#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCA13	154664	genome.wustl.edu	37	7	48559855	48559855	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr7:48559855G>T	ENST00000435803.1	+	53	14040	c.14016G>T	c.(14014-14016)agG>agT	p.R4672S	ABCA13_ENST00000544596.1_Missense_Mutation_p.R402S	NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4672					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TCCTCTTGAGGGTTCTGCTAC	0.507																																																	0													58.0	54.0	55.0					7																	48559855		1934	4156	6090	SO:0001583	missense	0			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.14016G>T	7.37:g.48559855G>T	ENSP00000411096:p.Arg4672Ser		K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.R4672S	ENST00000435803.1	37	c.14016	CCDS47584.1	7	.	.	.	.	.	.	.	.	.	.	G	16.18	3.051006	0.55218	.	.	ENSG00000179869	ENST00000435803;ENST00000411975;ENST00000544596	D;D;D	0.87334	-2.07;-2.24;-2.19	5.32	0.907	0.19321	.	0.000000	0.51477	D	0.000098	D	0.90369	0.6986	M	0.80183	2.485	0.09310	N	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.996;0.999;0.999	T	0.80346	-0.1421	10	0.15066	T	0.55	.	6.3605	0.21425	0.3608:0.0:0.5148:0.1244	.	402;2374;4672	F5H7B7;Q86UQ4-3;Q86UQ4	.;.;ABCAD_HUMAN	S	4672;445;402	ENSP00000411096:R4672S;ENSP00000391042:R445S;ENSP00000442634:R402S	ENSP00000391042:R445S	R	+	3	2	ABCA13	48530401	0.000000	0.05858	0.001000	0.08648	0.177000	0.22998	-0.365000	0.07573	0.014000	0.14944	-0.797000	0.03246	AGG	ABCA13	-	NULL	ENSG00000179869		0.507	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2		0.00	55	0	G	NM_152701		48559855	+1			no_errors	ENST00000435803	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.001	T
ABCC9	10060	genome.wustl.edu	37	12	22069892	22069892	+	Silent	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr12:22069892C>T	ENST00000261201.4	-	4	551	c.552G>A	c.(550-552)gaG>gaA	p.E184E	ABCC9_ENST00000261200.4_Silent_p.E184E|ABCC9_ENST00000345162.2_Silent_p.E184E	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	184					defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	TGACATTGATCTCCACAGCCA	0.413																																																	0													231.0	216.0	221.0					12																	22069892		2203	4300	6503	SO:0001819	synonymous_variant	0			AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.552G>A	12.37:g.22069892C>T			O60707	Silent	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,prints_Sulphorea_rcpt,prints_Sulphonylurea_rcpt-2	p.E184	ENST00000261201.4	37	c.552	CCDS8694.1	12																																																																																			ABCC9	-	NULL	ENSG00000069431		0.413	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	ABCC9	HGNC	protein_coding	OTTHUMT00000402230.1	-	0.00	58	0	C	NM_005691		22069892	-1	tier1	-	no_errors	ENST00000261200	ensembl	human	known	74_37	silent	5.63	67	4	SNP	1.000	T
ABCG2	9429	genome.wustl.edu	37	4	89015732	89015732	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr4:89015732G>T	ENST00000237612.3	-	15	2362	c.1817C>A	c.(1816-1818)gCa>gAa	p.A606E	ABCG2_ENST00000515655.1_Missense_Mutation_p.Q603K	NM_004827.2	NP_004818.2	Q9UNQ0	ABCG2_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 2 (Junior blood group)	606	ABC transmembrane type-2.				cellular iron ion homeostasis (GO:0006879)|drug export (GO:0046618)|drug transmembrane transport (GO:0006855)|embryonic process involved in female pregnancy (GO:0060136)|heme transport (GO:0015886)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|urate metabolic process (GO:0046415)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|heme transporter activity (GO:0015232)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(13)|lung(10)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;7.02e-05)	Afatinib(DB08916)|Apixaban(DB06605)|Buprenorphine(DB00921)|Cabazitaxel(DB06772)|Carboplatin(DB00958)|Cisplatin(DB00515)|Cladribine(DB00242)|Clofarabine(DB00631)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Diethylstilbestrol(DB00255)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gefitinib(DB00317)|Glyburide(DB01016)|Hesperetin(DB01094)|Hydrocortisone(DB00741)|Imatinib(DB00619)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Lansoprazole(DB00448)|Leflunomide(DB01097)|Methotrexate(DB00563)|Mitoxantrone(DB01204)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Nilotinib(DB04868)|Nitrofurantoin(DB00698)|Novobiocin(DB01051)|Omeprazole(DB00338)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Pitavastatin(DB08860)|Ponatinib(DB08901)|Pravastatin(DB00175)|Prazosin(DB00457)|Rabeprazole(DB01129)|Regorafenib(DB08896)|Rilpivirine(DB08864)|Riluzole(DB00740)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Sorafenib(DB00398)|Sulfasalazine(DB00795)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Teniposide(DB00444)|Teriflunomide(DB08880)|Testosterone(DB00624)|Topotecan(DB01030)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vincristine(DB00541)|Vismodegib(DB08828)|Zafirlukast(DB00549)|Zidovudine(DB00495)	AACTTACGTTGCATAGTTACA	0.423																																																	0													131.0	107.0	115.0					4																	89015732		2203	4300	6503	SO:0001583	missense	0			AF103796	CCDS3628.1, CCDS58910.1	4q22.1	2014-08-27	2014-08-27		ENSG00000118777	ENSG00000118777		"""CD molecules"", ""ATP binding cassette transporters / subfamily G"""	74	protein-coding gene	gene with protein product		603756	"""ATP-binding cassette, sub-family G (WHITE), member 2"""			8894702, 9861027	Standard	NM_001257386		Approved	EST157481, MXR, BCRP, ABCP, CD338	uc003hrg.3	Q9UNQ0	OTTHUMG00000130601	ENST00000237612.3:c.1817C>A	4.37:g.89015732G>T	ENSP00000237612:p.Ala606Glu		A0A1W3|A8K1T5|O95374|Q4W5I3|Q53ZQ1|Q569L4|Q5YLG4|Q86V64|Q8IX16|Q96LD6|Q96TA8|Q9BY73|Q9NUS0	Missense_Mutation	SNP	pfam_ABC_2_trans,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.A606E	ENST00000237612.3	37	c.1817	CCDS3628.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.23|13.23	2.174396|2.174396	0.38413|0.38413	.|.	.|.	ENSG00000118777|ENSG00000118777	ENST00000237612|ENST00000515655	D|D	0.85556|0.85629	-2.0|-2.01	5.46|5.46	3.75|3.75	0.43078|0.43078	.|.	0.748251|.	0.12804|.	N|.	0.437721|.	T|T	0.77018|0.77018	0.4069|0.4069	L|L	0.31065|0.31065	0.9|0.9	0.09310|0.09310	N|N	0.999997|0.999997	B;P|B	0.34462|0.25272	0.033;0.454|0.122	B;B|B	0.32805|0.30572	0.014;0.153|0.117	T|T	0.63242|0.63242	-0.6681|-0.6681	10|9	0.31617|0.29301	T|T	0.26|0.29	.|.	8.2299|8.2299	0.31593|0.31593	0.1817:0.0:0.8183:0.0|0.1817:0.0:0.8183:0.0	.|.	606;606|603	Q9UNQ0;Q4W5I3|Q9UNQ0-2	ABCG2_HUMAN;.|.	E|K	606|603	ENSP00000237612:A606E|ENSP00000426917:Q603K	ENSP00000237612:A606E|ENSP00000426917:Q603K	A|Q	-|-	2|1	0|0	ABCG2|ABCG2	89234756|89234756	0.039000|0.039000	0.19947|0.19947	0.029000|0.029000	0.17559|0.17559	0.016000|0.016000	0.09150|0.09150	1.436000|1.436000	0.34980|0.34980	0.687000|0.687000	0.31509|0.31509	0.563000|0.563000	0.77884|0.77884	GCA|CAA	ABCG2	-	NULL	ENSG00000118777		0.423	ABCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCG2	HGNC	protein_coding	OTTHUMT00000253051.1		0.00	71	0	G	NM_004827		89015732	-1			no_errors	ENST00000237612	ensembl	human	known	74_37	missense	5.17	55	3	SNP	0.240	T
ACTN2	88	genome.wustl.edu	37	1	236906269	236906269	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr1:236906269G>A	ENST00000366578.4	+	11	1347	c.1181G>A	c.(1180-1182)cGg>cAg	p.R394Q	ACTN2_ENST00000546208.1_5'UTR|ACTN2_ENST00000492634.1_3'UTR|ACTN2_ENST00000542672.1_Missense_Mutation_p.R394Q	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	394					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)			endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			AATGAGATTCGGAGACTGGAG	0.547																																																	0													115.0	110.0	112.0					1																	236906269		2203	4300	6503	SO:0001583	missense	0			BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.1181G>A	1.37:g.236906269G>A	ENSP00000355537:p.Arg394Gln		B1ANE4|B2RCS5|Q86TF4|Q86TI8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_EF-hand_Ca_insen,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.R394Q	ENST00000366578.4	37	c.1181	CCDS1613.1	1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.511040	0.85389	.	.	ENSG00000077522	ENST00000542672;ENST00000366578;ENST00000545611	T;T	0.54866	0.55;0.55	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.69984	0.3172	L	0.55017	1.72	0.80722	D	1	D;P;D;D	0.89917	1.0;0.635;1.0;0.988	D;B;D;P	0.81914	0.995;0.046;0.995;0.867	T	0.67329	-0.5698	10	0.46703	T	0.11	.	20.0345	0.97552	0.0:0.0:1.0:0.0	.	179;394;164;394	B7Z4K1;B2RCS5;Q59FD9;P35609	.;.;.;ACTN2_HUMAN	Q	394;394;163	ENSP00000443495:R394Q;ENSP00000355537:R394Q	ENSP00000355537:R394Q	R	+	2	0	ACTN2	234972892	1.000000	0.71417	0.992000	0.48379	0.929000	0.56500	9.860000	0.99555	2.797000	0.96272	0.655000	0.94253	CGG	ACTN2	-	NULL	ENSG00000077522		0.547	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACTN2	HGNC	protein_coding	OTTHUMT00000096628.1	-	0.00	31	0	G	NM_001103		236906269	+1	tier1	-	no_errors	ENST00000366578	ensembl	human	known	74_37	missense	39.13	14	9	SNP	1.000	A
ADAMTS12	81792	genome.wustl.edu	37	5	33637695	33637695	+	Silent	SNP	G	G	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr5:33637695G>T	ENST00000504830.1	-	12	2210	c.1875C>A	c.(1873-1875)ccC>ccA	p.P625P	ADAMTS12_ENST00000504582.1_5'UTR|ADAMTS12_ENST00000352040.3_Silent_p.P625P	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	625	Cys-rich.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						GGTTAAAAATGGGAAACCAGT	0.468										HNSCC(64;0.19)																																							0													131.0	133.0	132.0					5																	33637695		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.1875C>A	5.37:g.33637695G>T			A2RRN9|A5D6V6|Q6UWL3	Silent	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.P625	ENST00000504830.1	37	c.1875	CCDS34140.1	5																																																																																			ADAMTS12	-	NULL	ENSG00000151388		0.468	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS12	HGNC	protein_coding	OTTHUMT00000367164.2	-	0.00	71	0	G	NM_030955		33637695	-1	tier1	-	no_errors	ENST00000504830	ensembl	human	known	74_37	silent	5.88	63	4	SNP	0.333	T
