#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCA8	10351	genome.wustl.edu	37	17	66914209	66914209	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr17:66914209C>G	ENST00000269080.2	-	14	2043	c.1906G>C	c.(1906-1908)Gat>Cat	p.D636H	ABCA8_ENST00000586539.1_Missense_Mutation_p.D676H|ABCA8_ENST00000430352.2_Missense_Mutation_p.D676H	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	636	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					TCGGCCTCATCCATGAACTGG	0.448																																																	0													171.0	138.0	149.0					17																	66914209		2203	4300	6503	SO:0001583	missense	0			AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.1906G>C	17.37:g.66914209C>G	ENSP00000269080:p.Asp636His		A1L3U3|C9JQE6|Q86WW0	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.D676H	ENST00000269080.2	37	c.2026	CCDS11680.1	17	.	.	.	.	.	.	.	.	.	.	C	21.8	4.208285	0.79240	.	.	ENSG00000141338	ENST00000269080;ENST00000430352;ENST00000541225	T;T	0.42513	0.97;0.97	4.26	4.26	0.50523	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.129906	0.33980	N	0.004370	T	0.60779	0.2295	L	0.57536	1.79	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.998;0.999;0.999;0.999	D;D;D;D;D	0.80764	0.96;0.963;0.978;0.994;0.967	T	0.65389	-0.6180	10	0.87932	D	0	.	16.1975	0.82042	0.0:1.0:0.0:0.0	.	615;676;676;676;636	F5H6Z4;A1L3U3;B4DJ11;C9JQE6;O94911	.;.;.;.;ABCA8_HUMAN	H	636;676;615	ENSP00000269080:D636H;ENSP00000402814:D676H	ENSP00000269080:D636H	D	-	1	0	ABCA8	64425804	1.000000	0.71417	1.000000	0.80357	0.840000	0.47671	7.251000	0.78297	2.369000	0.80426	0.643000	0.83706	GAT	ABCA8	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000141338		0.448	ABCA8-001	KNOWN	basic|CCDS	protein_coding	ABCA8	HGNC	protein_coding	OTTHUMT00000450172.1	-	0.00	61	0	C	NM_007168		66914209	-1	tier1	-	no_errors	ENST00000430352	ensembl	human	known	74_37	missense	41.56	45	32	SNP	1.000	G
ABCC9	10060	genome.wustl.edu	37	12	22005335	22005335	+	Silent	SNP	A	A	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr12:22005335A>G	ENST00000261201.4	-	21	2609	c.2610T>C	c.(2608-2610)acT>acC	p.T870T	ABCC9_ENST00000345162.2_Silent_p.T834T|RP11-729I10.2_ENST00000539874.1_RNA|ABCC9_ENST00000261200.4_Silent_p.T870T	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	870	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	GTAATTTGTGAGTCACAAGAA	0.363																																																	0													129.0	124.0	126.0					12																	22005335		2203	4300	6503	SO:0001819	synonymous_variant	0			AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.2610T>C	12.37:g.22005335A>G			O60707	Silent	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,prints_Sulphorea_rcpt,prints_Sulphonylurea_rcpt-2	p.T870	ENST00000261201.4	37	c.2610	CCDS8694.1	12																																																																																			ABCC9	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000069431		0.363	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	ABCC9	HGNC	protein_coding	OTTHUMT00000402230.1	-	0.00	84	0	A	NM_005691		22005335	-1	tier1	-	no_errors	ENST00000261200	ensembl	human	known	74_37	silent	26.32	56	20	SNP	0.986	G
ACP2	53	genome.wustl.edu	37	11	47266688	47266688	+	Intron	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr11:47266688C>T	ENST00000256997.3	-	6	756				ACP2_ENST00000537863.1_Intron|ACP2_ENST00000530453.1_3'UTR|ACP2_ENST00000527256.1_Intron|ACP2_ENST00000533929.1_Intron|ACP2_ENST00000525230.1_5'Flank|ACP2_ENST00000529444.1_Intron	NM_001610.2	NP_001601.1	P11117	PPAL_HUMAN	acid phosphatase 2, lysosomal						dephosphorylation (GO:0016311)|lysosome organization (GO:0007040)|skeletal system development (GO:0001501)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)	acid phosphatase activity (GO:0003993)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)	10						ATTTCCCACTCTGAGGATCTC	0.537																																					Melanoma(90;262 1440 11488 44828 48531)												0																																										SO:0001627	intron_variant	0			X15525	CCDS7928.1, CCDS44583.1	11p11.2	2008-02-05			ENSG00000134575	ENSG00000134575	3.1.3.2		123	protein-coding gene	gene with protein product		171650				975882	Standard	NM_001610		Approved		uc001nei.3	P11117	OTTHUMG00000166949	ENST00000256997.3:c.639+167G>A	11.37:g.47266688C>T			E9PCI1|Q561W5|Q9BTU7	RNA	SNP	-	NULL	ENST00000256997.3	37	NULL	CCDS7928.1	11																																																																																			ACP2	-	-	ENSG00000134575		0.537	ACP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACP2	HGNC	protein_coding	OTTHUMT00000392022.2	-	0.00	9	0	C	NM_001610		47266688	-1	tier1	-	no_errors	ENST00000524769	ensembl	human	putative	74_37	rna	66.67	5	10	SNP	0.454	T
ADAM22	53616	genome.wustl.edu	37	7	87795159	87795159	+	Nonsense_Mutation	SNP	G	G	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr7:87795159G>T	ENST00000265727.7	+	24	2168	c.2089G>T	c.(2089-2091)Gag>Tag	p.E697*	ADAM22_ENST00000398204.4_Nonsense_Mutation_p.E697*|ADAM22_ENST00000398209.3_Nonsense_Mutation_p.E697*|ADAM22_ENST00000398201.4_Nonsense_Mutation_p.E697*|ADAM22_ENST00000315984.7_Nonsense_Mutation_p.E697*			Q9P0K1	ADA22_HUMAN	ADAM metallopeptidase domain 22	697	EGF-like.				adult locomotory behavior (GO:0008344)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell adhesion (GO:0007162)	integral component of membrane (GO:0016021)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(7)|kidney(4)|large_intestine(7)|liver(2)|lung(20)|ovary(6)|prostate(4)|skin(3)	53	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)			TTGCAGTAATGAGCTGAAGTG	0.378																																																	0													128.0	119.0	122.0					7																	87795159		1897	4114	6011	SO:0001587	stop_gained	0			AB009671	CCDS43608.1, CCDS43609.1, CCDS43610.1, CCDS47637.1	7q21	2008-07-18	2005-08-18		ENSG00000008277	ENSG00000008277		"""ADAM metallopeptidase domain containing"""	201	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, and cysteine-rich protein 2"""	603709	"""a disintegrin and metalloproteinase domain 22"""			9693107, 10524237	Standard	NM_021723		Approved	MDC2	uc003ujn.3	Q9P0K1	OTTHUMG00000137417	ENST00000265727.7:c.2089G>T	7.37:g.87795159G>T	ENSP00000265727:p.Glu697*		O75075|O75076|Q9P0K2|Q9UIA1|Q9UKK2	Nonsense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.E697*	ENST00000265727.7	37	c.2089	CCDS47637.1	7	.	.	.	.	.	.	.	.	.	.	G	42	9.755375	0.99256	.	.	ENSG00000008277	ENST00000398204;ENST00000398201;ENST00000265727;ENST00000315984;ENST00000398209;ENST00000398203;ENST00000426930	.	.	.	5.58	5.58	0.84498	.	0.049165	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	18.6828	0.91553	0.0:0.0:1.0:0.0	.	.	.	.	X	697;697;697;697;697;664;55	.	ENSP00000265727:E697X	E	+	1	0	ADAM22	87633095	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.756000	0.91651	2.782000	0.95742	0.650000	0.86243	GAG	ADAM22	-	NULL	ENSG00000008277		0.378	ADAM22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADAM22	HGNC	protein_coding	OTTHUMT00000268370.2	-	0.00	52	0	G	NM_021723		87795159	+1	tier1	-	no_errors	ENST00000265727	ensembl	human	known	74_37	nonsense	7.14	52	4	SNP	1.000	T
ADAM22	53616	genome.wustl.edu	37	7	87795159	87795159	+	Nonsense_Mutation	SNP	G	G	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr7:87795159G>T	ENST00000265727.7	+	24	2168	c.2089G>T	c.(2089-2091)Gag>Tag	p.E697*	ADAM22_ENST00000398204.4_Nonsense_Mutation_p.E697*|ADAM22_ENST00000398209.3_Nonsense_Mutation_p.E697*|ADAM22_ENST00000398201.4_Nonsense_Mutation_p.E697*|ADAM22_ENST00000315984.7_Nonsense_Mutation_p.E697*			Q9P0K1	ADA22_HUMAN	ADAM metallopeptidase domain 22	697	EGF-like.				adult locomotory behavior (GO:0008344)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell adhesion (GO:0007162)	integral component of membrane (GO:0016021)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(7)|kidney(4)|large_intestine(7)|liver(2)|lung(20)|ovary(6)|prostate(4)|skin(3)	53	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)			TTGCAGTAATGAGCTGAAGTG	0.378																																																	0													128.0	119.0	122.0					7																	87795159		1897	4114	6011	SO:0001587	stop_gained	0			AB009671	CCDS43608.1, CCDS43609.1, CCDS43610.1, CCDS47637.1	7q21	2008-07-18	2005-08-18		ENSG00000008277	ENSG00000008277		"""ADAM metallopeptidase domain containing"""	201	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, and cysteine-rich protein 2"""	603709	"""a disintegrin and metalloproteinase domain 22"""			9693107, 10524237	Standard	NM_021723		Approved	MDC2	uc003ujn.3	Q9P0K1	OTTHUMG00000137417	ENST00000265727.7:c.2089G>T	7.37:g.87795159G>T	ENSP00000265727:p.Glu697*		O75075|O75076|Q9P0K2|Q9UIA1|Q9UKK2	Nonsense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.E697*	ENST00000265727.7	37	c.2089	CCDS47637.1	7	.	.	.	.	.	.	.	.	.	.	G	42	9.755375	0.99256	.	.	ENSG00000008277	ENST00000398204;ENST00000398201;ENST00000265727;ENST00000315984;ENST00000398209;ENST00000398203;ENST00000426930	.	.	.	5.58	5.58	0.84498	.	0.049165	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	18.6828	0.91553	0.0:0.0:1.0:0.0	.	.	.	.	X	697;697;697;697;697;664;55	.	ENSP00000265727:E697X	E	+	1	0	ADAM22	87633095	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.756000	0.91651	2.782000	0.95742	0.650000	0.86243	GAG	ADAM22	-	NULL	ENSG00000008277		0.378	ADAM22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADAM22	HGNC	protein_coding	OTTHUMT00000268370.2	-	0.00	61	0	G	NM_021723		87795159	+1	tier1	-	no_errors	ENST00000265727	ensembl	human	known	74_37	nonsense	7.14	52	4	SNP	1.000	T
AHCTF1	25909	genome.wustl.edu	37	1	247013637	247013637	+	Silent	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:247013637G>A	ENST00000391829.2	-	33	5794	c.5671C>T	c.(5671-5673)Cta>Tta	p.L1891L	AHCTF1_ENST00000366508.1_Silent_p.L1926L|AHCTF1_ENST00000326225.3_Silent_p.L1900L|AHCTF1_ENST00000470300.1_5'UTR			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	1891	Disordered. {ECO:0000250}.|Necessary for nuclear localization. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			CTAACTTTTAGATCATTTATA	0.294																																					Colon(145;197 1800 4745 15099 26333)												0													49.0	53.0	52.0					1																	247013637		2193	4288	6481	SO:0001819	synonymous_variant	0				CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.5671C>T	1.37:g.247013637G>A			A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Silent	SNP	superfamily_Quinonprotein_ADH-like_supfam	p.L1900	ENST00000391829.2	37	c.5698		1																																																																																			AHCTF1	-	NULL	ENSG00000153207		0.294	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	AHCTF1	HGNC	protein_coding		-	0.00	45	0	G	NM_015446		247013637	-1	tier1	-	no_errors	ENST00000326225	ensembl	human	known	74_37	silent	34.38	42	22	SNP	0.001	A
AHSG	197	genome.wustl.edu	37	3	186333527	186333527	+	Silent	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr3:186333527C>T	ENST00000273784.5	+	2	343	c.267C>T	c.(265-267)tgC>tgT	p.C89C	AHSG_ENST00000411641.2_Silent_p.C89C	NM_001622.2	NP_001613.2	P02765	FETUA_HUMAN	alpha-2-HS-glycoprotein	89	Cystatin fetuin-A-type 1. {ECO:0000255|PROSITE-ProRule:PRU00861}.				acute-phase response (GO:0006953)|negative regulation of bone mineralization (GO:0030502)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of phosphorylation (GO:0042326)|ossification (GO:0001503)|pinocytosis (GO:0006907)|positive regulation of phagocytosis (GO:0050766)|regulation of bone mineralization (GO:0030500)|regulation of inflammatory response (GO:0050727)|skeletal system development (GO:0001501)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|kinase inhibitor activity (GO:0019210)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(15)|prostate(2)|stomach(1)	22	all_cancers(143;3.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.27e-20)	GBM - Glioblastoma multiforme(93;0.0463)		AAACCACCTGCCATGTGCTGG	0.562																																																	0													85.0	83.0	84.0					3																	186333527		2203	4300	6503	SO:0001819	synonymous_variant	0			D67013, M16961	CCDS3278.1	3q27.3	2006-02-22			ENSG00000145192	ENSG00000145192			349	protein-coding gene	gene with protein product		138680				9322749, 7736783	Standard	NM_001622		Approved	FETUA, A2HS, HSGA	uc003fqk.4	P02765	OTTHUMG00000156605	ENST00000273784.5:c.267C>T	3.37:g.186333527C>T			A8K9N6|B2R7G1|O14961|O14962|Q9P152	Silent	SNP	pfam_Prot_inh_cystat,smart_Prot_inh_cystat	p.C89	ENST00000273784.5	37	c.267		3																																																																																			AHSG	-	smart_Prot_inh_cystat	ENSG00000145192		0.562	AHSG-002	NOVEL	basic|appris_candidate_longest|exp_conf	protein_coding	AHSG	HGNC	protein_coding	OTTHUMT00000344762.1	-	0.00	35	0	C	NM_001622		186333527	+1	tier1	-	no_errors	ENST00000411641	ensembl	human	known	74_37	silent	69.23	16	36	SNP	1.000	T
AKAP12	9590	genome.wustl.edu	37	6	151626944	151626944	+	Silent	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr6:151626944C>T	ENST00000253332.1	+	2	414	c.225C>T	c.(223-225)agC>agT	p.S75S	AKAP12_ENST00000402676.2_Silent_p.S75S			Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12	75					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|protein targeting (GO:0006605)|regulation of protein kinase C signaling (GO:0090036)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	adenylate cyclase binding (GO:0008179)|protein kinase A binding (GO:0051018)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	68		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		ATGAGCTCAGCCTCCAGGAGG	0.493																																					Melanoma(141;1616 1805 10049 24534 51979)												0													66.0	59.0	62.0					6																	151626944		2203	4300	6503	SO:0001819	synonymous_variant	0			U81607	CCDS5229.1, CCDS5230.1	6q24-q25	2011-07-01	2008-08-29		ENSG00000131016	ENSG00000131016		"""A-kinase anchor proteins"""	370	protein-coding gene	gene with protein product	"""gravin"", ""Src-Suppressed C Kinase Substrate"""	604698	"""A kinase (PRKA) anchor protein (gravin) 12"""			9000000	Standard	NM_144497		Approved	AKAP250, SSeCKS	uc011eep.2	Q02952	OTTHUMG00000015833	ENST00000253332.1:c.225C>T	6.37:g.151626944C>T			O00310|O00498|Q4LE68|Q5SZ80|Q5TGN1|Q68D82|Q99970	Silent	SNP	pfam_Pkinase-A_anch_WSK-motif,pfam_RII_binding_1	p.S75	ENST00000253332.1	37	c.225	CCDS5229.1	6																																																																																			AKAP12	-	NULL	ENSG00000131016		0.493	AKAP12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AKAP12	HGNC	protein_coding	OTTHUMT00000042712.1	-	0.00	50	0	C			151626944	+1	tier1	-	no_errors	ENST00000253332	ensembl	human	known	74_37	silent	17.07	34	7	SNP	0.142	T
ANAPC7	51434	genome.wustl.edu	37	12	110813935	110813935	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr12:110813935C>T	ENST00000455511.3	-	10	1546	c.1546G>A	c.(1546-1548)Gga>Aga	p.G516R	ANAPC7_ENST00000450008.2_Missense_Mutation_p.G516R|ANAPC7_ENST00000481473.1_5'UTR	NM_016238.2	NP_057322.2	Q9UJX3	APC7_HUMAN	anaphase promoting complex subunit 7	516					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)			breast(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)	19						AGGAAATCTCCTAGGATCCGA	0.483																																																	0													144.0	122.0	130.0					12																	110813935		2203	4300	6503	SO:0001583	missense	0			AF191340	CCDS9145.2, CCDS44971.1	12q13.12	2013-01-10			ENSG00000196510	ENSG00000196510		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	17380	protein-coding gene	gene with protein product		606949					Standard	NM_016238		Approved	APC7	uc001tqo.2	Q9UJX3	OTTHUMG00000157009	ENST00000455511.3:c.1546G>A	12.37:g.110813935C>T	ENSP00000394394:p.Gly516Arg		Q96AC4|Q96GF4|Q9BU24|Q9NT16	Missense_Mutation	SNP	pfam_TPR_2,pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.G516R	ENST00000455511.3	37	c.1546	CCDS9145.2	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.384695|5.384695	0.95967|0.95967	.|.	.|.	ENSG00000196510|ENSG00000196510	ENST00000455511;ENST00000481473;ENST00000486321;ENST00000450008|ENST00000552087	D;T|.	0.96967|.	-4.19;0.59|.	5.55|5.55	5.55|5.55	0.83447|0.83447	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77572|0.77572	0.4150|0.4150	M|M	0.76574|0.76574	2.34|2.34	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.998;0.999|.	T|T	0.76664|0.76664	-0.2876|-0.2876	10|5	0.87932|.	D|.	0|.	-20.8197|-20.8197	19.4921|19.4921	0.95054|0.95054	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	516;516|.	Q9UJX3-2;Q9UJX3|.	.;APC7_HUMAN|.	R|K	516;90;114;516|65	ENSP00000394394:G516R;ENSP00000402314:G516R|.	ENSP00000402314:G516R|.	G|R	-|-	1|2	0|0	ANAPC7|ANAPC7	109298318|109298318	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	7.487000|7.487000	0.81328|0.81328	2.624000|2.624000	0.88883|0.88883	0.561000|0.561000	0.74099|0.74099	GGA|AGG	ANAPC7	-	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000196510		0.483	ANAPC7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANAPC7	HGNC	protein_coding	OTTHUMT00000347075.3	-	0.00	55	0	C	NM_016238		110813935	-1	tier1	-	no_errors	ENST00000455511	ensembl	human	known	74_37	missense	20.29	55	14	SNP	1.000	T
ARHGDIG	398	genome.wustl.edu	37	16	331883	331883	+	Frame_Shift_Del	DEL	A	A	-			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr16:331883delA	ENST00000219409.3	+	2	286	c.211delA	c.(211-213)aagfs	p.K71fs	PDIA2_ENST00000219406.6_5'Flank|PDIA2_ENST00000404312.1_5'Flank	NM_001176.3	NP_001167.2	Q99819	GDIR3_HUMAN	Rho GDP dissociation inhibitor (GDI) gamma	71					negative regulation of cell adhesion (GO:0007162)|regulation of protein localization (GO:0032880)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|Rho GDP-dissociation inhibitor activity (GO:0005094)			breast(1)|central_nervous_system(1)|large_intestine(1)	3		all_cancers(16;6.71e-07)|all_epithelial(16;1.59e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00769)|all_lung(18;0.0186)				GAGCCTGGCCAAGTACAAGCG	0.692																																																	0													16.0	22.0	20.0					16																	331883		2138	4189	6327	SO:0001589	frameshift_variant	0			U82532	CCDS10404.1	16p13.3	2008-07-29			ENSG00000242173	ENSG00000242173			680	protein-coding gene	gene with protein product	"""RhoGDI gamma"""	602844				9113980, 11967128	Standard	NM_001176		Approved	RHOGDI-3	uc002cgm.1	Q99819	OTTHUMG00000064892	ENST00000219409.3:c.211delA	16.37:g.331883delA	ENSP00000219409:p.Lys71fs		Q4TT69|Q96S29	Frame_Shift_Del	DEL	pfam_Rho_GDI,superfamily_Ig_E-set,prints_Rho_GDI	p.K71fs	ENST00000219409.3	37	c.211	CCDS10404.1	16																																																																																			ARHGDIG	-	pfam_Rho_GDI,superfamily_Ig_E-set	ENSG00000242173		0.692	ARHGDIG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGDIG	HGNC	protein_coding	OTTHUMT00000139321.1		0.00	39	0	A			331883	+1	tier1		no_errors	ENST00000219409	ensembl	human	known	74_37	frame_shift_del	41.67	7	5	DEL	0.316	-
ARHGEF10	9639	genome.wustl.edu	37	8	1905331	1905331	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr8:1905331C>A	ENST00000398564.1	+	29	4012	c.4012C>A	c.(4012-4014)Cag>Aag	p.Q1338K	ARHGEF10_ENST00000262112.6_Missense_Mutation_p.Q1309K|ARHGEF10_ENST00000349830.3_Missense_Mutation_p.Q1313K|ARHGEF10_ENST00000521927.1_3'UTR|ARHGEF10_ENST00000520359.1_Missense_Mutation_p.Q1275K|ARHGEF10_ENST00000518288.1_Missense_Mutation_p.Q1337K			O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10	1338					centrosome duplication (GO:0051298)|myelination in peripheral nervous system (GO:0022011)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cytosol (GO:0005829)	kinesin binding (GO:0019894)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(3)|large_intestine(11)|lung(11)|prostate(3)|skin(3)|stomach(3)|urinary_tract(1)	35		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		CTGTGGAGGGCAGGGCCACCG	0.627																																																	0													19.0	21.0	20.0					8																	1905331		2202	4291	6493	SO:0001583	missense	0			AF009205	CCDS34794.1	8p23	2014-09-17			ENSG00000104728	ENSG00000104728		"""Rho guanine nucleotide exchange factors"""	14103	protein-coding gene	gene with protein product		608136				9205841, 16896804	Standard	XM_005266039		Approved	KIAA0294, Gef10	uc003wpr.3	O15013	OTTHUMG00000163626	ENST00000398564.1:c.4012C>A	8.37:g.1905331C>A	ENSP00000381571:p.Gln1338Lys		O14665|Q2KHR8|Q68D55|Q8IWD9|Q8IY77	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,superfamily_WD40_repeat_dom,smart_DH-domain,pfscan_DH-domain	p.Q1338K	ENST00000398564.1	37	c.4012		8	.	.	.	.	.	.	.	.	.	.	C	20.5	3.998310	0.74818	.	.	ENSG00000104728	ENST00000349830;ENST00000520359;ENST00000518288;ENST00000398564;ENST00000262112;ENST00000522435	T;T;T;T;T;T	0.58358	0.35;0.42;0.34;0.34;0.37;0.45	5.71	5.71	0.89125	.	0.131397	0.52532	D	0.000067	T	0.56016	0.1957	L	0.45051	1.395	0.80722	D	1	D;B	0.53312	0.959;0.194	P;B	0.48840	0.592;0.09	T	0.51196	-0.8736	10	0.34782	T	0.22	-40.2145	19.8366	0.96659	0.0:1.0:0.0:0.0	.	1275;1313	O15013-7;O15013-5	.;.	K	1313;1275;1337;1338;1309;957	ENSP00000340297:Q1313K;ENSP00000427909:Q1275K;ENSP00000431012:Q1337K;ENSP00000381571:Q1338K;ENSP00000262112:Q1309K;ENSP00000427768:Q957K	ENSP00000262112:Q1309K	Q	+	1	0	ARHGEF10	1892738	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	4.071000	0.57556	2.673000	0.90976	0.655000	0.94253	CAG	ARHGEF10	-	NULL	ENSG00000104728		0.627	ARHGEF10-203	KNOWN	basic	protein_coding	ARHGEF10	HGNC	protein_coding		-	0.00	11	0	C			1905331	+1	tier1	-	no_errors	ENST00000398564	ensembl	human	known	74_37	missense	50.00	5	5	SNP	1.000	A
ARHGEF12	23365	genome.wustl.edu	37	11	120328461	120328461	+	Nonsense_Mutation	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr11:120328461C>T	ENST00000397843.2	+	24	2387	c.2221C>T	c.(2221-2223)Cga>Tga	p.R741*	ARHGEF12_ENST00000356641.3_Nonsense_Mutation_p.R722*|ARHGEF12_ENST00000532993.1_Nonsense_Mutation_p.R638*	NM_015313.2	NP_056128.1	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	741					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(5)|endometrium(6)|kidney(5)|large_intestine(13)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(2)	61		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		AAAGCCCTTTCGAAAGTAAGT	0.333			T	MLL	AML																																			Dom	yes		11	11q23.3	23365	RHO guanine nucleotide exchange factor (GEF) 12 (LARG)		L	0													68.0	58.0	61.0					11																	120328461		1835	4077	5912	SO:0001587	stop_gained	0			AF180681	CCDS41727.1, CCDS55794.1	11q23.3	2011-11-16			ENSG00000196914	ENSG00000196914		"""Rho guanine nucleotide exchange factors"""	14193	protein-coding gene	gene with protein product		604763				10681437, 9205841	Standard	NM_001198665		Approved	KIAA0382, LARG	uc001pxl.2	Q9NZN5	OTTHUMG00000166143	ENST00000397843.2:c.2221C>T	11.37:g.120328461C>T	ENSP00000380942:p.Arg741*		O15086|Q6P526	Nonsense_Mutation	SNP	pfam_RGS-like_dom,pfam_DH-domain,pfam_PDZ,superfamily_Regulat_G_prot_signal_superfam,superfamily_DH-domain,superfamily_PDZ,smart_PDZ,smart_DH-domain,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.R722*	ENST00000397843.2	37	c.2164	CCDS41727.1	11	.	.	.	.	.	.	.	.	.	.	C	42	9.333607	0.99140	.	.	ENSG00000196914	ENST00000397843;ENST00000356641;ENST00000532993	.	.	.	5.66	3.76	0.43208	.	0.000000	0.40469	N	0.001091	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09084	T	0.74	-10.5339	13.7475	0.62883	0.4042:0.5958:0.0:0.0	.	.	.	.	X	741;722;638	.	ENSP00000349056:R722X	R	+	1	2	ARHGEF12	119833671	0.995000	0.38212	1.000000	0.80357	0.898000	0.52572	0.445000	0.21677	0.836000	0.34901	0.591000	0.81541	CGA	ARHGEF12	-	NULL	ENSG00000196914		0.333	ARHGEF12-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	ARHGEF12	HGNC	protein_coding	OTTHUMT00000388052.1	-	0.00	36	0	C	NM_015313		120328461	+1	tier1	-	no_errors	ENST00000356641	ensembl	human	known	74_37	nonsense	22.41	45	13	SNP	1.000	T
ARHGEF38	54848	genome.wustl.edu	37	4	106569729	106569729	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr4:106569729G>A	ENST00000420470.2	+	7	1042	c.898G>A	c.(898-900)Gag>Aag	p.E300K	ARHGEF38_ENST00000508036.2_3'UTR	NM_001242729.1	NP_001229658.1	Q9NXL2	ARH38_HUMAN	Rho guanine nucleotide exchange factor (GEF) 38	300						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(3)	11						GAAGAATGACGAGGATGAATC	0.338																																																	0																																										SO:0001583	missense	0			AK000191	CCDS3670.1, CCDS56338.1	4q24	2012-07-24			ENSG00000236699	ENSG00000236699		"""Rho guanine nucleotide exchange factors"""	25968	protein-coding gene	gene with protein product							Standard	NM_001242729		Approved	FLJ20184	uc003hxv.2	Q9NXL2	OTTHUMG00000154752	ENST00000420470.2:c.898G>A	4.37:g.106569729G>A	ENSP00000416125:p.Glu300Lys		C9JIB4	Missense_Mutation	SNP	pfam_DH-domain,pfam_BAR_dom,pfam_SH3_2,pfam_SH3_domain,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_BAR_dom,smart_SH3_domain,pfscan_BAR_dom,pfscan_SH3_domain,pfscan_DH-domain	p.E300K	ENST00000420470.2	37	c.898	CCDS56338.1	4	.	.	.	.	.	.	.	.	.	.	G	33	5.249357	0.95305	.	.	ENSG00000236699	ENST00000420470	T	0.56444	0.46	5.3	5.3	0.74995	.	.	.	.	.	T	0.61788	0.2375	L	0.51422	1.61	0.58432	D	0.999998	.	.	.	.	.	.	T	0.55704	-0.8099	7	0.28530	T	0.3	-11.9962	18.9971	0.92818	0.0:0.0:1.0:0.0	.	.	.	.	K	300	ENSP00000416125:E300K	ENSP00000416125:E300K	E	+	1	0	ARHGEF38	106789178	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	6.585000	0.74062	2.480000	0.83734	0.650000	0.86243	GAG	ARHGEF38	-	NULL	ENSG00000236699		0.338	ARHGEF38-001	PUTATIVE	basic|appris_principal|readthrough_transcript|exp_conf|CCDS	protein_coding	ARHGEF38	HGNC	protein_coding	OTTHUMT00000336934.3	-	0.00	31	0	G	NM_017700		106569729	+1	tier1	-	no_errors	ENST00000420470	ensembl	human	putative	74_37	missense	14.71	29	5	SNP	1.000	A
ASAP2	8853	genome.wustl.edu	37	2	9474924	9474924	+	Silent	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr2:9474924G>A	ENST00000281419.3	+	8	1084	c.744G>A	c.(742-744)ctG>ctA	p.L248L	ASAP2_ENST00000315273.4_Silent_p.L248L	NM_003887.2	NP_003878.1	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 2	248					positive regulation of catalytic activity (GO:0043085)|regulation of ARF GTPase activity (GO:0032312)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|enzyme activator activity (GO:0008047)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	36						TTGAAACGCTGTCTACGGATC	0.413																																																	0													118.0	101.0	107.0					2																	9474924		2203	4300	6503	SO:0001819	synonymous_variant	0			AB007860	CCDS1661.1, CCDS46224.1	2p24	2013-01-10	2008-09-22	2008-09-22	ENSG00000151693	ENSG00000151693		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2721	protein-coding gene	gene with protein product	"""centaurin, beta 3"""	603817	"""development and differentiation enhancing factor 2"""	DDEF2		10022920, 9455477	Standard	NM_003887		Approved	KIAA0400, PAP, SHAG1, CENTB3	uc002qzh.2	O43150	OTTHUMG00000117485	ENST00000281419.3:c.744G>A	2.37:g.9474924G>A			D6W4Y8	Silent	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,pfam_SH3_domain,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,smart_SH3_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_ArfGAP,prints_ArfGAP	p.L248	ENST00000281419.3	37	c.744	CCDS1661.1	2																																																																																			ASAP2	-	NULL	ENSG00000151693		0.413	ASAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASAP2	HGNC	protein_coding	OTTHUMT00000237522.1	-	0.00	36	0	G	NM_003887		9474924	+1	tier1	-	no_errors	ENST00000281419	ensembl	human	known	74_37	silent	17.50	33	7	SNP	0.877	A
ASAP2	8853	genome.wustl.edu	37	2	9474924	9474924	+	Silent	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr2:9474924G>A	ENST00000281419.3	+	8	1084	c.744G>A	c.(742-744)ctG>ctA	p.L248L	ASAP2_ENST00000315273.4_Silent_p.L248L	NM_003887.2	NP_003878.1	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 2	248					positive regulation of catalytic activity (GO:0043085)|regulation of ARF GTPase activity (GO:0032312)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|enzyme activator activity (GO:0008047)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	36						TTGAAACGCTGTCTACGGATC	0.413																																																	0													118.0	101.0	107.0					2																	9474924		2203	4300	6503	SO:0001819	synonymous_variant	0			AB007860	CCDS1661.1, CCDS46224.1	2p24	2013-01-10	2008-09-22	2008-09-22	ENSG00000151693	ENSG00000151693		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2721	protein-coding gene	gene with protein product	"""centaurin, beta 3"""	603817	"""development and differentiation enhancing factor 2"""	DDEF2		10022920, 9455477	Standard	NM_003887		Approved	KIAA0400, PAP, SHAG1, CENTB3	uc002qzh.2	O43150	OTTHUMG00000117485	ENST00000281419.3:c.744G>A	2.37:g.9474924G>A			D6W4Y8	Silent	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,pfam_SH3_domain,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,smart_SH3_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_ArfGAP,prints_ArfGAP	p.L248	ENST00000281419.3	37	c.744	CCDS1661.1	2																																																																																			ASAP2	-	NULL	ENSG00000151693		0.413	ASAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASAP2	HGNC	protein_coding	OTTHUMT00000237522.1	-	0.00	39	0	G	NM_003887		9474924	+1	tier1	-	no_errors	ENST00000281419	ensembl	human	known	74_37	silent	17.50	33	7	SNP	0.877	A
ASMTL	8623	genome.wustl.edu	37	X	1537981	1537981	+	Silent	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chrX:1537981C>T	ENST00000381317.3	-	10	1304	c.1272G>A	c.(1270-1272)acG>acA	p.T424T	ASMTL_ENST00000416733.2_Silent_p.T348T|ASMTL_ENST00000381333.4_Silent_p.T408T|ASMTL_ENST00000534940.1_Silent_p.T366T	NM_004192.3	NP_004183.2	O95671	ASML_HUMAN	acetylserotonin O-methyltransferase-like	424	ASMT-like.					cytoplasm (GO:0005737)	O-methyltransferase activity (GO:0008171)			NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(9)|pancreas(1)|soft_tissue(1)	23		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				ACCTCAGCCGCGTCTCCGGGC	0.667													c|||	6	0.00119808	0.0045	0.0	5008	,	,		15115	0.0		0.0	False		,,,				2504	0.0																0									,,	9,4213		0,9,2102	33.0	44.0	40.0		1098,1224,1272	0.3	0.0	X		40	0,8438		0,0,4219	no	coding-synonymous,coding-synonymous,coding-synonymous	ASMTL	NM_001173473.1,NM_001173474.1,NM_004192.3	,,	0,9,6321	TT,TC,CC		0.0,0.2132,0.0711	,,	366/564,408/606,424/622	1537981	9,12651	2111	4219	6330	SO:0001819	synonymous_variant	0			Y15521	CCDS43917.1, CCDS55362.1, CCDS55363.1	Xp22.3 and Yp11.3	2008-02-05			ENSG00000169093	ENSG00000169093		"""Pseudoautosomal regions / PAR1"""	751	protein-coding gene	gene with protein product		300162, 400011				9736779	Standard	NM_004192		Approved		uc004cpx.2	O95671	OTTHUMG00000021057	ENST00000381317.3:c.1272G>A	X.37:g.1537981C>T			B4DX75|F5GXH4|J3JS33|Q5JQ53|Q8NBH5|Q96G02|Q9BUL6	Silent	SNP	pfam_Maf,pfam_O_MeTrfase_2,tigrfam_Maf	p.T424	ENST00000381317.3	37	c.1272	CCDS43917.1	X																																																																																			ASMTL	-	pfam_O_MeTrfase_2	ENSG00000169093		0.667	ASMTL-005	KNOWN	basic|appris_principal|CCDS	protein_coding	ASMTL	HGNC	protein_coding	OTTHUMT00000055595.1	-	0.00	117	0	C	NM_004192		1537981	-1	tier1	-	no_errors	ENST00000381317	ensembl	human	known	74_37	silent	21.43	77	21	SNP	0.144	T
ASMTL	8623	genome.wustl.edu	37	X	1537981	1537981	+	Silent	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chrX:1537981C>T	ENST00000381317.3	-	10	1304	c.1272G>A	c.(1270-1272)acG>acA	p.T424T	ASMTL_ENST00000416733.2_Silent_p.T348T|ASMTL_ENST00000381333.4_Silent_p.T408T|ASMTL_ENST00000534940.1_Silent_p.T366T	NM_004192.3	NP_004183.2	O95671	ASML_HUMAN	acetylserotonin O-methyltransferase-like	424	ASMT-like.					cytoplasm (GO:0005737)	O-methyltransferase activity (GO:0008171)			NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(9)|pancreas(1)|soft_tissue(1)	23		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				ACCTCAGCCGCGTCTCCGGGC	0.667													c|||	6	0.00119808	0.0045	0.0	5008	,	,		15115	0.0		0.0	False		,,,				2504	0.0																0									,,	9,4213		0,9,2102	33.0	44.0	40.0		1098,1224,1272	0.3	0.0	X		40	0,8438		0,0,4219	no	coding-synonymous,coding-synonymous,coding-synonymous	ASMTL	NM_001173473.1,NM_001173474.1,NM_004192.3	,,	0,9,6321	TT,TC,CC		0.0,0.2132,0.0711	,,	366/564,408/606,424/622	1537981	9,12651	2111	4219	6330	SO:0001819	synonymous_variant	0			Y15521	CCDS43917.1, CCDS55362.1, CCDS55363.1	Xp22.3 and Yp11.3	2008-02-05			ENSG00000169093	ENSG00000169093		"""Pseudoautosomal regions / PAR1"""	751	protein-coding gene	gene with protein product		300162, 400011				9736779	Standard	NM_004192		Approved		uc004cpx.2	O95671	OTTHUMG00000021057	ENST00000381317.3:c.1272G>A	X.37:g.1537981C>T			B4DX75|F5GXH4|J3JS33|Q5JQ53|Q8NBH5|Q96G02|Q9BUL6	Silent	SNP	pfam_Maf,pfam_O_MeTrfase_2,tigrfam_Maf	p.T424	ENST00000381317.3	37	c.1272	CCDS43917.1	X																																																																																			ASMTL	-	pfam_O_MeTrfase_2	ENSG00000169093		0.667	ASMTL-005	KNOWN	basic|appris_principal|CCDS	protein_coding	ASMTL	HGNC	protein_coding	OTTHUMT00000055595.1	-	0.00	94	0	C	NM_004192		1537981	-1	tier1	-	no_errors	ENST00000381317	ensembl	human	known	74_37	silent	21.43	77	21	SNP	0.144	T
ASXL3	80816	genome.wustl.edu	37	18	31226215	31226215	+	Missense_Mutation	SNP	G	G	C			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr18:31226215G>C	ENST00000269197.5	+	4	253	c.253G>C	c.(253-255)Gag>Cag	p.E85Q		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	85					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						ACAGAAAGAGGAGTCGTCATG	0.388																																																	0													105.0	102.0	103.0					18																	31226215		1953	4158	6111	SO:0001583	missense	0			AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.253G>C	18.37:g.31226215G>C	ENSP00000269197:p.Glu85Gln		Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD	p.E85Q	ENST00000269197.5	37	c.253	CCDS45847.1	18	.	.	.	.	.	.	.	.	.	.	G	25.6	4.651449	0.88056	.	.	ENSG00000141431	ENST00000269197	T	0.15487	2.42	5.47	5.47	0.80525	.	.	.	.	.	T	0.26195	0.0639	L	0.36672	1.1	0.39339	D	0.965545	D	0.58268	0.982	P	0.52793	0.709	T	0.00553	-1.1674	9	0.34782	T	0.22	.	19.6817	0.95967	0.0:0.0:1.0:0.0	.	85	Q9C0F0	ASXL3_HUMAN	Q	85	ENSP00000269197:E85Q	ENSP00000269197:E85Q	E	+	1	0	ASXL3	29480213	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.041000	0.76558	2.730000	0.93505	0.555000	0.69702	GAG	ASXL3	-	NULL	ENSG00000141431		0.388	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASXL3	HGNC	protein_coding	OTTHUMT00000441865.2	-	0.00	31	0	G			31226215	+1	tier1	-	no_errors	ENST00000269197	ensembl	human	known	74_37	missense	48.84	22	21	SNP	1.000	C
ASXL3	80816	genome.wustl.edu	37	18	31226215	31226215	+	Missense_Mutation	SNP	G	G	C			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr18:31226215G>C	ENST00000269197.5	+	4	253	c.253G>C	c.(253-255)Gag>Cag	p.E85Q		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	85					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						ACAGAAAGAGGAGTCGTCATG	0.388																																																	0													105.0	102.0	103.0					18																	31226215		1953	4158	6111	SO:0001583	missense	0			AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.253G>C	18.37:g.31226215G>C	ENSP00000269197:p.Glu85Gln		Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD	p.E85Q	ENST00000269197.5	37	c.253	CCDS45847.1	18	.	.	.	.	.	.	.	.	.	.	G	25.6	4.651449	0.88056	.	.	ENSG00000141431	ENST00000269197	T	0.15487	2.42	5.47	5.47	0.80525	.	.	.	.	.	T	0.26195	0.0639	L	0.36672	1.1	0.39339	D	0.965545	D	0.58268	0.982	P	0.52793	0.709	T	0.00553	-1.1674	9	0.34782	T	0.22	.	19.6817	0.95967	0.0:0.0:1.0:0.0	.	85	Q9C0F0	ASXL3_HUMAN	Q	85	ENSP00000269197:E85Q	ENSP00000269197:E85Q	E	+	1	0	ASXL3	29480213	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.041000	0.76558	2.730000	0.93505	0.555000	0.69702	GAG	ASXL3	-	NULL	ENSG00000141431		0.388	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASXL3	HGNC	protein_coding	OTTHUMT00000441865.2	-	0.00	38	0	G			31226215	+1	tier1	-	no_errors	ENST00000269197	ensembl	human	known	74_37	missense	48.84	22	21	SNP	1.000	C
ATL3	25923	genome.wustl.edu	37	11	63439021	63439021	+	5'UTR	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr11:63439021G>A	ENST00000398868.3	-	0	63				ATL3_ENST00000332645.4_Intron|ATL3_ENST00000538786.1_Intron|ATL3_ENST00000535789.1_5'UTR	NM_015459.3	NP_056274.3	Q6DD88	ATLA3_HUMAN	atlastin GTPase 3						endoplasmic reticulum organization (GO:0007029)|Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|protein homooligomerization (GO:0051260)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	11						agcgcaggacgaggctaggcg	0.741																																																	0																																										SO:0001623	5_prime_UTR_variant	0				CCDS41663.1, CCDS73309.1	11q13.1	2008-09-17			ENSG00000184743	ENSG00000184743			24526	protein-coding gene	gene with protein product		609369				18270207	Standard	XM_005273891		Approved	DKFZP564J0863	uc001nxk.1	Q6DD88	OTTHUMG00000167854	ENST00000398868.3:c.-214C>T	11.37:g.63439021G>A			Q8N7W5|Q9H8Q5|Q9UFL1	RNA	SNP	-	NULL	ENST00000398868.3	37	NULL	CCDS41663.1	11																																																																																			ATL3	-	-	ENSG00000184743		0.741	ATL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATL3	HGNC	protein_coding	OTTHUMT00000396637.1	-	0.00	75	0	G	NM_015459		63439021	-1	tier1	-	no_errors	ENST00000535789	ensembl	human	known	74_37	rna	29.21	63	26	SNP	0.000	A
ATP2B2	491	genome.wustl.edu	37	3	10401655	10401655	+	Silent	SNP	G	G	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr3:10401655G>T	ENST00000352432.4	-	12	1881	c.1812C>A	c.(1810-1812)tcC>tcA	p.S604S	ATP2B2_ENST00000383800.4_Silent_p.S559S|ATP2B2_ENST00000343816.4_Silent_p.S590S|ATP2B2_ENST00000360273.2_Silent_p.S604S|ATP2B2_ENST00000397077.1_Silent_p.S559S			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	604					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						ACTTGCGCACGGAGTTGAAGG	0.582																																					Ovarian(125;1619 1709 15675 19819 38835)												0													105.0	85.0	92.0					3																	10401655		2203	4300	6503	SO:0001819	synonymous_variant	0			X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.1812C>A	3.37:g.10401655G>T			O00766|Q12994|Q16818	Silent	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_plasma,tigrfam_Cation_transp_P_typ_ATPase	p.S604	ENST00000352432.4	37	c.1812	CCDS33701.1	3																																																																																			ATP2B2	-	superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Ca-transp_plasma	ENSG00000157087		0.582	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	ATP2B2	HGNC	protein_coding	OTTHUMT00000250576.2		0.00	35	0	G	NM_001683		10401655	-1			no_errors	ENST00000352432	ensembl	human	known	74_37	silent	5.13	37	2	SNP	0.010	T
ATP13A5	344905	genome.wustl.edu	37	3	193039503	193039503	+	Nonsense_Mutation	SNP	C	C	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr3:193039503C>A	ENST00000342358.4	-	16	1999	c.1882G>T	c.(1882-1884)Gaa>Taa	p.E628*		NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	628						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)	p.E628*(1)		NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		GCCACCATTTCTGGGGCACCT	0.443																																																	1	Substitution - Nonsense(1)	kidney(1)											77.0	75.0	76.0					3																	193039503		2203	4300	6503	SO:0001587	stop_gained	0			AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.1882G>T	3.37:g.193039503C>A	ENSP00000341942:p.Glu628*		Q6UWS4|Q6ZWL0	Nonsense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_Cation_typ_V,pfam_ATPase_P-typ_cation-transptr_N,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Cation_typ_V,tigrfam_Cation_transp_P_typ_ATPase	p.E628*	ENST00000342358.4	37	c.1882	CCDS33914.1	3	.	.	.	.	.	.	.	.	.	.	C	41	8.960551	0.99018	.	.	ENSG00000187527	ENST00000342358	.	.	.	5.82	5.82	0.92795	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-22.1569	18.6639	0.91481	0.0:1.0:0.0:0.0	.	.	.	.	X	628	.	ENSP00000341942:E628X	E	-	1	0	ATP13A5	194522197	1.000000	0.71417	0.993000	0.49108	0.973000	0.67179	7.353000	0.79414	2.760000	0.94817	0.655000	0.94253	GAA	ATP13A5	-	superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,tigrfam_ATPase_P-typ_Cation_typ_V	ENSG00000187527		0.443	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A5	HGNC	protein_coding	OTTHUMT00000343012.1	-	0.00	59	0	C	NM_198505		193039503	-1	tier1	-	no_errors	ENST00000342358	ensembl	human	known	74_37	nonsense	5.97	63	4	SNP	1.000	A
ATP13A5	344905	genome.wustl.edu	37	3	193039503	193039503	+	Nonsense_Mutation	SNP	C	C	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr3:193039503C>A	ENST00000342358.4	-	16	1999	c.1882G>T	c.(1882-1884)Gaa>Taa	p.E628*		NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	628						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)	p.E628*(1)		NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		GCCACCATTTCTGGGGCACCT	0.443																																																	1	Substitution - Nonsense(1)	kidney(1)											77.0	75.0	76.0					3																	193039503		2203	4300	6503	SO:0001587	stop_gained	0			AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.1882G>T	3.37:g.193039503C>A	ENSP00000341942:p.Glu628*		Q6UWS4|Q6ZWL0	Nonsense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_Cation_typ_V,pfam_ATPase_P-typ_cation-transptr_N,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Cation_typ_V,tigrfam_Cation_transp_P_typ_ATPase	p.E628*	ENST00000342358.4	37	c.1882	CCDS33914.1	3	.	.	.	.	.	.	.	.	.	.	C	41	8.960551	0.99018	.	.	ENSG00000187527	ENST00000342358	.	.	.	5.82	5.82	0.92795	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-22.1569	18.6639	0.91481	0.0:1.0:0.0:0.0	.	.	.	.	X	628	.	ENSP00000341942:E628X	E	-	1	0	ATP13A5	194522197	1.000000	0.71417	0.993000	0.49108	0.973000	0.67179	7.353000	0.79414	2.760000	0.94817	0.655000	0.94253	GAA	ATP13A5	-	superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,tigrfam_ATPase_P-typ_Cation_typ_V	ENSG00000187527		0.443	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A5	HGNC	protein_coding	OTTHUMT00000343012.1	-	0.00	74	0	C	NM_198505		193039503	-1	tier1	-	no_errors	ENST00000342358	ensembl	human	known	74_37	nonsense	5.97	63	4	SNP	1.000	A
ATP8B2	57198	genome.wustl.edu	37	1	154316625	154316625	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:154316625G>T	ENST00000368489.3	+	19	2029	c.2029G>T	c.(2029-2031)Ggt>Tgt	p.G677C		NM_020452.3	NP_065185.1	P98198	AT8B2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 2	663					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)		IL6R/ATP8B2(2)	breast(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			TCAGCTGCTGGGTGCAACGGC	0.552																																																	0													74.0	71.0	72.0					1																	154316625		2203	4300	6503	SO:0001583	missense	0			AB032963	CCDS1066.1, CCDS41405.1	1q21.3	2012-03-09	2012-03-09		ENSG00000143515	ENSG00000143515		"""ATPases / P-type"""	13534	protein-coding gene	gene with protein product		605867	"""ATPase, class I, type 8B, member 2"""			10574461, 11015572	Standard	NM_020452		Approved	ATPID, KIAA1137	uc001fex.3	P98198	OTTHUMG00000035979	ENST00000368489.3:c.2029G>T	1.37:g.154316625G>T	ENSP00000357475:p.Gly677Cys		B4E3P4|Q6NT69|Q7Z486|Q96I43|Q96NQ7	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.G677C	ENST00000368489.3	37	c.2029	CCDS1066.1	1	.	.	.	.	.	.	.	.	.	.	G	17.57	3.422819	0.62733	.	.	ENSG00000143515	ENST00000368489	D	0.85411	-1.98	5.38	5.38	0.77491	.	0.062041	0.64402	D	0.000006	D	0.93598	0.7956	M	0.91300	3.195	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94291	0.7528	10	0.87932	D	0	.	17.8785	0.88833	0.0:0.0:1.0:0.0	.	677	P98198-3	.	C	677	ENSP00000357475:G677C	ENSP00000357475:G677C	G	+	1	0	ATP8B2	152583249	1.000000	0.71417	0.995000	0.50966	0.034000	0.12701	9.657000	0.98554	2.791000	0.96007	0.650000	0.86243	GGT	ATP8B2	-	superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000143515		0.552	ATP8B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP8B2	HGNC	protein_coding	OTTHUMT00000087658.2		0.00	24	0	G	NM_020452		154316625	+1			no_errors	ENST00000368489	ensembl	human	known	74_37	missense	11.11	24	3	SNP	1.000	T
BCAM	4059	genome.wustl.edu	37	19	45322680	45322680	+	Silent	SNP	C	C	T	rs372072867		TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr19:45322680C>T	ENST00000270233.6	+	12	1573	c.1551C>T	c.(1549-1551)cgC>cgT	p.R517R	BCAM_ENST00000589651.1_Silent_p.R517R	NM_001013257.2|NM_005581.4	NP_001013275.1|NP_005572.2	P50895	BCAM_HUMAN	basal cell adhesion molecule (Lutheran blood group)	517	Ig-like C2-type 3.				cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	laminin binding (GO:0043236)|laminin receptor activity (GO:0005055)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	22	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)				CCCTGAGCCGCGATGGCATCT	0.652																																																	0													77.0	84.0	82.0					19																	45322680		2203	4300	6503	SO:0001819	synonymous_variant	0			X83425	CCDS12644.1, CCDS42575.1	19q12-q13	2014-07-18	2006-02-23	2006-01-12		ENSG00000187244		"""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6722	protein-coding gene	gene with protein product		612773	"""Lutheran blood group (Auberger b antigen included)"", ""basal cell adhesion molecule (Lu and Au blood groups)"""	LU			Standard	NM_005581		Approved	CD239	uc002ozu.4	P50895		ENST00000270233.6:c.1551C>T	19.37:g.45322680C>T			A8MYF9|A9YWT5|A9YWT6|Q86VC7	Silent	SNP	pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R517	ENST00000270233.6	37	c.1551	CCDS12644.1	19																																																																																			BCAM	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000187244		0.652	BCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCAM	HGNC	protein_coding	OTTHUMT00000453220.1	-	0.00	50	0	C	NM_005581		45322680	+1	tier1	-	no_errors	ENST00000270233	ensembl	human	known	74_37	silent	11.54	46	6	SNP	0.047	T
BZRAP1	9256	genome.wustl.edu	37	17	56388425	56388426	+	Missense_Mutation	DNP	GG	GG	CC	rs374031972		TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr17:56388425_56388426GG>CC	ENST00000343736.4	-	19	3393_3394	c.3230_3231CC>GG	c.(3229-3231)gCC>gGG	p.A1077G	BZRAP1_ENST00000268893.6_Missense_Mutation_p.A1017G|BZRAP1_ENST00000355701.3_Missense_Mutation_p.A1077G			O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1	1077	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.|Pro-rich.					cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)			cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CCGGAGCCAGGGCGGGAGTGAT	0.708																																																	0																																										SO:0001583	missense	0			AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153		ENST00000343736.4:c.3230_3231delinsCC	17.37:g.56388425_56388426delinsCC	ENSP00000345824:p.Ala1077Gly		O75111|Q8N5W3	Silent|Missense_Mutation	SNP	pfam_SH3_2,superfamily_SH3_domain,superfamily_Fibronectin_type3,smart_SH3_domain,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_SH3_domain	p.A1077|p.A1077G	ENST00000343736.4	37	c.3231|c.3230	CCDS11605.1	17																																																																																			BZRAP1	-	superfamily_Fibronectin_type3	ENSG00000005379		0.708	BZRAP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	BZRAP1	HGNC	protein_coding	OTTHUMT00000443980.1		0.00	36|37	0	G	NM_004758		56388425|56388426	-1			no_errors	ENST00000355701	ensembl	human	known	74_37	silent|missense	26.76|26.39	52|53	19	SNP	1.000	C
CCDC7	79741	genome.wustl.edu	37	10	33123743	33123743	+	Splice_Site	SNP	A	A	C			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr10:33123743A>C	ENST00000375030.2	+	15	1577	c.959A>C	c.(958-960)gAg>gCg	p.E320A	C10orf68_ENST00000375028.3_Splice_Site_p.E337A|C10orf68_ENST00000375025.4_Splice_Site_p.E397A			Q9H943	CJ068_HUMAN		361										breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(4)	29						ATTTTTATAGAGACTGTCTTA	0.299																																																	0													36.0	34.0	35.0					10																	33123743		2196	4288	6484	SO:0001630	splice_region_variant	0																														ENST00000375030.2:c.959-1A>C	10.37:g.33123743A>C			B0QZ71|Q08AN7|Q8N7T7	Missense_Mutation	SNP	NULL	p.E397A	ENST00000375030.2	37	c.1190		10	.	.	.	.	.	.	.	.	.	.	.	11.43	1.636390	0.29068	.	.	ENSG00000150076	ENST00000302316;ENST00000375030;ENST00000375028;ENST00000375025;ENST00000375037	T;T;T;T	0.31247	1.52;1.51;1.51;1.5	2.24	0.998	0.19857	.	.	.	.	.	T	0.42539	0.1207	L	0.55481	1.735	0.09310	N	1	D;P;D;P	0.56035	0.974;0.927;0.974;0.7	D;D;D;B	0.67725	0.953;0.953;0.953;0.162	T	0.16719	-1.0393	8	.	.	.	.	5.0217	0.14365	0.6847:0.3153:0.0:0.0	.	314;361;337;320	B4DX58;Q9H943;A2A3B4;A2A3D6	.;CJ068_HUMAN;.;.	A	361;320;337;397;309	ENSP00000303710:E361A;ENSP00000364170:E320A;ENSP00000364168:E337A;ENSP00000364165:E397A	.	E	+	2	0	C10orf68	33163749	0.173000	0.23056	0.034000	0.17996	0.015000	0.08874	0.486000	0.22340	0.263000	0.21812	0.402000	0.26972	GAG	C10orf68	-	NULL	ENSG00000150076		0.299	C10orf68-001	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	C10orf68	HGNC	protein_coding	OTTHUMT00000313999.2	-	0.00	88	0	A		Missense_Mutation	33123743	+1	tier1	-	no_errors	ENST00000375025	ensembl	human	known	74_37	missense	21.97	103	29	SNP	0.043	C
C16orf96	342346	genome.wustl.edu	37	16	4624733	4624733	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr16:4624733C>G	ENST00000444310.4	+	3	549	c.549C>G	c.(547-549)atC>atG	p.I183M		NM_001145011.1	NP_001138483.1			chromosome 16 open reading frame 96											NS(1)|breast(1)|endometrium(6)|kidney(1)|skin(3)	12						GAATGGACATCTTTGCTGAAG	0.557																																																	0													83.0	83.0	83.0					16																	4624733		692	1591	2283	SO:0001583	missense	0				CCDS53986.1	16p13.3	2012-10-10			ENSG00000205832	ENSG00000205832			40031	protein-coding gene	gene with protein product							Standard	NM_001145011		Approved		uc010uxn.2	A6NNT2	OTTHUMG00000176519	ENST00000444310.4:c.549C>G	16.37:g.4624733C>G	ENSP00000415027:p.Ile183Met			Missense_Mutation	SNP	NULL	p.I183M	ENST00000444310.4	37	c.549	CCDS53986.1	16	.	.	.	.	.	.	.	.	.	.	C	10.52	1.373962	0.24857	.	.	ENSG00000205832	ENST00000444310	T	0.22134	1.97	5.0	-10.0	0.00425	.	1.999330	0.02412	N	0.081709	T	0.08268	0.0206	N	0.08118	0	0.09310	N	1	B	0.12013	0.005	B	0.09377	0.004	T	0.23976	-1.0173	10	0.56958	D	0.05	3.5307	3.2377	0.06770	0.094:0.2041:0.3757:0.3262	.	183	A6NNT2	CP096_HUMAN	M	183	ENSP00000415027:I183M	ENSP00000415027:I183M	I	+	3	3	C16orf96	4564734	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.475000	0.00987	-2.018000	0.00943	-1.129000	0.01985	ATC	C16orf96	-	NULL	ENSG00000205832		0.557	C16orf96-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C16orf96	HGNC	protein_coding	OTTHUMT00000432384.1	-	0.00	43	0	C	NM_001145011		4624733	+1	tier1	-	no_errors	ENST00000444310	ensembl	human	known	74_37	missense	12.50	84	12	SNP	0.000	G
C16orf96	342346	genome.wustl.edu	37	16	4624733	4624733	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr16:4624733C>G	ENST00000444310.4	+	3	549	c.549C>G	c.(547-549)atC>atG	p.I183M		NM_001145011.1	NP_001138483.1			chromosome 16 open reading frame 96											NS(1)|breast(1)|endometrium(6)|kidney(1)|skin(3)	12						GAATGGACATCTTTGCTGAAG	0.557																																																	0													83.0	83.0	83.0					16																	4624733		692	1591	2283	SO:0001583	missense	0				CCDS53986.1	16p13.3	2012-10-10			ENSG00000205832	ENSG00000205832			40031	protein-coding gene	gene with protein product							Standard	NM_001145011		Approved		uc010uxn.2	A6NNT2	OTTHUMG00000176519	ENST00000444310.4:c.549C>G	16.37:g.4624733C>G	ENSP00000415027:p.Ile183Met			Missense_Mutation	SNP	NULL	p.I183M	ENST00000444310.4	37	c.549	CCDS53986.1	16	.	.	.	.	.	.	.	.	.	.	C	10.52	1.373962	0.24857	.	.	ENSG00000205832	ENST00000444310	T	0.22134	1.97	5.0	-10.0	0.00425	.	1.999330	0.02412	N	0.081709	T	0.08268	0.0206	N	0.08118	0	0.09310	N	1	B	0.12013	0.005	B	0.09377	0.004	T	0.23976	-1.0173	10	0.56958	D	0.05	3.5307	3.2377	0.06770	0.094:0.2041:0.3757:0.3262	.	183	A6NNT2	CP096_HUMAN	M	183	ENSP00000415027:I183M	ENSP00000415027:I183M	I	+	3	3	C16orf96	4564734	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.475000	0.00987	-2.018000	0.00943	-1.129000	0.01985	ATC	C16orf96	-	NULL	ENSG00000205832		0.557	C16orf96-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C16orf96	HGNC	protein_coding	OTTHUMT00000432384.1	-	0.00	56	0	C	NM_001145011		4624733	+1	tier1	-	no_errors	ENST00000444310	ensembl	human	known	74_37	missense	12.50	84	12	SNP	0.000	G
C16orf96	342346	genome.wustl.edu	37	16	4624981	4624981	+	Silent	SNP	C	C	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr16:4624981C>G	ENST00000444310.4	+	4	615	c.615C>G	c.(613-615)ctC>ctG	p.L205L		NM_001145011.1	NP_001138483.1			chromosome 16 open reading frame 96											NS(1)|breast(1)|endometrium(6)|kidney(1)|skin(3)	12						AGGCTTCTCTCCAGAATAAGT	0.542																																																	0													92.0	86.0	88.0					16																	4624981		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS53986.1	16p13.3	2012-10-10			ENSG00000205832	ENSG00000205832			40031	protein-coding gene	gene with protein product							Standard	NM_001145011		Approved		uc010uxn.2	A6NNT2	OTTHUMG00000176519	ENST00000444310.4:c.615C>G	16.37:g.4624981C>G				Silent	SNP	NULL	p.L205	ENST00000444310.4	37	c.615	CCDS53986.1	16																																																																																			C16orf96	-	NULL	ENSG00000205832		0.542	C16orf96-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C16orf96	HGNC	protein_coding	OTTHUMT00000432384.1	-	0.00	35	0	C	NM_001145011		4624981	+1	tier1	-	no_errors	ENST00000444310	ensembl	human	known	74_37	silent	9.86	64	7	SNP	0.932	G
C16orf96	342346	genome.wustl.edu	37	16	4624981	4624981	+	Silent	SNP	C	C	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr16:4624981C>G	ENST00000444310.4	+	4	615	c.615C>G	c.(613-615)ctC>ctG	p.L205L		NM_001145011.1	NP_001138483.1			chromosome 16 open reading frame 96											NS(1)|breast(1)|endometrium(6)|kidney(1)|skin(3)	12						AGGCTTCTCTCCAGAATAAGT	0.542																																																	0													92.0	86.0	88.0					16																	4624981		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS53986.1	16p13.3	2012-10-10			ENSG00000205832	ENSG00000205832			40031	protein-coding gene	gene with protein product							Standard	NM_001145011		Approved		uc010uxn.2	A6NNT2	OTTHUMG00000176519	ENST00000444310.4:c.615C>G	16.37:g.4624981C>G				Silent	SNP	NULL	p.L205	ENST00000444310.4	37	c.615	CCDS53986.1	16																																																																																			C16orf96	-	NULL	ENSG00000205832		0.542	C16orf96-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C16orf96	HGNC	protein_coding	OTTHUMT00000432384.1	-	0.00	51	0	C	NM_001145011		4624981	+1	tier1	-	no_errors	ENST00000444310	ensembl	human	known	74_37	silent	9.86	64	7	SNP	0.932	G
C16orf96	342346	genome.wustl.edu	37	16	4625294	4625294	+	Silent	SNP	C	C	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr16:4625294C>G	ENST00000444310.4	+	5	813	c.813C>G	c.(811-813)gtC>gtG	p.V271V		NM_001145011.1	NP_001138483.1			chromosome 16 open reading frame 96											NS(1)|breast(1)|endometrium(6)|kidney(1)|skin(3)	12						CCGAGCCCGTCCAAAACCCCC	0.607																																																	0													45.0	45.0	45.0					16																	4625294		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS53986.1	16p13.3	2012-10-10			ENSG00000205832	ENSG00000205832			40031	protein-coding gene	gene with protein product							Standard	NM_001145011		Approved		uc010uxn.2	A6NNT2	OTTHUMG00000176519	ENST00000444310.4:c.813C>G	16.37:g.4625294C>G				Silent	SNP	NULL	p.V271	ENST00000444310.4	37	c.813	CCDS53986.1	16																																																																																			C16orf96	-	NULL	ENSG00000205832		0.607	C16orf96-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C16orf96	HGNC	protein_coding	OTTHUMT00000432384.1	-	0.00	48	0	C	NM_001145011		4625294	+1	tier1	-	no_errors	ENST00000444310	ensembl	human	known	74_37	silent	5.83	97	6	SNP	0.000	G
C16orf96	342346	genome.wustl.edu	37	16	4625294	4625294	+	Silent	SNP	C	C	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr16:4625294C>G	ENST00000444310.4	+	5	813	c.813C>G	c.(811-813)gtC>gtG	p.V271V		NM_001145011.1	NP_001138483.1			chromosome 16 open reading frame 96											NS(1)|breast(1)|endometrium(6)|kidney(1)|skin(3)	12						CCGAGCCCGTCCAAAACCCCC	0.607																																																	0													45.0	45.0	45.0					16																	4625294		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS53986.1	16p13.3	2012-10-10			ENSG00000205832	ENSG00000205832			40031	protein-coding gene	gene with protein product							Standard	NM_001145011		Approved		uc010uxn.2	A6NNT2	OTTHUMG00000176519	ENST00000444310.4:c.813C>G	16.37:g.4625294C>G				Silent	SNP	NULL	p.V271	ENST00000444310.4	37	c.813	CCDS53986.1	16																																																																																			C16orf96	-	NULL	ENSG00000205832		0.607	C16orf96-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C16orf96	HGNC	protein_coding	OTTHUMT00000432384.1	-	0.00	82	0	C	NM_001145011		4625294	+1	tier1	-	no_errors	ENST00000444310	ensembl	human	known	74_37	silent	5.83	97	6	SNP	0.000	G
C16orf96	342346	genome.wustl.edu	37	16	4625362	4625362	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr16:4625362C>G	ENST00000444310.4	+	5	881	c.881C>G	c.(880-882)tCt>tGt	p.S294C		NM_001145011.1	NP_001138483.1			chromosome 16 open reading frame 96											NS(1)|breast(1)|endometrium(6)|kidney(1)|skin(3)	12						GAGGGCTCATCTGCCCAAGCA	0.622																																																	0													44.0	44.0	44.0					16																	4625362		692	1591	2283	SO:0001583	missense	0				CCDS53986.1	16p13.3	2012-10-10			ENSG00000205832	ENSG00000205832			40031	protein-coding gene	gene with protein product							Standard	NM_001145011		Approved		uc010uxn.2	A6NNT2	OTTHUMG00000176519	ENST00000444310.4:c.881C>G	16.37:g.4625362C>G	ENSP00000415027:p.Ser294Cys			Missense_Mutation	SNP	NULL	p.S294C	ENST00000444310.4	37	c.881	CCDS53986.1	16	.	.	.	.	.	.	.	.	.	.	C	12.22	1.873506	0.33069	.	.	ENSG00000205832	ENST00000444310	.	.	.	3.48	1.49	0.22878	.	.	.	.	.	T	0.34978	0.0916	N	0.19112	0.55	0.09310	N	1	D	0.71674	0.998	P	0.61940	0.896	T	0.11251	-1.0595	8	0.41790	T	0.15	.	5.1433	0.14971	0.0:0.7201:0.0:0.2799	.	294	A6NNT2	CP096_HUMAN	C	294	.	ENSP00000415027:S294C	S	+	2	0	C16orf96	4565363	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	0.135000	0.15952	0.456000	0.26937	0.462000	0.41574	TCT	C16orf96	-	NULL	ENSG00000205832		0.622	C16orf96-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C16orf96	HGNC	protein_coding	OTTHUMT00000432384.1	-	0.00	43	0	C	NM_001145011		4625362	+1	tier1	-	no_errors	ENST00000444310	ensembl	human	known	74_37	missense	7.50	74	6	SNP	0.000	G
C16orf96	342346	genome.wustl.edu	37	16	4625362	4625362	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr16:4625362C>G	ENST00000444310.4	+	5	881	c.881C>G	c.(880-882)tCt>tGt	p.S294C		NM_001145011.1	NP_001138483.1			chromosome 16 open reading frame 96											NS(1)|breast(1)|endometrium(6)|kidney(1)|skin(3)	12						GAGGGCTCATCTGCCCAAGCA	0.622																																																	0													44.0	44.0	44.0					16																	4625362		692	1591	2283	SO:0001583	missense	0				CCDS53986.1	16p13.3	2012-10-10			ENSG00000205832	ENSG00000205832			40031	protein-coding gene	gene with protein product							Standard	NM_001145011		Approved		uc010uxn.2	A6NNT2	OTTHUMG00000176519	ENST00000444310.4:c.881C>G	16.37:g.4625362C>G	ENSP00000415027:p.Ser294Cys			Missense_Mutation	SNP	NULL	p.S294C	ENST00000444310.4	37	c.881	CCDS53986.1	16	.	.	.	.	.	.	.	.	.	.	C	12.22	1.873506	0.33069	.	.	ENSG00000205832	ENST00000444310	.	.	.	3.48	1.49	0.22878	.	.	.	.	.	T	0.34978	0.0916	N	0.19112	0.55	0.09310	N	1	D	0.71674	0.998	P	0.61940	0.896	T	0.11251	-1.0595	8	0.41790	T	0.15	.	5.1433	0.14971	0.0:0.7201:0.0:0.2799	.	294	A6NNT2	CP096_HUMAN	C	294	.	ENSP00000415027:S294C	S	+	2	0	C16orf96	4565363	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	0.135000	0.15952	0.456000	0.26937	0.462000	0.41574	TCT	C16orf96	-	NULL	ENSG00000205832		0.622	C16orf96-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C16orf96	HGNC	protein_coding	OTTHUMT00000432384.1	-	0.00	66	0	C	NM_001145011		4625362	+1	tier1	-	no_errors	ENST00000444310	ensembl	human	known	74_37	missense	7.50	74	6	SNP	0.000	G
C16orf96	342346	genome.wustl.edu	37	16	4626538	4626538	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr16:4626538C>A	ENST00000444310.4	+	5	2057	c.2057C>A	c.(2056-2058)tCc>tAc	p.S686Y		NM_001145011.1	NP_001138483.1			chromosome 16 open reading frame 96											NS(1)|breast(1)|endometrium(6)|kidney(1)|skin(3)	12						GTCAAGTATTCCATGAGCCAC	0.542																																																	0													56.0	53.0	54.0					16																	4626538		692	1591	2283	SO:0001583	missense	0				CCDS53986.1	16p13.3	2012-10-10			ENSG00000205832	ENSG00000205832			40031	protein-coding gene	gene with protein product							Standard	NM_001145011		Approved		uc010uxn.2	A6NNT2	OTTHUMG00000176519	ENST00000444310.4:c.2057C>A	16.37:g.4626538C>A	ENSP00000415027:p.Ser686Tyr			Missense_Mutation	SNP	NULL	p.S686Y	ENST00000444310.4	37	c.2057	CCDS53986.1	16	.	.	.	.	.	.	.	.	.	.	C	13.17	2.155932	0.38021	.	.	ENSG00000205832	ENST00000444310	.	.	.	4.46	4.46	0.54185	.	.	.	.	.	T	0.59649	0.2209	L	0.27053	0.805	0.33335	D	0.569068	D	0.89917	1.0	D	0.91635	0.999	T	0.67688	-0.5606	8	0.87932	D	0	.	12.9053	0.58149	0.0:1.0:0.0:0.0	.	686	A6NNT2	CP096_HUMAN	Y	686	.	ENSP00000415027:S686Y	S	+	2	0	C16orf96	4566539	0.997000	0.39634	0.993000	0.49108	0.034000	0.12701	3.359000	0.52292	2.768000	0.95171	0.491000	0.48974	TCC	C16orf96	-	NULL	ENSG00000205832		0.542	C16orf96-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C16orf96	HGNC	protein_coding	OTTHUMT00000432384.1	-	0.00	38	0	C	NM_001145011		4626538	+1	tier1	-	no_errors	ENST00000444310	ensembl	human	known	74_37	missense	8.45	65	6	SNP	0.994	A
C16orf96	342346	genome.wustl.edu	37	16	4626538	4626538	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr16:4626538C>A	ENST00000444310.4	+	5	2057	c.2057C>A	c.(2056-2058)tCc>tAc	p.S686Y		NM_001145011.1	NP_001138483.1			chromosome 16 open reading frame 96											NS(1)|breast(1)|endometrium(6)|kidney(1)|skin(3)	12						GTCAAGTATTCCATGAGCCAC	0.542																																																	0													56.0	53.0	54.0					16																	4626538		692	1591	2283	SO:0001583	missense	0				CCDS53986.1	16p13.3	2012-10-10			ENSG00000205832	ENSG00000205832			40031	protein-coding gene	gene with protein product							Standard	NM_001145011		Approved		uc010uxn.2	A6NNT2	OTTHUMG00000176519	ENST00000444310.4:c.2057C>A	16.37:g.4626538C>A	ENSP00000415027:p.Ser686Tyr			Missense_Mutation	SNP	NULL	p.S686Y	ENST00000444310.4	37	c.2057	CCDS53986.1	16	.	.	.	.	.	.	.	.	.	.	C	13.17	2.155932	0.38021	.	.	ENSG00000205832	ENST00000444310	.	.	.	4.46	4.46	0.54185	.	.	.	.	.	T	0.59649	0.2209	L	0.27053	0.805	0.33335	D	0.569068	D	0.89917	1.0	D	0.91635	0.999	T	0.67688	-0.5606	8	0.87932	D	0	.	12.9053	0.58149	0.0:1.0:0.0:0.0	.	686	A6NNT2	CP096_HUMAN	Y	686	.	ENSP00000415027:S686Y	S	+	2	0	C16orf96	4566539	0.997000	0.39634	0.993000	0.49108	0.034000	0.12701	3.359000	0.52292	2.768000	0.95171	0.491000	0.48974	TCC	C16orf96	-	NULL	ENSG00000205832		0.542	C16orf96-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C16orf96	HGNC	protein_coding	OTTHUMT00000432384.1	-	0.00	41	0	C	NM_001145011		4626538	+1	tier1	-	no_errors	ENST00000444310	ensembl	human	known	74_37	missense	8.45	65	6	SNP	0.994	A
C16orf96	342346	genome.wustl.edu	37	16	4626566	4626566	+	Silent	SNP	C	C	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr16:4626566C>G	ENST00000444310.4	+	5	2085	c.2085C>G	c.(2083-2085)gtC>gtG	p.V695V		NM_001145011.1	NP_001138483.1			chromosome 16 open reading frame 96											NS(1)|breast(1)|endometrium(6)|kidney(1)|skin(3)	12						AGATACCTGTCAAACACGACT	0.552																																																	0													60.0	57.0	58.0					16																	4626566		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS53986.1	16p13.3	2012-10-10			ENSG00000205832	ENSG00000205832			40031	protein-coding gene	gene with protein product							Standard	NM_001145011		Approved		uc010uxn.2	A6NNT2	OTTHUMG00000176519	ENST00000444310.4:c.2085C>G	16.37:g.4626566C>G				Silent	SNP	NULL	p.V695	ENST00000444310.4	37	c.2085	CCDS53986.1	16																																																																																			C16orf96	-	NULL	ENSG00000205832		0.552	C16orf96-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C16orf96	HGNC	protein_coding	OTTHUMT00000432384.1	-	0.00	39	0	C	NM_001145011		4626566	+1	tier1	-	no_errors	ENST00000444310	ensembl	human	known	74_37	silent	7.14	64	5	SNP	0.000	G
C16orf96	342346	genome.wustl.edu	37	16	4626566	4626566	+	Silent	SNP	C	C	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr16:4626566C>G	ENST00000444310.4	+	5	2085	c.2085C>G	c.(2083-2085)gtC>gtG	p.V695V		NM_001145011.1	NP_001138483.1			chromosome 16 open reading frame 96											NS(1)|breast(1)|endometrium(6)|kidney(1)|skin(3)	12						AGATACCTGTCAAACACGACT	0.552																																																	0													60.0	57.0	58.0					16																	4626566		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS53986.1	16p13.3	2012-10-10			ENSG00000205832	ENSG00000205832			40031	protein-coding gene	gene with protein product							Standard	NM_001145011		Approved		uc010uxn.2	A6NNT2	OTTHUMG00000176519	ENST00000444310.4:c.2085C>G	16.37:g.4626566C>G				Silent	SNP	NULL	p.V695	ENST00000444310.4	37	c.2085	CCDS53986.1	16																																																																																			C16orf96	-	NULL	ENSG00000205832		0.552	C16orf96-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C16orf96	HGNC	protein_coding	OTTHUMT00000432384.1	-	0.00	51	0	C	NM_001145011		4626566	+1	tier1	-	no_errors	ENST00000444310	ensembl	human	known	74_37	silent	7.14	64	5	SNP	0.000	G
C16orf96	342346	genome.wustl.edu	37	16	4626438	4626439	+	Silent	DNP	TC	TC	AG			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	T|C	T|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr16:4626438_4626439TC>AG	ENST00000444310.4	+	5	1957_1958	c.1957_1958TC>AG	c.(1957-1959)TCt>AGt	p.S653S		NM_001145011.1	NP_001138483.1			chromosome 16 open reading frame 96											NS(1)|breast(1)|endometrium(6)|kidney(1)|skin(3)	12						TCCCTCCTACTCTGCTGCCAGC	0.579																																																	0																																										SO:0001819	synonymous_variant	0				CCDS53986.1	16p13.3	2012-10-10			ENSG00000205832	ENSG00000205832			40031	protein-coding gene	gene with protein product							Standard	NM_001145011		Approved		uc010uxn.2	A6NNT2	OTTHUMG00000176519	Exception_encountered	16.37:g.4626438_4626439delinsAG				Missense_Mutation	SNP	NULL	p.S653T|p.S653C	ENST00000444310.4	37	c.1957|c.1958	CCDS53986.1	16																																																																																			C16orf96	-	NULL	ENSG00000205832		0.579	C16orf96-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C16orf96	HGNC	protein_coding	OTTHUMT00000432384.1		0.00	49	0	T|C	NM_001145011		4626438|4626439	+1			no_errors	ENST00000444310	ensembl	human	known	74_37	missense	11.36|11.63	78|76	10	SNP	0.000	A|G
C16orf96	342346	genome.wustl.edu	37	16	4626579	4626579	+	Missense_Mutation	SNP	C	C	A	rs369792596		TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr16:4626579C>A	ENST00000444310.4	+	5	2098	c.2098C>A	c.(2098-2100)Ctg>Atg	p.L700M		NM_001145011.1	NP_001138483.1			chromosome 16 open reading frame 96											NS(1)|breast(1)|endometrium(6)|kidney(1)|skin(3)	12						ACACGACTCTCTGAAGGAAGA	0.547																																																	0													64.0	60.0	62.0					16																	4626579		692	1591	2283	SO:0001583	missense	0				CCDS53986.1	16p13.3	2012-10-10			ENSG00000205832	ENSG00000205832			40031	protein-coding gene	gene with protein product							Standard	NM_001145011		Approved		uc010uxn.2	A6NNT2	OTTHUMG00000176519	ENST00000444310.4:c.2098C>A	16.37:g.4626579C>A	ENSP00000415027:p.Leu700Met			Missense_Mutation	SNP	NULL	p.L700M	ENST00000444310.4	37	c.2098	CCDS53986.1	16	.	.	.	.	.	.	.	.	.	.	C	9.621	1.133919	0.21123	.	.	ENSG00000205832	ENST00000444310	.	.	.	4.46	1.36	0.22044	.	.	.	.	.	T	0.20333	0.0489	L	0.27053	0.805	0.09310	N	1	P	0.46912	0.886	B	0.42245	0.381	T	0.10222	-1.0639	8	0.59425	D	0.04	.	5.5445	0.17055	0.3105:0.5881:0.0:0.1013	.	700	A6NNT2	CP096_HUMAN	M	700	.	ENSP00000415027:L700M	L	+	1	2	C16orf96	4566580	0.974000	0.33945	0.170000	0.22879	0.034000	0.12701	0.576000	0.23744	0.345000	0.23873	0.491000	0.48974	CTG	C16orf96	-	NULL	ENSG00000205832		0.547	C16orf96-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C16orf96	HGNC	protein_coding	OTTHUMT00000432384.1	-	0.00	40	0	C	NM_001145011		4626579	+1	tier1	-	no_errors	ENST00000444310	ensembl	human	known	74_37	missense	8.82	62	6	SNP	0.253	A
C16orf96	342346	genome.wustl.edu	37	16	4626579	4626579	+	Missense_Mutation	SNP	C	C	A	rs369792596		TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr16:4626579C>A	ENST00000444310.4	+	5	2098	c.2098C>A	c.(2098-2100)Ctg>Atg	p.L700M		NM_001145011.1	NP_001138483.1			chromosome 16 open reading frame 96											NS(1)|breast(1)|endometrium(6)|kidney(1)|skin(3)	12						ACACGACTCTCTGAAGGAAGA	0.547																																																	0													64.0	60.0	62.0					16																	4626579		692	1591	2283	SO:0001583	missense	0				CCDS53986.1	16p13.3	2012-10-10			ENSG00000205832	ENSG00000205832			40031	protein-coding gene	gene with protein product							Standard	NM_001145011		Approved		uc010uxn.2	A6NNT2	OTTHUMG00000176519	ENST00000444310.4:c.2098C>A	16.37:g.4626579C>A	ENSP00000415027:p.Leu700Met			Missense_Mutation	SNP	NULL	p.L700M	ENST00000444310.4	37	c.2098	CCDS53986.1	16	.	.	.	.	.	.	.	.	.	.	C	9.621	1.133919	0.21123	.	.	ENSG00000205832	ENST00000444310	.	.	.	4.46	1.36	0.22044	.	.	.	.	.	T	0.20333	0.0489	L	0.27053	0.805	0.09310	N	1	P	0.46912	0.886	B	0.42245	0.381	T	0.10222	-1.0639	8	0.59425	D	0.04	.	5.5445	0.17055	0.3105:0.5881:0.0:0.1013	.	700	A6NNT2	CP096_HUMAN	M	700	.	ENSP00000415027:L700M	L	+	1	2	C16orf96	4566580	0.974000	0.33945	0.170000	0.22879	0.034000	0.12701	0.576000	0.23744	0.345000	0.23873	0.491000	0.48974	CTG	C16orf96	-	NULL	ENSG00000205832		0.547	C16orf96-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C16orf96	HGNC	protein_coding	OTTHUMT00000432384.1	-	0.00	49	0	C	NM_001145011		4626579	+1	tier1	-	no_errors	ENST00000444310	ensembl	human	known	74_37	missense	8.82	62	6	SNP	0.253	A
C1orf94	84970	genome.wustl.edu	37	1	34663156	34663156	+	Silent	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:34663156G>A	ENST00000488417.1	+	2	771	c.651G>A	c.(649-651)aaG>aaA	p.K217K	C1orf94_ENST00000373374.3_Silent_p.K27K	NM_001134734.1	NP_001128206.1	Q6P1W5	CA094_HUMAN	chromosome 1 open reading frame 94	217										central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(15)|skin(4)|upper_aerodigestive_tract(2)	32		Myeloproliferative disorder(586;0.0393)				CCGAGGTCAAGAGCAGCAAGG	0.552																																																	0													85.0	75.0	78.0					1																	34663156		2203	4300	6503	SO:0001819	synonymous_variant	0			AK123355	CCDS381.1, CCDS44108.1	1p34.3	2012-06-26			ENSG00000142698	ENSG00000142698			28250	protein-coding gene	gene with protein product						12477932	Standard	NM_001134734		Approved	MGC15882	uc001bxt.3	Q6P1W5	OTTHUMG00000004012	ENST00000488417.1:c.651G>A	1.37:g.34663156G>A			B3KVT1|D3DPR3|E9PJ76|Q96IC8	Silent	SNP	NULL	p.K217	ENST00000488417.1	37	c.651	CCDS44108.1	1																																																																																			C1orf94	-	NULL	ENSG00000142698		0.552	C1orf94-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf94	HGNC	protein_coding	OTTHUMT00000036845.2		0.00	34	0	G	NM_032884		34663156	+1			no_errors	ENST00000488417	ensembl	human	known	74_37	silent	23.53	13	4	SNP	0.773	A
C3P1	388503	genome.wustl.edu	37	19	10181677	10181677	+	RNA	SNP	C	C	T	rs566001873		TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr19:10181677C>T	ENST00000495140.1	+	0	2908							Q6ZMU1	C3P1_HUMAN	complement component 3 precursor pseudogene							extracellular space (GO:0005615)	endopeptidase inhibitor activity (GO:0004866)			endometrium(4)|large_intestine(2)|lung(6)|urinary_tract(1)	13						GAGAAGAACACGGTGCTGGGC	0.617													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18416	0.0		0.0	False		,,,				2504	0.0																0																																												0			AK131489		19p13.2	2009-04-08			ENSG00000167798	ENSG00000167798			34414	pseudogene	pseudogene							Standard	NR_027300		Approved	CPLP	uc010dwx.2	Q6ZMU1	OTTHUMG00000158555		19.37:g.10181677C>T				RNA	SNP	-	NULL	ENST00000495140.1	37	NULL		19																																																																																			C3P1	-	-	ENSG00000167798		0.617	C3P1-002	KNOWN	basic	processed_transcript	C3P1	HGNC	pseudogene	OTTHUMT00000351284.1	-	0.00	34	0	C	NR_027300		10181677	+1	tier1	-	no_errors	ENST00000495140	ensembl	human	known	74_37	rna	7.41	49	4	SNP	0.570	T
C3P1	388503	genome.wustl.edu	37	19	10181677	10181677	+	RNA	SNP	C	C	T	rs566001873		TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr19:10181677C>T	ENST00000495140.1	+	0	2908							Q6ZMU1	C3P1_HUMAN	complement component 3 precursor pseudogene							extracellular space (GO:0005615)	endopeptidase inhibitor activity (GO:0004866)			endometrium(4)|large_intestine(2)|lung(6)|urinary_tract(1)	13						GAGAAGAACACGGTGCTGGGC	0.617													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18416	0.0		0.0	False		,,,				2504	0.0																0																																												0			AK131489		19p13.2	2009-04-08			ENSG00000167798	ENSG00000167798			34414	pseudogene	pseudogene							Standard	NR_027300		Approved	CPLP	uc010dwx.2	Q6ZMU1	OTTHUMG00000158555		19.37:g.10181677C>T				RNA	SNP	-	NULL	ENST00000495140.1	37	NULL		19																																																																																			C3P1	-	-	ENSG00000167798		0.617	C3P1-002	KNOWN	basic	processed_transcript	C3P1	HGNC	pseudogene	OTTHUMT00000351284.1	-	0.00	36	0	C	NR_027300		10181677	+1	tier1	-	no_errors	ENST00000495140	ensembl	human	known	74_37	rna	7.41	49	4	SNP	0.570	T
CCDC160	347475	genome.wustl.edu	37	X	133379047	133379047	+	Missense_Mutation	SNP	A	A	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chrX:133379047A>G	ENST00000517294.1	+	3	600	c.217A>G	c.(217-219)Ata>Gta	p.I73V	CCDC160_ENST00000370809.4_Missense_Mutation_p.I73V			A6NGH7	CC160_HUMAN	coiled-coil domain containing 160	73										endometrium(1)|kidney(2)|large_intestine(10)|lung(2)|prostate(1)|skin(1)	17						ACTAAATGAAATAGAACAAGA	0.294																																																	0													17.0	14.0	15.0					X																	133379047		1775	4026	5801	SO:0001583	missense	0			BC017958	CCDS48171.1	Xq26.2	2010-02-17			ENSG00000203952	ENSG00000203952			37286	protein-coding gene	gene with protein product							Standard	NM_001101357		Approved		uc011mvj.2	A6NGH7	OTTHUMG00000164183	ENST00000517294.1:c.217A>G	X.37:g.133379047A>G	ENSP00000427951:p.Ile73Val			Missense_Mutation	SNP	NULL	p.I73V	ENST00000517294.1	37	c.217	CCDS48171.1	X	.	.	.	.	.	.	.	.	.	.	A	1.334	-0.595964	0.03771	.	.	ENSG00000203952	ENST00000517294;ENST00000370809	.	.	.	5.31	2.78	0.32641	.	0.828034	0.10555	N	0.660994	T	0.14787	0.0357	N	0.08118	0	0.09310	N	1	B	0.21225	0.053	B	0.23018	0.043	T	0.31888	-0.9927	9	0.12430	T	0.62	0.0469	1.2251	0.01932	0.4731:0.2544:0.108:0.1646	.	73	A6NGH7	CC160_HUMAN	V	73	.	ENSP00000359845:I73V	I	+	1	0	CCDC160	133206713	0.010000	0.17322	0.010000	0.14722	0.069000	0.16628	0.489000	0.22387	0.758000	0.33059	0.481000	0.45027	ATA	CCDC160	-	NULL	ENSG00000203952		0.294	CCDC160-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	CCDC160	HGNC	protein_coding	OTTHUMT00000377679.1	-	0.00	47	0	A	NM_001101357		133379047	+1	tier1	-	no_errors	ENST00000370809	ensembl	human	known	74_37	missense	41.03	46	32	SNP	0.006	G
CCT6P3	643180	genome.wustl.edu	37	7	64530103	64530103	+	RNA	SNP	G	G	A	rs369683052		TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr7:64530103G>A	ENST00000426828.1	+	0	923				SNORA15_ENST00000384334.1_RNA	NR_033416.1				chaperonin containing TCP1, subunit 6 (zeta) pseudogene 3																		TGACTGCTTGGGACATGCAGG	0.388																																																	0																																												0					7q11.21	2010-06-29			ENSG00000234585	ENSG00000234585			35137	pseudogene	pseudogene							Standard	NR_033416		Approved		uc010kzt.1		OTTHUMG00000156630		7.37:g.64530103G>A				RNA	SNP	-	NULL	ENST00000426828.1	37	NULL		7																																																																																			CCT6P3	-	-	ENSG00000234585		0.388	CCT6P3-004	KNOWN	basic	processed_transcript	CCT6P3	HGNC	pseudogene	OTTHUMT00000344862.1		0.00	74	0	G			64530103	+1			no_errors	ENST00000426828	ensembl	human	known	74_37	rna	7.02	53	4	SNP	1.000	A
CDH12	1010	genome.wustl.edu	37	5	21802328	21802328	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr5:21802328T>C	ENST00000382254.1	-	10	2290	c.1204A>G	c.(1204-1206)Atc>Gtc	p.I402V	CDH12_ENST00000522262.1_Missense_Mutation_p.I362V|CDH12_ENST00000504376.2_Missense_Mutation_p.I402V|CDH12_ENST00000521384.1_5'UTR	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	402	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						GCGCCAATGATGGTCCCTACC	0.473										HNSCC(59;0.17)																																							0													100.0	76.0	84.0					5																	21802328		2203	4300	6503	SO:0001583	missense	0			L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.1204A>G	5.37:g.21802328T>C	ENSP00000371689:p.Ile402Val		B2RBT1|B7Z2U6|Q86UD2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.I402V	ENST00000382254.1	37	c.1204	CCDS3890.1	5	.	.	.	.	.	.	.	.	.	.	T	2.408	-0.336122	0.05278	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	T;T;T	0.50548	0.74;0.74;0.74	5.84	4.68	0.58851	Cadherin (3);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.43166	0.1235	N	0.11255	0.115	0.49582	D	0.999803	B;D	0.53151	0.004;0.958	B;D	0.70716	0.058;0.97	T	0.30679	-0.9970	10	0.07175	T	0.84	.	11.6147	0.51083	0.0:0.0691:0.0:0.9309	.	362;402	B7Z2U6;P55289	.;CAD12_HUMAN	V	402;402;362	ENSP00000423577:I402V;ENSP00000371689:I402V;ENSP00000428786:I362V	ENSP00000371689:I402V	I	-	1	0	CDH12	21838085	1.000000	0.71417	1.000000	0.80357	0.460000	0.32559	1.654000	0.37334	1.051000	0.40369	0.533000	0.62120	ATC	CDH12	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000154162		0.473	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH12	HGNC	protein_coding	OTTHUMT00000207139.1	-	0.00	44	0	T	NM_004061		21802328	-1	tier1	-	no_errors	ENST00000382254	ensembl	human	known	74_37	missense	23.53	52	16	SNP	1.000	C
CDH12	1010	genome.wustl.edu	37	5	21802328	21802328	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr5:21802328T>C	ENST00000382254.1	-	10	2290	c.1204A>G	c.(1204-1206)Atc>Gtc	p.I402V	CDH12_ENST00000522262.1_Missense_Mutation_p.I362V|CDH12_ENST00000504376.2_Missense_Mutation_p.I402V|CDH12_ENST00000521384.1_5'UTR	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	402	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						GCGCCAATGATGGTCCCTACC	0.473										HNSCC(59;0.17)																																							0													100.0	76.0	84.0					5																	21802328		2203	4300	6503	SO:0001583	missense	0			L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.1204A>G	5.37:g.21802328T>C	ENSP00000371689:p.Ile402Val		B2RBT1|B7Z2U6|Q86UD2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.I402V	ENST00000382254.1	37	c.1204	CCDS3890.1	5	.	.	.	.	.	.	.	.	.	.	T	2.408	-0.336122	0.05278	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	T;T;T	0.50548	0.74;0.74;0.74	5.84	4.68	0.58851	Cadherin (3);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.43166	0.1235	N	0.11255	0.115	0.49582	D	0.999803	B;D	0.53151	0.004;0.958	B;D	0.70716	0.058;0.97	T	0.30679	-0.9970	10	0.07175	T	0.84	.	11.6147	0.51083	0.0:0.0691:0.0:0.9309	.	362;402	B7Z2U6;P55289	.;CAD12_HUMAN	V	402;402;362	ENSP00000423577:I402V;ENSP00000371689:I402V;ENSP00000428786:I362V	ENSP00000371689:I402V	I	-	1	0	CDH12	21838085	1.000000	0.71417	1.000000	0.80357	0.460000	0.32559	1.654000	0.37334	1.051000	0.40369	0.533000	0.62120	ATC	CDH12	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000154162		0.473	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH12	HGNC	protein_coding	OTTHUMT00000207139.1	-	0.00	67	0	T	NM_004061		21802328	-1	tier1	-	no_errors	ENST00000382254	ensembl	human	known	74_37	missense	23.53	52	16	SNP	1.000	C
CDH23	64072	genome.wustl.edu	37	10	73447449	73447449	+	Missense_Mutation	SNP	G	G	A	rs547668692		TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr10:73447449G>A	ENST00000224721.6	+	18	2052	c.2047G>A	c.(2047-2049)Gtc>Atc	p.V683I	CDH23_ENST00000299366.7_Missense_Mutation_p.V723I	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	678	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						CGCCTACTTCGTCTCCGTGGT	0.627													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18685	0.0		0.0	False		,,,				2504	0.0																0													47.0	51.0	49.0					10																	73447449		2070	4207	6277	SO:0001583	missense	0			AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.2047G>A	10.37:g.73447449G>A	ENSP00000224721:p.Val683Ile		C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V683I	ENST00000224721.6	37	c.2047		10	.	.	.	.	.	.	.	.	.	.	G	11.60	1.688460	0.29962	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000398828;ENST00000299366;ENST00000224721;ENST00000442677	.	.	.	4.66	3.73	0.42828	Cadherin (3);Cadherin-like (1);	0.093724	0.42682	D	0.000661	T	0.40619	0.1124	L	0.35644	1.08	0.80722	D	1	B;B;B	0.18310	0.025;0.027;0.011	B;B;B	0.20955	0.032;0.005;0.009	T	0.17623	-1.0363	9	0.12103	T	0.63	.	7.2665	0.26232	0.2524:0.0:0.7476:0.0	.	678;681;678	Q6P152;G3XCN8;Q9H251	.;.;CAD23_HUMAN	I	683;678;678;681;681;195	.	ENSP00000224721:V683I	V	+	1	0	CDH23	73117455	0.998000	0.40836	0.996000	0.52242	0.987000	0.75469	2.375000	0.44283	2.310000	0.77875	0.563000	0.77884	GTC	CDH23	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin	ENSG00000107736		0.627	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	CDH23	HGNC	protein_coding	OTTHUMT00000051227.4	-	0.00	39	0	G	NM_052836		73447449	+1	tier1	-	no_errors	ENST00000224721	ensembl	human	putative	74_37	missense	46.67	16	14	SNP	0.999	A
