPSF3L_ENST00000419704.1_Missense_Mutation_p.T104M|CPSF3L_ENST00000411962.1_Missense_Mutation_p.T107M|RP5-890O3.9_ENST00000444968.1_RNA|CPSF3L_ENST00000462432.1_5'UTR|CPSF3L_ENST00000450926.2_Missense_Mutation_p.T183M	NM_001256460.1|NM_017871.5	NP_001243389.1|NP_060341.2	Q5TA45	INT11_HUMAN	cleavage and polyadenylation specific factor 3-like	205					snRNA processing (GO:0016180)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|integrator complex (GO:0032039)	hydrolase activity (GO:0016787)			endometrium(4)|kidney(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(3)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;6.71e-35)|OV - Ovarian serous cystadenocarcinoma(86;4.35e-21)|Colorectal(212;0.000166)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.00235)|BRCA - Breast invasive adenocarcinoma(365;0.00255)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0349)|Lung(427;0.201)		CGTGGCGTACGTGGACTCTGT	0.622																																																	0													84.0	71.0	75.0					1																	1250292		2201	4297	6498	SO:0001583	missense	0			AL136813	CCDS21.1, CCDS57959.1, CCDS57960.1, CCDS57961.1, CCDS72678.1	1p36.33	2008-02-05			ENSG00000127054	ENSG00000127054			26052	protein-coding gene	gene with protein product	"""integrator complex subunit 11"""	611354				15684398, 16239144	Standard	NM_001256456		Approved	FLJ20542, RC-68, CPSF73L, INT11, INTS11	uc001aee.2	Q5TA45	OTTHUMG00000003330	ENST00000435064.1:c.614C>T	1.37:g.1250292G>A	ENSP00000413493:p.Thr205Met		A8K5S2|B3KPR3|B4DM87|G3V1S5|Q5TA46|Q5TA48|Q5TA52|Q5TA53|Q5TA54|Q7L3D7|Q96HY1|Q9BW36|Q9H0F9|Q9H8R5|Q9HAA6|Q9NWX9	Missense_Mutation	SNP	pfam_Beta_Casp,pfam_Beta-lactamas-like,pfam_RMMBL,smart_Beta-lactamas-like	p.T211M	ENST00000435064.1	37	c.632	CCDS21.1	1	.	.	.	.	.	.	.	.	.	.	g	20.5	4.002090	0.74932	.	.	ENSG00000127054	ENST00000435064;ENST00000411962;ENST00000419704;ENST00000540437;ENST00000450926;ENST00000545578;ENST00000434694;ENST00000526332	T;T;T;T;T;T;T	0.60797	0.23;0.23;0.23;0.23;0.16;0.23;0.47	5.53	5.53	0.82687	Beta-lactamase-like (1);	0.000000	0.85682	D	0.000000	D	0.86410	0.5926	H	0.98370	4.215	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;0.999;0.998;1.0;1.0	D	0.91577	0.5276	10	0.87932	D	0	-24.9668	19.4626	0.94924	0.0:0.0:1.0:0.0	.	183;176;107;104;211;205	Q5TA45-3;B4DM87;C9IYS7;Q5TA45-2;G3V1S5;Q5TA45	.;.;.;.;.;INT11_HUMAN	M	205;107;104;211;183;176;235;81	ENSP00000413493:T205M;ENSP00000404886:T104M;ENSP00000445001:T211M;ENSP00000392848:T183M;ENSP00000444672:T176M;ENSP00000411233:T235M;ENSP00000434790:T81M	ENSP00000400548:T107M	T	-	2	0	CPSF3L	1240155	1.000000	0.71417	0.922000	0.36590	0.255000	0.26057	9.321000	0.96353	2.601000	0.87937	0.651000	0.88453	ACG	CPSF3L	-	smart_Beta-lactamas-like	ENSG00000127054		0.622	CPSF3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPSF3L	HGNC	protein_coding	OTTHUMT00000009360.2	-	0.00	57	0	G	NM_017871		1250292	-1	tier1	-	no_errors	ENST00000540437	ensembl	human	known	74_37	missense	31.11	31	14	SNP	1.000	A
CRISPLD1	83690	genome.wustl.edu	37	8	75926262	75926262	+	Missense_Mutation	SNP	A	A	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr8:75926262A>C	ENST00000262207.4	+	5	1019	c.551A>C	c.(550-552)aAt>aCt	p.N184T	CRISPLD1_ENST00000523524.1_5'UTR|CRISPLD1_ENST00000517786.1_Intron	NM_031461.5	NP_113649.1	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain containing 1	184	SCP.				face morphogenesis (GO:0060325)	extracellular vesicular exosome (GO:0070062)				biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			TGTGCCATTAATTTGTGTCAT	0.423																																																	0													156.0	140.0	146.0					8																	75926262		2203	4300	6503	SO:0001583	missense	0			AL834301	CCDS6219.1, CCDS69497.1, CCDS75754.1	8q21.13	2005-09-23	2005-02-16	2005-02-16	ENSG00000121005	ENSG00000121005			18206	protein-coding gene	gene with protein product			"""LCCL domain containing cysteine-rich secretory protein 1"""	LCRISP1			Standard	NM_031461		Approved	Cocoacrisp, DKFZp762F133	uc003yan.3	Q9H336	OTTHUMG00000164529	ENST00000262207.4:c.551A>C	8.37:g.75926262A>C	ENSP00000262207:p.Asn184Thr		B2RA60|B7Z929	Missense_Mutation	SNP	pfam_LCCL,pfam_CAP_domain,superfamily_CAP_domain,superfamily_LCCL,smart_Allrgn_V5/Tpx1,smart_LCCL,pfscan_LCCL,prints_Allrgn_V5/Tpx1	p.N184T	ENST00000262207.4	37	c.551	CCDS6219.1	8	.	.	.	.	.	.	.	.	.	.	A	21.7	4.182642	0.78677	.	.	ENSG00000121005	ENST00000262207	T	0.08282	3.11	4.95	4.95	0.65309	CAP domain (3);	0.000000	0.85682	D	0.000000	T	0.16642	0.0400	N	0.25647	0.755	0.80722	D	1	D	0.69078	0.997	D	0.74348	0.983	T	0.05920	-1.0856	10	0.33940	T	0.23	.	14.7877	0.69816	1.0:0.0:0.0:0.0	.	184	Q9H336	CRLD1_HUMAN	T	184	ENSP00000262207:N184T	ENSP00000262207:N184T	N	+	2	0	CRISPLD1	76088817	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	7.050000	0.76620	2.072000	0.62099	0.528000	0.53228	AAT	CRISPLD1	-	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1	ENSG00000121005		0.423	CRISPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRISPLD1	HGNC	protein_coding	OTTHUMT00000379117.1	-	0.00	95	0	A	NM_031461		75926262	+1	tier1	-	no_errors	ENST00000262207	ensembl	human	known	74_37	missense	43.86	32	25	SNP	1.000	C
CSF3R	1441	genome.wustl.edu	37	1	36938264	36938264	+	Missense_Mutation	SNP	G	G	A	rs150616658		TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:36938264G>A	ENST00000373106.1	-	7	1244	c.697C>T	c.(697-699)Cgg>Tgg	p.R233W	CSF3R_ENST00000418048.2_Missense_Mutation_p.R233W|CSF3R_ENST00000361632.4_Missense_Mutation_p.R233W|CSF3R_ENST00000338937.5_Missense_Mutation_p.R233W|CSF3R_ENST00000373104.1_Missense_Mutation_p.R233W|CSF3R_ENST00000440588.2_Missense_Mutation_p.R233W|CSF3R_ENST00000373103.1_Missense_Mutation_p.R233W|CSF3R_ENST00000331941.5_Missense_Mutation_p.R233W|CSF3R_ENST00000487540.2_5'Flank	NM_000760.3	NP_000751.1	Q99062	CSF3R_HUMAN	colony stimulating factor 3 receptor (granulocyte)	233	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|defense response (GO:0006952)|neutrophil chemotaxis (GO:0030593)|odontogenesis of dentin-containing tooth (GO:0042475)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)	p.R233W(2)		central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)			Filgrastim(DB00099)|Pegfilgrastim(DB00019)	TCCATGGTCCGCAGCATGGGG	0.627																																																	2	Substitution - Missense(2)	large_intestine(2)						G	TRP/ARG,TRP/ARG,TRP/ARG	1,4363		0,1,2181	11.0	12.0	12.0		697,697,697	-2.4	0.3	1	dbSNP_134	12	0,8546		0,0,4273	no	missense,missense,missense	CSF3R	NM_000760.3,NM_156039.3,NM_172313.2	101,101,101	0,1,6454	AA,AG,GG		0.0,0.0229,0.0077	benign,benign,benign	233/837,233/864,233/784	36938264	1,12909	2182	4273	6455	SO:0001583	missense	0			M59820	CCDS412.1, CCDS413.1, CCDS414.1	1p35-p34.3	2014-09-17			ENSG00000119535	ENSG00000119535		"""CD molecules"", ""Fibronectin type III domain containing"""	2439	protein-coding gene	gene with protein product		138971		CD114		1371413	Standard	NM_000760		Approved	GCSFR	uc001cax.2	Q99062	OTTHUMG00000008010	ENST00000373106.1:c.697C>T	1.37:g.36938264G>A	ENSP00000362198:p.Arg233Trp			Missense_Mutation	SNP	pfam_IgC2-like_lig-bd,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.R233W	ENST00000373106.1	37	c.697	CCDS413.1	1	.	.	.	.	.	.	.	.	.	.	G	6.594	0.477964	0.12521	2.29E-4	0.0	ENSG00000119535	ENST00000373106;ENST00000373104;ENST00000373103;ENST00000361632;ENST00000331941;ENST00000418048;ENST00000338937;ENST00000440588	T;T;T;T;T;T;T;T	0.54479	0.57;0.57;0.57;0.57;0.57;0.57;0.57;0.57	4.6	-2.38	0.06622	Fibronectin, type III (1);Immunoglobulin-like fold (1);	6.027910	0.01642	N	0.024086	T	0.24890	0.0604	N	0.02802	-0.49	0.09310	N	0.99999	B;B;B;B	0.21147	0.052;0.008;0.01;0.005	B;B;B;B	0.06405	0.001;0.002;0.001;0.002	T	0.09552	-1.0669	10	0.37606	T	0.19	0.3242	2.467	0.04555	0.1744:0.2883:0.3953:0.142	.	233;233;233;233	E1B6W6;Q99062-3;Q99062;Q99062-4	.;.;CSF3R_HUMAN;.	W	233	ENSP00000362198:R233W;ENSP00000362196:R233W;ENSP00000362195:R233W;ENSP00000355406:R233W;ENSP00000332180:R233W;ENSP00000401588:R233W;ENSP00000345013:R233W;ENSP00000397568:R233W	ENSP00000332180:R233W	R	-	1	2	CSF3R	36710851	0.000000	0.05858	0.300000	0.25030	0.032000	0.12392	-0.365000	0.07573	-0.315000	0.08703	-0.345000	0.07892	CGG	CSF3R	-	superfamily_Fibronectin_type3	ENSG00000119535		0.627	CSF3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSF3R	HGNC	protein_coding	OTTHUMT00000021997.2	-	0.00	65	0	G	NM_156039		36938264	-1	tier1	rs150616658	no_errors	ENST00000373103	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.172	A
CTNNB1	1499	genome.wustl.edu	37	3	41268766	41268766	+	Missense_Mutation	SNP	A	A	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr3:41268766A>C	ENST00000349496.5	+	7	1284	c.1004A>C	c.(1003-1005)aAa>aCa	p.K335T	CTNNB1_ENST00000396183.3_Missense_Mutation_p.K335T|CTNNB1_ENST00000453024.1_Missense_Mutation_p.K328T|CTNNB1_ENST00000405570.1_Missense_Mutation_p.K335T|CTNNB1_ENST00000396185.3_Missense_Mutation_p.K335T	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	335					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.K335I(8)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		ACTTACGAAAAACTACTGTGG	0.383		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												Colon(6;3 56 14213 18255)			Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	8	Substitution - Missense(8)	liver(7)|kidney(1)											110.0	108.0	109.0					3																	41268766		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.1004A>C	3.37:g.41268766A>C	ENSP00000344456:p.Lys335Thr		A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,prints_Beta-catenin	p.K335T	ENST00000349496.5	37	c.1004	CCDS2694.1	3	.	.	.	.	.	.	.	.	.	.	A	26.4	4.732055	0.89390	.	.	ENSG00000168036	ENST00000405570;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185	T;T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14;-0.14	5.5	5.5	0.81552	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.82121	0.4968	M	0.89287	3.02	0.80722	D	1	D;D	0.71674	0.981;0.998	D;D	0.76575	0.913;0.988	D	0.85665	0.1291	10	0.66056	D	0.02	-3.7939	15.5934	0.76558	1.0:0.0:0.0:0.0	.	263;335	B4DSW9;P35222	.;CTNB1_HUMAN	T	335;335;335;328;335	ENSP00000385604:K335T;ENSP00000379486:K335T;ENSP00000344456:K335T;ENSP00000411226:K328T;ENSP00000379488:K335T	ENSP00000344456:K335T	K	+	2	0	CTNNB1	41243770	1.000000	0.71417	0.998000	0.56505	0.968000	0.65278	9.339000	0.96797	2.094000	0.63399	0.482000	0.46254	AAA	CTNNB1	-	superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,prints_Beta-catenin	ENSG00000168036		0.383	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNB1	HGNC	protein_coding	OTTHUMT00000254182.2	-	0.00	130	0	A	NM_001098210		41268766	+1	tier1	-	no_errors	ENST00000349496	ensembl	human	known	74_37	missense	20.75	84	22	SNP	1.000	C
CTSK	1513	genome.wustl.edu	37	1	150776494	150776494	+	Intron	SNP	C	C	T	rs74819661		TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:150776494C>T	ENST00000271651.3	-	5	729				CTSK_ENST00000480670.1_5'UTR	NM_000396.3	NP_000387.1	P43235	CATK_HUMAN	cathepsin K						bone resorption (GO:0045453)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|intramembranous ossification (GO:0001957)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|fibronectin binding (GO:0001968)|proteoglycan binding (GO:0043394)			cervix(1)|endometrium(1)|lung(4)|skin(1)	7	all_cancers(9;2.32e-51)|all_epithelial(9;3.89e-42)|all_lung(15;4.59e-35)|Lung NSC(24;1.7e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Colorectal(459;0.171)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0485)|BRCA - Breast invasive adenocarcinoma(12;0.00606)|LUSC - Lung squamous cell carcinoma(543;0.211)			GGAGCAATCTCACCTGTCCCA	0.463																																																	0													120.0	111.0	114.0					1																	150776494		2203	4300	6503	SO:0001627	intron_variant	0			BC016058	CCDS969.1	1q21	2008-02-05	2006-12-05		ENSG00000143387	ENSG00000143387		"""Cathepsins"""	2536	protein-coding gene	gene with protein product		601105	"""cathepsin K (pycnodysostosis)"""	CTSO2, CTSO, PYCD		7818555	Standard	NM_000396		Approved	PKND	uc001evp.2	P43235	OTTHUMG00000035008	ENST00000271651.3:c.618+2G>A	1.37:g.150776494C>T			Q6FHS6	RNA	SNP	-	NULL	ENST00000271651.3	37	NULL	CCDS969.1	1																																																																																			CTSK	-	-	ENSG00000143387		0.463	CTSK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTSK	HGNC	protein_coding	OTTHUMT00000084732.1	-	0.00	65	0	C	NM_000396		150776494	-1	tier1	rs74819661	no_errors	ENST00000480670	ensembl	human	known	74_37	rna	15.07	62	11	SNP	0.997	T
CYLC2	1539	genome.wustl.edu	37	9	105767695	105767695	+	Missense_Mutation	SNP	A	A	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr9:105767695A>G	ENST00000374798.3	+	5	852	c.782A>G	c.(781-783)aAg>aGg	p.K261R	CYLC2_ENST00000487798.1_Missense_Mutation_p.K261R	NM_001340.3	NP_001331.1	Q14093	CYLC2_HUMAN	cylicin, basic protein of sperm head cytoskeleton 2	261	31 X 3 AA repeats of K-K-X.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)	41		all_hematologic(171;0.125)				AAGGATGCCAAGAAAGATGCA	0.373																																																	0													119.0	113.0	115.0					9																	105767695		2203	4300	6503	SO:0001583	missense	0			Z46788	CCDS35085.1	9q31.2	2008-07-21			ENSG00000155833	ENSG00000155833			2583	protein-coding gene	gene with protein product		604035				7737358	Standard	NM_001340		Approved		uc004bbs.2	Q14093	OTTHUMG00000020396	ENST00000374798.3:c.782A>G	9.37:g.105767695A>G	ENSP00000420256:p.Lys261Arg		B2R8F4|Q5VVJ9	Missense_Mutation	SNP	NULL	p.K261R	ENST00000374798.3	37	c.782	CCDS35085.1	9	.	.	.	.	.	.	.	.	.	.	A	12.75	2.031178	0.35797	.	.	ENSG00000155833	ENST00000374798;ENST00000487798	T;T	0.17054	2.3;2.3	4.36	1.97	0.26223	.	0.000000	0.44483	D	0.000456	T	0.10723	0.0262	L	0.29908	0.895	0.09310	N	1	P	0.44816	0.844	B	0.42319	0.383	T	0.15122	-1.0448	10	0.30854	T	0.27	-1.4191	4.4293	0.11520	0.6946:0.2008:0.1045:0.0	.	261	Q14093	CYLC2_HUMAN	R	261	ENSP00000420256:K261R;ENSP00000417674:K261R	ENSP00000420256:K261R	K	+	2	0	CYLC2	104807516	0.011000	0.17503	0.044000	0.18714	0.193000	0.23685	1.662000	0.37418	0.304000	0.22809	0.477000	0.44152	AAG	CYLC2	-	NULL	ENSG00000155833		0.373	CYLC2-001	KNOWN	alternative_3_UTR|NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	CYLC2	HGNC	protein_coding	OTTHUMT00000053463.3	-	0.00	56	0	A	NM_001340		105767695	+1	tier1	-	no_errors	ENST00000374798	ensembl	human	known	74_37	missense	21.21	26	7	SNP	0.254	G
CYP4V2	285440	genome.wustl.edu	37	4	187131993	187131994	+	IGR	INS	-	-	T	rs199938898|rs200614627|rs150697121	byFrequency	TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr4:187131993_187131994insT	ENST00000378802.4	+	0	2042				CYP4V2_ENST00000502665.1_3'UTR	NM_207352.3	NP_997235.3	Q6ZWL3	CP4V2_HUMAN	cytochrome P450, family 4, subfamily V, polypeptide 2						fatty acid omega-oxidation (GO:0010430)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|skin(1)|stomach(2)	20		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.33e-10)|BRCA - Breast invasive adenocarcinoma(30;3.84e-05)|GBM - Glioblastoma multiforme(59;0.000132)|STAD - Stomach adenocarcinoma(60;0.000293)|LUSC - Lung squamous cell carcinoma(40;0.00242)|READ - Rectum adenocarcinoma(43;0.17)		ttttttctttattttttttttt	0.406													|||unknown(HR)	758	0.151358	0.1241	0.2017	5008	,	,		18502	0.1716		0.1938	False		,,,				2504	0.0879																0																																										SO:0001628	intergenic_variant	0			AK022114	CCDS34119.1	4q35.2	2004-07-05			ENSG00000145476	ENSG00000145476		"""Cytochrome P450s"""	23198	protein-coding gene	gene with protein product		608614				15042513	Standard	NM_207352		Approved	CYP4AH1	uc003iyw.4	Q6ZWL3	OTTHUMG00000160379		4.37:g.187132004_187132004dupT			B7U6W2|Q6ZTM4	RNA	INS	-	NULL	ENST00000378802.4	37	NULL	CCDS34119.1	4																																																																																			CYP4V2	-	-	ENSG00000145476		0.406	CYP4V2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP4V2	HGNC	protein_coding	OTTHUMT00000360398.1		0.00	12	0	-	XM_209612		187131994	+1	tier1		no_errors	ENST00000502665	ensembl	human	known	74_37	rna	50.00	5	5	INS	0.075:0.089	T
DCHS2	54798	genome.wustl.edu	37	4	155243619	155243619	+	Missense_Mutation	SNP	T	T	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr4:155243619T>G	ENST00000357232.4	-	13	2674	c.2675A>C	c.(2674-2676)aAg>aCg	p.K892T		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	892	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		GGCGTCAATCTTAAAGTGATC	0.343																																																	0													131.0	111.0	118.0					4																	155243619		2203	4300	6503	SO:0001583	missense	0			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.2675A>C	4.37:g.155243619T>G	ENSP00000349768:p.Lys892Thr		B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	pfam_Cadherin,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.K892T	ENST00000357232.4	37	c.2675	CCDS3785.1	4	.	.	.	.	.	.	.	.	.	.	T	16.12	3.031980	0.54790	.	.	ENSG00000197410	ENST00000357232	T	0.49720	0.77	5.73	3.32	0.38043	Cadherin (4);Cadherin-like (1);	0.405721	0.24072	N	0.041815	T	0.32436	0.0829	N	0.11651	0.15	0.80722	D	1	P	0.49185	0.92	P	0.53313	0.723	T	0.13442	-1.0509	10	0.12103	T	0.63	.	5.2485	0.15510	0.1311:0.1394:0.0:0.7294	.	892	Q6V1P9	PCD23_HUMAN	T	892	ENSP00000349768:K892T	ENSP00000349768:K892T	K	-	2	0	DCHS2	155463069	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	4.149000	0.58091	0.538000	0.28769	0.533000	0.62120	AAG	DCHS2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000197410		0.343	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365281.2	-	0.00	86	0	T	NM_001142552		155243619	-1	tier1	-	no_errors	ENST00000357232	ensembl	human	known	74_37	missense	34.78	30	16	SNP	1.000	G
DCHS2	54798	genome.wustl.edu	37	4	155254348	155254348	+	Missense_Mutation	SNP	T	T	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr4:155254348T>G	ENST00000357232.4	-	9	1514	c.1515A>C	c.(1513-1515)gaA>gaC	p.E505D	DCHS2_ENST00000339452.1_Missense_Mutation_p.E1004D|DCHS2_ENST00000507542.1_5'UTR	NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	505	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TGTCTCTGTCTTCCGCACGTG	0.602																																																	0													65.0	61.0	62.0					4																	155254348		2203	4300	6503	SO:0001583	missense	0			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.1515A>C	4.37:g.155254348T>G	ENSP00000349768:p.Glu505Asp		B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	pfam_Cadherin,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E505D	ENST00000357232.4	37	c.1515	CCDS3785.1	4	.	.	.	.	.	.	.	.	.	.	T	11.62	1.691539	0.30052	.	.	ENSG00000197410	ENST00000357232;ENST00000339452;ENST00000544161	T;T	0.52295	0.67;0.67	5.6	-4.58	0.03410	Cadherin (4);Cadherin-like (1);	0.845925	0.10156	N	0.709001	T	0.42585	0.1209	L	0.58810	1.83	0.80722	D	1	P;P	0.44521	0.837;0.837	B;P	0.46543	0.318;0.52	T	0.52056	-0.8626	10	0.20519	T	0.43	.	8.1433	0.31097	0.0:0.4549:0.1198:0.4253	.	1004;505	E9PC11;Q6V1P9	.;PCD23_HUMAN	D	505;1004;1004	ENSP00000349768:E505D;ENSP00000345062:E1004D	ENSP00000345062:E1004D	E	-	3	2	DCHS2	155473798	0.001000	0.12720	0.001000	0.08648	0.420000	0.31355	-0.461000	0.06712	-1.168000	0.02776	-0.376000	0.06991	GAA	DCHS2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000197410		0.602	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365281.2	-	0.00	51	0	T	NM_001142552		155254348	-1	tier1	-	no_errors	ENST00000357232	ensembl	human	known	74_37	missense	25.76	49	17	SNP	0.002	G
DCX	1641	genome.wustl.edu	37	X	110653400	110653400	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chrX:110653400C>T	ENST00000338081.3	-	2	641	c.470G>A	c.(469-471)cGt>cAt	p.R157H	DCX_ENST00000356915.2_Missense_Mutation_p.R76H|DCX_ENST00000488120.1_Missense_Mutation_p.R76H|DCX_ENST00000356220.3_Missense_Mutation_p.R76H|DCX_ENST00000496551.1_5'UTR|DCX_ENST00000371993.2_Missense_Mutation_p.R76H	NM_000555.3	NP_000546.2	O43602	DCX_HUMAN	doublecortin	157	Doublecortin 1. {ECO:0000255|PROSITE- ProRule:PRU00072}.				axon extension (GO:0048675)|axon guidance (GO:0007411)|brain development (GO:0007420)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neuron migration (GO:0001764)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuron projection (GO:0043005)	microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(17)|skin(6)|upper_aerodigestive_tract(1)	41						GCTGCGAAAACGGTCAGAGGA	0.512																																																	0													277.0	199.0	225.0					X																	110653400		2203	4300	6503	SO:0001583	missense	0			AF040254	CCDS14556.1, CCDS14557.1, CCDS14558.1	Xq22.3-q23	2008-08-01	2008-08-01		ENSG00000077279	ENSG00000077279			2714	protein-coding gene	gene with protein product	"""doublecortex"""	300121	"""doublecortex; lissencephaly, X-linked (doublecortin)"""			9489699, 9489700	Standard	NM_178151		Approved	SCLH, DC, LISX, DBCN, XLIS	uc004epd.3	O43602	OTTHUMG00000022204	ENST00000338081.3:c.470G>A	X.37:g.110653400C>T	ENSP00000337697:p.Arg157His		A6NFY6|A9Z1V8|D3DUY8|D3DUY9|D3DUZ0|O43911|Q5JYZ5	Missense_Mutation	SNP	pfam_Doublecortin_dom,smart_Doublecortin_dom,pirsf_Doublecortin_chordata,pfscan_Doublecortin_dom	p.R157H	ENST00000338081.3	37	c.470	CCDS14556.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.376587|5.376587	0.95945|0.95945	.|.	.|.	ENSG00000077279|ENSG00000077279	ENST00000356915;ENST00000371993;ENST00000338081;ENST00000356220;ENST00000488120;ENST00000468911|ENST00000358070	D;D;D;D;D;D|.	0.92805|.	-3.11;-3.11;-3.11;-3.11;-3.11;-3.11|.	5.5|5.5	5.5|5.5	0.81552|0.81552	Doublecortin domain (5);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.84406|0.84406	0.5465|0.5465	M|M	0.89214|0.89214	3.015|3.015	0.80722|0.80722	D|D	1|1	D;P|.	0.76494|.	0.999;0.939|.	D;P|.	0.74674|.	0.984;0.727|.	D|D	0.86708|0.86708	0.1934|0.1934	10|5	0.66056|.	D|.	0.02|.	.|.	18.4403|18.4403	0.90664|0.90664	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	145;157|.	B4DM53;O43602|.	.;DCX_HUMAN|.	H|I	76;76;157;76;76;76|149	ENSP00000349385:R76H;ENSP00000361061:R76H;ENSP00000337697:R157H;ENSP00000348553:R76H;ENSP00000419861:R76H;ENSP00000418811:R76H|.	ENSP00000337697:R157H|.	R|V	-|-	2|1	0|0	DCX|DCX	110540056|110540056	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	7.651000|7.651000	0.83577|0.83577	2.551000|2.551000	0.86045|0.86045	0.600000|0.600000	0.82982|0.82982	CGT|GTT	DCX	-	pfam_Doublecortin_dom,smart_Doublecortin_dom,pirsf_Doublecortin_chordata,pfscan_Doublecortin_dom	ENSG00000077279		0.512	DCX-006	KNOWN	basic|CCDS	protein_coding	DCX	HGNC	protein_coding	OTTHUMT00000357058.1	-	0.00	55	0	C	NM_178153		110653400	-1	tier1	-	no_errors	ENST00000338081	ensembl	human	known	74_37	missense	55.26	17	21	SNP	1.000	T
DDX3Y	8653	genome.wustl.edu	37	Y	15026659	15026659	+	Intron	DEL	T	T	-			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chrY:15026659delT	ENST00000336079.3	+	8	865				DDX3Y_ENST00000463199.1_Intron|DDX3Y_ENST00000360160.4_Intron	NM_001122665.1|NM_004660.3	NP_001116137.1|NP_004651.2	O15523	DDX3Y_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 3, Y-linked							cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)|RNA binding (GO:0003723)			kidney(1)|liver(2)|lung(1)|upper_aerodigestive_tract(1)	5						CTTATTTTCATTTTTTTTTTT	0.284																																																	0																																										SO:0001627	intron_variant	0			AF000984	CCDS14782.1	Yq11	2013-07-16	2013-07-16	2003-06-20	ENSG00000067048	ENSG00000067048		"""DEAD-boxes"""	2699	protein-coding gene	gene with protein product		400010	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide, Y chromosome"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked"""	DBY		9381176	Standard	NM_004660		Approved		uc004fsv.2	O15523	OTTHUMG00000036324	ENST00000336079.3:c.759+98T>-	Y.37:g.15026659delT			B4DK29|B4DXX7|Q8IYV7	RNA	DEL	-	NULL	ENST00000336079.3	37	NULL	CCDS14782.1	Y																																																																																			DDX3Y	-	-	ENSG00000067048		0.284	DDX3Y-003	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX3Y	HGNC	protein_coding	OTTHUMT00000088407.1		0.00	28	0	T	NM_004660		15026659	+1	tier1		no_errors	ENST00000472510	ensembl	human	putative	74_37	rna	18.42	31	7	DEL	0.001	-
DDX6	1656	genome.wustl.edu	37	11	118636000	118636000	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr11:118636000C>T	ENST00000526070.2	-	6	923	c.563G>A	c.(562-564)aGc>aAc	p.S188N	DDX6_ENST00000534980.1_Missense_Mutation_p.S188N|DDX6_ENST00000264018.4_Missense_Mutation_p.S188N	NM_001257191.1	NP_001244120.1	P26196	DDX6_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 6	188	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cytoplasmic mRNA processing body assembly (GO:0033962)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)	13	all_hematologic(175;0.0839)	Renal(330;0.0183)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)|Hepatocellular(160;0.0893)|Breast(348;0.0979)|all_hematologic(192;0.103)		OV - Ovarian serous cystadenocarcinoma(223;3.39e-06)|BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Colorectal(284;0.0377)		CATGTGTTTGCTGACCTGGAT	0.413			T	IGH@	B-NHL																																			Dom	yes		11	11q23.3	1656	DEAD (Asp-Glu-Ala-Asp) box polypeptide 6		L	0													281.0	271.0	274.0					11																	118636000		1909	4133	6042	SO:0001583	missense	0			D17532	CCDS44751.1	11q23.3	2012-02-23	2012-02-23		ENSG00000110367	ENSG00000110367		"""DEAD-boxes"""	2747	protein-coding gene	gene with protein product		600326	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 6 (RNA helicase, 54kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 6"""	HLR2		1579499, 11839790	Standard	NM_004397		Approved	RCK	uc001pub.2	P26196	OTTHUMG00000166411	ENST00000526070.2:c.563G>A	11.37:g.118636000C>T	ENSP00000433704:p.Ser188Asn		Q5D048	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.S188N	ENST00000526070.2	37	c.563	CCDS44751.1	11	.	.	.	.	.	.	.	.	.	.	C	35	5.438136	0.96168	.	.	ENSG00000110367	ENST00000264018;ENST00000534980;ENST00000526070	T;T;T	0.04917	3.53;3.53;3.53	5.7	5.7	0.88788	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.15305	0.0369	L	0.45581	1.43	0.80722	D	1	P	0.40332	0.713	P	0.49047	0.599	T	0.00102	-1.2063	10	0.87932	D	0	.	19.5067	0.95121	0.0:1.0:0.0:0.0	.	188	P26196	DDX6_HUMAN	N	188	ENSP00000264018:S188N;ENSP00000442266:S188N;ENSP00000433704:S188N	ENSP00000264018:S188N	S	-	2	0	DDX6	118141210	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.808000	0.86044	2.696000	0.92011	0.644000	0.83932	AGC	DDX6	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000110367		0.413	DDX6-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	DDX6	HGNC	protein_coding	OTTHUMT00000389647.2	-	0.00	89	0	C	NM_004397		118636000	-1	tier1	-	no_errors	ENST00000264018	ensembl	human	known	74_37	missense	7.04	66	5	SNP	1.000	T
DENND1B	163486	genome.wustl.edu	37	1	197704897	197704897	+	Intron	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:197704897G>A	ENST00000367396.3	-	3	252				DENND1B_ENST00000477581.1_5'UTR|DENND1B_ENST00000235453.4_5'UTR|DENND1B_ENST00000400967.2_5'Flank	NM_144977.4	NP_659414.2	Q6P3S1	DEN1B_HUMAN	DENN/MADD domain containing 1B						positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|breast(2)|kidney(2)|large_intestine(3)|lung(12)|upper_aerodigestive_tract(1)	22						TTTCCAGGGGGAATCCTCGGC	0.478																																																	0																																										SO:0001627	intron_variant	0			BC016588	CCDS41452.2, CCDS72996.1, CCDS72997.1	1q31.3	2012-10-03	2005-08-17	2005-08-17	ENSG00000213047	ENSG00000213047		"""DENN/MADD domain containing"""	28404	protein-coding gene	gene with protein product		613292	"""family with sequence similarity 31, member B"", ""chromosome 1 open reading frame 218"""	FAM31B, C1orf218		12477932	Standard	NM_144977		Approved	MGC27044, FLJ20054	uc021pgu.1	Q6P3S1	OTTHUMG00000035653	ENST00000367396.3:c.83-20693C>T	1.37:g.197704897G>A			B5MD89|D3PFD5|Q5T3B8|Q5T3B9|Q5T3C1|Q5TAI8|Q6B0I8|Q8NDT1|Q8TBE6|Q9H774|Q9NXU2	RNA	SNP	-	NULL	ENST00000367396.3	37	NULL	CCDS41452.2	1																																																																																			DENND1B	-	-	ENSG00000213047		0.478	DENND1B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND1B	HGNC	protein_coding	OTTHUMT00000086539.1	-	0.00	98	0	G	NM_144977		197704897	-1	tier1	-	no_errors	ENST00000477581	ensembl	human	known	74_37	rna	34.25	48	25	SNP	1.000	A
DIP2C	22982	genome.wustl.edu	37	10	430013	430013	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr10:430013G>T	ENST00000280886.6	-	16	1917	c.1830C>A	c.(1828-1830)aaC>aaA	p.N610K	DIP2C_ENST00000381496.3_Missense_Mutation_p.N503K	NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	610						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		GAGAGGAGAGGTTGATGTCTC	0.478																																																	0													112.0	94.0	100.0					10																	430013		2203	4300	6503	SO:0001583	missense	0			BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.1830C>A	10.37:g.430013G>T	ENSP00000280886:p.Asn610Lys		B4DPI5|Q5SS78	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.N610K	ENST00000280886.6	37	c.1830	CCDS7054.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.86|12.86	2.064846|2.064846	0.36470|0.36470	.|.	.|.	ENSG00000151240|ENSG00000151240	ENST00000280886;ENST00000381496|ENST00000421992	T;T|.	0.39406|.	1.08;1.08|.	5.43|5.43	1.55|1.55	0.23275|0.23275	AMP-dependent synthetase/ligase (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.56352|0.56352	0.1979|0.1979	L|L	0.49350|0.49350	1.555|1.555	0.35819|0.35819	D|D	0.824437|0.824437	P;B|.	0.41188|.	0.741;0.035|.	B;B|.	0.36766|.	0.232;0.1|.	T|T	0.58047|0.58047	-0.7705|-0.7705	10|5	0.49607|.	T|.	0.09|.	-39.6918|-39.6918	9.9743|9.9743	0.41774|0.41774	0.2671:0.0:0.7329:0.0|0.2671:0.0:0.7329:0.0	.|.	503;610|.	E7EPU2;Q9Y2E4|.	.;DIP2C_HUMAN|.	K|N	610;503|78	ENSP00000280886:N610K;ENSP00000370907:N503K|.	ENSP00000280886:N610K|.	N|T	-|-	3|2	2|0	DIP2C|DIP2C	420013|420013	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.099000|0.099000	0.18886|0.18886	2.786000|2.786000	0.47790|0.47790	0.027000|0.027000	0.15297|0.15297	0.563000|0.563000	0.77884|0.77884	AAC|ACC	DIP2C	-	pfam_AMP-dep_Synth/Lig	ENSG00000151240		0.478	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DIP2C	HGNC	protein_coding	OTTHUMT00000046389.1	-	0.00	51	0	G	NM_014974		430013	-1	tier1	-	no_errors	ENST00000280886	ensembl	human	known	74_37	missense	11.43	31	4	SNP	1.000	T
DKK3	27122	genome.wustl.edu	37	11	11989986	11989986	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr11:11989986C>A	ENST00000396505.2	-	5	722	c.484G>T	c.(484-486)Gcc>Tcc	p.A162S	DKK3_ENST00000450094.2_Missense_Mutation_p.A134S|DKK3_ENST00000527132.1_Intron|DKK3_ENST00000525493.1_Missense_Mutation_p.A162S|DKK3_ENST00000326932.4_Missense_Mutation_p.A162S	NM_015881.5	NP_056965.3	Q9UBP4	DKK3_HUMAN	dickkopf WNT signaling pathway inhibitor 3	162	DKK-type Cys-1.				adrenal gland development (GO:0030325)|anatomical structure morphogenesis (GO:0009653)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of transcription, DNA-templated (GO:0045892)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)				breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(1)|pancreas(1)	8				Epithelial(150;0.000502)		TGGAAGCTGGCAAACTGGCAG	0.632																																																	0													84.0	72.0	76.0					11																	11989986		2201	4294	6495	SO:0001583	missense	0			AF177396	CCDS7808.1	11p15.3	2013-05-15	2013-05-15		ENSG00000050165	ENSG00000050165			2893	protein-coding gene	gene with protein product	"""regulated in glioma"""	605416	"""dickkopf (Xenopus laevis) homolog 3"", ""dickkopf 3 homolog (Xenopus laevis)"""			10570958	Standard	XM_006718177		Approved	REIC, RIG	uc001mjv.3	Q9UBP4	OTTHUMG00000165709	ENST00000396505.2:c.484G>T	11.37:g.11989986C>A	ENSP00000379762:p.Ala162Ser		A8K1I2|D3DQW1|Q9ULB7	Missense_Mutation	SNP	pfam_Dickkopf_N	p.A162S	ENST00000396505.2	37	c.484	CCDS7808.1	11	.	.	.	.	.	.	.	.	.	.	C	9.999	1.233056	0.22626	.	.	ENSG00000050165	ENST00000396505;ENST00000326932;ENST00000366345;ENST00000525493;ENST00000450094;ENST00000326914;ENST00000533813;ENST00000534511	T;T;T;T;T;T	0.41065	2.41;2.41;2.39;1.67;2.02;1.01	5.52	-3.43	0.04810	Dickkopf, N-terminal cysteine-rich (1);	0.658158	0.15623	N	0.252767	T	0.14874	0.0359	N	0.01219	-0.95	0.24973	N	0.991659	B;B;B	0.16166	0.008;0.001;0.016	B;B;B	0.17098	0.014;0.001;0.017	T	0.23368	-1.0190	10	0.08381	T	0.77	-13.3912	18.4724	0.90779	0.7542:0.2457:0.0:0.0	.	162;134;162	F6SYF8;E7EUD0;Q9UBP4	.;.;DKK3_HUMAN	S	162;162;105;162;134;6;162;134	ENSP00000379762:A162S;ENSP00000314910:A162S;ENSP00000433112:A162S;ENSP00000398365:A134S;ENSP00000435269:A162S;ENSP00000436645:A134S	ENSP00000314730:A6S	A	-	1	0	DKK3	11946562	0.773000	0.28580	0.980000	0.43619	0.990000	0.78478	-0.023000	0.12456	-0.364000	0.08088	-0.182000	0.12963	GCC	DKK3	-	pfam_Dickkopf_N	ENSG00000050165		0.632	DKK3-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DKK3	HGNC	protein_coding	OTTHUMT00000385863.1	-	0.00	74	0	C	NM_013253		11989986	-1	tier1	-	no_errors	ENST00000326932	ensembl	human	known	74_37	missense	16.42	55	11	SNP	0.923	A
DLG2	1740	genome.wustl.edu	37	11	83177803	83177803	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr11:83177803G>T	ENST00000532653.1	-	21	2610	c.2308C>A	c.(2308-2310)Cag>Aag	p.Q770K	DLG2_ENST00000537455.1_Missense_Mutation_p.Q538K|DLG2_ENST00000330014.6_Missense_Mutation_p.Q709K|DLG2_ENST00000418306.2_Missense_Mutation_p.Q667K|DLG2_ENST00000426717.2_Missense_Mutation_p.Q252K|DLG2_ENST00000404783.3_Missense_Mutation_p.Q266K|DLG2_ENST00000376104.2_Missense_Mutation_p.Q893K|DLG2_ENST00000543673.1_Missense_Mutation_p.Q893K|DLG2_ENST00000398309.2_Missense_Mutation_p.Q788K|DLG2_ENST00000531015.1_Missense_Mutation_p.Q755K|DLG2_ENST00000524982.1_Missense_Mutation_p.Q784K|DLG2_ENST00000376106.3_Missense_Mutation_p.Q252K|DLG2_ENST00000280241.8_Missense_Mutation_p.Q827K			Q14168	MPP2_HUMAN	discs, large homolog 2 (Drosophila)	484					nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(11)|lung(35)|ovary(3)|pancreas(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	71		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				GGATAGAGCTGGGCAACTTGT	0.433																																																	0													146.0	143.0	144.0					11																	83177803		1884	4105	5989	SO:0001583	missense	0			U32376	CCDS41696.1, CCDS44690.1, CCDS44691.1, CCDS44692.1, CCDS55782.1, CCDS73357.1	11q21	2012-04-17	2008-12-15		ENSG00000150672	ENSG00000150672		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	2901	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 58"""	603583	"""discs, large homolog 2, chapsyn-110 (Drosophila)"""			8755482, 9806853	Standard	NM_001142702		Approved	PSD-93, PSD93, chapsyn-110, PPP1R58	uc001pak.2	Q15700	OTTHUMG00000134309	ENST00000532653.1:c.2308C>A	11.37:g.83177803G>T	ENSP00000435849:p.Gln770Lys		B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Missense_Mutation	SNP	pfam_PDZ,pfam_GK/Ca_channel_bsu,pfam_MAGUK_PEST_N,pfam_PDZ_assoc,pfam_L27_1,pfam_SH3_2,pfam_SH3_domain,superfamily_P-loop_NTPase,superfamily_SH3_domain,superfamily_PDZ,smart_PDZ,smart_SH3_domain,smart_GK/Ca_channel_bsu,pirsf_M-assoc_guanylate_kinase,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin-like	p.Q893K	ENST00000532653.1	37	c.2677		11	.	.	.	.	.	.	.	.	.	.	G	29.1	4.980145	0.92982	.	.	ENSG00000150672	ENST00000398309;ENST00000426717;ENST00000376104;ENST00000418306;ENST00000543673;ENST00000280241;ENST00000404783;ENST00000330014;ENST00000537455;ENST00000376106;ENST00000524982;ENST00000532653;ENST00000546021;ENST00000531015;ENST00000457267	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.02;1.02;1.02;1.02;1.02;1.02;1.02;1.02;1.02;1.02	5.84	5.84	0.93424	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (2);	0.000000	0.64402	D	0.000004	T	0.54013	0.1832	L	0.27975	0.815	0.80722	D	1	D;P;B;D;B;P;P;D	0.71674	0.998;0.947;0.022;0.982;0.198;0.917;0.614;0.997	D;P;B;D;B;D;B;D	0.83275	0.996;0.855;0.101;0.93;0.088;0.915;0.326;0.968	T	0.46091	-0.9216	9	.	.	.	.	20.1454	0.98074	0.0:0.0:1.0:0.0	.	755;770;784;709;266;893;788;667	E9PIW2;B7Z2T4;E9PN83;B7Z264;B5MCC5;Q15700-2;Q15700;Q15700-3	.;.;.;.;.;.;DLG2_HUMAN;.	K	788;252;893;667;893;827;266;709;538;252;784;770;893;755;140	ENSP00000381355:Q788K;ENSP00000393049:Q252K;ENSP00000365272:Q893K;ENSP00000402275:Q667K;ENSP00000441994:Q893K;ENSP00000280241:Q827K;ENSP00000385113:Q266K;ENSP00000381353:Q709K;ENSP00000443248:Q538K;ENSP00000365274:Q252K;ENSP00000432894:Q784K;ENSP00000435849:Q770K;ENSP00000433848:Q755K;ENSP00000409133:Q140K	.	Q	-	1	0	DLG2	82855451	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.748000	0.94277	0.650000	0.86243	CAG	DLG2	-	pfam_GK/Ca_channel_bsu,superfamily_P-loop_NTPase,smart_GK/Ca_channel_bsu,pirsf_M-assoc_guanylate_kinase,pfscan_Guanylate_kin-like	ENSG00000150672		0.433	DLG2-009	NOVEL	basic|appris_candidate	protein_coding	DLG2	HGNC	protein_coding	OTTHUMT00000259253.2	-	0.00	133	0	G	NM_001364		83177803	-1	tier1	-	no_errors	ENST00000376104	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	T
DLGAP3	58512	genome.wustl.edu	37	1	35391089	35391089	+	Intron	SNP	G	G	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:35391089G>T	ENST00000373347.1	-	1	135				DLGAP3_ENST00000495979.1_5'UTR			O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated protein 3						cell-cell signaling (GO:0007267)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|prostate(3)|skin(3)|urinary_tract(1)	46		Myeloproliferative disorder(586;0.0393)				CTGGACTGGGGGGAGGAGAGA	0.652																																																	0																																										SO:0001627	intron_variant	0			AF131778	CCDS30670.1	1p35.3-p34.1	2008-02-05			ENSG00000116544	ENSG00000116544			30368	protein-coding gene	gene with protein product		611413				8619474, 9110174	Standard	NM_001080418		Approved	SAPAP3, DAP3	uc001byc.3	O95886	OTTHUMG00000004049	ENST00000373347.1:c.133+3962C>A	1.37:g.35391089G>T			Q5TDD5|Q9H3X7	RNA	SNP	-	NULL	ENST00000373347.1	37	NULL	CCDS30670.1	1																																																																																			DLGAP3	-	-	ENSG00000116544		0.652	DLGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP3	HGNC	protein_coding	OTTHUMT00000011554.1	-	0.00	154	0	G	NM_021234		35391089	-1	tier1	-	no_errors	ENST00000495979	ensembl	human	known	74_37	rna	36.96	58	34	SNP	1.000	T
DLX4	1748	genome.wustl.edu	37	17	48050479	48050479	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr17:48050479G>T	ENST00000240306.3	+	2	621	c.326G>T	c.(325-327)cGc>cTc	p.R109L	DLX4_ENST00000411890.2_Missense_Mutation_p.R37L|DLX4_ENST00000503410.1_3'UTR	NM_138281.2	NP_612138.1	Q92988	DLX4_HUMAN	distal-less homeobox 4	109					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(3)	10						TCCGAGCGGCGCCCTCAGGCC	0.667																																																	0													27.0	34.0	31.0					17																	48050479		2203	4299	6502	SO:0001583	missense	0				CCDS11555.1, CCDS45728.1	17q21.33	2011-06-20			ENSG00000108813	ENSG00000108813		"""Homeoboxes / ANTP class : NKL subclass"""	2917	protein-coding gene	gene with protein product		601911		DLX7, DLX9			Standard	NM_138281		Approved	DLX8, BP1	uc002ipv.3	Q92988	OTTHUMG00000161839	ENST00000240306.3:c.326G>T	17.37:g.48050479G>T	ENSP00000240306:p.Arg109Leu		D3DTX2|D3DTX3|O60480|Q13265|Q6PJK0|Q9HBE0	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,prints_HTH_motif,prints_Homeobox_metazoa,pfscan_Homeobox_dom	p.R109L	ENST00000240306.3	37	c.326	CCDS11555.1	17	.	.	.	.	.	.	.	.	.	.	G	14.56	2.572579	0.45798	.	.	ENSG00000108813	ENST00000240306;ENST00000411890	D;D	0.95342	-2.9;-3.68	4.65	-2.96	0.05547	Homeodomain-related (1);Homeodomain-like (1);	.	.	.	.	D	0.88123	0.6352	L	0.45581	1.43	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.08055	0.003;0.002	T	0.73839	-0.3856	9	0.25751	T	0.34	-1.378	2.1351	0.03760	0.1202:0.1376:0.3228:0.4194	.	37;109	Q92988-2;Q92988	.;DLX4_HUMAN	L	109;37	ENSP00000240306:R109L;ENSP00000410622:R37L	ENSP00000240306:R109L	R	+	2	0	DLX4	45405478	0.171000	0.23029	0.000000	0.03702	0.013000	0.08279	1.211000	0.32382	-0.304000	0.08843	0.655000	0.94253	CGC	DLX4	-	superfamily_Homeodomain-like	ENSG00000108813		0.667	DLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLX4	HGNC	protein_coding	OTTHUMT00000366214.1		0.00	90	0	G			48050479	+1			no_errors	ENST00000240306	ensembl	human	known	74_37	missense	6.12	46	3	SNP	0.000	T
DNAH6	1768	genome.wustl.edu	37	2	84931260	84931260	+	Missense_Mutation	SNP	G	G	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr2:84931260G>C	ENST00000237449.6	+	50	8307	c.8299G>C	c.(8299-8301)Gat>Cat	p.D2767H	DNAH6_ENST00000389394.3_Missense_Mutation_p.D2767H			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	2767	Stalk. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						AGCAATAGCTGATGATGCTCA	0.438																																																	0													173.0	148.0	156.0					2																	84931260		692	1591	2283	SO:0001583	missense	0			U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.8299G>C	2.37:g.84931260G>C	ENSP00000237449:p.Asp2767His		A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.D2767H	ENST00000237449.6	37	c.8299	CCDS46348.1	2	.	.	.	.	.	.	.	.	.	.	G	20.1	3.931533	0.73442	.	.	ENSG00000115423	ENST00000389394;ENST00000237449	T;T	0.74421	-0.84;-0.84	5.25	5.25	0.73442	Dynein heavy chain, coiled coil stalk (1);	.	.	.	.	D	0.89280	0.6670	M	0.92459	3.31	0.80722	D	1	D	0.76494	0.999	D	0.70935	0.971	D	0.91763	0.5421	9	0.72032	D	0.01	.	17.6211	0.88082	0.0:0.0:1.0:0.0	.	2767	Q9C0G6	DYH6_HUMAN	H	2767	ENSP00000374045:D2767H;ENSP00000237449:D2767H	ENSP00000237449:D2767H	D	+	1	0	DNAH6	84784771	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.103000	0.64578	2.449000	0.82847	0.563000	0.77884	GAT	DNAH6	-	superfamily_P-loop_NTPase	ENSG00000115423		0.438	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH6	HGNC	protein_coding	OTTHUMT00000328537.2		0.00	46	0	G	NM_001370		84931260	+1			no_errors	ENST00000237449	ensembl	human	known	74_37	missense	6.12	46	3	SNP	1.000	C
DOCK2	1794	genome.wustl.edu	37	5	169423170	169423170	+	Splice_Site	SNP	T	T	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr5:169423170T>C	ENST00000256935.8	+	30	3152		c.e30+2		DOCK2_ENST00000523351.1_Splice_Site|DOCK2_ENST00000520908.1_Splice_Site|DOCK2_ENST00000540750.1_Splice_Site	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2						actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GAGTTCCAGGTGAGTATAAGC	0.502																																																	0													77.0	71.0	73.0					5																	169423170		2203	4300	6503	SO:0001630	splice_region_variant	0			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.3072+2T>C	5.37:g.169423170T>C			Q2M3I0|Q96AK7	Splice_Site	SNP	-	e30+2	ENST00000256935.8	37	c.3072+2	CCDS4371.1	5	.	.	.	.	.	.	.	.	.	.	T	12.81	2.050009	0.36181	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	.	.	.	5.5	5.5	0.81552	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.5748	0.61868	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	DOCK2	169355748	1.000000	0.71417	1.000000	0.80357	0.227000	0.25037	5.843000	0.69424	2.093000	0.63338	0.523000	0.50628	.	DOCK2	-	-	ENSG00000134516		0.502	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	HGNC	protein_coding	OTTHUMT00000252828.2	-	0.00	74	0	T	NM_004946	Intron	169423170	+1	tier1	-	no_errors	ENST00000256935	ensembl	human	known	74_37	splice_site	22.39	52	15	SNP	1.000	C
DPF3	8110	genome.wustl.edu	37	14	73086616	73086616	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr14:73086616G>A	ENST00000556509.1	-	10	1060	c.1061C>T	c.(1060-1062)cCa>cTa	p.P354L		NM_001280542.1	NP_001267471.1	Q92784	DPF3_HUMAN	D4, zinc and double PHD fingers, family 3	354					chromatin modification (GO:0016568)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)	zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)	22				BRCA - Breast invasive adenocarcinoma(234;0.00649)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		ATTACCTTCTGGGGGCTCAGC	0.468																																																	0																																										SO:0001583	missense	0			U43919	CCDS45133.1, CCDS61495.1, CCDS61496.1, CCDS61497.1	14q24.2	2014-05-13			ENSG00000205683	ENSG00000205683		"""Zinc fingers, PHD-type"""	17427	protein-coding gene	gene with protein product		601672				11845289, 8812431	Standard	NM_012074		Approved	cer-d4, Cerd4, FLJ14079, BAF45c	uc010ari.1	Q92784		ENST00000556509.1:c.1061C>T	14.37:g.73086616G>A	ENSP00000450518:p.Pro354Leu		A8MSI3|B7Z276|F5H575|Q32UJ0|Q6P9E6|Q6ZT41|Q9H7Y5	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_C2H2-like,smart_Znf_PHD,pfscan_Znf_PHD-finger,pfscan_Znf_C2H2	p.P354L	ENST00000556509.1	37	c.1061		14	.	.	.	.	.	.	.	.	.	.	G	32	5.128177	0.94473	.	.	ENSG00000205683	ENST00000556509;ENST00000398816	D	0.89552	-2.53	5.46	5.46	0.80206	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	.	.	.	.	D	0.95076	0.8405	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95135	0.8258	8	0.87932	D	0	.	19.5125	0.95148	0.0:0.0:1.0:0.0	.	354	Q92784	DPF3_HUMAN	L	354;353	ENSP00000450518:P354L	ENSP00000381797:P353L	P	-	2	0	DPF3	72156369	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	9.657000	0.98554	2.840000	0.97914	0.655000	0.94253	CCA	DPF3	-	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	ENSG00000205683		0.468	DPF3-004	NOVEL	basic|appris_principal|exp_conf	protein_coding	DPF3	HGNC	protein_coding	OTTHUMT00000413152.2	-	0.00	79	0	G			73086616	-1	tier1	-	no_errors	ENST00000556509	ensembl	human	novel	74_37	missense	24.53	40	13	SNP	1.000	A
DSEL	92126	genome.wustl.edu	37	18	65179113	65179113	+	Missense_Mutation	SNP	G	G	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr18:65179113G>C	ENST00000310045.7	-	2	4236	c.2763C>G	c.(2761-2763)atC>atG	p.I921M	CTD-2541J13.2_ENST00000581951.1_RNA|CTD-2541J13.2_ENST00000583493.1_RNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	911					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)			NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				GCCCACTGCGGATATCTGACA	0.433																																																	0													77.0	78.0	77.0					18																	65179113		2203	4300	6503	SO:0001583	missense	0			AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.2763C>G	18.37:g.65179113G>C	ENSP00000310565:p.Ile921Met		Q17RH1|Q6P5Z3	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase,superfamily_Chondroitin_lyas	p.I921M	ENST00000310045.7	37	c.2763	CCDS11995.1	18	.	.	.	.	.	.	.	.	.	.	G	12.52	1.963301	0.34659	.	.	ENSG00000171451	ENST00000310045;ENST00000397964	T	0.18502	2.21	5.13	1.03	0.20045	Sulfotransferase domain (1);	0.669254	0.14811	N	0.297073	T	0.14399	0.0348	L	0.36672	1.1	0.24364	N	0.994862	B	0.27192	0.171	B	0.35655	0.207	T	0.27297	-1.0078	10	0.51188	T	0.08	-6.3724	5.8573	0.18727	0.4154:0.1333:0.4513:0.0	.	911	Q8IZU8	DSEL_HUMAN	M	921;911	ENSP00000310565:I921M	ENSP00000310565:I921M	I	-	3	3	DSEL	63330093	0.996000	0.38824	0.235000	0.24058	0.950000	0.60333	0.434000	0.21494	0.571000	0.29365	-0.253000	0.11424	ATC	DSEL	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	ENSG00000171451		0.433	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSEL	HGNC	protein_coding	OTTHUMT00000256221.1	-	0.00	68	0	G	NM_032160		65179113	-1	tier1	-	no_errors	ENST00000310045	ensembl	human	known	74_37	missense	53.19	22	25	SNP	0.719	C
DYNC2H1	79659	genome.wustl.edu	37	11	103022954	103022954	+	Silent	SNP	A	A	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr11:103022954A>G	ENST00000375735.2	+	21	3180	c.3036A>G	c.(3034-3036)aaA>aaG	p.K1012K	DYNC2H1_ENST00000398093.3_Silent_p.K1012K|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	1012	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		GTAATTTGAAAGCCAAGTGGG	0.313																																																	0													62.0	66.0	65.0					11																	103022954		1797	4069	5866	SO:0001819	synonymous_variant	0			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.3036A>G	11.37:g.103022954A>G			O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.K1012	ENST00000375735.2	37	c.3036	CCDS53701.1	11																																																																																			DYNC2H1	-	NULL	ENSG00000187240		0.313	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC2H1	HGNC	protein_coding	OTTHUMT00000387196.1	-	0.00	419	0	A	XM_370652		103022954	+1	tier1	-	no_errors	ENST00000398093	ensembl	human	known	74_37	silent	26.98	203	75	SNP	1.000	G
ELAVL2	1993	genome.wustl.edu	37	9	23704933	23704933	+	Missense_Mutation	SNP	A	A	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr9:23704933A>C	ENST00000397312.2	-	4	744	c.470T>G	c.(469-471)cTt>cGt	p.L157R	ELAVL2_ENST00000380110.4_Missense_Mutation_p.L186R|ELAVL2_ENST00000544538.1_Missense_Mutation_p.L157R|ELAVL2_ENST00000380117.1_Missense_Mutation_p.L157R|ELAVL2_ENST00000223951.6_Missense_Mutation_p.L157R	NM_004432.3	NP_004423.2	Q12926	ELAV2_HUMAN	ELAV like neuron-specific RNA binding protein 2	157	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				regulation of transcription, DNA-templated (GO:0006355)		mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(20)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(1;2.18e-156)|Lung(42;2.15e-28)|LUSC - Lung squamous cell carcinoma(38;1.02e-19)		CTGGTCGACAAGAATACGAGA	0.428																																																	0													155.0	142.0	146.0					9																	23704933		2203	4300	6503	SO:0001583	missense	0			BC030692	CCDS6515.1, CCDS55298.1	9p21	2013-10-03	2013-10-03		ENSG00000107105	ENSG00000107105		"""RNA binding motif (RRM) containing"""	3313	protein-coding gene	gene with protein product	"""Hu antigen B"""	601673	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2"", ""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B)"""			8812435	Standard	NM_004432		Approved	HuB, HEL-N1	uc003zpu.3	Q12926	OTTHUMG00000019700	ENST00000397312.2:c.470T>G	9.37:g.23704933A>C	ENSP00000380479:p.Leu157Arg		D3DRK3|Q13235|Q59G15|Q8NEM4|Q9H1Q8	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,prints_Hud_Sxl_RNA,tigrfam_ELAD_HUD_SF	p.L157R	ENST00000397312.2	37	c.470	CCDS6515.1	9	.	.	.	.	.	.	.	.	.	.	A	21.9	4.220274	0.79464	.	.	ENSG00000107105	ENST00000223951;ENST00000397312;ENST00000544538;ENST00000380110;ENST00000380117;ENST00000359598;ENST00000423281;ENST00000440102	T;T;T;T;T;T	0.16597	2.33;2.33;2.33;2.33;2.33;2.33	5.71	5.71	0.89125	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.42966	0.1226	M	0.71206	2.165	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.993	T	0.36261	-0.9755	10	0.87932	D	0	.	15.9885	0.80179	1.0:0.0:0.0:0.0	.	157;157	Q12926;Q12926-2	ELAV2_HUMAN;.	R	157;157;157;157;157;185;22;157	ENSP00000223951:L157R;ENSP00000380479:L157R;ENSP00000440998:L157R;ENSP00000369460:L157R;ENSP00000391757:L22R;ENSP00000412602:L157R	ENSP00000223951:L157R	L	-	2	0	ELAVL2	23694933	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.938000	0.92943	2.183000	0.69458	0.533000	0.62120	CTT	ELAVL2	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,prints_Hud_Sxl_RNA,tigrfam_ELAD_HUD_SF	ENSG00000107105		0.428	ELAVL2-201	KNOWN	basic|CCDS	protein_coding	ELAVL2	HGNC	protein_coding	OTTHUMT00000051943.2	-	0.00	97	0	A	NM_004432		23704933	-1	tier1	-	no_errors	ENST00000380117	ensembl	human	known	74_37	missense	40.91	26	18	SNP	1.000	C
ELK1	2002	genome.wustl.edu	37	X	47498709	47498709	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chrX:47498709T>C	ENST00000247161.3	-	3	338	c.239A>G	c.(238-240)aAg>aGg	p.K80R	ELK1_ENST00000592066.1_Missense_Mutation_p.K26R|ELK1_ENST00000376983.3_Missense_Mutation_p.K80R|ELK1_ENST00000343894.4_Missense_Mutation_p.K80R	NM_005229.4	NP_005220.2	P19419	ELK1_HUMAN	ELK1, member of ETS oncogene family	80					cell differentiation (GO:0030154)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|skin(2)	10						GTAGACGAACTTCTGGCCGCT	0.597																																																	0													25.0	20.0	21.0					X																	47498709		2203	4300	6503	SO:0001583	missense	0			M25269	CCDS14283.1, CCDS59165.1	Xp11.23	2010-07-20			ENSG00000126767	ENSG00000126767			3321	protein-coding gene	gene with protein product		311040				2539641	Standard	NM_001114123		Approved		uc010nhv.4	P19419	OTTHUMG00000021452	ENST00000247161.3:c.239A>G	X.37:g.47498709T>C	ENSP00000247161:p.Lys80Arg		B2R7H4|O75606|O95058|Q969X8|Q9UJM4	Missense_Mutation	SNP	pfam_Ets_dom,smart_Ets_dom,pfscan_Ets_dom,prints_Ets_dom	p.K80R	ENST00000247161.3	37	c.239	CCDS14283.1	X	.	.	.	.	.	.	.	.	.	.	T	27.0	4.787615	0.90367	.	.	ENSG00000126767	ENST00000247161;ENST00000376983;ENST00000343894	T;T;T	0.19938	2.11;2.11;2.11	5.37	5.37	0.77165	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (4);	0.000000	0.85682	D	0.000000	T	0.33411	0.0862	L	0.33485	1.01	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.03619	-1.1019	10	0.33940	T	0.23	.	12.3955	0.55382	0.0:0.0:0.0:1.0	.	80	P19419	ELK1_HUMAN	R	80	ENSP00000247161:K80R;ENSP00000366182:K80R;ENSP00000345585:K80R	ENSP00000247161:K80R	K	-	2	0	ELK1	47383653	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.125000	0.71627	1.902000	0.55061	0.486000	0.48141	AAG	ELK1	-	pfam_Ets_dom,smart_Ets_dom,pfscan_Ets_dom,prints_Ets_dom	ENSG00000126767		0.597	ELK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ELK1	HGNC	protein_coding	OTTHUMT00000056436.1	-	0.00	25	0	T	NM_005229		47498709	-1	tier1	-	no_errors	ENST00000247161	ensembl	human	known	74_37	missense	48.39	16	15	SNP	1.000	C
ENPP4	22875	genome.wustl.edu	37	6	46107601	46107601	+	Missense_Mutation	SNP	A	A	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr6:46107601A>G	ENST00000321037.4	+	2	511	c.281A>G	c.(280-282)tAt>tGt	p.Y94C		NM_014936.4	NP_055751.1	Q9Y6X5	ENPP4_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative)	94					blood coagulation (GO:0007596)|positive regulation of blood coagulation (GO:0030194)|purine ribonucleoside catabolic process (GO:0046130)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	bis(5'-adenosyl)-triphosphatase activity (GO:0047710)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	18						AATTCCATGTATGATGCAGTC	0.383																																																	0													86.0	77.0	80.0					6																	46107601		2203	4299	6502	SO:0001583	missense	0			AB020686	CCDS34468.1	6p12.3	2010-06-24	2010-06-24		ENSG00000001561	ENSG00000001561			3359	protein-coding gene	gene with protein product						11027689	Standard	NM_014936		Approved	NPP4, KIAA0879	uc003oxy.3	Q9Y6X5	OTTHUMG00000014779	ENST00000321037.4:c.281A>G	6.37:g.46107601A>G	ENSP00000318066:p.Tyr94Cys		A8K5G1|Q7L2N1	Missense_Mutation	SNP	pfam_Phosphodiest/P_Trfase,pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.Y94C	ENST00000321037.4	37	c.281	CCDS34468.1	6	.	.	.	.	.	.	.	.	.	.	A	16.57	3.160148	0.57368	.	.	ENSG00000001561	ENST00000321037;ENST00000371401	T	0.76968	-1.06	5.97	3.42	0.39159	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.162257	0.56097	D	0.000025	D	0.86585	0.5968	M	0.91872	3.25	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	D	0.88639	0.3174	10	0.72032	D	0.01	-20.376	11.2702	0.49133	0.757:0.0:0.0:0.243	.	94	Q9Y6X5	ENPP4_HUMAN	C	94	ENSP00000318066:Y94C	ENSP00000318066:Y94C	Y	+	2	0	ENPP4	46215560	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	3.140000	0.50585	1.029000	0.39812	0.533000	0.62120	TAT	ENPP4	-	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	ENSG00000001561		0.383	ENPP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP4	HGNC	protein_coding	OTTHUMT00000040777.2	-	0.00	38	0	A			46107601	+1	tier1	-	no_errors	ENST00000321037	ensembl	human	known	74_37	missense	26.47	25	9	SNP	1.000	G
RP11-43F13.1	0	genome.wustl.edu	37	5	1633017	1633017	+	RNA	SNP	C	C	T	rs374193293		TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr5:1633017C>T	ENST00000507841.1	-	0	202																											CTGTCTTTATCGACCCTATAA	0.517																																																	0																																												0																															5.37:g.1633017C>T				RNA	SNP	-	NULL	ENST00000507841.1	37	NULL		5																																																																																			RP11-43F13.1	-	-	ENSG00000188002		0.517	RP11-43F13.1-003	KNOWN	basic	processed_transcript	ENSG00000188002	Clone_based_vega_gene	pseudogene	OTTHUMT00000365919.1		0.00	52	0	C			1633017	-1			no_errors	ENST00000343123	ensembl	human	known	74_37	rna	30.00	35	15	SNP	0.016	T
RP11-782C8.2	0	genome.wustl.edu	37	1	143196764	143196764	+	lincRNA	SNP	T	T	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:143196764T>G	ENST00000412204.2	-	0	1830				RP11-782C8.1_ENST00000438000.1_lincRNA																							TTGACACATTTTGAAGATACA	0.313																																																	0																																												0																															1.37:g.143196764T>G				RNA	SNP	-	NULL	ENST00000412204.2	37	NULL		1																																																																																			RP11-782C8.2	-	-	ENSG00000232274		0.313	RP11-782C8.2-004	KNOWN	basic	lincRNA	ENSG00000232274	Clone_based_vega_gene	lincRNA	OTTHUMT00000037567.2	-	0.00	300	0	T			143196764	-1	tier1	-	no_errors	ENST00000412204	ensembl	human	known	74_37	rna	19.00	179	42	SNP	0.767	G
RP11-782C8.1	0	genome.wustl.edu	37	1	143233160	143233160	+	lincRNA	SNP	A	A	C	rs541427551		TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:143233160A>C	ENST00000438000.1	+	0	1529				RP11-782C8.5_ENST00000427309.1_lincRNA																							TAAATCAATAATAAATGTACA	0.323																																																	0																																												0																															1.37:g.143233160A>C				RNA	SNP	-	NULL	ENST00000438000.1	37	NULL		1																																																																																			RP11-782C8.1	-	-	ENSG00000230850		0.323	RP11-782C8.1-002	KNOWN	basic	lincRNA	ENSG00000230850	Clone_based_vega_gene	lincRNA	OTTHUMT00000037560.1	-	0.00	174	0	A			143233160	+1	tier1	-	no_errors	ENST00000438000	ensembl	human	known	74_37	rna	18.81	82	19	SNP	0.047	C
CR1	1378	genome.wustl.edu	37	1	207726288	207726289	+	Intron	INS	-	-	T	rs557359271	byFrequency	TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:207726288_207726289insT	ENST00000367049.4	+	19	3101				RP11-78B10.2_ENST00000439443.1_RNA|RP11-78B10.2_ENST00000597497.1_RNA|CR1_ENST00000400960.2_Intron|CR1_ENST00000367052.1_Intron|CR1_ENST00000367050.4_Intron|CR1_ENST00000367053.1_Intron|CR1_ENST00000367051.1_Intron	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)						complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						AGGCTATTGCCACCTGCTCTTA	0.441													-|-|T|insertion	866	0.172923	0.1029	0.1614	5008	,	,		18024	0.2183		0.1044	False		,,,				2504	0.2996																0																																										SO:0001627	intron_variant	0			Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.3101+92->T	1.37:g.207726288_207726289insT			Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	RNA	INS	-	NULL	ENST00000367049.4	37	NULL	CCDS44308.1	1																																																																																			RP11-78B10.2	-	-	ENSG00000236911		0.441	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000236911	Clone_based_vega_gene	protein_coding	OTTHUMT00000382527.1		0.00	14	0	-	NM_000573		207726289	-1	tier1		no_errors	ENST00000439443	ensembl	human	known	74_37	rna	28.57	10	4	INS	0.000:0.000	T
CLCA4	22802	genome.wustl.edu	37	1	87037069	87037069	+	Intron	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:87037069C>T	ENST00000370563.3	+	8	1402				CLCA4_ENST00000496322.1_Intron|RP4-651E10.4_ENST00000456587.1_RNA|CLCA4_ENST00000263723.5_Intron	NM_012128.3	NP_036260.2	Q14CN2	CLCA4_HUMAN	chloride channel accessory 4						chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44		Lung NSC(277;0.238)		all cancers(265;0.0202)|Epithelial(280;0.0404)		tctctgttctcgtggcacttg	0.413																																																	0																																										SO:0001627	intron_variant	0			AF127035	CCDS41355.1	1p31-p22	2012-02-26	2009-01-29		ENSG00000016602	ENSG00000016602			2018	protein-coding gene	gene with protein product			"""chloride channel, calcium activated, family member 4"", ""chloride channel regulator 4"""			10437792	Standard	NM_012128		Approved	CaCC2	uc009wcs.3	Q14CN2	OTTHUMG00000010260	ENST00000370563.3:c.1360+132C>T	1.37:g.87037069C>T			A8MQC9|B7Z1Q5|Q6UX81|Q9UNF7	RNA	SNP	-	NULL	ENST00000370563.3	37	NULL	CCDS41355.1	1																																																																																			RP4-651E10.4	-	-	ENSG00000236915		0.413	CLCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000236915	Clone_based_vega_gene	protein_coding	OTTHUMT00000028292.1	-	0.00	11	0	C	NM_012128		87037069	-1	tier1	-	no_errors	ENST00000456587	ensembl	human	known	74_37	rna	33.33	12	6	SNP	0.000	T
RP11-483E23.2	0	genome.wustl.edu	37	15	28599818	28599818	+	RNA	SNP	G	G	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr15:28599818G>T	ENST00000568624.1	-	0	493																											CAGATCCCTGGCCTCTCCTGG	0.537																																																	0																																												0																															15.37:g.28599818G>T				RNA	SNP	-	NULL	ENST00000568624.1	37	NULL		15	.	.	.	.	.	.	.	.	.	.	.	3.789	-0.044048	0.07452	.	.	ENSG00000237850	ENST00000454724;ENST00000424531	.	.	.	.	.	.	.	.	.	.	.	T	0.46833	0.1413	.	.	.	.	.	.	P	0.51351	0.944	P	0.50659	0.647	T	0.55186	-0.8180	4	0.39692	T	0.17	.	.	.	.	.	142	B4DY83	.	D	148;146	.	ENSP00000393266:A146D	A	-	2	0	AC091304.2	26273413	1.000000	0.71417	0.120000	0.21714	0.122000	0.20287	3.613000	0.54152	0.159000	0.19401	0.162000	0.16502	GCC	RP11-483E23.2	-	-	ENSG00000237850		0.537	RP11-483E23.2-002	KNOWN	basic	processed_transcript	ENSG00000237850	Clone_based_vega_gene	pseudogene	OTTHUMT00000431212.1	-	0.00	141	0	G			28599818	-1	tier1	-	no_errors	ENST00000568624	ensembl	human	known	74_37	rna	18.48	75	17	SNP	0.995	T
RP11-652G5.1	0	genome.wustl.edu	37	16	32616964	32616964	+	RNA	SNP	A	A	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr16:32616964A>C	ENST00000562976.1	+	0	312																											CAGGTGGACAAAGCCACAGAG	0.418																																																	0																																												0																															16.37:g.32616964A>C				RNA	SNP	-	NULL	ENST00000562976.1	37	NULL		16																																																																																			RP11-652G5.1	-	-	ENSG00000259966		0.418	RP11-652G5.1-002	KNOWN	basic	processed_transcript	ENSG00000259966	Clone_based_vega_gene	pseudogene	OTTHUMT00000432347.1	-	0.00	213	0	A			32616964	+1	tier1	-	no_errors	ENST00000562976	ensembl	human	known	74_37	rna	7.94	116	10	SNP	0.000	C
AC015849.16	0	genome.wustl.edu	37	17	34237145	34237145	+	lincRNA	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr17:34237145G>A	ENST00000587132.1	-	0	882																											GCCTCCTGCTGGTTTGGAGAA	0.552																																																	0																																												0																															17.37:g.34237145G>A				RNA	SNP	-	NULL	ENST00000587132.1	37	NULL		17																																																																																			AC015849.16	-	-	ENSG00000266999		0.552	AC015849.16-001	KNOWN	basic	lincRNA	ENSG00000266999	Clone_based_vega_gene	lincRNA	OTTHUMT00000449325.1	-	0.00	25	0	G			34237145	-1	tier1	-	no_errors	ENST00000587132	ensembl	human	known	74_37	rna	33.33	8	4	SNP	0.000	A
MLLT1	4298	genome.wustl.edu	37	19	6210417	6210418	+	IGR	INS	-	-	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr19:6210417_6210418insT	ENST00000252674.7	-	0	1931				CTC-503J8.6_ENST00000586154.1_lincRNA|MLLT1_ENST00000585588.1_5'Flank	NM_005934.3	NP_005925.2	Q03111	ENL_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1						negative regulation of protein kinase activity (GO:0006469)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)			endometrium(3)|kidney(3)|large_intestine(2)|lung(5)|prostate(2)|skin(2)	17						CTTTATTTCACTTTTTTTTTCT	0.446			T	MLL	AL																																			Dom	yes		19	19p13.3	4298	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1 (ENL)"""		L	0																																										SO:0001628	intergenic_variant	0				CCDS12160.1	19p13.3	2012-10-04	2001-11-28		ENSG00000130382	ENSG00000130382			7134	protein-coding gene	gene with protein product		159556	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 1"""				Standard	XM_005259561		Approved	ENL, LTG19, YEATS1	uc002mek.3	Q03111	OTTHUMG00000180757		19.37:g.6210426_6210426dupT			Q14768	RNA	INS	-	NULL	ENST00000252674.7	37	NULL	CCDS12160.1	19																																																																																			CTC-503J8.6	-	-	ENSG00000267427		0.446	MLLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000267427	Clone_based_vega_gene	protein_coding	OTTHUMT00000452909.1		0.00	59	0	-	NM_005934		6210418	-1	tier1		no_errors	ENST00000586154	ensembl	human	known	74_37	rna	12.73	48	7	INS	0.998:0.999	T
USP9X	8239	genome.wustl.edu	37	X	41093299	41093300	+	3'UTR	DEL	TT	TT	-			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	TT	TT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chrX:41093299_41093300delTT	ENST00000324545.8	+	0	9868_9869				RP5-1172N10.4_ENST00000602481.1_RNA	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked						axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						ttttttgtcctttttttttttt	0.292																																					Ovarian(172;1807 2695 35459 49286)												0																																										SO:0001624	3_prime_UTR_variant	0			X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.*1523TT>-	X.37:g.41093309_41093310delTT			O75550|Q8WWT3|Q8WX12	RNA	DEL	-	NULL	ENST00000324545.8	37	NULL	CCDS43930.1	X																																																																																			RP5-1172N10.4	-	-	ENSG00000269941		0.292	USP9X-003	KNOWN	basic|CCDS	protein_coding	ENSG00000269941	Clone_based_vega_gene	protein_coding	OTTHUMT00000056250.4		0.00	18	0	TT	NM_004652		41093300	+1	tier1		no_errors	ENST00000602481	ensembl	human	known	74_37	rna	8.00	23	2	DEL	0.000:0.000	-
LOC102723968	102723968	genome.wustl.edu	37	13	64411607	64411607	+	lincRNA	SNP	G	G	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr13:64411607G>T	ENST00000607822.1	-	0	2159				RP11-394A14.4_ENST00000606894.1_lincRNA																							GGAACTGAGAGCCAGCCCCTC	0.567																																																	0																																												0																															13.37:g.64411607G>T				RNA	SNP	-	NULL	ENST00000607822.1	37	NULL		13																																																																																			RP11-394A14.4	-	-	ENSG00000272299		0.567	RP11-394A14.2-002	KNOWN	basic	lincRNA	ENSG00000272299	Clone_based_vega_gene	lincRNA	OTTHUMT00000471084.1	-	0.00	14	0	G			64411607	-1	tier1	-	no_errors	ENST00000606894	ensembl	human	known	74_37	rna	45.45	6	5	SNP	0.117	T
EPB41L3	23136	genome.wustl.edu	37	18	5489096	5489096	+	Silent	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr18:5489096C>T	ENST00000341928.2	-	2	427	c.87G>A	c.(85-87)gcG>gcA	p.A29A	EPB41L3_ENST00000342933.3_Silent_p.A29A|EPB41L3_ENST00000400111.3_Silent_p.A29A|EPB41L3_ENST00000540638.2_Silent_p.A29A|EPB41L3_ENST00000544123.1_Silent_p.A29A	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	29					apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						cgggcgcccccgcgcgcccct	0.716																																																	0													13.0	16.0	15.0					18																	5489096		2118	4126	6244	SO:0001819	synonymous_variant	0			AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.87G>A	18.37:g.5489096C>T			B7Z4I5|F5GX05|O95713|Q9BRP5	Silent	SNP	pirsf_Band_41_protein,pfam_Band_4.1_C,pfam_SAB_dom,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.A29	ENST00000341928.2	37	c.87	CCDS11838.1	18																																																																																			EPB41L3	-	pirsf_Band_41_protein	ENSG00000082397		0.716	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPB41L3	HGNC	protein_coding	OTTHUMT00000254424.1	-	0.00	20	0	C	NM_012307		5489096	-1	tier1	-	no_errors	ENST00000341928	ensembl	human	known	74_37	silent	33.33	8	4	SNP	0.010	T