ADCY1	107	genome.wustl.edu	37	7	45747987	45747987	+	Silent	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr7:45747987G>A	ENST00000297323.7	+	18	2878	c.2856G>A	c.(2854-2856)gcG>gcA	p.A952A		NM_021116.2	NP_066939.1	Q08828	ADCY1_HUMAN	adenylate cyclase 1 (brain)	952					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|axonogenesis (GO:0007409)|cellular response to glucagon stimulus (GO:0071377)|circadian rhythm (GO:0007623)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of circadian rhythm (GO:0042752)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(33)|ovary(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	71					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	GCACGCTGGCGGACTTTGCCA	0.512																																																	0													217.0	171.0	187.0					7																	45747987		2203	4300	6503	SO:0001819	synonymous_variant	0			L05500	CCDS34631.1, CCDS75593.1	7p13-p12	2013-02-04			ENSG00000164742	ENSG00000164742	4.6.1.1	"""Adenylate cyclases"""	232	protein-coding gene	gene with protein product		103072				8314585	Standard	NM_021116		Approved	AC1	uc003tne.4	Q08828	OTTHUMG00000155420	ENST00000297323.7:c.2856G>A	7.37:g.45747987G>A			A4D2L8|Q75MI1	Silent	SNP	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.A952	ENST00000297323.7	37	c.2856	CCDS34631.1	7																																																																																			ADCY1	-	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	ENSG00000164742		0.512	ADCY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY1	HGNC	protein_coding	OTTHUMT00000340055.2	-	0.00	47	0	G	NM_021116		45747987	+1	tier1	-	no_errors	ENST00000297323	ensembl	human	known	74_37	silent	9.26	49	5	SNP	0.001	A
ADCYAP1	116	genome.wustl.edu	37	18	908309	908309	+	Silent	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr18:908309C>T	ENST00000579794.1	+	3	564	c.286C>T	c.(286-288)Ctg>Ttg	p.L96L	ADCYAP1_ENST00000450565.3_Silent_p.L96L|RP11-672L10.3_ENST00000582554.1_RNA|RP11-672L10.2_ENST00000581719.2_RNA|RP11-672L10.2_ENST00000577358.1_RNA	NM_001117.3	NP_001108.2	P18509	PACA_HUMAN	adenylate cyclase activating polypeptide 1 (pituitary)	96					activation of adenylate cyclase activity (GO:0007190)|ATP metabolic process (GO:0046034)|behavioral fear response (GO:0001662)|cAMP-mediated signaling (GO:0019933)|cell-cell signaling (GO:0007267)|cellular response to glucocorticoid stimulus (GO:0071385)|female pregnancy (GO:0007565)|histamine secretion (GO:0001821)|negative regulation of acute inflammatory response to antigenic stimulus (GO:0002865)|negative regulation of acute inflammatory response to non-antigenic stimulus (GO:0002878)|negative regulation of cell cycle (GO:0045786)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of Rho GTPase activity (GO:0034259)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|pituitary gland development (GO:0021983)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of somatostatin secretion (GO:0090274)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasodilation (GO:0045909)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)|regulation of postsynaptic membrane potential (GO:0060078)|regulation of protein localization (GO:0032880)|response to ethanol (GO:0045471)|response to starvation (GO:0042594)|sensory perception of pain (GO:0019233)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|terminal bouton (GO:0043195)	neuropeptide hormone activity (GO:0005184)|peptide hormone receptor binding (GO:0051428)|pituitary adenylate cyclase activating polypeptide activity (GO:0016521)|receptor binding (GO:0005102)|receptor signaling protein activity (GO:0005057)			endometrium(1)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)	12						CCGCAAAGTGCTGGACCAGCT	0.657																																																	0													28.0	29.0	29.0					18																	908309		2203	4299	6502	SO:0001819	synonymous_variant	0			S83513	CCDS11825.1	18p11	2013-02-28			ENSG00000141433	ENSG00000141433		"""Endogenous ligands"""	241	protein-coding gene	gene with protein product	"""prepro-PACAP"""	102980				1730060	Standard	NM_001099733		Approved	PACAP	uc010dkh.4	P18509	OTTHUMG00000131479	ENST00000579794.1:c.286C>T	18.37:g.908309C>T			B2R7N4|Q52LQ0	Silent	SNP	pfam_Glucagon_GIP_secretin_VIP,smart_Glucagon_GIP_secretin_VIP,prints_Glucagon_GIP_secretin_VIP	p.L96	ENST00000579794.1	37	c.286	CCDS11825.1	18																																																																																			ADCYAP1	-	pfam_Glucagon_GIP_secretin_VIP,smart_Glucagon_GIP_secretin_VIP	ENSG00000141433		0.657	ADCYAP1-003	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	ADCYAP1	HGNC	protein_coding	OTTHUMT00000440765.3	-	0.00	129	0	C	NM_001117		908309	+1	tier1	-	no_errors	ENST00000450565	ensembl	human	known	74_37	silent	6.78	55	4	SNP	1.000	T
AFF2	2334	genome.wustl.edu	37	X	148048401	148048401	+	Missense_Mutation	SNP	A	A	G			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chrX:148048401A>G	ENST00000370460.2	+	14	3474	c.2995A>G	c.(2995-2997)Act>Gct	p.T999A	AFF2_ENST00000370457.5_Missense_Mutation_p.T964A|AFF2_ENST00000342251.3_Missense_Mutation_p.T966A|AFF2_ENST00000286437.5_Missense_Mutation_p.T640A	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	999					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					tgtcactgctactgccaTTGT	0.522																																																	0													269.0	165.0	200.0					X																	148048401		2203	4300	6503	SO:0001583	missense	0			U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.2995A>G	X.37:g.148048401A>G	ENSP00000359489:p.Thr999Ala		A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	pfam_TF_AF4/FMR2	p.T999A	ENST00000370460.2	37	c.2995	CCDS14684.1	X	.	.	.	.	.	.	.	.	.	.	A	9.574	1.121909	0.20877	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000286437	T;T;T;T	0.72505	-0.06;-0.3;-0.32;-0.66	3.59	2.42	0.29668	.	1.742040	0.03353	N	0.196495	T	0.55924	0.1951	L	0.29908	0.895	0.21290	N	0.999738	B;B;B;B;B;B	0.21071	0.051;0.004;0.004;0.004;0.004;0.004	B;B;B;B;B;B	0.20577	0.03;0.01;0.01;0.01;0.01;0.017	T	0.37174	-0.9717	10	0.08837	T	0.75	.	4.7437	0.13028	0.8545:0.0:0.1455:0.0	.	640;964;964;960;989;999	B4DXD5;P51816-6;P51816-3;P51816-2;P51816-5;P51816	.;.;.;.;.;AFF2_HUMAN	A	999;964;966;640	ENSP00000359489:T999A;ENSP00000359486:T964A;ENSP00000345459:T966A;ENSP00000286437:T640A	ENSP00000286437:T640A	T	+	1	0	AFF2	147856095	0.997000	0.39634	0.939000	0.37840	0.915000	0.54546	0.578000	0.23773	0.585000	0.29608	0.412000	0.27726	ACT	AFF2	-	pfam_TF_AF4/FMR2	ENSG00000155966		0.522	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AFF2	HGNC	protein_coding	OTTHUMT00000058673.2	-	0.00	31	0	A	NM_002025		148048401	+1	tier1	-	no_errors	ENST00000370460	ensembl	human	known	74_37	missense	38.71	19	12	SNP	0.933	G
AFF3	3899	genome.wustl.edu	37	2	100623713	100623713	+	Silent	SNP	A	A	G			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr2:100623713A>G	ENST00000409236.2	-	4	496	c.384T>C	c.(382-384)acT>acC	p.T128T	AFF3_ENST00000356421.2_Silent_p.T153T|AFF3_ENST00000317233.4_Silent_p.T128T|AFF3_ENST00000409579.1_Silent_p.T153T			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	128					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)			NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						TGGAAGTTGTAGTGCTACAGA	0.547																																																	0													118.0	127.0	124.0					2																	100623713		2203	4300	6503	SO:0001819	synonymous_variant	0			U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.384T>C	2.37:g.100623713A>G			B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Silent	SNP	pfam_TF_AF4/FMR2	p.T153	ENST00000409236.2	37	c.459	CCDS42723.1	2																																																																																			AFF3	-	pfam_TF_AF4/FMR2	ENSG00000144218		0.547	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFF3	HGNC	protein_coding	OTTHUMT00000328982.3	-	0.00	55	0	A	NM_002285		100623713	-1	tier1	-	no_errors	ENST00000356421	ensembl	human	known	74_37	silent	21.95	32	9	SNP	0.005	G
ANK2	287	genome.wustl.edu	37	4	114203968	114203968	+	Silent	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr4:114203968G>A	ENST00000357077.4	+	18	2072	c.2019G>A	c.(2017-2019)ggG>ggA	p.G673G	ANK2_ENST00000264366.6_Silent_p.G673G|ANK2_ENST00000394537.3_Silent_p.G673G|ANK2_ENST00000506722.1_Silent_p.G652G	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	673					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CGCAGGAGGGGCACACAGATA	0.453																																																	0													140.0	106.0	118.0					4																	114203968		2203	4300	6503	SO:0001819	synonymous_variant	0			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.2019G>A	4.37:g.114203968G>A			Q01485|Q08AC7|Q08AC8|Q7Z3L5	Silent	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.G673	ENST00000357077.4	37	c.2019	CCDS3702.1	4																																																																																			ANK2	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000145362		0.453	ANK2-001	KNOWN	basic|CCDS	protein_coding	ANK2	HGNC	protein_coding	OTTHUMT00000256422.2	-	0.00	46	0	G	NM_001148		114203968	+1	tier1	-	no_errors	ENST00000357077	ensembl	human	known	74_37	silent	9.52	38	4	SNP	0.109	A