CDH8	1006	genome.wustl.edu	37	16	61851478	61851478	+	Silent	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr16:61851478C>T	ENST00000577390.1	-	7	2136	c.1182G>A	c.(1180-1182)ccG>ccA	p.P394P	CDH8_ENST00000299345.6_Silent_p.P394P|CDH8_ENST00000577730.1_Silent_p.P394P|CDH8_ENST00000584337.1_Silent_p.P394P	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	394	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		GTAGGTAAGTCGGTGAAGAGA	0.483																																																	0													96.0	84.0	88.0					16																	61851478		2203	4300	6503	SO:0001819	synonymous_variant	0			L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.1182G>A	16.37:g.61851478C>T			B3KWC1|Q14DC6|Q9ULB2	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P394	ENST00000577390.1	37	c.1182	CCDS10802.1	16																																																																																			CDH8	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000150394		0.483	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH8	HGNC	protein_coding	OTTHUMT00000268754.3	-	0.00	66	0	C	NM_001796		61851478	-1	tier1	-	no_errors	ENST00000577390	ensembl	human	known	74_37	silent	6.56	57	4	SNP	0.000	T
CDK5RAP3	80279	genome.wustl.edu	37	17	46053334	46053334	+	Silent	SNP	A	A	G	rs202125432	byFrequency	TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr17:46053334A>G	ENST00000338399.4	+	8	859	c.753A>G	c.(751-753)gaA>gaG	p.E251E	RP11-6N17.9_ENST00000582262.1_RNA|CDK5RAP3_ENST00000536708.2_Silent_p.E276E	NM_176096.1	NP_788276.1	Q96JB5	CK5P3_HUMAN	CDK5 regulatory subunit associated protein 3	251					brain development (GO:0007420)|protein ufmylation (GO:0071569)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of neuron differentiation (GO:0045664)	membrane (GO:0016020)	protein kinase binding (GO:0019901)	p.E251E(1)		NS(1)|central_nervous_system(2)|cervix(3)|endometrium(3)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	18						CTGTGGTGGAACGACCCCACC	0.602																																																	1	Substitution - coding silent(1)	prostate(1)																																								SO:0001819	synonymous_variant	0			AF110322	CCDS42356.1, CCDS62232.1	17q21.2	2008-07-18				ENSG00000108465			18673	protein-coding gene	gene with protein product	"""ischemic heart CDK5 activator-binding protein C53"", ""LXXLL/leucine-zipper-containing ARFbinding protein"""	608202				10721722	Standard	NM_176096		Approved	MST016, FLJ13660, C53, IC53, HSF-27, OK/SW-cl.114, LZAP	uc010wlc.3	Q96JB5		ENST00000338399.4:c.753A>G	17.37:g.46053334A>G			B7Z6N4|D3DTU1|D3DTU2|F5H3I5|Q53FA2|Q9H3F8|Q9H8G0|Q9HBR9	Silent	SNP	pfam_DUF773	p.E251	ENST00000338399.4	37	c.753	CCDS42356.1	17																																																																																			CDK5RAP3	-	pfam_DUF773	ENSG00000108465		0.602	CDK5RAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK5RAP3	HGNC	protein_coding	OTTHUMT00000442913.1	-	0.00	58	0	A	NM_176096		46053334	+1	tier1	rs202125432	no_errors	ENST00000338399	ensembl	human	known	74_37	silent	10.26	35	4	SNP	1.000	G
CDKL2	8999	genome.wustl.edu	37	4	76522369	76522369	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr4:76522369C>A	ENST00000429927.2	-	9	1775	c.1072G>T	c.(1072-1074)Ggc>Tgc	p.G358C	CDKL2_ENST00000307465.4_Missense_Mutation_p.G358C	NM_003948.3	NP_003939.1	Q92772	CDKL2_HUMAN	cyclin-dependent kinase-like 2 (CDC2-related kinase)	358					sex differentiation (GO:0007548)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)			breast(3)|endometrium(1)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(2)|stomach(2)	22			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			ATTTTTGAGCCTTTTATTTTA	0.333																																																	0													58.0	58.0	58.0					4																	76522369		2203	4300	6503	SO:0001583	missense	0			U35146	CCDS3570.1	4q21.21	2011-11-04			ENSG00000138769	ENSG00000138769		"""Cyclin-dependent kinases"""	1782	protein-coding gene	gene with protein product		603442				9000130	Standard	NM_003948		Approved	P56, KKIAMRE	uc003hiq.3	Q92772	OTTHUMG00000130103	ENST00000429927.2:c.1072G>T	4.37:g.76522369C>A	ENSP00000412365:p.Gly358Cys		B2R695	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.G358C	ENST00000429927.2	37	c.1072	CCDS3570.1	4	.	.	.	.	.	.	.	.	.	.	C	9.280	1.047919	0.19827	.	.	ENSG00000138769	ENST00000429927;ENST00000307465	T;T	0.72505	0.83;-0.66	4.74	2.94	0.34122	.	.	.	.	.	T	0.50343	0.1610	N	0.17082	0.46	0.09310	N	1	B;B	0.18741	0.004;0.03	B;B	0.17979	0.005;0.02	T	0.39941	-0.9589	9	0.51188	T	0.08	-5.2047	3.7348	0.08507	0.1693:0.5743:0.1641:0.0924	.	358;358	B4DH08;Q92772	.;CDKL2_HUMAN	C	358	ENSP00000412365:G358C;ENSP00000306340:G358C	ENSP00000306340:G358C	G	-	1	0	CDKL2	76741393	0.009000	0.17119	0.890000	0.34922	0.723000	0.41478	0.104000	0.15313	1.187000	0.43000	0.591000	0.81541	GGC	CDKL2	-	NULL	ENSG00000138769		0.333	CDKL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CDKL2	HGNC	protein_coding	OTTHUMT00000252409.2		0.00	37	0	C	NM_003948		76522369	-1			no_errors	ENST00000429927	ensembl	human	known	74_37	missense	8.00	23	2	SNP	0.036	A
CHAT	1103	genome.wustl.edu	37	10	50872851	50872851	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr10:50872851G>T	ENST00000337653.2	+	15	2159	c.2006G>T	c.(2005-2007)tGc>tTc	p.C669F	CHAT_ENST00000339797.1_Missense_Mutation_p.C551F|CHAT_ENST00000395562.2_Missense_Mutation_p.C587F|CHAT_ENST00000455728.2_Intron|CHAT_ENST00000351556.3_Missense_Mutation_p.C551F|CHAT_ENST00000395559.2_Missense_Mutation_p.C551F	NM_001142929.1|NM_020549.4	NP_001136401.1|NP_065574	P28329	CLAT_HUMAN	choline O-acetyltransferase	669					adult walking behavior (GO:0007628)|dendrite development (GO:0016358)|establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|rhythmic behavior (GO:0007622)|rhythmic excitation (GO:0043179)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	choline O-acetyltransferase activity (GO:0004102)			central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(11)|lung(34)|prostate(3)|urinary_tract(1)	56		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)|Nicotine(DB00184)	ATGTTCTGCTGCTATGGTCCT	0.567																																																	0													180.0	173.0	176.0					10																	50872851		2203	4300	6503	SO:0001583	missense	0			AF305907	CCDS7232.1, CCDS7233.1, CCDS44389.1	10q11.2	2010-05-11	2010-05-11		ENSG00000070748	ENSG00000070748	2.3.1.6		1912	protein-coding gene	gene with protein product		118490	"""choline acetyltransferase"""			1840566	Standard	NM_020984		Approved		uc001jhz.2	P28329	OTTHUMG00000018198	ENST00000337653.2:c.2006G>T	10.37:g.50872851G>T	ENSP00000337103:p.Cys669Phe		A2BDF4|A2BDF5|Q16488|Q9BQ23|Q9BQ35|Q9BQE1	Missense_Mutation	SNP	pfam_Carn_acyl_trans	p.C669F	ENST00000337653.2	37	c.2006	CCDS7232.1	10	.	.	.	.	.	.	.	.	.	.	G	23.6	4.431645	0.83776	.	.	ENSG00000070748	ENST00000339797;ENST00000351556;ENST00000395559;ENST00000337653;ENST00000395562	D;D;D;D;D	0.96619	-4.07;-4.07;-4.07;-4.07;-4.07	5.76	5.76	0.90799	.	0.139568	0.64402	D	0.000002	D	0.98065	0.9362	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97506	1.0063	10	0.39692	T	0.17	-22.3187	19.9576	0.97228	0.0:0.0:1.0:0.0	.	669	P28329	CLAT_HUMAN	F	551;551;551;669;587	ENSP00000343486:C551F;ENSP00000345878:C551F;ENSP00000378926:C551F;ENSP00000337103:C669F;ENSP00000378929:C587F	ENSP00000337103:C669F	C	+	2	0	CHAT	50542857	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.771000	0.98977	2.736000	0.93811	0.655000	0.94253	TGC	CHAT	-	pfam_Carn_acyl_trans	ENSG00000070748		0.567	CHAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHAT	HGNC	protein_coding	OTTHUMT00000047997.1	-	0.00	46	0	G	NM_020549		50872851	+1	tier1	-	no_errors	ENST00000337653	ensembl	human	known	74_37	missense	61.54	15	24	SNP	1.000	T
CHRNA6	8973	genome.wustl.edu	37	8	42611499	42611499	+	Silent	SNP	A	A	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr8:42611499A>G	ENST00000276410.2	-	5	1198	c.843T>C	c.(841-843)tcT>tcC	p.S281S	CHRNA6_ENST00000530869.1_5'Flank|CHRNA6_ENST00000534622.1_Silent_p.S266S	NM_004198.3	NP_004189.1	Q15825	ACHA6_HUMAN	cholinergic receptor, nicotinic, alpha 6 (neuronal)	281					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|membrane depolarization (GO:0051899)|regulation of dopamine secretion (GO:0014059)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)			endometrium(2)|large_intestine(3)|liver(1)|lung(15)|ovary(1)	22	all_lung(13;3.33e-12)|Lung NSC(13;9.17e-11)|Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00439)|Lung NSC(58;0.0124)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	Lung(22;0.0252)|LUSC - Lung squamous cell carcinoma(45;0.0869)		Galantamine(DB00674)|Nicotine(DB00184)|Varenicline(DB01273)	ACACAGTCAGAGAAAGCAGGA	0.453																																																	0													103.0	89.0	94.0					8																	42611499		2203	4300	6503	SO:0001819	synonymous_variant	0			U62435	CCDS6135.1, CCDS56536.1	8p22	2012-02-11	2012-02-07					"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	15963	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 6 (neuronal)"""	606888	"""cholinergic receptor, nicotinic, alpha polypeptide 6"""			8906617	Standard	NM_004198		Approved		uc003xpj.3	Q15825		ENST00000276410.2:c.843T>C	8.37:g.42611499A>G			B2R8V4|B4DQH1	Silent	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.S281	ENST00000276410.2	37	c.843	CCDS6135.1	8																																																																																			CHRNA6	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,tigrfam_Neur_channel	ENSG00000147434		0.453	CHRNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNA6	HGNC	protein_coding	OTTHUMT00000383156.1	-	0.00	52	0	A			42611499	-1	tier1	-	no_errors	ENST00000276410	ensembl	human	known	74_37	silent	38.64	27	17	SNP	0.990	G
CILP	8483	genome.wustl.edu	37	15	65489146	65489146	+	Silent	SNP	T	T	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr15:65489146T>G	ENST00000261883.4	-	9	3644	c.3478A>C	c.(3478-3480)Agg>Cgg	p.R1160R		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	1160					negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						TGGCCACCCCTGCTCGCTCGC	0.597																																																	0													39.0	38.0	39.0					15																	65489146		2202	4299	6501	SO:0001819	synonymous_variant	0			AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.3478A>C	15.37:g.65489146T>G			B2R8F7|Q6UW99|Q8IYI5	Silent	SNP	pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,superfamily_CarboxyPept-like_regulatory,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.R1160	ENST00000261883.4	37	c.3478	CCDS10203.1	15																																																																																			CILP	-	NULL	ENSG00000138615		0.597	CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CILP	HGNC	protein_coding	OTTHUMT00000256829.1	-	0.00	14	0	T	NM_003613		65489146	-1	tier1	-	no_errors	ENST00000261883	ensembl	human	known	74_37	silent	68.97	9	20	SNP	0.000	G
CLSTN2	64084	genome.wustl.edu	37	3	140277669	140277669	+	Missense_Mutation	SNP	A	A	C			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr3:140277669A>C	ENST00000458420.3	+	12	2201	c.2011A>C	c.(2011-2013)Acc>Ccc	p.T671P		NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	671					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						CTTCGCCAAAACCGAAGCCCC	0.522										HNSCC(16;0.037)																											GBM(45;858 913 3709 36904 37282)												0													46.0	48.0	48.0					3																	140277669		2203	4300	6503	SO:0001583	missense	0			AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.2011A>C	3.37:g.140277669A>C	ENSP00000402460:p.Thr671Pro		B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	pfam_Cadherin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T671P	ENST00000458420.3	37	c.2011	CCDS3112.1	3	.	.	.	.	.	.	.	.	.	.	A	9.331	1.060554	0.19987	.	.	ENSG00000158258	ENST00000458420	T	0.29917	1.55	5.41	-0.994	0.10225	.	0.887861	0.09600	N	0.780298	T	0.13713	0.0332	N	0.16368	0.405	0.20403	N	0.999904	B	0.31730	0.337	B	0.23574	0.047	T	0.23619	-1.0183	9	.	.	.	-35.3494	4.8884	0.13715	0.4279:0.2851:0.287:0.0	.	671	Q9H4D0	CSTN2_HUMAN	P	671	ENSP00000402460:T671P	.	T	+	1	0	CLSTN2	141760359	0.000000	0.05858	0.031000	0.17742	0.008000	0.06430	-0.021000	0.12504	-0.262000	0.09392	-0.248000	0.11899	ACC	CLSTN2	-	NULL	ENSG00000158258		0.522	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLSTN2	HGNC	protein_coding	OTTHUMT00000359393.3	-	0.00	31	0	A	NM_022131		140277669	+1	tier1	-	no_errors	ENST00000458420	ensembl	human	known	74_37	missense	20.24	67	17	SNP	0.033	C
CLSTN2	64084	genome.wustl.edu	37	3	140277669	140277669	+	Missense_Mutation	SNP	A	A	C			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr3:140277669A>C	ENST00000458420.3	+	12	2201	c.2011A>C	c.(2011-2013)Acc>Ccc	p.T671P		NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	671					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						CTTCGCCAAAACCGAAGCCCC	0.522										HNSCC(16;0.037)																											GBM(45;858 913 3709 36904 37282)												0													46.0	48.0	48.0					3																	140277669		2203	4300	6503	SO:0001583	missense	0			AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.2011A>C	3.37:g.140277669A>C	ENSP00000402460:p.Thr671Pro		B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	pfam_Cadherin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T671P	ENST00000458420.3	37	c.2011	CCDS3112.1	3	.	.	.	.	.	.	.	.	.	.	A	9.331	1.060554	0.19987	.	.	ENSG00000158258	ENST00000458420	T	0.29917	1.55	5.41	-0.994	0.10225	.	0.887861	0.09600	N	0.780298	T	0.13713	0.0332	N	0.16368	0.405	0.20403	N	0.999904	B	0.31730	0.337	B	0.23574	0.047	T	0.23619	-1.0183	9	.	.	.	-35.3494	4.8884	0.13715	0.4279:0.2851:0.287:0.0	.	671	Q9H4D0	CSTN2_HUMAN	P	671	ENSP00000402460:T671P	.	T	+	1	0	CLSTN2	141760359	0.000000	0.05858	0.031000	0.17742	0.008000	0.06430	-0.021000	0.12504	-0.262000	0.09392	-0.248000	0.11899	ACC	CLSTN2	-	NULL	ENSG00000158258		0.522	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLSTN2	HGNC	protein_coding	OTTHUMT00000359393.3	-	0.00	59	0	A	NM_022131		140277669	+1	tier1	-	no_errors	ENST00000458420	ensembl	human	known	74_37	missense	20.24	67	17	SNP	0.033	C
CLSTN2	64084	genome.wustl.edu	37	3	140282913	140282913	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr3:140282913G>A	ENST00000458420.3	+	16	2783	c.2593G>A	c.(2593-2595)Gag>Aag	p.E865K		NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	865					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						CTTCATCCAGGAGACTGAGGC	0.562										HNSCC(16;0.037)																											GBM(45;858 913 3709 36904 37282)												0													182.0	160.0	167.0					3																	140282913		2203	4300	6503	SO:0001583	missense	0			AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.2593G>A	3.37:g.140282913G>A	ENSP00000402460:p.Glu865Lys		B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	pfam_Cadherin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E865K	ENST00000458420.3	37	c.2593	CCDS3112.1	3	.	.	.	.	.	.	.	.	.	.	G	13.94	2.388384	0.42308	.	.	ENSG00000158258	ENST00000458420	T	0.28895	1.59	5.75	5.75	0.90469	.	0.361115	0.32671	N	0.005797	T	0.32793	0.0841	M	0.64997	1.995	0.49687	D	0.999812	B	0.30763	0.294	B	0.24974	0.057	T	0.04855	-1.0922	9	.	.	.	-33.5473	17.4314	0.87540	0.0:0.0:1.0:0.0	.	865	Q9H4D0	CSTN2_HUMAN	K	865	ENSP00000402460:E865K	.	E	+	1	0	CLSTN2	141765603	1.000000	0.71417	0.752000	0.31206	0.259000	0.26198	7.985000	0.88162	2.711000	0.92665	0.655000	0.94253	GAG	CLSTN2	-	NULL	ENSG00000158258		0.562	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLSTN2	HGNC	protein_coding	OTTHUMT00000359393.3	-	0.00	51	0	G	NM_022131		140282913	+1	tier1	-	no_errors	ENST00000458420	ensembl	human	known	74_37	missense	19.05	34	8	SNP	0.994	A
CNTN1	1272	genome.wustl.edu	37	12	41463781	41463781	+	Missense_Mutation	SNP	A	A	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr12:41463781A>G	ENST00000551295.2	+	24	3118	c.3001A>G	c.(3001-3003)Agt>Ggt	p.S1001G	CNTN1_ENST00000348761.2_Missense_Mutation_p.S990G|CNTN1_ENST00000347616.1_Missense_Mutation_p.S1001G	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	1001					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				CCTATCCCCAAGTCTTCTCGG	0.468																																																	0													236.0	172.0	193.0					12																	41463781		2203	4300	6503	SO:0001583	missense	0			Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.3001A>G	12.37:g.41463781A>G	ENSP00000447006:p.Ser1001Gly		A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.S1001G	ENST00000551295.2	37	c.3001	CCDS8737.1	12	.	.	.	.	.	.	.	.	.	.	A	3.793	-0.043190	0.07452	.	.	ENSG00000018236	ENST00000551295;ENST00000347616;ENST00000348761	T;T;T	0.59772	0.25;0.25;0.24	5.58	-1.37	0.09056	.	0.880014	0.10337	N	0.686772	T	0.37046	0.0989	L	0.36672	1.1	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.19712	-1.0297	10	0.22706	T	0.39	.	0.9696	0.01413	0.3809:0.1147:0.281:0.2233	.	990;1001	Q12860-2;Q12860	.;CNTN1_HUMAN	G	1001;1001;990	ENSP00000447006:S1001G;ENSP00000325660:S1001G;ENSP00000261160:S990G	ENSP00000325660:S1001G	S	+	1	0	CNTN1	39750048	0.239000	0.23836	0.008000	0.14137	0.372000	0.29890	0.604000	0.24164	-0.388000	0.07797	0.482000	0.46254	AGT	CNTN1	-	NULL	ENSG00000018236		0.468	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN1	HGNC	protein_coding	OTTHUMT00000403692.2	-	0.00	37	0	A	NM_001843		41463781	+1	tier1	-	no_errors	ENST00000347616	ensembl	human	known	74_37	missense	19.44	29	7	SNP	0.003	G
COBL	23242	genome.wustl.edu	37	7	51258724	51258724	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr7:51258724G>A	ENST00000265136.7	-	4	673	c.508C>T	c.(508-510)Cgt>Tgt	p.R170C	COBL_ENST00000441453.1_Missense_Mutation_p.R170C|COBL_ENST00000395540.2_Missense_Mutation_p.R170C|COBL_ENST00000395542.2_Missense_Mutation_p.R170C	NM_015198.3	NP_056013.2	O75128	COBL_HUMAN	cordon-bleu WH2 repeat protein	170					actin filament network formation (GO:0051639)|actin filament polymerization (GO:0030041)|collateral sprouting in absence of injury (GO:0048669)|digestive tract development (GO:0048565)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|liver development (GO:0001889)|neural tube closure (GO:0001843)|notochord development (GO:0030903)|positive regulation of dendrite development (GO:1900006)|somite specification (GO:0001757)	actin filament (GO:0005884)|axon (GO:0030424)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic growth cone (GO:0044294)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)	p.R170C(1)		NS(2)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(26)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Glioma(55;0.08)					GGGCTCACACGCACAACAGCT	0.483																																					NSCLC(189;2119 2138 12223 30818 34679)												1	Substitution - Missense(1)	lung(1)											57.0	53.0	55.0					7																	51258724		2203	4300	6503	SO:0001583	missense	0			AB014533	CCDS34637.1, CCDS75601.1, CCDS75602.1	7p12.2-p12.1	2012-12-07	2012-12-07		ENSG00000106078	ENSG00000106078			22199	protein-coding gene	gene with protein product		610317	"""cordon-bleu homolog (mouse)"""				Standard	NM_015198		Approved	KIAA0633	uc003tpr.4	O75128	OTTHUMG00000155999	ENST00000265136.7:c.508C>T	7.37:g.51258724G>A	ENSP00000265136:p.Arg170Cys		A4D257|A7E2B0|B7ZLW9|B9EGF8|Q2T9J3|Q504Y4|Q86XA7|Q8N304|Q8TCM1	Missense_Mutation	SNP	pfam_Cordon-bleu_ubiquitin_domain,pfam_WH2_dom,smart_WH2_dom,pfscan_WH2_dom	p.R170C	ENST00000265136.7	37	c.508	CCDS34637.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.9|23.9	4.475577|4.475577	0.84640|0.84640	.|.	.|.	ENSG00000106078|ENSG00000106078	ENST00000452534|ENST00000265136;ENST00000445054;ENST00000395542;ENST00000395540;ENST00000441453;ENST00000449281	.|T;T;T;T;T	.|0.44881	.|0.91;1.92;0.91;0.91;0.91	5.78|5.78	4.88|4.88	0.63580|0.63580	.|Cordon-bleu domain (1);	.|0.000000	.|0.43416	.|D	.|0.000580	T|T	0.66376|0.66376	0.2783|0.2783	M|M	0.84326|0.84326	2.69|2.69	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D	.|0.97110	.|0.994;0.99;0.994;1.0;0.997	T|T	0.71842|0.71842	-0.4470|-0.4470	5|10	.|0.87932	.|D	.|0	.|.	12.9468|12.9468	0.58376|0.58376	0.0:0.0:0.7054:0.2946|0.0:0.0:0.7054:0.2946	.|.	.|170;170;170;170;170	.|O75128-3;O75128-5;O75128-7;O75128;O75128-2	.|.;.;.;COBL_HUMAN;.	V|C	88|170;37;170;170;170;154	.|ENSP00000265136:R170C;ENSP00000401204:R37C;ENSP00000378912:R170C;ENSP00000378910:R170C;ENSP00000399500:R170C	.|ENSP00000265136:R170C	A|R	-|-	2|1	0|0	COBL|COBL	51226218|51226218	1.000000|1.000000	0.71417|0.71417	0.984000|0.984000	0.44739|0.44739	0.976000|0.976000	0.68499|0.68499	5.201000|5.201000	0.65163|0.65163	1.407000|1.407000	0.46875|0.46875	0.557000|0.557000	0.71058|0.71058	GCG|CGT	COBL	-	pfam_Cordon-bleu_ubiquitin_domain	ENSG00000106078		0.483	COBL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COBL	HGNC	protein_coding	OTTHUMT00000342682.1		0.00	22	0	G	NM_015198		51258724	-1			no_errors	ENST00000395542	ensembl	human	known	74_37	missense	7.14	26	2	SNP	1.000	A
CNTNAP2	26047	genome.wustl.edu	37	7	148080841	148080841	+	Silent	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr7:148080841C>T	ENST00000361727.3	+	22	4092	c.3576C>T	c.(3574-3576)gcC>gcT	p.A1192A	CNTNAP2_ENST00000538075.1_Silent_p.A251A|CNTNAP2_ENST00000463592.2_3'UTR	NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	1192	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			CTCTCAAGGCCGCCTTGAGGC	0.582										HNSCC(39;0.1)																																							0													52.0	53.0	52.0					7																	148080841		2203	4300	6503	SO:0001819	synonymous_variant	0			AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.3576C>T	7.37:g.148080841C>T			D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Silent	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,pfam_EG-like_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.A1192	ENST00000361727.3	37	c.3576	CCDS5889.1	7																																																																																			CNTNAP2	-	pfscan_Laminin_G	ENSG00000174469		0.582	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP2	HGNC	protein_coding	OTTHUMT00000327668.1	-	0.00	80	0	C			148080841	+1	tier1	-	no_errors	ENST00000361727	ensembl	human	known	74_37	silent	46.15	42	36	SNP	0.010	T
COL11A2	1302	genome.wustl.edu	37	6	33141697	33141697	+	Missense_Mutation	SNP	G	G	A	rs149071920		TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr6:33141697G>A	ENST00000374708.4	-	32	2536	c.2278C>T	c.(2278-2280)Cgg>Tgg	p.R760W	COL11A2_ENST00000477772.1_Intron|COL11A2_ENST00000374712.1_Missense_Mutation_p.R765W|COL11A2_ENST00000361917.1_Missense_Mutation_p.R739W|COL11A2_ENST00000395197.1_Missense_Mutation_p.R786W|COL11A2_ENST00000357486.1_Missense_Mutation_p.R825W|COL11A2_ENST00000374713.1_Missense_Mutation_p.R799W|COL11A2_ENST00000341947.2_Missense_Mutation_p.R846W|COL11A2_ENST00000374714.1_Missense_Mutation_p.R820W	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	846	Triple-helical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						CGCTGACCCCGTGGACCCTAC	0.627													G|||	1	0.000199681	0.0008	0.0	5008	,	,		14206	0.0		0.0	False		,,,				2504	0.0				Melanoma(1;90 116 3946 5341 17093)												0								G	TRP/ARG,TRP/ARG,TRP/ARG	6,4400	11.4+/-27.6	0,6,2197	73.0	77.0	75.0		2215,2536,2278	2.7	1.0	6	dbSNP_134	75	0,8600		0,0,4300	yes	missense,missense,missense	COL11A2	NM_080679.2,NM_080680.2,NM_080681.2	101,101,101	0,6,6497	AA,AG,GG		0.0,0.1362,0.0461	probably-damaging,probably-damaging,probably-damaging	739/1630,846/1737,760/1651	33141697	6,13000	2203	4300	6503	SO:0001583	missense	0			U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.2278C>T	6.37:g.33141697G>A	ENSP00000363840:p.Arg760Trp		A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Laminin_G,smart_Fib_collagen_C	p.R846W	ENST00000374708.4	37	c.2536	CCDS43452.1	6	.	.	.	.	.	.	.	.	.	.	G	16.91	3.253105	0.59212	0.001362	0.0	ENSG00000204248	ENST00000374708;ENST00000341947;ENST00000357486;ENST00000374714;ENST00000374713;ENST00000395197;ENST00000374712;ENST00000361917	T;T;T;T;T;T;T;T	0.54479	0.57;0.57;0.57;0.57;0.57;0.57;0.57;0.57	4.6	2.69	0.31865	.	0.000000	0.85682	D	0.000000	T	0.65312	0.2679	M	0.86573	2.825	0.53688	D	0.999977	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.997;0.99	T	0.70510	-0.4852	10	0.87932	D	0	.	10.2092	0.43131	0.0:0.0:0.4537:0.5463	.	739;760;846	P13942-8;P13942-6;P13942	.;.;COBA2_HUMAN	W	760;846;825;820;799;786;765;739	ENSP00000363840:R760W;ENSP00000339915:R846W;ENSP00000350079:R825W;ENSP00000363846:R820W;ENSP00000363845:R799W;ENSP00000378623:R786W;ENSP00000363844:R765W;ENSP00000355123:R739W	ENSP00000339915:R846W	R	-	1	2	COL11A2	33249675	0.019000	0.18553	0.974000	0.42286	0.887000	0.51463	0.109000	0.15417	0.469000	0.27268	0.448000	0.29417	CGG	COL11A2	-	pfam_Collagen	ENSG00000204248		0.627	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	COL11A2	HGNC	protein_coding	OTTHUMT00000076032.2	-	0.00	25	0	G			33141697	-1	tier1	rs149071920	no_errors	ENST00000341947	ensembl	human	known	74_37	missense	20.93	34	9	SNP	0.917	A
COL2A1	1280	genome.wustl.edu	37	12	48378877	48378877	+	Splice_Site	SNP	C	C	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr12:48378877C>A	ENST00000380518.3	-	27	1899		c.e27-1		COL2A1_ENST00000493991.1_Splice_Site|COL2A1_ENST00000337299.6_Splice_Site	NM_001844.4|NM_033150.2	NP_001835.3|NP_149162.2	P02458	CO2A1_HUMAN	collagen, type II, alpha 1						axon guidance (GO:0007411)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to BMP stimulus (GO:0071773)|central nervous system development (GO:0007417)|chondrocyte differentiation (GO:0002062)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal joint morphogenesis (GO:0060272)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart morphogenesis (GO:0003007)|inner ear morphogenesis (GO:0042472)|limb bud formation (GO:0060174)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|notochord development (GO:0030903)|otic vesicle development (GO:0071599)|palate development (GO:0060021)|proteoglycan metabolic process (GO:0006029)|regulation of gene expression (GO:0010468)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|tissue homeostasis (GO:0001894)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen type II trimer (GO:0005585)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(3)	64		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	CAGGGGCTCCCTGAAAGACAG	0.592																																																	0			GRCh37	CS081885	COL2A1	S							38.0	34.0	36.0					12																	48378877		2203	4300	6503	SO:0001630	splice_region_variant	0			X16468	CCDS8759.1, CCDS41778.1	12q12-q13.2	2013-11-14	2008-02-04		ENSG00000139219	ENSG00000139219		"""Collagens"""	2200	protein-coding gene	gene with protein product		120140	"""collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)"", ""arthroophthalmopathy, progressive (Stickler syndrome)"""	SEDC, AOM		1677770	Standard	NM_033150		Approved	STL1	uc001rqu.3	P02458	OTTHUMG00000149896	ENST00000380518.3:c.1735-1G>T	12.37:g.48378877C>A			A6NGA0|Q12985|Q14009|Q14044|Q14045|Q14046|Q14047|Q14056|Q14058|Q16672|Q1JQ82|Q2V4X7|Q6LBY1|Q6LBY2|Q6LBY3|Q96IT5|Q99227|Q9UE38|Q9UE39|Q9UE40|Q9UE41|Q9UE42|Q9UE43	Splice_Site	SNP	-	e27-1	ENST00000380518.3	37	c.1735-1	CCDS41778.1	12	.	.	.	.	.	.	.	.	.	.	C	22.5	4.296954	0.81025	.	.	ENSG00000139219	ENST00000380518;ENST00000395281;ENST00000337299	.	.	.	5.01	5.01	0.66863	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.2551	0.87053	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	COL2A1	46665144	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	3.150000	0.50662	2.606000	0.88127	0.655000	0.94253	.	COL2A1	-	-	ENSG00000139219		0.592	COL2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL2A1	HGNC	protein_coding	OTTHUMT00000313810.2	-	0.00	44	0	C	NM_001844	Intron	48378877	-1	tier1	-	no_errors	ENST00000380518	ensembl	human	known	74_37	splice_site	5.80	65	4	SNP	1.000	A
COL2A1	1280	genome.wustl.edu	37	12	48378877	48378877	+	Splice_Site	SNP	C	C	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr12:48378877C>A	ENST00000380518.3	-	27	1899		c.e27-1		COL2A1_ENST00000493991.1_Splice_Site|COL2A1_ENST00000337299.6_Splice_Site	NM_001844.4|NM_033150.2	NP_001835.3|NP_149162.2	P02458	CO2A1_HUMAN	collagen, type II, alpha 1						axon guidance (GO:0007411)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to BMP stimulus (GO:0071773)|central nervous system development (GO:0007417)|chondrocyte differentiation (GO:0002062)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal joint morphogenesis (GO:0060272)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart morphogenesis (GO:0003007)|inner ear morphogenesis (GO:0042472)|limb bud formation (GO:0060174)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|notochord development (GO:0030903)|otic vesicle development (GO:0071599)|palate development (GO:0060021)|proteoglycan metabolic process (GO:0006029)|regulation of gene expression (GO:0010468)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|tissue homeostasis (GO:0001894)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen type II trimer (GO:0005585)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(3)	64		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	CAGGGGCTCCCTGAAAGACAG	0.592																																																	0			GRCh37	CS081885	COL2A1	S							38.0	34.0	36.0					12																	48378877		2203	4300	6503	SO:0001630	splice_region_variant	0			X16468	CCDS8759.1, CCDS41778.1	12q12-q13.2	2013-11-14	2008-02-04		ENSG00000139219	ENSG00000139219		"""Collagens"""	2200	protein-coding gene	gene with protein product		120140	"""collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)"", ""arthroophthalmopathy, progressive (Stickler syndrome)"""	SEDC, AOM		1677770	Standard	NM_033150		Approved	STL1	uc001rqu.3	P02458	OTTHUMG00000149896	ENST00000380518.3:c.1735-1G>T	12.37:g.48378877C>A			A6NGA0|Q12985|Q14009|Q14044|Q14045|Q14046|Q14047|Q14056|Q14058|Q16672|Q1JQ82|Q2V4X7|Q6LBY1|Q6LBY2|Q6LBY3|Q96IT5|Q99227|Q9UE38|Q9UE39|Q9UE40|Q9UE41|Q9UE42|Q9UE43	Splice_Site	SNP	-	e27-1	ENST00000380518.3	37	c.1735-1	CCDS41778.1	12	.	.	.	.	.	.	.	.	.	.	C	22.5	4.296954	0.81025	.	.	ENSG00000139219	ENST00000380518;ENST00000395281;ENST00000337299	.	.	.	5.01	5.01	0.66863	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.2551	0.87053	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	COL2A1	46665144	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	3.150000	0.50662	2.606000	0.88127	0.655000	0.94253	.	COL2A1	-	-	ENSG00000139219		0.592	COL2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL2A1	HGNC	protein_coding	OTTHUMT00000313810.2	-	0.00	59	0	C	NM_001844	Intron	48378877	-1	tier1	-	no_errors	ENST00000380518	ensembl	human	known	74_37	splice_site	5.80	65	4	SNP	1.000	A
COL6A6	131873	genome.wustl.edu	37	3	130282231	130282231	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr3:130282231G>T	ENST00000358511.6	+	2	415	c.384G>T	c.(382-384)aaG>aaT	p.K128N	COL6A6_ENST00000453409.2_Missense_Mutation_p.K128N	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	128	Nonhelical region.|VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						GGAGAGACAAGAAACAGTTTC	0.498																																																	0													42.0	42.0	42.0					3																	130282231		1886	4112	5998	SO:0001583	missense	0			AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.384G>T	3.37:g.130282231G>T	ENSP00000351310:p.Lys128Asn		A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.K128N	ENST00000358511.6	37	c.384	CCDS46911.1	3	.	.	.	.	.	.	.	.	.	.	G	8.613	0.889623	0.17540	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	D;D	0.82984	-1.67;-1.67	5.21	3.29	0.37713	von Willebrand factor, type A (3);	0.460721	0.20698	N	0.087328	T	0.70456	0.3226	L	0.31476	0.935	0.22050	N	0.999394	B	0.06786	0.001	B	0.13407	0.009	T	0.57499	-0.7801	10	0.34782	T	0.22	.	6.782	0.23650	0.165:0.1489:0.6862:0.0	.	128	A6NMZ7	CO6A6_HUMAN	N	128	ENSP00000351310:K128N;ENSP00000399236:K128N	ENSP00000351310:K128N	K	+	3	2	COL6A6	131764921	0.047000	0.20315	0.873000	0.34254	0.315000	0.28087	0.440000	0.21592	1.334000	0.45468	0.561000	0.74099	AAG	COL6A6	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000206384		0.498	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL6A6	HGNC	protein_coding	OTTHUMT00000356705.5	-	0.00	47	0	G	NM_001102608		130282231	+1	tier1	-	no_errors	ENST00000358511	ensembl	human	known	74_37	missense	27.03	54	20	SNP	0.603	T
CSNK1D	1453	genome.wustl.edu	37	17	80213421	80213421	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr17:80213421C>T	ENST00000314028.6	-	3	569	c.220G>A	c.(220-222)Gag>Aag	p.E74K	CSNK1D_ENST00000578904.1_5'UTR|AC132872.2_ENST00000598222.1_5'Flank|CSNK1D_ENST00000392334.2_Missense_Mutation_p.E74K|CSNK1D_ENST00000398519.5_Missense_Mutation_p.E74K	NM_001893.4	NP_001884.2	P48730	KC1D_HUMAN	casein kinase 1, delta	74	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				circadian regulation of gene expression (GO:0032922)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein phosphorylation (GO:0001934)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|signal transduction (GO:0007165)|spindle assembly (GO:0051225)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle (GO:0005819)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|peptide binding (GO:0042277)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			breast(2)|large_intestine(2)|lung(7)	11	Breast(20;0.00136)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.227)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0155)			TAGTCCCCCTCTGCCCCGCAC	0.567																																																	0													135.0	117.0	123.0					17																	80213421		2203	4300	6503	SO:0001583	missense	0				CCDS11805.1, CCDS11806.1	17q25	2013-01-17				ENSG00000141551			2452	protein-coding gene	gene with protein product		600864				7797465	Standard	NM_001893		Approved	HCKID, CKID, CKIdelta	uc002kej.3	P48730		ENST00000314028.6:c.220G>A	17.37:g.80213421C>T	ENSP00000324464:p.Glu74Lys		A2I2P2|Q96KZ6|Q9BTN5	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.E74K	ENST00000314028.6	37	c.220	CCDS11805.1	17	.	.	.	.	.	.	.	.	.	.	C	35	5.570863	0.96540	.	.	ENSG00000141551	ENST00000314028;ENST00000392334;ENST00000398519;ENST00000403276	T;T;T	0.21361	2.01;2.01;2.01	5.42	5.42	0.78866	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.52964	0.1767	M	0.85099	2.735	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.75484	0.957;0.966;0.986	T	0.59747	-0.7396	10	0.87932	D	0	.	18.2326	0.89938	0.0:1.0:0.0:0.0	.	74;74;17	P48730;P48730-2;B4E0G1	KC1D_HUMAN;.;.	K	74;74;17;74	ENSP00000324464:E74K;ENSP00000376146:E74K;ENSP00000385769:E74K	ENSP00000324464:E74K	E	-	1	0	CSNK1D	77806710	1.000000	0.71417	0.940000	0.37924	0.927000	0.56198	7.665000	0.83852	2.553000	0.86117	0.651000	0.88453	GAG	CSNK1D	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000141551		0.567	CSNK1D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CSNK1D	HGNC	protein_coding	OTTHUMT00000442632.1	-	0.00	59	0	C	NM_139062		80213421	-1	tier1	-	no_errors	ENST00000314028	ensembl	human	known	74_37	missense	30.43	32	14	SNP	1.000	T
CUL3	8452	genome.wustl.edu	37	2	225371635	225371635	+	Silent	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr2:225371635C>T	ENST00000264414.4	-	7	1307	c.969G>A	c.(967-969)gaG>gaA	p.E323E	CUL3_ENST00000409777.1_Silent_p.E299E|CUL3_ENST00000409096.1_Silent_p.E299E|CUL3_ENST00000344951.4_Silent_p.E257E	NM_003590.4	NP_003581.1	Q13618	CUL3_HUMAN	cullin 3	323					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|COPII vesicle coating (GO:0048208)|cyclin catabolic process (GO:0008054)|embryonic cleavage (GO:0040016)|ER to Golgi vesicle-mediated transport (GO:0006888)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|integrin-mediated signaling pathway (GO:0007229)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic metaphase plate congression (GO:0007080)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|stem cell division (GO:0017145)|stress fiber assembly (GO:0043149)|trophectodermal cellular morphogenesis (GO:0001831)|Wnt signaling pathway (GO:0016055)	Cul3-RING ubiquitin ligase complex (GO:0031463)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|nucleus (GO:0005634)|polar microtubule (GO:0005827)	POZ domain binding (GO:0031208)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	46		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		CTTTACCTTGCTCCCTCAAAT	0.378																																																	0													99.0	92.0	94.0					2																	225371635		2203	4300	6503	SO:0001819	synonymous_variant	0			U58089	CCDS2462.1, CCDS58751.1	2q36.2	2011-05-24			ENSG00000036257	ENSG00000036257			2553	protein-coding gene	gene with protein product		603136				8681378, 17192413	Standard	NM_003590		Approved		uc002vny.3	Q13618	OTTHUMG00000133167	ENST00000264414.4:c.969G>A	2.37:g.225371635C>T			A8K536|B8ZZC3|O75415|Q569L3|Q9UBI8|Q9UET7	Silent	SNP	pfam_Cullin_N,pfam_Cullin_neddylation_domain,superfamily_Cullin_repeat-like_dom,superfamily_Cullin_homology,smart_Cullin_homology,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.E323	ENST00000264414.4	37	c.969	CCDS2462.1	2																																																																																			CUL3	-	pfam_Cullin_N,superfamily_Cullin_repeat-like_dom	ENSG00000036257		0.378	CUL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUL3	HGNC	protein_coding	OTTHUMT00000256871.2	-	0.00	43	0	C			225371635	-1	tier1	-	no_errors	ENST00000264414	ensembl	human	known	74_37	silent	8.33	44	4	SNP	0.998	T
CUL3	8452	genome.wustl.edu	37	2	225371635	225371635	+	Silent	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr2:225371635C>T	ENST00000264414.4	-	7	1307	c.969G>A	c.(967-969)gaG>gaA	p.E323E	CUL3_ENST00000409777.1_Silent_p.E299E|CUL3_ENST00000409096.1_Silent_p.E299E|CUL3_ENST00000344951.4_Silent_p.E257E	NM_003590.4	NP_003581.1	Q13618	CUL3_HUMAN	cullin 3	323					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|COPII vesicle coating (GO:0048208)|cyclin catabolic process (GO:0008054)|embryonic cleavage (GO:0040016)|ER to Golgi vesicle-mediated transport (GO:0006888)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|integrin-mediated signaling pathway (GO:0007229)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic metaphase plate congression (GO:0007080)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|stem cell division (GO:0017145)|stress fiber assembly (GO:0043149)|trophectodermal cellular morphogenesis (GO:0001831)|Wnt signaling pathway (GO:0016055)	Cul3-RING ubiquitin ligase complex (GO:0031463)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|nucleus (GO:0005634)|polar microtubule (GO:0005827)	POZ domain binding (GO:0031208)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	46		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		CTTTACCTTGCTCCCTCAAAT	0.378																																																	0													99.0	92.0	94.0					2																	225371635		2203	4300	6503	SO:0001819	synonymous_variant	0			U58089	CCDS2462.1, CCDS58751.1	2q36.2	2011-05-24			ENSG00000036257	ENSG00000036257			2553	protein-coding gene	gene with protein product		603136				8681378, 17192413	Standard	NM_003590		Approved		uc002vny.3	Q13618	OTTHUMG00000133167	ENST00000264414.4:c.969G>A	2.37:g.225371635C>T			A8K536|B8ZZC3|O75415|Q569L3|Q9UBI8|Q9UET7	Silent	SNP	pfam_Cullin_N,pfam_Cullin_neddylation_domain,superfamily_Cullin_repeat-like_dom,superfamily_Cullin_homology,smart_Cullin_homology,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.E323	ENST00000264414.4	37	c.969	CCDS2462.1	2																																																																																			CUL3	-	pfam_Cullin_N,superfamily_Cullin_repeat-like_dom	ENSG00000036257		0.378	CUL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUL3	HGNC	protein_coding	OTTHUMT00000256871.2	-	0.00	58	0	C			225371635	-1	tier1	-	no_errors	ENST00000264414	ensembl	human	known	74_37	silent	8.33	44	4	SNP	0.998	T
CYP4F11	57834	genome.wustl.edu	37	19	16045083	16045083	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr19:16045083G>A	ENST00000402119.4	-	1	562	c.136C>T	c.(136-138)Cgc>Tgc	p.R46C	CYP4F11_ENST00000248041.8_Missense_Mutation_p.R46C|CYP4F11_ENST00000326742.8_Missense_Mutation_p.R46C	NM_021187.3	NP_067010.3			cytochrome P450, family 4, subfamily F, polypeptide 11											NS(1)|breast(3)|endometrium(4)|large_intestine(2)|lung(11)|ovary(1)|skin(3)	25						TGGAGGCGGCGGCAGTTGTCA	0.627																																																	0													56.0	54.0	55.0					19																	16045083		2203	4300	6503	SO:0001583	missense	0			AF236085	CCDS12337.1	19p13.1	2011-07-29	2003-01-14		ENSG00000171903	ENSG00000171903		"""Cytochrome P450s"""	13265	protein-coding gene	gene with protein product		611517	"""cytochrome P450, subfamily IVF, polypeptide 11"""			10964514, 9068972	Standard	NM_021187		Approved		uc002nbu.2	Q9HBI6		ENST00000402119.4:c.136C>T	19.37:g.16045083G>A	ENSP00000384588:p.Arg46Cys			Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.R46C	ENST00000402119.4	37	c.136	CCDS12337.1	19	.	.	.	.	.	.	.	.	.	.	g	7.386	0.629733	0.14257	.	.	ENSG00000171903	ENST00000402119;ENST00000248041;ENST00000326742	D;D;D	0.97791	-4.54;-4.54;-4.54	2.18	-0.00717	0.14010	.	0.283347	0.26109	U	0.026284	D	0.92883	0.7736	L	0.35723	1.085	0.09310	N	0.999994	B;B	0.21071	0.051;0.008	B;B	0.20767	0.031;0.014	D	0.85446	0.1158	10	0.49607	T	0.09	.	2.171	0.03849	0.3121:0.0:0.4381:0.2497	.	46;46	F8W978;Q9HBI6	.;CP4FB_HUMAN	C	46	ENSP00000384588:R46C;ENSP00000248041:R46C;ENSP00000319859:R46C	ENSP00000248041:R46C	R	-	1	0	CYP4F11	15906083	0.000000	0.05858	0.000000	0.03702	0.137000	0.21094	-1.898000	0.01602	0.060000	0.16281	0.306000	0.20318	CGC	CYP4F11	-	NULL	ENSG00000171903		0.627	CYP4F11-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CYP4F11	HGNC	protein_coding	OTTHUMT00000460385.2	-	0.00	150	0	G	NM_021187		16045083	-1	tier1	-	no_errors	ENST00000248041	ensembl	human	known	74_37	missense	11.83	163	22	SNP	0.000	A
CYP4F11	57834	genome.wustl.edu	37	19	16045083	16045083	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr19:16045083G>A	ENST00000402119.4	-	1	562	c.136C>T	c.(136-138)Cgc>Tgc	p.R46C	CYP4F11_ENST00000248041.8_Missense_Mutation_p.R46C|CYP4F11_ENST00000326742.8_Missense_Mutation_p.R46C	NM_021187.3	NP_067010.3			cytochrome P450, family 4, subfamily F, polypeptide 11											NS(1)|breast(3)|endometrium(4)|large_intestine(2)|lung(11)|ovary(1)|skin(3)	25						TGGAGGCGGCGGCAGTTGTCA	0.627																																																	0													56.0	54.0	55.0					19																	16045083		2203	4300	6503	SO:0001583	missense	0			AF236085	CCDS12337.1	19p13.1	2011-07-29	2003-01-14		ENSG00000171903	ENSG00000171903		"""Cytochrome P450s"""	13265	protein-coding gene	gene with protein product		611517	"""cytochrome P450, subfamily IVF, polypeptide 11"""			10964514, 9068972	Standard	NM_021187		Approved		uc002nbu.2	Q9HBI6		ENST00000402119.4:c.136C>T	19.37:g.16045083G>A	ENSP00000384588:p.Arg46Cys			Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.R46C	ENST00000402119.4	37	c.136	CCDS12337.1	19	.	.	.	.	.	.	.	.	.	.	g	7.386	0.629733	0.14257	.	.	ENSG00000171903	ENST00000402119;ENST00000248041;ENST00000326742	D;D;D	0.97791	-4.54;-4.54;-4.54	2.18	-0.00717	0.14010	.	0.283347	0.26109	U	0.026284	D	0.92883	0.7736	L	0.35723	1.085	0.09310	N	0.999994	B;B	0.21071	0.051;0.008	B;B	0.20767	0.031;0.014	D	0.85446	0.1158	10	0.49607	T	0.09	.	2.171	0.03849	0.3121:0.0:0.4381:0.2497	.	46;46	F8W978;Q9HBI6	.;CP4FB_HUMAN	C	46	ENSP00000384588:R46C;ENSP00000248041:R46C;ENSP00000319859:R46C	ENSP00000248041:R46C	R	-	1	0	CYP4F11	15906083	0.000000	0.05858	0.000000	0.03702	0.137000	0.21094	-1.898000	0.01602	0.060000	0.16281	0.306000	0.20318	CGC	CYP4F11	-	NULL	ENSG00000171903		0.627	CYP4F11-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CYP4F11	HGNC	protein_coding	OTTHUMT00000460385.2	-	0.00	175	0	G	NM_021187		16045083	-1	tier1	-	no_errors	ENST00000248041	ensembl	human	known	74_37	missense	11.83	163	22	SNP	0.000	A
DDX3Y	8653	genome.wustl.edu	37	Y	15026659	15026659	+	Intron	DEL	T	T	-			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chrY:15026659delT	ENST00000336079.3	+	8	865				DDX3Y_ENST00000463199.1_Intron|DDX3Y_ENST00000360160.4_Intron	NM_001122665.1|NM_004660.3	NP_001116137.1|NP_004651.2	O15523	DDX3Y_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 3, Y-linked							cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)|RNA binding (GO:0003723)			kidney(1)|liver(2)|lung(1)|upper_aerodigestive_tract(1)	5						CTTATTTTCATTTTTTTTTTT	0.284																																																	0																																										SO:0001627	intron_variant	0			AF000984	CCDS14782.1	Yq11	2013-07-16	2013-07-16	2003-06-20	ENSG00000067048	ENSG00000067048		"""DEAD-boxes"""	2699	protein-coding gene	gene with protein product		400010	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide, Y chromosome"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked"""	DBY		9381176	Standard	NM_004660		Approved		uc004fsv.2	O15523	OTTHUMG00000036324	ENST00000336079.3:c.759+98T>-	Y.37:g.15026659delT			B4DK29|B4DXX7|Q8IYV7	RNA	DEL	-	NULL	ENST00000336079.3	37	NULL	CCDS14782.1	Y																																																																																			DDX3Y	-	-	ENSG00000067048		0.284	DDX3Y-003	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX3Y	HGNC	protein_coding	OTTHUMT00000088407.1		0.00	13	0	T	NM_004660		15026659	+1	tier1		no_errors	ENST00000472510	ensembl	human	putative	74_37	rna	26.67	11	4	DEL	0.001	-
DEFB118	117285	genome.wustl.edu	37	20	29960672	29960672	+	Frame_Shift_Del	DEL	A	A	-			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr20:29960672delA	ENST00000253381.2	+	2	104	c.71delA	c.(70-72)gaafs	p.E24fs		NM_054112.2	NP_473453.1	Q96PH6	DB118_HUMAN	defensin, beta 118	24					cell-matrix adhesion (GO:0007160)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)				breast(1)|endometrium(1)|lung(7)|ovary(3)|pancreas(1)|prostate(1)	14	all_hematologic(12;0.158)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			TATAGTGGTGAAAAAAAATGC	0.398																																																	0										2,5,4257		0,0,2,0,5,2125	73.0	72.0	72.0			-3.9	0.0	20		72	1,3,8250		0,0,1,0,3,4123	no	codingComplex	DEFB118	NM_054112.2		0,0,3,0,8,6248	A1A1,A1A2,A1R,A2A2,A2R,RR		0.0485,0.1642,0.0879			29960672	3,8,12507	2203	4300	6503	SO:0001589	frameshift_variant	0			AF347073	CCDS13177.1	20q11.21	2008-02-01	2002-05-09	2002-05-10	ENSG00000131068	ENSG00000131068		"""Defensins, beta"""	16196	protein-coding gene	gene with protein product		607650	"""chromosome 20 open reading frame 63"""	C20orf63		11564719, 15033915	Standard	NM_054112		Approved	dJ1018D12.3, DEFB-18, ESC42	uc002wvr.3	Q96PH6	OTTHUMG00000032161	ENST00000253381.2:c.71delA	20.37:g.29960672delA	ENSP00000253381:p.Glu24fs		Q17RC4|Q8N691|Q9NUH0	Frame_Shift_Del	DEL	NULL	p.K26fs	ENST00000253381.2	37	c.71	CCDS13177.1	20																																																																																			DEFB118	-	NULL	ENSG00000131068		0.398	DEFB118-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB118	HGNC	protein_coding	OTTHUMT00000078501.2		0.00	62	0	A	NM_054112		29960672	+1	tier1		no_errors	ENST00000253381	ensembl	human	known	74_37	frame_shift_del	20.27	59	15	DEL	0.000	-
DHX9	1660	genome.wustl.edu	37	1	182856565	182856565	+	Missense_Mutation	SNP	A	A	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:182856565A>T	ENST00000367549.3	+	28	3919	c.3809A>T	c.(3808-3810)tAt>tTt	p.Y1270F	DHX9_ENST00000485081.1_3'UTR	NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	1270				FGQGRGGGGY -> LDIEEEVAAIKLGYVSSVCRQ (in Ref. 1; AAB48855). {ECO:0000305}.	ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						GGTGGCGGCTATTAAAACTTG	0.478																																					Colon(69;210 1162 3697 13559 39565)												0													50.0	57.0	55.0					1																	182856565		1905	4118	6023	SO:0001583	missense	0			L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.3809A>T	1.37:g.182856565A>T	ENSP00000356520:p.Tyr1270Phe		B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Missense_Mutation	SNP	pfam_dsRNA-bd_dom,pfam_Helicase-assoc_dom,pfam_Helicase_C,pfam_DUF1605,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_dsRNA-bd_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_dsRNA-bd_dom	p.Y1270F	ENST00000367549.3	37	c.3809	CCDS41444.1	1	.	.	.	.	.	.	.	.	.	.	A	4.068	0.010467	0.07912	.	.	ENSG00000135829	ENST00000367549	T	0.03553	3.89	4.52	0.247	0.15521	.	0.840669	0.10510	N	0.666256	T	0.02083	0.0065	N	0.08118	0	0.22266	N	0.99924	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.44982	-0.9292	10	0.87932	D	0	.	4.757	0.13090	0.3384:0.0:0.1093:0.5523	.	549;1270	B3KU66;Q08211	.;DHX9_HUMAN	F	1270	ENSP00000356520:Y1270F	ENSP00000356520:Y1270F	Y	+	2	0	DHX9	181123188	1.000000	0.71417	0.991000	0.47740	0.123000	0.20343	0.840000	0.27600	0.158000	0.19367	0.459000	0.35465	TAT	DHX9	-	NULL	ENSG00000135829		0.478	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX9	HGNC	protein_coding	OTTHUMT00000085522.2	-	0.00	24	0	A	NM_030588		182856565	+1	tier1	-	no_errors	ENST00000367549	ensembl	human	known	74_37	missense	58.70	19	27	SNP	0.993	T
DENND1B	163486	genome.wustl.edu	37	1	197522116	197522116	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:197522116G>T	ENST00000367396.3	-	16	1445	c.1276C>A	c.(1276-1278)Caa>Aaa	p.Q426K	DENND1B_ENST00000400967.2_Missense_Mutation_p.Q396K|DENND1B_ENST00000235453.4_Missense_Mutation_p.Q396K	NM_144977.4	NP_659414.2	Q6P3S1	DEN1B_HUMAN	DENN/MADD domain containing 1B	426					positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|breast(2)|kidney(2)|large_intestine(3)|lung(12)|upper_aerodigestive_tract(1)	22						AATTGTTATTGAGAAAATGGA	0.318																																																	0													105.0	103.0	103.0					1																	197522116		1823	4088	5911	SO:0001583	missense	0			BC016588	CCDS41452.2, CCDS72996.1, CCDS72997.1	1q31.3	2012-10-03	2005-08-17	2005-08-17	ENSG00000213047	ENSG00000213047		"""DENN/MADD domain containing"""	28404	protein-coding gene	gene with protein product		613292	"""family with sequence similarity 31, member B"", ""chromosome 1 open reading frame 218"""	FAM31B, C1orf218		12477932	Standard	NM_144977		Approved	MGC27044, FLJ20054	uc021pgu.1	Q6P3S1	OTTHUMG00000035653	ENST00000367396.3:c.1276C>A	1.37:g.197522116G>T	ENSP00000356366:p.Gln426Lys		B5MD89|D3PFD5|Q5T3B8|Q5T3B9|Q5T3C1|Q5TAI8|Q6B0I8|Q8NDT1|Q8TBE6|Q9H774|Q9NXU2	Missense_Mutation	SNP	pfam_DENN_dom,pfam_dDENN_dom,pfam_uDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.Q426K	ENST00000367396.3	37	c.1276	CCDS41452.2	1	.	.	.	.	.	.	.	.	.	.	G	8.028	0.761079	0.15914	.	.	ENSG00000213047	ENST00000235453;ENST00000367396;ENST00000400967	T;T;T	0.10960	3.16;2.82;3.16	4.91	-2.54	0.06307	.	.	.	.	.	T	0.03564	0.0102	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.45264	-0.9273	9	0.13853	T	0.58	.	1.6054	0.02683	0.15:0.196:0.1541:0.4999	.	426;396	Q6P3S1;Q6P3S1-4	DEN1B_HUMAN;.	K	396;426;396	ENSP00000235453:Q396K;ENSP00000356366:Q426K;ENSP00000383751:Q396K	ENSP00000235453:Q396K	Q	-	1	0	DENND1B	195788739	0.000000	0.05858	0.000000	0.03702	0.054000	0.15201	-0.381000	0.07417	-0.271000	0.09272	-2.361000	0.00239	CAA	DENND1B	-	NULL	ENSG00000213047		0.318	DENND1B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND1B	HGNC	protein_coding	OTTHUMT00000086539.1		0.00	22	0	G	NM_144977		197522116	-1			no_errors	ENST00000367396	ensembl	human	known	74_37	missense	7.69	36	3	SNP	0.000	T
DIAPH3	81624	genome.wustl.edu	37	13	60384942	60384942	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr13:60384942C>G	ENST00000400324.4	-	25	3363	c.3143G>C	c.(3142-3144)cGt>cCt	p.R1048P	DIAPH3_ENST00000465066.1_5'UTR|DIAPH3_ENST00000377908.2_Missense_Mutation_p.R1037P|DIAPH3_ENST00000400319.1_Missense_Mutation_p.R978P|DIAPH3_ENST00000400320.1_Missense_Mutation_p.R1002P|DIAPH3_ENST00000267215.4_Missense_Mutation_p.R1048P|DIAPH3_ENST00000400330.1_Missense_Mutation_p.R1048P	NM_001042517.1|NM_001258366.1	NP_001035982.1|NP_001245295.1	Q9NSV4	DIAP3_HUMAN	diaphanous-related formin 3	1048					actin cytoskeleton organization (GO:0030036)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|liver(1)|lung(20)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		TTCTAATAAACGCTTTTTCTT	0.303																																																	0													152.0	140.0	144.0					13																	60384942		1800	4061	5861	SO:0001583	missense	0			AL137718	CCDS41898.1, CCDS58294.1, CCDS58295.1, CCDS58296.1, CCDS58297.1, CCDS73579.1, CCDS73580.1	13q21.2	2013-05-24	2013-05-24		ENSG00000139734	ENSG00000139734			15480	protein-coding gene	gene with protein product		614567	"""diaphanous (Drosophila, homolog) 3"", ""auditory neuropathy, autosomal dominant 1"", ""diaphanous homolog 3 (Drosophila)"""	AUNA1		14767582, 20624953	Standard	NM_030932		Approved	DRF3, FLJ34705, AN, NSDAN	uc001vht.4	Q9NSV4	OTTHUMG00000017004	ENST00000400324.4:c.3143G>C	13.37:g.60384942C>G	ENSP00000383178:p.Arg1048Pro		A2A3B8|A2A3B9|A2A3C0|Q18P99|Q18PA0|Q18PA1|Q2KPB6|Q3ZK23|Q5JTP8|Q5T2S7|Q5XKF6|Q6MZF0|Q6NUP0|Q86VS4|Q8NAV4	Missense_Mutation	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,pfam_Drf_DAD,superfamily_ARM-type_fold,smart_FH2_Formin	p.R1048P	ENST00000400324.4	37	c.3143	CCDS41898.1	13	.	.	.	.	.	.	.	.	.	.	C	17.45	3.393763	0.62066	.	.	ENSG00000139734	ENST00000400324;ENST00000400330;ENST00000400327;ENST00000413168;ENST00000400329;ENST00000377908;ENST00000400319;ENST00000400320;ENST00000267215;ENST00000267214	D;D;D;D;D;D	0.81821	-1.54;-1.54;-1.53;-1.52;-1.52;-1.52	5.37	3.58	0.41010	Actin-binding FH2/DRF autoregulatory (1);	0.266045	0.35936	N	0.002891	T	0.73760	0.3628	L	0.55103	1.725	0.27964	N	0.936656	B;P	0.43094	0.013;0.799	B;B	0.39738	0.046;0.308	T	0.67245	-0.5719	10	0.48119	T	0.1	.	8.303	0.32025	0.1556:0.7614:0.0:0.083	.	785;1048	Q9NSV4-1;Q9NSV4	.;DIAP3_HUMAN	P	1048;1048;1037;1002;978;1037;978;1002;1048;785	ENSP00000383178:R1048P;ENSP00000383184:R1048P;ENSP00000367141:R1037P;ENSP00000383173:R978P;ENSP00000383174:R1002P;ENSP00000267215:R1048P	ENSP00000267214:R785P	R	-	2	0	DIAPH3	59282943	0.986000	0.35501	0.958000	0.39756	0.939000	0.58152	1.179000	0.31993	0.708000	0.31955	0.591000	0.81541	CGT	DIAPH3	-	smart_FH2_Formin	ENSG00000139734		0.303	DIAPH3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIAPH3	HGNC	protein_coding	OTTHUMT00000045166.3	-	0.00	28	0	C	NM_001042517		60384942	-1	tier1	-	no_errors	ENST00000400324	ensembl	human	known	74_37	missense	32.26	21	10	SNP	0.981	G
DIS3L	115752	genome.wustl.edu	37	15	66613011	66613011	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr15:66613011G>A	ENST00000319212.4	+	9	1317	c.1267G>A	c.(1267-1269)Gaa>Aaa	p.E423K	DIS3L_ENST00000319194.5_Missense_Mutation_p.E340K|DIS3L_ENST00000441424.2_Missense_Mutation_p.G232E|RP11-352G18.2_ENST00000565993.1_RNA	NM_001143688.1	NP_001137160.1	Q8TF46	DI3L1_HUMAN	DIS3 like exosome 3'-5' exoribonuclease	423					RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)	cytoplasmic exosome (RNase complex) (GO:0000177)	3'-5'-exoribonuclease activity (GO:0000175)|enzyme binding (GO:0019899)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						TCTGGAAGGGGAAATTGCAAC	0.438																																																	0													187.0	176.0	180.0					15																	66613011		2201	4299	6500	SO:0001583	missense	0				CCDS10214.1, CCDS45286.1	15q22.31	2014-03-05	2014-03-05		ENSG00000166938	ENSG00000166938			28698	protein-coding gene	gene with protein product		614183	"""DIS3 mitotic control homolog (S. cerevisiae)-like"""			20531386	Standard	NM_001143688		Approved	MGC4562, FLJ38088, KIAA1955, DIS3L1	uc010ujm.2	Q8TF46	OTTHUMG00000133181	ENST00000319212.4:c.1267G>A	15.37:g.66613011G>A	ENSP00000321711:p.Glu423Lys		Q8N1N8|Q8WTU9|Q96CM7	Missense_Mutation	SNP	NULL	p.E423K	ENST00000319212.4	37	c.1267	CCDS45286.1	15	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.5|27.5	4.840989|4.840989	0.91197|0.91197	.|.	.|.	ENSG00000166938|ENSG00000166938	ENST00000319194;ENST00000319212|ENST00000441424	T;T|T	0.50813|0.54866	0.73;0.73|0.55	5.18|5.18	4.26|4.26	0.50523|0.50523	.|.	0.207171|.	0.50627|.	D|.	0.000108|.	T|T	0.77418|0.77418	0.4127|0.4127	H|H	0.95437|0.95437	3.67|3.67	0.32359|0.32359	N|N	0.557499|0.557499	D;D;D|.	0.76494|.	0.997;0.999;0.999|.	D;D;D|.	0.76575|.	0.959;0.988;0.971|.	D|D	0.85701|0.85701	0.1313|0.1313	10|7	0.87932|0.87932	D|D	0|0	-6.8243|-6.8243	12.6919|12.6919	0.56980|0.56980	0.0799:0.0:0.9201:0.0|0.0799:0.0:0.9201:0.0	.|.	423;289;423|.	Q8TF46;Q8TF46-2;Q8TF46-3|.	DI3L1_HUMAN;.;.|.	K|E	340;423|232	ENSP00000321583:E340K;ENSP00000321711:E423K|ENSP00000388980:G232E	ENSP00000321583:E340K|ENSP00000388980:G232E	E|G	+|+	1|2	0|0	DIS3L|DIS3L	64400065|64400065	1.000000|1.000000	0.71417|0.71417	0.915000|0.915000	0.36163|0.36163	0.941000|0.941000	0.58515|0.58515	9.583000|9.583000	0.98217|0.98217	1.177000|1.177000	0.42855|0.42855	0.561000|0.561000	0.74099|0.74099	GAA|GGA	DIS3L	-	NULL	ENSG00000166938		0.438	DIS3L-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIS3L	HGNC	protein_coding	OTTHUMT00000382792.2	-	0.00	54	0	G	NM_133375		66613011	+1	tier1	-	no_errors	ENST00000319212	ensembl	human	known	74_37	missense	36.00	48	27	SNP	1.000	A
DNAH17	8632	genome.wustl.edu	37	17	76464751	76464751	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr17:76464751G>T	ENST00000585328.1	-	55	8835	c.8711C>A	c.(8710-8712)aCt>aAt	p.T2904N	DNAH17_ENST00000389840.5_Missense_Mutation_p.T2895N|DNAH17_ENST00000586052.1_5'UTR	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	2895	AAA 4. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			TGTTTCCCGAGTGTCATTCAT	0.567																																																	0													65.0	66.0	66.0					17																	76464751		1980	4171	6151	SO:0001583	missense	0			AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.8711C>A	17.37:g.76464751G>T	ENSP00000465516:p.Thr2904Asn		O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_HR1_rho-bd	p.T2895N	ENST00000585328.1	37	c.8684		17	.	.	.	.	.	.	.	.	.	.	G	9.346	1.064322	0.20067	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.45668	0.89	4.9	3.91	0.45181	.	.	.	.	.	T	0.57080	0.2029	M	0.72894	2.215	0.38623	D	0.951185	.	.	.	.	.	.	T	0.62402	-0.6862	7	0.44086	T	0.13	.	15.1245	0.72472	0.0:0.1422:0.8578:0.0	.	.	.	.	N	2904;2895	ENSP00000374490:T2895N	ENSP00000300671:T2904N	T	-	2	0	DNAH17	73976346	1.000000	0.71417	0.662000	0.29724	0.032000	0.12392	7.677000	0.84024	1.032000	0.39892	0.650000	0.86243	ACT	DNAH17	-	superfamily_P-loop_NTPase	ENSG00000187775		0.567	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	DNAH17	HGNC	protein_coding	OTTHUMT00000318962.2	-	0.00	34	0	G	NM_173628		76464751	-1	tier1	-	no_errors	ENST00000389840	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.998	T
DNAH17	8632	genome.wustl.edu	37	17	76464751	76464751	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr17:76464751G>T	ENST00000585328.1	-	55	8835	c.8711C>A	c.(8710-8712)aCt>aAt	p.T2904N	DNAH17_ENST00000389840.5_Missense_Mutation_p.T2895N|DNAH17_ENST00000586052.1_5'UTR	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	2895	AAA 4. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			TGTTTCCCGAGTGTCATTCAT	0.567																																																	0													65.0	66.0	66.0					17																	76464751		1980	4171	6151	SO:0001583	missense	0			AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.8711C>A	17.37:g.76464751G>T	ENSP00000465516:p.Thr2904Asn		O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_HR1_rho-bd	p.T2895N	ENST00000585328.1	37	c.8684		17	.	.	.	.	.	.	.	.	.	.	G	9.346	1.064322	0.20067	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.45668	0.89	4.9	3.91	0.45181	.	.	.	.	.	T	0.57080	0.2029	M	0.72894	2.215	0.38623	D	0.951185	.	.	.	.	.	.	T	0.62402	-0.6862	7	0.44086	T	0.13	.	15.1245	0.72472	0.0:0.1422:0.8578:0.0	.	.	.	.	N	2904;2895	ENSP00000374490:T2895N	ENSP00000300671:T2904N	T	-	2	0	DNAH17	73976346	1.000000	0.71417	0.662000	0.29724	0.032000	0.12392	7.677000	0.84024	1.032000	0.39892	0.650000	0.86243	ACT	DNAH17	-	superfamily_P-loop_NTPase	ENSG00000187775		0.567	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	DNAH17	HGNC	protein_coding	OTTHUMT00000318962.2	-	0.00	38	0	G	NM_173628		76464751	-1	tier1	-	no_errors	ENST00000389840	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.998	T
DNAJA1	3301	genome.wustl.edu	37	9	33030447	33030447	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr9:33030447G>A	ENST00000330899.4	+	5	608	c.425G>A	c.(424-426)gGt>gAt	p.G142D	DNAJA1_ENST00000495015.1_Intron|DNAJA1_ENST00000544625.1_5'UTR	NM_001539.2	NP_001530.1	P31689	DNJA1_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 1	142					androgen receptor signaling pathway (GO:0030521)|DNA damage response, detection of DNA damage (GO:0042769)|negative regulation of apoptotic process (GO:0043066)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of protein ubiquitination (GO:0031397)|positive regulation of apoptotic process (GO:0043065)|protein folding (GO:0006457)|protein localization to mitochondrion (GO:0070585)|regulation of protein transport (GO:0051223)|response to heat (GO:0009408)|response to unfolded protein (GO:0006986)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasmic side of endoplasmic reticulum membrane (GO:0098554)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|G-protein coupled receptor binding (GO:0001664)|Hsp70 protein binding (GO:0030544)|low-density lipoprotein particle receptor binding (GO:0050750)|metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)			large_intestine(2)|ovary(1)|skin(3)	6			LUSC - Lung squamous cell carcinoma(29;0.0227)	GBM - Glioblastoma multiforme(74;0.102)		GGTAGAGGAGGTAAGAAAGGA	0.338																																																	0													48.0	44.0	45.0					9																	33030447		2203	4300	6503	SO:0001583	missense	0			L08069	CCDS6533.1	9p13.3	2011-09-02			ENSG00000086061	ENSG00000086061		"""Heat shock proteins / DNAJ (HSP40)"""	5229	protein-coding gene	gene with protein product	"""neural precursor cell expressed, developmentally down-regulated 7"""	602837		HSJ2		8334160, 11147971	Standard	NM_001539		Approved	HSPF4, hdj-2, dj-2, NEDD7	uc003zsd.1	P31689	OTTHUMG00000019760	ENST00000330899.4:c.425G>A	9.37:g.33030447G>A	ENSP00000369127:p.Gly142Asp		Q5T7Q0|Q86TL9	Missense_Mutation	SNP	pfam_DnaJ_C,pfam_DnaJ_domain,pfam_HSP_DnaJ_Cys-rich_dom,superfamily_DnaJ_domain,superfamily_HSP40/DnaJ_pept-bd,superfamily_HSP_DnaJ_Cys-rich_dom,smart_DnaJ_domain,pfscan_DnaJ_domain,pfscan_HSP_DnaJ_Cys-rich_dom,prints_DnaJ_domain	p.G142D	ENST00000330899.4	37	c.425	CCDS6533.1	9	.	.	.	.	.	.	.	.	.	.	G	22.6	4.314436	0.81358	.	.	ENSG00000086061	ENST00000330899	T	0.61859	0.07	4.79	4.79	0.61399	HSP40/DnaJ peptide-binding (1);Heat shock protein DnaJ, cysteine-rich domain (4);	0.051698	0.85682	D	0.000000	T	0.78935	0.4362	M	0.91768	3.24	0.80722	D	1	P;P	0.50066	0.879;0.931	P;P	0.59948	0.658;0.866	D	0.84290	0.0499	10	0.87932	D	0	-7.8456	15.6808	0.77367	0.0:0.0:1.0:0.0	.	142;142	Q86TL9;P31689	.;DNJA1_HUMAN	D	142	ENSP00000369127:G142D	ENSP00000369127:G142D	G	+	2	0	DNAJA1	33020447	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	9.655000	0.98512	2.377000	0.81083	0.313000	0.20887	GGT	DNAJA1	-	pfam_HSP_DnaJ_Cys-rich_dom,superfamily_HSP40/DnaJ_pept-bd,superfamily_HSP_DnaJ_Cys-rich_dom,pfscan_HSP_DnaJ_Cys-rich_dom	ENSG00000086061		0.338	DNAJA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJA1	HGNC	protein_coding	OTTHUMT00000052031.1	-	0.00	24	0	G			33030447	+1	tier1	-	no_errors	ENST00000330899	ensembl	human	known	74_37	missense	71.43	4	10	SNP	1.000	A
DOPEY2	9980	genome.wustl.edu	37	21	37617444	37617444	+	Silent	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr21:37617444C>T	ENST00000399151.3	+	19	3251	c.3166C>T	c.(3166-3168)Ctg>Ttg	p.L1056L		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	1056					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						GCACCTGCCTCTGAGCCAGTT	0.582																																																	0													32.0	33.0	33.0					21																	37617444		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.3166C>T	21.37:g.37617444C>T			D3DSG5|Q6PJQ7|Q9UEZ3	Silent	SNP	pfam_Dopey_N	p.L1056	ENST00000399151.3	37	c.3166	CCDS13643.1	21																																																																																			DOPEY2	-	NULL	ENSG00000142197		0.582	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOPEY2	HGNC	protein_coding	OTTHUMT00000194636.1	-	0.00	35	0	C	NM_005128		37617444	+1	tier1	-	no_errors	ENST00000399151	ensembl	human	known	74_37	silent	26.53	36	13	SNP	0.284	T
DOPEY2	9980	genome.wustl.edu	37	21	37617444	37617444	+	Silent	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr21:37617444C>T	ENST00000399151.3	+	19	3251	c.3166C>T	c.(3166-3168)Ctg>Ttg	p.L1056L		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	1056					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						GCACCTGCCTCTGAGCCAGTT	0.582																																																	0													32.0	33.0	33.0					21																	37617444		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.3166C>T	21.37:g.37617444C>T			D3DSG5|Q6PJQ7|Q9UEZ3	Silent	SNP	pfam_Dopey_N	p.L1056	ENST00000399151.3	37	c.3166	CCDS13643.1	21																																																																																			DOPEY2	-	NULL	ENSG00000142197		0.582	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOPEY2	HGNC	protein_coding	OTTHUMT00000194636.1	-	0.00	46	0	C	NM_005128		37617444	+1	tier1	-	no_errors	ENST00000399151	ensembl	human	known	74_37	silent	26.53	36	13	SNP	0.284	T
DYRK1B	9149	genome.wustl.edu	37	19	40320627	40320627	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr19:40320627G>A	ENST00000593685.1	-	5	881	c.413C>T	c.(412-414)gCc>gTc	p.A138V	DYRK1B_ENST00000323039.5_Missense_Mutation_p.A138V|DYRK1B_ENST00000430012.2_Missense_Mutation_p.A138V|DYRK1B_ENST00000348817.3_Missense_Mutation_p.A138V|DYRK1B_ENST00000597639.1_Missense_Mutation_p.A138V			Q9Y463	DYR1B_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B	138	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adipose tissue development (GO:0060612)|myoblast fusion (GO:0007520)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(7)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	24	all_cancers(60;5.79e-06)|all_lung(34;5.2e-08)|Lung NSC(34;6.14e-08)|Ovarian(47;0.06)		Epithelial(26;5.74e-25)|OV - Ovarian serous cystadenocarcinoma(5;3.13e-24)|all cancers(26;8.59e-23)			GATCTTGATGGCCACAAGCTC	0.547																																																	0													111.0	96.0	101.0					19																	40320627		2203	4300	6503	SO:0001583	missense	0			Y17999	CCDS12543.1, CCDS12544.1, CCDS46075.1	19q13.2	2012-10-02			ENSG00000105204	ENSG00000105204	2.7.12.1		3092	protein-coding gene	gene with protein product	"""minibrain-related kinase"""	604556				9918863	Standard	XM_005259395		Approved	MIRK	uc002omj.3	Q9Y463		ENST00000593685.1:c.413C>T	19.37:g.40320627G>A	ENSP00000469863:p.Ala138Val		O75258|O75788|O75789	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.A138V	ENST00000593685.1	37	c.413	CCDS12543.1	19	.	.	.	.	.	.	.	.	.	.	G	28.0	4.884056	0.91814	.	.	ENSG00000105204	ENST00000323039;ENST00000348817;ENST00000430012	T;T;T	0.52526	0.66;0.66;0.66	4.3	4.3	0.51218	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.060827	0.64402	D	0.000004	T	0.75481	0.3855	M	0.93898	3.47	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.999;0.997	T	0.82849	-0.0254	10	0.87932	D	0	.	14.313	0.66429	0.0:0.0:1.0:0.0	.	138;138;138	Q9Y463-2;Q9Y463;Q9Y463-3	.;DYR1B_HUMAN;.	V	138	ENSP00000312789:A138V;ENSP00000221803:A138V;ENSP00000403182:A138V	ENSP00000312789:A138V	A	-	2	0	DYRK1B	45012467	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	9.601000	0.98297	2.236000	0.73375	0.561000	0.74099	GCC	DYRK1B	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000105204		0.547	DYRK1B-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DYRK1B	HGNC	protein_coding	OTTHUMT00000462874.2	-	0.00	28	0	G	NM_004714		40320627	-1	tier1	-	no_errors	ENST00000323039	ensembl	human	known	74_37	missense	8.51	43	4	SNP	1.000	A
EBF1	1879	genome.wustl.edu	37	5	158141168	158141168	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr5:158141168G>A	ENST00000313708.6	-	12	1430	c.1148C>T	c.(1147-1149)gCg>gTg	p.A383V	EBF1_ENST00000517373.1_Missense_Mutation_p.A375V|EBF1_ENST00000518836.1_5'UTR|EBF1_ENST00000380654.4_Missense_Mutation_p.A352V	NM_024007.3	NP_076870.1	Q9UH73	COE1_HUMAN	early B-cell factor 1	383					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)		HMGA2/EBF1(2)	breast(3)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TACCAGATCCGCAGCCCTTTT	0.468			T	HMGA2	lipoma																																			Dom	yes		5	5q34	1879	early B-cell factor 1		M	0													232.0	217.0	222.0					5																	158141168		2203	4300	6503	SO:0001583	missense	0			AF208502	CCDS4343.1	5q34	2008-02-05	2006-09-26	2006-09-26	ENSG00000164330	ENSG00000164330			3126	protein-coding gene	gene with protein product		164343	"""early B-cell factor"""	EBF		8012110	Standard	NM_024007		Approved	OLF1	uc010jip.3	Q9UH73	OTTHUMG00000130304	ENST00000313708.6:c.1148C>T	5.37:g.158141168G>A	ENSP00000322898:p.Ala383Val		Q8IW11	Missense_Mutation	SNP	pfam_IPT,superfamily_Ig_E-set,superfamily_bHLH_dom,smart_IPT	p.A383V	ENST00000313708.6	37	c.1148	CCDS4343.1	5	.	.	.	.	.	.	.	.	.	.	G	26.7	4.765339	0.90020	.	.	ENSG00000164330	ENST00000318060;ENST00000313708;ENST00000380654;ENST00000517373	D;D;D	0.87103	-2.21;-2.21;-2.21	5.76	5.76	0.90799	Helix-loop-helix DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.94506	0.8231	M	0.85859	2.78	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.998;1.0	D;D;P;D	0.91635	0.995;0.915;0.691;0.999	D	0.94576	0.7775	10	0.72032	D	0.01	-4.5561	19.9759	0.97304	0.0:0.0:1.0:0.0	.	383;370;383;352	A8K0Z7;B4E2U8;Q9UH73;Q9UH73-2	.;.;COE1_HUMAN;.	V	383;383;352;375	ENSP00000322898:A383V;ENSP00000370029:A352V;ENSP00000428020:A375V	ENSP00000322898:A383V	A	-	2	0	EBF1	158073746	1.000000	0.71417	0.751000	0.31187	0.579000	0.36224	9.869000	0.99810	2.713000	0.92767	0.655000	0.94253	GCG	EBF1	-	superfamily_bHLH_dom	ENSG00000164330		0.468	EBF1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	EBF1	HGNC	protein_coding	OTTHUMT00000252649.1	-	0.00	38	0	G	NM_024007		158141168	-1	tier1	-	no_errors	ENST00000313708	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	A
EBF1	1879	genome.wustl.edu	37	5	158141168	158141168	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr5:158141168G>A	ENST00000313708.6	-	12	1430	c.1148C>T	c.(1147-1149)gCg>gTg	p.A383V	EBF1_ENST00000517373.1_Missense_Mutation_p.A375V|EBF1_ENST00000518836.1_5'UTR|EBF1_ENST00000380654.4_Missense_Mutation_p.A352V	NM_024007.3	NP_076870.1	Q9UH73	COE1_HUMAN	early B-cell factor 1	383					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)		HMGA2/EBF1(2)	breast(3)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TACCAGATCCGCAGCCCTTTT	0.468			T	HMGA2	lipoma																																			Dom	yes		5	5q34	1879	early B-cell factor 1		M	0													232.0	217.0	222.0					5																	158141168		2203	4300	6503	SO:0001583	missense	0			AF208502	CCDS4343.1	5q34	2008-02-05	2006-09-26	2006-09-26	ENSG00000164330	ENSG00000164330			3126	protein-coding gene	gene with protein product		164343	"""early B-cell factor"""	EBF		8012110	Standard	NM_024007		Approved	OLF1	uc010jip.3	Q9UH73	OTTHUMG00000130304	ENST00000313708.6:c.1148C>T	5.37:g.158141168G>A	ENSP00000322898:p.Ala383Val		Q8IW11	Missense_Mutation	SNP	pfam_IPT,superfamily_Ig_E-set,superfamily_bHLH_dom,smart_IPT	p.A383V	ENST00000313708.6	37	c.1148	CCDS4343.1	5	.	.	.	.	.	.	.	.	.	.	G	26.7	4.765339	0.90020	.	.	ENSG00000164330	ENST00000318060;ENST00000313708;ENST00000380654;ENST00000517373	D;D;D	0.87103	-2.21;-2.21;-2.21	5.76	5.76	0.90799	Helix-loop-helix DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.94506	0.8231	M	0.85859	2.78	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.998;1.0	D;D;P;D	0.91635	0.995;0.915;0.691;0.999	D	0.94576	0.7775	10	0.72032	D	0.01	-4.5561	19.9759	0.97304	0.0:0.0:1.0:0.0	.	383;370;383;352	A8K0Z7;B4E2U8;Q9UH73;Q9UH73-2	.;.;COE1_HUMAN;.	V	383;383;352;375	ENSP00000322898:A383V;ENSP00000370029:A352V;ENSP00000428020:A375V	ENSP00000322898:A383V	A	-	2	0	EBF1	158073746	1.000000	0.71417	0.751000	0.31187	0.579000	0.36224	9.869000	0.99810	2.713000	0.92767	0.655000	0.94253	GCG	EBF1	-	superfamily_bHLH_dom	ENSG00000164330		0.468	EBF1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	EBF1	HGNC	protein_coding	OTTHUMT00000252649.1	-	0.00	61	0	G	NM_024007		158141168	-1	tier1	-	no_errors	ENST00000313708	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	A
EEA1	8411	genome.wustl.edu	37	12	93171841	93171841	+	Missense_Mutation	SNP	A	A	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr12:93171841A>G	ENST00000322349.8	-	26	4033	c.3769T>C	c.(3769-3771)Tgg>Cgg	p.W1257R		NM_003566.3	NP_003557	Q15075	EEA1_HUMAN	early endosome antigen 1	1257					early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|synaptic vesicle to endosome fusion (GO:0016189)|vesicle fusion (GO:0006906)	axonal spine (GO:0044308)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|recycling endosome (GO:0055037)|serine-pyruvate aminotransferase complex (GO:0005969)	1-phosphatidylinositol binding (GO:0005545)|calmodulin binding (GO:0005516)|GTP-dependent protein binding (GO:0030742)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(11)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	36						CTAGATTGCCACTCCTTCTTC	0.393																																																	0													258.0	235.0	243.0					12																	93171841		2203	4300	6503	SO:0001583	missense	0			L40157	CCDS31874.1	12q22	2007-02-23	2007-02-23			ENSG00000102189		"""Zinc fingers, FYVE domain containing"""	3185	protein-coding gene	gene with protein product		605070	"""early endosome antigen 1, 162kD"""			7768953, 9697774	Standard	NM_003566		Approved	ZFYVE2	uc001tck.3	Q15075	OTTHUMG00000170110	ENST00000322349.8:c.3769T>C	12.37:g.93171841A>G	ENSP00000317955:p.Trp1257Arg		Q14221	Missense_Mutation	SNP	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel,pfscan_Znf_C2H2	p.W1257R	ENST00000322349.8	37	c.3769	CCDS31874.1	12	.	.	.	.	.	.	.	.	.	.	A	22.2	4.263346	0.80358	.	.	ENSG00000102189	ENST00000322349	T	0.64618	-0.11	5.61	5.61	0.85477	.	0.000000	0.50627	D	0.000113	T	0.69178	0.3082	L	0.36672	1.1	0.80722	D	1	D	0.61697	0.99	D	0.66716	0.946	T	0.65561	-0.6138	10	0.25106	T	0.35	.	15.7982	0.78428	1.0:0.0:0.0:0.0	.	1257	Q15075	EEA1_HUMAN	R	1257	ENSP00000317955:W1257R	ENSP00000317955:W1257R	W	-	1	0	EEA1	91695972	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	9.069000	0.93967	2.124000	0.65301	0.477000	0.44152	TGG	EEA1	-	NULL	ENSG00000102189		0.393	EEA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEA1	HGNC	protein_coding	OTTHUMT00000407304.1	-	0.00	77	0	A	NM_003566		93171841	-1	tier1	-	no_errors	ENST00000322349	ensembl	human	known	74_37	missense	53.03	31	35	SNP	1.000	G
EIF1	10209	genome.wustl.edu	37	17	39845272	39845272	+	5'UTR	SNP	G	G	C			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr17:39845272G>C	ENST00000469257.1	+	0	128				JUP_ENST00000540235.1_Intron|EIF1_ENST00000310837.4_3'UTR|EIF1_ENST00000591776.1_5'UTR			P41567	EIF1_HUMAN	eukaryotic translation initiation factor 1						dosage compensation by inactivation of X chromosome (GO:0009048)|regulation of translational initiation (GO:0006446)|response to stress (GO:0006950)	cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(2)|skin(1)	5		Breast(137;0.000307)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			TTTCCACCGAGGAAAAGGAAT	0.677																																					Pancreas(176;1692 2837 16734 17588)												0													35.0	33.0	34.0					17																	39845272		2203	4299	6502	SO:0001623	5_prime_UTR_variant	0			AF083441	CCDS11403.1	17q21.2	2006-02-02			ENSG00000173812	ENSG00000173812			3249	protein-coding gene	gene with protein product						7904817, 10347211	Standard	NM_005801		Approved	EIF-1, ISO1, A121, SUI1, EIF1A	uc002hxj.3	P41567	OTTHUMG00000133492	ENST00000469257.1:c.-19G>C	17.37:g.39845272G>C			Q9UNQ9	RNA	SNP	-	NULL	ENST00000469257.1	37	NULL	CCDS11403.1	17																																																																																			EIF1	-	-	ENSG00000173812		0.677	EIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF1	HGNC	protein_coding	OTTHUMT00000257390.1	-	0.00	94	0	G	NM_005801		39845272	+1	tier1	-	no_errors	ENST00000310837	ensembl	human	known	74_37	rna	66.11	163	318	SNP	1.000	C
EIF1	10209	genome.wustl.edu	37	17	39845305	39845305	+	Missense_Mutation	SNP	G	G	C			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr17:39845305G>C	ENST00000469257.1	+	1	161	c.15G>C	c.(13-15)caG>caC	p.Q5H	JUP_ENST00000540235.1_Intron|EIF1_ENST00000310837.4_3'UTR|EIF1_ENST00000591776.1_Missense_Mutation_p.Q5H			P41567	EIF1_HUMAN	eukaryotic translation initiation factor 1	5					dosage compensation by inactivation of X chromosome (GO:0009048)|regulation of translational initiation (GO:0006446)|response to stress (GO:0006950)	cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(2)|skin(1)	5		Breast(137;0.000307)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			CCGCTATCCAGAACCTCCACT	0.667																																					Pancreas(176;1692 2837 16734 17588)												0													44.0	43.0	43.0					17																	39845305		2203	4298	6501	SO:0001583	missense	0			AF083441	CCDS11403.1	17q21.2	2006-02-02			ENSG00000173812	ENSG00000173812			3249	protein-coding gene	gene with protein product						7904817, 10347211	Standard	NM_005801		Approved	EIF-1, ISO1, A121, SUI1, EIF1A	uc002hxj.3	P41567	OTTHUMG00000133492	ENST00000469257.1:c.15G>C	17.37:g.39845305G>C	ENSP00000419449:p.Gln5His		Q9UNQ9	Missense_Mutation	SNP	pfam_TIF_SUI1,superfamily_TIF_SUI1,pirsf_SUI1_euk,pfscan_TIF_SUI1,tigrfam_SUI1_euk	p.Q5H	ENST00000469257.1	37	c.15	CCDS11403.1	17	.	.	.	.	.	.	.	.	.	.	G	18.36	3.606150	0.66445	.	.	ENSG00000173812	ENST00000469257	T	0.30714	1.52	5.53	3.5	0.40072	Translation initiation factor SUI1 (1);	0.058090	0.64402	D	0.000001	T	0.33789	0.0875	M	0.75085	2.285	0.47621	D	0.999472	B	0.06786	0.001	B	0.11329	0.006	T	0.19877	-1.0292	10	0.62326	D	0.03	-3.8261	10.4599	0.44572	0.0738:0.1339:0.7922:0.0	.	5	P41567	EIF1_HUMAN	H	5	ENSP00000419449:Q5H	ENSP00000419449:Q5H	Q	+	3	2	EIF1	37098831	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.377000	0.79668	0.848000	0.35191	0.650000	0.86243	CAG	EIF1	-	superfamily_TIF_SUI1,pirsf_SUI1_euk,tigrfam_SUI1_euk	ENSG00000173812		0.667	EIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF1	HGNC	protein_coding	OTTHUMT00000257390.1	-	0.00	82	0	G	NM_005801		39845305	+1	tier1	-	no_errors	ENST00000469257	ensembl	human	known	74_37	missense	68.59	177	393	SNP	1.000	C
EIF1	10209	genome.wustl.edu	37	17	39845392	39845392	+	Intron	SNP	G	G	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr17:39845392G>T	ENST00000469257.1	+	1	177				JUP_ENST00000540235.1_Intron|EIF1_ENST00000310837.4_Intron|EIF1_ENST00000591776.1_Intron			P41567	EIF1_HUMAN	eukaryotic translation initiation factor 1						dosage compensation by inactivation of X chromosome (GO:0009048)|regulation of translational initiation (GO:0006446)|response to stress (GO:0006950)	cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(2)|skin(1)	5		Breast(137;0.000307)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			CGTGTTCCGGGAAGTTGCCAA	0.682																																					Pancreas(176;1692 2837 16734 17588)												0													21.0	20.0	20.0					17																	39845392		692	1591	2283	SO:0001627	intron_variant	0			AF083441	CCDS11403.1	17q21.2	2006-02-02			ENSG00000173812	ENSG00000173812			3249	protein-coding gene	gene with protein product						7904817, 10347211	Standard	NM_005801		Approved	EIF-1, ISO1, A121, SUI1, EIF1A	uc002hxj.3	P41567	OTTHUMG00000133492	ENST00000469257.1:c.31+71G>T	17.37:g.39845392G>T			Q9UNQ9	RNA	SNP	-	NULL	ENST00000469257.1	37	NULL	CCDS11403.1	17																																																																																			EIF1	-	-	ENSG00000173812		0.682	EIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF1	HGNC	protein_coding	OTTHUMT00000257390.1	-	0.00	40	0	G	NM_005801		39845392	+1	tier1	-	no_errors	ENST00000469308	ensembl	human	known	74_37	rna	68.93	95	213	SNP	0.000	T
BCRP7	100133163	genome.wustl.edu	37	22	18844491	18844491	+	3'UTR	SNP	A	A	G	rs4080535		TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr22:18844491A>G	ENST00000412938.1	+	0	2741																											TGGCTGGACCAGGACCCATGG	0.582																																																	0																																										SO:0001624	3_prime_UTR_variant	0																														ENST00000412938.1:c.*2738A>G	22.37:g.18844491A>G				RNA	SNP	-	NULL	ENST00000412938.1	37	NULL		22																																																																																			AC008132.13	-	-	ENSG00000161103		0.582	AC008132.13-002	KNOWN	basic	processed_transcript	ENSG00000161103	Clone_based_vega_gene	protein_coding	OTTHUMT00000471615.1		0.00	8	0	A			18844491	+1			no_errors	ENST00000412938	ensembl	human	known	74_37	rna	42.86	4	3	SNP	0.004	G
YEATS2	55689	genome.wustl.edu	37	3	183520275	183520276	+	Intron	INS	-	-	TG	rs146218655|rs199651221|rs200684537|rs57389342|rs10663581		TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr3:183520275_183520276insTG	ENST00000305135.5	+	26	3697				AC131160.1_ENST00000401347.1_RNA	NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2						chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			TCTCTtatatatgtgtgtgtgt	0.322																																																	0																																										SO:0001627	intron_variant	0			AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.3503-768->TG	3.37:g.183520284_183520285dupTG			A7E2B9|D3DNS9|Q641P6|Q9NW96	RNA	INS	-	NULL	ENST00000305135.5	37	NULL	CCDS43175.1	3																																																																																			AC131160.1	-	-	ENSG00000216166		0.322	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000216166	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000346507.2		0.00	21	0	-	NM_018023		183520276	-1	tier1		no_errors	ENST00000401347	ensembl	human	novel	74_37	rna	21.05	15	4	INS	0.001:0.000	TG
EXOSC10	5394	genome.wustl.edu	37	1	11131924	11131926	+	Intron	DEL	CAA	CAA	-	rs113298819|rs113478689|rs33957776|rs58280885	byFrequency	TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	CAA	CAA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:11131924_11131926delCAA	ENST00000376936.4	-	20	2292				EXOSC10_ENST00000304457.7_Intron|RP4-635E18.7_ENST00000452378.1_RNA|EXOSC10_ENST00000544779.1_Intron	NM_001001998.1	NP_001001998.1	Q01780	EXOSX_HUMAN	exosome component 10						CUT catabolic process (GO:0071034)|dosage compensation by inactivation of X chromosome (GO:0009048)|histone mRNA catabolic process (GO:0071044)|maturation of 5.8S rRNA (GO:0000460)|nuclear mRNA surveillance (GO:0071028)|nuclear polyadenylation-dependent rRNA catabolic process (GO:0071035)|nuclear retention of unspliced pre-mRNA at the site of transcription (GO:0071048)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)	cytoplasm (GO:0005737)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	3'-5' exonuclease activity (GO:0008408)|exoribonuclease activity (GO:0004532)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|stomach(3)|upper_aerodigestive_tract(1)	27	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.18e-07)|COAD - Colon adenocarcinoma(227;8.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000315)|Kidney(185;0.000832)|KIRC - Kidney renal clear cell carcinoma(229;0.00269)|READ - Rectum adenocarcinoma(331;0.0526)|STAD - Stomach adenocarcinoma(313;0.202)		CTCCAACCACCAACGAGACAGCT	0.567														2711	0.541334	0.0885	0.7046	5008	,	,		19902	0.7421		0.7416	False		,,,				2504	0.6247				Colon(179;105 1987 14326 27364 29542)												0																																										SO:0001627	intron_variant	0			BC073788	CCDS126.1, CCDS30584.1	1p36.22	2008-02-05	2004-06-16	2004-06-18	ENSG00000171824	ENSG00000171824			9138	protein-coding gene	gene with protein product	"""polymyositis/scleroderma autoantigen 2 (100kD)"""	605960	"""polymyositis/scleroderma autoantigen 2, 100kDa"""	PMSCL2		1383382, 1644924	Standard	NM_001001998		Approved	PM-Scl, PM/Scl-100, Rrp6p, RRP6, p2, p3, p4	uc001asa.3	Q01780	OTTHUMG00000002123	ENST00000376936.4:c.2242+217TTG>-	1.37:g.11131924_11131926delCAA			B1AKQ0|B1AKQ1|Q15158	RNA	DEL	-	NULL	ENST00000376936.4	37	NULL	CCDS30584.1	1																																																																																			RP4-635E18.7	-	-	ENSG00000226849		0.567	EXOSC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000226849	Clone_based_vega_gene	protein_coding	OTTHUMT00000006078.1		0.00	8	0	CAA	NM_001001998		11131926	+1	tier1		no_errors	ENST00000452378	ensembl	human	known	74_37	rna	30.00	7	3	DEL	0.000:0.000:0.000	-