ERVMER61-1	339476	genome.wustl.edu	37	1	187610583	187610583	+	lincRNA	SNP	C	C	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:187610583C>G	ENST00000429725.1	+	0	120									endogenous retrovirus group MER61, member 1																		acatttttgacgtgcaacttg	0.453																																																	0													70.0	79.0	76.0					1																	187610583		692	1591	2283			0			BC040856		1q31.1	2013-10-11	2011-05-05	2011-05-05	ENSG00000230426	ENSG00000230426			27919	other	endogenous retrovirus			"""chromosome 1 open reading frame 99"""	C1orf99		21542922	Standard			Approved				OTTHUMG00000035624		1.37:g.187610583C>G				RNA	SNP	-	NULL	ENST00000429725.1	37	NULL		1																																																																																			ERVMER61-1	-	-	ENSG00000230426		0.453	ERVMER61-1-001	KNOWN	basic	lincRNA	ERVMER61-1	HGNC	lincRNA	OTTHUMT00000086446.2	-	0.00	71	0	C	NM_001012274		187610583	+1	tier1	-	no_errors	ENST00000429725	ensembl	human	known	74_37	rna	25.00	51	17	SNP	0.059	G
EVC2	132884	genome.wustl.edu	37	4	5642461	5642461	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr4:5642461C>A	ENST00000344408.5	-	10	1303	c.1250G>T	c.(1249-1251)aGt>aTt	p.S417I	EVC2_ENST00000310917.2_Missense_Mutation_p.S337I|EVC2_ENST00000344938.1_Missense_Mutation_p.S417I	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	417					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						gaggtggccactgctggtgag	0.453																																																	0													101.0	100.0	101.0					4																	5642461		2203	4300	6503	SO:0001583	missense	0			AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.1250G>T	4.37:g.5642461C>A	ENSP00000342144:p.Ser417Ile		Q86YT3|Q86YT4|Q8NG49	Missense_Mutation	SNP	pfam_Limbin	p.S417I	ENST00000344408.5	37	c.1250	CCDS3382.2	4	.	.	.	.	.	.	.	.	.	.	C	6.822	0.520788	0.13005	.	.	ENSG00000173040	ENST00000344938;ENST00000310917;ENST00000344408	T;T;T	0.78364	-1.17;-1.17;-1.17	4.25	1.51	0.23008	.	0.537818	0.19199	N	0.120234	T	0.75968	0.3922	L	0.56769	1.78	0.09310	N	1	D	0.54397	0.966	P	0.52109	0.69	T	0.64888	-0.6301	10	0.40728	T	0.16	3.2052	5.2606	0.15571	0.0:0.4799:0.2742:0.246	.	417	Q86UK5	LBN_HUMAN	I	417;337;417	ENSP00000339954:S417I;ENSP00000311683:S337I;ENSP00000342144:S417I	ENSP00000311683:S337I	S	-	2	0	EVC2	5693362	0.000000	0.05858	0.004000	0.12327	0.049000	0.14656	-0.097000	0.11042	0.041000	0.15688	-0.948000	0.02665	AGT	EVC2	-	pfam_Limbin	ENSG00000173040		0.453	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EVC2	HGNC	protein_coding	OTTHUMT00000289822.2	-	0.00	31	0	C	NM_147127		5642461	-1	tier1	-	no_errors	ENST00000344408	ensembl	human	known	74_37	missense	29.17	17	7	SNP	0.001	A
FAM120C	54954	genome.wustl.edu	37	X	54161520	54161520	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chrX:54161520C>T	ENST00000375180.2	-	7	1416	c.1360G>A	c.(1360-1362)Gtg>Atg	p.V454M	FAM120C_ENST00000328235.4_Missense_Mutation_p.V454M	NM_017848.4	NP_060318.3	Q9NX05	F120C_HUMAN	family with sequence similarity 120C	454							poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						GGATATTTCACTTTCTGGGGC	0.448																																																	0													79.0	74.0	76.0					X																	54161520		2203	4300	6503	SO:0001583	missense	0			AY150025	CCDS14356.1, CCDS55421.1, CCDS75987.1	Xp11.22	2011-04-13	2006-07-04	2006-07-04	ENSG00000184083	ENSG00000184083			16949	protein-coding gene	gene with protein product		300741	"""chromosome X open reading frame 17"""	CXorf17		14585507	Standard	XM_006724589		Approved	ORF34, FLJ20506	uc004dsz.4	Q9NX05	OTTHUMG00000021625	ENST00000375180.2:c.1360G>A	X.37:g.54161520C>T	ENSP00000364324:p.Val454Met		B2RMT7	Missense_Mutation	SNP	NULL	p.V454M	ENST00000375180.2	37	c.1360	CCDS14356.1	X	.	.	.	.	.	.	.	.	.	.	C	5.638	0.302429	0.10678	.	.	ENSG00000184083	ENST00000375180;ENST00000328235	T;T	0.42131	0.98;0.98	5.2	4.05	0.47172	.	0.382779	0.33834	N	0.004506	T	0.21761	0.0524	N	0.08118	0	0.80722	D	1	B;B	0.19583	0.037;0.001	B;B	0.12837	0.008;0.005	T	0.04065	-1.0980	10	0.45353	T	0.12	-5.7256	8.1874	0.31348	0.0:0.1014:0.0:0.8986	.	454;454	F8W881;Q9NX05	.;F120C_HUMAN	M	454	ENSP00000364324:V454M;ENSP00000329896:V454M	ENSP00000329896:V454M	V	-	1	0	FAM120C	54178245	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.074000	0.30703	0.865000	0.35603	-0.340000	0.08031	GTG	FAM120C	-	NULL	ENSG00000184083		0.448	FAM120C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM120C	HGNC	protein_coding	OTTHUMT00000056795.2	-	0.00	41	0	C	NM_017848		54161520	-1	tier1	-	no_errors	ENST00000375180	ensembl	human	known	74_37	missense	47.22	19	17	SNP	1.000	T
FAM13C	220965	genome.wustl.edu	37	10	61122452	61122452	+	5'Flank	SNP	G	G	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr10:61122452G>C	ENST00000373868.2	-	0	0				FAM13C_ENST00000468840.2_5'UTR|FAM13C_ENST00000373867.3_5'Flank|FAM13C_ENST00000442566.3_5'Flank|FAM13C_ENST00000435852.2_5'Flank|FAM13C_ENST00000277705.6_5'Flank|FAM13C_ENST00000419214.2_5'Flank|FAM13C_ENST00000422313.2_5'Flank	NM_198215.3	NP_937858.2	Q8NE31	FA13C_HUMAN	family with sequence similarity 13, member C											NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						gcggggcgcggcggcggggcT	0.721																																																	0																																										SO:0001631	upstream_gene_variant	0			U79304	CCDS31207.1, CCDS44406.1, CCDS7255.1, CCDS53538.1	10q21	2009-09-15	2009-01-20	2009-01-20	ENSG00000148541	ENSG00000148541			19371	protein-coding gene	gene with protein product			"""family with sequence similarity 13, member C1"""	FAM13C1			Standard	NM_001001971		Approved		uc001jkn.3	Q8NE31	OTTHUMG00000018277		10.37:g.61122452G>C	Exception_encountered		B7ZB77|Q5T631|Q6P2M3|Q99787	RNA	SNP	-	NULL	ENST00000373868.2	37	NULL	CCDS7255.1	10																																																																																			FAM13C	-	-	ENSG00000148541		0.721	FAM13C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM13C	HGNC	protein_coding	OTTHUMT00000048162.2	-	0.00	8	0	G			61122452	-1	tier1	-	no_errors	ENST00000470220	ensembl	human	known	74_37	rna	21.05	15	4	SNP	0.893	C
FAM196A	642938	genome.wustl.edu	37	10	128974405	128974405	+	Silent	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr10:128974405G>A	ENST00000522781.1	-	4	810	c.255C>T	c.(253-255)cgC>cgT	p.R85R	DOCK1_ENST00000280333.6_Intron|FAM196A_ENST00000424811.2_Silent_p.R85R	NM_001039762.2	NP_001034851.1	Q6ZSG2	F196A_HUMAN	family with sequence similarity 196, member A	85										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						TCATGTATTTGCGGTAGGCTG	0.617																																																	0													123.0	105.0	111.0					10																	128974405		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS31312.1	10q26.2	2009-09-11	2009-09-11	2009-09-11		ENSG00000188916			33859	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 141"""	C10orf141			Standard	NM_001039762		Approved	FLJ45557	uc001ljv.1	Q6ZSG2		ENST00000522781.1:c.255C>T	10.37:g.128974405G>A			B2RNT4|B7ZME7	Silent	SNP	NULL	p.R85	ENST00000522781.1	37	c.255	CCDS31312.1	10																																																																																			FAM196A	-	NULL	ENSG00000188916		0.617	FAM196A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM196A	HGNC	protein_coding	OTTHUMT00000050978.2	-	0.00	73	0	G	NM_001039762		128974405	-1	tier1	-	no_errors	ENST00000522781	ensembl	human	known	74_37	silent	13.56	51	8	SNP	0.998	A
FAM230C	26080	genome.wustl.edu	37	22	21663380	21663380	+	lincRNA	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr22:21663380G>A	ENST00000436681.1	-	0	790																											CCTCCTTGGCGATGCCCTGGG	0.736																																																	0																																												0																															22.37:g.21663380G>A				RNA	SNP	-	NULL	ENST00000436681.1	37	NULL		22																																																																																			KB-1183D5.13	-	-	ENSG00000206142		0.736	KB-1183D5.13-003	KNOWN	basic	lincRNA	FAM230C	Clone_based_vega_gene	lincRNA	OTTHUMT00000320109.1	-	0.00	54	0	G			21663380	-1	tier1	-	no_errors	ENST00000436681	ensembl	human	known	74_37	rna	33.33	18	9	SNP	0.975	A
FAM26D	221301	genome.wustl.edu	37	6	116875029	116875029	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr6:116875029G>A	ENST00000368596.3	+	1	117	c.73G>A	c.(73-75)Gcc>Acc	p.A25T	FAM26D_ENST00000405399.1_Intron|FAM26D_ENST00000368597.2_Intron|FAM26D_ENST00000416171.2_Intron			Q5JW98	FA26D_HUMAN	family with sequence similarity 26, member D	25					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				endometrium(1)|lung(5)	6		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0258)|all cancers(137;0.0458)|OV - Ovarian serous cystadenocarcinoma(136;0.0694)|Epithelial(106;0.222)		TTTAATTGCAGCCTTGACTAT	0.383																																																	0																																										SO:0001583	missense	0			AK056801	CCDS5109.1, CCDS59032.1	6q22.31	2008-02-05	2007-03-19	2007-03-19	ENSG00000164451	ENSG00000164451			21094	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 78"""	C6orf78			Standard	NM_153036		Approved	FLJ32239	uc010ked.4	Q5JW98	OTTHUMG00000015443	ENST00000368596.3:c.73G>A	6.37:g.116875029G>A	ENSP00000357585:p.Ala25Thr		B0QZ25|B0QZ27|B4DTQ0|Q96MK0	Missense_Mutation	SNP	NULL	p.A25T	ENST00000368596.3	37	c.73		6	.	.	.	.	.	.	.	.	.	.	G	10.82	1.459635	0.26248	.	.	ENSG00000164451	ENST00000368596	T	0.17854	2.25	5.91	1.94	0.25998	.	0.623406	0.15089	N	0.281161	T	0.07188	0.0182	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.24657	-1.0154	7	0.66056	D	0.02	-14.53	4.3095	0.10964	0.3741:0.0:0.4729:0.153	.	.	.	.	T	25	ENSP00000357585:A25T	ENSP00000357585:A25T	A	+	1	0	FAM26D	116981722	0.010000	0.17322	0.080000	0.20451	0.397000	0.30659	1.117000	0.31234	0.819000	0.34492	0.655000	0.94253	GCC	FAM26D	-	NULL	ENSG00000164451		0.383	FAM26D-002	KNOWN	basic|appris_principal	protein_coding	FAM26D	HGNC	protein_coding	OTTHUMT00000041958.1	-	0.00	50	0	G	NM_153036		116875029	+1	tier1	-	no_errors	ENST00000368596	ensembl	human	known	74_37	missense	63.33	11	19	SNP	0.000	A
FAM50A	9130	genome.wustl.edu	37	X	153677073	153677073	+	Missense_Mutation	SNP	G	G	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chrX:153677073G>C	ENST00000393600.3	+	6	665	c.555G>C	c.(553-555)caG>caC	p.Q185H		NM_004699.3	NP_004690.1	Q14320	FA50A_HUMAN	family with sequence similarity 50, member A	185					spermatogenesis (GO:0007283)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|lung(9)|ovary(2)|skin(1)	15	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AGCTGCGGCAGGAGTGGGAAG	0.642																																																	0													61.0	66.0	64.0					X																	153677073		2203	4300	6503	SO:0001583	missense	0			BC000028	CCDS14751.1	Xq28	2008-02-05			ENSG00000071859	ENSG00000071859			18786	protein-coding gene	gene with protein product	"""DNA segment on chromosome X (unique) 9928 expressed sequence"""	300453				9339379, 9039504	Standard	NM_004699		Approved	DXS9928E, XAP5, HXC-26, 9F	uc004fll.4	Q14320	OTTHUMG00000033292	ENST00000393600.3:c.555G>C	X.37:g.153677073G>C	ENSP00000377225:p.Gln185His		A8KAQ4|B2R997|Q5HY37|Q6PJH5	Missense_Mutation	SNP	pfam_XAP5	p.Q185H	ENST00000393600.3	37	c.555	CCDS14751.1	X	.	.	.	.	.	.	.	.	.	.	G	20.1	3.934927	0.73442	.	.	ENSG00000071859	ENST00000393600;ENST00000158526	.	.	.	5.32	1.39	0.22231	.	0.054736	0.85682	D	0.000000	T	0.71143	0.3305	M	0.86502	2.82	0.49915	D	0.999836	D	0.60160	0.987	P	0.62298	0.9	T	0.68957	-0.5272	9	0.72032	D	0.01	-47.9025	5.9384	0.19179	0.2349:0.0:0.6321:0.1329	.	185	Q14320	FA50A_HUMAN	H	185;145	.	ENSP00000158526:Q145H	Q	+	3	2	FAM50A	153330267	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	3.460000	0.53028	0.106000	0.17784	0.600000	0.82982	CAG	FAM50A	-	pfam_XAP5	ENSG00000071859		0.642	FAM50A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM50A	HGNC	protein_coding	OTTHUMT00000081643.2	-	0.00	40	0	G	NM_004699		153677073	+1	tier1	-	no_errors	ENST00000393600	ensembl	human	known	74_37	missense	61.29	12	19	SNP	1.000	C
FAM78A	286336	genome.wustl.edu	37	9	134135560	134135560	+	3'UTR	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr9:134135560C>T	ENST00000372271.3	-	0	1868				FAM78A_ENST00000372269.3_3'UTR|FAM78A_ENST00000247295.4_5'UTR	NM_033387.3	NP_203745.2	Q5JUQ0	FA78A_HUMAN	family with sequence similarity 78, member A											NS(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	9	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.15e-05)|Epithelial(140;0.000267)		TCTCCCAAGACAACCGGGAAG	0.522																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK095423	CCDS6941.2	9q34	2008-02-05	2005-07-18	2005-07-18	ENSG00000126882	ENSG00000126882			25465	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 59"""	C9orf59		11214971	Standard	NM_033387		Approved	FLJ00024	uc004cak.3	Q5JUQ0	OTTHUMG00000020821	ENST00000372271.3:c.*649G>A	9.37:g.134135560C>T			Q86VQ9|Q9H7P4	RNA	SNP	-	NULL	ENST00000372271.3	37	NULL	CCDS6941.2	9																																																																																			FAM78A	-	-	ENSG00000126882		0.522	FAM78A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM78A	HGNC	protein_coding	OTTHUMT00000054720.1	-	0.00	37	0	C	NM_033387		134135560	-1	tier1	-	no_errors	ENST00000247295	ensembl	human	known	74_37	rna	42.31	15	11	SNP	0.000	T
FASTK	10922	genome.wustl.edu	37	7	150776706	150776706	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr7:150776706G>A	ENST00000297532.6	-	2	463	c.386C>T	c.(385-387)cCa>cTa	p.P129L	FASTK_ENST00000540185.1_Missense_Mutation_p.P95L|FASTK_ENST00000489884.1_Intron|FASTK_ENST00000482571.1_Missense_Mutation_p.P129L|FASTK_ENST00000353841.2_Intron	NM_006712.4	NP_006703.1	Q14296	FASTK_HUMAN	Fas-activated serine/threonine kinase	129					apoptotic signaling pathway (GO:0097190)|protein phosphorylation (GO:0006468)|regulation of RNA splicing (GO:0043484)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|Fas-activated serine/threonine kinase activity (GO:0033867)|protein serine/threonine kinase activity (GO:0004674)			lung(4)|stomach(2)	6			OV - Ovarian serous cystadenocarcinoma(82;0.00989)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)|LUSC - Lung squamous cell carcinoma(290;0.0718)|Lung(243;0.138)		AGGGGGCCGTGGCCGAGACCC	0.642																																																	0													47.0	45.0	45.0					7																	150776706		2203	4299	6502	SO:0001583	missense	0				CCDS5918.1, CCDS5919.1, CCDS59088.1	7q35	2006-07-06			ENSG00000164896	ENSG00000164896			24676	protein-coding gene	gene with protein product		606965				7544399, 15572676	Standard	NM_006712		Approved	FAST	uc003wix.2	Q14296	OTTHUMG00000158694	ENST00000297532.6:c.386C>T	7.37:g.150776706G>A	ENSP00000297532:p.Pro129Leu		A8K867|F8VTW9|Q59EM8|Q8IVA0	Missense_Mutation	SNP	pfam_FAST_2,pfam_FAST_Leu-rich,pfam_RAP,smart_RAP	p.P129L	ENST00000297532.6	37	c.386	CCDS5918.1	7	.	.	.	.	.	.	.	.	.	.	G	14.28	2.486959	0.44249	.	.	ENSG00000164896	ENST00000483105;ENST00000297530;ENST00000297532;ENST00000482571;ENST00000540185	T;T;T	0.42900	0.96;0.96;0.96	3.96	3.96	0.45880	.	0.313340	0.20788	N	0.085662	T	0.50222	0.1603	L	0.27053	0.805	0.47737	D	0.999509	D;D;D	0.89917	1.0;0.999;0.997	D;D;P	0.91635	0.999;0.958;0.831	T	0.50972	-0.8764	10	0.52906	T	0.07	-22.4417	13.8606	0.63557	0.0:0.0:1.0:0.0	.	95;129;129	G3V1R6;F8VTW9;Q14296	.;.;FASTK_HUMAN	L	129;129;129;129;95	ENSP00000297532:P129L;ENSP00000418516:P129L;ENSP00000444498:P95L	ENSP00000297530:P129L	P	-	2	0	FASTK	150407639	0.887000	0.30362	0.127000	0.21898	0.988000	0.76386	1.203000	0.32284	2.484000	0.83849	0.655000	0.94253	CCA	FASTK	-	NULL	ENSG00000164896		0.642	FASTK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	FASTK	HGNC	protein_coding	OTTHUMT00000351832.2	-	0.00	44	0	G	NM_006712		150776706	-1	tier1	-	no_errors	ENST00000297532	ensembl	human	known	74_37	missense	41.67	14	10	SNP	0.744	A
FAT3	120114	genome.wustl.edu	37	11	92613954	92613954	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr11:92613954C>T	ENST00000298047.6	+	22	12202	c.12185C>T	c.(12184-12186)aCa>aTa	p.T4062I	FAT3_ENST00000525166.1_Missense_Mutation_p.T3912I|FAT3_ENST00000409404.2_Missense_Mutation_p.T4062I|FAT3_ENST00000533797.1_Missense_Mutation_p.T397I			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	4062	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TCTGAGATTACAGCCTGCTTC	0.502										TCGA Ovarian(4;0.039)																																							0													183.0	187.0	186.0					11																	92613954		1938	4130	6068	SO:0001583	missense	0			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.12185C>T	11.37:g.92613954C>T	ENSP00000298047:p.Thr4062Ile		B5MDB0|Q96AU6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.T4062I	ENST00000298047.6	37	c.12185		11	.	.	.	.	.	.	.	.	.	.	C	32	5.117803	0.94385	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166;ENST00000533797	D;D;D;D	0.98437	-4.93;-4.93;-4.93;-4.93	6.16	6.16	0.99307	Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.98595	0.9530	L	0.56124	1.755	0.80722	D	1	D;P	0.76494	0.999;0.928	D;P	0.67382	0.951;0.65	D	0.99429	1.0935	9	0.72032	D	0.01	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	4062;4062	Q8TDW7-3;Q8TDW7	.;FAT3_HUMAN	I	4062;4062;3912;397	ENSP00000298047:T4062I;ENSP00000387040:T4062I;ENSP00000432586:T3912I;ENSP00000436399:T397I	ENSP00000298047:T4062I	T	+	2	0	FAT3	92253602	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.815000	0.48018	2.937000	0.99478	0.650000	0.86243	ACA	FAT3	-	smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	ENSG00000165323		0.502	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding			0.00	65	0	C	NM_001008781		92613954	+1			no_errors	ENST00000298047	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	T
FBN2	2201	genome.wustl.edu	37	5	127647076	127647076	+	Nonsense_Mutation	SNP	C	C	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr5:127647076C>A	ENST00000508053.1	-	45	5964	c.4990G>T	c.(4990-4992)Gga>Tga	p.G1664*	FBN2_ENST00000262464.4_Nonsense_Mutation_p.G1664*			P35556	FBN2_HUMAN	fibrillin 2	1664	EGF-like 27; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		ATGCAGTTTCCACCCTGGCAG	0.463																																																	0													87.0	70.0	76.0					5																	127647076		2203	4300	6503	SO:0001587	stop_gained	0			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.4990G>T	5.37:g.127647076C>A	ENSP00000424571:p.Gly1664*		B4DU01|Q59ES6	Nonsense_Mutation	SNP	pirsf_FBN,pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Cadherin-like,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.G1664*	ENST00000508053.1	37	c.4990	CCDS34222.1	5	.	.	.	.	.	.	.	.	.	.	C	48	14.894327	0.99814	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	.	.	.	5.22	5.22	0.72569	.	0.000000	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.9654	0.92694	0.0:1.0:0.0:0.0	.	.	.	.	X	1664	.	ENSP00000262464:G1664X	G	-	1	0	FBN2	127674975	1.000000	0.71417	0.998000	0.56505	0.960000	0.62799	7.609000	0.82925	2.732000	0.93576	0.591000	0.81541	GGA	FBN2	-	pirsf_FBN,pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000138829		0.463	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN2	HGNC	protein_coding	OTTHUMT00000371618.2	-	0.00	106	0	C	NM_001999		127647076	-1	tier1	-	no_errors	ENST00000262464	ensembl	human	known	74_37	nonsense	29.69	45	19	SNP	1.000	A
FBXL12	54850	genome.wustl.edu	37	19	9922157	9922157	+	Missense_Mutation	SNP	G	G	T	rs151187593		TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr19:9922157G>T	ENST00000247977.4	-	3	637	c.396C>A	c.(394-396)caC>caA	p.H132Q	FBXL12_ENST00000588922.1_3'UTR|FBXL12_ENST00000585379.1_Missense_Mutation_p.H79Q|FBXL12_ENST00000592067.1_3'UTR|FBXL12_ENST00000591009.1_Missense_Mutation_p.H79Q|FBXL12_ENST00000589626.1_3'UTR|FBXL12_ENST00000586651.1_3'UTR	NM_017703.1	NP_060173.1	Q9NXK8	FXL12_HUMAN	F-box and leucine-rich repeat protein 12	132					protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|ubiquitin ligase complex (GO:0000151)				endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(2)	10						TCTCGCAGCTGTGCAGCTCCA	0.657																																																	0													65.0	70.0	68.0					19																	9922157		2203	4300	6503	SO:0001583	missense	0			AK000195	CCDS12218.1	19p13.2	2011-06-09				ENSG00000127452		"""F-boxes / Leucine-rich repeats"""	13611	protein-coding gene	gene with protein product		609079				10531037	Standard	XM_005259964		Approved	FLJ20188, Fbl12	uc002mme.3	Q9NXK8		ENST00000247977.4:c.396C>A	19.37:g.9922157G>T	ENSP00000247977:p.His132Gln		B3KSJ8|Q9H5K4	Missense_Mutation	SNP	pfam_F-box_dom,superfamily_F-box_dom,smart_F-box_dom,pfscan_F-box_dom	p.H132Q	ENST00000247977.4	37	c.396	CCDS12218.1	19	.	.	.	.	.	.	.	.	.	.	G	7.608	0.674149	0.14841	.	.	ENSG00000127452	ENST00000247977	T	0.16457	2.34	4.76	3.67	0.42095	.	0.333100	0.32041	N	0.006678	T	0.07773	0.0195	N	0.08118	0	0.80722	D	1	B	0.16603	0.018	B	0.15484	0.013	T	0.26916	-1.0089	9	.	.	.	.	10.0288	0.42087	0.0:0.2228:0.7772:0.0	.	132	Q9NXK8	FXL12_HUMAN	Q	132	ENSP00000247977:H132Q	.	H	-	3	2	FBXL12	9783157	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	0.687000	0.25407	2.474000	0.83562	0.655000	0.94253	CAC	FBXL12	-	NULL	ENSG00000127452		0.657	FBXL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL12	HGNC	protein_coding	OTTHUMT00000450265.1		0.00	82	0	G	NM_017703		9922157	-1			no_errors	ENST00000247977	ensembl	human	known	74_37	missense	5.45	52	3	SNP	1.000	T
FBXW7	55294	genome.wustl.edu	37	4	153245464	153245464	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr4:153245464G>A	ENST00000281708.4	-	11	2956	c.1727C>T	c.(1726-1728)aCg>aTg	p.T576M	FBXW7_ENST00000393956.3_Missense_Mutation_p.T400M|FBXW7_ENST00000603548.1_Missense_Mutation_p.T576M|FBXW7_ENST00000603841.1_Missense_Mutation_p.T576M|FBXW7_ENST00000296555.5_Missense_Mutation_p.T458M|FBXW7_ENST00000263981.5_Missense_Mutation_p.T496M	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	576					cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.?(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				CCCTGTTAACGTGTGAATGCA	0.408			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																			Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)											146.0	118.0	127.0					4																	153245464		2203	4300	6503	SO:0001583	missense	0			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1727C>T	4.37:g.153245464G>A	ENSP00000281708:p.Thr576Met		B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_F-box_dom,superfamily_WD40_repeat_dom,superfamily_F-box_dom,smart_F-box_dom,smart_WD40_repeat,pfscan_F-box_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.T576M	ENST00000281708.4	37	c.1727	CCDS3777.1	4	.	.	.	.	.	.	.	.	.	.	G	17.41	3.383182	0.61845	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	T;T;T;T	0.63255	-0.03;-0.03;-0.03;-0.03	5.71	5.71	0.89125	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.83399	0.5246	M	0.88241	2.94	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.75484	0.947;0.986;0.957;0.957	D	0.85700	0.1312	10	0.72032	D	0.01	-10.0142	19.8576	0.96767	0.0:0.0:1.0:0.0	.	400;576;458;496	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	M	576;458;496;400	ENSP00000281708:T576M;ENSP00000296555:T458M;ENSP00000263981:T496M;ENSP00000377528:T400M	ENSP00000263981:T496M	T	-	2	0	FBXW7	153464914	1.000000	0.71417	0.997000	0.53966	0.979000	0.70002	9.869000	0.99810	2.696000	0.92011	0.655000	0.94253	ACG	FBXW7	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000109670		0.408	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW7	HGNC	protein_coding	OTTHUMT00000469956.1	-	0.00	58	0	G			153245464	-1	tier1	rs150160525	no_errors	ENST00000281708	ensembl	human	known	74_37	missense	19.35	25	6	SNP	1.000	A
FNDC1	84624	genome.wustl.edu	37	6	159654479	159654479	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr6:159654479G>T	ENST00000297267.9	+	11	3135	c.2935G>T	c.(2935-2937)Gct>Tct	p.A979S	FNDC1_ENST00000340366.6_Missense_Mutation_p.A916S	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	979					cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		CGCGTCCCCTGCTCGTCCGCC	0.667																																																	0													33.0	40.0	38.0					6																	159654479		2192	4285	6477	SO:0001583	missense	0			AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.2935G>T	6.37:g.159654479G>T	ENSP00000297267:p.Ala979Ser		A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.A979S	ENST00000297267.9	37	c.2935	CCDS47512.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.159|5.159	0.214846|0.214846	0.09810|0.09810	.|.	.|.	ENSG00000164694|ENSG00000164694	ENST00000297267;ENST00000340366|ENST00000329629	T;T|.	0.09163|.	3.01;3.84|.	3.2|3.2	1.32|1.32	0.21799|0.21799	.|.	2.025790|.	0.01986|.	N|.	0.045164|.	T|T	0.16171|0.16171	0.0389|0.0389	L|L	0.29908|0.29908	0.895|0.895	0.09310|0.09310	N|N	1|1	B;B|.	0.25809|.	0.135;0.048|.	B;B|.	0.32211|.	0.084;0.142|.	T|T	0.28299|0.28299	-1.0048|-1.0048	10|5	0.09084|.	T|.	0.74|.	-1.3636|-1.3636	11.2961|11.2961	0.49280|0.49280	0.0:0.3513:0.6487:0.0|0.0:0.3513:0.6487:0.0	.|.	916;979|.	Q4ZHG4-2;Q4ZHG4|.	.;FNDC1_HUMAN|.	S|F	979;916|874	ENSP00000297267:A979S;ENSP00000342460:A916S|.	ENSP00000297267:A979S|.	A|C	+|+	1|2	0|0	FNDC1|FNDC1	159574469|159574469	0.001000|0.001000	0.12720|0.12720	0.000000|0.000000	0.03702|0.03702	0.011000|0.011000	0.07611|0.07611	0.635000|0.635000	0.24629|0.24629	0.038000|0.038000	0.15604|0.15604	-1.358000|-1.358000	0.01219|0.01219	GCT|TGC	FNDC1	-	NULL	ENSG00000164694		0.667	FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FNDC1	HGNC	protein_coding	OTTHUMT00000042897.3		0.00	45	0	G	NM_032532		159654479	+1			no_errors	ENST00000297267	ensembl	human	known	74_37	missense	15.00	34	6	SNP	0.000	T
FOLH1B	219595	genome.wustl.edu	37	11	89431638	89431638	+	RNA	SNP	T	T	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr11:89431638T>G	ENST00000532352.1	+	0	1920							Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B							cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(26)|ovary(4)|skin(4)|urinary_tract(2)	48						TCCCAGGAATTTATGATGCTC	0.458																																																	0													105.0	105.0	105.0					11																	89431638		2201	4296	6497			0			AF261715		11q14.3	2014-03-18			ENSG00000134612	ENSG00000134612			13636	protein-coding gene	gene with protein product	"""prostate specific membrane antigen like protein"", ""Cell growth-inhibiting gene 26 protein"", ""glutamate carboxypeptidase III"""	609020	"""folate hydrolase 2"""	FOLH2, FOLHP		9838072, 14716746	Standard	NM_153696		Approved	PSMAL, GCPIII	uc001pda.3	Q9HBA9	OTTHUMG00000167376		11.37:g.89431638T>G				RNA	SNP	-	NULL	ENST00000532352.1	37	NULL		11																																																																																			FOLH1B	-	-	ENSG00000134612		0.458	FOLH1B-004	KNOWN	basic	processed_transcript	FOLH1B	HGNC	pseudogene	OTTHUMT00000395421.1	-	0.00	103	0	T	NM_153696		89431638	+1	tier1	-	no_errors	ENST00000525540	ensembl	human	known	74_37	rna	21.05	60	16	SNP	0.998	G
GALNT14	79623	genome.wustl.edu	37	2	31189139	31189139	+	Missense_Mutation	SNP	A	A	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr2:31189139A>C	ENST00000349752.5	-	3	968	c.329T>G	c.(328-330)cTt>cGt	p.L110R	GALNT14_ENST00000324589.5_Missense_Mutation_p.L115R|GALNT14_ENST00000406653.1_Missense_Mutation_p.L90R|GALNT14_ENST00000356174.3_Intron|GALNT14_ENST00000420311.2_Missense_Mutation_p.L75R	NM_024572.3	NP_078848.2	Q96FL9	GLT14_HUMAN	polypeptide N-acetylgalactosaminyltransferase 14	110	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			cervix(1)|endometrium(3)|large_intestine(10)|liver(1)|lung(21)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)	43	Acute lymphoblastic leukemia(172;0.155)					AGTGGGTGGAAGGTCCGTGCA	0.577																																																	0													266.0	207.0	227.0					2																	31189139		2203	4300	6503	SO:0001583	missense	0			AB078144	CCDS1773.2, CCDS58705.1, CCDS58706.1	2p23.2	2014-03-13	2014-03-13		ENSG00000158089	ENSG00000158089	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	22946	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 14"""	608225	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)"""			12507512	Standard	NM_024572		Approved	GalNac-T10, FLJ12691, GalNac-T14	uc002rns.3	Q96FL9	OTTHUMG00000074077	ENST00000349752.5:c.329T>G	2.37:g.31189139A>C	ENSP00000288988:p.Leu110Arg		B3KV89|Q4ZG75|Q53SU1|Q53TJ0|Q8IVI4|Q9BRH1|Q9H827|Q9H9J8	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.L110R	ENST00000349752.5	37	c.329	CCDS1773.2	2	.	.	.	.	.	.	.	.	.	.	a	22.2	4.252075	0.80135	.	.	ENSG00000158089	ENST00000349752;ENST00000324589;ENST00000406653;ENST00000420311	T;T;T;T	0.60171	0.21;0.21;0.21;0.21	4.85	4.85	0.62838	.	0.134645	0.51477	D	0.000094	T	0.78451	0.4285	M	0.88640	2.97	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;0.999	T	0.82667	-0.0344	10	0.87932	D	0	.	12.2267	0.54463	1.0:0.0:0.0:0.0	.	75;75;115;110;90	F5H263;B7Z5C5;Q96FL9-3;Q96FL9;B3KV89	.;.;.;GLT14_HUMAN;.	R	110;115;90;75	ENSP00000288988:L110R;ENSP00000314500:L115R;ENSP00000385435:L90R;ENSP00000415514:L75R	ENSP00000314500:L115R	L	-	2	0	GALNT14	31042643	1.000000	0.71417	0.485000	0.27403	0.833000	0.47200	7.985000	0.88162	1.814000	0.52955	0.393000	0.25936	CTT	GALNT14	-	NULL	ENSG00000158089		0.577	GALNT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT14	HGNC	protein_coding	OTTHUMT00000157264.1	-	0.00	57	0	A	NM_024572		31189139	-1	tier1	-	no_errors	ENST00000349752	ensembl	human	known	74_37	missense	54.35	21	25	SNP	0.995	C
GDF1	2657	genome.wustl.edu	37	19	18980809	18980809	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr19:18980809C>T	ENST00000247005.6	-	7	1653	c.308G>A	c.(307-309)cGc>cAc	p.R103H	CERS1_ENST00000427170.2_3'UTR			P27539	GDF1_HUMAN	growth differentiation factor 1	103					growth (GO:0040007)	extracellular space (GO:0005615)											CGGGATGTGGCGCACGATGTT	0.716																																																	0													9.0	12.0	11.0					19																	18980809		2054	4192	6246	SO:0001583	missense	0			M62302	CCDS42526.1	19p13.11	2014-01-30			ENSG00000130283	ENSG00000130283		"""Endogenous ligands"""	4214	protein-coding gene	gene with protein product		602880				2034669	Standard	NM_001492		Approved			P27539		ENST00000247005.6:c.308G>A	19.37:g.18980809C>T	ENSP00000247005:p.Arg103His		O43344	Missense_Mutation	SNP	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C,prints_Inhibin_asu	p.R103H	ENST00000247005.6	37	c.308	CCDS42526.1	19	.	.	.	.	.	.	.	.	.	.	C	22.5	4.302870	0.81136	.	.	ENSG00000130283	ENST00000247005	T	0.71222	-0.55	3.29	2.11	0.27256	.	0.064544	0.64402	U	0.000005	T	0.74535	0.3729	L	0.61218	1.895	0.49130	D	0.999753	.	.	.	.	.	.	T	0.77498	-0.2565	8	0.87932	D	0	.	10.3268	0.43798	0.1971:0.8028:0.0:0.0	.	.	.	.	H	103	ENSP00000247005:R103H	ENSP00000247005:R103H	R	-	2	0	GDF1	18841809	0.991000	0.36638	0.999000	0.59377	0.888000	0.51559	1.780000	0.38634	1.558000	0.49541	0.471000	0.43371	CGC	GDF1	-	pfam_TGF-b_N	ENSG00000130283		0.716	GDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDF1	HGNC	protein_coding	OTTHUMT00000465926.1	-	0.00	23	0	C	NM_001492		18980809	-1	tier1	-	no_errors	ENST00000247005	ensembl	human	known	74_37	missense	58.33	5	7	SNP	0.949	T
GFRA3	2676	genome.wustl.edu	37	5	137593535	137593535	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr5:137593535C>T	ENST00000274721.3	-	4	824	c.578G>A	c.(577-579)cGc>cAc	p.R193H	GFRA3_ENST00000378362.3_Missense_Mutation_p.R162H	NM_001496.3	NP_001487.2	O60609	GFRA3_HUMAN	GDNF family receptor alpha 3	193					nervous system development (GO:0007399)|neuron migration (GO:0001764)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extrinsic component of membrane (GO:0019898)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|receptor binding (GO:0005102)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)	12			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			GCAGACGTGGCGCTGGCAGTG	0.662																																																	0													25.0	27.0	26.0					5																	137593535		2203	4299	6502	SO:0001583	missense	0			AY358997	CCDS4201.1	5q31.1-q31.3	2008-02-05			ENSG00000146013	ENSG00000146013			4245	protein-coding gene	gene with protein product		605710				9407096	Standard	NM_001496		Approved	GFRa-3	uc003lcn.3	O60609	OTTHUMG00000129200	ENST00000274721.3:c.578G>A	5.37:g.137593535C>T	ENSP00000274721:p.Arg193His		B2RA36|B4DMY9|Q6UW20|Q8IUZ2	Missense_Mutation	SNP	pfam_GDNF/GAS1,smart_GDNF/GAS1,prints_GDNF_rcpt,prints_GDNF_rcpt_A3	p.R193H	ENST00000274721.3	37	c.578	CCDS4201.1	5	.	.	.	.	.	.	.	.	.	.	C	16.51	3.144366	0.57044	.	.	ENSG00000146013	ENST00000274721;ENST00000378362	T;T	0.65364	-0.15;-0.15	4.81	2.88	0.33553	GDNF/GAS1 (2);	0.123300	0.53938	D	0.000045	T	0.73442	0.3587	M	0.80332	2.49	0.39815	D	0.972754	D;D	0.76494	0.997;0.999	P;P	0.61874	0.7;0.895	T	0.75243	-0.3386	10	0.62326	D	0.03	-24.387	7.4483	0.27223	0.0:0.7087:0.1858:0.1055	.	162;193	O60609-2;O60609	.;GFRA3_HUMAN	H	193;162	ENSP00000274721:R193H;ENSP00000367613:R162H	ENSP00000274721:R193H	R	-	2	0	GFRA3	137621434	0.522000	0.26266	0.919000	0.36401	0.434000	0.31775	0.204000	0.17335	1.018000	0.39521	0.655000	0.94253	CGC	GFRA3	-	pfam_GDNF/GAS1,smart_GDNF/GAS1,prints_GDNF_rcpt	ENSG00000146013		0.662	GFRA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GFRA3	HGNC	protein_coding	OTTHUMT00000251277.1	-	0.00	36	0	C	NM_001496		137593535	-1	tier1	-	no_errors	ENST00000274721	ensembl	human	known	74_37	missense	28.57	20	8	SNP	0.547	T
GGNBP2	79893	genome.wustl.edu	37	17	34937781	34937781	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr17:34937781T>C	ENST00000304718.4	+	9	1344	c.1028T>C	c.(1027-1029)gTg>gCg	p.V343A		NM_024835.3	NP_079111.1	Q9H3C7	GGNB2_HUMAN	gametogenetin binding protein 2	343					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)	38		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		TAGATGACCGTGGAAAAAGTA	0.383																																																	0													78.0	81.0	80.0					17																	34937781		2203	4300	6503	SO:0001583	missense	0			AF126964	CCDS11314.1	17q21.1	2014-05-06	2007-08-20	2007-08-20	ENSG00000005955	ENSG00000278311			19357	protein-coding gene	gene with protein product		612275	"""zinc finger protein 403"""	ZNF403		11728448	Standard	NM_024835		Approved	ZFP403, LZK1, FLJ22561, FLJ21230, DIF-3, DIF3	uc002hnb.3	Q9H3C7	OTTHUMG00000188440	ENST00000304718.4:c.1028T>C	17.37:g.34937781T>C	ENSP00000307617:p.Val343Ala		B2RPK7|Q96T90|Q9GZR8|Q9H767	Missense_Mutation	SNP	NULL	p.V343A	ENST00000304718.4	37	c.1028	CCDS11314.1	17	.	.	.	.	.	.	.	.	.	.	T	14.97	2.694828	0.48202	.	.	ENSG00000005955	ENST00000304718	.	.	.	5.48	4.41	0.53225	.	0.000000	0.85682	D	0.000000	T	0.62998	0.2474	L	0.34521	1.04	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.993	D;D;P	0.66084	0.941;0.941;0.879	T	0.64896	-0.6299	9	0.87932	D	0	-8.547	11.0374	0.47808	0.0:0.0728:0.0:0.9272	.	343;343;343	A8K3S2;Q9H3C7;Q9H3C7-3	.;GGNB2_HUMAN;.	A	343	.	ENSP00000307617:V343A	V	+	2	0	GGNBP2	32011894	1.000000	0.71417	1.000000	0.80357	0.097000	0.18754	7.284000	0.78650	0.924000	0.37069	0.402000	0.26972	GTG	GGNBP2	-	NULL	ENSG00000005955		0.383	GGNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GGNBP2	HGNC	protein_coding	OTTHUMT00000256684.2	-	0.00	86	0	T	NM_024835		34937781	+1	tier1	-	no_errors	ENST00000304718	ensembl	human	known	74_37	missense	23.64	42	13	SNP	1.000	C
GIT2	9815	genome.wustl.edu	37	12	110370786	110370788	+	In_Frame_Del	DEL	GTT	GTT	-			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	GTT	GTT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr12:110370786_110370788delGTT	ENST00000355312.3	-	20	2274_2276	c.2275_2277delAAC	c.(2275-2277)aacdel	p.N759del	GIT2_ENST00000356259.4_In_Frame_Del_p.N646del|GIT2_ENST00000360185.4_In_Frame_Del_p.N709del|GIT2_ENST00000551209.1_In_Frame_Del_p.N708del|GIT2_ENST00000361006.5_In_Frame_Del_p.N729del|GIT2_ENST00000548655.1_5'Flank|GIT2_ENST00000553118.1_In_Frame_Del_p.N631del|GIT2_ENST00000338373.5_In_Frame_Del_p.N661del|GIT2_ENST00000354574.4_In_Frame_Del_p.N681del|GIT2_ENST00000457474.2_In_Frame_Del_p.N681del|GIT2_ENST00000343646.5_In_Frame_Del_p.N649del	NM_057169.3	NP_476510.1	Q14161	GIT2_HUMAN	G protein-coupled receptor kinase interacting ArfGAP 2	759					behavioral response to pain (GO:0048266)|regulation of ARF GTPase activity (GO:0032312)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(8)|skin(4)	27						GCCCTTGTCAGTTGTTGTTCTCT	0.483																																																	0									,,,,	4,4260		2,0,2130					,,,,	4.4	1.0			143	5,8249		2,1,4124	no	coding,coding,coding,coding,coding	GIT2	NM_057170.3,NM_057169.3,NM_014776.3,NM_001135214.1,NM_001135213.1	,,,,	4,1,6254	A1A1,A1R,RR		0.0606,0.0938,0.0719	,,,,	,,,,		9,12509				SO:0001651	inframe_deletion	0			AF124491	CCDS9138.1, CCDS9139.1, CCDS44968.1, CCDS44969.1, CCDS55884.1	12q24.1	2013-01-10	2008-09-05			ENSG00000139436		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	4273	protein-coding gene	gene with protein product		608564	"""G protein-coupled receptor kinase interactor 2"""			9826657, 10896954	Standard	NM_139201		Approved	KIAA0148	uc001tps.2	Q14161	OTTHUMG00000169313	ENST00000355312.3:c.2275_2277delAAC	12.37:g.110370792_110370794delGTT	ENSP00000347464:p.Asn759del		Q86U59|Q96CI2|Q9BV91|Q9Y5V2	In_Frame_Del	DEL	pfam_GIT1_C,pfam_GIT_SHD,pfam_ArfGAP,superfamily_Ankyrin_rpt-contain_dom,smart_ArfGAP,smart_Ankyrin_rpt,smart_GIT_SHD,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_ArfGAP,prints_ArfGAP	p.N759in_frame_del	ENST00000355312.3	37	c.2277_2275	CCDS9138.1	12																																																																																			GIT2	-	NULL	ENSG00000139436		0.483	GIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIT2	HGNC	protein_coding	OTTHUMT00000403407.1		0.00	47	0	GTT	NM_057169		110370788	-1	tier1		no_errors	ENST00000355312	ensembl	human	known	74_37	in_frame_del	26.47	25	9	DEL	1.000:1.000:1.000	-
GLYATL2	219970	genome.wustl.edu	37	11	58604841	58604841	+	Silent	SNP	G	G	C	rs544614171	byFrequency	TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr11:58604841G>C	ENST00000287275.1	-	4	606	c.216C>G	c.(214-216)acC>acG	p.T72T	GLYATL2_ENST00000532258.1_Silent_p.T72T|GLYATL2_ENST00000533636.1_5'UTR	NM_145016.3	NP_659453.3	Q8WU03	GLYL2_HUMAN	glycine-N-acyltransferase-like 2	72						endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	glycine N-acyltransferase activity (GO:0047961)			breast(1)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	23		Breast(21;0.0044)|all_epithelial(135;0.0216)			Glycine(DB00145)	GGTAAGTGTTGGTATAATGAT	0.373																																																	0													206.0	192.0	196.0					11																	58604841		1859	4105	5964	SO:0001819	synonymous_variant	0			AF426250	CCDS41649.1	11q12.1	2008-02-05				ENSG00000156689			24178	protein-coding gene	gene with protein product		614762				12477932	Standard	NM_145016		Approved	BXMAS2-10, MGC24009	uc001nnd.4	Q8WU03		ENST00000287275.1:c.216C>G	11.37:g.58604841G>C			A5LGC7|Q86WC3|Q96AT2	Silent	SNP	pfam_Glycine_N-acyltransferase_N,pfam_Glycine_N-acyltransferase_C,pfam_FR47,superfamily_Acyl_CoA_acyltransferase	p.T72	ENST00000287275.1	37	c.216	CCDS41649.1	11																																																																																			GLYATL2	-	pfam_Glycine_N-acyltransferase_N,superfamily_Acyl_CoA_acyltransferase	ENSG00000156689		0.373	GLYATL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLYATL2	HGNC	protein_coding	OTTHUMT00000394599.1	-	0.00	36	0	G	NM_145016		58604841	-1	tier1	-	no_errors	ENST00000287275	ensembl	human	known	74_37	silent	46.51	23	20	SNP	0.982	C
GOLGA7	51125	genome.wustl.edu	37	8	41355027	41355027	+	Splice_Site	SNP	G	G	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr8:41355027G>C	ENST00000357743.4	+	2	312		c.e2-1		GOLGA7_ENST00000520817.1_Splice_Site|GOLGA7_ENST00000518270.1_Splice_Site|GOLGA7_ENST00000405786.2_Splice_Site	NM_001002296.1	NP_001002296.1	Q7Z5G4	GOGA7_HUMAN	golgin A7						Golgi to plasma membrane protein transport (GO:0043001)|peptidyl-L-cysteine S-palmitoylation (GO:0018230)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|intrinsic component of Golgi membrane (GO:0031228)|palmitoyltransferase complex (GO:0002178)				breast(1)|large_intestine(1)	2	Ovarian(28;0.014)|Colorectal(14;0.0234)|Lung SC(25;0.211)	all_lung(54;0.000771)|Lung NSC(58;0.0031)|Hepatocellular(245;0.014)|Esophageal squamous(32;0.0559)	Colorectal(10;0.0014)|OV - Ovarian serous cystadenocarcinoma(14;0.00596)|LUSC - Lung squamous cell carcinoma(45;0.0137)|COAD - Colon adenocarcinoma(11;0.0147)			CTTCTCTACAGATTGATAGGC	0.338																																																	0													98.0	108.0	105.0					8																	41355027		2202	4300	6502	SO:0001630	splice_region_variant	0			AF125102	CCDS34887.1, CCDS55226.1	8p11.21	2011-10-25	2010-02-12		ENSG00000147533	ENSG00000147533			24876	protein-coding gene	gene with protein product		609453	"""golgi autoantigen, golgin subfamily a, 7"""			11042152	Standard	NM_001174124		Approved	GCP16, HSPC041, GOLGA3AP1, GOLGA7A	uc003xnu.3	Q7Z5G4	OTTHUMG00000164077	ENST00000357743.4:c.112-1G>C	8.37:g.41355027G>C			D3DSX9|J3KQ24|Q96EQ4|Q9P1S0|Q9Y5U7	Splice_Site	SNP	-	e2-1	ENST00000357743.4	37	c.112-1	CCDS34887.1	8	.	.	.	.	.	.	.	.	.	.	G	22.3	4.267296	0.80469	.	.	ENSG00000147533	ENST00000518270;ENST00000520817;ENST00000405786;ENST00000357743	.	.	.	5.66	5.66	0.87406	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.734	0.91748	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GOLGA7	41474184	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	7.925000	0.87563	2.669000	0.90835	0.655000	0.94253	.	GOLGA7	-	-	ENSG00000147533		0.338	GOLGA7-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GOLGA7	HGNC	protein_coding	OTTHUMT00000377142.1	-	0.00	47	0	G	NM_016099	Intron	41355027	+1	tier1	-	no_errors	ENST00000520817	ensembl	human	known	74_37	splice_site	50.00	8	8	SNP	1.000	C
GON4L	54856	genome.wustl.edu	37	1	155784178	155784178	+	Missense_Mutation	SNP	T	T	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:155784178T>G	ENST00000368331.1	-	9	1272	c.1224A>C	c.(1222-1224)agA>agC	p.R408S	GON4L_ENST00000471341.1_5'UTR|GON4L_ENST00000437809.1_Missense_Mutation_p.R408S|GON4L_ENST00000361040.5_Missense_Mutation_p.R408S|GON4L_ENST00000271883.5_Missense_Mutation_p.R408S	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	408					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					ACTGCCTCAATCTGGATTTCT	0.403																																																	0													182.0	170.0	174.0					1																	155784178		2203	4300	6503	SO:0001583	missense	0			AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.1224A>C	1.37:g.155784178T>G	ENSP00000357315:p.Arg408Ser		B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Missense_Mutation	SNP	pfam_PAH,superfamily_PAH,superfamily_Homeodomain-like,pfscan_Myb-like_dom	p.R408S	ENST00000368331.1	37	c.1224		1	.	.	.	.	.	.	.	.	.	.	T	19.29	3.799866	0.70567	.	.	ENSG00000116580	ENST00000437809;ENST00000368331;ENST00000271883;ENST00000539959;ENST00000361040	T;T;T;T	0.12879	2.83;2.83;2.83;2.64	4.56	2.22	0.28083	.	0.118078	0.53938	D	0.000049	T	0.13798	0.0334	L	0.54323	1.7	0.25603	N	0.986574	P;D;D;D;D	0.89917	0.728;0.988;0.998;0.999;1.0	B;P;D;D;D	0.83275	0.23;0.736;0.957;0.991;0.996	T	0.04855	-1.0922	10	0.52906	T	0.07	.	6.3713	0.21483	0.0:0.2941:0.0:0.7058	.	102;408;408;408;408	Q9H5U2;A4PB68;Q3T8J9-2;Q3T8J9;Q3T8J9-3	.;.;.;GON4L_HUMAN;.	S	408	ENSP00000396117:R408S;ENSP00000357315:R408S;ENSP00000271883:R408S;ENSP00000354322:R408S	ENSP00000271883:R408S	R	-	3	2	GON4L	154050802	0.575000	0.26692	0.998000	0.56505	0.999000	0.98932	0.316000	0.19469	0.367000	0.24454	0.533000	0.62120	AGA	GON4L	-	NULL	ENSG00000116580		0.403	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	GON4L	HGNC	protein_coding		-	0.00	71	0	T	NM_032292		155784178	-1	tier1	-	no_errors	ENST00000368331	ensembl	human	known	74_37	missense	30.00	28	12	SNP	0.996	G
GP5	2814	genome.wustl.edu	37	3	194117361	194117361	+	Nonsense_Mutation	SNP	G	G	A	rs143237677		TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr3:194117361G>A	ENST00000401815.1	-	1	1722	c.1651C>T	c.(1651-1653)Cga>Tga	p.R551*	GP5_ENST00000323007.3_Nonsense_Mutation_p.R551*			P40197	GPV_HUMAN	glycoprotein V (platelet)	551					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|negative regulation of platelet activation (GO:0010544)|platelet activation (GO:0030168)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(3)|central_nervous_system(2)|endometrium(2)|large_intestine(9)|lung(14)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	35	all_cancers(143;6.64e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;7.38e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.06e-05)		ATTAATTTTCGAAAGAGTTGG	0.438																																																	0													105.0	123.0	117.0					3																	194117361		2199	4297	6496	SO:0001587	stop_gained	0			L11238	CCDS3307.1	3q29	2008-02-01			ENSG00000178732	ENSG00000178732		"""CD molecules"""	4443	protein-coding gene	gene with protein product		173511				7690959	Standard	NM_004488		Approved	CD42d	uc003ftv.1	P40197	OTTHUMG00000150345	ENST00000401815.1:c.1651C>T	3.37:g.194117361G>A	ENSP00000383931:p.Arg551*		D1MER9	Nonsense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.R551*	ENST00000401815.1	37	c.1651	CCDS3307.1	3	.	.	.	.	.	.	.	.	.	.	G	37	6.039549	0.97226	.	.	ENSG00000178732	ENST00000401815;ENST00000323007	.	.	.	4.1	2.13	0.27403	.	0.312775	0.18568	N	0.137438	.	.	.	.	.	.	0.40239	D	0.977932	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.8303	0.23907	0.0:0.1776:0.5892:0.2332	.	.	.	.	X	551	.	ENSP00000319286:R551X	R	-	1	2	GP5	195598650	0.964000	0.33143	0.659000	0.29680	0.898000	0.52572	0.764000	0.26532	0.355000	0.24131	0.542000	0.68232	CGA	GP5	-	NULL	ENSG00000178732		0.438	GP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GP5	HGNC	protein_coding	OTTHUMT00000317710.1	-	0.00	103	0	G	NM_004488		194117361	-1	tier1	-	no_errors	ENST00000323007	ensembl	human	known	74_37	nonsense	9.62	47	5	SNP	0.999	A
GPATCH8	23131	genome.wustl.edu	37	17	42475361	42475361	+	Nonsense_Mutation	SNP	G	G	A	rs370643934		TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr17:42475361G>A	ENST00000591680.1	-	8	4114	c.4084C>T	c.(4084-4086)Cag>Tag	p.Q1362*	GPATCH8_ENST00000434000.1_Nonsense_Mutation_p.Q1284*	NM_001002909.2	NP_001002909.1	Q9UKJ3	GPTC8_HUMAN	G patch domain containing 8	1362							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(7)|kidney(6)|large_intestine(4)|liver(2)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)		GCTGGCTGCTGAATGTGGATG	0.597																																																	0													77.0	56.0	63.0					17																	42475361		2203	4300	6503	SO:0001587	stop_gained	0			AB011125	CCDS32666.1	17q21.31	2013-01-28	2006-08-22	2006-12-13	ENSG00000186566	ENSG00000186566		"""G patch domain containing"""	29066	protein-coding gene	gene with protein product		614396	"""KIAA0553"""	KIAA0553, GPATC8		9628581	Standard	NM_001002909		Approved		uc002igw.2	Q9UKJ3	OTTHUMG00000181818	ENST00000591680.1:c.4084C>T	17.37:g.42475361G>A	ENSP00000467556:p.Gln1362*		B9EGP9|O60300|Q8TB99	Nonsense_Mutation	SNP	pfam_G_patch_dom,pfam_Znf_C2H2_jaz,smart_G_patch_dom,pfscan_Znf_C2H2,pfscan_G_patch_dom	p.Q1362*	ENST00000591680.1	37	c.4084	CCDS32666.1	17	.	.	.	.	.	.	.	.	.	.	G	39	7.306336	0.98200	.	.	ENSG00000186566	ENST00000335500;ENST00000434000	.	.	.	5.24	4.27	0.50696	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	-15.5519	13.4654	0.61251	0.077:0.0:0.923:0.0	.	.	.	.	X	1362;1284	.	ENSP00000335486:Q1362X	Q	-	1	0	GPATCH8	39830887	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	9.382000	0.97209	1.215000	0.43411	0.305000	0.20034	CAG	GPATCH8	-	NULL	ENSG00000186566		0.597	GPATCH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPATCH8	HGNC	protein_coding	OTTHUMT00000457797.1	-	0.00	49	0	G	NM_001002909		42475361	-1	tier1	-	no_errors	ENST00000591680	ensembl	human	known	74_37	nonsense	10.26	35	4	SNP	1.000	A
GPC5	2262	genome.wustl.edu	37	13	92346119	92346119	+	Missense_Mutation	SNP	A	A	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr13:92346119A>C	ENST00000377067.3	+	3	1376	c.1004A>C	c.(1003-1005)cAa>cCa	p.Q335P		NM_004466.4	NP_004457.1	P78333	GPC5_HUMAN	glypican 5	335					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(4)|endometrium(6)|kidney(4)|large_intestine(7)|lung(34)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				CTCAATGGACAAAAATTATTG	0.393																																																	0													82.0	85.0	84.0					13																	92346119		2203	4300	6503	SO:0001583	missense	0			AF001462	CCDS9468.1	13q32	2011-08-01			ENSG00000179399	ENSG00000179399		"""Proteoglycans / Cell Surface : Glypicans"""	4453	protein-coding gene	gene with protein product	"""glypican proteoglycan 5"""	602446				9070915, 20304703, 19556317, 15057823	Standard	NM_004466		Approved		uc010tif.2	P78333	OTTHUMG00000017200	ENST00000377067.3:c.1004A>C	13.37:g.92346119A>C	ENSP00000366267:p.Gln335Pro		B2R726|O60436|Q9BX27	Missense_Mutation	SNP	pfam_Glypican	p.Q335P	ENST00000377067.3	37	c.1004	CCDS9468.1	13	.	.	.	.	.	.	.	.	.	.	A	1.616	-0.522730	0.04141	.	.	ENSG00000179399	ENST00000377067	T	0.49720	0.77	5.65	3.11	0.35812	.	0.514311	0.21445	N	0.074430	T	0.25044	0.0608	N	0.04746	-0.17	0.25234	N	0.989809	B	0.02656	0.0	B	0.06405	0.002	T	0.14309	-1.0477	10	0.17369	T	0.5	1.1779	12.5494	0.56218	0.5739:0.4261:0.0:0.0	.	335	P78333	GPC5_HUMAN	P	335	ENSP00000366267:Q335P	ENSP00000366267:Q335P	Q	+	2	0	GPC5	91144120	0.933000	0.31639	0.071000	0.20095	0.957000	0.61999	2.104000	0.41815	0.373000	0.24621	0.528000	0.53228	CAA	GPC5	-	pfam_Glypican	ENSG00000179399		0.393	GPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC5	HGNC	protein_coding	OTTHUMT00000045454.1	-	0.00	18	0	A	NM_004466		92346119	+1	tier1	-	no_errors	ENST00000377067	ensembl	human	known	74_37	missense	42.86	8	6	SNP	0.629	C
GPR141	353345	genome.wustl.edu	37	7	37780847	37780847	+	Silent	SNP	C	C	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr7:37780847C>A	ENST00000447769.1	+	4	1141	c.852C>A	c.(850-852)gtC>gtA	p.V284V	EPDR1_ENST00000476620.1_Intron|GPR141_ENST00000461610.1_Intron|GPR141_ENST00000334425.1_Silent_p.V284V			Q7Z602	GP141_HUMAN	G protein-coupled receptor 141	284						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(13)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TTCTCTTTGTCTTTGGGGGAA	0.378																																																	0													112.0	110.0	110.0					7																	37780847		2203	4300	6503	SO:0001819	synonymous_variant	0			AY288420	CCDS5451.1	7p14.1	2012-08-21			ENSG00000187037	ENSG00000187037		"""GPCR / Class A : Orphans"""	19997	protein-coding gene	gene with protein product		609045				12679517, 14623098	Standard	NM_181791		Approved	PGR13	uc003tfm.1	Q7Z602	OTTHUMG00000102105	ENST00000447769.1:c.852C>A	7.37:g.37780847C>A			A4D1X7|Q0VAR5|Q86SP3	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.V284	ENST00000447769.1	37	c.852	CCDS5451.1	7																																																																																			GPR141	-	NULL	ENSG00000187037		0.378	GPR141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR141	HGNC	protein_coding	OTTHUMT00000219943.2	-	0.00	44	0	C	NM_181791		37780847	+1	tier1	-	no_errors	ENST00000334425	ensembl	human	known	74_37	silent	28.79	47	19	SNP	0.148	A
GPR158	57512	genome.wustl.edu	37	10	25883308	25883308	+	Silent	SNP	G	G	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr10:25883308G>C	ENST00000376351.3	+	9	2339	c.1980G>C	c.(1978-1980)ggG>ggC	p.G660G	GPR158_ENST00000490549.1_3'UTR	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	660					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						TCACCATTGGGTTGCTTTTGA	0.338																																																	0													190.0	174.0	179.0					10																	25883308		2203	4300	6503	SO:0001819	synonymous_variant	0			AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.1980G>C	10.37:g.25883308G>C			Q6QR81|Q9ULT3	Silent	SNP	pfam_GPCR_3_C,pfscan_GPCR_3_C	p.G660	ENST00000376351.3	37	c.1980	CCDS31166.1	10																																																																																			GPR158	-	pfam_GPCR_3_C,pfscan_GPCR_3_C	ENSG00000151025		0.338	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR158	HGNC	protein_coding	OTTHUMT00000047248.2	-	0.00	31	0	G	XM_166110		25883308	+1	tier1	-	no_errors	ENST00000376351	ensembl	human	known	74_37	silent	17.86	23	5	SNP	0.988	C
GPR22	2845	genome.wustl.edu	37	7	107115700	107115700	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr7:107115700G>T	ENST00000304402.4	+	3	2538	c.1195G>T	c.(1195-1197)Gct>Tct	p.A399S	COG5_ENST00000297135.3_Intron|COG5_ENST00000347053.3_Intron|COG5_ENST00000475638.2_Intron|COG5_ENST00000393603.2_Intron	NM_005295.2	NP_005286.2	Q99680	GPR22_HUMAN	G protein-coupled receptor 22	399					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			large_intestine(3)|lung(6)|ovary(2)|stomach(1)	12						GCCTAATAATGCTGTAATACA	0.318																																																	0													48.0	54.0	52.0					7																	107115700		2201	4292	6493	SO:0001583	missense	0			U66581	CCDS5744.1	7q22-q31.1	2012-08-21			ENSG00000172209	ENSG00000172209		"""GPCR / Class A : Orphans"""	4477	protein-coding gene	gene with protein product		601910				9073069	Standard	NM_005295		Approved		uc003vef.3	Q99680	OTTHUMG00000154902	ENST00000304402.4:c.1195G>T	7.37:g.107115700G>T	ENSP00000302676:p.Ala399Ser		O14554	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.A399S	ENST00000304402.4	37	c.1195	CCDS5744.1	7	.	.	.	.	.	.	.	.	.	.	G	15.27	2.782920	0.49891	.	.	ENSG00000172209	ENST00000304402	T	0.30448	1.53	5.92	5.92	0.95590	.	0.234186	0.43110	D	0.000616	T	0.18593	0.0446	N	0.11560	0.145	0.58432	D	0.999994	P	0.45044	0.849	B	0.37015	0.239	T	0.05146	-1.0903	10	0.19590	T	0.45	-8.7183	20.33	0.98713	0.0:0.0:1.0:0.0	.	399	Q99680	GPR22_HUMAN	S	399	ENSP00000302676:A399S	ENSP00000302676:A399S	A	+	1	0	GPR22	106902936	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.872000	0.87187	2.810000	0.96702	0.585000	0.79938	GCT	GPR22	-	NULL	ENSG00000172209		0.318	GPR22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR22	HGNC	protein_coding	OTTHUMT00000337598.1		0.00	84	0	G			107115700	+1			no_errors	ENST00000304402	ensembl	human	known	74_37	missense	5.19	73	4	SNP	1.000	T
GRIK4	2900	genome.wustl.edu	37	11	120690507	120690507	+	Missense_Mutation	SNP	A	A	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr11:120690507A>G	ENST00000527524.2	+	6	676	c.389A>G	c.(388-390)cAg>cGg	p.Q130R	GRIK4_ENST00000438375.2_Missense_Mutation_p.Q130R	NM_001282470.1	NP_001269399.1	Q16099	GRIK4_HUMAN	glutamate receptor, ionotropic, kainate 4	130					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|response to corticosteroid (GO:0031960)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|nucleus (GO:0005634)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(20)|liver(1)|lung(29)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	69		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)		GTCAAGTTCCAGTTCCAGAGA	0.552																																																	0													234.0	237.0	236.0					11																	120690507		2203	4299	6502	SO:0001583	missense	0			S67803	CCDS8433.1	11q23.3	2012-08-29			ENSG00000149403	ENSG00000149403		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4582	protein-coding gene	gene with protein product		600282		GRIK			Standard	NM_001282470		Approved	GluK4, KA1	uc009zax.1	Q16099	OTTHUMG00000048255	ENST00000527524.2:c.389A>G	11.37:g.120690507A>G	ENSP00000435648:p.Gln130Arg		A8K9L1	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.Q130R	ENST00000527524.2	37	c.389	CCDS8433.1	11	.	.	.	.	.	.	.	.	.	.	A	11.87	1.766763	0.31320	.	.	ENSG00000149403	ENST00000527524;ENST00000438375	D;D	0.83419	-1.72;-1.72	4.27	4.27	0.50696	Extracellular ligand-binding receptor (1);	0.537610	0.12025	U	0.506507	D	0.82337	0.5015	L	0.51422	1.61	0.43988	D	0.996689	B;B	0.31209	0.313;0.31	B;B	0.37888	0.187;0.26	T	0.81011	-0.1126	10	0.66056	D	0.02	.	13.5674	0.61826	1.0:0.0:0.0:0.0	.	130;130	A6H8K8;Q16099	.;GRIK4_HUMAN	R	130	ENSP00000435648:Q130R;ENSP00000404063:Q130R	ENSP00000404063:Q130R	Q	+	2	0	GRIK4	120195717	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.070000	0.57548	1.782000	0.52362	0.459000	0.35465	CAG	GRIK4	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I	ENSG00000149403		0.552	GRIK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK4	HGNC	protein_coding	OTTHUMT00000109760.4	-	0.00	32	0	A	NM_014619		120690507	+1	tier1	-	no_errors	ENST00000527524	ensembl	human	known	74_37	missense	23.26	33	10	SNP	1.000	G
GRIN2B	2904	genome.wustl.edu	37	12	14018892	14018892	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr12:14018892C>T	ENST00000609686.1	-	2	460	c.251G>A	c.(250-252)cGc>cAc	p.R84H		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	84					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	ATCACAGATGCGGGTGATGAT	0.532																																																	0													180.0	154.0	163.0					12																	14018892		2203	4300	6503	SO:0001583	missense	0				CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.251G>A	12.37:g.14018892C>T	ENSP00000477455:p.Arg84His		Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Missense_Mutation	SNP	pfam_NMDAR2_C,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.R84H	ENST00000609686.1	37	c.251	CCDS8662.1	12	.	.	.	.	.	.	.	.	.	.	C	14.43	2.532144	0.45073	.	.	ENSG00000150086	ENST00000279593	D	0.86230	-2.09	5.37	5.37	0.77165	.	0.060138	0.64402	D	0.000002	T	0.67599	0.2910	N	0.01122	-1.005	0.41035	D	0.985181	B	0.18166	0.026	B	0.08055	0.003	T	0.68070	-0.5506	10	0.07990	T	0.79	.	19.1153	0.93336	0.0:1.0:0.0:0.0	.	84	Q13224	NMDE2_HUMAN	H	84	ENSP00000279593:R84H	ENSP00000279593:R84H	R	-	2	0	GRIN2B	13910159	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.048000	0.71046	2.496000	0.84212	0.563000	0.77884	CGC	GRIN2B	-	superfamily_Peripla_BP_I	ENSG00000273079		0.532	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2B	HGNC	protein_coding	OTTHUMT00000268014.2		0.00	46	0	C			14018892	-1			no_errors	ENST00000609686	ensembl	human	known	74_37	missense	5.88	32	2	SNP	1.000	T
GRIN3B	116444	genome.wustl.edu	37	19	1004753	1004753	+	Missense_Mutation	SNP	G	G	A	rs201293199		TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr19:1004753G>A	ENST00000234389.3	+	3	1272	c.1253G>A	c.(1252-1254)cGt>cAt	p.R418H	AC004528.4_ENST00000588380.1_RNA|GRIN3B_ENST00000588335.1_Intron	NM_138690.1	NP_619635.1	O60391	NMD3B_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3B	418					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|protein insertion into membrane (GO:0051205)|regulation of calcium ion transport (GO:0051924)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|neurotransmitter receptor activity (GO:0030594)			breast(1)|kidney(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000226)|all_lung(49;0.000353)|Breast(49;0.00066)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CCCAAGCTGCGTGTGGTAACG	0.677																																																	0								G	HIS/ARG	0,4394		0,0,2197	41.0	40.0	40.0		1253	4.6	0.6	19		40	1,8585	1.2+/-3.3	0,1,4292	no	missense	GRIN3B	NM_138690.1	29	0,1,6489	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	418/1044	1004753	1,12979	2197	4293	6490	SO:0001583	missense	0				CCDS32861.1	19p13.3	2014-05-06			ENSG00000116032	ENSG00000116032		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16768	protein-coding gene	gene with protein product		606651					Standard	XM_003403700		Approved	GluN3B	uc002lqo.1	O60391	OTTHUMG00000181904	ENST00000234389.3:c.1253G>A	19.37:g.1004753G>A	ENSP00000234389:p.Arg418His		Q5EAK7|Q7RTW9	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.R418H	ENST00000234389.3	37	c.1253	CCDS32861.1	19	.	.	.	.	.	.	.	.	.	.	G	18.18	3.565744	0.65651	0.0	1.16E-4	ENSG00000116032	ENST00000234389	T	0.56941	0.43	4.59	4.59	0.56863	.	0.000000	0.85682	D	0.000000	T	0.72606	0.3481	M	0.79258	2.445	0.46149	D	0.998891	D	0.89917	1.0	D	0.81914	0.995	T	0.76498	-0.2937	10	0.56958	D	0.05	.	16.0132	0.80417	0.0:0.0:1.0:0.0	.	418	O60391	NMD3B_HUMAN	H	418	ENSP00000234389:R418H	ENSP00000234389:R418H	R	+	2	0	GRIN3B	955753	1.000000	0.71417	0.618000	0.29105	0.364000	0.29643	9.390000	0.97246	2.137000	0.66172	0.472000	0.43445	CGT	GRIN3B	-	NULL	ENSG00000116032		0.677	GRIN3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN3B	HGNC	protein_coding	OTTHUMT00000103923.2	-	0.00	26	0	G			1004753	+1	tier1	rs201293199	no_errors	ENST00000234389	ensembl	human	known	74_37	missense	17.86	23	5	SNP	0.994	A
GRM8	2918	genome.wustl.edu	37	7	126249516	126249516	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr7:126249516C>A	ENST00000339582.2	-	8	2202	c.1394G>T	c.(1393-1395)gGa>gTa	p.G465V	GRM8_ENST00000480995.1_Intron|GRM8_ENST00000405249.1_Nonsense_Mutation_p.E489*|GRM8_ENST00000444921.2_Missense_Mutation_p.G465V|GRM8_ENST00000358373.3_Missense_Mutation_p.G465V			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	465					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)	p.G465E(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				AGGAGCATCTCCGTTTTCATT	0.373										HNSCC(24;0.065)																																							1	Substitution - Missense(1)	skin(1)											143.0	123.0	130.0					7																	126249516		2203	4300	6503	SO:0001583	missense	0				CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.1394G>T	7.37:g.126249516C>A	ENSP00000344173:p.Gly465Val		A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Nonsense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_8,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_4	p.E489*	ENST00000339582.2	37	c.1465	CCDS5794.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	30|30	5.056631|5.056631	0.93793|0.93793	.|.	.|.	ENSG00000179603|ENSG00000179603	ENST00000405249|ENST00000339582;ENST00000444921;ENST00000358373	.|D;D;D	.|0.92199	.|-2.99;-2.99;-2.99	5.45|5.45	5.45|5.45	0.79879|0.79879	.|Extracellular ligand-binding receptor (1);	.|0.000000	.|0.85682	.|D	.|0.000000	.|D	.|0.97536	.|0.9193	H|H	0.96365|0.96365	3.81|3.81	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|0.99;1.0	.|P;D	.|0.87578	.|0.64;0.998	.|D	.|0.98683	.|1.0693	.|10	0.87932|0.87932	D|D	0|0	.|.	18.2877|18.2877	0.90119|0.90119	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|465;465	.|O00222-2;O00222	.|.;GRM8_HUMAN	X|V	489|465	.|ENSP00000344173:G465V;ENSP00000409790:G465V;ENSP00000351142:G465V	ENSP00000345747:E489X|ENSP00000344173:G465V	E|G	-|-	1|2	0|0	GRM8|GRM8	126036752|126036752	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.792000|7.792000	0.85828|0.85828	2.535000|2.535000	0.85469|0.85469	0.563000|0.563000	0.77884|0.77884	GAG|GGA	GRM8	-	NULL	ENSG00000179603		0.373	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRM8	HGNC	protein_coding	OTTHUMT00000059209.4		0.00	73	0	C			126249516	-1			no_errors	ENST00000341617	ensembl	human	known	74_37	nonsense	5.41	35	2	SNP	1.000	A
GYG2P1	352887	genome.wustl.edu	37	Y	14495029	14495029	+	RNA	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chrY:14495029G>A	ENST00000493160.1	-	0	906									glycogenin 2 pseudogene 1																		CTGGCTGAGTGATTGGAGAGC	0.607																																																	0																																												0					Yq11.21	2010-07-02	2010-03-19	2010-03-19	ENSG00000206159	ENSG00000206159			4701	pseudogene	pseudogene			"""glycogenin 2 pseudogene"""	GYG2P		10542153	Standard	NR_033667		Approved		uc022cji.1		OTTHUMG00000036382		Y.37:g.14495029G>A				RNA	SNP	-	NULL	ENST00000493160.1	37	NULL		Y																																																																																			GYG2P1	-	-	ENSG00000206159		0.607	GYG2P1-003	KNOWN	basic	processed_transcript	GYG2P1	HGNC	pseudogene	OTTHUMT00000088556.1	-	0.00	25	0	G	NG_002811		14495029	-1	tier1	-	no_errors	ENST00000493160	ensembl	human	known	74_37	rna	18.42	31	7	SNP	0.992	A
HDAC5	10014	genome.wustl.edu	37	17	42170115	42170115	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr17:42170115G>A	ENST00000393622.2	-	7	1032	c.701C>T	c.(700-702)aCg>aTg	p.T234M	HDAC5_ENST00000225983.6_Missense_Mutation_p.T235M|HDAC5_ENST00000586802.1_Missense_Mutation_p.T234M|HDAC5_ENST00000336057.5_Missense_Mutation_p.T234M	NM_001015053.1|NM_005474.4	NP_001015053.1|NP_005465.2	Q9UQL6	HDAC5_HUMAN	histone deacetylase 5	234					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|chromatin silencing (GO:0006342)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|inflammatory response (GO:0006954)|multicellular organismal response to stress (GO:0033555)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|osteoblast development (GO:0002076)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression, epigenetic (GO:0040029)|regulation of myotube differentiation (GO:0010830)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|histone deacetylase complex (GO:0000118)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)|skin(1)	21		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.118)		GGAGGGAGGCGTCCCAGGGGG	0.652																																																	0													23.0	29.0	27.0					17																	42170115		2177	4261	6438	SO:0001583	missense	0			AF249731	CCDS32663.1, CCDS45696.1	17q21	2008-07-18					3.5.1.98		14068	protein-coding gene	gene with protein product		605315				10220385, 9610721	Standard	XM_005256905		Approved	KIAA0600, NY-CO-9, FLJ90614	uc002iff.1	Q9UQL6		ENST00000393622.2:c.701C>T	17.37:g.42170115G>A	ENSP00000377244:p.Thr234Met		C9JFV9|O60340|O60528|Q96DY4	Missense_Mutation	SNP	pfam_His_deacetylse_dom,pfam_Hist_deacetylase_Gln_rich_N,pirsf_Histone_deAcase_II_euk,prints_His_deacetylse	p.T235M	ENST00000393622.2	37	c.704	CCDS45696.1	17	.	.	.	.	.	.	.	.	.	.	G	23.4	4.412901	0.83340	.	.	ENSG00000108840	ENST00000225983;ENST00000393622;ENST00000336057	T;T;T	0.49720	0.81;0.81;0.77	5.52	5.52	0.82312	.	0.000000	0.64402	D	0.000001	T	0.64616	0.2614	L	0.54323	1.7	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.71414	0.973;0.94;0.973;0.94	T	0.61691	-0.7011	10	0.41790	T	0.15	-9.7899	18.2096	0.89866	0.0:0.0:1.0:0.0	.	234;234;235;234	Q9UQL6-2;B4DGT4;Q9UQL6-3;Q9UQL6	.;.;.;HDAC5_HUMAN	M	235;234;234	ENSP00000225983:T235M;ENSP00000377244:T234M;ENSP00000337290:T234M	ENSP00000225983:T235M	T	-	2	0	HDAC5	39525641	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.491000	0.60326	2.606000	0.88127	0.561000	0.74099	ACG	HDAC5	-	pirsf_Histone_deAcase_II_euk	ENSG00000108840		0.652	HDAC5-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	HDAC5	HGNC	protein_coding	OTTHUMT00000457686.1		0.00	24	0	G	NM_001015053		42170115	-1			no_errors	ENST00000225983	ensembl	human	known	74_37	missense	22.22	7	2	SNP	1.000	A
HEATR5B	54497	genome.wustl.edu	37	2	37306297	37306297	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr2:37306297T>C	ENST00000233099.5	-	3	399	c.304A>G	c.(304-306)Aaa>Gaa	p.K102E	HEATR5B_ENST00000354531.2_Missense_Mutation_p.K102E	NM_019024.1	NP_061897.1	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	102						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|pancreas(1)|prostate(1)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	77		all_hematologic(82;0.21)				GTGTCATCTTTATTTCTGATA	0.343																																																	0													59.0	55.0	56.0					2																	37306297		2203	4299	6502	SO:0001583	missense	0			AB037835	CCDS33181.1	2p22.2	2007-01-02			ENSG00000008869	ENSG00000008869			29273	protein-coding gene	gene with protein product						10718198	Standard	XM_005264379		Approved	KIAA1414, DKFZp686P15184	uc002rpp.1	Q9P2D3	OTTHUMG00000152158	ENST00000233099.5:c.304A>G	2.37:g.37306297T>C	ENSP00000233099:p.Lys102Glu		B5MDU8|Q7Z3B2|Q9NVL7	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.K102E	ENST00000233099.5	37	c.304	CCDS33181.1	2	.	.	.	.	.	.	.	.	.	.	T	29.0	4.968400	0.92855	.	.	ENSG00000008869	ENST00000233099;ENST00000354531;ENST00000424416	T;T	0.63744	-0.06;-0.06	5.88	5.88	0.94601	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.80859	0.4704	M	0.83603	2.65	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	T	0.82975	-0.0190	10	0.56958	D	0.05	-23.6682	16.2879	0.82732	0.0:0.0:0.0:1.0	.	102	Q9P2D3	HTR5B_HUMAN	E	102	ENSP00000233099:K102E;ENSP00000346531:K102E	ENSP00000233099:K102E	K	-	1	0	HEATR5B	37159801	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.969000	0.87988	2.242000	0.73789	0.533000	0.62120	AAA	HEATR5B	-	superfamily_ARM-type_fold	ENSG00000008869		0.343	HEATR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR5B	HGNC	protein_coding	OTTHUMT00000325492.1	-	0.00	96	0	T	NM_019024		37306297	-1	tier1	-	no_errors	ENST00000233099	ensembl	human	known	74_37	missense	28.57	50	20	SNP	1.000	C