ANK2	287	genome.wustl.edu	37	4	114277685	114277685	+	Frame_Shift_Del	DEL	A	A	-			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr4:114277685delA	ENST00000357077.4	+	38	7964	c.7911delA	c.(7909-7911)ccafs	p.P2637fs	ANK2_ENST00000264366.6_Frame_Shift_Del_p.P2604fs|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000394537.3_Intron|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000506722.1_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	2637					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		TGGATGAACCAAAACATACAG	0.453																																																	0													141.0	145.0	143.0					4																	114277685		2203	4300	6503	SO:0001589	frameshift_variant	0			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.7911delA	4.37:g.114277685delA	ENSP00000349588:p.Pro2637fs		Q01485|Q08AC7|Q08AC8|Q7Z3L5	Frame_Shift_Del	DEL	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.K2638fs	ENST00000357077.4	37	c.7911	CCDS3702.1	4																																																																																			ANK2	-	NULL	ENSG00000145362		0.453	ANK2-001	KNOWN	basic|CCDS	protein_coding	ANK2	HGNC	protein_coding	OTTHUMT00000256422.2		0.00	48	0	A	NM_001148		114277685	+1	tier1		no_errors	ENST00000357077	ensembl	human	known	74_37	frame_shift_del	5.88	32	2	DEL	0.000	-
ANK3	288	genome.wustl.edu	37	10	61842444	61842444	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr10:61842444G>T	ENST00000280772.2	-	34	4443	c.4252C>A	c.(4252-4254)Cca>Aca	p.P1418T	ANK3_ENST00000503366.1_Missense_Mutation_p.P1419T|ANK3_ENST00000373827.2_Missense_Mutation_p.P1412T|Y_RNA_ENST00000365320.1_RNA|ANK3_ENST00000355288.2_Missense_Mutation_p.P552T	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	1418				P -> R (in Ref. 1; AAA64834). {ECO:0000305}.	axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						GTTGTCTTTGGTTCTTTCAGA	0.388																																																	0													145.0	143.0	143.0					10																	61842444		2203	4300	6503	SO:0001583	missense	0			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.4252C>A	10.37:g.61842444G>T	ENSP00000280772:p.Pro1418Thr		B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.P1418T	ENST00000280772.2	37	c.4252	CCDS7258.1	10	.	.	.	.	.	.	.	.	.	.	G	21.7	4.188754	0.78789	.	.	ENSG00000151150	ENST00000280772;ENST00000373827;ENST00000373820;ENST00000355288;ENST00000423532;ENST00000503366;ENST00000395299;ENST00000373817;ENST00000395293;ENST00000395304	T;T;D;T;T	0.89343	1.76;1.76;-2.5;1.76;1.76	5.89	3.99	0.46301	.	0.367060	0.19820	N	0.105328	D	0.93347	0.7879	M	0.74647	2.275	0.80722	D	1	B;P;D;D;D;D	0.89917	0.137;0.944;0.985;0.986;1.0;0.998	B;P;P;P;D;D	0.76071	0.065;0.585;0.754;0.573;0.987;0.987	D	0.92710	0.6182	10	0.72032	D	0.01	.	11.5376	0.50648	0.0673:0.126:0.8067:0.0	.	1419;552;1412;1418;653;552	E9PE32;A8KA62;Q5CZH9;Q12955;F5GXK0;B1AQT2	.;.;.;ANK3_HUMAN;.;.	T	1418;1412;1;552;552;1419;1398;653;1053;1053	ENSP00000280772:P1418T;ENSP00000362933:P1412T;ENSP00000362926:P1T;ENSP00000347436:P552T;ENSP00000425236:P1419T	ENSP00000280772:P1418T	P	-	1	0	ANK3	61512450	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.606000	0.67641	0.792000	0.33850	0.557000	0.71058	CCA	ANK3	-	NULL	ENSG00000151150		0.388	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANK3	HGNC	protein_coding	OTTHUMT00000048201.4	-	0.00	66	0	G	NM_020987		61842444	-1	tier1	-	no_errors	ENST00000280772	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	T
ANKRD30BL	554226	genome.wustl.edu	37	2	132914994	132914994	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr2:132914994G>A	ENST00000409867.1	-	2	470	c.221C>T	c.(220-222)aCt>aTt	p.T74I	ANKRD30BL_ENST00000470729.1_Intron			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	74										endometrium(1)|kidney(3)	4						GTATAGAGCAGTCCTACAAGA	0.408																																																	0																																										SO:0001583	missense	0					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.221C>T	2.37:g.132914994G>A	ENSP00000386398:p.Thr74Ile		B8ZZL7	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.T74I	ENST00000409867.1	37	c.221		2	.	.	.	.	.	.	.	.	.	.	.	13.31	2.198982	0.38806	.	.	ENSG00000163046	ENST00000409867	T	0.75050	-0.9	0.569	0.569	0.17340	.	.	.	.	.	T	0.79534	0.4462	.	.	.	0.41073	D	0.985466	.	.	.	.	.	.	T	0.80861	-0.1193	5	0.87932	D	0	.	.	.	.	.	.	.	.	I	74	ENSP00000386398:T74I	ENSP00000295181:T74I	T	-	2	0	ANKRD30BL	132631464	1.000000	0.71417	0.733000	0.30861	0.059000	0.15707	4.660000	0.61511	0.567000	0.29293	0.184000	0.17185	ACT	ANKRD30BL	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	ENSG00000163046		0.408	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	ANKRD30BL	HGNC	protein_coding	OTTHUMT00000331353.2	-	0.00	76	0	G	NR_027019		132914994	-1	tier1	-	no_errors	ENST00000295181	ensembl	human	known	74_37	missense	47.62	33	30	SNP	1.000	A
ANKRD50	57182	genome.wustl.edu	37	4	125593272	125593272	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr4:125593272C>T	ENST00000504087.1	-	4	2197	c.1160G>A	c.(1159-1161)cGc>cAc	p.R387H	ANKRD50_ENST00000515641.1_Missense_Mutation_p.R208H	NM_020337.2	NP_065070.1	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	387										NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(14)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	55						ATCTAACTTGCGTTGAAAATC	0.388																																																	0													133.0	135.0	134.0					4																	125593272		2203	4300	6503	SO:0001583	missense	0			AB033049	CCDS34060.1, CCDS54802.1	4q28.1	2013-01-10			ENSG00000151458	ENSG00000151458		"""Ankyrin repeat domain containing"""	29223	protein-coding gene	gene with protein product							Standard	NM_020337		Approved	KIAA1223	uc010inw.3	Q9ULJ7	OTTHUMG00000161398	ENST00000504087.1:c.1160G>A	4.37:g.125593272C>T	ENSP00000425658:p.Arg387His		A8K4V3|B4DHJ6|E9PDW0|Q6N064|Q6ZSE6	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_P-loop_NTPase,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.R387H	ENST00000504087.1	37	c.1160	CCDS34060.1	4	.	.	.	.	.	.	.	.	.	.	C	13.45	2.239622	0.39598	.	.	ENSG00000151458	ENST00000504087;ENST00000515641	T;T	0.67171	-0.25;-0.22	5.29	5.29	0.74685	.	0.134060	0.51477	D	0.000088	T	0.58750	0.2144	L	0.36672	1.1	0.42449	D	0.992745	B	0.27679	0.185	B	0.12156	0.007	T	0.57341	-0.7828	10	0.48119	T	0.1	.	19.1267	0.93388	0.0:1.0:0.0:0.0	.	387	Q9ULJ7	ANR50_HUMAN	H	387;208	ENSP00000425658:R387H;ENSP00000425355:R208H	ENSP00000425658:R387H	R	-	2	0	ANKRD50	125812722	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.403000	0.52615	2.753000	0.94483	0.555000	0.69702	CGC	ANKRD50	-	NULL	ENSG00000151458		0.388	ANKRD50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD50	HGNC	protein_coding	OTTHUMT00000364775.1	-	0.00	54	0	C	NM_020337		125593272	-1	tier1	-	no_errors	ENST00000504087	ensembl	human	known	74_37	missense	40.00	30	20	SNP	1.000	T
ARID1B	57492	genome.wustl.edu	37	6	157099427	157099429	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	CAG	CAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr6:157099427_157099429delCAG	ENST00000350026.5	+	1	365_367	c.364_366delCAG	c.(364-366)cagdel	p.Q131del	ARID1B_ENST00000275248.4_In_Frame_Del_p.Q73del|RP11-230C9.3_ENST00000604792.1_RNA|ARID1B_ENST00000367148.1_In_Frame_Del_p.Q131del|MIR4466_ENST00000606121.1_RNA|ARID1B_ENST00000346085.5_In_Frame_Del_p.Q131del|RP11-230C9.2_ENST00000603191.1_lincRNA	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	131	Gln-rich.|Poly-Gln.				chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		gcagcagcaacagcagcagcagc	0.65																																																	0									,	35,81,2332		8,2,17,12,55,1130					,	0.0	0.9			6	48,164,4794		13,0,22,25,114,2329	no	codingComplex,codingComplex	ARID1B	NM_020732.3,NM_017519.2	,	21,2,39,37,169,3459	A1A1,A1A2,A1R,A2A2,A2R,RR		4.2349,4.7386,4.4003	,	,		83,245,7126				SO:0001651	inframe_deletion	0			AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.364_366delCAG	6.37:g.157099436_157099438delCAG	ENSP00000055163:p.Gln131del		Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	In_Frame_Del	DEL	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.Q125in_frame_del	ENST00000350026.5	37	c.364_366	CCDS5251.2	6																																																																																			ARID1B	-	NULL	ENSG00000049618		0.650	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARID1B	HGNC	protein_coding	OTTHUMT00000372723.1		0.00	12	0	CAG	NM_020732		157099429	+1	tier1		no_errors	ENST00000367148	ensembl	human	known	74_37	in_frame_del	30.00	7	3	DEL	0.974:0.990:0.991	-
ARID3C	138715	genome.wustl.edu	37	9	34627840	34627840	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr9:34627840C>G	ENST00000378909.2	-	1	264	c.172G>C	c.(172-174)Gaa>Caa	p.E58Q		NM_001017363.1	NP_001017363.1	A6NKF2	ARI3C_HUMAN	AT rich interactive domain 3C (BRIGHT-like)	58	Glu-rich.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane raft (GO:0045121)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)	14	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.175)		tcctcatcttcttcagcatct	0.682																																																	0													28.0	24.0	26.0					9																	34627840		2197	4296	6493	SO:0001583	missense	0				CCDS35006.1	9p13.2	2013-02-07	2006-11-08		ENSG00000205143	ENSG00000205143		"""-"""	21209	protein-coding gene	gene with protein product			"""AT rich interactive domain 3C (BRIGHT- like)"""				Standard	NM_001017363		Approved		uc011lon.2	A6NKF2	OTTHUMG00000000445	ENST00000378909.2:c.172G>C	9.37:g.34627840C>G	ENSP00000368189:p.Glu58Gln			Missense_Mutation	SNP	pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.E58Q	ENST00000378909.2	37	c.172	CCDS35006.1	9	.	.	.	.	.	.	.	.	.	.	c	19.38	3.815984	0.70912	.	.	ENSG00000205143	ENST00000378909	T	0.49720	0.77	4.96	4.96	0.65561	.	0.272209	0.26166	N	0.025943	T	0.39627	0.1085	N	0.24115	0.695	0.25675	N	0.985854	P	0.51240	0.943	P	0.47346	0.544	T	0.23226	-1.0194	10	0.21540	T	0.41	-8.0021	15.0507	0.71867	0.0:1.0:0.0:0.0	.	58	A6NKF2	ARI3C_HUMAN	Q	58	ENSP00000368189:E58Q	ENSP00000368189:E58Q	E	-	1	0	ARID3C	34617840	1.000000	0.71417	0.986000	0.45419	0.877000	0.50540	4.744000	0.62118	2.569000	0.86673	0.486000	0.48141	GAA	ARID3C	-	NULL	ENSG00000205143		0.682	ARID3C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID3C	HGNC	protein_coding	OTTHUMT00000348265.1	-	0.00	24	0	C	XM_071061		34627840	-1	tier1	-	no_errors	ENST00000378909	ensembl	human	known	74_37	missense	11.90	37	5	SNP	1.000	G