CGGBP1	8545	genome.wustl.edu	37	3	88135426	88135426	+	Intron	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr3:88135426G>A	ENST00000462901.1	-	3	284				RP11-159G9.5_ENST00000473136.1_Missense_Mutation_p.G69E			Q9UFW8	CGBP1_HUMAN	CGG triplet repeat binding protein 1						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)			kidney(1)|large_intestine(2)|lung(2)	5		Lung NSC(201;0.0283)		LUSC - Lung squamous cell carcinoma(29;0.00359)|Lung(72;0.00677)		GATTATGCTGGAAGATGGCAG	0.413																																																	0																																										SO:0001627	intron_variant	0			AJ000258	CCDS43111.1	3p12-p11.1	2008-07-18			ENSG00000163320	ENSG00000163320			1888	protein-coding gene	gene with protein product	"""p20-CGG binding protein"""	603363				9201980, 14667814	Standard	NM_001195308		Approved	p20-CGGBP, CGGBP	uc003dqt.3	Q9UFW8	OTTHUMG00000159009	ENST00000462901.1:c.228-28053C>T	3.37:g.88135426G>A			D3DU38|O15183	Missense_Mutation	SNP	NULL	p.G69E	ENST00000462901.1	37	c.206	CCDS43111.1	3	.	.	.	.	.	.	.	.	.	.	G	15.74	2.921334	0.52653	.	.	ENSG00000229729	ENST00000473136	.	.	.	5.72	5.72	0.89469	.	.	.	.	.	T	0.50377	0.1612	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.34800	-0.9814	5	0.08837	T	0.75	.	14.7938	0.69863	0.0:0.1437:0.8563:0.0	.	.	.	.	E	69	.	ENSP00000419057:G69E	G	+	2	0	RP11-159G9.5	88218116	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.628000	0.67791	2.857000	0.98124	0.650000	0.86243	GGA	RP11-159G9.5	-	NULL	ENSG00000229729		0.413	CGGBP1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ENSG00000229729	Clone_based_vega_gene	protein_coding	OTTHUMT00000353159.1	-	0.00	36	0	G	NM_001008390		88135426	+1	tier1	-	no_errors	ENST00000473136	ensembl	human	putative	74_37	missense	47.22	19	17	SNP	1.000	A
LOC102546299	102546299	genome.wustl.edu	37	5	164028139	164028139	+	RNA	SNP	T	T	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr5:164028139T>G	ENST00000486913.3	+	0	317				CTC-340A15.2_ENST00000519750.1_RNA|CTC-340A15.2_ENST00000519570.1_RNA|CTC-340A15.2_ENST00000517508.1_RNA|CTC-340A15.2_ENST00000522303.1_RNA|CTC-340A15.2_ENST00000523704.1_RNA|CTC-340A15.2_ENST00000522646.1_RNA																							TCCACCTGGTTGAAGGTCTTG	0.592																																																	0																																												0																															5.37:g.164028139T>G				RNA	SNP	-	NULL	ENST00000486913.3	37	NULL		5																																																																																			CTC-340A15.2	-	-	ENSG00000241956		0.592	CTC-340A15.2-001	KNOWN	basic	antisense	ENSG00000241956	Clone_based_vega_gene	antisense	OTTHUMT00000370926.1	-	0.00	87	0	T			164028139	+1	tier1	-	no_errors	ENST00000486913	ensembl	human	known	74_37	rna	16.85	74	15	SNP	1.000	G
LOC102546299	102546299	genome.wustl.edu	37	5	164028139	164028139	+	RNA	SNP	T	T	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr5:164028139T>G	ENST00000486913.3	+	0	317				CTC-340A15.2_ENST00000519750.1_RNA|CTC-340A15.2_ENST00000519570.1_RNA|CTC-340A15.2_ENST00000517508.1_RNA|CTC-340A15.2_ENST00000522303.1_RNA|CTC-340A15.2_ENST00000523704.1_RNA|CTC-340A15.2_ENST00000522646.1_RNA																							TCCACCTGGTTGAAGGTCTTG	0.592																																																	0																																												0																															5.37:g.164028139T>G				RNA	SNP	-	NULL	ENST00000486913.3	37	NULL		5																																																																																			CTC-340A15.2	-	-	ENSG00000241956		0.592	CTC-340A15.2-001	KNOWN	basic	antisense	ENSG00000241956	Clone_based_vega_gene	antisense	OTTHUMT00000370926.1	-	0.00	95	0	T			164028139	+1	tier1	-	no_errors	ENST00000486913	ensembl	human	known	74_37	rna	16.85	74	15	SNP	1.000	G
SALL1	6299	genome.wustl.edu	37	16	51183170	51183171	+	Intron	INS	-	-	T	rs535438423		TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr16:51183170_51183171insT	ENST00000251020.4	-	1	110				SALL1_ENST00000541611.1_Intron|AC009166.5_ENST00000570060.1_RNA|SALL1_ENST00000562674.1_Intron|SALL1_ENST00000440970.1_Intron|SALL1_ENST00000566102.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1						adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			AAGGCCGAGACTTTTTTTTTTT	0.317																																					GBM(103;1352 1446 1855 4775 8890)												0																																										SO:0001627	intron_variant	0			X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.76+1905->A	16.37:g.51183181_51183181dupT			Q99881|Q9NSC3|Q9P1R0	RNA	INS	-	NULL	ENST00000251020.4	37	NULL	CCDS10747.1	16																																																																																			AC009166.5	-	-	ENSG00000261238		0.317	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000261238	Clone_based_vega_gene	protein_coding	OTTHUMT00000256883.2		0.00	27	0	-	NM_002968		51183171	+1	tier1		no_errors	ENST00000570060	ensembl	human	known	74_37	rna	12.90	27	4	INS	0.000:0.007	T
SALL1	6299	genome.wustl.edu	37	16	51183181	51183181	+	Intron	SNP	T	T	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr16:51183181T>A	ENST00000251020.4	-	1	110				SALL1_ENST00000541611.1_Intron|AC009166.5_ENST00000570060.1_RNA|SALL1_ENST00000562674.1_Intron|SALL1_ENST00000440970.1_Intron|SALL1_ENST00000566102.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1						adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			TTTTTTTTTTTAAATGTAGAA	0.323																																					GBM(103;1352 1446 1855 4775 8890)												0																																										SO:0001627	intron_variant	0			X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.76+1895A>T	16.37:g.51183181T>A			Q99881|Q9NSC3|Q9P1R0	RNA	SNP	-	NULL	ENST00000251020.4	37	NULL	CCDS10747.1	16																																																																																			AC009166.5	-	-	ENSG00000261238		0.323	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000261238	Clone_based_vega_gene	protein_coding	OTTHUMT00000256883.2	-	0.00	31	0	T	NM_002968		51183181	+1	tier1	-	no_errors	ENST00000570060	ensembl	human	known	74_37	rna	20.00	24	6	SNP	0.006	A
NLRP9	338321	genome.wustl.edu	37	19	56220430	56220431	+	Intron	INS	-	-	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr19:56220430_56220431insT	ENST00000332836.2	-	9	2871				CTD-2611O12.8_ENST00000596293.1_RNA|CTD-2611O12.6_ENST00000600582.1_RNA|CTD-2611O12.7_ENST00000597680.1_RNA	NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9							cytoplasm (GO:0005737)	ATP binding (GO:0005524)			NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		TAGAAATAAAGTTTTTTTTTTT	0.366																																																	0																																										SO:0001627	intron_variant	0			AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.2844-20->A	19.37:g.56220441_56220441dupT			B2RN12|Q86W27	RNA	INS	-	NULL	ENST00000332836.2	37	NULL	CCDS12934.1	19																																																																																			CTD-2611O12.8	-	-	ENSG00000267865		0.366	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000267865	Clone_based_vega_gene	protein_coding	OTTHUMT00000453653.1		0.00	29	0	-	NM_176820		56220431	+1	tier1		no_errors	ENST00000596293	ensembl	human	known	74_37	rna	22.22	14	4	INS	0.000:0.000	T
ZNF596	169270	genome.wustl.edu	37	8	183315	183315	+	Intron	SNP	T	T	C	rs73668545		TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr8:183315T>C	ENST00000398612.1	+	1	311				ZNF596_ENST00000308811.4_Intron|ZNF596_ENST00000320552.2_Intron|RP5-855D21.3_ENST00000609090.1_RNA|RP5-855D21.1_ENST00000606572.1_RNA|ZNF596_ENST00000521238.2_Intron|RPL23AP53_ENST00000606975.1_RNA	NM_001042415.1|NM_001042416.1	NP_001035880.1|NP_001035881.1	Q8TC21	ZN596_HUMAN	zinc finger protein 596						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|endometrium(2)|large_intestine(6)|lung(5)	14		all_cancers(2;4.81e-29)|all_epithelial(2;5.03e-19)|Lung NSC(2;8.68e-08)|all_lung(2;1.52e-07)|Ovarian(12;0.00965)|Colorectal(14;0.0367)|all_neural(12;0.0837)|Myeloproliferative disorder(644;0.116)|all_hematologic(2;0.138)|Acute lymphoblastic leukemia(644;0.242)		Epithelial(5;3.77e-18)|all cancers(2;5.2e-17)|OV - Ovarian serous cystadenocarcinoma(5;5.37e-09)|BRCA - Breast invasive adenocarcinoma(11;1.7e-06)|Colorectal(2;6.51e-05)|READ - Rectum adenocarcinoma(2;0.0276)|COAD - Colon adenocarcinoma(149;0.0702)		TCCCAAATTCTTTAGATGGTT	0.388																																																	0																																										SO:0001627	intron_variant	0			BC026190	CCDS5951.2	8p23.3	2013-01-08			ENSG00000172748	ENSG00000172748		"""Zinc fingers, C2H2-type"", ""-"""	27268	protein-coding gene	gene with protein product						12477932	Standard	NM_001287256		Approved		uc003wot.3	Q8TC21	OTTHUMG00000086931	ENST00000398612.1:c.-73+621T>C	8.37:g.183315T>C			B2R8P4|O95015|Q8N9X0	RNA	SNP	-	NULL	ENST00000398612.1	37	NULL	CCDS5951.2	8																																																																																			RP5-855D21.3	-	-	ENSG00000272812		0.388	ZNF596-202	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000272812	Clone_based_vega_gene	protein_coding	OTTHUMT00000195858.4	-	0.00	19	0	T	NM_173539		183315	+1	tier1	rs73668545	no_errors	ENST00000609090	ensembl	human	known	74_37	rna	42.86	8	6	SNP	0.000	C
EP400	57634	genome.wustl.edu	37	12	132547141	132547141	+	Silent	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr12:132547141G>A	ENST00000333577.4	+	48	8446	c.8337G>A	c.(8335-8337)caG>caA	p.Q2779Q	EP400_ENST00000332482.4_Silent_p.Q2706Q|EP400_ENST00000389561.2_Silent_p.Q2743Q|EP400_ENST00000389562.2_Silent_p.Q2742Q|EP400_ENST00000330386.6_Silent_p.Q2662Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2779	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.Q2742Q(2)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcaacagcagcagcagc	0.597																																																	2	Substitution - coding silent(2)	kidney(2)											52.0	42.0	46.0					12																	132547141		2203	4300	6503	SO:0001819	synonymous_variant	0			U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8337G>A	12.37:g.132547141G>A			O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	pfam_SNF2_N,pfam_Helicase/SANT-assoc_DNA-bd,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Homeodomain-like,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Myb-like_dom,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.Q2779	ENST00000333577.4	37	c.8337		12																																																																																			EP400	-	NULL	ENSG00000183495		0.597	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	EP400	HGNC	protein_coding		-	0.00	30	0	G	NM_015409		132547141	+1	tier1	-	no_errors	ENST00000333577	ensembl	human	known	74_37	silent	15.15	28	5	SNP	0.737	A
EPB41L2	2037	genome.wustl.edu	37	6	131215506	131215506	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr6:131215506C>T	ENST00000337057.3	-	10	1646	c.1465G>A	c.(1465-1467)Gtg>Atg	p.V489M	EPB41L2_ENST00000527659.1_Missense_Mutation_p.V489M|EPB41L2_ENST00000445890.2_Missense_Mutation_p.V489M|EPB41L2_ENST00000528282.1_Missense_Mutation_p.V489M|EPB41L2_ENST00000525271.1_Missense_Mutation_p.V489M|EPB41L2_ENST00000527411.1_Missense_Mutation_p.V489M|EPB41L2_ENST00000368128.2_Missense_Mutation_p.V489M|EPB41L2_ENST00000525193.1_Missense_Mutation_p.V489M|EPB41L2_ENST00000392427.3_Missense_Mutation_p.V489M|EPB41L2_ENST00000529208.1_Missense_Mutation_p.V489M|EPB41L2_ENST00000530481.1_Missense_Mutation_p.V489M	NM_001431.3	NP_001422.1	O43491	E41L2_HUMAN	erythrocyte membrane protein band 4.1-like 2	489	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cortical actin cytoskeleton organization (GO:0030866)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|spectrin (GO:0008091)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(23)|prostate(1)|skin(2)	44	Breast(56;0.0639)			OV - Ovarian serous cystadenocarcinoma(155;0.0271)|GBM - Glioblastoma multiforme(226;0.0355)		TGATGCTCCACGCACACTTTC	0.468																																																	0													156.0	152.0	153.0					6																	131215506		2203	4300	6503	SO:0001583	missense	0			AF027299	CCDS5141.1, CCDS47474.1, CCDS56450.1, CCDS59037.1	6q23	2008-08-29			ENSG00000079819	ENSG00000079819			3379	protein-coding gene	gene with protein product		603237				9598318, 9828140	Standard	NM_001431		Approved	4.1-G	uc003qch.2	O43491	OTTHUMG00000015560	ENST00000337057.3:c.1465G>A	6.37:g.131215506C>T	ENSP00000338481:p.Val489Met		B4DHI8|E9PPD9|Q5T4F0|Q68DV2	Missense_Mutation	SNP	pirsf_Band_41_protein,pfam_Band_4.1_C,pfam_SAB_dom,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like,pfscan_FERM_domain	p.V489M	ENST00000337057.3	37	c.1465	CCDS5141.1	6	.	.	.	.	.	.	.	.	.	.	C	24.2	4.510178	0.85282	.	.	ENSG00000079819	ENST00000528282;ENST00000530481;ENST00000445890;ENST00000337057;ENST00000392427;ENST00000425439;ENST00000368128;ENST00000527411;ENST00000525271;ENST00000525193;ENST00000527659;ENST00000529208	D;D;D;D;D;D;D;D;D;D;D	0.88431	-2.38;-2.38;-2.38;-2.38;-2.38;-2.38;-2.38;-2.38;-2.38;-2.38;-2.38	5.44	5.44	0.79542	FERM, C-terminal PH-like domain (1);FERM domain (1);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	D	0.94804	0.8322	M	0.85945	2.785	0.58432	D	0.999997	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.996;0.994;0.996;1.0;0.996	D	0.95170	0.8289	10	0.87932	D	0	.	19.263	0.93975	0.0:1.0:0.0:0.0	.	489;489;489;489;489	E9PHY5;B4DHI8;E9PPD9;O43491;Q68DV2	.;.;.;E41L2_HUMAN;.	M	489	ENSP00000434308:V489M;ENSP00000434576:V489M;ENSP00000402041:V489M;ENSP00000338481:V489M;ENSP00000376222:V489M;ENSP00000357110:V489M;ENSP00000436348:V489M;ENSP00000432803:V489M;ENSP00000431988:V489M;ENSP00000431647:V489M;ENSP00000436641:V489M	ENSP00000338481:V489M	V	-	1	0	EPB41L2	131257199	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	6.042000	0.70996	2.545000	0.85829	0.655000	0.94253	GTG	EPB41L2	-	pirsf_Band_41_protein,pfam_FERM_PH-like_C,pfscan_FERM_domain	ENSG00000079819		0.468	EPB41L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPB41L2	HGNC	protein_coding	OTTHUMT00000042204.3	-	0.00	34	0	C			131215506	-1	tier1	-	no_errors	ENST00000337057	ensembl	human	known	74_37	missense	24.24	25	8	SNP	1.000	T
ERCC3	2071	genome.wustl.edu	37	2	128038201	128038201	+	Missense_Mutation	SNP	A	A	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr2:128038201A>T	ENST00000285398.2	-	9	1443	c.1349T>A	c.(1348-1350)aTg>aAg	p.M450K	ERCC3_ENST00000493187.2_Missense_Mutation_p.M386K	NM_000122.1	NP_000113.1	P19447	ERCC3_HUMAN	excision repair cross-complementation group 3	450	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				7-methylguanosine mRNA capping (GO:0006370)|apoptotic process (GO:0006915)|DNA repair (GO:0006281)|DNA topological change (GO:0006265)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA duplex unwinding (GO:0000717)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein localization (GO:0008104)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|response to UV (GO:0009411)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' DNA helicase activity (GO:0043138)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|damaged DNA binding (GO:0003684)|dATP binding (GO:0032564)|DNA binding (GO:0003677)|GTP binding (GO:0005525)|peptide binding (GO:0042277)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	31	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.073)		CCTTCGGAACATCTTGGCTGA	0.403			"""Mis, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																														yes	Rec		Xeroderma pigmentosum (B)	2	2q21	2071	"""excision repair cross-complementing rodent repair deficiency, complementation group 3 (xeroderma pigmentosum group B complementing)"""		E	0													61.0	57.0	58.0					2																	128038201		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	M31899	CCDS2144.1	2q21	2014-09-17	2014-03-07		ENSG00000163161	ENSG00000163161		"""General transcription factors"", ""General transcription factor IIH complex subunits"""	3435	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group B complementing"""	133510	"""excision repair cross-complementing rodent repair deficiency, complementation group 3"""			8202161	Standard	NM_000122		Approved	XPB, BTF2, RAD25, TFIIH, GTF2H	uc002toh.1	P19447	OTTHUMG00000131530	ENST00000285398.2:c.1349T>A	2.37:g.128038201A>T	ENSP00000285398:p.Met450Lys		Q53QM0	Missense_Mutation	SNP	pfam_Helicase/UvrB_dom,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_Helicase_Ercc3,tigrfam_Helicase_Ercc3	p.M450K	ENST00000285398.2	37	c.1349	CCDS2144.1	2	.	.	.	.	.	.	.	.	.	.	a	15.88	2.964910	0.53507	.	.	ENSG00000163161	ENST00000285398;ENST00000493187	T;T	0.31769	1.48;1.48	5.72	5.72	0.89469	DEAD-like helicase (2);Helicase/UvrB domain (1);	0.000000	0.85682	D	0.000000	T	0.27731	0.0682	L	0.35542	1.07	0.80722	D	1	B	0.09022	0.002	B	0.12837	0.008	T	0.03077	-1.1075	10	0.59425	D	0.04	-35.294	16.0197	0.80472	1.0:0.0:0.0:0.0	.	450	P19447	ERCC3_HUMAN	K	450;386	ENSP00000285398:M450K;ENSP00000444796:M386K	ENSP00000285398:M450K	M	-	2	0	ERCC3	127754671	1.000000	0.71417	1.000000	0.80357	0.617000	0.37484	9.328000	0.96403	2.177000	0.69029	0.524000	0.50904	ATG	ERCC3	-	pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd,prints_Helicase_Ercc3,tigrfam_Helicase_Ercc3	ENSG00000163161		0.403	ERCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERCC3	HGNC	protein_coding	OTTHUMT00000331028.1	-	0.00	39	0	A	NM_000122		128038201	-1	tier1	-	no_errors	ENST00000285398	ensembl	human	known	74_37	missense	36.54	33	19	SNP	1.000	T
EVX1	2128	genome.wustl.edu	37	7	27282878	27282878	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr7:27282878G>A	ENST00000496902.4	+	1	715	c.229G>A	c.(229-231)Gcg>Acg	p.A77T	EVX1-AS_ENST00000519050.1_RNA|EVX1-AS_ENST00000519218.1_RNA|EVX1_ENST00000222761.3_Missense_Mutation_p.A77T|EVX1_ENST00000535619.1_5'Flank|EVX1-AS_ENST00000517726.1_RNA|RP1-170O19.17_ENST00000523608.2_lincRNA			P49640	EVX1_HUMAN	even-skipped homeobox 1	77					embryo development ending in birth or egg hatching (GO:0009792)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter involved in ventral spinal cord interneuron specification (GO:0021913)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|liver(1)|lung(10)|prostate(1)|skin(1)	14						CGCAGGCAgcgcggcggggcc	0.786																																																	0													2.0	3.0	3.0					7																	27282878		1476	3198	4674	SO:0001583	missense	0				CCDS5413.1	7p15.2	2012-03-09	2007-02-15		ENSG00000106038	ENSG00000106038		"""Homeoboxes / ANTP class : HOXL subclass"""	3506	protein-coding gene	gene with protein product		142996	"""eve, even-skipped homeobox homolog 1 (Drosophila)"""			1684419	Standard	XM_005249640		Approved		uc003szd.1	P49640	OTTHUMG00000023093	ENST00000496902.4:c.229G>A	7.37:g.27282878G>A	ENSP00000419266:p.Ala77Thr		A4D199|B4DQJ0	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.A77T	ENST00000496902.4	37	c.229	CCDS5413.1	7	.	.	.	.	.	.	.	.	.	.	G	8.721	0.914242	0.17907	.	.	ENSG00000106038	ENST00000496902;ENST00000222761	D	0.91407	-2.84	5.03	3.2	0.36748	.	0.393883	0.28241	N	0.016061	D	0.82444	0.5038	L	0.44542	1.39	0.80722	D	1	B;B	0.34313	0.448;0.0	B;B	0.25405	0.06;0.0	T	0.74309	-0.3707	10	0.14252	T	0.57	-8.4316	9.6259	0.39750	0.0744:0.0:0.7841:0.1416	.	77;77	F8W9J5;P49640	.;EVX1_HUMAN	T	77	ENSP00000419266:A77T	ENSP00000222761:A77T	A	+	1	0	EVX1	27249403	1.000000	0.71417	0.990000	0.47175	0.957000	0.61999	3.275000	0.51639	0.510000	0.28216	0.462000	0.41574	GCG	EVX1	-	NULL	ENSG00000106038		0.786	EVX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVX1	HGNC	protein_coding	OTTHUMT00000358750.3	-	0.00	19	0	G			27282878	+1	tier1	-	no_errors	ENST00000496902	ensembl	human	known	74_37	missense	41.38	17	12	SNP	0.878	A
F2	2147	genome.wustl.edu	37	11	46750222	46750222	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr11:46750222G>A	ENST00000311907.5	+	11	1363	c.1307G>A	c.(1306-1308)cGa>cAa	p.R436Q	F2_ENST00000530231.1_Missense_Mutation_p.R436Q	NM_000506.3	NP_000497.1	P00734	THRB_HUMAN	coagulation factor II (thrombin)	436	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell surface receptor signaling pathway (GO:0007166)|cellular protein metabolic process (GO:0044267)|cytosolic calcium ion homeostasis (GO:0051480)|fibrinolysis (GO:0042730)|leukocyte migration (GO:0050900)|multicellular organismal development (GO:0007275)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of platelet activation (GO:0010544)|negative regulation of proteolysis (GO:0045861)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|positive regulation of blood coagulation (GO:0030194)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900738)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of blood coagulation (GO:0030193)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|receptor binding (GO:0005102)|serine-type endopeptidase activity (GO:0004252)|thrombospondin receptor activity (GO:0070053)			endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	27		all_lung(304;0.000414)|Lung NSC(402;0.0011)		BRCA - Breast invasive adenocarcinoma(625;0.146)	Antihemophilic Factor(DB00025)|Argatroban(DB00278)|ART-123(DB05777)|Bivalirudin(DB00006)|Coagulation Factor IX(DB00100)|Dabigatran etexilate(DB06695)|Drotrecogin alfa(DB00055)|Lepirudin(DB00001)|Menadione(DB00170)|Proflavine(DB01123)|Suramin(DB04786)|Ximelagatran(DB04898)	AGGTACGAGCGAAACATTGAA	0.527																																					Esophageal Squamous(147;1147 1808 2148 38609 51144)												0													82.0	75.0	77.0					11																	46750222		2201	4299	6500	SO:0001583	missense	0			M33031	CCDS31476.1	11p11.2	2013-02-28			ENSG00000180210	ENSG00000180210	3.4.21.5	"""Endogenous ligands"""	3535	protein-coding gene	gene with protein product	"""prepro-coagulation factor II"""	176930					Standard	NM_000506		Approved		uc001ndf.4	P00734	OTTHUMG00000150344	ENST00000311907.5:c.1307G>A	11.37:g.46750222G>A	ENSP00000308541:p.Arg436Gln		B2R7F7|B4E1A7|Q4QZ40|Q53H04|Q53H06|Q69EZ7|Q7Z7P3|Q9UCA1	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_Kringle,pfam_Thrombin_light_chain,pfam_GLA_domain,superfamily_Trypsin-like_Pept_dom,superfamily_Kringle-like,superfamily_GLA_domain,smart_GLA_domain,smart_Kringle,smart_Peptidase_S1,pirsf_Prothrombin/thrombin,pfscan_GLA_domain,pfscan_Kringle,pfscan_Peptidase_S1,prints_Prothrombin/thrombin,prints_Peptidase_S1A,prints_GLA_domain	p.R436Q	ENST00000311907.5	37	c.1307	CCDS31476.1	11	.	.	.	.	.	.	.	.	.	.	G	13.95	2.391045	0.42410	.	.	ENSG00000180210	ENST00000311907;ENST00000530231	D;D	0.92752	-3.1;-3.1	5.88	5.88	0.94601	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.053985	0.64402	D	0.000001	D	0.84795	0.5551	N	0.16708	0.43	0.45216	D	0.99822	P	0.49447	0.924	B	0.40677	0.337	D	0.86403	0.1743	10	0.87932	D	0	.	10.9104	0.47106	0.0688:0.0:0.8001:0.1311	.	436	P00734	THRB_HUMAN	Q	436	ENSP00000308541:R436Q;ENSP00000433907:R436Q	ENSP00000308541:R436Q	R	+	2	0	F2	46706798	0.965000	0.33210	0.888000	0.34837	0.094000	0.18550	1.766000	0.38491	2.780000	0.95670	0.655000	0.94253	CGA	F2	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pirsf_Prothrombin/thrombin,pfscan_Peptidase_S1	ENSG00000180210		0.527	F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F2	HGNC	protein_coding	OTTHUMT00000317706.1	-	0.00	54	0	G			46750222	+1	tier1	-	no_errors	ENST00000311907	ensembl	human	known	74_37	missense	47.06	27	24	SNP	0.934	A
F2	2147	genome.wustl.edu	37	11	46750222	46750222	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr11:46750222G>A	ENST00000311907.5	+	11	1363	c.1307G>A	c.(1306-1308)cGa>cAa	p.R436Q	F2_ENST00000530231.1_Missense_Mutation_p.R436Q	NM_000506.3	NP_000497.1	P00734	THRB_HUMAN	coagulation factor II (thrombin)	436	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell surface receptor signaling pathway (GO:0007166)|cellular protein metabolic process (GO:0044267)|cytosolic calcium ion homeostasis (GO:0051480)|fibrinolysis (GO:0042730)|leukocyte migration (GO:0050900)|multicellular organismal development (GO:0007275)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of platelet activation (GO:0010544)|negative regulation of proteolysis (GO:0045861)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|positive regulation of blood coagulation (GO:0030194)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900738)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of blood coagulation (GO:0030193)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|receptor binding (GO:0005102)|serine-type endopeptidase activity (GO:0004252)|thrombospondin receptor activity (GO:0070053)			endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	27		all_lung(304;0.000414)|Lung NSC(402;0.0011)		BRCA - Breast invasive adenocarcinoma(625;0.146)	Antihemophilic Factor(DB00025)|Argatroban(DB00278)|ART-123(DB05777)|Bivalirudin(DB00006)|Coagulation Factor IX(DB00100)|Dabigatran etexilate(DB06695)|Drotrecogin alfa(DB00055)|Lepirudin(DB00001)|Menadione(DB00170)|Proflavine(DB01123)|Suramin(DB04786)|Ximelagatran(DB04898)	AGGTACGAGCGAAACATTGAA	0.527																																					Esophageal Squamous(147;1147 1808 2148 38609 51144)												0													82.0	75.0	77.0					11																	46750222		2201	4299	6500	SO:0001583	missense	0			M33031	CCDS31476.1	11p11.2	2013-02-28			ENSG00000180210	ENSG00000180210	3.4.21.5	"""Endogenous ligands"""	3535	protein-coding gene	gene with protein product	"""prepro-coagulation factor II"""	176930					Standard	NM_000506		Approved		uc001ndf.4	P00734	OTTHUMG00000150344	ENST00000311907.5:c.1307G>A	11.37:g.46750222G>A	ENSP00000308541:p.Arg436Gln		B2R7F7|B4E1A7|Q4QZ40|Q53H04|Q53H06|Q69EZ7|Q7Z7P3|Q9UCA1	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_Kringle,pfam_Thrombin_light_chain,pfam_GLA_domain,superfamily_Trypsin-like_Pept_dom,superfamily_Kringle-like,superfamily_GLA_domain,smart_GLA_domain,smart_Kringle,smart_Peptidase_S1,pirsf_Prothrombin/thrombin,pfscan_GLA_domain,pfscan_Kringle,pfscan_Peptidase_S1,prints_Prothrombin/thrombin,prints_Peptidase_S1A,prints_GLA_domain	p.R436Q	ENST00000311907.5	37	c.1307	CCDS31476.1	11	.	.	.	.	.	.	.	.	.	.	G	13.95	2.391045	0.42410	.	.	ENSG00000180210	ENST00000311907;ENST00000530231	D;D	0.92752	-3.1;-3.1	5.88	5.88	0.94601	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.053985	0.64402	D	0.000001	D	0.84795	0.5551	N	0.16708	0.43	0.45216	D	0.99822	P	0.49447	0.924	B	0.40677	0.337	D	0.86403	0.1743	10	0.87932	D	0	.	10.9104	0.47106	0.0688:0.0:0.8001:0.1311	.	436	P00734	THRB_HUMAN	Q	436	ENSP00000308541:R436Q;ENSP00000433907:R436Q	ENSP00000308541:R436Q	R	+	2	0	F2	46706798	0.965000	0.33210	0.888000	0.34837	0.094000	0.18550	1.766000	0.38491	2.780000	0.95670	0.655000	0.94253	CGA	F2	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pirsf_Prothrombin/thrombin,pfscan_Peptidase_S1	ENSG00000180210		0.527	F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F2	HGNC	protein_coding	OTTHUMT00000317706.1	-	0.00	61	0	G			46750222	+1	tier1	-	no_errors	ENST00000311907	ensembl	human	known	74_37	missense	47.06	27	24	SNP	0.934	A
F9	2158	genome.wustl.edu	37	X	138643757	138643757	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chrX:138643757T>C	ENST00000218099.2	+	8	920	c.913T>C	c.(913-915)Tac>Cac	p.Y305H	F9_ENST00000394090.2_Missense_Mutation_p.Y267H	NM_000133.3	NP_000124.1	P00740	FA9_HUMAN	coagulation factor IX	305	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|blood coagulation, intrinsic pathway (GO:0007597)|cellular protein metabolic process (GO:0044267)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(7)|lung(19)|ovary(1)|skin(1)	35	Acute lymphoblastic leukemia(192;0.000127)				Antihemophilic Factor(DB00025)|Menadione(DB00170)	TCACCACAACTACAATGCAGC	0.363																																																	0			GRCh37	CM001680	F9	M							176.0	151.0	159.0					X																	138643757		2203	4299	6502	SO:0001583	missense	0			M11309	CCDS14666.1	Xq26.3-q27.1	2014-09-17	2008-08-01		ENSG00000101981	ENSG00000101981	3.4.21.22		3551	protein-coding gene	gene with protein product	"""Factor IX"", ""plasma thromboplastic component"", ""Christmas disease"", ""hemophilia B"""	300746					Standard	NM_000133		Approved	FIX	uc004fas.1	P00740	OTTHUMG00000022536	ENST00000218099.2:c.913T>C	X.37:g.138643757T>C	ENSP00000218099:p.Tyr305His		A8K9N4|F2RM36|Q5FBE1|Q5JYJ8	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_GLA_domain,pfam_EG-like_dom,superfamily_Trypsin-like_Pept_dom,superfamily_GLA_domain,smart_GLA_domain,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Peptidase_S1,pirsf_Pept_S1A_FX,pfscan_EG-like_dom,pfscan_GLA_domain,pfscan_Peptidase_S1,prints_Peptidase_S1A,prints_GLA_domain	p.Y305H	ENST00000218099.2	37	c.913	CCDS14666.1	X	.	.	.	.	.	.	.	.	.	.	T	18.59	3.657780	0.67586	.	.	ENSG00000101981	ENST00000218099;ENST00000394090	D;D	0.95690	-3.78;-3.78	5.42	5.42	0.78866	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.85682	D	0.000000	D	0.97961	0.9329	M	0.89840	3.065	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.996	D	0.98829	1.0750	10	0.87932	D	0	.	13.5766	0.61877	0.0:0.0:0.0:1.0	.	267;305	Q5FBE1;P00740	.;FA9_HUMAN	H	305;267	ENSP00000218099:Y305H;ENSP00000377650:Y267H	ENSP00000218099:Y305H	Y	+	1	0	F9	138471423	1.000000	0.71417	0.887000	0.34795	0.666000	0.39218	5.945000	0.70226	1.801000	0.52704	0.441000	0.28932	TAC	F9	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pirsf_Pept_S1A_FX,pfscan_Peptidase_S1	ENSG00000101981		0.363	F9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F9	HGNC	protein_coding	OTTHUMT00000058557.1	-	0.00	35	0	T			138643757	+1	tier1	-	no_errors	ENST00000218099	ensembl	human	known	74_37	missense	37.50	30	18	SNP	0.998	C
FAM178B	51252	genome.wustl.edu	37	2	97637859	97637859	+	Missense_Mutation	SNP	C	C	T	rs533483443	byFrequency	TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr2:97637859C>T	ENST00000417561.3	-	7	786	c.787G>A	c.(787-789)Gtg>Atg	p.V263M	FAM178B_ENST00000490605.2_Missense_Mutation_p.V115M|FAM178B_ENST00000327896.3_Missense_Mutation_p.V83M			Q8IXR5	F178B_HUMAN	family with sequence similarity 178, member B	263										large_intestine(1)|ovary(1)	2						AGGAATTCCACGGGCGGGGGG	0.687																																																	0													4.0	7.0	6.0					2																	97637859		679	1564	2243	SO:0001583	missense	0			AF151068, BC039488	CCDS33252.1, CCDS46366.1, CCDS46366.2	2q11.2	2008-08-08			ENSG00000168754	ENSG00000168754			28036	protein-coding gene	gene with protein product						11042152	Standard	NM_001122646		Approved	LOC51252	uc002sxl.4	Q8IXR5	OTTHUMG00000155257	ENST00000417561.3:c.787G>A	2.37:g.97637859C>T	ENSP00000413245:p.Val263Met		A8MXN2|E9PD86|Q8IUY0|Q9P0P4	Missense_Mutation	SNP	NULL	p.V263M	ENST00000417561.3	37	c.787		2	.	.	.	.	.	.	.	.	.	.	C	9.041	0.989769	0.18966	.	.	ENSG00000168754	ENST00000417561;ENST00000327896;ENST00000490605	T;T;T	0.59906	0.23;0.29;0.27	4.04	-1.14	0.09741	.	.	.	.	.	T	0.43634	0.1256	N	0.24115	0.695	0.09310	N	1	.	.	.	.	.	.	T	0.42732	-0.9434	7	0.59425	D	0.04	-0.7855	7.5193	0.27618	0.0:0.4206:0.0:0.5794	.	.	.	.	M	263;83;115	ENSP00000413245:V263M;ENSP00000333553:V83M;ENSP00000429896:V115M	ENSP00000333553:V83M	V	-	1	0	FAM178B	97001586	0.000000	0.05858	0.005000	0.12908	0.001000	0.01503	-0.819000	0.04462	-0.237000	0.09739	-0.345000	0.07892	GTG	FAM178B	-	NULL	ENSG00000168754		0.687	FAM178B-202	KNOWN	basic	protein_coding	FAM178B	HGNC	protein_coding		-	0.00	47	0	C	NM_016490		97637859	-1	tier1	-	no_errors	ENST00000417561	ensembl	human	known	74_37	missense	10.71	50	6	SNP	0.007	T
FAM182B	728882	genome.wustl.edu	37	20	25755880	25755880	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr20:25755880C>G	ENST00000376403.1	-	3	454	c.76G>C	c.(76-78)Ggt>Cgt	p.G26R	FAM182B_ENST00000376404.2_Missense_Mutation_p.G23R|FAM182B_ENST00000478164.1_5'UTR			Q5T319	F182B_HUMAN	family with sequence similarity 182, member B	26										lung(1)	1						TGCTGACCACCCCAAGTGCAG	0.537																																																	0																																										SO:0001583	missense	0					20p11.1	2010-07-14			ENSG00000175170	ENSG00000175170			34503	pseudogene	pseudogene							Standard	NR_027061		Approved			Q5T319	OTTHUMG00000032136	ENST00000376403.1:c.76G>C	20.37:g.25755880C>G	ENSP00000365585:p.Gly26Arg		Q4G0Q1	Missense_Mutation	SNP	NULL	p.G23R	ENST00000376403.1	37	c.67		20	.	.	.	.	.	.	.	.	.	.	.	0.740	-0.776716	0.02929	.	.	ENSG00000175170	ENST00000376404;ENST00000376403	.	.	.	.	.	.	.	.	.	.	.	T	0.39064	0.1064	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.39187	-0.9626	3	0.87932	D	0	.	.	.	.	.	.	.	.	R	23;26	.	ENSP00000365585:G26R	G	-	1	0	FAM182B	25703880	0.002000	0.14202	0.333000	0.25482	0.338000	0.28826	0.601000	0.24119	0.064000	0.16427	0.064000	0.15345	GGT	FAM182B	-	NULL	ENSG00000175170		0.537	FAM182B-003	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	FAM182B	HGNC	protein_coding	OTTHUMT00000078463.2	-	0.00	64	0	C	NR_026714		25755880	-1	tier1	-	no_errors	ENST00000376404	ensembl	human	known	74_37	missense	9.33	68	7	SNP	0.337	G
FAM198A	729085	genome.wustl.edu	37	3	43074077	43074077	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr3:43074077C>T	ENST00000430121.2	+	2	417	c.322C>T	c.(322-324)Cca>Tca	p.P108S	KRBOX1_ENST00000443313.1_Intron	NM_001129908.2	NP_001123380.2	Q9UFP1	F198A_HUMAN	family with sequence similarity 198, member A	108						extracellular region (GO:0005576)				endometrium(1)	1						CAGGGAGTCCCCAGGAGGGGA	0.567																																																	0													66.0	66.0	66.0					3																	43074077		692	1591	2283	SO:0001583	missense	0			AL117530	CCDS46808.1	3p22.1	2012-11-29	2009-10-19	2009-10-19	ENSG00000144649	ENSG00000144649			24485	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 41"""	C3orf41			Standard	NM_001129908		Approved	DKFZP434B172	uc003cmp.4	Q9UFP1	OTTHUMG00000156449	ENST00000430121.2:c.322C>T	3.37:g.43074077C>T	ENSP00000407301:p.Pro108Ser		B3KR48	Missense_Mutation	SNP	NULL	p.P108S	ENST00000430121.2	37	c.322	CCDS46808.1	3	.	.	.	.	.	.	.	.	.	.	C	10.58	1.389588	0.25118	.	.	ENSG00000144649	ENST00000430121	T	0.21932	1.98	4.25	3.37	0.38596	.	0.680005	0.12180	N	0.492157	T	0.13329	0.0323	N	0.24115	0.695	0.09310	N	1	B	0.12013	0.005	B	0.13407	0.009	T	0.30650	-0.9971	9	.	.	.	-19.9123	8.0616	0.30635	0.0:0.8838:0.0:0.1162	.	108	Q9UFP1	F198A_HUMAN	S	108	ENSP00000407301:P108S	.	P	+	1	0	FAM198A	43049081	0.014000	0.17966	0.010000	0.14722	0.129000	0.20672	2.662000	0.46766	0.905000	0.36596	0.585000	0.79938	CCA	FAM198A	-	NULL	ENSG00000144649		0.567	FAM198A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM198A	HGNC	protein_coding	OTTHUMT00000344240.3	-	0.00	21	0	C	NM_001129908		43074077	+1	tier1	-	no_errors	ENST00000273146	ensembl	human	known	74_37	missense	21.05	30	8	SNP	0.030	T
FAM230B	642633	genome.wustl.edu	37	22	21538275	21538275	+	RNA	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr22:21538275C>T	ENST00000451257.1	+	0	1261									family with sequence similarity 230, member B (non-protein coding)																		CCAACGAGGACGCCGCCCAGG	0.716																																																	0																																												0			BC039313, AK128837		22q11.21	2014-01-24	2014-01-06		ENSG00000215498	ENSG00000215498			32943	non-coding RNA	RNA, long non-coding			"""family with sequence similarity 230, member B"""				Standard	NR_108107		Approved	FLJ46366			OTTHUMG00000150782		22.37:g.21538275C>T				RNA	SNP	-	NULL	ENST00000451257.1	37	NULL		22																																																																																			FAM230B	-	-	ENSG00000215498		0.716	FAM230B-002	KNOWN	basic	lincRNA	FAM230B	HGNC	processed_transcript	OTTHUMT00000320063.1		0.00	81	0	C	NR_108107		21538275	+1			no_errors	ENST00000451257	ensembl	human	known	74_37	rna	5.36	53	3	SNP	0.000	T
FAM46A	55603	genome.wustl.edu	37	6	82461728	82461742	+	In_Frame_Del	DEL	CCGCCGAAGTCGCCG	CCGCCGAAGTCGCCG	-	rs375746695	byFrequency	TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	CCGCCGAAGTCGCCG	CCGCCGAAGTCGCCG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr6:82461728_82461742delCCGCCGAAGTCGCCG	ENST00000320172.6	-	2	431_445	c.117_131delCGGCGACTTCGGCGG	c.(115-132)ggcggcgacttcggcggt>ggt	p.39_44GGDFGG>G	FAM46A_ENST00000369756.3_In_Frame_Del_p.120_125GGDFGG>G|FAM46A_ENST00000369754.3_In_Frame_Del_p.58_63GGDFGG>G	NM_017633.2	NP_060103.2	Q96IP4	FA46A_HUMAN	family with sequence similarity 46, member A	39			Missing. {ECO:0000269|PubMed:12054608, ECO:0000269|PubMed:16545789}.		regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)		poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	12		all_cancers(76;6.74e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000282)|all_epithelial(107;0.0104)		BRCA - Breast invasive adenocarcinoma(397;0.0428)		gctgccgccaccgccgaagtcgccgccgccgaagt	0.67																																																	0																																										SO:0001651	inframe_deletion	0			AF350451	CCDS34489.1	6q14	2008-07-03	2004-08-19	2004-08-26	ENSG00000112773	ENSG00000112773			18345	protein-coding gene	gene with protein product		611357	"""chromosome 6 open reading frame 37"""	C6orf37		12054608, 17803723	Standard	NM_017633		Approved	FLJ20037	uc003pjg.3	Q96IP4	OTTHUMG00000015097	ENST00000320172.6:c.117_131delCGGCGACTTCGGCGG	6.37:g.82461728_82461742delCCGCCGAAGTCGCCG	ENSP00000318298:p.Gly39_Gly43del		A8K7U4|Q5TF86|Q8NFZ9|Q9BW32|Q9NXV5	In_Frame_Del	DEL	pfam_DUF1693	p.DFGGG60in_frame_del	ENST00000320172.6	37	c.188_174	CCDS34489.1	6																																																																																			FAM46A	-	NULL	ENSG00000112773		0.670	FAM46A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM46A	HGNC	protein_coding	OTTHUMT00000041331.1		0.00	8	0	CCGCCGAAGTCGCCG			82461742	-1			no_errors	ENST00000369754	ensembl	human	known	74_37	in_frame_del	25.00	6	2	DEL	0.610:0.584:0.613:0.651:0.551:0.194:0.094:0.019:0.005:0.001:0.002:0.002:0.002:0.002:0.008	0
FANCM	57697	genome.wustl.edu	37	14	45656996	45656996	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr14:45656996G>T	ENST00000267430.5	+	19	4770	c.4685G>T	c.(4684-4686)aGa>aTa	p.R1562I	FANCM_ENST00000555013.1_3'UTR|FANCM_ENST00000542564.2_Missense_Mutation_p.R1536I	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	1562					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						TCTGAAATGAGAGCTATTTAC	0.254								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																																								0													47.0	46.0	46.0					14																	45656996		2202	4296	6498	SO:0001583	missense	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.4685G>T	14.37:g.45656996G>T	ENSP00000267430:p.Arg1562Ile		B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,superfamily_Restrct_endonuc-II-like,superfamily_RuvA_2-like,smart_Helicase_ATP-bd,smart_Helicase_C,smart_ERCC4_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R1562I	ENST00000267430.5	37	c.4685	CCDS32070.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.61|19.61	3.860813|3.860813	0.71834|0.71834	.|.	.|.	ENSG00000187790|ENSG00000187790	ENST00000554809|ENST00000267430;ENST00000542564;ENST00000556250	.|T;T;T	.|0.78364	.|-1.17;-1.17;-1.17	5.22|5.22	4.21|4.21	0.49690|0.49690	.|.	.|0.393291	.|0.29972	.|N	.|0.010735	D|D	0.83133|0.83133	0.5188|0.5188	M|M	0.67953|0.67953	2.075|2.075	0.48040|0.48040	D|D	0.999575|0.999575	.|D;D	.|0.76494	.|0.999;0.998	.|D;P	.|0.66196	.|0.942;0.896	D|D	0.83624|0.83624	0.0141|0.0141	5|10	.|0.72032	.|D	.|0.01	.|.	7.1533|7.1533	0.25622|0.25622	0.2299:0.0:0.7701:0.0|0.2299:0.0:0.7701:0.0	.|.	.|1536;1562	.|B2RTQ9;Q8IYD8	.|.;FANCM_HUMAN	D|I	494|1562;1536;1078	.|ENSP00000267430:R1562I;ENSP00000442493:R1536I;ENSP00000452033:R1078I	.|ENSP00000267430:R1562I	E|R	+|+	3|2	2|0	FANCM|FANCM	44726746|44726746	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	1.334000|1.334000	0.33827|0.33827	2.445000|2.445000	0.82738|0.82738	0.655000|0.655000	0.94253|0.94253	GAG|AGA	FANCM	-	NULL	ENSG00000187790		0.254	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCM	HGNC	protein_coding	OTTHUMT00000410474.1	-	0.00	41	0	G	XM_048128		45656996	+1	tier1	-	no_errors	ENST00000267430	ensembl	human	known	74_37	missense	5.48	69	4	SNP	1.000	T
FANCM	57697	genome.wustl.edu	37	14	45656996	45656996	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr14:45656996G>T	ENST00000267430.5	+	19	4770	c.4685G>T	c.(4684-4686)aGa>aTa	p.R1562I	FANCM_ENST00000555013.1_3'UTR|FANCM_ENST00000542564.2_Missense_Mutation_p.R1536I	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	1562					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						TCTGAAATGAGAGCTATTTAC	0.254								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																																								0													47.0	46.0	46.0					14																	45656996		2202	4296	6498	SO:0001583	missense	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.4685G>T	14.37:g.45656996G>T	ENSP00000267430:p.Arg1562Ile		B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,superfamily_Restrct_endonuc-II-like,superfamily_RuvA_2-like,smart_Helicase_ATP-bd,smart_Helicase_C,smart_ERCC4_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R1562I	ENST00000267430.5	37	c.4685	CCDS32070.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.61|19.61	3.860813|3.860813	0.71834|0.71834	.|.	.|.	ENSG00000187790|ENSG00000187790	ENST00000554809|ENST00000267430;ENST00000542564;ENST00000556250	.|T;T;T	.|0.78364	.|-1.17;-1.17;-1.17	5.22|5.22	4.21|4.21	0.49690|0.49690	.|.	.|0.393291	.|0.29972	.|N	.|0.010735	D|D	0.83133|0.83133	0.5188|0.5188	M|M	0.67953|0.67953	2.075|2.075	0.48040|0.48040	D|D	0.999575|0.999575	.|D;D	.|0.76494	.|0.999;0.998	.|D;P	.|0.66196	.|0.942;0.896	D|D	0.83624|0.83624	0.0141|0.0141	5|10	.|0.72032	.|D	.|0.01	.|.	7.1533|7.1533	0.25622|0.25622	0.2299:0.0:0.7701:0.0|0.2299:0.0:0.7701:0.0	.|.	.|1536;1562	.|B2RTQ9;Q8IYD8	.|.;FANCM_HUMAN	D|I	494|1562;1536;1078	.|ENSP00000267430:R1562I;ENSP00000442493:R1536I;ENSP00000452033:R1078I	.|ENSP00000267430:R1562I	E|R	+|+	3|2	2|0	FANCM|FANCM	44726746|44726746	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	1.334000|1.334000	0.33827|0.33827	2.445000|2.445000	0.82738|0.82738	0.655000|0.655000	0.94253|0.94253	GAG|AGA	FANCM	-	NULL	ENSG00000187790		0.254	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCM	HGNC	protein_coding	OTTHUMT00000410474.1	-	0.00	54	0	G	XM_048128		45656996	+1	tier1	-	no_errors	ENST00000267430	ensembl	human	known	74_37	missense	5.48	69	4	SNP	1.000	T
FAT3	120114	genome.wustl.edu	37	11	92569825	92569825	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr11:92569825G>T	ENST00000298047.6	+	15	10197	c.10180G>T	c.(10180-10182)Gtc>Ttc	p.V3394F	FAT3_ENST00000409404.2_Missense_Mutation_p.V3394F|FAT3_ENST00000525166.1_Missense_Mutation_p.V3244F			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	3394	Cadherin 31. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TGTAGATCCTGTCTTGGGACT	0.438										TCGA Ovarian(4;0.039)																																							0													124.0	117.0	119.0					11																	92569825		1876	4106	5982	SO:0001583	missense	0			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.10180G>T	11.37:g.92569825G>T	ENSP00000298047:p.Val3394Phe		B5MDB0|Q96AU6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.V3394F	ENST00000298047.6	37	c.10180		11	.	.	.	.	.	.	.	.	.	.	G	16.71	3.199078	0.58126	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.02812	4.15;4.15;4.15	5.09	0.989	0.19802	.	.	.	.	.	T	0.03136	0.0092	L	0.55017	1.72	0.54753	D	0.999981	P	0.35077	0.483	B	0.32342	0.144	T	0.50931	-0.8769	9	0.56958	D	0.05	.	5.4277	0.16436	0.2346:0.2902:0.4752:0.0	.	3394	Q8TDW7-3	.	F	3394;3394;3244	ENSP00000298047:V3394F;ENSP00000387040:V3394F;ENSP00000432586:V3244F	ENSP00000298047:V3394F	V	+	1	0	FAT3	92209473	0.000000	0.05858	0.997000	0.53966	0.988000	0.76386	-0.339000	0.07832	-0.009000	0.14296	-0.244000	0.11960	GTC	FAT3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000165323		0.438	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		-	0.00	68	0	G	NM_001008781		92569825	+1	tier1	-	no_errors	ENST00000298047	ensembl	human	known	74_37	missense	30.00	42	18	SNP	0.862	T
FAT3	120114	genome.wustl.edu	37	11	92569825	92569825	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr11:92569825G>T	ENST00000298047.6	+	15	10197	c.10180G>T	c.(10180-10182)Gtc>Ttc	p.V3394F	FAT3_ENST00000409404.2_Missense_Mutation_p.V3394F|FAT3_ENST00000525166.1_Missense_Mutation_p.V3244F			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	3394	Cadherin 31. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TGTAGATCCTGTCTTGGGACT	0.438										TCGA Ovarian(4;0.039)																																							0													124.0	117.0	119.0					11																	92569825		1876	4106	5982	SO:0001583	missense	0			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.10180G>T	11.37:g.92569825G>T	ENSP00000298047:p.Val3394Phe		B5MDB0|Q96AU6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.V3394F	ENST00000298047.6	37	c.10180		11	.	.	.	.	.	.	.	.	.	.	G	16.71	3.199078	0.58126	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.02812	4.15;4.15;4.15	5.09	0.989	0.19802	.	.	.	.	.	T	0.03136	0.0092	L	0.55017	1.72	0.54753	D	0.999981	P	0.35077	0.483	B	0.32342	0.144	T	0.50931	-0.8769	9	0.56958	D	0.05	.	5.4277	0.16436	0.2346:0.2902:0.4752:0.0	.	3394	Q8TDW7-3	.	F	3394;3394;3244	ENSP00000298047:V3394F;ENSP00000387040:V3394F;ENSP00000432586:V3244F	ENSP00000298047:V3394F	V	+	1	0	FAT3	92209473	0.000000	0.05858	0.997000	0.53966	0.988000	0.76386	-0.339000	0.07832	-0.009000	0.14296	-0.244000	0.11960	GTC	FAT3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000165323		0.438	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		-	0.00	85	0	G	NM_001008781		92569825	+1	tier1	-	no_errors	ENST00000298047	ensembl	human	known	74_37	missense	30.00	42	18	SNP	0.862	T
FBXL3	26224	genome.wustl.edu	37	13	77581683	77581683	+	Frame_Shift_Del	DEL	A	A	-			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr13:77581683delA	ENST00000355619.5	-	5	1208	c.884delT	c.(883-885)ttafs	p.L295fs	FBXL3_ENST00000477982.1_Intron	NM_012158.2	NP_036290.1	Q9UKT7	FBXL3_HUMAN	F-box and leucine-rich repeat protein 3	295					entrainment of circadian clock by photoperiod (GO:0043153)|protein destabilization (GO:0031648)|protein ubiquitination (GO:0016567)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.L295fs*3(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|urinary_tract(1)	16		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.218)		GBM - Glioblastoma multiforme(99;0.0521)		TTCTTCATATAAAAAAAAATA	0.418																																																	1	Insertion - Frameshift(1)	lung(1)											72.0	73.0	72.0					13																	77581683		2203	4300	6503	SO:0001589	frameshift_variant	0			AF129532	CCDS9457.1	13q22	2011-06-09	2004-07-20	2004-07-21	ENSG00000005812	ENSG00000005812		"""F-boxes / Leucine-rich repeats"""	13599	protein-coding gene	gene with protein product		605653	"""F-box and leucine-rich repeat protein 3A"""	FBXL3A		10531035, 10828603	Standard	NM_012158		Approved	FBL3, FBL3A	uc001vkd.3	Q9UKT7	OTTHUMG00000017099	ENST00000355619.5:c.884delT	13.37:g.77581683delA	ENSP00000347834:p.Leu295fs		B2RB04|Q9P122	Frame_Shift_Del	DEL	pfam_F-box_dom,superfamily_F-box_dom,smart_F-box_dom	p.L295fs	ENST00000355619.5	37	c.884	CCDS9457.1	13																																																																																			FBXL3	-	NULL	ENSG00000005812		0.418	FBXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL3	HGNC	protein_coding	OTTHUMT00000045312.3		0.00	42	0	A			77581683	-1	tier1		no_errors	ENST00000355619	ensembl	human	known	74_37	frame_shift_del	10.81	33	4	DEL	1.000	-
FBXL3	26224	genome.wustl.edu	37	13	77581683	77581683	+	Frame_Shift_Del	DEL	A	A	-			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr13:77581683delA	ENST00000355619.5	-	5	1208	c.884delT	c.(883-885)ttafs	p.L295fs	FBXL3_ENST00000477982.1_Intron	NM_012158.2	NP_036290.1	Q9UKT7	FBXL3_HUMAN	F-box and leucine-rich repeat protein 3	295					entrainment of circadian clock by photoperiod (GO:0043153)|protein destabilization (GO:0031648)|protein ubiquitination (GO:0016567)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.L295fs*3(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|urinary_tract(1)	16		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.218)		GBM - Glioblastoma multiforme(99;0.0521)		TTCTTCATATAAAAAAAAATA	0.418																																																	1	Insertion - Frameshift(1)	lung(1)											72.0	73.0	72.0					13																	77581683		2203	4300	6503	SO:0001589	frameshift_variant	0			AF129532	CCDS9457.1	13q22	2011-06-09	2004-07-20	2004-07-21	ENSG00000005812	ENSG00000005812		"""F-boxes / Leucine-rich repeats"""	13599	protein-coding gene	gene with protein product		605653	"""F-box and leucine-rich repeat protein 3A"""	FBXL3A		10531035, 10828603	Standard	NM_012158		Approved	FBL3, FBL3A	uc001vkd.3	Q9UKT7	OTTHUMG00000017099	ENST00000355619.5:c.884delT	13.37:g.77581683delA	ENSP00000347834:p.Leu295fs		B2RB04|Q9P122	Frame_Shift_Del	DEL	pfam_F-box_dom,superfamily_F-box_dom,smart_F-box_dom	p.L295fs	ENST00000355619.5	37	c.884	CCDS9457.1	13																																																																																			FBXL3	-	NULL	ENSG00000005812		0.418	FBXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL3	HGNC	protein_coding	OTTHUMT00000045312.3		0.00	50	0	A			77581683	-1	tier1		no_errors	ENST00000355619	ensembl	human	known	74_37	frame_shift_del	10.81	33	4	DEL	1.000	-
FKBP10	60681	genome.wustl.edu	37	17	39969528	39969528	+	Nonsense_Mutation	SNP	C	C	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr17:39969528C>A	ENST00000321562.4	+	1	346	c.242C>A	c.(241-243)tCa>tAa	p.S81*	LEPREL4_ENST00000393928.1_5'Flank|LEPREL4_ENST00000355468.3_5'Flank	NM_021939.3	NP_068758.3	Q96AY3	FKB10_HUMAN	FK506 binding protein 10, 65 kDa	81	PPIase FKBP-type 1. {ECO:0000255|PROSITE- ProRule:PRU00277}.				chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			cervix(1)|endometrium(3)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	14		Breast(137;0.00122)		BRCA - Breast invasive adenocarcinoma(366;0.148)		AAGTTTGATTCAAGGTAACCC	0.557																																																	0													100.0	110.0	107.0					17																	39969528		2203	4300	6503	SO:0001587	stop_gained	0			AB045981	CCDS11409.1	17q21.2	2014-09-17	2002-08-29		ENSG00000141756	ENSG00000141756		"""EF-hand domain containing"""	18169	protein-coding gene	gene with protein product		607063	"""FK506 binding protein 10 (65 kDa)"""			11071917, 18786928	Standard	NM_021939		Approved	hFKBP65, FLJ22041, FKBP6, FLJ20683, FLJ23833	uc002hxv.2	Q96AY3	OTTHUMG00000133497	ENST00000321562.4:c.242C>A	17.37:g.39969528C>A	ENSP00000317232:p.Ser81*		Q7Z3R4|Q9H3N3|Q9H6J3|Q9H6N5|Q9UF89	Nonsense_Mutation	SNP	pfam_PPIase_FKBP_dom,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_PPIase_FKBP_dom	p.S81*	ENST00000321562.4	37	c.242	CCDS11409.1	17	.	.	.	.	.	.	.	.	.	.	C	37	6.443296	0.97572	.	.	ENSG00000141756	ENST00000269598;ENST00000429461;ENST00000321562;ENST00000414352	.	.	.	5.54	5.54	0.83059	.	0.889944	0.09234	N	0.830179	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.5484	19.0918	0.93229	0.0:1.0:0.0:0.0	.	.	.	.	X	81;21;81;81	.	ENSP00000269598:S81X	S	+	2	0	FKBP10	37223054	1.000000	0.71417	0.996000	0.52242	0.677000	0.39632	7.640000	0.83355	2.603000	0.88011	0.655000	0.94253	TCA	FKBP10	-	pfam_PPIase_FKBP_dom,pfscan_PPIase_FKBP_dom	ENSG00000141756		0.557	FKBP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP10	HGNC	protein_coding	OTTHUMT00000257410.2	-	0.00	37	0	C	NM_021939		39969528	+1	tier1	-	no_errors	ENST00000321562	ensembl	human	known	74_37	nonsense	17.92	435	95	SNP	1.000	A
FKBP10	60681	genome.wustl.edu	37	17	39975621	39975621	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr17:39975621C>A	ENST00000321562.4	+	5	991	c.887C>A	c.(886-888)tCc>tAc	p.S296Y	FKBP10_ENST00000544340.1_Missense_Mutation_p.S8Y	NM_021939.3	NP_068758.3	Q96AY3	FKB10_HUMAN	FK506 binding protein 10, 65 kDa	296	PPIase FKBP-type 3. {ECO:0000255|PROSITE- ProRule:PRU00277}.				chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			cervix(1)|endometrium(3)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	14		Breast(137;0.00122)		BRCA - Breast invasive adenocarcinoma(366;0.148)		TACAATGGCTCCTTGATGGAC	0.647																																																	0													63.0	67.0	66.0					17																	39975621		2203	4300	6503	SO:0001583	missense	0			AB045981	CCDS11409.1	17q21.2	2014-09-17	2002-08-29		ENSG00000141756	ENSG00000141756		"""EF-hand domain containing"""	18169	protein-coding gene	gene with protein product		607063	"""FK506 binding protein 10 (65 kDa)"""			11071917, 18786928	Standard	NM_021939		Approved	hFKBP65, FLJ22041, FKBP6, FLJ20683, FLJ23833	uc002hxv.2	Q96AY3	OTTHUMG00000133497	ENST00000321562.4:c.887C>A	17.37:g.39975621C>A	ENSP00000317232:p.Ser296Tyr		Q7Z3R4|Q9H3N3|Q9H6J3|Q9H6N5|Q9UF89	Missense_Mutation	SNP	pfam_PPIase_FKBP_dom,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_PPIase_FKBP_dom	p.S296Y	ENST00000321562.4	37	c.887	CCDS11409.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.05|15.05	2.718240|2.718240	0.48622|0.48622	.|.	.|.	ENSG00000141756|ENSG00000141756	ENST00000455106|ENST00000321562;ENST00000414352;ENST00000544340	.|D;D	.|0.86164	.|-2.08;-2.08	5.03|5.03	5.03|5.03	0.67393|0.67393	.|Peptidyl-prolyl cis-trans isomerase, FKBP-type, domain (2);	.|0.159741	.|0.41712	.|D	.|0.000840	D|D	0.86024|0.86024	0.5834|0.5834	N|N	0.17901|0.17901	0.54|0.54	0.24291|0.24291	N|N	0.995166|0.995166	.|D	.|0.63880	.|0.993	.|D	.|0.65323	.|0.934	T|T	0.73911|0.73911	-0.3833|-0.3833	5|10	.|0.02654	.|T	.|1	-21.517|-21.517	18.5447|18.5447	0.91042|0.91042	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|296	.|Q96AY3	.|FKB10_HUMAN	T|Y	39|296;296;8	.|ENSP00000317232:S296Y;ENSP00000442009:S8Y	.|ENSP00000317232:S296Y	P|S	+|+	1|2	0|0	FKBP10|FKBP10	37229147|37229147	0.997000|0.997000	0.39634|0.39634	0.962000|0.962000	0.40283|0.40283	0.536000|0.536000	0.34869|0.34869	3.649000|3.649000	0.54417|0.54417	2.627000|2.627000	0.88993|0.88993	0.561000|0.561000	0.74099|0.74099	CCT|TCC	FKBP10	-	pfam_PPIase_FKBP_dom,pfscan_PPIase_FKBP_dom	ENSG00000141756		0.647	FKBP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP10	HGNC	protein_coding	OTTHUMT00000257410.2	-	0.00	35	0	C	NM_021939		39975621	+1	tier1	-	no_errors	ENST00000321562	ensembl	human	known	74_37	missense	16.15	456	88	SNP	0.995	A
FKBP10	60681	genome.wustl.edu	37	17	39976532	39976533	+	Missense_Mutation	DNP	CC	CC	TA			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr17:39976532_39976533CC>TA	ENST00000321562.4	+	7	1179_1180	c.1075_1076CC>TA	c.(1075-1077)CCt>TAt	p.P359Y	FKBP10_ENST00000544340.1_Missense_Mutation_p.P132Y	NM_021939.3	NP_068758.3	Q96AY3	FKB10_HUMAN	FK506 binding protein 10, 65 kDa	359	PPIase FKBP-type 3. {ECO:0000255|PROSITE- ProRule:PRU00277}.				chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			cervix(1)|endometrium(3)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	14		Breast(137;0.00122)		BRCA - Breast invasive adenocarcinoma(366;0.148)		AGACAAGATCCCTGGCTCTGCC	0.564																																																	0																																										SO:0001583	missense	0			AB045981	CCDS11409.1	17q21.2	2014-09-17	2002-08-29		ENSG00000141756	ENSG00000141756		"""EF-hand domain containing"""	18169	protein-coding gene	gene with protein product		607063	"""FK506 binding protein 10 (65 kDa)"""			11071917, 18786928	Standard	NM_021939		Approved	hFKBP65, FLJ22041, FKBP6, FLJ20683, FLJ23833	uc002hxv.2	Q96AY3	OTTHUMG00000133497	Exception_encountered	17.37:g.39976532_39976533delinsTA	ENSP00000317232:p.Pro359Tyr		Q7Z3R4|Q9H3N3|Q9H6J3|Q9H6N5|Q9UF89	Missense_Mutation	SNP	pfam_PPIase_FKBP_dom,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_PPIase_FKBP_dom	p.P359S|p.P359H	ENST00000321562.4	37	c.1075|c.1076	CCDS11409.1	17																																																																																			FKBP10	-	pfam_PPIase_FKBP_dom,pfscan_PPIase_FKBP_dom	ENSG00000141756		0.564	FKBP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP10	HGNC	protein_coding	OTTHUMT00000257410.2	-	0.00	18|19	0	C	NM_021939		39976532|39976533	+1	tier1	-	no_errors	ENST00000321562	ensembl	human	known	74_37	missense	19.27|19.08	264|263	63|62	SNP	1.000	T|A
FLG	2312	genome.wustl.edu	37	1	152282266	152282266	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:152282266C>T	ENST00000368799.1	-	3	5131	c.5096G>A	c.(5095-5097)cGc>cAc	p.R1699H	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1699	Ser-rich.		R -> C (in dbSNP:rs12405278).		establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ATCTTGTCTGCGCCCAGTGCC	0.572									Ichthyosis																																								0													253.0	256.0	255.0					1																	152282266		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.5096G>A	1.37:g.152282266C>T	ENSP00000357789:p.Arg1699His		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.R1699H	ENST00000368799.1	37	c.5096	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	C	5.271	0.235356	0.10023	.	.	ENSG00000143631	ENST00000368799	T	0.03951	3.75	2.69	-1.42	0.08913	.	.	.	.	.	T	0.00875	0.0029	N	0.17082	0.46	0.09310	N	1	B	0.24882	0.113	B	0.15484	0.013	T	0.45920	-0.9228	9	0.44086	T	0.13	.	5.9351	0.19161	0.0:0.485:0.0:0.515	.	1699	P20930	FILA_HUMAN	H	1699	ENSP00000357789:R1699H	ENSP00000357789:R1699H	R	-	2	0	FLG	150548890	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.335000	0.07873	-0.429000	0.07329	0.306000	0.20318	CGC	FLG	-	pfam_Filaggrin	ENSG00000143631		0.572	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	-	0.00	102	0	C	NM_002016		152282266	-1	tier1	-	no_errors	ENST00000368799	ensembl	human	known	74_37	missense	14.29	102	17	SNP	0.000	T
FLG	2312	genome.wustl.edu	37	1	152282266	152282266	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:152282266C>T	ENST00000368799.1	-	3	5131	c.5096G>A	c.(5095-5097)cGc>cAc	p.R1699H	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1699	Ser-rich.		R -> C (in dbSNP:rs12405278).		establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ATCTTGTCTGCGCCCAGTGCC	0.572									Ichthyosis																																								0													253.0	256.0	255.0					1																	152282266		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.5096G>A	1.37:g.152282266C>T	ENSP00000357789:p.Arg1699His		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.R1699H	ENST00000368799.1	37	c.5096	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	C	5.271	0.235356	0.10023	.	.	ENSG00000143631	ENST00000368799	T	0.03951	3.75	2.69	-1.42	0.08913	.	.	.	.	.	T	0.00875	0.0029	N	0.17082	0.46	0.09310	N	1	B	0.24882	0.113	B	0.15484	0.013	T	0.45920	-0.9228	9	0.44086	T	0.13	.	5.9351	0.19161	0.0:0.485:0.0:0.515	.	1699	P20930	FILA_HUMAN	H	1699	ENSP00000357789:R1699H	ENSP00000357789:R1699H	R	-	2	0	FLG	150548890	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.335000	0.07873	-0.429000	0.07329	0.306000	0.20318	CGC	FLG	-	pfam_Filaggrin	ENSG00000143631		0.572	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	-	0.00	148	0	C	NM_002016		152282266	-1	tier1	-	no_errors	ENST00000368799	ensembl	human	known	74_37	missense	14.29	102	17	SNP	0.000	T
FLJ12825	440101	genome.wustl.edu	37	12	54515525	54515525	+	lincRNA	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr12:54515525C>T	ENST00000515617.1	+	0	3449				RP11-834C11.5_ENST00000508763.1_RNA	NR_026655.1																						AATGTGACCACCCATCCCCTA	0.517																																																	0																																												0																															12.37:g.54515525C>T				RNA	SNP	-	NULL	ENST00000515617.1	37	NULL		12																																																																																			RP11-834C11.3	-	-	ENSG00000248265		0.517	RP11-834C11.3-001	KNOWN	basic	lincRNA	FLJ12825	Clone_based_vega_gene	lincRNA	OTTHUMT00000358961.1		0.00	54	0	C			54515525	+1			no_errors	ENST00000515617	ensembl	human	known	74_37	rna	11.90	37	5	SNP	0.004	T
FLT4	2324	genome.wustl.edu	37	5	180043381	180043381	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr5:180043381C>T	ENST00000261937.6	-	23	3283	c.3205G>A	c.(3205-3207)Gtc>Atc	p.V1069I	FLT4_ENST00000502649.1_Missense_Mutation_p.V1069I|FLT4_ENST00000393347.3_Missense_Mutation_p.V1069I	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	1069	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CCCTTGCGGACGTAGTCGGGG	0.602																																					Colon(97;1075 1466 27033 27547 35871)												0													115.0	104.0	108.0					5																	180043381		2203	4300	6503	SO:0001583	missense	0			X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.3205G>A	5.37:g.180043381C>T	ENSP00000261937:p.Val1069Ile		A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_VEGFR3_rcpt	p.V1069I	ENST00000261937.6	37	c.3205	CCDS4457.1	5	.	.	.	.	.	.	.	.	.	.	C	22.0	4.233214	0.79688	.	.	ENSG00000037280	ENST00000261937;ENST00000393347;ENST00000502649;ENST00000512795	D;D;D;D	0.82984	-1.67;-1.67;-1.67;-1.67	3.19	3.19	0.36642	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	D	0.83257	0.5215	N	0.13352	0.335	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.995;0.996	D	0.86338	0.1703	9	0.72032	D	0.01	.	14.8959	0.70644	0.0:1.0:0.0:0.0	.	1069;1069	E9PD35;P35916	.;VGFR3_HUMAN	I	1069;1069;1069;107	ENSP00000261937:V1069I;ENSP00000377016:V1069I;ENSP00000426057:V1069I;ENSP00000421535:V107I	ENSP00000261937:V1069I	V	-	1	0	FLT4	179975987	1.000000	0.71417	0.994000	0.49952	0.745000	0.42441	7.579000	0.82511	1.807000	0.52817	0.491000	0.48974	GTC	FLT4	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000037280		0.602	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLT4	HGNC	protein_coding	OTTHUMT00000253527.4	-	0.00	36	0	C			180043381	-1	tier1	-	no_errors	ENST00000261937	ensembl	human	known	74_37	missense	33.33	38	19	SNP	1.000	T
FNDC7	163479	genome.wustl.edu	37	1	109264971	109264971	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:109264971G>A	ENST00000370017.3	+	5	890	c.613G>A	c.(613-615)Gcc>Acc	p.A205T	FNDC7_ENST00000271311.2_Missense_Mutation_p.A206T	NM_001144937.1	NP_001138409.1	Q5VTL7	FNDC7_HUMAN	fibronectin type III domain containing 7	205	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.					extracellular region (GO:0005576)				breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|skin(4)|stomach(1)|urinary_tract(1)	20		all_lung(203;0.00439)|Lung NSC(277;0.00683)|all_epithelial(167;0.00728)		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.173)|all cancers(265;0.244)		TCGGGCCCCTGCCAACATTCA	0.453																																																	0													41.0	36.0	38.0					1																	109264971		692	1591	2283	SO:0001583	missense	0				CCDS44185.1	1p13.3	2013-02-11			ENSG00000143107	ENSG00000143107		"""Fibronectin type III domain containing"""	26668	protein-coding gene	gene with protein product						12477932	Standard	NM_001144937		Approved	FLJ35838	uc001dvx.3	Q5VTL7	OTTHUMG00000011120	ENST00000370017.3:c.613G>A	1.37:g.109264971G>A	ENSP00000359034:p.Ala205Thr		A1L468|E9PAZ5|Q6PF16|Q8NA51	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.A206T	ENST00000370017.3	37	c.616	CCDS44185.1	1	.	.	.	.	.	.	.	.	.	.	G	12.60	1.985521	0.35036	.	.	ENSG00000143107	ENST00000370017;ENST00000271311	T;T	0.53206	0.63;0.63	5.63	2.7	0.31948	.	0.747353	0.13521	N	0.381683	T	0.11580	0.0282	L	0.36672	1.1	0.09310	N	1	B	0.17268	0.021	B	0.09377	0.004	T	0.32508	-0.9904	10	0.07813	T	0.8	-3.1834	5.7856	0.18331	0.1431:0.0:0.5662:0.2906	.	205	E9PAZ5	.	T	205;206	ENSP00000359034:A205T;ENSP00000271311:A206T	ENSP00000271311:A206T	A	+	1	0	FNDC7	109066494	0.983000	0.35010	0.952000	0.39060	0.985000	0.73830	1.513000	0.35823	0.706000	0.31912	0.455000	0.32223	GCC	FNDC7	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000143107		0.453	FNDC7-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FNDC7	HGNC	protein_coding	OTTHUMT00000030589.4	-	0.00	104	0	G	NM_173532		109264971	+1	tier1	-	no_errors	ENST00000271311	ensembl	human	known	74_37	missense	5.00	76	4	SNP	0.058	A
FNDC7	163479	genome.wustl.edu	37	1	109264971	109264971	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:109264971G>A	ENST00000370017.3	+	5	890	c.613G>A	c.(613-615)Gcc>Acc	p.A205T	FNDC7_ENST00000271311.2_Missense_Mutation_p.A206T	NM_001144937.1	NP_001138409.1	Q5VTL7	FNDC7_HUMAN	fibronectin type III domain containing 7	205	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.					extracellular region (GO:0005576)				breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|skin(4)|stomach(1)|urinary_tract(1)	20		all_lung(203;0.00439)|Lung NSC(277;0.00683)|all_epithelial(167;0.00728)		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.173)|all cancers(265;0.244)		TCGGGCCCCTGCCAACATTCA	0.453																																																	0													41.0	36.0	38.0					1																	109264971		692	1591	2283	SO:0001583	missense	0				CCDS44185.1	1p13.3	2013-02-11			ENSG00000143107	ENSG00000143107		"""Fibronectin type III domain containing"""	26668	protein-coding gene	gene with protein product						12477932	Standard	NM_001144937		Approved	FLJ35838	uc001dvx.3	Q5VTL7	OTTHUMG00000011120	ENST00000370017.3:c.613G>A	1.37:g.109264971G>A	ENSP00000359034:p.Ala205Thr		A1L468|E9PAZ5|Q6PF16|Q8NA51	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.A206T	ENST00000370017.3	37	c.616	CCDS44185.1	1	.	.	.	.	.	.	.	.	.	.	G	12.60	1.985521	0.35036	.	.	ENSG00000143107	ENST00000370017;ENST00000271311	T;T	0.53206	0.63;0.63	5.63	2.7	0.31948	.	0.747353	0.13521	N	0.381683	T	0.11580	0.0282	L	0.36672	1.1	0.09310	N	1	B	0.17268	0.021	B	0.09377	0.004	T	0.32508	-0.9904	10	0.07813	T	0.8	-3.1834	5.7856	0.18331	0.1431:0.0:0.5662:0.2906	.	205	E9PAZ5	.	T	205;206	ENSP00000359034:A205T;ENSP00000271311:A206T	ENSP00000271311:A206T	A	+	1	0	FNDC7	109066494	0.983000	0.35010	0.952000	0.39060	0.985000	0.73830	1.513000	0.35823	0.706000	0.31912	0.455000	0.32223	GCC	FNDC7	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000143107		0.453	FNDC7-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FNDC7	HGNC	protein_coding	OTTHUMT00000030589.4	-	0.00	63	0	G	NM_173532		109264971	+1	tier1	-	no_errors	ENST00000271311	ensembl	human	known	74_37	missense	5.00	76	4	SNP	0.058	A
FLVCR1	28982	genome.wustl.edu	37	1	213032241	213032241	+	Silent	SNP	G	G	A	rs371271294		TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:213032241G>A	ENST00000366971.4	+	1	645	c.447G>A	c.(445-447)ctG>ctA	p.L149L	FLVCR1-AS1_ENST00000356684.3_lincRNA	NM_014053.3	NP_054772.1	Q9Y5Y0	FLVC1_HUMAN	feline leukemia virus subgroup C cellular receptor 1	149					blood vessel development (GO:0001568)|cell death (GO:0008219)|cellular iron ion homeostasis (GO:0006879)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|erythrocyte differentiation (GO:0030218)|erythrocyte maturation (GO:0043249)|head morphogenesis (GO:0060323)|heme export (GO:0097037)|heme transport (GO:0015886)|in utero embryonic development (GO:0001701)|mitochondrial transport (GO:0006839)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|regulation of organ growth (GO:0046620)|spleen development (GO:0048536)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	heme transporter activity (GO:0015232)|transporter activity (GO:0005215)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(2)	12				OV - Ovarian serous cystadenocarcinoma(81;0.00733)|all cancers(67;0.013)|GBM - Glioblastoma multiforme(131;0.0845)|Epithelial(68;0.11)		TCGACTGGCTGTCCATGGTGT	0.612																																					Esophageal Squamous(199;2235 2952 19233 26256)												0								G		1,4405	2.1+/-5.4	0,1,2202	112.0	85.0	94.0		447	3.7	1.0	1		94	0,8600		0,0,4300	no	coding-synonymous	FLVCR1	NM_014053.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		149/556	213032241	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AF118637	CCDS1510.1	1q32.3	2014-05-30			ENSG00000162769	ENSG00000162769		"""Solute carriers"""	24682	protein-coding gene	gene with protein product		609144	"""ataxia, posterior column 1, with retinitis pigmentosa"""	AXPC1		10400745, 10648427, 21070897	Standard	NM_014053		Approved	FLVCR, MFSD7B, PCA	uc001hjt.3	Q9Y5Y0	OTTHUMG00000036924	ENST00000366971.4:c.447G>A	1.37:g.213032241G>A			Q1HE16|Q86XY9|Q9NVR9	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.L149	ENST00000366971.4	37	c.447	CCDS1510.1	1																																																																																			FLVCR1	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000162769		0.612	FLVCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLVCR1	HGNC	protein_coding	OTTHUMT00000089678.2	-	0.00	14	0	G	NM_014053		213032241	+1	tier1	-	no_errors	ENST00000366971	ensembl	human	known	74_37	silent	32.00	17	8	SNP	1.000	A
FLVCR1	28982	genome.wustl.edu	37	1	213032241	213032241	+	Silent	SNP	G	G	A	rs371271294		TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:213032241G>A	ENST00000366971.4	+	1	645	c.447G>A	c.(445-447)ctG>ctA	p.L149L	FLVCR1-AS1_ENST00000356684.3_lincRNA	NM_014053.3	NP_054772.1	Q9Y5Y0	FLVC1_HUMAN	feline leukemia virus subgroup C cellular receptor 1	149					blood vessel development (GO:0001568)|cell death (GO:0008219)|cellular iron ion homeostasis (GO:0006879)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|erythrocyte differentiation (GO:0030218)|erythrocyte maturation (GO:0043249)|head morphogenesis (GO:0060323)|heme export (GO:0097037)|heme transport (GO:0015886)|in utero embryonic development (GO:0001701)|mitochondrial transport (GO:0006839)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|regulation of organ growth (GO:0046620)|spleen development (GO:0048536)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	heme transporter activity (GO:0015232)|transporter activity (GO:0005215)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(2)	12				OV - Ovarian serous cystadenocarcinoma(81;0.00733)|all cancers(67;0.013)|GBM - Glioblastoma multiforme(131;0.0845)|Epithelial(68;0.11)		TCGACTGGCTGTCCATGGTGT	0.612																																					Esophageal Squamous(199;2235 2952 19233 26256)												0								G		1,4405	2.1+/-5.4	0,1,2202	112.0	85.0	94.0		447	3.7	1.0	1		94	0,8600		0,0,4300	no	coding-synonymous	FLVCR1	NM_014053.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		149/556	213032241	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AF118637	CCDS1510.1	1q32.3	2014-05-30			ENSG00000162769	ENSG00000162769		"""Solute carriers"""	24682	protein-coding gene	gene with protein product		609144	"""ataxia, posterior column 1, with retinitis pigmentosa"""	AXPC1		10400745, 10648427, 21070897	Standard	NM_014053		Approved	FLVCR, MFSD7B, PCA	uc001hjt.3	Q9Y5Y0	OTTHUMG00000036924	ENST00000366971.4:c.447G>A	1.37:g.213032241G>A			Q1HE16|Q86XY9|Q9NVR9	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.L149	ENST00000366971.4	37	c.447	CCDS1510.1	1																																																																																			FLVCR1	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000162769		0.612	FLVCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLVCR1	HGNC	protein_coding	OTTHUMT00000089678.2	-	0.00	19	0	G	NM_014053		213032241	+1	tier1	-	no_errors	ENST00000366971	ensembl	human	known	74_37	silent	32.00	17	8	SNP	1.000	A
FOXN1	8456	genome.wustl.edu	37	17	26851109	26851109	+	Splice_Site	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr17:26851109G>A	ENST00000226247.2	+	1	151	c.122G>A	c.(121-123)aGt>aAt	p.S41N	FOXN1_ENST00000579795.1_Splice_Site_p.S41N	NM_003593.2	NP_003584.2	O15353	FOXN1_HUMAN	forkhead box N1	41					defense response (GO:0006952)|epidermis development (GO:0008544)|epithelial cell proliferation (GO:0050673)|hair follicle development (GO:0001942)|keratinocyte differentiation (GO:0030216)|lymphocyte homeostasis (GO:0002260)|nail development (GO:0035878)|organ morphogenesis (GO:0009887)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(3)|lung(8)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Lung NSC(42;0.00431)					GCCCCACAGAGTGTAAGTACC	0.682																																																	0													10.0	10.0	10.0					17																	26851109		2192	4284	6476	SO:0001630	splice_region_variant	0			Y11739	CCDS11232.1	17q11-q12	2014-09-17	2003-06-12	2003-06-13	ENSG00000109101	ENSG00000109101		"""Forkhead boxes"""	12765	protein-coding gene	gene with protein product		600838	"""winged-helix nude"", ""Rowett nude"""	WHN, RONU		9321431	Standard	NM_003593		Approved	FKHL20	uc002hbj.3	O15353	OTTHUMG00000132603	ENST00000226247.2:c.123+1G>A	17.37:g.26851109G>A			B2R9Q7|O15352	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.S41N	ENST00000226247.2	37	c.122	CCDS11232.1	17	.	.	.	.	.	.	.	.	.	.	G	7.157	0.584989	0.13749	.	.	ENSG00000109101	ENST00000226247	D	0.92699	-3.09	5.03	0.129	0.14739	.	0.431911	0.24229	N	0.040373	T	0.76912	0.4054	N	0.08118	0	0.21933	N	0.99947	B	0.02656	0.0	B	0.04013	0.001	T	0.62383	-0.6866	10	0.06099	T	0.92	.	7.9671	0.30104	0.3666:0.0:0.6334:0.0	.	41	O15353	FOXN1_HUMAN	N	41	ENSP00000226247:S41N	ENSP00000226247:S41N	S	+	2	0	FOXN1	23875236	0.037000	0.19845	0.969000	0.41365	0.619000	0.37552	-0.171000	0.09883	-0.133000	0.11537	0.561000	0.74099	AGT	FOXN1	-	NULL	ENSG00000109101		0.682	FOXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXN1	HGNC	protein_coding	OTTHUMT00000255832.1	-	0.00	94	0	G		Missense_Mutation	26851109	+1	tier1	-	no_errors	ENST00000226247	ensembl	human	known	74_37	missense	86.06	87	537	SNP	0.974	A
GALNT13	114805	genome.wustl.edu	37	2	155099226	155099226	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr2:155099226C>T	ENST00000392825.3	+	6	1061	c.494C>T	c.(493-495)aCa>aTa	p.T165I	GALNT13_ENST00000409237.1_Missense_Mutation_p.T165I	NM_052917.2	NP_443149.2	Q8IUC8	GLT13_HUMAN	polypeptide N-acetylgalactosaminyltransferase 13	165	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|lung(37)|ovary(3)|pancreas(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	65						CTCAAGTTGACATTAGAGAAT	0.338																																																	0													27.0	29.0	28.0					2																	155099226		2202	4299	6501	SO:0001583	missense	0			AB067505	CCDS2199.1	2q24.1	2014-03-13	2014-03-13		ENSG00000144278	ENSG00000144278	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	23242	protein-coding gene	gene with protein product	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13"", ""polypeptide GalNAc transferase 13"""	608369	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)"""			11572484, 12407114	Standard	XM_005246267		Approved	KIAA1918, GalNAc-T13	uc002tyr.4	Q8IUC8	OTTHUMG00000131917	ENST00000392825.3:c.494C>T	2.37:g.155099226C>T	ENSP00000376570:p.Thr165Ile		Q08ER7|Q68VI8|Q6ZWG1|Q96PX0|Q9UIE5	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.T165I	ENST00000392825.3	37	c.494	CCDS2199.1	2	.	.	.	.	.	.	.	.	.	.	C	15.20	2.761491	0.49468	.	.	ENSG00000144278	ENST00000392825;ENST00000409237	T;T	0.54675	0.56;0.56	5.98	5.98	0.97165	Glycosyl transferase, family 2 (1);	0.353837	0.34178	N	0.004193	T	0.30262	0.0759	N	0.01209	-0.955	0.34480	D	0.703788	B;B	0.06786	0.001;0.0	B;B	0.16722	0.016;0.01	T	0.36625	-0.9740	10	0.45353	T	0.12	.	19.4247	0.94737	0.0:1.0:0.0:0.0	.	165;165	Q08ER7;Q8IUC8	.;GLT13_HUMAN	I	165	ENSP00000376570:T165I;ENSP00000387239:T165I	ENSP00000376570:T165I	T	+	2	0	GALNT13	154807472	0.375000	0.25089	1.000000	0.80357	0.986000	0.74619	3.957000	0.56730	2.843000	0.97960	0.585000	0.79938	ACA	GALNT13	-	pfam_Glyco_trans_2	ENSG00000144278		0.338	GALNT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT13	HGNC	protein_coding	OTTHUMT00000254870.2	-	0.00	92	0	C	NM_052917		155099226	+1	tier1	-	no_errors	ENST00000409237	ensembl	human	known	74_37	missense	12.84	95	14	SNP	1.000	T
GBX2	2637	genome.wustl.edu	37	2	237076427	237076429	+	In_Frame_Del	DEL	GGC	GGC	-	rs557135639|rs559648034	byFrequency	TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	GGC	GGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr2:237076427_237076429delGGC	ENST00000306318.4	-	1	583_585	c.186_188delGCC	c.(184-189)ccgccc>ccc	p.62_63PP>P	AC079135.1_ENST00000415226.1_RNA|GBX2_ENST00000551105.1_In_Frame_Del_p.62_63PP>P|AC079135.1_ENST00000483218.1_RNA|GBX2_ENST00000465889.1_5'Flank	NM_001485.2	NP_001476.2	P52951	GBX2_HUMAN	gastrulation brain homeobox 2	62	Poly-Pro.				autonomic nervous system development (GO:0048483)|axon guidance (GO:0007411)|cerebellar granule cell precursor proliferation (GO:0021930)|cerebellum development (GO:0021549)|forebrain neuron development (GO:0021884)|inner ear morphogenesis (GO:0042472)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|patterning of blood vessels (GO:0001569)|rhombomere 2 development (GO:0021568)|thalamus development (GO:0021794)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	7		Breast(86;0.00235)|Renal(207;0.00339)|all_hematologic(139;0.00357)|all_lung(227;0.0616)|Acute lymphoblastic leukemia(138;0.0775)|Ovarian(221;0.089)|Lung NSC(271;0.179)		Epithelial(121;4.5e-25)|OV - Ovarian serous cystadenocarcinoma(60;5.16e-11)|BRCA - Breast invasive adenocarcinoma(100;3.4e-05)|Lung(119;0.00195)|LUSC - Lung squamous cell carcinoma(224;0.00471)		GGGCAGCGCGggcggcggcggcg	0.754																																																	0																																										SO:0001651	inframe_deletion	0			AF118452	CCDS2515.1	2q37.2	2012-03-09	2005-12-22		ENSG00000168505	ENSG00000168505		"""Homeoboxes / ANTP class : HOXL subclass"""	4186	protein-coding gene	gene with protein product		601135	"""gastrulation brain homeo box 2"""			9346236, 8838315	Standard	XM_005246071		Approved		uc002vvw.1	P52951	OTTHUMG00000133294	ENST00000306318.4:c.186_188delGCC	2.37:g.237076436_237076438delGGC	ENSP00000302251:p.Pro63del		B2RPH7|O43833|Q53RX5|Q9Y5Y1	In_Frame_Del	DEL	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.P63in_frame_del	ENST00000306318.4	37	c.188_186	CCDS2515.1	2																																																																																			GBX2	-	NULL	ENSG00000168505		0.754	GBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBX2	HGNC	protein_coding	OTTHUMT00000257078.3		0.00	12	0	GGC	NM_001485		237076429	-1	tier1		no_errors	ENST00000306318	ensembl	human	known	74_37	in_frame_del	37.50	5	3	DEL	1.000:1.000:0.973	-
GFPT2	9945	genome.wustl.edu	37	5	179745892	179745892	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr5:179745892C>G	ENST00000253778.8	-	10	1028	c.859G>C	c.(859-861)Gat>Cat	p.D287H	GFPT2_ENST00000520165.1_5'UTR	NM_005110.2	NP_005101.1	O94808	GFPT2_HUMAN	glutamine-fructose-6-phosphate transaminase 2	287	Glutamine amidotransferase type-2. {ECO:0000255|PROSITE-ProRule:PRU00609}.				carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|energy reserve metabolic process (GO:0006112)|fructose 6-phosphate metabolic process (GO:0006002)|glutamine metabolic process (GO:0006541)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)	carbohydrate binding (GO:0030246)|glutamine-fructose-6-phosphate transaminase (isomerizing) activity (GO:0004360)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34	all_cancers(89;4.97e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	Medulloblastoma(196;0.0392)|all_neural(177;0.0529)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		L-Glutamine(DB00130)	AGTTTCCCATCAGCCACTGCG	0.567																																																	0													63.0	68.0	66.0					5																	179745892		2100	4227	6327	SO:0001583	missense	0			AB016789	CCDS43411.1	5q	2008-07-18			ENSG00000131459	ENSG00000131459			4242	protein-coding gene	gene with protein product	"""glutamine: fructose-6-phosphate aminotransferase 2"""	603865				10198162	Standard	NM_005110		Approved	GFAT2	uc003mlw.1	O94808	OTTHUMG00000163442	ENST00000253778.8:c.859G>C	5.37:g.179745892C>G	ENSP00000253778:p.Asp287His		Q53XM2|Q9BWS4	Missense_Mutation	SNP	pfam_SIS,pfam_GATase_dom,tigrfam_GlmS_trans	p.D287H	ENST00000253778.8	37	c.859	CCDS43411.1	5	.	.	.	.	.	.	.	.	.	.	C	20.2	3.957534	0.73902	.	.	ENSG00000131459	ENST00000253778;ENST00000518906	T;T	0.76968	0.97;-1.06	5.39	5.39	0.77823	Glutamine amidotransferase, type II (1);	0.414031	0.29087	N	0.013188	T	0.77343	0.4116	M	0.67397	2.05	0.58432	D	0.999999	B	0.09022	0.002	B	0.12837	0.008	T	0.71876	-0.4460	9	.	.	.	-14.9382	19.1516	0.93491	0.0:1.0:0.0:0.0	.	287	O94808	GFPT2_HUMAN	H	287;189	ENSP00000253778:D287H;ENSP00000431125:D189H	.	D	-	1	0	GFPT2	179678498	1.000000	0.71417	1.000000	0.80357	0.810000	0.45777	5.965000	0.70387	2.545000	0.85829	0.555000	0.69702	GAT	GFPT2	-	tigrfam_GlmS_trans	ENSG00000131459		0.567	GFPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GFPT2	HGNC	protein_coding	OTTHUMT00000373444.4	-	0.00	30	0	C	NM_005110		179745892	-1	tier1	-	no_errors	ENST00000253778	ensembl	human	known	74_37	missense	10.87	41	5	SNP	1.000	G
GFPT2	9945	genome.wustl.edu	37	5	179745892	179745892	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr5:179745892C>G	ENST00000253778.8	-	10	1028	c.859G>C	c.(859-861)Gat>Cat	p.D287H	GFPT2_ENST00000520165.1_5'UTR	NM_005110.2	NP_005101.1	O94808	GFPT2_HUMAN	glutamine-fructose-6-phosphate transaminase 2	287	Glutamine amidotransferase type-2. {ECO:0000255|PROSITE-ProRule:PRU00609}.				carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|energy reserve metabolic process (GO:0006112)|fructose 6-phosphate metabolic process (GO:0006002)|glutamine metabolic process (GO:0006541)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)	carbohydrate binding (GO:0030246)|glutamine-fructose-6-phosphate transaminase (isomerizing) activity (GO:0004360)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34	all_cancers(89;4.97e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	Medulloblastoma(196;0.0392)|all_neural(177;0.0529)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		L-Glutamine(DB00130)	AGTTTCCCATCAGCCACTGCG	0.567																																																	0													63.0	68.0	66.0					5																	179745892		2100	4227	6327	SO:0001583	missense	0			AB016789	CCDS43411.1	5q	2008-07-18			ENSG00000131459	ENSG00000131459			4242	protein-coding gene	gene with protein product	"""glutamine: fructose-6-phosphate aminotransferase 2"""	603865				10198162	Standard	NM_005110		Approved	GFAT2	uc003mlw.1	O94808	OTTHUMG00000163442	ENST00000253778.8:c.859G>C	5.37:g.179745892C>G	ENSP00000253778:p.Asp287His		Q53XM2|Q9BWS4	Missense_Mutation	SNP	pfam_SIS,pfam_GATase_dom,tigrfam_GlmS_trans	p.D287H	ENST00000253778.8	37	c.859	CCDS43411.1	5	.	.	.	.	.	.	.	.	.	.	C	20.2	3.957534	0.73902	.	.	ENSG00000131459	ENST00000253778;ENST00000518906	T;T	0.76968	0.97;-1.06	5.39	5.39	0.77823	Glutamine amidotransferase, type II (1);	0.414031	0.29087	N	0.013188	T	0.77343	0.4116	M	0.67397	2.05	0.58432	D	0.999999	B	0.09022	0.002	B	0.12837	0.008	T	0.71876	-0.4460	9	.	.	.	-14.9382	19.1516	0.93491	0.0:1.0:0.0:0.0	.	287	O94808	GFPT2_HUMAN	H	287;189	ENSP00000253778:D287H;ENSP00000431125:D189H	.	D	-	1	0	GFPT2	179678498	1.000000	0.71417	1.000000	0.80357	0.810000	0.45777	5.965000	0.70387	2.545000	0.85829	0.555000	0.69702	GAT	GFPT2	-	tigrfam_GlmS_trans	ENSG00000131459		0.567	GFPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GFPT2	HGNC	protein_coding	OTTHUMT00000373444.4	-	0.00	38	0	C	NM_005110		179745892	-1	tier1	-	no_errors	ENST00000253778	ensembl	human	known	74_37	missense	10.87	41	5	SNP	1.000	G