HEPH	9843	genome.wustl.edu	37	X	65415044	65415044	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chrX:65415044G>T	ENST00000343002.2	+	8	2138	c.1474G>T	c.(1474-1476)Gac>Tac	p.D492Y	HEPH_ENST00000441993.2_Missense_Mutation_p.D495Y|HEPH_ENST00000419594.1_Missense_Mutation_p.D495Y|HEPH_ENST00000374727.3_Missense_Mutation_p.D495Y|HEPH_ENST00000336279.5_Missense_Mutation_p.D225Y|HEPH_ENST00000519389.1_Missense_Mutation_p.D546Y			Q9BQS7	HEPH_HUMAN	hephaestin	492	Plastocyanin-like 3.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|iron ion transport (GO:0006826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	copper ion binding (GO:0005507)|ferrous iron binding (GO:0008198)|ferroxidase activity (GO:0004322)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(56)|ovary(5)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	89						TTATGAGAAAGACTATGAAGG	0.493																																																	0													48.0	39.0	42.0					X																	65415044		2203	4300	6503	SO:0001583	missense	0			AB014598	CCDS14384.2, CCDS14385.1, CCDS48133.1, CCDS14384.3, CCDS65277.1	Xq11-q12	2008-02-05			ENSG00000089472	ENSG00000089472			4866	protein-coding gene	gene with protein product		300167				9988272, 9734811	Standard	NM_014799		Approved	KIAA0698, CPL	uc011moz.2	Q9BQS7	OTTHUMG00000021732	ENST00000343002.2:c.1474G>T	X.37:g.65415044G>T	ENSP00000343939:p.Asp492Tyr		B1AJX8|D3DVT7|E9PHN8|O75180|Q6UW45|Q9C058	Missense_Mutation	SNP	pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Cupredoxin	p.D546Y	ENST00000343002.2	37	c.1636		X	.	.	.	.	.	.	.	.	.	.	G	15.87	2.959605	0.53400	.	.	ENSG00000089472	ENST00000519389;ENST00000374727;ENST00000336279;ENST00000441993;ENST00000419594;ENST00000343002;ENST00000425114	D;D;D;D;D;D;D	0.98901	-5.22;-5.22;-5.22;-5.22;-5.22;-5.22;-5.22	5.46	3.67	0.42095	Cupredoxin (2);Multicopper oxidase, type 3 (1);	0.850231	0.10682	N	0.646245	D	0.97983	0.9336	L	0.43152	1.355	0.22226	N	0.999276	P;P;P	0.48764	0.915;0.679;0.752	P;B;P	0.54590	0.756;0.365;0.673	D	0.93360	0.6726	10	0.59425	D	0.04	.	10.3831	0.44123	0.1403:0.0:0.8597:0.0	.	546;495;492	E9PHN8;E7ES21;Q9BQS7	.;.;HEPH_HUMAN	Y	546;495;225;495;495;492;492	ENSP00000430620:D546Y;ENSP00000363859:D495Y;ENSP00000337418:D225Y;ENSP00000411687:D495Y;ENSP00000413211:D495Y;ENSP00000343939:D492Y;ENSP00000398078:D492Y	ENSP00000337418:D225Y	D	+	1	0	HEPH	65331769	1.000000	0.71417	0.756000	0.31282	0.894000	0.52154	2.622000	0.46427	0.494000	0.27859	0.529000	0.55759	GAC	HEPH	-	pfam_Cu-oxidase_3,superfamily_Cupredoxin	ENSG00000089472		0.493	HEPH-002	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	HEPH	HGNC	protein_coding	OTTHUMT00000056995.1		0.00	29	0	G	NM_138737		65415044	+1			no_errors	ENST00000519389	ensembl	human	known	74_37	missense	9.09	30	3	SNP	0.629	T
ZNRD1-AS1	80862	genome.wustl.edu	37	6	29974679	29974679	+	RNA	SNP	G	G	A	rs556213389		TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr6:29974679G>A	ENST00000376797.3	-	0	1346				HLA-J_ENST00000462773.1_RNA|ZNRD1-AS1_ENST00000425604.1_RNA|ZNRD1-AS1_ENST00000420251.1_RNA|ZNRD1-AS1_ENST00000448093.1_RNA			Q2KJ03	ZRAS1_HUMAN	ZNRD1 antisense RNA 1																		CAGTTCGTGCGGGTCGACAGT	0.657													G|||	1	0.000199681	0.0	0.0	5008	,	,		15129	0.001		0.0	False		,,,				2504	0.0																0																																												0			AF032110		6p21.33	2014-08-14	2012-08-15	2010-11-25	ENSG00000204623	ENSG00000204623		"""Long non-coding RNAs"""	13924	non-coding RNA	RNA, long non-coding		615714	"""chromosome 6 open reading frame 12"", ""non-protein coding RNA 171"", ""ZNRD1 antisense RNA (non-protein coding)"", ""ZNRD1 antisense RNA 1 (non-protein coding)"""	C6orf12, NCRNA00171, ZNRD1AS, ZNRD1-AS		9553157, 11130983, 25110835	Standard	NR_026751		Approved	HTEX4, Em:AB023056.3	uc003rto.3	Q2KJ03	OTTHUMG00000031109		6.37:g.29974679G>A				RNA	SNP	-	NULL	ENST00000376797.3	37	NULL		6																																																																																			HLA-J	-	-	ENSG00000204622		0.657	ZNRD1-AS1-006	KNOWN	basic|exp_conf	antisense	HLA-J	HGNC	antisense	OTTHUMT00000253083.1	-	0.00	78	0	G	NR_026751		29974679	+1	tier1	-	no_errors	ENST00000462773	ensembl	human	known	74_37	rna	24.07	41	13	SNP	1.000	A
HOOK1	51361	genome.wustl.edu	37	1	60299159	60299159	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:60299159G>A	ENST00000371208.3	+	5	613	c.356G>A	c.(355-357)aGg>aAg	p.R119K	HOOK1_ENST00000395561.2_Missense_Mutation_p.R77K|HOOK1_ENST00000465876.1_3'UTR	NM_015888.4	NP_056972.1	Q9UJC3	HOOK1_HUMAN	hook microtubule-tethering protein 1	119	Sufficient for interaction with microtubules.				early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)|spermatid development (GO:0007286)	FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)			biliary_tract(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|urinary_tract(1)	29	all_cancers(7;0.000129)					GAGCTTGGGAGGTTGCTCCAG	0.363																																																	0													93.0	95.0	94.0					1																	60299159		2203	4300	6503	SO:0001583	missense	0			AF044923	CCDS612.1	1p32.1	2013-08-21	2013-08-21		ENSG00000134709	ENSG00000134709			19884	protein-coding gene	gene with protein product		607820	"""hook homolog 1 (Drosophila)"""			9927460	Standard	XM_005270922		Approved	HK1	uc001czo.3	Q9UJC3	OTTHUMG00000008990	ENST00000371208.3:c.356G>A	1.37:g.60299159G>A	ENSP00000360252:p.Arg119Lys		A8K8E9|A8MU44|B4DX15|O60561|Q5TG44	Missense_Mutation	SNP	pfam_Hook-related_fam,superfamily_Prefoldin	p.R119K	ENST00000371208.3	37	c.356	CCDS612.1	1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.197127	0.79015	.	.	ENSG00000134709	ENST00000455990;ENST00000371208;ENST00000395561	T;T;T	0.20200	2.09;2.09;2.09	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.33059	0.0850	L	0.41906	1.305	0.80722	D	1	B	0.24426	0.103	P	0.48840	0.592	T	0.04693	-1.0933	10	0.02654	T	1	.	19.6951	0.96022	0.0:0.0:1.0:0.0	.	119	Q9UJC3	HOOK1_HUMAN	K	119;119;77	ENSP00000398860:R119K;ENSP00000360252:R119K;ENSP00000378928:R77K	ENSP00000360252:R119K	R	+	2	0	HOOK1	60071747	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	8.197000	0.89727	2.728000	0.93425	0.585000	0.79938	AGG	HOOK1	-	pfam_Hook-related_fam	ENSG00000134709		0.363	HOOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOOK1	HGNC	protein_coding	OTTHUMT00000024934.1	-	0.00	82	0	G	NM_015888		60299159	+1	tier1	-	no_errors	ENST00000371208	ensembl	human	known	74_37	missense	32.65	33	16	SNP	1.000	A
HMCN1	83872	genome.wustl.edu	37	1	186081978	186081978	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:186081978G>A	ENST00000271588.4	+	72	11253	c.11024G>A	c.(11023-11025)aGa>aAa	p.R3675K	HMCN1_ENST00000367492.2_Missense_Mutation_p.R3675K	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3675	Ig-like C2-type 35.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TCTGGAGGGAGATACTTGCAA	0.393																																																	0													132.0	125.0	127.0					1																	186081978		2203	4300	6503	SO:0001583	missense	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.11024G>A	1.37:g.186081978G>A	ENSP00000271588:p.Arg3675Lys		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd_dom,pfam_Thrombospondin_1_rpt,superfamily_GFP,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.R3675K	ENST00000271588.4	37	c.11024	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.763062	0.89932	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.66099	-0.19;-0.19	4.91	4.91	0.64330	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.098616	0.64402	D	0.000001	T	0.66396	0.2785	L	0.41415	1.275	0.45118	D	0.998137	D	0.60575	0.988	D	0.74023	0.982	T	0.59731	-0.7399	10	0.09590	T	0.72	.	11.9092	0.52729	0.0806:0.0:0.9194:0.0	.	3675	Q96RW7	HMCN1_HUMAN	K	3675	ENSP00000271588:R3675K;ENSP00000356462:R3675K	ENSP00000271588:R3675K	R	+	2	0	HMCN1	184348601	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.797000	0.85911	2.416000	0.81992	0.655000	0.94253	AGA	HMCN1	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	ENSG00000143341		0.393	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	-	0.00	69	0	G	NM_031935		186081978	+1	tier1	-	no_errors	ENST00000271588	ensembl	human	known	74_37	missense	29.41	36	15	SNP	1.000	A
HOXC9	3225	genome.wustl.edu	37	12	54396372	54396372	+	Nonsense_Mutation	SNP	G	G	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr12:54396372G>T	ENST00000303450.4	+	2	767	c.697G>T	c.(697-699)Gag>Tag	p.E233*	RP11-834C11.12_ENST00000513209.1_Intron|HOXC9_ENST00000508190.1_Nonsense_Mutation_p.E233*|HOXC-AS1_ENST00000512427.1_RNA|HOXC-AS1_ENST00000505700.1_RNA|HOXC9_ENST00000504557.1_3'UTR	NM_006897.1	NP_008828.1	P31274	HXC9_HUMAN	homeobox C9	233					anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			large_intestine(3)|liver(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	14						CAATCTCACCGAGCGGCAGGT	0.478																																																	0													64.0	68.0	66.0					12																	54396372		2203	4300	6503	SO:0001587	stop_gained	0				CCDS8869.1	12q13.13	2011-06-20	2005-12-22			ENSG00000180806		"""Homeoboxes / ANTP class : HOXL subclass"""	5130	protein-coding gene	gene with protein product		142971	"""homeo box C9"""	HOX3, HOX3B		1973146	Standard	NM_006897		Approved		uc001seq.3	P31274		ENST00000303450.4:c.697G>T	12.37:g.54396372G>T	ENSP00000302836:p.Glu233*		B2RCN7|Q9H1I0	Nonsense_Mutation	SNP	pfam_Hox9_activation_N,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pirsf_Homeobox_Hox9,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.E233*	ENST00000303450.4	37	c.697	CCDS8869.1	12	.	.	.	.	.	.	.	.	.	.	G	23.1	4.376329	0.82682	.	.	ENSG00000180806	ENST00000508190;ENST00000303450	.	.	.	4.13	4.13	0.48395	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	15.6908	0.77450	0.0:0.0:1.0:0.0	.	.	.	.	X	233	.	ENSP00000302836:E233X	E	+	1	0	HOXC9	52682639	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.490000	0.97952	2.326000	0.78906	0.561000	0.74099	GAG	HOXC9	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pirsf_Homeobox_Hox9,pfscan_Homeobox_dom,prints_Homeobox_metazoa	ENSG00000180806		0.478	HOXC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXC9	HGNC	protein_coding	OTTHUMT00000358958.1	-	0.00	113	0	G			54396372	+1	tier1	-	no_errors	ENST00000303450	ensembl	human	known	74_37	nonsense	32.79	41	20	SNP	1.000	T
HSD17B7P2	158160	genome.wustl.edu	37	10	38654432	38654432	+	RNA	SNP	A	A	G	rs2257765		TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr10:38654432A>G	ENST00000494540.1	+	0	599					NR_003086.1				hydroxysteroid (17-beta) dehydrogenase 7 pseudogene 2																		TCATCTCGCAATGCAAGGAAA	0.453																																																	0																																												0					10p11.1	2011-06-29			ENSG00000099251	ENSG00000099251			28120	pseudogene	pseudogene						10544267	Standard	NR_003086		Approved	HSD17B7, bA291L22.1	uc010qex.1		OTTHUMG00000017993		10.37:g.38654432A>G				RNA	SNP	-	NULL	ENST00000494540.1	37	NULL		10																																																																																			HSD17B7P2	-	-	ENSG00000099251		0.453	HSD17B7P2-001	KNOWN	basic	processed_transcript	HSD17B7P2	HGNC	pseudogene	OTTHUMT00000047631.2		0.00	67	0	A	NR_003086		38654432	+1			no_errors	ENST00000494540	ensembl	human	known	74_37	rna	5.45	52	3	SNP	1.000	G
IL2RG	3561	genome.wustl.edu	37	X	70330007	70330007	+	Splice_Site	SNP	G	G	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chrX:70330007G>T	ENST00000374202.2	-	4	684	c.593C>A	c.(592-594)aCt>aAt	p.T198N	IL2RG_ENST00000374188.3_5'Flank|IL2RG_ENST00000456850.2_Intron	NM_000206.2	NP_000197.1	P31785	IL2RG_HUMAN	interleukin 2 receptor, gamma	198	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				immune response (GO:0006955)|interleukin-2-mediated signaling pathway (GO:0038110)|interleukin-4-mediated signaling pathway (GO:0035771)|interleukin-7-mediated signaling pathway (GO:0038111)|signal transduction (GO:0007165)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|interleukin-2 binding (GO:0019976)			breast(1)|endometrium(3)|large_intestine(1)|lung(7)|pancreas(1)|prostate(1)|urinary_tract(1)	15	Renal(35;0.156)				Aldesleukin(DB00041)|Denileukin diftitox(DB00004)	GTCACTCACAGTCCAGCTGTG	0.483									Severe Combined Immunodeficiency, X-linked																																								0													170.0	121.0	137.0					X																	70330007		2203	4300	6503	SO:0001630	splice_region_variant	0	Familial Cancer Database	Agammaglobulinemia, Swiss Type	D11086	CCDS14406.1	Xq13	2014-09-17	2010-06-24		ENSG00000147168	ENSG00000147168		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6010	protein-coding gene	gene with protein product		308380	"""severe combined immunodeficiency"", ""combined immunodeficiency, X-linked"""	SCIDX1, IMD4, CIDX		1631559, 7883965	Standard	NM_000206		Approved	CD132	uc004dyw.2	P31785	OTTHUMG00000021787	ENST00000374202.2:c.594+1C>A	X.37:g.70330007G>T			Q5FC12	Missense_Mutation	SNP	pfam_IL-6_rcpt_alpha-bd,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.T198N	ENST00000374202.2	37	c.593	CCDS14406.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.16|19.16	3.773924|3.773924	0.69992|0.69992	.|.	.|.	ENSG00000147168|ENSG00000147168	ENST00000482750|ENST00000374202;ENST00000464642	.|T;T	.|0.55930	.|0.49;0.49	5.09|5.09	5.09|5.09	0.68999|0.68999	.|Fibronectin, type III (4);Immunoglobulin-like fold (1);	.|0.358364	.|0.29253	.|N	.|0.012688	T|T	0.68035|0.68035	0.2957|0.2957	M|M	0.68952|0.68952	2.095|2.095	0.80722|0.80722	D|D	1|1	.|D	.|0.63880	.|0.993	.|D	.|0.70935	.|0.971	T|T	0.65030|0.65030	-0.6267|-0.6267	5|10	.|0.24483	.|T	.|0.36	-0.1429|-0.1429	14.6823|14.6823	0.69026|0.69026	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|198	.|P31785	.|IL2RG_HUMAN	E|N	2|198;154	.|ENSP00000363318:T198N;ENSP00000425233:T154N	.|ENSP00000363318:T198N	D|T	-|-	3|2	2|0	IL2RG|IL2RG	70246732|70246732	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	2.822000|2.822000	0.48073|0.48073	2.102000|2.102000	0.63906|0.63906	0.600000|0.600000	0.82982|0.82982	GAC|ACT	IL2RG	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000147168		0.483	IL2RG-004	KNOWN	basic|appris_principal|CCDS	protein_coding	IL2RG	HGNC	protein_coding	OTTHUMT00000057102.2	-	0.00	52	0	G		Missense_Mutation	70330007	-1	tier1	-	no_errors	ENST00000374202	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	T
INTS2	57508	genome.wustl.edu	37	17	59955255	59955255	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr17:59955255G>A	ENST00000444766.3	-	18	2548	c.2473C>T	c.(2473-2475)Cct>Tct	p.P825S	INTS2_ENST00000251334.6_Missense_Mutation_p.P817S	NM_020748.2	NP_065799	Q9H0H0	INT2_HUMAN	integrator complex subunit 2	825					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|intracellular (GO:0005622)|membrane (GO:0016020)				NS(1)|breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	38						TACCTTCTAGGCATCACAGTA	0.313																																																	0													85.0	79.0	81.0					17																	59955255		1829	4066	5895	SO:0001583	missense	0			AB033113	CCDS45750.1	17q23.2	2006-04-26	2006-03-15	2006-03-15		ENSG00000108506			29241	protein-coding gene	gene with protein product		611346	"""KIAA1287"""	KIAA1287		16239144	Standard	NR_026641		Approved	INT2	uc002izn.3	Q9H0H0		ENST00000444766.3:c.2473C>T	17.37:g.59955255G>A	ENSP00000414237:p.Pro825Ser		Q9ULD3	Missense_Mutation	SNP	NULL	p.P825S	ENST00000444766.3	37	c.2473	CCDS45750.1	17	.	.	.	.	.	.	.	.	.	.	G	25.2	4.613484	0.87359	.	.	ENSG00000108506	ENST00000444766;ENST00000251334	T	0.52295	0.67	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.66973	0.2844	M	0.63843	1.955	0.80722	D	1	D	0.67145	0.996	D	0.78314	0.991	T	0.65038	-0.6265	9	.	.	.	-15.8074	18.365	0.90388	0.0:0.0:1.0:0.0	.	825	Q9H0H0	INT2_HUMAN	S	825;824	ENSP00000414237:P825S	.	P	-	1	0	INTS2	57310037	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.987000	0.93497	2.577000	0.86979	0.650000	0.86243	CCT	INTS2	-	NULL	ENSG00000108506		0.313	INTS2-001	KNOWN	basic|CCDS	protein_coding	INTS2	HGNC	protein_coding	OTTHUMT00000445368.1	-	0.00	117	0	G	NM_020748		59955255	-1	tier1	-	no_errors	ENST00000444766	ensembl	human	known	74_37	missense	5.26	72	4	SNP	1.000	A
IQCA1	79781	genome.wustl.edu	37	2	237252386	237252386	+	Intron	SNP	T	T	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr2:237252386T>G	ENST00000409907.3	-	16	2231				IQCA1_ENST00000309507.5_Intron|IQCA1_ENST00000431676.2_Intron	NM_024726.4	NP_079002.3	Q86XH1	IQCA1_HUMAN	IQ motif containing with AAA domain 1								ATP binding (GO:0005524)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(1)	26						ATGCAGCAACTTCGCCAGCAG	0.453											OREG0015318	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001627	intron_variant	0			AK026180	CCDS46549.1, CCDS59441.1, CCDS74677.1	2q37.3	2014-07-18	2008-07-02	2008-07-02	ENSG00000132321	ENSG00000132321		"""ATPases / AAA-type"""	26195	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 11"""		"""IQ motif containing with AAA domain"""	IQCA		23427265	Standard	NM_024726		Approved	FLJ22527, DRC11	uc002vwb.3	Q86XH1	OTTHUMG00000153058	ENST00000409907.3:c.1956+813A>C	2.37:g.237252386T>G		2395	B4DFH9|E7EWQ0|Q4G164|Q53R37|Q53RV3|Q96NS7|Q9H680	Missense_Mutation	SNP	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,pfscan_IQ_motif_EF-hand-BS	p.E660D	ENST00000409907.3	37	c.1980	CCDS46549.1	2	.	.	.	.	.	.	.	.	.	.	T	4.684	0.127092	0.08981	.	.	ENSG00000132321	ENST00000412437	.	.	.	4.66	-9.12	0.00707	.	.	.	.	.	T	0.14570	0.0352	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.19353	-1.0308	5	0.13853	T	0.58	.	6.8079	0.23788	0.1174:0.0797:0.6032:0.1997	.	.	.	.	D	656	.	ENSP00000254653:E660D	E	-	3	2	IQCA1	236917125	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.429000	0.06982	-2.127000	0.00819	-1.444000	0.01066	GAA	IQCA1	-	NULL	ENSG00000132321		0.453	IQCA1-001	KNOWN	basic|CCDS	protein_coding	IQCA1	HGNC	protein_coding	OTTHUMT00000329266.1	-	0.00	55	0	T	NM_024726		237252386	-1	tier1	-	no_errors	ENST00000254653	ensembl	human	known	74_37	missense	38.30	29	18	SNP	0.000	G
IRF2BPL	64207	genome.wustl.edu	37	14	77491802	77491802	+	Silent	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr14:77491802G>A	ENST00000238647.3	-	1	3232	c.2334C>T	c.(2332-2334)ggC>ggT	p.G778G		NM_024496.3	NP_078772.1	Q9H1B7	I2BPL_HUMAN	interferon regulatory factor 2 binding protein-like	778					development of secondary female sexual characteristics (GO:0046543)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular space (GO:0005615)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	11						TCGCGATTTCGCCCTGCATGA	0.572																																																	0													94.0	91.0	92.0					14																	77491802		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ277365	CCDS9854.1	14q24.3	2011-02-23	2011-02-23	2011-02-23	ENSG00000119669	ENSG00000119669			14282	protein-coding gene	gene with protein product	"""enhanced at puberty 1"""	611720	"""chromosome 14 open reading frame 4"""	C14orf4		11095982, 17627301	Standard	NM_024496		Approved	EAP1, KIAA1865	uc001xsy.4	Q9H1B7		ENST00000238647.3:c.2334C>T	14.37:g.77491802G>A			Q8NDQ2|Q96JG2|Q9H3I7	Silent	SNP	pfam_Interferon_reg_fac2-bd1_2_Znf	p.G778	ENST00000238647.3	37	c.2334	CCDS9854.1	14																																																																																			IRF2BPL	-	pfam_Interferon_reg_fac2-bd1_2_Znf	ENSG00000119669		0.572	IRF2BPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRF2BPL	HGNC	protein_coding	OTTHUMT00000414298.1	-	0.00	70	0	G	NM_024496		77491802	-1	tier1	-	no_errors	ENST00000238647	ensembl	human	known	74_37	silent	27.59	42	16	SNP	1.000	A
IRF4	3662	genome.wustl.edu	37	6	401596	401596	+	Missense_Mutation	SNP	G	G	C	rs1050973		TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr6:401596G>C	ENST00000380956.4	+	7	1044	c.918G>C	c.(916-918)aaG>aaC	p.K306N		NM_001195286.1|NM_002460.3	NP_001182215.1|NP_002451.2	Q15306	IRF4_HUMAN	interferon regulatory factor 4	306				K -> N (in Ref. 2; AAB37258). {ECO:0000305}.	cytokine-mediated signaling pathway (GO:0019221)|defense response to protozoan (GO:0042832)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of DNA binding (GO:0043388)|positive regulation of interleukin-10 biosynthetic process (GO:0045082)|positive regulation of interleukin-13 biosynthetic process (GO:0045368)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 biosynthetic process (GO:0045404)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of T-helper cell differentiation (GO:0045622)|T cell activation (GO:0042110)|T-helper 17 cell lineage commitment (GO:0072540)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear nucleosome (GO:0000788)|nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Breast(5;0.0155)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.03)|BRCA - Breast invasive adenocarcinoma(62;0.0702)		ACATTGAGAAGCTGCTGAGCC	0.607			T	IGH@	MM																																			Dom	yes		6	6p25-p23	3662	interferon regulatory factor 4		L	0													53.0	45.0	48.0					6																	401596		2203	4300	6503	SO:0001583	missense	0			U52682	CCDS4469.1	6p25-p23	2008-08-29			ENSG00000137265	ENSG00000137265			6119	protein-coding gene	gene with protein product		601900		MUM1		8921401, 18417578	Standard	NM_002460		Approved	LSIRF	uc003msz.4	Q15306	OTTHUMG00000016294	ENST00000380956.4:c.918G>C	6.37:g.401596G>C	ENSP00000370343:p.Lys306Asn		Q5VUI7|Q99660	Missense_Mutation	SNP	pfam_Interferon_reg_factor-3,pfam_Interferon_reg_fact_DNA-bd_dom,superfamily_SMAD_FHA_domain,smart_Interferon_reg_fact_DNA-bd_dom,prints_Interferon_reg_fact_DNA-bd_dom	p.K306N	ENST00000380956.4	37	c.918	CCDS4469.1	6	.	.	.	.	.	.	.	.	.	.	G	9.016	0.983629	0.18889	.	.	ENSG00000137265	ENST00000380956;ENST00000412334	D	0.94497	-3.44	5.76	0.569	0.17340	SMAD domain-like (1);SMAD/FHA domain (1);Interferon regulatory factor-3 (1);	0.306608	0.39834	N	0.001254	D	0.89389	0.6701	M	0.62723	1.935	0.44188	D	0.997	B;B;B;P	0.41041	0.218;0.36;0.182;0.736	B;B;B;B	0.44278	0.275;0.223;0.18;0.445	D	0.84843	0.0809	10	0.30854	T	0.27	-33.023	10.4756	0.44663	0.6778:0.0:0.3222:0.0	rs1050973	306;336;305;306	F2Z3D5;Q99419;Q15306-2;Q15306	.;.;.;IRF4_HUMAN	N	306;335	ENSP00000370343:K306N	ENSP00000370343:K306N	K	+	3	2	IRF4	346596	0.975000	0.34042	0.997000	0.53966	0.179000	0.23085	0.771000	0.26633	-0.022000	0.13986	-0.150000	0.13652	AAG	IRF4	-	pfam_Interferon_reg_factor-3,superfamily_SMAD_FHA_domain	ENSG00000137265		0.607	IRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRF4	HGNC	protein_coding	OTTHUMT00000043638.1	-	0.00	51	0	G			401596	+1	tier1	rs1050973	no_errors	ENST00000380956	ensembl	human	known	74_37	missense	33.33	18	9	SNP	0.933	C
ITGA1	3672	genome.wustl.edu	37	5	52233285	52233285	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr5:52233285C>A	ENST00000282588.6	+	24	3477	c.3019C>A	c.(3019-3021)Ccc>Acc	p.P1007T	CTD-2175A23.1_ENST00000503559.1_RNA|CTD-2175A23.1_ENST00000505701.1_RNA	NM_181501.1	NP_852478.1	P56199	ITA1_HUMAN	integrin, alpha 1	1007					activation of MAPK activity (GO:0000187)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular extravasation (GO:0045123)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neutrophil chemotaxis (GO:0030593)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|vasodilation (GO:0042311)	acrosomal vesicle (GO:0001669)|basal part of cell (GO:0045178)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha1-beta1 complex (GO:0034665)|integrin complex (GO:0008305)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|protein phosphatase binding (GO:0019903)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(19)|ovary(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				AATTTCATTCCCCAATATGAC	0.363																																																	0													226.0	213.0	218.0					5																	52233285		2203	4300	6503	SO:0001583	missense	0			X68742	CCDS3955.1	5q11.1	2010-03-23			ENSG00000213949	ENSG00000213949		"""CD molecules"", ""Integrins"""	6134	protein-coding gene	gene with protein product		192968				8428973, 11937138	Standard	NM_181501		Approved	VLA1, CD49a	uc003jou.3	P56199	OTTHUMG00000131163	ENST00000282588.6:c.3019C>A	5.37:g.52233285C>A	ENSP00000282588:p.Pro1007Thr		B2RNU0	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.P1007T	ENST00000282588.6	37	c.3019	CCDS3955.1	5	.	.	.	.	.	.	.	.	.	.	C	21.8	4.201387	0.79015	.	.	ENSG00000213949	ENST00000282588	D	0.88124	-2.34	5.69	5.69	0.88448	Integrin alpha-2 (1);	0.177749	0.49916	D	0.000140	D	0.91600	0.7346	L	0.50333	1.59	0.54753	D	0.999986	D	0.89917	1.0	D	0.77557	0.99	D	0.92077	0.5669	10	0.87932	D	0	.	16.731	0.85435	0.0:1.0:0.0:0.0	.	1007	P56199	ITA1_HUMAN	T	1007	ENSP00000282588:P1007T	ENSP00000282588:P1007T	P	+	1	0	ITGA1	52269042	1.000000	0.71417	0.995000	0.50966	0.975000	0.68041	4.586000	0.60984	2.688000	0.91661	0.585000	0.79938	CCC	ITGA1	-	pfam_Integrin_alpha-2	ENSG00000213949		0.363	ITGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA1	HGNC	protein_coding	OTTHUMT00000253855.3		0.00	99	0	C	NM_181501		52233285	+1			no_errors	ENST00000282588	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	A
ITGA1	3672	genome.wustl.edu	37	5	52240786	52240786	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr5:52240786G>T	ENST00000282588.6	+	27	3757	c.3299G>T	c.(3298-3300)aGc>aTc	p.S1100I	CTD-2175A23.1_ENST00000503559.1_RNA|CTD-2175A23.1_ENST00000505701.1_RNA	NM_181501.1	NP_852478.1	P56199	ITA1_HUMAN	integrin, alpha 1	1100					activation of MAPK activity (GO:0000187)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular extravasation (GO:0045123)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neutrophil chemotaxis (GO:0030593)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|vasodilation (GO:0042311)	acrosomal vesicle (GO:0001669)|basal part of cell (GO:0045178)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha1-beta1 complex (GO:0034665)|integrin complex (GO:0008305)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|protein phosphatase binding (GO:0019903)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(19)|ovary(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				TATTTTTCCAGCTTAAATCTT	0.333																																																	0													96.0	107.0	103.0					5																	52240786		2203	4299	6502	SO:0001583	missense	0			X68742	CCDS3955.1	5q11.1	2010-03-23			ENSG00000213949	ENSG00000213949		"""CD molecules"", ""Integrins"""	6134	protein-coding gene	gene with protein product		192968				8428973, 11937138	Standard	NM_181501		Approved	VLA1, CD49a	uc003jou.3	P56199	OTTHUMG00000131163	ENST00000282588.6:c.3299G>T	5.37:g.52240786G>T	ENSP00000282588:p.Ser1100Ile		B2RNU0	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.S1100I	ENST00000282588.6	37	c.3299	CCDS3955.1	5	.	.	.	.	.	.	.	.	.	.	G	18.25	3.582568	0.65992	.	.	ENSG00000213949	ENST00000282588	T	0.46063	0.88	5.63	5.63	0.86233	.	0.121096	0.85682	D	0.000000	T	0.33990	0.0882	L	0.50333	1.59	0.45762	D	0.998652	P	0.43973	0.823	B	0.32090	0.14	T	0.14337	-1.0476	10	0.22706	T	0.39	.	16.9486	0.86237	0.0:0.0:1.0:0.0	.	1100	P56199	ITA1_HUMAN	I	1100	ENSP00000282588:S1100I	ENSP00000282588:S1100I	S	+	2	0	ITGA1	52276543	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.935000	0.56560	2.797000	0.96272	0.655000	0.94253	AGC	ITGA1	-	NULL	ENSG00000213949		0.333	ITGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA1	HGNC	protein_coding	OTTHUMT00000253855.3		0.00	64	0	G	NM_181501		52240786	+1			no_errors	ENST00000282588	ensembl	human	known	74_37	missense	6.25	30	2	SNP	1.000	T
ITGAL	3683	genome.wustl.edu	37	16	30490755	30490755	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr16:30490755G>T	ENST00000356798.6	+	6	729	c.549G>T	c.(547-549)atG>atT	p.M183I	ITGAL_ENST00000454514.2_Intron|RP11-297C4.2_ENST00000569459.1_RNA|RP11-297C4.3_ENST00000562525.1_RNA|ITGAL_ENST00000433423.2_Intron|ITGAL_ENST00000358164.5_Intron	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	183	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	AGGATGTGATGAAGAAACTCA	0.408																																					NSCLC(110;1462 1641 3311 33990 49495)												0													82.0	74.0	77.0					16																	30490755		2197	4300	6497	SO:0001583	missense	0				CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.549G>T	16.37:g.30490755G>T	ENSP00000349252:p.Met183Ile		O43746|Q45H73|Q96HB1|Q9UBC8	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,prints_Integrin_alpha,pfscan_VWF_A	p.M183I	ENST00000356798.6	37	c.549	CCDS32433.1	16	.	.	.	.	.	.	.	.	.	.	G	23.0	4.362380	0.82353	.	.	ENSG00000005844	ENST00000356798	T	0.80033	-1.33	5.85	4.9	0.64082	von Willebrand factor, type A (3);	0.000000	0.64402	D	0.000003	D	0.82829	0.5122	L	0.39898	1.24	0.80722	D	1	P	0.49090	0.919	P	0.59825	0.864	T	0.82862	-0.0247	10	0.48119	T	0.1	.	12.1823	0.54218	0.08:0.0:0.92:0.0	.	183	P20701	ITAL_HUMAN	I	183	ENSP00000349252:M183I	ENSP00000349252:M183I	M	+	3	0	ITGAL	30398256	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.713000	0.61895	1.489000	0.48450	0.411000	0.27672	ATG	ITGAL	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000005844		0.408	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGAL	HGNC	protein_coding	OTTHUMT00000434508.2		0.00	74	0	G			30490755	+1			no_errors	ENST00000356798	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	T
ITIH5	80760	genome.wustl.edu	37	10	7611473	7611473	+	Intron	SNP	A	A	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr10:7611473A>C	ENST00000256861.6	-	12	2228				ITIH5_ENST00000446830.2_Intron|ITIH5_ENST00000298441.6_Intron|ITIH5_ENST00000397146.2_Intron|ITIH5_ENST00000434980.1_5'Flank	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5						hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						cggatgcataagtccaggagc	0.512																																																	0																																										SO:0001627	intron_variant	0					10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.2149+157T>G	10.37:g.7611473A>C			Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	RNA	SNP	-	NULL	ENST00000256861.6	37	NULL		10																																																																																			ITIH5	-	-	ENSG00000123243		0.512	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	ITIH5	HGNC	protein_coding	OTTHUMT00000046688.1	-	0.00	23	0	A	NM_030569		7611473	-1	tier1	-	no_errors	ENST00000492668	ensembl	human	putative	74_37	rna	20.00	16	4	SNP	0.006	C
IVL	3713	genome.wustl.edu	37	1	152882956	152882956	+	Missense_Mutation	SNP	A	A	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:152882956A>G	ENST00000368764.3	+	2	747	c.683A>G	c.(682-684)cAg>cGg	p.Q228R	IVL_ENST00000392667.2_Missense_Mutation_p.Q82R			P07476	INVO_HUMAN	involucrin	228	39 X 10 AA approximate tandem repeats of [LP]-[EKG]-[LHVYQEK]-[PLSQE]-[EQDV]- [QHEKRGA]-Q-[EMVQLP]-[GKLE]-[QHVNLD].				isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			ctcccagagcagcaggagggg	0.687																																																	0													2.0	2.0	2.0					1																	152882956		1234	2870	4104	SO:0001583	missense	0			BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.683A>G	1.37:g.152882956A>G	ENSP00000357753:p.Gln228Arg		Q5T7P4	Missense_Mutation	SNP	pfam_Involucrin_N,pfam_Involucrin_rpt	p.Q228R	ENST00000368764.3	37	c.683	CCDS1030.1	1	.	.	.	.	.	.	.	.	.	.	A	7.980	0.751000	0.15778	.	.	ENSG00000163207	ENST00000368764;ENST00000392667	T;T	0.11495	3.01;2.77	3.86	2.61	0.31194	.	.	.	.	.	T	0.07503	0.0189	L	0.34521	1.04	0.09310	N	1	D	0.59357	0.985	P	0.58660	0.843	T	0.26916	-1.0089	9	0.38643	T	0.18	.	8.47	0.32980	0.7474:0.2526:0.0:0.0	.	228	P07476	INVO_HUMAN	R	228;82	ENSP00000357753:Q228R;ENSP00000376435:Q82R	ENSP00000357753:Q228R	Q	+	2	0	IVL	151149580	0.000000	0.05858	0.006000	0.13384	0.002000	0.02628	-0.127000	0.10547	1.556000	0.49512	0.339000	0.21740	CAG	IVL	-	pfam_Involucrin_rpt	ENSG00000163207		0.687	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IVL	HGNC	protein_coding	OTTHUMT00000034664.1	-	0.00	41	0	A	NM_005547		152882956	+1	tier1	-	no_errors	ENST00000368764	ensembl	human	known	74_37	missense	21.43	33	9	SNP	0.005	G
KCNA5	3741	genome.wustl.edu	37	12	5154628	5154628	+	Missense_Mutation	SNP	T	T	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr12:5154628T>G	ENST00000252321.3	+	1	1544	c.1315T>G	c.(1315-1317)Ttc>Gtc	p.F439V		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	439					atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	GCTGCTCATCTTCTTCCTCTT	0.592																																																	0													56.0	52.0	53.0					12																	5154628		2203	4297	6500	SO:0001583	missense	0			M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.1315T>G	12.37:g.5154628T>G	ENSP00000252321:p.Phe439Val		Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,pfam_PKD1_2_channel,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1.5,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.F439V	ENST00000252321.3	37	c.1315	CCDS8536.1	12	.	.	.	.	.	.	.	.	.	.	T	15.98	2.993406	0.54041	.	.	ENSG00000130037	ENST00000252321	D	0.98313	-4.86	4.87	3.73	0.42828	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98435	0.9479	M	0.73430	2.235	0.80722	D	1	D	0.56287	0.975	D	0.67900	0.954	D	0.98554	1.0638	10	0.87932	D	0	.	9.8069	0.40799	0.0:0.0804:0.0:0.9196	.	439	P22460	KCNA5_HUMAN	V	439	ENSP00000252321:F439V	ENSP00000252321:F439V	F	+	1	0	KCNA5	5024889	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.786000	0.85741	0.899000	0.36444	0.459000	0.35465	TTC	KCNA5	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_K_chnl,prints_K_chnl_volt-dep_Kv	ENSG00000130037		0.592	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA5	HGNC	protein_coding	OTTHUMT00000398925.2	-	0.00	36	0	T	NM_002234		5154628	+1	tier1	-	no_errors	ENST00000252321	ensembl	human	known	74_37	missense	36.36	21	12	SNP	1.000	G
KCNMA1	3778	genome.wustl.edu	37	10	78734121	78734121	+	Intron	SNP	A	A	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr10:78734121A>C	ENST00000286628.8	-	20	2266				RP11-443A13.5_ENST00000598613.1_RNA|KCNMA1_ENST00000372440.1_Intron|KCNMA1_ENST00000404857.1_Intron|KCNMA1_ENST00000354353.5_Intron|RP11-443A13.5_ENST00000600782.1_RNA|RP11-443A13.5_ENST00000458661.2_RNA|KCNMA1_ENST00000404771.3_Intron|KCNMA1_ENST00000406533.3_Intron|KCNMA1_ENST00000372443.1_Intron|KCNMA1_ENST00000286627.5_Intron	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1						blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	CAACAAGCTAAGTGCAAGCTG	0.423																																																	0																																										SO:0001627	intron_variant	0			U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.2267-4296T>G	10.37:g.78734121A>C			F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	RNA	SNP	-	NULL	ENST00000286628.8	37	NULL		10																																																																																			KCNMA1	-	-	ENSG00000156113		0.423	KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	KCNMA1	HGNC	protein_coding	OTTHUMT00000048885.3	-	0.00	29	0	A	NM_002247		78734121	-1	tier1	-	no_errors	ENST00000475352	ensembl	human	known	74_37	rna	37.14	22	13	SNP	0.248	C
KCP	375616	genome.wustl.edu	37	7	128531839	128531839	+	RNA	SNP	G	G	A	rs373548770		TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr7:128531839G>A	ENST00000476647.2	-	0	1698							Q6ZWJ8	KCP_HUMAN	kielin/chordin-like protein							extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)	4						AGAAGCTCTCGCCGTCCACAA	0.677																																																	0								G	,	1,1383		0,1,691	51.0	56.0	54.0		1482,1656	-9.6	0.0	7		54	0,3182		0,0,1591	no	coding-synonymous,coding-synonymous	KCP	NM_001135914.1,NM_199349.2	,	0,1,2282	AA,AG,GG		0.0,0.0723,0.0219	,	494/1504,552/815	128531839	1,4565	692	1591	2283			0			AK122706		7q32.3	2009-11-06	2009-02-18	2009-02-18	ENSG00000135253	ENSG00000135253			17585	protein-coding gene	gene with protein product	"""kielin"""	609344	"""cysteine rich BMP regulator 2 (chordin-like)"""	CRIM2		15793581	Standard	NM_001135914		Approved	FLJ33365, NET67	uc011kor.2	Q6ZWJ8	OTTHUMG00000158363		7.37:g.128531839G>A			Q8NBE0	RNA	SNP	-	NULL	ENST00000476647.2	37	NULL		7																																																																																			KCP	-	-	ENSG00000135253		0.677	KCP-006	KNOWN	basic	processed_transcript	KCP	HGNC	processed_transcript	OTTHUMT00000403051.1	-	0.00	33	0	G	NM_199349		128531839	-1	tier1	-	no_errors	ENST00000297801	ensembl	human	known	74_37	rna	38.46	8	5	SNP	0.079	A
KHDRBS2	202559	genome.wustl.edu	37	6	62995778	62995778	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr6:62995778G>A	ENST00000281156.4	-	1	354	c.76C>T	c.(76-78)Cgc>Tgc	p.R26C		NM_152688.2	NP_689901.2	Q5VWX1	KHDR2_HUMAN	KH domain containing, RNA binding, signal transduction associated 2	26					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) binding (GO:0008143)|poly(U) RNA binding (GO:0008266)			NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|liver(1)|lung(13)|ovary(3)|prostate(3)|skin(12)|upper_aerodigestive_tract(2)|urinary_tract(1)	49				BRCA - Breast invasive adenocarcinoma(397;0.149)		GCCAAAAGGCGCGACGCATGC	0.567																																																	0													114.0	87.0	96.0					6																	62995778		2203	4300	6503	SO:0001583	missense	0			BC034043	CCDS4963.1	6q11.1	2013-09-20			ENSG00000112232	ENSG00000112232			18114	protein-coding gene	gene with protein product	"""Sam68-like mammalian protein 1"""	610487					Standard	NM_152688		Approved	SLM1, SLM-1, MGC26664	uc003peg.2	Q5VWX1	OTTHUMG00000014936	ENST00000281156.4:c.76C>T	6.37:g.62995778G>A	ENSP00000281156:p.Arg26Cys		A8K7M8|Q8N4I4|Q8TCZ4	Missense_Mutation	SNP	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	p.R26C	ENST00000281156.4	37	c.76	CCDS4963.1	6	.	.	.	.	.	.	.	.	.	.	G	22.7	4.320909	0.81469	.	.	ENSG00000112232	ENST00000281156;ENST00000539571	T	0.55760	0.5	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.61862	0.2381	M	0.65975	2.015	0.80722	D	1	D	0.89917	1.0	D	0.63033	0.91	T	0.66304	-0.5957	10	0.87932	D	0	.	14.7163	0.69272	0.0:0.0:1.0:0.0	.	26	Q5VWX1	KHDR2_HUMAN	C	26	ENSP00000281156:R26C	ENSP00000281156:R26C	R	-	1	0	KHDRBS2	63053737	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.569000	0.82380	2.543000	0.85770	0.555000	0.69702	CGC	KHDRBS2	-	NULL	ENSG00000112232		0.567	KHDRBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KHDRBS2	HGNC	protein_coding	OTTHUMT00000041066.2	-	0.00	60	0	G	NM_152688		62995778	-1	tier1	-	no_errors	ENST00000281156	ensembl	human	known	74_37	missense	23.91	35	11	SNP	1.000	A
KIAA1217	56243	genome.wustl.edu	37	10	24762740	24762740	+	Missense_Mutation	SNP	G	G	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr10:24762740G>C	ENST00000376454.3	+	6	1460	c.1430G>C	c.(1429-1431)aGa>aCa	p.R477T	KIAA1217_ENST00000458595.1_Missense_Mutation_p.R477T|KIAA1217_ENST00000396445.1_Missense_Mutation_p.R195T|KIAA1217_ENST00000430453.2_Missense_Mutation_p.R398T|KIAA1217_ENST00000376452.3_Missense_Mutation_p.R477T|KIAA1217_ENST00000307544.6_Missense_Mutation_p.R195T|KIAA1217_ENST00000396446.1_Missense_Mutation_p.R195T|KIAA1217_ENST00000376462.1_Missense_Mutation_p.R397T|KIAA1217_ENST00000376451.2_Missense_Mutation_p.R195T	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	477					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						TCTCCTCACAGAGTCAGTGAC	0.552																																																	0													96.0	82.0	87.0					10																	24762740		2203	4300	6503	SO:0001583	missense	0			BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.1430G>C	10.37:g.24762740G>C	ENSP00000365637:p.Arg477Thr		A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Missense_Mutation	SNP	pfam_AIP3_C	p.R477T	ENST00000376454.3	37	c.1430	CCDS31165.1	10	.	.	.	.	.	.	.	.	.	.	G	16.18	3.050519	0.55218	.	.	ENSG00000120549	ENST00000376462;ENST00000376456;ENST00000458595;ENST00000442879;ENST00000376454;ENST00000376452;ENST00000438429;ENST00000430453;ENST00000307544;ENST00000450158;ENST00000396445;ENST00000376451;ENST00000396446	T;T;T;T;T;T;T;T;T;T;T	0.51071	0.72;0.72;0.72;0.72;0.72;0.72;0.72;0.72;0.72;0.72;0.72	5.65	5.65	0.86999	.	0.055127	0.64402	D	0.000001	T	0.71031	0.3292	M	0.74881	2.28	0.58432	D	0.999999	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;0.998;1.0	D;D;D;D;D;D;D;D	0.91635	0.998;0.999;0.998;0.998;0.999;0.998;0.995;0.997	T	0.72997	-0.4121	10	0.72032	D	0.01	.	19.7032	0.96063	0.0:0.0:1.0:0.0	.	477;477;195;195;195;195;477;477	Q5T5P2-7;A6NLF3;Q5T5P2-4;Q5T5P2-8;Q5T5P2-3;Q5T5P2-6;Q5T5P2;Q5T5P2-2	.;.;.;.;.;.;SKT_HUMAN;.	T	397;477;477;195;477;477;327;398;195;195;195;195;195	ENSP00000365645:R397T;ENSP00000365639:R477T;ENSP00000392625:R477T;ENSP00000365637:R477T;ENSP00000365635:R477T;ENSP00000404798:R327T;ENSP00000389680:R398T;ENSP00000302343:R195T;ENSP00000379722:R195T;ENSP00000365634:R195T;ENSP00000379723:R195T	ENSP00000302343:R195T	R	+	2	0	KIAA1217	24802746	1.000000	0.71417	0.915000	0.36163	0.049000	0.14656	9.185000	0.94900	2.671000	0.90904	0.655000	0.94253	AGA	KIAA1217	-	NULL	ENSG00000120549		0.552	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1217	HGNC	protein_coding	OTTHUMT00000047223.2	-	0.00	64	0	G	NM_019590		24762740	+1	tier1	-	no_errors	ENST00000376454	ensembl	human	known	74_37	missense	37.14	22	13	SNP	0.999	C
KMT2A	4297	genome.wustl.edu	37	11	118366503	118366503	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr11:118366503G>A	ENST00000389506.5	+	19	5443	c.5443G>A	c.(5443-5445)Gag>Aag	p.E1815K	KMT2A_ENST00000534358.1_Missense_Mutation_p.E1818K|KMT2A_ENST00000354520.4_Missense_Mutation_p.E1777K			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	1815					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										CAGCCACACTGAGCAGCCTCC	0.478																																																	0													132.0	135.0	134.0					11																	118366503		2200	4296	6496	SO:0001583	missense	0			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.5443G>A	11.37:g.118366503G>A	ENSP00000374157:p.Glu1815Lys		E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_Bromodomain,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pirsf_MeTrfase_trithorax,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC,pfscan_Bromodomain	p.E1815K	ENST00000389506.5	37	c.5443	CCDS31686.1	11	.	.	.	.	.	.	.	.	.	.	G	15.03	2.712696	0.48517	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313	D;D;D	0.82081	-1.57;-1.56;-1.52	5.66	5.66	0.87406	.	0.053759	0.64402	D	0.000001	T	0.56093	0.1962	N	0.02011	-0.69	0.45607	D	0.99854	B;B	0.27229	0.136;0.172	B;B	0.23275	0.045;0.015	T	0.60556	-0.7240	10	0.07175	T	0.84	.	9.8199	0.40876	0.0727:0.1409:0.7863:0.0	.	1818;1815	E9PQG7;Q03164	.;MLL1_HUMAN	K	1818;1815;1777;725	ENSP00000436786:E1818K;ENSP00000374157:E1815K;ENSP00000346516:E1777K	ENSP00000346516:E1777K	E	+	1	0	MLL	117871713	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.525000	0.67110	2.830000	0.97506	0.585000	0.79938	GAG	KMT2A	-	pirsf_MeTrfase_trithorax	ENSG00000118058		0.478	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2A	HGNC	protein_coding	OTTHUMT00000399085.2	-	0.00	74	0	G	NM_005933		118366503	+1	tier1	-	no_errors	ENST00000389506	ensembl	human	known	74_37	missense	36.96	29	17	SNP	1.000	A
KRT15	3866	genome.wustl.edu	37	17	39673193	39673193	+	Missense_Mutation	SNP	C	C	T	rs200854917		TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr17:39673193C>T	ENST00000254043.3	-	3	4190	c.605G>A	c.(604-606)cGc>cAc	p.R202H	KRT15_ENST00000393981.3_Missense_Mutation_p.R37H|KRT15_ENST00000393974.3_Missense_Mutation_p.R37H|KRT15_ENST00000393976.2_Missense_Mutation_p.R202H	NM_002275.3	NP_002266	P19012	K1C15_HUMAN	keratin 15	202	Coil 1B.|Rod.				epidermis development (GO:0008544)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16		Breast(137;0.000286)				AACGCCCTGGCGCAGGGCCAG	0.602																																																	0													72.0	74.0	73.0					17																	39673193		2203	4300	6503	SO:0001583	missense	0				CCDS11398.1	17q21.2	2013-06-20			ENSG00000171346	ENSG00000171346		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6421	protein-coding gene	gene with protein product	"""keratin-15, basic"", ""keratin-15, beta"", ""type I cytoskeletal 15"", ""cytokeratin 15"""	148030				16831889	Standard	NM_002275		Approved	K15, CK15, K1CO	uc002hwy.3	P19012	OTTHUMG00000133435	ENST00000254043.3:c.605G>A	17.37:g.39673193C>T	ENSP00000254043:p.Arg202His		B3KQY1|B3KRA2|E0CX14|Q53XV8|Q9BUG4	Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.R202H	ENST00000254043.3	37	c.605	CCDS11398.1	17	.	.	.	.	.	.	.	.	.	.	C	20.6	4.015646	0.75161	.	.	ENSG00000171346	ENST00000254043;ENST00000393974;ENST00000393976;ENST00000393981;ENST00000458290	D;D;D;D;D	0.91945	-2.94;-2.94;-2.94;-2.94;-2.94	4.86	3.86	0.44501	Filament (1);	0.000000	0.50627	D	0.000119	D	0.95014	0.8386	M	0.84683	2.71	0.52501	D	0.999952	D;D;D	0.69078	0.973;0.982;0.997	P;P;P	0.57846	0.828;0.749;0.828	D	0.94978	0.8123	10	0.54805	T	0.06	.	13.6849	0.62511	0.0:0.9237:0.0:0.0763	.	37;202;202	A8MT21;B3KVF5;P19012	.;.;K1C15_HUMAN	H	202;37;202;37;37	ENSP00000254043:R202H;ENSP00000377544:R37H;ENSP00000377546:R202H;ENSP00000377550:R37H;ENSP00000409282:R37H	ENSP00000254043:R202H	R	-	2	0	KRT15	36926719	0.964000	0.33143	1.000000	0.80357	0.353000	0.29299	2.076000	0.41548	2.514000	0.84764	0.650000	0.86243	CGC	KRT15	-	pfam_IF	ENSG00000171346		0.602	KRT15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT15	HGNC	protein_coding	OTTHUMT00000257301.1	-	0.00	77	0	C	NM_002275		39673193	-1	tier1	rs200854917	no_errors	ENST00000254043	ensembl	human	known	74_37	missense	25.00	30	10	SNP	1.000	T
KRT18	3875	genome.wustl.edu	37	12	53345361	53345361	+	Missense_Mutation	SNP	A	A	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr12:53345361A>G	ENST00000388835.3	+	4	964	c.754A>G	c.(754-756)Atc>Gtc	p.I252V	KRT18_ENST00000388837.2_Missense_Mutation_p.I252V|KRT8_ENST00000552551.1_5'Flank|KRT8_ENST00000546897.1_5'Flank|AC107016.2_ENST00000581256.1_RNA|KRT18_ENST00000550600.1_Missense_Mutation_p.I252V|KRT8_ENST00000549198.1_5'Flank	NM_000224.2	NP_000215.1	P05783	K1C18_HUMAN	keratin 18	252	Coil 2.|Interaction with DNAJB6.|Necessary for interaction with PNN.|Rod.				anatomical structure morphogenesis (GO:0009653)|cell cycle (GO:0007049)|extrinsic apoptotic signaling pathway (GO:0097191)|Golgi to plasma membrane CFTR protein transport (GO:0043000)|hepatocyte apoptotic process (GO:0097284)|intermediate filament cytoskeleton organization (GO:0045104)|negative regulation of apoptotic process (GO:0043066)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	cell periphery (GO:0071944)|centriolar satellite (GO:0034451)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|scaffold protein binding (GO:0097110)|structural molecule activity (GO:0005198)			central_nervous_system(1)|large_intestine(2)|lung(4)|prostate(3)|skin(1)	11						CATGGCAGACATCCGGGCCCA	0.572																																																	0													48.0	53.0	51.0					12																	53345361		2203	4300	6503	SO:0001583	missense	0				CCDS31809.1	12q13	2013-01-16			ENSG00000111057	ENSG00000111057		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6430	protein-coding gene	gene with protein product		148070				1705144, 16831889	Standard	NM_000224		Approved		uc001sbg.3	P05783	OTTHUMG00000169882	ENST00000388835.3:c.754A>G	12.37:g.53345361A>G	ENSP00000373487:p.Ile252Val		Q53G38|Q5U0N8|Q9BW26	Missense_Mutation	SNP	pfam_IF,prints_Keratin_I	p.I252V	ENST00000388835.3	37	c.754	CCDS31809.1	12	.	.	.	.	.	.	.	.	.	.	a	12.04	1.817653	0.32145	.	.	ENSG00000111057	ENST00000388837;ENST00000550600;ENST00000388835	D;D;D	0.89270	-2.49;-2.49;-2.49	3.59	3.59	0.41128	Filament (1);	0.236488	0.28647	N	0.014606	D	0.86493	0.5946	M	0.67700	2.07	0.39250	D	0.964012	B;B	0.22541	0.071;0.025	B;B	0.29716	0.106;0.084	D	0.85104	0.0959	10	0.54805	T	0.06	.	7.1356	0.25527	0.77:0.23:0.0:0.0	.	252;252	F8VZY9;P05783	.;K1C18_HUMAN	V	252	ENSP00000373489:I252V;ENSP00000447278:I252V;ENSP00000373487:I252V	ENSP00000373487:I252V	I	+	1	0	KRT18	51631628	1.000000	0.71417	1.000000	0.80357	0.735000	0.41995	4.886000	0.63149	1.872000	0.54250	0.402000	0.26972	ATC	KRT18	-	pfam_IF,prints_Keratin_I	ENSG00000111057		0.572	KRT18-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT18	HGNC	protein_coding	OTTHUMT00000406405.1	-	0.00	85	0	A	NM_199187		53345361	+1	tier1	-	no_errors	ENST00000388835	ensembl	human	known	74_37	missense	34.33	44	23	SNP	1.000	G
KRT24	192666	genome.wustl.edu	37	17	38856557	38856557	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr17:38856557T>C	ENST00000264651.2	-	4	990	c.934A>G	c.(934-936)Aaa>Gaa	p.K312E		NM_019016.2	NP_061889.2	Q2M2I5	K1C24_HUMAN	keratin 24	312	Linker 12.|Rod.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Breast(137;0.00526)				TTCAGTAATTTGGTCAGGTCG	0.522																																					GBM(61;380 1051 14702 23642 31441)												0													203.0	210.0	207.0					17																	38856557		2203	4300	6503	SO:0001583	missense	0				CCDS11372.1	17q21.2	2013-06-25			ENSG00000167916	ENSG00000167916		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	18527	protein-coding gene	gene with protein product		607742				16831889	Standard	NM_019016		Approved	FLJ20261, MGC138169, MGC138173	uc002hvd.3	Q2M2I5	OTTHUMG00000133372	ENST00000264651.2:c.934A>G	17.37:g.38856557T>C	ENSP00000264651:p.Lys312Glu		Q9NXG7	Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.K312E	ENST00000264651.2	37	c.934	CCDS11372.1	17	.	.	.	.	.	.	.	.	.	.	T	13.57	2.277493	0.40294	.	.	ENSG00000167916	ENST00000264651	T	0.78003	-1.14	5.86	3.66	0.41972	Prefoldin (1);Filament (1);	.	.	.	.	T	0.71492	0.3346	L	0.48935	1.535	0.41578	D	0.988724	P	0.43024	0.798	B	0.42030	0.373	T	0.69087	-0.5238	9	0.52906	T	0.07	.	10.1106	0.42561	0.0:0.135:0.0:0.865	.	312	Q2M2I5	K1C24_HUMAN	E	312	ENSP00000264651:K312E	ENSP00000264651:K312E	K	-	1	0	KRT24	36110083	0.405000	0.25336	0.718000	0.30602	0.711000	0.40976	1.838000	0.39211	0.481000	0.27557	0.460000	0.39030	AAA	KRT24	-	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	ENSG00000167916		0.522	KRT24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT24	HGNC	protein_coding	OTTHUMT00000257217.1	-	0.00	56	0	T	NM_019016		38856557	-1	tier1	-	no_errors	ENST00000264651	ensembl	human	known	74_37	missense	34.29	23	12	SNP	1.000	C
LILRA1	11024	genome.wustl.edu	37	19	55107841	55107841	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr19:55107841C>A	ENST00000251372.3	+	7	1328	c.1146C>A	c.(1144-1146)ttC>ttA	p.F382L	LILRB1_ENST00000396321.2_Intron|LILRB1_ENST00000418536.2_Intron|LILRA1_ENST00000453777.1_Intron|LILRA1_ENST00000473156.1_3'UTR|LILRB1_ENST00000448689.1_Intron	NM_006863.2	NP_006854.1	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1	382	Ig-like C2-type 4.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	47				GBM - Glioblastoma multiforme(193;0.0348)		AGGCTGAATTCCCTATGAGTC	0.587																																																	0													151.0	144.0	147.0					19																	55107841		2203	4300	6503	SO:0001583	missense	0			AF025530	CCDS12901.1, CCDS62802.1	19q13.4	2013-01-11			ENSG00000104974	ENSG00000104974		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6602	protein-coding gene	gene with protein product		604810				9548455	Standard	NM_006863		Approved	LIR-6, CD85i, LIR6	uc002qgh.2	O75019	OTTHUMG00000065701	ENST00000251372.3:c.1146C>A	19.37:g.55107841C>A	ENSP00000251372:p.Phe382Leu		O75018|Q3MJA6	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt,pfscan_Ig-like_dom	p.F382L	ENST00000251372.3	37	c.1146	CCDS12901.1	19	.	.	.	.	.	.	.	.	.	.	C	12.59	1.983038	0.34942	.	.	ENSG00000104974	ENST00000251372	T	0.00642	6.02	1.8	0.73	0.18271	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.954871	0.08577	N	0.925155	T	0.04998	0.0134	H	0.96301	3.8	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.19418	-1.0306	10	0.72032	D	0.01	.	4.5437	0.12071	0.0:0.798:0.0:0.202	.	382	O75019	LIRA1_HUMAN	L	382	ENSP00000251372:F382L	ENSP00000251372:F382L	F	+	3	2	LILRA1	59799653	0.001000	0.12720	0.001000	0.08648	0.004000	0.04260	-0.436000	0.06922	0.328000	0.23435	-1.054000	0.02325	TTC	LILRA1	-	smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt	ENSG00000104974		0.587	LILRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LILRA1	HGNC	protein_coding	OTTHUMT00000140807.2	-	0.00	175	0	C	NM_006863		55107841	+1	tier1	-	no_errors	ENST00000251372	ensembl	human	known	74_37	missense	7.44	111	9	SNP	0.002	A
LINC01020	340094	genome.wustl.edu	37	5	5034556	5034556	+	lincRNA	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr5:5034556G>A	ENST00000508201.1	+	0	85				CTD-2247C11.1_ENST00000509057.1_lincRNA					long intergenic non-protein coding RNA 1020																		aggacaggaggactccaattg	0.463																																																	0																																												0					5p15.32	2013-07-26			ENSG00000215231	ENSG00000215231		"""Long non-coding RNAs"""	27968	non-coding RNA	RNA, long non-coding						12477932	Standard	NR_026994		Approved				OTTHUMG00000161653		5.37:g.5034556G>A				RNA	SNP	-	NULL	ENST00000508201.1	37	NULL		5																																																																																			LINC01020	-	-	ENSG00000215231		0.463	LINC01020-001	KNOWN	basic	lincRNA	LINC01020	HGNC	lincRNA	OTTHUMT00000365595.1		0.00	68	0	G			5034556	+1			no_errors	ENST00000508201	ensembl	human	known	74_37	rna	6.38	44	3	SNP	0.000	A
LMNB2	84823	genome.wustl.edu	37	19	2434893	2434893	+	Missense_Mutation	SNP	T	T	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr19:2434893T>G	ENST00000582871.1	-	6	900	c.814A>C	c.(814-816)Agc>Cgc	p.S272R	LMNB2_ENST00000325327.3_Missense_Mutation_p.S292R	NM_032737.3	NP_116126.3	Q03252	LMNB2_HUMAN	lamin B2	272	Coil 2.|Rod.					lamin filament (GO:0005638)|nuclear inner membrane (GO:0005637)	structural molecule activity (GO:0005198)			NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGTCAGAGCTCAGCTTGGCG	0.746																																																	0													17.0	15.0	16.0					19																	2434893		2186	4281	6467	SO:0001583	missense	0			M94362	CCDS12090.1, CCDS12090.2	19p13.3	2013-01-16			ENSG00000176619	ENSG00000176619		"""Intermediate filaments type V, lamins"""	6638	protein-coding gene	gene with protein product		150341		LMN2		1630457	Standard	NM_032737		Approved		uc002lvy.4	Q03252	OTTHUMG00000150626	ENST00000582871.1:c.814A>C	19.37:g.2434893T>G	ENSP00000462730:p.Ser272Arg		O75292|Q14734|Q96DF6	Missense_Mutation	SNP	pfam_IF,pfam_Lamin_tail_dom,superfamily_Prefoldin	p.S292R	ENST00000582871.1	37	c.874		19	.	.	.	.	.	.	.	.	.	.	T	22.9	4.346240	0.82022	.	.	ENSG00000176619	ENST00000325327	.	.	.	4.43	-3.09	0.05331	Filament (1);	0.664940	0.15024	N	0.284859	T	0.58680	0.2139	M	0.85197	2.74	0.34388	D	0.693834	B	0.31548	0.328	B	0.42112	0.376	T	0.62506	-0.6840	9	0.62326	D	0.03	.	1.8304	0.03129	0.5463:0.136:0.1281:0.1896	.	272	Q03252	LMNB2_HUMAN	R	272	.	ENSP00000327054:S272R	S	-	1	0	LMNB2	2385893	1.000000	0.71417	0.663000	0.29738	0.963000	0.63663	1.493000	0.35605	-0.249000	0.09569	0.459000	0.35465	AGC	LMNB2	-	pfam_IF	ENSG00000176619		0.746	LMNB2-201	KNOWN	basic|appris_principal	protein_coding	LMNB2	HGNC	protein_coding			0.00	13	0	T	NM_032737		2434893	-1			no_errors	ENST00000325327	ensembl	human	known	74_37	missense	30.77	9	4	SNP	0.972	G
FAR2P2	100216479	genome.wustl.edu	37	2	131183142	131183142	+	RNA	DEL	A	A	-			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr2:131183142delA	ENST00000424873.1	-	0	283					NR_046260.1																						GAGTTCAATTAAAAAAATACT	0.343																																																	0																																												0																															2.37:g.131183142delA				RNA	DEL	-	NULL	ENST00000424873.1	37	NULL		2																																																																																			AC140481.1	-	-	ENSG00000178162		0.343	AC140481.1-001	KNOWN	basic	processed_transcript	LOC100288897	Clone_based_vega_gene	pseudogene	OTTHUMT00000333044.1		0.00	40	0	A			131183142	-1	tier1		no_errors	ENST00000438056	ensembl	human	known	74_37	rna	24.24	25	8	DEL	0.203	-
RP11-435B5.5	0	genome.wustl.edu	37	1	143380613	143380613	+	lincRNA	SNP	A	A	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:143380613A>C	ENST00000428624.1	+	0	1783				RP11-435B5.4_ENST00000423249.1_lincRNA																							TGGAAAGTCAAGTATGTATGG	0.323																																																	0																																												0																															1.37:g.143380613A>C				RNA	SNP	-	NULL	ENST00000428624.1	37	NULL		1																																																																																			RP11-435B5.5	-	-	ENSG00000238261		0.323	RP11-435B5.5-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	LOC101927345	Clone_based_vega_gene	lincRNA	OTTHUMT00000037971.1	-	0.00	40	0	A			143380613	+1	tier1	-	no_errors	ENST00000423394	ensembl	human	known	74_37	rna	31.25	11	5	SNP	0.028	C
LOC101929232	101929232	genome.wustl.edu	37	15	29084026	29084026	+	IGR	SNP	T	T	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr15:29084026T>G								RP11-578F21.12 (30582 upstream) : GOLGA6L7P (6080 downstream)																							TCTAAATAACTTGGATGGATT	0.338																																																	0																																										SO:0001628	intergenic_variant	0																															15.37:g.29084026T>G				RNA	SNP	-	NULL		37	NULL		15																																																																																			RP11-578F21.12	-	-	ENSG00000261377	0	0.338					LOC101929232	Clone_based_vega_gene			-	0.00	139	0	T			29084026	+1	tier1	-	no_errors	ENST00000563144	ensembl	human	putative	74_37	rna	34.92	41	22	SNP	0.133	G
LOC285556	285556	genome.wustl.edu	37	4	100574197	100574197	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr4:100574197G>A	ENST00000511828.1	-	1	1608	c.1609C>T	c.(1609-1611)Cgt>Tgt	p.R537C																								TGCTTTGCACGCACGTTGCTA	0.532																																																	0																																										SO:0001583	missense	0																														ENST00000511828.1:c.1609C>T	4.37:g.100574197G>A	ENSP00000427555:p.Arg537Cys			Missense_Mutation	SNP	NULL	p.R537C	ENST00000511828.1	37	c.1609		4	.	.	.	.	.	.	.	.	.	.	G	11.37	1.618345	0.28801	.	.	ENSG00000248713	ENST00000511828	T	0.19250	2.16	4.8	3.94	0.45596	.	.	.	.	.	T	0.17492	0.0420	N	0.14661	0.345	.	.	.	.	.	.	.	.	.	T	0.29640	-1.0005	6	0.42905	T	0.14	.	12.224	0.54449	0.0842:0.0:0.9158:0.0	.	.	.	.	C	537	ENSP00000427555:R537C	ENSP00000427555:R537C	R	-	1	0	RP11-766F14.2	100793220	0.999000	0.42202	1.000000	0.80357	0.997000	0.91878	3.101000	0.50283	1.339000	0.45563	0.655000	0.94253	CGT	RP11-766F14.2	-	NULL	ENSG00000248713		0.532	RP11-766F14.2-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	LOC285556	Clone_based_vega_gene	protein_coding	OTTHUMT00000365456.1	-	0.00	37	0	G			100574197	-1	tier1	-	no_errors	ENST00000511828	ensembl	human	putative	74_37	missense	48.15	14	13	SNP	1.000	A
LRRC74B	400891	genome.wustl.edu	37	22	21414754	21414754	+	Silent	SNP	G	G	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr22:21414754G>T	ENST00000342608.4	+	9	1140	c.1113G>T	c.(1111-1113)gtG>gtT	p.V371V	AC002472.13_ENST00000543388.1_3'UTR|AC002472.13_ENST00000497328.1_3'UTR																lung(2)	2						CTTGCAGAGTGGAGTATAAAA	0.512																																																	0																																										SO:0001819	synonymous_variant	0																														ENST00000342608.4:c.1113G>T	22.37:g.21414754G>T				Silent	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.V371	ENST00000342608.4	37	c.1113		22																																																																																			AC002472.13	-	NULL	ENSG00000187905		0.512	AC002472.13-201	KNOWN	basic|appris_principal	protein_coding	LOC400891	Clone_based_vega_gene	protein_coding		-	0.00	94	0	G			21414754	+1	tier1	-	no_errors	ENST00000342608	ensembl	human	known	74_37	silent	50.00	16	16	SNP	0.098	T
RGPD4	285190	genome.wustl.edu	37	2	108443272	108443272	+	5'Flank	SNP	G	G	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr2:108443272G>C	ENST00000408999.3	+	0	0				RGPD4_ENST00000354986.4_5'Flank|AC096655.2_ENST00000457647.2_lincRNA	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4						protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						GTGCTGCCAAGAGCCCAGCGG	0.652																																																	0																																										SO:0001631	upstream_gene_variant	0			BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208		2.37:g.108443272G>C	Exception_encountered		B9A029	RNA	SNP	-	NULL	ENST00000408999.3	37	NULL	CCDS46381.1	2																																																																																			AC096655.2	-	-	ENSG00000230651		0.652	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	LOC729121	Clone_based_vega_gene	protein_coding	OTTHUMT00000330096.2	-	0.00	30	0	G	XM_496581		108443272	-1	tier1	-	no_errors	ENST00000457647	ensembl	human	known	74_37	rna	42.11	11	8	SNP	0.014	C
LRP12	29967	genome.wustl.edu	37	8	105601095	105601095	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr8:105601095G>A	ENST00000276654.5	-	1	139	c.31C>T	c.(31-33)Ccg>Tcg	p.P11S	RP11-127H5.1_ENST00000521923.1_5'Flank|LRP12_ENST00000424843.2_Missense_Mutation_p.P11S	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	11					endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			CTCCACCGCGGAGACTCTTTT	0.622																																																	0													68.0	56.0	60.0					8																	105601095		2203	4300	6503	SO:0001583	missense	0			AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.31C>T	8.37:g.105601095G>A	ENSP00000276654:p.Pro11Ser		A8K137|B4DRQ2	Missense_Mutation	SNP	pfam_CUB_dom,pfam_LDrepeatLR_classA_rpt,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_LDrepeatLR_classA_rpt,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt	p.P11S	ENST00000276654.5	37	c.31	CCDS6303.1	8	.	.	.	.	.	.	.	.	.	.	G	13.57	2.277912	0.40294	.	.	ENSG00000147650	ENST00000424843;ENST00000276654;ENST00000523830	D;D	0.83075	-1.68;-1.58	4.0	3.12	0.35913	.	0.550330	0.14518	U	0.314626	T	0.66557	0.2801	N	0.08118	0	0.80722	D	1	B;B;B	0.19445	0.036;0.007;0.002	B;B;B	0.12156	0.003;0.007;0.007	T	0.61422	-0.7066	10	0.59425	D	0.04	-1.2386	9.2326	0.37446	0.1061:0.0:0.8939:0.0	.	11;11;11	Q68DE8;Q9Y561-2;Q9Y561	.;.;LRP12_HUMAN	S	11	ENSP00000399148:P11S;ENSP00000276654:P11S	ENSP00000276654:P11S	P	-	1	0	LRP12	105670271	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	2.971000	0.49248	0.873000	0.35799	0.655000	0.94253	CCG	LRP12	-	NULL	ENSG00000147650		0.622	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LRP12	HGNC	protein_coding	OTTHUMT00000380821.1	-	0.00	164	0	G	NM_013437		105601095	-1	tier1	-	no_errors	ENST00000424843	ensembl	human	known	74_37	missense	11.59	122	16	SNP	1.000	A
LRRIQ1	84125	genome.wustl.edu	37	12	85446011	85446011	+	Missense_Mutation	SNP	G	G	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr12:85446011G>C	ENST00000393217.2	+	7	796	c.735G>C	c.(733-735)gaG>gaC	p.E245D		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	245	Glu-rich.									breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		TTTGGAAAGAGAAATTTAAAC	0.259																																																	0													69.0	81.0	77.0					12																	85446011		2189	4270	6459	SO:0001583	missense	0			AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.735G>C	12.37:g.85446011G>C	ENSP00000376910:p.Glu245Asp		Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,smart_Leu-rich_rpt_typical-subtyp,pfscan_IQ_motif_EF-hand-BS	p.E245D	ENST00000393217.2	37	c.735	CCDS41816.1	12	.	.	.	.	.	.	.	.	.	.	G	11.31	1.602066	0.28534	.	.	ENSG00000133640	ENST00000256007;ENST00000393217	T	0.60797	0.16	5.41	-1.72	0.08107	.	0.323644	0.30949	N	0.008542	T	0.43344	0.1243	L	0.46157	1.445	0.25423	N	0.988255	B	0.29378	0.243	B	0.34452	0.183	T	0.28650	-1.0037	10	0.34782	T	0.22	.	4.7373	0.12995	0.5065:0.0:0.3412:0.1522	.	245	Q96JM4	LRIQ1_HUMAN	D	245	ENSP00000376910:E245D	ENSP00000256007:E245D	E	+	3	2	LRRIQ1	83970142	0.859000	0.29813	0.992000	0.48379	0.356000	0.29392	-0.310000	0.08135	-0.272000	0.09259	-0.350000	0.07774	GAG	LRRIQ1	-	NULL	ENSG00000133640		0.259	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRIQ1	HGNC	protein_coding	OTTHUMT00000388249.2	-	0.00	48	0	G	NM_032165		85446011	+1	tier1	-	no_errors	ENST00000393217	ensembl	human	known	74_37	missense	14.29	36	6	SNP	0.989	C
LRRIQ1	84125	genome.wustl.edu	37	12	85518039	85518039	+	Missense_Mutation	SNP	A	A	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr12:85518039A>G	ENST00000393217.2	+	17	3810	c.3749A>G	c.(3748-3750)tAc>tGc	p.Y1250C		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1250										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		GGAGTCTTCTACTCTTGTGCA	0.473																																																	0													103.0	106.0	105.0					12																	85518039		2203	4300	6503	SO:0001583	missense	0			AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.3749A>G	12.37:g.85518039A>G	ENSP00000376910:p.Tyr1250Cys		Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,smart_Leu-rich_rpt_typical-subtyp,pfscan_IQ_motif_EF-hand-BS	p.Y1250C	ENST00000393217.2	37	c.3749	CCDS41816.1	12	.	.	.	.	.	.	.	.	.	.	A	10.40	1.340310	0.24339	.	.	ENSG00000133640	ENST00000256007;ENST00000378580;ENST00000393217	T	0.50813	0.73	5.45	-2.45	0.06481	.	2.919130	0.02481	N	0.088491	T	0.26521	0.0648	N	0.14661	0.345	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.09530	-1.0670	10	0.38643	T	0.18	.	0.7805	0.01040	0.2947:0.11:0.1785:0.4168	.	1250;1225	Q96JM4;C9JI57	LRIQ1_HUMAN;.	C	1250;1225;1250	ENSP00000376910:Y1250C	ENSP00000256007:Y1250C	Y	+	2	0	LRRIQ1	84042170	0.000000	0.05858	0.000000	0.03702	0.056000	0.15407	0.296000	0.19083	-0.233000	0.09797	0.377000	0.23210	TAC	LRRIQ1	-	NULL	ENSG00000133640		0.473	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRIQ1	HGNC	protein_coding	OTTHUMT00000388249.2	-	0.00	52	0	A	NM_032165		85518039	+1	tier1	-	no_errors	ENST00000393217	ensembl	human	known	74_37	missense	25.93	20	7	SNP	0.000	G
LTBP4	8425	genome.wustl.edu	37	19	41105104	41105104	+	De_novo_Start_InFrame	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr19:41105104G>A	ENST00000545697.1	+	0	18				LTBP4_ENST00000204005.9_Splice_Site_p.A6A|LTBP4_ENST00000602240.1_3'UTR|LTBP4_ENST00000396819.3_5'Flank|LTBP4_ENST00000308370.7_Splice_Site_p.V50I			Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding protein 4						extracellular matrix organization (GO:0030198)|growth hormone secretion (GO:0030252)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|regulation of cell differentiation (GO:0045595)|regulation of cell growth (GO:0001558)|regulation of proteolysis (GO:0030162)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|integrin binding (GO:0005178)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			TATTTATAGCGTTGCTGTTTG	0.582											OREG0025473	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													38.0	41.0	40.0					19																	41105104		1959	4133	6092			0			Y13622	CCDS74368.1, CCDS74369.1, CCDS74370.1	19q13.1-q13.2	2011-10-20				ENSG00000090006		"""Latent transforming growth factor, beta binding proteins"""	6717	protein-coding gene	gene with protein product		604710				9660815, 9271198	Standard	NM_003573		Approved	LTBP-4, LTBP-4L, FLJ46318, FLJ90018	uc002ooh.1	Q8N2S1			19.37:g.41105104G>A		898	O00508|O75412|O75413	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.V50I	ENST00000545697.1	37	c.148		19	.	.	.	.	.	.	.	.	.	.	G	8.852	0.944770	0.18356	.	.	ENSG00000090006	ENST00000308370	T	0.81078	-1.45	3.5	-7.0	0.01599	.	.	.	.	.	T	0.61837	0.2379	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.45338	-0.9268	8	0.34782	T	0.22	.	5.782	0.18312	0.4016:0.4101:0.1883:0.0	.	50	Q8N2S1	LTBP4_HUMAN	I	50	ENSP00000311905:V50I	ENSP00000311905:V50I	V	+	1	0	LTBP4	45796944	0.000000	0.05858	0.000000	0.03702	0.806000	0.45545	-0.830000	0.04410	-1.109000	0.02996	0.455000	0.32223	GTT	LTBP4	-	NULL	ENSG00000090006		0.582	LTBP4-205	KNOWN	basic	protein_coding	LTBP4	HGNC	protein_coding		-	0.00	53	0	G	NM_003573		41105104	+1	tier1	-	no_errors	ENST00000308370	ensembl	human	known	74_37	missense	18.60	34	8	SNP	0.000	A