ARRB1	408	genome.wustl.edu	37	11	74985188	74985188	+	Nonsense_Mutation	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr11:74985188G>A	ENST00000420843.2	-	11	941	c.844C>T	c.(844-846)Cga>Tga	p.R282*	ARRB1_ENST00000360025.3_Nonsense_Mutation_p.R282*|ARRB1_ENST00000393505.4_Nonsense_Mutation_p.R282*	NM_004041.4	NP_004032.2	P49407	ARRB1_HUMAN	arrestin, beta 1	282					activation of MAPK activity (GO:0000187)|apoptotic DNA fragmentation (GO:0006309)|blood coagulation (GO:0007596)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor internalization (GO:0002031)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of GTPase activity (GO:0034260)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein ubiquitination (GO:0031397)|Notch signaling pathway (GO:0007219)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of GTPase activity (GO:0043547)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H4 acetylation (GO:0090240)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of receptor internalization (GO:0002092)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-Golgi vesicle-mediated transport (GO:0006892)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|stress fiber assembly (GO:0043149)|transcription from RNA polymerase II promoter (GO:0006366)	basolateral plasma membrane (GO:0016323)|chromatin (GO:0000785)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|pseudopodium (GO:0031143)	angiotensin receptor binding (GO:0031701)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|enzyme inhibitor activity (GO:0004857)|GTPase activator activity (GO:0005096)|insulin-like growth factor receptor binding (GO:0005159)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			breast(4)|large_intestine(2)|lung(4)|prostate(1)	11						CGCTTCTCTCGGTTATTGGCT	0.602																																																	0													242.0	212.0	222.0					11																	74985188		2200	4293	6493	SO:0001587	stop_gained	0			BC003636	CCDS31640.1, CCDS44684.1	11q13	2008-12-11			ENSG00000137486	ENSG00000137486			711	protein-coding gene	gene with protein product	"""arrestin 2"""	107940		ARR1		8486659	Standard	NM_004041		Approved		uc001owe.2	P49407	OTTHUMG00000165444	ENST00000420843.2:c.844C>T	11.37:g.74985188G>A	ENSP00000409581:p.Arg282*		B6V9G8|O75625|O75630|Q2PP20|Q9BTK8	Nonsense_Mutation	SNP	pfam_Arrestin-like_N,pfam_Arrestin_C-like,superfamily_Ig_E-set,prints_Arrestin	p.R282*	ENST00000420843.2	37	c.844	CCDS44684.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.739213|5.739213	0.96873|0.96873	.|.	.|.	ENSG00000137486|ENSG00000137486	ENST00000532447|ENST00000420843;ENST00000393505;ENST00000360025	.|.	.|.	.|.	4.47|4.47	3.54|3.54	0.40534|0.40534	.|.	.|0.105269	.|0.40064	.|N	.|0.001195	T|.	0.27027|.	0.0662|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.30679|.	-0.9970|.	3|.	.|0.02654	.|T	.|1	-0.4467|-0.4467	11.7452|11.7452	0.51815|0.51815	0.0:0.0:0.8231:0.1769|0.0:0.0:0.8231:0.1769	.|.	.|.	.|.	.|.	L|X	106|282	.|.	.|ENSP00000353124:R282X	P|R	-|-	2|1	0|2	ARRB1|ARRB1	74662836|74662836	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.873000|0.873000	0.50193|0.50193	4.736000|4.736000	0.62059|0.62059	0.856000|0.856000	0.35383|0.35383	0.456000|0.456000	0.33151|0.33151	CCG|CGA	ARRB1	-	pfam_Arrestin_C-like,superfamily_Ig_E-set,prints_Arrestin	ENSG00000137486		0.602	ARRB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARRB1	HGNC	protein_coding	OTTHUMT00000384092.3		0.00	60	0	G	NM_004041		74985188	-1			no_errors	ENST00000393505	ensembl	human	known	74_37	nonsense	5.56	68	4	SNP	1.000	A
ATP10D	57205	genome.wustl.edu	37	4	47561024	47561024	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr4:47561024G>A	ENST00000273859.3	+	13	2788	c.2519G>A	c.(2518-2520)cGt>cAt	p.R840H	AC092597.3_ENST00000508081.1_RNA	NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	840					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						CAAGGCCTTCGTACTTTATGT	0.418																																																	0													185.0	175.0	179.0					4																	47561024		2203	4300	6503	SO:0001583	missense	0			AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.2519G>A	4.37:g.47561024G>A	ENSP00000273859:p.Arg840His		A2RRC8|D6REN2|Q8NC70|Q96SR3	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.R840H	ENST00000273859.3	37	c.2519	CCDS3476.1	4	.	.	.	.	.	.	.	.	.	.	G	17.18	3.324850	0.60634	.	.	ENSG00000145246	ENST00000273859	D	0.94862	-3.54	4.52	4.52	0.55395	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	D	0.98369	0.9458	H	0.97783	4.075	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99719	1.1009	10	0.87932	D	0	-11.2511	16.4074	0.83684	0.0:0.0:1.0:0.0	.	840	Q9P241	AT10D_HUMAN	H	840	ENSP00000273859:R840H	ENSP00000273859:R840H	R	+	2	0	ATP10D	47255781	1.000000	0.71417	0.973000	0.42090	0.025000	0.11179	9.098000	0.94202	2.351000	0.79841	0.555000	0.69702	CGT	ATP10D	-	superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000145246		0.418	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10D	HGNC	protein_coding	OTTHUMT00000216900.1	-	0.00	93	0	G	NM_020453		47561024	+1	tier1	-	no_errors	ENST00000273859	ensembl	human	known	74_37	missense	34.21	50	26	SNP	1.000	A
ATP10D	57205	genome.wustl.edu	37	4	47574176	47574176	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr4:47574176G>A	ENST00000273859.3	+	17	3438	c.3169G>A	c.(3169-3171)Ggt>Agt	p.G1057S		NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	1057					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						TGAAGGTGATGGTGCCAATGA	0.438																																																	0													264.0	229.0	240.0					4																	47574176		2203	4300	6503	SO:0001583	missense	0			AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.3169G>A	4.37:g.47574176G>A	ENSP00000273859:p.Gly1057Ser		A2RRC8|D6REN2|Q8NC70|Q96SR3	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.G1057S	ENST00000273859.3	37	c.3169	CCDS3476.1	4	.	.	.	.	.	.	.	.	.	.	G	35	5.579596	0.96565	.	.	ENSG00000145246	ENST00000273859	T	0.64260	-0.09	5.77	5.77	0.91146	HAD-like domain (2);	0.053643	0.85682	D	0.000000	D	0.87237	0.6127	H	0.97758	4.07	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	D	0.91254	0.5031	10	0.87932	D	0	-10.6704	18.965	0.92692	0.0:0.0:1.0:0.0	.	1057	Q9P241	AT10D_HUMAN	S	1057	ENSP00000273859:G1057S	ENSP00000273859:G1057S	G	+	1	0	ATP10D	47268933	1.000000	0.71417	0.995000	0.50966	0.981000	0.71138	9.828000	0.99408	2.724000	0.93272	0.591000	0.81541	GGT	ATP10D	-	pfam_HAD-like_dom,superfamily_HAD-like_dom,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	ENSG00000145246		0.438	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10D	HGNC	protein_coding	OTTHUMT00000216900.1	-	0.00	64	0	G	NM_020453		47574176	+1	tier1	-	no_errors	ENST00000273859	ensembl	human	known	74_37	missense	26.98	46	17	SNP	1.000	A
ATP13A3	79572	genome.wustl.edu	37	3	194146150	194146150	+	Frame_Shift_Del	DEL	A	A	-			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr3:194146150delA	ENST00000439040.1	-	30	4025	c.3234delT	c.(3232-3234)tttfs	p.F1078fs	ATP13A3_ENST00000256031.4_Frame_Shift_Del_p.F1078fs			Q9H7F0	AT133_HUMAN	ATPase type 13A3	1078						integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	24	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)		AACTGGAAATAAAAAACACTG	0.348																																																	0													88.0	84.0	85.0					3																	194146150		1813	4074	5887	SO:0001589	frameshift_variant	0			AJ306929	CCDS43187.1	3q29	2010-04-20			ENSG00000133657	ENSG00000133657		"""ATPases / P-type"""	24113	protein-coding gene	gene with protein product	"""ATPase family homolog up regulated in senescence cells"""	610232				11867234	Standard	NM_024524		Approved	AFURS1	uc003fty.4	Q9H7F0	OTTHUMG00000156034	ENST00000439040.1:c.3234delT	3.37:g.194146150delA	ENSP00000416508:p.Phe1078fs		Q8NC11|Q96KS1	Frame_Shift_Del	DEL	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_Cation_typ_V,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Cation_typ_V,tigrfam_Cation_transp_P_typ_ATPase	p.F1078fs	ENST00000439040.1	37	c.3234	CCDS43187.1	3																																																																																			ATP13A3	-	tigrfam_ATPase_P-typ_Cation_typ_V	ENSG00000133657		0.348	ATP13A3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ATP13A3	HGNC	protein_coding	OTTHUMT00000342799.2		0.00	62	0	A	NM_024524		194146150	-1			no_errors	ENST00000256031	ensembl	human	known	74_37	frame_shift_del	7.23	154	12	DEL	1.000	0