GOLGA6L2	283685	genome.wustl.edu	37	15	23686304	23686304	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr15:23686304G>A	ENST00000567107.1	-	8	1370	c.1318C>T	c.(1318-1320)Cgg>Tgg	p.R440W	GOLGA6L2_ENST00000312015.5_Missense_Mutation_p.R440W|GOLGA6L2_ENST00000345070.5_Missense_Mutation_p.R167W			Q8N9W4	GG6L2_HUMAN	golgin A6 family-like 2	440	Glu-rich.							p.R440W(3)		breast(1)|endometrium(7)	8						tcctggtcccgcgtcttcttc	0.587																																																	3	Substitution - Missense(3)	endometrium(3)																																								SO:0001583	missense	0			AK093463		15q11.2	2012-10-05	2010-02-12		ENSG00000174450	ENSG00000174450			26695	protein-coding gene	gene with protein product	"""cancer/testis antigen 105"""		"""golgi autoantigen, golgin subfamily a, 6-like 2"""				Standard	XM_002343322		Approved	CT105, FLJ36144	uc021sfy.1	Q8N9W4	OTTHUMG00000176417	ENST00000567107.1:c.1318C>T	15.37:g.23686304G>A	ENSP00000454407:p.Arg440Trp		A1L301	Missense_Mutation	SNP	prints_Tropomyosin	p.R440W	ENST00000567107.1	37	c.1318		15	.	.	.	.	.	.	.	.	.	.	N	6.059	0.379198	0.11466	.	.	ENSG00000174450	ENST00000345070;ENST00000312015	T;T	0.51817	0.69;2.77	.	.	.	.	.	.	.	.	T	0.24812	0.0602	.	.	.	0.09310	N	1	P	0.39940	0.696	B	0.26094	0.066	T	0.08146	-1.0736	6	0.56958	D	0.05	.	.	.	.	.	440	Q8N9W4	GG6L2_HUMAN	W	167;440	ENSP00000344626:R167W;ENSP00000307928:R440W	ENSP00000307928:R440W	R	-	1	2	GOLGA6L2	21237397	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	-0.200000	0.09478	-0.893000	0.03930	0.000000	0.15137	CGG	GOLGA6L2	-	NULL	ENSG00000174450		0.587	GOLGA6L2-002	PUTATIVE	basic|appris_candidate_longest	protein_coding	GOLGA6L2	HGNC	protein_coding	OTTHUMT00000431937.1	-	0.00	66	0	G	NM_182561		23686304	-1	tier1	rs76463121	no_errors	ENST00000312015	ensembl	human	known	74_37	missense	47.14	36	33	SNP	0.001	A
GOLGA6L3	100133220	genome.wustl.edu	37	15	83013939	83013939	+	Missense_Mutation	SNP	A	A	C	rs368451235		TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr15:83013939A>C	ENST00000557886.1	-	6	743	c.644T>G	c.(643-645)cTa>cGa	p.L215R																	endometrium(6)|kidney(5)|prostate(1)	12						CTGTTCATGTAGCCTCTCCTC	0.542																																																	0																																										SO:0001583	missense	0																														ENST00000557886.1:c.644T>G	15.37:g.83013939A>C	ENSP00000452844:p.Leu215Arg			Missense_Mutation	SNP	NULL	p.L215R	ENST00000557886.1	37	c.644		15																																																																																			RP13-996F3.4	-	NULL	ENSG00000259243		0.542	RP13-996F3.4-001	PUTATIVE	basic|appris_principal	protein_coding	GOLGA6L3	Clone_based_vega_gene	protein_coding	OTTHUMT00000419277.1	-	0.00	15	0	A			83013939	-1	tier1	-	no_errors	ENST00000557886	ensembl	human	putative	74_37	missense	66.67	2	4	SNP	0.020	C
GPR125	166647	genome.wustl.edu	37	4	22517302	22517304	+	In_Frame_Del	DEL	CGC	CGC	-			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	CGC	CGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr4:22517302_22517304delCGC	ENST00000334304.5	-	1	373_375	c.104_106delGCG	c.(103-108)ggcgcc>gcc	p.G35del	GPR125_ENST00000502482.1_In_Frame_Del_p.G35del	NM_145290.3	NP_660333.2	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125	35					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(33)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	56		Breast(46;0.198)				agcgccgcggcgccgccgccgcc	0.808																																																	0																																										SO:0001651	inframe_deletion	0			AK095866	CCDS33964.1	4p15.31	2014-08-08			ENSG00000152990	ENSG00000152990		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"""	13839	protein-coding gene	gene with protein product		612303				12565841	Standard	NM_145290		Approved	FLJ38547, PGR21	uc003gqm.2	Q8IWK6	OTTHUMG00000160926	ENST00000334304.5:c.104_106delGCG	4.37:g.22517311_22517313delCGC	ENSP00000334952:p.Gly35del		Q6UXK9|Q86SQ5|Q8TC55	In_Frame_Del	DEL	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_GPCR_2_extracellular_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,pfscan_Ig-like_dom	p.G35in_frame_del	ENST00000334304.5	37	c.106_104	CCDS33964.1	4																																																																																			GPR125	-	NULL	ENSG00000152990		0.808	GPR125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR125	HGNC	protein_coding	OTTHUMT00000362960.3		0.00	38	0	CGC			22517304	-1	tier1		no_errors	ENST00000334304	ensembl	human	known	74_37	in_frame_del	9.38	29	3	DEL	0.040:0.037:0.033	-
GPR126	57211	genome.wustl.edu	37	6	142715055	142715055	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr6:142715055G>T	ENST00000230173.6	+	9	1860	c.1384G>T	c.(1384-1386)Gac>Tac	p.D462Y	GPR126_ENST00000367608.2_Missense_Mutation_p.D434Y|GPR126_ENST00000296932.8_Missense_Mutation_p.D434Y|GPR126_ENST00000367609.3_Missense_Mutation_p.D462Y	NM_020455.5	NP_065188	Q86SQ4	GP126_HUMAN	G protein-coupled receptor 126	462					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(12)|lung(10)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36	Breast(32;0.176)			OV - Ovarian serous cystadenocarcinoma(155;9.33e-06)|GBM - Glioblastoma multiforme(68;0.00121)		TGCTGGAGAGGACAAGATTAA	0.358																																																	0													114.0	103.0	106.0					6																	142715055		1843	4101	5944	SO:0001583	missense	0			AK027843	CCDS47489.1, CCDS47490.1, CCDS47491.1, CCDS55064.1	6q23.1-q24.3	2014-08-08			ENSG00000112414	ENSG00000112414		"""-"", ""GPCR / Class B : Orphans"""	13841	protein-coding gene	gene with protein product		612243				12565841	Standard	NM_001032395		Approved	FLJ14937	uc010khe.3	Q86SQ4	OTTHUMG00000015709	ENST00000230173.6:c.1384G>T	6.37:g.142715055G>T	ENSP00000230173:p.Asp462Tyr		Q5TGN7|Q6DHZ4|Q6F3F5|Q6F3F6|Q6F3F7|Q6F3F8|Q6MZU7|Q8IXA4|Q8NC14|Q96JW0	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_CUB_dom,pfam_GPS_dom,pfam_Pentaxin,superfamily_CUB_dom,superfamily_ConA-like_lec_gl_sf,smart_CUB_dom,smart_Pentaxin,smart_GPS_dom,pfscan_CUB_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.D462Y	ENST00000230173.6	37	c.1384	CCDS47490.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.6|20.6	4.011596|4.011596	0.75046|0.75046	.|.	.|.	ENSG00000112414|ENSG00000112414	ENST00000230173;ENST00000367608;ENST00000296932;ENST00000367609|ENST00000508295	T;T;T;T|.	0.63096|.	-0.02;-0.02;-0.02;-0.02|.	5.23|5.23	5.23|5.23	0.72850|0.72850	.|.	0.282732|.	0.30602|.	N|.	0.009267|.	T|T	0.52256|0.52256	0.1723|0.1723	L|L	0.47716|0.47716	1.5|1.5	0.35036|0.35036	D|D	0.759268|0.759268	B;D;B;P|.	0.53885|.	0.016;0.963;0.065;0.89|.	B;P;B;B|.	0.53809|.	0.019;0.735;0.031;0.223|.	T|T	0.52487|0.52487	-0.8569|-0.8569	10|5	0.72032|.	D|.	0.01|.	.|.	16.0869|16.0869	0.81060|0.81060	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	434;462;434;462|.	Q86SQ4-4;Q86SQ4-3;Q86SQ4-2;Q86SQ4|.	.;.;.;GP126_HUMAN|.	Y|S	462;434;434;462|36	ENSP00000230173:D462Y;ENSP00000356580:D434Y;ENSP00000296932:D434Y;ENSP00000356581:D462Y|.	ENSP00000230173:D462Y|.	D|R	+|+	1|3	0|2	GPR126|GPR126	142756748|142756748	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.865000|0.865000	0.49528|0.49528	4.643000|4.643000	0.61390|0.61390	2.587000|2.587000	0.87381|0.87381	0.591000|0.591000	0.81541|0.81541	GAC|AGG	GPR126	-	NULL	ENSG00000112414		0.358	GPR126-001	KNOWN	basic|CCDS	protein_coding	GPR126	HGNC	protein_coding	OTTHUMT00000042487.2	-	0.00	45	0	G			142715055	+1	tier1	-	no_errors	ENST00000367609	ensembl	human	known	74_37	missense	9.80	46	5	SNP	1.000	T
GPR126	57211	genome.wustl.edu	37	6	142715055	142715055	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr6:142715055G>T	ENST00000230173.6	+	9	1860	c.1384G>T	c.(1384-1386)Gac>Tac	p.D462Y	GPR126_ENST00000367608.2_Missense_Mutation_p.D434Y|GPR126_ENST00000296932.8_Missense_Mutation_p.D434Y|GPR126_ENST00000367609.3_Missense_Mutation_p.D462Y	NM_020455.5	NP_065188	Q86SQ4	GP126_HUMAN	G protein-coupled receptor 126	462					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(12)|lung(10)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36	Breast(32;0.176)			OV - Ovarian serous cystadenocarcinoma(155;9.33e-06)|GBM - Glioblastoma multiforme(68;0.00121)		TGCTGGAGAGGACAAGATTAA	0.358																																																	0													114.0	103.0	106.0					6																	142715055		1843	4101	5944	SO:0001583	missense	0			AK027843	CCDS47489.1, CCDS47490.1, CCDS47491.1, CCDS55064.1	6q23.1-q24.3	2014-08-08			ENSG00000112414	ENSG00000112414		"""-"", ""GPCR / Class B : Orphans"""	13841	protein-coding gene	gene with protein product		612243				12565841	Standard	NM_001032395		Approved	FLJ14937	uc010khe.3	Q86SQ4	OTTHUMG00000015709	ENST00000230173.6:c.1384G>T	6.37:g.142715055G>T	ENSP00000230173:p.Asp462Tyr		Q5TGN7|Q6DHZ4|Q6F3F5|Q6F3F6|Q6F3F7|Q6F3F8|Q6MZU7|Q8IXA4|Q8NC14|Q96JW0	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_CUB_dom,pfam_GPS_dom,pfam_Pentaxin,superfamily_CUB_dom,superfamily_ConA-like_lec_gl_sf,smart_CUB_dom,smart_Pentaxin,smart_GPS_dom,pfscan_CUB_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.D462Y	ENST00000230173.6	37	c.1384	CCDS47490.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.6|20.6	4.011596|4.011596	0.75046|0.75046	.|.	.|.	ENSG00000112414|ENSG00000112414	ENST00000230173;ENST00000367608;ENST00000296932;ENST00000367609|ENST00000508295	T;T;T;T|.	0.63096|.	-0.02;-0.02;-0.02;-0.02|.	5.23|5.23	5.23|5.23	0.72850|0.72850	.|.	0.282732|.	0.30602|.	N|.	0.009267|.	T|T	0.52256|0.52256	0.1723|0.1723	L|L	0.47716|0.47716	1.5|1.5	0.35036|0.35036	D|D	0.759268|0.759268	B;D;B;P|.	0.53885|.	0.016;0.963;0.065;0.89|.	B;P;B;B|.	0.53809|.	0.019;0.735;0.031;0.223|.	T|T	0.52487|0.52487	-0.8569|-0.8569	10|5	0.72032|.	D|.	0.01|.	.|.	16.0869|16.0869	0.81060|0.81060	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	434;462;434;462|.	Q86SQ4-4;Q86SQ4-3;Q86SQ4-2;Q86SQ4|.	.;.;.;GP126_HUMAN|.	Y|S	462;434;434;462|36	ENSP00000230173:D462Y;ENSP00000356580:D434Y;ENSP00000296932:D434Y;ENSP00000356581:D462Y|.	ENSP00000230173:D462Y|.	D|R	+|+	1|3	0|2	GPR126|GPR126	142756748|142756748	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.865000|0.865000	0.49528|0.49528	4.643000|4.643000	0.61390|0.61390	2.587000|2.587000	0.87381|0.87381	0.591000|0.591000	0.81541|0.81541	GAC|AGG	GPR126	-	NULL	ENSG00000112414		0.358	GPR126-001	KNOWN	basic|CCDS	protein_coding	GPR126	HGNC	protein_coding	OTTHUMT00000042487.2	-	0.00	68	0	G			142715055	+1	tier1	-	no_errors	ENST00000367609	ensembl	human	known	74_37	missense	9.80	46	5	SNP	1.000	T
GPRC5C	55890	genome.wustl.edu	37	17	72436045	72436045	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr17:72436045G>A	ENST00000481232.1	+	2	776	c.265G>A	c.(265-267)Gac>Aac	p.D89N	GPRC5C_ENST00000342648.5_Intron|GPRC5C_ENST00000392629.2_Missense_Mutation_p.D56N|GPRC5C_ENST00000392627.1_Missense_Mutation_p.D89N			Q9NQ84	GPC5C_HUMAN	G protein-coupled receptor, class C, group 5, member C	44					G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)|vesicle (GO:0031982)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|large_intestine(3)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	17						CAACCTGTGTGACCGCTCTGG	0.667																																																	0													64.0	60.0	61.0					17																	72436045		2203	4299	6502	SO:0001583	missense	0			AF207989	CCDS11699.1, CCDS42378.1	17q25	2014-01-30	2014-01-30		ENSG00000170412	ENSG00000170412		"""GPCR / Class C : Orphans"""	13309	protein-coding gene	gene with protein product		605949	"""G protein-coupled receptor, family C, group 5, member C"""			10945465	Standard	NM_022036		Approved	RAIG-3	uc002jkr.3	Q9NQ84	OTTHUMG00000067613	ENST00000481232.1:c.265G>A	17.37:g.72436045G>A	ENSP00000462147:p.Asp89Asn		B5BUN4|Q2NL85|Q9NZG5	Missense_Mutation	SNP	pfam_GPCR_3_C,pfscan_GPCR_3_C	p.D89N	ENST00000481232.1	37	c.265		17	.	.	.	.	.	.	.	.	.	.	G	16.04	3.009647	0.54361	.	.	ENSG00000170412	ENST00000392627;ENST00000342648;ENST00000392629;ENST00000392628	T	0.31247	1.5	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.58409	0.2120	M	0.74647	2.275	0.80722	D	1	D;D;D;D	0.89917	0.995;0.995;0.997;1.0	P;P;D;D	0.91635	0.788;0.788;0.935;0.999	T	0.60495	-0.7252	10	0.66056	D	0.02	-3.2719	18.5	0.90877	0.0:0.0:1.0:0.0	.	44;44;56;44	A8MXZ4;Q9NQ84;Q9NQ84-2;Q9BSP0	.;GPC5C_HUMAN;.;.	N	44;89;56;44	ENSP00000376405:D56N	ENSP00000340595:D89N	D	+	1	0	GPRC5C	69947640	1.000000	0.71417	1.000000	0.80357	0.822000	0.46500	4.674000	0.61612	2.616000	0.88540	0.561000	0.74099	GAC	GPRC5C	-	NULL	ENSG00000170412		0.667	GPRC5C-002	PUTATIVE	basic|exp_conf	protein_coding	GPRC5C	HGNC	protein_coding	OTTHUMT00000145095.2	-	0.00	17	0	G			72436045	+1	tier1	-	no_errors	ENST00000392627	ensembl	human	known	74_37	missense	17.40	280	59	SNP	1.000	A
GPRC5C	55890	genome.wustl.edu	37	17	72436912	72436913	+	Frame_Shift_Ins	INS	-	-	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr17:72436912_72436913insA	ENST00000392627.1	+	2	2258_2259	c.1132_1133insA	c.(1132-1134)ggtfs	p.G378fs	GPRC5C_ENST00000342648.5_Frame_Shift_Ins_p.G18fs|GPRC5C_ENST00000392629.2_Frame_Shift_Ins_p.G345fs|GPRC5C_ENST00000481232.1_Intron	NM_022036.2	NP_071319.2	Q9NQ84	GPC5C_HUMAN	G protein-coupled receptor, class C, group 5, member C	333					G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)|vesicle (GO:0031982)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|large_intestine(3)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	17						AGAGCAGAAGGGTCAGAGCATG	0.594																																																	0																																										SO:0001589	frameshift_variant	0			AF207989	CCDS11699.1, CCDS42378.1	17q25	2014-01-30	2014-01-30		ENSG00000170412	ENSG00000170412		"""GPCR / Class C : Orphans"""	13309	protein-coding gene	gene with protein product		605949	"""G protein-coupled receptor, family C, group 5, member C"""			10945465	Standard	NM_022036		Approved	RAIG-3	uc002jkr.3	Q9NQ84	OTTHUMG00000067613	Exception_encountered	17.37:g.72436912_72436913insA	ENSP00000376403:p.Gly378fs		B5BUN4|Q2NL85|Q9NZG5	Frame_Shift_Ins	INS	pfam_GPCR_3_C,pfscan_GPCR_3_C	p.G378fs	ENST00000392627.1	37	c.1132_1133	CCDS11699.1	17																																																																																			GPRC5C	-	NULL	ENSG00000170412		0.594	GPRC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRC5C	HGNC	protein_coding	OTTHUMT00000145094.2		0.00	13	0	0			72436913	+1			no_errors	ENST00000392627	ensembl	human	known	74_37	frame_shift_ins	7.17	285	22	INS	0.998:0.997	A
GRIA3	2892	genome.wustl.edu	37	X	122616852	122616852	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chrX:122616852G>A	ENST00000371251.1	+	15	2694	c.2642G>A	c.(2641-2643)aGa>aAa	p.R881K	GRIA3_ENST00000371256.5_Missense_Mutation_p.R881K|GRIA3_ENST00000542149.1_3'UTR|GRIA3_ENST00000264357.5_Missense_Mutation_p.R881K			P42263	GRIA3_HUMAN	glutamate receptor, ionotropic, AMPA 3	881					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)			breast(2)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|pancreas(2)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	57					Lithium(DB01356)	GCTACATACAGAGAAGGCTAC	0.418																																																	0													119.0	104.0	109.0					X																	122616852		2203	4300	6503	SO:0001583	missense	0			U10301	CCDS14604.1, CCDS14605.1, CCDS76017.1	Xq25	2012-08-29	2012-02-03		ENSG00000125675	ENSG00000125675		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4573	protein-coding gene	gene with protein product		305915	"""glutamate receptor, ionotrophic, AMPA 3"""	GLUR3		1319477, 10644433	Standard	NM_007325		Approved	GluA3, GLURC, MRX94	uc004etr.4	P42263	OTTHUMG00000022685	ENST00000371251.1:c.2642G>A	X.37:g.122616852G>A	ENSP00000360297:p.Arg881Lys		D3DTF1|Q4VXD5|Q4VXD6|Q9HDA0|Q9HDA1|Q9HDA2|Q9P0H1	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.R881K	ENST00000371251.1	37	c.2642	CCDS14604.1	X	.	.	.	.	.	.	.	.	.	.	G	11.36	1.616076	0.28801	.	.	ENSG00000125675	ENST00000264357;ENST00000371256;ENST00000371251	T;T;T	0.12774	2.66;2.65;2.66	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.26159	0.0638	L	0.43701	1.375	0.80722	D	1	P;P	0.47910	0.841;0.902	P;D	0.63033	0.815;0.91	T	0.01767	-1.1278	10	0.07030	T	0.85	.	17.8613	0.88781	0.0:0.0:1.0:0.0	.	881;881	P42263;P42263-2	GRIA3_HUMAN;.	K	881	ENSP00000264357:R881K;ENSP00000360302:R881K;ENSP00000360297:R881K	ENSP00000264357:R881K	R	+	2	0	GRIA3	122444533	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.829000	0.75314	2.436000	0.82500	0.600000	0.82982	AGA	GRIA3	-	NULL	ENSG00000125675		0.418	GRIA3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA3	HGNC	protein_coding	OTTHUMT00000058854.1	-	0.00	42	0	G	NM_000828		122616852	+1	tier1	-	no_errors	ENST00000264357	ensembl	human	known	74_37	missense	78.57	12	44	SNP	1.000	A
GSK3B	2932	genome.wustl.edu	37	3	119812226	119812226	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr3:119812226T>C	ENST00000264235.8	-	1	1038	c.56A>G	c.(55-57)cAg>cGg	p.Q19R	RP11-18H7.1_ENST00000469070.1_lincRNA|GSK3B_ENST00000316626.5_Missense_Mutation_p.Q19R	NM_001146156.1|NM_002093.3	NP_001139628.1|NP_002084.2	P49841	GSK3B_HUMAN	glycogen synthase kinase 3 beta	19					axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell migration (GO:0016477)|cellular response to interleukin-3 (GO:0036016)|cellular response to mechanical stimulus (GO:0071260)|circadian rhythm (GO:0007623)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial to mesenchymal transition (GO:0001837)|ER overload response (GO:0006983)|establishment of cell polarity (GO:0030010)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fat cell differentiation (GO:0045444)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glycogen metabolic process (GO:0005977)|hippocampus development (GO:0021766)|hypermethylation of CpG island (GO:0044027)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|myoblast fusion (GO:0007520)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of glycogen (starch) synthase activity (GO:2000466)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neuron maturation (GO:0014043)|negative regulation of neuron projection development (GO:0010977)|negative regulation of NFAT protein import into nucleus (GO:0051534)|negative regulation of protein binding (GO:0032091)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of type B pancreatic cell development (GO:2000077)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein binding (GO:0032092)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of stem cell differentiation (GO:2000738)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|protein localization to microtubule (GO:0035372)|protein phosphorylation (GO:0006468)|re-entry into mitotic cell cycle (GO:0000320)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of microtubule-based process (GO:0032886)|regulation of neuronal synaptic plasticity (GO:0048168)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|superior temporal gyrus development (GO:0071109)	beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|kinase activity (GO:0016301)|NF-kappaB binding (GO:0051059)|p53 binding (GO:0002039)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II transcription factor binding (GO:0001085)|tau-protein kinase activity (GO:0050321)|ubiquitin protein ligase binding (GO:0031625)			endometrium(1)|large_intestine(8)|lung(7)|prostate(2)	18				GBM - Glioblastoma multiforme(114;0.24)	Lithium(DB01356)	AGCTGAAGGCTGCTGCACCGG	0.488																																																	0													101.0	107.0	105.0					3																	119812226		2203	4300	6503	SO:0001583	missense	0			BC012760	CCDS2996.1, CCDS54628.1	3q13.3	2008-02-15			ENSG00000082701	ENSG00000082701			4617	protein-coding gene	gene with protein product		605004				10486203	Standard	NM_002093		Approved		uc003edm.3	P49841	OTTHUMG00000133765	ENST00000264235.8:c.56A>G	3.37:g.119812226T>C	ENSP00000264235:p.Gln19Arg		D3DN89|Q9BWH3|Q9UL47	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.Q19R	ENST00000264235.8	37	c.56	CCDS54628.1	3	.	.	.	.	.	.	.	.	.	.	T	4.985	0.182899	0.09495	.	.	ENSG00000082701	ENST00000264235;ENST00000316626	T;T	0.59502	0.26;0.3	4.65	4.65	0.58169	.	0.000000	0.85682	D	0.000000	T	0.36110	0.0955	N	0.14661	0.345	0.47276	D	0.999378	B;B	0.06786	0.0;0.001	B;B	0.06405	0.0;0.002	T	0.17349	-1.0372	10	0.09084	T	0.74	-5.6943	12.0184	0.53329	0.0:0.0:0.0:1.0	.	19;19	P49841;P49841-2	GSK3B_HUMAN;.	R	19	ENSP00000264235:Q19R;ENSP00000324806:Q19R	ENSP00000264235:Q19R	Q	-	2	0	GSK3B	121294916	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.427000	0.66483	1.721000	0.51461	0.450000	0.29827	CAG	GSK3B	-	NULL	ENSG00000082701		0.488	GSK3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSK3B	HGNC	protein_coding	OTTHUMT00000258240.2	-	0.00	29	0	T			119812226	-1	tier1	-	no_errors	ENST00000316626	ensembl	human	known	74_37	missense	21.57	40	11	SNP	1.000	C
GTF2IRD2P1	401375	genome.wustl.edu	37	7	72664015	72664016	+	RNA	INS	-	-	G	rs202030378|rs372212945	byFrequency	TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr7:72664015_72664016insG	ENST00000425256.1	-	0	884_885									GTF2I repeat domain containing 2 pseudogene 1																		ATACCACCCCCGGGGCATGCCA	0.505													GGGGG|GGGG|GGGGG|deletion	3786	0.75599	0.7247	0.8242	5008	,	,		6539	0.7212		0.8101	False		,,,				2504	0.7301																0																																												0			AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72664019_72664019dupG				RNA	INS	-	NULL	ENST00000425256.1	37	NULL		7																																																																																			GTF2IRD2P1	-	-	ENSG00000214544		0.505	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	GTF2IRD2P1	HGNC	pseudogene	OTTHUMT00000345921.1		0.00	13	0	-	NR_002164		72664016	-1	tier1		no_errors	ENST00000425256	ensembl	human	known	74_37	rna	23.08	10	3	INS	0.912:0.964	G
HCN1	348980	genome.wustl.edu	37	5	45262169	45262169	+	Nonsense_Mutation	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr5:45262169G>A	ENST00000303230.4	-	8	2584	c.2527C>T	c.(2527-2529)Cga>Tga	p.R843*		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	843					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						GACATCTGTCGGAAGAGGGTG	0.652																																																	0													43.0	50.0	48.0					5																	45262169		2203	4300	6503	SO:0001587	stop_gained	0			AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.2527C>T	5.37:g.45262169G>A	ENSP00000307342:p.Arg843*			Nonsense_Mutation	SNP	pfam_Ion_trans_N,pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG	p.R843*	ENST00000303230.4	37	c.2527	CCDS3952.1	5	.	.	.	.	.	.	.	.	.	.	g	37	6.571771	0.97671	.	.	ENSG00000164588	ENST00000303230	.	.	.	5.01	3.16	0.36331	.	0.000000	0.52532	D	0.000076	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.1728	0.65522	0.0:0.0:0.7336:0.2664	.	.	.	.	X	843	.	ENSP00000307342:R843X	R	-	1	2	HCN1	45297926	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.207000	0.58480	0.571000	0.29365	0.651000	0.88453	CGA	HCN1	-	NULL	ENSG00000164588		0.652	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCN1	HGNC	protein_coding	OTTHUMT00000253847.1	-	0.00	53	0	G	NM_021072		45262169	-1	tier1	-	no_errors	ENST00000303230	ensembl	human	known	74_37	nonsense	17.81	60	13	SNP	1.000	A
HIF1A	3091	genome.wustl.edu	37	14	62207581	62207581	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr14:62207581C>T	ENST00000337138.4	+	12	2033	c.1768C>T	c.(1768-1770)Cct>Tct	p.P590S	HIF1A_ENST00000557538.1_Missense_Mutation_p.P531S|HIF1A-AS2_ENST00000554254.1_lincRNA|HIF1A_ENST00000539097.1_Missense_Mutation_p.P614S|HIF1A_ENST00000394997.1_Missense_Mutation_p.P591S|HIF1A_ENST00000323441.6_Missense_Mutation_p.P590S|RP11-618G20.1_ENST00000555937.1_RNA	NM_001530.3	NP_001521.1	Q16665	HIF1A_HUMAN	hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)	590	ID.|ODD.				angiogenesis (GO:0001525)|axon transport of mitochondrion (GO:0019896)|B-1 B cell homeostasis (GO:0001922)|cardiac ventricle morphogenesis (GO:0003208)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cerebral cortex development (GO:0021987)|collagen metabolic process (GO:0032963)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|digestive tract morphogenesis (GO:0048546)|dopaminergic neuron differentiation (GO:0071542)|elastin metabolic process (GO:0051541)|embryonic hemopoiesis (GO:0035162)|embryonic placenta development (GO:0001892)|epithelial cell differentiation involved in mammary gland alveolus development (GO:0061030)|epithelial to mesenchymal transition (GO:0001837)|glucose homeostasis (GO:0042593)|heart looping (GO:0001947)|hemoglobin biosynthetic process (GO:0042541)|intestinal epithelial cell maturation (GO:0060574)|lactate metabolic process (GO:0006089)|lactation (GO:0007595)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of bone mineralization (GO:0030502)|negative regulation of growth (GO:0045926)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of thymocyte apoptotic process (GO:0070244)|negative regulation of TOR signaling (GO:0032007)|neural crest cell migration (GO:0001755)|neural fold elevation formation (GO:0021502)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|oxygen homeostasis (GO:0032364)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine production (GO:0032722)|positive regulation of chemokine-mediated signaling pathway (GO:0070101)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of glycolytic process (GO:0045821)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|vascular endothelial growth factor production (GO:0010573)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|Hsp90 protein binding (GO:0051879)|nuclear hormone receptor binding (GO:0035257)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|endometrium(8)|kidney(6)|large_intestine(3)|lung(4)	23				OV - Ovarian serous cystadenocarcinoma(108;1.62e-09)|BRCA - Breast invasive adenocarcinoma(234;0.189)	Carvedilol(DB01136)	TTCCGCAAGCCCTGAAAGCGC	0.458																																																	0													138.0	130.0	133.0					14																	62207581		2203	4300	6503	SO:0001583	missense	0			U22431	CCDS9753.1, CCDS9754.1, CCDS58324.1	14q23.2	2013-05-21	2008-12-02		ENSG00000100644	ENSG00000100644		"""Basic helix-loop-helix proteins"""	4910	protein-coding gene	gene with protein product		603348				8786149, 9079689	Standard	NM_001530		Approved	MOP1, HIF-1alpha, PASD8, HIF1, bHLHe78	uc001xfq.2	Q16665	OTTHUMG00000140344	ENST00000337138.4:c.1768C>T	14.37:g.62207581C>T	ENSP00000338018:p.Pro590Ser		C0LZJ3|Q53XP6|Q96PT9|Q9UPB1	Missense_Mutation	SNP	pfam_PAS_fold_3,pfam_HIF-1_TAD_C,pfam_HIF_alpha_subunit,pfam_PAS_fold,superfamily_PAS,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,smart_PAC,prints_HIF-1_alpha,pfscan_PAS,pfscan_bHLH_dom,tigrfam_PAS	p.P614S	ENST00000337138.4	37	c.1840	CCDS9753.1	14	.	.	.	.	.	.	.	.	.	.	C	13.64	2.298511	0.40694	.	.	ENSG00000100644	ENST00000539494;ENST00000394988;ENST00000337138;ENST00000394997;ENST00000323441;ENST00000557538;ENST00000539097	T;T;T;T;T	0.51817	0.69;0.69;0.69;0.69;0.69	5.39	4.49	0.54785	.	0.356387	0.31884	N	0.006918	T	0.33556	0.0867	L	0.29908	0.895	0.43564	D	0.995887	B;B;B	0.12013	0.002;0.005;0.005	B;B;B	0.12156	0.004;0.007;0.007	T	0.08638	-1.0712	10	0.16420	T	0.52	.	12.6752	0.56891	0.0:0.8727:0.0:0.1273	.	591;590;590	A8MYV6;D0VY79;Q16665	.;.;HIF1A_HUMAN	S	341;531;590;591;590;531;614	ENSP00000338018:P590S;ENSP00000378446:P591S;ENSP00000323326:P590S;ENSP00000451696:P531S;ENSP00000437955:P614S	ENSP00000323326:P590S	P	+	1	0	HIF1A	61277334	0.988000	0.35896	1.000000	0.80357	0.904000	0.53231	1.544000	0.36158	2.682000	0.91365	0.650000	0.86243	CCT	HIF1A	-	NULL	ENSG00000100644		0.458	HIF1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HIF1A	HGNC	protein_coding	OTTHUMT00000276977.2	-	0.00	61	0	C	NM_001530		62207581	+1	tier1	-	no_errors	ENST00000539097	ensembl	human	known	74_37	missense	21.62	58	16	SNP	1.000	T
HIST1H1E	3008	genome.wustl.edu	37	6	26156678	26156680	+	In_Frame_Del	DEL	GAA	GAA	-	rs545095988	byFrequency	TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	GAA	GAA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr6:26156678_26156680delGAA	ENST00000304218.3	+	1	120_122	c.60_62delGAA	c.(58-63)gtgaag>gtg	p.K23del	HIST1H2BD_ENST00000289316.2_5'Flank|HIST1H2BD_ENST00000377777.4_5'Flank	NM_005321.2	NP_005312.1	P10412	H14_HUMAN	histone cluster 1, H1e	23					nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	26						AGACTCCCGTGAAGAAGAAGGCC	0.65														3	0.000599042	0.0	0.0043	5008	,	,		14947	0.0		0.0	False		,,,				2504	0.0																0										3,4135		0,3,2066						4.3	1.0			45	0,8162		0,0,4081	no	coding	HIST1H1E	NM_005321.2		0,3,6147	A1A1,A1R,RR		0.0,0.0725,0.0244				3,12297				SO:0001651	inframe_deletion	0			M60748	CCDS4586.1	6p22.1	2012-05-04	2006-10-11	2003-02-21	ENSG00000168298	ENSG00000168298		"""Histones / Replication-dependent"""	4718	protein-coding gene	gene with protein product		142220	"""H1 histone family, member 4"", ""histone 1, H1e"""	H1F4		1916825, 12408966	Standard	NM_005321		Approved	H1.4, H1e, H1s-4	uc003ngq.3	P10412	OTTHUMG00000014422	ENST00000304218.3:c.60_62delGAA	6.37:g.26156684_26156686delGAA	ENSP00000307705:p.Lys23del		Q4VB25	In_Frame_Del	DEL	pfam_Histone_H1/H5_H15,smart_Histone_H1/H5_H15,prints_Histone_H5	p.K23in_frame_del	ENST00000304218.3	37	c.60_62	CCDS4586.1	6																																																																																			HIST1H1E	-	prints_Histone_H5	ENSG00000168298		0.650	HIST1H1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H1E	HGNC	protein_coding	OTTHUMT00000040084.1		0.00	38	0	GAA	NM_005321		26156680	+1	tier1		no_errors	ENST00000304218	ensembl	human	known	74_37	in_frame_del	17.46	52	11	DEL	0.932:0.994:0.999	-
HIST1H3F	8968	genome.wustl.edu	37	6	26250430	26250431	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	CT	CT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr6:26250430_26250431delCT	ENST00000446824.2	-	1	404_405	c.403_404delAG	c.(403-405)aggfs	p.R135fs	HIST1H2BH_ENST00000356350.2_5'Flank	NM_021018.2	NP_066298.1	P68431	H31_HUMAN	histone cluster 1, H3f	135				Missing (in Ref. 2; AAA52651). {ECO:0000305}.	blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			lung(6)|urinary_tract(1)	7						AACTTATGCCCTCTCTCCGCGA	0.535											OREG0017241	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001589	frameshift_variant	0			Z80786	CCDS4600.1	6p22.1	2011-01-27	2006-10-11	2003-03-14	ENSG00000256316	ENSG00000277775		"""Histones / Replication-dependent"""	4773	protein-coding gene	gene with protein product		602816	"""H3 histone family, member I"", ""histone 1, H3f"""	H3FI		9119399, 12408966	Standard	NM_021018		Approved	H3/i	uc003nhg.1	P68431	OTTHUMG00000014435	ENST00000446824.2:c.403_404delAG	6.37:g.26250434_26250435delCT	ENSP00000444823:p.Arg135fs	785	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Frame_Shift_Del	DEL	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.R135fs	ENST00000446824.2	37	c.404_403	CCDS4600.1	6																																																																																			HIST1H3F	-	superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	ENSG00000256316		0.535	HIST1H3F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H3F	HGNC	protein_coding	OTTHUMT00000040098.1		0.00	50	0	CT	NM_021018		26250431	-1	tier1		no_errors	ENST00000446824	ensembl	human	known	74_37	frame_shift_del	38.89	33	21	DEL	0.994:0.813	-
HIST1H4K	8362	genome.wustl.edu	37	6	27798995	27798995	+	Nonstop_Mutation	SNP	C	C	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr6:27798995C>G	ENST00000357549.2	-	1	310	c.311G>C	c.(310-312)tGa>tCa	p.*104S		NM_003541.2	NP_003532.1	P62805	H4_HUMAN	histone cluster 1, H4k	0					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|lung(3)|ovary(1)|prostate(1)	7						AAGGGACGCTCAACCACCGAA	0.552																																																	0													37.0	40.0	39.0					6																	27798995		2203	4300	6503	SO:0001578	stop_lost	0			X60483	CCDS4631.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197914	ENSG00000273542		"""Histones / Replication-dependent"""	4784	protein-coding gene	gene with protein product		602825	"""H4 histone family, member D"", ""histone 1, H4k"""	H4FD		9439656, 12408966	Standard	NM_003541		Approved	H4/d, H4F2iii, dJ160A22.1	uc003njr.3	P62805	OTTHUMG00000014488	ENST00000357549.2:c.311G>C	6.37:g.27798995C>G			A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Nonstop_Mutation	SNP	pfam_Histone_core_D,pfam_TAF_TATA-bd,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4	p.*104S	ENST00000357549.2	37	c.311	CCDS4631.1	6	.	.	.	.	.	.	.	.	.	.	.	1.798	-0.477920	0.04414	.	.	ENSG00000197914	ENST00000357549	.	.	.	4.26	-6.96	0.01622	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7158	0.77667	0.0:0.3071:0.0:0.6929	.	.	.	.	S	104	.	.	X	-	2	2	HIST1H4K	27906974	0.850000	0.29656	0.000000	0.03702	0.000000	0.00434	0.033000	0.13754	-2.164000	0.00782	-1.851000	0.00568	TGA	HIST1H4K	-	NULL	ENSG00000197914		0.552	HIST1H4K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H4K	HGNC	protein_coding	OTTHUMT00000040156.1	-	0.00	50	0	C	NM_003541		27798995	-1	tier1	-	no_errors	ENST00000357549	ensembl	human	known	74_37	nonstop	20.51	31	8	SNP	0.004	G
HNRNPKP3	399881	genome.wustl.edu	37	11	43283411	43283412	+	RNA	INS	-	-	C			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr11:43283411_43283412insC	ENST00000511537.1	-	0	1523_1524					NR_033868.1				heterogeneous nuclear ribonucleoprotein K pseudogene 3																		CAATGAACACAAAAAAAAATCC	0.381																																																	0																																												0					11p12	2011-07-05				ENSG00000251557			42376	pseudogene	pseudogene							Standard	NR_033868		Approved		uc001mxe.2				11.37:g.43283411_43283412insC				RNA	INS	-	NULL	ENST00000511537.1	37	NULL		11																																																																																			HNRNPKP3	-	-	ENSG00000251557		0.381	HNRNPKP3-003	KNOWN	basic	processed_transcript	HNRNPKP3	HGNC	pseudogene	OTTHUMT00000390385.1		0.00	19	0	-	NR_033868		43283412	-1	tier1		no_errors	ENST00000511537	ensembl	human	known	74_37	rna	30.77	9	4	INS	0.923:0.935	C
HSPB9	94086	genome.wustl.edu	37	17	40275105	40275105	+	Silent	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr17:40275105G>A	ENST00000355067.3	+	1	350	c.237G>A	c.(235-237)gtG>gtA	p.V79V	CTD-2132N18.3_ENST00000592574.1_Intron|KAT2A_ENST00000225916.5_5'Flank	NM_033194.2	NP_149971.1	Q9BQS6	HSPB9_HUMAN	heat shock protein, alpha-crystallin-related, B9	79					response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)	4		all_cancers(22;0.00064)|Breast(137;0.00104)|all_epithelial(22;0.00866)		BRCA - Breast invasive adenocarcinoma(366;0.124)		GGCTGATGGTGACCGGACAGC	0.582																																																	0													118.0	104.0	109.0					17																	40275105		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ302068	CCDS11418.1	17q21	2011-09-02			ENSG00000197723	ENSG00000260325		"""Heat shock proteins / HSPB"""	30589	protein-coding gene	gene with protein product	"""cancer/testis antigen 51"""	608344				11470154, 12820654	Standard	NM_033194		Approved	CT51	uc002hyy.2	Q9BQS6	OTTHUMG00000133500	ENST00000355067.3:c.237G>A	17.37:g.40275105G>A			B3KSG6|Q52LB4	Silent	SNP	pfam_a-crystallin/Hsp20_dom,superfamily_HSP20-like_chaperone,pfscan_a-crystallin/Hsp20_dom	p.V79	ENST00000355067.3	37	c.237	CCDS11418.1	17																																																																																			HSPB9	-	pfam_a-crystallin/Hsp20_dom,superfamily_HSP20-like_chaperone,pfscan_a-crystallin/Hsp20_dom	ENSG00000197723		0.582	HSPB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPB9	HGNC	protein_coding	OTTHUMT00000257438.1	-	0.00	44	0	G	NM_033194		40275105	+1	tier1	-	no_errors	ENST00000355067	ensembl	human	known	74_37	silent	80.55	71	294	SNP	1.000	A
HUS1B	135458	genome.wustl.edu	37	6	656675	656675	+	Silent	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr6:656675C>T	ENST00000380907.2	-	1	288	c.270G>A	c.(268-270)gcG>gcA	p.A90A	EXOC2_ENST00000230449.4_Intron|EXOC2_ENST00000448181.3_Intron	NM_148959.3	NP_683762.2	Q8NHY5	HUS1B_HUMAN	HUS1 checkpoint homolog b (S. pombe)	90					DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)	checkpoint clamp complex (GO:0030896)|nucleolus (GO:0005730)				endometrium(3)|large_intestine(1)|lung(7)	11	Ovarian(93;0.0733)	Breast(5;0.00139)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.041)|BRCA - Breast invasive adenocarcinoma(62;0.0965)		CGCTTCTCGCCGCCCGGGACA	0.687																																																	0													14.0	15.0	15.0					6																	656675		2185	4276	6461	SO:0001819	synonymous_variant	0			AF508547	CCDS4470.1	6p25.3	2008-08-08	2001-11-28		ENSG00000188996	ENSG00000188996			16485	protein-coding gene	gene with protein product		609713	"""HUS1 (S. pombe) checkpoint homolog b"""			11944979	Standard	NM_148959		Approved		uc003mtg.3	Q8NHY5	OTTHUMG00000090059	ENST00000380907.2:c.270G>A	6.37:g.656675C>T			Q5T4Z2	Silent	SNP	pfam_Hus1/Mec3,pirsf_Cell_cycle_HUS1	p.A90	ENST00000380907.2	37	c.270	CCDS4470.1	6																																																																																			HUS1B	-	pfam_Hus1/Mec3,pirsf_Cell_cycle_HUS1	ENSG00000188996		0.687	HUS1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUS1B	HGNC	protein_coding	OTTHUMT00000205617.2	-	0.00	13	0	C	NM_148959		656675	-1	tier1	-	no_errors	ENST00000380907	ensembl	human	known	74_37	silent	26.67	11	4	SNP	0.005	T
HYDIN	54768	genome.wustl.edu	37	16	71009107	71009107	+	Silent	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr16:71009107C>T	ENST00000393567.2	-	31	4854	c.4704G>A	c.(4702-4704)caG>caA	p.Q1568Q		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	1568					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				TGGTTGTTTTCTGATGTTCTA	0.488																																																	0													1.0	1.0	1.0					16																	71009107		1116	2421	3537	SO:0001819	synonymous_variant	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.4704G>A	16.37:g.71009107C>T			A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Silent	SNP	superfamily_P-loop_NTPase,superfamily_PapD-like	p.Q1568	ENST00000393567.2	37	c.4704	CCDS59269.1	16																																																																																			HYDIN	-	NULL	ENSG00000157423		0.488	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	-	0.00	23	0	C			71009107	-1	tier1	-	no_errors	ENST00000393567	ensembl	human	putative	74_37	silent	35.00	13	7	SNP	0.139	T
HYDIN	54768	genome.wustl.edu	37	16	71009107	71009107	+	Silent	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr16:71009107C>T	ENST00000393567.2	-	31	4854	c.4704G>A	c.(4702-4704)caG>caA	p.Q1568Q		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	1568					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				TGGTTGTTTTCTGATGTTCTA	0.488																																																	0													1.0	1.0	1.0					16																	71009107		1116	2421	3537	SO:0001819	synonymous_variant	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.4704G>A	16.37:g.71009107C>T			A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Silent	SNP	superfamily_P-loop_NTPase,superfamily_PapD-like	p.Q1568	ENST00000393567.2	37	c.4704	CCDS59269.1	16																																																																																			HYDIN	-	NULL	ENSG00000157423		0.488	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	-	0.00	28	0	C			71009107	-1	tier1	-	no_errors	ENST00000393567	ensembl	human	putative	74_37	silent	35.00	13	7	SNP	0.139	T
HYOU1	10525	genome.wustl.edu	37	11	118918983	118918983	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr11:118918983C>T	ENST00000404233.3	-	20	2477	c.2353G>A	c.(2353-2355)Gag>Aag	p.E785K	HYOU1_ENST00000525859.1_Missense_Mutation_p.E723K|RP11-110I1.6_ENST00000531886.1_RNA|HYOU1_ENST00000529972.1_Missense_Mutation_p.E723K	NM_001130991.1|NM_006389.3	NP_001124463.1|NP_006380.1	Q9Y4L1	HYOU1_HUMAN	hypoxia up-regulated 1	785					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|response to ischemia (GO:0002931)|response to stress (GO:0006950)	endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(10)|prostate(1)|skin(2)	33	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.78e-05)		CCAACACCCTCATCCTCCAGC	0.612																																																	0													82.0	81.0	81.0					11																	118918983		2200	4295	6495	SO:0001583	missense	0			U65785	CCDS8408.1	11q23.1-q23.3	2011-09-02			ENSG00000149428	ENSG00000149428		"""Heat shock proteins / HSP70"""	16931	protein-coding gene	gene with protein product	"""glucose-regulated protein 170"""	601746				9020069, 10037731	Standard	XM_005271390		Approved	ORP150, HSP12A, Grp170	uc001pux.3	Q9Y4L1	OTTHUMG00000166354	ENST00000404233.3:c.2353G>A	11.37:g.118918983C>T	ENSP00000384144:p.Glu785Lys		A8C1Z0|B7Z909|Q2I204|Q53H25	Missense_Mutation	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.E785K	ENST00000404233.3	37	c.2353	CCDS8408.1	11	.	.	.	.	.	.	.	.	.	.	C	35	5.534057	0.96460	.	.	ENSG00000149428	ENST00000404233;ENST00000353883;ENST00000529972;ENST00000535579;ENST00000525859;ENST00000544701	T;T;T	0.14391	2.51;2.51;2.51	5.54	5.54	0.83059	.	0.111023	0.64402	D	0.000009	T	0.34513	0.0900	M	0.82823	2.61	0.80722	D	1	P;B;P;P	0.44429	0.739;0.183;0.835;0.835	B;B;P;P	0.50378	0.403;0.089;0.639;0.639	T	0.03933	-1.0991	10	0.52906	T	0.07	-27.1175	19.2714	0.94011	0.0:1.0:0.0:0.0	.	776;767;785;785	B3KXH0;B7Z2N4;Q9Y4L1;A8C1Z0	.;.;HYOU1_HUMAN;.	K	785;776;723;634;723;766	ENSP00000384144:E785K;ENSP00000437313:E723K;ENSP00000433397:E723K	ENSP00000278752:E776K	E	-	1	0	HYOU1	118424193	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	6.549000	0.73900	2.884000	0.98904	0.655000	0.94253	GAG	HYOU1	-	pfam_Hsp_70_fam	ENSG00000149428		0.612	HYOU1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	HYOU1	HGNC	protein_coding	OTTHUMT00000389353.1		0.00	13	0	C	NM_006389		118918983	-1			no_errors	ENST00000404233	ensembl	human	known	74_37	missense	8.82	31	3	SNP	1.000	T
IGSF3	3321	genome.wustl.edu	37	1	117156561	117156561	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:117156561G>A	ENST00000369486.3	-	4	1423	c.658C>T	c.(658-660)Cgg>Tgg	p.R220W	IGSF3_ENST00000369483.1_Missense_Mutation_p.R220W|IGSF3_ENST00000318837.6_Missense_Mutation_p.R220W	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	220	Ig-like C2-type 2.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		TTGTCCAGCCGCACCTCCCCC	0.612																																																	0													34.0	35.0	35.0					1																	117156561		2202	4299	6501	SO:0001583	missense	0			AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.658C>T	1.37:g.117156561G>A	ENSP00000358498:p.Arg220Trp		A6NJZ6|A6NMC7	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.R220W	ENST00000369486.3	37	c.658	CCDS30813.1	1	.	.	.	.	.	.	.	.	.	.	G	18.05	3.537991	0.65085	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.22945	1.93;1.93;1.93	4.77	4.77	0.60923	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.062472	0.64402	D	0.000008	T	0.39733	0.1089	M	0.76727	2.345	0.53688	D	0.999977	D;D	0.89917	1.0;1.0	D;D	0.80764	0.992;0.994	T	0.32481	-0.9905	10	0.87932	D	0	-49.6278	10.3864	0.44143	0.0:0.0:0.8047:0.1953	.	220;220	O75054;A6NJZ6	IGSF3_HUMAN;.	W	220	ENSP00000358498:R220W;ENSP00000358495:R220W;ENSP00000321184:R220W	ENSP00000321184:R220W	R	-	1	2	IGSF3	116958084	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.869000	0.56062	2.470000	0.83445	0.557000	0.71058	CGG	IGSF3	-	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	ENSG00000143061		0.612	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGSF3	HGNC	protein_coding	OTTHUMT00000059040.1	-	0.00	56	0	G	NM_001542		117156561	-1	tier1	-	no_errors	ENST00000318837	ensembl	human	known	74_37	missense	23.81	48	15	SNP	0.999	A
IGSF3	3321	genome.wustl.edu	37	1	117156561	117156561	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:117156561G>A	ENST00000369486.3	-	4	1423	c.658C>T	c.(658-660)Cgg>Tgg	p.R220W	IGSF3_ENST00000369483.1_Missense_Mutation_p.R220W|IGSF3_ENST00000318837.6_Missense_Mutation_p.R220W	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	220	Ig-like C2-type 2.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		TTGTCCAGCCGCACCTCCCCC	0.612																																																	0													34.0	35.0	35.0					1																	117156561		2202	4299	6501	SO:0001583	missense	0			AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.658C>T	1.37:g.117156561G>A	ENSP00000358498:p.Arg220Trp		A6NJZ6|A6NMC7	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.R220W	ENST00000369486.3	37	c.658	CCDS30813.1	1	.	.	.	.	.	.	.	.	.	.	G	18.05	3.537991	0.65085	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.22945	1.93;1.93;1.93	4.77	4.77	0.60923	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.062472	0.64402	D	0.000008	T	0.39733	0.1089	M	0.76727	2.345	0.53688	D	0.999977	D;D	0.89917	1.0;1.0	D;D	0.80764	0.992;0.994	T	0.32481	-0.9905	10	0.87932	D	0	-49.6278	10.3864	0.44143	0.0:0.0:0.8047:0.1953	.	220;220	O75054;A6NJZ6	IGSF3_HUMAN;.	W	220	ENSP00000358498:R220W;ENSP00000358495:R220W;ENSP00000321184:R220W	ENSP00000321184:R220W	R	-	1	2	IGSF3	116958084	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.869000	0.56062	2.470000	0.83445	0.557000	0.71058	CGG	IGSF3	-	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	ENSG00000143061		0.612	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGSF3	HGNC	protein_coding	OTTHUMT00000059040.1	-	0.00	76	0	G	NM_001542		117156561	-1	tier1	-	no_errors	ENST00000318837	ensembl	human	known	74_37	missense	23.81	48	15	SNP	0.999	A
IPO8	10526	genome.wustl.edu	37	12	30805929	30805929	+	Silent	SNP	A	A	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr12:30805929A>G	ENST00000256079.4	-	18	2384	c.2046T>C	c.(2044-2046)ttT>ttC	p.F682F	IPO8_ENST00000544829.1_Silent_p.F477F	NM_006390.3	NP_006381.2	O15397	IPO8_HUMAN	importin 8	682					intracellular protein transport (GO:0006886)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	Ran GTPase binding (GO:0008536)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(16)|liver(1)|lung(22)|prostate(2)|skin(2)|urinary_tract(2)	52	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					AATCCTGCTGAAACACTTCAT	0.363																																																	0													67.0	71.0	70.0					12																	30805929		2202	4300	6502	SO:0001819	synonymous_variant	0			U77494	CCDS8719.1, CCDS53773.1	12p11.21	2011-05-23	2003-03-11	2003-03-14	ENSG00000133704	ENSG00000133704		"""Importins"""	9853	protein-coding gene	gene with protein product		605600	"""RAN binding protein 8"""	RANBP8		9214382	Standard	NM_006390		Approved	IMP8	uc001rjd.3	O15397	OTTHUMG00000169172	ENST00000256079.4:c.2046T>C	12.37:g.30805929A>G			B7Z7M3	Silent	SNP	pfam_Importin-beta_N,pfam_Cse1,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.F682	ENST00000256079.4	37	c.2046	CCDS8719.1	12																																																																																			IPO8	-	superfamily_ARM-type_fold	ENSG00000133704		0.363	IPO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO8	HGNC	protein_coding	OTTHUMT00000402700.2	-	0.00	120	0	A	NM_006390		30805929	-1	tier1	-	no_errors	ENST00000256079	ensembl	human	known	74_37	silent	12.37	85	12	SNP	1.000	G
IPO8	10526	genome.wustl.edu	37	12	30805929	30805929	+	Silent	SNP	A	A	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr12:30805929A>G	ENST00000256079.4	-	18	2384	c.2046T>C	c.(2044-2046)ttT>ttC	p.F682F	IPO8_ENST00000544829.1_Silent_p.F477F	NM_006390.3	NP_006381.2	O15397	IPO8_HUMAN	importin 8	682					intracellular protein transport (GO:0006886)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	Ran GTPase binding (GO:0008536)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(16)|liver(1)|lung(22)|prostate(2)|skin(2)|urinary_tract(2)	52	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					AATCCTGCTGAAACACTTCAT	0.363																																																	0													67.0	71.0	70.0					12																	30805929		2202	4300	6502	SO:0001819	synonymous_variant	0			U77494	CCDS8719.1, CCDS53773.1	12p11.21	2011-05-23	2003-03-11	2003-03-14	ENSG00000133704	ENSG00000133704		"""Importins"""	9853	protein-coding gene	gene with protein product		605600	"""RAN binding protein 8"""	RANBP8		9214382	Standard	NM_006390		Approved	IMP8	uc001rjd.3	O15397	OTTHUMG00000169172	ENST00000256079.4:c.2046T>C	12.37:g.30805929A>G			B7Z7M3	Silent	SNP	pfam_Importin-beta_N,pfam_Cse1,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.F682	ENST00000256079.4	37	c.2046	CCDS8719.1	12																																																																																			IPO8	-	superfamily_ARM-type_fold	ENSG00000133704		0.363	IPO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO8	HGNC	protein_coding	OTTHUMT00000402700.2	-	0.00	89	0	A	NM_006390		30805929	-1	tier1	-	no_errors	ENST00000256079	ensembl	human	known	74_37	silent	12.37	85	12	SNP	1.000	G
IRF4	3662	genome.wustl.edu	37	6	393167	393167	+	Silent	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr6:393167C>T	ENST00000380956.4	+	2	141	c.15C>T	c.(13-15)ggC>ggT	p.G5G	IRF4_ENST00000495137.1_Intron	NM_001195286.1|NM_002460.3	NP_001182215.1|NP_002451.2	Q15306	IRF4_HUMAN	interferon regulatory factor 4	5					cytokine-mediated signaling pathway (GO:0019221)|defense response to protozoan (GO:0042832)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of DNA binding (GO:0043388)|positive regulation of interleukin-10 biosynthetic process (GO:0045082)|positive regulation of interleukin-13 biosynthetic process (GO:0045368)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 biosynthetic process (GO:0045404)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of T-helper cell differentiation (GO:0045622)|T cell activation (GO:0042110)|T-helper 17 cell lineage commitment (GO:0072540)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear nucleosome (GO:0000788)|nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Breast(5;0.0155)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.03)|BRCA - Breast invasive adenocarcinoma(62;0.0702)		ACCTGGAGGGCGGCGGCCGAG	0.721			T	IGH@	MM																																			Dom	yes		6	6p25-p23	3662	interferon regulatory factor 4		L	0													14.0	19.0	17.0					6																	393167		2081	4089	6170	SO:0001819	synonymous_variant	0			U52682	CCDS4469.1	6p25-p23	2008-08-29			ENSG00000137265	ENSG00000137265			6119	protein-coding gene	gene with protein product		601900		MUM1		8921401, 18417578	Standard	NM_002460		Approved	LSIRF	uc003msz.4	Q15306	OTTHUMG00000016294	ENST00000380956.4:c.15C>T	6.37:g.393167C>T			Q5VUI7|Q99660	Silent	SNP	pfam_Interferon_reg_factor-3,pfam_Interferon_reg_fact_DNA-bd_dom,superfamily_SMAD_FHA_domain,smart_Interferon_reg_fact_DNA-bd_dom,prints_Interferon_reg_fact_DNA-bd_dom	p.G5	ENST00000380956.4	37	c.15	CCDS4469.1	6																																																																																			IRF4	-	NULL	ENSG00000137265		0.721	IRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRF4	HGNC	protein_coding	OTTHUMT00000043638.1	-	0.00	15	0	C			393167	+1	tier1	-	no_errors	ENST00000380956	ensembl	human	known	74_37	silent	35.00	13	7	SNP	0.106	T
IVNS1ABP	10625	genome.wustl.edu	37	1	185269606	185269606	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:185269606C>T	ENST00000367498.3	-	11	1827	c.1205G>A	c.(1204-1206)aGa>aAa	p.R402K	IVNS1ABP_ENST00000392007.3_Missense_Mutation_p.R184K|IVNS1ABP_ENST00000459929.1_5'UTR	NM_006469.4	NP_006460.2	Q9Y6Y0	NS1BP_HUMAN	influenza virus NS1A binding protein	402					negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|response to virus (GO:0009615)|RNA splicing (GO:0008380)|transcription from RNA polymerase III promoter (GO:0006383)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|spliceosomal complex (GO:0005681)|transcription factor complex (GO:0005667)				breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|ovary(4)|prostate(2)	29						TCTTGGTGTTCTCATGGGAGC	0.423																																																	0													127.0	131.0	130.0					1																	185269606		2203	4300	6503	SO:0001583	missense	0			AB020657	CCDS1368.1	1q25.1-q31.1	2013-01-30			ENSG00000116679	ENSG00000116679		"""Kelch-like"", ""BTB/POZ domain containing"""	16951	protein-coding gene	gene with protein product	"""kelch-like family member 39"""	609209				9696811, 10048485	Standard	NM_006469		Approved	NS1-BP, HSPC068, NS-1, KIAA0850, ND1, KLHL39	uc001grl.3	Q9Y6Y0	OTTHUMG00000035384	ENST00000367498.3:c.1205G>A	1.37:g.185269606C>T	ENSP00000356468:p.Arg402Lys		A8K8R6|Q1G4T6|Q1G4T7|Q5TF75|Q6NW38|Q7LCG2|Q9NZX0|Q9Y480	Missense_Mutation	SNP	pfam_Kelch_1,pfam_Kelch_2,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.R402K	ENST00000367498.3	37	c.1205	CCDS1368.1	1	.	.	.	.	.	.	.	.	.	.	c	9.516	1.107033	0.20714	.	.	ENSG00000116679	ENST00000367498;ENST00000392007	T;T	0.66099	-0.19;-0.19	5.76	4.86	0.63082	Galactose oxidase, beta-propeller (1);	0.097545	0.64402	D	0.000003	T	0.41789	0.1174	N	0.11756	0.17	0.45056	D	0.998072	B;B;B	0.19200	0.034;0.003;0.007	B;B;B	0.18561	0.022;0.003;0.022	T	0.26503	-1.0101	10	0.31617	T	0.26	.	9.7775	0.40628	0.1414:0.7897:0.0:0.069	.	184;103;402	A8MVR0;Q6MZF3;Q9Y6Y0	.;.;NS1BP_HUMAN	K	402;184	ENSP00000356468:R402K;ENSP00000375864:R184K	ENSP00000356468:R402K	R	-	2	0	IVNS1ABP	183536229	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.859000	0.62954	1.442000	0.47568	-0.121000	0.15023	AGA	IVNS1ABP	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000116679		0.423	IVNS1ABP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IVNS1ABP	HGNC	protein_coding	OTTHUMT00000085774.1	-	0.00	64	0	C	NM_006469		185269606	-1	tier1	-	no_errors	ENST00000367498	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	T
IVNS1ABP	10625	genome.wustl.edu	37	1	185269606	185269606	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:185269606C>T	ENST00000367498.3	-	11	1827	c.1205G>A	c.(1204-1206)aGa>aAa	p.R402K	IVNS1ABP_ENST00000392007.3_Missense_Mutation_p.R184K|IVNS1ABP_ENST00000459929.1_5'UTR	NM_006469.4	NP_006460.2	Q9Y6Y0	NS1BP_HUMAN	influenza virus NS1A binding protein	402					negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|response to virus (GO:0009615)|RNA splicing (GO:0008380)|transcription from RNA polymerase III promoter (GO:0006383)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|spliceosomal complex (GO:0005681)|transcription factor complex (GO:0005667)				breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|ovary(4)|prostate(2)	29						TCTTGGTGTTCTCATGGGAGC	0.423																																																	0													127.0	131.0	130.0					1																	185269606		2203	4300	6503	SO:0001583	missense	0			AB020657	CCDS1368.1	1q25.1-q31.1	2013-01-30			ENSG00000116679	ENSG00000116679		"""Kelch-like"", ""BTB/POZ domain containing"""	16951	protein-coding gene	gene with protein product	"""kelch-like family member 39"""	609209				9696811, 10048485	Standard	NM_006469		Approved	NS1-BP, HSPC068, NS-1, KIAA0850, ND1, KLHL39	uc001grl.3	Q9Y6Y0	OTTHUMG00000035384	ENST00000367498.3:c.1205G>A	1.37:g.185269606C>T	ENSP00000356468:p.Arg402Lys		A8K8R6|Q1G4T6|Q1G4T7|Q5TF75|Q6NW38|Q7LCG2|Q9NZX0|Q9Y480	Missense_Mutation	SNP	pfam_Kelch_1,pfam_Kelch_2,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.R402K	ENST00000367498.3	37	c.1205	CCDS1368.1	1	.	.	.	.	.	.	.	.	.	.	c	9.516	1.107033	0.20714	.	.	ENSG00000116679	ENST00000367498;ENST00000392007	T;T	0.66099	-0.19;-0.19	5.76	4.86	0.63082	Galactose oxidase, beta-propeller (1);	0.097545	0.64402	D	0.000003	T	0.41789	0.1174	N	0.11756	0.17	0.45056	D	0.998072	B;B;B	0.19200	0.034;0.003;0.007	B;B;B	0.18561	0.022;0.003;0.022	T	0.26503	-1.0101	10	0.31617	T	0.26	.	9.7775	0.40628	0.1414:0.7897:0.0:0.069	.	184;103;402	A8MVR0;Q6MZF3;Q9Y6Y0	.;.;NS1BP_HUMAN	K	402;184	ENSP00000356468:R402K;ENSP00000375864:R184K	ENSP00000356468:R402K	R	-	2	0	IVNS1ABP	183536229	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.859000	0.62954	1.442000	0.47568	-0.121000	0.15023	AGA	IVNS1ABP	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000116679		0.423	IVNS1ABP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IVNS1ABP	HGNC	protein_coding	OTTHUMT00000085774.1	-	0.00	68	0	C	NM_006469		185269606	-1	tier1	-	no_errors	ENST00000367498	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	T
KAT2A	2648	genome.wustl.edu	37	17	40269136	40269136	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr17:40269136C>T	ENST00000225916.5	-	11	1734	c.1681G>A	c.(1681-1683)Ggt>Agt	p.G561S		NM_021078.2	NP_066564.2	Q92830	KAT2A_HUMAN	K(lysine) acetyltransferase 2A	561	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				cell proliferation (GO:0008283)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|histone deubiquitination (GO:0016578)|histone H3 acetylation (GO:0043966)|histone H3-K14 acetylation (GO:0044154)|in utero embryonic development (GO:0001701)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|positive regulation of gluconeogenesis (GO:0045722)|regulation of protein stability (GO:0031647)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|somitogenesis (GO:0001756)|telencephalon development (GO:0021537)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|extracellular space (GO:0005615)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	chromatin binding (GO:0003682)|H3 histone acetyltransferase activity (GO:0010484)|histone acetyltransferase activity (GO:0004402)|histone acetyltransferase activity (H4-K12 specific) (GO:0043997)|histone deacetylase binding (GO:0042826)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(4)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						CAGATGCCACCGATGACCCGC	0.597											OREG0024419	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													58.0	54.0	55.0					17																	40269136		2203	4300	6503	SO:0001583	missense	0			AF029777	CCDS11417.1	17q12-q21	2011-07-01	2008-07-04	2008-07-04	ENSG00000108773	ENSG00000108773		"""Chromatin-modifying enzymes / K-acetyltransferases"""	4201	protein-coding gene	gene with protein product		602301	"""GCN5 general control of amino-acid synthesis 5-like 2 (yeast)"""	GCN5L2		8552087	Standard	NM_021078		Approved	GCN5, PCAF-b	uc002hyx.2	Q92830	OTTHUMG00000133504	ENST00000225916.5:c.1681G>A	17.37:g.40269136C>T	ENSP00000225916:p.Gly561Ser	892	Q8N1A2|Q9UCW1	Missense_Mutation	SNP	pirsf_Hist_acetylase_PCAF,pfam_PCAF_N,pfam_Bromodomain,pfam_GNAT_dom,superfamily_Bromodomain,superfamily_Acyl_CoA_acyltransferase,smart_Bromodomain,pfscan_Bromodomain,pfscan_GNAT_dom,prints_Bromodomain	p.G561S	ENST00000225916.5	37	c.1681	CCDS11417.1	17	.	.	.	.	.	.	.	.	.	.	C	24.8	4.569885	0.86542	.	.	ENSG00000108773	ENST00000225916	T	0.21734	1.99	4.22	4.22	0.49857	GCN5-related N-acetyltransferase (GNAT) domain (2);Acyl-CoA N-acyltransferase (2);	0.109701	0.64402	D	0.000009	T	0.50871	0.1641	M	0.86953	2.85	0.80722	D	1	D	0.76494	0.999	D	0.65233	0.933	T	0.63256	-0.6678	10	0.87932	D	0	-9.2085	17.4774	0.87662	0.0:1.0:0.0:0.0	.	561	Q92830	KAT2A_HUMAN	S	561	ENSP00000225916:G561S	ENSP00000225916:G561S	G	-	1	0	KAT2A	37522662	1.000000	0.71417	1.000000	0.80357	0.483000	0.33249	7.776000	0.85560	2.296000	0.77279	0.462000	0.41574	GGT	KAT2A	-	pirsf_Hist_acetylase_PCAF,pfam_GNAT_dom,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	ENSG00000108773		0.597	KAT2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KAT2A	HGNC	protein_coding	OTTHUMT00000257458.1	-	0.00	45	0	C	NM_021078		40269136	-1	tier1	-	no_errors	ENST00000225916	ensembl	human	known	74_37	missense	47.62	44	40	SNP	1.000	T
KAT2A	2648	genome.wustl.edu	37	17	40269136	40269136	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr17:40269136C>T	ENST00000225916.5	-	11	1734	c.1681G>A	c.(1681-1683)Ggt>Agt	p.G561S		NM_021078.2	NP_066564.2	Q92830	KAT2A_HUMAN	K(lysine) acetyltransferase 2A	561	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				cell proliferation (GO:0008283)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|histone deubiquitination (GO:0016578)|histone H3 acetylation (GO:0043966)|histone H3-K14 acetylation (GO:0044154)|in utero embryonic development (GO:0001701)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|positive regulation of gluconeogenesis (GO:0045722)|regulation of protein stability (GO:0031647)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|somitogenesis (GO:0001756)|telencephalon development (GO:0021537)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|extracellular space (GO:0005615)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	chromatin binding (GO:0003682)|H3 histone acetyltransferase activity (GO:0010484)|histone acetyltransferase activity (GO:0004402)|histone acetyltransferase activity (H4-K12 specific) (GO:0043997)|histone deacetylase binding (GO:0042826)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(4)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						CAGATGCCACCGATGACCCGC	0.597											OREG0024419	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													58.0	54.0	55.0					17																	40269136		2203	4300	6503	SO:0001583	missense	0			AF029777	CCDS11417.1	17q12-q21	2011-07-01	2008-07-04	2008-07-04	ENSG00000108773	ENSG00000108773		"""Chromatin-modifying enzymes / K-acetyltransferases"""	4201	protein-coding gene	gene with protein product		602301	"""GCN5 general control of amino-acid synthesis 5-like 2 (yeast)"""	GCN5L2		8552087	Standard	NM_021078		Approved	GCN5, PCAF-b	uc002hyx.2	Q92830	OTTHUMG00000133504	ENST00000225916.5:c.1681G>A	17.37:g.40269136C>T	ENSP00000225916:p.Gly561Ser	892	Q8N1A2|Q9UCW1	Missense_Mutation	SNP	pirsf_Hist_acetylase_PCAF,pfam_PCAF_N,pfam_Bromodomain,pfam_GNAT_dom,superfamily_Bromodomain,superfamily_Acyl_CoA_acyltransferase,smart_Bromodomain,pfscan_Bromodomain,pfscan_GNAT_dom,prints_Bromodomain	p.G561S	ENST00000225916.5	37	c.1681	CCDS11417.1	17	.	.	.	.	.	.	.	.	.	.	C	24.8	4.569885	0.86542	.	.	ENSG00000108773	ENST00000225916	T	0.21734	1.99	4.22	4.22	0.49857	GCN5-related N-acetyltransferase (GNAT) domain (2);Acyl-CoA N-acyltransferase (2);	0.109701	0.64402	D	0.000009	T	0.50871	0.1641	M	0.86953	2.85	0.80722	D	1	D	0.76494	0.999	D	0.65233	0.933	T	0.63256	-0.6678	10	0.87932	D	0	-9.2085	17.4774	0.87662	0.0:1.0:0.0:0.0	.	561	Q92830	KAT2A_HUMAN	S	561	ENSP00000225916:G561S	ENSP00000225916:G561S	G	-	1	0	KAT2A	37522662	1.000000	0.71417	1.000000	0.80357	0.483000	0.33249	7.776000	0.85560	2.296000	0.77279	0.462000	0.41574	GGT	KAT2A	-	pirsf_Hist_acetylase_PCAF,pfam_GNAT_dom,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	ENSG00000108773		0.597	KAT2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KAT2A	HGNC	protein_coding	OTTHUMT00000257458.1	-	0.00	54	0	C	NM_021078		40269136	-1	tier1	-	no_errors	ENST00000225916	ensembl	human	known	74_37	missense	47.62	44	40	SNP	1.000	T
KCNA5	3741	genome.wustl.edu	37	12	5154191	5154191	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr12:5154191C>T	ENST00000252321.3	+	1	1107	c.878C>T	c.(877-879)gCg>gTg	p.A293V		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	293					atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	CAGCCTCCCGCGCCCGCCCCT	0.692																																																	0													29.0	35.0	33.0					12																	5154191		2199	4290	6489	SO:0001583	missense	0			M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.878C>T	12.37:g.5154191C>T	ENSP00000252321:p.Ala293Val		Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,pfam_PKD1_2_channel,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1.5,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.A293V	ENST00000252321.3	37	c.878	CCDS8536.1	12	.	.	.	.	.	.	.	.	.	.	C	0.613	-0.824126	0.02755	.	.	ENSG00000130037	ENST00000252321	D	0.97303	-4.33	4.77	-0.325	0.12702	.	1154.810000	0.00166	N	0.000004	D	0.89326	0.6683	N	0.03016	-0.435	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	D	0.84038	0.0363	10	0.26408	T	0.33	.	2.4633	0.04547	0.1278:0.361:0.3392:0.172	.	293	P22460	KCNA5_HUMAN	V	293	ENSP00000252321:A293V	ENSP00000252321:A293V	A	+	2	0	KCNA5	5024452	.	.	0.001000	0.08648	0.249000	0.25844	.	.	-0.244000	0.09639	-0.258000	0.10820	GCG	KCNA5	-	NULL	ENSG00000130037		0.692	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA5	HGNC	protein_coding	OTTHUMT00000398925.2	-	0.00	11	0	C	NM_002234		5154191	+1	tier1	-	no_errors	ENST00000252321	ensembl	human	known	74_37	missense	31.58	13	6	SNP	0.002	T
KCNN4	3783	genome.wustl.edu	37	19	44276179	44276179	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr19:44276179C>A	ENST00000262888.3	-	4	1187	c.792G>T	c.(790-792)aaG>aaT	p.K264N		NM_002250.2	NP_002241.1	O15554	KCNN4_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4	264					calcium ion transport (GO:0006816)|cell volume homeostasis (GO:0006884)|defense response (GO:0006952)|immune system process (GO:0002376)|phospholipid translocation (GO:0045332)|positive regulation of protein secretion (GO:0050714)|positive regulation of T cell receptor signaling pathway (GO:0050862)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|saliva secretion (GO:0046541)|stabilization of membrane potential (GO:0030322)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|Intermediate conductance calcium-activated potassium channel activity (GO:0022894)|protein phosphatase binding (GO:0019903)			biliary_tract(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	15		Prostate(69;0.0352)			Clotrimazole(DB00257)|Enflurane(DB00228)|Halothane(DB01159)|Miconazole(DB01110)|Procaine(DB00721)|Quinine(DB00468)	GGCAGACGATCTTGCCCCACA	0.557																																																	0													153.0	116.0	129.0					19																	44276179		2203	4300	6503	SO:0001583	missense	0			AF022797	CCDS12630.1	19q13.2	2012-07-05				ENSG00000104783		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6293	protein-coding gene	gene with protein product		602754				9380751, 9407042, 16382103	Standard	NM_002250		Approved	KCa3.1, hSK4, hKCa4, hIKCa1	uc002oxl.3	O15554		ENST00000262888.3:c.792G>T	19.37:g.44276179C>A	ENSP00000262888:p.Lys264Asn		Q53XR4	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_SK,pfam_CaM-bd_dom,pfam_2pore_dom_K_chnl_dom,superfamily_CaM-bd_dom	p.K264N	ENST00000262888.3	37	c.792	CCDS12630.1	19	.	.	.	.	.	.	.	.	.	.	C	19.97	3.925316	0.73213	.	.	ENSG00000104783	ENST00000262888;ENST00000407385	T	0.38077	1.16	5.28	3.15	0.36227	Ion transport 2 (1);	0.000000	0.85682	D	0.000000	T	0.63988	0.2558	M	0.93328	3.405	0.45946	D	0.998778	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.67925	-0.5544	10	0.87932	D	0	-25.8665	6.6171	0.22782	0.0:0.7266:0.0:0.2734	.	158;264	D1MQ10;O15554	.;KCNN4_HUMAN	N	264;132	ENSP00000262888:K264N	ENSP00000262888:K264N	K	-	3	2	KCNN4	48968019	0.998000	0.40836	1.000000	0.80357	0.945000	0.59286	1.295000	0.33377	1.382000	0.46385	0.561000	0.74099	AAG	KCNN4	-	pfam_2pore_dom_K_chnl_dom	ENSG00000104783		0.557	KCNN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNN4	HGNC	protein_coding	OTTHUMT00000463598.1	-	0.00	37	0	C	NM_002250		44276179	-1	tier1	-	no_errors	ENST00000262888	ensembl	human	known	74_37	missense	20.31	51	13	SNP	1.000	A
KCNN4	3783	genome.wustl.edu	37	19	44276179	44276179	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr19:44276179C>A	ENST00000262888.3	-	4	1187	c.792G>T	c.(790-792)aaG>aaT	p.K264N		NM_002250.2	NP_002241.1	O15554	KCNN4_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4	264					calcium ion transport (GO:0006816)|cell volume homeostasis (GO:0006884)|defense response (GO:0006952)|immune system process (GO:0002376)|phospholipid translocation (GO:0045332)|positive regulation of protein secretion (GO:0050714)|positive regulation of T cell receptor signaling pathway (GO:0050862)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|saliva secretion (GO:0046541)|stabilization of membrane potential (GO:0030322)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|Intermediate conductance calcium-activated potassium channel activity (GO:0022894)|protein phosphatase binding (GO:0019903)			biliary_tract(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	15		Prostate(69;0.0352)			Clotrimazole(DB00257)|Enflurane(DB00228)|Halothane(DB01159)|Miconazole(DB01110)|Procaine(DB00721)|Quinine(DB00468)	GGCAGACGATCTTGCCCCACA	0.557																																																	0													153.0	116.0	129.0					19																	44276179		2203	4300	6503	SO:0001583	missense	0			AF022797	CCDS12630.1	19q13.2	2012-07-05				ENSG00000104783		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6293	protein-coding gene	gene with protein product		602754				9380751, 9407042, 16382103	Standard	NM_002250		Approved	KCa3.1, hSK4, hKCa4, hIKCa1	uc002oxl.3	O15554		ENST00000262888.3:c.792G>T	19.37:g.44276179C>A	ENSP00000262888:p.Lys264Asn		Q53XR4	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_SK,pfam_CaM-bd_dom,pfam_2pore_dom_K_chnl_dom,superfamily_CaM-bd_dom	p.K264N	ENST00000262888.3	37	c.792	CCDS12630.1	19	.	.	.	.	.	.	.	.	.	.	C	19.97	3.925316	0.73213	.	.	ENSG00000104783	ENST00000262888;ENST00000407385	T	0.38077	1.16	5.28	3.15	0.36227	Ion transport 2 (1);	0.000000	0.85682	D	0.000000	T	0.63988	0.2558	M	0.93328	3.405	0.45946	D	0.998778	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.67925	-0.5544	10	0.87932	D	0	-25.8665	6.6171	0.22782	0.0:0.7266:0.0:0.2734	.	158;264	D1MQ10;O15554	.;KCNN4_HUMAN	N	264;132	ENSP00000262888:K264N	ENSP00000262888:K264N	K	-	3	2	KCNN4	48968019	0.998000	0.40836	1.000000	0.80357	0.945000	0.59286	1.295000	0.33377	1.382000	0.46385	0.561000	0.74099	AAG	KCNN4	-	pfam_2pore_dom_K_chnl_dom	ENSG00000104783		0.557	KCNN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNN4	HGNC	protein_coding	OTTHUMT00000463598.1	-	0.00	40	0	C	NM_002250		44276179	-1	tier1	-	no_errors	ENST00000262888	ensembl	human	known	74_37	missense	20.31	51	13	SNP	1.000	A
KCNV1	27012	genome.wustl.edu	37	8	110986364	110986364	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr8:110986364G>A	ENST00000524391.1	-	2	1286	c.254C>T	c.(253-255)cCc>cTc	p.P85L	KCNV1_ENST00000297404.1_Missense_Mutation_p.P85L|RP11-696P8.2_ENST00000530667.1_RNA			Q6PIU1	KCNV1_HUMAN	potassium channel, subfamily V, member 1	85					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|ion channel inhibitor activity (GO:0008200)|potassium channel regulator activity (GO:0015459)	p.P85H(2)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(20)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;5.35e-13)			CAGAGGGCTGGGCACGGCGGC	0.677																																																	2	Substitution - Missense(2)	lung(2)											24.0	22.0	23.0					8																	110986364		2201	4297	6498	SO:0001583	missense	0			AF167082	CCDS6314.1	8q23.2	2011-07-05				ENSG00000164794		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18861	protein-coding gene	gene with protein product		608164				8670833, 16382104	Standard	NM_014379		Approved	Kv8.1	uc003ynr.4	Q6PIU1		ENST00000524391.1:c.254C>T	8.37:g.110986364G>A	ENSP00000435954:p.Pro85Leu		Q9UHJ4	Missense_Mutation	SNP	pfam_T1-type_BTB,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv8,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv4	p.P85L	ENST00000524391.1	37	c.254	CCDS6314.1	8	.	.	.	.	.	.	.	.	.	.	G	16.56	3.156187	0.57259	.	.	ENSG00000164794	ENST00000524391;ENST00000297404	D;D	0.97378	-4.36;-4.36	4.95	4.95	0.65309	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.438594	0.25065	N	0.033414	D	0.93128	0.7812	N	0.17082	0.46	0.43347	D	0.9954	B	0.02656	0.0	B	0.04013	0.001	D	0.89970	0.4093	10	0.72032	D	0.01	.	15.5082	0.75757	0.0:0.0:1.0:0.0	.	85	Q6PIU1	KCNV1_HUMAN	L	85	ENSP00000435954:P85L;ENSP00000297404:P85L	ENSP00000297404:P85L	P	-	2	0	KCNV1	111055540	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	2.875000	0.48491	2.554000	0.86153	0.655000	0.94253	CCC	KCNV1	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl_volt-dep_Kv8	ENSG00000164794		0.677	KCNV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNV1	HGNC	protein_coding	OTTHUMT00000385525.1	-	0.00	60	0	G	NM_014379		110986364	-1	tier1	-	no_errors	ENST00000297404	ensembl	human	known	74_37	missense	10.64	84	10	SNP	1.000	A
KCNV1	27012	genome.wustl.edu	37	8	110986364	110986364	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr8:110986364G>A	ENST00000524391.1	-	2	1286	c.254C>T	c.(253-255)cCc>cTc	p.P85L	KCNV1_ENST00000297404.1_Missense_Mutation_p.P85L|RP11-696P8.2_ENST00000530667.1_RNA			Q6PIU1	KCNV1_HUMAN	potassium channel, subfamily V, member 1	85					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|ion channel inhibitor activity (GO:0008200)|potassium channel regulator activity (GO:0015459)	p.P85H(2)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(20)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;5.35e-13)			CAGAGGGCTGGGCACGGCGGC	0.677																																																	2	Substitution - Missense(2)	lung(2)											24.0	22.0	23.0					8																	110986364		2201	4297	6498	SO:0001583	missense	0			AF167082	CCDS6314.1	8q23.2	2011-07-05				ENSG00000164794		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18861	protein-coding gene	gene with protein product		608164				8670833, 16382104	Standard	NM_014379		Approved	Kv8.1	uc003ynr.4	Q6PIU1		ENST00000524391.1:c.254C>T	8.37:g.110986364G>A	ENSP00000435954:p.Pro85Leu		Q9UHJ4	Missense_Mutation	SNP	pfam_T1-type_BTB,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv8,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv4	p.P85L	ENST00000524391.1	37	c.254	CCDS6314.1	8	.	.	.	.	.	.	.	.	.	.	G	16.56	3.156187	0.57259	.	.	ENSG00000164794	ENST00000524391;ENST00000297404	D;D	0.97378	-4.36;-4.36	4.95	4.95	0.65309	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.438594	0.25065	N	0.033414	D	0.93128	0.7812	N	0.17082	0.46	0.43347	D	0.9954	B	0.02656	0.0	B	0.04013	0.001	D	0.89970	0.4093	10	0.72032	D	0.01	.	15.5082	0.75757	0.0:0.0:1.0:0.0	.	85	Q6PIU1	KCNV1_HUMAN	L	85	ENSP00000435954:P85L;ENSP00000297404:P85L	ENSP00000297404:P85L	P	-	2	0	KCNV1	111055540	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	2.875000	0.48491	2.554000	0.86153	0.655000	0.94253	CCC	KCNV1	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl_volt-dep_Kv8	ENSG00000164794		0.677	KCNV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNV1	HGNC	protein_coding	OTTHUMT00000385525.1	-	0.00	82	0	G	NM_014379		110986364	-1	tier1	-	no_errors	ENST00000297404	ensembl	human	known	74_37	missense	10.64	84	10	SNP	1.000	A
KIAA0430	9665	genome.wustl.edu	37	16	15724221	15724221	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr16:15724221C>T	ENST00000396368.3	-	7	1698	c.1492G>A	c.(1492-1494)Gac>Aac	p.D498N	KIAA0430_ENST00000551742.1_Missense_Mutation_p.D498N|KIAA0430_ENST00000344181.3_Missense_Mutation_p.D320N|KIAA0430_ENST00000540441.2_Missense_Mutation_p.D498N|KIAA0430_ENST00000602337.1_Missense_Mutation_p.D495N|KIAA0430_ENST00000548025.1_Missense_Mutation_p.D495N	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430	498					double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						GGGGGCAAGTCGGAAATGAAC	0.438																																																	0													107.0	103.0	104.0					16																	15724221		1905	4136	6041	SO:0001583	missense	0			AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.1492G>A	16.37:g.15724221C>T	ENSP00000379654:p.Asp498Asn		A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Missense_Mutation	SNP	pfam_Limkain_b1_cons_dom,pfam_NYN_limkain-b1,smart_RRM_dom,pfscan_RRM_dom	p.D498N	ENST00000396368.3	37	c.1492	CCDS10562.2	16	.	.	.	.	.	.	.	.	.	.	C	36	5.718631	0.96839	.	.	ENSG00000166783	ENST00000396368;ENST00000540441;ENST00000321370;ENST00000344181;ENST00000548025;ENST00000551742;ENST00000551298	.	.	.	6.05	6.05	0.98169	.	0.082852	0.85682	D	0.000000	T	0.78233	0.4251	M	0.64997	1.995	0.40419	D	0.979825	D;D;D;D	0.67145	0.996;0.995;0.995;0.993	D;P;P;D	0.71184	0.972;0.899;0.899;0.959	T	0.76271	-0.3020	9	0.48119	T	0.1	.	20.6013	0.99457	0.0:1.0:0.0:0.0	.	497;495;494;497	Q9Y4F3-5;F8VV09;Q9Y4F3-4;Q9Y4F3	.;.;.;LKAP_HUMAN	N	498;498;497;320;495;498;498	.	ENSP00000315718:D497N	D	-	1	0	KIAA0430	15631722	1.000000	0.71417	0.895000	0.35142	0.992000	0.81027	5.369000	0.66138	2.878000	0.98634	0.650000	0.86243	GAC	KIAA0430	-	NULL	ENSG00000166783		0.438	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA0430	HGNC	protein_coding	OTTHUMT00000252131.2	-	0.00	99	0	C	NM_014647		15724221	-1	tier1	-	no_errors	ENST00000396368	ensembl	human	known	74_37	missense	11.25	71	9	SNP	1.000	T
KLF6	1316	genome.wustl.edu	37	10	3821248	3821249	+	3'UTR	INS	-	-	T	rs375375286		TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr10:3821248_3821249insT	ENST00000497571.1	-	0	1594_1595				KLF6_ENST00000542957.1_3'UTR|KLF6_ENST00000173785.4_5'UTR	NM_001160124.1|NM_001300.5	NP_001153596.1|NP_001291.3	Q99612	KLF6_HUMAN	Kruppel-like factor 6						B cell differentiation (GO:0030183)|cytokine-mediated signaling pathway (GO:0019221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|endometrium(1)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16				Colorectal(1;0.238)		tttgatttttctttttttttCT	0.426																																																	0																																										SO:0001624	3_prime_UTR_variant	0			U51869	CCDS7060.1, CCDS53490.1	10p15	2013-01-08	2004-11-29	2004-12-01	ENSG00000067082	ENSG00000067082		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	2235	protein-coding gene	gene with protein product	"""GC-rich binding factor"""	602053	"""core promoter element binding protein"""	BCD1, ST12, COPEB		9503030, 9685731	Standard	NM_001300		Approved	CPBP, GBF, Zf9, PAC1	uc001iha.3	Q99612	OTTHUMG00000017567	ENST00000497571.1:c.*483->A	10.37:g.3821257_3821257dupT			B2RE86|B4DDN0|D3DRR1|F5H3M5|Q5VUT7|Q5VUT8|Q9BT79	RNA	INS	-	NULL	ENST00000497571.1	37	NULL	CCDS7060.1	10																																																																																			KLF6	-	-	ENSG00000067082		0.426	KLF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF6	HGNC	protein_coding	OTTHUMT00000046495.1		0.00	30	0	-			3821249	-1	tier1		no_errors	ENST00000173785	ensembl	human	known	74_37	rna	10.00	27	3	INS	0.001:0.006	T
KLHL38	340359	genome.wustl.edu	37	8	124664819	124664819	+	Silent	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr8:124664819G>A	ENST00000325995.7	-	1	371	c.348C>T	c.(346-348)ttC>ttT	p.F116F	CTD-2552K11.2_ENST00000524355.1_RNA	NM_001081675.2	NP_001075144.2	Q2WGJ6	KLH38_HUMAN	kelch-like family member 38	116										breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(16)|pancreas(1)|prostate(3)|stomach(1)	38						ACAGCTTGGGGAACTGTAGCA	0.562																																																	0													52.0	58.0	56.0					8																	124664819		2017	4172	6189	SO:0001819	synonymous_variant	0				CCDS43766.1	8q24.13	2013-02-22	2013-02-22		ENSG00000175946	ENSG00000175946		"""Kelch-like"", ""BTB/POZ domain containing"""	34435	protein-coding gene	gene with protein product			"""kelch-like 38 (Drosophila)"""				Standard	NM_001081675		Approved	C8ORFK36	uc003yqs.1	Q2WGJ6	OTTHUMG00000164983	ENST00000325995.7:c.348C>T	8.37:g.124664819G>A			A0PK12	Silent	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.F116	ENST00000325995.7	37	c.348	CCDS43766.1	8																																																																																			KLHL38	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pirsf_Kelch-like_gigaxonin	ENSG00000175946		0.562	KLHL38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL38	HGNC	protein_coding	OTTHUMT00000381288.1	-	0.00	27	0	G			124664819	-1	tier1	-	no_errors	ENST00000325995	ensembl	human	known	74_37	silent	22.22	21	6	SNP	0.992	A
KLHL38	340359	genome.wustl.edu	37	8	124664819	124664819	+	Silent	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr8:124664819G>A	ENST00000325995.7	-	1	371	c.348C>T	c.(346-348)ttC>ttT	p.F116F	CTD-2552K11.2_ENST00000524355.1_RNA	NM_001081675.2	NP_001075144.2	Q2WGJ6	KLH38_HUMAN	kelch-like family member 38	116										breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(16)|pancreas(1)|prostate(3)|stomach(1)	38						ACAGCTTGGGGAACTGTAGCA	0.562																																																	0													52.0	58.0	56.0					8																	124664819		2017	4172	6189	SO:0001819	synonymous_variant	0				CCDS43766.1	8q24.13	2013-02-22	2013-02-22		ENSG00000175946	ENSG00000175946		"""Kelch-like"", ""BTB/POZ domain containing"""	34435	protein-coding gene	gene with protein product			"""kelch-like 38 (Drosophila)"""				Standard	NM_001081675		Approved	C8ORFK36	uc003yqs.1	Q2WGJ6	OTTHUMG00000164983	ENST00000325995.7:c.348C>T	8.37:g.124664819G>A			A0PK12	Silent	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.F116	ENST00000325995.7	37	c.348	CCDS43766.1	8																																																																																			KLHL38	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pirsf_Kelch-like_gigaxonin	ENSG00000175946		0.562	KLHL38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL38	HGNC	protein_coding	OTTHUMT00000381288.1	-	0.00	38	0	G			124664819	-1	tier1	-	no_errors	ENST00000325995	ensembl	human	known	74_37	silent	22.22	21	6	SNP	0.992	A
LINC00265	349114	genome.wustl.edu	37	7	39832146	39832146	+	lincRNA	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr7:39832146G>A	ENST00000340510.4	+	0	2504					NR_026999.1				long intergenic non-protein coding RNA 265																		CCCTTCCGGCGGCCTCTCCGG	0.677																																																	0																																												0					7p14.1	2012-10-12	2011-08-11	2011-08-11	ENSG00000188185	ENSG00000188185		"""Long non-coding RNAs"""	28019	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 265-1"""		"""non-protein coding RNA 265"""	NCRNA00265		12477932	Standard	NR_026999		Approved	NCRNA00265-1	uc003thf.3		OTTHUMG00000155273		7.37:g.39832146G>A				RNA	SNP	-	NULL	ENST00000340510.4	37	NULL		7																																																																																			LINC00265	-	-	ENSG00000188185		0.677	LINC00265-001	KNOWN	basic	lincRNA	LINC00265	HGNC	lincRNA	OTTHUMT00000339278.1		0.00	33	0	G	NR_026999		39832146	+1			no_errors	ENST00000340510	ensembl	human	known	74_37	rna	17.65	42	9	SNP	0.385	A
LOC100130331	100130331	genome.wustl.edu	37	1	238090365	238090365	+	RNA	SNP	G	G	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:238090365G>T	ENST00000450451.1	+	0	1871					NR_027247.2																						GTCACCAACTGGGACGACATG	0.617																																																	0																																												0																															1.37:g.238090365G>T				RNA	SNP	-	NULL	ENST00000450451.1	37	NULL		1																																																																																			RP11-193H5.1	-	-	ENSG00000237250		0.617	RP11-193H5.1-001	KNOWN	basic	antisense	LOC100130331	Clone_based_vega_gene	antisense	OTTHUMT00000095477.1	-	0.00	30	0	G			238090365	+1	tier1	-	no_errors	ENST00000450451	ensembl	human	known	74_37	rna	61.54	20	32	SNP	1.000	T