MADD	8567	genome.wustl.edu	37	11	47330888	47330888	+	Missense_Mutation	SNP	G	G	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr11:47330888G>C	ENST00000311027.5	+	27	4153	c.3988G>C	c.(3988-3990)Gat>Cat	p.D1330H	MADD_ENST00000402192.2_Missense_Mutation_p.D1270H|MADD_ENST00000402799.1_Missense_Mutation_p.D1228H|MADD_ENST00000405573.2_Missense_Mutation_p.D140H|MADD_ENST00000342922.4_Missense_Mutation_p.D1271H|MADD_ENST00000407859.3_Missense_Mutation_p.D1248H|MADD_ENST00000406482.1_Missense_Mutation_p.D1228H|MADD_ENST00000349238.3_Missense_Mutation_p.D1291H|MADD_ENST00000395336.3_Missense_Mutation_p.D1330H|MADD_ENST00000395344.3_Missense_Mutation_p.D1224H	NM_003682.3	NP_003673.3			MAP-kinase activating death domain											breast(7)|central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(19)|lung(26)|ovary(6)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	84				Lung(87;0.182)		TGCCTTCTTAGATGCTGTGAT	0.453																																																	0													110.0	110.0	110.0					11																	47330888		2201	4298	6499	SO:0001583	missense	0			AB002356	CCDS7930.1, CCDS7931.1, CCDS7932.1, CCDS41642.1, CCDS44586.1, CCDS44587.1, CCDS44588.1, CCDS44589.1, CCDS44590.1	11p11.2	2012-10-04			ENSG00000110514	ENSG00000110514		"""DENN/MADD domain containing"""	6766	protein-coding gene	gene with protein product		603584				9115275, 9796103	Standard	NM_130476		Approved	DENN, KIAA0358, RAB3GEP	uc001ner.1	Q8WXG6	OTTHUMG00000150350	ENST00000311027.5:c.3988G>C	11.37:g.47330888G>C	ENSP00000310933:p.Asp1330His			Missense_Mutation	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.D1330H	ENST00000311027.5	37	c.3988	CCDS7930.1	11	.	.	.	.	.	.	.	.	.	.	G	24.6	4.549918	0.86127	.	.	ENSG00000110514	ENST00000342922;ENST00000395342;ENST00000402799;ENST00000406482;ENST00000349238;ENST00000311027;ENST00000407859;ENST00000395344;ENST00000395336;ENST00000402192;ENST00000405573	T;T;T;T;T;T;T;T;T;T	0.63580	2.4;2.26;2.28;2.37;2.36;2.26;2.26;2.38;2.4;-0.05	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.78805	0.4341	M	0.67700	2.07	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D	0.97110	1.0;0.999;0.999;1.0;1.0;1.0;1.0;0.999;0.999;0.999;0.999	T	0.81095	-0.1088	10	0.87932	D	0	-15.2819	18.7242	0.91708	0.0:0.0:1.0:0.0	.	140;1224;1224;1330;1228;1228;1228;1291;1248;1330;1271	F8W8U2;B5MEE5;A8K8S7;Q8WXG6-7;F8W9P9;Q8WXG6-6;Q8WXG6-5;Q8WXG6-2;Q8WXG6-4;Q8WXG6;Q8WXG6-3	.;.;.;.;.;.;.;.;.;MADD_HUMAN;.	H	1271;1228;1228;1228;1291;1330;1248;1224;1330;1270;140	ENSP00000343902:D1271H;ENSP00000385585:D1228H;ENSP00000384435:D1228H;ENSP00000304505:D1291H;ENSP00000310933:D1330H;ENSP00000384204:D1248H;ENSP00000378753:D1224H;ENSP00000378745:D1330H;ENSP00000384287:D1270H;ENSP00000384483:D140H	ENSP00000310933:D1330H	D	+	1	0	MADD	47287464	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.205000	0.95048	2.409000	0.81822	0.563000	0.77884	GAT	MADD	-	NULL	ENSG00000110514		0.453	MADD-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MADD	HGNC	protein_coding	OTTHUMT00000317746.1	-	0.00	121	0	G			47330888	+1	tier1	-	no_errors	ENST00000311027	ensembl	human	known	74_37	missense	37.21	54	32	SNP	1.000	C
MAP10	54627	genome.wustl.edu	37	1	232942340	232942340	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:232942340G>T	ENST00000418460.1	+	1	1698	c.1571G>T	c.(1570-1572)tGt>tTt	p.C524F		NM_019090.2	NP_061963.2	Q9P2G4	MAP10_HUMAN	microtubule-associated protein 10	382					cytoplasmic microtubule organization (GO:0031122)|positive regulation of cytokinesis (GO:0032467)|regulation of microtubule-based process (GO:0032886)|spindle midzone assembly involved in mitosis (GO:0051256)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|mitotic spindle pole (GO:0097431)	microtubule binding (GO:0008017)										AATCAAACATGTCAAACTGAA	0.373																																																	0													83.0	77.0	79.0					1																	232942340		1904	4127	6031	SO:0001583	missense	0			AB037804	CCDS44334.1	1q42.2	2013-02-12	2013-02-12	2013-02-12	ENSG00000212916	ENSG00000212916			29265	protein-coding gene	gene with protein product	"""microtubule regulator 120 KDa"""		"""KIAA1383"""	KIAA1383		23264731	Standard	NM_019090		Approved	MTR120	uc001hvh.2	Q9P2G4	OTTHUMG00000037819	ENST00000418460.1:c.1571G>T	1.37:g.232942340G>T	ENSP00000403208:p.Cys524Phe		A8K2F1|Q32MI1|Q58EZ9|Q5VV83	Missense_Mutation	SNP	NULL	p.C524F	ENST00000418460.1	37	c.1571	CCDS44334.1	1	.	.	.	.	.	.	.	.	.	.	G	10.73	1.432924	0.25813	.	.	ENSG00000212916	ENST00000418460	.	.	.	4.58	-0.00759	0.14008	.	6.059670	0.00815	U	0.001539	T	0.27419	0.0673	N	0.22421	0.69	0.09310	N	1	P	0.41080	0.737	B	0.38458	0.274	T	0.29305	-1.0016	9	0.46703	T	0.11	2.3171	8.2753	0.31868	0.309:0.0:0.691:0.0	.	382	Q9P2G4	K1383_HUMAN	F	524	.	ENSP00000403208:C524F	C	+	2	0	KIAA1383	231008963	0.000000	0.05858	0.000000	0.03702	0.335000	0.28730	0.448000	0.21726	0.006000	0.14734	0.655000	0.94253	TGT	MAP10	-	NULL	ENSG00000212916		0.373	MAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP10	HGNC	protein_coding	OTTHUMT00000092317.3		0.00	48	0	G	NM_019090		232942340	+1			no_errors	ENST00000418460	ensembl	human	known	74_37	missense	10.71	25	3	SNP	0.000	T
MAP1A	4130	genome.wustl.edu	37	15	43815630	43815630	+	Missense_Mutation	SNP	A	A	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr15:43815630A>G	ENST00000300231.5	+	4	2409	c.1959A>G	c.(1957-1959)atA>atG	p.I653M	MAP1A_ENST00000399453.1_Missense_Mutation_p.I653M|MAP1A_ENST00000382031.1_Missense_Mutation_p.I891M			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	653					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	AGGATGTGATAGAAAAGGCTG	0.473																																																	0													41.0	42.0	42.0					15																	43815630		1938	4129	6067	SO:0001583	missense	0			U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.1959A>G	15.37:g.43815630A>G	ENSP00000300231:p.Ile653Met		O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	NULL	p.I653M	ENST00000300231.5	37	c.1959	CCDS42031.1	15	.	.	.	.	.	.	.	.	.	.	A	11.00	1.511651	0.27036	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231	T;T;T	0.52526	0.66;0.66;0.66	5.26	-0.423	0.12325	.	0.000000	0.35407	N	0.003235	T	0.54838	0.1883	M	0.79475	2.455	0.31336	N	0.684236	D	0.64830	0.994	P	0.59643	0.861	T	0.56159	-0.8025	10	0.48119	T	0.1	-12.866	3.0856	0.06277	0.4342:0.3015:0.0672:0.197	.	653	P78559	MAP1A_HUMAN	M	891;653;653	ENSP00000371462:I891M;ENSP00000382380:I653M;ENSP00000300231:I653M	ENSP00000300231:I653M	I	+	3	3	MAP1A	41602922	0.304000	0.24472	0.988000	0.46212	0.985000	0.73830	-0.057000	0.11768	0.070000	0.16634	0.460000	0.39030	ATA	MAP1A	-	NULL	ENSG00000166963		0.473	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP1A	HGNC	protein_coding	OTTHUMT00000132894.5	-	0.00	64	0	A	NM_002373		43815630	+1	tier1	-	no_errors	ENST00000399453	ensembl	human	known	74_37	missense	26.00	37	13	SNP	0.802	G
MAP2K4P1	139201	genome.wustl.edu	37	X	72744368	72744368	+	RNA	SNP	T	T	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chrX:72744368T>A	ENST00000602584.1	-	0	2281					NR_029423.1				mitogen-activated protein kinase kinase 4 pseudogene 1																		CTCTTCTCACTCAAGCCTGAG	0.448																																																	0																																												0					Xq13.2	2013-08-05			ENSG00000269904	ENSG00000269904			43837	pseudogene	pseudogene							Standard	NR_029423		Approved		uc022bza.1		OTTHUMG00000021833		X.37:g.72744368T>A				RNA	SNP	-	NULL	ENST00000602584.1	37	NULL		X																																																																																			MAP2K4P1	-	-	ENSG00000269904		0.448	MAP2K4P1-002	KNOWN	basic	processed_transcript	MAP2K4P1	HGNC	pseudogene	OTTHUMT00000467477.1	-	0.00	38	0	T			72744368	-1	tier1	-	no_errors	ENST00000602584	ensembl	human	known	74_37	rna	45.16	17	14	SNP	0.018	A
MAP3K19	80122	genome.wustl.edu	37	2	135743599	135743599	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr2:135743599C>T	ENST00000375845.3	-	7	2873	c.2843G>A	c.(2842-2844)gGc>gAc	p.G948D	MAP3K19_ENST00000315513.3_5'UTR|MAP3K19_ENST00000375844.3_Intron|MAP3K19_ENST00000392915.1_Missense_Mutation_p.G965D|MAP3K19_ENST00000392917.3_Intron|MAP3K19_ENST00000358371.4_Missense_Mutation_p.G835D|MAP3K19_ENST00000392918.3_Intron	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	948							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)										TGAATTTGTGCCACTTAAGGT	0.323																																																	0													57.0	58.0	58.0					2																	135743599		2203	4296	6499	SO:0001583	missense	0			AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.2843G>A	2.37:g.135743599C>T	ENSP00000365005:p.Gly948Asp		B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.G948D	ENST00000375845.3	37	c.2843	CCDS2176.2	2	.	.	.	.	.	.	.	.	.	.	C	0.003	-2.473402	0.00167	.	.	ENSG00000176601	ENST00000375845;ENST00000358371;ENST00000392915;ENST00000437365	T;T;T;T	0.70282	-0.31;-0.31;2.07;-0.47	4.16	-1.85	0.07784	.	1.322900	0.05247	N	0.513342	T	0.44138	0.1279	N	0.08118	0	0.19300	N	0.999979	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.06405	0.002;0.0;0.0	T	0.17899	-1.0354	10	0.33141	T	0.24	.	0.9364	0.01346	0.3774:0.1046:0.2854:0.2325	.	835;965;948	Q56UN5-3;A8MWG7;Q56UN5	.;.;YSK4_HUMAN	D	948;835;965;338	ENSP00000365005:G948D;ENSP00000351140:G835D;ENSP00000376647:G965D;ENSP00000392827:G338D	ENSP00000351140:G835D	G	-	2	0	YSK4	135460069	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.531000	0.06171	-0.103000	0.12175	-0.391000	0.06502	GGC	MAP3K19	-	NULL	ENSG00000176601		0.323	MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP3K19	HGNC	protein_coding	OTTHUMT00000158244.1		0.00	43	0	C	NM_025052		135743599	-1			no_errors	ENST00000375845	ensembl	human	known	74_37	missense	8.57	32	3	SNP	0.000	T
MED15	51586	genome.wustl.edu	37	22	20937531	20937531	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr22:20937531G>A	ENST00000263205.7	+	12	1738	c.1669G>A	c.(1669-1671)Gaa>Aaa	p.E557K	MED15_ENST00000406969.1_Missense_Mutation_p.E491K|MED15_ENST00000382974.2_Missense_Mutation_p.E446K|MED15_ENST00000541476.1_Missense_Mutation_p.E491K|MED15_ENST00000292733.7_Missense_Mutation_p.E517K|MED15_ENST00000542773.1_3'UTR|MED15_ENST00000425759.2_Missense_Mutation_p.E406K	NM_001003891.1	NP_001003891.1	Q96RN5	MED15_HUMAN	mediator complex subunit 15	557					gene expression (GO:0010467)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	25	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			CGACAAGAACGAAGGTAGGCT	0.582																																																	0													76.0	78.0	78.0					22																	20937531		2203	4300	6503	SO:0001583	missense	0			AF056191	CCDS13781.1, CCDS33602.1, CCDS74824.1	22q11.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000099917	ENSG00000099917			14248	protein-coding gene	gene with protein product		607372	"""trinucleotide repeat containing 7"", ""PC2 (positive cofactor 2, multiprotein complex) glutamine/Q-rich-associated protein"""	TNRC7, PCQAP		11024300, 11414760, 15175163	Standard	XM_005261632		Approved	TIG-1, CAG7A, Arc105	uc002zsp.3	Q96RN5	OTTHUMG00000150810	ENST00000263205.7:c.1669G>A	22.37:g.20937531G>A	ENSP00000263205:p.Glu557Lys		D3DX31|D3DX32|O15413|Q6IC31|Q8NF16|Q96CT0|Q96IH7|Q9P1T3	Missense_Mutation	SNP	pfam_Mediator_Med15_met	p.E557K	ENST00000263205.7	37	c.1669	CCDS33602.1	22	.	.	.	.	.	.	.	.	.	.	G	34	5.340189	0.95783	.	.	ENSG00000099917	ENST00000425759;ENST00000292733;ENST00000263205;ENST00000406969;ENST00000382974;ENST00000541476;ENST00000542312	.	.	.	5.76	5.76	0.90799	Mediator complex, subunit Med15, metazoa (1);	0.000000	0.85682	D	0.000000	T	0.78874	0.4352	M	0.73217	2.22	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.81914	0.967;0.995;0.995;0.992;0.965;0.995	T	0.79831	-0.1637	9	0.66056	D	0.02	.	17.4554	0.87605	0.0:0.0:1.0:0.0	.	487;536;173;491;517;557	B4DGD6;Q6PKB8;B3KWF1;G3V1P5;Q96RN5-2;Q96RN5	.;.;.;.;.;MED15_HUMAN	K	406;517;557;491;446;491;487	.	ENSP00000263205:E557K	E	+	1	0	MED15	19267531	1.000000	0.71417	0.980000	0.43619	0.949000	0.60115	9.139000	0.94554	2.724000	0.93272	0.561000	0.74099	GAA	MED15	-	pfam_Mediator_Med15_met	ENSG00000099917		0.582	MED15-004	KNOWN	basic|CCDS	protein_coding	MED15	HGNC	protein_coding	OTTHUMT00000320177.2	-	0.00	53	0	G	NM_015889		20937531	+1	tier1	-	no_errors	ENST00000263205	ensembl	human	known	74_37	missense	57.58	14	19	SNP	1.000	A
MFAP3	4238	genome.wustl.edu	37	5	153432941	153432943	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	GAG	GAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr5:153432941_153432943delGAG	ENST00000436816.1	+	3	976_978	c.757_759delGAG	c.(757-759)gagdel	p.E254del	MFAP3_ENST00000439768.2_In_Frame_Del_p.E108del|MFAP3_ENST00000322602.5_In_Frame_Del_p.E254del	NM_001242336.1|NM_005927.4	NP_001229265.1|NP_005918.1	P55082	MFAP3_HUMAN	microfibrillar-associated protein 3	254					extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|kidney(2)|large_intestine(1)|lung(2)|pancreas(1)	7	Renal(175;0.00488)	Lung NSC(249;0.00145)|all_lung(500;0.00226)|all_neural(177;0.122)|Breast(839;0.14)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)	OV - Ovarian serous cystadenocarcinoma(192;9.69e-06)|GBM - Glioblastoma multiforme(465;0.0201)		AGCCTTTGTTGAGGAGATGTTTG	0.448																																																	0																																										SO:0001651	inframe_deletion	0				CCDS4324.1, CCDS47319.1	5q32-q33.2	2013-01-11			ENSG00000037749	ENSG00000037749		"""Immunoglobulin superfamily / I-set domain containing"""	7034	protein-coding gene	gene with protein product		600491				7782085	Standard	NM_005927		Approved		uc010jib.2	P55082	OTTHUMG00000130149	ENST00000436816.1:c.757_759delGAG	5.37:g.153432944_153432946delGAG	ENSP00000409933:p.Glu254del		B2RDK0|B4DKA1|Q9NXA7	In_Frame_Del	DEL	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.E254in_frame_del	ENST00000436816.1	37	c.757_759	CCDS4324.1	5																																																																																			MFAP3	-	NULL	ENSG00000037749		0.448	MFAP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	MFAP3	HGNC	protein_coding	OTTHUMT00000252457.2		0.00	39	0	GAG	NM_005927		153432943	+1	tier1		no_errors	ENST00000322602	ensembl	human	known	74_37	in_frame_del	29.55	31	13	DEL	1.000:1.000:1.000	-
MGAT5B	146664	genome.wustl.edu	37	17	74921094	74921094	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr17:74921094C>A	ENST00000569840.2	+	9	1646	c.1072C>A	c.(1072-1074)Ccc>Acc	p.P358T	MGAT5B_ENST00000428789.2_Missense_Mutation_p.P369T|MGAT5B_ENST00000301618.4_Missense_Mutation_p.P358T	NM_001199172.1	NP_001186101.1	Q3V5L5	MGT5B_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B	358					protein N-linked glycosylation (GO:0006487)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(15)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GCTCACCATGCCCCTGCCCTT	0.617																																																	0													92.0	90.0	91.0					17																	74921094		2203	4300	6503	SO:0001583	missense	0			AB109185	CCDS11751.1, CCDS45788.1, CCDS59299.1	17q25.3	2013-02-25	2005-11-16		ENSG00000167889	ENSG00000167889		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	24140	protein-coding gene	gene with protein product		612441	"""mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isoenzyme B"""			14617637, 14623122	Standard	NM_001199172		Approved	GnT-IX, FLJ25132, GnT-VB	uc002jth.3	Q3V5L5	OTTHUMG00000177278	ENST00000569840.2:c.1072C>A	17.37:g.74921094C>A	ENSP00000456037:p.Pro358Thr		Q6P3S8|Q6P6B3|Q766X5|Q76D04|Q96LS2	Missense_Mutation	SNP	superfamily_PyrdxlP-dep_Trfase	p.P369T	ENST00000569840.2	37	c.1105	CCDS59299.1	17	.	.	.	.	.	.	.	.	.	.	C	19.62	3.861505	0.71949	.	.	ENSG00000167889	ENST00000301618;ENST00000428789	T;T	0.42900	0.96;0.96	5.25	5.25	0.73442	.	0.224365	0.39985	N	0.001214	T	0.56587	0.1995	L	0.59436	1.845	0.46336	D	0.998991	D;D	0.63046	0.992;0.992	P;P	0.59948	0.866;0.866	T	0.49331	-0.8951	10	0.21540	T	0.41	-25.0014	17.8384	0.88707	0.0:1.0:0.0:0.0	.	369;358	Q3V5L5-2;Q3V5L5-5	.;.	T	358;369	ENSP00000301618:P358T;ENSP00000391227:P369T	ENSP00000301618:P358T	P	+	1	0	MGAT5B	72432689	0.998000	0.40836	0.959000	0.39883	0.974000	0.67602	3.799000	0.55529	2.453000	0.82957	0.561000	0.74099	CCC	MGAT5B	-	NULL	ENSG00000167889		0.617	MGAT5B-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MGAT5B	HGNC	protein_coding	OTTHUMT00000460624.2	-	0.00	56	0	C	NM_144677		74921094	+1	tier1	-	no_errors	ENST00000428789	ensembl	human	known	74_37	missense	33.33	24	12	SNP	0.992	A
CLCN5	1184	genome.wustl.edu	37	X	49777894	49777894	+	Intron	SNP	C	C	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chrX:49777894C>G	ENST00000376088.3	+	4	657				MIR500B_ENST00000458843.1_RNA|CLCN5_ENST00000482218.2_Intron|CLCN5_ENST00000376091.3_Intron|MIR660_ENST00000385235.1_RNA|MIR502_ENST00000606349.1_RNA	NM_001127898.1|NM_001127899.1	NP_001121370.1|NP_001121371.1	P51795	CLCN5_HUMAN	chloride channel, voltage-sensitive 5						chloride transmembrane transport (GO:1902476)|endocytosis (GO:0006897)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)	30	Ovarian(276;0.236)					TGTGAATTCTCAAAACACCTC	0.488																																																	0													306.0	254.0	270.0					X																	49777894		1568	3582	5150	SO:0001627	intron_variant	0			X91906	CCDS14328.1, CCDS48115.1, CCDS69763.1	Xp11.23-p11.22	2012-09-26	2012-02-23		ENSG00000171365	ENSG00000171365		"""Ion channels / Chloride channels : Voltage-sensitive"""	2023	protein-coding gene	gene with protein product	"""Dent disease"""	300008	"""nephrolithiasis 2, X-linked"", ""nephrolithiasis 1 (X-linked)"", ""chloride channel 5"""	NPHL2, NPHL1		7874126, 8111383, 8099916, 8559248, 9602200	Standard	NM_001272102		Approved	DENTS, XLRH, hClC-K2, hCIC-K2, CLC5, XRN, ClC-5	uc004doq.1	P51795	OTTHUMG00000021514	ENST00000376088.3:c.17-29031C>G	X.37:g.49777894C>G			A1L475|B3KPN6|Q5JQD5|Q7RTN8	RNA	SNP	-	NULL	ENST00000376088.3	37	NULL	CCDS48115.1	X																																																																																			MIR660	-	-	ENSG00000207970		0.488	CLCN5-001	KNOWN	basic|CCDS	protein_coding	MIR660	HGNC	protein_coding	OTTHUMT00000056542.2	-	0.00	23	0	C			49777894	+1	tier1	-	no_errors	ENST00000385235	ensembl	human	known	74_37	rna	36.36	7	4	SNP	1.000	G
MMD2	221938	genome.wustl.edu	37	7	4950836	4950836	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr7:4950836C>T	ENST00000404774.3	-	5	601	c.407G>A	c.(406-408)cGc>cAc	p.R136H	MMD2_ENST00000401401.3_Missense_Mutation_p.R136H|MMD2_ENST00000406755.1_Missense_Mutation_p.R136H	NM_001100600.1	NP_001094070.1	Q8IY49	PAQRA_HUMAN	monocyte to macrophage differentiation-associated 2	136						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(11)	14		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.097)|OV - Ovarian serous cystadenocarcinoma(56;3.4e-14)		GACCAGCCAGCGCATGTGGGA	0.652																																																	0													20.0	24.0	23.0					7																	4950836		1920	4126	6046	SO:0001583	missense	0			BC037881	CCDS47529.1, CCDS47530.1, CCDS59047.1	7p22	2004-06-23			ENSG00000136297	ENSG00000136297			30133	protein-coding gene	gene with protein product		614581				12477932	Standard	NM_198403		Approved	PAQR10	uc003sno.4	Q8IY49	OTTHUMG00000151844	ENST00000404774.3:c.407G>A	7.37:g.4950836C>T	ENSP00000384690:p.Arg136His		B5MBW4|Q6NVU5|Q6TCH0	Missense_Mutation	SNP	pfam_HlyIII-related	p.R136H	ENST00000404774.3	37	c.407	CCDS47529.1	7	.	.	.	.	.	.	.	.	.	.	C	35	5.438498	0.96168	.	.	ENSG00000136297	ENST00000404774;ENST00000406755;ENST00000401401	T;T;T	0.29917	1.55;1.55;1.55	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.55832	0.1945	M	0.65498	2.005	0.80722	D	1	D;D;D	0.89917	1.0;0.994;0.988	D;P;P	0.97110	1.0;0.846;0.651	T	0.53542	-0.8424	10	0.48119	T	0.1	-44.6347	18.4095	0.90546	0.0:1.0:0.0:0.0	.	136;136;136	B5MBW4;Q8IY49;Q8IY49-2	.;PAQRA_HUMAN;.	H	136	ENSP00000384690:R136H;ENSP00000385963:R136H;ENSP00000384141:R136H	ENSP00000384141:R136H	R	-	2	0	MMD2	4917362	1.000000	0.71417	0.997000	0.53966	0.974000	0.67602	7.678000	0.84035	2.589000	0.87451	0.655000	0.94253	CGC	MMD2	-	pfam_HlyIII-related	ENSG00000136297		0.652	MMD2-001	KNOWN	basic|CCDS	protein_coding	MMD2	HGNC	protein_coding	OTTHUMT00000324136.1	-	0.00	129	0	C	NM_198403		4950836	-1	tier1	-	no_errors	ENST00000404774	ensembl	human	known	74_37	missense	43.17	79	60	SNP	1.000	T
MOXD1	26002	genome.wustl.edu	37	6	132645151	132645151	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr6:132645151C>G	ENST00000367963.3	-	7	1150	c.1032G>C	c.(1030-1032)tgG>tgC	p.W344C	MOXD1_ENST00000489128.1_5'UTR|MOXD1_ENST00000336749.3_Missense_Mutation_p.W276C	NM_015529.2	NP_056344.2	Q6UVY6	MOXD1_HUMAN	monooxygenase, DBH-like 1	344						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|prostate(3)|skin(1)	37	Breast(56;0.0495)			OV - Ovarian serous cystadenocarcinoma(155;0.0132)|GBM - Glioblastoma multiforme(226;0.0191)		AGAGGCTCACCCAGAGGCCAG	0.478																																																	0													122.0	121.0	122.0					6																	132645151		2203	4300	6503	SO:0001583	missense	0			AY007239	CCDS5152.2	6q23.2	2010-09-24			ENSG00000079931	ENSG00000079931			21063	protein-coding gene	gene with protein product		609000				9751809	Standard	XM_006715456		Approved	DKFZP564G202, MOX, dJ248E1.1	uc003qdf.3	Q6UVY6	OTTHUMG00000055853	ENST00000367963.3:c.1032G>C	6.37:g.132645151C>G	ENSP00000356940:p.Trp344Cys		Q5THU6|Q8NC97|Q8WV49|Q9H4M6|Q9Y4U3	Missense_Mutation	SNP	pfam_Cu2_ascorb_mOase_N,pfam_DOMON_domain,superfamily_PHM/PNGase_F_dom,smart_DOMON_domain,pfscan_DOMON_domain,prints_Dopamine_b_mOase	p.W344C	ENST00000367963.3	37	c.1032	CCDS5152.2	6	.	.	.	.	.	.	.	.	.	.	C	16.82	3.228938	0.58777	.	.	ENSG00000079931	ENST00000367963;ENST00000336749	T;T	0.76186	-1.0;-1.0	5.75	5.75	0.90469	PHM/PNGase F domain (1);Copper type II, ascorbate-dependent monooxygenase-like, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.79604	0.4474	L	0.44542	1.39	0.80722	D	1	D;D	0.89917	0.981;1.0	D;D	0.85130	0.95;0.997	T	0.76528	-0.2926	10	0.38643	T	0.18	-11.9947	19.9341	0.97130	0.0:1.0:0.0:0.0	.	344;276	Q6UVY6;Q6UVY6-2	MOXD1_HUMAN;.	C	344;276	ENSP00000356940:W344C;ENSP00000336998:W276C	ENSP00000336998:W276C	W	-	3	0	MOXD1	132686844	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.557000	0.73937	2.711000	0.92665	0.563000	0.77884	TGG	MOXD1	-	superfamily_PHM/PNGase_F_dom,prints_Dopamine_b_mOase	ENSG00000079931		0.478	MOXD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MOXD1	HGNC	protein_coding	OTTHUMT00000125837.1	-	0.00	37	0	C	NM_015529		132645151	-1	tier1	-	no_errors	ENST00000367963	ensembl	human	known	74_37	missense	26.67	22	8	SNP	1.000	G
MPHOSPH8	54737	genome.wustl.edu	37	13	20220923	20220923	+	Missense_Mutation	SNP	A	A	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr13:20220923A>T	ENST00000361479.5	+	3	778	c.710A>T	c.(709-711)gAt>gTt	p.D237V	MPHOSPH8_ENST00000414242.2_Missense_Mutation_p.D237V	NM_017520.3	NP_059990.2	Q99549	MPP8_HUMAN	M-phase phosphoprotein 8	237	Lys-rich.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of DNA methylation (GO:0044030)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nuclear nucleosome (GO:0000788)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	methylated histone binding (GO:0035064)			breast(2)|endometrium(1)|large_intestine(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_cancers(29;2.83e-16)|all_lung(29;1.16e-17)|all_epithelial(30;8.13e-16)|Lung NSC(5;6.91e-15)|Lung SC(185;0.0367)		all cancers(112;8.43e-05)|Epithelial(112;0.000426)|OV - Ovarian serous cystadenocarcinoma(117;0.00596)|Lung(94;0.015)|LUSC - Lung squamous cell carcinoma(192;0.0795)		gaaataagagatttaaagacg	0.303																																																	0													20.0	23.0	22.0					13																	20220923		2126	4265	6391	SO:0001583	missense	0			AK056785, AJ293409	CCDS9287.1	13q12.11	2013-01-10			ENSG00000196199	ENSG00000196199		"""Ankyrin repeat domain containing"""	29810	protein-coding gene	gene with protein product		611626				8885239	Standard	NM_017520		Approved	mpp8, HSMPP8	uc001umh.3	Q99549	OTTHUMG00000016498	ENST00000361479.5:c.710A>T	13.37:g.20220923A>T	ENSP00000355388:p.Asp237Val		B7Z6F9|Q5JPE5|Q5JTQ0|Q86TK3|Q96MK4|Q9BTP1	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Chromo_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Chromo_domain/shadow	p.D237V	ENST00000361479.5	37	c.710	CCDS9287.1	13	.	.	.	.	.	.	.	.	.	.	A	21.2	4.118793	0.77323	.	.	ENSG00000196199	ENST00000414242;ENST00000361479;ENST00000538024	T;T	0.38560	1.13;1.13	6.02	6.02	0.97574	.	0.690059	0.15602	N	0.253880	T	0.64800	0.2631	M	0.68952	2.095	0.80722	D	1	D;D;D	0.89917	0.993;0.999;1.0	D;D;D	0.74674	0.927;0.981;0.984	T	0.65331	-0.6194	10	0.87932	D	0	.	16.542	0.84395	1.0:0.0:0.0:0.0	.	237;237;237	Q99549;Q99549-2;B3KS10	MPP8_HUMAN;.;.	V	237	ENSP00000414663:D237V;ENSP00000355388:D237V	ENSP00000355388:D237V	D	+	2	0	MPHOSPH8	19118923	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.722000	0.74735	2.304000	0.77564	0.528000	0.53228	GAT	MPHOSPH8	-	NULL	ENSG00000196199		0.303	MPHOSPH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPHOSPH8	HGNC	protein_coding	OTTHUMT00000044028.2	-	0.00	50	0	A	NM_017520		20220923	+1	tier1	-	no_errors	ENST00000414242	ensembl	human	known	74_37	missense	38.30	29	18	SNP	1.000	T
MSI1	4440	genome.wustl.edu	37	12	120805876	120805876	+	Missense_Mutation	SNP	A	A	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr12:120805876A>C	ENST00000257552.2	-	4	290	c.202T>G	c.(202-204)Ttc>Gtc	p.F68V	RPS27P25_ENST00000477404.1_RNA	NM_002442.3	NP_002433.1	O43347	MSI1H_HUMAN	musashi RNA-binding protein 1	68	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				epithelial cell differentiation (GO:0030855)|nervous system development (GO:0007399)|response to hormone (GO:0009725)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|polysome (GO:0005844)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|RNA binding (GO:0003723)			breast(4)|central_nervous_system(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(5)|skin(2)	19	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TGGTCCATGAAAGTGACGAAG	0.652																																																	0													39.0	34.0	36.0					12																	120805876		2203	4300	6503	SO:0001583	missense	0			AB012851	CCDS9196.1	12q24	2013-07-16	2012-12-13					"""RNA binding motif (RRM) containing"""	7330	protein-coding gene	gene with protein product		603328	"""Musashi (Drosophila) homolog 1"", ""musashi homolog 1 (Drosophila)"""			9790759	Standard	NM_002442		Approved		uc001tye.2	O43347	OTTHUMG00000169344	ENST00000257552.2:c.202T>G	12.37:g.120805876A>C	ENSP00000257552:p.Phe68Val		Q96PU0|Q96PU1|Q96PU2|Q96PU3	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.F68V	ENST00000257552.2	37	c.202	CCDS9196.1	12	.	.	.	.	.	.	.	.	.	.	A	19.39	3.818768	0.71028	.	.	ENSG00000135097	ENST00000257552	T	0.41400	1.0	3.24	3.24	0.37175	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.114428	0.36972	N	0.002304	T	0.69495	0.3117	M	0.93550	3.43	0.58432	D	0.999999	D	0.60575	0.988	D	0.68765	0.96	T	0.77702	-0.2489	10	0.87932	D	0	.	11.6848	0.51479	1.0:0.0:0.0:0.0	.	68	O43347	MSI1H_HUMAN	V	68	ENSP00000257552:F68V	ENSP00000257552:F68V	F	-	1	0	MSI1	119290259	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	8.672000	0.91181	1.476000	0.48215	0.254000	0.18369	TTC	MSI1	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000135097		0.652	MSI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSI1	HGNC	protein_coding	OTTHUMT00000403629.1	-	0.00	78	0	A	NM_002442		120805876	-1	tier1	-	no_errors	ENST00000257552	ensembl	human	known	74_37	missense	26.03	53	19	SNP	1.000	C
MST1L	11223	genome.wustl.edu	37	1	17083821	17083821	+	RNA	SNP	G	G	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:17083821G>C	ENST00000455405.2	-	0	767							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)										TACTCGGTTGGGGATTCTAAT	0.582																																																	0																																												0			U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17083821G>C			B7WPB1|Q13209	RNA	SNP	-	NULL	ENST00000455405.2	37	NULL		1	.	.	.	.	.	.	.	.	.	.	.	12.48	1.949257	0.34377	.	.	ENSG00000186715	ENST00000334998;ENST00000442552	.	.	.	.	.	.	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.41823	D	0.000801	T	0.61937	0.2387	.	.	.	.	.	.	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.65594	-0.6130	6	0.30078	T	0.28	.	6.7402	0.23431	2.0E-4:0.0:0.9998:0.0	.	659;685	Q2TV78-2;Q2TV78	.;MSTP9_HUMAN	R	659;685	.	ENSP00000439273:P659R	P	-	2	0	MST1P9	16956408	1.000000	0.71417	0.911000	0.35937	0.000000	0.00434	5.834000	0.69361	0.502000	0.28037	0.000000	0.15137	CCC	MST1L	-	-	ENSG00000186715		0.582	MST1L-002	KNOWN	basic	processed_transcript	MST1L	HGNC	pseudogene	OTTHUMT00000400328.1		0.00	105	0	G	NM_001271733		17083821	-1			no_errors	ENST00000455405	ensembl	human	known	74_37	rna	7.78	83	7	SNP	1.000	C
MTA1	9112	genome.wustl.edu	37	14	105924626	105924626	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr14:105924626C>G	ENST00000331320.7	+	8	784	c.570C>G	c.(568-570)gaC>gaG	p.D190E	MTA1_ENST00000405646.1_Missense_Mutation_p.D173E|MTA1_ENST00000406191.1_Missense_Mutation_p.D190E	NM_001203258.1|NM_004689.3	NP_001190187.1|NP_004680.2	Q13330	MTA1_HUMAN	metastasis associated 1	190	ELM2. {ECO:0000255|PROSITE- ProRule:PRU00512}.				circadian regulation of gene expression (GO:0032922)|double-strand break repair (GO:0006302)|entrainment of circadian clock by photoperiod (GO:0043153)|locomotor rhythm (GO:0045475)|positive regulation of protein autoubiquitination (GO:1902499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of gene expression, epigenetic (GO:0040029)|regulation of inflammatory response (GO:0050727)|response to ionizing radiation (GO:0010212)|response to lipopolysaccharide (GO:0032496)|secretory granule organization (GO:0033363)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|microtubule (GO:0005874)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|core promoter sequence-specific DNA binding (GO:0001046)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|stomach(1)	14		all_cancers(154;0.0293)|all_epithelial(191;0.128)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00897)|Epithelial(46;0.026)	Epithelial(152;0.19)		ATGGCCGAGACCAGTCCAGGT	0.682																																																	0													106.0	73.0	85.0					14																	105924626		2201	4299	6500	SO:0001583	missense	0			U35113	CCDS32169.1, CCDS55954.1	14q32.33	2013-01-25			ENSG00000182979	ENSG00000182979		"""GATA zinc finger domain containing"""	7410	protein-coding gene	gene with protein product		603526				8083195, 7607577	Standard	NM_004689		Approved		uc001yqx.3	Q13330	OTTHUMG00000150362	ENST00000331320.7:c.570C>G	14.37:g.105924626C>G	ENSP00000333633:p.Asp190Glu		A5PLK4|Q86SW2|Q8NFI8|Q96GI8	Missense_Mutation	SNP	pfam_BAH_dom,pfam_ELM2_dom,pfam_Znf_GATA,superfamily_Homeodomain-like,smart_BAH_dom,smart_SANT/Myb,smart_Znf_GATA,pfscan_BAH_dom,pfscan_ELM2_dom	p.D190E	ENST00000331320.7	37	c.570	CCDS32169.1	14	.	.	.	.	.	.	.	.	.	.	C	2.233	-0.375767	0.05034	.	.	ENSG00000182979	ENST00000414153;ENST00000331320;ENST00000406191;ENST00000405646;ENST00000498644	T;T;T;T	0.27890	1.64;1.64;1.64;1.64	4.83	2.97	0.34412	ELM2 domain (2);	0.046481	0.85682	D	0.000000	T	0.13628	0.0330	N	0.11560	0.145	0.80722	D	1	B	0.09022	0.002	B	0.17979	0.02	T	0.10086	-1.0645	10	0.10377	T	0.69	-41.875	7.9629	0.30081	0.0:0.7175:0.0:0.2825	.	190	Q13330	MTA1_HUMAN	E	99;190;190;173;104	ENSP00000333633:D190E;ENSP00000385702:D190E;ENSP00000384180:D173E;ENSP00000448146:D104E	ENSP00000333633:D190E	D	+	3	2	MTA1	104995671	1.000000	0.71417	0.987000	0.45799	0.046000	0.14306	0.916000	0.28651	0.445000	0.26639	0.491000	0.48974	GAC	MTA1	-	pfam_ELM2_dom,pfscan_ELM2_dom	ENSG00000182979		0.682	MTA1-001	KNOWN	basic|CCDS	protein_coding	MTA1	HGNC	protein_coding	OTTHUMT00000317849.15	-	0.00	39	0	C			105924626	+1	tier1	-	no_errors	ENST00000331320	ensembl	human	known	74_37	missense	39.13	14	9	SNP	1.000	G
MTF1	4520	genome.wustl.edu	37	1	38323168	38323168	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:38323168G>T	ENST00000373036.4	-	2	303	c.163C>A	c.(163-165)Cct>Act	p.P55T	MTF1_ENST00000468190.1_5'UTR	NM_005955.2	NP_005946.2	Q14872	MTF1_HUMAN	metal-regulatory transcription factor 1	55					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cadmium ion (GO:0046686)|response to metal ion (GO:0010038)|response to oxidative stress (GO:0006979)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(3)|kidney(5)|large_intestine(6)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(1)	31	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				AAAGTGCCAGGGTCCTGCTCA	0.483																																																	0													131.0	114.0	120.0					1																	38323168		2203	4300	6503	SO:0001583	missense	0			BC014454	CCDS30676.1	1p33	2008-02-05			ENSG00000188786	ENSG00000188786			7428	protein-coding gene	gene with protein product		600172				8065932	Standard	NM_005955		Approved		uc001cce.1	Q14872	OTTHUMG00000004439	ENST00000373036.4:c.163C>A	1.37:g.38323168G>T	ENSP00000362127:p.Pro55Thr		B2RAK6|Q96CB1	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P55T	ENST00000373036.4	37	c.163	CCDS30676.1	1	.	.	.	.	.	.	.	.	.	.	G	15.61	2.883809	0.51908	.	.	ENSG00000188786	ENST00000373036	T	0.10573	2.86	5.62	3.76	0.43208	.	0.411157	0.27139	N	0.020753	T	0.07413	0.0187	L	0.29908	0.895	0.35406	D	0.792005	B	0.34103	0.437	B	0.32864	0.154	T	0.32640	-0.9899	10	0.12766	T	0.61	.	10.4869	0.44729	0.1522:0.0:0.8478:0.0	.	55	Q14872	MTF1_HUMAN	T	55	ENSP00000362127:P55T	ENSP00000362127:P55T	P	-	1	0	MTF1	38095755	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.493000	0.60341	0.732000	0.32470	-0.145000	0.13849	CCT	MTF1	-	NULL	ENSG00000188786		0.483	MTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTF1	HGNC	protein_coding	OTTHUMT00000012984.2		0.00	56	0	G	NM_005955		38323168	-1			no_errors	ENST00000373036	ensembl	human	known	74_37	missense	6.82	41	3	SNP	1.000	T
MUC16	94025	genome.wustl.edu	37	19	9073601	9073601	+	Silent	SNP	A	A	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr19:9073601A>C	ENST00000397910.4	-	3	14048	c.13845T>G	c.(13843-13845)acT>acG	p.T4615T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	4617	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TTGACTCTGTAGTTGAGTTCA	0.478																																																	0													104.0	100.0	101.0					19																	9073601		1975	4162	6137	SO:0001819	synonymous_variant	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.13845T>G	19.37:g.9073601A>C			Q6ZQW5|Q96RK2	Silent	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.T4615	ENST00000397910.4	37	c.13845	CCDS54212.1	19																																																																																			MUC16	-	NULL	ENSG00000181143		0.478	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	69	0	A	NM_024690		9073601	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	silent	46.15	21	18	SNP	0.000	C
MUC19	283463	genome.wustl.edu	37	12	40938804	40938804	+	Intron	SNP	T	T	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr12:40938804T>G	ENST00000454784.4	+	56	17711							Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						CACTCTAATTTTTACATTTAT	0.378																																																	0																																										SO:0001627	intron_variant	0			AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000454784.4:c.10891-48T>G	12.37:g.40938804T>G			Q8NA85	RNA	SNP	-	NULL	ENST00000454784.4	37	NULL		12																																																																																			MUC19	-	-	ENSG00000205592		0.378	MUC19-001	NOVEL	non_canonical_conserved|non_canonical_genome_sequence_error|basic|appris_principal	protein_coding	MUC19	HGNC	protein_coding	OTTHUMT00000384257.6	-	0.00	33	0	T	XM_003403524		40938804	+1	tier1	-	no_errors	ENST00000492952	ensembl	human	known	74_37	rna	33.33	20	10	SNP	0.003	G
MYO1F	4542	genome.wustl.edu	37	19	8595219	8595219	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr19:8595219C>T	ENST00000338257.8	-	21	2456	c.2189G>A	c.(2188-2190)cGg>cAg	p.R730Q		NM_012335.3	NP_036467.2	O00160	MYO1F_HUMAN	myosin IF	730	Myosin tail. {ECO:0000255}.				defense response to Gram-positive bacterium (GO:0050830)|negative regulation of cell adhesion (GO:0007162)|neutrophil degranulation (GO:0043312)|positive regulation of cell migration (GO:0030335)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of innate immune response (GO:0045088)	cortical actin cytoskeleton (GO:0030864)|filamentous actin (GO:0031941)|unconventional myosin complex (GO:0016461)	actin binding (GO:0003779)|ATP binding (GO:0005524)|motor activity (GO:0003774)	p.R730L(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(7)|lung(13)|ovary(3)|prostate(3)|skin(3)|urinary_tract(1)	42						GTTGCGCCTCCGCTCCTTCTT	0.647																																																	1	Substitution - Missense(1)	lung(1)											153.0	159.0	157.0					19																	8595219		2069	4178	6247	SO:0001583	missense	0			X98411	CCDS42494.1	19p13.3-p13.2	2011-09-27			ENSG00000142347	ENSG00000142347		"""Myosins / Myosin superfamily : Class I"""	7600	protein-coding gene	gene with protein product		601480				9119401, 8884266	Standard	NM_012335		Approved		uc002mkg.3	O00160	OTTHUMG00000156005	ENST00000338257.8:c.2189G>A	19.37:g.8595219C>T	ENSP00000344871:p.Arg730Gln		Q8WWN7	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,pfam_SH3_domain,pfam_SH3_2,superfamily_P-loop_NTPase,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_SH3_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_SH3_domain,prints_Myosin_head_motor_dom,prints_SH3_domain	p.R730Q	ENST00000338257.8	37	c.2189	CCDS42494.1	19	.	.	.	.	.	.	.	.	.	.	C	35	5.555260	0.96514	.	.	ENSG00000142347	ENST00000305795;ENST00000338257	D	0.95171	-3.63	5.58	5.58	0.84498	Myosin tail 2 (1);	0.000000	0.85682	D	0.000000	D	0.98286	0.9432	H	0.96080	3.765	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98939	1.0790	10	0.59425	D	0.04	.	18.61	0.91281	0.0:1.0:0.0:0.0	.	730	O00160	MYO1F_HUMAN	Q	775;730	ENSP00000344871:R730Q	ENSP00000304899:R775Q	R	-	2	0	MYO1F	8501219	1.000000	0.71417	0.596000	0.28811	0.822000	0.46500	6.041000	0.70988	2.647000	0.89833	0.555000	0.69702	CGG	MYO1F	-	pfam_Myosin_tail_2,superfamily_P-loop_NTPase	ENSG00000142347		0.647	MYO1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO1F	HGNC	protein_coding	OTTHUMT00000342716.2	-	0.00	61	0	C			8595219	-1	tier1	-	no_errors	ENST00000338257	ensembl	human	known	74_37	missense	30.00	35	15	SNP	1.000	T
NAV2	89797	genome.wustl.edu	37	11	20083861	20083862	+	Missense_Mutation	DNP	TC	TC	AA			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T|C	T|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr11:20083861_20083862TC>AA	ENST00000396087.3	+	22	5107_5108	c.5008_5009TC>AA	c.(5008-5010)TCc>AAc	p.S1670N	NAV2_ENST00000396085.1_Missense_Mutation_p.S1614N|NAV2_ENST00000360655.4_Missense_Mutation_p.S1550N|NAV2_ENST00000311043.8_Missense_Mutation_p.S678N|NAV2_ENST00000527559.2_Missense_Mutation_p.S1599N|NAV2_ENST00000540292.1_Missense_Mutation_p.S1601N|NAV2_ENST00000349880.4_Missense_Mutation_p.S1614N|NAV2_ENST00000533917.1_Missense_Mutation_p.S678N	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2	1670	Ser-rich.				glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						AGTTCATGGATCCTCACTCTCC	0.411																																																	0																																										SO:0001583	missense	0			AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	Exception_encountered	11.37:g.20083861_20083862delinsAA	ENSP00000379396:p.Ser1670Asn		A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Missense_Mutation	SNP	pfam_CH-domain,superfamily_CH-domain,superfamily_P-loop_NTPase,smart_CH-domain,smart_AAA+_ATPase,pfscan_CH-domain	p.S1670T|p.S1670Y	ENST00000396087.3	37	c.5008|c.5009	CCDS58126.1	11																																																																																			NAV2	-	NULL	ENSG00000166833		0.411	NAV2-001	KNOWN	basic|CCDS	protein_coding	NAV2	HGNC	protein_coding	OTTHUMT00000324112.1	-	0.00	49	0	T|C	NM_145117		20083861|20083862	+1	tier1	-	no_errors	ENST00000396087	ensembl	human	known	74_37	missense	33.33|31.03	20	10|9	SNP	1.000	A
NCALD	83988	genome.wustl.edu	37	8	102701306	102701306	+	3'UTR	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr8:102701306G>A	ENST00000311028.3	-	0	1191				NCALD_ENST00000521599.1_3'UTR|NCALD_ENST00000522951.1_Missense_Mutation_p.S189L|NCALD_ENST00000395923.1_3'UTR|NCALD_ENST00000220931.6_3'UTR|NCALD_ENST00000519508.2_3'UTR|KB-1107E3.1_ENST00000518749.1_RNA	NM_001040624.1|NM_001040626.1	NP_001035714.1|NP_001035716.1	P61601	NCALD_HUMAN	neurocalcin delta						calcium-mediated signaling (GO:0019722)|regulation of systemic arterial blood pressure (GO:0003073)|synaptic transmission (GO:0007268)|vesicle-mediated transport (GO:0016192)	clathrin coat of trans-Golgi network vesicle (GO:0030130)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|clathrin binding (GO:0030276)|tubulin binding (GO:0015631)			endometrium(1)|large_intestine(2)|lung(4)|prostate(1)	8	all_cancers(14;8.94e-08)|all_epithelial(15;7.03e-10)|Lung NSC(17;1.36e-05)|all_lung(17;2.7e-05)		all cancers(13;1.09e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000699)			ATCAAACAATGAACACCACGA	0.448																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF052142	CCDS6292.1	8q22.3	2014-08-12			ENSG00000104490	ENSG00000104490		"""EF-hand domain containing"""	7655	protein-coding gene	gene with protein product		606722				11267673	Standard	XM_006716672		Approved		uc003ykk.3	P61601	OTTHUMG00000164876	ENST00000311028.3:c.*231C>T	8.37:g.102701306G>A			P29554|Q8IYC3|Q9H0W2	Missense_Mutation	SNP	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom,prints_Recoverin	p.S189L	ENST00000311028.3	37	c.566	CCDS6292.1	8	.	.	.	.	.	.	.	.	.	.	G	13.80	2.346140	0.41599	.	.	ENSG00000104490	ENST00000522951	T	0.72835	-0.69	5.37	2.62	0.31277	.	.	.	.	.	T	0.74465	0.3720	.	.	.	0.42909	D	0.994252	.	.	.	.	.	.	T	0.73030	-0.4111	6	0.72032	D	0.01	.	8.122	0.30976	0.308:0.0:0.692:0.0	.	.	.	.	L	189	ENSP00000428781:S189L	ENSP00000428781:S189L	S	-	2	0	NCALD	102770482	0.064000	0.20934	0.135000	0.22099	0.603000	0.37013	0.523000	0.22925	0.349000	0.23975	0.655000	0.94253	TCA	NCALD	-	NULL	ENSG00000104490		0.448	NCALD-201	KNOWN	basic|appris_principal|CCDS	protein_coding	NCALD	HGNC	protein_coding	OTTHUMT00000380732.2	-	0.00	90	0	G			102701306	-1	tier1	-	no_errors	ENST00000522951	ensembl	human	putative	74_37	missense	8.59	117	11	SNP	0.425	A
NEB	4703	genome.wustl.edu	37	2	152528931	152528931	+	Silent	SNP	G	G	A	rs550832252		TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr2:152528931G>A	ENST00000172853.10	-	37	4398	c.4251C>T	c.(4249-4251)gaC>gaT	p.D1417D	NEB_ENST00000603639.1_Silent_p.D1417D|NEB_ENST00000427231.2_Silent_p.D1417D|NEB_ENST00000397345.3_Silent_p.D1417D|NEB_ENST00000604864.1_Silent_p.D1417D|NEB_ENST00000409198.1_Silent_p.D1417D			P20929	NEBU_HUMAN	nebulin	1417					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		GACTCATGGCGTCAGGTAGGT	0.443													g|||	1	0.000199681	0.0	0.0	5008	,	,		22284	0.0		0.001	False		,,,				2504	0.0																0													171.0	159.0	163.0					2																	152528931		2045	4199	6244	SO:0001819	synonymous_variant	0			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.4251C>T	2.37:g.152528931G>A			F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,pfscan_Nebulin_35r-motif,pfscan_SH3_domain,prints_Nebulin	p.D1417	ENST00000172853.10	37	c.4251		2																																																																																			NEB	-	smart_Nebulin_35r-motif,pfscan_Nebulin_35r-motif	ENSG00000183091		0.443	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding		-	0.00	64	0	G	NM_004543		152528931	-1	tier1	-	no_errors	ENST00000397345	ensembl	human	known	74_37	silent	5.71	66	4	SNP	0.021	A
NEGR1	257194	genome.wustl.edu	37	1	72076804	72076804	+	Missense_Mutation	SNP	T	T	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:72076804T>G	ENST00000357731.5	-	5	932	c.693A>C	c.(691-693)aaA>aaC	p.K231N	NEGR1_ENST00000306821.3_Missense_Mutation_p.K103N|NEGR1_ENST00000434200.1_Missense_Mutation_p.K185N	NM_173808.2	NP_776169.2	Q7Z3B1	NEGR1_HUMAN	neuronal growth regulator 1	231	Ig-like C2-type 3.				feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|positive regulation of neuron projection development (GO:0010976)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				endometrium(1)|kidney(4)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)		CGGTGCCAGATTTAATTTCCT	0.423																																																	0													48.0	51.0	50.0					1																	72076804		2203	4300	6503	SO:0001583	missense	0			AK092307	CCDS661.1	1p31.1	2013-01-11			ENSG00000172260	ENSG00000172260		"""Immunoglobulin superfamily / I-set domain containing"""	17302	protein-coding gene	gene with protein product	"""a kindred of IgLON"", ""neurotractin"", ""IgLON family member 4"""	613173				10075727	Standard	NM_173808		Approved	KILON, MGC46680, Ntra, IGLON4	uc001dfw.3	Q7Z3B1	OTTHUMG00000009698	ENST00000357731.5:c.693A>C	1.37:g.72076804T>G	ENSP00000350364:p.Lys231Asn		Q5VT21|Q6UY06|Q8N440|Q8NAQ3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.K231N	ENST00000357731.5	37	c.693	CCDS661.1	1	.	.	.	.	.	.	.	.	.	.	T	15.72	2.918041	0.52546	.	.	ENSG00000172260	ENST00000357731;ENST00000306821;ENST00000434200	T;T;T	0.69685	-0.42;-0.42;-0.42	5.93	3.63	0.41609	Immunoglobulin I-set (1);Immunoglobulin-like (1);	0.051513	0.85682	D	0.000000	T	0.41073	0.1143	L	0.50919	1.6	0.43118	D	0.99483	B;B	0.24576	0.106;0.095	B;B	0.35899	0.213;0.142	T	0.27331	-1.0077	10	0.09338	T	0.73	-15.5507	9.281	0.37729	0.0:0.1472:0.0:0.8528	.	185;231	B4DI94;Q7Z3B1	.;NEGR1_HUMAN	N	231;103;185	ENSP00000350364:K231N;ENSP00000305938:K103N;ENSP00000413294:K185N	ENSP00000305938:K103N	K	-	3	2	NEGR1	71849392	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	1.284000	0.33249	0.508000	0.28173	0.533000	0.62120	AAA	NEGR1	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000172260		0.423	NEGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEGR1	HGNC	protein_coding	OTTHUMT00000026722.4	-	0.00	51	0	T	NM_173808		72076804	-1	tier1	-	no_errors	ENST00000357731	ensembl	human	known	74_37	missense	38.10	26	16	SNP	1.000	G
NEK1	4750	genome.wustl.edu	37	4	170476957	170476957	+	Silent	SNP	T	T	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr4:170476957T>A	ENST00000439128.2	-	17	2116	c.1476A>T	c.(1474-1476)gcA>gcT	p.A492A	NEK1_ENST00000510533.1_Intron|NEK1_ENST00000512193.1_Intron|NEK1_ENST00000511633.1_Intron|NEK1_ENST00000507142.1_Silent_p.A492A	NM_012224.2	NP_036356.1	Q96PY6	NEK1_HUMAN	NIMA-related kinase 1	492					cellular response to DNA damage stimulus (GO:0006974)|cilium assembly (GO:0042384)|mitotic nuclear division (GO:0007067)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|stomach(1)	45		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)		GGTGATGACCTGCAGCCCCAT	0.413																																																	0													107.0	101.0	103.0					4																	170476957		1849	4103	5952	SO:0001819	synonymous_variant	0			AB067488	CCDS47162.1, CCDS56348.1, CCDS56349.1, CCDS56350.1, CCDS56351.1	4q32.3	2012-11-15	2012-11-15		ENSG00000137601	ENSG00000137601			7744	protein-coding gene	gene with protein product		604588	"""NIMA (never in mitosis gene a)-related kinase 1"""			1382974, 8274451	Standard	NM_012224		Approved	NY-REN-55, KIAA1901	uc003isd.2	Q96PY6	OTTHUMG00000160963	ENST00000439128.2:c.1476A>T	4.37:g.170476957T>A			G5E9Z3|Q05DG5|Q14CB7|Q5H9T1|Q6PIB8|Q96SS2|Q9H6P7|Q9Y594	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.A492	ENST00000439128.2	37	c.1476	CCDS47162.1	4																																																																																			NEK1	-	NULL	ENSG00000137601		0.413	NEK1-001	KNOWN	basic|CCDS	protein_coding	NEK1	HGNC	protein_coding	OTTHUMT00000363157.3	-	0.00	82	0	T			170476957	-1	tier1	-	no_errors	ENST00000507142	ensembl	human	known	74_37	silent	6.56	57	4	SNP	1.000	A
NGFR	4804	genome.wustl.edu	37	17	47590297	47590297	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr17:47590297G>T	ENST00000172229.3	+	6	1335	c.1210G>T	c.(1210-1212)Gcc>Tcc	p.A404S	NGFR_ENST00000504201.1_Missense_Mutation_p.A310S|RP5-1029K10.2_ENST00000514506.1_RNA	NM_002507.3	NP_002498.1	P08138	TNR16_HUMAN	nerve growth factor receptor	404	Death. {ECO:0000255|PROSITE- ProRule:PRU00064}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|detection of temperature stimulus (GO:0016048)|glucose homeostasis (GO:0042593)|hair follicle morphogenesis (GO:0031069)|intracellular protein transport (GO:0006886)|membrane protein intracellular domain proteolysis (GO:0031293)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell cycle (GO:0045786)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of hair follicle development (GO:0051799)|nerve development (GO:0021675)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of axonogenesis (GO:0050772)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of odontogenesis of dentin-containing tooth (GO:0042488)|regulation of axonogenesis (GO:0050770)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cell surface (GO:0009986)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	death receptor activity (GO:0005035)|Rab GTPase binding (GO:0017137)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)	17	all_cancers(4;1.45e-13)|Breast(4;6.34e-28)|all_epithelial(4;4.95e-17)					CCTCCTGGCCGCCCTGCGCCG	0.697																																																	0													16.0	17.0	17.0					17																	47590297		2200	4294	6494	SO:0001583	missense	0			M14764	CCDS11549.1	17q21-q22	2013-05-22	2010-04-28		ENSG00000064300	ENSG00000064300		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	7809	protein-coding gene	gene with protein product	"""low affinity nerve growth factor receptor"", ""TNFR superfamily, member 16"""	162010	"""nerve growth factor receptor (TNFR superfamily, member 16)"""			3022937, 3006050	Standard	NM_002507		Approved	TNFRSF16, CD271, p75NTR	uc002ioz.4	P08138	OTTHUMG00000161495	ENST00000172229.3:c.1210G>T	17.37:g.47590297G>T	ENSP00000172229:p.Ala404Ser		B2R961|B4E096	Missense_Mutation	SNP	pfam_TNFR/NGFR_Cys_rich_reg,pfam_Death_domain,superfamily_DEATH-like_dom,smart_TNFR/NGFR_Cys_rich_reg,smart_Death_domain,pfscan_Death_domain,pfscan_TNFR/NGFR_Cys_rich_reg,prints_TNFR_16	p.A404S	ENST00000172229.3	37	c.1210	CCDS11549.1	17	.	.	.	.	.	.	.	.	.	.	G	28.7	4.940091	0.92526	.	.	ENSG00000064300	ENST00000172229;ENST00000504201	D;D	0.89681	-2.55;-2.55	4.55	3.49	0.39957	Death (3);DEATH-like (2);	0.272209	0.34314	N	0.004069	D	0.91875	0.7428	L	0.49778	1.585	0.50467	D	0.999879	D	0.89917	1.0	D	0.91635	0.999	D	0.92350	0.5889	10	0.72032	D	0.01	-22.2625	13.2254	0.59912	0.0:0.1611:0.8389:0.0	.	404	P08138	TNR16_HUMAN	S	404;310	ENSP00000172229:A404S;ENSP00000421731:A310S	ENSP00000172229:A404S	A	+	1	0	NGFR	44945296	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.269000	0.95684	2.233000	0.73108	0.561000	0.74099	GCC	NGFR	-	pfam_Death_domain,superfamily_DEATH-like_dom,smart_Death_domain,pfscan_Death_domain	ENSG00000064300		0.697	NGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NGFR	HGNC	protein_coding	OTTHUMT00000365150.1		0.00	77	0	G			47590297	+1			no_errors	ENST00000172229	ensembl	human	known	74_37	missense	5.45	52	3	SNP	1.000	T
NINL	22981	genome.wustl.edu	37	20	25457438	25457438	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr20:25457438G>A	ENST00000278886.6	-	17	2562	c.2489C>T	c.(2488-2490)cCg>cTg	p.P830L	NINL_ENST00000422516.1_Intron	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	830					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						CCCATCTTTCGGCAGGGCCTG	0.682																																																	0													36.0	33.0	34.0					20																	25457438		2203	4300	6503	SO:0001583	missense	0				CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.2489C>T	20.37:g.25457438G>A	ENSP00000278886:p.Pro830Leu		A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Missense_Mutation	SNP	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	p.P830L	ENST00000278886.6	37	c.2489	CCDS33452.1	20	.	.	.	.	.	.	.	.	.	.	G	0.008	-1.876448	0.00537	.	.	ENSG00000101004	ENST00000278886	T	0.19806	2.12	2.57	-0.0918	0.13659	.	4.027350	0.00424	N	0.000078	T	0.10766	0.0263	N	0.12182	0.205	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.15665	-1.0429	10	0.15952	T	0.53	0.215	2.4589	0.04536	0.4893:0.284:0.2267:0.0	.	830	Q9Y2I6	NINL_HUMAN	L	830	ENSP00000278886:P830L	ENSP00000278886:P830L	P	-	2	0	NINL	25405438	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.293000	0.19029	-0.035000	0.13691	-0.304000	0.09214	CCG	NINL	-	NULL	ENSG00000101004		0.682	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NINL	HGNC	protein_coding	OTTHUMT00000078445.3	-	0.00	21	0	G	NM_025176		25457438	-1	tier1	-	no_errors	ENST00000278886	ensembl	human	known	74_37	missense	30.77	18	8	SNP	0.000	A
NKAPL	222698	genome.wustl.edu	37	6	28227240	28227240	+	Nonsense_Mutation	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr6:28227240C>T	ENST00000343684.3	+	1	143	c.91C>T	c.(91-93)Cag>Tag	p.Q31*	ZKSCAN4_ENST00000423974.2_5'Flank	NM_001007531.1	NP_001007532.1	Q5M9Q1	NKAPL_HUMAN	NFKB activating protein-like	31										breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31						ACCATCCCCGCAGAGCAGATG	0.657																																																	0													38.0	37.0	37.0					6																	28227240		2203	4299	6502	SO:0001587	stop_gained	0			BC038240	CCDS34353.1	6p21.33	2008-02-05	2007-08-16	2007-08-16	ENSG00000189134	ENSG00000189134			21584	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 194"""	C6orf194			Standard	NM_001007531		Approved	bA424I5.1	uc003nkt.4	Q5M9Q1	OTTHUMG00000014517	ENST00000343684.3:c.91C>T	6.37:g.28227240C>T	ENSP00000345716:p.Gln31*		Q3MIV1|Q9H4Q7	Nonsense_Mutation	SNP	pfam_DUF926	p.Q31*	ENST00000343684.3	37	c.91	CCDS34353.1	6	.	.	.	.	.	.	.	.	.	.	C	14.95	2.689150	0.48097	.	.	ENSG00000189134	ENST00000343684	.	.	.	4.11	-0.0297	0.13917	.	0.859058	0.09901	N	0.741022	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	-2.47	0.7881	0.01052	0.2032:0.3943:0.1992:0.2033	.	.	.	.	X	31	.	ENSP00000345716:Q31X	Q	+	1	0	NKAPL	28335219	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.446000	0.21694	0.166000	0.19597	0.655000	0.94253	CAG	NKAPL	-	NULL	ENSG00000189134		0.657	NKAPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKAPL	HGNC	protein_coding	OTTHUMT00000040185.1	-	0.00	88	0	C			28227240	+1	tier1	-	no_errors	ENST00000343684	ensembl	human	known	74_37	nonsense	23.19	53	16	SNP	0.000	T
NKD2	85409	genome.wustl.edu	37	5	1032294	1032294	+	Missense_Mutation	SNP	G	G	C	rs370298155		TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr5:1032294G>C	ENST00000296849.5	+	4	398	c.169G>C	c.(169-171)Ggg>Cgg	p.G57R	NKD2_ENST00000537972.1_Missense_Mutation_p.G57R|NKD2_ENST00000274150.4_Missense_Mutation_p.G57R	NM_033120.3	NP_149111.1	Q969F2	NKD2_HUMAN	naked cuticle homolog 2 (Drosophila)	57	Targeting to the basolateral cell membrane.				exocytosis (GO:0006887)|Golgi vesicle fusion to target membrane (GO:0048210)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein processing (GO:0010954)|protein targeting to plasma membrane (GO:0072661)|Wnt signaling pathway (GO:0016055)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cytoplasmic vesicle (GO:0031410)	calcium ion binding (GO:0005509)|growth factor binding (GO:0019838)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(3)|large_intestine(1)|lung(8)|pancreas(1)	14	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)			CCCCAAGGAGGGGCCTTTCCG	0.652																																																	0													60.0	70.0	67.0					5																	1032294		2202	4298	6500	SO:0001583	missense	0			AF358137	CCDS3859.1, CCDS59486.1	5p15.3	2013-01-10			ENSG00000145506	ENSG00000145506		"""EF-hand domain containing"""	17046	protein-coding gene	gene with protein product	"""naked cuticle-2"", ""Dvl-binding protein NKD2"""	607852				11356022, 11604995	Standard	NM_033120		Approved	Naked2	uc003jbt.2	Q969F2	OTTHUMG00000090348	ENST00000296849.5:c.169G>C	5.37:g.1032294G>C	ENSP00000296849:p.Gly57Arg		Q96EK8|Q9BSN0	Missense_Mutation	SNP	pfscan_EF_hand_dom	p.G57R	ENST00000296849.5	37	c.169	CCDS3859.1	5	.	.	.	.	.	.	.	.	.	.	G	5.279	0.236886	0.10023	.	.	ENSG00000145506	ENST00000296849;ENST00000274150;ENST00000537972	T;T;T	0.00585	6.39;6.39;6.39	4.2	3.33	0.38152	.	0.325492	0.26180	N	0.025878	T	0.00754	0.0025	M	0.61703	1.905	0.41039	D	0.985218	B;B	0.23735	0.09;0.087	B;B	0.23419	0.046;0.029	T	0.61192	-0.7112	10	0.25751	T	0.34	-0.2579	7.7983	0.29160	0.1187:0.0:0.8813:0.0	.	57;57	Q969F2-2;Q969F2	.;NKD2_HUMAN	R	57	ENSP00000296849:G57R;ENSP00000274150:G57R;ENSP00000440925:G57R	ENSP00000274150:G57R	G	+	1	0	NKD2	1085294	0.999000	0.42202	0.004000	0.12327	0.048000	0.14542	2.755000	0.47540	0.762000	0.33152	0.491000	0.48974	GGG	NKD2	-	NULL	ENSG00000145506		0.652	NKD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NKD2	HGNC	protein_coding	OTTHUMT00000206720.2	-	0.00	104	0	G	NM_033120		1032294	+1	tier1	-	no_errors	ENST00000296849	ensembl	human	known	74_37	missense	35.59	38	21	SNP	0.595	C
NPR1	4881	genome.wustl.edu	37	1	153655852	153655852	+	Splice_Site	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:153655852G>A	ENST00000368680.3	+	6	1736	c.1264G>A	c.(1264-1266)Gtt>Att	p.V422I		NM_000906.3	NP_000897.3	P16066	ANPRA_HUMAN	natriuretic peptide receptor 1	422					body fluid secretion (GO:0007589)|cell surface receptor signaling pathway (GO:0007166)|cGMP biosynthetic process (GO:0006182)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|regulation of vascular permeability (GO:0043114)|regulation of vasodilation (GO:0042312)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|G-protein coupled peptide receptor activity (GO:0008528)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(17)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)		Amyl Nitrite(DB01612)|Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Nesiritide(DB04899)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)	TCTCCCTTAGGTTGTACTGAA	0.602																																					Pancreas(141;1349 1870 15144 15830 40702)												0													57.0	48.0	51.0					1																	153655852		2203	4300	6503	SO:0001630	splice_region_variant	0			BC063304	CCDS1051.1	1q21-q22	2014-03-03	2014-03-03		ENSG00000169418	ENSG00000169418			7943	protein-coding gene	gene with protein product	"""guanylate cyclase A"""	108960	"""atrionatriuretic peptide receptor A"", ""natriuretic peptide receptor A"""	ANPRA, NPRA		1979052	Standard	NM_000906		Approved	GUCY2A, ANPa	uc001fcs.4	P16066	OTTHUMG00000037085	ENST00000368680.3:c.1264-1G>A	1.37:g.153655852G>A			B0ZBF0|Q5SR08|Q6P4Q3	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_ANF_lig-bd_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Peripla_BP_I,superfamily_A/G_cyclase,superfamily_Kinase-like_dom,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_A/G_cyclase,prints_Ntpep_rcpt,pfscan_Prot_kinase_dom,pfscan_A/G_cyclase	p.V422I	ENST00000368680.3	37	c.1264	CCDS1051.1	1	.	.	.	.	.	.	.	.	.	.	G	11.24	1.579517	0.28180	.	.	ENSG00000169418	ENST00000368680	T	0.74421	-0.84	5.29	5.29	0.74685	.	0.338480	0.26532	N	0.023841	T	0.39226	0.1070	N	0.16098	0.37	0.80722	D	1	B	0.19583	0.037	B	0.17722	0.019	T	0.34129	-0.9841	9	.	.	.	.	10.2827	0.43550	0.0904:0.0:0.9096:0.0	.	422	P16066	ANPRA_HUMAN	I	422	ENSP00000357669:V422I	.	V	+	1	0	NPR1	151922476	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	3.036000	0.49767	2.636000	0.89361	0.655000	0.94253	GTT	NPR1	-	superfamily_Peripla_BP_I	ENSG00000169418		0.602	NPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPR1	HGNC	protein_coding	OTTHUMT00000090034.1	-	0.00	55	0	G	NM_000906	Missense_Mutation	153655852	+1	tier1	-	no_errors	ENST00000368680	ensembl	human	known	74_37	missense	29.27	29	12	SNP	1.000	A
NRAP	4892	genome.wustl.edu	37	10	115380372	115380372	+	Silent	SNP	G	G	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr10:115380372G>C	ENST00000359988.3	-	25	3109	c.2865C>G	c.(2863-2865)ctC>ctG	p.L955L	NRAP_ENST00000369360.3_Silent_p.L928L|NRAP_ENST00000360478.3_Silent_p.L920L|NRAP_ENST00000369358.4_Silent_p.L963L	NM_001261463.1|NM_198060.3	NP_001248392.1|NP_932326.2			nebulin-related anchoring protein											autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(18)|lung(39)|ovary(6)|prostate(3)|skin(1)|stomach(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		CCTCGCTAATGAGTTCTCCTG	0.498																																																	0													145.0	126.0	132.0					10																	115380372		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS7578.1, CCDS7579.1, CCDS73199.1	10q24-q26	2008-08-01			ENSG00000197893	ENSG00000197893			7988	protein-coding gene	gene with protein product		602873				12789664, 10320340	Standard	NM_006175		Approved		uc001lal.4	Q86VF7	OTTHUMG00000019072	ENST00000359988.3:c.2865C>G	10.37:g.115380372G>C				Silent	SNP	pfam_Nebulin_35r-motif,pfam_Znf_LIM,smart_Znf_LIM,smart_Nebulin_35r-motif,pfscan_Znf_LIM,pfscan_Nebulin_35r-motif,prints_Nebulin	p.L963	ENST00000359988.3	37	c.2889	CCDS7579.1	10																																																																																			NRAP	-	smart_Nebulin_35r-motif	ENSG00000197893		0.498	NRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRAP	HGNC	protein_coding	OTTHUMT00000050425.2	-	0.00	42	0	G	NM_006175		115380372	-1	tier1	-	no_errors	ENST00000369358	ensembl	human	known	74_37	silent	21.62	29	8	SNP	1.000	C
NXF4	55999	genome.wustl.edu	37	X	101818265	101818265	+	RNA	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chrX:101818265G>A	ENST00000360035.2	+	0	855					NR_002216.1				nuclear RNA export factor 4 pseudogene											endometrium(2)|lung(8)	10						CTGGAAAGGAGACTTATATGG	0.562																																																	0																																												0			AK124700		Xq22	2005-01-24			ENSG00000196970	ENSG00000196970			8074	pseudogene	pseudogene		300318	"""nuclear RNA export factor 4"""			11566096	Standard	NR_002216		Approved		uc004ejf.1		OTTHUMG00000039695		X.37:g.101818265G>A				RNA	SNP	-	NULL	ENST00000360035.2	37	NULL		X																																																																																			NXF4	-	-	ENSG00000196970		0.562	NXF4-001	KNOWN	basic	processed_transcript	NXF4	HGNC	pseudogene	OTTHUMT00000095720.1	-	0.00	56	0	G			101818265	+1	tier1	-	no_errors	ENST00000360035	ensembl	human	known	74_37	rna	61.11	14	22	SNP	0.000	A
OCA2	4948	genome.wustl.edu	37	15	28200322	28200322	+	Silent	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr15:28200322G>A	ENST00000354638.3	-	17	1979	c.1824C>T	c.(1822-1824)atC>atT	p.I608I	OCA2_ENST00000382996.2_Silent_p.I608I|OCA2_ENST00000353809.5_Silent_p.I584I	NM_000275.2	NP_000266.2	Q04671	P_HUMAN	oculocutaneous albinism II	608					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|spermatid development (GO:0007286)|tyrosine transport (GO:0015828)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome membrane (GO:0033162)	L-tyrosine transmembrane transporter activity (GO:0005302)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(48)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		GGAGTTCTTGGATATTGGTCT	0.458									Oculocutaneous Albinism																																								0													242.0	232.0	235.0					15																	28200322		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database			CCDS10020.1, CCDS73701.1	15q12	2013-01-08	2008-01-30		ENSG00000104044	ENSG00000104044			8101	protein-coding gene	gene with protein product	"""melanocyte-specific transporter protein"""	611409	"""oculocutaneous albinism II (pink-eye dilution (murine) homolog)"", ""eye color 3 (brown)"", ""eye color 2 (central brown)"", ""oculocutaneous albinism II (pink-eye dilution homolog, mouse)"""	D15S12, P, EYCL3, EYCL2			Standard	NM_000275		Approved	BEY2, EYCL, BEY, BEY1	uc001zbh.4	Q04671	OTTHUMG00000128871	ENST00000354638.3:c.1824C>T	15.37:g.28200322G>A			Q15211|Q15212|Q96EN1|Q9UMI5	Silent	SNP	pfam_Cit_transptr-like_dom,pfam_Na/sul_symport,pfam_Arsenical_pump_ArsB,tigrfam_Arsenical_pump_ArsB	p.I608	ENST00000354638.3	37	c.1824	CCDS10020.1	15																																																																																			OCA2	-	pfam_Cit_transptr-like_dom,tigrfam_Arsenical_pump_ArsB	ENSG00000104044		0.458	OCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OCA2	HGNC	protein_coding	OTTHUMT00000250823.1	-	0.00	86	0	G	NM_000275		28200322	-1	tier1	-	no_errors	ENST00000354638	ensembl	human	known	74_37	silent	15.79	48	9	SNP	1.000	A
OCSTAMP	128506	genome.wustl.edu	37	20	45170209	45170209	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr20:45170209C>T	ENST00000279028.2	-	3	1418	c.1405G>A	c.(1405-1407)Gtc>Atc	p.V469I		NM_080721.1	NP_542452.1	Q9BR26	OCSTP_HUMAN	osteoclast stimulatory transmembrane protein	469					cellular response to estrogen stimulus (GO:0071391)|cellular response to tumor necrosis factor (GO:0071356)|multinuclear osteoclast differentiation (GO:0072674)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of osteoclast proliferation (GO:0090290)	integral component of membrane (GO:0016021)				breast(1)|endometrium(1)	2						GGTGTGGGGACGCAAGAAGGA	0.632																																																	0													70.0	71.0	71.0					20																	45170209		692	1591	2283	SO:0001583	missense	0			AL034424	CCDS54468.1	20q13.12	2012-03-27	2012-03-27	2012-03-27	ENSG00000149635	ENSG00000149635			16116	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 123"""	C20orf123		18064667	Standard	NM_080721		Approved	dJ257E24.3	uc010zxu.2	Q9BR26	OTTHUMG00000032652	ENST00000279028.2:c.1405G>A	20.37:g.45170209C>T	ENSP00000279028:p.Val469Ile			Missense_Mutation	SNP	pfam_DC_STAMP-like	p.V469I	ENST00000279028.2	37	c.1405	CCDS54468.1	20	.	.	.	.	.	.	.	.	.	.	C	9.362	1.068186	0.20067	.	.	ENSG00000149635	ENST00000279028	T	0.56444	0.46	3.82	-7.29	0.01451	.	2.927490	0.01654	N	0.024726	T	0.24586	0.0596	N	0.08118	0	0.09310	N	1	B	0.15473	0.013	B	0.01281	0.0	T	0.08868	-1.0701	10	0.22706	T	0.39	.	2.0273	0.03522	0.2473:0.3448:0.2919:0.116	.	469	Q9BR26	CT123_HUMAN	I	469	ENSP00000279028:V469I	ENSP00000279028:V469I	V	-	1	0	C20orf123	44603616	.	.	0.000000	0.03702	0.001000	0.01503	.	.	-1.554000	0.01700	-0.894000	0.02916	GTC	OCSTAMP	-	NULL	ENSG00000149635		0.632	OCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OCSTAMP	HGNC	protein_coding	OTTHUMT00000079573.2	-	0.00	20	0	C	XM_496476		45170209	-1	tier1	-	no_errors	ENST00000279028	ensembl	human	known	74_37	missense	70.59	10	24	SNP	0.000	T