BCL11A	53335	genome.wustl.edu	37	2	60688816	60688816	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr2:60688816C>T	ENST00000335712.6	-	4	1458	c.1231G>A	c.(1231-1233)Gac>Aac	p.D411N	BCL11A_ENST00000538214.1_Missense_Mutation_p.D377N|BCL11A_ENST00000358510.4_Missense_Mutation_p.D377N|BCL11A_ENST00000359629.5_Intron|BCL11A_ENST00000356842.4_Missense_Mutation_p.D411N|BCL11A_ENST00000477659.1_5'UTR|BCL11A_ENST00000537768.1_Missense_Mutation_p.D80N	NM_022893.3	NP_075044.2	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A (zinc finger protein)	411					B cell differentiation (GO:0030183)|negative regulation of axon extension (GO:0030517)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|negative regulation of protein homooligomerization (GO:0032463)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of dendrite development (GO:0050773)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)			NS(1)|breast(6)|central_nervous_system(6)|endometrium(4)|kidney(1)|large_intestine(8)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	59			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			CACGCGTGGTCGCACAGGTTG	0.602			T	IGH@	B-CLL																																			Dom	yes		2	2p13	53335	B-cell CLL/lymphoma 11A		L	0													98.0	92.0	94.0					2																	60688816		2203	4300	6503	SO:0001583	missense	0			AJ404611	CCDS1861.1, CCDS1862.1, CCDS46295.1	2p16.1	2013-01-08	2002-05-08		ENSG00000119866	ENSG00000119866		"""Zinc fingers, C2H2-type"""	13221	protein-coding gene	gene with protein product		606557	"""ecotropic viral integration site 9"""	EVI9		11719382, 18245381	Standard	NM_018014		Approved	BCL11A-XL, BCL11A-L, BCL11A-S, CTIP1, HBFQTL5, ZNF856	uc002sae.1	Q9H165	OTTHUMG00000129420	ENST00000335712.6:c.1231G>A	2.37:g.60688816C>T	ENSP00000338774:p.Asp411Asn		D6W5D7|Q86W14|Q8WU92|Q96JL6|Q9H163|Q9H164|Q9H3G9|Q9NWA7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D411N	ENST00000335712.6	37	c.1231	CCDS1862.1	2	.	.	.	.	.	.	.	.	.	.	C	12.38	1.919339	0.33908	.	.	ENSG00000119866	ENST00000356842;ENST00000378117;ENST00000538214;ENST00000537768;ENST00000335712;ENST00000358510	T;T;T;T;T	0.28666	3.2;3.2;2.42;1.6;1.6	5.27	5.27	0.74061	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.20981	0.0505	N	0.16862	0.45	0.80722	D	1	B;P;B;B;P	0.42483	0.209;0.781;0.036;0.249;0.582	B;B;B;B;B	0.35413	0.202;0.058;0.01;0.201;0.13	T	0.03608	-1.1020	10	0.40728	T	0.16	-2.5374	18.9015	0.92444	0.0:1.0:0.0:0.0	.	377;80;377;411;411	F5H2Y4;B4DT16;Q9H165-6;Q9H165;D9YZV9	.;.;.;BC11A_HUMAN;.	N	411;447;377;80;411;377	ENSP00000349300:D411N;ENSP00000438303:D377N;ENSP00000443712:D80N;ENSP00000338774:D411N;ENSP00000351307:D377N	ENSP00000338774:D411N	D	-	1	0	BCL11A	60542320	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	6.079000	0.71291	2.461000	0.83175	0.655000	0.94253	GAC	BCL11A	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000119866		0.602	BCL11A-001	KNOWN	basic|CCDS	protein_coding	BCL11A	HGNC	protein_coding	OTTHUMT00000251579.2	-	0.00	18	0	C	NM_022893		60688816	-1	tier1	-	no_errors	ENST00000335712	ensembl	human	known	74_37	missense	61.11	7	11	SNP	1.000	T
BLOC1S5	63915	genome.wustl.edu	37	6	8015900	8015900	+	Silent	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr6:8015900C>T	ENST00000397457.2	-	5	583	c.546G>A	c.(544-546)gcG>gcA	p.A182A	BLOC1S5-TXNDC5_ENST00000439343.2_Intron|TXNDC5_ENST00000539054.1_Intron|BLOC1S5_ENST00000475998.1_5'UTR|BLOC1S5_ENST00000543936.1_Silent_p.A118A	NM_001199323.1|NM_201280.2	NP_001186252.1|NP_958437.1	Q8TDH9	BL1S5_HUMAN	biogenesis of lysosomal organelles complex-1, subunit 5, muted	182					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|endosome to melanosome transport (GO:0035646)|melanosome organization (GO:0032438)|melanosome transport (GO:0032402)|neuron projection development (GO:0031175)|otolith morphogenesis (GO:0032474)|positive regulation of pigment cell differentiation (GO:0050942)	BLOC-1 complex (GO:0031083)|transport vesicle (GO:0030133)											TTGAAAATTTCGCTAGGTCCT	0.423																																																	0													226.0	213.0	218.0					6																	8015900		2202	4300	6502	SO:0001819	synonymous_variant	0			AF426434	CCDS4506.1, CCDS75394.1	6p25.1-p24.3	2012-08-01	2012-08-01	2012-08-01		ENSG00000188428		"""Biogenesis of lysosomal organelles complex-1 subunits"""	18561	protein-coding gene	gene with protein product		607289	"""muted homolog (mouse)"""	MUTED		11912185	Standard	NM_001199322		Approved	MU, dJ303A1.3		Q8TDH9	OTTHUMG00000014220	ENST00000397457.2:c.546G>A	6.37:g.8015900C>T			B4DVM2|Q0VDJ6|Q0VDJ7|Q5THS1|Q68D56|Q8N5F9|Q9NU16	Silent	SNP	pirsf_Bloc1s5	p.A182	ENST00000397457.2	37	c.546	CCDS4506.1	6																																																																																			BLOC1S5	-	pirsf_Bloc1s5	ENSG00000188428		0.423	BLOC1S5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLOC1S5	HGNC	protein_coding	OTTHUMT00000039797.2	-	0.00	86	0	C	NM_201280		8015900	-1	tier1	-	no_errors	ENST00000397457	ensembl	human	known	74_37	silent	46.88	34	30	SNP	0.037	T
BRINP2	57795	genome.wustl.edu	37	1	177249883	177249883	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr1:177249883G>A	ENST00000361539.4	+	8	1883	c.1571G>A	c.(1570-1572)cGc>cAc	p.R524H	BRINP2_ENST00000478325.1_3'UTR	NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2	524					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)		p.R524H(1)									CAGGATAGCCGCATTGAGGTA	0.567																																																	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											42.0	38.0	40.0					1																	177249883		2203	4300	6503	SO:0001583	missense	0				CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.1571G>A	1.37:g.177249883G>A	ENSP00000354481:p.Arg524His		O95560|Q6ZWC1|Q7LCZ9|Q8N360	Missense_Mutation	SNP	pfam_MACPF,smart_MACPF	p.R524H	ENST00000361539.4	37	c.1571	CCDS1320.1	1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.147035	0.77888	.	.	ENSG00000198797	ENST00000536589;ENST00000361539	T	0.56444	0.46	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.74673	0.3747	M	0.79475	2.455	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.994	T	0.77958	-0.2392	10	0.87932	D	0	-20.1931	18.6898	0.91578	0.0:0.0:1.0:0.0	.	419;524	Q9C0B6-2;Q9C0B6	.;FAM5B_HUMAN	H	277;524	ENSP00000354481:R524H	ENSP00000354481:R524H	R	+	2	0	FAM5B	175516506	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	9.731000	0.98807	2.514000	0.84764	0.313000	0.20887	CGC	BRINP2	-	NULL	ENSG00000198797		0.567	BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRINP2	HGNC	protein_coding	OTTHUMT00000084599.1	-	0.00	14	0	G	NM_021165		177249883	+1	tier1	-	no_errors	ENST00000361539	ensembl	human	known	74_37	missense	45.45	6	5	SNP	1.000	A
PROSER3	148137	genome.wustl.edu	37	19	36259320	36259320	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr19:36259320G>A	ENST00000396908.4	+	12	1386	c.1313G>A	c.(1312-1314)cGa>cAa	p.R438Q	AC002398.13_ENST00000589397.1_RNA|C19orf55_ENST00000544099.1_3'UTR|C19orf55_ENST00000536037.1_3'UTR	NM_001039887.2	NP_001034976.2	Q2NL68	PRSR3_HUMAN		439										cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|prostate(1)	15	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GCGGATGCCCGATTATCGTTC	0.617																																																	0													46.0	49.0	48.0					19																	36259320		876	1991	2867	SO:0001583	missense	0																														ENST00000396908.4:c.1313G>A	19.37:g.36259320G>A	ENSP00000380116:p.Arg438Gln		Q8NDI3|Q8WWC8|Q96NL4	Missense_Mutation	SNP	NULL	p.R438Q	ENST00000396908.4	37	c.1313		19	.	.	.	.	.	.	.	.	.	.	G	8.831	0.939896	0.18281	.	.	ENSG00000167595	ENST00000396908	T	0.29917	1.55	5.22	-4.05	0.03998	.	.	.	.	.	T	0.12178	0.0296	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.36311	-0.9753	6	0.10902	T	0.67	9.8336	6.2766	0.20983	0.5264:0.0:0.3541:0.1196	.	.	.	.	Q	438	ENSP00000380116:R438Q	ENSP00000380116:R438Q	R	+	2	0	C19orf55	40951160	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.120000	0.10660	-0.645000	0.05458	-1.138000	0.01928	CGA	C19orf55	-	NULL	ENSG00000167595		0.617	C19orf55-201	KNOWN	basic|appris_principal	protein_coding	C19orf55	HGNC	protein_coding		-	0.00	52	0	G			36259320	+1	tier1	-	no_errors	ENST00000396908	ensembl	human	known	74_37	missense	67.65	22	46	SNP	0.000	A
C1orf111	284680	genome.wustl.edu	37	1	162343935	162343935	+	Missense_Mutation	SNP	C	C	T	rs528900704	byFrequency	TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr1:162343935C>T	ENST00000367935.5	-	3	768	c.689G>A	c.(688-690)cGg>cAg	p.R230Q	RP11-565P22.6_ENST00000431696.1_Intron	NM_182581.3	NP_872387.2	Q5T0L3	CA111_HUMAN	chromosome 1 open reading frame 111	230										central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)	11	all_hematologic(112;0.15)		BRCA - Breast invasive adenocarcinoma(70;0.0938)			GTCTCCCAGCCGGGCCTTCTG	0.567													C|||	4	0.000798722	0.0	0.0	5008	,	,		18360	0.0		0.0	False		,,,				2504	0.0041																0													104.0	109.0	107.0					1																	162343935		2203	4300	6503	SO:0001583	missense	0			BC032957	CCDS1238.1	1q23.3	2008-02-05			ENSG00000171722	ENSG00000171722			27648	protein-coding gene	gene with protein product						12477932	Standard	NM_182581		Approved		uc001gbx.2	Q5T0L3	OTTHUMG00000031375	ENST00000367935.5:c.689G>A	1.37:g.162343935C>T	ENSP00000356912:p.Arg230Gln		Q6X961|Q8NEC3	Missense_Mutation	SNP	NULL	p.R230Q	ENST00000367935.5	37	c.689	CCDS1238.1	1	.	.	.	.	.	.	.	.	.	.	C	3.496	-0.102744	0.06967	.	.	ENSG00000171722	ENST00000367935	T	0.32753	1.44	5.21	3.33	0.38152	.	0.554110	0.17739	N	0.163616	T	0.04182	0.0116	N	0.12746	0.255	0.23449	N	0.997655	P	0.50710	0.938	B	0.35510	0.204	T	0.17961	-1.0352	9	0.19147	T	0.46	-15.9253	5.6871	0.17809	0.3517:0.5581:0.0:0.0903	.	230	Q5T0L3	CA111_HUMAN	Q	230	ENSP00000356912:R230Q	ENSP00000356912:R230Q	R	-	2	0	C1orf111	160610559	0.001000	0.12720	0.205000	0.23548	0.001000	0.01503	1.078000	0.30754	1.178000	0.42870	-0.152000	0.13540	CGG	C1orf111	-	NULL	ENSG00000171722		0.567	C1orf111-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf111	HGNC	protein_coding	OTTHUMT00000076791.2	-	0.00	42	0	C	NM_182581		162343935	-1	tier1	-	no_errors	ENST00000367935	ensembl	human	known	74_37	missense	57.89	16	22	SNP	0.012	T