APELA	100506013	genome.wustl.edu	37	4	165798490	165798490	+	RNA	SNP	T	T	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr4:165798490T>A	ENST00000507152.1	+	0	335					NR_038825.1																						GAAAATGAGATTTCAGCAATT	0.368																																																	0																																												0																															4.37:g.165798490T>A				RNA	SNP	-	NULL	ENST00000507152.1	37	NULL		4																																																																																			RP11-366M4.3	-	-	ENSG00000248329		0.368	RP11-366M4.3-001	KNOWN	basic	lincRNA	LOC100506013	Clone_based_vega_gene	processed_transcript	OTTHUMT00000364313.1	-	0.00	41	0	T			165798490	+1	tier1	-	no_errors	ENST00000507152	ensembl	human	known	74_37	rna	37.50	15	9	SNP	0.080	A
APELA	100506013	genome.wustl.edu	37	4	165798496	165798496	+	RNA	SNP	C	C	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr4:165798496C>G	ENST00000507152.1	+	0	341					NR_038825.1																						GAGATTTCAGCAATTCCTTTT	0.363																																																	0																																												0																															4.37:g.165798496C>G				RNA	SNP	-	NULL	ENST00000507152.1	37	NULL		4																																																																																			RP11-366M4.3	-	-	ENSG00000248329		0.363	RP11-366M4.3-001	KNOWN	basic	lincRNA	LOC100506013	Clone_based_vega_gene	processed_transcript	OTTHUMT00000364313.1	-	0.00	41	0	C			165798496	+1	tier1	-	no_errors	ENST00000507152	ensembl	human	known	74_37	rna	37.04	17	10	SNP	0.001	G
EXOSC10	5394	genome.wustl.edu	37	1	11159759	11159759	+	Intron	SNP	C	C	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:11159759C>A	ENST00000376936.4	-	1	161				EXOSC10_ENST00000304457.7_Intron|EXOSC10_ENST00000544779.1_Intron|RP4-635E18.6_ENST00000435388.1_RNA|RP4-635E18.6_ENST00000447600.1_RNA	NM_001001998.1	NP_001001998.1	Q01780	EXOSX_HUMAN	exosome component 10						CUT catabolic process (GO:0071034)|dosage compensation by inactivation of X chromosome (GO:0009048)|histone mRNA catabolic process (GO:0071044)|maturation of 5.8S rRNA (GO:0000460)|nuclear mRNA surveillance (GO:0071028)|nuclear polyadenylation-dependent rRNA catabolic process (GO:0071035)|nuclear retention of unspliced pre-mRNA at the site of transcription (GO:0071048)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)	cytoplasm (GO:0005737)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	3'-5' exonuclease activity (GO:0008408)|exoribonuclease activity (GO:0004532)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|stomach(3)|upper_aerodigestive_tract(1)	27	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.18e-07)|COAD - Colon adenocarcinoma(227;8.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000315)|Kidney(185;0.000832)|KIRC - Kidney renal clear cell carcinoma(229;0.00269)|READ - Rectum adenocarcinoma(331;0.0526)|STAD - Stomach adenocarcinoma(313;0.202)		CTGGTACCCCCGAGGCCCCGC	0.716																																					Colon(179;105 1987 14326 27364 29542)												0													14.0	18.0	17.0					1																	11159759		2202	4298	6500	SO:0001627	intron_variant	0			BC073788	CCDS126.1, CCDS30584.1	1p36.22	2008-02-05	2004-06-16	2004-06-18	ENSG00000171824	ENSG00000171824			9138	protein-coding gene	gene with protein product	"""polymyositis/scleroderma autoantigen 2 (100kD)"""	605960	"""polymyositis/scleroderma autoantigen 2, 100kDa"""	PMSCL2		1383382, 1644924	Standard	NM_001001998		Approved	PM-Scl, PM/Scl-100, Rrp6p, RRP6, p2, p3, p4	uc001asa.3	Q01780	OTTHUMG00000002123	ENST00000376936.4:c.111+18G>T	1.37:g.11159759C>A			B1AKQ0|B1AKQ1|Q15158	RNA	SNP	-	NULL	ENST00000376936.4	37	NULL	CCDS30584.1	1																																																																																			RP4-635E18.6	-	-	ENSG00000230337		0.716	EXOSC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LOC101929136	Clone_based_vega_gene	protein_coding	OTTHUMT00000006078.1	-	0.00	58	0	C	NM_001001998		11159759	+1	tier1	-	no_errors	ENST00000435388	ensembl	human	known	74_37	rna	25.00	39	13	SNP	0.000	A
EXOSC10	5394	genome.wustl.edu	37	1	11159759	11159759	+	Intron	SNP	C	C	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:11159759C>A	ENST00000376936.4	-	1	161				EXOSC10_ENST00000304457.7_Intron|EXOSC10_ENST00000544779.1_Intron|RP4-635E18.6_ENST00000435388.1_RNA|RP4-635E18.6_ENST00000447600.1_RNA	NM_001001998.1	NP_001001998.1	Q01780	EXOSX_HUMAN	exosome component 10						CUT catabolic process (GO:0071034)|dosage compensation by inactivation of X chromosome (GO:0009048)|histone mRNA catabolic process (GO:0071044)|maturation of 5.8S rRNA (GO:0000460)|nuclear mRNA surveillance (GO:0071028)|nuclear polyadenylation-dependent rRNA catabolic process (GO:0071035)|nuclear retention of unspliced pre-mRNA at the site of transcription (GO:0071048)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)	cytoplasm (GO:0005737)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	3'-5' exonuclease activity (GO:0008408)|exoribonuclease activity (GO:0004532)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|stomach(3)|upper_aerodigestive_tract(1)	27	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.18e-07)|COAD - Colon adenocarcinoma(227;8.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000315)|Kidney(185;0.000832)|KIRC - Kidney renal clear cell carcinoma(229;0.00269)|READ - Rectum adenocarcinoma(331;0.0526)|STAD - Stomach adenocarcinoma(313;0.202)		CTGGTACCCCCGAGGCCCCGC	0.716																																					Colon(179;105 1987 14326 27364 29542)												0													14.0	18.0	17.0					1																	11159759		2202	4298	6500	SO:0001627	intron_variant	0			BC073788	CCDS126.1, CCDS30584.1	1p36.22	2008-02-05	2004-06-16	2004-06-18	ENSG00000171824	ENSG00000171824			9138	protein-coding gene	gene with protein product	"""polymyositis/scleroderma autoantigen 2 (100kD)"""	605960	"""polymyositis/scleroderma autoantigen 2, 100kDa"""	PMSCL2		1383382, 1644924	Standard	NM_001001998		Approved	PM-Scl, PM/Scl-100, Rrp6p, RRP6, p2, p3, p4	uc001asa.3	Q01780	OTTHUMG00000002123	ENST00000376936.4:c.111+18G>T	1.37:g.11159759C>A			B1AKQ0|B1AKQ1|Q15158	RNA	SNP	-	NULL	ENST00000376936.4	37	NULL	CCDS30584.1	1																																																																																			RP4-635E18.6	-	-	ENSG00000230337		0.716	EXOSC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LOC101929136	Clone_based_vega_gene	protein_coding	OTTHUMT00000006078.1	-	0.00	63	0	C	NM_001001998		11159759	+1	tier1	-	no_errors	ENST00000435388	ensembl	human	known	74_37	rna	25.00	39	13	SNP	0.000	A
PKD1P1	339044	genome.wustl.edu	37	16	16415216	16415216	+	IGR	SNP	C	C	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr16:16415216C>G	ENST00000537112.1	+	0	0					NR_036447.1																						TCTGTGGCCTCCGCGCCACGC	0.692																																																	0																																										SO:0001628	intergenic_variant	0																															16.37:g.16415216C>G				RNA	SNP	-	NULL	ENST00000537112.1	37	NULL		16																																																																																			AC138969.4	-	-	ENSG00000183889		0.692	AC138969.4-005	KNOWN	non_canonical_other|basic	processed_transcript	LOC101930008	Clone_based_vega_gene	protein_coding	OTTHUMT00000399242.1	-	0.00	111	0	C			16415216	+1	tier1	-	no_errors	ENST00000536260	ensembl	human	known	74_37	rna	12.07	102	14	SNP	0.840	G
LOC100287934	100287934	genome.wustl.edu	37	1	745347	745347	+	RNA	SNP	T	T	C	rs373594198		TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:745347T>C	ENST00000435300.1	-	0	804				RP11-206L10.8_ENST00000447500.1_RNA																							GTTATTTACATATTTGTATCA	0.299																																																	0																																												0																															1.37:g.745347T>C				RNA	SNP	-	NULL	ENST00000435300.1	37	NULL		1																																																																																			RP11-206L10.9	-	-	ENSG00000237491		0.299	RP11-206L10.10-001	KNOWN	basic	processed_transcript	LOC101930657	Clone_based_vega_gene	processed_transcript	OTTHUMT00000007014.1	-	0.00	17	0	T			745347	+1	tier1	-	no_errors	ENST00000412115	ensembl	human	known	74_37	rna	23.53	13	4	SNP	0.005	C
LOC400743	400743	genome.wustl.edu	37	1	17521162	17521162	+	lincRNA	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:17521162C>T	ENST00000412427.1	+	0	1726																											GTCTTTGTCCCCTGCACTCCC	0.542																																																	0																																												0																															1.37:g.17521162C>T				RNA	SNP	-	NULL	ENST00000412427.1	37	NULL		1																																																																																			RP11-380J14.1	-	-	ENSG00000204362		0.542	RP11-380J14.1-001	KNOWN	basic	lincRNA	LOC400743	Clone_based_vega_gene	lincRNA	OTTHUMT00000006615.1	-	0.00	33	0	C			17521162	+1	tier1	-	no_errors	ENST00000412427	ensembl	human	known	74_37	rna	34.78	30	16	SNP	0.006	T
LRFN1	57622	genome.wustl.edu	37	19	39798949	39798949	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr19:39798949G>A	ENST00000248668.4	-	2	1639	c.1640C>T	c.(1639-1641)tCg>tTg	p.S547L		NM_020862.1	NP_065913.1	Q9P244	LRFN1_HUMAN	leucine rich repeat and fibronectin type III domain containing 1	547						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	18	all_cancers(60;1.85e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;1.96e-27)|all cancers(26;2.05e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			GACGAGGACCGAGGCGACGAT	0.667																																																	0													26.0	31.0	29.0					19																	39798949		2179	4283	6462	SO:0001583	missense	0			BC014678	CCDS46071.1	19q13.2	2013-02-11				ENSG00000128011		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29290	protein-coding gene	gene with protein product		612807				10819331, 16828986	Standard	NM_020862		Approved	KIAA1484, SALM2	uc002okw.2	Q9P244		ENST00000248668.4:c.1640C>T	19.37:g.39798949G>A	ENSP00000248668:p.Ser547Leu		Q8TBS9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.S547L	ENST00000248668.4	37	c.1640	CCDS46071.1	19	.	.	.	.	.	.	.	.	.	.	G	28.6	4.931187	0.92389	.	.	ENSG00000128011	ENST00000248668	T	0.63744	-0.06	4.17	4.17	0.49024	.	0.000000	0.32608	N	0.005879	T	0.63319	0.2501	L	0.43923	1.385	0.80722	D	1	D	0.57571	0.98	P	0.51016	0.656	T	0.68565	-0.5375	10	0.72032	D	0.01	.	14.0383	0.64658	0.0:0.0:1.0:0.0	.	547	Q9P244	LRFN1_HUMAN	L	547	ENSP00000248668:S547L	ENSP00000248668:S547L	S	-	2	0	LRFN1	44490789	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.438000	0.97539	2.176000	0.68965	0.462000	0.41574	TCG	LRFN1	-	NULL	ENSG00000128011		0.667	LRFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRFN1	HGNC	protein_coding	OTTHUMT00000463835.1	-	0.00	33	0	G	NM_020862		39798949	-1	tier1	-	no_errors	ENST00000248668	ensembl	human	known	74_37	missense	22.00	39	11	SNP	1.000	A
LRP2	4036	genome.wustl.edu	37	2	170042241	170042241	+	Missense_Mutation	SNP	C	C	T	rs148251117	byFrequency	TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr2:170042241C>T	ENST00000263816.3	-	50	9902	c.9617G>A	c.(9616-9618)cGt>cAt	p.R3206H		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	3206					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CAAATAGTAACGGTTGCTAAA	0.428																																																	0								C	HIS/ARG	0,4406		0,0,2203	162.0	166.0	165.0		9617	6.0	1.0	2	dbSNP_134	165	6,8594	5.0+/-18.6	0,6,4294	yes	missense	LRP2	NM_004525.2	29	0,6,6497	TT,TC,CC		0.0698,0.0,0.0461	probably-damaging	3206/4656	170042241	6,13000	2203	4300	6503	SO:0001583	missense	0				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.9617G>A	2.37:g.170042241C>T	ENSP00000263816:p.Arg3206His		O00711|Q16215	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.R3206H	ENST00000263816.3	37	c.9617	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	C	35	5.444125	0.96187	0.0	6.98E-4	ENSG00000081479	ENST00000263816	D	0.91631	-2.88	5.97	5.97	0.96955	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	D	0.96697	0.8922	M	0.84846	2.72	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.96297	0.9218	10	0.62326	D	0.03	.	20.4388	0.99107	0.0:1.0:0.0:0.0	.	3206	P98164	LRP2_HUMAN	H	3206	ENSP00000263816:R3206H	ENSP00000263816:R3206H	R	-	2	0	LRP2	169750487	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.045000	0.71020	2.836000	0.97738	0.655000	0.94253	CGT	LRP2	-	superfamily_Growth_fac_rcpt_N_dom	ENSG00000081479		0.428	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	HGNC	protein_coding	OTTHUMT00000255231.2	-	0.00	21	0	C	NM_004525		170042241	-1	tier1	rs148251117	no_errors	ENST00000263816	ensembl	human	known	74_37	missense	30.00	35	15	SNP	1.000	T
LRRC38	126755	genome.wustl.edu	37	1	13839807	13839807	+	Silent	SNP	C	C	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:13839807C>G	ENST00000376085.3	-	1	736	c.282G>C	c.(280-282)tcG>tcC	p.S94S	RP4-597A16.2_ENST00000563570.1_RNA	NM_001010847.1	NP_001010847.1	Q5VT99	LRC38_HUMAN	leucine rich repeat containing 38	94					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											CCTCCTCCAGCGAGCGCAGCG	0.647																																																	0																																										SO:0001819	synonymous_variant	0			BC016048	CCDS53269.1	1p36.21	2008-02-05			ENSG00000162494	ENSG00000162494			27005	protein-coding gene	gene with protein product		615212				12477932	Standard	NM_001010847		Approved		uc001avb.3	Q5VT99	OTTHUMG00000007918	ENST00000376085.3:c.282G>C	1.37:g.13839807C>G			Q96B32	Silent	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.S94	ENST00000376085.3	37	c.282	CCDS53269.1	1																																																																																			LRRC38	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000162494		0.647	LRRC38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC38	HGNC	protein_coding	OTTHUMT00000021793.1	-	0.00	54	0	C			13839807	-1	tier1	-	no_errors	ENST00000376085	ensembl	human	known	74_37	silent	39.22	31	20	SNP	0.838	G
LRP8	7804	genome.wustl.edu	37	1	53755344	53755344	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:53755344C>G	ENST00000306052.6	-	3	363	c.262G>C	c.(262-264)Gac>Cac	p.D88H	LRP8_ENST00000371454.2_Missense_Mutation_p.D88H|RP4-784A16.2_ENST00000421637.1_RNA|LRP8_ENST00000347547.2_Missense_Mutation_p.D88H|LRP8_ENST00000354412.3_Missense_Mutation_p.D88H|LRP8_ENST00000465675.1_5'UTR|RP4-784A16.3_ENST00000450469.1_RNA	NM_004631.4	NP_004622.2	Q14114	LRP8_HUMAN	low density lipoprotein receptor-related protein 8, apolipoprotein e receptor	88	LDL-receptor class A 2. {ECO:0000255|PROSITE-ProRule:PRU00124}.				ammon gyrus development (GO:0021541)|blood coagulation (GO:0007596)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cytokine-mediated signaling pathway (GO:0019221)|endocytosis (GO:0006897)|layer formation in cerebral cortex (GO:0021819)|lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phototransduction, visible light (GO:0007603)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendrite development (GO:1900006)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|proteolysis (GO:0006508)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|regulation of synaptic transmission (GO:0050804)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)	caveola (GO:0005901)|dendrite (GO:0030425)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|high-density lipoprotein particle binding (GO:0008035)|reelin receptor activity (GO:0038025)|transmembrane signaling receptor activity (GO:0004888)|very-low-density lipoprotein particle receptor activity (GO:0030229)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(1)	21						AAGTCACTGTCTGCACAGGTC	0.607																																																	0													101.0	72.0	82.0					1																	53755344		2203	4300	6503	SO:0001583	missense	0			D50678	CCDS578.1, CCDS579.1, CCDS580.1, CCDS30720.1	1p32.3	2013-05-29			ENSG00000157193	ENSG00000157193		"""Low density lipoprotein receptors"""	6700	protein-coding gene	gene with protein product		602600				8626535, 9079678	Standard	NM_004631		Approved	APOER2, MCI1, LRP-8, HSZ75190	uc001cvi.2	Q14114	OTTHUMG00000008924	ENST00000306052.6:c.262G>C	1.37:g.53755344C>G	ENSP00000303634:p.Asp88His		B1AMT6|B1AMT7|B1AMT8|O14968|Q86V27|Q99876|Q9BR78	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EGF-like_Ca-bd_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.D88H	ENST00000306052.6	37	c.262	CCDS578.1	1	.	.	.	.	.	.	.	.	.	.	C	16.20	3.054734	0.55325	.	.	ENSG00000157193	ENST00000306052;ENST00000371454;ENST00000354412;ENST00000347547	D;D;D;D	0.95482	-3.72;-3.72;-3.72;-3.72	5.33	5.33	0.75918	.	.	.	.	.	D	0.96244	0.8775	L	0.32530	0.975	0.22199	N	0.999295	D;P;D;P	0.60575	0.98;0.831;0.988;0.632	P;P;D;B	0.71414	0.804;0.712;0.973;0.443	D	0.91449	0.5180	9	0.62326	D	0.03	.	17.9523	0.89057	0.0:1.0:0.0:0.0	.	88;88;88;88	Q14114-2;Q14114-4;Q14114-3;Q14114	.;.;.;LRP8_HUMAN	H	88	ENSP00000303634:D88H;ENSP00000360509:D88H;ENSP00000346391:D88H;ENSP00000334522:D88H	ENSP00000303634:D88H	D	-	1	0	LRP8	53527932	0.923000	0.31300	0.946000	0.38457	0.426000	0.31534	2.060000	0.41394	2.778000	0.95560	0.655000	0.94253	GAC	LRP8	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,pfscan_LDrepeatLR_classA_rpt	ENSG00000157193		0.607	LRP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRP8	HGNC	protein_coding	OTTHUMT00000024699.1	-	0.00	27	0	C	NM_004631		53755344	-1	tier1	-	no_errors	ENST00000306052	ensembl	human	known	74_37	missense	33.33	12	6	SNP	0.987	G
M1AP	130951	genome.wustl.edu	37	2	74789417	74789417	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr2:74789417C>T	ENST00000290536.5	-	8	1324	c.1208G>A	c.(1207-1209)cGg>cAg	p.R403Q	M1AP_ENST00000358434.2_Intron|M1AP_ENST00000464686.1_5'UTR|M1AP_ENST00000536235.1_Missense_Mutation_p.R403Q|M1AP_ENST00000409585.1_Missense_Mutation_p.R403Q	NM_001281296.1|NM_138804.3	NP_001268225.1|NP_620159.2	Q8TC57	M1AP_HUMAN	meiosis 1 associated protein	403					cell differentiation (GO:0030154)|chromatin assembly (GO:0031497)|female gamete generation (GO:0007292)|male meiosis chromosome separation (GO:0051308)|RNA processing (GO:0006396)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.R403Q(1)									CATCAGTTCCCGCGTGGCCAC	0.587																																																	1	Substitution - Missense(1)	endometrium(1)											201.0	170.0	181.0					2																	74789417		2203	4300	6503	SO:0001583	missense	0				CCDS33229.1, CCDS62941.1	2p13.1	2013-02-05	2013-02-05	2013-01-16	ENSG00000159374	ENSG00000159374			25183	protein-coding gene	gene with protein product	"""meiosis 1 arresting protein"", ""spermatogenesis associated 37"""		"""chromosome 2 open reading frame 65"""	C2orf65		16881047, 23269666	Standard	NM_138804		Approved	D6Mm5e, SPATA37	uc002smy.3	Q8TC57	OTTHUMG00000152918	ENST00000290536.5:c.1208G>A	2.37:g.74789417C>T	ENSP00000290536:p.Arg403Gln		B7Z6E7|E9PGG8|Q6ZP30|Q96L07	Missense_Mutation	SNP	NULL	p.R403Q	ENST00000290536.5	37	c.1208	CCDS33229.1	2	.	.	.	.	.	.	.	.	.	.	C	23.7	4.443470	0.83993	.	.	ENSG00000159374	ENST00000290536;ENST00000409585;ENST00000536235	T;T;T	0.51325	0.71;0.71;0.71	5.41	5.41	0.78517	.	0.129832	0.49305	D	0.000143	T	0.56920	0.2018	L	0.59436	1.845	0.80722	D	1	D;D;D	0.67145	0.996;0.996;0.991	P;P;P	0.54174	0.744;0.744;0.69	T	0.57189	-0.7854	10	0.46703	T	0.11	-13.6368	14.7033	0.69171	0.0:1.0:0.0:0.0	.	403;403;159	E9PGG8;Q8TC57;B3KX03	.;CB065_HUMAN;.	Q	403	ENSP00000290536:R403Q;ENSP00000386793:R403Q;ENSP00000445662:R403Q	ENSP00000290536:R403Q	R	-	2	0	C2orf65	74642925	1.000000	0.71417	0.940000	0.37924	0.484000	0.33280	5.514000	0.67043	2.535000	0.85469	0.655000	0.94253	CGG	M1AP	-	NULL	ENSG00000159374		0.587	M1AP-001	KNOWN	basic|CCDS	protein_coding	M1AP	HGNC	protein_coding	OTTHUMT00000328569.1	-	0.00	21	0	C	NM_138804		74789417	-1	tier1	-	no_errors	ENST00000290536	ensembl	human	known	74_37	missense	21.95	32	9	SNP	0.966	T
M1AP	130951	genome.wustl.edu	37	2	74789417	74789417	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr2:74789417C>T	ENST00000290536.5	-	8	1324	c.1208G>A	c.(1207-1209)cGg>cAg	p.R403Q	M1AP_ENST00000358434.2_Intron|M1AP_ENST00000464686.1_5'UTR|M1AP_ENST00000536235.1_Missense_Mutation_p.R403Q|M1AP_ENST00000409585.1_Missense_Mutation_p.R403Q	NM_001281296.1|NM_138804.3	NP_001268225.1|NP_620159.2	Q8TC57	M1AP_HUMAN	meiosis 1 associated protein	403					cell differentiation (GO:0030154)|chromatin assembly (GO:0031497)|female gamete generation (GO:0007292)|male meiosis chromosome separation (GO:0051308)|RNA processing (GO:0006396)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.R403Q(1)									CATCAGTTCCCGCGTGGCCAC	0.587																																																	1	Substitution - Missense(1)	endometrium(1)											201.0	170.0	181.0					2																	74789417		2203	4300	6503	SO:0001583	missense	0				CCDS33229.1, CCDS62941.1	2p13.1	2013-02-05	2013-02-05	2013-01-16	ENSG00000159374	ENSG00000159374			25183	protein-coding gene	gene with protein product	"""meiosis 1 arresting protein"", ""spermatogenesis associated 37"""		"""chromosome 2 open reading frame 65"""	C2orf65		16881047, 23269666	Standard	NM_138804		Approved	D6Mm5e, SPATA37	uc002smy.3	Q8TC57	OTTHUMG00000152918	ENST00000290536.5:c.1208G>A	2.37:g.74789417C>T	ENSP00000290536:p.Arg403Gln		B7Z6E7|E9PGG8|Q6ZP30|Q96L07	Missense_Mutation	SNP	NULL	p.R403Q	ENST00000290536.5	37	c.1208	CCDS33229.1	2	.	.	.	.	.	.	.	.	.	.	C	23.7	4.443470	0.83993	.	.	ENSG00000159374	ENST00000290536;ENST00000409585;ENST00000536235	T;T;T	0.51325	0.71;0.71;0.71	5.41	5.41	0.78517	.	0.129832	0.49305	D	0.000143	T	0.56920	0.2018	L	0.59436	1.845	0.80722	D	1	D;D;D	0.67145	0.996;0.996;0.991	P;P;P	0.54174	0.744;0.744;0.69	T	0.57189	-0.7854	10	0.46703	T	0.11	-13.6368	14.7033	0.69171	0.0:1.0:0.0:0.0	.	403;403;159	E9PGG8;Q8TC57;B3KX03	.;CB065_HUMAN;.	Q	403	ENSP00000290536:R403Q;ENSP00000386793:R403Q;ENSP00000445662:R403Q	ENSP00000290536:R403Q	R	-	2	0	C2orf65	74642925	1.000000	0.71417	0.940000	0.37924	0.484000	0.33280	5.514000	0.67043	2.535000	0.85469	0.655000	0.94253	CGG	M1AP	-	NULL	ENSG00000159374		0.587	M1AP-001	KNOWN	basic|CCDS	protein_coding	M1AP	HGNC	protein_coding	OTTHUMT00000328569.1	-	0.00	29	0	C	NM_138804		74789417	-1	tier1	-	no_errors	ENST00000290536	ensembl	human	known	74_37	missense	21.95	32	9	SNP	0.966	T
MALAT1	378938	genome.wustl.edu	37	11	65270090	65270091	+	lincRNA	INS	-	-	T	rs3842272	byFrequency	TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr11:65270090_65270091insT	ENST00000534336.1	+	0	4858_4859					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		GGAGGGGAAACTTTTTTTTTTT	0.371																																																	0																																												0			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65270101_65270101dupT				RNA	INS	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			MALAT1	-	-	ENSG00000251562		0.371	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1		0.00	36	0	-	NR_002819		65270091	+1	tier1		no_errors	ENST00000534336	ensembl	human	known	74_37	rna	14.29	42	7	INS	0.929:0.911	T
MAP1B	4131	genome.wustl.edu	37	5	71494043	71494043	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr5:71494043C>T	ENST00000296755.7	+	5	5159	c.4861C>T	c.(4861-4863)Cca>Tca	p.P1621S		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	1621					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		GTCAATTTCTCCACCAGATTT	0.443																																					Melanoma(17;367 822 11631 31730 47712)												0													108.0	110.0	109.0					5																	71494043		2203	4300	6503	SO:0001583	missense	0			L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.4861C>T	5.37:g.71494043C>T	ENSP00000296755:p.Pro1621Ser		A2BDK5	Missense_Mutation	SNP	pfam_MAP1B_neuraxin	p.P1621S	ENST00000296755.7	37	c.4861	CCDS4012.1	5	.	.	.	.	.	.	.	.	.	.	C	13.38	2.219308	0.39201	.	.	ENSG00000131711	ENST00000296755	T	0.03831	3.79	5.19	5.19	0.71726	.	0.000000	0.64402	D	0.000008	T	0.10294	0.0252	N	0.11560	0.145	0.58432	D	0.999995	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.994	T	0.48328	-0.9045	10	0.48119	T	0.1	-11.8203	18.7095	0.91651	0.0:1.0:0.0:0.0	.	1495;1621	A2BDK6;P46821	.;MAP1B_HUMAN	S	1621	ENSP00000296755:P1621S	ENSP00000296755:P1621S	P	+	1	0	MAP1B	71529799	1.000000	0.71417	1.000000	0.80357	0.701000	0.40568	7.818000	0.86416	2.435000	0.82474	0.313000	0.20887	CCA	MAP1B	-	NULL	ENSG00000131711		0.443	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP1B	HGNC	protein_coding	OTTHUMT00000218561.6	-	0.00	44	0	C	NM_005909		71494043	+1	tier1	-	no_errors	ENST00000296755	ensembl	human	known	74_37	missense	14.58	41	7	SNP	1.000	T
MAP1B	4131	genome.wustl.edu	37	5	71494043	71494043	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr5:71494043C>T	ENST00000296755.7	+	5	5159	c.4861C>T	c.(4861-4863)Cca>Tca	p.P1621S		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	1621					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		GTCAATTTCTCCACCAGATTT	0.443																																					Melanoma(17;367 822 11631 31730 47712)												0													108.0	110.0	109.0					5																	71494043		2203	4300	6503	SO:0001583	missense	0			L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.4861C>T	5.37:g.71494043C>T	ENSP00000296755:p.Pro1621Ser		A2BDK5	Missense_Mutation	SNP	pfam_MAP1B_neuraxin	p.P1621S	ENST00000296755.7	37	c.4861	CCDS4012.1	5	.	.	.	.	.	.	.	.	.	.	C	13.38	2.219308	0.39201	.	.	ENSG00000131711	ENST00000296755	T	0.03831	3.79	5.19	5.19	0.71726	.	0.000000	0.64402	D	0.000008	T	0.10294	0.0252	N	0.11560	0.145	0.58432	D	0.999995	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.994	T	0.48328	-0.9045	10	0.48119	T	0.1	-11.8203	18.7095	0.91651	0.0:1.0:0.0:0.0	.	1495;1621	A2BDK6;P46821	.;MAP1B_HUMAN	S	1621	ENSP00000296755:P1621S	ENSP00000296755:P1621S	P	+	1	0	MAP1B	71529799	1.000000	0.71417	1.000000	0.80357	0.701000	0.40568	7.818000	0.86416	2.435000	0.82474	0.313000	0.20887	CCA	MAP1B	-	NULL	ENSG00000131711		0.443	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP1B	HGNC	protein_coding	OTTHUMT00000218561.6	-	0.00	57	0	C	NM_005909		71494043	+1	tier1	-	no_errors	ENST00000296755	ensembl	human	known	74_37	missense	14.58	41	7	SNP	1.000	T
MBLAC2	153364	genome.wustl.edu	37	5	89756984	89756984	+	Nonstop_Mutation	SNP	C	C	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr5:89756984C>A	ENST00000316610.6	-	2	1315	c.840G>T	c.(838-840)taG>taT	p.*280Y		NM_203406.1	NP_981951	Q68D91	MBLC2_HUMAN	metallo-beta-lactamase domain containing 2	0						extracellular vesicular exosome (GO:0070062)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			kidney(1)|liver(1)|lung(3)	5						AGTATAGATACTAGGGCGAGG	0.318																																																	0													23.0	24.0	23.0					5																	89756984		2198	4297	6495	SO:0001578	stop_lost	0			BC038230	CCDS4067.1	5q14.3	2009-04-08	2009-04-08		ENSG00000176055	ENSG00000176055			33711	protein-coding gene	gene with protein product							Standard	NM_203406		Approved	DKFZp686P15118, MGC46734	uc003kjp.3	Q68D91	OTTHUMG00000131327	ENST00000316610.6:c.840G>T	5.37:g.89756984C>A			D6RJI1|Q8IY16|Q8N8D8	Nonstop_Mutation	SNP	pfam_Beta-lactamas-like,smart_Beta-lactamas-like	p.*280Y	ENST00000316610.6	37	c.840	CCDS4067.1	5	.	.	.	.	.	.	.	.	.	.	C	3.943	-0.013910	0.07681	.	.	ENSG00000176055;ENSG00000259131;ENSG00000259131	ENST00000316610;ENST00000556122;ENST00000546270	.	.	.	6.08	4.31	0.51392	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.7207	0.23328	0.0:0.6613:0.1289:0.2098	.	.	.	.	Y	280;280;210	.	.	X	-	3	2	AC093510.2;MBLAC2	89792740	0.976000	0.34144	0.515000	0.27774	0.379000	0.30106	1.058000	0.30504	0.910000	0.36722	0.655000	0.94253	TAG	MBLAC2	-	NULL	ENSG00000176055		0.318	MBLAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBLAC2	HGNC	protein_coding	OTTHUMT00000254098.2	-	0.00	41	0	C	NM_203406		89756984	-1	tier1	-	no_errors	ENST00000316610	ensembl	human	known	74_37	nonstop	16.28	36	7	SNP	0.450	A
MBLAC2	153364	genome.wustl.edu	37	5	89756984	89756984	+	Nonstop_Mutation	SNP	C	C	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr5:89756984C>A	ENST00000316610.6	-	2	1315	c.840G>T	c.(838-840)taG>taT	p.*280Y		NM_203406.1	NP_981951	Q68D91	MBLC2_HUMAN	metallo-beta-lactamase domain containing 2	0						extracellular vesicular exosome (GO:0070062)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			kidney(1)|liver(1)|lung(3)	5						AGTATAGATACTAGGGCGAGG	0.318																																																	0													23.0	24.0	23.0					5																	89756984		2198	4297	6495	SO:0001578	stop_lost	0			BC038230	CCDS4067.1	5q14.3	2009-04-08	2009-04-08		ENSG00000176055	ENSG00000176055			33711	protein-coding gene	gene with protein product							Standard	NM_203406		Approved	DKFZp686P15118, MGC46734	uc003kjp.3	Q68D91	OTTHUMG00000131327	ENST00000316610.6:c.840G>T	5.37:g.89756984C>A			D6RJI1|Q8IY16|Q8N8D8	Nonstop_Mutation	SNP	pfam_Beta-lactamas-like,smart_Beta-lactamas-like	p.*280Y	ENST00000316610.6	37	c.840	CCDS4067.1	5	.	.	.	.	.	.	.	.	.	.	C	3.943	-0.013910	0.07681	.	.	ENSG00000176055;ENSG00000259131;ENSG00000259131	ENST00000316610;ENST00000556122;ENST00000546270	.	.	.	6.08	4.31	0.51392	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.7207	0.23328	0.0:0.6613:0.1289:0.2098	.	.	.	.	Y	280;280;210	.	.	X	-	3	2	AC093510.2;MBLAC2	89792740	0.976000	0.34144	0.515000	0.27774	0.379000	0.30106	1.058000	0.30504	0.910000	0.36722	0.655000	0.94253	TAG	MBLAC2	-	NULL	ENSG00000176055		0.318	MBLAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBLAC2	HGNC	protein_coding	OTTHUMT00000254098.2	-	0.00	65	0	C	NM_203406		89756984	-1	tier1	-	no_errors	ENST00000316610	ensembl	human	known	74_37	nonstop	16.28	36	7	SNP	0.450	A
MCMDC2	157777	genome.wustl.edu	37	8	67803132	67803132	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr8:67803132G>A	ENST00000422365.2	+	10	1277	c.1106G>A	c.(1105-1107)cGt>cAt	p.R369H	MCMDC2_ENST00000396592.3_Missense_Mutation_p.R369H|MCMDC2_ENST00000541540.1_Missense_Mutation_p.R306H|MCMDC2_ENST00000313616.5_Missense_Mutation_p.R369H	NM_173518.4	NP_775789.3	Q4G0Z9	MCMD2_HUMAN	minichromosome maintenance domain containing 2	369					DNA replication (GO:0006260)		ATP binding (GO:0005524)|DNA binding (GO:0003677)			endometrium(2)|kidney(2)|lung(5)	9						CTTGTCCCCCGTGGTATACGT	0.348																																																	0													108.0	111.0	110.0					8																	67803132		2203	4300	6503	SO:0001583	missense	0			BC034576	CCDS6197.2, CCDS47868.1, CCDS47869.1	8q13.1	2012-04-13	2012-04-13	2012-04-13	ENSG00000178460	ENSG00000178460			26368	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 45"""	C8orf45			Standard	NM_173518		Approved	FLJ25692	uc003xwz.4	Q4G0Z9	OTTHUMG00000157068	ENST00000422365.2:c.1106G>A	8.37:g.67803132G>A	ENSP00000413632:p.Arg369His		B4DYZ3|B4DZM4|B4E293|Q6P533|Q7Z3P4	Missense_Mutation	SNP	pfam_MCM_DNA-dep_ATPase,superfamily_NA-bd_OB-fold,superfamily_P-loop_NTPase,smart_MCM_DNA-dep_ATPase	p.R369H	ENST00000422365.2	37	c.1106	CCDS6197.2	8	.	.	.	.	.	.	.	.	.	.	G	10.42	1.345726	0.24426	.	.	ENSG00000178460	ENST00000379356;ENST00000396592;ENST00000422365;ENST00000313616;ENST00000541540	T;T;T;T	0.32272	1.46;1.46;1.46;1.46	4.84	3.97	0.46021	.	0.166810	0.53938	N	0.000045	T	0.26919	0.0659	L	0.44542	1.39	0.53688	D	0.99997	B;B;B	0.30211	0.273;0.179;0.015	B;B;B	0.26094	0.066;0.03;0.008	T	0.09143	-1.0688	10	0.66056	D	0.02	-5.2519	13.2025	0.59776	0.0778:0.0:0.9222:0.0	.	306;369;369	Q4G0Z9-4;Q4G0Z9;B4DXX4	.;CH045_HUMAN;.	H	241;369;369;369;306	ENSP00000379837:R369H;ENSP00000413632:R369H;ENSP00000317234:R369H;ENSP00000445629:R306H	ENSP00000317234:R369H	R	+	2	0	C8orf45	67965686	1.000000	0.71417	0.995000	0.50966	0.094000	0.18550	5.510000	0.67018	1.160000	0.42584	0.591000	0.81541	CGT	MCMDC2	-	smart_MCM_DNA-dep_ATPase	ENSG00000178460		0.348	MCMDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCMDC2	HGNC	protein_coding	OTTHUMT00000347350.1	-	0.00	55	0	G	NM_173518		67803132	+1	tier1	-	no_errors	ENST00000422365	ensembl	human	known	74_37	missense	60.26	31	47	SNP	1.000	A
MGAM	8972	genome.wustl.edu	37	7	141739972	141739972	+	Splice_Site	SNP	G	G	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr7:141739972G>T	ENST00000549489.2	+	20	2468		c.e20+1		MGAM_ENST00000475668.2_Splice_Site	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)						carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CTACGAGACTGTAAGTAGCTT	0.428																																																	0													137.0	133.0	135.0					7																	141739972		1936	4140	6076	SO:0001630	splice_region_variant	0			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.2373+1G>T	7.37:g.141739972G>T			Q0VAX6|Q75ME7|Q86UM5	Splice_Site	SNP	-	e19+1	ENST00000549489.2	37	c.2373+1	CCDS47727.1	7	.	.	.	.	.	.	.	.	.	.	G	19.23	3.787226	0.70337	.	.	ENSG00000257335	ENST00000549489;ENST00000475668;ENST00000548812	.	.	.	5.25	5.25	0.73442	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.9801	0.89138	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MGAM	141386441	1.000000	0.71417	0.998000	0.56505	0.765000	0.43378	9.342000	0.97044	2.622000	0.88805	0.655000	0.94253	.	MGAM	-	-	ENSG00000257335		0.428	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	HGNC	protein_coding	OTTHUMT00000351244.3		0.00	31	0	G		Intron	141739972	+1			no_errors	ENST00000549489	ensembl	human	known	74_37	splice_site	7.41	50	4	SNP	1.000	T
MIEF2	125170	genome.wustl.edu	37	17	18167166	18167166	+	Missense_Mutation	SNP	G	G	C			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr17:18167166G>C	ENST00000323019.4	+	4	664	c.453G>C	c.(451-453)caG>caC	p.Q151H	MIEF2_ENST00000577216.1_3'UTR|MIEF2_ENST00000395704.4_Missense_Mutation_p.A127P|MIEF2_ENST00000395706.2_Missense_Mutation_p.Q162H	NM_001144900.1|NM_139162.3	NP_001138372.1|NP_631901.2	Q96C03	MID49_HUMAN	mitochondrial elongation factor 2	151					mitochondrion organization (GO:0007005)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein targeting to membrane (GO:0090314)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)											TGGCCAAACAGCTGGCTGGCG	0.657																																																	0													40.0	39.0	39.0					17																	18167166		2203	4299	6502	SO:0001583	missense	0			BC014973	CCDS11193.1, CCDS45624.1, CCDS45625.1	17p11.2	2013-09-23	2013-09-23	2013-09-23	ENSG00000177427	ENSG00000177427			17920	protein-coding gene	gene with protein product		615498	"""Smith-Magenis syndrome chromosome region, candidate 7"""	SMCR7		11997338, 21508961	Standard	NM_001144900		Approved	MGC23130, MiD49	uc010vxq.2	Q96C03	OTTHUMG00000059392	ENST00000323019.4:c.453G>C	17.37:g.18167166G>C	ENSP00000323591:p.Gln151His		J3KPT3|Q6ZRD4|Q96N07	Missense_Mutation	SNP	NULL	p.Q151H	ENST00000323019.4	37	c.453	CCDS11193.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.54|15.54	2.865086|2.865086	0.51482|0.51482	.|.	.|.	ENSG00000177427|ENSG00000177427	ENST00000395704|ENST00000323019;ENST00000395706	T|T;T	0.37752|0.13196	1.18|2.62;2.61	5.32|5.32	3.33|3.33	0.38152|0.38152	.|.	.|0.253708	.|0.41097	.|D	.|0.000942	T|T	0.31263|0.31263	0.0791|0.0791	.|.	.|.	.|.	0.41790|0.41790	D|D	0.989863|0.989863	D|D	0.67145|0.76494	0.996|0.999	P|P	0.61201|0.59703	0.885|0.862	T|T	0.07328|0.07328	-1.0778|-1.0778	8|9	0.41790|0.87932	T|D	0.15|0	-39.1365|-39.1365	11.8225|11.8225	0.52247|0.52247	0.1428:0.0:0.8572:0.0|0.1428:0.0:0.8572:0.0	.|.	127|151	Q96C03-2|Q96C03	.|MID49_HUMAN	P|H	127|151;162	ENSP00000379056:A127P|ENSP00000323591:Q151H;ENSP00000379057:Q162H	ENSP00000379056:A127P|ENSP00000323591:Q151H	A|Q	+|+	1|3	0|2	SMCR7|SMCR7	18107891|18107891	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.916000|0.916000	0.54674|0.54674	5.547000|5.547000	0.67249|0.67249	0.632000|0.632000	0.30432|0.30432	-0.251000|-0.251000	0.11542|0.11542	GCT|CAG	MIEF2	-	NULL	ENSG00000177427		0.657	MIEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIEF2	HGNC	protein_coding	OTTHUMT00000132060.2	-	0.00	26	0	G	NM_139162		18167166	+1	tier1	-	no_errors	ENST00000323019	ensembl	human	known	74_37	missense	26.67	11	4	SNP	1.000	C
MKRN1	23608	genome.wustl.edu	37	7	140158882	140158882	+	Silent	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr7:140158882G>A	ENST00000255977.2	-	4	920	c.696C>T	c.(694-696)caC>caT	p.H232H	MKRN1_ENST00000437223.2_Intron|MKRN1_ENST00000480552.1_Intron|MKRN1_ENST00000481705.1_5'Flank|MKRN1_ENST00000443720.2_Silent_p.H232H|MKRN1_ENST00000474576.1_Silent_p.H168H	NM_013446.3	NP_038474.2	Q9UHC7	MKRN1_HUMAN	makorin ring finger protein 1	232					protein polyubiquitination (GO:0000209)		chromatin binding (GO:0003682)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	16	Melanoma(164;0.00956)					AAGAATCTCCGTGGAGATACA	0.522																																																	0													119.0	115.0	116.0					7																	140158882		2203	4300	6503	SO:0001819	synonymous_variant	0			AF192784	CCDS5860.1, CCDS47725.1	7q34	2013-01-09	2008-08-13		ENSG00000133606	ENSG00000133606		"""RING-type (C3HC4) zinc fingers"""	7112	protein-coding gene	gene with protein product		607754				10843807	Standard	NM_013446		Approved	RNF61	uc003vvt.2	Q9UHC7	OTTHUMG00000157412	ENST00000255977.2:c.696C>T	7.37:g.140158882G>A			A4D1T7|B3KXB4|Q256Y7|Q59G11|Q6GSF1|Q9H0G0|Q9UEZ7|Q9UHW2	Silent	SNP	pfam_Znf_CCCH,pfam_Znf_C3HC4_RING-type,smart_Znf_CCCH,smart_Znf_RING,pfscan_Znf_RING	p.H232	ENST00000255977.2	37	c.696	CCDS5860.1	7																																																																																			MKRN1	-	pfam_Znf_CCCH,smart_Znf_CCCH	ENSG00000133606		0.522	MKRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MKRN1	HGNC	protein_coding	OTTHUMT00000348752.1	-	0.00	18	0	G	NM_013446		140158882	-1	tier1	-	no_errors	ENST00000255977	ensembl	human	known	74_37	silent	42.11	11	8	SNP	1.000	A
MKRN1	23608	genome.wustl.edu	37	7	140158882	140158882	+	Silent	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr7:140158882G>A	ENST00000255977.2	-	4	920	c.696C>T	c.(694-696)caC>caT	p.H232H	MKRN1_ENST00000437223.2_Intron|MKRN1_ENST00000480552.1_Intron|MKRN1_ENST00000481705.1_5'Flank|MKRN1_ENST00000443720.2_Silent_p.H232H|MKRN1_ENST00000474576.1_Silent_p.H168H	NM_013446.3	NP_038474.2	Q9UHC7	MKRN1_HUMAN	makorin ring finger protein 1	232					protein polyubiquitination (GO:0000209)		chromatin binding (GO:0003682)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	16	Melanoma(164;0.00956)					AAGAATCTCCGTGGAGATACA	0.522																																																	0													119.0	115.0	116.0					7																	140158882		2203	4300	6503	SO:0001819	synonymous_variant	0			AF192784	CCDS5860.1, CCDS47725.1	7q34	2013-01-09	2008-08-13		ENSG00000133606	ENSG00000133606		"""RING-type (C3HC4) zinc fingers"""	7112	protein-coding gene	gene with protein product		607754				10843807	Standard	NM_013446		Approved	RNF61	uc003vvt.2	Q9UHC7	OTTHUMG00000157412	ENST00000255977.2:c.696C>T	7.37:g.140158882G>A			A4D1T7|B3KXB4|Q256Y7|Q59G11|Q6GSF1|Q9H0G0|Q9UEZ7|Q9UHW2	Silent	SNP	pfam_Znf_CCCH,pfam_Znf_C3HC4_RING-type,smart_Znf_CCCH,smart_Znf_RING,pfscan_Znf_RING	p.H232	ENST00000255977.2	37	c.696	CCDS5860.1	7																																																																																			MKRN1	-	pfam_Znf_CCCH,smart_Znf_CCCH	ENSG00000133606		0.522	MKRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MKRN1	HGNC	protein_coding	OTTHUMT00000348752.1	-	0.00	19	0	G	NM_013446		140158882	-1	tier1	-	no_errors	ENST00000255977	ensembl	human	known	74_37	silent	42.11	11	8	SNP	1.000	A
MME	4311	genome.wustl.edu	37	3	154859844	154859844	+	Missense_Mutation	SNP	A	A	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr3:154859844A>T	ENST00000460393.1	+	11	1142	c.1022A>T	c.(1021-1023)gAg>gTg	p.E341V	MME_ENST00000462745.1_Missense_Mutation_p.E341V|MME_ENST00000492661.1_Missense_Mutation_p.E341V|MME_ENST00000360490.2_Missense_Mutation_p.E341V|MME_ENST00000493237.1_Missense_Mutation_p.E341V	NM_000902.3|NM_007287.2	NP_000893.2|NP_009218.2	P08473	NEP_HUMAN	membrane metallo-endopeptidase	341					angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cellular protein metabolic process (GO:0044267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to UV-A (GO:0071492)|cellular response to UV-B (GO:0071493)|creatinine metabolic process (GO:0046449)|kidney development (GO:0001822)|peptide metabolic process (GO:0006518)|proteolysis (GO:0006508)|replicative senescence (GO:0090399)|sensory perception of pain (GO:0019233)	axon (GO:0030424)|brush border (GO:0005903)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(31)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)|Liraglutide(DB06655)	ATTACAAATGAGGAAGATGTG	0.373																																																	0													118.0	121.0	120.0					3																	154859844		2203	4300	6503	SO:0001583	missense	0				CCDS3172.1	3q25.2	2012-01-31	2007-02-21		ENSG00000196549	ENSG00000196549	3.4.24.11	"""CD molecules"""	7154	protein-coding gene	gene with protein product	"""neutral endopeptidase"", ""enkephalinase"", ""neprilysin"""	120520					Standard	NM_007287		Approved	CALLA, CD10, NEP	uc003fad.1	P08473	OTTHUMG00000158455	ENST00000460393.1:c.1022A>T	3.37:g.154859844A>T	ENSP00000418525:p.Glu341Val		A8K6U6|D3DNJ9|Q3MIX4	Missense_Mutation	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,prints_Peptidase_M13_C	p.E341V	ENST00000460393.1	37	c.1022	CCDS3172.1	3	.	.	.	.	.	.	.	.	.	.	A	14.04	2.417372	0.42918	.	.	ENSG00000196549	ENST00000492661;ENST00000460393;ENST00000462745;ENST00000493237;ENST00000360490	T;T;T;T;T	0.74209	-0.82;-0.82;-0.82;-0.82;-0.82	6.02	6.02	0.97574	Peptidase M13 (1);	0.251850	0.41938	D	0.000796	T	0.67636	0.2914	L	0.39147	1.195	0.31341	N	0.683653	B	0.29085	0.232	B	0.30943	0.122	T	0.72707	-0.4212	10	0.59425	D	0.04	-31.8745	12.7166	0.57119	0.826:0.174:0.0:0.0	.	341	P08473	NEP_HUMAN	V	341	ENSP00000420389:E341V;ENSP00000418525:E341V;ENSP00000419653:E341V;ENSP00000417079:E341V;ENSP00000353679:E341V	ENSP00000353679:E341V	E	+	2	0	MME	156342538	0.997000	0.39634	0.996000	0.52242	0.989000	0.77384	3.462000	0.53042	2.306000	0.77630	0.482000	0.46254	GAG	MME	-	pfam_Peptidase_M13_N	ENSG00000196549		0.373	MME-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MME	HGNC	protein_coding	OTTHUMT00000351076.1	-	0.00	67	0	A	NM_000902		154859844	+1	tier1	-	no_errors	ENST00000360490	ensembl	human	known	74_37	missense	26.37	67	24	SNP	0.982	T
MMP19	4327	genome.wustl.edu	37	12	56233466	56233466	+	Nonsense_Mutation	SNP	C	C	A	rs536616162		TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr12:56233466C>A	ENST00000322569.4	-	5	671	c.580G>T	c.(580-582)Gag>Tag	p.E194*	MMP19_ENST00000394182.1_5'Flank|MMP19_ENST00000409200.3_Intron|MMP19_ENST00000547487.1_5'Flank|MMP19_ENST00000548629.1_Nonsense_Mutation_p.E171*	NM_002429.4	NP_002420.1	Q99542	MMP19_HUMAN	matrix metallopeptidase 19	194					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|luteolysis (GO:0001554)|ovarian follicle development (GO:0001541)|ovulation from ovarian follicle (GO:0001542)|proteolysis (GO:0006508)|response to cAMP (GO:0051591)|response to hormone (GO:0009725)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.E194K(1)		endometrium(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(2)|skin(2)	26					Marimastat(DB00786)	GTCCAGAACTCGTCTTCGTCG	0.602																																																	1	Substitution - Missense(1)	large_intestine(1)											81.0	61.0	67.0					12																	56233466		2203	4300	6503	SO:0001587	stop_gained	0			X92521	CCDS8895.1, CCDS61146.1	12q14	2005-08-08	2005-08-08			ENSG00000123342			7165	protein-coding gene	gene with protein product		601807	"""matrix metalloproteinase 19"""	MMP18		9232430	Standard	NM_002429		Approved	RASI-1	uc001sib.4	Q99542	OTTHUMG00000170216	ENST00000322569.4:c.580G>T	12.37:g.56233466C>A	ENSP00000313437:p.Glu194*		B4E030|O15278|O95606|Q99580	Nonsense_Mutation	SNP	pfam_Pept_M10_metallopeptidase,pfam_Hemopexin-like_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,pirsf_Pept_M10A_Metazoans,prints_Pept_M10A	p.E194*	ENST00000322569.4	37	c.580	CCDS8895.1	12	.	.	.	.	.	.	.	.	.	.	C	22.4	4.286049	0.80803	.	.	ENSG00000123342	ENST00000322569;ENST00000548629	.	.	.	5.22	5.22	0.72569	.	0.094766	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.7115	0.88323	0.0:1.0:0.0:0.0	.	.	.	.	X	194;171	.	ENSP00000313437:E194X	E	-	1	0	MMP19	54519733	1.000000	0.71417	0.998000	0.56505	0.067000	0.16453	7.288000	0.78691	2.721000	0.93114	0.511000	0.50034	GAG	MMP19	-	pfam_Pept_M10_metallopeptidase,smart_Peptidase_Metallo,pirsf_Pept_M10A_Metazoans	ENSG00000123342		0.602	MMP19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP19	HGNC	protein_coding	OTTHUMT00000408023.1		0.00	33	0	C	NM_002429		56233466	-1			no_errors	ENST00000322569	ensembl	human	known	74_37	nonsense	5.41	35	2	SNP	1.000	A
MSR1	4481	genome.wustl.edu	37	8	16012634	16012634	+	Silent	SNP	A	A	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr8:16012634A>G	ENST00000262101.5	-	6	958	c.837T>C	c.(835-837)ggT>ggC	p.G279G	MSR1_ENST00000536385.1_Silent_p.G53G|MSR1_ENST00000355282.2_Silent_p.G279G|MSR1_ENST00000381998.4_Silent_p.G279G|MSR1_ENST00000445506.2_Silent_p.G297G|MSR1_ENST00000350896.3_Silent_p.G279G			P21757	MSRE_HUMAN	macrophage scavenger receptor 1	279	Collagen-like.				cholesterol transport (GO:0030301)|lipoprotein transport (GO:0042953)|plasma lipoprotein particle clearance (GO:0034381)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|plasma membrane (GO:0005886)	low-density lipoprotein particle binding (GO:0030169)|scavenger receptor activity (GO:0005044)			haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(7)|lung(14)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	37				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)		CTCCTTTTTCACCCGGGGGTC	0.393																																																	0													59.0	59.0	59.0					8																	16012634		2203	4300	6503	SO:0001819	synonymous_variant	0			D13263	CCDS5995.1, CCDS5996.1, CCDS5997.1	8p22	2006-02-22			ENSG00000038945	ENSG00000038945		"""CD molecules"""	7376	protein-coding gene	gene with protein product		153622				2251254	Standard	NM_138715		Approved	SCARA1, CD204	uc003wwz.3	P21757	OTTHUMG00000094809	ENST00000262101.5:c.837T>C	8.37:g.16012634A>G			D3DSP3|O60505|P21759|Q45F10	Silent	SNP	pfam_SRCR,pfam_Macro_scav_rcpt,pfam_Collagen,superfamily_Srcr_rcpt-rel,superfamily_STAT_TF_coiled-coil,smart_Srcr_rcpt-rel,prints_Macro_scav_rcpt,prints_SRCR,pfscan_SRCR	p.G279	ENST00000262101.5	37	c.837	CCDS5995.1	8																																																																																			MSR1	-	pfam_Collagen	ENSG00000038945		0.393	MSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSR1	HGNC	protein_coding	OTTHUMT00000211627.2	-	0.00	53	0	A			16012634	-1	tier1	-	no_errors	ENST00000262101	ensembl	human	known	74_37	silent	33.33	20	10	SNP	0.996	G
MT-CO1	4512	genome.wustl.edu	37	M	5999	5999	+	Silent	SNP	T	T	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chrM:5999T>G	ENST00000361624.2	+	1	96	c.96T>G	c.(94-96)gcT>gcG	p.A32A	MT-ATP8_ENST00000361851.1_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-CO2_ENST00000361739.1_5'Flank|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	32					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						CTAGGCACAGCTCTAAGCCTC	0.493																																																	0																																										SO:0001819	synonymous_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.96T>G	M.37:g.5999T>G			Q34770	Silent	SNP	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1	p.A32	ENST00000361624.2	37	c.96		MT																																																																																			MT-CO1	-	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom	ENSG00000198804		0.493	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-CO1	HGNC	protein_coding		-	0.00	170	0	T	YP_003024028		5999	+1	tier1	-	no_errors	ENST00000361624	ensembl	human	known	74_37	silent	11.11	48	6	SNP	NULL	G
MTUS1	57509	genome.wustl.edu	37	8	17507462	17507462	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr8:17507462G>T	ENST00000262102.6	-	13	3618	c.3394C>A	c.(3394-3396)Cag>Aag	p.Q1132K	MTUS1_ENST00000381869.3_Missense_Mutation_p.Q1078K|MTUS1_ENST00000519263.1_Missense_Mutation_p.Q1078K|MTUS1_ENST00000381861.3_Missense_Mutation_p.Q379K|MTUS1_ENST00000400046.1_Missense_Mutation_p.Q204K|MTUS1_ENST00000544260.1_Missense_Mutation_p.Q277K|MTUS1_ENST00000297488.6_Missense_Mutation_p.Q298K|MTUS1_ENST00000518713.1_5'UTR	NM_001001924.2	NP_001001924.1	Q9ULD2	MTUS1_HUMAN	microtubule associated tumor suppressor 1	1132					cellular response to peptide hormone stimulus (GO:0071375)|regulation of macrophage chemotaxis (GO:0010758)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.Q379*(1)|p.Q1132*(1)|p.Q298*(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(14)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	36				Colorectal(111;0.0778)		TACATGATCTGAGGATTTTTC	0.353																																																	3	Substitution - Nonsense(3)	endometrium(3)											149.0	133.0	138.0					8																	17507462		1859	4091	5950	SO:0001583	missense	0			AL096842	CCDS43716.1, CCDS43717.1, CCDS43718.1, CCDS43719.1, CCDS55204.1	8p22	2013-01-17	2009-10-20		ENSG00000129422	ENSG00000129422			29789	protein-coding gene	gene with protein product	"""AT2 receptor-interacting protein"", ""AT2R binding protein"", ""mitochondrial tumor suppressor gene 1"""	609589	"""mitochondrial tumor suppressor 1"""			10574462, 12692079	Standard	NM_001001931		Approved	MTSG1, KIAA1288, DKFZp586D1519, FLJ14295, ATIP1, MP44, ATBP, ICIS	uc003wxv.3	Q9ULD2	OTTHUMG00000163756	ENST00000262102.6:c.3394C>A	8.37:g.17507462G>T	ENSP00000262102:p.Gln1132Lys		A8K135|B2RBJ6|B3KWJ9|B4DH03|B9EGA1|D3DSP8|Q63HJ6|Q659F4|Q6PK49|Q6URW7|Q8N4M6|Q8WTT9|Q9H7T2	Missense_Mutation	SNP	superfamily_Ferritin-like_SF	p.Q1132K	ENST00000262102.6	37	c.3394	CCDS43717.1	8	.	.	.	.	.	.	.	.	.	.	G	16.19	3.052005	0.55218	.	.	ENSG00000129422	ENST00000381869;ENST00000544260;ENST00000400046;ENST00000297488;ENST00000381861;ENST00000262102;ENST00000519263	T;T;T;T;T;T;T	0.76968	-1.06;-1.06;-1.06;-1.06;-1.06;-1.06;-1.06	5.41	5.41	0.78517	.	0.048793	0.85682	D	0.000000	T	0.80048	0.4552	M	0.64997	1.995	0.80722	D	1	P;P;P;P	0.48162	0.746;0.746;0.906;0.69	P;P;P;B	0.50440	0.487;0.557;0.641;0.439	T	0.75297	-0.3367	10	0.06099	T	0.92	-18.4008	19.5817	0.95469	0.0:0.0:1.0:0.0	.	1078;1132;379;298	Q9ULD2-2;Q9ULD2;Q9ULD2-6;Q9ULD2-3	.;MTUS1_HUMAN;.;.	K	1078;277;204;298;379;1132;1078	ENSP00000371293:Q1078K;ENSP00000445738:Q277K;ENSP00000382921:Q204K;ENSP00000297488:Q298K;ENSP00000371285:Q379K;ENSP00000262102:Q1132K;ENSP00000430167:Q1078K	ENSP00000262102:Q1132K	Q	-	1	0	MTUS1	17551742	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.579000	0.82511	2.712000	0.92718	0.557000	0.71058	CAG	MTUS1	-	NULL	ENSG00000129422		0.353	MTUS1-001	KNOWN	basic|CCDS	protein_coding	MTUS1	HGNC	protein_coding	OTTHUMT00000375247.1		0.00	49	0	G	XM_372031		17507462	-1			no_errors	ENST00000262102	ensembl	human	known	74_37	missense	5.26	35	2	SNP	1.000	T
MUC16	94025	genome.wustl.edu	37	19	9085345	9085345	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr19:9085345G>T	ENST00000397910.4	-	1	6673	c.6470C>A	c.(6469-6471)tCt>tAt	p.S2157Y		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	2157	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGTAAGGCCAGAAACATCTGA	0.493																																																	0													61.0	60.0	61.0					19																	9085345		1920	4126	6046	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.6470C>A	19.37:g.9085345G>T	ENSP00000381008:p.Ser2157Tyr		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.S2157Y	ENST00000397910.4	37	c.6470	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	0.738	-0.777497	0.02929	.	.	ENSG00000181143	ENST00000397910	T	0.02737	4.18	0.495	0.495	0.16890	.	.	.	.	.	T	0.04137	0.0115	N	0.08118	0	.	.	.	D	0.58970	0.984	D	0.63877	0.919	T	0.46091	-0.9216	7	0.87932	D	0	.	.	.	.	.	2157	B5ME49	.	Y	2157	ENSP00000381008:S2157Y	ENSP00000381008:S2157Y	S	-	2	0	MUC16	8946345	0.008000	0.16893	0.016000	0.15963	0.013000	0.08279	0.913000	0.28611	0.502000	0.28037	0.313000	0.20887	TCT	MUC16	-	NULL	ENSG00000181143		0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	46	0	G	NM_024690		9085345	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	26.32	42	15	SNP	0.018	T
MYBPC3	4607	genome.wustl.edu	37	11	47372077	47372077	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr11:47372077C>T	ENST00000545968.1	-	3	436	c.382G>A	c.(382-384)Gga>Aga	p.G128R	MYBPC3_ENST00000399249.2_Missense_Mutation_p.G128R|MYBPC3_ENST00000256993.4_Missense_Mutation_p.G128R	NM_000256.3	NP_000247.2	Q14896	MYPC3_HUMAN	myosin binding protein C, cardiac	128	Pro-rich.				cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|heart morphogenesis (GO:0003007)|muscle filament sliding (GO:0030049)|myosin filament assembly (GO:0031034)|positive regulation of ATPase activity (GO:0032781)|regulation of heart rate (GO:0002027)|regulation of muscle filament sliding (GO:0032971)|regulation of striated muscle contraction (GO:0006942)|sarcomere organization (GO:0045214)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	A band (GO:0031672)|C zone (GO:0014705)|cytosol (GO:0005829)|sarcomere (GO:0030017)|striated muscle myosin thick filament (GO:0005863)	ATPase activator activity (GO:0001671)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|myosin binding (GO:0017022)|myosin heavy chain binding (GO:0032036)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(4)|lung(16)|ovary(3)|prostate(3)|urinary_tract(2)	42				Lung(87;0.176)		GCACTTTCTCCCAGCTCAGCG	0.677																																																	0													15.0	16.0	16.0					11																	47372077		1848	4080	5928	SO:0001583	missense	0			X84075	CCDS53621.1	11p11.2	2014-09-17	2001-11-28			ENSG00000134571		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7551	protein-coding gene	gene with protein product		600958	"""myosin-binding protein C, cardiac"""	CMH4		7744002, 8358441	Standard	NM_000256		Approved	MYBP-C, FHC	uc021qis.1	Q14896		ENST00000545968.1:c.382G>A	11.37:g.47372077C>T	ENSP00000442795:p.Gly128Arg		A5PL00|Q16410|Q6R2F7|Q9UE27|Q9UM53	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.G128R	ENST00000545968.1	37	c.382	CCDS53621.1	11	.	.	.	.	.	.	.	.	.	.	C	9.673	1.147316	0.21288	.	.	ENSG00000134571	ENST00000545968;ENST00000399249;ENST00000256993	T;T;T	0.56611	0.45;0.45;0.5	3.07	2.15	0.27550	.	.	.	.	.	T	0.26340	0.0643	N	0.08118	0	0.09310	N	1	B	0.15141	0.012	B	0.09377	0.004	T	0.20538	-1.0272	9	0.12430	T	0.62	.	6.2865	0.21037	0.0:0.861:0.0:0.139	.	128	Q14896	MYPC3_HUMAN	R	128	ENSP00000442795:G128R;ENSP00000382193:G128R;ENSP00000256993:G128R	ENSP00000256993:G128R	G	-	1	0	MYBPC3	47328653	0.009000	0.17119	0.025000	0.17156	0.198000	0.23893	2.290000	0.43531	0.879000	0.35944	0.462000	0.41574	GGA	MYBPC3	-	NULL	ENSG00000134571		0.677	MYBPC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYBPC3	HGNC	protein_coding	OTTHUMT00000392271.3	-	0.00	155	0	C			47372077	-1	tier1	-	no_errors	ENST00000399249	ensembl	human	known	74_37	missense	73.94	37	105	SNP	0.147	T
MYCL	4610	genome.wustl.edu	37	1	40363557	40363557	+	Silent	SNP	G	G	A	rs544662303	byFrequency	TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:40363557G>A	ENST00000372816.2	-	2	1029	c.582C>T	c.(580-582)gaC>gaT	p.D194D	RP1-118J21.5_ENST00000418255.1_RNA|MYCL_ENST00000397332.2_Silent_p.D224D			P12524	MYCL_HUMAN	v-myc avian myelocytomatosis viral oncogene lung carcinoma derived homolog	194						nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GATCCAGGGGGTCTGCTCGCA	0.512																																																	0													98.0	100.0	99.0					1																	40363557		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS30682.1, CCDS44117.1, CCDS44117.2, CCDS53300.1	1p34.3	2013-07-09	2013-07-09	2013-07-09	ENSG00000116990	ENSG00000116990		"""Basic helix-loop-helix proteins"""	7555	protein-coding gene	gene with protein product	"""l-myc protein"", ""myc-related gene from lung cancer"", ""oncogene lmyc"""	164850	"""v-myc avian myelocytomatosis viral oncogene homolog 1, lung carcinoma derived"""	MYCL1		8978772	Standard	NM_001033082		Approved	LMYC, bHLHe38	uc001cer.2	P12524	OTTHUMG00000009243	ENST00000372816.2:c.582C>T	1.37:g.40363557G>A			A2A2C9|B4DJH2|Q14897|Q5QPL0|Q5QPL1|Q9NUE9	Silent	SNP	pfam_Tscrpt_reg_Myc_N,pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom,prints_Tscrpt_reg_Myc	p.D194	ENST00000372816.2	37	c.582	CCDS30682.1	1																																																																																			MYCL	-	pfam_Tscrpt_reg_Myc_N	ENSG00000116990		0.512	MYCL-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYCL	HGNC	protein_coding	OTTHUMT00000277004.1	-	0.00	47	0	G	NM_001033082		40363557	-1	tier1	-	no_errors	ENST00000372816	ensembl	human	known	74_37	silent	26.42	39	14	SNP	1.000	A
MYO7A	4647	genome.wustl.edu	37	11	76900423	76900423	+	Missense_Mutation	SNP	A	A	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr11:76900423A>G	ENST00000409709.3	+	28	3810	c.3538A>G	c.(3538-3540)Acc>Gcc	p.T1180A	MYO7A_ENST00000409619.2_Missense_Mutation_p.T1169A|MYO7A_ENST00000458637.2_Missense_Mutation_p.T1180A	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	1180	MyTH4 1. {ECO:0000255|PROSITE- ProRule:PRU00359}.				actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						CAAGCAGCTGACCCACAACCC	0.622																																																	0													64.0	75.0	72.0					11																	76900423		2084	4179	6263	SO:0001583	missense	0			U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.3538A>G	11.37:g.76900423A>G	ENSP00000386331:p.Thr1180Ala		B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_FERM_central,pfam_FERM_N,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_Band_41_domain,smart_SH3_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_SH3_domain,prints_Myosin_head_motor_dom	p.T1180A	ENST00000409709.3	37	c.3538	CCDS53683.1	11	.	.	.	.	.	.	.	.	.	.	.	20.7	4.034035	0.75504	.	.	ENSG00000137474	ENST00000409709;ENST00000458637;ENST00000409619;ENST00000545136;ENST00000358342;ENST00000343356;ENST00000341717;ENST00000458169	D;D;D;D	0.92495	-3.05;-3.05;-3.05;-3.05	5.43	5.43	0.79202	MyTH4 domain (3);	0.208449	0.44483	D	0.000447	D	0.95711	0.8605	M	0.94021	3.485	0.58432	D	0.999995	B;P;P	0.44946	0.177;0.624;0.846	B;B;P	0.49683	0.363;0.386;0.619	D	0.96431	0.9319	10	0.62326	D	0.03	.	15.4979	0.75669	1.0:0.0:0.0:0.0	.	1169;1180;1180	B9A011;F8VUN5;Q13402	.;.;MYO7A_HUMAN	A	1180;1180;1169;391;1179;1149;1056;361	ENSP00000386331:T1180A;ENSP00000392185:T1180A;ENSP00000386635:T1169A;ENSP00000417017:T361A	ENSP00000345075:T1056A	T	+	1	0	MYO7A	76578071	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.152000	0.77419	2.060000	0.61445	0.523000	0.50628	ACC	MYO7A	-	pfam_MyTH4_dom,smart_MyTH4_dom,pfscan_MyTH4_dom	ENSG00000137474		0.622	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	MYO7A	HGNC	protein_coding	OTTHUMT00000328133.1	-	0.00	34	0	A	NM_000260		76900423	+1	tier1	-	no_errors	ENST00000409709	ensembl	human	known	74_37	missense	16.67	40	8	SNP	1.000	G
NAALADL2	254827	genome.wustl.edu	37	3	175293960	175293960	+	Silent	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr3:175293960C>T	ENST00000454872.1	+	10	1913	c.1785C>T	c.(1783-1785)gaC>gaT	p.D595D	NAALADL2_ENST00000473253.1_3'UTR	NM_207015.2	NP_996898.2	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase-like 2	595						integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(20)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	49	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		CTTACGAGGACATCAAAACAT	0.373																																																	0													156.0	151.0	153.0					3																	175293960		1877	4113	5990	SO:0001819	synonymous_variant	0				CCDS46960.1	3q26.3	2011-08-16			ENSG00000177694	ENSG00000177694			23219	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase II-type non-peptidase homologue"""	608806				15168106	Standard	NM_207015		Approved		uc003fir.3	Q58DX5	OTTHUMG00000157120	ENST00000454872.1:c.1785C>T	3.37:g.175293960C>T			Q658X9|Q6H9J8|Q6H9J9|Q6PG38	Silent	SNP	superfamily_TFR-like_dimer_dom	p.D595	ENST00000454872.1	37	c.1785	CCDS46960.1	3																																																																																			NAALADL2	-	NULL	ENSG00000177694		0.373	NAALADL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAALADL2	HGNC	protein_coding	OTTHUMT00000347390.2	-	0.00	40	0	C	NM_207015		175293960	+1	tier1	-	no_errors	ENST00000454872	ensembl	human	known	74_37	silent	22.00	39	11	SNP	0.998	T
NBEA	26960	genome.wustl.edu	37	13	35731369	35731369	+	Missense_Mutation	SNP	A	A	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr13:35731369A>G	ENST00000400445.3	+	21	3340	c.2806A>G	c.(2806-2808)Aga>Gga	p.R936G	NBEA_ENST00000540320.1_Missense_Mutation_p.R936G|NBEA_ENST00000379939.2_Missense_Mutation_p.R936G|NBEA_ENST00000310336.4_Missense_Mutation_p.R936G	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	936					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		GGGAGGCTGGAGAGTCTGGGT	0.388																																																	0													64.0	66.0	66.0					13																	35731369		1852	4093	5945	SO:0001583	missense	0			AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.2806A>G	13.37:g.35731369A>G	ENSP00000383295:p.Arg936Gly		B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_DUF1088,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_ConA-like_lec_gl_sf,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat_dom	p.R936G	ENST00000400445.3	37	c.2806	CCDS45026.1	13	.	.	.	.	.	.	.	.	.	.	A	20.2	3.958056	0.73902	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336	T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13	5.37	2.72	0.32119	.	0.000000	0.85682	D	0.000000	T	0.77618	0.4157	M	0.81497	2.545	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	T	0.80453	-0.1376	10	0.87932	D	0	.	12.1123	0.53846	0.7292:0.2708:0.0:0.0	.	936	Q5T321	.	G	936	ENSP00000440951:R936G;ENSP00000383295:R936G;ENSP00000369271:R936G;ENSP00000308534:R936G	ENSP00000308534:R936G	R	+	1	2	NBEA	34629369	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.495000	0.35627	0.969000	0.38237	0.528000	0.53228	AGA	NBEA	-	superfamily_ARM-type_fold	ENSG00000172915		0.388	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NBEA	HGNC	protein_coding		-	0.00	36	0	A	NM_015678		35731369	+1	tier1	-	no_errors	ENST00000310336	ensembl	human	known	74_37	missense	35.71	18	10	SNP	1.000	G
NEB	4703	genome.wustl.edu	37	2	152531850	152531850	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr2:152531850T>C	ENST00000172853.10	-	35	3977	c.3830A>G	c.(3829-3831)gAt>gGt	p.D1277G	NEB_ENST00000427231.2_Missense_Mutation_p.D1277G|NEB_ENST00000603639.1_Missense_Mutation_p.D1277G|NEB_ENST00000409198.1_Missense_Mutation_p.D1277G|NEB_ENST00000397345.3_Missense_Mutation_p.D1277G|NEB_ENST00000604864.1_Missense_Mutation_p.D1277G			P20929	NEBU_HUMAN	nebulin	1277					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		CTGAGGAAGATCAGGACTCAT	0.368																																																	0													183.0	186.0	185.0					2																	152531850		1893	4113	6006	SO:0001583	missense	0			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.3830A>G	2.37:g.152531850T>C	ENSP00000172853:p.Asp1277Gly		F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,pfscan_Nebulin_35r-motif,pfscan_SH3_domain,prints_Nebulin	p.D1277G	ENST00000172853.10	37	c.3830		2	.	.	.	.	.	.	.	.	.	.	T	21.8	4.207323	0.79240	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.68765	-0.35;-0.35;-0.35;-0.35	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.80314	0.4600	M	0.75447	2.3	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80049	-0.1545	10	0.38643	T	0.18	.	13.5283	0.61607	0.0:0.0:0.0:1.0	.	1277	P20929	NEBU_HUMAN	G	1277	ENSP00000386259:D1277G;ENSP00000380505:D1277G;ENSP00000416578:D1277G;ENSP00000172853:D1277G	ENSP00000172853:D1277G	D	-	2	0	NEB	152240096	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.285000	0.58989	2.080000	0.62538	0.528000	0.53228	GAT	NEB	-	pfam_Nebulin_35r-motif,smart_Nebulin_35r-motif,pfscan_Nebulin_35r-motif	ENSG00000183091		0.368	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding		-	0.00	38	0	T	NM_004543		152531850	-1	tier1	-	no_errors	ENST00000397345	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	C
NEB	4703	genome.wustl.edu	37	2	152531850	152531850	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr2:152531850T>C	ENST00000172853.10	-	35	3977	c.3830A>G	c.(3829-3831)gAt>gGt	p.D1277G	NEB_ENST00000427231.2_Missense_Mutation_p.D1277G|NEB_ENST00000603639.1_Missense_Mutation_p.D1277G|NEB_ENST00000409198.1_Missense_Mutation_p.D1277G|NEB_ENST00000397345.3_Missense_Mutation_p.D1277G|NEB_ENST00000604864.1_Missense_Mutation_p.D1277G			P20929	NEBU_HUMAN	nebulin	1277					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		CTGAGGAAGATCAGGACTCAT	0.368																																																	0													183.0	186.0	185.0					2																	152531850		1893	4113	6006	SO:0001583	missense	0			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.3830A>G	2.37:g.152531850T>C	ENSP00000172853:p.Asp1277Gly		F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,pfscan_Nebulin_35r-motif,pfscan_SH3_domain,prints_Nebulin	p.D1277G	ENST00000172853.10	37	c.3830		2	.	.	.	.	.	.	.	.	.	.	T	21.8	4.207323	0.79240	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.68765	-0.35;-0.35;-0.35;-0.35	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.80314	0.4600	M	0.75447	2.3	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80049	-0.1545	10	0.38643	T	0.18	.	13.5283	0.61607	0.0:0.0:0.0:1.0	.	1277	P20929	NEBU_HUMAN	G	1277	ENSP00000386259:D1277G;ENSP00000380505:D1277G;ENSP00000416578:D1277G;ENSP00000172853:D1277G	ENSP00000172853:D1277G	D	-	2	0	NEB	152240096	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.285000	0.58989	2.080000	0.62538	0.528000	0.53228	GAT	NEB	-	pfam_Nebulin_35r-motif,smart_Nebulin_35r-motif,pfscan_Nebulin_35r-motif	ENSG00000183091		0.368	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding		-	0.00	82	0	T	NM_004543		152531850	-1	tier1	-	no_errors	ENST00000397345	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	C
NID1	4811	genome.wustl.edu	37	1	236175225	236175225	+	Silent	SNP	G	G	A	rs371961637		TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:236175225G>A	ENST00000264187.6	-	12	2605	c.2523C>T	c.(2521-2523)ccC>ccT	p.P841P	NID1_ENST00000366595.3_Intron	NM_002508.2	NP_002499.2	P14543	NID1_HUMAN	nidogen 1	841					basement membrane organization (GO:0071711)|cell-matrix adhesion (GO:0007160)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|positive regulation of cell-substrate adhesion (GO:0010811)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|cell periphery (GO:0071944)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)			breast(4)|endometrium(9)|kidney(1)|large_intestine(23)|lung(20)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(1)	66	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Urokinase(DB00013)	CCTTACCTCCGGGCACGCAAC	0.572																																																	0								G		0,4406		0,0,2203	135.0	108.0	118.0		2523	-3.4	1.0	1		118	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	NID1	NM_002508.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		841/1248	236175225	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			BC045606	CCDS1608.1	1q43	2011-05-08	2005-06-02	2005-06-02	ENSG00000116962	ENSG00000116962			7821	protein-coding gene	gene with protein product		131390	"""nidogen (enactin)"""	NID		2471408, 7557988	Standard	NM_002508		Approved	entactin	uc001hxo.3	P14543	OTTHUMG00000040071	ENST00000264187.6:c.2523C>T	1.37:g.236175225G>A			Q14942|Q59FL2|Q5TAF2|Q5TAF3|Q86XD7	Silent	SNP	pfam_G2_nidogen/fibulin_G2F,pfam_LDLR_classB_rpt,pfam_Nidogen_extracell_dom,pfam_Thyroglobulin_1,pfam_EGF-like_Ca-bd_dom,superfamily_GFP,superfamily_Thyroglobulin_1,smart_Nidogen_extracell_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_G2_nidogen/fibulin_G2F,smart_Thyroglobulin_1,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDLR_classB_rpt,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thyroglobulin_1	p.P841	ENST00000264187.6	37	c.2523	CCDS1608.1	1																																																																																			NID1	-	superfamily_Thyroglobulin_1	ENSG00000116962		0.572	NID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NID1	HGNC	protein_coding	OTTHUMT00000096647.2		0.00	38	0	G	NM_002508		236175225	-1			no_errors	ENST00000264187	ensembl	human	known	74_37	silent	5.45	52	3	SNP	0.997	A
NKX2-2	4821	genome.wustl.edu	37	20	21492202	21492202	+	3'UTR	SNP	G	G	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr20:21492202G>T	ENST00000377142.4	-	0	1537				NKX2-2-AS1_ENST00000549659.1_RNA	NM_002509.3	NP_002500.1	O95096	NKX22_HUMAN	NK2 homeobox 2						astrocyte differentiation (GO:0048708)|brain development (GO:0007420)|digestive tract development (GO:0048565)|endocrine pancreas development (GO:0031018)|negative regulation of neuron differentiation (GO:0045665)|neuron fate specification (GO:0048665)|oligodendrocyte development (GO:0014003)|optic nerve development (GO:0021554)|pancreatic A cell fate commitment (GO:0003326)|pancreatic PP cell fate commitment (GO:0003329)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)|spinal cord oligodendrocyte cell fate specification (GO:0021530)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell fate commitment (GO:0003327)|ventral spinal cord interneuron fate determination (GO:0060580)	nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|core promoter proximal region DNA binding (GO:0001159)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21						AGCAGGGGTGGGGGGTCGGTC	0.473																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF019415	CCDS13145.1	20p11.22	2012-03-09	2007-07-09	2002-10-04	ENSG00000125820	ENSG00000125820		"""Homeoboxes / ANTP class : NKL subclass"""	7835	protein-coding gene	gene with protein product		604612	"""NK-2 (Drosophila) homolog B"", ""NK2 transcription factor related, locus 2 (Drosophila)"""	NKX2B		9703340, 1346742	Standard	NM_002509		Approved	NKX2.2	uc002wsi.3	O95096	OTTHUMG00000170524	ENST00000377142.4:c.*359C>A	20.37:g.21492202G>T				RNA	SNP	-	NULL	ENST00000377142.4	37	NULL	CCDS13145.1	20																																																																																			NKX2-2-AS1	-	-	ENSG00000258197		0.473	NKX2-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKX2-2-AS1	HGNC	protein_coding	OTTHUMT00000078278.9	-	0.00	55	0	G			21492202	+1	tier1	-	no_errors	ENST00000549659	ensembl	human	known	74_37	rna	8.89	41	4	SNP	0.015	T
NKX2-2	4821	genome.wustl.edu	37	20	21492202	21492202	+	3'UTR	SNP	G	G	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr20:21492202G>T	ENST00000377142.4	-	0	1537				NKX2-2-AS1_ENST00000549659.1_RNA	NM_002509.3	NP_002500.1	O95096	NKX22_HUMAN	NK2 homeobox 2						astrocyte differentiation (GO:0048708)|brain development (GO:0007420)|digestive tract development (GO:0048565)|endocrine pancreas development (GO:0031018)|negative regulation of neuron differentiation (GO:0045665)|neuron fate specification (GO:0048665)|oligodendrocyte development (GO:0014003)|optic nerve development (GO:0021554)|pancreatic A cell fate commitment (GO:0003326)|pancreatic PP cell fate commitment (GO:0003329)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)|spinal cord oligodendrocyte cell fate specification (GO:0021530)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell fate commitment (GO:0003327)|ventral spinal cord interneuron fate determination (GO:0060580)	nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|core promoter proximal region DNA binding (GO:0001159)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21						AGCAGGGGTGGGGGGTCGGTC	0.473																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF019415	CCDS13145.1	20p11.22	2012-03-09	2007-07-09	2002-10-04	ENSG00000125820	ENSG00000125820		"""Homeoboxes / ANTP class : NKL subclass"""	7835	protein-coding gene	gene with protein product		604612	"""NK-2 (Drosophila) homolog B"", ""NK2 transcription factor related, locus 2 (Drosophila)"""	NKX2B		9703340, 1346742	Standard	NM_002509		Approved	NKX2.2	uc002wsi.3	O95096	OTTHUMG00000170524	ENST00000377142.4:c.*359C>A	20.37:g.21492202G>T				RNA	SNP	-	NULL	ENST00000377142.4	37	NULL	CCDS13145.1	20																																																																																			NKX2-2-AS1	-	-	ENSG00000258197		0.473	NKX2-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKX2-2-AS1	HGNC	protein_coding	OTTHUMT00000078278.9	-	0.00	65	0	G			21492202	+1	tier1	-	no_errors	ENST00000549659	ensembl	human	known	74_37	rna	8.89	41	4	SNP	0.015	T
NKX2-6	137814	genome.wustl.edu	37	8	23560561	23560561	+	Silent	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr8:23560561G>A	ENST00000325017.3	-	2	308	c.309C>T	c.(307-309)ggC>ggT	p.G103G	NKX2-6_ENST00000418222.1_Silent_p.G21G	NM_001136271.2	NP_001129743.2	A6NCS4	NKX26_HUMAN	NK2 homeobox 6	103					atrial cardiac muscle cell development (GO:0055014)|cell differentiation (GO:0030154)|digestive tract development (GO:0048565)|embryonic heart tube development (GO:0035050)|hypothalamus development (GO:0021854)|negative regulation of apoptotic process (GO:0043066)|pericardium development (GO:0060039)|pharyngeal system development (GO:0060037)|positive regulation of cell proliferation (GO:0008284)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|ventricular cardiac muscle cell development (GO:0055015)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)										CCCTGGTCCCGCCGCCGAGGG	0.701																																																	0													1.0	2.0	2.0					8																	23560561		416	1160	1576	SO:0001819	synonymous_variant	0			CN272646		8p21.2	2012-03-09	2011-06-01			ENSG00000180053		"""Homeoboxes / ANTP class : NKL subclass"""	32940	protein-coding gene	gene with protein product	"""tinman paralog (Drosophila)"""	611770	"""NK2 transcription factor related, locus 6 (Drosophila)"""			15649947	Standard	NM_001136271		Approved	CSX2, NKX4-2	uc011kzy.3	A6NCS4		ENST00000325017.3:c.309C>T	8.37:g.23560561G>A				Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.G103	ENST00000325017.3	37	c.309		8																																																																																			NKX2-6	-	NULL	ENSG00000180053		0.701	NKX2-6-001	KNOWN	basic|appris_principal	protein_coding	NKX2-6	HGNC	protein_coding	OTTHUMT00000376057.4	-	0.00	13	0	G	NM_001136271		23560561	-1	tier1	-	no_errors	ENST00000325017	ensembl	human	known	74_37	silent	59.26	11	16	SNP	0.004	A
NOB1	28987	genome.wustl.edu	37	16	69778842	69778842	+	Silent	SNP	G	G	A	rs147206895		TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr16:69778842G>A	ENST00000268802.5	-	8	932	c.903C>T	c.(901-903)agC>agT	p.S301S	CTD-2033A16.3_ENST00000575838.1_RNA	NM_014062.1	NP_054781.1	Q9ULX3	NOB1_HUMAN	NIN1/RPN12 binding protein 1 homolog (S. cerevisiae)	301					visual perception (GO:0007601)	nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(2)|cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						TGCCGTCGTCGCTGACGGTCA	0.612																																																	0								G		0,4396		0,0,2198	85.0	65.0	72.0		903	-1.9	0.0	16	dbSNP_134	72	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	NOB1	NM_014062.1		0,1,6497	AA,AG,GG		0.0116,0.0,0.0077		301/413	69778842	1,12995	2198	4300	6498	SO:0001819	synonymous_variant	0			AB026125	CCDS10884.1	16q22.1	2008-02-05	2006-04-20	2006-04-20	ENSG00000141101	ENSG00000141101			29540	protein-coding gene	gene with protein product	"""nin one binding protein"""	613586	"""PSMD8 binding protein 1"""	PSMD8BP1		16172919	Standard	NM_014062		Approved	NOB1P, ART-4, MST158	uc002exs.4	Q9ULX3	OTTHUMG00000137576	ENST00000268802.5:c.903C>T	16.37:g.69778842G>A			Q7L6B7|Q7M4M4|Q7Z4B5|Q9NWB0	Silent	SNP	pfam_NOB1_Zn-bd,smart_PIN_dom,pirsf_D-site_20S_pre-rRNA_nuclease	p.S301	ENST00000268802.5	37	c.903	CCDS10884.1	16																																																																																			NOB1	-	pfam_NOB1_Zn-bd,pirsf_D-site_20S_pre-rRNA_nuclease	ENSG00000141101		0.612	NOB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOB1	HGNC	protein_coding	OTTHUMT00000268958.2	-	0.00	44	0	G	NM_014062		69778842	-1	tier1	rs147206895	no_errors	ENST00000268802	ensembl	human	known	74_37	silent	10.81	33	4	SNP	0.144	A
NOS1	4842	genome.wustl.edu	37	12	117724013	117724013	+	Missense_Mutation	SNP	T	T	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr12:117724013T>A	ENST00000338101.4	-	5	1190	c.1186A>T	c.(1186-1188)Act>Tct	p.T396S	NOS1_ENST00000344089.3_3'UTR|NOS1_ENST00000317775.6_Missense_Mutation_p.T396S			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		TAAGTGCTAGTGGTGTCGATC	0.557																																					Esophageal Squamous(162;1748 2599 51982 52956)												0													186.0	183.0	184.0					12																	117724013		2157	4290	6447	SO:0001583	missense	0				CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.1186A>T	12.37:g.117724013T>A	ENSP00000337459:p.Thr396Ser			Missense_Mutation	SNP	pfam_NO_synthase_oxygenase_dom,pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,pfam_PDZ,superfamily_NO_synthase_oxygenase_dom,superfamily_Riboflavin_synthase-like_b-brl,superfamily_PDZ,smart_PDZ,pirsf_NOS_euk,pfscan_PDZ,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.T396S	ENST00000338101.4	37	c.1186	CCDS55890.1	12	.	.	.	.	.	.	.	.	.	.	T	14.88	2.667810	0.47677	.	.	ENSG00000089250	ENST00000397605;ENST00000317775;ENST00000541241;ENST00000338101	T;T	0.23950	1.88;1.88	4.93	4.93	0.64822	Nitric oxide synthase, oxygenase domain (3);	0.101580	0.64402	D	0.000002	T	0.24624	0.0597	L	0.43757	1.38	0.80722	D	1	B	0.10296	0.003	B	0.10450	0.005	T	0.02983	-1.1086	10	0.44086	T	0.13	-28.7065	14.7436	0.69474	0.0:0.0:0.0:1.0	.	396	P29475	NOS1_HUMAN	S	396	ENSP00000320758:T396S;ENSP00000337459:T396S	ENSP00000320758:T396S	T	-	1	0	NOS1	116208396	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	4.921000	0.63397	2.070000	0.61991	0.482000	0.46254	ACT	NOS1	-	pfam_NO_synthase_oxygenase_dom,superfamily_NO_synthase_oxygenase_dom,pirsf_NOS_euk	ENSG00000089250		0.557	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	NOS1	HGNC	protein_coding	OTTHUMT00000268053.1	-	0.00	29	0	T			117724013	-1	tier1	-	no_errors	ENST00000317775	ensembl	human	known	74_37	missense	15.15	28	5	SNP	1.000	A
NOS1	4842	genome.wustl.edu	37	12	117724013	117724013	+	Missense_Mutation	SNP	T	T	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr12:117724013T>A	ENST00000338101.4	-	5	1190	c.1186A>T	c.(1186-1188)Act>Tct	p.T396S	NOS1_ENST00000344089.3_3'UTR|NOS1_ENST00000317775.6_Missense_Mutation_p.T396S			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		TAAGTGCTAGTGGTGTCGATC	0.557																																					Esophageal Squamous(162;1748 2599 51982 52956)												0													186.0	183.0	184.0					12																	117724013		2157	4290	6447	SO:0001583	missense	0				CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.1186A>T	12.37:g.117724013T>A	ENSP00000337459:p.Thr396Ser			Missense_Mutation	SNP	pfam_NO_synthase_oxygenase_dom,pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,pfam_PDZ,superfamily_NO_synthase_oxygenase_dom,superfamily_Riboflavin_synthase-like_b-brl,superfamily_PDZ,smart_PDZ,pirsf_NOS_euk,pfscan_PDZ,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.T396S	ENST00000338101.4	37	c.1186	CCDS55890.1	12	.	.	.	.	.	.	.	.	.	.	T	14.88	2.667810	0.47677	.	.	ENSG00000089250	ENST00000397605;ENST00000317775;ENST00000541241;ENST00000338101	T;T	0.23950	1.88;1.88	4.93	4.93	0.64822	Nitric oxide synthase, oxygenase domain (3);	0.101580	0.64402	D	0.000002	T	0.24624	0.0597	L	0.43757	1.38	0.80722	D	1	B	0.10296	0.003	B	0.10450	0.005	T	0.02983	-1.1086	10	0.44086	T	0.13	-28.7065	14.7436	0.69474	0.0:0.0:0.0:1.0	.	396	P29475	NOS1_HUMAN	S	396	ENSP00000320758:T396S;ENSP00000337459:T396S	ENSP00000320758:T396S	T	-	1	0	NOS1	116208396	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	4.921000	0.63397	2.070000	0.61991	0.482000	0.46254	ACT	NOS1	-	pfam_NO_synthase_oxygenase_dom,superfamily_NO_synthase_oxygenase_dom,pirsf_NOS_euk	ENSG00000089250		0.557	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	NOS1	HGNC	protein_coding	OTTHUMT00000268053.1	-	0.00	59	0	T			117724013	-1	tier1	-	no_errors	ENST00000317775	ensembl	human	known	74_37	missense	15.15	28	5	SNP	1.000	A
NT5C3B	115024	genome.wustl.edu	37	17	39987091	39987091	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr17:39987091C>G	ENST00000435506.2	-	6	435	c.366G>C	c.(364-366)caG>caC	p.Q122H	NT5C3B_ENST00000521789.1_Missense_Mutation_p.Q89H|NT5C3B_ENST00000269534.8_Missense_Mutation_p.Q114H			Q969T7	5NT3B_HUMAN	5'-nucleotidase, cytosolic IIIB	122					nucleotide metabolic process (GO:0009117)	cytoplasm (GO:0005737)	5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)										CCTGGGCTATCTGAAACTTCT	0.398																																																	0													166.0	163.0	164.0					17																	39987091		2203	4300	6503	SO:0001583	missense	0				CCDS11410.1, CCDS11410.2	17q21.2	2013-01-31	2013-01-31	2013-01-31	ENSG00000141698	ENSG00000141698	3.1.3.5		28300	protein-coding gene	gene with protein product			"""5'-nucleotidase, cytosolic III-like"""	NT5C3L		23223233	Standard	NM_052935		Approved	MGC20781	uc021txo.1	Q969T7	OTTHUMG00000133499	ENST00000435506.2:c.366G>C	17.37:g.39987091C>G	ENSP00000389948:p.Gln122His		A8MWB9|C9JKC4|Q7L3B7	Missense_Mutation	SNP	pfam_Pyrimidine_nucleotidase_eu,superfamily_HAD-like_dom,tigrfam_Pyrimidine_nucleotidase_eu	p.Q114H	ENST00000435506.2	37	c.342	CCDS11410.2	17	.	.	.	.	.	.	.	.	.	.	C	5.845	0.340130	0.11069	.	.	ENSG00000141698	ENST00000269534;ENST00000521789;ENST00000393911;ENST00000435506	T;T;T	0.81415	-1.49;-1.49;-1.49	5.08	3.06	0.35304	HAD-like domain (1);	0.514986	0.20346	N	0.094159	T	0.69142	0.3078	L	0.34521	1.04	0.22226	N	0.99928	B;B;B	0.24963	0.036;0.115;0.036	B;B;B	0.29716	0.03;0.106;0.03	T	0.58962	-0.7543	10	0.44086	T	0.13	24.7789	5.9516	0.19250	0.1241:0.6233:0.1755:0.077	.	122;89;114	C9JKC4;E5RH64;Q969T7	.;.;5NT3L_HUMAN	H	114;89;156;122	ENSP00000269534:Q114H;ENSP00000429878:Q89H;ENSP00000389948:Q122H	ENSP00000269534:Q114H	Q	-	3	2	NT5C3L	37240617	1.000000	0.71417	0.328000	0.25416	0.051000	0.14879	1.664000	0.37439	0.637000	0.30526	0.561000	0.74099	CAG	NT5C3B	-	pfam_Pyrimidine_nucleotidase_eu,superfamily_HAD-like_dom,tigrfam_Pyrimidine_nucleotidase_eu	ENSG00000141698		0.398	NT5C3B-008	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	NT5C3B	HGNC	protein_coding	OTTHUMT00000257430.2	-	0.00	55	0	C	NM_052935		39987091	-1	tier1	-	no_errors	ENST00000269534	ensembl	human	known	74_37	missense	14.37	697	117	SNP	0.471	G