OR10K1	391109	genome.wustl.edu	37	1	158435617	158435617	+	Missense_Mutation	SNP	A	A	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:158435617A>C	ENST00000289451.2	+	1	346	c.266A>C	c.(265-267)aAg>aCg	p.K89T		NM_001004473.1	NP_001004473.1	Q8NGX5	O10K1_HUMAN	olfactory receptor, family 10, subfamily K, member 1	89						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	27	all_hematologic(112;0.0378)					CTGTCCCAGAAGAAGACCATT	0.488																																																	0													188.0	184.0	185.0					1																	158435617		2203	4300	6503	SO:0001583	missense	0			AP002532	CCDS30897.1	1q23.1	2012-08-09			ENSG00000173285	ENSG00000173285		"""GPCR / Class A : Olfactory receptors"""	14693	protein-coding gene	gene with protein product							Standard	NM_001004473		Approved		uc010pij.2	Q8NGX5	OTTHUMG00000017517	ENST00000289451.2:c.266A>C	1.37:g.158435617A>C	ENSP00000289451:p.Lys89Thr		Q6IFS2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.K89T	ENST00000289451.2	37	c.266	CCDS30897.1	1	.	.	.	.	.	.	.	.	.	.	a	9.515	1.106703	0.20714	.	.	ENSG00000173285	ENST00000289451	T	0.03094	4.05	4.5	0.829	0.18847	GPCR, rhodopsin-like superfamily (1);	0.151222	0.30620	N	0.009238	T	0.00784	0.0026	N	0.10664	0.02	0.20638	N	0.99988	P	0.41041	0.736	B	0.41332	0.354	T	0.52411	-0.8579	10	0.37606	T	0.19	.	8.1015	0.30859	0.7386:0.0:0.2614:0.0	.	89	Q8NGX5	O10K1_HUMAN	T	89	ENSP00000289451:K89T	ENSP00000289451:K89T	K	+	2	0	OR10K1	156702241	0.000000	0.05858	0.998000	0.56505	0.738000	0.42128	0.087000	0.14958	0.268000	0.21939	0.455000	0.32223	AAG	OR10K1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000173285		0.488	OR10K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10K1	HGNC	protein_coding	OTTHUMT00000046367.1	-	0.00	71	0	A			158435617	+1	tier1	-	no_errors	ENST00000289451	ensembl	human	known	74_37	missense	17.39	38	8	SNP	0.737	C
OR13C2	392376	genome.wustl.edu	37	9	107367311	107367311	+	Missense_Mutation	SNP	G	G	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr9:107367311G>C	ENST00000542196.1	-	1	640	c.598C>G	c.(598-600)Ctt>Gtt	p.L200V		NM_001004481.1	NP_001004481.1	Q8NGS9	O13C2_HUMAN	olfactory receptor, family 13, subfamily C, member 2	200						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22						GTGGCCACAAGCATGATGAAC	0.403																																																	0													155.0	147.0	150.0					9																	107367311		2201	4300	6501	SO:0001583	missense	0				CCDS35092.1	9q31.1	2012-10-03			ENSG00000257019	ENSG00000276119		"""GPCR / Class A : Olfactory receptors"""	14701	protein-coding gene	gene with protein product							Standard	NM_001004481		Approved		uc011lvq.2	Q8NGS9	OTTHUMG00000020415	ENST00000542196.1:c.598C>G	9.37:g.107367311G>C	ENSP00000438815:p.Leu200Val		B9EGV8|Q6IF54	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L200V	ENST00000542196.1	37	c.598	CCDS35092.1	9	.	.	.	.	.	.	.	.	.	.	G	0.008	-1.897527	0.00517	.	.	ENSG00000257019	ENST00000542196	T	0.00164	8.64	3.53	0.302	0.15786	GPCR, rhodopsin-like superfamily (1);	0.700134	0.10552	N	0.661382	T	0.00109	0.0003	L	0.28115	0.83	0.09310	N	1	B	0.06786	0.001	B	0.13407	0.009	T	0.14727	-1.0462	10	0.27785	T	0.31	.	0.8727	0.01217	0.2219:0.1841:0.4054:0.1886	.	200	Q8NGS9	O13C2_HUMAN	V	200	ENSP00000438815:L200V	ENSP00000438815:L200V	L	-	1	0	OR13C2	106407132	0.000000	0.05858	0.030000	0.17652	0.061000	0.15899	-0.980000	0.03770	0.196000	0.20367	-0.502000	0.04539	CTT	OR13C2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000257019		0.403	OR13C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13C2	HGNC	protein_coding	OTTHUMT00000053489.2	-	0.00	80	0	G	NM_001004481		107367311	-1	tier1	-	no_errors	ENST00000542196	ensembl	human	known	74_37	missense	33.90	39	20	SNP	0.001	C
OR2C3	81472	genome.wustl.edu	37	1	247694864	247694864	+	Missense_Mutation	SNP	A	A	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:247694864A>G	ENST00000366487.3	-	2	1311	c.950T>C	c.(949-951)cTg>cCg	p.L317P	GCSAML_ENST00000463359.1_Intron|GCSAML_ENST00000527541.1_Intron|GCSAML_ENST00000366489.1_Intron|GCSAML_ENST00000366491.2_Intron|GCSAML_ENST00000527084.1_Intron|GCSAML_ENST00000366490.3_Intron|GCSAML_ENST00000531662.1_Intron	NM_198074.4	NP_932340	Q8N628	OR2C3_HUMAN	olfactory receptor, family 2, subfamily C, member 3	317						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|large_intestine(2)|lung(31)|ovary(1)|prostate(1)|skin(2)	43	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0242)	OV - Ovarian serous cystadenocarcinoma(106;0.0241)			AATTTGCGCCAGCTTGCCTGC	0.517																																																	0													57.0	53.0	55.0					1																	247694864		2203	4300	6503	SO:0001583	missense	0			BC030717	CCDS1634.2	1q44	2014-02-19	2002-02-28		ENSG00000196242	ENSG00000196242		"""GPCR / Class A : Olfactory receptors"""	15005	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily C, member 4"""	OR2C4, OR2C5P			Standard	NM_198074		Approved	OST742	uc009xgy.3	Q8N628	OTTHUMG00000040579	ENST00000366487.3:c.950T>C	1.37:g.247694864A>G	ENSP00000355443:p.Leu317Pro		Q5JQS4|Q6IEZ1|Q8NGW7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L317P	ENST00000366487.3	37	c.950	CCDS1634.2	1	.	.	.	.	.	.	.	.	.	.	A	8.104	0.777374	0.16120	.	.	ENSG00000196242	ENST00000366487	T	0.00490	7.03	3.71	-4.59	0.03400	.	.	.	.	.	T	0.00210	0.0006	N	0.08118	0	0.09310	N	1	B	0.11235	0.004	B	0.14578	0.011	T	0.25813	-1.0121	9	0.34782	T	0.22	.	4.0107	0.09621	0.2949:0.1858:0.0:0.5194	.	317	Q8N628	OR2C3_HUMAN	P	317	ENSP00000355443:L317P	ENSP00000355443:L317P	L	-	2	0	OR2C3	245761487	0.105000	0.21958	0.000000	0.03702	0.001000	0.01503	-0.769000	0.04710	-0.936000	0.03723	-0.144000	0.13903	CTG	OR2C3	-	NULL	ENSG00000196242		0.517	OR2C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2C3	HGNC	protein_coding	OTTHUMT00000097626.2	-	0.00	23	0	A	NM_198074		247694864	-1	tier1	-	no_errors	ENST00000366487	ensembl	human	known	74_37	missense	25.00	21	7	SNP	0.000	G
OR52E6	390078	genome.wustl.edu	37	11	5862453	5862453	+	Silent	SNP	A	A	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr11:5862453A>G	ENST00000329322.5	-	1	674	c.675T>C	c.(673-675)gcT>gcC	p.A225A	OR52E6_ENST00000379946.2_Silent_p.A229A|TRIM5_ENST00000380027.1_Intron	NM_001005167.1	NP_001005167.1	Q96RD3	O52E6_HUMAN	olfactory receptor, family 52, subfamily E, member 6	225						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.55e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGCAGAAGACAGCATAGAGGA	0.443																																																	0													54.0	55.0	54.0					11																	5862453		2196	4296	6492	SO:0001819	synonymous_variant	0			AB065815	CCDS53597.1	11p15.4	2012-08-09				ENSG00000205409		"""GPCR / Class A : Olfactory receptors"""	15215	protein-coding gene	gene with protein product							Standard	NM_001005167		Approved		uc010qzq.2	Q96RD3		ENST00000329322.5:c.675T>C	11.37:g.5862453A>G			Q6IFF8	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A229	ENST00000329322.5	37	c.687	CCDS53597.1	11																																																																																			OR52E6	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000205409		0.443	OR52E6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52E6	HGNC	protein_coding	OTTHUMT00000401144.1	-	0.00	54	0	A	NM_001005167		5862453	-1	tier1	-	no_errors	ENST00000379946	ensembl	human	known	74_37	silent	15.62	27	5	SNP	0.001	G
OR5AS1	219447	genome.wustl.edu	37	11	55798108	55798108	+	Missense_Mutation	SNP	A	A	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr11:55798108A>C	ENST00000313555.1	+	1	214	c.214A>C	c.(214-216)Agc>Cgc	p.S72R		NM_001001921.1	NP_001001921.1	Q8N127	O5AS1_HUMAN	olfactory receptor, family 5, subfamily AS, member 1	72						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(7)|large_intestine(7)|liver(1)|lung(22)|ovary(3)|prostate(4)|skin(3)|stomach(1)	48	Esophageal squamous(21;0.00693)					CTTAGACATCAGCTGTTCTAC	0.353																																																	0													68.0	64.0	65.0					11																	55798108		2201	4296	6497	SO:0001583	missense	0			AB065543	CCDS31516.1	11q11	2012-08-09			ENSG00000181785	ENSG00000181785		"""GPCR / Class A : Olfactory receptors"""	15261	protein-coding gene	gene with protein product							Standard	NM_001001921		Approved		uc010riw.2	Q8N127	OTTHUMG00000166830	ENST00000313555.1:c.214A>C	11.37:g.55798108A>C	ENSP00000324111:p.Ser72Arg		Q6IFB8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S72R	ENST00000313555.1	37	c.214	CCDS31516.1	11	.	.	.	.	.	.	.	.	.	.	A	7.695	0.691786	0.15039	.	.	ENSG00000181785	ENST00000313555	T	0.79247	-1.25	5.65	-1.7	0.08159	GPCR, rhodopsin-like superfamily (1);	0.363748	0.19901	N	0.103517	T	0.72700	0.3493	M	0.67569	2.06	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.66563	-0.5892	10	0.72032	D	0.01	.	13.2071	0.59803	0.2485:0.0:0.0:0.7514	.	72	Q8N127	O5AS1_HUMAN	R	72	ENSP00000324111:S72R	ENSP00000324111:S72R	S	+	1	0	OR5AS1	55554684	0.000000	0.05858	0.007000	0.13788	0.166000	0.22503	-0.035000	0.12205	-0.208000	0.10171	0.523000	0.50628	AGC	OR5AS1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000181785		0.353	OR5AS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5AS1	HGNC	protein_coding	OTTHUMT00000391538.1	-	0.00	72	0	A	NM_001001921		55798108	+1	tier1	-	no_errors	ENST00000313555	ensembl	human	known	74_37	missense	30.19	37	16	SNP	0.001	C
OSBPL8	114882	genome.wustl.edu	37	12	76786525	76786525	+	Silent	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr12:76786525G>A	ENST00000261183.3	-	10	1244	c.765C>T	c.(763-765)tgC>tgT	p.C255C	OSBPL8_ENST00000393249.2_Silent_p.C213C|OSBPL8_ENST00000393250.4_Silent_p.C213C	NM_020841.4	NP_065892.1	Q9BZF1	OSBL8_HUMAN	oxysterol binding protein-like 8	255	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				fat cell differentiation (GO:0045444)|lipid transport (GO:0006869)|negative regulation of cell migration (GO:0030336)|negative regulation of sequestering of triglyceride (GO:0010891)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of protein kinase B signaling (GO:0051897)|protein localization to nuclear pore (GO:0090204)	membrane (GO:0016020)|nuclear membrane (GO:0031965)	cholesterol binding (GO:0015485)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(14)|ovary(2)	28						CATCCATCCAGCACCTTCCTA	0.363																																																	0													134.0	118.0	123.0					12																	76786525		2203	4300	6503	SO:0001819	synonymous_variant	0			AF392452	CCDS31862.1, CCDS41814.1	12q14	2013-01-10				ENSG00000091039		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16396	protein-coding gene	gene with protein product		606736				1735225, 17991739	Standard	NM_020841		Approved	OSBP10, ORP8, MST120, MSTP120	uc001sye.1	Q9BZF1		ENST00000261183.3:c.765C>T	12.37:g.76786525G>A			A8K1T2|E9PE66|E9PE68|Q52LQ3|Q68D75|Q8WXP8|Q9P277	Silent	SNP	pfam_Oxysterol-bd,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.C255	ENST00000261183.3	37	c.765	CCDS31862.1	12																																																																																			OSBPL8	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000091039		0.363	OSBPL8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OSBPL8	HGNC	protein_coding	OTTHUMT00000406357.1	-	0.00	63	0	G	NM_020841		76786525	-1	tier1	-	no_errors	ENST00000261183	ensembl	human	known	74_37	silent	8.00	46	4	SNP	1.000	A
OTOP3	347741	genome.wustl.edu	37	17	72943297	72943297	+	Silent	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr17:72943297C>T	ENST00000328801.4	+	6	1347	c.1347C>T	c.(1345-1347)ctC>ctT	p.L449L		NM_178233.1	NP_839947.1	Q7RTS5	OTOP3_HUMAN	otopetrin 3	449						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_lung(278;0.151)|Lung NSC(278;0.185)					TCAACCGCCTCATCCTGGCCT	0.617																																																	0													53.0	53.0	53.0					17																	72943297		2203	4300	6503	SO:0001819	synonymous_variant	0			BK000568	CCDS11709.1	17q25	2004-01-19				ENSG00000182938			19658	protein-coding gene	gene with protein product		607828				12651873	Standard	NM_178233		Approved		uc010wrr.3	Q7RTS5		ENST00000328801.4:c.1347C>T	17.37:g.72943297C>T				Silent	SNP	pfam_Otopetrin	p.L449	ENST00000328801.4	37	c.1347	CCDS11709.1	17																																																																																			OTOP3	-	pfam_Otopetrin	ENSG00000182938		0.617	OTOP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOP3	HGNC	protein_coding	OTTHUMT00000445308.1	-	0.00	48	0	C	NM_178233		72943297	+1	tier1	-	no_errors	ENST00000328801	ensembl	human	known	74_37	silent	26.67	22	8	SNP	0.992	T
PAAF1	80227	genome.wustl.edu	37	11	73602157	73602157	+	Splice_Site	SNP	A	A	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr11:73602157A>G	ENST00000310571.3	+	4	246	c.193A>G	c.(193-195)Aaa>Gaa	p.K65E	PAAF1_ENST00000376384.5_Splice_Site_p.K48E|PAAF1_ENST00000544909.1_Splice_Site_p.K66E|PAAF1_ENST00000544552.1_Splice_Site_p.K48E|PAAF1_ENST00000543079.1_3'UTR|PAAF1_ENST00000536003.1_Splice_Site_p.K48E|PAAF1_ENST00000535604.1_5'UTR|PAAF1_ENST00000541951.1_5'UTR	NM_025155.2	NP_079431.1	Q9BRP4	PAAF1_HUMAN	proteasomal ATPase-associated factor 1	65					viral process (GO:0016032)	proteasome complex (GO:0000502)				breast(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Breast(11;7.42e-05)					CTTTGTTTAGAAAAGCATTCA	0.308																																																	0													83.0	79.0	80.0					11																	73602157		2195	4290	6485	SO:0001630	splice_region_variant	0			BC006142	CCDS8226.1, CCDS58157.1, CCDS58158.1	11q13.4	2013-05-21	2007-08-16	2007-08-16	ENSG00000175575	ENSG00000175575		"""WD repeat domain containing"""	25687	protein-coding gene	gene with protein product			"""WD repeat domain 71"""	WDR71		15831487, 17317272, 17289585	Standard	NM_001267803		Approved	FLJ11848, Rpn14	uc001ouk.2	Q9BRP4	OTTHUMG00000168062	ENST00000310571.3:c.193-1A>G	11.37:g.73602157A>G			A6NDR5|B4DPB0|B7ZAS9|Q4G165|Q53HS9|Q7Z500|Q8TBU6|Q9HAB6	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.K65E	ENST00000310571.3	37	c.193	CCDS8226.1	11	.	.	.	.	.	.	.	.	.	.	A	20.5	3.998525	0.74818	.	.	ENSG00000175575	ENST00000310571;ENST00000504441;ENST00000543814;ENST00000536003;ENST00000544552;ENST00000376384;ENST00000536582;ENST00000544909	T;T;T;T;T;T;T;T	0.58652	0.65;0.53;0.32;0.59;0.59;0.59;1.4;0.4	5.81	4.65	0.58169	.	0.000000	0.64402	D	0.000001	T	0.65647	0.2711	L	0.59436	1.845	0.37273	D	0.907502	D;D	0.61697	0.99;0.982	P;P	0.59115	0.852;0.624	T	0.68914	-0.5283	9	.	.	.	-11.3484	9.8001	0.40759	0.9201:0.0:0.0798:0.0	.	48;65	Q9BRP4-2;Q9BRP4	.;PAAF1_HUMAN	E	65;48;48;48;48;48;43;66	ENSP00000311665:K65E;ENSP00000439747:K48E;ENSP00000438894:K48E;ENSP00000438124:K48E;ENSP00000441494:K48E;ENSP00000365564:K48E;ENSP00000443473:K43E;ENSP00000438071:K66E	.	K	+	1	0	PAAF1	73279805	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	3.294000	0.51787	0.981000	0.38548	0.533000	0.62120	AAA	PAAF1	-	NULL	ENSG00000175575		0.308	PAAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAAF1	HGNC	protein_coding	OTTHUMT00000397885.1	-	0.00	29	0	A	NM_025155	Missense_Mutation	73602157	+1	tier1	-	no_errors	ENST00000310571	ensembl	human	known	74_37	missense	25.71	26	9	SNP	1.000	G
PANK3	79646	genome.wustl.edu	37	5	167990909	167990909	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr5:167990909C>A	ENST00000239231.6	-	4	1113	c.797G>T	c.(796-798)tGg>tTg	p.W266L	MIR103A1_ENST00000362165.1_RNA|PANK3_ENST00000520504.1_Intron	NM_024594.3	NP_078870.1	Q9H999	PANK3_HUMAN	pantothenate kinase 3	266					coenzyme A biosynthetic process (GO:0015937)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			NS(1)|cervix(2)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	Renal(175;0.000159)|Lung NSC(126;0.0441)|all_lung(126;0.0909)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0989)|OV - Ovarian serous cystadenocarcinoma(192;0.147)|Epithelial(171;0.188)		TGCTACAGCCCAACCTGGCAA	0.378																																																	0													101.0	105.0	104.0					5																	167990909		2203	4300	6503	SO:0001583	missense	0			AK022961	CCDS4368.1	5q35.1	2008-02-05			ENSG00000120137	ENSG00000120137			19365	protein-coding gene	gene with protein product		606161				11479594	Standard	NM_024594		Approved	FLJ12899	uc003lzz.2	Q9H999	OTTHUMG00000130410	ENST00000239231.6:c.797G>T	5.37:g.167990909C>A	ENSP00000239231:p.Trp266Leu		D3DQL1|Q53FJ9|Q7RTX4	Missense_Mutation	SNP	pfam_Type_II_PanK,tigrfam_Type_II_PanK	p.W266L	ENST00000239231.6	37	c.797	CCDS4368.1	5	.	.	.	.	.	.	.	.	.	.	C	14.77	2.634266	0.47049	.	.	ENSG00000120137	ENST00000239231	D	0.99474	-5.97	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	D	0.98635	0.9543	L	0.54323	1.7	0.47819	D	0.999529	B	0.20671	0.047	B	0.30646	0.118	D	0.98122	1.0426	10	0.72032	D	0.01	-5.5837	17.4478	0.87583	0.0:1.0:0.0:0.0	.	266	Q9H999	PANK3_HUMAN	L	266	ENSP00000239231:W266L	ENSP00000239231:W266L	W	-	2	0	PANK3	167923487	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.477000	0.45180	2.432000	0.82394	0.591000	0.81541	TGG	PANK3	-	pfam_Type_II_PanK,tigrfam_Type_II_PanK	ENSG00000120137		0.378	PANK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PANK3	HGNC	protein_coding	OTTHUMT00000252793.2		0.00	64	0	C	NM_024594		167990909	-1			no_errors	ENST00000239231	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	A
PAX4	5078	genome.wustl.edu	37	7	127255505	127255505	+	Missense_Mutation	SNP	G	G	A	rs151008936	byFrequency	TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr7:127255505G>A	ENST00000341640.2	-	1	275	c.70C>T	c.(70-72)Cgg>Tgg	p.R24W	PAX4_ENST00000378740.2_Missense_Mutation_p.R24W|PAX4_ENST00000463946.1_5'UTR|PAX4_ENST00000338516.3_Missense_Mutation_p.R32W	NM_006193.2	NP_006184.2	O43316	PAX4_HUMAN	paired box 4	32	Paired. {ECO:0000255|PROSITE- ProRule:PRU00381}.				cell differentiation (GO:0030154)|circadian rhythm (GO:0007623)|endocrine pancreas development (GO:0031018)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|positive regulation of cell differentiation (GO:0045597)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|retina development in camera-type eye (GO:0060041)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)			cervix(1)|kidney(2)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35						ACTGCTAGCCGCACAATCTGC	0.587																																					Ovarian(113;737 1605 7858 27720 34092)												0								G	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	91.0	93.0	92.0		70	-0.3	0.0	7	dbSNP_134	92	2,8598	2.2+/-6.3	0,2,4298	yes	missense	PAX4	NM_006193.2	101	0,3,6500	AA,AG,GG		0.0233,0.0227,0.0231	probably-damaging	24/344	127255505	3,13003	2203	4300	6503	SO:0001583	missense	0				CCDS5797.1	7q32.1	2011-06-20	2007-07-12		ENSG00000106331	ENSG00000106331		"""Paired boxes"", ""Homeoboxes / PRD class"""	8618	protein-coding gene	gene with protein product		167413	"""paired box gene 4"""				Standard	NM_006193		Approved	MODY9	uc010lld.1	O43316	OTTHUMG00000157562	ENST00000341640.2:c.70C>T	7.37:g.127255505G>A	ENSP00000339906:p.Arg24Trp		O95161|Q6B0H0	Missense_Mutation	SNP	pfam_Paired_dom,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Paired_dom,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Paired_dom,prints_Paired_dom	p.R24W	ENST00000341640.2	37	c.70	CCDS5797.1	7	.	.	.	.	.	.	.	.	.	.	G	14.05	2.419690	0.42918	2.27E-4	2.33E-4	ENSG00000106331	ENST00000341640;ENST00000338516;ENST00000378740	D;D	0.99376	-5.79;-5.79	5.73	-0.33	0.12683	Paired box protein, N-terminal (4);Winged helix-turn-helix transcription repressor DNA-binding (1);Homeodomain-like (1);	0.478397	0.22649	N	0.057342	D	0.98153	0.9390	L	0.29908	0.895	0.19575	N	0.999963	D;D	0.71674	0.998;0.995	P;P	0.58970	0.827;0.849	D	0.95445	0.8529	10	0.87932	D	0	.	10.9252	0.47187	0.0:0.103:0.3367:0.5603	.	24;32	O43316-4;O43316	.;PAX4_HUMAN	W	24;32;32	ENSP00000339906:R24W;ENSP00000344297:R32W	ENSP00000344297:R32W	R	-	1	2	PAX4	127042741	0.005000	0.15991	0.003000	0.11579	0.105000	0.19272	1.748000	0.38308	0.019000	0.15079	-0.181000	0.13052	CGG	PAX4	-	pfam_Paired_dom,superfamily_Homeodomain-like,smart_Paired_dom,pfscan_Paired_dom,prints_Paired_dom	ENSG00000106331		0.587	PAX4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAX4	HGNC	protein_coding	OTTHUMT00000349165.1		0.00	83	0	G			127255505	-1			no_errors	ENST00000341640	ensembl	human	known	74_37	missense	6.00	47	3	SNP	0.379	A
PBRM1	55193	genome.wustl.edu	37	3	52712580	52712580	+	Silent	SNP	G	G	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr3:52712580G>T	ENST00000296302.7	-	2	173	c.172C>A	c.(172-174)Cga>Aga	p.R58R	PBRM1_ENST00000394830.3_Silent_p.R58R|PBRM1_ENST00000409767.1_Silent_p.R58R|PBRM1_ENST00000410007.1_Silent_p.R58R|PBRM1_ENST00000356770.4_Silent_p.R58R|PBRM1_ENST00000409057.1_Silent_p.R58R|PBRM1_ENST00000409114.3_Silent_p.R58R|PBRM1_ENST00000337303.4_Silent_p.R58R			Q86U86	PB1_HUMAN	polybromo 1	58					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.R58*(7)		breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TTATAGTCTCGGATGGTATTA	0.433			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	7	Substitution - Nonsense(7)	kidney(6)|large_intestine(1)											130.0	118.0	122.0					3																	52712580		2203	4300	6503	SO:0001819	synonymous_variant	0			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.172C>A	3.37:g.52712580G>T			A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Silent	SNP	pfam_Bromodomain,pfam_BAH_dom,pfam_HMG_box_dom,superfamily_Bromodomain,superfamily_HMG_box_dom,smart_Bromodomain,smart_BAH_dom,smart_HMG_box_dom,pfscan_BAH_dom,pfscan_HMG_box_dom,pfscan_Bromodomain,prints_Bromodomain	p.R58	ENST00000296302.7	37	c.172		3																																																																																			PBRM1	-	superfamily_Bromodomain,smart_Bromodomain	ENSG00000163939		0.433	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	PBRM1	HGNC	protein_coding	OTTHUMT00000327232.1	-	0.00	55	0	G	NM_018165		52712580	-1	tier1	-	no_errors	ENST00000296302	ensembl	human	known	74_37	silent	9.76	36	4	SNP	1.000	T
PCDH18	54510	genome.wustl.edu	37	4	138451539	138451539	+	Silent	SNP	G	G	A	rs373847652	byFrequency	TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr4:138451539G>A	ENST00000344876.4	-	1	2090	c.1704C>T	c.(1702-1704)gaC>gaT	p.D568D	PCDH18_ENST00000510305.1_Intron|PCDH18_ENST00000412923.2_Silent_p.D568D|PCDH18_ENST00000507846.1_Silent_p.D348D|PCDH18_ENST00000511115.1_Intron	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	568	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					TGTCATTTTCGTCAATGATGG	0.453													G|||	2	0.000399361	0.0008	0.0	5008	,	,		22857	0.0		0.0	False		,,,				2504	0.001																0								G		1,4405	2.1+/-5.4	0,1,2202	185.0	175.0	178.0		1704	0.7	1.0	4		178	0,8600		0,0,4300	no	coding-synonymous	PCDH18	NM_019035.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		568/1136	138451539	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.1704C>T	4.37:g.138451539G>A			A8K7K3|B7ZKT1|Q52LS2	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D568	ENST00000344876.4	37	c.1704	CCDS34064.1	4																																																																																			PCDH18	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000189184		0.453	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH18	HGNC	protein_coding	OTTHUMT00000364614.1	-	0.00	22	0	G	NM_019035		138451539	-1	tier1	-	no_errors	ENST00000344876	ensembl	human	known	74_37	silent	31.25	11	5	SNP	1.000	A
PCDHA7	56141	genome.wustl.edu	37	5	140216110	140216110	+	Silent	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr5:140216110C>T	ENST00000525929.1	+	1	2142	c.2142C>T	c.(2140-2142)acC>acT	p.T714T	PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA7_ENST00000378125.3_Silent_p.T714T|PCDHA5_ENST00000529619.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	714					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGTGCTTACCCTGCTGCTGT	0.617																																					NSCLC(160;258 2013 5070 22440 28951)												0													114.0	95.0	102.0					5																	140216110		2203	4300	6503	SO:0001819	synonymous_variant	0			AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.2142C>T	5.37:g.140216110C>T			O75282	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.T714	ENST00000525929.1	37	c.2142	CCDS54918.1	5																																																																																			PCDHA7	-	NULL	ENSG00000204963		0.617	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA7	HGNC	protein_coding	OTTHUMT00000372887.2	-	0.00	100	0	C	NM_018910		140216110	+1	tier1	-	no_errors	ENST00000525929	ensembl	human	known	74_37	silent	32.26	42	20	SNP	0.015	T
PCNXL2	80003	genome.wustl.edu	37	1	233393833	233393833	+	Missense_Mutation	SNP	G	G	A	rs201633704		TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:233393833G>A	ENST00000258229.9	-	5	2009	c.1775C>T	c.(1774-1776)aCg>aTg	p.T592M	PCNXL2_ENST00000430153.1_De_novo_Start_InFrame	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	592						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				ACTGGATGCCGTCATCTTGGA	0.448													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20263	0.0		0.0	False		,,,				2504	0.0																0								G	MET/THR	6,3838		0,6,1916	91.0	86.0	87.0		1775	-3.7	0.0	1		87	0,8272		0,0,4136	yes	missense	PCNXL2	NM_014801.3	81	0,6,6052	AA,AG,GG		0.0,0.1561,0.0495	benign	592/2138	233393833	6,12110	1922	4136	6058	SO:0001583	missense	0			AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.1775C>T	1.37:g.233393833G>A	ENSP00000258229:p.Thr592Met		O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Missense_Mutation	SNP	pfam_Pecanex,superfamily_Trypsin-like_Pept_dom	p.T592M	ENST00000258229.9	37	c.1775	CCDS44335.1	1	.	.	.	.	.	.	.	.	.	.	G	9.809	1.182664	0.21870	0.001561	0.0	ENSG00000135749	ENST00000258229	T	0.08282	3.11	5.7	-3.72	0.04411	.	.	.	.	.	T	0.03263	0.0095	N	0.03608	-0.345	0.09310	N	0.999998	B	0.10296	0.003	B	0.04013	0.001	T	0.42632	-0.9440	9	0.45353	T	0.12	.	7.4751	0.27371	0.1917:0.1116:0.576:0.1207	.	592	A6NKB5	PCX2_HUMAN	M	592	ENSP00000258229:T592M	ENSP00000258229:T592M	T	-	2	0	PCNXL2	231460456	0.000000	0.05858	0.002000	0.10522	0.031000	0.12232	0.213000	0.17521	-0.727000	0.04888	-0.302000	0.09304	ACG	PCNXL2	-	NULL	ENSG00000135749		0.448	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNXL2	HGNC	protein_coding	OTTHUMT00000092480.3	-	0.00	76	0	G	NM_014801		233393833	-1	tier1	rs201633704	no_errors	ENST00000258229	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.000	A
PDE10A	10846	genome.wustl.edu	37	6	165848801	165848801	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr6:165848801G>A	ENST00000366882.1	-	7	585	c.431C>T	c.(430-432)cCc>cTc	p.P144L	PDE10A_ENST00000539869.2_Missense_Mutation_p.P154L|PDE10A_ENST00000354448.4_Missense_Mutation_p.P144L			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	144	GAF 1.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)			breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	CTGAGTGATGGGCCCAGCAGG	0.488																																					Esophageal Squamous(22;308 615 5753 12038 40624)												0													153.0	135.0	141.0					6																	165848801		2203	4300	6503	SO:0001583	missense	0			AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.431C>T	6.37:g.165848801G>A	ENSP00000355847:p.Pro144Leu		Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.P154L	ENST00000366882.1	37	c.461		6	.	.	.	.	.	.	.	.	.	.	G	21.9	4.217813	0.79352	.	.	ENSG00000112541	ENST00000366882;ENST00000539869;ENST00000343842;ENST00000354448;ENST00000392126	T;T	0.67865	-0.29;-0.29	5.32	5.32	0.75619	GAF (2);	0.098954	0.64402	D	0.000001	T	0.78553	0.4301	M	0.68952	2.095	0.80722	D	1	D;P	0.89917	1.0;0.937	D;P	0.91635	0.999;0.621	T	0.79596	-0.1738	10	0.66056	D	0.02	.	19.3636	0.94453	0.0:0.0:1.0:0.0	.	154;144	Q9ULW9;Q9Y233	.;PDE10_HUMAN	L	144;172;154;144;143	ENSP00000355847:P144L;ENSP00000346435:P144L	ENSP00000341187:P154L	P	-	2	0	PDE10A	165768791	1.000000	0.71417	0.998000	0.56505	0.811000	0.45836	9.419000	0.97397	2.638000	0.89438	0.460000	0.39030	CCC	PDE10A	-	pfam_GAF,smart_GAF	ENSG00000112541		0.488	PDE10A-001	PUTATIVE	basic	protein_coding	PDE10A	HGNC	protein_coding	OTTHUMT00000043031.1	-	0.00	61	0	G			165848801	-1	tier1	-	no_errors	ENST00000539869	ensembl	human	known	74_37	missense	48.39	16	15	SNP	1.000	A
PDE4DIP	9659	genome.wustl.edu	37	1	144911890	144911890	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:144911890G>A	ENST00000369354.3	-	16	2408	c.2219C>T	c.(2218-2220)tCc>tTc	p.S740F	PDE4DIP_ENST00000313382.9_Missense_Mutation_p.S806F|PDE4DIP_ENST00000369359.4_Missense_Mutation_p.S877F|PDE4DIP_ENST00000369356.4_Missense_Mutation_p.S740F|PDE4DIP_ENST00000529945.1_Missense_Mutation_p.S903F|PDE4DIP_ENST00000479408.2_Missense_Mutation_p.S527F|PDE4DIP_ENST00000369351.3_Missense_Mutation_p.S740F|PDE4DIP_ENST00000369349.3_Missense_Mutation_p.S740F|PDE4DIP_ENST00000313431.9_Missense_Mutation_p.S903F|PDE4DIP_ENST00000530740.1_Missense_Mutation_p.S877F|PDE4DIP_ENST00000524974.1_5'Flank			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	740					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		ACCTAATGTGGATCTGGGTAT	0.373			T	PDGFRB	MPD																																			Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0													229.0	213.0	218.0					1																	144911890		2203	4300	6503	SO:0001583	missense	0			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.2219C>T	1.37:g.144911890G>A	ENSP00000358360:p.Ser740Phe		A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	pfam_Spindle_assoc,superfamily_ARM-type_fold	p.S740F	ENST00000369354.3	37	c.2219	CCDS30824.1	1	.	.	.	.	.	.	.	.	.	.	G	13.75	2.330558	0.41297	.	.	ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000369353;ENST00000530740;ENST00000369359;ENST00000369351;ENST00000369349;ENST00000313431;ENST00000529945;ENST00000479408	T;T;T;T;T;T;T;T;T;T	0.13307	4.61;4.7;4.7;4.7;4.7;3.7;3.71;2.63;2.63;2.6	5.53	4.61	0.57282	.	.	.	.	.	T	0.11580	0.0282	L	0.29908	0.895	0.38597	D	0.950572	P;P;D;P;D;P	0.64830	0.911;0.933;0.994;0.941;0.994;0.89	B;P;P;P;P;P	0.59825	0.346;0.451;0.864;0.532;0.791;0.569	T	0.01702	-1.1292	9	0.46703	T	0.11	.	9.3591	0.38184	0.095:0.0:0.905:0.0	.	903;527;740;903;806;740	E9PL24;E9PQG4;Q5VU43-7;Q5VU43-2;Q5VU43-3;Q5VU43	.;.;.;.;.;MYOME_HUMAN	F	806;740;740;903;877;877;740;740;903;903;527	ENSP00000327209:S806F;ENSP00000358360:S740F;ENSP00000358363:S740F;ENSP00000435654:S877F;ENSP00000358366:S877F;ENSP00000358357:S740F;ENSP00000358355:S740F;ENSP00000316434:S903F;ENSP00000433392:S903F;ENSP00000436791:S527F	ENSP00000327209:S806F	S	-	2	0	PDE4DIP	143623247	0.984000	0.35163	0.925000	0.36789	0.191000	0.23601	2.890000	0.48609	2.624000	0.88883	0.650000	0.86243	TCC	PDE4DIP	-	NULL	ENSG00000178104		0.373	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	PDE4DIP	HGNC	protein_coding	OTTHUMT00000038858.2	-	0.00	142	0	G	NM_022359		144911890	-1	tier1	-	no_errors	ENST00000369356	ensembl	human	known	74_37	missense	14.44	77	13	SNP	0.386	A
PDLIM3	27295	genome.wustl.edu	37	4	186435954	186435954	+	Intron	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr4:186435954C>T	ENST00000284770.5	-	4	404				PDLIM3_ENST00000284767.5_Missense_Mutation_p.A141T|PDLIM3_ENST00000284771.6_Missense_Mutation_p.A141T	NM_014476.5	NP_055291.2	Q53GG5	PDLI3_HUMAN	PDZ and LIM domain 3						actin filament organization (GO:0007015)|heart development (GO:0007507)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	structural constituent of muscle (GO:0008307)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(1)|lung(5)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	17		all_lung(41;1.03e-13)|Lung NSC(41;2.49e-13)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.00996)|Colorectal(36;0.0161)|all_hematologic(60;0.0592)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.4e-10)|BRCA - Breast invasive adenocarcinoma(30;8.64e-05)|GBM - Glioblastoma multiforme(59;0.000167)|STAD - Stomach adenocarcinoma(60;0.000828)|LUSC - Lung squamous cell carcinoma(40;0.00984)|COAD - Colon adenocarcinoma(29;0.0115)|READ - Rectum adenocarcinoma(43;0.171)		TTATAGGAAGCGCTCACTACC	0.478																																																	0													143.0	129.0	133.0					4																	186435954		692	1591	2283	SO:0001627	intron_variant	0			AF002280	CCDS3844.1, CCDS47172.1, CCDS75218.1, CCDS75219.1	4q35	2014-09-17			ENSG00000154553	ENSG00000154553			20767	protein-coding gene	gene with protein product		605889				10063829, 8828038	Standard	NM_014476		Approved	ALP	uc003ixw.4	Q53GG5	OTTHUMG00000160412	ENST00000284770.5:c.331-463G>A	4.37:g.186435954C>T			B2R866|O43590|O60439|O60440|Q8N6Y6|Q9BVP4	Missense_Mutation	SNP	pfam_PDZ,pfam_Znf_LIM,superfamily_PDZ,smart_PDZ,smart_ZASP,smart_Znf_LIM,pfscan_Znf_LIM,pfscan_PDZ	p.A141T	ENST00000284770.5	37	c.421	CCDS3844.1	4	.	.	.	.	.	.	.	.	.	.	C	14.20	2.463161	0.43736	.	.	ENSG00000154553	ENST00000284771;ENST00000284767	T;T	0.47869	2.06;0.83	6.07	5.16	0.70880	.	.	.	.	.	T	0.34571	0.0902	.	.	.	0.53005	D	0.999967	B;B	0.20550	0.046;0.011	B;B	0.16289	0.015;0.013	T	0.07616	-1.0763	8	0.27082	T	0.32	.	11.8976	0.52665	0.3681:0.6319:0.0:0.0	.	141;141	Q53GG5-3;Q53GG5-2	.;.	T	141	ENSP00000284771:A141T;ENSP00000284767:A141T	ENSP00000284767:A141T	A	-	1	0	PDLIM3	186672948	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.094000	0.50227	2.885000	0.99019	0.655000	0.94253	GCT	PDLIM3	-	smart_ZASP	ENSG00000154553		0.478	PDLIM3-001	KNOWN	basic|CCDS	protein_coding	PDLIM3	HGNC	protein_coding	OTTHUMT00000360499.2	-	0.00	70	0	C	NM_014476		186435954	-1	tier1	-	no_errors	ENST00000284771	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	T
PDPN	10630	genome.wustl.edu	37	1	13940876	13940876	+	Missense_Mutation	SNP	T	T	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:13940876T>A	ENST00000509009.1	+	5	481	c.437T>A	c.(436-438)gTg>gAg	p.V146E	PDPN_ENST00000475043.1_Missense_Mutation_p.V109E|PDPN_ENST00000487038.1_Missense_Mutation_p.V109E|PDPN_ENST00000376057.4_Missense_Mutation_p.V227E|PDPN_ENST00000294489.6_Missense_Mutation_p.V227E|PDPN_ENST00000513143.1_Missense_Mutation_p.V109E|PDPN_ENST00000376061.4_Missense_Mutation_p.V109E					podoplanin											endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	16	Ovarian(185;0.249)	all_lung(284;2.29e-05)|Lung NSC(185;4.37e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00969)|Colorectal(212;4.48e-06)|COAD - Colon adenocarcinoma(227;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000347)|Kidney(185;0.00087)|KIRC - Kidney renal clear cell carcinoma(229;0.0027)|STAD - Stomach adenocarcinoma(313;0.00802)|READ - Rectum adenocarcinoma(331;0.0678)		ATCATCGTTGTGGTTATGCGA	0.423																																																	0													199.0	187.0	192.0					1																	13940876		2203	4300	6503	SO:0001583	missense	0			AB127958, AY194238	CCDS30602.1, CCDS41266.1, CCDS44060.1, CCDS53270.1	1p36.21	2008-02-05			ENSG00000162493	ENSG00000162493			29602	protein-coding gene	gene with protein product	"""lung type I cell membrane associated glycoprotein"""	608863				10393083, 9651190	Standard	NM_006474		Approved	T1A-2, Gp38, aggrus, GP40, PA2.26	uc001avd.3	Q86YL7	OTTHUMG00000007912	ENST00000509009.1:c.437T>A	1.37:g.13940876T>A	ENSP00000422977:p.Val146Glu			Missense_Mutation	SNP	pfam_Podoplanin	p.V227E	ENST00000509009.1	37	c.680		1	.	.	.	.	.	.	.	.	.	.	T	17.04	3.286703	0.59867	.	.	ENSG00000162493	ENST00000294489;ENST00000376057;ENST00000510906;ENST00000509009;ENST00000376061;ENST00000513143;ENST00000487038;ENST00000475043	T;T;T;T;T;T;T;T	0.47528	0.84;0.84;0.84;0.84;0.84;0.84;0.84;0.84	5.93	3.61	0.41365	.	0.705996	0.13190	N	0.406827	T	0.59985	0.2234	M	0.61703	1.905	0.09310	N	1	D;D;D;D	0.69078	0.997;0.997;0.996;0.996	D;D;D;D	0.68621	0.93;0.959;0.931;0.931	T	0.48864	-0.8997	10	0.87932	D	0	-25.0448	5.2172	0.15348	0.0:0.2548:0.0:0.7452	.	151;109;227;227	Q86YL7;E9PB68;Q86YL7-3;Q86YL7-4	PDPN_HUMAN;.;.;.	E	227;227;218;146;109;109;109;109	ENSP00000294489:V227E;ENSP00000365225:V227E;ENSP00000426302:V218E;ENSP00000422977:V146E;ENSP00000365229:V109E;ENSP00000425304:V109E;ENSP00000427537:V109E;ENSP00000426063:V109E	ENSP00000294489:V227E	V	+	2	0	PDPN	13813463	0.201000	0.23410	0.002000	0.10522	0.913000	0.54294	1.536000	0.36072	1.077000	0.40990	0.533000	0.62120	GTG	PDPN	-	pfam_Podoplanin	ENSG00000162493		0.423	PDPN-009	PUTATIVE	basic|exp_conf	protein_coding	PDPN	HGNC	protein_coding	OTTHUMT00000367736.1	-	0.00	131	0	T	NM_006474		13940876	+1	tier1	-	no_errors	ENST00000294489	ensembl	human	known	74_37	missense	24.75	76	25	SNP	0.002	A
PDS5A	23244	genome.wustl.edu	37	4	39905727	39905727	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr4:39905727C>T	ENST00000303538.8	-	12	1857	c.1318G>A	c.(1318-1320)Gca>Aca	p.A440T	PDS5A_ENST00000503396.1_Missense_Mutation_p.A440T	NM_001100399.1	NP_001093869.1			PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae)											breast(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(9)|lung(14)|prostate(3)|skin(1)|urinary_tract(1)	39						ACTTTCTCTGCAGCTTCCTTT	0.383																																																	0													83.0	74.0	77.0					4																	39905727		1862	4118	5980	SO:0001583	missense	0			AF294791	CCDS47045.1, CCDS54759.1	4p14	2007-06-20			ENSG00000121892	ENSG00000121892			29088	protein-coding gene	gene with protein product		613200				11076961, 15855230	Standard	NM_001100399		Approved	KIAA0648, PIG54, SCC-112	uc003guv.4	Q29RF7	OTTHUMG00000160582	ENST00000303538.8:c.1318G>A	4.37:g.39905727C>T	ENSP00000303427:p.Ala440Thr			Missense_Mutation	SNP	superfamily_ARM-type_fold	p.A440T	ENST00000303538.8	37	c.1318	CCDS47045.1	4	.	.	.	.	.	.	.	.	.	.	C	18.38	3.610912	0.66558	.	.	ENSG00000121892	ENST00000303538;ENST00000503396	T	0.64803	-0.12	5.04	5.04	0.67666	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.68751	0.3035	L	0.54323	1.7	0.80722	D	1	B;P	0.41345	0.321;0.746	B;P	0.49451	0.138;0.611	T	0.66444	-0.5922	9	.	.	.	-13.2431	18.7363	0.91756	0.0:1.0:0.0:0.0	.	440;440	Q29RF7-3;Q29RF7	.;PDS5A_HUMAN	T	440	ENSP00000303427:A440T	.	A	-	1	0	PDS5A	39582122	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.915000	0.56409	2.502000	0.84385	0.655000	0.94253	GCA	PDS5A	-	superfamily_ARM-type_fold	ENSG00000121892		0.383	PDS5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDS5A	HGNC	protein_coding	OTTHUMT00000361287.1	-	0.00	57	0	C	NM_015200		39905727	-1	tier1	-	no_errors	ENST00000303538	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	T
PEG3	5178	genome.wustl.edu	37	19	57326073	57326073	+	Missense_Mutation	SNP	A	A	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr19:57326073A>C	ENST00000326441.9	-	10	4100	c.3737T>G	c.(3736-3738)cTt>cGt	p.L1246R	ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000593711.1_Intron|ZIM2_ENST00000221722.5_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.L1246R|PEG3_ENST00000593695.1_Missense_Mutation_p.L1120R|PEG3_ENST00000598410.1_Missense_Mutation_p.L1122R	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	1246					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		TTCCCTATGAAGTCTCATATG	0.498																																																	0													50.0	45.0	47.0					19																	57326073		2203	4300	6503	SO:0001583	missense	0			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.3737T>G	19.37:g.57326073A>C	ENSP00000326581:p.Leu1246Arg		A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.L1246R	ENST00000326441.9	37	c.3737	CCDS12948.1	19	.	.	.	.	.	.	.	.	.	.	A	11.99	1.803336	0.31869	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.29142	1.58;1.58	4.06	1.93	0.25924	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.928181	0.08927	N	0.873592	T	0.29749	0.0743	N	0.17723	0.515	.	.	.	B;D;P	0.55800	0.17;0.973;0.714	B;P;B	0.55455	0.091;0.776;0.418	T	0.28554	-1.0040	9	0.87932	D	0	-3.0727	4.2058	0.10488	0.3908:0.1548:0.0:0.4544	.	1122;1246;1181	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	R	1246	ENSP00000326581:L1246R;ENSP00000403051:L1246R	ENSP00000326581:L1246R	L	-	2	0	ZIM2	62017885	0.000000	0.05858	0.000000	0.03702	0.730000	0.41778	0.143000	0.16115	0.339000	0.23719	0.533000	0.62120	CTT	PEG3	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198300		0.498	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG3	HGNC	protein_coding	OTTHUMT00000416099.2	-	0.00	45	0	A			57326073	-1	tier1	-	no_errors	ENST00000326441	ensembl	human	known	74_37	missense	47.83	12	11	SNP	0.001	C
PHC1	1911	genome.wustl.edu	37	12	9086980	9086980	+	Missense_Mutation	SNP	G	G	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr12:9086980G>C	ENST00000543824.1	+	11	2491	c.2159G>C	c.(2158-2160)gGt>gCt	p.G720A	PHC1_ENST00000536844.1_Missense_Mutation_p.G326A|PHC1_ENST00000544916.1_Missense_Mutation_p.G720A|PHC1_ENST00000433083.2_Missense_Mutation_p.G675A			P78364	PHC1_HUMAN	polyhomeotic homolog 1 (Drosophila)	720					cellular response to retinoic acid (GO:0071300)|histone ubiquitination (GO:0016574)|multicellular organismal development (GO:0007275)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|large_intestine(8)|liver(2)|lung(3)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	27						AGACAAATGGGTGACTCAAAA	0.522																																																	0													69.0	69.0	69.0					12																	9086980		2203	4290	6493	SO:0001583	missense	0			U89277	CCDS8597.1	12p13	2013-01-10	2006-09-12	2002-11-15	ENSG00000111752	ENSG00000111752		"""Sterile alpha motif (SAM) domain containing"""	3182	protein-coding gene	gene with protein product		602978	"""early development regulator 1 (homolog of polyhomeotic 1)"", ""polyhomeotic-like 1 (Drosophila)"""	EDR1		9121482	Standard	XM_005253334		Approved	HPH1, RAE28	uc001qvd.3	P78364	OTTHUMG00000168275	ENST00000543824.1:c.2159G>C	12.37:g.9086980G>C	ENSP00000440674:p.Gly720Ala		D3DUV4|Q8WVM3|Q9BU63	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,pfam_Znf_MYM,superfamily_SAM/pointed,smart_SAM,pfscan_SAM,pfscan_Znf_FCS	p.G720A	ENST00000543824.1	37	c.2159	CCDS8597.1	12	.	.	.	.	.	.	.	.	.	.	G	6.556	0.470888	0.12461	.	.	ENSG00000111752	ENST00000543824;ENST00000251757;ENST00000433083;ENST00000544916;ENST00000536844	T;T;T;T;T	0.39406	1.08;1.08;1.08;1.08;1.08	5.91	5.02	0.67125	.	0.278870	0.36444	N	0.002585	T	0.44095	0.1277	M	0.64170	1.965	0.49389	D	0.99978	B	0.16603	0.018	B	0.14023	0.01	T	0.36962	-0.9726	10	0.54805	T	0.06	-9.9003	16.2098	0.82148	0.0:0.0:0.8658:0.1342	.	720	P78364	PHC1_HUMAN	A	720;720;675;720;326	ENSP00000440674:G720A;ENSP00000251757:G720A;ENSP00000399194:G675A;ENSP00000437659:G720A;ENSP00000440488:G326A	ENSP00000251757:G720A	G	+	2	0	PHC1	8978247	1.000000	0.71417	0.985000	0.45067	0.016000	0.09150	5.286000	0.65639	1.505000	0.48720	-0.169000	0.13324	GGT	PHC1	-	NULL	ENSG00000111752		0.522	PHC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHC1	HGNC	protein_coding	OTTHUMT00000399115.1	-	0.00	77	0	G	NM_004426		9086980	+1	tier1	-	no_errors	ENST00000543824	ensembl	human	known	74_37	missense	19.67	49	12	SNP	0.975	C
PHKG1	5260	genome.wustl.edu	37	7	56149877	56149877	+	Missense_Mutation	SNP	C	C	T	rs376787464		TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr7:56149877C>T	ENST00000297373.2	-	7	811	c.617G>A	c.(616-618)gGc>gAc	p.G206D	PHKG1_ENST00000537360.1_Missense_Mutation_p.G152D|PHKG1_ENST00000452681.2_Missense_Mutation_p.G238D|PHKG1_ENST00000489604.1_5'Flank	NM_001258460.1|NM_006213.4	NP_001245389.1|NP_006204.1	Q16816	PHKG1_HUMAN	phosphorylase kinase, gamma 1 (muscle)	206	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)	ATP binding (GO:0005524)|phosphorylase kinase activity (GO:0004689)|tau-protein kinase activity (GO:0050321)			endometrium(1)|large_intestine(1)|lung(5)	7	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			TTTCCCGTAGCCCGGGTGGTC	0.627																																					Melanoma(184;580 2064 5329 24177 35303)												0													85.0	81.0	82.0					7																	56149877		2203	4300	6503	SO:0001583	missense	0			X80590	CCDS5525.1, CCDS59057.1	7p11.2	2009-07-10			ENSG00000164776	ENSG00000164776	2.7.11.19		8930	protein-coding gene	gene with protein product		172470		PHKG		8530014	Standard	NM_001258459		Approved		uc011kdb.2	Q16816	OTTHUMG00000023869	ENST00000297373.2:c.617G>A	7.37:g.56149877C>T	ENSP00000297373:p.Gly206Asp		B7Z1D0|F5H2S1|Q75LP5	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Phosph_kin_gamma	p.G238D	ENST00000297373.2	37	c.713	CCDS5525.1	7	.	.	.	.	.	.	.	.	.	.	C	23.2	4.382556	0.82792	.	.	ENSG00000164776	ENST00000452681;ENST00000537360;ENST00000297373;ENST00000432123	T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16	5.49	5.49	0.81192	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000002	T	0.76666	0.4019	L	0.53249	1.67	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.998;1.0	T	0.76761	-0.2840	10	0.59425	D	0.04	-43.4464	18.7426	0.91779	0.0:1.0:0.0:0.0	.	152;197;238;206	B7Z5U3;B7Z6U2;F5H2S1;Q16816	.;.;.;PHKG1_HUMAN	D	238;152;206;128	ENSP00000445440:G238D;ENSP00000441528:G152D;ENSP00000297373:G206D;ENSP00000397193:G128D	ENSP00000297373:G206D	G	-	2	0	PHKG1	56117371	1.000000	0.71417	0.993000	0.49108	0.413000	0.31143	4.937000	0.63513	2.759000	0.94783	0.549000	0.68633	GGC	PHKG1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000164776		0.627	PHKG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHKG1	HGNC	protein_coding	OTTHUMT00000251587.1	-	0.00	45	0	C	NM_006213		56149877	-1	tier1	-	no_errors	ENST00000452681	ensembl	human	known	74_37	missense	9.33	68	7	SNP	1.000	T
PLCD3	113026	genome.wustl.edu	37	17	43190893	43190893	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr17:43190893C>T	ENST00000322765.5	-	13	2019	c.1906G>A	c.(1906-1908)Gtc>Atc	p.V636I	PLCD3_ENST00000540511.1_5'UTR	NM_133373.3	NP_588614.1	Q8N3E9	PLCD3_HUMAN	phospholipase C, delta 3	637	PI-PLC Y-box. {ECO:0000255|PROSITE- ProRule:PRU00271}.				angiogenesis (GO:0001525)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|labyrinthine layer blood vessel development (GO:0060716)|lipid catabolic process (GO:0016042)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			breast(2)|endometrium(2)|large_intestine(3)|lung(5)|prostate(1)|stomach(2)|urinary_tract(2)	17						GGTTTTAGGACGTAGCCACAC	0.597																																																	0													51.0	56.0	54.0					17																	43190893		2065	4191	6256	SO:0001583	missense	0			AC002117	CCDS74077.1	17q21	2012-04-20			ENSG00000161714	ENSG00000161714	3.1.4.11		9061	protein-coding gene	gene with protein product		608795				10702670, 9056492	Standard	NM_133373		Approved		uc002iib.3	Q8N3E9	OTTHUMG00000168029	ENST00000322765.5:c.1906G>A	17.37:g.43190893C>T	ENSP00000313731:p.Val636Ile		Q8TEC1|Q8TF37|Q96FL6	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_C2_dom,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.V636I	ENST00000322765.5	37	c.1906		17	.	.	.	.	.	.	.	.	.	.	C	13.88	2.370122	0.42003	.	.	ENSG00000161714	ENST00000322765	T	0.70869	-0.52	4.84	0.535	0.17133	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific, Y domain (3);	0.195709	0.43110	N	0.000601	T	0.53626	0.1808	.	.	.	0.31213	N	0.698447	B	0.22800	0.075	B	0.17433	0.018	T	0.48980	-0.8986	9	0.33940	T	0.23	.	8.5424	0.33402	0.0:0.659:0.0:0.341	.	637	Q8N3E9	PLCD3_HUMAN	I	636	ENSP00000313731:V636I	ENSP00000313731:V636I	V	-	1	0	PLCD3	40546419	0.000000	0.05858	0.242000	0.24170	0.665000	0.39181	-0.421000	0.07053	0.053000	0.16036	0.555000	0.69702	GTC	PLCD3	-	pfam_PLipase_C_Pinositol-sp_Y,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_Pinositol-sp_Y,pfscan_PLipase_C_Pinositol-sp_Y	ENSG00000161714		0.597	PLCD3-201	KNOWN	basic|appris_principal	protein_coding	PLCD3	HGNC	protein_coding		-	0.00	51	0	C	NM_133373		43190893	-1	tier1	-	no_errors	ENST00000322765	ensembl	human	known	74_37	missense	24.00	19	6	SNP	0.883	T
PLCD3	113026	genome.wustl.edu	37	17	43192760	43192762	+	In_Frame_Del	DEL	TCC	TCC	-			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	TCC	TCC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr17:43192760_43192762delTCC	ENST00000322765.5	-	9	1622_1624	c.1509_1511delGGA	c.(1507-1512)gaggat>gat	p.E503del	PLCD3_ENST00000540511.1_5'UTR	NM_133373.3	NP_588614.1	Q8N3E9	PLCD3_HUMAN	phospholipase C, delta 3	503					angiogenesis (GO:0001525)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|labyrinthine layer blood vessel development (GO:0060716)|lipid catabolic process (GO:0016042)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)	p.E503D(2)		breast(2)|endometrium(2)|large_intestine(3)|lung(5)|prostate(1)|stomach(2)|urinary_tract(2)	17						ctcctcgtcatcctcctcctcct	0.67																																																	2	Substitution - Missense(2)	prostate(2)								316,3576		28,260,1658						-0.9	0.0			15	741,7257		61,619,3319	no	coding	PLCD3	NM_133373.3		89,879,4977	A1A1,A1R,RR		9.2648,8.1192,8.8898				1057,10833				SO:0001651	inframe_deletion	0			AC002117	CCDS74077.1	17q21	2012-04-20			ENSG00000161714	ENSG00000161714	3.1.4.11		9061	protein-coding gene	gene with protein product		608795				10702670, 9056492	Standard	NM_133373		Approved		uc002iib.3	Q8N3E9	OTTHUMG00000168029	ENST00000322765.5:c.1509_1511delGGA	17.37:g.43192769_43192771delTCC	ENSP00000313731:p.Glu503del		Q8TEC1|Q8TF37|Q96FL6	In_Frame_Del	DEL	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_C2_dom,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.E503in_frame_del	ENST00000322765.5	37	c.1511_1509		17																																																																																			PLCD3	-	superfamily_PLC-like_Pdiesterase_TIM-brl	ENSG00000161714		0.670	PLCD3-201	KNOWN	basic|appris_principal	protein_coding	PLCD3	HGNC	protein_coding			0.00	54	0	TCC	NM_133373		43192762	-1	tier1		no_errors	ENST00000322765	ensembl	human	known	74_37	in_frame_del	11.11	40	5	DEL	0.000:0.003:0.000	-
PLCE1	51196	genome.wustl.edu	37	10	96058148	96058148	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr10:96058148G>A	ENST00000371380.3	+	23	5415	c.5180G>A	c.(5179-5181)gGc>gAc	p.G1727D	PLCE1_ENST00000371375.1_Missense_Mutation_p.G1419D|PLCE1_ENST00000371385.3_Missense_Mutation_p.G1419D|PLCE1_ENST00000260766.3_Missense_Mutation_p.G1727D			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	1727	Required for activation by RHOA, RHOB, GNA12, GNA13 and G-beta gamma. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				TCCTGTGAAGGCATTCGACAG	0.428																																																	0													89.0	87.0	87.0					10																	96058148		1854	4096	5950	SO:0001583	missense	0				CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.5180G>A	10.37:g.96058148G>A	ENSP00000360431:p.Gly1727Asp		A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_Ras-assoc,pfam_RasGRF_CDC25,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_Ras_GEF_dom,superfamily_C2_dom,smart_RasGRF_CDC25,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,smart_Ras-assoc,pfscan_C2_dom,pfscan_Ras-assoc,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,pfscan_RasGRF_CDC25,prints_Pinositol_PLipase_C	p.G1727D	ENST00000371380.3	37	c.5180	CCDS41552.1	10	.	.	.	.	.	.	.	.	.	.	G	14.05	2.418312	0.42918	.	.	ENSG00000138193	ENST00000260766;ENST00000371380;ENST00000371385;ENST00000371375	T;T;T;T	0.24723	1.84;1.84;1.85;1.85	5.6	5.6	0.85130	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (1);	0.000000	0.52532	D	0.000078	T	0.25082	0.0609	N	0.19112	0.55	0.35600	D	0.807776	P;P;P	0.49090	0.868;0.919;0.704	B;P;B	0.48795	0.386;0.59;0.216	T	0.20472	-1.0274	10	0.59425	D	0.04	.	14.1954	0.65667	0.0:0.1494:0.8506:0.0	.	1711;1419;1727	B7ZM61;Q9P212-2;Q9P212	.;.;PLCE1_HUMAN	D	1727;1727;1419;1419	ENSP00000260766:G1727D;ENSP00000360431:G1727D;ENSP00000360438:G1419D;ENSP00000360426:G1419D	ENSP00000260766:G1727D	G	+	2	0	PLCE1	96048138	1.000000	0.71417	0.997000	0.53966	0.533000	0.34776	3.374000	0.52402	2.650000	0.89964	0.655000	0.94253	GGC	PLCE1	-	superfamily_PLC-like_Pdiesterase_TIM-brl	ENSG00000138193		0.428	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCE1	HGNC	protein_coding	OTTHUMT00000049469.3		0.00	46	0	G	NM_016341		96058148	+1			no_errors	ENST00000260766	ensembl	human	known	74_37	missense	10.00	27	3	SNP	0.970	A
PLD5	200150	genome.wustl.edu	37	1	242271125	242271125	+	Silent	SNP	A	A	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:242271125A>G	ENST00000536534.2	-	8	1328	c.1087T>C	c.(1087-1089)Ttg>Ctg	p.L363L	PLD5_ENST00000442594.2_Silent_p.L271L|PLD5_ENST00000427495.1_Silent_p.L301L			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5	363						integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			TTTGCATCCAAGTCTGGCCAG	0.343																																																	0													69.0	70.0	70.0					1																	242271125		2203	4300	6503	SO:0001819	synonymous_variant	0			AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.1087T>C	1.37:g.242271125A>G			A1KXV0|B7Z324|Q494U9|Q8NB22	Silent	SNP	smart_PLipase_D/transphosphatidylase	p.L363	ENST00000536534.2	37	c.1087	CCDS1621.2	1																																																																																			PLD5	-	NULL	ENSG00000180287		0.343	PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PLD5	HGNC	protein_coding	OTTHUMT00000397213.2	-	0.00	89	0	A	NM_152666		242271125	-1	tier1	-	no_errors	ENST00000536534	ensembl	human	known	74_37	silent	32.05	52	25	SNP	0.998	G
PLEKHH3	79990	genome.wustl.edu	37	17	40823101	40823101	+	Silent	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr17:40823101G>A	ENST00000591022.1	-	9	1719	c.1332C>T	c.(1330-1332)aaC>aaT	p.N444N	PLEKHH3_ENST00000293349.6_Silent_p.N444N|PLEKHH3_ENST00000456950.2_5'UTR|PLEKHH3_ENST00000412503.1_Silent_p.N444N	NM_024927.4	NP_079203	Q7Z736	PKHH3_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 3	444	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				signal transduction (GO:0007165)	cytoskeleton (GO:0005856)|extracellular space (GO:0005615)				endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(2)|skin(2)	13		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.14)		GCGCGAATGCGTTGCGGCTCC	0.657																																																	0													22.0	28.0	26.0					17																	40823101		2171	4256	6427	SO:0001819	synonymous_variant	0			BC052978	CCDS11434.1	17q21.2	2013-01-11				ENSG00000068137		"""Pleckstrin homology (PH) domain containing"""	26105	protein-coding gene	gene with protein product						12477932	Standard	NM_024927		Approved	FLJ21019	uc002iau.3	Q7Z736		ENST00000591022.1:c.1332C>T	17.37:g.40823101G>A			C9JQ76|Q59H20|Q96B28|Q9H7D6|Q9NT18	Silent	SNP	pfam_MyTH4_dom,pfam_FERM_central,pfam_Ras-assoc,superfamily_FERM_central,smart_Pleckstrin_homology,smart_MyTH4_dom,smart_Band_41_domain,pfscan_FERM_domain,pfscan_MyTH4_dom,pfscan_Pleckstrin_homology	p.N444	ENST00000591022.1	37	c.1332	CCDS11434.1	17																																																																																			PLEKHH3	-	pfam_Ras-assoc,smart_Band_41_domain,pfscan_FERM_domain	ENSG00000068137		0.657	PLEKHH3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLEKHH3	HGNC	protein_coding	OTTHUMT00000452332.1	-	0.00	61	0	G	NM_024927		40823101	-1	tier1	-	no_errors	ENST00000591022	ensembl	human	known	74_37	silent	36.11	23	13	SNP	0.158	A
PLXNA2	5362	genome.wustl.edu	37	1	208390427	208390427	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:208390427C>T	ENST00000367033.3	-	2	1598	c.841G>A	c.(841-843)Gtg>Atg	p.V281M		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	281	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		CAGAGCCGCACGATGCGTGAG	0.612																																																	0													99.0	97.0	97.0					1																	208390427		2203	4300	6503	SO:0001583	missense	0			X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.841G>A	1.37:g.208390427C>T	ENSP00000356000:p.Val281Met		A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semap_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.V281M	ENST00000367033.3	37	c.841	CCDS31013.1	1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.714544	0.89112	.	.	ENSG00000076356	ENST00000367033	T	0.12879	2.64	5.84	5.84	0.93424	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.073718	0.53938	D	0.000059	T	0.46927	0.1418	M	0.87971	2.92	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.989	T	0.50499	-0.8821	10	0.87932	D	0	.	20.1346	0.98019	0.0:1.0:0.0:0.0	.	335;281	O75051-2;O75051	.;PLXA2_HUMAN	M	281	ENSP00000356000:V281M	ENSP00000356000:V281M	V	-	1	0	PLXNA2	206457050	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.533000	0.81994	2.765000	0.95021	0.655000	0.94253	GTG	PLXNA2	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000076356		0.612	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA2	HGNC	protein_coding	OTTHUMT00000088932.6		0.00	30	0	C	NM_025179		208390427	-1			no_errors	ENST00000367033	ensembl	human	known	74_37	missense	13.04	20	3	SNP	1.000	T
PLXND1	23129	genome.wustl.edu	37	3	129291689	129291689	+	Missense_Mutation	SNP	T	T	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr3:129291689T>G	ENST00000324093.4	-	14	3111	c.2933A>C	c.(2932-2934)tAc>tCc	p.Y978S	PLXND1_ENST00000393239.1_Missense_Mutation_p.Y978S	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	978	IPT/TIG 1.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)		PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						CCTTACCACGTAGGAGAAGCG	0.682																																					Ovarian(97;366 1484 3738 22084 39045)												0													52.0	49.0	50.0					3																	129291689		2203	4300	6503	SO:0001583	missense	0			AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.2933A>C	3.37:g.129291689T>G	ENSP00000317128:p.Tyr978Ser		A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT,pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.Y978S	ENST00000324093.4	37	c.2933	CCDS33854.1	3	.	.	.	.	.	.	.	.	.	.	T	18.01	3.528508	0.64860	.	.	ENSG00000004399	ENST00000324093;ENST00000393239	T;T	0.69685	-0.42;-0.42	5.1	5.1	0.69264	Cell surface receptor IPT/TIG (1);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.551299	0.18397	N	0.142471	D	0.83408	0.5248	M	0.88377	2.95	0.80722	D	1	D	0.76494	0.999	D	0.68192	0.956	D	0.86292	0.1674	10	0.87932	D	0	.	13.4772	0.61316	0.0:0.0:0.0:1.0	.	978	Q9Y4D7	PLXD1_HUMAN	S	978	ENSP00000317128:Y978S;ENSP00000376931:Y978S	ENSP00000317128:Y978S	Y	-	2	0	PLXND1	130774379	0.997000	0.39634	0.985000	0.45067	0.709000	0.40893	2.841000	0.48223	1.916000	0.55485	0.533000	0.62120	TAC	PLXND1	-	superfamily_Ig_E-set,smart_IPT	ENSG00000004399		0.682	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXND1	HGNC	protein_coding	OTTHUMT00000356132.4	-	0.00	81	0	T	NM_015103		129291689	-1	tier1	-	no_errors	ENST00000324093	ensembl	human	known	74_37	missense	25.71	52	18	SNP	0.947	G
POLR2B	5431	genome.wustl.edu	37	4	57889570	57889570	+	Missense_Mutation	SNP	G	G	A	rs553505190		TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr4:57889570G>A	ENST00000381227.1	+	20	3003	c.2590G>A	c.(2590-2592)Gat>Aat	p.D864N	POLR2B_ENST00000431623.2_Missense_Mutation_p.D789N|POLR2B_ENST00000441246.2_Missense_Mutation_p.D857N|POLR2B_ENST00000314595.5_Missense_Mutation_p.D864N			P30876	RPB2_HUMAN	polymerase (RNA) II (DNA directed) polypeptide B, 140kDa	864					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonucleoside binding (GO:0032549)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(10)|large_intestine(9)|lung(17)|ovary(2)|prostate(4)|skin(1)	52	Glioma(25;0.08)|all_neural(26;0.181)					ATCAGGAGATGATGTTATTAT	0.443													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18916	0.0		0.0	False		,,,				2504	0.0																0													107.0	99.0	102.0					4																	57889570		2203	4300	6503	SO:0001583	missense	0				CCDS3511.1	4q12	2013-01-21	2002-08-29		ENSG00000047315	ENSG00000047315		"""RNA polymerase subunits"""	9188	protein-coding gene	gene with protein product		180661	"""polymerase (RNA) II (DNA directed) polypeptide B (140kD)"""			1518060, 8034326	Standard	NM_000938		Approved	RPB2	uc003hcl.1	P30876	OTTHUMG00000128771	ENST00000381227.1:c.2590G>A	4.37:g.57889570G>A	ENSP00000370625:p.Asp864Asn		A8K1A8|Q8IZ61	Missense_Mutation	SNP	pfam_DNA-dir_RNA_pol_su2_6,pfam_RNA_pol_bsu_protrusion,pfam_RNA_pol_Rpb2_2,pfam_RNA_pol_Rpb2_7,pfam_RNA_pol_Rpb2_4,pfam_RNA_pol_Rpb2_3,pfam_RNA_pol_Rpb2_5	p.D864N	ENST00000381227.1	37	c.2590	CCDS3511.1	4	.	.	.	.	.	.	.	.	.	.	G	35	5.532746	0.96446	.	.	ENSG00000047315	ENST00000381227;ENST00000431623;ENST00000441246;ENST00000314595	T;T;T;T	0.81415	-1.49;-1.49;-1.49;-1.49	5.52	5.52	0.82312	RNA polymerase Rpb2, OB-fold (1);DNA-directed RNA polymerase, subunit 2, domain 6 (1);	0.000000	0.85682	D	0.000000	D	0.93239	0.7846	H	0.95816	3.725	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94497	0.7706	10	0.87932	D	0	.	19.6296	0.95694	0.0:0.0:1.0:0.0	.	789;864	C9J4M6;P30876	.;RPB2_HUMAN	N	864;789;857;864	ENSP00000370625:D864N;ENSP00000391096:D789N;ENSP00000391452:D857N;ENSP00000312735:D864N	ENSP00000312735:D864N	D	+	1	0	POLR2B	57584327	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.657000	0.98554	2.873000	0.98535	0.563000	0.77884	GAT	POLR2B	-	pfam_DNA-dir_RNA_pol_su2_6	ENSG00000047315		0.443	POLR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR2B	HGNC	protein_coding	OTTHUMT00000250692.1	-	0.00	76	0	G	NM_000938		57889570	+1	tier1	-	no_errors	ENST00000314595	ensembl	human	known	74_37	missense	29.23	46	19	SNP	1.000	A
POTEH	23784	genome.wustl.edu	37	22	16277579	16277579	+	Intron	SNP	T	T	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr22:16277579T>G	ENST00000343518.6	-	5	1218				RNU6-816P_ENST00000390914.1_RNA|POTEH-AS1_ENST00000422014.1_RNA	NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H											NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						TACTTCTAACTTGTCTTGTTT	0.413																																																	0																																										SO:0001627	intron_variant	0			AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.1166+168A>C	22.37:g.16277579T>G			A2CEK4|A6NCI1|A9Z1W0	RNA	SNP	-	NULL	ENST00000343518.6	37	NULL	CCDS46658.1	22																																																																																			POTEH-AS1	-	-	ENSG00000236666		0.413	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	POTEH-AS1	HGNC	protein_coding	OTTHUMT00000276918.4	-	0.00	20	0	T	NM_001136213		16277579	+1	tier1	-	no_errors	ENST00000422014	ensembl	human	known	74_37	rna	68.42	6	13	SNP	0.012	G
PPP2R4	5524	genome.wustl.edu	37	9	131898874	131898874	+	Splice_Site	SNP	G	G	T	rs112063689		TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr9:131898874G>T	ENST00000337738.1	+	8	1057	c.790G>T	c.(790-792)Gac>Tac	p.D264Y	PPP2R4_ENST00000423100.1_5'Flank|PPP2R4_ENST00000393370.2_Splice_Site_p.D229Y|PPP2R4_ENST00000524946.2_5'Flank|PPP2R4_ENST00000452489.2_Splice_Site_p.D264Y|PPP2R4_ENST00000347048.4_Intron|PPP2R4_ENST00000348141.5_Splice_Site_p.D235Y|PPP2R4_ENST00000355007.3_Splice_Site_p.D187Y|PPP2R4_ENST00000357197.4_Splice_Site_p.D200Y|PPP2R4_ENST00000358994.4_Splice_Site_p.D229Y	NM_178001.2	NP_821068.1	Q15257	PTPA_HUMAN	protein phosphatase 2A activator, regulatory subunit 4	264					ATP catabolic process (GO:0006200)|mitotic spindle organization in nucleus (GO:0030472)|negative regulation of phosphoprotein phosphatase activity (GO:0032515)|negative regulation of protein dephosphorylation (GO:0035308)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein dephosphorylation (GO:0035307)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|regulation of phosphoprotein phosphatase activity (GO:0043666)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	ATP binding (GO:0005524)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase type 2A regulator activity (GO:0008601)|protein tyrosine phosphatase activator activity (GO:0008160)|receptor binding (GO:0005102)			breast(3)|endometrium(1)|kidney(1)|lung(3)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	12		Medulloblastoma(224;0.235)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)		GCAGCTGATAGGTACTAGAGC	0.617																																					Colon(158;2158 2504 4450 20433)												0													118.0	126.0	123.0					9																	131898874		2203	4300	6503	SO:0001630	splice_region_variant	0			X73478	CCDS6920.1, CCDS65156.1, CCDS75917.1	9q34	2010-06-18	2007-01-22		ENSG00000119383	ENSG00000119383		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9308	protein-coding gene	gene with protein product	"""phosphotyrosyl phosphatase activator"", ""PP2A phosphatase activator"""	600756	"""protein phosphatase 2A, regulatory subunit B' (PR 53)"""			8530035	Standard	NM_021131		Approved	PTPA, PR53	uc004bxm.2	Q15257	OTTHUMG00000020774	ENST00000337738.1:c.790+1G>T	9.37:g.131898874G>T			A2A347|A9IZU4|B4DXM4|Q15258|Q53GZ3|Q5TZQ2|Q9BUK1|Q9NNZ7|Q9NNZ8|Q9NNZ9	Missense_Mutation	SNP	pfam_Phstyr_phstse_ac,pirsf_Phstyr_phstse_ac	p.D264Y	ENST00000337738.1	37	c.790		9	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	27.0|27.0|27.0	4.792136|4.792136|4.792136	0.90453|0.90453|0.90453	.|.|.	.|.|.	ENSG00000119383|ENSG00000119383|ENSG00000119383	ENST00000358994;ENST00000393370;ENST00000337738;ENST00000348141;ENST00000452489;ENST00000357197;ENST00000355007;ENST00000417728|ENST00000455240|ENST00000411917	T;T;T;T;T;T;T;T|.|.	0.31247|.|.	1.5;1.5;1.5;1.5;1.5;1.5;1.5;1.55|.|.	5.42|5.42|5.42	5.42|5.42|5.42	0.78866|0.78866|0.78866	.|.|.	0.189976|.|.	0.53938|.|.	D|.|.	0.000043|.|.	T|T|.	0.68659|0.68659|.	0.3025|0.3025|.	L|L|L	0.50919|0.50919|0.50919	1.6|1.6|1.6	0.80722|0.80722|0.80722	D|D|D	1|1|1	D;P;D;P;B;D|.|.	0.64830|.|.	0.994;0.876;0.976;0.662;0.033;0.963|.|.	D;P;D;P;B;P|.|.	0.68943|.|.	0.961;0.729;0.928;0.757;0.155;0.804|.|.	T|T|.	0.65569|0.65569|.	-0.6136|-0.6136|.	10|5|.	0.49607|.|.	T|.|.	0.09|.|.	-30.7074|-30.7074|-30.7074	16.371|16.371|16.371	0.83361|0.83361|0.83361	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	187;200;264;187;264;229|.|.	B4DLX5;Q15257-3;B4DZF8;Q15257-4;Q15257;Q15257-2|.|.	.;.;.;.;PTPA_HUMAN;.|.|.	Y|I|Y	229;229;264;235;264;200;187;194|42|33	ENSP00000351885:D229Y;ENSP00000377036:D229Y;ENSP00000337448:D264Y;ENSP00000335200:D235Y;ENSP00000394338:D264Y;ENSP00000349726:D200Y;ENSP00000347109:D187Y;ENSP00000403542:D194Y|.|.	ENSP00000337448:D264Y|.|.	D|R|X	+|+|+	1|2|3	0|0|2	PPP2R4|PPP2R4|PPP2R4	130938695|130938695|130938695	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.832000|0.832000|0.832000	0.47134|0.47134|0.47134	9.823000|9.823000|9.823000	0.99369|0.99369|0.99369	2.537000|2.537000|2.537000	0.85549|0.85549|0.85549	0.557000|0.557000|0.557000	0.71058|0.71058|0.71058	GAC|AGA|TAG	PPP2R4	-	pfam_Phstyr_phstse_ac,pirsf_Phstyr_phstse_ac	ENSG00000119383		0.617	PPP2R4-201	KNOWN	basic	protein_coding	PPP2R4	HGNC	protein_coding			0.00	55	0	G	NM_021131	Missense_Mutation	131898874	+1			no_errors	ENST00000452489	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	T
PREX2	80243	genome.wustl.edu	37	8	69012064	69012064	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr8:69012064T>C	ENST00000288368.4	+	23	2978	c.2701T>C	c.(2701-2703)Tcc>Ccc	p.S901P	PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	901					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						TCAGAGAATATCCAGTTATAA	0.284																																																	0													73.0	73.0	73.0					8																	69012064		2203	4300	6503	SO:0001583	missense	0			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.2701T>C	8.37:g.69012064T>C	ENSP00000288368:p.Ser901Pro		B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.S901P	ENST00000288368.4	37	c.2701	CCDS6201.1	8	.	.	.	.	.	.	.	.	.	.	T	14.99	2.700880	0.48307	.	.	ENSG00000046889	ENST00000288368;ENST00000396539;ENST00000354677	T	0.36878	1.23	5.66	4.51	0.55191	.	0.131468	0.53938	D	0.000055	T	0.34919	0.0914	L	0.38175	1.15	0.38321	D	0.943536	P;B;B	0.39831	0.69;0.146;0.429	P;B;P	0.49140	0.596;0.16;0.601	T	0.27226	-1.0080	10	0.38643	T	0.18	.	5.4663	0.16646	0.2603:0.0725:0.0:0.6673	.	901;901;901	Q70Z35-2;Q70Z35;Q70Z35-3	.;PREX2_HUMAN;.	P	901	ENSP00000288368:S901P	ENSP00000288368:S901P	S	+	1	0	PREX2	69174618	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.955000	0.49121	0.974000	0.38366	0.528000	0.53228	TCC	PREX2	-	NULL	ENSG00000046889		0.284	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREX2	HGNC	protein_coding	OTTHUMT00000378620.1	-	0.00	28	0	T	NM_025170		69012064	+1	tier1	-	no_errors	ENST00000288368	ensembl	human	known	74_37	missense	17.86	23	5	SNP	1.000	C