C3orf67	200844	genome.wustl.edu	37	3	58792173	58792173	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr3:58792173G>T	ENST00000482387.1	-	11	1906	c.1810C>A	c.(1810-1812)Cag>Aag	p.Q604K	C3orf67_ENST00000295966.7_Missense_Mutation_p.Q478K			Q6ZVT6	CC067_HUMAN	chromosome 3 open reading frame 67	604										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(3)|prostate(2)|skin(1)	19		all_cancers(2;0.000156)|all_epithelial(2;0.000493)|Breast(2;0.00446)|all_lung(2;0.074)|Lung NSC(2;0.248)		BRCA - Breast invasive adenocarcinoma(55;5.93e-06)|Kidney(10;0.00155)|KIRC - Kidney renal clear cell carcinoma(10;0.00172)|OV - Ovarian serous cystadenocarcinoma(275;0.23)		TGGCGACCCTGGTTGACAGGC	0.363																																																	0													119.0	119.0	119.0					3																	58792173		2203	4300	6503	SO:0001583	missense	0			AK124920	CCDS33776.1	3p14.2	2011-01-25			ENSG00000163689	ENSG00000163689			24763	protein-coding gene	gene with protein product							Standard	NM_198463		Approved	FLJ42117, FLJ42930	uc003dkt.1	Q6ZVT6	OTTHUMG00000159151	ENST00000482387.1:c.1810C>A	3.37:g.58792173G>T	ENSP00000417122:p.Gln604Lys		B9EKV6|Q6ZV69	Missense_Mutation	SNP	NULL	p.Q604K	ENST00000482387.1	37	c.1810		3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.3|21.3	4.124820|4.124820	0.77436|0.77436	.|.	.|.	ENSG00000163689|ENSG00000163689	ENST00000486145|ENST00000295966;ENST00000482387	.|T;T	.|0.20332	.|2.15;2.08	5.36|5.36	5.36|5.36	0.76844|0.76844	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.40015|0.40015	0.1100|0.1100	L|L	0.54323|0.54323	1.7|1.7	0.80722|0.80722	D|D	1|1	.|P;D	.|0.67145	.|0.867;0.996	.|B;D	.|0.79784	.|0.367;0.993	T|T	0.02721|0.02721	-1.1119|-1.1119	5|10	.|0.19590	.|T	.|0.45	-7.0508|-7.0508	16.1607|16.1607	0.81704|0.81704	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|478;604	.|Q6ZVT6-2;Q6ZVT6	.|.;CC067_HUMAN	Q|K	17|478;604	.|ENSP00000295966:Q478K;ENSP00000417122:Q604K	.|ENSP00000295966:Q478K	P|Q	-|-	2|1	0|0	C3orf67|C3orf67	58767213|58767213	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	5.401000|5.401000	0.66326|0.66326	2.677000|2.677000	0.91161|0.91161	0.591000|0.591000	0.81541|0.81541	CCA|CAG	C3orf67	-	NULL	ENSG00000163689		0.363	C3orf67-003	KNOWN	basic	protein_coding	C3orf67	HGNC	protein_coding	OTTHUMT00000353803.1	-	0.00	75	0	G	NM_198463		58792173	-1	tier1	-	no_errors	ENST00000482387	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	T
CADPS	8618	genome.wustl.edu	37	3	62499335	62499335	+	Intron	SNP	G	G	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr3:62499335G>T	ENST00000383710.4	-	17	2931				CADPS_ENST00000357948.3_Intron|CADPS_ENST00000283269.9_Silent_p.S876S	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator						catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		CCATCACTTGGGAGGCCAAGC	0.423																																																	0													126.0	99.0	108.0					3																	62499335		2203	4299	6502	SO:0001627	intron_variant	0			U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.2582-892C>A	3.37:g.62499335G>T			A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Silent	SNP	pfam_Ca-dep_secretion_activator,superfamily_C2_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.S876	ENST00000383710.4	37	c.2628	CCDS46858.1	3																																																																																			CADPS	-	pfam_Ca-dep_secretion_activator	ENSG00000163618		0.423	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	CADPS	HGNC	protein_coding	OTTHUMT00000351951.5	-	0.00	48	0	G	NM_003716, NM_183393, NM_183394		62499335	-1	tier1	-	no_errors	ENST00000283269	ensembl	human	known	74_37	silent	17.39	19	4	SNP	1.000	T
CAPS2	84698	genome.wustl.edu	37	12	75710108	75710108	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr12:75710108G>T	ENST00000409445.3	-	7	828	c.632C>A	c.(631-633)gCa>gAa	p.A211E	CAPS2_ENST00000393284.3_5'UTR|CAPS2_ENST00000442339.2_5'UTR|CAPS2_ENST00000409004.1_5'UTR|CAPS2_ENST00000409799.1_Missense_Mutation_p.A161E	NM_032606.3	NP_115995.2	Q9BXY5	CAYP2_HUMAN	calcyphosine 2	211							calcium ion binding (GO:0005509)			endometrium(2)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	10						CAATTTTCTTGCCCTCTGTTG	0.368																																																	0													263.0	210.0	226.0					12																	75710108		692	1591	2283	SO:0001583	missense	0			AF251056	CCDS9008.2, CCDS66424.1, CCDS73497.1	12q14.1	2013-01-10	2005-05-09		ENSG00000180881	ENSG00000180881		"""EF-hand domain containing"""	16471	protein-coding gene	gene with protein product		607724	"""calcyphosphine 2"""			11846421	Standard	NM_032606		Approved		uc001sxk.4	Q9BXY5	OTTHUMG00000152787	ENST00000409445.3:c.632C>A	12.37:g.75710108G>T	ENSP00000386959:p.Ala211Glu		Q6PH84|Q8N242|Q8NAY5	Missense_Mutation	SNP	smart_EF_hand_dom,pfscan_EF_hand_dom	p.A211E	ENST00000409445.3	37	c.632	CCDS9008.2	12	.	.	.	.	.	.	.	.	.	.	G	8.610	0.889005	0.17540	.	.	ENSG00000180881	ENST00000409799;ENST00000409445;ENST00000552497;ENST00000436898	T;T;T;T	0.44482	1.93;1.91;0.92;0.93	5.75	1.54	0.23209	.	1.572370	0.03196	N	0.174034	T	0.23451	0.0567	N	0.08118	0	0.21220	N	0.99975	B;B	0.23806	0.091;0.091	B;B	0.19148	0.024;0.024	T	0.21655	-1.0239	10	0.49607	T	0.09	0.7733	3.4123	0.07363	0.402:0.0:0.4137:0.1843	.	211;161	Q9BXY5;B9A061	CAYP2_HUMAN;.	E	161;211;106;105	ENSP00000386977:A161E;ENSP00000386959:A211E;ENSP00000449797:A106E;ENSP00000411797:A105E	ENSP00000338474:A106E	A	-	2	0	CAPS2	73996375	0.008000	0.16893	0.233000	0.24025	0.480000	0.33159	0.439000	0.21575	0.790000	0.33803	0.655000	0.94253	GCA	CAPS2	-	NULL	ENSG00000180881		0.368	CAPS2-001	KNOWN	basic|CCDS	protein_coding	CAPS2	HGNC	protein_coding	OTTHUMT00000327880.2		0.00	55	0	G			75710108	-1			no_errors	ENST00000409445	ensembl	human	known	74_37	missense	5.97	63	4	SNP	0.138	T
CASC5	57082	genome.wustl.edu	37	15	40914039	40914039	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr15:40914039C>T	ENST00000346991.5	+	11	2045	c.1655C>T	c.(1654-1656)aCa>aTa	p.T552I	CASC5_ENST00000399668.2_Missense_Mutation_p.T526I|CASC5_ENST00000527044.1_3'UTR			Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5	552	Interaction with BUB1 and BUB1B.				acrosome assembly (GO:0001675)|attachment of spindle microtubules to kinetochore (GO:0008608)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|nucleosome assembly (GO:0006334)|protein localization to kinetochore (GO:0034501)|spindle assembly checkpoint (GO:0071173)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(1)|breast(7)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(13)|lung(16)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		CTTATGACCACATCAGAAGAT	0.348																																																	0													71.0	67.0	68.0					15																	40914039		1889	4116	6005	SO:0001583	missense	0			AF173994	CCDS42023.1, CCDS42024.1	15q14	2013-07-03			ENSG00000137812	ENSG00000137812		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	24054	protein-coding gene	gene with protein product	"""cancer/testis antigen 29"", ""kinetochore null 1 homolog (C. elegans)"", ""blinkin, bub-linking kinetochore protein"", ""protein phosphatase 1, regulatory subunit 55"""	609173				10980622, 10780384, 18045986	Standard	NM_170589		Approved	D40, AF15Q14, CT29, hKNL-1, KNL1, hSpc105, PPP1R55, Spc7	uc010bbt.1	Q8NG31	OTTHUMG00000166532	ENST00000346991.5:c.1655C>T	15.37:g.40914039C>T	ENSP00000335463:p.Thr552Ile		Q8NHE1|Q8WXA6|Q9HCK2|Q9NR92	Missense_Mutation	SNP	NULL	p.T552I	ENST00000346991.5	37	c.1655	CCDS42023.1	15	.	.	.	.	.	.	.	.	.	.	C	0.013	-1.608505	0.00842	.	.	ENSG00000137812	ENST00000346991;ENST00000260369;ENST00000399668	T;T	0.12569	2.67;2.67	5.41	2.93	0.34026	.	1.674110	0.02947	N	0.141234	T	0.06371	0.0164	N	0.03608	-0.345	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.35425	-0.9789	10	0.08837	T	0.75	.	6.0452	0.19755	0.0:0.1935:0.1331:0.6734	.	526;552;526	Q8NG31-2;Q8NG31;Q8NG31-4	.;CASC5_HUMAN;.	I	552;526;526	ENSP00000335463:T552I;ENSP00000382576:T526I	ENSP00000260369:T526I	T	+	2	0	CASC5	38701331	0.002000	0.14202	0.003000	0.11579	0.020000	0.10135	0.191000	0.17076	0.466000	0.27193	-0.455000	0.05494	ACA	CASC5	-	NULL	ENSG00000137812		0.348	CASC5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CASC5	HGNC	protein_coding	OTTHUMT00000390224.2	-	0.00	51	0	C	NM_144508		40914039	+1	tier1	-	no_errors	ENST00000346991	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.001	T
CASC4	113201	genome.wustl.edu	37	15	44620946	44620946	+	Missense_Mutation	SNP	A	A	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr15:44620946A>T	ENST00000345795.2	+	3	716	c.446A>T	c.(445-447)aAg>aTg	p.K149M	CASC4_ENST00000299957.6_Missense_Mutation_p.K149M|CASC4_ENST00000360824.3_Missense_Mutation_p.K149M	NM_177974.2	NP_816929.1	Q6P4E1	CASC4_HUMAN	cancer susceptibility candidate 4	149						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(2)|large_intestine(3)|lung(7)|ovary(1)|urinary_tract(2)	17		all_cancers(109;1.69e-13)|all_epithelial(112;3.94e-11)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.027)		all cancers(107;2.91e-20)|GBM - Glioblastoma multiforme(94;1.57e-06)|COAD - Colon adenocarcinoma(120;0.217)|Colorectal(105;0.237)		GACTATAGGAAGAACAATACT	0.383																																																	0													93.0	85.0	88.0					15																	44620946		2198	4298	6496	SO:0001583	missense	0			AF103804	CCDS10108.1, CCDS10109.1	15q15.1	2010-11-24			ENSG00000166734	ENSG00000166734			24892	protein-coding gene	gene with protein product						10497265	Standard	NM_138423		Approved	H63, DKFZp459F1927	uc001ztp.3	Q6P4E1	OTTHUMG00000131133	ENST00000345795.2:c.446A>T	15.37:g.44620946A>T	ENSP00000335063:p.Lys149Met		B4DPZ6|G5E934|Q6UY45|Q96EM1	Missense_Mutation	SNP	NULL	p.K149M	ENST00000345795.2	37	c.446	CCDS10109.1	15	.	.	.	.	.	.	.	.	.	.	A	24.5	4.540653	0.85917	.	.	ENSG00000166734	ENST00000299957;ENST00000345795;ENST00000360824;ENST00000416522	D;D	0.85088	-1.94;-1.94	5.96	5.96	0.96718	.	0.043938	0.85682	D	0.000000	D	0.91710	0.7379	M	0.73217	2.22	0.53688	D	0.999973	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.98;0.997;0.991	D	0.92476	0.5989	10	0.87932	D	0	.	15.431	0.75099	1.0:0.0:0.0:0.0	.	149;149;149	Q6P4E1-2;G5E934;Q6P4E1	.;.;CASC4_HUMAN	M	149;149;149;128	ENSP00000299957:K149M;ENSP00000335063:K149M	ENSP00000299957:K149M	K	+	2	0	CASC4	42408238	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.930000	0.70104	2.285000	0.76669	0.533000	0.62120	AAG	CASC4	-	NULL	ENSG00000166734		0.383	CASC4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CASC4	HGNC	protein_coding	OTTHUMT00000253816.1	-	0.00	46	0	A	NM_138423		44620946	+1	tier1	-	no_errors	ENST00000299957	ensembl	human	known	74_37	missense	15.09	45	8	SNP	1.000	T