NYAP1	222950	genome.wustl.edu	37	7	100084483	100084483	+	Silent	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr7:100084483C>T	ENST00000300179.2	+	3	267	c.108C>T	c.(106-108)ccC>ccT	p.P36P	NYAP1_ENST00000423930.1_Silent_p.P36P|NYAP1_ENST00000454988.1_5'Flank	NM_173564.2	NP_775835.2	Q6ZVC0	NYAP1_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 1	36					neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												CGGCTGGGCCCGCGGCCGGCC	0.711																																																	0													2.0	3.0	3.0					7																	100084483		1482	3259	4741	SO:0001819	synonymous_variant	0			AK094857	CCDS5696.1	7q22.1	2011-11-30	2011-11-30	2011-11-30	ENSG00000166924	ENSG00000166924			22009	protein-coding gene	gene with protein product		615477	"""chromosome 7 open reading frame 51"", ""KIAA1486-like"""	C7orf51, KIAA1486L		21946561	Standard	NM_173564		Approved	FLJ37538	uc003uvd.2	Q6ZVC0	OTTHUMG00000155290	ENST00000300179.2:c.108C>T	7.37:g.100084483C>T			Q6U9Y3|Q8N1V0	Silent	SNP	NULL	p.P36	ENST00000300179.2	37	c.108	CCDS5696.1	7																																																																																			NYAP1	-	NULL	ENSG00000166924		0.711	NYAP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NYAP1	HGNC	protein_coding	OTTHUMT00000339335.2	-	0.00	24	0	C	NM_173564		100084483	+1	tier1	-	no_errors	ENST00000423930	ensembl	human	known	74_37	silent	54.90	23	28	SNP	0.984	T
OR10J5	127385	genome.wustl.edu	37	1	159505593	159505593	+	Missense_Mutation	SNP	A	A	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:159505593A>G	ENST00000334857.2	-	1	249	c.205T>C	c.(205-207)Tca>Cca	p.S69P		NM_001004469.1	NP_001004469.1	Q8NHC4	O10J5_HUMAN	olfactory receptor, family 10, subfamily J, member 5	69						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	22	all_hematologic(112;0.0429)					ACCGTCTCTGAACTAGCCAGC	0.433																																																	0													170.0	137.0	148.0					1																	159505593		2203	4300	6503	SO:0001583	missense	0				CCDS30910.1	1q23.2	2012-08-09			ENSG00000184155	ENSG00000184155		"""GPCR / Class A : Olfactory receptors"""	14993	protein-coding gene	gene with protein product							Standard	NM_001004469		Approved		uc010piw.2	Q8NHC4	OTTHUMG00000022738	ENST00000334857.2:c.205T>C	1.37:g.159505593A>G	ENSP00000334441:p.Ser69Pro		B9EH35|Q6IFH2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S69P	ENST00000334857.2	37	c.205	CCDS30910.1	1	.	.	.	.	.	.	.	.	.	.	A	10.26	1.300509	0.23650	.	.	ENSG00000184155	ENST00000334857	T	0.03004	4.08	4.31	3.17	0.36434	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.07638	0.0192	M	0.84082	2.675	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.20706	-1.0267	9	0.49607	T	0.09	.	5.8136	0.18479	0.7874:0.0:0.2126:0.0	.	69	Q8NHC4	O10J5_HUMAN	P	69	ENSP00000334441:S69P	ENSP00000334441:S69P	S	-	1	0	OR10J5	157772217	0.000000	0.05858	0.047000	0.18901	0.203000	0.24098	-1.056000	0.03489	0.786000	0.33708	0.377000	0.23210	TCA	OR10J5	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000184155		0.433	OR10J5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10J5	HGNC	protein_coding	OTTHUMT00000059021.1	-	0.00	48	0	A	NM_001004469		159505593	-1	tier1	-	no_errors	ENST00000334857	ensembl	human	known	74_37	missense	55.56	24	30	SNP	0.001	G
OR11H4	390442	genome.wustl.edu	37	14	20711241	20711241	+	Silent	SNP	C	C	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr14:20711241C>G	ENST00000315409.2	+	1	344	c.291C>G	c.(289-291)tcC>tcG	p.S97S		NM_001004479.1	NP_001004479.1	Q8NGC9	O11H4_HUMAN	olfactory receptor, family 11, subfamily H, member 4	97						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(3)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	29	all_cancers(95;0.000888)		Epithelial(56;1.75e-06)|all cancers(55;1.22e-05)	GBM - Glioblastoma multiforme(265;0.0146)		ACATTCTCTCCAAGACCAAGG	0.438																																																	0													144.0	144.0	144.0					14																	20711241		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS32034.1	14q11.2	2013-09-24			ENSG00000176198	ENSG00000176198		"""GPCR / Class A : Olfactory receptors"""	15347	protein-coding gene	gene with protein product							Standard	NM_001004479		Approved		uc010tld.2	Q8NGC9	OTTHUMG00000170852	ENST00000315409.2:c.291C>G	14.37:g.20711241C>G			B2RNQ4|Q6IF07	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S97	ENST00000315409.2	37	c.291	CCDS32034.1	14																																																																																			OR11H4	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000176198		0.438	OR11H4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR11H4	HGNC	protein_coding	OTTHUMT00000410678.1	-	0.00	58	0	C			20711241	+1	tier1	-	no_errors	ENST00000315409	ensembl	human	known	74_37	silent	6.98	80	6	SNP	0.066	G
OR11H4	390442	genome.wustl.edu	37	14	20711241	20711241	+	Silent	SNP	C	C	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr14:20711241C>G	ENST00000315409.2	+	1	344	c.291C>G	c.(289-291)tcC>tcG	p.S97S		NM_001004479.1	NP_001004479.1	Q8NGC9	O11H4_HUMAN	olfactory receptor, family 11, subfamily H, member 4	97						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(3)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	29	all_cancers(95;0.000888)		Epithelial(56;1.75e-06)|all cancers(55;1.22e-05)	GBM - Glioblastoma multiforme(265;0.0146)		ACATTCTCTCCAAGACCAAGG	0.438																																																	0													144.0	144.0	144.0					14																	20711241		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS32034.1	14q11.2	2013-09-24			ENSG00000176198	ENSG00000176198		"""GPCR / Class A : Olfactory receptors"""	15347	protein-coding gene	gene with protein product							Standard	NM_001004479		Approved		uc010tld.2	Q8NGC9	OTTHUMG00000170852	ENST00000315409.2:c.291C>G	14.37:g.20711241C>G			B2RNQ4|Q6IF07	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S97	ENST00000315409.2	37	c.291	CCDS32034.1	14																																																																																			OR11H4	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000176198		0.438	OR11H4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR11H4	HGNC	protein_coding	OTTHUMT00000410678.1	-	0.00	67	0	C			20711241	+1	tier1	-	no_errors	ENST00000315409	ensembl	human	known	74_37	silent	6.98	80	6	SNP	0.066	G
OR2T7	81458	genome.wustl.edu	37	1	248605049	248605049	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:248605049C>A	ENST00000460972.3	+	1	542	c.542C>A	c.(541-543)aCg>aAg	p.T181K				P0C7T2	OR2T7_HUMAN	olfactory receptor, family 2, subfamily T, member 7	181						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										CTCTCCTGCACGGACACATCA	0.522																																																	0																																										SO:0001583	missense	0					1q44	2013-09-05		2004-03-10	ENSG00000227152	ENSG00000227152		"""GPCR / Class A : Olfactory receptors"""	15019	protein-coding gene	gene with protein product				OR2T7P			Standard	NG_004272		Approved	OST723		P0C7T2	OTTHUMG00000040449	ENST00000460972.3:c.542C>A	1.37:g.248605049C>A	ENSP00000475521:p.Thr181Lys			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T181K	ENST00000460972.3	37	c.542		1																																																																																			OR2T7	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000227152		0.522	OR2T7-001	KNOWN	basic|appris_principal	protein_coding	OR2T7	HGNC	protein_coding	OTTHUMT00000097345.3	-	0.00	74	0	C			248605049	+1	tier1	-	no_errors	ENST00000460972	ensembl	human	known	74_37	missense	10.62	101	12	SNP	0.000	A
OR51B4	79339	genome.wustl.edu	37	11	5322505	5322505	+	Silent	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr11:5322505G>A	ENST00000380224.1	-	1	721	c.672C>T	c.(670-672)ggC>ggT	p.G224G	HBG2_ENST00000380259.2_Intron|HBG2_ENST00000380252.1_Intron|HBE1_ENST00000380237.1_Intron	NM_033179.2	NP_149419.2	Q9Y5P0	O51B4_HUMAN	olfactory receptor, family 51, subfamily B, member 4	224					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	20		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CAGACGCAATGCCCATCACTG	0.373																																																	0													85.0	79.0	81.0					11																	5322505		2201	4297	6498	SO:0001819	synonymous_variant	0			BC069094	CCDS7757.1	11p15.4	2012-08-09			ENSG00000183251	ENSG00000183251		"""GPCR / Class A : Olfactory receptors"""	14708	protein-coding gene	gene with protein product							Standard	NM_033179		Approved		uc010qza.2	Q9Y5P0	OTTHUMG00000066665	ENST00000380224.1:c.672C>T	11.37:g.5322505G>A			A7MAV5|Q6NTD7	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G224	ENST00000380224.1	37	c.672	CCDS7757.1	11																																																																																			OR51B4	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000183251		0.373	OR51B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51B4	HGNC	protein_coding	OTTHUMT00000142956.2	-	0.00	53	0	G	NM_033179		5322505	-1	tier1	-	no_errors	ENST00000380224	ensembl	human	known	74_37	silent	67.61	23	48	SNP	0.999	A
OR56A1	120796	genome.wustl.edu	37	11	6048776	6048776	+	Silent	SNP	C	C	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr11:6048776C>A	ENST00000316650.5	-	1	195	c.159G>T	c.(157-159)ctG>ctT	p.L53L		NM_001001917.2	NP_001001917.2	Q8NGH5	O56A1_HUMAN	olfactory receptor, family 56, subfamily A, member 1	53						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(22)|ovary(2)	33		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGATGGTGATCAGGAGGGTGG	0.612																																																	0													66.0	66.0	66.0					11																	6048776		2201	4293	6494	SO:0001819	synonymous_variant	0			AB065821	CCDS31405.1	11p15.4	2012-08-09			ENSG00000180934	ENSG00000180934		"""GPCR / Class A : Olfactory receptors"""	14781	protein-coding gene	gene with protein product							Standard	NM_001001917		Approved		uc010qzw.2	Q8NGH5	OTTHUMG00000165377	ENST00000316650.5:c.159G>T	11.37:g.6048776C>A			B2RNI2|Q6IFL0	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L53	ENST00000316650.5	37	c.159	CCDS31405.1	11																																																																																			OR56A1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000180934		0.612	OR56A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR56A1	HGNC	protein_coding	OTTHUMT00000383757.1	-	0.00	47	0	C	NM_001001917		6048776	-1	tier1	-	no_errors	ENST00000316650	ensembl	human	known	74_37	silent	25.00	24	8	SNP	0.277	A
OR5D18	219438	genome.wustl.edu	37	11	55587113	55587113	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr11:55587113T>C	ENST00000333976.4	+	1	28	c.8T>C	c.(7-9)cTg>cCg	p.L3P		NM_001001952.1	NP_001001952.1	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D, member 18	3						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(3)|large_intestine(6)|lung(33)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		all_epithelial(135;0.208)				GCGATGCTGCTGACTGATAGA	0.423																																																	0													79.0	74.0	75.0					11																	55587113		2200	4296	6496	SO:0001583	missense	0			AB065781	CCDS31510.1	11q11	2012-08-09			ENSG00000186119	ENSG00000186119		"""GPCR / Class A : Olfactory receptors"""	15285	protein-coding gene	gene with protein product							Standard	NM_001001952		Approved		uc010rin.2	Q8NGL1	OTTHUMG00000166811	ENST00000333976.4:c.8T>C	11.37:g.55587113T>C	ENSP00000335025:p.Leu3Pro		Q6IF67|Q6IFD3|Q96RB3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L3P	ENST00000333976.4	37	c.8	CCDS31510.1	11	.	.	.	.	.	.	.	.	.	.	t	8.736	0.917762	0.17982	.	.	ENSG00000186119	ENST00000333976	T	0.00337	8.05	4.54	0.851	0.18989	.	0.609345	0.12553	N	0.458888	T	0.00144	0.0004	N	0.08118	0	0.09310	N	0.999997	B	0.15930	0.015	B	0.18263	0.021	T	0.14392	-1.0474	10	0.32370	T	0.25	-0.1737	3.8766	0.09059	0.1601:0.1845:0.0:0.6555	.	3	Q8NGL1	OR5DI_HUMAN	P	3	ENSP00000335025:L3P	ENSP00000335025:L3P	L	+	2	0	OR5D18	55343689	0.037000	0.19845	0.000000	0.03702	0.002000	0.02628	0.570000	0.23653	0.329000	0.23460	0.514000	0.50259	CTG	OR5D18	-	NULL	ENSG00000186119		0.423	OR5D18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5D18	HGNC	protein_coding	OTTHUMT00000391515.1		0.00	18	0	T	NM_001001952		55587113	+1			no_errors	ENST00000333976	ensembl	human	known	74_37	missense	10.71	25	3	SNP	0.000	C
OR8B4	283162	genome.wustl.edu	37	11	124294641	124294641	+	Silent	SNP	A	A	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr11:124294641A>G	ENST00000356130.3	-	1	148	c.127T>C	c.(127-129)Ttg>Ctg	p.L43L		NM_001005196.1	NP_001005196.1	Q96RC9	OR8B4_HUMAN	olfactory receptor, family 8, subfamily B, member 4	43						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(7)|lung(15)|ovary(1)|skin(6)|stomach(1)|urinary_tract(1)	32		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		ATCAAGCCCAAGTTGCCCACC	0.438																																																	0													77.0	74.0	75.0					11																	124294641		2201	4299	6500	SO:0001819	synonymous_variant	0			AB065831	CCDS31710.1	11q24	2012-08-09		2001-06-29	ENSG00000198657	ENSG00000198657		"""GPCR / Class A : Olfactory receptors"""	8473	protein-coding gene	gene with protein product				OR8B4P			Standard	NM_001005196		Approved		uc010sak.2	Q96RC9	OTTHUMG00000165916	ENST00000356130.3:c.127T>C	11.37:g.124294641A>G			B2RNF8|Q6IFQ7	Silent	SNP	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.L43	ENST00000356130.3	37	c.127	CCDS31710.1	11																																																																																			OR8B4	-	pfam_GPCR_Rhodpsn,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000198657		0.438	OR8B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8B4	HGNC	protein_coding	OTTHUMT00000387055.1		0.00	19	0	A	NM_001005196		124294641	-1			no_errors	ENST00000356130	ensembl	human	known	74_37	silent	10.81	33	4	SNP	0.039	G
OTUD4	54726	genome.wustl.edu	37	4	146085307	146085307	+	Splice_Site	DEL	T	T	-			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr4:146085307delT	ENST00000447906.2	-	5	600	c.413delA	c.(412-414)aag>ag	p.K138fs	OTUD4_ENST00000509620.2_Splice_Site_p.K73fs|OTUD4_ENST00000454497.2_Splice_Site_p.K73fs|OTUD4_ENST00000296579.6_Splice_Site_p.K73fs|OTUD4_ENST00000455611.2_5'UTR			Q01804	OTUD4_HUMAN	OTU deubiquitinase 4	138	OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.				protein K48-linked deubiquitination (GO:0071108)		poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(180;0.151)					AATTCTTACCTTTTCAGGAAA	0.254																																																	0													13.0	13.0	13.0					4																	146085307		2101	4185	6286	SO:0001630	splice_region_variant	0				CCDS3764.1, CCDS47139.1	4q31.21	2014-02-24	2014-02-24		ENSG00000164164	ENSG00000164164		"""OTU domain containing"""	24949	protein-coding gene	gene with protein product		611744	"""OTU domain containing 4"""			1475186, 12727813, 19996094	Standard	NM_001102653		Approved	HSHIN1, KIAA1046, DUBA6	uc003ika.4	Q01804	OTTHUMG00000161480	ENST00000447906.2:c.414+1A>-	4.37:g.146085307delT			B4DYS4|Q147U2|Q1ZYK1|Q6PG39|Q96MQ5|Q9NT94|Q9UPV6	Frame_Shift_Del	DEL	pfam_OTU,pfscan_OTU	p.K138fs	ENST00000447906.2	37	c.413		4																																																																																			OTUD4	-	pfam_OTU,pfscan_OTU	ENSG00000164164		0.254	OTUD4-004	KNOWN	basic|appris_principal	protein_coding	OTUD4	HGNC	protein_coding	OTTHUMT00000365117.2		0.00	113	0	T	NM_017493	Frame_Shift_Del	146085307	-1	tier1		no_errors	ENST00000447906	ensembl	human	known	74_37	frame_shift_del	32.65	66	32	DEL	1.000	-
PAK2	5062	genome.wustl.edu	37	3	196529902	196529902	+	Missense_Mutation	SNP	G	G	C	rs201465227	byFrequency	TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr3:196529902G>C	ENST00000327134.3	+	4	625	c.303G>C	c.(301-303)caG>caC	p.Q101H		NM_002577.4	NP_002568.2	Q13177	PAK2_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 2	101	Autoregulatory region. {ECO:0000250}.|GTPase-binding. {ECO:0000250}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in execution phase of apoptosis (GO:2001271)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of defense response to virus by virus (GO:0050690)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activator activity (GO:0030296)			breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)	12	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;6.38e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00405)		TGCCAGAACAGTGGGCTCGAT	0.373																																																	0													82.0	72.0	76.0					3																	196529902		2203	4300	6503	SO:0001583	missense	0			U24153	CCDS3321.1	3q29	2008-06-17	2008-06-17			ENSG00000180370	2.7.11.1		8591	protein-coding gene	gene with protein product	"""S6/H4 kinase"""	605022	"""p21 (CDKN1A)-activated kinase 2"""			7744004, 7618083	Standard	NM_002577		Approved	PAK65, PAKgamma	uc003fwy.4	Q13177		ENST00000327134.3:c.303G>C	3.37:g.196529902G>C	ENSP00000314067:p.Gln101His		Q13154|Q6ISC3	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_CRIB_dom,superfamily_Kinase-like_dom,superfamily_WASP_C,smart_CRIB_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRIB_dom,pfscan_Prot_kinase_dom	p.Q101H	ENST00000327134.3	37	c.303	CCDS3321.1	3	.	.	.	.	.	.	.	.	.	.	G	17.81	3.480973	0.63849	.	.	ENSG00000180370	ENST00000327134	D	0.86366	-2.11	5.51	1.7	0.24286	PAK-box/P21-Rho-binding (2);	0.000000	0.85682	D	0.000000	D	0.92283	0.7552	M	0.91090	3.175	0.52099	D	0.999949	D	0.60160	0.987	P	0.61275	0.886	D	0.90843	0.4725	10	0.72032	D	0.01	.	6.8738	0.24135	0.4882:0.0:0.5118:0.0	.	101	Q13177	PAK2_HUMAN	H	101	ENSP00000314067:Q101H	ENSP00000314067:Q101H	Q	+	3	2	PAK2	198014299	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	0.826000	0.27407	0.705000	0.31890	-0.253000	0.11424	CAG	PAK2	-	pfam_CRIB_dom,superfamily_WASP_C,smart_CRIB_dom	ENSG00000180370		0.373	PAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAK2	HGNC	protein_coding	OTTHUMT00000340548.1	-	0.00	47	0	G	NM_002577		196529902	+1	tier1	rs201465227	no_errors	ENST00000327134	ensembl	human	known	74_37	missense	5.26	72	4	SNP	1.000	C
PCDH10	57575	genome.wustl.edu	37	4	134071353	134071353	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr4:134071353C>A	ENST00000264360.5	+	1	884	c.58C>A	c.(58-60)Ctt>Att	p.L20I	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	20	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		CTTTTCCCAGCTTCACTACAC	0.502																																																	0													133.0	127.0	129.0					4																	134071353		2203	4300	6503	SO:0001583	missense	0			AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.58C>A	4.37:g.134071353C>A	ENSP00000264360:p.Leu20Ile		Q4W5F6|Q96SF0	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L20I	ENST00000264360.5	37	c.58	CCDS34063.1	4	.	.	.	.	.	.	.	.	.	.	C	1.351	-0.591298	0.03799	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.38077	1.16	4.91	4.91	0.64330	Cadherin, N-terminal (1);Cadherin (1);Cadherin-like (1);	0.000000	0.40222	N	0.001146	T	0.16514	0.0397	N	0.02685	-0.53	0.58432	D	0.999991	B;B	0.20550	0.046;0.001	B;B	0.22601	0.04;0.023	T	0.12760	-1.0535	10	0.02654	T	1	.	17.8782	0.88831	0.0:1.0:0.0:0.0	.	20;20	Q9P2E7;Q96SF0	PCD10_HUMAN;.	I	20	ENSP00000264360:L20I	ENSP00000264360:L20I	L	+	1	0	PCDH10	134290803	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.144000	0.50616	2.550000	0.86006	0.555000	0.69702	CTT	PCDH10	-	pfam_Cadherin_N,superfamily_Cadherin-like	ENSG00000138650		0.502	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PCDH10	HGNC	protein_coding	OTTHUMT00000364457.2	-	0.00	48	0	C	NM_032961		134071353	+1	tier1	-	no_errors	ENST00000264360	ensembl	human	known	74_37	missense	16.44	61	12	SNP	1.000	A
PCDH12	51294	genome.wustl.edu	37	5	141324976	141324976	+	Missense_Mutation	SNP	T	T	G	rs13188049		TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr5:141324976T>G	ENST00000231484.3	-	4	4735	c.3525A>C	c.(3523-3525)agA>agC	p.R1175S		NM_016580.2	NP_057664.1	Q9NPG4	PCD12_HUMAN	protocadherin 12	1175					calcium-dependent cell-cell adhesion (GO:0016339)|glycogen metabolic process (GO:0005977)|homophilic cell adhesion (GO:0007156)|labyrinthine layer development (GO:0060711)|neuron recognition (GO:0008038)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(3)|prostate(2)|skin(1)	38		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			tgctgctgcctctgctCTTGC	0.587																																																	0													22.0	22.0	22.0					5																	141324976		2203	4299	6502	SO:0001583	missense	0			AF231025	CCDS4269.1	5q31.3	2010-01-26			ENSG00000113555	ENSG00000113555		"""Cadherins / Protocadherins : Non-clustered"""	8657	protein-coding gene	gene with protein product		605622				10716726, 10380929	Standard	NM_016580		Approved	VE-cadherin-2	uc003llx.3	Q9NPG4	OTTHUMG00000129658	ENST00000231484.3:c.3525A>C	5.37:g.141324976T>G	ENSP00000231484:p.Arg1175Ser		Q6UXB6|Q96KB8|Q9H7Y6|Q9H8E0	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R1175S	ENST00000231484.3	37	c.3525	CCDS4269.1	5	.	.	.	.	.	.	.	.	.	.	T	0.007	-1.989340	0.00439	.	.	ENSG00000113555	ENST00000231484	T	0.51574	0.7	2.0	-4.01	0.04045	.	0.962512	0.08510	N	0.935114	T	0.13970	0.0338	N	0.00926	-1.1	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.10917	-1.0609	10	0.40728	T	0.16	.	1.3153	0.02106	0.1544:0.3727:0.2631:0.2098	rs13188049	1175	Q9NPG4	PCD12_HUMAN	S	1175	ENSP00000231484:R1175S	ENSP00000231484:R1175S	R	-	3	2	PCDH12	141305160	0.002000	0.14202	0.001000	0.08648	0.005000	0.04900	0.151000	0.16283	-1.050000	0.03230	-1.263000	0.01449	AGA	PCDH12	-	NULL	ENSG00000113555		0.587	PCDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDH12	HGNC	protein_coding	OTTHUMT00000251858.1	-	0.00	24	0	T	NM_016580		141324976	-1	tier1	rs13188049	no_errors	ENST00000231484	ensembl	human	known	74_37	missense	20.00	32	8	SNP	0.004	G
PCDH17	27253	genome.wustl.edu	37	13	58298998	58298998	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr13:58298998C>T	ENST00000377918.3	+	4	3076	c.3050C>T	c.(3049-3051)cCt>cTt	p.P1017L		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	1017					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		AACGTTAAACCTTATTTAAAA	0.478																																					Melanoma(72;952 1291 1619 12849 33676)												0													111.0	109.0	110.0					13																	58298998		2203	4300	6503	SO:0001583	missense	0			AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.3050C>T	13.37:g.58298998C>T	ENSP00000367151:p.Pro1017Leu		A8K1R5|Q5VVW9|Q5VVX0	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P1017L	ENST00000377918.3	37	c.3050	CCDS31986.1	13	.	.	.	.	.	.	.	.	.	.	C	19.19	3.780418	0.70222	.	.	ENSG00000118946	ENST00000377918	T	0.50277	0.75	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.45013	0.1321	L	0.48642	1.525	0.80722	D	1	B	0.26258	0.145	B	0.20955	0.032	T	0.21177	-1.0253	9	.	.	.	.	20.6593	0.99626	0.0:1.0:0.0:0.0	.	1017	O14917	PCD17_HUMAN	L	1017	ENSP00000367151:P1017L	.	P	+	2	0	PCDH17	57196999	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.885000	0.99019	0.655000	0.94253	CCT	PCDH17	-	NULL	ENSG00000118946		0.478	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDH17	HGNC	protein_coding	OTTHUMT00000045139.1	-	0.00	29	0	C	NM_001040429		58298998	+1	tier1	-	no_errors	ENST00000377918	ensembl	human	known	74_37	missense	15.00	34	6	SNP	1.000	T
PCDHB7	56129	genome.wustl.edu	37	5	140552744	140552744	+	Silent	SNP	T	T	C	rs539087999		TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr5:140552744T>C	ENST00000231137.3	+	1	502	c.328T>C	c.(328-330)Ttg>Ctg	p.L110L		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	110	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L110L(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCAGTTGTTATTGGAAAAACC	0.438													T|||	1	0.000199681	0.0	0.0	5008	,	,		18122	0.001		0.0	False		,,,				2504	0.0																1	Substitution - coding silent(1)	prostate(1)											71.0	75.0	74.0					5																	140552744		2203	4300	6503	SO:0001819	synonymous_variant	0			AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.328T>C	5.37:g.140552744T>C			A1L3Y8	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L110	ENST00000231137.3	37	c.328	CCDS4249.1	5																																																																																			PCDHB7	-	pfam_Cadherin_N	ENSG00000113212		0.438	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB7	HGNC	protein_coding	OTTHUMT00000251803.2	-	0.00	53	0	T	NM_018940		140552744	+1	tier1	-	no_errors	ENST00000231137	ensembl	human	known	74_37	silent	29.76	59	25	SNP	0.125	C
PCDHB7	56129	genome.wustl.edu	37	5	140552744	140552744	+	Silent	SNP	T	T	C	rs539087999		TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr5:140552744T>C	ENST00000231137.3	+	1	502	c.328T>C	c.(328-330)Ttg>Ctg	p.L110L		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	110	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L110L(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCAGTTGTTATTGGAAAAACC	0.438													T|||	1	0.000199681	0.0	0.0	5008	,	,		18122	0.001		0.0	False		,,,				2504	0.0																1	Substitution - coding silent(1)	prostate(1)											71.0	75.0	74.0					5																	140552744		2203	4300	6503	SO:0001819	synonymous_variant	0			AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.328T>C	5.37:g.140552744T>C			A1L3Y8	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L110	ENST00000231137.3	37	c.328	CCDS4249.1	5																																																																																			PCDHB7	-	pfam_Cadherin_N	ENSG00000113212		0.438	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB7	HGNC	protein_coding	OTTHUMT00000251803.2	-	0.00	68	0	T	NM_018940		140552744	+1	tier1	-	no_errors	ENST00000231137	ensembl	human	known	74_37	silent	29.76	59	25	SNP	0.125	C
PCSK6	5046	genome.wustl.edu	37	15	101906495	101906495	+	Silent	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr15:101906495G>A	ENST00000348070.1	-	14	1760	c.1761C>T	c.(1759-1761)ttC>ttT	p.F587F	PCSK6_ENST00000358417.3_Silent_p.F587F|PCSK6_ENST00000561177.1_5'UTR|PCSK6_ENST00000398181.2_Silent_p.F587F|PCSK6_ENST00000344273.2_Silent_p.F587F|PCSK6_ENST00000331826.7_Silent_p.F422F	NM_002570.3|NM_138320.1	NP_002561.1|NP_612193.1	P29122	PCSK6_HUMAN	proprotein convertase subtilisin/kexin type 6	588					determination of left/right symmetry (GO:0007368)|glycoprotein metabolic process (GO:0009100)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|regulation of BMP signaling pathway (GO:0030510)|secretion by cell (GO:0032940)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|nerve growth factor binding (GO:0048406)|serine-type endopeptidase activity (GO:0004252)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GGACAGTCATGAATTCCCAGT	0.527																																																	0													82.0	80.0	81.0					15																	101906495		1914	4128	6042	SO:0001819	synonymous_variant	0				CCDS73789.1, CCDS73790.1, CCDS73791.1, CCDS73792.1, CCDS73793.1	15q26	2008-07-18	2004-06-14	2004-06-16		ENSG00000140479			8569	protein-coding gene	gene with protein product	"""subtilisin-like protease"", ""subtilisin-like proprotein convertase 4"", ""subtilisin/kexin-like protease PACE4"""	167405	"""paired basic amino acid cleaving system 4"""	PACE4		1741956	Standard	NM_002570		Approved	SPC4	uc002bwy.3	P29122		ENST00000348070.1:c.1761C>T	15.37:g.101906495G>A			Q15099|Q15100|Q9UEG7|Q9UEJ1|Q9UEJ2|Q9UEJ7|Q9UEJ8|Q9UEJ9|Q9Y4G9|Q9Y4H0|Q9Y4H1	Silent	SNP	pfam_Peptidase_S8/S53_dom,pfam_PrprotnconvertsP,pfam_PLAC,superfamily_Peptidase_S8/S53_dom,superfamily_Galactose-bd-like,superfamily_Growth_fac_rcpt_N_dom,superfamily_Prot_inh_propept,smart_Furin_repeat,smart_EG-like_dom,pfscan_PLAC,prints_Peptidase_S8_subtilisin-rel	p.F587	ENST00000348070.1	37	c.1761		15																																																																																			PCSK6	-	pfam_PrprotnconvertsP,superfamily_Galactose-bd-like	ENSG00000140479		0.527	PCSK6-203	KNOWN	basic|appris_candidate_longest	protein_coding	PCSK6	HGNC	protein_coding			0.00	44	0	G	NM_002570		101906495	-1			no_errors	ENST00000348070	ensembl	human	known	74_37	silent	7.69	36	3	SNP	1.000	A
PDZD2	23037	genome.wustl.edu	37	5	31799459	31799459	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr5:31799459G>A	ENST00000438447.1	+	2	492	c.104G>A	c.(103-105)tGc>tAc	p.C35Y	PDZD2_ENST00000282493.3_Missense_Mutation_p.C35Y			O15018	PDZD2_HUMAN	PDZ domain containing 2	35					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						CAGCGGCTCTGCCAGGCGGCC	0.622																																																	0													67.0	69.0	68.0					5																	31799459		2203	4300	6503	SO:0001583	missense	0			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.104G>A	5.37:g.31799459G>A	ENSP00000402033:p.Cys35Tyr		Q9BXD4	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.C35Y	ENST00000438447.1	37	c.104	CCDS34137.1	5	.	.	.	.	.	.	.	.	.	.	G	16.36	3.101467	0.56183	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.65364	-0.15;-0.15	5.67	5.67	0.87782	.	0.000000	0.49916	D	0.000121	T	0.49779	0.1577	N	0.17082	0.46	0.43126	D	0.994858	D	0.53312	0.959	P	0.46659	0.523	T	0.53129	-0.8482	10	0.48119	T	0.1	.	10.6552	0.45671	0.0866:0.0:0.9134:0.0	.	35	O15018	PDZD2_HUMAN	Y	35	ENSP00000402033:C35Y;ENSP00000282493:C35Y	ENSP00000282493:C35Y	C	+	2	0	PDZD2	31835216	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.124000	0.77185	2.661000	0.90470	0.655000	0.94253	TGC	PDZD2	-	NULL	ENSG00000133401		0.622	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD2	HGNC	protein_coding	OTTHUMT00000366608.1	-	0.00	36	0	G			31799459	+1	tier1	-	no_errors	ENST00000282493	ensembl	human	known	74_37	missense	25.00	39	13	SNP	1.000	A
PDZD2	23037	genome.wustl.edu	37	5	31799459	31799459	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr5:31799459G>A	ENST00000438447.1	+	2	492	c.104G>A	c.(103-105)tGc>tAc	p.C35Y	PDZD2_ENST00000282493.3_Missense_Mutation_p.C35Y			O15018	PDZD2_HUMAN	PDZ domain containing 2	35					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						CAGCGGCTCTGCCAGGCGGCC	0.622																																																	0													67.0	69.0	68.0					5																	31799459		2203	4300	6503	SO:0001583	missense	0			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.104G>A	5.37:g.31799459G>A	ENSP00000402033:p.Cys35Tyr		Q9BXD4	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.C35Y	ENST00000438447.1	37	c.104	CCDS34137.1	5	.	.	.	.	.	.	.	.	.	.	G	16.36	3.101467	0.56183	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.65364	-0.15;-0.15	5.67	5.67	0.87782	.	0.000000	0.49916	D	0.000121	T	0.49779	0.1577	N	0.17082	0.46	0.43126	D	0.994858	D	0.53312	0.959	P	0.46659	0.523	T	0.53129	-0.8482	10	0.48119	T	0.1	.	10.6552	0.45671	0.0866:0.0:0.9134:0.0	.	35	O15018	PDZD2_HUMAN	Y	35	ENSP00000402033:C35Y;ENSP00000282493:C35Y	ENSP00000282493:C35Y	C	+	2	0	PDZD2	31835216	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.124000	0.77185	2.661000	0.90470	0.655000	0.94253	TGC	PDZD2	-	NULL	ENSG00000133401		0.622	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD2	HGNC	protein_coding	OTTHUMT00000366608.1	-	0.00	41	0	G			31799459	+1	tier1	-	no_errors	ENST00000282493	ensembl	human	known	74_37	missense	25.00	39	13	SNP	1.000	A
PHLPP1	23239	genome.wustl.edu	37	18	60639886	60639887	+	Frame_Shift_Ins	INS	-	-	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr18:60639886_60639887insA	ENST00000262719.5	+	15	3934_3935	c.3700_3701insA	c.(3700-3702)caafs	p.Q1234fs	PHLPP1_ENST00000400316.4_Frame_Shift_Ins_p.Q722fs			O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein phosphatase 1	1234	PP2C-like.				apoptotic process (GO:0006915)|entrainment of circadian clock (GO:0009649)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			endometrium(2)|kidney(2)|lung(13)	17						TGAAGAGCTGCAAAAAACAAAA	0.45																																																	0																																										SO:0001589	frameshift_variant	0			AB011178	CCDS45881.1, CCDS45881.2	18q21.32	2013-01-11	2009-05-26	2009-05-26	ENSG00000081913	ENSG00000081913		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	20610	protein-coding gene	gene with protein product		609396	"""pleckstrin homology domain containing, family E (with leucine rich repeats) member 1"", ""PH domain and leucine rich repeat protein phosphatase"""	PLEKHE1, PHLPP		10570941, 15808505	Standard	NM_194449		Approved	KIAA0606, SCOP	uc021ule.1	O60346	OTTHUMG00000150629	ENST00000262719.5:c.3706dupA	18.37:g.60639892_60639892dupA	ENSP00000262719:p.Gln1234fs		A1A4F5|Q641Q7|Q6P4C4|Q6PJI6|Q86TN6|Q96FK2|Q9NUY1	Frame_Shift_Ins	INS	pfam_PP2C-like_dom,pfam_Leu-rich_rpt,superfamily_PP2C-like_dom,smart_Leu-rich_rpt_typical-subtyp,smart_PP2C-like_dom,pfscan_Pleckstrin_homology	p.T1236fs	ENST00000262719.5	37	c.3700_3701	CCDS45881.2	18																																																																																			PHLPP1	-	pfam_PP2C-like_dom,superfamily_PP2C-like_dom,smart_PP2C-like_dom	ENSG00000081913		0.450	PHLPP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PHLPP1	HGNC	protein_coding	OTTHUMT00000319249.2		0.00	57	0	-	NM_194449		60639887	+1	tier1		no_errors	ENST00000262719	ensembl	human	known	74_37	frame_shift_ins	41.67	14	10	INS	1.000:1.000	A
PHLPP1	23239	genome.wustl.edu	37	18	60639893	60639894	+	Missense_Mutation	DNP	CA	CA	AC	rs17355988|rs375407457		TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C|A	C|A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr18:60639893_60639894CA>AC	ENST00000262719.5	+	15	3941_3942	c.3707_3708CA>AC	c.(3706-3708)aCA>aAC	p.T1236N	PHLPP1_ENST00000400316.4_Missense_Mutation_p.T724N			O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein phosphatase 1	1236	PP2C-like.				apoptotic process (GO:0006915)|entrainment of circadian clock (GO:0009649)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			endometrium(2)|kidney(2)|lung(13)	17						CTGCAAAAAACAAAAAACGAAG	0.441																																																	0																																										SO:0001583	missense	0			AB011178	CCDS45881.1, CCDS45881.2	18q21.32	2013-01-11	2009-05-26	2009-05-26	ENSG00000081913	ENSG00000081913		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	20610	protein-coding gene	gene with protein product		609396	"""pleckstrin homology domain containing, family E (with leucine rich repeats) member 1"", ""PH domain and leucine rich repeat protein phosphatase"""	PLEKHE1, PHLPP		10570941, 15808505	Standard	NM_194449		Approved	KIAA0606, SCOP	uc021ule.1	O60346	OTTHUMG00000150629	Exception_encountered	18.37:g.60639893_60639894delinsAC	ENSP00000262719:p.Thr1236Asn		A1A4F5|Q641Q7|Q6P4C4|Q6PJI6|Q86TN6|Q96FK2|Q9NUY1	Missense_Mutation|Silent	SNP	pfam_PP2C-like_dom,pfam_Leu-rich_rpt,superfamily_PP2C-like_dom,smart_Leu-rich_rpt_typical-subtyp,smart_PP2C-like_dom,pfscan_Pleckstrin_homology	p.T1236K|p.T1236	ENST00000262719.5	37	c.3707|c.3708	CCDS45881.2	18																																																																																			PHLPP1	-	pfam_PP2C-like_dom,superfamily_PP2C-like_dom,smart_PP2C-like_dom	ENSG00000081913		0.441	PHLPP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PHLPP1	HGNC	protein_coding	OTTHUMT00000319249.2		0.00	58|57	0	C|A	NM_194449		60639893|60639894	+1			no_errors	ENST00000262719	ensembl	human	known	74_37	missense|silent	16.67	20	4	SNP	1.000|0.974	A|C
PI4KA	5297	genome.wustl.edu	37	22	21088410	21088410	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr22:21088410G>T	ENST00000572273.1	-	34	4029	c.3799C>A	c.(3799-3801)Cag>Aag	p.Q1267K	PI4KA_ENST00000414196.3_Missense_Mutation_p.Q77K|PI4KA_ENST00000255882.6_Missense_Mutation_p.Q1325K			P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha	1267					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi-associated vesicle membrane (GO:0030660)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(8)|kidney(9)|large_intestine(19)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|salivary_gland(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	79	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			ATGGAGCGCTGCAGCAGGCTG	0.622																																					GBM(136;1332 1831 3115 23601 50806)												0													21.0	18.0	19.0					22																	21088410		2197	4296	6493	SO:0001583	missense	0			L36151	CCDS33603.1, CCDS33603.2	22q11.21	2011-05-25	2007-08-14	2007-08-02	ENSG00000241973	ENSG00000241973			8983	protein-coding gene	gene with protein product		600286		PIK4CA		7961848, 8662589	Standard	NM_002650		Approved	PI4K-ALPHA, pi4K230	uc002zsz.5	P42356	OTTHUMG00000167440	ENST00000572273.1:c.3799C>A	22.37:g.21088410G>T	ENSP00000458238:p.Gln1267Lys		Q7Z625|Q9UPG2	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.Q1325K	ENST00000572273.1	37	c.3973		22	.	.	.	.	.	.	.	.	.	.	G	20.7	4.030332	0.75504	.	.	ENSG00000241973	ENST00000255882;ENST00000414196	T	0.77620	-1.11	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	T	0.77082	0.4078	M	0.66939	2.045	0.80722	D	1	P	0.39326	0.668	B	0.39660	0.306	T	0.75274	-0.3375	10	0.21540	T	0.41	-24.3326	17.9749	0.89124	0.0:0.0:1.0:0.0	.	1267	P42356	PI4KA_HUMAN	K	1267;77	ENSP00000402981:Q77K	ENSP00000255882:Q1267K	Q	-	1	0	PI4KA	19418410	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.618000	0.98365	2.475000	0.83589	0.555000	0.69702	CAG	PI4KA	-	NULL	ENSG00000241973		0.622	PI4KA-202	KNOWN	basic|appris_principal	protein_coding	PI4KA	HGNC	protein_coding		-	0.00	55	0	G	NM_058004		21088410	-1	tier1	-	no_errors	ENST00000255882	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	T
PI4KA	5297	genome.wustl.edu	37	22	21088410	21088410	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr22:21088410G>T	ENST00000572273.1	-	34	4029	c.3799C>A	c.(3799-3801)Cag>Aag	p.Q1267K	PI4KA_ENST00000414196.3_Missense_Mutation_p.Q77K|PI4KA_ENST00000255882.6_Missense_Mutation_p.Q1325K			P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha	1267					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi-associated vesicle membrane (GO:0030660)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(8)|kidney(9)|large_intestine(19)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|salivary_gland(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	79	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			ATGGAGCGCTGCAGCAGGCTG	0.622																																					GBM(136;1332 1831 3115 23601 50806)												0													21.0	18.0	19.0					22																	21088410		2197	4296	6493	SO:0001583	missense	0			L36151	CCDS33603.1, CCDS33603.2	22q11.21	2011-05-25	2007-08-14	2007-08-02	ENSG00000241973	ENSG00000241973			8983	protein-coding gene	gene with protein product		600286		PIK4CA		7961848, 8662589	Standard	NM_002650		Approved	PI4K-ALPHA, pi4K230	uc002zsz.5	P42356	OTTHUMG00000167440	ENST00000572273.1:c.3799C>A	22.37:g.21088410G>T	ENSP00000458238:p.Gln1267Lys		Q7Z625|Q9UPG2	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.Q1325K	ENST00000572273.1	37	c.3973		22	.	.	.	.	.	.	.	.	.	.	G	20.7	4.030332	0.75504	.	.	ENSG00000241973	ENST00000255882;ENST00000414196	T	0.77620	-1.11	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	T	0.77082	0.4078	M	0.66939	2.045	0.80722	D	1	P	0.39326	0.668	B	0.39660	0.306	T	0.75274	-0.3375	10	0.21540	T	0.41	-24.3326	17.9749	0.89124	0.0:0.0:1.0:0.0	.	1267	P42356	PI4KA_HUMAN	K	1267;77	ENSP00000402981:Q77K	ENSP00000255882:Q1267K	Q	-	1	0	PI4KA	19418410	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.618000	0.98365	2.475000	0.83589	0.555000	0.69702	CAG	PI4KA	-	NULL	ENSG00000241973		0.622	PI4KA-202	KNOWN	basic|appris_principal	protein_coding	PI4KA	HGNC	protein_coding		-	0.00	62	0	G	NM_058004		21088410	-1	tier1	-	no_errors	ENST00000255882	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	T
PID1	55022	genome.wustl.edu	37	2	229890416	229890416	+	Missense_Mutation	SNP	C	C	A	rs375488219		TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr2:229890416C>A	ENST00000354069.6	-	3	715	c.685G>T	c.(685-687)Gac>Tac	p.D229Y	PID1_ENST00000409462.1_Missense_Mutation_p.D147Y|PID1_ENST00000392055.3_Missense_Mutation_p.D196Y|PID1_ENST00000482518.2_Intron|PID1_ENST00000392054.3_Missense_Mutation_p.D227Y			Q7Z2X4	PCLI1_HUMAN	phosphotyrosine interaction domain containing 1	229	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				cellular response to cytokine stimulus (GO:0071345)|cellular response to fatty acid (GO:0071398)|cellular response to interleukin-6 (GO:0071354)|cellular response to leptin stimulus (GO:0044320)|cellular response to tumor necrosis factor (GO:0071356)|energy reserve metabolic process (GO:0006112)|mitochondrion morphogenesis (GO:0070584)|negative regulation of ATP biosynthetic process (GO:2001170)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of glucose import in response to insulin stimulus (GO:2001274)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of mitochondrial DNA replication (GO:0090298)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of ATP biosynthetic process (GO:2001171)|positive regulation of fat cell proliferation (GO:0070346)|positive regulation of gene expression (GO:0010628)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of mitochondrial fusion (GO:0010635)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of reactive oxygen species metabolic process (GO:2000377)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(4)|endometrium(3)|large_intestine(5)|lung(8)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	26		Renal(207;0.0112)|all_lung(227;0.0191)|Lung NSC(271;0.0851)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.171)		Epithelial(121;3.08e-11)|all cancers(144;2.28e-08)|LUSC - Lung squamous cell carcinoma(224;0.0145)|Lung(261;0.0189)		ATCCGCCCGTCGCTCTTCATA	0.562																																																	0													101.0	96.0	98.0					2																	229890416		2203	4300	6503	SO:0001583	missense	0			AK096636	CCDS2471.1, CCDS42830.1	2q36.3	2007-02-02			ENSG00000153823	ENSG00000153823			26084	protein-coding gene	gene with protein product		612930				17124247, 16815647, 15221005	Standard	NM_001100818		Approved	NYGGF4, FLJ20701	uc002vps.4	Q7Z2X4	OTTHUMG00000133191	ENST00000354069.6:c.685G>T	2.37:g.229890416C>A	ENSP00000283937:p.Asp229Tyr		B3KU82|Q68CJ2|Q6ZUS3|Q8IXL0|Q9NWP6	Missense_Mutation	SNP	pfam_PTB/PI_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom	p.D229Y	ENST00000354069.6	37	c.685		2	.	.	.	.	.	.	.	.	.	.	C	24.7	4.557232	0.86231	.	.	ENSG00000153823	ENST00000392054;ENST00000409462;ENST00000392055;ENST00000542363;ENST00000354069	.	.	.	5.96	5.96	0.96718	.	0.043912	0.85682	D	0.000000	T	0.75436	0.3849	L	0.50333	1.59	0.80722	D	1	D;D;D;D	0.89917	0.998;0.993;1.0;0.999	D;P;D;D	0.74348	0.937;0.895;0.98;0.983	T	0.71553	-0.4558	8	.	.	.	-47.9026	19.3963	0.94608	0.0:1.0:0.0:0.0	.	147;196;227;229	Q7Z2X4-3;Q7Z2X4-4;Q7Z2X4-2;Q7Z2X4	.;.;.;PCLI1_HUMAN	Y	227;147;196;229;229	.	.	D	-	1	0	PID1	229598660	1.000000	0.71417	0.669000	0.29828	0.973000	0.67179	7.397000	0.79903	2.814000	0.96858	0.655000	0.94253	GAC	PID1	-	smart_PTB/PI_dom	ENSG00000153823		0.562	PID1-005	KNOWN	basic	protein_coding	PID1	HGNC	protein_coding	OTTHUMT00000331810.2	-	0.00	23	0	C	NM_017933		229890416	-1	tier1	-	no_errors	ENST00000354069	ensembl	human	known	74_37	missense	36.36	21	12	SNP	1.000	A
PIWIL1	9271	genome.wustl.edu	37	12	130845767	130845767	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr12:130845767G>A	ENST00000245255.3	+	15	1980	c.1708G>A	c.(1708-1710)Gct>Act	p.A570T		NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	570	Piwi. {ECO:0000255|PROSITE- ProRule:PRU00150}.|RNA-binding. {ECO:0000250}.				gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)			breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		CAAATACGATGCTATTAAAAA	0.433																																																	0													78.0	74.0	75.0					12																	130845767		2203	4300	6503	SO:0001583	missense	0			AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.1708G>A	12.37:g.130845767G>A	ENSP00000245255:p.Ala570Thr		A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ_dom,pfam_GAGE,superfamily_RNaseH-like_dom,superfamily_PAZ_dom,smart_PAZ_dom,smart_Piwi,pfscan_PAZ_dom,pfscan_Piwi	p.A570T	ENST00000245255.3	37	c.1708	CCDS9268.1	12	.	.	.	.	.	.	.	.	.	.	G	16.39	3.109230	0.56398	.	.	ENSG00000125207	ENST00000245255	T	0.28895	1.59	5.43	4.52	0.55395	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.224368	0.48767	D	0.000178	T	0.31231	0.0790	L	0.52364	1.645	0.48901	D	0.999728	B;B	0.25955	0.036;0.138	B;B	0.26614	0.043;0.071	T	0.10870	-1.0611	10	0.56958	D	0.05	-25.9397	14.7917	0.69846	0.0:0.0:0.8547:0.1453	.	570;570	Q96J94;Q96J94-2	PIWL1_HUMAN;.	T	570	ENSP00000245255:A570T	ENSP00000245255:A570T	A	+	1	0	PIWIL1	129411720	1.000000	0.71417	0.894000	0.35097	0.971000	0.66376	4.056000	0.57448	1.383000	0.46405	0.655000	0.94253	GCT	PIWIL1	-	pfam_Piwi,superfamily_RNaseH-like_dom,smart_Piwi,pfscan_Piwi	ENSG00000125207		0.433	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIWIL1	HGNC	protein_coding	OTTHUMT00000399510.1	-	0.00	54	0	G			130845767	+1	tier1	-	no_errors	ENST00000245255	ensembl	human	known	74_37	missense	29.31	41	17	SNP	1.000	A
PLOD3	8985	genome.wustl.edu	37	7	100855170	100855170	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr7:100855170G>T	ENST00000223127.3	-	11	1587	c.1189C>A	c.(1189-1191)Ctc>Atc	p.L397I		NM_001084.4	NP_001075.1	O60568	PLOD3_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3	397					basement membrane assembly (GO:0070831)|cellular protein modification process (GO:0006464)|cellular response to hormone stimulus (GO:0032870)|collagen fibril organization (GO:0030199)|endothelial cell morphogenesis (GO:0001886)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|in utero embryonic development (GO:0001701)|lung morphogenesis (GO:0060425)|neural tube development (GO:0021915)|protein localization (GO:0008104)|vasodilation (GO:0042311)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen galactosyltransferase activity (GO:0050211)|procollagen glucosyltransferase activity (GO:0033823)|procollagen-lysine 5-dioxygenase activity (GO:0008475)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	31	Lung NSC(181;0.168)|all_lung(186;0.215)				Succinic acid(DB00139)|Vitamin C(DB00126)	AGGTTGGTGAGGACAGCGTCG	0.667																																																	0													45.0	39.0	41.0					7																	100855170		2203	4300	6503	SO:0001583	missense	0			AF046889	CCDS5715.1	7q22.1	2011-08-24			ENSG00000106397	ENSG00000106397	1.14.11.4		9083	protein-coding gene	gene with protein product	"""lysyl hydroxlase 3"""	603066				9724729, 9582318	Standard	NM_001084		Approved	LH3	uc003uyd.3	O60568	OTTHUMG00000157111	ENST00000223127.3:c.1189C>A	7.37:g.100855170G>T	ENSP00000223127:p.Leu397Ile		B2R6W6|Q540C3	Missense_Mutation	SNP	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	p.L397I	ENST00000223127.3	37	c.1189	CCDS5715.1	7	.	.	.	.	.	.	.	.	.	.	G	5.363	0.252291	0.10185	.	.	ENSG00000106397	ENST00000223127	D	0.86030	-2.06	4.26	0.646	0.17789	.	0.185316	0.31673	N	0.007248	T	0.74114	0.3674	L	0.47016	1.485	0.34160	D	0.668573	B	0.18166	0.026	B	0.21151	0.033	T	0.62817	-0.6774	10	0.30078	T	0.28	-0.0414	2.2825	0.04118	0.1313:0.1231:0.4665:0.2791	.	397	O60568	PLOD3_HUMAN	I	397	ENSP00000223127:L397I	ENSP00000223127:L397I	L	-	1	0	PLOD3	100641890	0.208000	0.23494	0.650000	0.29550	0.062000	0.15995	0.457000	0.21875	0.185000	0.20105	0.456000	0.33151	CTC	PLOD3	-	NULL	ENSG00000106397		0.667	PLOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLOD3	HGNC	protein_coding	OTTHUMT00000347470.1		0.00	59	0	G			100855170	-1			no_errors	ENST00000223127	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.808	T
PREX2	80243	genome.wustl.edu	37	8	69046447	69046447	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr8:69046447G>T	ENST00000288368.4	+	32	4197	c.3920G>T	c.(3919-3921)tGg>tTg	p.W1307L		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	1307					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						AGCAGGAGGTGGCTGGACCAG	0.483																																																	0													121.0	108.0	112.0					8																	69046447		2203	4300	6503	SO:0001583	missense	0			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.3920G>T	8.37:g.69046447G>T	ENSP00000288368:p.Trp1307Leu		B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.W1307L	ENST00000288368.4	37	c.3920	CCDS6201.1	8	.	.	.	.	.	.	.	.	.	.	G	26.9	4.783033	0.90282	.	.	ENSG00000046889	ENST00000288368	T	0.54866	0.55	5.42	5.42	0.78866	.	0.069773	0.64402	D	0.000008	T	0.70430	0.3223	M	0.72118	2.19	0.80722	D	1	D	0.56521	0.976	P	0.60173	0.87	T	0.73091	-0.4092	10	0.66056	D	0.02	.	19.2126	0.93763	0.0:0.0:1.0:0.0	.	1307	Q70Z35	PREX2_HUMAN	L	1307	ENSP00000288368:W1307L	ENSP00000288368:W1307L	W	+	2	0	PREX2	69209001	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	7.561000	0.82288	2.559000	0.86315	0.655000	0.94253	TGG	PREX2	-	NULL	ENSG00000046889		0.483	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREX2	HGNC	protein_coding	OTTHUMT00000378620.1	-	0.00	31	0	G	NM_025170		69046447	+1	tier1	-	no_errors	ENST00000288368	ensembl	human	known	74_37	missense	50.00	17	17	SNP	1.000	T
PRKD2	25865	genome.wustl.edu	37	19	47197354	47197354	+	Missense_Mutation	SNP	C	C	T	rs536434220		TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr19:47197354C>T	ENST00000291281.4	-	10	1579	c.1354G>A	c.(1354-1356)Gcc>Acc	p.A452T	PRKD2_ENST00000595515.1_Missense_Mutation_p.A452T|PRKD2_ENST00000600194.1_Missense_Mutation_p.A295T|PRKD2_ENST00000433867.1_Missense_Mutation_p.A452T|PRKD2_ENST00000601806.1_Missense_Mutation_p.A295T			Q9BZL6	KPCD2_HUMAN	protein kinase D2	452	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	41		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		AAGTTCTGGGCGGACTCCACC	0.587													C|||	1	0.000199681	0.0	0.0	5008	,	,		18139	0.0		0.0	False		,,,				2504	0.001																0													56.0	47.0	50.0					19																	47197354		2203	4300	6503	SO:0001583	missense	0			AF151021	CCDS12689.1, CCDS59401.1	19q13.2	2013-01-10				ENSG00000105287		"""Pleckstrin homology (PH) domain containing"""	17293	protein-coding gene	gene with protein product		607074				11042152, 11062248	Standard	NM_001079880		Approved	PKD2, HSPC187, DKFZP586E0820	uc002pfj.3	Q9BZL6		ENST00000291281.4:c.1354G>A	19.37:g.47197354C>T	ENSP00000291281:p.Ala452Thr		Q8TB08|Q9P0T6|Q9Y3X8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd	p.A452T	ENST00000291281.4	37	c.1354	CCDS12689.1	19	.	.	.	.	.	.	.	.	.	.	C	16.56	3.158750	0.57368	.	.	ENSG00000105287	ENST00000291281;ENST00000433867	T;T	0.23754	1.89;1.89	4.73	3.67	0.42095	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.150484	0.42548	D	0.000691	T	0.29652	0.0740	M	0.66378	2.025	0.47949	D	0.999552	B;P	0.35959	0.056;0.53	B;B	0.38225	0.084;0.268	T	0.05903	-1.0857	10	0.30854	T	0.27	-18.6129	13.2803	0.60210	0.1602:0.8398:0.0:0.0	.	452;452	E7ER94;Q9BZL6	.;KPCD2_HUMAN	T	452	ENSP00000291281:A452T;ENSP00000393978:A452T	ENSP00000291281:A452T	A	-	1	0	PRKD2	51889194	0.987000	0.35691	0.922000	0.36590	0.927000	0.56198	2.694000	0.47035	1.096000	0.41439	0.555000	0.69702	GCC	PRKD2	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000105287		0.587	PRKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKD2	HGNC	protein_coding	OTTHUMT00000466591.1		0.00	38	0	C	NM_016457		47197354	-1			no_errors	ENST00000291281	ensembl	human	known	74_37	missense	5.66	50	3	SNP	0.998	T
SUPT6H	6830	genome.wustl.edu	37	17	27030613	27030613	+	IGR	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr17:27030613C>T	ENST00000314616.6	+	0	6518				PROCA1_ENST00000579650.1_5'Flank|PROCA1_ENST00000439862.3_Missense_Mutation_p.R327K|PROCA1_ENST00000301039.2_Missense_Mutation_p.R325K	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)						chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					GGGAGATTTTCTCTTGTTTAC	0.537																																																	0													112.0	111.0	112.0					17																	27030613		2203	4300	6503	SO:0001628	intergenic_variant	0			U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85			17.37:g.27030613C>T			A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	pfam_PLipase_A2,superfamily_PLipase_A2_dom	p.R327K	ENST00000314616.6	37	c.980	CCDS32596.1	17	.	.	.	.	.	.	.	.	.	.	C	15.24	2.775069	0.49786	.	.	ENSG00000167525	ENST00000301039;ENST00000439862;ENST00000415329	T;T	0.04654	3.58;3.58	4.84	2.86	0.33363	.	0.238357	0.32328	N	0.006258	T	0.07818	0.0196	N	0.20986	0.625	0.24983	N	0.991585	D;P;P	0.64830	0.994;0.734;0.734	D;B;B	0.70716	0.97;0.203;0.203	T	0.28332	-1.0047	10	0.25106	T	0.35	-24.7794	6.396	0.21613	0.0:0.787:0.0:0.213	.	353;327;325	Q8NCQ7;G5E9R8;Q8NCQ7-2	PRCA1_HUMAN;.;.	K	325;327;353	ENSP00000301039:R325K;ENSP00000411400:R327K	ENSP00000301039:R325K	R	-	2	0	PROCA1	24054740	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	1.024000	0.30077	1.338000	0.45544	0.655000	0.94253	AGA	PROCA1	-	NULL	ENSG00000167525		0.537	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PROCA1	HGNC	protein_coding	OTTHUMT00000446422.2	-	0.00	36	0	C	NM_003170		27030613	-1	tier1	-	no_errors	ENST00000439862	ensembl	human	known	74_37	missense	43.44	345	265	SNP	1.000	T
SUPT6H	6830	genome.wustl.edu	37	17	27030654	27030654	+	IGR	SNP	C	C	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr17:27030654C>G	ENST00000314616.6	+	0	6518				PROCA1_ENST00000579650.1_5'Flank|PROCA1_ENST00000439862.3_Missense_Mutation_p.K313N|PROCA1_ENST00000301039.2_Missense_Mutation_p.K311N|PROCA1_ENST00000581289.1_3'UTR	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)						chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					TTGCCCCTGTCTTTTTGGCCT	0.547																																																	0													113.0	111.0	112.0					17																	27030654		2203	4300	6503	SO:0001628	intergenic_variant	0			U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85			17.37:g.27030654C>G			A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	pfam_PLipase_A2,superfamily_PLipase_A2_dom	p.K313N	ENST00000314616.6	37	c.939	CCDS32596.1	17	.	.	.	.	.	.	.	.	.	.	C	11.37	1.618093	0.28801	.	.	ENSG00000167525	ENST00000301039;ENST00000439862;ENST00000415329	T;T	0.04809	3.55;3.55	4.84	0.421	0.16451	.	0.244211	0.32533	N	0.005976	T	0.07593	0.0191	L	0.32530	0.975	0.19575	N	0.999965	D;D;D	0.63046	0.961;0.992;0.992	P;P;P	0.57101	0.541;0.813;0.813	T	0.16100	-1.0414	10	0.72032	D	0.01	-24.0622	7.4189	0.27061	0.0:0.6058:0.0:0.3942	.	339;313;311	Q8NCQ7;G5E9R8;Q8NCQ7-2	PRCA1_HUMAN;.;.	N	311;313;339	ENSP00000301039:K311N;ENSP00000411400:K313N	ENSP00000301039:K311N	K	-	3	2	PROCA1	24054781	0.077000	0.21312	0.029000	0.17559	0.017000	0.09413	0.102000	0.15272	0.018000	0.15052	-0.140000	0.14226	AAG	PROCA1	-	NULL	ENSG00000167525		0.547	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PROCA1	HGNC	protein_coding	OTTHUMT00000446422.2	-	0.00	33	0	C	NM_003170		27030654	-1	tier1	-	no_errors	ENST00000439862	ensembl	human	known	74_37	missense	40.85	373	261	SNP	0.094	G
SUPT6H	6830	genome.wustl.edu	37	17	27030761	27030761	+	IGR	SNP	C	C	A	rs547305035		TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr17:27030761C>A	ENST00000314616.6	+	0	6518				PROCA1_ENST00000579650.1_5'Flank|PROCA1_ENST00000439862.3_Nonsense_Mutation_p.E278*|PROCA1_ENST00000301039.2_Nonsense_Mutation_p.E276*|PROCA1_ENST00000581289.1_3'UTR	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)						chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					TCCTCGCTCTCCAGCTCTTCC	0.577																																																	0													100.0	98.0	98.0					17																	27030761		2203	4300	6503	SO:0001628	intergenic_variant	0			U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85			17.37:g.27030761C>A			A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Nonsense_Mutation	SNP	pfam_PLipase_A2,superfamily_PLipase_A2_dom	p.E278*	ENST00000314616.6	37	c.832	CCDS32596.1	17	.	.	.	.	.	.	.	.	.	.	C	31	5.103677	0.94245	.	.	ENSG00000167525	ENST00000301039;ENST00000439862;ENST00000415329	.	.	.	5.27	5.27	0.74061	.	0.404229	0.23610	N	0.046356	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-22.967	14.739	0.69440	0.0:1.0:0.0:0.0	.	.	.	.	X	276;278;304	.	ENSP00000301039:E276X	E	-	1	0	PROCA1	24054888	1.000000	0.71417	0.999000	0.59377	0.947000	0.59692	3.687000	0.54692	2.599000	0.87857	0.655000	0.94253	GAG	PROCA1	-	NULL	ENSG00000167525		0.577	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PROCA1	HGNC	protein_coding	OTTHUMT00000446422.2	-	0.00	24	0	C	NM_003170		27030761	-1	tier1	-	no_errors	ENST00000439862	ensembl	human	known	74_37	nonsense	45.23	241	199	SNP	0.994	A
SUPT6H	6830	genome.wustl.edu	37	17	27030779	27030779	+	IGR	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr17:27030779C>T	ENST00000314616.6	+	0	6518				PROCA1_ENST00000579650.1_5'Flank|PROCA1_ENST00000439862.3_Missense_Mutation_p.E272K|PROCA1_ENST00000301039.2_Missense_Mutation_p.E270K|PROCA1_ENST00000581289.1_3'UTR	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)						chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					TCCCGGCTTTCTGGGCTGGAC	0.567																																																	0													97.0	97.0	97.0					17																	27030779		2203	4300	6503	SO:0001628	intergenic_variant	0			U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85			17.37:g.27030779C>T			A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	pfam_PLipase_A2,superfamily_PLipase_A2_dom	p.E272K	ENST00000314616.6	37	c.814	CCDS32596.1	17	.	.	.	.	.	.	.	.	.	.	C	23.4	4.413998	0.83449	.	.	ENSG00000167525	ENST00000301039;ENST00000439862;ENST00000415329	T;T	0.05025	3.51;3.51	5.27	5.27	0.74061	.	0.734280	0.12403	N	0.471997	T	0.06280	0.0162	N	0.14661	0.345	0.30320	N	0.787706	P;P;P	0.46142	0.651;0.873;0.873	B;B;B	0.42361	0.115;0.385;0.385	T	0.14587	-1.0467	10	0.54805	T	0.06	-5.722	14.739	0.69440	0.0:1.0:0.0:0.0	.	298;272;270	Q8NCQ7;G5E9R8;Q8NCQ7-2	PRCA1_HUMAN;.;.	K	270;272;298	ENSP00000301039:E270K;ENSP00000411400:E272K	ENSP00000301039:E270K	E	-	1	0	PROCA1	24054906	0.986000	0.35501	0.996000	0.52242	0.994000	0.84299	3.436000	0.52856	2.599000	0.87857	0.655000	0.94253	GAA	PROCA1	-	NULL	ENSG00000167525		0.567	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PROCA1	HGNC	protein_coding	OTTHUMT00000446422.2	-	0.00	23	0	C	NM_003170		27030779	-1	tier1	-	no_errors	ENST00000439862	ensembl	human	known	74_37	missense	41.23	247	174	SNP	0.995	T
SUPT6H	6830	genome.wustl.edu	37	17	27030811	27030811	+	IGR	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr17:27030811C>T	ENST00000314616.6	+	0	6518				PROCA1_ENST00000579650.1_5'Flank|PROCA1_ENST00000439862.3_Missense_Mutation_p.R261K|PROCA1_ENST00000301039.2_Missense_Mutation_p.R259K|PROCA1_ENST00000581289.1_3'UTR	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)						chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					GGCCAGCTGTCTTGCGCTTAA	0.557																																																	0													105.0	107.0	106.0					17																	27030811		2203	4300	6503	SO:0001628	intergenic_variant	0			U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85			17.37:g.27030811C>T			A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	pfam_PLipase_A2,superfamily_PLipase_A2_dom	p.R261K	ENST00000314616.6	37	c.782	CCDS32596.1	17	.	.	.	.	.	.	.	.	.	.	c	22.1	4.245017	0.79912	.	.	ENSG00000167525	ENST00000301039;ENST00000439862;ENST00000415329	T;T	0.04862	3.54;3.54	4.97	4.97	0.65823	.	0.096626	0.43579	D	0.000557	T	0.14917	0.0360	L	0.34521	1.04	0.28159	N	0.929077	D;D;D	0.67145	0.994;0.996;0.996	D;D;D	0.76071	0.97;0.987;0.987	T	0.03051	-1.1078	10	0.36615	T	0.2	-10.8405	14.0644	0.64819	0.0:1.0:0.0:0.0	.	287;261;259	Q8NCQ7;G5E9R8;Q8NCQ7-2	PRCA1_HUMAN;.;.	K	259;261;287	ENSP00000301039:R259K;ENSP00000411400:R261K	ENSP00000301039:R259K	R	-	2	0	PROCA1	24054938	0.058000	0.20735	0.477000	0.27303	0.638000	0.38207	2.006000	0.40874	2.434000	0.82447	0.651000	0.88453	AGA	PROCA1	-	NULL	ENSG00000167525		0.557	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PROCA1	HGNC	protein_coding	OTTHUMT00000446422.2	-	0.00	21	0	C	NM_003170		27030811	-1	tier1	-	no_errors	ENST00000439862	ensembl	human	known	74_37	missense	41.18	239	168	SNP	0.892	T
SUPT6H	6830	genome.wustl.edu	37	17	27031622	27031622	+	IGR	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr17:27031622C>T	ENST00000314616.6	+	0	6518				PROCA1_ENST00000579650.1_5'UTR|PROCA1_ENST00000439862.3_Intron|PROCA1_ENST00000301039.2_Intron|PROCA1_ENST00000581289.1_Intron	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)						chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					GGGCTGGCAGCACCAATTCAA	0.602																																																	0																																										SO:0001628	intergenic_variant	0			U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85			17.37:g.27031622C>T			A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Silent	SNP	pfam_PLipase_A2,superfamily_PLipase_A2_dom	p.V108	ENST00000314616.6	37	c.324	CCDS32596.1	17																																																																																			PROCA1	-	pfam_PLipase_A2	ENSG00000167525		0.602	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PROCA1	HGNC	protein_coding	OTTHUMT00000446422.2	-	0.00	34	0	C	NM_003170		27031622	-1	tier1	-	no_errors	ENST00000473751	ensembl	human	known	74_37	silent	36.32	263	150	SNP	0.000	T
SUPT6H	6830	genome.wustl.edu	37	17	27031741	27031741	+	IGR	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr17:27031741C>T	ENST00000314616.6	+	0	6518				PROCA1_ENST00000579650.1_5'UTR|PROCA1_ENST00000439862.3_Missense_Mutation_p.C73Y|PROCA1_ENST00000301039.2_Missense_Mutation_p.C71Y|PROCA1_ENST00000581289.1_Intron	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)						chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					ATTACAGTTGCAGTGGTTGAC	0.567																																																	0													106.0	92.0	97.0					17																	27031741		2203	4300	6503	SO:0001628	intergenic_variant	0			U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85			17.37:g.27031741C>T			A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	pfam_PLipase_A2,superfamily_PLipase_A2_dom	p.C73Y	ENST00000314616.6	37	c.218	CCDS32596.1	17	.	.	.	.	.	.	.	.	.	.	C	20.5	4.002019	0.74932	.	.	ENSG00000167525	ENST00000301039;ENST00000439862;ENST00000415329;ENST00000422880	T;T	0.59224	0.85;0.28	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.75049	0.3797	M	0.76574	2.34	0.54753	D	0.999989	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.78277	-0.2266	10	0.87932	D	0	-17.4279	14.1313	0.65255	0.0:1.0:0.0:0.0	.	73;71	G5E9R8;Q8NCQ7-2	.;.	Y	71;73;99;73	ENSP00000301039:C71Y;ENSP00000411400:C73Y	ENSP00000301039:C71Y	C	-	2	0	PROCA1	24055868	1.000000	0.71417	0.995000	0.50966	0.832000	0.47134	5.355000	0.66046	2.379000	0.81126	0.655000	0.94253	TGC	PROCA1	-	pfam_PLipase_A2,superfamily_PLipase_A2_dom	ENSG00000167525		0.567	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PROCA1	HGNC	protein_coding	OTTHUMT00000446422.2	-	0.00	33	0	C	NM_003170		27031741	-1	tier1	-	no_errors	ENST00000439862	ensembl	human	known	74_37	missense	34.41	326	171	SNP	1.000	T
SUPT6H	6830	genome.wustl.edu	37	17	27030923	27030923	+	IGR	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr17:27030923C>T	ENST00000314616.6	+	0	6518				PROCA1_ENST00000579650.1_5'Flank|PROCA1_ENST00000439862.3_Missense_Mutation_p.D224N|PROCA1_ENST00000301039.2_Missense_Mutation_p.D222N|PROCA1_ENST00000581289.1_3'UTR	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)						chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					gccttctcatccatctcctcc	0.498																																																	0													84.0	86.0	85.0					17																	27030923		2202	4300	6502	SO:0001628	intergenic_variant	0			U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85			17.37:g.27030923C>T			A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	pfam_PLipase_A2,superfamily_PLipase_A2_dom	p.D224N	ENST00000314616.6	37	c.670	CCDS32596.1	17	.	.	.	.	.	.	.	.	.	.	C	20.9	4.063231	0.76187	.	.	ENSG00000167525	ENST00000301039;ENST00000439862;ENST00000415329	T;T	0.04706	3.57;3.57	5.27	5.27	0.74061	.	3.353030	0.01057	N	0.004570	T	0.16385	0.0394	L	0.32530	0.975	0.39941	D	0.974413	D;D;D	0.76494	0.993;0.999;0.998	P;D;P	0.66351	0.805;0.943;0.904	T	0.01378	-1.1370	10	0.33940	T	0.23	-11.7804	14.739	0.69440	0.0:1.0:0.0:0.0	.	250;224;222	Q8NCQ7;G5E9R8;Q8NCQ7-2	PRCA1_HUMAN;.;.	N	222;224;250	ENSP00000301039:D222N;ENSP00000411400:D224N	ENSP00000301039:D222N	D	-	1	0	PROCA1	24055050	0.008000	0.16893	0.904000	0.35570	0.617000	0.37484	0.868000	0.27982	2.599000	0.87857	0.655000	0.94253	GAT	PROCA1	-	NULL	ENSG00000167525		0.498	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PROCA1	HGNC	protein_coding	OTTHUMT00000446422.2		0.00	15	0	C	NM_003170		27030923	-1			no_errors	ENST00000439862	ensembl	human	known	74_37	missense	49.85	160	161	SNP	0.978	T
SUPT6H	6830	genome.wustl.edu	37	17	27030929	27030929	+	IGR	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr17:27030929C>T	ENST00000314616.6	+	0	6518				PROCA1_ENST00000579650.1_5'Flank|PROCA1_ENST00000439862.3_Missense_Mutation_p.E222K|PROCA1_ENST00000301039.2_Missense_Mutation_p.E220K|PROCA1_ENST00000581289.1_3'UTR	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)						chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					tcatccatctcctccttgtct	0.493																																																	0													80.0	81.0	81.0					17																	27030929		2202	4300	6502	SO:0001628	intergenic_variant	0			U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85			17.37:g.27030929C>T			A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	pfam_PLipase_A2,superfamily_PLipase_A2_dom	p.E222K	ENST00000314616.6	37	c.664	CCDS32596.1	17	.	.	.	.	.	.	.	.	.	.	c	12.46	1.944197	0.34283	.	.	ENSG00000167525	ENST00000301039;ENST00000439862;ENST00000415329	T;T	0.04917	3.53;3.53	4.84	3.6	0.41247	.	1.056300	0.07409	N	0.892147	T	0.05593	0.0147	N	0.24115	0.695	0.28148	N	0.929512	B;B;B	0.23058	0.079;0.0;0.0	B;B;B	0.21546	0.035;0.002;0.002	T	0.38757	-0.9646	10	0.33141	T	0.24	-10.318	7.5073	0.27553	0.0:0.8335:0.0:0.1665	.	248;222;220	Q8NCQ7;G5E9R8;Q8NCQ7-2	PRCA1_HUMAN;.;.	K	220;222;248	ENSP00000301039:E220K;ENSP00000411400:E222K	ENSP00000301039:E220K	E	-	1	0	PROCA1	24055056	0.012000	0.17670	0.793000	0.32043	0.346000	0.29079	0.523000	0.22925	0.994000	0.38892	0.655000	0.94253	GAG	PROCA1	-	NULL	ENSG00000167525		0.493	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PROCA1	HGNC	protein_coding	OTTHUMT00000446422.2		0.00	14	0	C	NM_003170		27030929	-1			no_errors	ENST00000439862	ensembl	human	known	74_37	missense	50.00	161	161	SNP	0.938	T
SUPT6H	6830	genome.wustl.edu	37	17	27031844	27031844	+	IGR	SNP	C	C	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr17:27031844C>G	ENST00000314616.6	+	0	6518				PROCA1_ENST00000579650.1_5'UTR|PROCA1_ENST00000439862.3_Missense_Mutation_p.D39H|PROCA1_ENST00000301039.2_Missense_Mutation_p.D37H|PROCA1_ENST00000581289.1_Intron	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)						chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					CAGCACTTGTCAGGCTCCTTG	0.567																																																	0													100.0	82.0	88.0					17																	27031844		2203	4300	6503	SO:0001628	intergenic_variant	0			U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85			17.37:g.27031844C>G			A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	pfam_PLipase_A2,superfamily_PLipase_A2_dom	p.D39H	ENST00000314616.6	37	c.115	CCDS32596.1	17	.	.	.	.	.	.	.	.	.	.	C	19.34	3.808728	0.70797	.	.	ENSG00000167525	ENST00000301039;ENST00000439862;ENST00000415329;ENST00000422880	T;T	0.55234	0.53;0.53	5.38	4.42	0.53409	.	0.213275	0.46145	D	0.000310	T	0.67144	0.2862	M	0.69823	2.125	0.46981	D	0.999279	D;D	0.76494	0.997;0.999	D;D	0.66351	0.912;0.943	T	0.69928	-0.5012	10	0.87932	D	0	.	9.9239	0.41481	0.0:0.9058:0.0:0.0942	.	39;37	G5E9R8;Q8NCQ7-2	.;.	H	37;39;65;39	ENSP00000301039:D37H;ENSP00000411400:D39H	ENSP00000301039:D37H	D	-	1	0	PROCA1	24055971	0.988000	0.35896	0.749000	0.31150	0.893000	0.52053	2.832000	0.48152	1.268000	0.44264	0.561000	0.74099	GAC	PROCA1	-	pfam_PLipase_A2,superfamily_PLipase_A2_dom	ENSG00000167525		0.567	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PROCA1	HGNC	protein_coding	OTTHUMT00000446422.2	-	0.00	47	0	C	NM_003170		27031844	-1	tier1	-	no_errors	ENST00000439862	ensembl	human	known	74_37	missense	17.49	349	74	SNP	0.989	G
PRR5L	79899	genome.wustl.edu	37	11	36485195	36485195	+	3'UTR	DEL	A	A	-	rs200390084	byFrequency	TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr11:36485195delA	ENST00000378867.3	+	0	2371				PRR5L_ENST00000311599.5_3'UTR|PRR5L_ENST00000389693.3_3'UTR	NM_024841.4	NP_079117.3	Q6MZQ0	PRR5L_HUMAN	proline rich 5 like						negative regulation of protein phosphorylation (GO:0001933)|negative regulation of signal transduction (GO:0009968)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|regulation of fibroblast migration (GO:0010762)|TORC2 signaling (GO:0038203)	mitochondrion (GO:0005739)|TORC2 complex (GO:0031932)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(7)|ovary(1)	19						TGTATCGTTTAAAAAAAAAAA	0.393													|||unknown(HR)	1189	0.23742	0.2224	0.3184	5008	,	,		21881	0.1944		0.2913	False		,,,				2504	0.1892																0																																										SO:0001624	3_prime_UTR_variant	0				CCDS31463.1, CCDS53617.1	11p13-p12	2009-07-09				ENSG00000135362			25878	protein-coding gene	gene with protein product	"""protein observed with Rictor-2"""	611728				17461779	Standard	NM_024841		Approved	FLJ14213, PROTOR-2	uc001mwp.3	Q6MZQ0		ENST00000378867.3:c.*909A>-	11.37:g.36485195delA			A4QN22|E9PKY1|Q96H46|Q9H7V4	RNA	DEL	-	NULL	ENST00000378867.3	37	NULL	CCDS31463.1	11																																																																																			PRR5L	-	-	ENSG00000135362		0.393	PRR5L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PRR5L	HGNC	protein_coding	OTTHUMT00000389209.1		0.00	31	0	A	NM_024841		36485195	+1	tier1		no_errors	ENST00000389693	ensembl	human	known	74_37	rna	16.00	21	4	DEL	0.022	-
PSME4	23198	genome.wustl.edu	37	2	54128624	54128624	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr2:54128624C>T	ENST00000404125.1	-	28	3203	c.3148G>A	c.(3148-3150)Gta>Ata	p.V1050I	PSME4_ENST00000421748.2_Missense_Mutation_p.V194I	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	1050					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)			breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			CACGTCTGTACAATACAGTCC	0.418																																																	0													143.0	137.0	139.0					2																	54128624		2203	4300	6503	SO:0001583	missense	0			D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.3148G>A	2.37:g.54128624C>T	ENSP00000384211:p.Val1050Ile		Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Missense_Mutation	SNP	pfam_DUF3437,superfamily_ARM-type_fold	p.V1050I	ENST00000404125.1	37	c.3148	CCDS33197.2	2	.	.	.	.	.	.	.	.	.	.	C	16.18	3.048848	0.55110	.	.	ENSG00000068878	ENST00000421748;ENST00000404125	T;T	0.22336	1.97;1.96	5.6	5.6	0.85130	Armadillo-like helical (1);Armadillo-type fold (1);	0.171581	0.51477	D	0.000096	T	0.17323	0.0416	N	0.22421	0.69	0.33968	D	0.646478	B;B;B	0.28850	0.225;0.095;0.073	B;B;B	0.23574	0.047;0.032;0.03	T	0.10314	-1.0635	10	0.36615	T	0.2	-21.4061	19.6148	0.95629	0.0:1.0:0.0:0.0	.	425;194;1050	Q14997-2;Q14997-3;Q14997	.;.;PSME4_HUMAN	I	194;1050	ENSP00000410830:V194I;ENSP00000384211:V1050I	ENSP00000384211:V1050I	V	-	1	0	PSME4	53982128	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.294000	0.51787	2.634000	0.89283	0.557000	0.71058	GTA	PSME4	-	superfamily_ARM-type_fold	ENSG00000068878		0.418	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSME4	HGNC	protein_coding	OTTHUMT00000324163.1	-	0.00	46	0	C	XM_040158		54128624	-1	tier1	-	no_errors	ENST00000404125	ensembl	human	known	74_37	missense	28.57	30	12	SNP	1.000	T
PSD4	23550	genome.wustl.edu	37	2	113943282	113943282	+	Intron	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr2:113943282G>A	ENST00000245796.6	+	5	1444				PSD4_ENST00000441564.3_Intron	NM_012455.2	NP_036587.2	Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4						neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			cervix(1)|endometrium(2)|large_intestine(4)|lung(13)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TGAGTCCTGGGAGCCCGCTGT	0.597																																																	0																																										SO:0001627	intron_variant	0			U63127	CCDS33276.1	2q13	2013-01-10			ENSG00000125637	ENSG00000125637		"""Pleckstrin homology (PH) domain containing"""	19096	protein-coding gene	gene with protein product		614442				12082148	Standard	XM_005263634		Approved	TIC, EFA6B	uc002tjc.3	Q8NDX1	OTTHUMG00000153339	ENST00000245796.6:c.1250-172G>A	2.37:g.113943282G>A			A6NEG7|A8K1Y0|O95621|Q4ZG34|Q6GPH8|Q8IYP4	RNA	SNP	-	NULL	ENST00000245796.6	37	NULL	CCDS33276.1	2																																																																																			PSD4	-	-	ENSG00000125637		0.597	PSD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSD4	HGNC	protein_coding	OTTHUMT00000330789.1	-	0.00	35	0	G	NM_012455		113943282	+1	tier1	-	no_errors	ENST00000485525	ensembl	human	known	74_37	rna	42.03	40	29	SNP	0.006	A
PTPN14	5784	genome.wustl.edu	37	1	214557049	214557051	+	In_Frame_Del	DEL	CCT	CCT	-	rs143136196|rs376331360|rs189081489|rs539310988	byFrequency	TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	CCT	CCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:214557049_214557051delCCT	ENST00000366956.5	-	13	2341_2343	c.2147_2149delAGG	c.(2146-2151)gaggct>gct	p.E716del	PTPN14_ENST00000543945.1_3'UTR	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14	716	Poly-Glu.				lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)	p.E716delE(1)		NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		GATTCTGGAGCCTCCTCCTCCTC	0.626																																					Colon(92;557 1424 24372 34121 40073)												1	Deletion - In frame(1)	liver(1)																																								SO:0001651	inframe_deletion	0			X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.2147_2149delAGG	1.37:g.214557058_214557060delCCT	ENSP00000355923:p.Glu716del		Q5VSI0	In_Frame_Del	DEL	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_FERM_central,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_Dual-sp_phosphatase_cat-dom,superfamily_FERM_central,smart_Band_41_domain,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-14/21,pfscan_FERM_domain,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam	p.E716in_frame_del	ENST00000366956.5	37	c.2149_2147	CCDS1514.1	1																																																																																			PTPN14	-	pirsf_Tyr_Pase_non-rcpt_typ-14/21	ENSG00000152104		0.626	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN14	HGNC	protein_coding	OTTHUMT00000089918.2		0.00	12	0	CCT	NM_005401		214557051	-1	tier1		no_errors	ENST00000366956	ensembl	human	known	74_37	in_frame_del	17.24	24	5	DEL	0.182:0.503:0.995	-
PXDN	7837	genome.wustl.edu	37	2	1683968	1683968	+	Missense_Mutation	SNP	A	A	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr2:1683968A>G	ENST00000252804.4	-	7	777	c.727T>C	c.(727-729)Tgt>Cgt	p.C243R		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	243	LRRCT.				extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		CACTCACCACAGTTCAGCTCT	0.582																																																	0													43.0	45.0	44.0					2																	1683968		2186	4274	6460	SO:0001583	missense	0			AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.727T>C	2.37:g.1683968A>G	ENSP00000252804:p.Cys243Arg		A8QM65|D6W4Y0|Q4KMG2	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_VWF_C,pfam_Leu-rich_rpt,superfamily_Haem_peroxidase,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_VWF_C,prints_Haem_peroxidase_animal_subgr,pfscan_VWF_C,pfscan_Haem_peroxidase_animal,pfscan_Ig-like_dom	p.C243R	ENST00000252804.4	37	c.727	CCDS46221.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	17.34|17.34	3.364586|3.364586	0.61513|0.61513	.|.	.|.	ENSG00000130508|ENSG00000130508	ENST00000252804;ENST00000425171|ENST00000447941	T;T|.	0.78003|.	0.53;-1.14|.	4.64|4.64	4.64|4.64	0.57946|0.57946	Cysteine-rich flanking region, C-terminal (1);|.	0.656995|.	0.11496|.	U|.	0.558176|.	D|D	0.86385|0.86385	0.5920|0.5920	H|H	0.95574|0.95574	3.69|3.69	0.80722|0.80722	D|D	1|1	P;P|.	0.44627|.	0.839;0.742|.	P;P|.	0.54401|.	0.751;0.486|.	D|D	0.90488|0.90488	0.4465|0.4465	10|5	0.72032|.	D|.	0.01|.	.|.	14.1244|14.1244	0.65210|0.65210	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	243;243|.	Q92626-2;Q92626|.	.;PXDN_HUMAN|.	R|P	243;219|166	ENSP00000252804:C243R;ENSP00000398363:C219R|.	ENSP00000252804:C243R|.	C|L	-|-	1|2	0|0	PXDN|PXDN	1662975|1662975	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.520000|0.520000	0.34377|0.34377	9.199000|9.199000	0.95003|0.95003	1.737000|1.737000	0.51674|0.51674	0.364000|0.364000	0.22116|0.22116	TGT|CTG	PXDN	-	smart_Cys-rich_flank_reg_C	ENSG00000130508		0.582	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDN	HGNC	protein_coding	OTTHUMT00000322505.1		0.00	8	0	A	XM_056455		1683968	-1			no_errors	ENST00000252804	ensembl	human	known	74_37	missense	14.29	18	3	SNP	1.000	G
RBM5	10181	genome.wustl.edu	37	3	50155888	50155889	+	Stop_Codon_Del	DEL	GA	GA	-	rs112672304		TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	GA	GA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr3:50155888_50155889delGA	ENST00000347869.3	+	0	2622_2623				RP11-493K19.3_ENST00000425674.1_RNA|RP11-493K19.3_ENST00000437204.1_RNA	NM_005778.3	NP_005769.1	P52756	RBM5_HUMAN	RNA binding motif protein 5						apoptotic process (GO:0006915)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.*816fs?(1)		breast(2)|cervix(2)|endometrium(3)|large_intestine(4)|lung(6)|prostate(2)	19				BRCA - Breast invasive adenocarcinoma(193;0.000121)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GAGATGgagtgagagagagaga	0.535																																																	1	Deletion - Frameshift(1)	breast(1)																																								SO:0001567	stop_retained_variant	0			U23946	CCDS2810.1	3p21.3	2013-08-15			ENSG00000003756	ENSG00000003756		"""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9902	protein-coding gene	gene with protein product		606884				10352938, 23935508	Standard	NM_005778		Approved	LUCA15, H37	uc003cyg.3	P52756	OTTHUMG00000156785	Exception_encountered	3.37:g.50155898_50155899delGA			B2RA45|B4DM16|B4DMF9|B4DZ63|Q93021|Q9BU14|Q9HDA6|Q9UKY8|Q9UL24	Frame_Shift_Del	DEL	pfam_G_patch_dom,pfam_RRM_dom,pfam_Znf_RanBP2,smart_RRM_dom,smart_Znf_RanBP2,smart_G_patch_dom,pfscan_Znf_RanBP2,pfscan_Znf_C2H2,pfscan_G_patch_dom,pfscan_RRM_dom	p.*816fs	ENST00000347869.3	37	c.2447_2448	CCDS2810.1	3																																																																																			RBM5	-	NULL	ENSG00000003756		0.535	RBM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM5	HGNC	protein_coding	OTTHUMT00000345797.3		0.00	40	0	GA	NM_005778		50155889	+1	tier1		no_errors	ENST00000347869	ensembl	human	known	74_37	frame_shift_del	11.63	38	5	DEL	1.000:0.999	-
RCOR3	55758	genome.wustl.edu	37	1	211486260	211486260	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:211486260C>T	ENST00000367005.4	+	10	1241	c.1100C>T	c.(1099-1101)gCt>gTt	p.A367V	RCOR3_ENST00000419091.2_Missense_Mutation_p.A425V|RCOR3_ENST00000526255.1_3'UTR|RCOR3_ENST00000452621.2_Missense_Mutation_p.A425V|RCOR3_ENST00000367006.4_Intron	NM_018254.3	NP_060724.1	Q9P2K3	RCOR3_HUMAN	REST corepressor 3	367					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.00961)|all cancers(67;0.0999)|Epithelial(68;0.171)		ACAAAAAGTGCTTCTAATGTG	0.443																																																	0													141.0	134.0	137.0					1																	211486260		2203	4300	6503	SO:0001583	missense	0			AK001738	CCDS31016.1, CCDS44312.1, CCDS44313.1, CCDS44314.1	1q32.3	2008-02-05			ENSG00000117625	ENSG00000117625			25594	protein-coding gene	gene with protein product						10718198	Standard	NM_018254		Approved	FLJ10876	uc010psw.2	Q9P2K3	OTTHUMG00000036996	ENST00000367005.4:c.1100C>T	1.37:g.211486260C>T	ENSP00000355972:p.Ala367Val		B3KYA2|B4DYY7|Q5VT47|Q7L9I5|Q8N5U3|Q9NV83	Missense_Mutation	SNP	pfam_SANT/Myb,pfam_ELM2_dom,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_ELM2_dom	p.A367V	ENST00000367005.4	37	c.1100	CCDS31016.1	1	.	.	.	.	.	.	.	.	.	.	C	12.03	1.814577	0.32053	.	.	ENSG00000117625	ENST00000452621;ENST00000419091;ENST00000367005	T;T;T	0.46451	0.87;2.16;2.16	5.11	4.2	0.49525	.	0.271358	0.40385	N	0.001119	T	0.29423	0.0733	N	0.19112	0.55	0.27446	N	0.95357	B;B;B	0.16802	0.009;0.012;0.019	B;B;B	0.22601	0.005;0.04;0.013	T	0.18398	-1.0338	10	0.38643	T	0.18	-9.4594	12.7368	0.57230	0.0:0.9201:0.0:0.0799	.	425;367;425	Q9P2K3-3;Q9P2K3;Q9P2K3-4	.;RCOR3_HUMAN;.	V	425;425;367	ENSP00000398558:A425V;ENSP00000413929:A425V;ENSP00000355972:A367V	ENSP00000355972:A367V	A	+	2	0	RCOR3	209552883	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.665000	0.68052	1.278000	0.44430	0.650000	0.86243	GCT	RCOR3	-	NULL	ENSG00000117625		0.443	RCOR3-001	KNOWN	basic|CCDS	protein_coding	RCOR3	HGNC	protein_coding	OTTHUMT00000089821.1	-	0.00	59	0	C	NM_018254		211486260	+1	tier1	-	no_errors	ENST00000367005	ensembl	human	known	74_37	missense	54.12	39	46	SNP	1.000	T
RECQL	5965	genome.wustl.edu	37	12	21630863	21630863	+	Silent	SNP	G	G	A	rs148490073	byFrequency	TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr12:21630863G>A	ENST00000444129.2	-	7	1209	c.741C>T	c.(739-741)aaC>aaT	p.N247N	RECQL_ENST00000421138.2_Silent_p.N247N	NM_002907.3|NM_032941.2	NP_002898.2|NP_116559.1	P46063	RECQ1_HUMAN	RecQ helicase-like	247	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand renaturation (GO:0000733)	membrane (GO:0016020)|nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	17						TTAGTGATGCGTTAGGGAACT	0.363								Other identified genes with known or suspected DNA repair function																																									0								G	,	0,4406		0,0,2203	94.0	94.0	94.0		741,741	-1.6	0.0	12	dbSNP_134	94	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous	RECQL	NM_002907.3,NM_032941.2	,	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	,	247/650,247/650	21630863	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0			D37984	CCDS31756.1	12p12.1	2014-03-07	2014-03-07	2014-03-07	ENSG00000004700	ENSG00000004700			9948	protein-coding gene	gene with protein product	"""DNA helicase Q1-like"""	600537	"""RecQ protein-like (DNA helicase Q1-like)"""			7527136, 7961977	Standard	NM_002907		Approved	RecQ1, RecQL1	uc001rex.3	P46063	OTTHUMG00000169131	ENST00000444129.2:c.741C>T	12.37:g.21630863G>A			A8K6G2	Silent	SNP	pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_RQC_domain,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.N247	ENST00000444129.2	37	c.741	CCDS31756.1	12																																																																																			RECQL	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd,tigrfam_DNA_helicase_ATP-dep_RecQ	ENSG00000004700		0.363	RECQL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RECQL	HGNC	protein_coding	OTTHUMT00000402371.1	-	0.00	37	0	G	NM_002907		21630863	-1	tier1	rs148490073	no_errors	ENST00000421138	ensembl	human	known	74_37	silent	37.50	40	24	SNP	0.025	A