PRLHR	2834	genome.wustl.edu	37	10	120354616	120354616	+	Silent	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr10:120354616G>A	ENST00000369169.1	-	1	140	c.141C>T	c.(139-141)gtC>gtT	p.V47V	PRLHR_ENST00000239032.2_Silent_p.V47V			P49683	PRLHR_HUMAN	prolactin releasing hormone receptor	47					feeding behavior (GO:0007631)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|hormone metabolic process (GO:0042445)|neuropeptide signaling pathway (GO:0007218)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)|neuropeptide Y receptor activity (GO:0004983)			large_intestine(2)|lung(8)|ovary(1)|skin(1)	12		Colorectal(252;0.0429)|Lung NSC(174;0.142)|all_lung(145;0.175)		all cancers(201;0.0166)		GGAAGGGCGTGACGGCTGGAG	0.682																																																	0													34.0	39.0	37.0					10																	120354616		2203	4299	6502	SO:0001819	synonymous_variant	0			AB048946	CCDS7606.1	10q25.3-q26	2014-02-21	2005-11-24	2005-11-24	ENSG00000119973	ENSG00000119973		"""GPCR / Class A : RF amide peptide receptors"""	4464	protein-coding gene	gene with protein product		600895	"""G protein-coupled receptor 10"""	GPR10		8666380, 15885496	Standard	NM_004248		Approved	PrRPR	uc001ldp.1	P49683	OTTHUMG00000019136	ENST00000369169.1:c.141C>T	10.37:g.120354616G>A			O75194|Q502U8|Q5VXR9	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Prolrel_pep_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt	p.V47	ENST00000369169.1	37	c.141	CCDS7606.1	10																																																																																			PRLHR	-	prints_Prolrel_pep_rcpt	ENSG00000119973		0.682	PRLHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRLHR	HGNC	protein_coding	OTTHUMT00000050610.1	-	0.00	51	0	G	NM_004248		120354616	-1	tier1	-	no_errors	ENST00000239032	ensembl	human	known	74_37	silent	45.45	36	30	SNP	0.867	A
PRRC2C	23215	genome.wustl.edu	37	1	171505351	171505351	+	Nonsense_Mutation	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:171505351C>T	ENST00000338920.4	+	14	2458	c.2221C>T	c.(2221-2223)Cag>Tag	p.Q741*	PRRC2C_ENST00000367742.3_Nonsense_Mutation_p.Q743*|PRRC2C_ENST00000426496.2_Nonsense_Mutation_p.Q741*|PRRC2C_ENST00000392078.3_Nonsense_Mutation_p.Q743*	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	741	Pro-rich.				hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										GCTCATGATGCAGTCCTACAT	0.458																																																	0													141.0	111.0	121.0					1																	171505351		2203	4300	6503	SO:0001587	stop_gained	0			AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.2221C>T	1.37:g.171505351C>T	ENSP00000343629:p.Gln741*		Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Nonsense_Mutation	SNP	pfam_BAT2_N	p.Q743*	ENST00000338920.4	37	c.2227	CCDS1296.2	1	.	.	.	.	.	.	.	.	.	.	C	43	9.842982	0.99277	.	.	ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080;ENST00000483654	.	.	.	5.81	5.81	0.92471	.	0.000000	0.43260	D	0.000581	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.17832	T	0.49	.	20.0784	0.97758	0.0:1.0:0.0:0.0	.	.	.	.	X	743;742;741;743;741;498;500	.	ENSP00000343629:Q741X	Q	+	1	0	PRRC2C	169771975	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.190000	0.77755	2.736000	0.93811	0.655000	0.94253	CAG	PRRC2C	-	NULL	ENSG00000117523		0.458	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRRC2C	HGNC	protein_coding	OTTHUMT00000314826.4		0.00	69	0	C	NM_015172		171505351	+1			no_errors	ENST00000392078	ensembl	human	known	74_37	nonsense	6.12	46	3	SNP	1.000	T
PZP	5858	genome.wustl.edu	37	12	9303324	9303324	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr12:9303324T>C	ENST00000261336.2	-	34	4328	c.4300A>G	c.(4300-4302)Agt>Ggt	p.S1434G	PZP_ENST00000381997.2_Missense_Mutation_p.S1220G	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	1434					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						AAGGAAAAACTTAGCGTCTGA	0.383																																					Melanoma(125;1402 1695 4685 34487 38571)												0													110.0	106.0	108.0					12																	9303324		2203	4300	6503	SO:0001583	missense	0			X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.4300A>G	12.37:g.9303324T>C	ENSP00000261336:p.Ser1434Gly		A6ND27|Q15273|Q2NKL2|Q7M4N7	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_SV_autoAg,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd	p.S1434G	ENST00000261336.2	37	c.4300	CCDS8600.1	12	.	.	.	.	.	.	.	.	.	.	T	2.829	-0.243156	0.05906	.	.	ENSG00000126838	ENST00000261336;ENST00000381997	T;T	0.22743	1.94;1.94	3.95	2.72	0.32119	Alpha-macroglobulin, receptor-binding (3);	1.354810	0.05109	U	0.488557	T	0.23171	0.0560	M	0.73372	2.23	0.09310	N	1	D;B	0.53619	0.961;0.423	B;B	0.38225	0.268;0.155	T	0.28364	-1.0046	10	0.48119	T	0.1	.	5.3898	0.16237	0.1753:0.0:0.1816:0.6431	.	1220;1434	P20742-2;P20742	.;PZP_HUMAN	G	1434;1220	ENSP00000261336:S1434G;ENSP00000371427:S1220G	ENSP00000261336:S1434G	S	-	1	0	PZP	9194591	0.001000	0.12720	0.001000	0.08648	0.020000	0.10135	0.879000	0.28146	0.571000	0.29365	0.460000	0.39030	AGT	PZP	-	pfam_A-macroglobulin_rcpt-bd,superfamily_A-macroglobulin_rcpt-bd	ENSG00000126838		0.383	PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PZP	HGNC	protein_coding	OTTHUMT00000337624.1	-	0.00	66	0	T	NM_002864		9303324	-1	tier1	-	no_errors	ENST00000261336	ensembl	human	known	74_37	missense	26.32	28	10	SNP	0.019	C
RANBP1	5902	genome.wustl.edu	37	22	20106698	20106698	+	Intron	SNP	A	A	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr22:20106698A>T	ENST00000331821.3	+	2	254				TRMT2A_ENST00000439169.2_5'Flank|TRMT2A_ENST00000403707.3_5'Flank|RANBP1_ENST00000402752.1_Intron|TRMT2A_ENST00000252136.7_5'Flank|TRMT2A_ENST00000404751.3_5'Flank|RANBP1_ENST00000467920.1_3'UTR|RANBP1_ENST00000430524.1_Intron	NM_002882.2	NP_002873.1	P43487	RANG_HUMAN	RAN binding protein 1						intracellular transport (GO:0046907)|positive regulation of mitotic centrosome separation (GO:0046604)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)|spindle organization (GO:0007051)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	GDP-dissociation inhibitor activity (GO:0005092)|GTPase activator activity (GO:0005096)|Ran GTPase binding (GO:0008536)			breast(1)|large_intestine(1)|lung(1)|ovary(1)	4	Colorectal(54;0.0993)					TCCCAGAAATAGGACTCTTTA	0.393																																																	0													49.0	51.0	50.0					22																	20106698		2203	4299	6502	SO:0001627	intron_variant	0			D38076	CCDS13775.1, CCDS63408.1, CCDS74823.1	22q11.21	2008-06-16			ENSG00000099901	ENSG00000099901			9847	protein-coding gene	gene with protein product		601180				7616957, 10330396	Standard	NM_001278639		Approved	HTF9A	uc002zro.1	P43487	OTTHUMG00000150490	ENST00000331821.3:c.152+26A>T	22.37:g.20106698A>T			Q53EY3	RNA	SNP	-	NULL	ENST00000331821.3	37	NULL	CCDS13775.1	22																																																																																			RANBP1	-	-	ENSG00000099901		0.393	RANBP1-015	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RANBP1	HGNC	protein_coding	OTTHUMT00000343733.1	-	0.00	56	0	A	NM_002882		20106698	+1	tier1	-	no_errors	ENST00000467920	ensembl	human	putative	74_37	rna	53.85	6	7	SNP	0.000	T
REG3G	130120	genome.wustl.edu	37	2	79253844	79253844	+	Missense_Mutation	SNP	G	G	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr2:79253844G>C	ENST00000272324.5	+	3	266	c.82G>C	c.(82-84)Gaa>Caa	p.E28Q	REG3G_ENST00000409471.1_Missense_Mutation_p.E28Q|REG3G_ENST00000393897.2_Missense_Mutation_p.E28Q	NM_001008387.2	NP_001008388.1	Q6UW15	REG3G_HUMAN	regenerating islet-derived 3 gamma	28					acute-phase response (GO:0006953)|defense response to Gram-positive bacterium (GO:0050830)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of keratinocyte differentiation (GO:0045617)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of wound healing (GO:0090303)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)	p.E28*(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(27)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CCCAGGTGAAGAAACCCAGAA	0.537																																																	1	Substitution - Nonsense(1)	lung(1)											64.0	63.0	63.0					2																	79253844		2203	4300	6503	SO:0001583	missense	0			AY359047	CCDS1962.1, CCDS58714.1	2p12	2005-02-11			ENSG00000143954	ENSG00000143954			29595	protein-coding gene	gene with protein product		609933				12975309	Standard	NM_001008387		Approved	UNQ429, LPPM429, PAP1B	uc002snx.4	Q6UW15	OTTHUMG00000130018	ENST00000272324.5:c.82G>C	2.37:g.79253844G>C	ENSP00000272324:p.Glu28Gln		A8K980|D6W5J6|Q3SYE4|Q3SYE6|Q6FH18	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.E28Q	ENST00000272324.5	37	c.82	CCDS1962.1	2	.	.	.	.	.	.	.	.	.	.	G	10.10	1.256360	0.22965	.	.	ENSG00000143954	ENST00000393897;ENST00000272324;ENST00000409471	T;T;T	0.17691	4.22;4.22;2.26	5.05	3.25	0.37280	.	0.251594	0.28499	N	0.015132	T	0.12008	0.0292	L	0.41961	1.31	0.18873	N	0.999985	B;B	0.31730	0.282;0.337	B;B	0.28784	0.094;0.047	T	0.22138	-1.0225	10	0.21014	T	0.42	.	7.1903	0.25822	0.0906:0.1713:0.7381:0.0	.	28;28	Q3SYE6;Q6UW15	.;REG3G_HUMAN	Q	28	ENSP00000377475:E28Q;ENSP00000272324:E28Q;ENSP00000387105:E28Q	ENSP00000272324:E28Q	E	+	1	0	REG3G	79107352	0.543000	0.26434	0.698000	0.30274	0.022000	0.10575	1.777000	0.38604	0.831000	0.34780	0.655000	0.94253	GAA	REG3G	-	NULL	ENSG00000143954		0.537	REG3G-002	KNOWN	basic|appris_principal|CCDS	protein_coding	REG3G	HGNC	protein_coding	OTTHUMT00000328247.1	-	0.00	70	0	G	NM_198448		79253844	+1	tier1	-	no_errors	ENST00000272324	ensembl	human	known	74_37	missense	22.22	55	16	SNP	0.557	C
REPIN1	29803	genome.wustl.edu	37	7	150069801	150069801	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr7:150069801G>T	ENST00000425389.2	+	1	1549	c.1471G>T	c.(1471-1473)Gac>Tac	p.D491Y	REPIN1_ENST00000540729.1_Missense_Mutation_p.D491Y|REPIN1_ENST00000397281.2_Missense_Mutation_p.D491Y|RP4-584D14.5_ENST00000488310.1_RNA|REPIN1_ENST00000444957.1_Missense_Mutation_p.D491Y|REPIN1_ENST00000489432.2_Missense_Mutation_p.D548Y|REPIN1_ENST00000479668.1_3'UTR	NM_014374.3	NP_055189.2	Q9BWE0	REPI1_HUMAN	replication initiator 1	491					DNA replication (GO:0006260)|regulation of fatty acid transport (GO:2000191)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cytosolic ribosome (GO:0022626)|lipid particle (GO:0005811)|nuclear membrane (GO:0031965)|nuclear origin of replication recognition complex (GO:0005664)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	14	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.011)			CGTCTGCCCCGACTGCGGCAA	0.687																																																	0													39.0	46.0	44.0					7																	150069801		2202	4299	6501	SO:0001583	missense	0			AF201303	CCDS43677.1, CCDS47745.1	7q36.1	2013-01-08	2003-08-07	2003-08-08				"""Zinc fingers, C2H2-type"""	17922	protein-coding gene	gene with protein product	"""replication initiation region protein (60kD)"", ""zinc finger protein AP4"", ""zinc finger protein 464 (RIP60)"""		"""zinc finger protein 464 (RIP60)"""	ZNF464		10606657	Standard	NM_013400		Approved	RIP60, AP4, H_DJ0584D14.12, Zfp464	uc010lpr.1	Q9BWE0		ENST00000425389.2:c.1471G>T	7.37:g.150069801G>T	ENSP00000388287:p.Asp491Tyr		C9J3L7|D3DWZ1|Q7LE03|Q9BUZ6|Q9NZH2|Q9UMP5	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D548Y	ENST00000425389.2	37	c.1642	CCDS43677.1	7	.	.	.	.	.	.	.	.	.	.	G	14.36	2.512414	0.44660	.	.	ENSG00000214022	ENST00000540729;ENST00000397281;ENST00000444957;ENST00000489432;ENST00000425389	T;T;T;T;T	0.01051	5.4;5.4;5.4;5.4;5.4	4.11	4.11	0.48088	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02012	0.0063	N	0.05441	-0.05	0.22888	N	0.99861	B;D	0.53885	0.058;0.963	B;P	0.59171	0.07;0.853	T	0.60073	-0.7334	9	0.72032	D	0.01	-11.439	13.8973	0.63781	0.0:0.0:1.0:0.0	.	548;491	C9J3L7;Q9BWE0	.;REPI1_HUMAN	Y	491;491;491;548;491	ENSP00000445016:D491Y;ENSP00000380451:D491Y;ENSP00000407714:D491Y;ENSP00000417291:D548Y;ENSP00000388287:D491Y	ENSP00000380451:D491Y	D	+	1	0	REPIN1	149700734	0.000000	0.05858	1.000000	0.80357	0.995000	0.86356	-0.216000	0.09266	2.142000	0.66516	0.462000	0.41574	GAC	REPIN1	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000214022		0.687	REPIN1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	REPIN1	HGNC	protein_coding	OTTHUMT00000376940.1	-	0.00	41	0	G	NM_014374		150069801	+1	tier1	-	no_errors	ENST00000489432	ensembl	human	known	74_37	missense	45.83	13	11	SNP	0.245	T
RGS3	5998	genome.wustl.edu	37	9	116267774	116267774	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr9:116267774C>T	ENST00000374140.2	+	12	1159	c.950C>T	c.(949-951)tCt>tTt	p.S317F	RGS3_ENST00000374136.1_5'UTR|RGS3_ENST00000317613.6_Missense_Mutation_p.S205F|RGS3_ENST00000343817.5_Missense_Mutation_p.S36F|RGS3_ENST00000394646.3_Missense_Mutation_p.S36F|RGS3_ENST00000350696.5_Missense_Mutation_p.S317F	NM_001282923.1|NM_144488.4	NP_001269852.1|NP_652759.3	P49796	RGS3_HUMAN	regulator of G-protein signaling 3	317	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				inactivation of MAPK activity (GO:0000188)|positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			cervix(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	48						TGCTGCGACTCTCCAGTTCGA	0.582																																																	0													160.0	114.0	129.0					9																	116267774		2203	4300	6503	SO:0001583	missense	0			AF006610	CCDS6797.1, CCDS6798.1, CCDS35113.1, CCDS35114.1, CCDS43869.1, CCDS65111.1	9q32	2008-02-05	2007-08-14		ENSG00000138835	ENSG00000138835		"""Regulators of G-protein signaling"""	9999	protein-coding gene	gene with protein product		602189	"""regulator of G-protein signalling 3"""			8602223, 11034339	Standard	NM_001276260		Approved	C2PA, FLJ20370, PDZ-RGS3	uc004bhq.4	P49796	OTTHUMG00000021048	ENST00000374140.2:c.950C>T	9.37:g.116267774C>T	ENSP00000363255:p.Ser317Phe		A6NHA0|A8K0V1|B3KUB2|Q5VXB8|Q5VXC1|Q5VZ05|Q5VZ06|Q6ZRM5|Q8IUQ1|Q8NC47|Q8NFN4|Q8NFN5|Q8NFN6|Q8TD59|Q8TD68|Q8WV02|Q8WXA0	Missense_Mutation	SNP	pfam_RGS_dom,pfam_C2_dom,pfam_PDZ,superfamily_Regulat_G_prot_signal_superfam,superfamily_C2_dom,superfamily_PDZ,smart_C2_dom,smart_PDZ,smart_Regulat_G_prot_signal_superfam,pfscan_C2_dom,pfscan_PDZ,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.S317F	ENST00000374140.2	37	c.950	CCDS43869.1	9	.	.	.	.	.	.	.	.	.	.	C	31	5.102316	0.94245	.	.	ENSG00000138835	ENST00000374140;ENST00000350696;ENST00000317613;ENST00000343817;ENST00000394646	T;T;T;T;T	0.32272	1.46;1.46;1.46;1.46;1.46	6.01	6.01	0.97437	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.58278	0.2111	M	0.76433	2.335	0.80722	D	1	D;D;D;D;D	0.89917	0.96;1.0;1.0;0.998;1.0	P;D;D;D;D	0.83275	0.857;0.996;0.995;0.949;0.993	T	0.58858	-0.7562	10	0.87932	D	0	.	17.6771	0.88233	0.0:1.0:0.0:0.0	.	36;36;207;205;317	B3KUB2;P49796-4;B3KWG8;P49796-5;P49796	.;.;.;.;RGS3_HUMAN	F	317;317;205;36;36	ENSP00000363255:S317F;ENSP00000259406:S317F;ENSP00000312844:S205F;ENSP00000340284:S36F;ENSP00000378141:S36F	ENSP00000312844:S205F	S	+	2	0	RGS3	115307595	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	4.178000	0.58284	2.861000	0.98227	0.650000	0.86243	TCT	RGS3	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000138835		0.582	RGS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS3	HGNC	protein_coding	OTTHUMT00000055561.3	-	0.00	90	0	C	NM_017790		116267774	+1	tier1	-	no_errors	ENST00000350696	ensembl	human	known	74_37	missense	35.09	37	20	SNP	1.000	T
RNF11	26994	genome.wustl.edu	37	1	51735793	51735793	+	Missense_Mutation	SNP	C	C	T	rs141444156		TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:51735793C>T	ENST00000242719.3	+	2	775	c.289C>T	c.(289-291)Cgg>Tgg	p.R97W	RNF11_ENST00000494873.1_Intron	NM_014372.4	NP_055187.1	Q9Y3C5	RNF11_HUMAN	ring finger protein 11	97					protein autoubiquitination (GO:0051865)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	DNA binding (GO:0003677)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.0?(2)		large_intestine(1)	1						AAAAAAGATCCGGGAGTAAGT	0.328																																																	2	Whole gene deletion(2)	thyroid(1)|central_nervous_system(1)						C	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	42.0	47.0	45.0		289	5.9	1.0	1	dbSNP_134	45	0,8600		0,0,4300	no	missense	RNF11	NM_014372.4	101	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	97/155	51735793	1,13005	2203	4300	6503	SO:0001583	missense	0			AB024703	CCDS556.1	1p32	2013-01-09			ENSG00000123091	ENSG00000123091		"""RING-type (C3HC4) zinc fingers"""	10056	protein-coding gene	gene with protein product		612598				10673045, 10810093	Standard	NM_014372		Approved	CGI-123, Sid1669p, MGC51169	uc001csi.4	Q9Y3C5	OTTHUMG00000008190	ENST00000242719.3:c.289C>T	1.37:g.51735793C>T	ENSP00000242719:p.Arg97Trp		A8KAI2|Q5T7R8	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.R97W	ENST00000242719.3	37	c.289	CCDS556.1	1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.233701	0.79688	2.27E-4	0.0	ENSG00000123091	ENST00000242719	T	0.19105	2.17	5.91	5.91	0.95273	Zinc finger, RING/FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.40040	0.1101	L	0.56769	1.78	0.80722	D	1	D	0.76494	0.999	P	0.61658	0.892	T	0.07635	-1.0762	10	0.72032	D	0.01	-2.5246	14.6057	0.68478	0.2604:0.7396:0.0:0.0	.	97	Q9Y3C5	RNF11_HUMAN	W	97	ENSP00000242719:R97W	ENSP00000242719:R97W	R	+	1	2	RNF11	51508381	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.171000	0.50824	2.804000	0.96469	0.650000	0.86243	CGG	RNF11	-	NULL	ENSG00000123091		0.328	RNF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF11	HGNC	protein_coding	OTTHUMT00000022419.1	-	0.00	157	0	C	NM_014372		51735793	+1	tier1	rs141444156	no_errors	ENST00000242719	ensembl	human	known	74_37	missense	32.43	75	36	SNP	1.000	T
RNPC3	55599	genome.wustl.edu	37	1	104086028	104086028	+	Missense_Mutation	SNP	A	A	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:104086028A>C	ENST00000533099.1	+	10	1240	c.1004A>C	c.(1003-1005)aAa>aCa	p.K335T	RNPC3_ENST00000524631.1_Missense_Mutation_p.K334T|RNPC3_ENST00000423855.2_Missense_Mutation_p.K335T			Q96LT9	RBM40_HUMAN	RNA-binding region (RNP1, RRM) containing 3	335	Necessary for binding to m(7)G-capped U12 snRNA.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Lung(183;0.111)|Epithelial(280;0.122)|all cancers(265;0.125)|Colorectal(144;0.163)		GCATTTAAGAAAGATTTAGAA	0.333																																																	0													69.0	60.0	63.0					1																	104086028		692	1587	2279	SO:0001583	missense	0			AB058742, AY099329	CCDS781.1	1p21.1	2013-07-16			ENSG00000185946	ENSG00000185946		"""RNA binding motif (RRM) containing"""	18666	protein-coding gene	gene with protein product	"""U11/U12 snRNP 65K"""					14974681, 15146077	Standard	NM_017619		Approved	KIAA1839, FLJ20008, RBM40, SNRNP65	uc010oun.2	Q96LT9	OTTHUMG00000166613	ENST00000533099.1:c.1004A>C	1.37:g.104086028A>C	ENSP00000432886:p.Lys335Thr		A8K1C9|D3DT74|Q5TZ87|Q96FK7|Q96JI8|Q9NSU7|Q9NXX2	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.K335T	ENST00000533099.1	37	c.1004	CCDS781.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.68|10.68	1.418758|1.418758	0.25552|0.25552	.|.	.|.	ENSG00000185946|ENSG00000185946	ENST00000524641|ENST00000524631;ENST00000533099;ENST00000423855	.|T;T;T	.|0.18174	.|2.24;2.23;2.23	5.7|5.7	4.58|4.58	0.56647|0.56647	.|.	.|.	.|.	.|.	.|.	T|T	0.04907|0.04907	0.0132|0.0132	L|L	0.47716|0.47716	1.5|1.5	0.25482|0.25482	N|N	0.98772|0.98772	.|B;B	.|0.28233	.|0.006;0.204	.|B;B	.|0.25614	.|0.014;0.062	T|T	0.31752|0.31752	-0.9932|-0.9932	6|9	0.08599|0.15066	T|T	0.76|0.55	.|.	7.0305|7.0305	0.24965|0.24965	0.7844:0.0:0.074:0.1416|0.7844:0.0:0.074:0.1416	.|.	.|334;335	.|A8K1C9;Q96LT9	.|.;RBM40_HUMAN	Q|T	76|334;335;335	.|ENSP00000437278:K334T;ENSP00000432886:K335T;ENSP00000391432:K335T	ENSP00000435440:K76Q|ENSP00000391432:K335T	K|K	+|+	1|2	0|0	RNPC3|RNPC3	.|.	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.745000|0.745000	0.42441|0.42441	1.955000|1.955000	0.40372|0.40372	2.174000|2.174000	0.68829|0.68829	0.533000|0.533000	0.62120|0.62120	AAG|AAA	RNPC3	-	NULL	ENSG00000185946		0.333	RNPC3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNPC3	HGNC	protein_coding	OTTHUMT00000390812.1	-	0.00	43	0	A	NM_017619		104086028	+1	tier1	-	no_errors	ENST00000423855	ensembl	human	known	74_37	missense	12.12	29	4	SNP	1.000	C
RPS9	6203	genome.wustl.edu	37	19	54711426	54711426	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr19:54711426G>T	ENST00000302907.4	+	5	740	c.568G>T	c.(568-570)Gac>Tac	p.D190Y	RPS9_ENST00000441429.1_3'UTR|RPS9_ENST00000391751.3_3'UTR|RPS9_ENST00000391752.1_Missense_Mutation_p.D190Y|RPS9_ENST00000391753.2_Missense_Mutation_p.D190Y|RPS9_ENST00000402367.1_3'UTR	NM_001013.3	NP_001004.2	P46781	RS9_HUMAN	ribosomal protein S9	190					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of cell proliferation (GO:0008284)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)|translation regulator activity (GO:0045182)			NS(1)|breast(1)|kidney(11)|large_intestine(3)|lung(2)|ovary(1)|urinary_tract(1)	20	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.18)		GGCTGGAGACGACGAGGAGGA	0.597																																																	0													23.0	23.0	23.0					19																	54711426		2202	4300	6502	SO:0001583	missense	0			U14971	CCDS12884.1	19q13.4	2011-04-05			ENSG00000170889	ENSG00000170889		"""S ribosomal proteins"""	10442	protein-coding gene	gene with protein product	"""40S ribosomal protein S9"""	603631				7772601, 9582194	Standard	XM_005259135		Approved	S9	uc002qdx.3	P46781	OTTHUMG00000066618	ENST00000302907.4:c.568G>T	19.37:g.54711426G>T	ENSP00000302896:p.Asp190Tyr		A9C4C1|Q4QRK7|Q9BVZ0	Missense_Mutation	SNP	pfam_Ribosomal_S4/S9_N,pfam_S4_RNA-bd,smart_S4_RNA-bd,pfscan_S4_RNA-bd,tigrfam_Ribosomal_S4/S9_euk/arc	p.D190Y	ENST00000302907.4	37	c.568	CCDS12884.1	19	.	.	.	.	.	.	.	.	.	.	G	19.25	3.791120	0.70452	.	.	ENSG00000170889	ENST00000302907;ENST00000391752;ENST00000391753	T;T;T	0.53640	0.61;0.61;0.61	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	T	0.40498	0.1119	L	0.47190	1.495	0.80722	D	1	B	0.33549	0.417	B	0.24394	0.053	T	0.44314	-0.9336	10	0.62326	D	0.03	-34.7015	15.8659	0.79063	0.0:0.0:1.0:0.0	.	190	P46781	RS9_HUMAN	Y	190	ENSP00000302896:D190Y;ENSP00000375632:D190Y;ENSP00000375633:D190Y	ENSP00000302896:D190Y	D	+	1	0	RPS9	59403238	1.000000	0.71417	0.813000	0.32504	0.871000	0.50021	8.552000	0.90682	2.692000	0.91855	0.655000	0.94253	GAC	RPS9	-	NULL	ENSG00000170889		0.597	RPS9-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS9	HGNC	protein_coding	OTTHUMT00000142834.3	-	0.00	38	0	G	NM_001013		54711426	+1	tier1	-	no_errors	ENST00000302907	ensembl	human	known	74_37	missense	26.32	14	5	SNP	1.000	T
RTP3	83597	genome.wustl.edu	37	3	46542088	46542088	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr3:46542088T>C	ENST00000296142.3	+	2	970	c.398T>C	c.(397-399)tTg>tCg	p.L133S		NM_031440.1	NP_113628.1	Q9BQQ7	RTP3_HUMAN	receptor (chemosensory) transporter protein 3	133					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|protein targeting to membrane (GO:0006612)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(1)|lung(4)|ovary(3)|prostate(1)|urinary_tract(1)	10				BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0173)|Kidney(197;0.0204)		AGATTTCAGTTGATAGAGGAG	0.463																																																	0													99.0	102.0	101.0					3																	46542088		2203	4300	6503	SO:0001583	missense	0			AJ312776	CCDS2740.1	3p21.3	2014-02-20	2006-11-21	2006-02-07	ENSG00000163825	ENSG00000163825		"""Receptor transporter proteins"""	15572	protein-coding gene	gene with protein product	"""zinc finger, 3CxxC-type 3"""	607181	"""transmembrane protein 7"", ""receptor transporter protein 3"""	TMEM7		16271481, 15550249, 16720576	Standard	NM_031440		Approved	LTM1, Z3CXXC3	uc003cps.1	Q9BQQ7	OTTHUMG00000133483	ENST00000296142.3:c.398T>C	3.37:g.46542088T>C	ENSP00000296142:p.Leu133Ser		A2RRP6	Missense_Mutation	SNP	NULL	p.L133S	ENST00000296142.3	37	c.398	CCDS2740.1	3	.	.	.	.	.	.	.	.	.	.	T	0.040	-1.287124	0.01387	.	.	ENSG00000163825	ENST00000296142	T	0.20200	2.09	3.45	-6.89	0.01660	.	5.261840	0.00357	N	0.000027	T	0.07818	0.0196	N	0.02802	-0.49	0.09310	N	1	B	0.31383	0.321	B	0.31869	0.137	T	0.15809	-1.0424	10	0.08837	T	0.75	0.2985	8.6059	0.33773	0.1804:0.578:0.0:0.2415	.	133	Q9BQQ7	RTP3_HUMAN	S	133	ENSP00000296142:L133S	ENSP00000296142:L133S	L	+	2	0	RTP3	46517092	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-2.845000	0.00735	-2.719000	0.00389	-0.464000	0.05259	TTG	RTP3	-	NULL	ENSG00000163825		0.463	RTP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTP3	HGNC	protein_coding	OTTHUMT00000257379.2	-	0.00	84	0	T	NM_031440		46542088	+1	tier1	-	no_errors	ENST00000296142	ensembl	human	known	74_37	missense	30.86	56	25	SNP	0.000	C
SCN3A	6328	genome.wustl.edu	37	2	165953850	165953850	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr2:165953850C>A	ENST00000360093.3	-	23	4642	c.4151G>T	c.(4150-4152)tGt>tTt	p.C1384F	SCN3A_ENST00000409101.3_Missense_Mutation_p.C1335F|SCN3A_ENST00000283254.7_Missense_Mutation_p.C1384F	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	1384					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AAGAGCCTGACAGTCACTCAA	0.428																																																	0													130.0	111.0	118.0					2																	165953850		2203	4300	6503	SO:0001583	missense	0			AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.4151G>T	2.37:g.165953850C>A	ENSP00000353206:p.Cys1384Phe		Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfscan_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2	p.C1384F	ENST00000360093.3	37	c.4151		2	.	.	.	.	.	.	.	.	.	.	C	22.6	4.316602	0.81469	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000440431	D;D;D;D	0.97480	-4.4;-4.4;-4.35;-4.08	5.72	5.72	0.89469	Ion transport (1);	0.000000	0.64402	D	0.000001	D	0.99296	0.9754	H	0.99130	4.44	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.997;0.997;0.997;1.0	D;D;D;D;D	0.97110	1.0;0.996;0.994;0.994;1.0	D	0.98440	1.0586	10	0.87932	D	0	.	20.2441	0.98394	0.0:1.0:0.0:0.0	.	1384;1335;1335;1335;1384	Q9NY46;E7EUE6;Q9NY46-2;Q9NY46-4;Q9NY46-3	SCN3A_HUMAN;.;.;.;.	F	1384;1384;1335;1335	ENSP00000353206:C1384F;ENSP00000283254:C1384F;ENSP00000386726:C1335F;ENSP00000403348:C1335F	ENSP00000283254:C1384F	C	-	2	0	SCN3A	165662096	1.000000	0.71417	0.982000	0.44146	0.553000	0.35397	7.776000	0.85560	2.865000	0.98341	0.655000	0.94253	TGT	SCN3A	-	pfam_Ion_trans_dom	ENSG00000153253		0.428	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	SCN3A	HGNC	protein_coding		-	0.00	80	0	C	NM_006922		165953850	-1	tier1	-	no_errors	ENST00000283254	ensembl	human	known	74_37	missense	7.55	49	4	SNP	1.000	A
SCN1A	6323	genome.wustl.edu	37	2	166850801	166850801	+	Silent	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr2:166850801C>T	ENST00000303395.4	-	25	4706	c.4707G>A	c.(4705-4707)gtG>gtA	p.V1569V	SCN1A_ENST00000409050.1_Silent_p.V1541V|SCN1A_ENST00000375405.3_Silent_p.V1558V|SCN1A_ENST00000423058.2_Silent_p.V1569V|AC010127.3_ENST00000597623.1_RNA|AC010127.3_ENST00000595647.1_RNA			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	1569					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AAATGGTAGTCACATATTCAC	0.383																																																	0													153.0	123.0	133.0					2																	166850801		2203	4300	6503	SO:0001819	synonymous_variant	0			AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.4707G>A	2.37:g.166850801C>T			E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Silent	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_a1su,prints_Na_channel_asu,prints_PKD_2	p.V1569	ENST00000303395.4	37	c.4707	CCDS54413.1	2																																																																																			SCN1A	-	NULL	ENSG00000144285		0.383	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN1A	HGNC	protein_coding	OTTHUMT00000102661.1	-	0.00	119	0	C	NM_006920		166850801	-1	tier1	-	no_errors	ENST00000303395	ensembl	human	known	74_37	silent	30.91	38	17	SNP	1.000	T
SCN5A	6331	genome.wustl.edu	37	3	38647455	38647455	+	Missense_Mutation	SNP	T	T	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr3:38647455T>A	ENST00000333535.4	-	10	1474	c.1325A>T	c.(1324-1326)aAg>aTg	p.K442M	SCN5A_ENST00000414099.2_Missense_Mutation_p.K442M|SCN5A_ENST00000455624.2_Missense_Mutation_p.K442M|SCN5A_ENST00000425664.1_Missense_Mutation_p.K442M|SCN5A_ENST00000449557.2_Missense_Mutation_p.K442M|SCN5A_ENST00000450102.2_Missense_Mutation_p.K442M|SCN5A_ENST00000413689.1_Missense_Mutation_p.K442M|SCN5A_ENST00000423572.2_Missense_Mutation_p.K442M|SCN5A_ENST00000443581.1_Missense_Mutation_p.K442M|SCN5A_ENST00000451551.2_Missense_Mutation_p.K442M			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	442					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	GTGTTCTTTCTTGAGCATTTC	0.557																																																	0													74.0	82.0	79.0					3																	38647455		2057	4187	6244	SO:0001583	missense	0			AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.1325A>T	3.37:g.38647455T>A	ENSP00000328968:p.Lys442Met		A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,prints_Na_channel_a5su,prints_Na_channel_asu	p.K442M	ENST00000333535.4	37	c.1325	CCDS46796.1	3	.	.	.	.	.	.	.	.	.	.	T	18.79	3.698637	0.68501	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	D;D;D;D;D;D;D;D;D;D	0.97066	-4.12;-4.16;-4.16;-4.15;-4.16;-4.12;-4.16;-4.23;-4.15;-4.15	5.54	1.84	0.25277	.	0.240144	0.38272	N	0.001744	D	0.97854	0.9295	M	0.86097	2.795	0.36066	D	0.84179	D;P;D;D;D;D;D	0.69078	0.99;0.739;0.994;0.994;0.994;0.992;0.997	P;P;P;P;P;D;P	0.64144	0.707;0.466;0.847;0.707;0.707;0.922;0.847	D	0.98429	1.0581	10	0.87932	D	0	.	9.4266	0.38583	0.0:0.2025:0.0:0.7975	.	442;442;442;442;442;442;442	E9PEF3;E9PHB6;Q14524-6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;.;SCN5A_HUMAN;.;.	M	442	ENSP00000398962:K442M;ENSP00000398266:K442M;ENSP00000410257:K442M;ENSP00000388797:K442M;ENSP00000397915:K442M;ENSP00000416634:K442M;ENSP00000328968:K442M;ENSP00000399524:K442M;ENSP00000403355:K442M;ENSP00000413996:K442M	ENSP00000328968:K442M	K	-	2	0	SCN5A	38622459	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	2.366000	0.44204	0.169000	0.19679	0.533000	0.62120	AAG	SCN5A	-	NULL	ENSG00000183873		0.557	SCN5A-014	KNOWN	basic|CCDS	protein_coding	SCN5A	HGNC	protein_coding	OTTHUMT00000377958.1	-	0.00	59	0	T	NM_198056		38647455	-1	tier1	-	no_errors	ENST00000333535	ensembl	human	known	74_37	missense	33.33	24	12	SNP	1.000	A
SDK1	221935	genome.wustl.edu	37	7	4185504	4185504	+	Nonsense_Mutation	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr7:4185504G>A	ENST00000404826.2	+	29	4518	c.4379G>A	c.(4378-4380)tGg>tAg	p.W1460*	SDK1_ENST00000389531.3_Nonsense_Mutation_p.W1460*	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1460	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		AGGCAGGGCTGGGGGGAGCCA	0.642																																																	0																																										SO:0001587	stop_gained	0			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.4379G>A	7.37:g.4185504G>A	ENSP00000385899:p.Trp1460*		Q8TEN9|Q8TEP5|Q96N44	Nonsense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.W1460*	ENST00000404826.2	37	c.4379	CCDS34590.1	7	.	.	.	.	.	.	.	.	.	.	G	46	12.784737	0.99696	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	.	.	.	4.96	4.96	0.65561	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.2171	0.86947	0.0:0.0:1.0:0.0	.	.	.	.	X	1460	.	ENSP00000374182:W1460X	W	+	2	0	SDK1	4152030	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.287000	0.95975	2.296000	0.77279	0.462000	0.41574	TGG	SDK1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000146555		0.642	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK1	HGNC	protein_coding	OTTHUMT00000323702.1	-	0.00	120	0	G	NM_152744		4185504	+1	tier1	-	no_errors	ENST00000404826	ensembl	human	known	74_37	nonsense	14.86	63	11	SNP	1.000	A
SEMA6D	80031	genome.wustl.edu	37	15	48063701	48063701	+	Missense_Mutation	SNP	T	T	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr15:48063701T>G	ENST00000316364.5	+	19	3380	c.2941T>G	c.(2941-2943)Tta>Gta	p.L981V	SEMA6D_ENST00000536845.2_Missense_Mutation_p.L981V|SEMA6D_ENST00000389433.2_Missense_Mutation_p.L962V|SEMA6D_ENST00000354744.4_Missense_Mutation_p.L925V|SEMA6D_ENST00000389428.3_Missense_Mutation_p.L906V|SEMA6D_ENST00000389432.2_Missense_Mutation_p.L938V|SEMA6D_ENST00000355997.3_3'UTR|SEMA6D_ENST00000358066.4_Missense_Mutation_p.L919V|SEMA6D_ENST00000558816.1_3'UTR|SEMA6D_ENST00000558014.1_Missense_Mutation_p.L919V|SEMA6D_ENST00000537942.1_Missense_Mutation_p.L919V	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	981					axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		GCCTAAAAACTTAAACTCACC	0.473																																																	0													99.0	103.0	101.0					15																	48063701		2198	4297	6495	SO:0001583	missense	0			AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.2941T>G	15.37:g.48063701T>G	ENSP00000324857:p.Leu981Val		A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Missense_Mutation	SNP	pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,pfscan_Semap_dom	p.L981V	ENST00000316364.5	37	c.2941	CCDS32225.1	15	.	.	.	.	.	.	.	.	.	.	T	5.245	0.230637	0.09969	.	.	ENSG00000137872	ENST00000537942;ENST00000536845;ENST00000316364;ENST00000389433;ENST00000389432;ENST00000354744;ENST00000358066;ENST00000389428	T;T;T;T;T;T;T;T	0.16324	2.37;2.36;2.36;2.35;2.37;2.37;2.37;2.37	5.8	3.52	0.40303	.	0.236955	0.36066	N	0.002820	T	0.07324	0.0185	N	0.08118	0	0.80722	D	1	B;B;B;B	0.20780	0.01;0.0;0.0;0.048	B;B;B;B	0.18871	0.007;0.003;0.003;0.023	T	0.21075	-1.0256	10	0.44086	T	0.13	.	3.5285	0.07768	0.1302:0.0714:0.15:0.6484	.	906;925;981;919	Q8NFY4-3;Q8NFY4-4;Q8NFY4;Q8NFY4-2	.;.;SEM6D_HUMAN;.	V	919;981;981;962;938;925;919;906	ENSP00000442040:L919V;ENSP00000446152:L981V;ENSP00000324857:L981V;ENSP00000374084:L962V;ENSP00000374083:L938V;ENSP00000346786:L925V;ENSP00000350770:L919V;ENSP00000374079:L906V	ENSP00000324857:L981V	L	+	1	2	SEMA6D	45850993	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.102000	0.31050	1.032000	0.39892	0.460000	0.39030	TTA	SEMA6D	-	NULL	ENSG00000137872		0.473	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SEMA6D	HGNC	protein_coding	OTTHUMT00000416868.1	-	0.00	60	0	T	NM_024966		48063701	+1	tier1	-	no_errors	ENST00000316364	ensembl	human	known	74_37	missense	27.08	35	13	SNP	1.000	G
SERINC3	10955	genome.wustl.edu	37	20	43138568	43138568	+	Silent	SNP	G	G	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr20:43138568G>T	ENST00000342374.4	-	5	734	c.577C>A	c.(577-579)Cga>Aga	p.R193R	SERINC3_ENST00000541235.1_Silent_p.R138R|SERINC3_ENST00000255175.1_Silent_p.R193R	NM_006811.2	NP_006802.1	Q13530	SERC3_HUMAN	serine incorporator 3	193					phosphatidylserine metabolic process (GO:0006658)|positive regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902237)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	L-serine transmembrane transporter activity (GO:0015194)			endometrium(4)|large_intestine(2)|lung(8)|skin(3)|urinary_tract(1)	18		Myeloproliferative disorder(115;0.0122)	Colorectal(3;0.000291)|COAD - Colon adenocarcinoma(18;0.00189)			TCTTCCATTCGATTTACCCAT	0.443																																																	0													228.0	190.0	203.0					20																	43138568		2203	4300	6503	SO:0001819	synonymous_variant	0			U49188	CCDS13333.1	20q13.12	2008-05-14	2005-11-15	2005-11-15	ENSG00000132824	ENSG00000132824			11699	protein-coding gene	gene with protein product		607165	"""tumor differentially expressed 1"""	TDE1		10559794	Standard	NM_006811		Approved	DIFF33, TDE, SBBI99, TMS-1, AIGP1	uc002xme.3	Q13530	OTTHUMG00000033087	ENST00000342374.4:c.577C>A	20.37:g.43138568G>T			B4DUE9|O43717|Q9BR33	Silent	SNP	pfam_TMS_TDE	p.R193	ENST00000342374.4	37	c.577	CCDS13333.1	20																																																																																			SERINC3	-	pfam_TMS_TDE	ENSG00000132824		0.443	SERINC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERINC3	HGNC	protein_coding	OTTHUMT00000080544.3	-	0.00	52	0	G	NM_006811		43138568	-1	tier1	-	no_errors	ENST00000255175	ensembl	human	known	74_37	silent	8.33	44	4	SNP	0.750	T
SF3B1	23451	genome.wustl.edu	37	2	198257072	198257072	+	Silent	SNP	A	A	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr2:198257072A>G	ENST00000335508.6	-	25	3961	c.3870T>C	c.(3868-3870)gaT>gaC	p.D1290D		NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	1290					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)			NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			TGTTCTTATCATCGTTGTAGA	0.353			Mis		myelodysplastic syndrome																																			Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	0													117.0	117.0	117.0					2																	198257072		2203	4300	6503	SO:0001819	synonymous_variant	0			AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.3870T>C	2.37:g.198257072A>G			E9PCH3	Silent	SNP	pfam_SF3b_su1,superfamily_ARM-type_fold	p.D1290	ENST00000335508.6	37	c.3870	CCDS33356.1	2																																																																																			SF3B1	-	superfamily_ARM-type_fold	ENSG00000115524		0.353	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3B1	HGNC	protein_coding	OTTHUMT00000335245.2	-	0.00	83	0	A			198257072	-1	tier1	-	no_errors	ENST00000335508	ensembl	human	known	74_37	silent	32.39	48	23	SNP	1.000	G
SF3B1	23451	genome.wustl.edu	37	2	198260982	198260982	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr2:198260982T>C	ENST00000335508.6	-	23	3428	c.3337A>G	c.(3337-3339)Act>Gct	p.T1113A		NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	1113					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)			NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			ATTGCTACAGTGGTACAAACT	0.398			Mis		myelodysplastic syndrome																																			Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	0													134.0	126.0	129.0					2																	198260982		2203	4300	6503	SO:0001583	missense	0			AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.3337A>G	2.37:g.198260982T>C	ENSP00000335321:p.Thr1113Ala		E9PCH3	Missense_Mutation	SNP	pfam_SF3b_su1,superfamily_ARM-type_fold	p.T1113A	ENST00000335508.6	37	c.3337	CCDS33356.1	2	.	.	.	.	.	.	.	.	.	.	T	13.19	2.162304	0.38217	.	.	ENSG00000115524	ENST00000335508	.	.	.	5.93	5.93	0.95920	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.51126	0.1656	L	0.48935	1.535	0.80722	D	1	B	0.32338	0.365	B	0.33750	0.169	T	0.46992	-0.9151	9	0.11182	T	0.66	.	16.3943	0.83563	0.0:0.0:0.0:1.0	.	1113	O75533	SF3B1_HUMAN	A	1113	.	ENSP00000335321:T1113A	T	-	1	0	SF3B1	197969227	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	7.963000	0.87922	2.281000	0.76405	0.533000	0.62120	ACT	SF3B1	-	superfamily_ARM-type_fold	ENSG00000115524		0.398	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3B1	HGNC	protein_coding	OTTHUMT00000335245.2	-	0.00	76	0	T			198260982	-1	tier1	-	no_errors	ENST00000335508	ensembl	human	known	74_37	missense	34.00	33	17	SNP	1.000	C
SH2D3A	10045	genome.wustl.edu	37	19	6760892	6760892	+	Missense_Mutation	SNP	T	T	C	rs371836476		TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr19:6760892T>C	ENST00000245908.6	-	3	445	c.176A>G	c.(175-177)cAt>cGt	p.H59R	SH2D3A_ENST00000437152.3_Intron|SH2D3A_ENST00000599563.1_5'UTR	NM_005490.2	NP_005481.2	Q9BRG2	SH23A_HUMAN	SH2 domain containing 3A	59	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				JNK cascade (GO:0007254)|positive regulation of signal transduction (GO:0009967)|small GTPase mediated signal transduction (GO:0007264)		guanyl-nucleotide exchange factor activity (GO:0005085)|SH3/SH2 adaptor activity (GO:0005070)			breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|skin(3)|urinary_tract(1)	24						CACCTCAAAATGGAGGGCTGA	0.632																																																	0								T	ARG/HIS	1,4405	2.1+/-5.4	0,1,2202	40.0	40.0	40.0		176	5.0	1.0	19		40	0,8598		0,0,4299	no	missense	SH2D3A	NM_005490.2	29	0,1,6501	CC,CT,TT		0.0,0.0227,0.0077	probably-damaging	59/577	6760892	1,13003	2203	4299	6502	SO:0001583	missense	0			AF124249	CCDS12173.1	19p13.3	2013-02-14	2002-01-14			ENSG00000125731		"""SH2 domain containing"""	16885	protein-coding gene	gene with protein product		604721	"""SH2 domain-containing 3A"""			10187783	Standard	NM_005490		Approved	NSP1	uc002mft.3	Q9BRG2		ENST00000245908.6:c.176A>G	19.37:g.6760892T>C	ENSP00000245908:p.His59Arg		A8K9R6|B4DRS7|Q9Y2X4	Missense_Mutation	SNP	pfam_SH2,pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_SH2,smart_RasGRF_CDC25,pfscan_SH2,prints_SH2	p.H59R	ENST00000245908.6	37	c.176	CCDS12173.1	19	.	.	.	.	.	.	.	.	.	.	T	17.53	3.412495	0.62511	2.27E-4	0.0	ENSG00000125731	ENST00000245908	T	0.73681	-0.77	4.97	4.97	0.65823	SH2 motif (4);	0.000000	0.44902	D	0.000410	D	0.90480	0.7018	H	0.97240	3.965	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93194	0.6586	10	0.87932	D	0	-25.7713	12.7066	0.57063	0.0:0.0:0.0:1.0	.	59	Q9BRG2	SH23A_HUMAN	R	59	ENSP00000245908:H59R	ENSP00000245908:H59R	H	-	2	0	SH2D3A	6711892	1.000000	0.71417	0.989000	0.46669	0.140000	0.21249	6.116000	0.71571	2.103000	0.63969	0.454000	0.30748	CAT	SH2D3A	-	pfam_SH2,smart_SH2,pfscan_SH2	ENSG00000125731		0.632	SH2D3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH2D3A	HGNC	protein_coding	OTTHUMT00000458016.1	-	0.00	63	0	T	NM_005490		6760892	-1	tier1	-	no_errors	ENST00000245908	ensembl	human	known	74_37	missense	16.67	35	7	SNP	1.000	C
SH3BP4	23677	genome.wustl.edu	37	2	235950358	235950358	+	Silent	SNP	G	G	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr2:235950358G>C	ENST00000409212.1	+	4	1452	c.945G>C	c.(943-945)gtG>gtC	p.V315V	SH3BP4_ENST00000392011.2_Silent_p.V315V|SH3BP4_ENST00000344528.4_Silent_p.V315V			Q9P0V3	SH3B4_HUMAN	SH3-domain binding protein 4	315					cellular response to amino acid stimulus (GO:0071230)|endocytosis (GO:0006897)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of GTPase activity (GO:0034260)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|protein localization to lysosome (GO:0061462)|regulation of catalytic activity (GO:0050790)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	GDP-dissociation inhibitor activity (GO:0005092)|identical protein binding (GO:0042802)|Ras GTPase binding (GO:0017016)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(6)|stomach(3)|urinary_tract(2)	44		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)		Epithelial(121;7.66e-20)|BRCA - Breast invasive adenocarcinoma(100;0.000402)|Lung(119;0.00299)|LUSC - Lung squamous cell carcinoma(224;0.00645)|GBM - Glioblastoma multiforme(43;0.237)		CCCAAGCCGTGGAGACAAACA	0.617																																																	0													31.0	37.0	35.0					2																	235950358		2202	4298	6500	SO:0001819	synonymous_variant	0			AF147747	CCDS2513.1	2q37.1-q37.2	2008-05-15			ENSG00000130147	ENSG00000130147			10826	protein-coding gene	gene with protein product		605611				10644451	Standard	NM_014521		Approved		uc002vvp.3	Q9P0V3	OTTHUMG00000133292	ENST00000409212.1:c.945G>C	2.37:g.235950358G>C			O95082|Q309A3|Q53QD0|Q53TD1	Silent	SNP	pfam_SH3_2,pfam_SH3_domain,pfam_ZU5,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.V315	ENST00000409212.1	37	c.945	CCDS2513.1	2																																																																																			SH3BP4	-	NULL	ENSG00000130147		0.617	SH3BP4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SH3BP4	HGNC	protein_coding	OTTHUMT00000329763.1	-	0.00	24	0	G			235950358	+1	tier1	-	no_errors	ENST00000344528	ensembl	human	known	74_37	silent	36.36	21	12	SNP	1.000	C
CAPN1	823	genome.wustl.edu	37	11	64981654	64981654	+	IGR	SNP	C	C	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr11:64981654C>G	ENST00000527323.1	+	0	3086				SLC22A20_ENST00000525437.1_RNA			P07384	CAN1_HUMAN	calpain 1, (mu/I) large subunit						extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell proliferation (GO:0008284)|proteolysis (GO:0006508)|receptor catabolic process (GO:0032801)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	13		Lung NSC(402;0.094)|Melanoma(852;0.16)		Lung(977;0.00168)|LUSC - Lung squamous cell carcinoma(976;0.00813)		ATCCCGGGCGCGGCCACGGAG	0.677																																																	0													7.0	8.0	8.0					11																	64981654		1888	4074	5962	SO:0001628	intergenic_variant	0			X04366	CCDS44644.1	11q13	2013-01-10			ENSG00000014216	ENSG00000014216	3.4.22.52	"""EF-hand domain containing"""	1476	protein-coding gene	gene with protein product		114220				3017764, 2209092	Standard	NM_005186		Approved	muCANP, muCL, CANP, CANPL1	uc009yqd.2	P07384	OTTHUMG00000165614		11.37:g.64981654C>G			Q2TTR0|Q6DHV4	RNA	SNP	-	NULL	ENST00000527323.1	37	NULL	CCDS44644.1	11																																																																																			SLC22A20	-	-	ENSG00000197847		0.677	CAPN1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC22A20	HGNC	protein_coding	OTTHUMT00000385325.1	-	0.00	143	0	C			64981654	+1	tier1	-	no_errors	ENST00000525264	ensembl	human	known	74_37	rna	6.25	90	6	SNP	0.000	G
SLC29A4	222962	genome.wustl.edu	37	7	5336571	5336571	+	Frame_Shift_Del	DEL	G	G	-			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr7:5336571delG	ENST00000396872.3	+	7	785	c.624delG	c.(622-624)acgfs	p.T208fs	SLC29A4_ENST00000297195.4_Frame_Shift_Del_p.T208fs|SLC29A4_ENST00000406453.3_Frame_Shift_Del_p.T194fs			Q7RTT9	S29A4_HUMAN	solute carrier family 29 (equilibrative nucleoside transporter), member 4	208					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nucleoside transmembrane transporter activity (GO:0005337)			breast(1)|cervix(2)|kidney(7)|large_intestine(1)|liver(1)|lung(7)|urinary_tract(1)	20		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0903)|OV - Ovarian serous cystadenocarcinoma(56;2.65e-15)	Metformin(DB00331)	CCCCAGGCACGGCGGGCGTGA	0.716																																																	0													10.0	11.0	11.0					7																	5336571		1998	3957	5955	SO:0001589	frameshift_variant	0			AK075422	CCDS5340.1, CCDS75561.1	7p22.2	2013-07-17	2013-07-17		ENSG00000164638	ENSG00000164638		"""Solute carriers"""	23097	protein-coding gene	gene with protein product		609149	"""solute carrier family 29 (nucleoside transporters), member 4"""			12838422	Standard	NM_153247		Approved	FLJ34923, ENT4	uc003soc.3	Q7RTT9	OTTHUMG00000023797	ENST00000396872.3:c.624delG	7.37:g.5336571delG	ENSP00000380081:p.Thr208fs		Q6PJ08|Q86WY8|Q8NAR3|Q8NBM2	Frame_Shift_Del	DEL	pfam_Eqnu_transpt,superfamily_MFS_dom_general_subst_transpt,prints_Eqnu_transpt	p.A209fs	ENST00000396872.3	37	c.624	CCDS5340.1	7																																																																																			SLC29A4	-	pfam_Eqnu_transpt,superfamily_MFS_dom_general_subst_transpt,prints_Eqnu_transpt	ENSG00000164638		0.716	SLC29A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC29A4	HGNC	protein_coding	OTTHUMT00000060118.6		0.00	48	0	G	NM_153247		5336571	+1	tier1		no_errors	ENST00000297195	ensembl	human	known	74_37	frame_shift_del	15.62	27	5	DEL	0.160	-
SLC35F6	54978	genome.wustl.edu	37	2	27001275	27001275	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr2:27001275C>T	ENST00000344420.5	+	6	1074	c.1012C>T	c.(1012-1014)Cgt>Tgt	p.R338C	CENPA_ENST00000475662.1_Intron|SLC35F6_ENST00000416475.2_Missense_Mutation_p.R255C	NM_017877.3	NP_060347.2	Q8N357	S35F6_HUMAN	solute carrier family 35, member F6	338					negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)|positive regulation of cell proliferation (GO:0008284)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)											TGGGCTACACCGTCCGCTGCT	0.642																																																	0													70.0	68.0	69.0					2																	27001275		2203	4300	6503	SO:0001583	missense	0			AK075164	CCDS1728.1	2p24.1	2012-12-13	2012-12-07	2012-12-07	ENSG00000213699	ENSG00000213699			26055	protein-coding gene	gene with protein product	"""ANT2-binding protein"", ""transport and golgi organization 9 homolog (Drosophila)"""		"""chromosome 2 open reading frame 18"""	C2orf18		15911612, 19154410	Standard	NM_017877		Approved	FLJ20555, ANT2BP, TANGO9	uc002rhp.1	Q8N357	OTTHUMG00000128407	ENST00000344420.5:c.1012C>T	2.37:g.27001275C>T	ENSP00000345528:p.Arg338Cys		D6W543|Q53GK2|Q8NBX6|Q9NWX0	Missense_Mutation	SNP	pfam_SLC35_F1/F2/F6,pfam_Nuc_sug_transpt,pfam_DMT,pfam_Tpt_PEP_trans_dom,pfam_UAA,pirsf_UCP036436	p.R338C	ENST00000344420.5	37	c.1012	CCDS1728.1	2	.	.	.	.	.	.	.	.	.	.	C	16.08	3.020268	0.54576	.	.	ENSG00000213699	ENST00000344420;ENST00000416475	.	.	.	5.72	4.79	0.61399	.	0.231174	0.41097	D	0.000956	T	0.50990	0.1648	M	0.61703	1.905	0.80722	D	1	D;D;D	0.67145	0.975;0.996;0.975	B;B;B	0.43623	0.333;0.425;0.333	T	0.57382	-0.7821	9	0.56958	D	0.05	-8.3975	12.3555	0.55174	0.285:0.715:0.0:0.0	.	191;255;338	E7ET27;B4DLH2;Q8N357	.;.;CB018_HUMAN	C	338;255	.	ENSP00000345528:R338C	R	+	1	0	C2orf18	26854779	0.996000	0.38824	0.985000	0.45067	0.738000	0.42128	1.025000	0.30090	2.706000	0.92434	0.561000	0.74099	CGT	SLC35F6	-	pirsf_UCP036436	ENSG00000213699		0.642	SLC35F6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35F6	HGNC	protein_coding	OTTHUMT00000250187.2		0.00	27	0	C	NM_017877		27001275	+1			no_errors	ENST00000344420	ensembl	human	known	74_37	missense	11.11	24	3	SNP	0.992	T
SLC37A3	84255	genome.wustl.edu	37	7	140051914	140051914	+	Frame_Shift_Del	DEL	A	A	-			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr7:140051914delA	ENST00000326232.9	-	8	854	c.651delT	c.(649-651)tttfs	p.F217fs	SLC37A3_ENST00000447932.2_Frame_Shift_Del_p.F217fs|SLC37A3_ENST00000340308.3_Frame_Shift_Del_p.F217fs|SLC37A3_ENST00000429996.2_3'UTR	NM_207113.1	NP_996996.1	Q8NCC5	SPX3_HUMAN	solute carrier family 37, member 3	217					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|stomach(3)	24	Melanoma(164;0.0142)					TCCCACCAGCAAACTGCACAG	0.488																																					Esophageal Squamous(133;211 1716 4665 11387 37873)												0													110.0	94.0	99.0					7																	140051914		2203	4300	6503	SO:0001589	frameshift_variant	0			AK074823	CCDS5858.1, CCDS5859.1, CCDS75669.1	7q34	2013-07-17	2013-07-17		ENSG00000157800	ENSG00000157800		"""Solute carriers"""	20651	protein-coding gene	gene with protein product							Standard	NM_001287498		Approved	DKFZp761N0624	uc003vvo.3	Q8NCC5	OTTHUMG00000157343	ENST00000326232.9:c.651delT	7.37:g.140051914delA	ENSP00000321498:p.Phe217fs		Q6PIU7|Q86SS4|Q9BQG7	Frame_Shift_Del	DEL	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.F217fs	ENST00000326232.9	37	c.651	CCDS5859.1	7																																																																																			SLC37A3	-	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000157800		0.488	SLC37A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC37A3	HGNC	protein_coding	OTTHUMT00000348492.1		0.00	61	0	A	NM_032295		140051914	-1	tier1		no_errors	ENST00000326232	ensembl	human	known	74_37	frame_shift_del	19.44	29	7	DEL	1.000	-
SLC4A3	6508	genome.wustl.edu	37	2	220497045	220497045	+	Missense_Mutation	SNP	C	C	T	rs369812780		TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr2:220497045C>T	ENST00000358055.3	+	8	1534	c.1022C>T	c.(1021-1023)aCg>aTg	p.T341M	SLC4A3_ENST00000273063.6_Missense_Mutation_p.T368M|SLC4A3_ENST00000373760.2_Missense_Mutation_p.T341M|SLC4A3_ENST00000317151.3_Missense_Mutation_p.T341M|SLC4A3_ENST00000497589.1_3'UTR|SLC4A3_ENST00000373762.3_Missense_Mutation_p.T368M			P48751	B3A3_HUMAN	solute carrier family 4 (anion exchanger), member 3	341					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	51		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGGCGGGAGACGGCCCGCTGG	0.662																																																	0								C	MET/THR,MET/THR	0,4406		0,0,2203	38.0	43.0	41.0		1022,1103	3.8	1.0	2		41	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	SLC4A3	NM_005070.3,NM_201574.2	81,81	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	341/1233,368/1260	220497045	1,13005	2203	4300	6503	SO:0001583	missense	0				CCDS2445.1, CCDS2446.1	2q35	2013-07-19	2013-07-19		ENSG00000114923	ENSG00000114923		"""Solute carriers"""	11029	protein-coding gene	gene with protein product	"""Anion exchanger 3, neuronal"""	106195	"""solute carrier family 4, anion exchanger, member 3"""			8001971	Standard	NM_005070		Approved	AE3, SLC2C	uc002vmo.4	P48751	OTTHUMG00000059238	ENST00000358055.3:c.1022C>T	2.37:g.220497045C>T	ENSP00000350756:p.Thr341Met		A6H8L2|A8K1Q9|B7ZVX6|B9EGD1|Q6YIQ9	Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Anion_exchange_3,prints_Anion_exchange,tigrfam_HCO3_transpt_euk	p.T368M	ENST00000358055.3	37	c.1103	CCDS2445.1	2	.	.	.	.	.	.	.	.	.	.	C	32	5.105717	0.94292	0.0	1.16E-4	ENSG00000114923	ENST00000358055;ENST00000373760;ENST00000273063;ENST00000373762;ENST00000317151;ENST00000413743	D;D;D;D;D;D	0.82255	-1.59;-1.59;-1.59;-1.59;-1.59;-1.59	3.85	3.85	0.44370	Bicarbonate transporter, cytoplasmic (1);Phosphotransferase/anion transporter (1);	0.119672	0.53938	D	0.000055	D	0.89332	0.6685	M	0.73372	2.23	0.58432	D	0.999997	D;D	0.69078	0.995;0.997	P;D	0.64321	0.677;0.924	D	0.91182	0.4977	10	0.87932	D	0	.	16.3106	0.82869	0.0:1.0:0.0:0.0	.	341;368	P48751;P48751-3	B3A3_HUMAN;.	M	341;341;368;368;341;143	ENSP00000350756:T341M;ENSP00000362865:T341M;ENSP00000273063:T368M;ENSP00000362867:T368M;ENSP00000314006:T341M;ENSP00000414722:T143M	ENSP00000273063:T368M	T	+	2	0	SLC4A3	220205289	0.998000	0.40836	0.996000	0.52242	0.996000	0.88848	3.781000	0.55394	2.126000	0.65437	0.561000	0.74099	ACG	SLC4A3	-	superfamily_PTrfase/Anion_transptr,tigrfam_HCO3_transpt_euk	ENSG00000114923		0.662	SLC4A3-009	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SLC4A3	HGNC	protein_coding	OTTHUMT00000316472.1		0.00	92	0	C	NM_005070		220497045	+1			no_errors	ENST00000273063	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	T
SLC6A10P	386757	genome.wustl.edu	37	16	32892642	32892642	+	RNA	SNP	T	T	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr16:32892642T>C	ENST00000330048.5	-	0	2172					NR_003083.2				solute carrier family 6 (neurotransmitter transporter), member 10, pseudogene																		GAGTGAGAGCTGTGTGAGTGT	0.647																																																	0																																												0			U41163		16p11.2	2013-07-19	2013-07-19	2013-07-19	ENSG00000214617	ENSG00000214617		"""Solute carriers"""	11043	pseudogene	pseudogene	"""creatine transporter-2"""		"""solute carrier family 6 (neurotransmitter transporter, creatine), member 10"""	SLC6A10		9154116	Standard	NR_003083		Approved	CT-2	uc002edh.1		OTTHUMG00000132481		16.37:g.32892642T>C				RNA	SNP	-	NULL	ENST00000330048.5	37	NULL		16																																																																																			SLC6A10P	-	-	ENSG00000214617		0.647	SLC6A10P-002	KNOWN	basic	processed_transcript	SLC6A10P	HGNC	pseudogene	OTTHUMT00000432081.2	-	0.00	26	0	T			32892642	-1	tier1	-	no_errors	ENST00000330048	ensembl	human	known	74_37	rna	44.44	5	4	SNP	0.077	C
SLFN12	55106	genome.wustl.edu	37	17	33750022	33750022	+	Missense_Mutation	SNP	G	G	A	rs143225670		TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr17:33750022G>A	ENST00000394562.1	-	4	549	c.26C>T	c.(25-27)aCg>aTg	p.T9M	SLFN12_ENST00000452764.3_Missense_Mutation_p.T9M|SLFN12_ENST00000460530.1_5'Flank|SLFN12_ENST00000304905.5_Missense_Mutation_p.T9M			Q8IYM2	SLN12_HUMAN	schlafen family member 12	9							ATP binding (GO:0005524)			breast(1)|kidney(2)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	18		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GGCATAATTCGTTTCCAAATC	0.388																																																	0								G	MET/THR	2,4404	2.1+/-5.4	0,2,2201	126.0	123.0	124.0		26	1.7	0.0	17	dbSNP_134	124	0,8600		0,0,4300	no	missense	SLFN12	NM_018042.3	81	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	probably-damaging	9/579	33750022	2,13004	2203	4300	6503	SO:0001583	missense	0			AK001122	CCDS11295.1	17q12	2006-04-05			ENSG00000172123	ENSG00000172123			25500	protein-coding gene	gene with protein product		614955				12477932	Standard	NM_018042		Approved	FLJ10260	uc002hji.4	Q8IYM2	OTTHUMG00000132952	ENST00000394562.1:c.26C>T	17.37:g.33750022G>A	ENSP00000378063:p.Thr9Met		A8K711|Q9NP47	Missense_Mutation	SNP	pfam_ATPase_AAA-4	p.T9M	ENST00000394562.1	37	c.26	CCDS11295.1	17	.	.	.	.	.	.	.	.	.	.	g	10.33	1.320907	0.23994	4.54E-4	0.0	ENSG00000172123	ENST00000394562;ENST00000304905;ENST00000452764;ENST00000447040;ENST00000445092;ENST00000428476	T;T;T;T;T	0.32988	3.77;3.77;3.77;1.87;1.43	2.81	1.74	0.24563	.	.	.	.	.	T	0.35189	0.0923	L	0.39085	1.19	0.09310	N	1	D	0.76494	0.999	P	0.58928	0.848	T	0.10800	-1.0614	9	0.45353	T	0.12	.	6.5602	0.22481	0.0:0.0:0.7131:0.2869	.	9	Q8IYM2	SLN12_HUMAN	M	9	ENSP00000378063:T9M;ENSP00000302077:T9M;ENSP00000394903:T9M;ENSP00000398315:T9M;ENSP00000404175:T9M	ENSP00000302077:T9M	T	-	2	0	SLFN12	30774135	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.306000	0.19279	0.427000	0.26145	0.436000	0.28706	ACG	SLFN12	-	NULL	ENSG00000172123		0.388	SLFN12-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLFN12	HGNC	protein_coding	OTTHUMT00000256491.1	-	0.00	44	0	G	NM_018042		33750022	-1	tier1	rs143225670	no_errors	ENST00000304905	ensembl	human	known	74_37	missense	31.25	22	10	SNP	0.000	A
SNHG14	104472715	genome.wustl.edu	37	15	25330454	25330454	+	RNA	SNP	T	T	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr15:25330454T>C	ENST00000546682.1	+	0	438				SNORD116-19_ENST00000384729.1_RNA|SNORD116-17_ENST00000383929.1_RNA|SNORD116-20_ENST00000384529.1_lincRNA|SNORD116-18_ENST00000383961.1_RNA|SNORD116-16_ENST00000384533.1_RNA|SNHG14_ENST00000553108.1_RNA|SNHG14_ENST00000549804.2_RNA	NR_003361.1				small nucleolar RNA host gene 14 (non-protein coding)																		CAGGTGCTAGTGGATTCCTTA	0.502																																																	0																																												0					15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25330454T>C				RNA	SNP	-	NULL	ENST00000546682.1	37	NULL		15																																																																																			SNHG14	-	-	ENSG00000224078		0.502	SNHG14-022	KNOWN	basic	antisense	SNHG14	HGNC	processed_transcript	OTTHUMT00000408281.1	-	0.00	107	0	T			25330454	+1	tier1	-	no_errors	ENST00000546682	ensembl	human	known	74_37	rna	34.94	54	29	SNP	0.000	C
SNHG14	104472715	genome.wustl.edu	37	15	25472155	25472155	+	RNA	SNP	T	T	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr15:25472155T>C	ENST00000453082.2	+	0	1197				SNORD115-30_ENST00000364117.1_RNA|SNORD115-32_ENST00000364079.1_RNA|SNORD115-31_ENST00000365318.1_RNA	NR_003343.1				small nucleolar RNA host gene 14 (non-protein coding)																		GCGCTGAAGCTCAGGACCTTC	0.627																																																	0																																												0					15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25472155T>C				RNA	SNP	-	NULL	ENST00000453082.2	37	NULL		15																																																																																			SNHG14	-	-	ENSG00000224078		0.627	SNHG14-003	KNOWN	non_canonical_TEC|basic	antisense	SNHG14	HGNC	processed_transcript	OTTHUMT00000126730.2	-	0.00	43	0	T			25472155	+1	tier1	-	no_errors	ENST00000453082	ensembl	human	known	74_37	rna	38.71	19	12	SNP	0.095	C
SNRPD2	6633	genome.wustl.edu	37	19	46190958	46190958	+	Silent	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr19:46190958C>T	ENST00000342669.3	-	3	654	c.210G>A	c.(208-210)gtG>gtA	p.V70V	SNRPD2_ENST00000391932.3_Silent_p.V60V|SNRPD2_ENST00000590212.1_Silent_p.*79*|SNRPD2_ENST00000585392.1_Silent_p.V6V|SNRPD2_ENST00000588301.1_Silent_p.V70V|SNRPD2_ENST00000587367.1_Silent_p.V60V|SNRPD2_ENST00000588599.1_Silent_p.V60V	NM_004597.5	NP_004588.1	P62316	SMD2_HUMAN	small nuclear ribonucleoprotein D2 polypeptide 16.5kDa	70					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)|spliceosomal snRNP assembly (GO:0000387)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|methylosome (GO:0034709)|nucleoplasm (GO:0005654)|pICln-Sm protein complex (GO:0034715)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN-Sm protein complex (GO:0034719)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U12-type spliceosomal complex (GO:0005689)|U4 snRNP (GO:0005687)	poly(A) RNA binding (GO:0044822)			breast(1)|large_intestine(1)|lung(2)	4		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00546)|GBM - Glioblastoma multiforme(486;0.0807)|Epithelial(262;0.194)		ACATCTCCTTCACGTTCTCCA	0.602																																																	0													127.0	98.0	108.0					19																	46190958		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS33053.1, CCDS54281.1	19q13.2-q13.3	2011-10-11	2002-08-29		ENSG00000125743	ENSG00000125743			11159	protein-coding gene	gene with protein product	"""snRNP core protein D2"""	601061	"""small nuclear ribonucleoprotein D2 polypeptide (16.5kD)"""	SNRPD1		7527560, 1701240	Standard	NM_004597		Approved	Sm-D2	uc002pcw.3	P62316		ENST00000342669.3:c.210G>A	19.37:g.46190958C>T			A8K797|J3KPM5|P43330	Silent	SNP	pfam_Ribonucl_LSM,superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc	p.V70	ENST00000342669.3	37	c.210	CCDS33053.1	19																																																																																			SNRPD2	-	pfam_Ribonucl_LSM,superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc	ENSG00000125743		0.602	SNRPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNRPD2	HGNC	protein_coding	OTTHUMT00000459648.1	-	0.00	40	0	C	NM_004597		46190958	-1	tier1	-	no_errors	ENST00000342669	ensembl	human	known	74_37	silent	29.41	36	15	SNP	1.000	T
SNX29	92017	genome.wustl.edu	37	16	12618568	12618568	+	Missense_Mutation	SNP	T	T	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr16:12618568T>A	ENST00000566228.1	+	20	2257	c.2188T>A	c.(2188-2190)Ttt>Att	p.F730I	SNX29_ENST00000323433.4_Missense_Mutation_p.F345I|SNX29_ENST00000306030.3_Missense_Mutation_p.F345I	NM_032167.3	NP_115543.3	Q8TEQ0	SNX29_HUMAN	sorting nexin 29	730	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.					extracellular vesicular exosome (GO:0070062)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	7						GGATGCCAAGTTTGTGGAGGA	0.522																																																	0													72.0	78.0	76.0					16																	12618568		2063	4210	6273	SO:0001583	missense	0			AK074072	CCDS10553.2	16p13.13-p13.12	2011-08-16			ENSG00000048471	ENSG00000048471		"""Sorting nexins"""	30542	protein-coding gene	gene with protein product			"""RUN domain containing 2A"""	RUNDC2A		16782399	Standard	XM_005255682		Approved	FLJ12363	uc002dby.5	Q8TEQ0		ENST00000566228.1:c.2188T>A	16.37:g.12618568T>A	ENSP00000456480:p.Phe730Ile		B5MDW2|Q8N2X2|Q9HA26	Missense_Mutation	SNP	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.F345I	ENST00000566228.1	37	c.1033	CCDS10553.2	16	.	.	.	.	.	.	.	.	.	.	T	30	5.056271	0.93793	.	.	ENSG00000048471	ENST00000306030;ENST00000323433;ENST00000219090	T;T	0.44083	0.93;0.93	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.62159	0.2405	M	0.80183	2.485	0.36271	D	0.855179	.	.	.	.	.	.	T	0.73582	-0.3937	8	0.72032	D	0.01	-17.5609	14.107	0.65096	0.0:0.0:0.0:1.0	.	.	.	.	I	345;345;25	ENSP00000306940:F345I;ENSP00000322226:F345I	ENSP00000219090:F25I	F	+	1	0	SNX29	12526069	1.000000	0.71417	0.996000	0.52242	0.911000	0.54048	6.707000	0.74654	2.209000	0.71365	0.533000	0.62120	TTT	SNX29	-	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	ENSG00000048471		0.522	SNX29-005	PUTATIVE	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SNX29	HGNC	protein_coding	OTTHUMT00000422622.1	-	0.00	76	0	T			12618568	+1	tier1	-	no_errors	ENST00000306030	ensembl	human	known	74_37	missense	45.00	22	18	SNP	1.000	A
SOX5	6660	genome.wustl.edu	37	12	23908618	23908618	+	Silent	SNP	T	T	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr12:23908618T>C	ENST00000451604.2	-	4	623	c.522A>G	c.(520-522)aaA>aaG	p.K174K	SOX5_ENST00000546136.1_Silent_p.K161K|SOX5_ENST00000381381.2_Silent_p.K161K|SOX5_ENST00000541536.1_Silent_p.K161K|SOX5_ENST00000541847.1_Silent_p.K164K|SOX5_ENST00000309359.1_Silent_p.K161K|SOX5_ENST00000537393.1_Silent_p.K139K|SOX5_ENST00000545921.1_Silent_p.K164K			P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5	174					cartilage development (GO:0051216)|cell fate commitment (GO:0045165)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system neuron differentiation (GO:0021953)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte differentiation (GO:0048709)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear transcription factor complex (GO:0044798)	sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(25)|ovary(5)|skin(2)|upper_aerodigestive_tract(3)	57						GAAGCTTGTCTTTCCAGTCCT	0.363																																																	0													138.0	131.0	133.0					12																	23908618		2203	4299	6502	SO:0001819	synonymous_variant	0			AB081589	CCDS8699.1, CCDS41761.1, CCDS44844.1, CCDS58216.1, CCDS58217.1	12p12.1	2010-04-20			ENSG00000134532	ENSG00000134532		"""SRY (sex determining region Y)-boxes"""	11201	protein-coding gene	gene with protein product		604975				8812465	Standard	NM_006940		Approved	L-SOX5, MGC35153	uc001rfw.3	P35711	OTTHUMG00000169026	ENST00000451604.2:c.522A>G	12.37:g.23908618T>C			B7Z8V0|F5H5B0|Q86UK8|Q8J017|Q8J018|Q8J019|Q8J020|Q8N1D9|Q8N7E0|Q8TEA4	Silent	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.K174	ENST00000451604.2	37	c.522	CCDS8699.1	12																																																																																			SOX5	-	NULL	ENSG00000134532		0.363	SOX5-002	KNOWN	basic|CCDS	protein_coding	SOX5	HGNC	protein_coding	OTTHUMT00000402006.2	-	0.00	75	0	T	NM_006940		23908618	-1	tier1	-	no_errors	ENST00000451604	ensembl	human	known	74_37	silent	36.84	24	14	SNP	1.000	C
SP100	6672	genome.wustl.edu	37	2	231406625	231406625	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr2:231406625G>T	ENST00000340126.4	+	28	2453	c.2422G>T	c.(2422-2424)Ggc>Tgc	p.G808C	AC010149.4_ENST00000455357.1_RNA|AC010149.4_ENST00000414539.1_RNA	NM_001080391.1	NP_001073860.1	P23497	SP100_HUMAN	SP100 nuclear antigen	0					cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cellular component movement (GO:0051271)|negative regulation of DNA binding (GO:0043392)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral transcription (GO:0032897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|regulation of Fas signaling pathway (GO:1902044)|response to cytokine (GO:0034097)|response to interferon-gamma (GO:0034341)|response to retinoic acid (GO:0032526)|response to type I interferon (GO:0034340)|retinoic acid receptor signaling pathway (GO:0048384)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(4)|upper_aerodigestive_tract(1)	25		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		GGGGTCTCAGGGCCCACAGAA	0.463																																																	0													82.0	81.0	81.0					2																	231406625		1884	4113	5997	SO:0001583	missense	0			AF056322	CCDS2477.1, CCDS42832.1, CCDS56170.1, CCDS56171.1, CCDS56172.1, CCDS56173.1	2q37.1	2013-01-28	2005-11-30		ENSG00000067066	ENSG00000067066		"""Zinc fingers, PHD-type"""	11206	protein-coding gene	gene with protein product		604585	"""nuclear antigen Sp100"""			2258622, 8695863	Standard	NM_001080391		Approved		uc002vqu.1	P23497	OTTHUMG00000133203	ENST00000340126.4:c.2422G>T	2.37:g.231406625G>T	ENSP00000343023:p.Gly808Cys		B4DDX5|B8ZZD8|E7EUA7|E9PH61|F8WFE2|O75450|Q13343|Q8TE34|Q96F70|Q96T24|Q96T95|Q9NP33|Q9UE32	Missense_Mutation	SNP	pfam_Sp100,pfam_SAND_dom,pfam_Bromodomain,superfamily_SAND_dom-like,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_SAND_dom,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_SAND_dom	p.G808C	ENST00000340126.4	37	c.2422	CCDS42832.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	4.797|4.797	0.148137|0.148137	0.09134|0.09134	.|.	.|.	ENSG00000067066|ENSG00000067066	ENST00000340126;ENST00000414648|ENST00000431952	T|.	0.46451|.	0.87|.	3.67|3.67	-1.37|-1.37	0.09056|0.09056	.|.	.|.	.|.	.|.	.|.	T|T	0.33585|0.33585	0.0868|0.0868	L|L	0.46157|0.46157	1.445|1.445	0.09310|0.09310	N|N	1|1	D;D|.	0.69078|.	0.992;0.997|.	P;P|.	0.54460|.	0.75;0.753|.	T|T	0.31861|0.31861	-0.9928|-0.9928	9|5	0.59425|.	D|.	0.04|.	.|.	4.0314|4.0314	0.09711|0.09711	0.4364:0.1805:0.3831:0.0|0.4364:0.1805:0.3831:0.0	.|.	278;808|.	E9PHN1;P23497-4|.	.;.|.	C|V	808;278|181	ENSP00000343023:G808C|.	ENSP00000343023:G808C|.	G|G	+|+	1|2	0|0	SP100|SP100	231114869|231114869	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.002000|0.002000	0.02628|0.02628	0.066000|0.066000	0.14489|0.14489	-0.293000|-0.293000	0.08986|0.08986	-0.136000|-0.136000	0.14681|0.14681	GGC|GGG	SP100	-	superfamily_Bromodomain,smart_Bromodomain	ENSG00000067066		0.463	SP100-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SP100	HGNC	protein_coding	OTTHUMT00000332246.1		0.00	45	0	G	NM_003113		231406625	+1			no_errors	ENST00000340126	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.000	T