CATSPERG	57828	genome.wustl.edu	37	19	38861354	38861354	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr19:38861354G>A	ENST00000409235.3	+	29	3517	c.3402G>A	c.(3400-3402)atG>atA	p.M1134I	CATSPERG_ENST00000410018.1_Missense_Mutation_p.M1094I|CATSPERG_ENST00000215069.4_3'UTR	NM_021185.4	NP_067008.3	Q6ZRH7	CTSRG_HUMAN	catsper channel auxiliary subunit gamma	1134					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)				breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(13)|ovary(1)|pancreas(2)|prostate(6)|skin(3)|stomach(1)|urinary_tract(2)	40						ATTCCAGGATGGGCTCCATGT	0.557																																																	0													129.0	120.0	123.0					19																	38861354		2203	4300	6503	SO:0001583	missense	0			AK128220	CCDS12514.2	19q13.1	2014-05-13	2012-02-22	2009-07-17	ENSG00000099338	ENSG00000099338			25243	protein-coding gene	gene with protein product		613452	"""chromosome 19 open reading frame 15"", ""cation channel, sperm-associated, gamma"""	C19orf15		19516020	Standard	NM_021185		Approved	DKFZp434A1022, FLJ46353	uc002oih.4	Q6ZRH7	OTTHUMG00000153223	ENST00000409235.3:c.3402G>A	19.37:g.38861354G>A	ENSP00000386962:p.Met1134Ile		A6NEG6|Q659E1	Missense_Mutation	SNP	NULL	p.M1134I	ENST00000409235.3	37	c.3402	CCDS12514.2	19	.	.	.	.	.	.	.	.	.	.	G	5.358	0.251383	0.10130	.	.	ENSG00000099338	ENST00000410018;ENST00000409235;ENST00000409410	T;T	0.20332	2.08;2.08	3.62	-7.25	0.01470	.	4.390070	0.00531	N	0.000204	T	0.08179	0.0204	N	0.08118	0	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.16571	-1.0398	10	0.31617	T	0.26	5.303	0.7019	0.00909	0.2443:0.1287:0.3291:0.2978	.	1134;1094	Q6ZRH7;B8ZZI7	CTSRG_HUMAN;.	I	1094;1134;1134	ENSP00000387057:M1094I;ENSP00000386962:M1134I	ENSP00000386962:M1134I	M	+	3	0	CATSPERG	43553194	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-3.728000	0.00382	-2.013000	0.00949	-0.680000	0.03767	ATG	CATSPERG	-	NULL	ENSG00000099338		0.557	CATSPERG-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CATSPERG	HGNC	protein_coding	OTTHUMT00000330204.1	-	0.00	29	0	G	NM_021185		38861354	+1	tier1	-	no_errors	ENST00000409235	ensembl	human	known	74_37	missense	57.14	9	12	SNP	0.000	A
CBFA2T2	9139	genome.wustl.edu	37	20	32194777	32194777	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr20:32194777G>T	ENST00000346541.3	+	3	614	c.77G>T	c.(76-78)aGg>aTg	p.R26M	CBFA2T2_ENST00000375279.2_Missense_Mutation_p.R26M|CBFA2T2_ENST00000342704.6_Missense_Mutation_p.R17M|CBFA2T2_ENST00000344201.3_5'UTR|CBFA2T2_ENST00000397798.2_5'UTR|CBFA2T2_ENST00000397800.1_5'UTR|CBFA2T2_ENST00000492345.1_5'UTR|CBFA2T2_ENST00000359606.3_Missense_Mutation_p.R36M	NM_005093.3	NP_005084.1	O43439	MTG8R_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 2	26					epithelial cell differentiation (GO:0030855)|negative regulation of neuron projection development (GO:0010977)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)	20						CCTGAGAAAAGGGTGCCAGCG	0.483																																					Esophageal Squamous(174;142 1955 14837 21276 28041)												0													111.0	108.0	109.0					20																	32194777		2203	4300	6503	SO:0001583	missense	0			AF052210	CCDS13221.1, CCDS46590.1	20q11	2007-01-29			ENSG00000078699	ENSG00000078699		"""Zinc fingers, MYND-type"""	1536	protein-coding gene	gene with protein product		603672				9790752	Standard	XM_006723886		Approved	MTGR1, ZMYND3	uc002wze.1	O43439	OTTHUMG00000032261	ENST00000346541.3:c.77G>T	20.37:g.32194777G>T	ENSP00000262653:p.Arg26Met		B2RAE6|F8W6D7|Q5TGE4|Q5TGE5|Q5TGE6|Q5TGE7|Q8IWF3|Q96B06|Q96L00|Q9H436|Q9UJP8|Q9UJP9|Q9UP24	Missense_Mutation	SNP	pfam_NHR2,pfam_TAFH_NHR1,pfam_Znf_MYND,smart_TAFH_NHR1,pfscan_TAFH_NHR1,pfscan_Znf_MYND,prints_ETO,prints_MTGR1	p.R26M	ENST00000346541.3	37	c.77	CCDS13221.1	20	.	.	.	.	.	.	.	.	.	.	G	21.8	4.207300	0.79240	.	.	ENSG00000078699	ENST00000375279;ENST00000342704;ENST00000417366;ENST00000346541;ENST00000454955;ENST00000359606	T;T;T;T	0.48522	0.87;0.81;0.87;1.45	5.85	4.91	0.64330	.	0.040065	0.85682	D	0.000000	T	0.45155	0.1328	N	0.08118	0	0.80722	D	1	D;D	0.69078	0.997;0.986	P;P	0.59288	0.781;0.855	T	0.57027	-0.7881	10	0.87932	D	0	0.2714	14.8269	0.70120	0.0689:0.0:0.931:0.0	.	26;17	O43439;F8W6D7	MTG8R_HUMAN;.	M	26;17;17;26;26;36	ENSP00000364428:R26M;ENSP00000345810:R17M;ENSP00000262653:R26M;ENSP00000352622:R36M	ENSP00000345810:R17M	R	+	2	0	CBFA2T2	31658438	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.231000	0.78106	1.483000	0.48342	0.557000	0.71058	AGG	CBFA2T2	-	NULL	ENSG00000078699		0.483	CBFA2T2-201	KNOWN	basic|CCDS	protein_coding	CBFA2T2	HGNC	protein_coding	OTTHUMT00000078708.2	-	0.00	56	0	G	NM_001032999		32194777	+1	tier1	-	no_errors	ENST00000346541	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	T
CCDC155	147872	genome.wustl.edu	37	19	49900949	49900949	+	Nonsense_Mutation	SNP	G	G	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr19:49900949G>T	ENST00000447857.3	+	6	647	c.442G>T	c.(442-444)Gga>Tga	p.G148*		NM_144688.4	NP_653289.3	Q8N6L0	KASH5_HUMAN	coiled-coil domain containing 155	148						chromosome, telomeric region (GO:0000781)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.G148R(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(10)|ovary(1)|stomach(1)	22						GGAGAGCTTCGGAGGCGAAGA	0.627																																																	1	Substitution - Missense(1)	kidney(1)											98.0	114.0	109.0					19																	49900949		1994	4155	6149	SO:0001587	stop_gained	0				CCDS46140.1	19q13.33	2014-01-21			ENSG00000161609	ENSG00000161609			26520	protein-coding gene	gene with protein product							Standard	NM_144688		Approved	FLJ32658, KASH5	uc002pnm.2	Q8N6L0	OTTHUMG00000183170	ENST00000447857.3:c.442G>T	19.37:g.49900949G>T	ENSP00000404220:p.Gly148*		Q96MC3	Nonsense_Mutation	SNP	NULL	p.G148*	ENST00000447857.3	37	c.442	CCDS46140.1	19	.	.	.	.	.	.	.	.	.	.	G	28.9	4.960670	0.92791	.	.	ENSG00000161609	ENST00000447857	.	.	.	4.76	3.72	0.42706	.	0.325996	0.24539	N	0.037649	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-17.1026	9.3277	0.38003	0.0986:0.0:0.9014:0.0	.	.	.	.	X	148	.	ENSP00000404220:G148X	G	+	1	0	CCDC155	54592761	0.997000	0.39634	1.000000	0.80357	0.384000	0.30261	2.981000	0.49329	1.377000	0.46286	-0.219000	0.12488	GGA	CCDC155	-	NULL	ENSG00000161609		0.627	CCDC155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC155	HGNC	protein_coding	OTTHUMT00000465436.2		0.00	30	0	G	NM_144688		49900949	+1			no_errors	ENST00000447857	ensembl	human	known	74_37	nonsense	5.88	32	2	SNP	1.000	T
CCDC168	643677	genome.wustl.edu	37	13	103384913	103384913	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr13:103384913G>A	ENST00000322527.2	-	1	4246	c.4247C>T	c.(4246-4248)tCt>tTt	p.S1416F		NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168	1416																	TTTTGCATTAGATGCTTCTAG	0.353																																																	0													163.0	117.0	131.0					13																	103384913		692	1590	2282	SO:0001583	missense	0				CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287	ENST00000322527.2:c.4247C>T	13.37:g.103384913G>A	ENSP00000320232:p.Ser1416Phe		Q8N800	Missense_Mutation	SNP	NULL	p.S1416F	ENST00000322527.2	37	c.4247		13	.	.	.	.	.	.	.	.	.	.	G	14.48	2.547673	0.45383	.	.	ENSG00000175820	ENST00000322527	T	0.04234	3.67	2.94	2.94	0.34122	.	.	.	.	.	T	0.07683	0.0193	N	0.14661	0.345	0.09310	N	1	D	0.89917	1.0	D	0.68353	0.957	T	0.44636	-0.9315	9	0.21540	T	0.41	.	9.5755	0.39454	0.0:0.0:1.0:0.0	.	1416	Q8NDH2	CC168_HUMAN	F	1416	ENSP00000320232:S1416F	ENSP00000320232:S1416F	S	-	2	0	CCDC168	102182914	0.002000	0.14202	0.002000	0.10522	0.111000	0.19643	1.177000	0.31969	1.944000	0.56390	0.460000	0.39030	TCT	CCDC168	-	NULL	ENSG00000175820		0.353	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	CCDC168	HGNC	protein_coding		-	0.00	40	0	G	NM_001146197		103384913	-1	tier1	-	no_errors	ENST00000322527	ensembl	human	known	74_37	missense	48.72	20	19	SNP	0.002	A
CCDC34	91057	genome.wustl.edu	37	11	27362982	27362982	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr11:27362982T>C	ENST00000328697.6	-	4	1395	c.722A>G	c.(721-723)aAg>aGg	p.K241R	CCDC34_ENST00000529615.1_5'UTR	NM_030771.1	NP_110398.1	Q96HJ3	CCD34_HUMAN	coiled-coil domain containing 34	241										endometrium(2)|large_intestine(4)|lung(1)|prostate(1)|urinary_tract(1)	9						attttttttctttaaccattc	0.294																																																	0													72.0	68.0	69.0					11																	27362982		2142	4218	6360	SO:0001583	missense	0			AF382034	CCDS7863.1, CCDS31448.1	11p14.1	2010-03-30			ENSG00000109881	ENSG00000109881			25079	protein-coding gene	gene with protein product		612324				11173847	Standard	NM_080654		Approved	NY-REN-41, L15, RAMA3	uc001mrh.1	Q96HJ3	OTTHUMG00000166211	ENST00000328697.6:c.722A>G	11.37:g.27362982T>C	ENSP00000330240:p.Lys241Arg		B2R8G2|Q8IX69|Q9H2A6|Q9Y599	Missense_Mutation	SNP	NULL	p.K241R	ENST00000328697.6	37	c.722	CCDS31448.1	11	.	.	.	.	.	.	.	.	.	.	T	10.64	1.405824	0.25378	.	.	ENSG00000109881	ENST00000328697	T	0.20881	2.04	3.84	3.84	0.44239	.	0.247587	0.33834	N	0.004513	T	0.16896	0.0406	L	0.37850	1.14	0.80722	D	1	P	0.35328	0.495	B	0.38616	0.277	T	0.04796	-1.0926	10	0.23302	T	0.38	-7.9258	9.2989	0.37833	0.0:0.0:0.0:1.0	.	241	Q96HJ3	CCD34_HUMAN	R	241	ENSP00000330240:K241R	ENSP00000330240:K241R	K	-	2	0	CCDC34	27319558	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.337000	0.43947	1.975000	0.57531	0.482000	0.46254	AAG	CCDC34	-	NULL	ENSG00000109881		0.294	CCDC34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC34	HGNC	protein_coding	OTTHUMT00000388396.2	-	0.00	37	0	T	NM_030771		27362982	-1	tier1	-	no_errors	ENST00000328697	ensembl	human	known	74_37	missense	32.00	17	8	SNP	1.000	C