REV3L	5980	genome.wustl.edu	37	6	111694948	111694948	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr6:111694948C>A	ENST00000358835.3	-	14	5064	c.4610G>T	c.(4609-4611)aGa>aTa	p.R1537I	REV3L_ENST00000435970.1_Missense_Mutation_p.R1459I|REV3L_ENST00000368802.3_Missense_Mutation_p.R1537I|REV3L_ENST00000368805.1_Missense_Mutation_p.R1537I			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	1537					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		TTTCTGCTGTCTTTTTTGTAA	0.358								DNA polymerases (catalytic subunits)																																									0													205.0	209.0	208.0					6																	111694948		2203	4300	6503	SO:0001583	missense	0			AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.4610G>T	6.37:g.111694948C>A	ENSP00000351697:p.Arg1537Ile		O43214|Q5TC33	Missense_Mutation	SNP	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B	p.R1537I	ENST00000358835.3	37	c.4610	CCDS5091.2	6	.	.	.	.	.	.	.	.	.	.	C	18.69	3.677465	0.68042	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970	T;T;T;T	0.02158	4.51;4.51;4.51;4.42	6.04	6.04	0.98038	Ribonuclease H-like (1);	0.000000	0.64402	D	0.000003	T	0.05273	0.0140	L	0.59436	1.845	0.58432	D	0.999999	D	0.76494	0.999	P	0.62649	0.905	T	0.11792	-1.0573	10	0.72032	D	0.01	-7.8585	13.7479	0.62887	0.0:0.9302:0.0:0.0698	.	1537	O60673	DPOLZ_HUMAN	I	1537;1537;1537;1459	ENSP00000357792:R1537I;ENSP00000357795:R1537I;ENSP00000351697:R1537I;ENSP00000402003:R1459I	ENSP00000351697:R1537I	R	-	2	0	REV3L	111801641	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.270000	0.51600	2.873000	0.98535	0.563000	0.77884	AGA	REV3L	-	superfamily_RNaseH-like_dom	ENSG00000009413		0.358	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	REV3L	HGNC	protein_coding	OTTHUMT00000043695.1	-	0.00	56	0	C	NM_002912		111694948	-1	tier1	-	no_errors	ENST00000358835	ensembl	human	known	74_37	missense	14.71	58	10	SNP	1.000	A
REV3L	5980	genome.wustl.edu	37	6	111694948	111694948	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr6:111694948C>A	ENST00000358835.3	-	14	5064	c.4610G>T	c.(4609-4611)aGa>aTa	p.R1537I	REV3L_ENST00000435970.1_Missense_Mutation_p.R1459I|REV3L_ENST00000368802.3_Missense_Mutation_p.R1537I|REV3L_ENST00000368805.1_Missense_Mutation_p.R1537I			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	1537					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		TTTCTGCTGTCTTTTTTGTAA	0.358								DNA polymerases (catalytic subunits)																																									0													205.0	209.0	208.0					6																	111694948		2203	4300	6503	SO:0001583	missense	0			AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.4610G>T	6.37:g.111694948C>A	ENSP00000351697:p.Arg1537Ile		O43214|Q5TC33	Missense_Mutation	SNP	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B	p.R1537I	ENST00000358835.3	37	c.4610	CCDS5091.2	6	.	.	.	.	.	.	.	.	.	.	C	18.69	3.677465	0.68042	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970	T;T;T;T	0.02158	4.51;4.51;4.51;4.42	6.04	6.04	0.98038	Ribonuclease H-like (1);	0.000000	0.64402	D	0.000003	T	0.05273	0.0140	L	0.59436	1.845	0.58432	D	0.999999	D	0.76494	0.999	P	0.62649	0.905	T	0.11792	-1.0573	10	0.72032	D	0.01	-7.8585	13.7479	0.62887	0.0:0.9302:0.0:0.0698	.	1537	O60673	DPOLZ_HUMAN	I	1537;1537;1537;1459	ENSP00000357792:R1537I;ENSP00000357795:R1537I;ENSP00000351697:R1537I;ENSP00000402003:R1459I	ENSP00000351697:R1537I	R	-	2	0	REV3L	111801641	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.270000	0.51600	2.873000	0.98535	0.563000	0.77884	AGA	REV3L	-	superfamily_RNaseH-like_dom	ENSG00000009413		0.358	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	REV3L	HGNC	protein_coding	OTTHUMT00000043695.1	-	0.00	93	0	C	NM_002912		111694948	-1	tier1	-	no_errors	ENST00000358835	ensembl	human	known	74_37	missense	14.71	58	10	SNP	1.000	A
RGPD4	285190	genome.wustl.edu	37	2	108476268	108476268	+	Silent	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr2:108476268G>A	ENST00000408999.3	+	12	1802	c.1725G>A	c.(1723-1725)ctG>ctA	p.L575L	RGPD4_ENST00000354986.4_Silent_p.L575L	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	575					protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						AACCTGCTCTGCTTGTACATT	0.323																																																	0													7.0	8.0	8.0					2																	108476268		663	1545	2208	SO:0001819	synonymous_variant	0			BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.1725G>A	2.37:g.108476268G>A			B9A029	Silent	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR_1,pfam_TPR_2,superfamily_GRIP,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.L575	ENST00000408999.3	37	c.1725	CCDS46381.1	2																																																																																			RGPD4	-	NULL	ENSG00000196862		0.323	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD4	HGNC	protein_coding	OTTHUMT00000330096.2	-	0.00	317	0	G	XM_496581		108476268	+1	tier1	-	no_errors	ENST00000354986	ensembl	human	known	74_37	silent	46.11	263	225	SNP	0.982	A
RN7SL319P	106479339	genome.wustl.edu	37	15	76077689	76077690	+	RNA	INS	-	-	G	rs200411336	byFrequency	TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr15:76077689_76077690insG	ENST00000395215.3	+	0	1184				RN7SL319P_ENST00000480656.2_RNA																							agcaagatcttgttcttaaaag	0.515													|||unknown(NO_COVERAGE)	899	0.179513	0.0817	0.255	5008	,	,		17448	0.2599		0.2028	False		,,,				2504	0.1513																0																																												0																															15.37:g.76077690_76077690dupG				RNA	INS	-	NULL	ENST00000395215.3	37	NULL		15																																																																																			RN7SL319P	-	-	ENSG00000241807		0.515	RP11-24M17.5-001	KNOWN	basic	processed_transcript	RN7SL319P	HGNC	pseudogene	OTTHUMT00000420501.1		0.00	63	0	-			76077690	+1	tier1		no_errors	ENST00000480656	ensembl	human	known	74_37	rna	12.50	14	2	INS	0.981:0.985	G
RP1	6101	genome.wustl.edu	37	8	55534695	55534695	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr8:55534695G>A	ENST00000220676.1	+	3	782	c.634G>A	c.(634-636)Gtg>Atg	p.V212M		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	212	Doublecortin 2. {ECO:0000255|PROSITE- ProRule:PRU00072}.				axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			CCTCCAGGCAGTGATCCTGAG	0.433																																					Colon(91;1014 1389 7634 14542 40420)												0													57.0	57.0	57.0					8																	55534695		2203	4300	6503	SO:0001583	missense	0			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.634G>A	8.37:g.55534695G>A	ENSP00000220676:p.Val212Met			Missense_Mutation	SNP	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.V212M	ENST00000220676.1	37	c.634	CCDS6160.1	8	.	.	.	.	.	.	.	.	.	.	G	17.29	3.352721	0.61293	.	.	ENSG00000104237	ENST00000427058;ENST00000220676	T	0.23552	1.9	5.55	4.68	0.58851	Doublecortin domain (5);	0.000000	0.52532	D	0.000065	T	0.35451	0.0932	M	0.68317	2.08	0.30198	N	0.798921	P;D	0.56968	0.91;0.978	P;P	0.54499	0.63;0.754	T	0.47182	-0.9137	10	0.87932	D	0	.	4.2535	0.10707	0.0759:0.234:0.4868:0.2033	.	22;212	E7EVW9;P56715	.;RP1_HUMAN	M	22;212	ENSP00000220676:V212M	ENSP00000220676:V212M	V	+	1	0	RP1	55697248	0.415000	0.25416	0.991000	0.47740	0.953000	0.61014	0.915000	0.28638	1.342000	0.45619	0.655000	0.94253	GTG	RP1	-	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	ENSG00000104237		0.433	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1	HGNC	protein_coding	OTTHUMT00000378532.2	-	0.00	71	0	G	NM_006269		55534695	+1	tier1	-	no_errors	ENST00000220676	ensembl	human	known	74_37	missense	15.62	54	10	SNP	0.951	A
RPIA	22934	genome.wustl.edu	37	2	89028849	89028849	+	Silent	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr2:89028849C>T	ENST00000283646.4	+	4	511	c.456C>T	c.(454-456)caC>caT	p.H152H		NM_144563.2	NP_653164.2	P49247	RPIA_HUMAN	ribose 5-phosphate isomerase A	152					carbohydrate metabolic process (GO:0005975)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, non-oxidative branch (GO:0009052)|ribose phosphate metabolic process (GO:0019693)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	monosaccharide binding (GO:0048029)|ribose-5-phosphate isomerase activity (GO:0004751)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|skin(1)	18		Acute lymphoblastic leukemia(2;0.000456)|all_hematologic(2;0.00287)				TGGATCGACACCCAGAGGTAA	0.498																																																	0													91.0	93.0	92.0					2																	89028849		1987	4165	6152	SO:0001819	synonymous_variant	0			L35035	CCDS2004.2	2p11.2	2008-07-31	2008-07-31		ENSG00000153574	ENSG00000153574	5.3.1.6		10297	protein-coding gene	gene with protein product	"""ribose 5-phosphate epimerase"""	180430				7758956	Standard	NM_144563		Approved		uc002ste.3	P49247	OTTHUMG00000130333	ENST00000283646.4:c.456C>T	2.37:g.89028849C>T			Q541P9|Q96BJ6	Silent	SNP	pfam_Ribose5P_isomerase_typA,tigrfam_Ribose5P_isomerase_typA	p.H152	ENST00000283646.4	37	c.456	CCDS2004.2	2																																																																																			RPIA	-	pfam_Ribose5P_isomerase_typA,tigrfam_Ribose5P_isomerase_typA	ENSG00000153574		0.498	RPIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPIA	HGNC	protein_coding	OTTHUMT00000252683.2	-	0.00	31	0	C			89028849	+1	tier1	-	no_errors	ENST00000283646	ensembl	human	known	74_37	silent	25.71	26	9	SNP	1.000	T
SAAL1	113174	genome.wustl.edu	37	11	18127524	18127524	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr11:18127524C>G	ENST00000524803.1	-	1	114	c.65G>C	c.(64-66)gGt>gCt	p.G22A	SAAL1_ENST00000300013.4_Missense_Mutation_p.G22A|SAAL1_ENST00000533851.1_5'UTR|SAAL1_ENST00000529318.1_Missense_Mutation_p.G22A			Q96ER3	SAAL1_HUMAN	serum amyloid A-like 1	22										breast(2)|large_intestine(5)|lung(8)	15						GCAGTCTCCACCGGCCACCTC	0.672											OREG0020819	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													57.0	41.0	47.0					11																	18127524		2200	4292	6492	SO:0001583	missense	0			AK123457	CCDS31439.1	11p15.1	2005-10-28			ENSG00000166788	ENSG00000166788			25158	protein-coding gene	gene with protein product							Standard	NM_138421		Approved	FLJ41463	uc001mnq.3	Q96ER3	OTTHUMG00000166428	ENST00000524803.1:c.65G>C	11.37:g.18127524C>G	ENSP00000432487:p.Gly22Ala	723	A6NH05	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.G22A	ENST00000524803.1	37	c.65	CCDS31439.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.39|10.39	1.336396|1.336396	0.24253|0.24253	.|.	.|.	ENSG00000166788|ENSG00000166788	ENST00000524803;ENST00000300013;ENST00000529318;ENST00000530180|ENST00000532452	T;T;T;T|.	0.34072|.	1.38;1.38;1.38;1.38|.	5.46|5.46	1.08|1.08	0.20341|0.20341	.|.	0.566937|.	0.19106|.	N|.	0.122564|.	T|T	0.31949|0.31949	0.0813|0.0813	L|L	0.36672|0.36672	1.1|1.1	0.09310|0.09310	N|N	1|1	B;B;B|.	0.15473|.	0.013;0.013;0.013|.	B;B;B|.	0.14578|.	0.011;0.011;0.011|.	T|T	0.24835|0.24835	-1.0149|-1.0149	10|5	0.08381|.	T|.	0.77|.	0.3292|0.3292	5.4988|5.4988	0.16817|0.16817	0.1305:0.3271:0.4602:0.0823|0.1305:0.3271:0.4602:0.0823	.|.	22;22;22|.	E9PRZ1;G1UCX3;Q96ER3|.	.;.;SAAL1_HUMAN|.	A|L	22|15	ENSP00000432487:G22A;ENSP00000300013:G22A;ENSP00000432216:G22A;ENSP00000431489:G22A|.	ENSP00000300013:G22A|.	G|V	-|-	2|1	0|0	SAAL1|SAAL1	18084100|18084100	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.470000|0.470000	0.32858|0.32858	-0.192000|-0.192000	0.09587|0.09587	-0.006000|-0.006000	0.14370|0.14370	-0.175000|-0.175000	0.13238|0.13238	GGT|GTG	SAAL1	-	NULL	ENSG00000166788		0.672	SAAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SAAL1	HGNC	protein_coding	OTTHUMT00000389728.1	-	0.00	106	0	C	NM_138421		18127524	-1	tier1	-	no_errors	ENST00000524803	ensembl	human	known	74_37	missense	30.53	66	29	SNP	0.000	G
SCARF1	8578	genome.wustl.edu	37	17	1538715	1538715	+	Silent	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr17:1538715G>A	ENST00000263071.4	-	11	1879	c.1830C>T	c.(1828-1830)tcC>tcT	p.S610S	SCARF1_ENST00000571272.1_3'UTR|SCARF1_ENST00000348987.3_Silent_p.S524S	NM_003693.2|NM_145350.1	NP_003684.2|NP_663325.1	Q14162	SREC_HUMAN	scavenger receptor class F, member 1	610	Pro/Ser-rich.				cell adhesion (GO:0007155)|cholesterol catabolic process (GO:0006707)|dendrite development (GO:0016358)|neuron remodeling (GO:0016322)|positive regulation of axon regeneration (GO:0048680)|positive regulation of neuron projection development (GO:0010976)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	endocytic vesicle membrane (GO:0030666)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	low-density lipoprotein particle binding (GO:0030169)|scavenger receptor activity (GO:0005044)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(3)|kidney(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		GGAGCGGGCTGGAGAGCTCCC	0.677																																																	0													52.0	55.0	54.0					17																	1538715		2203	4300	6503	SO:0001819	synonymous_variant	0			D63483	CCDS11007.1, CCDS45564.1	17p13.3	2008-07-18			ENSG00000074660	ENSG00000074660			16820	protein-coding gene	gene with protein product	"""scavenger receptor expressed by endothelial cells"", ""acetyl LDL receptor"""	607873				9395444, 8590280	Standard	NM_003693		Approved	SREC, KIAA0149	uc002fsz.2	Q14162	OTTHUMG00000090555	ENST00000263071.4:c.1830C>T	17.37:g.1538715G>A			A8MQ05|O43701|Q8NHD2|Q8NHD3|Q8NHD4|Q8NHD5	Silent	SNP	pfam_EGF_laminin,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,pfscan_EG-like_dom	p.S610	ENST00000263071.4	37	c.1830	CCDS11007.1	17																																																																																			SCARF1	-	NULL	ENSG00000074660		0.677	SCARF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCARF1	HGNC	protein_coding	OTTHUMT00000207081.4	-	0.00	49	0	G	NM_003693		1538715	-1	tier1	-	no_errors	ENST00000263071	ensembl	human	known	74_37	silent	8.45	65	6	SNP	0.983	A
SCARF1	8578	genome.wustl.edu	37	17	1538715	1538715	+	Silent	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr17:1538715G>A	ENST00000263071.4	-	11	1879	c.1830C>T	c.(1828-1830)tcC>tcT	p.S610S	SCARF1_ENST00000571272.1_3'UTR|SCARF1_ENST00000348987.3_Silent_p.S524S	NM_003693.2|NM_145350.1	NP_003684.2|NP_663325.1	Q14162	SREC_HUMAN	scavenger receptor class F, member 1	610	Pro/Ser-rich.				cell adhesion (GO:0007155)|cholesterol catabolic process (GO:0006707)|dendrite development (GO:0016358)|neuron remodeling (GO:0016322)|positive regulation of axon regeneration (GO:0048680)|positive regulation of neuron projection development (GO:0010976)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	endocytic vesicle membrane (GO:0030666)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	low-density lipoprotein particle binding (GO:0030169)|scavenger receptor activity (GO:0005044)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(3)|kidney(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		GGAGCGGGCTGGAGAGCTCCC	0.677																																																	0													52.0	55.0	54.0					17																	1538715		2203	4300	6503	SO:0001819	synonymous_variant	0			D63483	CCDS11007.1, CCDS45564.1	17p13.3	2008-07-18			ENSG00000074660	ENSG00000074660			16820	protein-coding gene	gene with protein product	"""scavenger receptor expressed by endothelial cells"", ""acetyl LDL receptor"""	607873				9395444, 8590280	Standard	NM_003693		Approved	SREC, KIAA0149	uc002fsz.2	Q14162	OTTHUMG00000090555	ENST00000263071.4:c.1830C>T	17.37:g.1538715G>A			A8MQ05|O43701|Q8NHD2|Q8NHD3|Q8NHD4|Q8NHD5	Silent	SNP	pfam_EGF_laminin,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,pfscan_EG-like_dom	p.S610	ENST00000263071.4	37	c.1830	CCDS11007.1	17																																																																																			SCARF1	-	NULL	ENSG00000074660		0.677	SCARF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCARF1	HGNC	protein_coding	OTTHUMT00000207081.4	-	0.00	70	0	G	NM_003693		1538715	-1	tier1	-	no_errors	ENST00000263071	ensembl	human	known	74_37	silent	8.45	65	6	SNP	0.983	A
SCEL	8796	genome.wustl.edu	37	13	78171713	78171713	+	Missense_Mutation	SNP	A	A	C			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr13:78171713A>C	ENST00000349847.3	+	13	870	c.786A>C	c.(784-786)aaA>aaC	p.K262N	SCEL_ENST00000469982.1_3'UTR|SCEL_ENST00000377246.3_Missense_Mutation_p.K242N|SCEL-AS1_ENST00000457528.2_RNA|SCEL_ENST00000535157.1_Missense_Mutation_p.K240N|SCEL-AS1_ENST00000456280.2_RNA	NM_144777.2	NP_659001.2	O95171	SCEL_HUMAN	sciellin	262	16 X approximate tandem repeats.				embryo development (GO:0009790)|epidermis development (GO:0008544)|keratinocyte differentiation (GO:0030216)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(18)|ovary(5)|prostate(1)|stomach(1)|urinary_tract(1)	40		Acute lymphoblastic leukemia(28;0.0282)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0233)		AAATGAACAAAAGCTTGAATA	0.333																																																	0													94.0	91.0	92.0					13																	78171713		2188	4294	6482	SO:0001583	missense	0			AF045941	CCDS9458.1, CCDS9459.1, CCDS53877.1	13q22	2008-07-18			ENSG00000136155	ENSG00000136155			10573	protein-coding gene	gene with protein product		604112				9813070	Standard	NM_003843		Approved	FLJ21667, MGC22531	uc001vki.3	O95171	OTTHUMG00000017107	ENST00000349847.3:c.786A>C	13.37:g.78171713A>C	ENSP00000302579:p.Lys262Asn		B7Z797|F5H651|Q53H61|Q5W0S8|Q5W0S9|Q86X00	Missense_Mutation	SNP	smart_Znf_LIM,pfscan_Znf_LIM	p.K262N	ENST00000349847.3	37	c.786	CCDS9459.1	13	.	.	.	.	.	.	.	.	.	.	A	16.54	3.151568	0.57151	.	.	ENSG00000136155	ENST00000348770;ENST00000535157;ENST00000377246;ENST00000349847	T;T;T	0.32988	1.43;1.43;1.43	4.74	4.74	0.60224	.	0.000000	0.56097	D	0.000036	T	0.49474	0.1559	M	0.68952	2.095	0.39864	D	0.973418	D;D;D	0.76494	0.999;0.997;0.999	D;P;D	0.66084	0.913;0.908;0.941	T	0.55159	-0.8184	10	0.87932	D	0	-28.9919	10.7993	0.46478	1.0:0.0:0.0:0.0	.	240;242;262	F5H651;O95171-2;O95171	.;.;SCEL_HUMAN	N	219;240;242;262	ENSP00000437895:K240N;ENSP00000366454:K242N;ENSP00000302579:K262N	ENSP00000315127:K219N	K	+	3	2	SCEL	77069714	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	2.396000	0.44468	2.102000	0.63906	0.533000	0.62120	AAA	SCEL	-	NULL	ENSG00000136155		0.333	SCEL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCEL	HGNC	protein_coding	OTTHUMT00000045339.2	-	0.00	59	0	A	NM_144777		78171713	+1	tier1	-	no_errors	ENST00000349847	ensembl	human	known	74_37	missense	61.90	24	39	SNP	1.000	C
SCN3A	6328	genome.wustl.edu	37	2	165986604	165986604	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr2:165986604C>T	ENST00000360093.3	-	17	3259	c.2768G>A	c.(2767-2769)cGg>cAg	p.R923Q	SCN3A_ENST00000409101.3_Missense_Mutation_p.R874Q|SCN3A_ENST00000283254.7_Missense_Mutation_p.R923Q	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	923					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CATGTGCCACCGTGGGAGCGT	0.512																																																	0													162.0	155.0	158.0					2																	165986604		2202	4281	6483	SO:0001583	missense	0			AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.2768G>A	2.37:g.165986604C>T	ENSP00000353206:p.Arg923Gln		Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfscan_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2	p.R923Q	ENST00000360093.3	37	c.2768		2	.	.	.	.	.	.	.	.	.	.	C	35	5.416951	0.96092	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000440431	D;D;D;D	0.98474	-4.95;-4.95;-4.95;-4.95	5.63	5.63	0.86233	Ion transport (1);	0.000000	0.64402	D	0.000013	D	0.99149	0.9706	M	0.88031	2.925	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.998;0.998;0.998;1.0	D;D;D;D;D	0.97110	1.0;0.992;0.986;0.986;1.0	D	0.99577	1.0972	10	0.87932	D	0	.	19.6755	0.95930	0.0:1.0:0.0:0.0	.	923;874;874;874;923	Q9NY46;E7EUE6;Q9NY46-2;Q9NY46-4;Q9NY46-3	SCN3A_HUMAN;.;.;.;.	Q	923;923;874;874	ENSP00000353206:R923Q;ENSP00000283254:R923Q;ENSP00000386726:R874Q;ENSP00000403348:R874Q	ENSP00000283254:R923Q	R	-	2	0	SCN3A	165694850	1.000000	0.71417	1.000000	0.80357	0.786000	0.44442	7.776000	0.85560	2.652000	0.90054	0.563000	0.77884	CGG	SCN3A	-	pfam_Ion_trans_dom	ENSG00000153253		0.512	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	SCN3A	HGNC	protein_coding		-	0.00	80	0	C	NM_006922		165986604	-1	tier1	-	no_errors	ENST00000283254	ensembl	human	known	74_37	missense	41.59	66	47	SNP	1.000	T
SCN3A	6328	genome.wustl.edu	37	2	166019171	166019171	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr2:166019171C>G	ENST00000360093.3	-	8	1353	c.862G>C	c.(862-864)Gaa>Caa	p.E288Q	SCN3A_ENST00000409101.3_Missense_Mutation_p.E288Q|SCN3A_ENST00000283254.7_Missense_Mutation_p.E288Q	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	288					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GTGTTGGTTTCAAAAGCAGAA	0.428																																																	0													111.0	111.0	111.0					2																	166019171		2203	4300	6503	SO:0001583	missense	0			AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.862G>C	2.37:g.166019171C>G	ENSP00000353206:p.Glu288Gln		Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfscan_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2	p.E288Q	ENST00000360093.3	37	c.862		2	.	.	.	.	.	.	.	.	.	.	C	13.88	2.370199	0.42003	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000440431	D;D;D;D	0.96041	-3.88;-3.89;-3.85;-3.72	5.82	5.82	0.92795	Ion transport (1);	0.325158	0.26571	N	0.023631	D	0.96917	0.8993	L	0.46741	1.465	0.80722	D	1	D;B;B;B;D	0.62365	0.991;0.0;0.0;0.0;0.989	D;B;B;B;D	0.74023	0.982;0.003;0.002;0.002;0.979	D	0.97163	0.9839	10	0.72032	D	0.01	.	20.0991	0.97865	0.0:1.0:0.0:0.0	.	288;288;288;288;288	Q9NY46;E7EUE6;Q9NY46-2;Q9NY46-4;Q9NY46-3	SCN3A_HUMAN;.;.;.;.	Q	288	ENSP00000353206:E288Q;ENSP00000283254:E288Q;ENSP00000386726:E288Q;ENSP00000403348:E288Q	ENSP00000283254:E288Q	E	-	1	0	SCN3A	165727417	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.480000	0.45206	2.752000	0.94435	0.655000	0.94253	GAA	SCN3A	-	pfam_Ion_trans_dom	ENSG00000153253		0.428	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	SCN3A	HGNC	protein_coding		-	0.00	56	0	C	NM_006922		166019171	-1	tier1	-	no_errors	ENST00000283254	ensembl	human	known	74_37	missense	18.84	56	13	SNP	1.000	G
SDHAP1	255812	genome.wustl.edu	37	3	195687265	195687265	+	RNA	SNP	C	C	T	rs112764107		TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr3:195687265C>T	ENST00000427841.1	-	0	2325					NR_003264.2				succinate dehydrogenase complex, subunit A, flavoprotein pseudogene 1																		cactgcactccagcctgggca	0.473																																					Ovarian(67;1158 1227 12109 20189 43170)												0																																												0			BC071730		3q29	2009-12-02	2006-11-21	2009-12-02	ENSG00000185485	ENSG00000185485			32455	pseudogene	pseudogene			"""succinate dehydrogenase complex, subunit A, flavoprotein-like 1"""	SDHAL1, SDHALP1			Standard	NR_003264		Approved		uc003fvy.3		OTTHUMG00000155716		3.37:g.195687265C>T				RNA	SNP	-	NULL	ENST00000427841.1	37	NULL		3																																																																																			SDHAP1	-	-	ENSG00000185485		0.473	SDHAP1-002	KNOWN	basic	processed_transcript	SDHAP1	HGNC	pseudogene	OTTHUMT00000341367.1	-	0.00	8	0	C			195687265	-1	tier1	rs112764107	no_errors	ENST00000427149	ensembl	human	known	74_37	rna	62.50	3	5	SNP	0.482	T
SETBP1	26040	genome.wustl.edu	37	18	42456670	42456671	+	Intron	DEL	CA	CA	-	rs33928380|rs200957852|rs74895636|rs3085861	byFrequency	TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	CA	CA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr18:42456670_42456671delCA	ENST00000282030.5	+	3	836				SETBP1_ENST00000426838.4_Frame_Shift_Del_p.T228fs	NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1							nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		CCGGTTCTCTCACTCTTCCTTT	0.52									Schinzel-Giedion syndrome																																								0																																										SO:0001627	intron_variant	0	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.540+7422CA>-	18.37:g.42456670_42456671delCA			A6H8W5|Q6P6C3|Q9UEF3	Frame_Shift_Del	DEL	NULL	p.T228fs	ENST00000282030.5	37	c.681_682	CCDS11923.2	18																																																																																			SETBP1	-	NULL	ENSG00000152217		0.520	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETBP1	HGNC	protein_coding	OTTHUMT00000255854.4		0.00	273	0	CA	NM_001130110		42456671	+1	tier1		no_errors	ENST00000426838	ensembl	human	known	74_37	frame_shift_del	7.42	262	21	DEL	0.000:0.000	-
SETD5	55209	genome.wustl.edu	37	3	9490247	9490247	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr3:9490247C>T	ENST00000406341.1	+	15	2469	c.2279C>T	c.(2278-2280)tCa>tTa	p.S760L	SETD5_ENST00000407969.1_Missense_Mutation_p.S779L|SETD5_ENST00000488236.1_3'UTR|SETD5_ENST00000402466.1_Missense_Mutation_p.S662L|SETD5_ENST00000302463.6_Missense_Mutation_p.S662L|SETD5_ENST00000402198.1_Missense_Mutation_p.S760L			Q9C0A6	SETD5_HUMAN	SET domain containing 5	760										NS(2)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(3)|prostate(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)		CGCTTTGGCTCACCCTTTATC	0.483																																																	0													100.0	96.0	97.0					3																	9490247		1944	4154	6098	SO:0001583	missense	0			BC020956	CCDS46741.1, CCDS74892.1	3p25.3	2011-12-13			ENSG00000168137	ENSG00000168137			25566	protein-coding gene	gene with protein product		615743				11214970	Standard	XM_005265299		Approved	FLJ10707	uc003brt.3	Q9C0A6	OTTHUMG00000150491	ENST00000406341.1:c.2279C>T	3.37:g.9490247C>T	ENSP00000383939:p.Ser760Leu		Q6AI17|Q8WUB6|Q9H3X4|Q9H6V7|Q9H7S3|Q9NVI9	Missense_Mutation	SNP	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	p.S760L	ENST00000406341.1	37	c.2279	CCDS46741.1	3	.	.	.	.	.	.	.	.	.	.	C	28.8	4.951410	0.92660	.	.	ENSG00000168137	ENST00000402198;ENST00000402466;ENST00000406341;ENST00000407969;ENST00000302463	D;D;D;D;D	0.96334	-3.61;-3.98;-3.61;-3.55;-3.98	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	D	0.98030	0.9351	M	0.69823	2.125	0.80722	D	1	D;D;D;D	0.89917	1.0;0.996;0.999;0.999	D;D;D;D	0.85130	0.997;0.99;0.991;0.991	D	0.98285	1.0510	10	0.87932	D	0	-11.0268	20.5568	0.99304	0.0:1.0:0.0:0.0	.	429;662;760;779	B3KXG4;Q9C0A6-3;Q9C0A6;E7EWN3	.;.;SETD5_HUMAN;.	L	760;662;760;779;662	ENSP00000385852:S760L;ENSP00000384429:S662L;ENSP00000383939:S760L;ENSP00000384114:S779L;ENSP00000302028:S662L	ENSP00000302028:S662L	S	+	2	0	SETD5	9465247	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.487000	0.81328	2.861000	0.98227	0.655000	0.94253	TCA	SETD5	-	NULL	ENSG00000168137		0.483	SETD5-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	SETD5	HGNC	protein_coding	OTTHUMT00000318425.1	-	0.00	71	0	C	XM_371614		9490247	+1	tier1	-	no_errors	ENST00000402198	ensembl	human	known	74_37	missense	51.32	37	39	SNP	1.000	T
SFMBT2	57713	genome.wustl.edu	37	10	7247841	7247841	+	Silent	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr10:7247841G>A	ENST00000361972.4	-	12	1470	c.1380C>T	c.(1378-1380)gaC>gaT	p.D460D	SFMBT2_ENST00000397167.1_Silent_p.D460D	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	460					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)			NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						CTGGGAAGATGTCCATGGATT	0.483																																																	0													121.0	106.0	111.0					10																	7247841		2203	4300	6503	SO:0001819	synonymous_variant	0			AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.1380C>T	10.37:g.7247841G>A			A7MD09|Q9HCF5	Silent	SNP	pfam_Mbt,pfam_DUF3588,pfam_SAM_type1,pfam_Pointed_dom,superfamily_SAM/pointed,superfamily_ARM-type_fold,smart_Mbt,smart_SAM,pfscan_Mbt	p.D460	ENST00000361972.4	37	c.1380	CCDS31138.1	10																																																																																			SFMBT2	-	pfam_Mbt,smart_Mbt,pfscan_Mbt	ENSG00000198879		0.483	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFMBT2	HGNC	protein_coding	OTTHUMT00000046673.1	-	0.00	48	0	G	NM_001029880		7247841	-1	tier1	-	no_errors	ENST00000361972	ensembl	human	known	74_37	silent	27.91	31	12	SNP	1.000	A
SFMBT2	57713	genome.wustl.edu	37	10	7247841	7247841	+	Silent	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr10:7247841G>A	ENST00000361972.4	-	12	1470	c.1380C>T	c.(1378-1380)gaC>gaT	p.D460D	SFMBT2_ENST00000397167.1_Silent_p.D460D	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	460					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)			NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						CTGGGAAGATGTCCATGGATT	0.483																																																	0													121.0	106.0	111.0					10																	7247841		2203	4300	6503	SO:0001819	synonymous_variant	0			AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.1380C>T	10.37:g.7247841G>A			A7MD09|Q9HCF5	Silent	SNP	pfam_Mbt,pfam_DUF3588,pfam_SAM_type1,pfam_Pointed_dom,superfamily_SAM/pointed,superfamily_ARM-type_fold,smart_Mbt,smart_SAM,pfscan_Mbt	p.D460	ENST00000361972.4	37	c.1380	CCDS31138.1	10																																																																																			SFMBT2	-	pfam_Mbt,smart_Mbt,pfscan_Mbt	ENSG00000198879		0.483	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFMBT2	HGNC	protein_coding	OTTHUMT00000046673.1	-	0.00	63	0	G	NM_001029880		7247841	-1	tier1	-	no_errors	ENST00000361972	ensembl	human	known	74_37	silent	27.91	31	12	SNP	1.000	A
SGOL2	151246	genome.wustl.edu	37	2	201437003	201437004	+	Frame_Shift_Ins	INS	-	-	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr2:201437003_201437004insT	ENST00000357799.4	+	7	2032_2033	c.1934_1935insT	c.(1933-1938)aattttfs	p.NF645fs		NM_001160033.1|NM_001160046.1|NM_152524.5	NP_001153505.1|NP_001153518.1|NP_689737.4	Q562F6	SGOL2_HUMAN	shugoshin-like 2 (S. pombe)	645					meiotic sister chromatid cohesion, centromeric (GO:0051754)|mitotic cell cycle (GO:0000278)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic cohesin complex (GO:0030892)|nucleus (GO:0005634)				NS(2)|breast(2)|cervix(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	46						AAAAAAGGTAATTTTTTTTTCA	0.337																																																	0																																										SO:0001589	frameshift_variant	0			AY094614	CCDS42796.1	2q33.2	2008-02-05			ENSG00000163535	ENSG00000163535			30812	protein-coding gene	gene with protein product		612425					Standard	NM_001160046		Approved	TRIPIN, FLJ25211	uc002uvw.2	Q562F6	OTTHUMG00000154535	ENST00000357799.4:c.1943dupT	2.37:g.201437012_201437012dupT	ENSP00000350447:p.Asn645fs		Q53RR9|Q53T20|Q86XY4|Q8IWK2|Q8IZK1|Q8N1Q5|Q96LQ3	Frame_Shift_Ins	INS	NULL	p.F649fs	ENST00000357799.4	37	c.1934_1935	CCDS42796.1	2																																																																																			SGOL2	-	NULL	ENSG00000163535		0.337	SGOL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGOL2	HGNC	protein_coding	OTTHUMT00000335834.1		0.00	85	0	0	NM_152524		201437004	+1			no_errors	ENST00000357799	ensembl	human	known	74_37	frame_shift_ins	6.61	113	8	INS	0.021:0.016	T
SIDT2	51092	genome.wustl.edu	37	11	117061434	117061434	+	Silent	SNP	C	C	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr11:117061434C>A	ENST00000324225.4	+	18	2244	c.1713C>A	c.(1711-1713)ccC>ccA	p.P571P	SIDT2_ENST00000532062.1_5'Flank|SIDT2_ENST00000431081.2_Silent_p.P568P	NM_001040455.1	NP_001035545.1	Q8NBJ9	SIDT2_HUMAN	SID1 transmembrane family, member 2	571					cell morphogenesis (GO:0000902)|dsRNA transport (GO:0033227)|glucose homeostasis (GO:0042593)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to glucose (GO:0009749)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell proliferation (GO:0044342)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	RNA transmembrane transporter activity (GO:0051033)			NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	36	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000219)|all cancers(92;0.00144)		ATGTGTGCCCCAACTATACCA	0.537																																																	0													141.0	114.0	123.0					11																	117061434		2201	4296	6497	SO:0001819	synonymous_variant	0			AF151799	CCDS31682.1	11q23.3	2008-02-05			ENSG00000149577	ENSG00000149577			24272	protein-coding gene	gene with protein product						10810093, 12975309	Standard	NM_001040455		Approved	CGI-40	uc001pqh.1	Q8NBJ9	OTTHUMG00000167065	ENST00000324225.4:c.1713C>A	11.37:g.117061434C>A			Q8NBY7|Q9Y357	Silent	SNP	NULL	p.P592	ENST00000324225.4	37	c.1776	CCDS31682.1	11																																																																																			SIDT2	-	NULL	ENSG00000149577		0.537	SIDT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIDT2	HGNC	protein_coding	OTTHUMT00000392836.1	-	0.00	35	0	C	NM_015996		117061434	+1	tier1	-	no_errors	ENST00000278951	ensembl	human	known	74_37	silent	8.70	42	4	SNP	1.000	A
SLC12A5	57468	genome.wustl.edu	37	20	44676707	44676707	+	Silent	SNP	A	A	C			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr20:44676707A>C	ENST00000454036.2	+	16	2113	c.2064A>C	c.(2062-2064)ccA>ccC	p.P688P	SLC12A5_ENST00000243964.3_Silent_p.P665P	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	688					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	AAGGGCCCCCACACACCAAGA	0.622																																																	0													65.0	48.0	54.0					20																	44676707		2203	4300	6503	SO:0001819	synonymous_variant	0			AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.2064A>C	20.37:g.44676707A>C			A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Silent	SNP	pfam_AA-permease/SLC12A_dom,prints_KCL_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.P688	ENST00000454036.2	37	c.2064	CCDS46610.1	20																																																																																			SLC12A5	-	pfam_AA-permease/SLC12A_dom,tigrfam_Na/K/Cl_cotransptS	ENSG00000124140		0.622	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	SLC12A5	HGNC	protein_coding	OTTHUMT00000471538.1	-	0.00	20	0	A			44676707	+1	tier1	-	no_errors	ENST00000454036	ensembl	human	known	74_37	silent	68.42	12	26	SNP	0.968	C
SLC16A1	6566	genome.wustl.edu	37	1	113471764	113471764	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:113471764C>G	ENST00000538576.1	-	2	998	c.167G>C	c.(166-168)aGc>aCc	p.S56T	SLC16A1_ENST00000433570.4_Missense_Mutation_p.S56T|SLC16A1_ENST00000478835.1_5'UTR|SLC16A1_ENST00000369626.3_Missense_Mutation_p.S56T	NM_001166496.1	NP_001159968.1	P53985	MOT1_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 1	56					behavioral response to nutrient (GO:0051780)|blood coagulation (GO:0007596)|cellular metabolic process (GO:0044237)|cellular response to organic cyclic compound (GO:0071407)|centrosome organization (GO:0051297)|glucose homeostasis (GO:0042593)|leukocyte migration (GO:0050900)|lipid metabolic process (GO:0006629)|mevalonate transport (GO:0015728)|monocarboxylic acid transport (GO:0015718)|plasma membrane lactate transport (GO:0035879)|pyruvate metabolic process (GO:0006090)|regulation of insulin secretion (GO:0050796)|response to food (GO:0032094)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	mevalonate transmembrane transporter activity (GO:0015130)|monocarboxylic acid transmembrane transporter activity (GO:0008028)|organic cyclic compound binding (GO:0097159)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(8)|skin(1)|urinary_tract(1)	20	Lung SC(450;0.246)	all_cancers(81;7.6e-08)|all_epithelial(167;3.82e-07)|all_lung(203;3.07e-05)|Lung NSC(69;5.51e-05)|Prostate(1639;0.00232)		Epithelial(280;7.31e-13)|all cancers(265;5.1e-10)|Kidney(133;5.29e-07)|KIRC - Kidney renal clear cell carcinoma(1967;8.63e-06)|OV - Ovarian serous cystadenocarcinoma(397;1.48e-05)|BRCA - Breast invasive adenocarcinoma(282;0.003)|LUSC - Lung squamous cell carcinoma(189;0.008)|Lung(183;0.00948)|Colorectal(144;0.0325)|COAD - Colon adenocarcinoma(174;0.0643)	Acetic acid(DB03166)|Aminohippurate(DB00345)|Ampicillin(DB00415)|Foscarnet(DB00529)|Gamma Hydroxybutyric Acid(DB01440)|Methotrexate(DB00563)|Nateglinide(DB00731)|Niacin(DB00627)|Niflumic Acid(DB04552)|Pravastatin(DB00175)|Probenecid(DB01032)|Pyruvic acid(DB00119)|Salicylic acid(DB00936)|Valproic Acid(DB00313)	TGACACTTCGCTGGTGGTGGC	0.418																																																	0													68.0	61.0	64.0					1																	113471764		2203	4300	6503	SO:0001583	missense	0			BC026317	CCDS858.1	1p12	2013-07-18	2013-07-18		ENSG00000155380	ENSG00000155380		"""Solute carriers"""	10922	protein-coding gene	gene with protein product		600682	"""solute carrier family 16 (monocarboxylic acid transporters), member 1"", ""solute carrier family 16, member 1 (monocarboxylic acid transporter 1)"""			8124722, 7835905	Standard	NM_003051		Approved	MCT, MCT1	uc001ecy.3	P53985	OTTHUMG00000012129	ENST00000538576.1:c.167G>C	1.37:g.113471764C>G	ENSP00000441065:p.Ser56Thr		Q49A45|Q5T8R6|Q9NSJ9	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Monocarb_transpt	p.S56T	ENST00000538576.1	37	c.167	CCDS858.1	1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.394935	0.83011	.	.	ENSG00000155380	ENST00000369626;ENST00000538576;ENST00000458229;ENST00000433570;ENST00000443580;ENST00000429288	T;T;T;T;T;T	0.58652	0.32;0.32;0.32;0.32;0.32;0.32	5.97	5.97	0.96955	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.71685	0.3369	M	0.72118	2.19	0.80722	D	1	D;D	0.71674	0.972;0.998	P;D	0.67382	0.874;0.951	T	0.71203	-0.4662	10	0.56958	D	0.05	.	20.0086	0.97443	0.0:1.0:0.0:0.0	.	56;56	Q49A45;P53985	.;MOT1_HUMAN	T	56	ENSP00000358640:S56T;ENSP00000441065:S56T;ENSP00000416167:S56T;ENSP00000445061:S56T;ENSP00000399104:S56T;ENSP00000397106:S56T	ENSP00000358640:S56T	S	-	2	0	SLC16A1	113273287	1.000000	0.71417	1.000000	0.80357	0.502000	0.33828	7.776000	0.85560	2.835000	0.97688	0.591000	0.81541	AGC	SLC16A1	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Monocarb_transpt	ENSG00000155380		0.418	SLC16A1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC16A1	HGNC	protein_coding	OTTHUMT00000033539.1	-	0.00	31	0	C	NM_003051		113471764	-1	tier1	-	no_errors	ENST00000369626	ensembl	human	known	74_37	missense	18.18	27	6	SNP	1.000	G
SLC16A1	6566	genome.wustl.edu	37	1	113471764	113471764	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:113471764C>G	ENST00000538576.1	-	2	998	c.167G>C	c.(166-168)aGc>aCc	p.S56T	SLC16A1_ENST00000433570.4_Missense_Mutation_p.S56T|SLC16A1_ENST00000478835.1_5'UTR|SLC16A1_ENST00000369626.3_Missense_Mutation_p.S56T	NM_001166496.1	NP_001159968.1	P53985	MOT1_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 1	56					behavioral response to nutrient (GO:0051780)|blood coagulation (GO:0007596)|cellular metabolic process (GO:0044237)|cellular response to organic cyclic compound (GO:0071407)|centrosome organization (GO:0051297)|glucose homeostasis (GO:0042593)|leukocyte migration (GO:0050900)|lipid metabolic process (GO:0006629)|mevalonate transport (GO:0015728)|monocarboxylic acid transport (GO:0015718)|plasma membrane lactate transport (GO:0035879)|pyruvate metabolic process (GO:0006090)|regulation of insulin secretion (GO:0050796)|response to food (GO:0032094)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	mevalonate transmembrane transporter activity (GO:0015130)|monocarboxylic acid transmembrane transporter activity (GO:0008028)|organic cyclic compound binding (GO:0097159)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(8)|skin(1)|urinary_tract(1)	20	Lung SC(450;0.246)	all_cancers(81;7.6e-08)|all_epithelial(167;3.82e-07)|all_lung(203;3.07e-05)|Lung NSC(69;5.51e-05)|Prostate(1639;0.00232)		Epithelial(280;7.31e-13)|all cancers(265;5.1e-10)|Kidney(133;5.29e-07)|KIRC - Kidney renal clear cell carcinoma(1967;8.63e-06)|OV - Ovarian serous cystadenocarcinoma(397;1.48e-05)|BRCA - Breast invasive adenocarcinoma(282;0.003)|LUSC - Lung squamous cell carcinoma(189;0.008)|Lung(183;0.00948)|Colorectal(144;0.0325)|COAD - Colon adenocarcinoma(174;0.0643)	Acetic acid(DB03166)|Aminohippurate(DB00345)|Ampicillin(DB00415)|Foscarnet(DB00529)|Gamma Hydroxybutyric Acid(DB01440)|Methotrexate(DB00563)|Nateglinide(DB00731)|Niacin(DB00627)|Niflumic Acid(DB04552)|Pravastatin(DB00175)|Probenecid(DB01032)|Pyruvic acid(DB00119)|Salicylic acid(DB00936)|Valproic Acid(DB00313)	TGACACTTCGCTGGTGGTGGC	0.418																																																	0													68.0	61.0	64.0					1																	113471764		2203	4300	6503	SO:0001583	missense	0			BC026317	CCDS858.1	1p12	2013-07-18	2013-07-18		ENSG00000155380	ENSG00000155380		"""Solute carriers"""	10922	protein-coding gene	gene with protein product		600682	"""solute carrier family 16 (monocarboxylic acid transporters), member 1"", ""solute carrier family 16, member 1 (monocarboxylic acid transporter 1)"""			8124722, 7835905	Standard	NM_003051		Approved	MCT, MCT1	uc001ecy.3	P53985	OTTHUMG00000012129	ENST00000538576.1:c.167G>C	1.37:g.113471764C>G	ENSP00000441065:p.Ser56Thr		Q49A45|Q5T8R6|Q9NSJ9	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Monocarb_transpt	p.S56T	ENST00000538576.1	37	c.167	CCDS858.1	1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.394935	0.83011	.	.	ENSG00000155380	ENST00000369626;ENST00000538576;ENST00000458229;ENST00000433570;ENST00000443580;ENST00000429288	T;T;T;T;T;T	0.58652	0.32;0.32;0.32;0.32;0.32;0.32	5.97	5.97	0.96955	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.71685	0.3369	M	0.72118	2.19	0.80722	D	1	D;D	0.71674	0.972;0.998	P;D	0.67382	0.874;0.951	T	0.71203	-0.4662	10	0.56958	D	0.05	.	20.0086	0.97443	0.0:1.0:0.0:0.0	.	56;56	Q49A45;P53985	.;MOT1_HUMAN	T	56	ENSP00000358640:S56T;ENSP00000441065:S56T;ENSP00000416167:S56T;ENSP00000445061:S56T;ENSP00000399104:S56T;ENSP00000397106:S56T	ENSP00000358640:S56T	S	-	2	0	SLC16A1	113273287	1.000000	0.71417	1.000000	0.80357	0.502000	0.33828	7.776000	0.85560	2.835000	0.97688	0.591000	0.81541	AGC	SLC16A1	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Monocarb_transpt	ENSG00000155380		0.418	SLC16A1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC16A1	HGNC	protein_coding	OTTHUMT00000033539.1	-	0.00	39	0	C	NM_003051		113471764	-1	tier1	-	no_errors	ENST00000369626	ensembl	human	known	74_37	missense	18.18	27	6	SNP	1.000	G
SLC26A5	375611	genome.wustl.edu	37	7	103029515	103029515	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr7:103029515T>C	ENST00000306312.3	-	14	1715	c.1454A>G	c.(1453-1455)gAc>gGc	p.D485G	SLC26A5_ENST00000393723.1_Missense_Mutation_p.D453G|SLC26A5_ENST00000393729.1_Missense_Mutation_p.D448G|SLC26A5_ENST00000393727.1_Missense_Mutation_p.D485G|SLC26A5_ENST00000339444.6_Missense_Mutation_p.D485G|SLC26A5_ENST00000393735.2_Missense_Mutation_p.D485G|SLC26A5_ENST00000356767.4_Intron|SLC26A5_ENST00000354356.4_5'UTR|SLC26A5_ENST00000432958.2_Missense_Mutation_p.D453G|SLC26A5_ENST00000393730.1_Missense_Mutation_p.D453G	NM_198999.2	NP_945350.1	P58743	S26A5_HUMAN	solute carrier family 26 (anion exchanger), member 5	485					regulation of cell shape (GO:0008360)|regulation of membrane potential (GO:0042391)|sensory perception of sound (GO:0007605)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)	secondary active sulfate transmembrane transporter activity (GO:0008271)			endometrium(5)|kidney(2)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)	43						CAAACCATAGTCCAATCCCAG	0.463																																																	0													146.0	111.0	123.0					7																	103029515		2203	4300	6503	SO:0001583	missense	0			AC005064	CCDS5733.1, CCDS43630.1, CCDS55150.1, CCDS5732.1, CCDS43629.1	7q22	2013-07-18	2013-07-18	2005-09-13	ENSG00000170615	ENSG00000170615		"""Solute carriers"""	9359	protein-coding gene	gene with protein product	"""deafness, neurosensory, autosomal recessive, 61"""	604943	"""prestin (motor protein)"""	PRES		10821263	Standard	NM_206883		Approved	DFNB61	uc003vbz.3	P58743	OTTHUMG00000149911	ENST00000306312.3:c.1454A>G	7.37:g.103029515T>C	ENSP00000304783:p.Asp485Gly		Q496J2|Q7Z7F3|Q86UF8|Q86UF9|Q86UG0	Missense_Mutation	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.D485G	ENST00000306312.3	37	c.1454	CCDS5733.1	7	.	.	.	.	.	.	.	.	.	.	T	29.9	5.045115	0.93685	.	.	ENSG00000170615	ENST00000339444;ENST00000393735;ENST00000306312;ENST00000393730;ENST00000432958;ENST00000393729;ENST00000393727;ENST00000393723	D;D;D;D;D;D;D;D	0.94232	-3.22;-3.26;-3.26;-3.38;-3.38;-3.15;-3.25;-3.38	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	D	0.96396	0.8824	M	0.78916	2.43	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.998;0.999;0.999	D	0.96493	0.9365	10	0.52906	T	0.07	.	14.9906	0.71384	0.0:0.0:0.0:1.0	.	485;453;485;485	P58743;Q496J2;P58743-3;P58743-2	S26A5_HUMAN;.;.;.	G	485;485;485;453;453;448;485;453	ENSP00000342396:D485G;ENSP00000377336:D485G;ENSP00000304783:D485G;ENSP00000377331:D453G;ENSP00000389733:D453G;ENSP00000377330:D448G;ENSP00000377328:D485G;ENSP00000377324:D453G	ENSP00000304783:D485G	D	-	2	0	SLC26A5	102816751	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.338000	0.79269	2.014000	0.59158	0.455000	0.32223	GAC	SLC26A5	-	tigrfam_SulP_transpt	ENSG00000170615		0.463	SLC26A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A5	HGNC	protein_coding	OTTHUMT00000313860.1	-	0.00	37	0	T	NM_198999		103029515	-1	tier1	-	no_errors	ENST00000306312	ensembl	human	known	74_37	missense	37.14	22	13	SNP	1.000	C
SLC45A3	85414	genome.wustl.edu	37	1	205632390	205632390	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:205632390G>T	ENST00000367145.3	-	3	824	c.529C>A	c.(529-531)Ctc>Atc	p.L177I	SLC45A3_ENST00000460934.1_5'Flank	NM_033102.2	NP_149093.1	Q96JT2	S45A3_HUMAN	solute carrier family 45, member 3	177					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)			SLC45A3/BRAF(2)|SLC45A3/ELK4(18)|SLC45A3/ETV1(3)|SLC45A3/ETV5_ENST00000306376(2)|SLC45A3/ERG(50)	cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(7)|ovary(3)|prostate(5)	21	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0194)			GCAGGCAGGAGGTAGCCCAGG	0.637			T	"""ETV1, ETV5, ELK4, ERG"""	prostate																																			Dom	yes		1	1q32	85414	"""solute carrier family 45, member 3"""		E	0													29.0	29.0	29.0					1																	205632390		2202	4299	6501	SO:0001583	missense	0			AF109301	CCDS1458.1	1q32.1	2013-05-22	2005-10-04	2005-10-04	ENSG00000158715	ENSG00000158715		"""Solute carriers"""	8642	protein-coding gene	gene with protein product		605097	"""prostate cancer associated protein 6"", ""prostate cancer associated protein 2"", ""prostate cancer associated protein 8"""	PCANAP6, PCANAP2, PCANAP8		10613842, 11245466	Standard	XM_005245556		Approved	IPCA-6, prostein, IPCA-2, IPCA-8	uc001hda.1	Q96JT2	OTTHUMG00000037223	ENST00000367145.3:c.529C>A	1.37:g.205632390G>T	ENSP00000356113:p.Leu177Ile		A8K2U9	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.L177I	ENST00000367145.3	37	c.529	CCDS1458.1	1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.307005	0.81247	.	.	ENSG00000158715	ENST00000367145	D	0.92249	-3.0	5.5	5.5	0.81552	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	D	0.94873	0.8343	L	0.54908	1.71	0.54753	D	0.999982	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	D	0.92785	0.6243	10	0.26408	T	0.33	-2.136	19.3614	0.94440	0.0:0.0:1.0:0.0	.	177;177	A8K2U9;Q96JT2	.;S45A3_HUMAN	I	177	ENSP00000356113:L177I	ENSP00000356113:L177I	L	-	1	0	SLC45A3	203899013	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.475000	0.73582	2.735000	0.93741	0.655000	0.94253	CTC	SLC45A3	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	ENSG00000158715		0.637	SLC45A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC45A3	HGNC	protein_coding	OTTHUMT00000090619.1		0.00	42	0	G	NM_033102		205632390	-1			no_errors	ENST00000367145	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	T
SLC5A5	6528	genome.wustl.edu	37	19	17994849	17994849	+	Frame_Shift_Del	DEL	C	C	-			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr19:17994849delC	ENST00000222248.3	+	12	1867	c.1520delC	c.(1519-1521)gccfs	p.A507fs		NM_000453.2	NP_000444.1	Q92911	SC5A5_HUMAN	solute carrier family 5 (sodium/iodide cotransporter), member 5	507					cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|iodide transport (GO:0015705)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	iodide transmembrane transporter activity (GO:0015111)|sodium:iodide symporter activity (GO:0008507)			NS(2)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						TCCAGCAGGGCCCCCAGGTGA	0.627																																					Melanoma(65;1008 1708 7910 46650)												0													6.0	6.0	6.0					19																	17994849		2184	4259	6443	SO:0001589	frameshift_variant	0				CCDS12368.1	19p13.11	2013-07-19	2013-07-19		ENSG00000105641	ENSG00000105641		"""Solute carriers"""	11040	protein-coding gene	gene with protein product		601843	"""solute carrier family 5 (sodium iodide symporter), member 5"""			9231811	Standard	NM_000453		Approved	NIS	uc002nhr.4	Q92911		ENST00000222248.3:c.1520delC	19.37:g.17994849delC	ENSP00000222248:p.Ala507fs		O43702|Q2M335|Q9NYB6	Frame_Shift_Del	DEL	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.S509fs	ENST00000222248.3	37	c.1520	CCDS12368.1	19																																																																																			SLC5A5	-	NULL	ENSG00000105641		0.627	SLC5A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A5	HGNC	protein_coding	OTTHUMT00000466690.1		0.00	8	0	C			17994849	+1	tier1		no_errors	ENST00000222248	ensembl	human	known	74_37	frame_shift_del	22.22	7	2	DEL	0.000	-
SOX11	6664	genome.wustl.edu	37	2	5834126	5834126	+	Missense_Mutation	SNP	A	A	C			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr2:5834126A>C	ENST00000322002.3	+	1	1328	c.1273A>C	c.(1273-1275)Atc>Ctc	p.I425L	AC010729.1_ENST00000455579.2_RNA|AC108025.2_ENST00000420221.1_RNA|AC107057.2_ENST00000458264.1_RNA|AC108025.2_ENST00000453678.1_RNA	NM_003108.3	NP_003099.1	P35716	SOX11_HUMAN	SRY (sex determining region Y)-box 11	425					cardiac ventricle formation (GO:0003211)|closure of optic fissure (GO:0061386)|cornea development in camera-type eye (GO:0061303)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|eyelid development in camera-type eye (GO:0061029)|glial cell development (GO:0021782)|glial cell proliferation (GO:0014009)|hard palate development (GO:0060022)|kidney development (GO:0001822)|lens morphogenesis in camera-type eye (GO:0002089)|limb bud formation (GO:0060174)|lung morphogenesis (GO:0060425)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of lymphocyte proliferation (GO:0050672)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|neural crest cell development (GO:0014032)|neural tube formation (GO:0001841)|neuroepithelial cell differentiation (GO:0060563)|neuron differentiation (GO:0030182)|noradrenergic neuron differentiation (GO:0003357)|oligodendrocyte development (GO:0014003)|outflow tract morphogenesis (GO:0003151)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of hippo signaling (GO:0035332)|positive regulation of hormone secretion (GO:0046887)|positive regulation of lens epithelial cell proliferation (GO:2001111)|positive regulation of neurogenesis (GO:0050769)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of ossification (GO:0045778)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|signal transduction involved in cell cycle checkpoint (GO:0072395)|skeletal muscle cell differentiation (GO:0035914)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)|somite development (GO:0061053)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|translation (GO:0006412)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|translation factor activity, nucleic acid binding (GO:0008135)			central_nervous_system(5)|cervix(1)|endometrium(1)|liver(1)|lung(4)|stomach(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			OV - Ovarian serous cystadenocarcinoma(76;0.132)		GAGCGAGATGATCGCGGGGGA	0.612																																																	0													9.0	7.0	8.0					2																	5834126		2028	3957	5985	SO:0001583	missense	0				CCDS1654.1	2p25	2008-05-21			ENSG00000176887	ENSG00000176887		"""SRY (sex determining region Y)-boxes"""	11191	protein-coding gene	gene with protein product	"""SRY-related HMG-box gene 11"""	600898				8666406, 12637543	Standard	NM_003108		Approved		uc002qyj.3	P35716	OTTHUMG00000090333	ENST00000322002.3:c.1273A>C	2.37:g.5834126A>C	ENSP00000322568:p.Ile425Leu		Q4ZFV8	Missense_Mutation	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pirsf_SOX-12/11/4a,pfscan_HMG_box_dom	p.I425L	ENST00000322002.3	37	c.1273	CCDS1654.1	2	.	.	.	.	.	.	.	.	.	.	A	16.76	3.212985	0.58452	.	.	ENSG00000176887	ENST00000322002	D	0.99194	-5.54	5.36	4.17	0.49024	.	0.000000	0.64402	U	0.000002	D	0.97971	0.9332	M	0.78285	2.405	0.53688	D	0.999978	P	0.42692	0.787	B	0.40199	0.322	D	0.96357	0.9263	10	0.49607	T	0.09	.	11.4767	0.50302	0.8651:0.0:0.0:0.1349	.	425	P35716	SOX11_HUMAN	L	425	ENSP00000322568:I425L	ENSP00000322568:I425L	I	+	1	0	SOX11	5751577	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.980000	0.93460	0.830000	0.34757	0.459000	0.35465	ATC	SOX11	-	pirsf_SOX-12/11/4a	ENSG00000176887		0.612	SOX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX11	HGNC	protein_coding	OTTHUMT00000206698.1	-	0.00	59	0	A	NM_003108		5834126	+1	tier1	-	no_errors	ENST00000322002	ensembl	human	known	74_37	missense	11.27	63	8	SNP	1.000	C
SOX11	6664	genome.wustl.edu	37	2	5834126	5834126	+	Missense_Mutation	SNP	A	A	C			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr2:5834126A>C	ENST00000322002.3	+	1	1328	c.1273A>C	c.(1273-1275)Atc>Ctc	p.I425L	AC010729.1_ENST00000455579.2_RNA|AC108025.2_ENST00000420221.1_RNA|AC107057.2_ENST00000458264.1_RNA|AC108025.2_ENST00000453678.1_RNA	NM_003108.3	NP_003099.1	P35716	SOX11_HUMAN	SRY (sex determining region Y)-box 11	425					cardiac ventricle formation (GO:0003211)|closure of optic fissure (GO:0061386)|cornea development in camera-type eye (GO:0061303)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|eyelid development in camera-type eye (GO:0061029)|glial cell development (GO:0021782)|glial cell proliferation (GO:0014009)|hard palate development (GO:0060022)|kidney development (GO:0001822)|lens morphogenesis in camera-type eye (GO:0002089)|limb bud formation (GO:0060174)|lung morphogenesis (GO:0060425)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of lymphocyte proliferation (GO:0050672)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|neural crest cell development (GO:0014032)|neural tube formation (GO:0001841)|neuroepithelial cell differentiation (GO:0060563)|neuron differentiation (GO:0030182)|noradrenergic neuron differentiation (GO:0003357)|oligodendrocyte development (GO:0014003)|outflow tract morphogenesis (GO:0003151)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of hippo signaling (GO:0035332)|positive regulation of hormone secretion (GO:0046887)|positive regulation of lens epithelial cell proliferation (GO:2001111)|positive regulation of neurogenesis (GO:0050769)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of ossification (GO:0045778)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|signal transduction involved in cell cycle checkpoint (GO:0072395)|skeletal muscle cell differentiation (GO:0035914)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)|somite development (GO:0061053)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|translation (GO:0006412)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|translation factor activity, nucleic acid binding (GO:0008135)			central_nervous_system(5)|cervix(1)|endometrium(1)|liver(1)|lung(4)|stomach(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			OV - Ovarian serous cystadenocarcinoma(76;0.132)		GAGCGAGATGATCGCGGGGGA	0.612																																																	0													9.0	7.0	8.0					2																	5834126		2028	3957	5985	SO:0001583	missense	0				CCDS1654.1	2p25	2008-05-21			ENSG00000176887	ENSG00000176887		"""SRY (sex determining region Y)-boxes"""	11191	protein-coding gene	gene with protein product	"""SRY-related HMG-box gene 11"""	600898				8666406, 12637543	Standard	NM_003108		Approved		uc002qyj.3	P35716	OTTHUMG00000090333	ENST00000322002.3:c.1273A>C	2.37:g.5834126A>C	ENSP00000322568:p.Ile425Leu		Q4ZFV8	Missense_Mutation	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pirsf_SOX-12/11/4a,pfscan_HMG_box_dom	p.I425L	ENST00000322002.3	37	c.1273	CCDS1654.1	2	.	.	.	.	.	.	.	.	.	.	A	16.76	3.212985	0.58452	.	.	ENSG00000176887	ENST00000322002	D	0.99194	-5.54	5.36	4.17	0.49024	.	0.000000	0.64402	U	0.000002	D	0.97971	0.9332	M	0.78285	2.405	0.53688	D	0.999978	P	0.42692	0.787	B	0.40199	0.322	D	0.96357	0.9263	10	0.49607	T	0.09	.	11.4767	0.50302	0.8651:0.0:0.0:0.1349	.	425	P35716	SOX11_HUMAN	L	425	ENSP00000322568:I425L	ENSP00000322568:I425L	I	+	1	0	SOX11	5751577	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.980000	0.93460	0.830000	0.34757	0.459000	0.35465	ATC	SOX11	-	pirsf_SOX-12/11/4a	ENSG00000176887		0.612	SOX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX11	HGNC	protein_coding	OTTHUMT00000206698.1	-	0.00	66	0	A	NM_003108		5834126	+1	tier1	-	no_errors	ENST00000322002	ensembl	human	known	74_37	missense	11.27	63	8	SNP	1.000	C
SRGAP3	9901	genome.wustl.edu	37	3	9291244	9291244	+	5'Flank	SNP	G	G	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr3:9291244G>T	ENST00000383836.3	-	0	0				SRGAP3_ENST00000360413.3_5'Flank	NM_014850.3	NP_055665.1	O43295	SRGP3_HUMAN	SLIT-ROBO Rho GTPase activating protein 3						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)		SRGAP3/RAF1(6)	breast(1)|endometrium(2)|kidney(21)|large_intestine(7)|lung(13)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	54				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		CCTCTGGTCTGATGTCCAGTG	0.582			T	RAF1	pilocytic astrocytoma																																			Dom	yes		3	3p25.3	9901	SLIT-ROBO Rho GTPase activating protein 3		M	0																																										SO:0001631	upstream_gene_variant	0			AB007871	CCDS2572.1, CCDS33689.1	3p25.3	2011-07-04	2004-11-12	2004-11-12	ENSG00000196220	ENSG00000196220		"""Rho GTPase activating proteins"""	19744	protein-coding gene	gene with protein product		606525	"""SLIT-ROBO Rho GTPase activating protein 2"""	SRGAP2		12195014	Standard	NM_014850		Approved	KIAA0411, MEGAP, WRP, ARHGAP14	uc003brf.2	O43295	OTTHUMG00000090589		3.37:g.9291244G>T	Exception_encountered		Q8IX13|Q8IZV8	RNA	SNP	-	NULL	ENST00000383836.3	37	NULL	CCDS2572.1	3																																																																																			SRGAP3	-	-	ENSG00000196220		0.582	SRGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRGAP3	HGNC	protein_coding	OTTHUMT00000207137.3	-	0.00	35	0	G			9291244	-1	tier1	-	no_errors	ENST00000490348	ensembl	human	known	74_37	rna	11.43	31	4	SNP	0.746	T
SRGAP3	9901	genome.wustl.edu	37	3	9291244	9291244	+	5'Flank	SNP	G	G	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr3:9291244G>T	ENST00000383836.3	-	0	0				SRGAP3_ENST00000360413.3_5'Flank	NM_014850.3	NP_055665.1	O43295	SRGP3_HUMAN	SLIT-ROBO Rho GTPase activating protein 3						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)		SRGAP3/RAF1(6)	breast(1)|endometrium(2)|kidney(21)|large_intestine(7)|lung(13)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	54				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		CCTCTGGTCTGATGTCCAGTG	0.582			T	RAF1	pilocytic astrocytoma																																			Dom	yes		3	3p25.3	9901	SLIT-ROBO Rho GTPase activating protein 3		M	0																																										SO:0001631	upstream_gene_variant	0			AB007871	CCDS2572.1, CCDS33689.1	3p25.3	2011-07-04	2004-11-12	2004-11-12	ENSG00000196220	ENSG00000196220		"""Rho GTPase activating proteins"""	19744	protein-coding gene	gene with protein product		606525	"""SLIT-ROBO Rho GTPase activating protein 2"""	SRGAP2		12195014	Standard	NM_014850		Approved	KIAA0411, MEGAP, WRP, ARHGAP14	uc003brf.2	O43295	OTTHUMG00000090589		3.37:g.9291244G>T	Exception_encountered		Q8IX13|Q8IZV8	RNA	SNP	-	NULL	ENST00000383836.3	37	NULL	CCDS2572.1	3																																																																																			SRGAP3	-	-	ENSG00000196220		0.582	SRGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRGAP3	HGNC	protein_coding	OTTHUMT00000207137.3	-	0.00	44	0	G			9291244	-1	tier1	-	no_errors	ENST00000490348	ensembl	human	known	74_37	rna	11.43	31	4	SNP	0.746	T
SRRM3	222183	genome.wustl.edu	37	7	75915066	75915066	+	3'UTR	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr7:75915066G>A	ENST00000326382.8	+	0	2074				SRRM3_ENST00000388802.4_Missense_Mutation_p.R623H	NM_001110199.1	NP_001103669.1	A6NNA2	SRRM3_HUMAN	serine/arginine repetitive matrix 3											NS(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|pancreas(1)	8						TACAGCAGTCGCAGCCATGGG	0.701																																																	0													8.0	16.0	14.0					7																	75915066		1319	3058	4377	SO:0001624	3_prime_UTR_variant	0			AK092590		7q11.23	2014-02-12			ENSG00000177679	ENSG00000177679			26729	protein-coding gene	gene with protein product							Standard	NM_001291831		Approved	FLJ37078	uc010ldi.2	A6NNA2	OTTHUMG00000130489	ENST00000326382.8:c.*73G>A	7.37:g.75915066G>A			A6ND75	Missense_Mutation	SNP	pfam_mRNA_splic_Cwf21	p.R623H	ENST00000326382.8	37	c.1868		7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.31|10.31	1.316048|1.316048	0.23908|0.23908	.|.	.|.	ENSG00000177679|ENSG00000177679	ENST00000413003|ENST00000388802	.|.	.|.	.|.	4.1|4.1	4.1|4.1	0.47936|0.47936	.|.	.|0.000000	.|0.41823	.|D	.|0.000810	T|T	0.77638|0.77638	0.4160|0.4160	.|.	.|.	.|.	0.38195|0.38195	D|D	0.940014|0.940014	.|D	.|0.76494	.|0.999	.|D	.|0.78314	.|0.991	T|T	0.81949|0.81949	-0.0699|-0.0699	4|8	.|0.52906	.|T	.|0.07	.|.	15.049|15.049	0.71850|0.71850	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|623	.|F5GYC8	.|.	T|H	204|623	.|.	.|ENSP00000373454:R623H	A|R	+|+	1|2	0|0	SRRM3|SRRM3	75753002|75753002	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.175000|0.175000	0.22909|0.22909	4.420000|4.420000	0.59841|0.59841	2.127000|2.127000	0.65507|0.65507	0.462000|0.462000	0.41574|0.41574	GCA|CGC	SRRM3	-	NULL	ENSG00000177679		0.701	SRRM3-001	KNOWN	basic	protein_coding	SRRM3	HGNC	protein_coding	OTTHUMT00000252889.2		0.00	31	0	G	NM_001110199		75915066	+1			no_errors	ENST00000388802	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	A
SRRT	51593	genome.wustl.edu	37	7	100478977	100478977	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr7:100478977G>A	ENST00000347433.4	+	3	352	c.194G>A	c.(193-195)cGc>cAc	p.R65H	SRRT_ENST00000388793.4_Missense_Mutation_p.R65H|SRRT_ENST00000457580.2_Missense_Mutation_p.R65H|SRRT_ENST00000432932.1_Missense_Mutation_p.R65H			Q9BXP5	SRRT_HUMAN	serrate, RNA effector molecule	65	Arg-rich.				cell proliferation (GO:0008283)|neuronal stem cell maintenance (GO:0097150)|primary miRNA processing (GO:0031053)|regulation of transcription, DNA-templated (GO:0006355)|response to arsenic-containing substance (GO:0046685)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.R65H(1)		breast(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						CGGCGAGAGCGCTTCTCGCCA	0.582																																																	1	Substitution - Missense(1)	endometrium(1)											64.0	59.0	61.0					7																	100478977		2203	4300	6503	SO:0001583	missense	0				CCDS34709.1, CCDS47665.1, CCDS47666.1, CCDS47667.1	7q21	2014-04-14	2014-04-14		ENSG00000087087	ENSG00000087087			24101	protein-coding gene	gene with protein product	"""arsenite resistance protein"""	614469	"""serrate RNA effector molecule homolog (Arabidopsis)"""			11239002, 11230166	Standard	NM_015908		Approved	Asr2, serrate, ARS2	uc003uwy.2	Q9BXP5	OTTHUMG00000157031	ENST00000347433.4:c.194G>A	7.37:g.100478977G>A	ENSP00000314491:p.Arg65His		A4D2E5|A4D2E6|A6NK22|B4DJL4|B4DZA6|O95808|Q32MI4|Q6NT74|Q8TDQ5|Q9BWP6|Q9BXP4|Q9Y4S4	Missense_Mutation	SNP	pfam_Arsenite-R_2,pfam_DUF3546	p.R65H	ENST00000347433.4	37	c.194	CCDS34709.1	7	.	.	.	.	.	.	.	.	.	.	G	19.78	3.891118	0.72524	.	.	ENSG00000087087	ENST00000457580;ENST00000388793;ENST00000432932;ENST00000347433;ENST00000431645	.	.	.	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.73567	0.3603	M	0.69358	2.11	0.80722	D	1	D;D;D;D	0.69078	0.997;0.997;0.997;0.995	P;P;P;P	0.56343	0.796;0.796;0.796;0.63	T	0.76841	-0.2810	9	0.72032	D	0.01	.	16.6233	0.84935	0.0:0.0:1.0:0.0	.	65;65;65;65	Q9BXP5-3;Q9BXP5-4;Q9BXP5-2;Q9BXP5	.;.;.;SRRT_HUMAN	H	65;65;65;65;72	.	ENSP00000314491:R65H	R	+	2	0	SRRT	100316913	1.000000	0.71417	1.000000	0.80357	0.821000	0.46438	6.732000	0.74790	2.512000	0.84698	0.650000	0.86243	CGC	SRRT	-	NULL	ENSG00000087087		0.582	SRRT-004	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	SRRT	HGNC	protein_coding	OTTHUMT00000347168.1		0.00	18	0	G	NM_015908		100478977	+1			no_errors	ENST00000388793	ensembl	human	known	74_37	missense	7.41	25	2	SNP	1.000	A
SSFA2	6744	genome.wustl.edu	37	2	182767078	182767078	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr2:182767078G>A	ENST00000431877.2	+	8	1477	c.1298G>A	c.(1297-1299)aGt>aAt	p.S433N	SSFA2_ENST00000409001.1_Missense_Mutation_p.S433N|SSFA2_ENST00000320370.7_Missense_Mutation_p.S433N|SSFA2_ENST00000428267.2_Missense_Mutation_p.S280N	NM_001130445.1	NP_001123917.1	P28290	SSFA2_HUMAN	sperm specific antigen 2	433						cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(18)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	38			OV - Ovarian serous cystadenocarcinoma(117;0.0856)			GAAAATAGCAGTGAGCTGAAA	0.408																																																	0													94.0	100.0	98.0					2																	182767078		2201	4300	6501	SO:0001583	missense	0			M61199	CCDS2284.1, CCDS46467.1, CCDS74611.1	2q32.1	2012-02-01			ENSG00000138434	ENSG00000138434			11319	protein-coding gene	gene with protein product	"""cleavage signal-1 protein"", ""KRAS-induced actin-interacting protein"", ""sperm associated antigen 13"""	118990				1555770	Standard	XM_005246812		Approved	CS-1, SPAG13, KRAP, KIAA1927	uc002uoh.3	P28290	OTTHUMG00000132584	ENST00000431877.2:c.1298G>A	2.37:g.182767078G>A	ENSP00000388731:p.Ser433Asn		A8K6T0|Q68DA6|Q7Z7L2|Q8N1L3|Q8N263|Q8N7H2|Q8NEN5|Q96E36|Q96PW1	Missense_Mutation	SNP	NULL	p.S433N	ENST00000431877.2	37	c.1298	CCDS46467.1	2	.	.	.	.	.	.	.	.	.	.	G	6.475	0.455780	0.12283	.	.	ENSG00000138434	ENST00000431877;ENST00000320370;ENST00000409001;ENST00000428267	T;T;T;T	0.15256	2.67;2.44;2.67;2.67	5.6	0.477	0.16784	.	1.037480	0.07473	N	0.902539	T	0.07638	0.0192	N	0.13043	0.29	0.09310	N	0.999999	B;B;B;B	0.06786	0.001;0.0;0.0;0.0	B;B;B;B	0.08055	0.003;0.002;0.002;0.002	T	0.41270	-0.9518	10	0.12103	T	0.63	1.396	1.5126	0.02499	0.1887:0.2506:0.3498:0.2109	.	280;433;433;433	E7END2;E9PHV5;P28290;P28290-3	.;.;SSFA2_HUMAN;.	N	433;433;433;280	ENSP00000388731:S433N;ENSP00000314669:S433N;ENSP00000387319:S433N;ENSP00000409867:S280N	ENSP00000314669:S433N	S	+	2	0	SSFA2	182475323	0.000000	0.05858	0.077000	0.20336	0.726000	0.41606	-0.112000	0.10791	-0.124000	0.11724	-0.136000	0.14681	AGT	SSFA2	-	NULL	ENSG00000138434		0.408	SSFA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SSFA2	HGNC	protein_coding	OTTHUMT00000255793.2	-	0.00	52	0	G	NM_006751		182767078	+1	tier1	-	no_errors	ENST00000431877	ensembl	human	known	74_37	missense	11.29	55	7	SNP	0.043	A
ST8SIA2	8128	genome.wustl.edu	37	15	92981790	92981790	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr15:92981790G>T	ENST00000268164.3	+	4	735	c.498G>T	c.(496-498)ttG>ttT	p.L166F	ST8SIA2_ENST00000539113.1_Missense_Mutation_p.L145F	NM_006011.3	NP_006002.1	Q92186	SIA8B_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2	166					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|ganglioside biosynthetic process (GO:0001574)|N-glycan processing (GO:0006491)|nervous system development (GO:0007399)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	early endosome (GO:0005769)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|recycling endosome (GO:0055037)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)			endometrium(2)|large_intestine(6)|lung(9)|skin(2)|urinary_tract(1)	20	Lung NSC(78;0.0893)|all_lung(78;0.125)		BRCA - Breast invasive adenocarcinoma(143;0.0355)|OV - Ovarian serous cystadenocarcinoma(32;0.203)			CGGGGGTCTTGCTGAACAGCG	0.602																																																	0													58.0	51.0	53.0					15																	92981790		2198	4298	6496	SO:0001583	missense	0			U33551	CCDS10372.1	15q26	2013-03-01	2003-01-14	2005-02-07	ENSG00000140557	ENSG00000140557		"""Sialyltransferases"""	10870	protein-coding gene	gene with protein product		602546	"""sialyltransferase 8 (alpha-2, 8-sialytransferase) B"""	SIAT8B		7559389	Standard	NM_006011		Approved	STX, ST8SIA-II, HsT19690	uc002bra.3	Q92186	OTTHUMG00000149843	ENST00000268164.3:c.498G>T	15.37:g.92981790G>T	ENSP00000268164:p.Leu166Phe		Q4VAZ0|Q92470|Q92746	Missense_Mutation	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.L166F	ENST00000268164.3	37	c.498	CCDS10372.1	15	.	.	.	.	.	.	.	.	.	.	G	19.89	3.910923	0.72983	.	.	ENSG00000140557	ENST00000268164;ENST00000539113;ENST00000555434	T;T;T	0.63580	-0.05;-0.05;-0.05	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	D	0.86016	0.5832	H	0.98178	4.165	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.81914	0.994;0.995	D	0.90627	0.4564	10	0.87932	D	0	-15.0807	13.3626	0.60665	0.0:0.0:0.8424:0.1576	.	145;166	C6G488;Q92186	.;SIA8B_HUMAN	F	166;145;123	ENSP00000268164:L166F;ENSP00000437382:L145F;ENSP00000450851:L123F	ENSP00000268164:L166F	L	+	3	2	ST8SIA2	90782794	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.183000	0.58317	2.332000	0.79248	0.563000	0.77884	TTG	ST8SIA2	-	pfam_Glyco_trans_29,pirsf_Sialyl_trans	ENSG00000140557		0.602	ST8SIA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST8SIA2	HGNC	protein_coding	OTTHUMT00000313526.1		0.00	31	0	G	NM_006011		92981790	+1			no_errors	ENST00000268164	ensembl	human	known	74_37	missense	6.98	40	3	SNP	1.000	T
SYCP1	6847	genome.wustl.edu	37	1	115430251	115430251	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:115430251G>A	ENST00000369522.3	+	15	1435	c.1195G>A	c.(1195-1197)Gaa>Aaa	p.E399K	SYCP1_ENST00000369518.1_Missense_Mutation_p.E399K	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	399					chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)		RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TACAAGATTGGAAAAAAATGA	0.264																																																	0													36.0	40.0	38.0					1																	115430251		2180	4256	6436	SO:0001583	missense	0			D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.1195G>A	1.37:g.115430251G>A	ENSP00000358535:p.Glu399Lys		O14963|Q5VXJ6	Missense_Mutation	SNP	pfam_SCP-1	p.E399K	ENST00000369522.3	37	c.1195	CCDS879.1	1	.	.	.	.	.	.	.	.	.	.	G	10.96	1.498910	0.26861	.	.	ENSG00000198765	ENST00000369522;ENST00000536734;ENST00000455987;ENST00000369518	T;T;T	0.56103	0.48;0.48;0.48	5.11	4.19	0.49359	.	0.239930	0.41823	D	0.000810	T	0.22475	0.0542	L	0.43923	1.385	0.37522	D	0.917591	B;B	0.06786	0.001;0.001	B;B	0.10450	0.005;0.005	T	0.06516	-1.0822	10	0.12766	T	0.61	-1.3561	8.553	0.33462	0.1021:0.0:0.8979:0.0	.	399;399	B7ZLS9;Q15431	.;SYCP1_HUMAN	K	399	ENSP00000358535:E399K;ENSP00000410011:E399K;ENSP00000358531:E399K	ENSP00000358531:E399K	E	+	1	0	SYCP1	115231774	1.000000	0.71417	1.000000	0.80357	0.804000	0.45430	0.867000	0.27968	2.375000	0.81037	0.650000	0.86243	GAA	SYCP1	-	pfam_SCP-1	ENSG00000198765		0.264	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP1	HGNC	protein_coding	OTTHUMT00000033386.1		0.00	113	0	G	NM_003176		115430251	+1			no_errors	ENST00000369518	ensembl	human	known	74_37	missense	5.59	152	9	SNP	1.000	A
SYCP1	6847	genome.wustl.edu	37	1	115430251	115430252	+	Frame_Shift_Ins	INS	-	-	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:115430251_115430252insA	ENST00000369522.3	+	15	1435_1436	c.1195_1196insA	c.(1195-1197)gaafs	p.E399fs	SYCP1_ENST00000369518.1_Frame_Shift_Ins_p.E399fs	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	399					chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)		RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TACAAGATTGGAAAAAAATGAA	0.262																																																	0																																										SO:0001589	frameshift_variant	0			D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.1202dupA	1.37:g.115430258_115430258dupA	ENSP00000358535:p.Glu399fs		O14963|Q5VXJ6	Frame_Shift_Ins	INS	pfam_SCP-1	p.N401fs	ENST00000369522.3	37	c.1195_1196	CCDS879.1	1																																																																																			SYCP1	-	pfam_SCP-1	ENSG00000198765		0.262	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP1	HGNC	protein_coding	OTTHUMT00000033386.1		0.00	113	0	-	NM_003176		115430252	+1	tier1		no_errors	ENST00000369518	ensembl	human	known	74_37	frame_shift_ins	15.53	136	25	INS	1.000:0.995	A
SYNGR2	9144	genome.wustl.edu	37	17	76167522	76167522	+	Intron	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr17:76167522G>A	ENST00000225777.3	+	3	396				SYNGR2_ENST00000588282.1_Intron|SYNGR2_ENST00000590201.1_Intron|SYNGR2_ENST00000589711.1_Intron|SYNGR2_ENST00000585591.1_Intron|SYNGR2_ENST00000592456.1_3'UTR			O43760	SNG2_HUMAN	synaptogyrin 2						protein targeting (GO:0006605)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)				endometrium(2)|large_intestine(1)|liver(1)|lung(1)|skin(1)|urinary_tract(1)	7			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)|OV - Ovarian serous cystadenocarcinoma(97;0.0994)			ACCTGCCCGCGTCCCCTCCCA	0.647																																																	0																																										SO:0001627	intron_variant	0			AJ002308	CCDS11753.1	17q25.3	2014-09-11			ENSG00000108639	ENSG00000108639			11499	protein-coding gene	gene with protein product	"""cellugyrin"""	603926				9760194	Standard	NM_004710		Approved		uc002juu.1	O43760	OTTHUMG00000177457	ENST00000225777.3:c.338-69G>A	17.37:g.76167522G>A			O43762|Q3KQZ2|Q658S7	RNA	SNP	-	NULL	ENST00000225777.3	37	NULL	CCDS11753.1	17																																																																																			SYNGR2	-	-	ENSG00000108639		0.647	SYNGR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNGR2	HGNC	protein_coding	OTTHUMT00000437009.2	-	0.00	62	0	G			76167522	+1	tier1	-	no_errors	ENST00000592456	ensembl	human	known	74_37	rna	12.73	48	7	SNP	0.001	A
SYNGR4	23546	genome.wustl.edu	37	19	48878931	48878931	+	Silent	SNP	G	G	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr19:48878931G>T	ENST00000344846.2	+	4	643	c.393G>T	c.(391-393)tcG>tcT	p.S131S	SYNGR4_ENST00000601610.1_Silent_p.S82S|SYNGR4_ENST00000595322.1_Intron	NM_012451.3	NP_036583.2	O95473	SNG4_HUMAN	synaptogyrin 4	131	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.					integral component of membrane (GO:0016021)		p.S131S(1)		breast(1)|endometrium(2)|large_intestine(4)|lung(2)|skin(1)	10		all_epithelial(76;5.08e-07)|all_lung(116;5.76e-06)|Lung NSC(112;1.18e-05)|Prostate(7;0.0143)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;0.000138)|all cancers(93;0.00017)|Epithelial(262;0.0138)|GBM - Glioblastoma multiforme(486;0.0146)		GGCAGCATTCGCCGCCCAAAG	0.592																																																	1	Substitution - coding silent(1)	endometrium(1)											93.0	85.0	88.0					19																	48878931		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ011733	CCDS12717.1	19q13.3	2008-07-04				ENSG00000105467			11502	protein-coding gene	gene with protein product		608373					Standard	NM_012451		Approved		uc002piz.3	O95473		ENST00000344846.2:c.393G>T	19.37:g.48878931G>T			Q3KP58	Silent	SNP	pfam_Marvel,pirsf_Synaptogyrin	p.S131	ENST00000344846.2	37	c.393	CCDS12717.1	19																																																																																			SYNGR4	-	pfam_Marvel,pirsf_Synaptogyrin	ENSG00000105467		0.592	SYNGR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNGR4	HGNC	protein_coding	OTTHUMT00000465704.1		0.00	27	0	G			48878931	+1			no_errors	ENST00000344846	ensembl	human	known	74_37	silent	6.25	30	2	SNP	0.000	T
SYT3	84258	genome.wustl.edu	37	19	51128486	51128486	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr19:51128486C>T	ENST00000338916.4	-	7	2273	c.1640G>A	c.(1639-1641)cGc>cAc	p.R547H	SYT3_ENST00000593901.1_Missense_Mutation_p.R547H|SYT3_ENST00000544769.1_Missense_Mutation_p.R547H|SYT3_ENST00000600079.1_Missense_Mutation_p.R547H	NM_032298.2	NP_115674.1	Q9BQG1	SYT3_HUMAN	synaptotagmin III	547					calcium ion-dependent exocytosis (GO:0017156)|positive regulation of vesicle fusion (GO:0031340)|response to calcium ion (GO:0051592)	cell junction (GO:0030054)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(2)|skin(3)|urinary_tract(2)	35		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		CCAGTGCTCGCGGCCGTGCGG	0.682																																																	0													32.0	28.0	29.0					19																	51128486		2201	4296	6497	SO:0001583	missense	0			AL136594	CCDS12798.1	19q13.33	2014-07-02			ENSG00000213023	ENSG00000213023		"""Synaptotagmins"""	11511	protein-coding gene	gene with protein product		600327				7749232	Standard	NM_032298		Approved		uc002psv.3	Q9BQG1	OTTHUMG00000183064	ENST00000338916.4:c.1640G>A	19.37:g.51128486C>T	ENSP00000340914:p.Arg547His		Q8N5Z1|Q8N640	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,prints_Synaptotagmin,prints_C2_dom,pfscan_C2_dom	p.R547H	ENST00000338916.4	37	c.1640	CCDS12798.1	19	.	.	.	.	.	.	.	.	.	.	C	29.4	5.004793	0.93287	.	.	ENSG00000213023	ENST00000338916;ENST00000544769	T;T	0.72615	-0.67;-0.67	3.98	3.98	0.46160	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.56097	U	0.000032	T	0.78394	0.4276	L	0.45137	1.4	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	T	0.81484	-0.0912	10	0.87932	D	0	.	15.2164	0.73270	0.0:1.0:0.0:0.0	.	547	Q9BQG1	SYT3_HUMAN	H	547	ENSP00000340914:R547H;ENSP00000438883:R547H	ENSP00000340914:R547H	R	-	2	0	SYT3	55820298	0.991000	0.36638	1.000000	0.80357	0.943000	0.58893	7.314000	0.78988	1.969000	0.57287	0.561000	0.74099	CGC	SYT3	-	superfamily_C2_dom,smart_C2_dom	ENSG00000213023		0.682	SYT3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SYT3	HGNC	protein_coding	OTTHUMT00000464910.1	-	0.00	24	0	C	NM_032298		51128486	-1	tier1	-	no_errors	ENST00000338916	ensembl	human	known	74_37	missense	66.67	12	24	SNP	1.000	T
TBP	6908	genome.wustl.edu	37	6	170871058	170871058	+	Silent	SNP	G	G	A	rs113440919		TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr6:170871058G>A	ENST00000392092.2	+	3	513	c.234G>A	c.(232-234)caG>caA	p.Q78Q	TBP_ENST00000230354.6_Silent_p.Q78Q|TBP_ENST00000540980.1_Silent_p.Q58Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	78	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcagcagcagcagcagcagc	0.577																																																	0													13.0	18.0	16.0					6																	170871058		1927	3786	5713	SO:0001819	synonymous_variant	0			M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.234G>A	6.37:g.170871058G>A			B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	pfam_TBP,prints_TBP	p.Q78	ENST00000392092.2	37	c.234	CCDS5315.1	6																																																																																			TBP	-	NULL	ENSG00000112592		0.577	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBP	HGNC	protein_coding	OTTHUMT00000043271.2	-	0.00	100	0	G	NM_003194		170871058	+1	tier1	rs113440919	no_errors	ENST00000230354	ensembl	human	known	74_37	silent	7.69	84	7	SNP	0.998	A
TCHH	7062	genome.wustl.edu	37	1	152086555	152086556	+	Start_Codon_Ins	INS	-	-	T	rs141946179	byFrequency	TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:152086555_152086556insT	ENST00000368804.1	-	0	0_1					NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin						keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AAGTGGAGACATTTTTTTTTCT	0.361																																																	0																																										SO:0001582	initiator_codon_variant	0			L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.2dupA	1.37:g.152086564_152086564dupT			Q5VUI3	Frame_Shift_Ins	INS	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.M1fs	ENST00000368804.1	37	c.2_1	CCDS41396.1	1																																																																																			TCHH	-	NULL	ENSG00000159450		0.361	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHH	HGNC	protein_coding	OTTHUMT00000036671.2		0.00	17	0	-	NM_007113		152086556	-1	tier1		no_errors	ENST00000368804	ensembl	human	known	74_37	frame_shift_ins	14.81	23	4	INS	1.000:1.000	T
TCHH	7062	genome.wustl.edu	37	1	152086555	152086556	+	Start_Codon_Ins	INS	-	-	T	rs141946179	byFrequency	TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:152086555_152086556insT	ENST00000368804.1	-	0	0_1					NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin						keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AAGTGGAGACATTTTTTTTTCT	0.361																																																	0																																										SO:0001582	initiator_codon_variant	0			L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.2dupA	1.37:g.152086564_152086564dupT			Q5VUI3	Frame_Shift_Ins	INS	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.M1fs	ENST00000368804.1	37	c.2_1	CCDS41396.1	1																																																																																			TCHH	-	NULL	ENSG00000159450		0.361	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHH	HGNC	protein_coding	OTTHUMT00000036671.2		0.00	31	0	-	NM_007113		152086556	-1	tier1		no_errors	ENST00000368804	ensembl	human	known	74_37	frame_shift_ins	14.81	23	4	INS	1.000:1.000	T
TGIF1	7050	genome.wustl.edu	37	18	3452225	3452225	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr18:3452225C>T	ENST00000330513.5	+	1	551	c.248C>T	c.(247-249)cCt>cTt	p.P83L	TGIF1_ENST00000577543.1_Intron|TGIF1_ENST00000405385.3_Intron|TGIF1_ENST00000551402.1_Intron|TGIF1_ENST00000407501.2_Intron|TGIF1_ENST00000548489.2_Intron|TGIF1_ENST00000343820.5_Intron|TGIF1_ENST00000345133.5_Intron|TGIF1_ENST00000551541.1_Intron|TGIF1_ENST00000400167.2_5'Flank|TGIF1_ENST00000401449.1_Intron	NM_170695.2	NP_733796.2	Q15583	TGIF1_HUMAN	TGFB-induced factor homeobox 1	83					determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|negative regulation of cell proliferation (GO:0008285)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nodal signaling pathway (GO:0038092)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of neuron differentiation (GO:0045666)|regulation of gastrulation (GO:0010470)|response to drug (GO:0042493)|retina development in camera-type eye (GO:0060041)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			cervix(1)|endometrium(3)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	13	Esophageal squamous(4;0.0859)	Colorectal(8;0.0104)				GCCCCCCCTCCTCCACCGGCG	0.761																																																	0													12.0	13.0	13.0					18																	3452225		2193	4262	6455	SO:0001583	missense	0			X89750	CCDS11832.1, CCDS11833.1, CCDS11834.1, CCDS11835.1	18p11.31	2011-06-20	2007-01-30	2007-01-30	ENSG00000177426	ENSG00000177426		"""Homeoboxes / TALE class"""	11776	protein-coding gene	gene with protein product		602630	"""TGFB-induced factor (TALE family homeobox)"""	HPE4, TGIF		8537382, 10835638	Standard	NM_173211		Approved		uc002klz.3	Q15583	OTTHUMG00000131511	ENST00000330513.5:c.248C>T	18.37:g.3452225C>T	ENSP00000327959:p.Pro83Leu		A6NE42|A6NLU7|F8VZB6|Q6ICR0|Q8N5X9|Q9NRS0	Missense_Mutation	SNP	pfam_Homeobox_KN_domain,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.P83L	ENST00000330513.5	37	c.248	CCDS11834.1	18	.	.	.	.	.	.	.	.	.	.	C	12.63	1.996039	0.35226	.	.	ENSG00000177426	ENST00000330513	T	0.52526	0.66	4.07	-2.89	0.05665	.	6.638940	0.00166	U	0.000014	T	0.30727	0.0774	N	0.14661	0.345	0.23260	N	0.998025	B	0.06786	0.001	B	0.01281	0.0	T	0.26503	-1.0101	10	0.66056	D	0.02	.	6.0329	0.19690	0.1302:0.2382:0.5436:0.088	.	83	Q15583	TGIF1_HUMAN	L	83	ENSP00000327959:P83L	ENSP00000327959:P83L	P	+	2	0	TGIF1	3442225	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.212000	0.09319	-1.041000	0.03266	-0.264000	0.10439	CCT	TGIF1	-	NULL	ENSG00000177426		0.761	TGIF1-003	KNOWN	basic|CCDS	protein_coding	TGIF1	HGNC	protein_coding	OTTHUMT00000254368.4		0.00	30	0	C	NM_170695		3452225	+1			no_errors	ENST00000330513	ensembl	human	known	74_37	missense	6.38	88	6	SNP	0.001	T