SPANXC	64663	genome.wustl.edu	37	X	140335763	140335763	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chrX:140335763T>C	ENST00000358993.2	-	2	219	c.181A>G	c.(181-183)Aga>Gga	p.R61G		NM_022661.2	NP_073152.1	Q9NY87	SPNXC_HUMAN	SPANX family, member C	61						cytoplasm (GO:0005737)|nucleus (GO:0005634)				large_intestine(2)|lung(3)|pancreas(1)	6	Acute lymphoblastic leukemia(192;7.65e-05)					GGAGATGTTCTTTTCACGTTC	0.483																																																	0													236.0	174.0	195.0					X																	140335763		2141	4142	6283	SO:0001583	missense	0			AJ238277	CCDS14673.1	Xq27.2	2009-03-25			ENSG00000198573	ENSG00000198573			14331	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 3"""	300330				10626816	Standard	NM_022661		Approved	CTp11, CT11.3	uc004fbk.3	Q9NY87	OTTHUMG00000022556	ENST00000358993.2:c.181A>G	X.37:g.140335763T>C	ENSP00000351884:p.Arg61Gly		Q32WL9|Q5JX88	Missense_Mutation	SNP	pfam_SPANX_prot	p.R61G	ENST00000358993.2	37	c.181	CCDS14673.1	X	.	.	.	.	.	.	.	.	.	.	t	8.201	0.798268	0.16397	.	.	ENSG00000198573	ENST00000358993	T	0.07800	3.16	.	.	.	.	.	.	.	.	T	0.11452	0.0279	L	0.60455	1.87	0.09310	N	1	D	0.54207	0.965	P	0.46885	0.53	T	0.17715	-1.0360	7	0.72032	D	0.01	.	.	.	.	.	61	Q9NY87	SPNXC_HUMAN	G	61	ENSP00000351884:R61G	ENSP00000351884:R61G	R	-	1	2	SPANXC	140163429	0.027000	0.19231	0.014000	0.15608	0.013000	0.08279	0.065000	0.14466	0.276000	0.22118	0.270000	0.19313	AGA	SPANXC	-	pfam_SPANX_prot	ENSG00000198573		0.483	SPANXC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPANXC	HGNC	protein_coding	OTTHUMT00000058590.1	-	0.00	174	0	T	NM_022661		140335763	-1	tier1	-	no_errors	ENST00000358993	ensembl	human	known	74_37	missense	63.49	46	80	SNP	0.014	C
SPEG	10290	genome.wustl.edu	37	2	220330747	220330747	+	Intron	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr2:220330747G>A	ENST00000312358.7	+	10	3013				SPEG_ENST00000396686.1_Intron|SPEG_ENST00000396689.2_Intron|SPEG_ENST00000396698.1_Intron|SPEG_ENST00000396695.2_Intron|SPEG_ENST00000485813.1_Intron|SPEG_ENST00000396688.1_Intron	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus						cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		CTAACCTGCCGCTTGCTGACT	0.642																																																	0													25.0	22.0	23.0					2																	220330747		876	1989	2865	SO:0001627	intron_variant	0			BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.2882-1149G>A	2.37:g.220330747G>A			A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	RNA	SNP	-	NULL	ENST00000312358.7	37	NULL	CCDS42824.1	2																																																																																			SPEG	-	-	ENSG00000072195		0.642	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEG	HGNC	protein_coding	OTTHUMT00000130252.2	-	0.00	89	0	G	NM_005876		220330747	+1	tier1	-	no_errors	ENST00000462545	ensembl	human	known	74_37	rna	30.16	44	19	SNP	1.000	A
STAT5B	6777	genome.wustl.edu	37	17	40370850	40370850	+	Missense_Mutation	SNP	G	G	A	rs199982340		TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr17:40370850G>A	ENST00000293328.3	-	8	1048	c.880C>T	c.(880-882)Cgc>Tgc	p.R294C		NM_012448.3	NP_036580.2	P51692	STA5B_HUMAN	signal transducer and activator of transcription 5B	294	Required for interaction with NMI.				2-oxoglutarate metabolic process (GO:0006103)|acute-phase response (GO:0006953)|allantoin metabolic process (GO:0000255)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hormone stimulus (GO:0032870)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|development of secondary female sexual characteristics (GO:0046543)|development of secondary male sexual characteristics (GO:0046544)|fatty acid metabolic process (GO:0006631)|female pregnancy (GO:0007565)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|lipid storage (GO:0019915)|liver development (GO:0001889)|luteinization (GO:0001553)|natural killer cell differentiation (GO:0001779)|negative regulation of apoptotic process (GO:0043066)|negative regulation of erythrocyte differentiation (GO:0045647)|oxaloacetate metabolic process (GO:0006107)|Peyer's patch development (GO:0048541)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of cellular component movement (GO:0051272)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone metabolic process (GO:0042448)|prolactin signaling pathway (GO:0038161)|regulation of cell adhesion (GO:0030155)|regulation of epithelial cell differentiation (GO:0030856)|regulation of multicellular organism growth (GO:0040014)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to lipopolysaccharide (GO:0032496)|succinate metabolic process (GO:0006105)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|taurine metabolic process (GO:0019530)|transcription from RNA polymerase II promoter (GO:0006366)|valine metabolic process (GO:0006573)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|glucocorticoid receptor binding (GO:0035259)|protein dimerization activity (GO:0046983)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_cancers(22;4.15e-07)|all_epithelial(22;2.83e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.135)	Dasatinib(DB01254)	TCAGCCCTGCGGATCTGCTGC	0.632																																																	0													33.0	28.0	30.0					17																	40370850		2202	4276	6478	SO:0001583	missense	0			BC065227	CCDS11423.1	17q11.2	2014-09-17			ENSG00000173757	ENSG00000173757		"""SH2 domain containing"""	11367	protein-coding gene	gene with protein product		604260				8631883	Standard	NM_012448		Approved		uc002hzh.3	P51692	OTTHUMG00000150724	ENST00000293328.3:c.880C>T	17.37:g.40370850G>A	ENSP00000293328:p.Arg294Cys		Q8WWS8	Missense_Mutation	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,smart_SH2,pfscan_SH2	p.R294C	ENST00000293328.3	37	c.880	CCDS11423.1	17	.	.	.	.	.	.	.	.	.	.	G	20.5	4.006223	0.74932	.	.	ENSG00000173757	ENST00000293328	T	0.60548	0.18	4.52	3.48	0.39840	STAT transcription factor, all-alpha (2);STAT transcription factor, coiled coil (1);	0.055373	0.64402	D	0.000001	T	0.70988	0.3287	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.73380	0.94;0.98	T	0.75473	-0.3305	10	0.87932	D	0	-5.2234	15.0749	0.72069	0.0:0.0:0.8487:0.1513	.	294;294	Q8WW55;P51692	.;STA5B_HUMAN	C	294	ENSP00000293328:R294C	ENSP00000293328:R294C	R	-	1	0	STAT5B	37624376	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.964000	0.56780	2.341000	0.79615	0.555000	0.69702	CGC	STAT5B	-	pfam_STAT_TF_alpha,superfamily_STAT_TF_coiled-coil	ENSG00000173757		0.632	STAT5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAT5B	HGNC	protein_coding	OTTHUMT00000319797.1	-	0.00	35	0	G	NM_012448		40370850	-1	tier1	rs199982340	no_errors	ENST00000293328	ensembl	human	known	74_37	missense	22.86	27	8	SNP	1.000	A
STX19	415117	genome.wustl.edu	37	3	93733819	93733819	+	Missense_Mutation	SNP	T	T	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr3:93733819T>G	ENST00000315099.2	-	2	551	c.295A>C	c.(295-297)Aaa>Caa	p.K99Q	ARL13B_ENST00000486562.1_Intron|ARL13B_ENST00000539730.1_Intron|ARL13B_ENST00000535334.1_Intron|ARL13B_ENST00000303097.7_Intron|ARL13B_ENST00000394222.3_Intron|ARL13B_ENST00000471138.1_Intron	NM_001001850.2	NP_001001850.1	Q8N4C7	STX19_HUMAN	syntaxin 19	99					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	integral component of membrane (GO:0016021)				kidney(2)|large_intestine(2)|lung(4)|prostate(1)	9						GCCTGAATTTTTATCTCCTTT	0.353																																																	0													140.0	145.0	143.0					3																	93733819		2203	4300	6503	SO:0001583	missense	0			AF461456	CCDS33793.1	3q11	2005-12-30			ENSG00000178750	ENSG00000178750			19300	protein-coding gene	gene with protein product							Standard	NM_001001850		Approved	MGC21382	uc003drh.1	Q8N4C7	OTTHUMG00000159013	ENST00000315099.2:c.295A>C	3.37:g.93733819T>G	ENSP00000320679:p.Lys99Gln			Missense_Mutation	SNP	pfam_T_SNARE_dom,pfam_Syntaxin_N,superfamily_t-SNARE,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.K99Q	ENST00000315099.2	37	c.295	CCDS33793.1	3	.	.	.	.	.	.	.	.	.	.	T	19.53	3.844666	0.71488	.	.	ENSG00000178750	ENST00000315099	T	0.22539	1.95	4.47	4.47	0.54385	t-SNARE (1);Syntaxin, N-terminal (1);	0.049848	0.85682	D	0.000000	T	0.43144	0.1234	M	0.67397	2.05	0.50467	D	0.999877	D	0.71674	0.998	D	0.68943	0.961	T	0.40136	-0.9579	10	0.59425	D	0.04	-13.6554	14.4476	0.67361	0.0:0.0:0.0:1.0	.	99	Q8N4C7	STX19_HUMAN	Q	99	ENSP00000320679:K99Q	ENSP00000320679:K99Q	K	-	1	0	STX19	95216509	1.000000	0.71417	0.991000	0.47740	0.942000	0.58702	7.593000	0.82686	1.964000	0.57103	0.533000	0.62120	AAA	STX19	-	pfam_Syntaxin_N,superfamily_t-SNARE	ENSG00000178750		0.353	STX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STX19	HGNC	protein_coding	OTTHUMT00000352909.1	-	0.00	42	0	T	NM_001001850		93733819	-1	tier1	-	no_errors	ENST00000315099	ensembl	human	known	74_37	missense	37.50	15	9	SNP	1.000	G
SVEP1	79987	genome.wustl.edu	37	9	113173558	113173558	+	Missense_Mutation	SNP	G	G	A	rs201043549		TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr9:113173558G>A	ENST00000401783.2	-	37	6769	c.6433C>T	c.(6433-6435)Cgg>Tgg	p.R2145W	SVEP1_ENST00000297826.5_Missense_Mutation_p.R71W|SVEP1_ENST00000374469.1_Missense_Mutation_p.R2122W	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	2145	Sushi 13. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						TCTCCACACCGCACAGGGATG	0.502																																																	0								G	TRP/ARG	0,4024		0,0,2012	89.0	94.0	92.0		6433	4.8	1.0	9		92	1,8341		0,1,4170	no	missense	SVEP1	NM_153366.3	101	0,1,6182	AA,AG,GG		0.012,0.0,0.0081	probably-damaging	2145/3572	113173558	1,12365	2012	4171	6183	SO:0001583	missense	0			AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.6433C>T	9.37:g.113173558G>A	ENSP00000384917:p.Arg2145Trp		Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_EG-like_dom,pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_Hyalin,pfam_VWF_A,pfam_Pentaxin,pfam_EGF_extracell,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Growth_fac_rcpt_N_dom,smart_VWF_A,smart_Sushi_SCR_CCP,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Pentaxin,pfscan_EG-like_dom,pfscan_Hyalin,pfscan_Sushi_SCR_CCP,pfscan_VWF_A,prints_Pentaxin	p.R2145W	ENST00000401783.2	37	c.6433	CCDS48004.1	9	.	.	.	.	.	.	.	.	.	.	G	18.12	3.553200	0.65425	0.0	1.2E-4	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000297826	T;T;T	0.25085	1.82;1.82;1.82	5.74	4.84	0.62591	Complement control module (2);Sushi/SCR/CCP (1);	0.000000	0.85682	D	0.000000	T	0.55289	0.1911	M	0.83953	2.67	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.62450	-0.6852	10	0.56958	D	0.05	.	16.3435	0.83110	0.0:0.0:0.8672:0.1328	.	2145	Q4LDE5	SVEP1_HUMAN	W	2145;2122;71	ENSP00000384917:R2145W;ENSP00000363593:R2122W;ENSP00000297826:R71W	ENSP00000297826:R71W	R	-	1	2	SVEP1	112213379	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.024000	0.57218	1.432000	0.47375	0.591000	0.81541	CGG	SVEP1	-	superfamily_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000165124		0.502	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SVEP1	HGNC	protein_coding		-	0.00	41	0	G			113173558	-1	tier1	rs201043549	no_errors	ENST00000401783	ensembl	human	known	74_37	missense	20.00	24	6	SNP	1.000	A
SYNJ2	8871	genome.wustl.edu	37	6	158483096	158483096	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr6:158483096G>T	ENST00000355585.4	+	8	1102	c.1027G>T	c.(1027-1029)Ggt>Tgt	p.G343C	SYNJ2_ENST00000367122.2_Missense_Mutation_p.G343C|SYNJ2_ENST00000367121.3_Missense_Mutation_p.G343C|SYNJ2_ENST00000449859.2_Missense_Mutation_p.G271C	NM_001178088.1|NM_003898.3	NP_001171559.1|NP_003889.1	O15056	SYNJ2_HUMAN	synaptojanin 2	343	SAC. {ECO:0000255|PROSITE- ProRule:PRU00183}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			biliary_tract(1)|endometrium(9)|kidney(3)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)		GTTTGCCAAAGGTGGGAAGCT	0.537																																																	0													204.0	205.0	205.0					6																	158483096		2203	4300	6503	SO:0001583	missense	0			AB002346	CCDS5254.1	6q25.3	2008-05-15			ENSG00000078269	ENSG00000078269			11504	protein-coding gene	gene with protein product		609410					Standard	NM_003898		Approved	INPP5H	uc003qqx.2	O15056	OTTHUMG00000015904	ENST00000355585.4:c.1027G>T	6.37:g.158483096G>T	ENSP00000347792:p.Gly343Cys		Q5TA13|Q5TA16|Q5TA19|Q86XK0|Q8IZA8|Q9H226	Missense_Mutation	SNP	pfam_Syja_N,pfam_DUF1866,pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc,pfscan_RRM_dom,pfscan_Syja_N	p.G343C	ENST00000355585.4	37	c.1027	CCDS5254.1	6	.	.	.	.	.	.	.	.	.	.	G	26.8	4.772824	0.90108	.	.	ENSG00000078269	ENST00000367122;ENST00000367121;ENST00000355585;ENST00000449859	T;T;T;T	0.60548	0.18;0.18;0.18;0.38	5.12	5.12	0.69794	Synaptojanin, N-terminal (2);	0.000000	0.64402	D	0.000006	D	0.83403	0.5247	H	0.97415	4	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.998;1.0;1.0	D	0.89649	0.3868	10	0.87932	D	0	.	18.63	0.91357	0.0:0.0:1.0:0.0	.	271;343;343;343	B4DJU8;E7ER60;O15056;O15056-3	.;.;SYNJ2_HUMAN;.	C	343;343;343;271	ENSP00000356089:G343C;ENSP00000356088:G343C;ENSP00000347792:G343C;ENSP00000388371:G271C	ENSP00000347792:G343C	G	+	1	0	SYNJ2	158403084	1.000000	0.71417	0.997000	0.53966	0.893000	0.52053	7.541000	0.82084	2.407000	0.81776	0.456000	0.33151	GGT	SYNJ2	-	pfam_Syja_N,pfscan_Syja_N	ENSG00000078269		0.537	SYNJ2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNJ2	HGNC	protein_coding	OTTHUMT00000042858.2	-	0.00	64	0	G			158483096	+1	tier1	-	no_errors	ENST00000355585	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	T
SYT1	6857	genome.wustl.edu	37	12	79679573	79679573	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr12:79679573C>T	ENST00000261205.4	+	5	830	c.173C>T	c.(172-174)cCg>cTg	p.P58L	SYT1_ENST00000552744.1_Missense_Mutation_p.P58L|SYT1_ENST00000457153.2_Missense_Mutation_p.P58L|SYT1_ENST00000393240.3_Missense_Mutation_p.P58L	NM_005639.2	NP_005630.1	P21579	SYT1_HUMAN	synaptotagmin I	58					calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|detection of calcium ion (GO:0005513)|glutamate secretion (GO:0014047)|neurotransmitter secretion (GO:0007269)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|positive regulation of synaptic transmission (GO:0050806)|positive regulation of vesicle fusion (GO:0031340)|protein homooligomerization (GO:0051260)|regulation of exocytosis (GO:0017157)|regulation of regulated secretory pathway (GO:1903305)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|vesicle docking (GO:0048278)	cell junction (GO:0030054)|clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|clathrin-sculpted glutamate transport vesicle membrane (GO:0060203)|clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|dense core granule (GO:0031045)|endocytic vesicle membrane (GO:0030666)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	1-phosphatidylinositol binding (GO:0005545)|calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|transporter activity (GO:0005215)			NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|pancreas(2)|skin(6)	25						TCAGTGCCACCGTGGGCCTTA	0.373																																																	0													134.0	123.0	127.0					12																	79679573		2203	4300	6503	SO:0001583	missense	0				CCDS9017.1	12q21.2	2013-09-20			ENSG00000067715	ENSG00000067715		"""Synaptotagmins"""	11509	protein-coding gene	gene with protein product		185605		SYT, SVP65		1840599	Standard	NM_001135805		Approved	P65	uc001syv.3	P21579	OTTHUMG00000134326	ENST00000261205.4:c.173C>T	12.37:g.79679573C>T	ENSP00000261205:p.Pro58Leu		Q6AI31	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom,prints_Synaptotagmin,prints_C2_dom	p.P58L	ENST00000261205.4	37	c.173	CCDS9017.1	12	.	.	.	.	.	.	.	.	.	.	C	28.1	4.889834	0.91889	.	.	ENSG00000067715	ENST00000393240;ENST00000261205;ENST00000457153;ENST00000552074;ENST00000547046;ENST00000549671;ENST00000551304;ENST00000552744;ENST00000552624;ENST00000446242	T;T;T;T;T;T;T	0.50277	0.75;0.75;0.75;0.75;0.75;0.75;0.75	5.93	5.93	0.95920	.	0.052393	0.85682	D	0.000000	T	0.44477	0.1295	L	0.39245	1.2	0.80722	D	1	B;B	0.19935	0.04;0.04	B;B	0.08055	0.003;0.003	T	0.19192	-1.0313	10	0.46703	T	0.11	.	20.3539	0.98825	0.0:1.0:0.0:0.0	.	58;58	Q6AI31;P21579	.;SYT1_HUMAN	L	58	ENSP00000376932:P58L;ENSP00000261205:P58L;ENSP00000391056:P58L;ENSP00000447035:P58L;ENSP00000447575:P58L;ENSP00000448861:P58L;ENSP00000401559:P58L	ENSP00000261205:P58L	P	+	2	0	SYT1	78203704	1.000000	0.71417	0.979000	0.43373	0.956000	0.61745	5.968000	0.70413	2.826000	0.97356	0.655000	0.94253	CCG	SYT1	-	NULL	ENSG00000067715		0.373	SYT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYT1	HGNC	protein_coding	OTTHUMT00000259415.1	-	0.00	53	0	C	NM_005639		79679573	+1	tier1	-	no_errors	ENST00000261205	ensembl	human	known	74_37	missense	25.86	43	15	SNP	1.000	T
SYTL2	54843	genome.wustl.edu	37	11	85445679	85445679	+	Silent	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr11:85445679G>A	ENST00000528231.1	-	6	967	c.690C>T	c.(688-690)atC>atT	p.I230I	SYTL2_ENST00000527523.1_Silent_p.I182I|SYTL2_ENST00000524452.1_Silent_p.I230I|SYTL2_ENST00000316356.4_Silent_p.I231I|SYTL2_ENST00000389960.4_Silent_p.I230I	NM_001162951.1|NM_001162953.1	NP_001156423.1|NP_001156425.1	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2	230					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of mucus secretion (GO:0070257)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|exocytic vesicle (GO:0070382)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|melanosome (GO:0042470)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)|phosphatase binding (GO:0019902)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(22)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		TTGGAGCCTTGATTTGGGACC	0.408																																																	0													110.0	110.0	110.0					11																	85445679		2203	4299	6502	SO:0001819	synonymous_variant	0			AJ303364	CCDS31649.1, CCDS31652.1, CCDS41698.1, CCDS53687.1, CCDS53688.1, CCDS53689.1	11q14.1	2014-06-13			ENSG00000137501	ENSG00000137501			15585	protein-coding gene	gene with protein product	"""chromosome 11 synaptotagmin"", ""breast cancer-associated antigen SGA-72M"", ""protein phosphatase 1, regulatory subunit 151"""	612880				10997877	Standard	XM_005274057		Approved	FLJ20163, FLJ21219, KIAA1597, exophilin-4, CHR11SYT, SLP2, SGA72M, MGC102768, PPP1R151	uc001pbb.3	Q9HCH5	OTTHUMG00000166977	ENST00000528231.1:c.690C>T	11.37:g.85445679G>A			B3KRS3|B4DJT5|B4DKW3|B4DQ26|B7SA85|B7ZLX6|B7ZLX7|Q2YDA7|Q6TV07|Q6ZN59|Q6ZVC5|Q8ND34|Q96BJ2|Q9H768|Q9NXM1	Silent	SNP	pfam_C2_dom,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,smart_C2_dom,pfscan_C2_dom,pfscan_Znf_FYVE-typ	p.I231	ENST00000528231.1	37	c.693	CCDS53688.1	11																																																																																			SYTL2	-	NULL	ENSG00000137501		0.408	SYTL2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	SYTL2	HGNC	protein_coding	OTTHUMT00000392192.1	-	0.00	73	0	G	NM_206927		85445679	-1	tier1	-	no_errors	ENST00000316356	ensembl	human	known	74_37	silent	39.53	26	17	SNP	0.074	A
TBC1D1	23216	genome.wustl.edu	37	4	38126581	38126581	+	Splice_Site	SNP	A	A	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr4:38126581A>T	ENST00000261439.4	+	18	3317		c.e18-1		TBC1D1_ENST00000508802.1_Intron|TBC1D1_ENST00000407365.1_Splice_Site	NM_001253914.1|NM_001253915.1|NM_015173.3	NP_001240843.1|NP_001240844.1|NP_055988.2	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1						membrane organization (GO:0061024)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(3)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	36						GTGTTTTCTCAGATATGATTT	0.418																																																	0													118.0	113.0	115.0					4																	38126581		2203	4300	6503	SO:0001630	splice_region_variant	0			AB029031	CCDS33972.1, CCDS58897.1	4p14	2013-07-09			ENSG00000065882	ENSG00000065882			11578	protein-coding gene	gene with protein product		609850				10965142, 18258599	Standard	NM_015173		Approved	TBC, TBC1, KIAA1108	uc003gtb.3	Q86TI0	OTTHUMG00000150302	ENST00000261439.4:c.2963-1A>T	4.37:g.38126581A>T			B7Z3D9|E9PGH8|Q96K82|Q9UPP4	Splice_Site	SNP	-	e17-2	ENST00000261439.4	37	c.2963-2	CCDS33972.1	4	.	.	.	.	.	.	.	.	.	.	A	22.4	4.287402	0.80803	.	.	ENSG00000065882	ENST00000261439;ENST00000454732;ENST00000510573	.	.	.	5.28	5.28	0.74379	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3756	0.74602	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TBC1D1	37802976	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.757000	0.91657	2.206000	0.71126	0.533000	0.62120	.	TBC1D1	-	-	ENSG00000065882		0.418	TBC1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D1	HGNC	protein_coding	OTTHUMT00000317443.2	-	0.00	87	0	A	NM_015173	Intron	38126581	+1	tier1	-	no_errors	ENST00000261439	ensembl	human	known	74_37	splice_site	38.75	49	31	SNP	1.000	T
TBC1D26	353149	genome.wustl.edu	37	17	15640806	15640806	+	Missense_Mutation	SNP	A	A	C	rs200208182	byFrequency	TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr17:15640806A>C	ENST00000437605.2	+	5	417	c.167A>C	c.(166-168)gAg>gCg	p.E56A	ZNF286A_ENST00000593105.1_3'UTR|AC005324.6_ENST00000433873.1_RNA|TBC1D26_ENST00000579428.1_Missense_Mutation_p.E56A|AC005324.6_ENST00000434017.1_RNA|ZNF286A_ENST00000413242.2_3'UTR	NM_178571.4	NP_848666	Q86UD7	TBC26_HUMAN	TBC1 domain family, member 26	56							Rab GTPase activator activity (GO:0005097)	p.E56A(1)		endometrium(1)|large_intestine(1)|lung(4)|skin(1)	7				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(1115;0.0222)|BRCA - Breast invasive adenocarcinoma(8;0.078)		AGTGAGATGGAGCTGCCCCAC	0.647																																																	1	Substitution - Missense(1)	skin(1)											35.0	39.0	37.0					17																	15640806		1942	4099	6041	SO:0001583	missense	0				CCDS42265.1	17p11.2	2008-11-04			ENSG00000214946	ENSG00000214946			28745	protein-coding gene	gene with protein product						11347906	Standard	NM_178571		Approved	MGC51025	uc010cov.3	Q86UD7	OTTHUMG00000059071	ENST00000437605.2:c.167A>C	17.37:g.15640806A>C	ENSP00000410111:p.Glu56Ala		A8K929|Q4G172	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.E56A	ENST00000437605.2	37	c.167	CCDS42265.1	17	.	.	.	.	.	.	.	.	.	.	a	8.747	0.920269	0.17982	.	.	ENSG00000214946	ENST00000437605	T	0.44881	0.91	0.888	-1.78	0.07957	.	0.321547	0.28187	U	0.016280	T	0.40067	0.1102	M	0.81682	2.555	0.09310	N	1	P;P	0.41710	0.76;0.481	B;B	0.44163	0.443;0.347	T	0.39292	-0.9621	10	0.51188	T	0.08	.	1.5879	0.02648	0.3144:0.2682:0.0:0.4174	.	56;56	Q86UD7;Q86UD7-2	TBC26_HUMAN;.	A	56	ENSP00000410111:E56A	ENSP00000410111:E56A	E	+	2	0	TBC1D26	15581531	0.176000	0.23096	0.000000	0.03702	0.001000	0.01503	0.354000	0.20146	-1.189000	0.02702	-0.811000	0.03165	GAG	TBC1D26	-	NULL	ENSG00000214946		0.647	TBC1D26-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D26	HGNC	protein_coding		-	0.00	55	0	A	NM_178571		15640806	+1	tier1	rs200208182	no_errors	ENST00000437605	ensembl	human	known	74_37	missense	22.73	17	5	SNP	0.285	C
TCEB3	6924	genome.wustl.edu	37	1	24077814	24077814	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:24077814G>T	ENST00000418390.2	+	4	1068	c.797G>T	c.(796-798)aGt>aTt	p.S266I	TCEB3_ENST00000609199.1_Missense_Mutation_p.S240I	NM_003198.2	NP_003189.2	Q14241	ELOA1_HUMAN	transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A)	266					gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	19		Colorectal(325;3.46e-05)|Lung NSC(340;0.000112)|all_lung(284;0.00016)|Renal(390;0.000219)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;2.42e-24)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;4.74e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000973)|KIRC - Kidney renal clear cell carcinoma(1967;0.00334)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		GGGGTTGTGAGTCAAAACAAG	0.547											OREG0013232	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													71.0	80.0	77.0					1																	24077814		2203	4300	6503	SO:0001583	missense	0			L47345	CCDS239.2	1p36.1	2010-06-22	2002-08-29		ENSG00000011007	ENSG00000011007			11620	protein-coding gene	gene with protein product		600786	"""transcription elongation factor B (SIII), polypeptide 3 (110kD, elongin A)"""			8586449, 7660129	Standard	NM_003198		Approved	SIII, TCEB3A	uc001bho.3	Q14241	OTTHUMG00000002957	ENST00000418390.2:c.797G>T	1.37:g.24077814G>T	ENSP00000395574:p.Ser266Ile	768	B2R7Q8|Q8IXH1	Missense_Mutation	SNP	pfam_RNA_pol_II_trans_fac_SIII_A,pfam_TFIIS_N,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub,pfscan_F-box_dom	p.S266I	ENST00000418390.2	37	c.797	CCDS239.2	1	.	.	.	.	.	.	.	.	.	.	G	15.39	2.819392	0.50633	.	.	ENSG00000011007	ENST00000418390	T	0.08984	3.03	5.74	-4.08	0.03963	.	0.725562	0.13496	N	0.383647	T	0.08223	0.0205	M	0.66939	2.045	0.09310	N	1	P	0.34780	0.468	B	0.31191	0.125	T	0.09487	-1.0672	10	0.87932	D	0	-0.1175	7.9311	0.29904	0.1502:0.1938:0.656:0.0	.	266	Q14241	ELOA1_HUMAN	I	266	ENSP00000395574:S266I	ENSP00000395574:S266I	S	+	2	0	TCEB3	23950401	0.978000	0.34361	0.000000	0.03702	0.596000	0.36781	0.855000	0.27805	-0.758000	0.04690	-0.302000	0.09304	AGT	TCEB3	-	NULL	ENSG00000011007		0.547	TCEB3-001	KNOWN	basic|CCDS	protein_coding	TCEB3	HGNC	protein_coding	OTTHUMT00000008230.2	-	0.00	58	0	G	NM_003198		24077814	+1	tier1	-	no_errors	ENST00000418390	ensembl	human	known	74_37	missense	8.16	45	4	SNP	0.000	T
TENM2	57451	genome.wustl.edu	37	5	167489111	167489111	+	Missense_Mutation	SNP	A	A	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr5:167489111A>C	ENST00000518659.1	+	7	1395	c.1356A>C	c.(1354-1356)gaA>gaC	p.E452D	TENM2_ENST00000403607.2_Missense_Mutation_p.E285D|TENM2_ENST00000545108.1_Missense_Mutation_p.E452D|TENM2_ENST00000519204.1_Missense_Mutation_p.E331D|TENM2_ENST00000520394.1_Missense_Mutation_p.E220D	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	452					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										GTGAAGCAGAAGTTGGTCGGC	0.453																																																	0													86.0	87.0	86.0					5																	167489111		1855	4096	5951	SO:0001583	missense	0			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.1356A>C	5.37:g.167489111A>C	ENSP00000429430:p.Glu452Asp		Q9ULU2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Quino_amine_DH_bsu,superfamily_ConA-like_lec_gl_sf,superfamily_Cytokine_IL1-like,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.E452D	ENST00000518659.1	37	c.1356		5	.	.	.	.	.	.	.	.	.	.	A	3.418	-0.118699	0.06838	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	T;T;T;T;T	0.19938	2.11;2.11;2.11;2.11;2.11	5.63	1.9	0.25705	.	0.161689	0.53938	N	0.000059	T	0.10981	0.0268	L	0.27053	0.805	0.37264	D	0.907111	B;P;B	0.41131	0.004;0.739;0.002	B;B;B	0.39119	0.012;0.291;0.016	T	0.18713	-1.0328	10	0.02654	T	1	.	9.3017	0.37849	0.6508:0.0:0.3492:0.0	.	452;220;331	Q9NT68;F8VNQ3;G3V106	TEN2_HUMAN;.;.	D	452;452;331;220;285	ENSP00000429430:E452D;ENSP00000438635:E452D;ENSP00000428964:E331D;ENSP00000427874:E220D;ENSP00000384905:E285D	ENSP00000384905:E285D	E	+	3	2	ODZ2	167421689	1.000000	0.71417	0.984000	0.44739	0.884000	0.51177	2.382000	0.44345	0.423000	0.26033	0.533000	0.62120	GAA	TENM2	-	NULL	ENSG00000145934		0.453	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	TENM2	HGNC	protein_coding	OTTHUMT00000376096.1	-	0.00	70	0	A	NM_001122679		167489111	+1	tier1	-	no_errors	ENST00000518659	ensembl	human	known	74_37	missense	54.90	23	28	SNP	1.000	C
TENM3	55714	genome.wustl.edu	37	4	183713770	183713770	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr4:183713770T>C	ENST00000511685.1	+	26	6068	c.5945T>C	c.(5944-5946)cTc>cCc	p.L1982P	TENM3_ENST00000406950.2_Missense_Mutation_p.L1982P			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	1982					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										ACAGTAAACCTCCAGAGTGAT	0.403																																																	0													230.0	220.0	223.0					4																	183713770		1913	4126	6039	SO:0001583	missense	0			AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.5945T>C	4.37:g.183713770T>C	ENSP00000424226:p.Leu1982Pro		Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Cyt_c-like_dom,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.L1982P	ENST00000511685.1	37	c.5945	CCDS47165.1	4	.	.	.	.	.	.	.	.	.	.	T	16.28	3.079281	0.55753	.	.	ENSG00000218336	ENST00000511685;ENST00000406950	D;D	0.87729	-2.29;-2.29	4.74	4.74	0.60224	.	.	.	.	.	D	0.93086	0.7799	M	0.81682	2.555	0.80722	D	1	D	0.71674	0.998	D	0.79784	0.993	D	0.93579	0.6911	9	0.54805	T	0.06	.	14.6876	0.69059	0.0:0.0:0.0:1.0	.	1982	Q9P273	TEN3_HUMAN	P	1982	ENSP00000424226:L1982P;ENSP00000385276:L1982P	ENSP00000385276:L1982P	L	+	2	0	ODZ3	183950764	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	7.798000	0.85924	2.108000	0.64289	0.482000	0.46254	CTC	TENM3	-	NULL	ENSG00000218336		0.403	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM3	HGNC	protein_coding	OTTHUMT00000361734.1	-	0.00	91	0	T			183713770	+1	tier1	-	no_errors	ENST00000406950	ensembl	human	known	74_37	missense	15.79	48	9	SNP	1.000	C
TESK2	10420	genome.wustl.edu	37	1	45809610	45809610	+	3'UTR	DEL	A	A	-			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:45809610delA	ENST00000372086.3	-	0	3018				TOE1_ENST00000372090.5_3'UTR|TOE1_ENST00000495703.1_3'UTR|TESK2_ENST00000486676.1_5'UTR|TESK2_ENST00000372084.1_3'UTR|TESK2_ENST00000341771.6_3'UTR	NM_007170.2	NP_009101.2	Q96S53	TESK2_HUMAN	testis-specific kinase 2						actin cytoskeleton organization (GO:0030036)|focal adhesion assembly (GO:0048041)|protein phosphorylation (GO:0006468)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(1)|lung(9)|ovary(2)|pancreas(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	32	Acute lymphoblastic leukemia(166;0.155)					AAAGTTTTACAAAAAAAAAAA	0.363																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AJ132545	CCDS41323.1	1p32	2010-04-27			ENSG00000070759	ENSG00000070759	2.7.12.1		11732	protein-coding gene	gene with protein product		604746				10512679	Standard	NM_007170		Approved		uc001cns.1	Q96S53	OTTHUMG00000007680	ENST00000372086.3:c.*902T>-	1.37:g.45809610delA			Q5T422|Q5T423|Q8N520|Q9Y3Q6	RNA	DEL	-	NULL	ENST00000372086.3	37	NULL	CCDS41323.1	1																																																																																			TESK2	-	-	ENSG00000070759		0.363	TESK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TESK2	HGNC	protein_coding	OTTHUMT00000020523.1		0.00	69	0	A	NM_007170		45809610	-1	tier1		no_errors	ENST00000486676	ensembl	human	known	74_37	rna	15.56	38	7	DEL	0.794	-
TESPA1	9840	genome.wustl.edu	37	12	55356627	55356627	+	Missense_Mutation	SNP	T	T	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr12:55356627T>G	ENST00000449076.1	-	9	1187	c.1055A>C	c.(1054-1056)aAg>aCg	p.K352T	TESPA1_ENST00000531122.1_Missense_Mutation_p.K214T|TESPA1_ENST00000316577.8_Missense_Mutation_p.K352T|TESPA1_ENST00000532804.1_Missense_Mutation_p.K214T|TESPA1_ENST00000524622.1_Missense_Mutation_p.K214T|TESPA1_ENST00000524959.1_5'Flank	NM_001136030.2	NP_001129502.1	A2RU30	TESP1_HUMAN	thymocyte expressed, positive selection associated 1	352					COP9 signalosome assembly (GO:0010387)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of T cell receptor signaling pathway (GO:0050862)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)											AGTGGGCAACTTCTTACCCTC	0.502																																																	0													54.0	56.0	55.0					12																	55356627		1961	4156	6117	SO:0001583	missense	0			AB018291	CCDS44913.1, CCDS58240.1	12q13.2	2012-03-21	2012-03-21	2012-03-21	ENSG00000135426	ENSG00000135426			29109	protein-coding gene	gene with protein product		615664	"""KIAA0748"""	KIAA0748		9872452	Standard	NM_001136030		Approved		uc001sgn.4	A2RU30	OTTHUMG00000165407	ENST00000449076.1:c.1055A>C	12.37:g.55356627T>G	ENSP00000400892:p.Lys352Thr		B4DPM3|B4E048|B7Z9K7|O94849|Q4G0P2|Q9P0C4	Missense_Mutation	SNP	NULL	p.K352T	ENST00000449076.1	37	c.1055	CCDS44913.1	12	.	.	.	.	.	.	.	.	.	.	T	9.966	1.224038	0.22457	.	.	ENSG00000135426	ENST00000524622;ENST00000532804;ENST00000449076;ENST00000316577;ENST00000531122	T;T;T;T;T	0.63255	-0.03;-0.03;-0.03;-0.03;-0.03	4.15	1.75	0.24633	.	1.297770	0.05290	N	0.520833	T	0.47266	0.1436	L	0.29908	0.895	0.09310	N	1	B	0.29037	0.231	B	0.22601	0.04	T	0.41574	-0.9501	10	0.66056	D	0.02	-12.3985	3.5193	0.07736	0.1948:0.1051:0.0:0.7001	.	352	A2RU30	K0748_HUMAN	T	214;214;352;352;214	ENSP00000435622:K214T;ENSP00000432030:K214T;ENSP00000400892:K352T;ENSP00000312679:K352T;ENSP00000433098:K214T	ENSP00000312679:K352T	K	-	2	0	KIAA0748	53642894	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	0.092000	0.15066	0.372000	0.24591	-0.256000	0.11100	AAG	TESPA1	-	NULL	ENSG00000135426		0.502	TESPA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TESPA1	HGNC	protein_coding	OTTHUMT00000383822.1	-	0.00	31	0	T	NM_001098815		55356627	-1	tier1	-	no_errors	ENST00000316577	ensembl	human	known	74_37	missense	31.58	13	6	SNP	0.000	G
TEX14	56155	genome.wustl.edu	37	17	56693620	56693620	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr17:56693620G>A	ENST00000240361.8	-	7	786	c.701C>T	c.(700-702)cCg>cTg	p.P234L	TEX14_ENST00000389934.3_Missense_Mutation_p.P228L|TEX14_ENST00000349033.5_Missense_Mutation_p.P228L			Q8IWB6	TEX14_HUMAN	testis expressed 14	234	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				attachment of spindle microtubules to kinetochore (GO:0008608)|intercellular bridge organization (GO:0043063)|male meiosis (GO:0007140)|mitotic sister chromatid separation (GO:0051306)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)	cell (GO:0005623)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|midbody (GO:0030496)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)	p.P228L(1)		breast(6)|endometrium(5)|kidney(3)|large_intestine(22)|liver(1)|lung(24)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	81	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TCCAATGACCGGAAGAGATCC	0.493																																																	1	Substitution - Missense(1)	stomach(1)											97.0	87.0	90.0					17																	56693620		2203	4300	6503	SO:0001583	missense	0			AF285601	CCDS32692.1, CCDS32693.1, CCDS56042.1	17q22	2013-09-20	2007-03-13		ENSG00000121101	ENSG00000121101			11737	protein-coding gene	gene with protein product	"""cancer/testis antigen 113"""	605792	"""testis expressed sequence 14"""			11279525, 12711554	Standard	NM_031272		Approved	CT113	uc010dcz.2	Q8IWB6	OTTHUMG00000179245	ENST00000240361.8:c.701C>T	17.37:g.56693620G>A	ENSP00000240361:p.Pro234Leu		A6NH19|Q7RTP3|Q8ND97|Q9BXT9	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom	p.P234L	ENST00000240361.8	37	c.701	CCDS56042.1	17	.	.	.	.	.	.	.	.	.	.	G	12.41	1.930620	0.34096	.	.	ENSG00000121101	ENST00000240361;ENST00000389934;ENST00000349033	D;D;D	0.83914	-1.78;-1.63;-1.53	5.65	4.67	0.58626	Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000002	D	0.82976	0.5154	M	0.65975	2.015	0.58432	D	0.999993	P;P;P	0.46621	0.464;0.599;0.881	B;B;B	0.41946	0.13;0.201;0.371	T	0.83344	-0.0006	10	0.66056	D	0.02	-20.068	16.4431	0.83908	0.0708:0.0:0.9292:0.0	.	234;228;228	Q8IWB6;Q8IWB6-3;Q8IWB6-2	TEX14_HUMAN;.;.	L	234;228;228	ENSP00000240361:P234L;ENSP00000374584:P228L;ENSP00000268910:P228L	ENSP00000240361:P234L	P	-	2	0	TEX14	54048619	1.000000	0.71417	0.506000	0.27664	0.374000	0.29953	4.072000	0.57563	0.760000	0.33108	-0.797000	0.03246	CCG	TEX14	-	pfscan_Prot_kinase_dom	ENSG00000121101		0.493	TEX14-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TEX14	HGNC	protein_coding	OTTHUMT00000445446.1	-	0.00	44	0	G			56693620	-1	tier1	-	no_errors	ENST00000240361	ensembl	human	known	74_37	missense	37.78	28	17	SNP	0.929	A
TMED1	11018	genome.wustl.edu	37	19	10945648	10945648	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr19:10945648G>A	ENST00000214869.2	-	3	525	c.427C>T	c.(427-429)Ccc>Tcc	p.P143S	TMED1_ENST00000588289.1_5'UTR|TMED1_ENST00000591695.1_Intron|C19orf38_ENST00000592854.1_5'Flank	NM_006858.2	NP_006849.1	Q13445	TMED1_HUMAN	transmembrane emp24 protein transport domain containing 1	143					cell-cell signaling (GO:0007267)|protein transport (GO:0015031)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|lung(2)|ovary(3)|prostate(1)|skin(1)	10						ATCTCCTCGGGCTCCACAGCC	0.567																																																	0													172.0	160.0	164.0					19																	10945648		2203	4300	6503	SO:0001583	missense	0			U41804	CCDS12249.1	19p13.2	2008-02-05	2005-08-26			ENSG00000099203			17291	protein-coding gene	gene with protein product		605395	"""transmembrane emp24 domain containing 1"""			11466339, 8621446	Standard	NM_006858		Approved	ST2L, MGC1270, IL1RL1LG, Il1rl1l	uc002mpy.3	Q13445		ENST00000214869.2:c.427C>T	19.37:g.10945648G>A	ENSP00000214869:p.Pro143Ser			Missense_Mutation	SNP	pfam_GOLD,superfamily_GOLD,pfscan_GOLD	p.P143S	ENST00000214869.2	37	c.427	CCDS12249.1	19	.	.	.	.	.	.	.	.	.	.	G	13.09	2.134269	0.37630	.	.	ENSG00000099203	ENST00000214869	T	0.16073	2.37	5.02	5.02	0.67125	GOLD (1);	0.052373	0.85682	D	0.000000	T	0.25121	0.0610	M	0.73430	2.235	0.80722	D	1	B	0.25272	0.122	B	0.29267	0.1	T	0.04467	-1.0949	10	0.25106	T	0.35	-24.3746	17.1231	0.86706	0.0:0.0:1.0:0.0	.	143	Q13445	TMED1_HUMAN	S	143	ENSP00000214869:P143S	ENSP00000214869:P143S	P	-	1	0	TMED1	10806648	1.000000	0.71417	0.992000	0.48379	0.980000	0.70556	3.068000	0.50018	2.337000	0.79520	0.462000	0.41574	CCC	TMED1	-	pfam_GOLD	ENSG00000099203		0.567	TMED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMED1	HGNC	protein_coding	OTTHUMT00000452614.1	-	0.00	40	0	G	NM_006858		10945648	-1	tier1	-	no_errors	ENST00000214869	ensembl	human	known	74_37	missense	26.32	27	10	SNP	1.000	A
TMPRSS15	5651	genome.wustl.edu	37	21	19737458	19737458	+	Splice_Site	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr21:19737458G>A	ENST00000284885.3	-	7	805	c.772C>T	c.(772-774)Cgt>Tgt	p.R258C		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	258	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)	p.R258S(1)		NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						TTGTATTACCGTATGATCCAC	0.343																																																	1	Substitution - Missense(1)	lung(1)											133.0	129.0	130.0					21																	19737458		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.773+1C>T	21.37:g.19737458G>A			Q2NKL7	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_CUB_dom,pfam_MAM_dom,pfam_SEA_dom,pfam_LDrepeatLR_classA_rpt,pfam_Peptidase_S1A_nudel,pfam_SRCR,superfamily_Trypsin-like_Pept_dom,superfamily_ConA-like_lec_gl_sf,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_Srcr_rcpt-rel,smart_SEA_dom,smart_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_MAM_dom,smart_Srcr_rcpt-rel,smart_Peptidase_S1,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_MAM_dom,pfscan_SEA_dom,pfscan_SRCR,pfscan_Peptidase_S1,prints_Peptidase_S1A,prints_LDrepeatLR_classA_rpt	p.R258C	ENST00000284885.3	37	c.772	CCDS13571.1	21	.	.	.	.	.	.	.	.	.	.	G	17.41	3.383162	0.61845	.	.	ENSG00000154646	ENST00000284885	T	0.20069	2.1	5.09	1.06	0.20224	CUB (5);	0.532256	0.19238	N	0.119244	T	0.38957	0.1060	M	0.83384	2.64	0.80722	D	1	D	0.89917	1.0	D	0.65987	0.94	T	0.15896	-1.0421	9	.	.	.	.	3.284	0.06925	0.0849:0.151:0.4524:0.3116	.	258	P98073	ENTK_HUMAN	C	258	ENSP00000284885:R258C	.	R	-	1	0	TMPRSS15	18659329	0.993000	0.37304	0.998000	0.56505	0.807000	0.45602	0.019000	0.13444	0.079000	0.16929	-0.196000	0.12772	CGT	TMPRSS15	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000154646		0.343	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS15	HGNC	protein_coding	OTTHUMT00000158231.2		0.00	66	0	G	NM_002772	Missense_Mutation	19737458	-1			no_errors	ENST00000284885	ensembl	human	known	74_37	missense	5.88	48	3	SNP	0.998	A
TP53	7157	genome.wustl.edu	37	17	7577538	7577538	+	Missense_Mutation	SNP	C	C	T	rs11540652		TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr17:7577538C>T	ENST00000269305.4	-	7	932	c.743G>A	c.(742-744)cGg>cAg	p.R248Q	TP53_ENST00000420246.2_Missense_Mutation_p.R248Q|TP53_ENST00000455263.2_Missense_Mutation_p.R248Q|TP53_ENST00000359597.4_Missense_Mutation_p.R248Q|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.R248Q|TP53_ENST00000445888.2_Missense_Mutation_p.R248Q	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248Q(580)|p.R248L(75)|p.R248P(19)|p.R155Q(18)|p.0?(8)|p.?(5)|p.R155L(3)|p.R155P(2)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.M246_P250delMNRRP(2)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*96(1)|p.R248fs*>39(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GATGGGCCTCCGGTTCATGCC	0.572	R248Q(BL41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CA46_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(EM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HCC1143_BREAST)|R248Q(HCC70_BREAST)|R248Q(HEC1A_ENDOMETRIUM)|R248Q(HS683_CENTRAL_NERVOUS_SYSTEM)|R248Q(HSC4_UPPER_AERODIGESTIVE_TRACT)|R248Q(KASUMI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYSE150_OESOPHAGUS)|R248Q(MOLM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NAMALWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NB4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIH211_LUNG)|R248Q(NCIN87_STOMACH)|R248Q(NIHOVCAR3_OVARY)|R248Q(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(P12ICHIKAWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PANC0203_PANCREAS)|R248Q(PC14_LUNG)|R248Q(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(RT112_URINARY_TRACT)|R248Q(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SF295_CENTRAL_NERVOUS_SYSTEM)|R248Q(SKUT1_SOFT_TISSUE)|R248Q(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SW1463_LARGE_INTESTINE)|R248Q(WSUDLCL2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	725	Substitution - Missense(698)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(2)|Complex - compound substitution(1)	large_intestine(138)|breast(83)|haematopoietic_and_lymphoid_tissue(74)|lung(71)|upper_aerodigestive_tract(63)|central_nervous_system(46)|oesophagus(37)|urinary_tract(37)|ovary(36)|stomach(35)|endometrium(23)|skin(18)|prostate(11)|bone(10)|biliary_tract(9)|liver(9)|pancreas(7)|vulva(3)|kidney(3)|cervix(3)|peritoneum(2)|thyroid(2)|soft_tissue(1)|pituitary(1)|adrenal_gland(1)|small_intestine(1)|thymus(1)	GRCh37	CM920675	TP53	M	rs11540652	C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	0,4406		0,0,2203	152.0	112.0	126.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	743,743,743,743,347,347,347	3.7	1.0	17	dbSNP_120	126	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	43,43,43,43,43,43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	248/394,248/394,248/347,248/342,116/262,116/210,116/215	7577538	1,13005	2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.743G>A	17.37:g.7577538C>T	ENSP00000269305:p.Arg248Gln		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R248Q	ENST00000269305.4	37	c.743	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	27.3	4.822907	0.90873	0.0	1.16E-4	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99864	-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28	4.62	3.65	0.41850	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99840	0.9927	M	0.88640	2.97	0.58432	A	0.999994	D;D;D;D;D;D	0.89917	1.0;0.994;1.0;1.0;1.0;1.0	D;P;D;D;D;D	0.91635	0.996;0.882;0.999;0.995;0.996;0.995	D	0.96819	0.9602	9	0.72032	D	0.01	-9.5643	10.6687	0.45745	0.0:0.9059:0.0:0.0941	rs11540652;rs11540652	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	Q	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248Q;ENSP00000352610:R248Q;ENSP00000269305:R248Q;ENSP00000398846:R248Q;ENSP00000391127:R248Q;ENSP00000391478:R248Q;ENSP00000425104:R116Q;ENSP00000423862:R155Q	ENSP00000269305:R248Q	R	-	2	0	TP53	7518263	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	5.884000	0.69729	1.305000	0.44909	0.462000	0.41574	CGG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	53	0	C	NM_000546		7577538	-1	tier1	rs11540652	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	57.14	18	24	SNP	1.000	T
TPSAB1	7177	genome.wustl.edu	37	16	1291569	1291569	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr16:1291569C>G	ENST00000338844.3	+	4	401	c.368C>G	c.(367-369)gCc>gGc	p.A123G	TPSAB1_ENST00000461509.2_Missense_Mutation_p.A130G	NM_003294.3	NP_003285.2	Q15661	TRYB1_HUMAN	tryptase alpha/beta 1	123	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				defense response (GO:0006952)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|skin(1)	10		Hepatocellular(780;0.00369)				GCGGACATCGCCCTGCTGGAG	0.667																																																	0													17.0	13.0	15.0					16																	1291569		2183	4259	6442	SO:0001583	missense	0			M33494	CCDS10431.1	16p13.3	2009-11-13	2004-10-14	2004-10-15	ENSG00000172236	ENSG00000172236			12019	protein-coding gene	gene with protein product	"""tryptase alpha II"", ""tryptase beta I"", ""tryptase-I"", ""tryptase-II"", ""tryptase-III"""	191080	"""tryptase beta 1"""	TPSB1, TPS1, TPS2		2203827, 9920877	Standard	NM_003294		Approved		uc002ckz.3	Q15661	OTTHUMG00000090467	ENST00000338844.3:c.368C>G	16.37:g.1291569C>G	ENSP00000343577:p.Ala123Gly		D2E6R9|D2E6S1|P15157|Q15663|Q6B052|Q9H2Y4|Q9H2Y5|Q9UQI1	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.A123G	ENST00000338844.3	37	c.368	CCDS10431.1	16	.	.	.	.	.	.	.	.	.	.	C	13.90	2.374399	0.42105	.	.	ENSG00000172236	ENST00000338844;ENST00000461509	D;D	0.91740	-2.9;-2.9	3.79	2.81	0.32909	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.48286	D	0.000200	D	0.93772	0.8009	M	0.64170	1.965	0.45914	D	0.998755	D;D	0.76494	0.996;0.999	D;D	0.71184	0.925;0.972	D	0.93243	0.6628	10	0.87932	D	0	.	8.6616	0.34097	0.0:0.8814:0.0:0.1186	.	114;123	Q15661-2;Q15661	.;TRYB1_HUMAN	G	123;130	ENSP00000343577:A123G;ENSP00000418247:A130G	ENSP00000343577:A123G	A	+	2	0	TPSAB1	1231570	0.000000	0.05858	0.992000	0.48379	0.488000	0.33401	0.213000	0.17521	1.845000	0.53610	0.479000	0.44913	GCC	TPSAB1	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	ENSG00000172236		0.667	TPSAB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TPSAB1	HGNC	protein_coding	OTTHUMT00000206914.1	-	0.00	66	0	C	NM_003294		1291569	+1	tier1	-	no_errors	ENST00000338844	ensembl	human	known	74_37	missense	16.67	20	4	SNP	0.964	G
TRIM61	391712	genome.wustl.edu	37	4	165891052	165891052	+	Missense_Mutation	SNP	A	A	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr4:165891052A>C	ENST00000329314.5	-	3	715	c.103T>G	c.(103-105)Ttc>Gtc	p.F35V		NM_001012414.2	NP_001012414.1	Q5EBN2	TRI61_HUMAN	tripartite motif containing 61	35						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|kidney(1)|liver(1)|skin(1)|upper_aerodigestive_tract(1)	5	all_hematologic(180;0.221)	Prostate(90;0.109)		GBM - Glioblastoma multiforme(119;0.155)		GAGAGACAGAAGTTATGCCCA	0.488																																																	0													23.0	21.0	21.0					4																	165891052		2127	4168	6295	SO:0001583	missense	0				CCDS34093.1	4q32.3	2013-01-09	2011-01-25			ENSG00000183439		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	24339	protein-coding gene	gene with protein product			"""ring finger protein 35"", ""tripartite motif-containing 61"""	RNF35			Standard	NM_001012414		Approved		uc003iqw.3	Q5EBN2		ENST00000329314.5:c.103T>G	4.37:g.165891052A>C	ENSP00000332288:p.Phe35Val			Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,pfam_Znf_B-box,smart_Znf_RING,pfscan_Znf_B-box,pfscan_Znf_RING	p.F35V	ENST00000329314.5	37	c.103	CCDS34093.1	4	.	.	.	.	.	.	.	.	.	.	A	16.70	3.196727	0.58126	.	.	ENSG00000183439	ENST00000329314	T	0.32753	1.44	3.22	1.97	0.26223	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type, conserved site (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	.	.	.	.	T	0.56645	0.1999	M	0.89534	3.04	0.24854	N	0.992388	D	0.71674	0.998	D	0.67382	0.951	T	0.45483	-0.9258	9	0.87932	D	0	.	7.5466	0.27770	0.7692:0.2307:0.0:0.0	.	35	Q5EBN2	TRI61_HUMAN	V	35	ENSP00000332288:F35V	ENSP00000332288:F35V	F	-	1	0	TRIM61	166110502	1.000000	0.71417	0.509000	0.27700	0.784000	0.44337	5.141000	0.64814	0.419000	0.25927	0.473000	0.43528	TTC	TRIM61	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	ENSG00000183439		0.488	TRIM61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM61	HGNC	protein_coding	OTTHUMT00000364331.1	-	0.00	231	0	A	XM_373038		165891052	-1	tier1	-	no_errors	ENST00000329314	ensembl	human	known	74_37	missense	8.21	123	11	SNP	1.000	C
TSEN2	80746	genome.wustl.edu	37	3	12546688	12546688	+	Missense_Mutation	SNP	T	T	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr3:12546688T>A	ENST00000284995.6	+	6	1254	c.867T>A	c.(865-867)aaT>aaA	p.N289K	TSEN2_ENST00000383797.5_Missense_Mutation_p.N289K|TSEN2_ENST00000402228.3_Missense_Mutation_p.N289K|TSEN2_ENST00000314571.7_Intron|TSEN2_ENST00000454502.2_Missense_Mutation_p.N230K|TSEN2_ENST00000415684.1_Intron|TSEN2_ENST00000444864.1_Intron	NM_025265.3	NP_079541.1	Q8NCE0	SEN2_HUMAN	TSEN2 tRNA splicing endonuclease subunit	289					mRNA processing (GO:0006397)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|tRNA-intron endonuclease complex (GO:0000214)	lyase activity (GO:0016829)|nucleic acid binding (GO:0003676)|tRNA-intron endonuclease activity (GO:0000213)			central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(7)	19						GCAGAAGAAATCCATATAGGA	0.348																																																	0													100.0	101.0	100.0					3																	12546688		2203	4300	6503	SO:0001583	missense	0			BC019582	CCDS2611.1, CCDS46757.1, CCDS46758.1, CCDS46759.1	3p25.2	2013-08-06	2013-08-06		ENSG00000154743	ENSG00000154743		"""tRNA splicing endonuclease subunits"""	28422	protein-coding gene	gene with protein product		608753	"""tRNA splicing endonuclease 2 homolog (SEN2, S. cerevisiae)"", ""tRNA splicing endonuclease 2 homolog (S. cerevisiae)"""			15109492	Standard	NM_025265		Approved	SEN2, SEN2L, MGC2776	uc003bxb.3	Q8NCE0	OTTHUMG00000129765	ENST00000284995.6:c.867T>A	3.37:g.12546688T>A	ENSP00000284995:p.Asn289Lys		B7Z6K1|C9IZI7|G5E9Q3|Q8WTW7|Q9BPU7	Missense_Mutation	SNP	pfam_tRNA_intron_Endonuc_cat-like,pfam_tRNA_intron_Endonuc_N,superfamily_tRNA_intron_Endonuc_cat-like,pirsf_tRNA_splic_SEN2	p.N289K	ENST00000284995.6	37	c.867	CCDS2611.1	3	.	.	.	.	.	.	.	.	.	.	T	19.38	3.815645	0.70912	.	.	ENSG00000154743	ENST00000446004;ENST00000454502;ENST00000383797;ENST00000402228;ENST00000284995;ENST00000537959	T;T;T;T;T	0.76709	-1.04;-1.04;-0.01;-1.04;-1.04	5.23	0.108	0.14548	tRNA intron endonuclease, N-terminal (1);	0.102401	0.64402	D	0.000006	T	0.82130	0.4970	M	0.64997	1.995	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.74674	0.984;0.976	T	0.77736	-0.2476	10	0.49607	T	0.09	-34.6917	7.8288	0.29330	0.0:0.3168:0.0:0.6832	.	289;230	Q8NCE0;C9IZI7	SEN2_HUMAN;.	K	289;230;289;289;289;262	ENSP00000406238:N289K;ENSP00000392029:N230K;ENSP00000373307:N289K;ENSP00000385976:N289K;ENSP00000284995:N289K	ENSP00000284995:N289K	N	+	3	2	TSEN2	12521688	0.939000	0.31865	0.961000	0.40146	0.994000	0.84299	-0.297000	0.08276	-0.206000	0.10203	0.459000	0.35465	AAT	TSEN2	-	pfam_tRNA_intron_Endonuc_N,pirsf_tRNA_splic_SEN2	ENSG00000154743		0.348	TSEN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSEN2	HGNC	protein_coding	OTTHUMT00000251981.1	-	0.00	35	0	T	NM_025265		12546688	+1	tier1	-	no_errors	ENST00000284995	ensembl	human	known	74_37	missense	32.50	27	13	SNP	0.996	A
TTC6	319089	genome.wustl.edu	37	14	38208098	38208098	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr14:38208098C>T	ENST00000553443.1	+	10	2101	c.2101C>T	c.(2101-2103)Cgt>Tgt	p.R701C				Q86TZ1	TTC6_HUMAN	tetratricopeptide repeat domain 6	0										central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|stomach(1)|urinary_tract(1)	14	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;1.59e-06)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0543)|all cancers(34;0.108)|BRCA - Breast invasive adenocarcinoma(188;0.156)|LUSC - Lung squamous cell carcinoma(13;0.176)	GBM - Glioblastoma multiforme(112;0.00551)		GGAATTGAAACGTCAGCTCCA	0.368																																																	0																																										SO:0001583	missense	0			BC014342		14q13.1	2013-01-10			ENSG00000139865	ENSG00000139865		"""Tetratricopeptide (TTC) repeat domain containing"""	19739	protein-coding gene	gene with protein product			"""non-protein coding RNA 291"", ""chromosome 14 open reading frame 25"""	NCRNA00291, C14orf25			Standard	XM_006709976		Approved		uc001wuj.3	Q86TZ1	OTTHUMG00000157369	ENST00000553443.1:c.2101C>T	14.37:g.38208098C>T	ENSP00000451131:p.Arg701Cys		Q3SY88|Q96CE6	Missense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R701C	ENST00000553443.1	37	c.2101		14	.	.	.	.	.	.	.	.	.	.	C	13.18	2.160412	0.38119	.	.	ENSG00000139865	ENST00000553443	T	0.72835	-0.69	5.28	2.15	0.27550	.	.	.	.	.	T	0.58495	0.2126	.	.	.	.	.	.	.	.	.	.	.	.	T	0.58781	-0.7576	4	.	.	.	.	3.2095	0.06677	0.2073:0.5633:0.0:0.2293	.	.	.	.	C	701	ENSP00000451131:R701C	.	R	+	1	0	TTC6	37277849	0.969000	0.33509	0.745000	0.31077	0.024000	0.10985	0.441000	0.21611	1.274000	0.44362	0.655000	0.94253	CGT	TTC6	-	NULL	ENSG00000139865		0.368	TTC6-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	TTC6	HGNC	protein_coding	OTTHUMT00000348620.4	-	0.00	72	0	C	XM_002343299		38208098	+1	tier1	-	no_errors	ENST00000553443	ensembl	human	novel	74_37	missense	14.52	52	9	SNP	0.262	T
TTN	7273	genome.wustl.edu	37	2	179419249	179419249	+	Nonsense_Mutation	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr2:179419249G>A	ENST00000591111.1	-	282	84126	c.83902C>T	c.(83902-83904)Cga>Tga	p.R27968*	TTN_ENST00000342992.6_Nonsense_Mutation_p.R27041*|TTN_ENST00000359218.5_Nonsense_Mutation_p.R20669*|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000460472.2_Nonsense_Mutation_p.R20544*|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000589042.1_Nonsense_Mutation_p.R29609*|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342175.6_Nonsense_Mutation_p.R20736*|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	27968	Fibronectin type-III 103. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCACGGCTCGGACCCGGAAG	0.433																																																	0													39.0	40.0	40.0					2																	179419249		1877	4104	5981	SO:0001587	stop_gained	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.83902C>T	2.37:g.179419249G>A	ENSP00000465570:p.Arg27968*		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.R27041*	ENST00000591111.1	37	c.81121		2	.	.	.	.	.	.	.	.	.	.	G	66	94.523692	0.99997	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	.	.	.	5.87	5.87	0.94306	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	15.3178	0.74095	0.0:0.0:0.8602:0.1398	.	.	.	.	X	27041;20544;20736;20669;20541	.	ENSP00000340554:R20736X	R	-	1	2	TTN	179127495	1.000000	0.71417	0.997000	0.53966	0.905000	0.53344	3.363000	0.52321	2.941000	0.99782	0.655000	0.94253	CGA	TTN	-	pfam_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.433	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	41	0	G	NM_133378		179419249	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	nonsense	25.00	18	6	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179472135	179472135	+	Missense_Mutation	SNP	T	T	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr2:179472135T>G	ENST00000591111.1	-	227	48581	c.48357A>C	c.(48355-48357)gaA>gaC	p.E16119D	TTN_ENST00000342992.6_Missense_Mutation_p.E15192D|TTN_ENST00000359218.5_Missense_Mutation_p.E8820D|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.E8695D|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E17760D|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E8887D|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	16119	Ig-like 99.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TACCAAAAACTTCTACCCTGG	0.383																																																	0													167.0	158.0	161.0					2																	179472135		1871	4091	5962	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.48357A>C	2.37:g.179472135T>G	ENSP00000465570:p.Glu16119Asp		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.E15192D	ENST00000591111.1	37	c.45576		2	.	.	.	.	.	.	.	.	.	.	T	10.23	1.292435	0.23564	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31	5.99	3.66	0.41972	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Fibronectin, type III (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.43144	0.1234	N	0.03281	-0.365	0.32084	N	0.592799	B;B;B;B	0.28605	0.121;0.121;0.121;0.217	B;B;B;B	0.30855	0.069;0.069;0.069;0.121	T	0.53092	-0.8487	9	0.87932	D	0	.	8.2865	0.31932	0.0:0.2092:0.0:0.7908	.	8695;8820;8887;16119	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	D	15192;8695;8887;8820;8695	ENSP00000343764:E15192D;ENSP00000434586:E8695D;ENSP00000340554:E8887D;ENSP00000352154:E8820D	ENSP00000340554:E8887D	E	-	3	2	TTN	179180380	0.973000	0.33851	1.000000	0.80357	0.996000	0.88848	0.030000	0.13688	1.089000	0.41292	0.533000	0.62120	GAA	TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Ig_sub	ENSG00000155657		0.383	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	39	0	T	NM_133378		179472135	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	30.30	23	10	SNP	1.000	G
TTN	7273	genome.wustl.edu	37	2	179476272	179476272	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr2:179476272C>T	ENST00000591111.1	-	219	45985	c.45761G>A	c.(45760-45762)gGc>gAc	p.G15254D	TTN_ENST00000342992.6_Missense_Mutation_p.G14327D|TTN_ENST00000359218.5_Missense_Mutation_p.G7955D|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.G7830D|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.G16895D|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.G8022D|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	15254	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTCTCAGTGCCTACTGGACA	0.423																																																	0													114.0	109.0	111.0					2																	179476272		1923	4130	6053	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.45761G>A	2.37:g.179476272C>T	ENSP00000465570:p.Gly15254Asp		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.G14327D	ENST00000591111.1	37	c.42980		2	.	.	.	.	.	.	.	.	.	.	C	14.93	2.682198	0.47991	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57595	0.39;0.39;0.39;0.39	5.95	5.95	0.96441	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.69522	0.3120	L	0.46741	1.465	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.69499	-0.5129	9	0.87932	D	0	.	20.3932	0.98965	0.0:1.0:0.0:0.0	.	7830;7955;8022;15254	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	D	14327;7830;8022;7955;7830	ENSP00000343764:G14327D;ENSP00000434586:G7830D;ENSP00000340554:G8022D;ENSP00000352154:G7955D	ENSP00000340554:G8022D	G	-	2	0	TTN	179184517	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.739000	0.84976	2.824000	0.97209	0.655000	0.94253	GGC	TTN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.423	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	19	0	C	NM_133378		179476272	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	20.69	23	6	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179604931	179604931	+	Silent	SNP	T	T	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr2:179604931T>C	ENST00000591111.1	-	46	12302	c.12078A>G	c.(12076-12078)gaA>gaG	p.E4026E	TTN-AS1_ENST00000582847.1_RNA|TTN_ENST00000342992.6_Intron|TTN_ENST00000359218.5_Silent_p.E4105E|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000460472.2_Silent_p.E3980E|TTN_ENST00000589042.1_Silent_p.E4343E|TTN_ENST00000342175.6_Silent_p.E4172E|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	0					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAGAATGCTCTTCTTTGAGCA	0.478																																																	0													100.0	98.0	99.0					2																	179604931		1903	4127	6030	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.12078A>G	2.37:g.179604931T>C			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.E4172	ENST00000591111.1	37	c.12516		2																																																																																			TTN	-	superfamily_RNaseH-like_dom	ENSG00000155657		0.478	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	38	0	T	NM_133378		179604931	-1	tier1	-	no_errors	ENST00000342175	ensembl	human	known	74_37	silent	32.00	17	8	SNP	1.000	C
TTN	7273	genome.wustl.edu	37	2	179621097	179621097	+	Intron	SNP	T	T	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr2:179621097T>G	ENST00000591111.1	-	44	10528				TTN_ENST00000342992.6_Intron|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000578746.1_RNA|TTN-AS1_ENST00000590773.1_RNA|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.E3702D|TTN_ENST00000342175.6_Missense_Mutation_p.E3531D|TTN_ENST00000360870.5_Intron|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTCTCTCGGATTCCTCTATCT	0.398																																																	0													112.0	107.0	108.0					2																	179621097		1885	4119	6004	SO:0001627	intron_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10303+2613A>C	2.37:g.179621097T>G			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.E3531D	ENST00000591111.1	37	c.10593		2	.	.	.	.	.	.	.	.	.	.	T	13.43	2.235289	0.39498	.	.	ENSG00000155657	ENST00000342175	T	0.68624	-0.34	6.16	0.749	0.18381	.	.	.	.	.	T	0.49881	0.1583	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.42649	-0.9439	8	0.87932	D	0	.	1.8071	0.03083	0.117:0.1612:0.2604:0.4614	.	3531	E7ET18	.	D	3531	ENSP00000340554:E3531D	ENSP00000340554:E3531D	E	-	3	2	TTN	179329342	0.990000	0.36364	0.366000	0.25914	0.949000	0.60115	1.110000	0.31147	-0.089000	0.12484	0.528000	0.53228	GAA	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	ENSG00000155657		0.398	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	52	0	T	NM_133378		179621097	-1	tier1	-	no_errors	ENST00000342175	ensembl	human	known	74_37	missense	45.83	26	22	SNP	0.950	G
TTN	7273	genome.wustl.edu	37	2	179480173	179480173	+	Nonsense_Mutation	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr2:179480173G>A	ENST00000591111.1	-	209	43800	c.43576C>T	c.(43576-43578)Cga>Tga	p.R14526*	TTN_ENST00000342992.6_Nonsense_Mutation_p.R13599*|TTN_ENST00000359218.5_Nonsense_Mutation_p.R7227*|TTN-AS1_ENST00000589234.1_RNA|RP11-171I2.4_ENST00000605334.1_lincRNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000460472.2_Nonsense_Mutation_p.R7102*|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000589042.1_Nonsense_Mutation_p.R16167*|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000342175.6_Nonsense_Mutation_p.R7294*|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	14526	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGGCTGTTCGATCTCTCCAT	0.433																																																	0													217.0	218.0	217.0					2																	179480173		1981	4156	6137	SO:0001587	stop_gained	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.43576C>T	2.37:g.179480173G>A	ENSP00000465570:p.Arg14526*		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.R13599*	ENST00000591111.1	37	c.40795		2	.	.	.	.	.	.	.	.	.	.	G	59	35.671649	0.99983	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	.	.	.	5.76	3.88	0.44766	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	14.6153	0.68544	0.0:0.0:0.7262:0.2738	.	.	.	.	X	13599;7102;7294;7227;7102	.	ENSP00000340554:R7294X	R	-	1	2	TTN	179188418	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.646000	0.46630	0.702000	0.31825	0.655000	0.94253	CGA	TTN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.433	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1		0.00	76	0	G	NM_133378		179480173	-1			no_errors	ENST00000342992	ensembl	human	known	74_37	nonsense	5.26	36	2	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179631332	179631332	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr2:179631332T>C	ENST00000591111.1	-	41	9703	c.9479A>G	c.(9478-9480)gAg>gGg	p.E3160G	TTN_ENST00000342992.6_Missense_Mutation_p.E3160G|TTN_ENST00000359218.5_Missense_Mutation_p.E3114G|TTN-AS1_ENST00000578746.1_RNA|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.E3114G|TTN_ENST00000589042.1_Missense_Mutation_p.E3160G|TTN_ENST00000342175.6_Missense_Mutation_p.E3114G|TTN_ENST00000360870.5_Missense_Mutation_p.E3160G|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13492					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACGCTGTTTCTCAATGACCTG	0.368																																																	0													86.0	77.0	80.0					2																	179631332		2203	4300	6503	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.9479A>G	2.37:g.179631332T>C	ENSP00000465570:p.Glu3160Gly		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.E3160G	ENST00000591111.1	37	c.9479		2	.	.	.	.	.	.	.	.	.	.	T	15.93	2.977005	0.53720	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.07216	3.21;3.21;3.21;3.21;3.21	5.7	5.7	0.88788	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.35307	0.0927	M	0.87971	2.92	0.38438	D	0.946613	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.998;0.998;0.998;0.998;0.999	T	0.42799	-0.9430	9	0.87932	D	0	.	15.9567	0.79893	0.0:0.0:0.0:1.0	.	3114;3114;3114;3160;3160	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	G	3160;3114;3114;3114;3114;3160	ENSP00000343764:E3160G;ENSP00000434586:E3114G;ENSP00000340554:E3114G;ENSP00000352154:E3114G;ENSP00000354117:E3160G	ENSP00000340554:E3114G	E	-	2	0	TTN	179339577	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.695000	0.84257	2.175000	0.68902	0.482000	0.46254	GAG	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub	ENSG00000155657		0.368	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	27	0	T	NM_133378		179631332	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	62.50	6	10	SNP	1.000	C
UBQLN3	50613	genome.wustl.edu	37	11	5529456	5529456	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr11:5529456C>G	ENST00000311659.4	-	2	1480	c.1333G>C	c.(1333-1335)Gtc>Ctc	p.V445L	HBG2_ENST00000380252.1_5'Flank|HBG2_ENST00000380259.2_Intron|AC104389.28_ENST00000415970.1_RNA|HBE1_ENST00000380237.1_5'Flank	NM_017481.2	NP_059509.1	Q9H347	UBQL3_HUMAN	ubiquilin 3	445										NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|prostate(1)|skin(2)	39		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGCCCCGAGACAAGATCAGGC	0.537																																					Ovarian(72;684 1260 12332 41642 52180)												0													92.0	98.0	96.0					11																	5529456		2201	4297	6498	SO:0001583	missense	0			AF230481	CCDS7758.1	11p15	2013-02-12			ENSG00000175520	ENSG00000175520		"""Ubiquilin family"""	12510	protein-coding gene	gene with protein product		605473				10831842	Standard	NM_017481		Approved	TUP-1	uc001may.1	Q9H347	OTTHUMG00000066886	ENST00000311659.4:c.1333G>C	11.37:g.5529456C>G	ENSP00000347997:p.Val445Leu		Q9NRE0	Missense_Mutation	SNP	pfam_Ubiquitin_dom,pfam_Rad60/SUMO_like,pfam_UBA/Ts_N,superfamily_UBA-like,superfamily_ARM-type_fold,smart_Ubiquitin_dom,smart_STI1_HS-bd,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Ubiquitin_supergroup	p.V445L	ENST00000311659.4	37	c.1333	CCDS7758.1	11	.	.	.	.	.	.	.	.	.	.	C	11.93	1.786569	0.31593	.	.	ENSG00000175520	ENST00000311659	T	0.36340	1.26	5.04	3.09	0.35607	.	0.735006	0.11159	N	0.593265	T	0.30916	0.0780	L	0.52759	1.655	0.21697	N	0.99959	B	0.14012	0.009	B	0.10450	0.005	T	0.25984	-1.0116	10	0.45353	T	0.12	-4.1472	6.002	0.19525	0.0:0.7019:0.1933:0.1048	.	445	Q9H347	UBQL3_HUMAN	L	445	ENSP00000347997:V445L	ENSP00000347997:V445L	V	-	1	0	UBQLN3	5486032	0.954000	0.32549	0.997000	0.53966	0.991000	0.79684	0.068000	0.14531	0.637000	0.30526	0.655000	0.94253	GTC	UBQLN3	-	NULL	ENSG00000175520		0.537	UBQLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBQLN3	HGNC	protein_coding	OTTHUMT00000143348.1	-	0.00	113	0	C	NM_017481		5529456	-1	tier1	-	no_errors	ENST00000311659	ensembl	human	known	74_37	missense	35.05	63	34	SNP	0.999	G