THUMPD1	55623	genome.wustl.edu	37	16	20749250	20749250	+	Silent	SNP	G	G	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr16:20749250G>T	ENST00000381337.2	-	3	779	c.435C>A	c.(433-435)ctC>ctA	p.L145L	THUMPD1_ENST00000431224.2_Silent_p.L231L|THUMPD1_ENST00000396083.2_Silent_p.L145L	NM_017736.3	NP_060206.2	Q9NXG2	THUM1_HUMAN	THUMP domain containing 1	145							poly(A) RNA binding (GO:0044822)			NS(2)|large_intestine(2)|lung(6)|pancreas(1)|urinary_tract(1)	12						ACATATCCTGGAGAATATGAT	0.318																																																	0													103.0	117.0	112.0					16																	20749250		2199	4300	6499	SO:0001819	synonymous_variant	0			BC000448	CCDS10588.1	16p13.11	2010-06-17			ENSG00000066654	ENSG00000066654			23807	protein-coding gene	gene with protein product							Standard	XM_005255422		Approved	FLJ20274	uc002dho.3	Q9NXG2	OTTHUMG00000131558	ENST00000381337.2:c.435C>A	16.37:g.20749250G>T			Q9BWC3	Silent	SNP	pfam_THUMP,smart_THUMP,pfscan_THUMP	p.L231	ENST00000381337.2	37	c.693	CCDS10588.1	16																																																																																			THUMPD1	-	NULL	ENSG00000066654		0.318	THUMPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THUMPD1	HGNC	protein_coding	OTTHUMT00000254420.1	-	0.00	47	0	G	NM_017736		20749250	-1	tier1	-	no_errors	ENST00000431224	ensembl	human	known	74_37	silent	42.31	30	22	SNP	0.997	T
TLR10	81793	genome.wustl.edu	37	4	38775354	38775354	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr4:38775354C>T	ENST00000308973.4	-	4	2463	c.1858G>A	c.(1858-1860)Gtt>Att	p.V620I	TLR10_ENST00000508334.1_Missense_Mutation_p.V620I|TLR10_ENST00000506111.1_Missense_Mutation_p.V620I|TLR10_ENST00000361424.2_Missense_Mutation_p.V620I|TLR10_ENST00000507953.1_5'Flank	NM_001017388.2|NM_001195107.1|NM_030956.3	NP_001017388.1|NP_001182036.1|NP_112218.2	Q9BXR5	TLR10_HUMAN	toll-like receptor 10	620					immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of inflammatory response (GO:0050729)|regulation of cytokine secretion (GO:0050707)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor signaling pathway (GO:0002224)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(11)|prostate(1)|urinary_tract(2)	25						GTTTTCCTAACCCTGTGCCAT	0.448																																																	0													141.0	131.0	135.0					4																	38775354		2203	4300	6503	SO:0001583	missense	0			AF296673	CCDS3445.1	4p14	2009-11-23			ENSG00000174123	ENSG00000174123		"""CD molecules"""	15634	protein-coding gene	gene with protein product		606270				11267672	Standard	NM_030956		Approved	CD290	uc003gtk.3	Q9BXR5	OTTHUMG00000128578	ENST00000308973.4:c.1858G>A	4.37:g.38775354C>T	ENSP00000308925:p.Val620Ile		A8K7L1|B3Y668|D1CS21|D1CS22|Q32MI7|Q32MI8|Q5FWG4|Q6UXL3	Missense_Mutation	SNP	pirsf_Toll-like_receptor,pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.V620I	ENST00000308973.4	37	c.1858	CCDS3445.1	4	.	.	.	.	.	.	.	.	.	.	C	3.203	-0.163337	0.06502	.	.	ENSG00000174123	ENST00000308973;ENST00000506111;ENST00000361424;ENST00000508334	T;T;T;T	0.11385	2.78;2.78;2.78;2.78	5.32	2.56	0.30785	.	0.852671	0.09763	N	0.758969	T	0.10809	0.0264	L	0.51422	1.61	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.34254	-0.9836	10	0.54805	T	0.06	.	4.7866	0.13227	0.1375:0.553:0.0:0.3095	.	620	Q9BXR5	TLR10_HUMAN	I	620	ENSP00000308925:V620I;ENSP00000421483:V620I;ENSP00000354459:V620I;ENSP00000424923:V620I	ENSP00000308925:V620I	V	-	1	0	TLR10	38451749	0.000000	0.05858	0.028000	0.17463	0.267000	0.26476	-0.055000	0.11807	0.194000	0.20326	-0.225000	0.12378	GTT	TLR10	-	pirsf_Toll-like_receptor	ENSG00000174123		0.448	TLR10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR10	HGNC	protein_coding	OTTHUMT00000250430.1	-	0.00	71	0	C			38775354	-1	tier1	-	no_errors	ENST00000308973	ensembl	human	known	74_37	missense	30.34	62	27	SNP	0.019	T
TP53	7157	genome.wustl.edu	37	17	7577017	7577017	+	Splice_Site	SNP	A	A	C			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr17:7577017A>C	ENST00000269305.4	-	8	1109		c.e8+1		TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.?(6)|p.A307fs*34(1)|p.L308fs*31(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTGCTTGCTTACCTCGCTTAG	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	16	Whole gene deletion(8)|Unknown(6)|Deletion - Frameshift(2)	bone(4)|haematopoietic_and_lymphoid_tissue(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|lung(2)|stomach(1)|urinary_tract(1)|ovary(1)											128.0	112.0	117.0					17																	7577017		2203	4300	6503	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.919+1T>G	17.37:g.7577017A>C			Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	-	e7+2	ENST00000269305.4	37	c.919+2	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	8.950	0.968007	0.18659	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	4.81	3.72	0.42706	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.7248	0.28753	0.8139:0.0:0.0:0.1861	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7517742	1.000000	0.71417	0.780000	0.31762	0.217000	0.24651	7.280000	0.78610	0.855000	0.35359	0.459000	0.35465	.	TP53	-	-	ENSG00000141510		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	62	0	A	NM_000546	Intron	7577017	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	splice_site	57.89	16	22	SNP	0.853	C
TPRA1	131601	genome.wustl.edu	37	3	127294385	127294385	+	Intron	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr3:127294385C>T	ENST00000355552.3	-	9	1047				TPRA1_ENST00000465915.1_5'UTR|TPRA1_ENST00000489960.1_Intron|TPRA1_ENST00000296210.7_Intron|TPRA1_ENST00000450633.2_Intron	NM_001136053.1	NP_001129525.1	Q86W33	TPRA1_HUMAN	transmembrane protein, adipocyte asscociated 1						aging (GO:0007568)|G-protein coupled receptor signaling pathway (GO:0007186)|lipid metabolic process (GO:0006629)	integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	9						AGGTCCCACCCTGGACAGGCC	0.677											OREG0015772	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													16.0	19.0	18.0					3																	127294385		2154	4229	6383	SO:0001627	intron_variant	0			AK056759	CCDS3042.1, CCDS46899.1	3q21.2	2012-08-22	2009-07-08	2009-07-08	ENSG00000163870	ENSG00000163870		"""GPCR / Unclassified : 7TM orphan receptors"""	30413	protein-coding gene	gene with protein product	"""transmembrane protein 227"""	608336	"""G protein-coupled receptor 175"""	GPR175		10342878	Standard	NM_001136053		Approved	TPRA40, FLJ32197, TMEM227	uc003ejn.3	Q86W33	OTTHUMG00000159639	ENST00000355552.3:c.671-37G>A	3.37:g.127294385C>T		1556	A8MVB8|D3DNA9|Q8WZ24|Q96AJ6|Q9P2R4	RNA	SNP	-	NULL	ENST00000355552.3	37	NULL	CCDS3042.1	3																																																																																			TPRA1	-	-	ENSG00000163870		0.677	TPRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPRA1	HGNC	protein_coding	OTTHUMT00000356624.1	-	0.00	35	0	C	NM_016372		127294385	-1	tier1	-	no_errors	ENST00000465915	ensembl	human	known	74_37	rna	17.39	38	8	SNP	0.007	T
TPTE2	93492	genome.wustl.edu	37	13	20048098	20048098	+	Silent	SNP	G	G	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr13:20048098G>T	ENST00000400230.2	-	6	392	c.348C>A	c.(346-348)ggC>ggA	p.G116G	TPTE2_ENST00000457266.2_Intron|TPTE2_ENST00000255310.6_Silent_p.G79G|TPTE2_ENST00000382977.4_Silent_p.G116G|TPTE2_ENST00000400103.2_Intron|TPTE2_ENST00000382978.1_Silent_p.G116G|TPTE2_ENST00000382975.4_Silent_p.G116G|TPTE2_ENST00000390680.2_Silent_p.G79G			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	116					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		GAAAAAATAAGCCAATAGCTA	0.338																																																	0													49.0	55.0	53.0					13																	20048098		2201	4296	6497	SO:0001819	synonymous_variant	0			AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.348C>A	13.37:g.20048098G>T			A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Silent	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_Ion_trans_dom,pfam_Dual-sp_phosphatase_cat-dom,superfamily_C2_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.G116	ENST00000400230.2	37	c.348	CCDS45014.1	13																																																																																			TPTE2	-	pfam_Ion_trans_dom	ENSG00000132958		0.338	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	TPTE2	HGNC	protein_coding		-	0.00	144	0	G	NM_199254		20048098	-1	tier1	-	no_errors	ENST00000382977	ensembl	human	known	74_37	silent	22.31	94	27	SNP	0.062	T
TPX2	22974	genome.wustl.edu	37	20	30381807	30381807	+	Missense_Mutation	SNP	A	A	C			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr20:30381807A>C	ENST00000300403.6	+	14	2194	c.1666A>C	c.(1666-1668)Aaa>Caa	p.K556Q	TPX2_ENST00000340513.4_Missense_Mutation_p.K592Q	NM_012112.4	NP_036244.2	Q9ULW0	TPX2_HUMAN	TPX2, microtubule-associated	556					activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|mitotic nuclear division (GO:0007067)|regulation of mitotic spindle organization (GO:0060236)	axon hillock (GO:0043203)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28			Epithelial(4;0.000771)|Colorectal(19;0.00306)|all cancers(5;0.004)|COAD - Colon adenocarcinoma(19;0.0347)|OV - Ovarian serous cystadenocarcinoma(3;0.0656)			GAAGAAAATAAAAGAACTGCA	0.393																																																	0													105.0	105.0	105.0					20																	30381807		2203	4300	6503	SO:0001583	missense	0			AF098158	CCDS13190.1	20q11.2	2013-07-23	2013-07-23	2003-10-08	ENSG00000088325	ENSG00000088325			1249	protein-coding gene	gene with protein product		605917	"""chromosome 20 open reading frame 1"", ""TPX2, microtubule-associated, homolog (Xenopus laevis)"""	C20orf2, C20orf1		9207457, 10393424	Standard	NM_012112		Approved	p100, DIL-2	uc002wwp.1	Q9ULW0	OTTHUMG00000032190	ENST00000300403.6:c.1666A>C	20.37:g.30381807A>C	ENSP00000300403:p.Lys556Gln		Q9H1R4|Q9NRA3|Q9UFN9|Q9UL00|Q9Y2M1	Missense_Mutation	SNP	pfam_TPX2_central_dom,pfam_Aurora-A-bd,pfam_TPX2_dom_C	p.K592Q	ENST00000300403.6	37	c.1774	CCDS13190.1	20	.	.	.	.	.	.	.	.	.	.	A	13.27	2.187501	0.38609	.	.	ENSG00000088325	ENST00000300403;ENST00000340513	T	0.35421	1.31	5.82	3.56	0.40772	.	0.119039	0.53938	D	0.000043	T	0.23572	0.0570	N	0.19112	0.55	0.38653	D	0.951881	D;P	0.53151	0.958;0.872	P;B	0.50082	0.63;0.325	T	0.21518	-1.0243	10	0.11794	T	0.64	-15.338	3.3214	0.07052	0.5876:0.2114:0.2009:0.0	.	592;556	Q96RR5;Q9ULW0	.;TPX2_HUMAN	Q	556;592	ENSP00000341145:K592Q	ENSP00000300403:K556Q	K	+	1	0	TPX2	29845468	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	4.225000	0.58600	1.009000	0.39289	-0.316000	0.08728	AAA	TPX2	-	NULL	ENSG00000088325		0.393	TPX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPX2	HGNC	protein_coding	OTTHUMT00000078569.2	-	0.00	54	0	A			30381807	+1	tier1	-	no_errors	ENST00000340513	ensembl	human	known	74_37	missense	14.47	65	11	SNP	1.000	C
TPX2	22974	genome.wustl.edu	37	20	30381807	30381807	+	Missense_Mutation	SNP	A	A	C			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr20:30381807A>C	ENST00000300403.6	+	14	2194	c.1666A>C	c.(1666-1668)Aaa>Caa	p.K556Q	TPX2_ENST00000340513.4_Missense_Mutation_p.K592Q	NM_012112.4	NP_036244.2	Q9ULW0	TPX2_HUMAN	TPX2, microtubule-associated	556					activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|mitotic nuclear division (GO:0007067)|regulation of mitotic spindle organization (GO:0060236)	axon hillock (GO:0043203)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28			Epithelial(4;0.000771)|Colorectal(19;0.00306)|all cancers(5;0.004)|COAD - Colon adenocarcinoma(19;0.0347)|OV - Ovarian serous cystadenocarcinoma(3;0.0656)			GAAGAAAATAAAAGAACTGCA	0.393																																																	0													105.0	105.0	105.0					20																	30381807		2203	4300	6503	SO:0001583	missense	0			AF098158	CCDS13190.1	20q11.2	2013-07-23	2013-07-23	2003-10-08	ENSG00000088325	ENSG00000088325			1249	protein-coding gene	gene with protein product		605917	"""chromosome 20 open reading frame 1"", ""TPX2, microtubule-associated, homolog (Xenopus laevis)"""	C20orf2, C20orf1		9207457, 10393424	Standard	NM_012112		Approved	p100, DIL-2	uc002wwp.1	Q9ULW0	OTTHUMG00000032190	ENST00000300403.6:c.1666A>C	20.37:g.30381807A>C	ENSP00000300403:p.Lys556Gln		Q9H1R4|Q9NRA3|Q9UFN9|Q9UL00|Q9Y2M1	Missense_Mutation	SNP	pfam_TPX2_central_dom,pfam_Aurora-A-bd,pfam_TPX2_dom_C	p.K592Q	ENST00000300403.6	37	c.1774	CCDS13190.1	20	.	.	.	.	.	.	.	.	.	.	A	13.27	2.187501	0.38609	.	.	ENSG00000088325	ENST00000300403;ENST00000340513	T	0.35421	1.31	5.82	3.56	0.40772	.	0.119039	0.53938	D	0.000043	T	0.23572	0.0570	N	0.19112	0.55	0.38653	D	0.951881	D;P	0.53151	0.958;0.872	P;B	0.50082	0.63;0.325	T	0.21518	-1.0243	10	0.11794	T	0.64	-15.338	3.3214	0.07052	0.5876:0.2114:0.2009:0.0	.	592;556	Q96RR5;Q9ULW0	.;TPX2_HUMAN	Q	556;592	ENSP00000341145:K592Q	ENSP00000300403:K556Q	K	+	1	0	TPX2	29845468	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	4.225000	0.58600	1.009000	0.39289	-0.316000	0.08728	AAA	TPX2	-	NULL	ENSG00000088325		0.393	TPX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPX2	HGNC	protein_coding	OTTHUMT00000078569.2	-	0.00	74	0	A			30381807	+1	tier1	-	no_errors	ENST00000340513	ensembl	human	known	74_37	missense	14.47	65	11	SNP	1.000	C
TRIM49	57093	genome.wustl.edu	37	11	89536873	89536873	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr11:89536873C>A	ENST00000329758.1	-	4	828	c.500G>T	c.(499-501)tGc>tTc	p.C167F	TRIM49_ENST00000532501.2_Missense_Mutation_p.C167F	NM_020358.2	NP_065091.1	P0CI25	TRI49_HUMAN	tripartite motif containing 49	167						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(14)|prostate(1)|skin(2)|stomach(1)	27		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				AACCTTCCAGCATCTGGTTCT	0.408																																																	0													5.0	4.0	4.0					11																	89536873		1778	3776	5554	SO:0001583	missense	0			AB037682	CCDS8287.1	11p11.12-q12	2012-05-21	2011-01-25	2004-11-17	ENSG00000168930	ENSG00000168930		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	13431	protein-coding gene	gene with protein product		606124	"""ring finger protein 18"", ""tripartite motif-containing 49"""	RNF18		11018261	Standard	NM_020358		Approved	TRIM49A	uc001pdb.3	P0CI25		ENST00000329758.1:c.500G>T	11.37:g.89536873C>A	ENSP00000327604:p.Cys167Phe		A0AVR7|A0AVR9|Q6DJV1|Q9NS80	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,superfamily_Lambda_DNA-bd_dom,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING	p.C167F	ENST00000329758.1	37	c.500	CCDS8287.1	11	.	.	.	.	.	.	.	.	.	.	C	0.001	-4.016619	0.00002	.	.	ENSG00000168930	ENST00000329758;ENST00000532501	T	0.04551	3.6	0.861	-1.72	0.08107	.	.	.	.	.	T	0.03434	0.0099	L	0.35414	1.06	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.41680	-0.9495	8	.	.	.	.	3.7359	0.08510	0.0:0.3242:0.1985:0.4773	.	167	P0CI25	TRI49_HUMAN	F	167	ENSP00000327604:C167F	.	C	-	2	0	TRIM49	89176521	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-4.084000	0.00298	-3.476000	0.00156	-2.583000	0.00167	TGC	TRIM49	-	NULL	ENSG00000168930		0.408	TRIM49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM49	HGNC	protein_coding	OTTHUMT00000395435.1	-	0.00	100	0	C	NM_020358		89536873	-1	tier1	-	no_errors	ENST00000329758	ensembl	human	known	74_37	missense	14.17	103	17	SNP	0.000	A
TRPS1	7227	genome.wustl.edu	37	8	116617156	116617156	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr8:116617156C>T	ENST00000220888.5	-	3	1160	c.1001G>A	c.(1000-1002)cGc>cAc	p.R334H	TRPS1_ENST00000519674.1_Missense_Mutation_p.R334H|TRPS1_ENST00000395715.3_Missense_Mutation_p.R347H|TRPS1_ENST00000520276.1_Missense_Mutation_p.R338H|TRPS1_ENST00000519076.1_Missense_Mutation_p.R288H			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	334					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			GAATTTACAGCGGAAATACTT	0.418									Langer-Giedion syndrome																																								0													95.0	93.0	94.0					8																	116617156		1894	4108	6002	SO:0001583	missense	0	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.1001G>A	8.37:g.116617156C>T	ENSP00000220888:p.Arg334His		B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	pfam_Znf_GATA,smart_Znf_C2H2-like,smart_Znf_GATA,pfscan_Znf_C2H2,pfscan_Znf_GATA,prints_Znf_GATA	p.R347H	ENST00000220888.5	37	c.1040		8	.	.	.	.	.	.	.	.	.	.	C	24.8	4.575815	0.86645	.	.	ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000519076;ENST00000520276;ENST00000519674	T;T;T;T;T	0.08282	3.11;3.11;3.11;3.11;3.11	5.69	5.69	0.88448	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.20047	0.0482	N	0.24115	0.695	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.996;0.998	T	0.01448	-1.1352	10	0.87932	D	0	.	20.181	0.98201	0.0:1.0:0.0:0.0	.	338;334;347	Q9UHF7-3;Q9UHF7;Q9UHF7-2	.;TRPS1_HUMAN;.	H	347;334;288;338;334	ENSP00000379065:R347H;ENSP00000220888:R334H;ENSP00000428910:R288H;ENSP00000428680:R338H;ENSP00000429174:R334H	ENSP00000220888:R334H	R	-	2	0	TRPS1	116686331	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.776000	0.85560	2.840000	0.97914	0.655000	0.94253	CGC	TRPS1	-	smart_Znf_C2H2-like	ENSG00000104447		0.418	TRPS1-002	KNOWN	basic	protein_coding	TRPS1	HGNC	protein_coding	OTTHUMT00000286436.3	-	0.00	52	0	C	NM_014112		116617156	-1	tier1	-	no_errors	ENST00000395715	ensembl	human	known	74_37	missense	7.58	61	5	SNP	1.000	T
TTC1	7265	genome.wustl.edu	37	5	159476628	159476628	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr5:159476628G>A	ENST00000231238.5	+	6	759	c.649G>A	c.(649-651)Gaa>Aaa	p.E217K	TTC1_ENST00000522793.1_Missense_Mutation_p.E217K|TTC1_ENST00000520274.1_3'UTR	NM_001282500.1|NM_003314.1	NP_001269429.1|NP_003305.1	Q99614	TTC1_HUMAN	tetratricopeptide repeat domain 1	217					protein folding (GO:0006457)	peroxisomal membrane (GO:0005778)	unfolded protein binding (GO:0051082)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(1)|prostate(1)|skin(1)	12	Renal(175;0.00196)	all_hematologic(541;0.00014)|Breast(839;0.0101)|all_neural(177;0.0281)|Medulloblastoma(196;0.0425)|Lung NSC(249;0.119)|all_lung(500;0.163)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	Epithelial(171;8.37e-05)|all cancers(165;0.000694)|OV - Ovarian serous cystadenocarcinoma(192;0.0402)		ATCTATATTAGAAAAAGATCC	0.353																																																	0													51.0	54.0	53.0					5																	159476628		2203	4300	6503	SO:0001583	missense	0			U46570	CCDS4348.1	5q32-q33.2	2013-01-10			ENSG00000113312	ENSG00000113312		"""Tetratricopeptide (TTC) repeat domain containing"""	12391	protein-coding gene	gene with protein product		601963				8836031	Standard	NM_003314		Approved	TPR1	uc003lxu.3	Q99614	OTTHUMG00000130326	ENST00000231238.5:c.649G>A	5.37:g.159476628G>A	ENSP00000231238:p.Glu217Lys		B2RCT2|D3DQJ8|Q9BVT3	Missense_Mutation	SNP	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E217K	ENST00000231238.5	37	c.649	CCDS4348.1	5	.	.	.	.	.	.	.	.	.	.	G	20.5	4.007708	0.75046	.	.	ENSG00000113312	ENST00000231238;ENST00000522793;ENST00000518560	T;T;T	0.67171	-0.25;-0.25;0.23	5.6	5.6	0.85130	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.143375	0.64402	D	0.000009	T	0.68109	0.2965	N	0.25890	0.77	0.80722	D	1	P	0.51057	0.941	P	0.53313	0.723	T	0.69796	-0.5048	10	0.52906	T	0.07	-5.7864	19.2616	0.93970	0.0:0.0:1.0:0.0	.	217	Q99614	TTC1_HUMAN	K	217;217;49	ENSP00000231238:E217K;ENSP00000429225:E217K;ENSP00000428613:E49K	ENSP00000231238:E217K	E	+	1	0	TTC1	159409206	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.527000	0.90594	2.647000	0.89833	0.650000	0.86243	GAA	TTC1	-	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000113312		0.353	TTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC1	HGNC	protein_coding	OTTHUMT00000252675.3	-	0.00	18	0	G	NM_003314		159476628	+1	tier1	-	no_errors	ENST00000231238	ensembl	human	known	74_37	missense	25.00	15	5	SNP	1.000	A
TTK	7272	genome.wustl.edu	37	6	80749976	80749976	+	Missense_Mutation	SNP	G	G	C			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr6:80749976G>C	ENST00000369798.2	+	20	2482	c.2371G>C	c.(2371-2373)Gtt>Ctt	p.V791L	TTK_ENST00000509894.1_Missense_Mutation_p.V790L|TTK_ENST00000230510.3_Missense_Mutation_p.V790L	NM_001166691.1|NM_003318.4	NP_001160163.1|NP_003309.2	P33981	TTK_HUMAN	TTK protein kinase	791	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				chromosome separation (GO:0051304)|mitotic spindle assembly checkpoint (GO:0007094)|mitotic spindle organization (GO:0007052)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|spindle organization (GO:0007051)	membrane (GO:0016020)|spindle (GO:0005819)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			endometrium(4)|kidney(2)|large_intestine(12)|lung(22)|ovary(7)|pancreas(1)|prostate(1)|stomach(3)|urinary_tract(1)	53		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)		BRCA - Breast invasive adenocarcinoma(397;0.0321)		TCATCCATATGTTCAAATTCA	0.308																																																	0													60.0	66.0	64.0					6																	80749976		2201	4294	6495	SO:0001583	missense	0				CCDS4993.1, CCDS55040.1	6q14.1	2014-04-07			ENSG00000112742	ENSG00000112742			12401	protein-coding gene	gene with protein product	"""cancer/testis antigen 96"", ""monopolar spindle 1 kinase"""	604092				1639825	Standard	NM_003318		Approved	MPS1, MPS1L1, CT96, MPH1	uc003pjc.3	P33981	OTTHUMG00000015088	ENST00000369798.2:c.2371G>C	6.37:g.80749976G>C	ENSP00000358813:p.Val791Leu		A8K8U5|B2RDW2|E1P543|Q15272|Q5TCS0|Q9BW51|Q9NTM0	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.V791L	ENST00000369798.2	37	c.2371	CCDS4993.1	6	.	.	.	.	.	.	.	.	.	.	G	6.255	0.415097	0.11870	.	.	ENSG00000112742	ENST00000509894;ENST00000230510;ENST00000369798	T;T;T	0.67345	-0.26;-0.26;-0.26	5.32	4.45	0.53987	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.138494	0.49916	D	0.000126	T	0.30854	0.0778	N	0.11313	0.125	0.41765	D	0.98973	B;B	0.30526	0.283;0.063	B;B	0.40009	0.316;0.069	T	0.22730	-1.0208	10	0.08381	T	0.77	.	11.4818	0.50331	0.0838:0.0:0.9162:0.0	.	791;790	P33981;A8K8U5	TTK_HUMAN;.	L	790;790;791	ENSP00000422936:V790L;ENSP00000230510:V790L;ENSP00000358813:V791L	ENSP00000230510:V790L	V	+	1	0	TTK	80806695	1.000000	0.71417	0.974000	0.42286	0.471000	0.32888	4.988000	0.63863	1.241000	0.43820	0.591000	0.81541	GTT	TTK	-	pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000112742		0.308	TTK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTK	HGNC	protein_coding	OTTHUMT00000041316.2	-	0.00	136	0	G			80749976	+1	tier1	-	no_errors	ENST00000369798	ensembl	human	known	74_37	missense	9.76	74	8	SNP	1.000	C
TTK	7272	genome.wustl.edu	37	6	80749976	80749976	+	Missense_Mutation	SNP	G	G	C			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr6:80749976G>C	ENST00000369798.2	+	20	2482	c.2371G>C	c.(2371-2373)Gtt>Ctt	p.V791L	TTK_ENST00000509894.1_Missense_Mutation_p.V790L|TTK_ENST00000230510.3_Missense_Mutation_p.V790L	NM_001166691.1|NM_003318.4	NP_001160163.1|NP_003309.2	P33981	TTK_HUMAN	TTK protein kinase	791	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				chromosome separation (GO:0051304)|mitotic spindle assembly checkpoint (GO:0007094)|mitotic spindle organization (GO:0007052)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|spindle organization (GO:0007051)	membrane (GO:0016020)|spindle (GO:0005819)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			endometrium(4)|kidney(2)|large_intestine(12)|lung(22)|ovary(7)|pancreas(1)|prostate(1)|stomach(3)|urinary_tract(1)	53		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)		BRCA - Breast invasive adenocarcinoma(397;0.0321)		TCATCCATATGTTCAAATTCA	0.308																																																	0													60.0	66.0	64.0					6																	80749976		2201	4294	6495	SO:0001583	missense	0				CCDS4993.1, CCDS55040.1	6q14.1	2014-04-07			ENSG00000112742	ENSG00000112742			12401	protein-coding gene	gene with protein product	"""cancer/testis antigen 96"", ""monopolar spindle 1 kinase"""	604092				1639825	Standard	NM_003318		Approved	MPS1, MPS1L1, CT96, MPH1	uc003pjc.3	P33981	OTTHUMG00000015088	ENST00000369798.2:c.2371G>C	6.37:g.80749976G>C	ENSP00000358813:p.Val791Leu		A8K8U5|B2RDW2|E1P543|Q15272|Q5TCS0|Q9BW51|Q9NTM0	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.V791L	ENST00000369798.2	37	c.2371	CCDS4993.1	6	.	.	.	.	.	.	.	.	.	.	G	6.255	0.415097	0.11870	.	.	ENSG00000112742	ENST00000509894;ENST00000230510;ENST00000369798	T;T;T	0.67345	-0.26;-0.26;-0.26	5.32	4.45	0.53987	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.138494	0.49916	D	0.000126	T	0.30854	0.0778	N	0.11313	0.125	0.41765	D	0.98973	B;B	0.30526	0.283;0.063	B;B	0.40009	0.316;0.069	T	0.22730	-1.0208	10	0.08381	T	0.77	.	11.4818	0.50331	0.0838:0.0:0.9162:0.0	.	791;790	P33981;A8K8U5	TTK_HUMAN;.	L	790;790;791	ENSP00000422936:V790L;ENSP00000230510:V790L;ENSP00000358813:V791L	ENSP00000230510:V790L	V	+	1	0	TTK	80806695	1.000000	0.71417	0.974000	0.42286	0.471000	0.32888	4.988000	0.63863	1.241000	0.43820	0.591000	0.81541	GTT	TTK	-	pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000112742		0.308	TTK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTK	HGNC	protein_coding	OTTHUMT00000041316.2	-	0.00	86	0	G			80749976	+1	tier1	-	no_errors	ENST00000369798	ensembl	human	known	74_37	missense	9.76	74	8	SNP	1.000	C
TTN	7273	genome.wustl.edu	37	2	179469633	179469633	+	Intron	SNP	G	G	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr2:179469633G>T	ENST00000591111.1	-	231	49492				TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000589042.1_Intron|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342992.6_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000359218.5_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGTCTGGAAAGGAATCAACAG	0.418																																																	0													123.0	114.0	117.0					2																	179469633		1899	4125	6024	SO:0001627	intron_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.49268-8C>A	2.37:g.179469633G>T			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	RNA	SNP	-	NULL	ENST00000591111.1	37	NULL		2																																																																																			TTN-AS1	-	-	ENSG00000237298		0.418	TTN-019	PUTATIVE	basic	protein_coding	TTN-AS1	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	51	0	G	NM_133378		179469633	+1	tier1	-	no_errors	ENST00000419746	ensembl	human	known	74_37	rna	5.19	73	4	SNP	0.946	T
UFD1L	7353	genome.wustl.edu	37	22	19466599	19466599	+	Intron	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr22:19466599C>T	ENST00000263202.10	-	1	133				CDC45_ENST00000407835.1_5'Flank|UFD1L_ENST00000399523.1_Intron|CDC45_ENST00000404724.3_5'Flank|UFD1L_ENST00000360834.4_Intron|UFD1L_ENST00000484101.1_5'UTR|CDC45_ENST00000263201.1_5'Flank|CDC45_ENST00000437685.2_5'Flank	NM_001035247.2|NM_005659.6	NP_001030324.2|NP_005650.2	Q92890	UFD1_HUMAN	ubiquitin fusion degradation 1 like (yeast)						proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|skeletal system development (GO:0001501)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			large_intestine(3)|upper_aerodigestive_tract(1)	4	Colorectal(54;0.0993)					TGCCCGTCAGCGCTTACCATG	0.746																																																	0													10.0	11.0	11.0					22																	19466599		2105	4147	6252	SO:0001627	intron_variant	0			AJ239058	CCDS13761.1, CCDS33600.1, CCDS33600.2	22q11.2	2014-05-02	2005-10-10		ENSG00000070010	ENSG00000070010			12520	protein-coding gene	gene with protein product		601754	"""ubiquitin fusion degradation 1-like"""			9063746	Standard	NM_005659		Approved	UFD1	uc002zpm.2	Q92890	OTTHUMG00000150130	ENST00000263202.10:c.3+6G>A	22.37:g.19466599C>T			A8MW31|Q9Y5N0	RNA	SNP	-	NULL	ENST00000263202.10	37	NULL	CCDS13761.1	22																																																																																			UFD1L	-	-	ENSG00000070010		0.746	UFD1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UFD1L	HGNC	protein_coding	OTTHUMT00000316460.6	-	0.00	14	0	C			19466599	-1	tier1	-	no_errors	ENST00000484101	ensembl	human	putative	74_37	rna	18.18	18	4	SNP	0.002	T
UFD1L	7353	genome.wustl.edu	37	22	19466599	19466599	+	Intron	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr22:19466599C>T	ENST00000263202.10	-	1	133				CDC45_ENST00000407835.1_5'Flank|UFD1L_ENST00000399523.1_Intron|CDC45_ENST00000404724.3_5'Flank|UFD1L_ENST00000360834.4_Intron|UFD1L_ENST00000484101.1_5'UTR|CDC45_ENST00000263201.1_5'Flank|CDC45_ENST00000437685.2_5'Flank	NM_001035247.2|NM_005659.6	NP_001030324.2|NP_005650.2	Q92890	UFD1_HUMAN	ubiquitin fusion degradation 1 like (yeast)						proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|skeletal system development (GO:0001501)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			large_intestine(3)|upper_aerodigestive_tract(1)	4	Colorectal(54;0.0993)					TGCCCGTCAGCGCTTACCATG	0.746																																																	0													10.0	11.0	11.0					22																	19466599		2105	4147	6252	SO:0001627	intron_variant	0			AJ239058	CCDS13761.1, CCDS33600.1, CCDS33600.2	22q11.2	2014-05-02	2005-10-10		ENSG00000070010	ENSG00000070010			12520	protein-coding gene	gene with protein product		601754	"""ubiquitin fusion degradation 1-like"""			9063746	Standard	NM_005659		Approved	UFD1	uc002zpm.2	Q92890	OTTHUMG00000150130	ENST00000263202.10:c.3+6G>A	22.37:g.19466599C>T			A8MW31|Q9Y5N0	RNA	SNP	-	NULL	ENST00000263202.10	37	NULL	CCDS13761.1	22																																																																																			UFD1L	-	-	ENSG00000070010		0.746	UFD1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UFD1L	HGNC	protein_coding	OTTHUMT00000316460.6	-	0.00	29	0	C			19466599	-1	tier1	-	no_errors	ENST00000484101	ensembl	human	putative	74_37	rna	18.18	18	4	SNP	0.002	T
UNC13C	440279	genome.wustl.edu	37	15	54527275	54527276	+	Frame_Shift_Ins	INS	-	-	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr15:54527275_54527276insA	ENST00000260323.11	+	4	3119_3120	c.3119_3120insA	c.(3118-3123)agaaaafs	p.RK1040fs	UNC13C_ENST00000545554.1_Frame_Shift_Ins_p.RK1040fs|UNC13C_ENST00000537900.1_Frame_Shift_Ins_p.RK1040fs	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1040					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		GATCTTCGCAGAAAAAAAACTT	0.366																																																	0																																										SO:0001589	frameshift_variant	0			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.3127dupA	15.37:g.54527283_54527283dupA	ENSP00000260323:p.Arg1040fs		Q0P613|Q8ND48|Q96NP3	Frame_Shift_Ins	INS	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_dom,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.T1043fs	ENST00000260323.11	37	c.3119_3120	CCDS45264.1	15																																																																																			UNC13C	-	NULL	ENSG00000137766		0.366	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	HGNC	protein_coding	OTTHUMT00000419028.3		0.00	51	0	-	NM_173166		54527276	+1	tier1		no_errors	ENST00000260323	ensembl	human	known	74_37	frame_shift_ins	30.77	27	12	INS	1.000:1.000	A
UNC13C	440279	genome.wustl.edu	37	15	54527275	54527276	+	Frame_Shift_Ins	INS	-	-	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr15:54527275_54527276insA	ENST00000260323.11	+	4	3119_3120	c.3119_3120insA	c.(3118-3123)agaaaafs	p.RK1040fs	UNC13C_ENST00000545554.1_Frame_Shift_Ins_p.RK1040fs|UNC13C_ENST00000537900.1_Frame_Shift_Ins_p.RK1040fs	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1040					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		GATCTTCGCAGAAAAAAAACTT	0.366																																																	0																																										SO:0001589	frameshift_variant	0			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.3127dupA	15.37:g.54527283_54527283dupA	ENSP00000260323:p.Arg1040fs		Q0P613|Q8ND48|Q96NP3	Frame_Shift_Ins	INS	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_dom,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.T1043fs	ENST00000260323.11	37	c.3119_3120	CCDS45264.1	15																																																																																			UNC13C	-	NULL	ENSG00000137766		0.366	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	HGNC	protein_coding	OTTHUMT00000419028.3		0.00	84	0	-	NM_173166		54527276	+1	tier1		no_errors	ENST00000260323	ensembl	human	known	74_37	frame_shift_ins	30.77	27	12	INS	1.000:1.000	A
UNC5D	137970	genome.wustl.edu	37	8	35608185	35608185	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr8:35608185G>T	ENST00000404895.2	+	13	2349	c.2021G>T	c.(2020-2022)gGg>gTg	p.G674V	UNC5D_ENST00000416672.1_Missense_Mutation_p.G679V|UNC5D_ENST00000453357.2_Missense_Mutation_p.G669V|UNC5D_ENST00000449677.1_Missense_Mutation_p.G250V|UNC5D_ENST00000420357.1_Missense_Mutation_p.G607V|UNC5D_ENST00000287272.2_Missense_Mutation_p.G605V	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	674					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		GACAGCTTTGGGACCTATGCG	0.507																																																	0													251.0	210.0	224.0					8																	35608185		2203	4300	6503	SO:0001583	missense	0			AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.2021G>T	8.37:g.35608185G>T	ENSP00000385143:p.Gly674Val		Q8WYP7	Missense_Mutation	SNP	pfam_ZU5,pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,pfam_Death_domain,pfam_Immunoglobulin,superfamily_DEATH-like_dom,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death_domain,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like_dom	p.G674V	ENST00000404895.2	37	c.2021	CCDS6093.2	8	.	.	.	.	.	.	.	.	.	.	G	25.7	4.660756	0.88154	.	.	ENSG00000156687	ENST00000404895;ENST00000420357;ENST00000287272;ENST00000416672;ENST00000453357;ENST00000449677	T;T;T;T;T;T	0.57595	0.42;0.84;0.83;0.42;0.39;2.3	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.76357	0.3976	M	0.81497	2.545	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	T	0.77859	-0.2431	10	0.87932	D	0	-24.6112	20.2822	0.98520	0.0:0.0:1.0:0.0	.	250;669;674	E9PDS8;Q6UXZ4-2;Q6UXZ4	.;.;UNC5D_HUMAN	V	674;607;605;679;669;250	ENSP00000385143:G674V;ENSP00000392739:G607V;ENSP00000287272:G605V;ENSP00000412652:G679V;ENSP00000394303:G669V;ENSP00000397211:G250V	ENSP00000287272:G605V	G	+	2	0	UNC5D	35727727	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	9.476000	0.97823	2.806000	0.96561	0.655000	0.94253	GGG	UNC5D	-	NULL	ENSG00000156687		0.507	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC5D	HGNC	protein_coding	OTTHUMT00000347586.2	-	0.00	51	0	G			35608185	+1	tier1	-	no_errors	ENST00000404895	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	T
UOX	391051	genome.wustl.edu	37	1	84835598	84835598	+	RNA	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:84835598G>A	ENST00000483236.1	-	0	538									urate oxidase, pseudogene																		GCAGGAACTCGGCTCAGGGAG	0.488																																																	0																																												0			AB074093		1p31.1	2011-09-02	2010-03-12		ENSG00000240520	ENSG00000240520			12575	pseudogene	pseudogene		191540	"""urate oxidase"""			1395718, 1556746	Standard	NR_003927		Approved	UOXP	uc009wcg.3		OTTHUMG00000009861		1.37:g.84835598G>A				RNA	SNP	-	NULL	ENST00000483236.1	37	NULL		1																																																																																			UOX	-	-	ENSG00000240520		0.488	UOX-002	KNOWN	basic	processed_transcript	UOX	HGNC	pseudogene	OTTHUMT00000331132.1	-	0.00	23	0	G	NR_003927		84835598	-1	tier1	-	no_errors	ENST00000483236	ensembl	human	known	74_37	rna	53.12	15	17	SNP	0.448	A
USP11	8237	genome.wustl.edu	37	X	47104174	47104174	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chrX:47104174G>T	ENST00000218348.3	+	15	2066	c.2066G>T	c.(2065-2067)gGa>gTa	p.G689V	USP11_ENST00000377107.2_Missense_Mutation_p.G646V	NM_004651.3	NP_004642.2	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11	689	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|ovary(3)|pancreas(1)|stomach(1)	40						CCCAGCTCTGGAGTCACGAAC	0.622																																																	0													31.0	24.0	26.0					X																	47104174		2203	4300	6503	SO:0001583	missense	0			U44839	CCDS14277.1	Xp11.23	2008-02-05	2005-08-08		ENSG00000102226	ENSG00000102226		"""Ubiquitin-specific peptidases"""	12609	protein-coding gene	gene with protein product		300050	"""ubiquitin specific protease 11"""			12838346	Standard	XM_005272674		Approved	UHX1	uc004dhp.3	P51784	OTTHUMG00000021437	ENST00000218348.3:c.2066G>T	X.37:g.47104174G>T	ENSP00000218348:p.Gly689Val		B2RTX1|Q8IUG6|Q9BWE1	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfam_Pept_C19_DUSP,smart_Pept_C19_DUSP,pfscan_Peptidase_C19/C67	p.G689V	ENST00000218348.3	37	c.2066	CCDS14277.1	X	.	.	.	.	.	.	.	.	.	.	G	10.38	1.335055	0.24253	.	.	ENSG00000102226	ENST00000377107;ENST00000218348	T;T	0.20738	2.07;2.05	4.9	1.78	0.24846	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.965677	0.08550	N	0.929213	T	0.14527	0.0351	N	0.16368	0.405	0.24621	N	0.993675	P;P	0.43542	0.81;0.669	P;B	0.44860	0.462;0.435	T	0.20773	-1.0265	10	0.27082	T	0.32	-6.024	5.986	0.19434	0.1101:0.3646:0.5253:0.0	.	415;689	B3KP28;P51784	.;UBP11_HUMAN	V	646;689	ENSP00000366311:G646V;ENSP00000218348:G689V	ENSP00000218348:G689V	G	+	2	0	USP11	46989118	0.993000	0.37304	0.435000	0.26784	0.826000	0.46750	0.987000	0.29603	0.826000	0.34661	0.422000	0.28245	GGA	USP11	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000102226		0.622	USP11-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP11	HGNC	protein_coding		-	0.00	21	0	G	NM_004651		47104174	+1	tier1	-	no_errors	ENST00000218348	ensembl	human	known	74_37	missense	79.55	9	35	SNP	0.002	T
USP30	84749	genome.wustl.edu	37	12	109523554	109523554	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr12:109523554C>T	ENST00000257548.5	+	13	1465	c.1372C>T	c.(1372-1374)Cgg>Tgg	p.R458W	USP30_ENST00000392784.2_Missense_Mutation_p.R427W	NM_032663.3	NP_116052.2	Q70CQ3	UBP30_HUMAN	ubiquitin specific peptidase 30	458	USP.				mitochondrial fusion (GO:0008053)|mitochondrion degradation (GO:0000422)|protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(7)|kidney(1)|large_intestine(1)|liver(2)|lung(11)|prostate(1)|skin(3)|stomach(2)	28						CACTTACCGACGGTCCCCACC	0.562																																																	0													160.0	130.0	140.0					12																	109523554		2203	4300	6503	SO:0001583	missense	0			BC022094	CCDS9123.2	12q23.3	2006-01-20	2005-08-08		ENSG00000135093	ENSG00000135093		"""Ubiquitin-specific peptidases"""	20065	protein-coding gene	gene with protein product		612492	"""ubiquitin specific protease 30"""			12838346	Standard	XM_005253962		Approved	MGC10702, FLJ40511	uc010sxi.2	Q70CQ3	OTTHUMG00000133613	ENST00000257548.5:c.1372C>T	12.37:g.109523554C>T	ENSP00000257548:p.Arg458Trp		Q8WTU7|Q96JX4|Q9BSS3	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.R458W	ENST00000257548.5	37	c.1372	CCDS9123.2	12	.	.	.	.	.	.	.	.	.	.	C	34	5.354564	0.95854	.	.	ENSG00000135093	ENST00000392784;ENST00000257548	T;T	0.77098	-1.07;-1.07	5.65	5.65	0.86999	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	D	0.89715	0.6795	M	0.86268	2.805	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.90809	0.4700	10	0.87932	D	0	-38.7726	18.7287	0.91726	0.0:1.0:0.0:0.0	.	458;427	Q70CQ3;B3KUS5	UBP30_HUMAN;.	W	427;458	ENSP00000376535:R427W;ENSP00000257548:R458W	ENSP00000257548:R458W	R	+	1	2	USP30	108007937	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.395000	0.79876	2.655000	0.90218	0.655000	0.94253	CGG	USP30	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000135093		0.562	USP30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP30	HGNC	protein_coding	OTTHUMT00000257733.2	-	0.00	39	0	C	NM_032663		109523554	+1	tier1	-	no_errors	ENST00000257548	ensembl	human	known	74_37	missense	14.00	43	7	SNP	1.000	T
USP45	85015	genome.wustl.edu	37	6	99936085	99936085	+	Silent	SNP	G	G	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr6:99936085G>A	ENST00000327681.6	-	7	1237	c.705C>T	c.(703-705)gaC>gaT	p.D235D	USP45_ENST00000329966.6_Silent_p.D235D|USP45_ENST00000369233.2_Silent_p.D235D|USP45_ENST00000500704.2_Silent_p.D235D|USP45_ENST00000392738.2_Missense_Mutation_p.T17I|USP45_ENST00000472914.2_Silent_p.D235D	NM_001080481.1	NP_001073950.1	Q70EL2	UBP45_HUMAN	ubiquitin specific peptidase 45	235	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(6)|lung(2)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	22		all_cancers(76;0.000208)|Acute lymphoblastic leukemia(125;8.41e-11)|all_hematologic(75;2.56e-07)|all_epithelial(107;0.122)|Colorectal(196;0.133)		BRCA - Breast invasive adenocarcinoma(108;0.0718)		CCAGCTGAGAGTCTGAGGAAG	0.358																																																	0													70.0	65.0	67.0					6																	99936085		2203	4300	6503	SO:0001819	synonymous_variant	0			AL832030	CCDS34501.1	6q16.2	2008-02-05	2005-08-08		ENSG00000123552	ENSG00000123552		"""Ubiquitin-specific peptidases"""	20080	protein-coding gene	gene with protein product			"""ubiquitin specific protease 45"""			12838346	Standard	NM_001080481		Approved	MGC14793	uc003ppx.2	Q70EL2	OTTHUMG00000015267	ENST00000327681.6:c.705C>T	6.37:g.99936085G>A			B2RXG0|Q5T062|Q86T44|Q86TC0|Q9BRU1	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.T17I	ENST00000327681.6	37	c.50	CCDS34501.1	6	.	.	.	.	.	.	.	.	.	.	G	11.39	1.624559	0.28889	.	.	ENSG00000123552	ENST00000392738	T	0.26518	1.73	4.85	2.68	0.31781	.	.	.	.	.	T	0.06600	0.0169	.	.	.	0.80722	D	1	B	0.13145	0.007	B	0.08055	0.003	T	0.12426	-1.0548	8	0.39692	T	0.17	.	4.2843	0.10848	0.388:0.0:0.4628:0.1492	.	17	Q70EL2-3	.	I	17	ENSP00000376495:T17I	ENSP00000376495:T17I	T	-	2	0	USP45	100042806	0.012000	0.17670	0.997000	0.53966	0.981000	0.71138	-0.701000	0.05075	0.369000	0.24510	0.591000	0.81541	ACT	USP45	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000123552		0.358	USP45-003	KNOWN	basic|appris_principal|CCDS	protein_coding	USP45	HGNC	protein_coding	OTTHUMT00000041609.2	-	0.00	68	0	G	NM_032929		99936085	-1	tier1	-	no_errors	ENST00000392738	ensembl	human	known	74_37	missense	51.67	29	31	SNP	0.979	A
VWF	7450	genome.wustl.edu	37	12	6103618	6103618	+	Missense_Mutation	SNP	G	G	T	rs147982896		TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr12:6103618G>T	ENST00000261405.5	-	36	6473	c.6219C>A	c.(6217-6219)agC>agA	p.S2073R		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	2073	VWFD 4. {ECO:0000255|PROSITE- ProRule:PRU00580}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	AAGTCTTGGGGCTGAGCTGCA	0.428																																																	0													324.0	267.0	286.0					12																	6103618		2203	4300	6503	SO:0001583	missense	0				CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.6219C>A	12.37:g.6103618G>T	ENSP00000261405:p.Ser2073Arg		Q8TCE8|Q99806	Missense_Mutation	SNP	pirsf_VWF,pfam_VWF_type-D,pfam_VWF_A,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_VWF_A,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_A,pfscan_VWF_C	p.S2073R	ENST00000261405.5	37	c.6219	CCDS8539.1	12	.	.	.	.	.	.	.	.	.	.	G	13.19	2.162879	0.38217	.	.	ENSG00000110799	ENST00000261405	T	0.60424	0.19	4.91	3.04	0.35103	von Willebrand factor, type D domain (3);	0.000000	0.52532	D	0.000062	T	0.44095	0.1277	L	0.47078	1.49	0.80722	D	1	B	0.21688	0.059	B	0.21917	0.037	T	0.29336	-1.0015	10	0.29301	T	0.29	.	4.8285	0.13428	0.2365:0.1743:0.5892:0.0	.	2073	P04275	VWF_HUMAN	R	2073	ENSP00000261405:S2073R	ENSP00000261405:S2073R	S	-	3	2	VWF	5973879	0.998000	0.40836	1.000000	0.80357	0.974000	0.67602	0.655000	0.24933	1.062000	0.40625	0.655000	0.94253	AGC	VWF	-	pirsf_VWF,pfam_VWF_type-D,smart_VWF_type-D	ENSG00000110799		0.428	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VWF	HGNC	protein_coding	OTTHUMT00000399020.1	-	0.00	54	0	G	NM_000552		6103618	-1	tier1	-	no_errors	ENST00000261405	ensembl	human	known	74_37	missense	13.85	56	9	SNP	1.000	T
WASF1	8936	genome.wustl.edu	37	6	110429777	110429777	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr6:110429777C>T	ENST00000392589.1	-	6	1212	c.376G>A	c.(376-378)Gat>Aat	p.D126N	WASF1_ENST00000392588.1_Missense_Mutation_p.D126N|WASF1_ENST00000392586.1_Missense_Mutation_p.D126N|WASF1_ENST00000392587.2_Missense_Mutation_p.D126N|WASF1_ENST00000359451.2_Missense_Mutation_p.D126N	NM_003931.2	NP_003922.1	Q92558	WASF1_HUMAN	WAS protein family, member 1	126					actin filament polymerization (GO:0030041)|cellular component movement (GO:0006928)|lamellipodium morphogenesis (GO:0072673)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|protein complex assembly (GO:0006461)|Rac protein signal transduction (GO:0016601)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|lamellipodium (GO:0030027)|mitochondrial outer membrane (GO:0005741)|SCAR complex (GO:0031209)|synapse (GO:0045202)	protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(87;1.18e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		OV - Ovarian serous cystadenocarcinoma(136;0.0364)|Epithelial(106;0.051)|all cancers(137;0.0687)		TCACAAACATCGTACGTCTCC	0.393																																																	0													115.0	107.0	110.0					6																	110429777		2203	4300	6503	SO:0001583	missense	0			D87459	CCDS5080.1	6q21	2010-08-20			ENSG00000112290	ENSG00000112290		"""A-kinase anchor proteins"""	12732	protein-coding gene	gene with protein product		605035				9843499, 9889097	Standard	XM_005267204		Approved	WAVE1, SCAR1, KIAA0269, WAVE	uc003pty.1	Q92558	OTTHUMG00000015357	ENST00000392589.1:c.376G>A	6.37:g.110429777C>T	ENSP00000376368:p.Asp126Asn		E1P5F2|Q5SZK7	Missense_Mutation	SNP	pfam_WH2_dom,smart_WH2_dom,pfscan_WH2_dom	p.D126N	ENST00000392589.1	37	c.376	CCDS5080.1	6	.	.	.	.	.	.	.	.	.	.	C	9.801	1.180515	0.21787	.	.	ENSG00000112290	ENST00000392586;ENST00000392587;ENST00000392589;ENST00000392588;ENST00000359451;ENST00000444391;ENST00000265601;ENST00000368938	T;T;T;T;T;T;T;T	0.39406	1.08;1.08;1.08;1.08;1.08;1.08;1.08;1.08	6.06	5.03	0.67393	.	0.252874	0.46442	D	0.000298	T	0.07052	0.0179	N	0.00771	-1.2	0.39326	D	0.965334	B	0.06786	0.001	B	0.01281	0.0	T	0.22556	-1.0213	10	0.13853	T	0.58	.	16.2639	0.82565	0.0:0.9269:0.0:0.0731	.	126	Q92558	WASF1_HUMAN	N	126	ENSP00000376365:D126N;ENSP00000376366:D126N;ENSP00000376368:D126N;ENSP00000376367:D126N;ENSP00000352425:D126N;ENSP00000407041:D126N;ENSP00000265601:D126N;ENSP00000357934:D126N	ENSP00000265601:D126N	D	-	1	0	WASF1	110536470	0.992000	0.36948	0.987000	0.45799	0.976000	0.68499	2.428000	0.44749	2.880000	0.98712	0.650000	0.86243	GAT	WASF1	-	NULL	ENSG00000112290		0.393	WASF1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	WASF1	HGNC	protein_coding	OTTHUMT00000041784.3	-	0.00	70	0	C	NM_003931		110429777	-1	tier1	-	no_errors	ENST00000359451	ensembl	human	known	74_37	missense	22.08	60	17	SNP	0.977	T
XIRP2	129446	genome.wustl.edu	37	2	168099201	168099201	+	Silent	SNP	C	C	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr2:168099201C>A	ENST00000409195.1	+	9	1388	c.1299C>A	c.(1297-1299)gtC>gtA	p.V433V	XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409273.1_Silent_p.V211V|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000295237.9_Silent_p.V433V|XIRP2_ENST00000409728.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	258					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						ATCACAGTGTCACTTCCTCAA	0.433																																																	0													102.0	93.0	96.0					2																	168099201		1960	4154	6114	SO:0001819	synonymous_variant	0			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.1299C>A	2.37:g.168099201C>A			A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Silent	SNP	pfam_Actin-binding_Xin_repeat	p.V433	ENST00000409195.1	37	c.1299	CCDS42769.1	2																																																																																			XIRP2	-	NULL	ENSG00000163092		0.433	XIRP2-001	KNOWN	basic|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333547.1	-	0.00	52	0	C	NM_152381		168099201	+1	tier1	-	no_errors	ENST00000295237	ensembl	human	known	74_37	silent	13.33	52	8	SNP	0.020	A
YIPF6	286451	genome.wustl.edu	37	X	67751767	67751767	+	Missense_Mutation	SNP	G	G	A	rs368588647		TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chrX:67751767G>A	ENST00000462683.1	+	7	1381	c.637G>A	c.(637-639)Gcc>Acc	p.A213T	YIPF6_ENST00000374622.2_Missense_Mutation_p.A170T	NM_173834.3	NP_776195.2	Q96EC8	YIPF6_HUMAN	Yip1 domain family, member 6	213					intestinal epithelial cell development (GO:0060576)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|urinary_tract(1)	7						AAACCGCAGAGCCCTAGCTGT	0.388																																																	0													162.0	114.0	130.0					X																	67751767		2193	4292	6485	SO:0001583	missense	0			BC012469	CCDS14389.1, CCDS56604.1	Xq13.1	2008-02-05			ENSG00000181704	ENSG00000181704		"""Yip1 domain family"""	28304	protein-coding gene	gene with protein product						12477932	Standard	NM_173834		Approved	MGC21416, FinGER6	uc004dwz.3	Q96EC8	OTTHUMG00000021745	ENST00000462683.1:c.637G>A	X.37:g.67751767G>A	ENSP00000417573:p.Ala213Thr		B4E1U7|G5E997|Q5JP08	Missense_Mutation	SNP	pfam_Yip1	p.A213T	ENST00000462683.1	37	c.637	CCDS14389.1	X	.	.	.	.	.	.	.	.	.	.	G	15.63	2.889311	0.52014	.	.	ENSG00000181704	ENST00000462683;ENST00000451537;ENST00000374622	T;T;T	0.61274	0.12;0.12;0.12	5.8	4.0	0.46444	Yip1 domain (1);	0.050135	0.85682	D	0.000000	T	0.68622	0.3021	M	0.76002	2.32	0.58432	D	0.999998	P;P	0.51057	0.941;0.774	P;P	0.54664	0.758;0.688	T	0.67643	-0.5618	10	0.39692	T	0.17	-16.0639	13.4385	0.61099	0.0:0.2921:0.7079:0.0	.	170;213	G5E997;Q96EC8	.;YIPF6_HUMAN	T	213;170;170	ENSP00000417573:A213T;ENSP00000401799:A170T;ENSP00000363751:A170T	ENSP00000363751:A170T	A	+	1	0	YIPF6	67668492	1.000000	0.71417	0.234000	0.24042	0.210000	0.24377	6.350000	0.73017	0.572000	0.29383	0.600000	0.82982	GCC	YIPF6	-	pfam_Yip1	ENSG00000181704		0.388	YIPF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YIPF6	HGNC	protein_coding	OTTHUMT00000057016.1		0.00	32	0	G	NM_173834		67751767	+1			no_errors	ENST00000462683	ensembl	human	known	74_37	missense	6.00	47	3	SNP	1.000	A
ZBTB37	84614	genome.wustl.edu	37	1	173840126	173840126	+	Missense_Mutation	SNP	G	G	C			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:173840126G>C	ENST00000367701.5	+	2	954	c.763G>C	c.(763-765)Ggg>Cgg	p.G255R	ZBTB37_ENST00000432989.1_Missense_Mutation_p.G255R|ZBTB37_ENST00000367702.1_Missense_Mutation_p.G255R|ZBTB37_ENST00000367704.1_Missense_Mutation_p.G255R|ZBTB37_ENST00000427304.1_Missense_Mutation_p.G255R			Q5TC79	ZBT37_HUMAN	zinc finger and BTB domain containing 37	255					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(4)	13						GGAGTGGCTTGGGCCTGAGAA	0.507																																																	0													76.0	79.0	78.0					1																	173840126		2203	4300	6503	SO:0001583	missense	0			AK057310	CCDS1312.1, CCDS44278.1	1q24.2	2013-01-08			ENSG00000185278	ENSG00000185278		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	28365	protein-coding gene	gene with protein product						12477932	Standard	NM_032522		Approved	MGC2629, ZNF908	uc009wwp.1	Q5TC79	OTTHUMG00000037274	ENST00000367701.5:c.763G>C	1.37:g.173840126G>C	ENSP00000356674:p.Gly255Arg		Q5TC80|Q96M87|Q9BQ88	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.G255R	ENST00000367701.5	37	c.763	CCDS44278.1	1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.290384	0.80914	.	.	ENSG00000185278	ENST00000367704;ENST00000427304;ENST00000432989;ENST00000367702;ENST00000367703;ENST00000367701	D;T;D;D;T	0.87809	-2.24;2.58;-2.3;-2.3;2.58	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	D	0.87317	0.6147	L	0.29908	0.895	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.952	T	0.82350	-0.0501	10	0.15952	T	0.53	.	20.5568	0.99304	0.0:0.0:1.0:0.0	.	255;255	Q5TC79;Q5TC79-2	ZBT37_HUMAN;.	R	255;255;255;255;163;255	ENSP00000356677:G255R;ENSP00000415293:G255R;ENSP00000409408:G255R;ENSP00000356675:G255R;ENSP00000356674:G255R	ENSP00000356674:G255R	G	+	1	0	ZBTB37	172106749	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	7.500000	0.81588	2.861000	0.98227	0.655000	0.94253	GGG	ZBTB37	-	NULL	ENSG00000185278		0.507	ZBTB37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB37	HGNC	protein_coding	OTTHUMT00000090729.2	-	0.00	36	0	G	NM_032522		173840126	+1	tier1	-	no_errors	ENST00000367701	ensembl	human	known	74_37	missense	37.78	28	17	SNP	1.000	C
ZBTB37	84614	genome.wustl.edu	37	1	173840126	173840126	+	Missense_Mutation	SNP	G	G	C			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr1:173840126G>C	ENST00000367701.5	+	2	954	c.763G>C	c.(763-765)Ggg>Cgg	p.G255R	ZBTB37_ENST00000432989.1_Missense_Mutation_p.G255R|ZBTB37_ENST00000367702.1_Missense_Mutation_p.G255R|ZBTB37_ENST00000367704.1_Missense_Mutation_p.G255R|ZBTB37_ENST00000427304.1_Missense_Mutation_p.G255R			Q5TC79	ZBT37_HUMAN	zinc finger and BTB domain containing 37	255					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(4)	13						GGAGTGGCTTGGGCCTGAGAA	0.507																																																	0													76.0	79.0	78.0					1																	173840126		2203	4300	6503	SO:0001583	missense	0			AK057310	CCDS1312.1, CCDS44278.1	1q24.2	2013-01-08			ENSG00000185278	ENSG00000185278		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	28365	protein-coding gene	gene with protein product						12477932	Standard	NM_032522		Approved	MGC2629, ZNF908	uc009wwp.1	Q5TC79	OTTHUMG00000037274	ENST00000367701.5:c.763G>C	1.37:g.173840126G>C	ENSP00000356674:p.Gly255Arg		Q5TC80|Q96M87|Q9BQ88	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.G255R	ENST00000367701.5	37	c.763	CCDS44278.1	1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.290384	0.80914	.	.	ENSG00000185278	ENST00000367704;ENST00000427304;ENST00000432989;ENST00000367702;ENST00000367703;ENST00000367701	D;T;D;D;T	0.87809	-2.24;2.58;-2.3;-2.3;2.58	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	D	0.87317	0.6147	L	0.29908	0.895	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.952	T	0.82350	-0.0501	10	0.15952	T	0.53	.	20.5568	0.99304	0.0:0.0:1.0:0.0	.	255;255	Q5TC79;Q5TC79-2	ZBT37_HUMAN;.	R	255;255;255;255;163;255	ENSP00000356677:G255R;ENSP00000415293:G255R;ENSP00000409408:G255R;ENSP00000356675:G255R;ENSP00000356674:G255R	ENSP00000356674:G255R	G	+	1	0	ZBTB37	172106749	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	7.500000	0.81588	2.861000	0.98227	0.655000	0.94253	GGG	ZBTB37	-	NULL	ENSG00000185278		0.507	ZBTB37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB37	HGNC	protein_coding	OTTHUMT00000090729.2	-	0.00	57	0	G	NM_032522		173840126	+1	tier1	-	no_errors	ENST00000367701	ensembl	human	known	74_37	missense	37.78	28	17	SNP	1.000	C
ZDBF2	57683	genome.wustl.edu	37	2	207171385	207171385	+	Silent	SNP	G	G	T	rs373918151		TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr2:207171385G>T	ENST00000374423.3	+	5	2519	c.2133G>T	c.(2131-2133)ccG>ccT	p.P711P		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	711							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						CTGATTCTCCGGCTTCTCTTT	0.403																																																	0													70.0	70.0	70.0					2																	207171385		1846	4104	5950	SO:0001819	synonymous_variant	0			AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.2133G>T	2.37:g.207171385G>T			Q6ZNP7|Q6ZSN8	Silent	SNP	pfam_Znf_DBF,smart_Znf_DBF	p.P711	ENST00000374423.3	37	c.2133	CCDS46501.1	2																																																																																			ZDBF2	-	NULL	ENSG00000204186		0.403	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDBF2	HGNC	protein_coding	OTTHUMT00000336458.1		0.00	26	0	G	NM_020923		207171385	+1			no_errors	ENST00000374423	ensembl	human	known	74_37	silent	10.00	27	3	SNP	0.000	T
ZKSCAN7	55888	genome.wustl.edu	37	3	44611892	44611892	+	Silent	SNP	C	C	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr3:44611892C>A	ENST00000273320.3	+	6	1719	c.1290C>A	c.(1288-1290)ctC>ctA	p.L430L	ZKSCAN7_ENST00000426540.1_Silent_p.L430L|RP11-944L7.5_ENST00000419137.1_Intron|ZKSCAN7_ENST00000341840.3_Intron|ZKSCAN7_ENST00000431636.1_Intron|RP11-944L7.4_ENST00000457331.1_RNA	NM_018651.2	NP_061121.2	Q9P0L1	ZKSC7_HUMAN	zinc finger with KRAB and SCAN domains 7	430					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										TTGTTCATCTCAGAACCCACA	0.488																																																	0													37.0	39.0	38.0					3																	44611892		2202	4299	6501	SO:0001819	synonymous_variant	0			L32164, AY280798	CCDS2714.1, CCDS2715.1, CCDS74924.1	3p21.32	2013-01-09	2013-01-09	2013-01-09	ENSG00000196345	ENSG00000196345		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12955	protein-coding gene	gene with protein product			"""zinc finger protein 64"", ""zinc finger protein 448"", ""zinc finger protein 167"""	ZNF64, ZNF448, ZNF167		7814019, 1505991	Standard	XM_005265323		Approved	FLJ12738, ZSCAN39	uc003cnj.3	Q9P0L1	OTTHUMG00000133094	ENST00000273320.3:c.1290C>A	3.37:g.44611892C>A			A0PJV3|A8K5H0|Q6WL09|Q96FQ2	Silent	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.L430	ENST00000273320.3	37	c.1290	CCDS2715.1	3																																																																																			ZKSCAN7	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196345		0.488	ZKSCAN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZKSCAN7	HGNC	protein_coding	OTTHUMT00000256752.4	-	0.00	73	0	C	NM_018651		44611892	+1	tier1	-	no_errors	ENST00000273320	ensembl	human	known	74_37	silent	5.43	87	5	SNP	0.923	A
ZKSCAN7	55888	genome.wustl.edu	37	3	44611892	44611892	+	Silent	SNP	C	C	A			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr3:44611892C>A	ENST00000273320.3	+	6	1719	c.1290C>A	c.(1288-1290)ctC>ctA	p.L430L	ZKSCAN7_ENST00000426540.1_Silent_p.L430L|RP11-944L7.5_ENST00000419137.1_Intron|ZKSCAN7_ENST00000341840.3_Intron|ZKSCAN7_ENST00000431636.1_Intron|RP11-944L7.4_ENST00000457331.1_RNA	NM_018651.2	NP_061121.2	Q9P0L1	ZKSC7_HUMAN	zinc finger with KRAB and SCAN domains 7	430					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										TTGTTCATCTCAGAACCCACA	0.488																																																	0													37.0	39.0	38.0					3																	44611892		2202	4299	6501	SO:0001819	synonymous_variant	0			L32164, AY280798	CCDS2714.1, CCDS2715.1, CCDS74924.1	3p21.32	2013-01-09	2013-01-09	2013-01-09	ENSG00000196345	ENSG00000196345		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12955	protein-coding gene	gene with protein product			"""zinc finger protein 64"", ""zinc finger protein 448"", ""zinc finger protein 167"""	ZNF64, ZNF448, ZNF167		7814019, 1505991	Standard	XM_005265323		Approved	FLJ12738, ZSCAN39	uc003cnj.3	Q9P0L1	OTTHUMG00000133094	ENST00000273320.3:c.1290C>A	3.37:g.44611892C>A			A0PJV3|A8K5H0|Q6WL09|Q96FQ2	Silent	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.L430	ENST00000273320.3	37	c.1290	CCDS2715.1	3																																																																																			ZKSCAN7	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196345		0.488	ZKSCAN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZKSCAN7	HGNC	protein_coding	OTTHUMT00000256752.4	-	0.00	88	0	C	NM_018651		44611892	+1	tier1	-	no_errors	ENST00000273320	ensembl	human	known	74_37	silent	5.43	87	5	SNP	0.923	A
ZNF226	7769	genome.wustl.edu	37	19	44681807	44681808	+	Frame_Shift_Ins	INS	-	-	A	rs201600907	byFrequency	TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr19:44681807_44681808insA	ENST00000590089.1	+	7	2759_2760	c.2392_2393insA	c.(2392-2394)gaafs	p.E798fs	ZNF226_ENST00000337433.5_Frame_Shift_Ins_p.E798fs|ZNF226_ENST00000588883.1_3'UTR|ZNF226_ENST00000454662.2_Frame_Shift_Ins_p.E798fs			Q9NYT6	ZN226_HUMAN	zinc finger protein 226	798					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K800fs*3(1)					Prostate(69;0.0352)|all_neural(266;0.202)				ATCCACACAGGAAAAAAAATCT	0.371													AAAAAAAA|AAAAAAAA|AAAAAAAAA|insertion	10	0.00199681	0.0061	0.0029	5008	,	,		18919	0.0		0.0	False		,,,				2504	0.0				Pancreas(115;581 1665 13228 19278 50070)												1	Deletion - Frameshift(1)	liver(1)							,	5,3545		0,5,1770					,	0.7	0.0			28	4,7830		0,4,3913	no	frameshift,frameshift	ZNF226	NM_001032373.1,NM_001032372.1	,	0,9,5683	A1A1,A1R,RR		0.0511,0.1408,0.0791	,	,		9,11375				SO:0001589	frameshift_variant	0			AF024707	CCDS46102.1, CCDS46103.1	19q13.31	2013-01-08	2012-09-11	2012-09-11	ENSG00000167380	ENSG00000167380		"""Zinc fingers, C2H2-type"", ""-"""	13019	protein-coding gene	gene with protein product							Standard	NM_001146220		Approved		uc002oyp.3	Q9NYT6		ENST00000590089.1:c.2400dupA	19.37:g.44681815_44681815dupA	ENSP00000465121:p.Glu798fs		Q8WWE6|Q96TE6|Q9NS44	Frame_Shift_Ins	INS	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S801fs	ENST00000590089.1	37	c.2392_2393	CCDS46102.1	19																																																																																			ZNF226	-	NULL	ENSG00000167380		0.371	ZNF226-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF226	HGNC	protein_coding	OTTHUMT00000460712.1		0.00	41	0	-			44681808	+1	tier1		no_errors	ENST00000337433	ensembl	human	known	74_37	frame_shift_ins	24.14	44	14	INS	0.385:0.382	A
ZNF226	7769	genome.wustl.edu	37	19	44681807	44681808	+	Frame_Shift_Ins	INS	-	-	A	rs201600907	byFrequency	TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr19:44681807_44681808insA	ENST00000590089.1	+	7	2759_2760	c.2392_2393insA	c.(2392-2394)gaafs	p.E798fs	ZNF226_ENST00000337433.5_Frame_Shift_Ins_p.E798fs|ZNF226_ENST00000588883.1_3'UTR|ZNF226_ENST00000454662.2_Frame_Shift_Ins_p.E798fs			Q9NYT6	ZN226_HUMAN	zinc finger protein 226	798					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K800fs*3(1)					Prostate(69;0.0352)|all_neural(266;0.202)				ATCCACACAGGAAAAAAAATCT	0.371													AAAAAAAA|AAAAAAAA|AAAAAAAAA|insertion	10	0.00199681	0.0061	0.0029	5008	,	,		18919	0.0		0.0	False		,,,				2504	0.0				Pancreas(115;581 1665 13228 19278 50070)												1	Deletion - Frameshift(1)	liver(1)							,	5,3545		0,5,1770					,	0.7	0.0			28	4,7830		0,4,3913	no	frameshift,frameshift	ZNF226	NM_001032373.1,NM_001032372.1	,	0,9,5683	A1A1,A1R,RR		0.0511,0.1408,0.0791	,	,		9,11375				SO:0001589	frameshift_variant	0			AF024707	CCDS46102.1, CCDS46103.1	19q13.31	2013-01-08	2012-09-11	2012-09-11	ENSG00000167380	ENSG00000167380		"""Zinc fingers, C2H2-type"", ""-"""	13019	protein-coding gene	gene with protein product							Standard	NM_001146220		Approved		uc002oyp.3	Q9NYT6		ENST00000590089.1:c.2400dupA	19.37:g.44681815_44681815dupA	ENSP00000465121:p.Glu798fs		Q8WWE6|Q96TE6|Q9NS44	Frame_Shift_Ins	INS	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S801fs	ENST00000590089.1	37	c.2392_2393	CCDS46102.1	19																																																																																			ZNF226	-	NULL	ENSG00000167380		0.371	ZNF226-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF226	HGNC	protein_coding	OTTHUMT00000460712.1		0.00	50	0	-			44681808	+1	tier1		no_errors	ENST00000337433	ensembl	human	known	74_37	frame_shift_ins	24.14	44	14	INS	0.385:0.382	A
ZNF333	84449	genome.wustl.edu	37	19	14829540	14829540	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr19:14829540C>G	ENST00000292530.6	+	12	1492	c.1401C>G	c.(1399-1401)agC>agG	p.S467R	ZNF333_ENST00000536363.1_Missense_Mutation_p.S358R|ZNF333_ENST00000540689.2_Intron	NM_032433.2	NP_115809.1	Q96JL9	ZN333_HUMAN	zinc finger protein 333	467					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|pancreas(1)|prostate(1)	21						CCCTCAGGAGCCACGTGAGAA	0.493																																					NSCLC(60;75 1281 16985 25154 29885)												0													63.0	66.0	65.0					19																	14829540		2203	4300	6503	SO:0001583	missense	0				CCDS12316.1, CCDS74298.1	19p13	2013-01-08				ENSG00000160961		"""Zinc fingers, C2H2-type"", ""-"""	15624	protein-coding gene	gene with protein product		611811				12151103	Standard	XM_005260098		Approved	KIAA1806	uc002mzn.3	Q96JL9		ENST00000292530.6:c.1401C>G	19.37:g.14829540C>G	ENSP00000292530:p.Ser467Arg		Q6P2E6|Q86WS6|Q8TDL0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,smart_Znf_BED_prd,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S467R	ENST00000292530.6	37	c.1401	CCDS12316.1	19	.	.	.	.	.	.	.	.	.	.	C	7.720	0.697073	0.15106	.	.	ENSG00000160961	ENST00000536363;ENST00000292530	T;T	0.11821	2.74;2.74	3.44	-2.02	0.07388	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05914	0.0154	N	0.01209	-0.955	0.09310	N	0.999999	D	0.60575	0.988	P	0.54759	0.76	T	0.22068	-1.0227	9	0.13470	T	0.59	.	4.6163	0.12428	0.0:0.2435:0.1813:0.5752	.	467	Q96JL9	ZN333_HUMAN	R	358;467	ENSP00000439749:S358R;ENSP00000292530:S467R	ENSP00000292530:S467R	S	+	3	2	ZNF333	14690540	0.000000	0.05858	0.118000	0.21660	0.957000	0.61999	-2.301000	0.01137	-0.074000	0.12820	0.655000	0.94253	AGC	ZNF333	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000160961		0.493	ZNF333-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF333	HGNC	protein_coding	OTTHUMT00000466496.1		0.00	27	0	C	NM_032433		14829540	+1			no_errors	ENST00000292530	ensembl	human	known	74_37	missense	7.50	37	3	SNP	0.002	G
ZNF423	23090	genome.wustl.edu	37	16	49669664	49669664	+	Missense_Mutation	SNP	T	T	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr16:49669664T>G	ENST00000561648.1	-	4	3452	c.3399A>C	c.(3397-3399)gaA>gaC	p.E1133D	ZNF423_ENST00000262383.2_Missense_Mutation_p.E1133D|ZNF423_ENST00000567169.1_Missense_Mutation_p.E1016D|ZNF423_ENST00000562520.1_Missense_Mutation_p.E1073D|ZNF423_ENST00000563137.2_Missense_Mutation_p.E1073D|ZNF423_ENST00000562871.1_Missense_Mutation_p.E1073D|ZNF423_ENST00000535559.1_Missense_Mutation_p.E1016D	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	1133					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				TCTCCAGGTCTTCGGCACTCT	0.692																																																	0													67.0	67.0	67.0					16																	49669664		2199	4300	6499	SO:0001583	missense	0			AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.3399A>C	16.37:g.49669664T>G	ENSP00000455426:p.Glu1133Asp		O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E1133D	ENST00000561648.1	37	c.3399	CCDS32445.1	16	.	.	.	.	.	.	.	.	.	.	T	12.80	2.047589	0.36085	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.09350	2.99;3.01	5.04	1.9	0.25705	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);	0.000000	0.85682	D	0.000000	T	0.07143	0.0181	L	0.27053	0.805	0.37918	D	0.931582	B	0.19445	0.036	B	0.29176	0.099	T	0.32402	-0.9908	9	.	.	.	-23.839	6.1898	0.20518	0.0:0.3946:0.0:0.6054	.	1133	Q2M1K9	ZN423_HUMAN	D	1133;1016	ENSP00000262383:E1133D;ENSP00000442321:E1016D	.	E	-	3	2	ZNF423	48227165	1.000000	0.71417	0.999000	0.59377	0.982000	0.71751	0.687000	0.25407	0.455000	0.26910	-0.366000	0.07423	GAA	ZNF423	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000102935		0.692	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF423	HGNC	protein_coding	OTTHUMT00000423258.1	-	0.00	30	0	T	NM_015069		49669664	-1	tier1	-	no_errors	ENST00000262383	ensembl	human	known	74_37	missense	28.57	15	6	SNP	1.000	G
ZNF423	23090	genome.wustl.edu	37	16	49669664	49669664	+	Missense_Mutation	SNP	T	T	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr16:49669664T>G	ENST00000561648.1	-	4	3452	c.3399A>C	c.(3397-3399)gaA>gaC	p.E1133D	ZNF423_ENST00000262383.2_Missense_Mutation_p.E1133D|ZNF423_ENST00000567169.1_Missense_Mutation_p.E1016D|ZNF423_ENST00000562520.1_Missense_Mutation_p.E1073D|ZNF423_ENST00000563137.2_Missense_Mutation_p.E1073D|ZNF423_ENST00000562871.1_Missense_Mutation_p.E1073D|ZNF423_ENST00000535559.1_Missense_Mutation_p.E1016D	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	1133					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				TCTCCAGGTCTTCGGCACTCT	0.692																																																	0													67.0	67.0	67.0					16																	49669664		2199	4300	6499	SO:0001583	missense	0			AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.3399A>C	16.37:g.49669664T>G	ENSP00000455426:p.Glu1133Asp		O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E1133D	ENST00000561648.1	37	c.3399	CCDS32445.1	16	.	.	.	.	.	.	.	.	.	.	T	12.80	2.047589	0.36085	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.09350	2.99;3.01	5.04	1.9	0.25705	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);	0.000000	0.85682	D	0.000000	T	0.07143	0.0181	L	0.27053	0.805	0.37918	D	0.931582	B	0.19445	0.036	B	0.29176	0.099	T	0.32402	-0.9908	9	.	.	.	-23.839	6.1898	0.20518	0.0:0.3946:0.0:0.6054	.	1133	Q2M1K9	ZN423_HUMAN	D	1133;1016	ENSP00000262383:E1133D;ENSP00000442321:E1016D	.	E	-	3	2	ZNF423	48227165	1.000000	0.71417	0.999000	0.59377	0.982000	0.71751	0.687000	0.25407	0.455000	0.26910	-0.366000	0.07423	GAA	ZNF423	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000102935		0.692	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF423	HGNC	protein_coding	OTTHUMT00000423258.1	-	0.00	41	0	T	NM_015069		49669664	-1	tier1	-	no_errors	ENST00000262383	ensembl	human	known	74_37	missense	28.57	15	6	SNP	1.000	G
ZNF445	353274	genome.wustl.edu	37	3	44489870	44489870	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr3:44489870C>G	ENST00000396077.2	-	8	1640	c.1293G>C	c.(1291-1293)aaG>aaC	p.K431N	ZNF445_ENST00000425708.2_Missense_Mutation_p.K431N	NM_181489.5	NP_852466.1	P59923	ZN445_HUMAN	zinc finger protein 445	431					transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|skin(3)	31				KIRC - Kidney renal clear cell carcinoma(197;0.0514)|Kidney(197;0.0646)		TCCCATATTTCTTGTAGTCAT	0.418																																																	0													120.0	121.0	121.0					3																	44489870		2203	4300	6503	SO:0001583	missense	0			AY262260	CCDS2713.1	3p21.32	2013-01-09	2003-10-07		ENSG00000185219	ENSG00000185219		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	21018	protein-coding gene	gene with protein product			"""zinc finger protein 168"""	ZNF168		7814019	Standard	NM_181489		Approved	ZKSCAN15, ZSCAN47	uc003cnf.2	P59923	OTTHUMG00000133042	ENST00000396077.2:c.1293G>C	3.37:g.44489870C>G	ENSP00000379387:p.Lys431Asn		Q3MJD1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.K431N	ENST00000396077.2	37	c.1293	CCDS2713.1	3	.	.	.	.	.	.	.	.	.	.	C	9.773	1.173141	0.21704	.	.	ENSG00000185219	ENST00000425708;ENST00000396077	T;T	0.05513	3.43;3.43	4.03	-0.0145	0.13980	.	0.495616	0.18794	N	0.130966	T	0.03263	0.0095	N	0.20357	0.565	0.23831	N	0.99672	B;B	0.15141	0.004;0.012	B;B	0.08055	0.003;0.003	T	0.42275	-0.9461	10	0.25751	T	0.34	.	3.9819	0.09498	0.4962:0.3104:0.0:0.1934	.	419;431	B7ZKX2;P59923	.;ZN445_HUMAN	N	431	ENSP00000413073:K431N;ENSP00000379387:K431N	ENSP00000379387:K431N	K	-	3	2	ZNF445	44464874	0.000000	0.05858	0.153000	0.22517	0.474000	0.32979	0.027000	0.13621	-0.014000	0.14175	-0.293000	0.09583	AAG	ZNF445	-	NULL	ENSG00000185219		0.418	ZNF445-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF445	HGNC	protein_coding	OTTHUMT00000256647.2	-	0.00	26	0	C	NM_181489		44489870	-1	tier1	-	no_errors	ENST00000396077	ensembl	human	known	74_37	missense	20.69	46	12	SNP	0.653	G
ZNF445	353274	genome.wustl.edu	37	3	44489870	44489870	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr3:44489870C>G	ENST00000396077.2	-	8	1640	c.1293G>C	c.(1291-1293)aaG>aaC	p.K431N	ZNF445_ENST00000425708.2_Missense_Mutation_p.K431N	NM_181489.5	NP_852466.1	P59923	ZN445_HUMAN	zinc finger protein 445	431					transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|skin(3)	31				KIRC - Kidney renal clear cell carcinoma(197;0.0514)|Kidney(197;0.0646)		TCCCATATTTCTTGTAGTCAT	0.418																																																	0													120.0	121.0	121.0					3																	44489870		2203	4300	6503	SO:0001583	missense	0			AY262260	CCDS2713.1	3p21.32	2013-01-09	2003-10-07		ENSG00000185219	ENSG00000185219		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	21018	protein-coding gene	gene with protein product			"""zinc finger protein 168"""	ZNF168		7814019	Standard	NM_181489		Approved	ZKSCAN15, ZSCAN47	uc003cnf.2	P59923	OTTHUMG00000133042	ENST00000396077.2:c.1293G>C	3.37:g.44489870C>G	ENSP00000379387:p.Lys431Asn		Q3MJD1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.K431N	ENST00000396077.2	37	c.1293	CCDS2713.1	3	.	.	.	.	.	.	.	.	.	.	C	9.773	1.173141	0.21704	.	.	ENSG00000185219	ENST00000425708;ENST00000396077	T;T	0.05513	3.43;3.43	4.03	-0.0145	0.13980	.	0.495616	0.18794	N	0.130966	T	0.03263	0.0095	N	0.20357	0.565	0.23831	N	0.99672	B;B	0.15141	0.004;0.012	B;B	0.08055	0.003;0.003	T	0.42275	-0.9461	10	0.25751	T	0.34	.	3.9819	0.09498	0.4962:0.3104:0.0:0.1934	.	419;431	B7ZKX2;P59923	.;ZN445_HUMAN	N	431	ENSP00000413073:K431N;ENSP00000379387:K431N	ENSP00000379387:K431N	K	-	3	2	ZNF445	44464874	0.000000	0.05858	0.153000	0.22517	0.474000	0.32979	0.027000	0.13621	-0.014000	0.14175	-0.293000	0.09583	AAG	ZNF445	-	NULL	ENSG00000185219		0.418	ZNF445-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF445	HGNC	protein_coding	OTTHUMT00000256647.2	-	0.00	47	0	C	NM_181489		44489870	-1	tier1	-	no_errors	ENST00000396077	ensembl	human	known	74_37	missense	20.69	46	12	SNP	0.653	G
ZNF702P	79986	genome.wustl.edu	37	19	53472790	53472790	+	RNA	DEL	C	C	-			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr19:53472790delC	ENST00000600068.1	-	0	489				ZNF702P_ENST00000270443.4_RNA																							TGGTTTCTCTCCAGTATGAAC	0.393																																																	0																																												0																															19.37:g.53472790delC				RNA	DEL	-	NULL	ENST00000600068.1	37	NULL		19																																																																																			ZNF702P	-	-	ENSG00000242779		0.393	CTD-2620I22.1-001	KNOWN	basic|readthrough_transcript	processed_transcript	ZNF702P	HGNC	processed_transcript	OTTHUMT00000463881.1		0.00	49	0	C			53472790	-1	tier1		no_errors	ENST00000270443	ensembl	human	known	74_37	rna	50.00	26	26	DEL	1.000	-
ZNF91	7644	genome.wustl.edu	37	19	23542543	23542543	+	Missense_Mutation	SNP	A	A	C			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr19:23542543A>C	ENST00000300619.7	-	4	3443	c.3238T>G	c.(3238-3240)Tgt>Ggt	p.C1080G	ZNF91_ENST00000397082.2_Missense_Mutation_p.C1048G|ZNF91_ENST00000596528.1_5'Flank|ZNF91_ENST00000599743.1_Intron	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	1080					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)						all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				CATTCTTCACATTTGTAGGGT	0.398																																																	0													66.0	73.0	71.0					19																	23542543		2171	4279	6450	SO:0001583	missense	0			M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.3238T>G	19.37:g.23542543A>C	ENSP00000300619:p.Cys1080Gly		A8K5E1|B7Z6G6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C1080G	ENST00000300619.7	37	c.3238	CCDS42541.1	19	.	.	.	.	.	.	.	.	.	.	A	13.47	2.247242	0.39697	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	D;D	0.85258	-1.96;-1.96	1.49	1.49	0.22878	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.95066	0.8402	H	0.99368	4.535	0.09310	N	0.999997	D;D	0.89917	0.981;1.0	D;D	0.97110	0.989;1.0	D	0.85465	0.1169	9	0.87932	D	0	.	7.8484	0.29440	1.0:0.0:0.0:0.0	.	1048;1080	Q05481-2;Q05481	.;ZNF91_HUMAN	G	1080;1048	ENSP00000300619:C1080G;ENSP00000380272:C1048G	ENSP00000300619:C1080G	C	-	1	0	ZNF91	23334383	0.997000	0.39634	0.012000	0.15200	0.689000	0.40095	6.225000	0.72271	0.660000	0.30964	0.165000	0.16767	TGT	ZNF91	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000167232		0.398	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF91	HGNC	protein_coding	OTTHUMT00000465891.1	-	0.00	77	0	A	NM_003430		23542543	-1	tier1	-	no_errors	ENST00000300619	ensembl	human	known	74_37	missense	21.43	55	15	SNP	0.200	C
ZNF92	168374	genome.wustl.edu	37	7	64864193	64864193	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr7:64864193G>T	ENST00000328747.7	+	4	1365	c.1166G>T	c.(1165-1167)aGa>aTa	p.R389I	ZNF92_ENST00000357512.2_Missense_Mutation_p.R357I|ZNF92_ENST00000431504.1_Missense_Mutation_p.R313I|ZNF92_ENST00000450302.2_Missense_Mutation_p.R320I	NM_152626.2	NP_689839.1	Q03936	ZNF92_HUMAN	zinc finger protein 92	389					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.R389I(1)		breast(2)|endometrium(1)|large_intestine(3)|lung(4)|pancreas(1)|skin(1)|stomach(1)	13		Lung NSC(55;0.159)				AAACATAAAAGAATTCATACG	0.363																																																	1	Substitution - Missense(1)	large_intestine(1)											36.0	41.0	39.0					7																	64864193		2196	4294	6490	SO:0001583	missense	0			M61872	CCDS34646.1, CCDS47596.1, CCDS75608.1, CCDS75609.1	7q11.21	2013-01-08	2006-05-12		ENSG00000146757	ENSG00000146757		"""Zinc fingers, C2H2-type"", ""-"""	13168	protein-coding gene	gene with protein product		603974	"""zinc finger protein 92 (HTF12)"""			8467795	Standard	NM_001287533		Approved	HPF12, TF12	uc003ttz.3	Q03936	OTTHUMG00000156557	ENST00000328747.7:c.1166G>T	7.37:g.64864193G>T	ENSP00000332595:p.Arg389Ile		A6NNF9|Q8N492|Q8NB35	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R389I	ENST00000328747.7	37	c.1166	CCDS34646.1	7	.	.	.	.	.	.	.	.	.	.	G	4.401	0.074165	0.08485	.	.	ENSG00000146757	ENST00000328747;ENST00000431504;ENST00000357512;ENST00000450302	T;T;T;T	0.02446	4.29;4.29;4.29;4.29	0.418	-0.581	0.11713	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03827	0.0108	M	0.69823	2.125	0.43242	D	0.995156	B;B	0.11235	0.001;0.004	B;B	0.12837	0.002;0.008	T	0.29274	-1.0017	9	0.42905	T	0.14	.	4.6192	0.12442	0.3005:0.0:0.6995:0.0	.	357;389	Q03936-3;Q03936	.;ZNF92_HUMAN	I	389;313;357;320	ENSP00000332595:R389I;ENSP00000400495:R313I;ENSP00000350113:R357I;ENSP00000396126:R320I	ENSP00000332595:R389I	R	+	2	0	ZNF92	64501628	0.000000	0.05858	0.220000	0.23810	0.211000	0.24417	-0.064000	0.11636	-0.396000	0.07703	-0.384000	0.06662	AGA	ZNF92	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000146757		0.363	ZNF92-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF92	HGNC	protein_coding	OTTHUMT00000344589.2		0.00	46	0	G	NM_152626		64864193	+1			no_errors	ENST00000328747	ensembl	human	known	74_37	missense	6.67	42	3	SNP	0.885	T
ZSCAN23	222696	genome.wustl.edu	37	6	28403278	28403278	+	Missense_Mutation	SNP	A	A	C			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr6:28403278A>C	ENST00000289788.4	-	3	660	c.515T>G	c.(514-516)cTt>cGt	p.L172R	ZSCAN23_ENST00000486481.1_5'UTR	NM_001012455.1	NP_001012458.1	Q3MJ62	ZSC23_HUMAN	zinc finger and SCAN domain containing 23	172					transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|prostate(1)|stomach(2)	4						ATTATACCCAAGTTGCTCTTC	0.448																																																	0													81.0	72.0	75.0					6																	28403278		692	1591	2283	SO:0001583	missense	0			AK092117	CCDS47393.1	6p21.33	2013-01-08	2007-02-20	2007-02-20	ENSG00000187987	ENSG00000187987		"""-"", ""Zinc fingers, C2H2-type"""	21193	protein-coding gene	gene with protein product			"""zinc finger protein 453"", ""zinc finger protein 390"""	ZNF453, ZNF390			Standard	NM_001012455		Approved	dJ29K1.3.1	uc003nli.4	Q3MJ62	OTTHUMG00000016346	ENST00000289788.4:c.515T>G	6.37:g.28403278A>C	ENSP00000289788:p.Leu172Arg		Q96KV9	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.L172R	ENST00000289788.4	37	c.515	CCDS47393.1	6	.	.	.	.	.	.	.	.	.	.	A	8.861	0.947051	0.18356	.	.	ENSG00000187987	ENST00000289788	T	0.06449	3.3	3.75	-7.5	0.01351	.	0.985731	0.08230	N	0.977772	T	0.00637	0.0021	N	0.08118	0	0.09310	N	0.999998	B	0.02656	0.0	B	0.01281	0.0	T	0.47686	-0.9098	10	0.25751	T	0.34	.	2.2117	0.03949	0.1477:0.2519:0.0992:0.5012	.	172	Q3MJ62	ZSC23_HUMAN	R	172	ENSP00000289788:L172R	ENSP00000289788:L172R	L	-	2	0	ZSCAN23	28511257	0.001000	0.12720	0.001000	0.08648	0.075000	0.17131	-1.597000	0.02089	-1.821000	0.01213	-0.429000	0.05907	CTT	ZSCAN23	-	NULL	ENSG00000187987		0.448	ZSCAN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN23	HGNC	protein_coding	OTTHUMT00000043751.2	-	0.00	33	0	A	XM_167147		28403278	-1	tier1	-	no_errors	ENST00000289788	ensembl	human	known	74_37	missense	17.14	29	6	SNP	0.009	C
ZSWIM4	65249	genome.wustl.edu	37	19	13934270	13934270	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr19:13934270C>T	ENST00000254323.2	+	10	2009	c.1820C>T	c.(1819-1821)aCc>aTc	p.T607I	ZSWIM4_ENST00000440752.2_Missense_Mutation_p.T441I	NM_023072.2	NP_075560.2	Q9H7M6	ZSWM4_HUMAN	zinc finger, SWIM-type containing 4	607							zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27			OV - Ovarian serous cystadenocarcinoma(19;2.94e-23)|Epithelial(5;4.58e-19)			CACCTGGAGACCCGCCAGTGT	0.592																																																	0													41.0	32.0	35.0					19																	13934270		2203	4298	6501	SO:0001583	missense	0			AK022283	CCDS32924.1	19p13.13	2012-02-23			ENSG00000132003	ENSG00000132003		"""Zinc fingers, SWIM-type"""	25704	protein-coding gene	gene with protein product							Standard	NM_023072		Approved	FLJ12221	uc002mxh.1	Q9H7M6		ENST00000254323.2:c.1820C>T	19.37:g.13934270C>T	ENSP00000254323:p.Thr607Ile			Missense_Mutation	SNP	pfscan_Znf_SWIM	p.T607I	ENST00000254323.2	37	c.1820	CCDS32924.1	19	.	.	.	.	.	.	.	.	.	.	C	19.82	3.898649	0.72639	.	.	ENSG00000132003	ENST00000254323;ENST00000440752	T;T	0.46063	0.88;0.88	4.48	3.45	0.39498	.	0.000000	0.52532	D	0.000073	T	0.47284	0.1437	L	0.59436	1.845	0.33935	D	0.642522	P;P	0.45957	0.557;0.869	B;P	0.51135	0.294;0.66	T	0.59984	-0.7351	10	0.38643	T	0.18	-39.9517	10.0212	0.42044	0.0:0.9004:0.0:0.0996	.	441;607	E7ERX2;Q9H7M6	.;ZSWM4_HUMAN	I	607;441	ENSP00000254323:T607I;ENSP00000405278:T441I	ENSP00000254323:T607I	T	+	2	0	ZSWIM4	13795270	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	4.435000	0.59941	1.101000	0.41535	0.591000	0.81541	ACC	ZSWIM4	-	NULL	ENSG00000132003		0.592	ZSWIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSWIM4	HGNC	protein_coding	OTTHUMT00000457457.1	-	0.00	22	0	C	XM_031342		13934270	+1	tier1	-	no_errors	ENST00000254323	ensembl	human	known	74_37	missense	29.63	19	8	SNP	0.999	T
ZSWIM4	65249	genome.wustl.edu	37	19	13934270	13934270	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-A7RE-01A-11D-A351-09	TCGA-V5-A7RE-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ed6348e8-0f78-481c-8e9f-d69e105a6fda	e15a5f53-3831-47e4-9f8a-ced7c5d38553	g.chr19:13934270C>T	ENST00000254323.2	+	10	2009	c.1820C>T	c.(1819-1821)aCc>aTc	p.T607I	ZSWIM4_ENST00000440752.2_Missense_Mutation_p.T441I	NM_023072.2	NP_075560.2	Q9H7M6	ZSWM4_HUMAN	zinc finger, SWIM-type containing 4	607							zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27			OV - Ovarian serous cystadenocarcinoma(19;2.94e-23)|Epithelial(5;4.58e-19)			CACCTGGAGACCCGCCAGTGT	0.592																																																	0													41.0	32.0	35.0					19																	13934270		2203	4298	6501	SO:0001583	missense	0			AK022283	CCDS32924.1	19p13.13	2012-02-23			ENSG00000132003	ENSG00000132003		"""Zinc fingers, SWIM-type"""	25704	protein-coding gene	gene with protein product							Standard	NM_023072		Approved	FLJ12221	uc002mxh.1	Q9H7M6		ENST00000254323.2:c.1820C>T	19.37:g.13934270C>T	ENSP00000254323:p.Thr607Ile			Missense_Mutation	SNP	pfscan_Znf_SWIM	p.T607I	ENST00000254323.2	37	c.1820	CCDS32924.1	19	.	.	.	.	.	.	.	.	.	.	C	19.82	3.898649	0.72639	.	.	ENSG00000132003	ENST00000254323;ENST00000440752	T;T	0.46063	0.88;0.88	4.48	3.45	0.39498	.	0.000000	0.52532	D	0.000073	T	0.47284	0.1437	L	0.59436	1.845	0.33935	D	0.642522	P;P	0.45957	0.557;0.869	B;P	0.51135	0.294;0.66	T	0.59984	-0.7351	10	0.38643	T	0.18	-39.9517	10.0212	0.42044	0.0:0.9004:0.0:0.0996	.	441;607	E7ERX2;Q9H7M6	.;ZSWM4_HUMAN	I	607;441	ENSP00000254323:T607I;ENSP00000405278:T441I	ENSP00000254323:T607I	T	+	2	0	ZSWIM4	13795270	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	4.435000	0.59941	1.101000	0.41535	0.591000	0.81541	ACC	ZSWIM4	-	NULL	ENSG00000132003		0.592	ZSWIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSWIM4	HGNC	protein_coding	OTTHUMT00000457457.1	-	0.00	27	0	C	XM_031342		13934270	+1	tier1	-	no_errors	ENST00000254323	ensembl	human	known	74_37	missense	29.63	19	8	SNP	0.999	T