UBR4	23352	genome.wustl.edu	37	1	19501494	19501494	+	Missense_Mutation	SNP	A	A	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:19501494A>G	ENST00000375254.3	-	21	2834	c.2807T>C	c.(2806-2808)cTg>cCg	p.L936P	UBR4_ENST00000375217.2_Missense_Mutation_p.L936P|UBR4_ENST00000375226.2_Missense_Mutation_p.L936P|UBR4_ENST00000375267.2_Missense_Mutation_p.L936P	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	936					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		TTCTGGGGACAGGACACAGTA	0.408																																																	0													100.0	94.0	96.0					1																	19501494		2203	4300	6503	SO:0001583	missense	0			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.2807T>C	1.37:g.19501494A>G	ENSP00000364403:p.Leu936Pro		A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.L936P	ENST00000375254.3	37	c.2807	CCDS189.1	1	.	.	.	.	.	.	.	.	.	.	A	23.0	4.361960	0.82353	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000419533	T;T;T;T	0.24350	1.87;1.87;1.86;1.86	5.96	5.96	0.96718	.	0.000000	0.64402	D	0.000002	T	0.31389	0.0795	N	0.08118	0	0.80722	D	1	D	0.65815	0.995	D	0.72982	0.979	T	0.33548	-0.9864	10	0.38643	T	0.18	.	16.1061	0.81223	1.0:0.0:0.0:0.0	.	936	Q5T4S7	UBR4_HUMAN	P	936;936;936;936;152	ENSP00000364403:L936P;ENSP00000364416:L936P;ENSP00000364365:L936P;ENSP00000364374:L936P	ENSP00000364365:L936P	L	-	2	0	UBR4	19374081	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.850000	0.92190	2.284000	0.76573	0.528000	0.53228	CTG	UBR4	-	NULL	ENSG00000127481		0.408	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR4	HGNC	protein_coding	OTTHUMT00000007085.1	-	0.00	71	0	A	NM_020765		19501494	-1	tier1	-	no_errors	ENST00000375267	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	G
UNC45B	146862	genome.wustl.edu	37	17	33504597	33504597	+	Silent	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr17:33504597C>T	ENST00000268876.5	+	17	2326	c.2229C>T	c.(2227-2229)ctC>ctT	p.L743L	UNC45B_ENST00000433649.1_Silent_p.L741L|UNC45B_ENST00000378449.1_Silent_p.L662L|UNC45B_ENST00000394570.2_Silent_p.L741L|UNC45B_ENST00000591048.1_Silent_p.L662L	NM_173167.2	NP_775259.1	Q8IWX7	UN45B_HUMAN	unc-45 homolog B (C. elegans)	743					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(10)|lung(24)|ovary(3)|prostate(2)|skin(1)|stomach(1)|urinary_tract(3)	59		Ovarian(249;0.17)				TCCTAGGCCTCACCAACCTGT	0.542																																																	0													41.0	31.0	34.0					17																	33504597		2197	4285	6482	SO:0001819	synonymous_variant	0			AW755253	CCDS11292.1, CCDS45648.1	17q12	2008-02-05	2005-11-17	2005-11-17	ENSG00000141161	ENSG00000141161			14304	protein-coding gene	gene with protein product		611220	"""cardiomyopathy associated 4"""	CMYA4		12356907	Standard	NM_001267052		Approved	UNC45	uc002hja.3	Q8IWX7	OTTHUMG00000132931	ENST00000268876.5:c.2229C>T	17.37:g.33504597C>T			Q495Q8|Q495Q9	Silent	SNP	pfam_UNC-45/Ring3,superfamily_ARM-type_fold,smart_TPR_repeat,smart_Armadillo,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.L743	ENST00000268876.5	37	c.2229	CCDS11292.1	17																																																																																			UNC45B	-	superfamily_ARM-type_fold	ENSG00000141161		0.542	UNC45B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UNC45B	HGNC	protein_coding	OTTHUMT00000256458.2	-	0.00	65	0	C	NM_173167		33504597	+1	tier1	-	no_errors	ENST00000268876	ensembl	human	known	74_37	silent	22.81	44	13	SNP	1.000	T
URGCP	55665	genome.wustl.edu	37	7	43916873	43916873	+	Missense_Mutation	SNP	A	A	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr7:43916873A>C	ENST00000453200.1	-	6	2682	c.2189T>G	c.(2188-2190)aTg>aGg	p.M730R	URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000443736.1_Missense_Mutation_p.M687R|URGCP_ENST00000223341.7_Missense_Mutation_p.M687R|URGCP_ENST00000402306.3_Missense_Mutation_p.M721R|URGCP_ENST00000336086.6_Missense_Mutation_p.M687R|URGCP_ENST00000447717.3_Missense_Mutation_p.M687R			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	730	VLIG-type G.				cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GATGAGCTGCATGAAGGCCCC	0.622																																																	0													43.0	46.0	45.0					7																	43916873		2085	4216	6301	SO:0001583	missense	0				CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.2189T>G	7.37:g.43916873A>C	ENSP00000396918:p.Met730Arg		E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Missense_Mutation	SNP	superfamily_P-loop_NTPase,prints_GTP_binding_domain	p.M730R	ENST00000453200.1	37	c.2189	CCDS47578.1	7	.	.	.	.	.	.	.	.	.	.	A	16.98	3.270516	0.59540	.	.	ENSG00000106608	ENST00000223341;ENST00000336086;ENST00000402306;ENST00000443736;ENST00000453200;ENST00000447717	T;T;T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09;-0.09;-0.09	5.51	5.51	0.81932	.	0.090855	0.85682	D	0.000000	T	0.77418	0.4127	M	0.81341	2.54	0.41527	D	0.98843	D;D	0.65815	0.995;0.995	P;P	0.61201	0.885;0.885	T	0.81482	-0.0913	10	0.87932	D	0	-57.1717	13.5411	0.61674	1.0:0.0:0.0:0.0	.	721;730	Q8TCY9-2;Q8TCY9	.;URGCP_HUMAN	R	687;687;721;687;730;687	ENSP00000223341:M687R;ENSP00000336872:M687R;ENSP00000384955:M721R;ENSP00000392136:M687R;ENSP00000396918:M730R;ENSP00000402803:M687R	ENSP00000223341:M687R	M	-	2	0	URGCP	43883398	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.076000	0.94009	2.089000	0.63090	0.482000	0.46254	ATG	URGCP	-	superfamily_P-loop_NTPase	ENSG00000106608		0.622	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	URGCP	HGNC	protein_coding	OTTHUMT00000338995.1		0.00	22	0	A	NM_001077664		43916873	-1			no_errors	ENST00000453200	ensembl	human	known	74_37	missense	7.14	39	3	SNP	1.000	C
USP24	23358	genome.wustl.edu	37	1	55622627	55622627	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:55622627C>G	ENST00000294383.6	-	12	1439	c.1440G>C	c.(1438-1440)aaG>aaC	p.K480N	USP24_ENST00000407756.1_Missense_Mutation_p.K368N	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	480					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						CTACCTGTATCTTCCAAATTT	0.383																																																	0													160.0	155.0	156.0					1																	55622627		1842	4103	5945	SO:0001583	missense	0			AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.1440G>C	1.37:g.55622627C>G	ENSP00000294383:p.Lys480Asn		Q6ZSY2|Q8N2Y4|Q9NXD1	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,superfamily_UBA-like,superfamily_ARM-type_fold,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Peptidase_C19/C67	p.K368N	ENST00000294383.6	37	c.1104	CCDS44154.2	1	.	.	.	.	.	.	.	.	.	.	C	14.89	2.671230	0.47781	.	.	ENSG00000162402	ENST00000294383;ENST00000407756	T;T	0.77750	-1.12;-1.12	5.92	2.65	0.31530	.	0.134101	0.51477	D	0.000093	T	0.63663	0.2530	L	0.47716	1.5	0.40171	D	0.977176	B	0.26635	0.155	B	0.23018	0.043	T	0.52215	-0.8605	10	0.15066	T	0.55	.	5.4548	0.16584	0.0:0.4745:0.0:0.5255	.	368	B7WPF4	.	N	480;368	ENSP00000294383:K480N;ENSP00000385700:K368N	ENSP00000294383:K480N	K	-	3	2	USP24	55395215	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.069000	0.30641	0.817000	0.34445	0.650000	0.86243	AAG	USP24	-	NULL	ENSG00000162402		0.383	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	USP24	HGNC	protein_coding	OTTHUMT00000022275.2	-	0.00	122	0	C			55622627	-1	tier1	-	no_errors	ENST00000407756	ensembl	human	known	74_37	missense	18.07	68	15	SNP	1.000	G
UTP20	27340	genome.wustl.edu	37	12	101777388	101777388	+	Missense_Mutation	SNP	A	A	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr12:101777388A>T	ENST00000261637.4	+	60	8171	c.7997A>T	c.(7996-7998)tAt>tTt	p.Y2666F		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	2666					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						GTAAAGCCGTATCTCCCAATG	0.448																																																	0													166.0	143.0	151.0					12																	101777388		2203	4300	6503	SO:0001583	missense	0			AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.7997A>T	12.37:g.101777388A>T	ENSP00000261637:p.Tyr2666Phe		Q9H3H4	Missense_Mutation	SNP	pfam_DRIM,superfamily_ARM-type_fold	p.Y2666F	ENST00000261637.4	37	c.7997	CCDS9081.1	12	.	.	.	.	.	.	.	.	.	.	A	9.025	0.985911	0.18889	.	.	ENSG00000120800	ENST00000261637	T	0.04454	3.62	5.75	3.07	0.35406	.	0.060776	0.64402	D	0.000002	T	0.02970	0.0088	N	0.12182	0.205	0.46185	D	0.998915	B	0.16166	0.016	B	0.09377	0.004	T	0.50634	-0.8805	10	0.21014	T	0.42	-11.8307	11.2225	0.48864	0.6567:0.0:0.0:0.3432	.	2666	O75691	UTP20_HUMAN	F	2666	ENSP00000261637:Y2666F	ENSP00000261637:Y2666F	Y	+	2	0	UTP20	100301519	1.000000	0.71417	0.650000	0.29550	0.034000	0.12701	4.699000	0.61796	0.981000	0.38548	0.519000	0.50382	TAT	UTP20	-	NULL	ENSG00000120800		0.448	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP20	HGNC	protein_coding	OTTHUMT00000408242.1		0.00	77	0	A	NM_014503		101777388	+1			no_errors	ENST00000261637	ensembl	human	known	74_37	missense	6.67	56	4	SNP	0.987	T
UTY	7404	genome.wustl.edu	37	Y	15448174	15448174	+	Missense_Mutation	SNP	A	A	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chrY:15448174A>C	ENST00000331397.4	-	16	2819	c.1812T>G	c.(1810-1812)aaT>aaG	p.N604K	UTY_ENST00000537580.1_Missense_Mutation_p.N525K|UTY_ENST00000329134.5_Missense_Mutation_p.N604K|UTY_ENST00000545955.1_Missense_Mutation_p.N679K|UTY_ENST00000382896.4_Missense_Mutation_p.N649K|UTY_ENST00000538878.1_Missense_Mutation_p.N571K|UTY_ENST00000540140.1_Missense_Mutation_p.N601K|UTY_ENST00000362096.4_Missense_Mutation_p.N604K	NM_001258267.1|NM_007125.4	NP_001245196.1|NP_009056.3	O14607	UTY_HUMAN	ubiquitously transcribed tetratricopeptide repeat containing, Y-linked	604					regulation of gene expression (GO:0010468)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)			kidney(1)|lung(6)	7						GTTGTTCTTCATTAGGTCCTG	0.383																																					Colon(103;1740 2135 40732 45171)												0													56.0	51.0	52.0					Y																	15448174		593	1932	2525	SO:0001583	missense	0			AF000994	CCDS14783.1, CCDS14784.1, CCDS14785.1, CCDS59184.1, CCDS76073.1, CCDS76074.1, CCDS76075.1, CCDS76076.1, CCDS76077.1, CCDS76078.1, CCDS76079.1	Yq11.221	2013-11-04	2012-11-15		ENSG00000183878	ENSG00000183878		"""Tetratricopeptide (TTC) repeat domain containing"""	12638	protein-coding gene	gene with protein product		400009	"""ubiquitously transcribed tetratricopeptide repeat gene, Y chromosome"", ""ubiquitously transcribed tetratricopeptide repeat gene, Y-linked"""			8944031, 9499428	Standard	NM_182659		Approved	KDM6AL	uc022ckf.2	O14607	OTTHUMG00000036319	ENST00000331397.4:c.1812T>G	Y.37:g.15448174A>C	ENSP00000328939:p.Asn604Lys		A8K9Z3|E1U199|E1U1A0|F5H4V7|F8W8R7|O14608	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_TPR_1,smart_TPR_repeat,smart_JmjC_dom,pfscan_JmjC_dom,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.N649K	ENST00000331397.4	37	c.1947	CCDS14783.1	Y																																																																																			UTY	-	NULL	ENSG00000183878		0.383	UTY-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UTY	HGNC	protein_coding	OTTHUMT00000088394.1	-	0.00	65	0	A	NM_182660		15448174	-1	tier1	-	no_errors	ENST00000382896	ensembl	human	known	74_37	missense	31.58	39	18	SNP	1.000	C
VANGL1	81839	genome.wustl.edu	37	1	116206711	116206711	+	Missense_Mutation	SNP	C	C	T	rs568821247		TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:116206711C>T	ENST00000355485.2	+	4	905	c.634C>T	c.(634-636)Cgg>Tgg	p.R212W	VANGL1_ENST00000369510.4_Missense_Mutation_p.R210W|VANGL1_ENST00000310260.3_Missense_Mutation_p.R212W|VANGL1_ENST00000369509.1_Missense_Mutation_p.R212W	NM_001172411.1|NM_138959.2	NP_001165882.1|NP_620409.1	Q8TAA9	VANG1_HUMAN	VANGL planar cell polarity protein 1	212					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)		p.R212W(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|liver(2)|lung(13)|urinary_tract(1)	27	Lung SC(450;0.211)	all_cancers(81;1.24e-06)|all_epithelial(167;1.02e-06)|all_lung(203;7.95e-06)|Lung NSC(69;4.97e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		TTTGGACTCTCGGGACCGGAA	0.517													C|||	1	0.000199681	0.0	0.0	5008	,	,		18907	0.0		0.001	False		,,,				2504	0.0																1	Substitution - Missense(1)	central_nervous_system(1)											194.0	197.0	196.0					1																	116206711		2203	4300	6503	SO:0001583	missense	0			AB075805	CCDS883.1, CCDS53350.1	1p13.1	2013-03-05	2013-03-05		ENSG00000173218	ENSG00000173218			15512	protein-coding gene	gene with protein product		610132	"""vang (van gogh, Drosophila)-like 1, vang, van gogh-like 1 (Drosophila)"", ""vang-like 1 (van gogh, Drosophila)"""			11956595, 12011995	Standard	NM_001172411		Approved	STB2	uc001efv.1	Q8TAA9	OTTHUMG00000011971	ENST00000355485.2:c.634C>T	1.37:g.116206711C>T	ENSP00000347672:p.Arg212Trp		Q5T1D3|Q5T1D4|Q86WG8|Q8N559	Missense_Mutation	SNP	pfam_Strabismus,pirsf_Strabismus	p.R212W	ENST00000355485.2	37	c.634	CCDS883.1	1	.	.	.	.	.	.	.	.	.	.	C	18.39	3.614462	0.66672	.	.	ENSG00000173218	ENST00000355485;ENST00000369510;ENST00000310260;ENST00000369509	D;D;D;D	0.82433	-1.61;-1.61;-1.61;-1.61	5.73	3.78	0.43462	.	0.120688	0.64402	D	0.000018	D	0.83783	0.5329	M	0.72894	2.215	0.38207	D	0.940342	D;D	0.65815	0.994;0.995	P;P	0.57283	0.721;0.817	D	0.86224	0.1633	10	0.87932	D	0	2.8345	10.9374	0.47253	0.175:0.7496:0.0:0.0754	.	210;212	Q8TAA9-2;Q8TAA9	.;VANG1_HUMAN	W	212;210;212;212	ENSP00000347672:R212W;ENSP00000358523:R210W;ENSP00000310800:R212W;ENSP00000358522:R212W	ENSP00000310800:R212W	R	+	1	2	VANGL1	116008234	0.993000	0.37304	0.956000	0.39512	0.954000	0.61252	3.124000	0.50461	1.582000	0.49881	-0.142000	0.14014	CGG	VANGL1	-	pfam_Strabismus,pirsf_Strabismus	ENSG00000173218		0.517	VANGL1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VANGL1	HGNC	protein_coding	OTTHUMT00000033096.1	-	0.00	89	0	C			116206711	+1	tier1	-	no_errors	ENST00000310260	ensembl	human	known	74_37	missense	17.24	72	15	SNP	0.731	T
VEPH1	79674	genome.wustl.edu	37	3	156983327	156983327	+	Missense_Mutation	SNP	T	T	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr3:156983327T>A	ENST00000362010.2	-	13	2560	c.2253A>T	c.(2251-2253)caA>caT	p.Q751H	VEPH1_ENST00000392833.2_Missense_Mutation_p.Q706H|RP11-550I24.2_ENST00000488040.1_RNA|RP11-550I24.2_ENST00000487238.1_RNA|VEPH1_ENST00000392832.2_Missense_Mutation_p.Q751H|VEPH1_ENST00000543418.1_Missense_Mutation_p.Q706H|RP11-550I24.2_ENST00000475102.1_RNA	NM_001167912.1	NP_001161384.1	Q14D04	MELT_HUMAN	ventricular zone expressed PH domain-containing 1	751	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.					plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|cervix(1)|kidney(3)|large_intestine(9)|lung(22)|ovary(1)|pancreas(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			ACTTTCCTTTTTGAAACAGAA	0.358																																																	0													140.0	135.0	137.0					3																	156983327		2203	4300	6503	SO:0001583	missense	0			AL713656	CCDS3179.1, CCDS54661.1, CCDS54662.1, CCDS54663.1	3q24-q25	2013-01-10	2012-12-10		ENSG00000197415	ENSG00000197415		"""Pleckstrin homology (PH) domain containing"""	25735	protein-coding gene	gene with protein product		609594	"""ventricular zone expressed PH domain homolog 1 (zebrafish)"""			11214970, 15388229	Standard	NM_024621		Approved	FLJ12604, KIAA1692	uc003fbk.2	Q14D04	OTTHUMG00000158711	ENST00000362010.2:c.2253A>T	3.37:g.156983327T>A	ENSP00000354919:p.Gln751His		D3DNL0|F5GZ91|Q2TAA9|Q3MIX2|Q6PEL3|Q86TL5|Q8TCR3|Q96SP7|Q9C0H1|Q9H9Q7	Missense_Mutation	SNP	pfam_Pleckstrin_homology,superfamily_ARM-type_fold,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.Q751H	ENST00000362010.2	37	c.2253	CCDS3179.1	3	.	.	.	.	.	.	.	.	.	.	T	18.44	3.623662	0.66901	.	.	ENSG00000197415	ENST00000392833;ENST00000362010;ENST00000543418;ENST00000392832	T;T;T;T	0.75154	-0.91;-0.91;-0.91;-0.91	5.55	-4.18	0.03846	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.053986	0.64402	D	0.000001	T	0.64571	0.2610	N	0.24115	0.695	0.80722	D	1	D;D	0.55800	0.966;0.973	P;P	0.57776	0.631;0.827	T	0.62751	-0.6788	10	0.32370	T	0.25	-2.8199	7.0072	0.24844	0.095:0.5333:0.2009:0.1708	.	706;751	Q14D04-2;Q14D04	.;MELT_HUMAN	H	706;751;706;751	ENSP00000376578:Q706H;ENSP00000354919:Q751H;ENSP00000446258:Q706H;ENSP00000376577:Q751H	ENSP00000354919:Q751H	Q	-	3	2	VEPH1	158466021	0.873000	0.30073	0.991000	0.47740	0.961000	0.63080	-0.189000	0.09629	-0.379000	0.07906	-0.256000	0.11100	CAA	VEPH1	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000197415		0.358	VEPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VEPH1	HGNC	protein_coding	OTTHUMT00000351845.3	-	0.00	112	0	T	NM_024621		156983327	-1	tier1	-	no_errors	ENST00000362010	ensembl	human	known	74_37	missense	5.56	68	4	SNP	0.590	A
VPS13D	55187	genome.wustl.edu	37	1	12409301	12409301	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr1:12409301C>T	ENST00000358136.3	+	46	9431	c.9301C>T	c.(9301-9303)Cgg>Tgg	p.R3101W	VPS13D_ENST00000356315.4_Missense_Mutation_p.R3076W	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		GCTACAGGCCCGGCCCAAAGG	0.498																																																	0													133.0	134.0	133.0					1																	12409301		2203	4300	6503	SO:0001583	missense	0			AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.9301C>T	1.37:g.12409301C>T	ENSP00000350854:p.Arg3101Trp			Missense_Mutation	SNP	pfam_VPSAP_dom,pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.R3101W	ENST00000358136.3	37	c.9301	CCDS30588.1	1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.292256	0.80914	.	.	ENSG00000048707	ENST00000356315;ENST00000358136	T;T	0.61274	0.16;0.12	5.88	3.86	0.44501	.	0.000000	0.85682	D	0.000000	T	0.71195	0.3311	L	0.55481	1.735	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.989	T	0.75662	-0.3240	10	0.87932	D	0	.	15.587	0.76491	0.3126:0.6874:0.0:0.0	.	3076;3100	Q5THJ4-2;Q5THJ4	.;VP13D_HUMAN	W	3076;3101	ENSP00000348666:R3076W;ENSP00000350854:R3101W	ENSP00000348666:R3076W	R	+	1	2	VPS13D	12331888	0.993000	0.37304	0.999000	0.59377	0.996000	0.88848	0.980000	0.29513	1.473000	0.48159	0.655000	0.94253	CGG	VPS13D	-	NULL	ENSG00000048707		0.498	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13D	HGNC	protein_coding	OTTHUMT00000036897.2	-	0.00	49	0	C	NM_015378		12409301	+1	tier1	-	no_errors	ENST00000358136	ensembl	human	known	74_37	missense	10.00	27	3	SNP	0.990	T
VPS41	27072	genome.wustl.edu	37	7	38857431	38857431	+	Missense_Mutation	SNP	T	T	G	rs35693565	byFrequency	TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr7:38857431T>G	ENST00000310301.4	-	7	490	c.436A>C	c.(436-438)Acc>Ccc	p.T146P	VPS41_ENST00000395969.2_Missense_Mutation_p.T121P	NM_014396.3	NP_055211.2	P49754	VPS41_HUMAN	vacuolar protein sorting 41 homolog (S. cerevisiae)	146			T -> P (in dbSNP:rs35693565).		Golgi vesicle transport (GO:0048193)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	cytosol (GO:0005829)|early endosome (GO:0005769)|Golgi-associated vesicle (GO:0005798)|HOPS complex (GO:0030897)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(5)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	44						TTCCCTCCGGTCACAAACTGC	0.438																																																	0													213.0	179.0	191.0					7																	38857431		2203	4300	6503	SO:0001583	missense	0			U87309	CCDS5457.1, CCDS5458.2	7p14.1-p13	2009-05-08	2006-12-19		ENSG00000006715	ENSG00000006715			12713	protein-coding gene	gene with protein product		605485	"""vacuolar protein sorting 41 (yeast homolog)"", ""vacuolar protein sorting 41 (yeast)"""			9159129	Standard	NM_080631		Approved	HVSP41	uc003tgy.3	P49754	OTTHUMG00000023629	ENST00000310301.4:c.436A>C	7.37:g.38857431T>G	ENSP00000309457:p.Thr146Pro		E9PF36|Q86TP8|Q99851|Q99852	Missense_Mutation	SNP	pfam_Clathrin_H-chain/VPS_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Clathrin_H-chain/VPS_repeat,pirsf_VPS41,pfscan_Znf_RING	p.T146P	ENST00000310301.4	37	c.436	CCDS5457.1	7	.	.	.	.	.	.	.	.	.	.	T	19.83	3.899643	0.72754	.	.	ENSG00000006715	ENST00000310301;ENST00000395969;ENST00000413141;ENST00000414632;ENST00000418457	T;T;T;T;T	0.59638	0.25;0.25;0.25;0.25;0.25	5.01	5.01	0.66863	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.74935	0.3782	M	0.83483	2.645	0.53688	D	0.999975	D;D;D	0.71674	0.998;0.998;0.998	D;D;D	0.63488	0.915;0.915;0.915	T	0.78720	-0.2094	10	0.56958	D	0.05	-16.6352	13.2953	0.60294	0.0:0.0:0.0:1.0	rs35693565	146;121;146	B2RB94;E9PF36;P49754	.;.;VPS41_HUMAN	P	146;121;72;133;96	ENSP00000309457:T146P;ENSP00000379297:T121P;ENSP00000412974:T72P;ENSP00000411919:T133P;ENSP00000407835:T96P	ENSP00000265745:T146P	T	-	1	0	VPS41	38823956	1.000000	0.71417	0.991000	0.47740	0.907000	0.53573	6.048000	0.71046	1.880000	0.54463	0.377000	0.23210	ACC	VPS41	-	superfamily_WD40_repeat_dom,pirsf_VPS41	ENSG00000006715		0.438	VPS41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS41	HGNC	protein_coding	OTTHUMT00000226986.3	-	0.00	58	0	T			38857431	-1	tier1	rs35693565	no_errors	ENST00000310301	ensembl	human	known	74_37	missense	13.79	75	12	SNP	1.000	G
VPS37D	155382	genome.wustl.edu	37	7	73085444	73085444	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr7:73085444C>T	ENST00000324941.4	+	4	628	c.494C>T	c.(493-495)gCa>gTa	p.A165V	VPS37D_ENST00000451519.1_Missense_Mutation_p.A80V	NM_001077621.1	NP_001071089.1			vacuolar protein sorting 37 homolog D (S. cerevisiae)											central_nervous_system(1)|ovary(1)	2		Lung NSC(55;0.0908)|all_lung(88;0.198)				CGGACGCAGGCAGAGAAGCTG	0.701																																																	0													10.0	12.0	11.0					7																	73085444		1894	3981	5875	SO:0001583	missense	0			AY081952	CCDS43596.1	7q11.23	2007-07-27	2006-04-04	2005-08-18	ENSG00000176428	ENSG00000176428			18287	protein-coding gene	gene with protein product		610039	"""Williams Beuren syndrome chromosome region 24"", ""vacuolar protein sorting 37D (yeast)"""	WBSCR24		15218037	Standard	NM_001077621		Approved	MGC35352	uc003tyr.3	Q86XT2	OTTHUMG00000157227	ENST00000324941.4:c.494C>T	7.37:g.73085444C>T	ENSP00000320416:p.Ala165Val			Missense_Mutation	SNP	pfam_Mod_r	p.A165V	ENST00000324941.4	37	c.494	CCDS43596.1	7	.	.	.	.	.	.	.	.	.	.	C	14.86	2.660926	0.47572	.	.	ENSG00000176428	ENST00000324941;ENST00000451519	T;T	0.76839	-1.05;-1.05	4.12	3.23	0.37069	Modifier of rudimentary, Modr (2);	0.083392	0.45606	N	0.000355	T	0.55909	0.1950	N	0.20357	0.565	0.39674	D	0.970793	B	0.25563	0.129	B	0.26614	0.071	T	0.49899	-0.8890	10	0.02654	T	1	.	7.4025	0.26973	0.0:0.8788:0.0:0.1212	.	165	Q86XT2	VP37D_HUMAN	V	165;80	ENSP00000320416:A165V;ENSP00000413337:A80V	ENSP00000320416:A165V	A	+	2	0	VPS37D	72723380	0.995000	0.38212	0.779000	0.31741	0.967000	0.64934	3.607000	0.54102	0.930000	0.37217	0.561000	0.74099	GCA	VPS37D	-	pfam_Mod_r	ENSG00000176428		0.701	VPS37D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS37D	HGNC	protein_coding	OTTHUMT00000348064.1		0.00	16	0	C	NM_152560		73085444	+1			no_errors	ENST00000324941	ensembl	human	known	74_37	missense	23.53	13	4	SNP	0.785	T
XKR4	114786	genome.wustl.edu	37	8	56436043	56436043	+	Missense_Mutation	SNP	T	T	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr8:56436043T>G	ENST00000327381.6	+	3	1310	c.1210T>G	c.(1210-1212)Ttc>Gtc	p.F404V	RP11-628E19.2_ENST00000522918.1_RNA	NM_052898.1	NP_443130.1	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related family, member 4	404						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34			Epithelial(17;0.000117)|all cancers(17;0.000836)			CTTTGGGATCTTCATCGTCCT	0.512																																																	0													341.0	272.0	295.0					8																	56436043		2203	4300	6503	SO:0001583	missense	0			AY534241	CCDS34893.1	8q12.1	2006-01-12	2006-01-12		ENSG00000206579	ENSG00000206579			29394	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 4"""				Standard	NM_052898		Approved	KIAA1889	uc003xsf.3	Q5GH76	OTTHUMG00000164288	ENST00000327381.6:c.1210T>G	8.37:g.56436043T>G	ENSP00000328326:p.Phe404Val		Q96PZ8	Missense_Mutation	SNP	pfam_Transport_prot_XK	p.F404V	ENST00000327381.6	37	c.1210	CCDS34893.1	8	.	.	.	.	.	.	.	.	.	.	T	19.38	3.816072	0.70912	.	.	ENSG00000206579	ENST00000327381;ENST00000543752	T	0.60672	0.17	5.71	5.71	0.89125	.	0.046062	0.85682	N	0.000000	T	0.62270	0.2414	N	0.25031	0.7	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.57642	-0.7776	10	0.15952	T	0.53	-11.8441	15.9804	0.80105	0.0:0.0:0.0:1.0	.	404	Q5GH76	XKR4_HUMAN	V	404	ENSP00000328326:F404V	ENSP00000328326:F404V	F	+	1	0	XKR4	56598597	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.040000	0.89188	2.176000	0.68965	0.455000	0.32223	TTC	XKR4	-	pfam_Transport_prot_XK	ENSG00000206579		0.512	XKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XKR4	HGNC	protein_coding	OTTHUMT00000378129.2	-	0.00	76	0	T	NM_052898		56436043	+1	tier1	-	no_errors	ENST00000327381	ensembl	human	known	74_37	missense	28.57	35	14	SNP	1.000	G
XRN1	54464	genome.wustl.edu	37	3	142066091	142066091	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr3:142066091C>A	ENST00000264951.4	-	33	3979	c.3862G>T	c.(3862-3864)Gac>Tac	p.D1288Y	XRN1_ENST00000392981.2_Missense_Mutation_p.D1288Y	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	1288					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						CTGTGAGGGTCATGTTTTCTT	0.299																																																	0													138.0	148.0	145.0					3																	142066091		2201	4292	6493	SO:0001583	missense	0			AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.3862G>T	3.37:g.142066091C>A	ENSP00000264951:p.Asp1288Tyr		Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Missense_Mutation	SNP	pfam_Put_53exo,pirsf_5_3_exoribonuclease_1	p.D1288Y	ENST00000264951.4	37	c.3862	CCDS3123.1	3	.	.	.	.	.	.	.	.	.	.	C	17.85	3.489215	0.64074	.	.	ENSG00000114127	ENST00000264951;ENST00000392981	T;T	0.31247	1.5;1.5	4.57	4.57	0.56435	.	0.374787	0.28630	N	0.014662	T	0.31482	0.0798	L	0.27053	0.805	0.80722	D	1	P;B	0.41265	0.744;0.057	P;B	0.46479	0.518;0.073	T	0.14090	-1.0485	10	0.59425	D	0.04	-5.9451	15.8858	0.79247	0.0:1.0:0.0:0.0	.	1288;1288	Q8IZH2-2;Q8IZH2	.;XRN1_HUMAN	Y	1288	ENSP00000264951:D1288Y;ENSP00000376707:D1288Y	ENSP00000264951:D1288Y	D	-	1	0	XRN1	143548781	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.883000	0.63128	2.244000	0.73946	0.563000	0.77884	GAC	XRN1	-	pirsf_5_3_exoribonuclease_1	ENSG00000114127		0.299	XRN1-001	KNOWN	basic|CCDS	protein_coding	XRN1	HGNC	protein_coding	OTTHUMT00000354087.2	-	0.00	86	0	C	NM_019001		142066091	-1	tier1	-	no_errors	ENST00000264951	ensembl	human	known	74_37	missense	33.33	30	15	SNP	1.000	A
ZBTB25	7597	genome.wustl.edu	37	14	64957175	64957175	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr14:64957175C>T	ENST00000608382.1	-	2	268	c.77G>A	c.(76-78)tGc>tAc	p.C26Y	ZBTB25_ENST00000555424.1_Missense_Mutation_p.C26Y|ZBTB25_ENST00000394715.1_Missense_Mutation_p.C26Y|ZBTB25_ENST00000555220.1_Missense_Mutation_p.C26Y	NM_006977.2	NP_008908.2	P24278	ZBT25_HUMAN	zinc finger and BTB domain containing 25	26	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				gene expression (GO:0010467)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(2)|skin(2)	10				all cancers(60;0.00865)|OV - Ovarian serous cystadenocarcinoma(108;0.0102)|BRCA - Breast invasive adenocarcinoma(234;0.0469)		TGCAACTGTGCAATCACACAG	0.413																																																	0													119.0	117.0	118.0					14																	64957175		2203	4300	6503	SO:0001583	missense	0			X16576	CCDS9765.1	14q23-q24	2013-01-08	2005-05-22	2005-05-22	ENSG00000089775	ENSG00000089775		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13112	protein-coding gene	gene with protein product		194541	"""zinc finger protein 46 (KUP)"", ""chromosome 14 open reading frame 51"""	ZNF46, C14orf51			Standard	NM_006977		Approved	KUP	uc001xhf.3	P24278	OTTHUMG00000141310	ENST00000608382.1:c.77G>A	14.37:g.64957175C>T	ENSP00000476746:p.Cys26Tyr		B3KUX6|Q8IYH9	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.C26Y	ENST00000608382.1	37	c.77	CCDS9765.1	14	.	.	.	.	.	.	.	.	.	.	C	25.9	4.682747	0.88542	.	.	ENSG00000089775	ENST00000555220;ENST00000555424;ENST00000261683;ENST00000394715	T;T;T;T	0.71222	-0.55;-0.28;-0.28;-0.28	5.39	5.39	0.77823	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.039844	0.85682	D	0.000000	D	0.86944	0.6055	M	0.87456	2.885	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.97110	1.0;0.996	D	0.88672	0.3196	10	0.87932	D	0	-12.6558	19.5016	0.95097	0.0:1.0:0.0:0.0	.	26;26	P24278;G3V2K3	ZBT25_HUMAN;.	Y	26	ENSP00000450718:C26Y;ENSP00000451046:C26Y;ENSP00000261683:C26Y;ENSP00000378204:C26Y	ENSP00000261683:C26Y	C	-	2	0	ZBTB25	64026928	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.703000	0.84585	2.693000	0.91896	0.313000	0.20887	TGC	ZBTB25	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	ENSG00000089775		0.413	ZBTB25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB25	HGNC	protein_coding	OTTHUMT00000280649.2		0.00	61	0	C	NM_006977		64957175	-1			no_errors	ENST00000394715	ensembl	human	known	74_37	missense	5.66	50	3	SNP	1.000	T
ZFHX4	79776	genome.wustl.edu	37	8	77763213	77763213	+	Missense_Mutation	SNP	A	A	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr8:77763213A>T	ENST00000521891.2	+	10	4504	c.4056A>T	c.(4054-4056)aaA>aaT	p.K1352N	ZFHX4_ENST00000050961.6_Missense_Mutation_p.K1307N|ZFHX4_ENST00000518282.1_Missense_Mutation_p.K1326N|ZFHX4_ENST00000455469.2_Missense_Mutation_p.K1307N	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	1307					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AACCGACTAAAGAACCCTTGG	0.408										HNSCC(33;0.089)																																							0													67.0	65.0	66.0					8																	77763213		1848	4088	5936	SO:0001583	missense	0				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.4056A>T	8.37:g.77763213A>T	ENSP00000430497:p.Lys1352Asn		G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.K1352N	ENST00000521891.2	37	c.4056	CCDS47878.2	8	.	.	.	.	.	.	.	.	.	.	A	11.82	1.753590	0.31046	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.52295	0.67;0.75;0.72;0.71	4.95	-0.044	0.13857	.	0.000000	0.46758	U	0.000263	T	0.62146	0.2404	M	0.73598	2.24	0.50467	D	0.99987	D;D;D	0.89917	0.998;1.0;0.999	D;D;D	0.85130	0.991;0.997;0.996	T	0.59490	-0.7445	10	0.40728	T	0.16	.	9.9123	0.41413	0.5512:0.0:0.4488:0.0	.	1307;1307;1352	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	N	1352;1352;1307;1307;1326	ENSP00000430497:K1352N;ENSP00000399605:K1307N;ENSP00000050961:K1307N;ENSP00000430848:K1326N	ENSP00000050961:K1307N	K	+	3	2	ZFHX4	77925768	1.000000	0.71417	0.758000	0.31321	0.878000	0.50629	0.692000	0.25482	0.085000	0.17107	0.454000	0.30748	AAA	ZFHX4	-	NULL	ENSG00000091656		0.408	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2	-	0.00	117	0	A	NM_024721		77763213	+1	tier1	-	no_errors	ENST00000521891	ensembl	human	known	74_37	missense	35.64	65	36	SNP	0.987	T
ZFP37	7539	genome.wustl.edu	37	9	115818904	115818904	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr9:115818904G>A	ENST00000374227.3	-	1	92	c.65C>T	c.(64-66)gCg>gTg	p.A22V	ZFP37_ENST00000555206.1_Missense_Mutation_p.A22V|ZFP37_ENST00000553380.1_Missense_Mutation_p.A22V	NM_001282515.1|NM_001282518.1	NP_001269444.1|NP_001269447.1	Q9Y6Q3	ZFP37_HUMAN	ZFP37 zinc finger protein	22					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	38						GGTCGTTTCCGCACTTCTCCT	0.662																																																	0													130.0	130.0	130.0					9																	115818904		2203	4300	6503	SO:0001583	missense	0			AF022158	CCDS6787.1, CCDS65109.1, CCDS65110.1	9q32	2013-01-08	2012-11-27		ENSG00000136866	ENSG00000136866		"""Zinc fingers, C2H2-type"", ""-"""	12863	protein-coding gene	gene with protein product		602951	"""zinc finger protein homologous to Zfp37 in mouse"", ""zinc finger protein 37 homolog (mouse)"""				Standard	NM_001282515		Approved	ZNF906	uc004bgm.1	Q9Y6Q3	OTTHUMG00000021019	ENST00000374227.3:c.65C>T	9.37:g.115818904G>A	ENSP00000363344:p.Ala22Val		A0AVJ9|B4DVX4|G3V3L7|Q5T7Q4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A22V	ENST00000374227.3	37	c.65	CCDS6787.1	9	.	.	.	.	.	.	.	.	.	.	g	18.86	3.712542	0.68730	.	.	ENSG00000136866	ENST00000374227;ENST00000555206;ENST00000553380	T;T;T	0.06687	3.37;3.27;3.51	3.29	1.34	0.21922	.	.	.	.	.	T	0.03827	0.0108	N	0.08118	0	0.09310	N	1	B;B;B	0.15141	0.012;0.012;0.007	B;B;B	0.06405	0.002;0.002;0.001	T	0.43556	-0.9384	9	0.31617	T	0.26	.	4.77	0.13151	0.1247:0.2205:0.6548:0.0	.	22;22;22	G3V3L7;Q9Y6Q3-2;Q9Y6Q3	.;.;ZFP37_HUMAN	V	22	ENSP00000363344:A22V;ENSP00000451310:A22V;ENSP00000452552:A22V	ENSP00000363344:A22V	A	-	2	0	ZFP37	114858725	0.002000	0.14202	0.000000	0.03702	0.066000	0.16364	1.177000	0.31969	0.364000	0.24374	0.558000	0.71614	GCG	ZFP37	-	NULL	ENSG00000136866		0.662	ZFP37-001	KNOWN	basic|CCDS	protein_coding	ZFP37	HGNC	protein_coding	OTTHUMT00000055439.1	-	0.00	56	0	G	NM_003408		115818904	-1	tier1	-	no_errors	ENST00000553380	ensembl	human	known	74_37	missense	31.58	26	12	SNP	0.000	A
ZKSCAN8	7745	genome.wustl.edu	37	6	28121231	28121231	+	Silent	SNP	A	A	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr6:28121231A>T	ENST00000330236.6	+	6	1357	c.1173A>T	c.(1171-1173)acA>acT	p.T391T	ZKSCAN8_ENST00000457389.2_Silent_p.T391T	NM_001278119.1|NM_001278121.1|NM_001278122.1|NM_006298.2	NP_001265048.1|NP_001265050.1|NP_001265051.1|NP_006289.2	Q15776	ZKSC8_HUMAN	zinc finger with KRAB and SCAN domains 8	391					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GTCAGAACACAGGCCTGATTC	0.493																																																	0													146.0	150.0	149.0					6																	28121231		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS4645.1	6p21	2013-01-09	2013-01-09	2013-01-09	ENSG00000198315	ENSG00000198315		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12983	protein-coding gene	gene with protein product		602240	"""zinc finger protein 192"""	ZNF192			Standard	NM_001278119		Approved	LD5-1, ZSCAN40	uc003nkn.2	Q15776	OTTHUMG00000014510	ENST00000330236.6:c.1173A>T	6.37:g.28121231A>T			A1L3D4|B4DYF1|Q4VAR1|Q4VAR2|Q4VAR3|Q9H4T1	Silent	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.T391	ENST00000330236.6	37	c.1173	CCDS4645.1	6																																																																																			ZKSCAN8	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198315		0.493	ZKSCAN8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZKSCAN8	HGNC	protein_coding	OTTHUMT00000040178.2	-	0.00	27	0	A			28121231	+1	tier1	-	no_errors	ENST00000330236	ensembl	human	known	74_37	silent	35.90	25	14	SNP	0.987	T
ZNF100	163227	genome.wustl.edu	37	19	21910725	21910725	+	Missense_Mutation	SNP	G	G	A	rs111519833		TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr19:21910725G>A	ENST00000358296.6	-	5	587	c.389C>T	c.(388-390)gCg>gTg	p.A130V	ZNF100_ENST00000305570.6_Missense_Mutation_p.A66V	NM_173531.3	NP_775802.2	Q8IYN0	ZN100_HUMAN	zinc finger protein 100	130					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(11)|skin(1)|upper_aerodigestive_tract(1)	21						TTTCAGAATCGCTTCTTGAAA	0.318													N|||	1	0.000199681	0.0	0.0014	5008	,	,		17384	0.0		0.0	False		,,,				2504	0.0																0													62.0	60.0	61.0					19																	21910725		1935	4170	6105	SO:0001583	missense	0			BC035579	CCDS42538.1	19p13.1	2013-01-08	2003-12-19		ENSG00000197020	ENSG00000197020		"""Zinc fingers, C2H2-type"", ""-"""	12880	protein-coding gene	gene with protein product		603982	"""zinc finger protein 100 (Y1)"""			12477932	Standard	NM_173531		Approved		uc002nqi.3	Q8IYN0		ENST00000358296.6:c.389C>T	19.37:g.21910725G>A	ENSP00000351042:p.Ala130Val		Q7M4M0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A130V	ENST00000358296.6	37	c.389	CCDS42538.1	19	.	.	.	.	.	.	.	.	.	.	.	0.003	-2.489479	0.00161	.	.	ENSG00000197020	ENST00000358296	T	0.04917	3.53	0.131	0.131	0.14755	.	.	.	.	.	T	0.01156	0.0038	N	0.00289	-1.7	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.01281	0.0;0.0	T	0.46456	-0.9190	9	0.02654	T	1	.	4.014	0.09636	0.0:1.0E-4:0.3753:0.6246	.	130;184	Q8IYN0;Q4G131	ZN100_HUMAN;.	V	130	ENSP00000351042:A130V	ENSP00000351042:A130V	A	-	2	0	ZNF100	21702565	0.006000	0.16342	0.081000	0.20488	0.080000	0.17528	0.082000	0.14847	0.171000	0.19730	0.174000	0.16983	GCG	ZNF100	-	NULL	ENSG00000197020		0.318	ZNF100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF100	HGNC	protein_coding	OTTHUMT00000464087.1	-	0.00	92	0	G	NM_173531		21910725	-1	tier1	rs111519833	no_errors	ENST00000358296	ensembl	human	known	74_37	missense	23.08	40	12	SNP	0.315	A
ZNF185	7739	genome.wustl.edu	37	X	152087570	152087572	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	GAG	GAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chrX:152087570_152087572delGAG	ENST00000370268.4	+	7	512_514	c.475_477delGAG	c.(475-477)gagdel	p.E165del	ZNF185_ENST00000318504.7_In_Frame_Del_p.E165del|ZNF185_ENST00000539731.1_In_Frame_Del_p.E165del|ZNF185_ENST00000449285.2_In_Frame_Del_p.E165del|ZNF185_ENST00000535861.1_In_Frame_Del_p.E165del|ZNF185_ENST00000324823.6_In_Frame_Del_p.E30del|ZNF185_ENST00000370270.2_In_Frame_Del_p.E165del|ZNF185_ENST00000318529.8_In_Frame_Del_p.E30del			O15231	ZN185_HUMAN	zinc finger protein 185 (LIM domain)	165	Poly-Glu.					actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(3)	12	Acute lymphoblastic leukemia(192;6.56e-05)					AGGGGACACCgaggaggaggagg	0.596																																																	0									,,,,,,	160,3115		6,91,57,1273,478					,,,,,,	-7.0	0.0			54	367,5848		0,178,189,2088,1494	no	coding,coding,coding,coding,coding,coding,coding	ZNF185	NM_007150.3,NM_001178113.1,NM_001178110.1,NM_001178109.1,NM_001178108.1,NM_001178107.1,NM_001178106.1	,,,,,,	6,269,246,3361,1972	A1A1,A1R,A1,RR,R		5.9051,4.8855,5.5532	,,,,,,	,,,,,,		527,8963				SO:0001651	inframe_deletion	0			AK056517	CCDS48184.1, CCDS55528.1, CCDS55529.1, CCDS55530.1, CCDS55531.1, CCDS55532.1, CCDS69832.1	Xq28	2012-08-08			ENSG00000147394	ENSG00000147394		"""Zinc fingers, C2H2-type"""	12976	protein-coding gene	gene with protein product		300381				9268636	Standard	NM_001178106		Approved		uc011myg.2	O15231	OTTHUMG00000024187	ENST00000370268.4:c.475_477delGAG	X.37:g.152087579_152087581delGAG	ENSP00000359291:p.Glu165del		A4FTV3|A6NME5|B4DLE9|B7Z771|B8K2L9|B8K2M0|B8K2M1|B8K2M2|E9PFR6|F5GXF7|F5GZL4|F8W8V7|H0Y4M8|O00345|Q8N1R8|Q9NSD2	In_Frame_Del	DEL	smart_Znf_LIM,pfscan_Znf_LIM	p.E162in_frame_del	ENST00000370268.4	37	c.475_477	CCDS48184.1	X																																																																																			ZNF185	-	NULL	ENSG00000147394		0.596	ZNF185-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF185	HGNC	protein_coding	OTTHUMT00000377480.1		0.00	25	0	GAG	NM_007150		152087572	+1	tier1		no_errors	ENST00000370270	ensembl	human	known	74_37	in_frame_del	16.67	20	4	DEL	0.026:0.052:0.078	-
ZNF224	7767	genome.wustl.edu	37	19	44611163	44611163	+	Missense_Mutation	SNP	G	G	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr19:44611163G>C	ENST00000336976.6	+	6	1104	c.850G>C	c.(850-852)Ggg>Cgg	p.G284R	AC084219.4_ENST00000592946.1_RNA	NM_013398.2	NP_037530.2	Q9NZL3	ZN224_HUMAN	zinc finger protein 224	284					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nuclear membrane (GO:0031965)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(2)|ovary(2)|prostate(1)|stomach(2)|urinary_tract(1)	19		Prostate(69;0.0435)				AATCCATACGGGGGAGAAGCC	0.433																																																	0													132.0	135.0	134.0					19																	44611163		2203	4300	6503	SO:0001583	missense	0			AF187990	CCDS33046.1	19q13.2	2013-01-08	2004-02-13			ENSG00000267680		"""Zinc fingers, C2H2-type"", ""-"""	13017	protein-coding gene	gene with protein product		194555	"""zinc finger protein 255"", ""zinc finger protein 27"""	ZNF255, ZNF27			Standard	NM_013398		Approved	BMZF-2, KOX22	uc002oyh.2	Q9NZL3		ENST00000336976.6:c.850G>C	19.37:g.44611163G>C	ENSP00000337368:p.Gly284Arg		A6NFW9|P17033|Q86V10|Q8IZC8|Q9UID9|Q9Y2P6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G284R	ENST00000336976.6	37	c.850	CCDS33046.1	19	.	.	.	.	.	.	.	.	.	.	g	17.74	3.463444	0.63513	.	.	ENSG00000186019	ENST00000336976	T	0.01629	4.72	3.44	-0.0121	0.13989	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05410	0.0143	L	0.51853	1.615	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.37572	-0.9700	9	0.59425	D	0.04	.	5.3527	0.16043	0.2037:0.0:0.6303:0.166	.	284	Q9NZL3	ZN224_HUMAN	R	284	ENSP00000337368:G284R	ENSP00000337368:G284R	G	+	1	0	ZNF224	49303003	0.973000	0.33851	0.003000	0.11579	0.415000	0.31203	2.463000	0.45058	0.248000	0.21435	0.591000	0.81541	GGG	ZNF224	-	pfscan_Znf_C2H2	ENSG00000267680		0.433	ZNF224-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF224	HGNC	protein_coding	OTTHUMT00000460477.1	-	0.00	104	0	G	NM_013398		44611163	+1	tier1	-	no_errors	ENST00000336976	ensembl	human	known	74_37	missense	7.61	85	7	SNP	0.158	C
ZNF252P	286101	genome.wustl.edu	37	8	146203030	146203030	+	RNA	SNP	C	C	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr8:146203030C>A	ENST00000426361.2	-	0	1154					NR_023392.1				zinc finger protein 252, pseudogene											endometrium(1)	1						ACTATGAATTCTCTGATGATG	0.368																																																	0																																												0			BC019922		8q24.3	2012-10-05	2012-04-19	2012-04-19	ENSG00000196922	ENSG00000196922			13046	pseudogene	pseudogene			"""zinc finger protein 252"""	ZNF252			Standard	NR_023392		Approved		uc011llo.2		OTTHUMG00000165201		8.37:g.146203030C>A				RNA	SNP	-	NULL	ENST00000426361.2	37	NULL		8	.	.	.	.	.	.	.	.	.	.	C	13.41	2.228946	0.39399	.	.	ENSG00000196922	ENST00000426361;ENST00000544285;ENST00000355436	.	.	.	2.79	1.81	0.25067	.	.	.	.	.	T	0.31389	0.0795	.	.	.	0.23366	N	0.997822	P	0.40619	0.724	B	0.36608	0.229	T	0.47623	-0.9103	6	0.54805	T	0.06	.	9.6248	0.39743	0.2088:0.7912:0.0:0.0	.	315	E9PMP9	.	I	315;315;294	.	ENSP00000347611:R294I	R	-	2	0	ZNF252	146173834	0.000000	0.05858	0.812000	0.32479	0.994000	0.84299	-0.156000	0.10100	1.369000	0.46134	0.514000	0.50259	AGA	ZNF252P	-	-	ENSG00000196922		0.368	ZNF252P-008	KNOWN	basic|exp_conf	processed_transcript	ZNF252P	HGNC	pseudogene	OTTHUMT00000451422.1	-	0.00	75	0	C	NR_023392		146203030	-1	tier1	-	no_errors	ENST00000426361	ensembl	human	known	74_37	rna	66.98	35	71	SNP	0.787	A
ZNF407	55628	genome.wustl.edu	37	18	72775130	72775130	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr18:72775130G>T	ENST00000299687.5	+	8	5453	c.5453G>T	c.(5452-5454)tGc>tTc	p.C1818F		NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	1818					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		TCGTACGAGTGCCGTCTAAAG	0.547																																																	0													87.0	98.0	94.0					18																	72775130		2089	4201	6290	SO:0001583	missense	0			AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.5453G>T	18.37:g.72775130G>T	ENSP00000299687:p.Cys1818Phe		B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,smart_Znf_U1,pfscan_Znf_C2H2	p.C1818F	ENST00000299687.5	37	c.5453	CCDS45885.1	18	.	.	.	.	.	.	.	.	.	.	G	21.9	4.216078	0.79352	.	.	ENSG00000215421	ENST00000299687	T	0.11385	2.78	4.97	4.97	0.65823	.	.	.	.	.	T	0.24470	0.0593	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.01312	-1.1388	9	0.72032	D	0.01	.	16.4342	0.83869	0.0:0.0:1.0:0.0	.	1818	Q9C0G0	ZN407_HUMAN	F	1818	ENSP00000299687:C1818F	ENSP00000299687:C1818F	C	+	2	0	ZNF407	70904118	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.147000	0.94646	1.094000	0.41399	-0.136000	0.14681	TGC	ZNF407	-	NULL	ENSG00000215421		0.547	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF407	HGNC	protein_coding	OTTHUMT00000444903.1	-	0.00	110	0	G	NM_017757		72775130	+1	tier1	-	no_errors	ENST00000299687	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
ZNF461	92283	genome.wustl.edu	37	19	37129715	37129715	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr19:37129715C>T	ENST00000588268.1	-	6	1759	c.1532G>A	c.(1531-1533)aGc>aAc	p.S511N	ZNF461_ENST00000540605.2_5'UTR|ZNF461_ENST00000360357.4_Missense_Mutation_p.S488N	NM_153257.2	NP_694989.2	Q8TAF7	ZN461_HUMAN	zinc finger protein 461	511					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(4)|lung(17)|prostate(1)|urinary_tract(2)	29	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			GTGTGAGAAGCTTGAATGATA	0.368																																																	0													102.0	111.0	108.0					19																	37129715		2198	4298	6496	SO:0001583	missense	0			BX649031	CCDS54257.1, CCDS74348.1	19q13.13	2013-01-08				ENSG00000197808		"""Zinc fingers, C2H2-type"", ""-"""	21629	protein-coding gene	gene with protein product		608640				11579202, 15004467	Standard	XM_005259402		Approved	GIOT-1, MGC33911	uc002oem.3	Q8TAF7		ENST00000588268.1:c.1532G>A	19.37:g.37129715C>T	ENSP00000467931:p.Ser511Asn		A8K9W9|Q6VSF7|Q9ULZ8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S511N	ENST00000588268.1	37	c.1532	CCDS54257.1	19	.	.	.	.	.	.	.	.	.	.	C	8.904	0.957155	0.18507	.	.	ENSG00000197808	ENST00000396893;ENST00000396896;ENST00000360357;ENST00000540605;ENST00000396892	T	0.15718	2.4	3.21	0.849	0.18972	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.15305	0.0369	N	0.17082	0.46	0.09310	N	1	D;P;B	0.54601	0.967;0.846;0.024	P;B;B	0.57776	0.827;0.351;0.007	T	0.13335	-1.0513	9	0.33940	T	0.23	.	2.6055	0.04877	0.2319:0.5036:0.0:0.2645	.	488;433;511	B4DRP8;Q59G30;Q8TAF7	.;.;ZN461_HUMAN	N	511;242;488;384;205	ENSP00000353515:S488N	ENSP00000353515:S488N	S	-	2	0	ZNF461	41821555	0.000000	0.05858	0.950000	0.38849	0.982000	0.71751	-2.531000	0.00943	0.147000	0.19030	0.491000	0.48974	AGC	ZNF461	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197808		0.368	ZNF461-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF461	HGNC	protein_coding	OTTHUMT00000453202.1	-	0.00	93	0	C	NM_153257		37129715	-1	tier1	-	no_errors	ENST00000588268	ensembl	human	known	74_37	missense	19.12	55	13	SNP	0.000	T
ZNF479	90827	genome.wustl.edu	37	7	57188644	57188644	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr7:57188644G>A	ENST00000331162.4	-	5	748	c.478C>T	c.(478-480)Cat>Tat	p.H160Y		NM_033273.1	NP_150376.1	Q96JC4	ZN479_HUMAN	zinc finger protein 479	160					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(53)|ovary(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	84			GBM - Glioblastoma multiforme(1;9.18e-12)			ACATATTTATGAGTCTGAAAT	0.303																																																	0													36.0	35.0	36.0					7																	57188644		1806	4055	5861	SO:0001583	missense	0			AF277624	CCDS43590.1	7p11.2	2013-01-08			ENSG00000185177	ENSG00000185177		"""Zinc fingers, C2H2-type"", ""-"""	23258	protein-coding gene	gene with protein product						11410164	Standard	NM_033273		Approved	KR19	uc010kzo.3	Q96JC4	OTTHUMG00000156682	ENST00000331162.4:c.478C>T	7.37:g.57188644G>A	ENSP00000333776:p.His160Tyr			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H160Y	ENST00000331162.4	37	c.478	CCDS43590.1	7	.	.	.	.	.	.	.	.	.	.	g	1.270	-0.613361	0.03690	.	.	ENSG00000185177	ENST00000331162	T	0.34072	1.38	1.29	-2.58	0.06228	.	.	.	.	.	T	0.24160	0.0585	L	0.45352	1.415	0.09310	N	1	B	0.15141	0.012	B	0.11329	0.006	T	0.26360	-1.0105	9	0.59425	D	0.04	.	2.0206	0.03508	0.2586:0.0:0.2741:0.4672	.	160	Q96JC4	ZN479_HUMAN	Y	160	ENSP00000333776:H160Y	ENSP00000333776:H160Y	H	-	1	0	ZNF479	57192586	.	.	0.002000	0.10522	0.022000	0.10575	.	.	-1.102000	0.03023	-0.498000	0.04607	CAT	ZNF479	-	NULL	ENSG00000185177		0.303	ZNF479-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF479	HGNC	protein_coding	OTTHUMT00000345302.1	-	0.00	224	0	G	XM_291202		57188644	-1	tier1	-	no_errors	ENST00000331162	ensembl	human	known	74_37	missense	44.13	157	124	SNP	0.001	A
ZNF540	163255	genome.wustl.edu	37	19	38047033	38047033	+	Intron	SNP	T	T	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr19:38047033T>G	ENST00000592533.1	+	1	260				ZNF571_ENST00000590751.1_Missense_Mutation_p.N56T|ZNF571-AS1_ENST00000586139.1_RNA|ZNF571-AS1_ENST00000585578.1_RNA|ZNF571-AS1_ENST00000589802.1_RNA|ZNF571-AS1_ENST00000586013.1_RNA|ZNF571-AS1_ENST00000592392.1_RNA|ZNF571-AS1_ENST00000590838.1_RNA|ZNF571-AS1_ENST00000589750.1_RNA|ZNF571-AS1_ENST00000588382.1_RNA|ZNF571-AS1_ENST00000587121.1_RNA|ZNF571-AS1_ENST00000591430.1_RNA	NM_152606.4	NP_689819.1	Q8NDQ6	ZN540_HUMAN	zinc finger protein 540						negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(13)|lung(8)|skin(1)	28			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			gaccggcagattgtgttgctc	0.522																																																	0																																										SO:0001627	intron_variant	0			AL832315	CCDS12506.1, CCDS54258.1	19q13.13	2013-01-08				ENSG00000171817		"""Zinc fingers, C2H2-type"", ""-"""	25331	protein-coding gene	gene with protein product		613903					Standard	NM_152606		Approved	DKFZp547B0714	uc002ogq.4	Q8NDQ6		ENST00000592533.1:c.-73+4466T>G	19.37:g.38047033T>G			A0AVS5|A8K371|Q05D58|Q3LIC5|Q6ZN36|Q7Z3C8|Q86T31	Missense_Mutation	SNP	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,superfamily_FMuLV_rcpt-bd,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	p.N56T	ENST00000592533.1	37	c.167	CCDS12506.1	19																																																																																			ZNF571	-	superfamily_Krueppel-associated_box,superfamily_FMuLV_rcpt-bd,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000180479		0.522	ZNF540-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZNF571	HGNC	protein_coding	OTTHUMT00000459481.1	-	0.00	48	0	T	NM_152606		38047033	-1	tier1	-	no_errors	ENST00000590751	ensembl	human	putative	74_37	missense	30.23	30	13	SNP	0.185	G
ZNF540	163255	genome.wustl.edu	37	19	38102847	38102847	+	Silent	SNP	A	A	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr19:38102847A>G	ENST00000592533.1	+	5	998	c.666A>G	c.(664-666)aaA>aaG	p.K222K	ZNF540_ENST00000589117.1_Silent_p.K190K|ZNF540_ENST00000316433.4_Silent_p.K222K|ZNF540_ENST00000343599.5_Silent_p.K222K	NM_152606.4	NP_689819.1	Q8NDQ6	ZN540_HUMAN	zinc finger protein 540	222					negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(13)|lung(8)|skin(1)	28			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AATGTGGGAAAGTTTTTAGTC	0.358																																																	0													48.0	49.0	48.0					19																	38102847		2203	4299	6502	SO:0001819	synonymous_variant	0			AL832315	CCDS12506.1, CCDS54258.1	19q13.13	2013-01-08				ENSG00000171817		"""Zinc fingers, C2H2-type"", ""-"""	25331	protein-coding gene	gene with protein product		613903					Standard	NM_152606		Approved	DKFZp547B0714	uc002ogq.4	Q8NDQ6		ENST00000592533.1:c.666A>G	19.37:g.38102847A>G			A0AVS5|A8K371|Q05D58|Q3LIC5|Q6ZN36|Q7Z3C8|Q86T31	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K222	ENST00000592533.1	37	c.666	CCDS12506.1	19																																																																																			ZNF540	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000171817		0.358	ZNF540-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZNF540	HGNC	protein_coding	OTTHUMT00000459481.1	-	0.00	76	0	A	NM_152606		38102847	+1	tier1	-	no_errors	ENST00000316433	ensembl	human	known	74_37	silent	32.08	36	17	SNP	0.102	G
ZNF587	84914	genome.wustl.edu	37	19	58370470	58370470	+	Silent	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr19:58370470C>T	ENST00000339656.5	+	3	872	c.690C>T	c.(688-690)caC>caT	p.H230H	ZNF814_ENST00000597652.1_5'Flank|ZNF587_ENST00000419854.1_Silent_p.H187H|ZNF587_ENST00000423137.1_Silent_p.H229H|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597342.1_Intron	NM_001204817.1|NM_032828.3	NP_001191746.1|NP_116217.1	Q96SQ5	ZN587_HUMAN	zinc finger protein 587	230					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	15		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)		TTATTCCACACCAGAAACTTT	0.423																																					Pancreas(59;641 1233 1885 20055 50741)												0													55.0	50.0	52.0					19																	58370470		2183	4275	6458	SO:0001819	synonymous_variant	0			AF294842	CCDS12964.1, CCDS56110.1	19q13.43	2013-01-08				ENSG00000198466		"""Zinc fingers, C2H2-type"", ""-"""	30955	protein-coding gene	gene with protein product						10520746	Standard	NM_032828		Approved	ZF6, FLJ14710, UBF-fl, FLJ20813	uc002qql.3	Q96SQ5	OTTHUMG00000154901	ENST00000339656.5:c.690C>T	19.37:g.58370470C>T			A0AV72|G3V0H5|Q6ZMK8	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H230	ENST00000339656.5	37	c.690	CCDS12964.1	19																																																																																			ZNF587	-	NULL	ENSG00000198466		0.423	ZNF587-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF587	HGNC	protein_coding	OTTHUMT00000337594.2	-	0.00	35	0	C	NM_032828		58370470	+1	tier1	-	no_errors	ENST00000339656	ensembl	human	known	74_37	silent	25.71	26	9	SNP	0.997	T
ZNF598	90850	genome.wustl.edu	37	16	2051642	2051642	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr16:2051642C>T	ENST00000563630.1	-	6	1032	c.790G>A	c.(790-792)Gcc>Acc	p.A264T	ZNF598_ENST00000562103.1_Missense_Mutation_p.A264T|ZNF598_ENST00000431526.1_Missense_Mutation_p.A319T			Q86UK7	ZN598_HUMAN	zinc finger protein 598	319							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						CCAGCCCGGGCCACTCGGCCC	0.687																																																	0													29.0	37.0	34.0					16																	2051642		2073	4187	6260	SO:0001583	missense	0			BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000563630.1:c.790G>A	16.37:g.2051642C>T	ENSP00000455882:p.Ala264Thr		Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Missense_Mutation	SNP	superfamily_PAH,smart_Znf_C2H2-like,pfscan_Znf_RING	p.A319T	ENST00000563630.1	37	c.955		16	.	.	.	.	.	.	.	.	.	.	.	12.51	1.961025	0.34565	.	.	ENSG00000167962	ENST00000431526	T	0.14516	2.5	5.41	0.572	0.17357	.	0.226324	0.45361	D	0.000376	T	0.07773	0.0195	L	0.29908	0.895	0.09310	N	0.999991	B	0.15141	0.012	B	0.13407	0.009	T	0.40365	-0.9567	10	0.13108	T	0.6	-16.7063	7.5462	0.27768	0.1207:0.6528:0.0:0.2265	.	319	Q86UK7	ZN598_HUMAN	T	319	ENSP00000411409:A319T	ENSP00000411409:A319T	A	-	1	0	ZNF598	1991643	0.011000	0.17503	0.234000	0.24042	0.023000	0.10783	0.773000	0.26661	0.249000	0.21456	-0.150000	0.13652	GCC	ZNF598	-	NULL	ENSG00000167962		0.687	ZNF598-001	NOVEL	basic	protein_coding	ZNF598	HGNC	protein_coding	OTTHUMT00000434439.1		0.00	75	0	C	NM_178167		2051642	-1			no_errors	ENST00000431526	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.260	T
ZNF66	7617	genome.wustl.edu	37	19	20989458	20989458	+	Missense_Mutation	SNP	A	A	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr19:20989458A>T	ENST00000344519.8	+	4	1075	c.1052A>T	c.(1051-1053)aAg>aTg	p.K351M	AC010329.1_ENST00000582722.1_RNA|ZNF66_ENST00000425625.1_Missense_Mutation_p.K397M			Q6ZN08	ZNF66_HUMAN	zinc finger protein 66	351					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										AAAGGCTTTAAGTACTCCTCT	0.398																																																	0																																										SO:0001583	missense	0			M88375		19p12	2013-03-06	2013-03-06	2013-03-06	ENSG00000160229	ENSG00000160229			13135	other	unknown			"""zinc finger protein 66, pseudogene"""	ZNF66P		1505991	Standard	NG_023377		Approved	FLJ16537	uc002npe.3	Q6ZN08	OTTHUMG00000167735	ENST00000344519.8:c.1052A>T	19.37:g.20989458A>T	ENSP00000461425:p.Lys351Met		I3L4P5|Q15939	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K351M	ENST00000344519.8	37	c.1052		19																																																																																			ZNF66	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000160229		0.398	ZNF66-001	KNOWN	basic|appris_principal	protein_coding	ZNF66	HGNC	protein_coding	OTTHUMT00000395955.2	-	0.00	43	0	A	NG_023377		20989458	+1	tier1	-	no_errors	ENST00000344519	ensembl	human	known	74_37	missense	33.33	22	11	SNP	0.000	T
ZNF675	171392	genome.wustl.edu	37	19	23836409	23836409	+	Silent	SNP	A	A	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr19:23836409A>G	ENST00000359788.4	-	4	1494	c.1326T>C	c.(1324-1326)caT>caC	p.H442H	ZNF675_ENST00000600313.1_Intron|ZNF675_ENST00000601935.1_Intron|ZNF675_ENST00000596211.1_Intron	NM_138330.2	NP_612203.2	Q8TD23	ZN675_HUMAN	zinc finger protein 675	442				H -> Y (in Ref. 1; AAK95822). {ECO:0000305}.	bone resorption (GO:0045453)|cytokine-mediated signaling pathway (GO:0019221)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of interleukin-1-mediated signaling pathway (GO:2000660)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	DNA binding (GO:0003677)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				GAAGTTTCTTATGTTCAGTAA	0.363																																																	0													49.0	52.0	51.0					19																	23836409		2201	4300	6501	SO:0001819	synonymous_variant	0				CCDS32981.1	19p12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	30768	protein-coding gene	gene with protein product	"""TRAF6 inhibitory zinc finger"""					11751921	Standard	NM_138330		Approved	TIZ, TBZF	uc002nri.3	Q8TD23		ENST00000359788.4:c.1326T>C	19.37:g.23836409A>G			Q8N211	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H442	ENST00000359788.4	37	c.1326	CCDS32981.1	19																																																																																			ZNF675	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197372		0.363	ZNF675-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF675	HGNC	protein_coding	OTTHUMT00000466433.1	-	0.00	76	0	A	NM_138330		23836409	-1	tier1	-	no_errors	ENST00000359788	ensembl	human	known	74_37	silent	34.48	38	20	SNP	0.665	G
ZNF727	442319	genome.wustl.edu	37	7	63529325	63529325	+	Silent	SNP	C	C	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr7:63529325C>T	ENST00000550760.3	+	2	239	c.60C>T	c.(58-60)tgC>tgT	p.C20C	RP11-3N2.13_ENST00000445978.1_RNA	NM_001159522.1	NP_001152994.1	A8MUV8	ZN727_HUMAN	zinc finger protein 727	20	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|skin(1)|stomach(1)|urinary_tract(1)	8						AGTGGGAATGCCTGGACTCTG	0.413																																																	0													109.0	98.0	102.0					7																	63529325		692	1591	2283	SO:0001819	synonymous_variant	0					7q11.21	2014-09-09	2014-09-09	2014-09-09	ENSG00000214652	ENSG00000214652		"""Zinc fingers, C2H2-type"", ""-"""	22785	pseudogene	pseudogene			"""zinc finger protein 727, pseudogene"""	ZNF727P			Standard	NM_001159522		Approved		uc011kdm.2	A8MUV8	OTTHUMG00000156536	ENST00000550760.3:c.60C>T	7.37:g.63529325C>T				Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C20	ENST00000550760.3	37	c.60	CCDS55113.1	7																																																																																			ZNF727	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000257482		0.413	ZNF727-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF727	HGNC	protein_coding		-	0.00	136	0	C	NM_001159522		63529325	+1	tier1	-	no_errors	ENST00000550760	ensembl	human	known	74_37	silent	6.59	85	6	SNP	0.905	T
ZNF727	442319	genome.wustl.edu	37	7	63538876	63538876	+	Missense_Mutation	SNP	G	G	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr7:63538876G>C	ENST00000550760.3	+	4	1628	c.1449G>C	c.(1447-1449)aaG>aaC	p.K483N	RP11-3N2.13_ENST00000445978.1_RNA	NM_001159522.1	NP_001152994.1	A8MUV8	ZN727_HUMAN	zinc finger protein 727	483					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|skin(1)|stomach(1)|urinary_tract(1)	8						CAAGTGCAAAGAATGTGGCAA	0.388																																																	0													53.0	49.0	50.0					7																	63538876		692	1591	2283	SO:0001583	missense	0					7q11.21	2014-09-09	2014-09-09	2014-09-09	ENSG00000214652	ENSG00000214652		"""Zinc fingers, C2H2-type"", ""-"""	22785	pseudogene	pseudogene			"""zinc finger protein 727, pseudogene"""	ZNF727P			Standard	NM_001159522		Approved		uc011kdm.2	A8MUV8	OTTHUMG00000156536	ENST00000550760.3:c.1449G>C	7.37:g.63538876G>C	ENSP00000447987:p.Lys483Asn			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K483N	ENST00000550760.3	37	c.1449	CCDS55113.1	7	.	.	.	.	.	.	.	.	.	.	G	3.611	-0.079570	0.07141	.	.	ENSG00000257482	ENST00000550760	T	0.01005	5.45	0.988	0.988	0.19796	.	.	.	.	.	T	0.00580	0.0019	N	0.08118	0	0.09310	N	1	B	0.28350	0.208	B	0.11329	0.006	T	0.47586	-0.9106	8	.	.	.	.	7.4067	0.26995	0.0:0.0:1.0:0.0	.	483	A8MUV8	ZN727_HUMAN	N	483	ENSP00000447987:K483N	.	K	+	3	2	ZNF727	63176311	0.000000	0.05858	0.089000	0.20774	0.086000	0.17979	-0.102000	0.10956	0.430000	0.26230	0.430000	0.28490	AAG	ZNF727	-	NULL	ENSG00000257482		0.388	ZNF727-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF727	HGNC	protein_coding		-	0.00	82	0	G	NM_001159522		63538876	+1	tier1	-	no_errors	ENST00000550760	ensembl	human	known	74_37	missense	11.11	48	6	SNP	0.069	C
ZNF736	728927	genome.wustl.edu	37	7	63808618	63808618	+	Missense_Mutation	SNP	A	A	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr7:63808618A>T	ENST00000423484.2	+	4	499	c.377A>T	c.(376-378)cAg>cTg	p.Q126L	ZNF736_ENST00000355095.4_Missense_Mutation_p.Q126L			B4DX44	ZN736_HUMAN	zinc finger protein 736	126					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|stomach(1)|urinary_tract(1)	9						TGCAAGGGGCAGAAAAGCAGT	0.363																																																	0													134.0	106.0	114.0					7																	63808618		692	1591	2283	SO:0001583	missense	0				CCDS55114.1	7q11.21	2013-01-08			ENSG00000234444	ENSG00000234444		"""Zinc fingers, C2H2-type"", ""-"""	32467	protein-coding gene	gene with protein product							Standard	XM_006716104		Approved		uc011kdo.2	B4DX44	OTTHUMG00000156537	ENST00000423484.2:c.377A>T	7.37:g.63808618A>T	ENSP00000400852:p.Gln126Leu			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q126L	ENST00000423484.2	37	c.377	CCDS55114.1	7	.	.	.	.	.	.	.	.	.	.	A	8.006	0.756384	0.15846	.	.	ENSG00000234444	ENST00000355095;ENST00000423484	T;T	0.05025	3.51;3.51	1.13	-0.559	0.11792	.	.	.	.	.	T	0.05273	0.0140	L	0.54965	1.715	0.09310	N	1	B	0.32409	0.37	B	0.19148	0.024	T	0.32402	-0.9908	9	0.54805	T	0.06	.	3.1711	0.06552	0.6756:0.0:0.3244:0.0	.	126	B4DX44	ZN736_HUMAN	L	126	ENSP00000347210:Q126L;ENSP00000400852:Q126L	ENSP00000347210:Q126L	Q	+	2	0	ZNF736	63446053	0.245000	0.23899	0.006000	0.13384	0.425000	0.31504	-0.022000	0.12480	-0.317000	0.08677	0.254000	0.18369	CAG	ZNF736	-	NULL	ENSG00000234444		0.363	ZNF736-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF736	HGNC	protein_coding	OTTHUMT00000344559.2	-	0.00	75	0	A	NM_001170905		63808618	+1	tier1	-	no_errors	ENST00000355095	ensembl	human	known	74_37	missense	41.67	28	20	SNP	0.001	T
ZNF878	729747	genome.wustl.edu	37	19	12155719	12155719	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr19:12155719G>T	ENST00000547628.1	-	4	634	c.497C>A	c.(496-498)tCt>tAt	p.S166Y	CTD-2006C1.10_ENST00000547473.1_Intron|ZNF878_ENST00000602107.1_Missense_Mutation_p.S213Y|CTD-2006C1.2_ENST00000591898.1_RNA|CTD-2006C1.2_ENST00000476474.1_RNA|CTD-2006C1.2_ENST00000591838.1_RNA	NM_001080404.2	NP_001073873.2	C9JN71	ZN878_HUMAN	zinc finger protein 878	166					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			cervix(1)|endometrium(1)|kidney(1)|lung(4)|urinary_tract(1)	8						TTTTTTTGCAGAGTGGATTCT	0.413																																																	0													139.0	153.0	148.0					19																	12155719		2101	4257	6358	SO:0001583	missense	0				CCDS45984.1, CCDS45984.2	19p13.2	2013-01-08				ENSG00000257446		"""Zinc fingers, C2H2-type"", ""-"""	37246	protein-coding gene	gene with protein product							Standard	NM_001080404		Approved		uc021upl.1	C9JN71		ENST00000547628.1:c.497C>A	19.37:g.12155719G>T	ENSP00000447931:p.Ser166Tyr			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S213Y	ENST00000547628.1	37	c.638	CCDS45984.2	19	.	.	.	.	.	.	.	.	.	.	G	15.75	2.926255	0.52759	.	.	ENSG00000257446;ENSG00000232371	ENST00000547628;ENST00000440730	T	0.19938	2.11	1.19	1.19	0.21007	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.42471	0.1204	M	0.78285	2.405	0.18873	N	0.999981	D	0.76494	0.999	D	0.67103	0.949	T	0.14952	-1.0454	9	0.87932	D	0	.	9.3177	0.37943	0.0:0.0:1.0:0.0	.	166	C9JN71	ZN878_HUMAN	Y	166;213	ENSP00000447931:S166Y	ENSP00000447931:S166Y	S	-	2	0	AC022415.4;ZNF878	12016719	0.019000	0.18553	0.002000	0.10522	0.451000	0.32288	0.780000	0.26760	0.619000	0.30197	0.186000	0.17326	TCT	ZNF878	-	pfscan_Znf_C2H2	ENSG00000257446		0.413	ZNF878-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF878	HGNC	protein_coding	OTTHUMT00000403723.1	-	0.00	103	0	G	NM_001080404		12155719	-1	tier1	-	no_errors	ENST00000602107	ensembl	human	known	74_37	missense	5.81	81	5	SNP	0.996	T
ZNF90	7643	genome.wustl.edu	37	19	20228743	20228743	+	Missense_Mutation	SNP	A	A	C			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr19:20228743A>C	ENST00000418063.2	+	4	492	c.380A>C	c.(379-381)aAa>aCa	p.K127T	ZNF90_ENST00000474284.1_Intron	NM_007138.1	NP_009069.1	Q03938	ZNF90_HUMAN	zinc finger protein 90	127					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|lung(2)|ovary(1)|skin(1)	5						AAAGTACACAAAAGAGGTTAT	0.328																																																	0													119.0	110.0	112.0					19																	20228743		692	1591	2283	SO:0001583	missense	0			M61870	CCDS46028.1	19p12	2013-01-08	2006-02-01		ENSG00000213988	ENSG00000213988		"""Zinc fingers, C2H2-type"", ""-"""	13165	protein-coding gene	gene with protein product		603973	"""zinc finger protein 90 (HTF9)"""			8467795	Standard	NM_007138		Approved	HTF9	uc002nor.2	Q03938	OTTHUMG00000158057	ENST00000418063.2:c.380A>C	19.37:g.20228743A>C	ENSP00000410466:p.Lys127Thr		B9EH87	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K127T	ENST00000418063.2	37	c.380	CCDS46028.1	19	.	.	.	.	.	.	.	.	.	.	a	2.012	-0.426868	0.04701	.	.	ENSG00000213988	ENST00000418063	T	0.05081	3.5	0.81	-1.62	0.08372	.	.	.	.	.	T	0.09686	0.0238	M	0.85197	2.74	0.09310	N	1	B	0.15473	0.013	B	0.12156	0.007	T	0.28618	-1.0038	9	0.51188	T	0.08	.	4.1737	0.10341	0.7415:0.0:0.2585:0.0	.	127	Q03938	ZNF90_HUMAN	T	127	ENSP00000410466:K127T	ENSP00000410466:K127T	K	+	2	0	ZNF90	20089743	0.000000	0.05858	0.036000	0.18154	0.036000	0.12997	-1.636000	0.02016	-1.367000	0.02152	-1.412000	0.01120	AAA	ZNF90	-	NULL	ENSG00000213988		0.328	ZNF90-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF90	HGNC	protein_coding	OTTHUMT00000350101.1	-	0.00	159	0	A	NM_007138		20228743	+1	tier1	-	no_errors	ENST00000418063	ensembl	human	known	74_37	missense	29.90	68	29	SNP	0.000	C
ZNF772	400720	genome.wustl.edu	37	19	57984813	57984813	+	Silent	SNP	A	A	G			TCGA-V5-A7RB-01A-11D-A351-09	TCGA-V5-A7RB-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	238ca1a1-3689-4105-838e-7c62d355d0fc	20e06ef0-ace9-4a23-bb45-3a7b8166690e	g.chr19:57984813A>G	ENST00000343280.4	-	5	1559	c.1299T>C	c.(1297-1299)ccT>ccC	p.P433P	ZNF772_ENST00000601768.1_Intron|AC004076.9_ENST00000415705.3_Intron|ZNF772_ENST00000427512.2_Silent_p.P321P|AC004076.9_ENST00000596831.1_Intron|ZNF772_ENST00000425074.3_3'UTR|ZNF772_ENST00000600175.1_Intron|ZNF772_ENST00000356584.3_Silent_p.P392P	NM_001024596.2	NP_001019767.1	Q68DY9	ZN772_HUMAN	zinc finger protein 772	433					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|large_intestine(4)|lung(3)	9		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)|Lung(386;0.174)		TGCACACATAAGGCTTTTCAC	0.418																																					Melanoma(5;289 436 14293 15924 30817)												0													115.0	101.0	106.0					19																	57984813		2203	4300	6503	SO:0001819	synonymous_variant	0			BX647068	CCDS33133.1, CCDS46210.1	19q13.43	2013-01-08				ENSG00000197128		"""Zinc fingers, C2H2-type"", ""-"""	33106	protein-coding gene	gene with protein product							Standard	NM_001024596		Approved	DKFZp686I1569	uc002qot.3	Q68DY9		ENST00000343280.4:c.1299T>C	19.37:g.57984813A>G			A6NJK9|B4DH56|B4DYS0	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P433	ENST00000343280.4	37	c.1299	CCDS33133.1	19																																																																																			ZNF772	-	pfscan_Znf_C2H2	ENSG00000197128		0.418	ZNF772-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF772	HGNC	protein_coding	OTTHUMT00000397447.1	-	0.00	65	0	A	NM_001024596		57984813	-1	tier1	-	no_errors	ENST00000343280	ensembl	human	known	74_37	silent	37.31	42	25	SNP	0.149	G