CCL4L2	388372	genome.wustl.edu	37	17	34641303	34641303	+	Intron	DEL	G	G	-			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr17:34641303delG	ENST00000394465.2	+	3	508				TBC1D3C_ENST00000451448.2_Intron|CCL4L2_ENST00000378342.4_Frame_Shift_Del_p.C41fs|CCL4L2_ENST00000482104.1_3'UTR|CCL4L2_ENST00000394463.2_Intron|CCL4L2_ENST00000339270.6_Intron|TBC1D3H_ENST00000400684.4_Intron|TBC1D3H_ENST00000535446.1_Intron|TBC1D3C_ENST00000308078.7_Intron			Q8NHW4	CC4L_HUMAN	chemokine (C-C motif) ligand 4-like 2						cell chemotaxis (GO:0060326)|immune response (GO:0006955)|inflammatory response (GO:0006954)	extracellular space (GO:0005615)				endometrium(1)	1		Breast(25;0.102)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		tgcttccagtgctgctcgagg	0.552																																																	0																																										SO:0001627	intron_variant	0					17q12	2005-08-09			ENSG00000197262			"""Chemokine ligands"""	24066	protein-coding gene	gene with protein product		603782				15028295	Standard	NM_001291468		Approved		uc010cuj.3	Q8NHW4	OTTHUMG00000133066	ENST00000394465.2:c.192-147G>-	17.37:g.34641303delG			B2RUZ3|B7ZMA8|Q50EM1|Q50EM2|Q50EM3|Q50EM4|Q50EM5|Q50EM6|Q50EM7|Q50EM8|Q569J2|Q6NSB0	Frame_Shift_Del	DEL	NULL	p.C40fs	ENST00000394465.2	37	c.119	CCDS11311.1	17																																																																																			CCL4L2	-	NULL	ENSG00000197262		0.552	CCL4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCL4L2	HGNC	protein_coding	OTTHUMT00000256699.1		0.00	18	0	G	NM_207007		34641303	+1	tier1		no_errors	ENST00000378342	ensembl	human	known	74_37	frame_shift_del	60.00	2	3	DEL	0.000	-
CCSAP	126731	genome.wustl.edu	37	1	229462666	229462666	+	Missense_Mutation	SNP	C	C	T	rs140506323		TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr1:229462666C>T	ENST00000366687.1	-	2	506	c.455G>A	c.(454-456)cGa>cAa	p.R152Q	CCSAP_ENST00000366686.1_Missense_Mutation_p.R38Q|CCSAP_ENST00000483092.1_5'UTR|CCSAP_ENST00000284617.2_Missense_Mutation_p.R152Q			Q6IQ19	CCSAP_HUMAN	centriole, cilia and spindle-associated protein	152					multicellular organismal development (GO:0007275)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|regulation of embryonic development (GO:0045995)	axon (GO:0030424)|axoneme (GO:0005930)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary transition zone (GO:0035869)|cilium (GO:0005929)|spindle (GO:0005819)		p.R152Q(1)									TGGTTGCTGTCGAGGCTCAGT	0.418																																																	1	Substitution - Missense(1)	endometrium(1)						C	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	304.0	301.0	302.0		455	1.1	0.0	1	dbSNP_134	302	0,8600		0,0,4300	no	missense	C1orf96	NM_145257.3	43	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	152/271	229462666	1,13005	2203	4300	6503	SO:0001583	missense	0			BC071609	CCDS1577.1	1q42.13	2012-06-19	2012-06-19	2012-06-19	ENSG00000154429	ENSG00000154429			29578	protein-coding gene	gene with protein product	"""centriole and spindle-associated protein"""		"""chromosome 1 open reading frame 96"""	C1orf96		22493317	Standard	NM_145257		Approved	FLJ41471, CSAP	uc001htl.4	Q6IQ19	OTTHUMG00000037663	ENST00000366687.1:c.455G>A	1.37:g.229462666C>T	ENSP00000355648:p.Arg152Gln		A8K5X2|Q6P9G2|Q6ZW85|Q8IXU1|Q96BM2	Missense_Mutation	SNP	NULL	p.R152Q	ENST00000366687.1	37	c.455	CCDS1577.1	1	.	.	.	.	.	.	.	.	.	.	C	10.92	1.485734	0.26686	2.27E-4	0.0	ENSG00000154429	ENST00000366687;ENST00000284617;ENST00000366686	T;T;T	0.46451	0.93;0.93;0.87	5.7	1.15	0.20763	.	0.713556	0.13921	N	0.353564	T	0.25938	0.0632	L	0.33485	1.01	0.09310	N	0.999999	B	0.27971	0.196	B	0.17722	0.019	T	0.13845	-1.0494	10	0.21014	T	0.42	-12.2896	8.0729	0.30699	0.0:0.5931:0.2512:0.1557	.	152	Q6IQ19	CA096_HUMAN	Q	152;152;38	ENSP00000355648:R152Q;ENSP00000284617:R152Q;ENSP00000355647:R38Q	ENSP00000284617:R152Q	R	-	2	0	C1orf96	227529289	0.075000	0.21258	0.002000	0.10522	0.006000	0.05464	0.200000	0.17257	0.679000	0.31345	-0.140000	0.14226	CGA	CCSAP	-	NULL	ENSG00000154429		0.418	CCSAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCSAP	HGNC	protein_coding	OTTHUMT00000091839.1	-	0.00	111	0	C	NM_145257		229462666	-1	tier1	rs140506323	no_errors	ENST00000284617	ensembl	human	known	74_37	missense	7.38	113	9	SNP	0.000	T
CCSER1	401145	genome.wustl.edu	37	4	92519966	92519966	+	Missense_Mutation	SNP	T	T	G			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr4:92519966T>G	ENST00000509176.1	+	11	2749	c.2461T>G	c.(2461-2463)Tta>Gta	p.L821V	CCSER1_ENST00000333691.8_Missense_Mutation_p.L821V	NM_001145065.1	NP_001138537.1	Q9C0I3	CCSE1_HUMAN	coiled-coil serine-rich protein 1	821																	TACACAGAACTTACGGGCCAC	0.468																																																	0													93.0	82.0	85.0					4																	92519966		692	1591	2283	SO:0001583	missense	0				CCDS47099.1, CCDS47100.1	4q22.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184305	ENSG00000184305			29349	protein-coding gene	gene with protein product			"""family with sequence similarity 190, member A"""	FAM190A		11214970	Standard	NM_001145065		Approved	KIAA1680	uc003hsv.4	Q9C0I3	OTTHUMG00000160950	ENST00000509176.1:c.2461T>G	4.37:g.92519966T>G	ENSP00000425040:p.Leu821Val		Q4W5M0|Q86V57	Missense_Mutation	SNP	NULL	p.L821V	ENST00000509176.1	37	c.2461	CCDS47099.1	4	.	.	.	.	.	.	.	.	.	.	T	5.842	0.339594	0.11069	.	.	ENSG00000184305	ENST00000509176;ENST00000333691	T;T	0.31510	1.49;1.49	5.47	-0.0172	0.13969	.	.	.	.	.	T	0.14313	0.0346	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.24154	-1.0168	9	0.38643	T	0.18	-0.0367	7.1904	0.25822	0.0:0.1496:0.4645:0.3859	.	821	Q9C0I3	F190A_HUMAN	V	821	ENSP00000425040:L821V;ENSP00000329482:L821V	ENSP00000329482:L821V	L	+	1	2	FAM190A	92738989	0.000000	0.05858	0.000000	0.03702	0.518000	0.34316	0.456000	0.21859	-0.125000	0.11703	-0.321000	0.08615	TTA	CCSER1	-	NULL	ENSG00000184305		0.468	CCSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCSER1	HGNC	protein_coding	OTTHUMT00000363109.3	-	0.00	64	0	T	NM_001145065		92519966	+1	tier1	-	no_errors	ENST00000333691	ensembl	human	known	74_37	missense	35.19	35	19	SNP	0.000	G
CCT6P3	643180	genome.wustl.edu	37	7	64531299	64531299	+	RNA	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr7:64531299C>T	ENST00000426828.1	+	0	1107				SNORA15_ENST00000384334.1_RNA	NR_033416.1				chaperonin containing TCP1, subunit 6 (zeta) pseudogene 3																		TGTGTGGTTCCGGGTGCTGGT	0.413																																																	0																																												0					7q11.21	2010-06-29			ENSG00000234585	ENSG00000234585			35137	pseudogene	pseudogene							Standard	NR_033416		Approved		uc010kzt.1		OTTHUMG00000156630		7.37:g.64531299C>T				RNA	SNP	-	NULL	ENST00000426828.1	37	NULL		7																																																																																			CCT6P3	-	-	ENSG00000234585		0.413	CCT6P3-004	KNOWN	basic	processed_transcript	CCT6P3	HGNC	pseudogene	OTTHUMT00000344862.1	-	0.00	97	0	C			64531299	+1	tier1	-	no_errors	ENST00000426828	ensembl	human	known	74_37	rna	6.40	117	8	SNP	1.000	T
CD163	9332	genome.wustl.edu	37	12	7640028	7640028	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr12:7640028C>T	ENST00000359156.4	-	8	2179	c.1977G>A	c.(1975-1977)atG>atA	p.M659I	CD163_ENST00000396620.3_Missense_Mutation_p.M692I|CD163_ENST00000541972.1_Missense_Mutation_p.M647I|CD163_ENST00000539632.1_5'Flank|CD163_ENST00000432237.2_Missense_Mutation_p.M659I	NM_004244.5	NP_004235.4	Q86VB7	C163A_HUMAN	CD163 molecule	659	SRCR 6. {ECO:0000255|PROSITE- ProRule:PRU00196}.				acute-phase response (GO:0006953)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(6)|pancreas(2)|prostate(1)|skin(5)|urinary_tract(4)	76					WF10(DB05389)	GACAATCTCCCATGTGCTGCT	0.507																																																	0													123.0	108.0	113.0					12																	7640028		2203	4300	6503	SO:0001583	missense	0			Z22968	CCDS8578.1, CCDS53742.1	12p13	2006-03-28	2006-03-28		ENSG00000177575	ENSG00000177575		"""CD molecules"""	1631	protein-coding gene	gene with protein product		605545	"""CD163 antigen"""			10403791, 8370408	Standard	NM_004244		Approved	M130, MM130	uc001qsz.3	Q86VB7	OTTHUMG00000168353	ENST00000359156.4:c.1977G>A	12.37:g.7640028C>T	ENSP00000352071:p.Met659Ile		C9JIG2|Q07898|Q07899|Q07900|Q07901|Q2VLH7	Missense_Mutation	SNP	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,prints_SRCR,pfscan_SRCR	p.M659I	ENST00000359156.4	37	c.1977	CCDS8578.1	12	.	.	.	.	.	.	.	.	.	.	C	9.170	1.020903	0.19433	.	.	ENSG00000177575	ENST00000359156;ENST00000541972;ENST00000396620;ENST00000432237	T;T;T;T	0.32988	1.43;1.43;1.43;1.43	5.36	-3.52	0.04682	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.679503	0.14941	N	0.289510	T	0.05640	0.0148	N	0.00155	-1.965	0.20196	N	0.999928	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.0;0.001	T	0.40646	-0.9552	10	0.38643	T	0.18	.	7.3759	0.26829	0.1245:0.2826:0.0:0.593	.	692;659;659	C9JHR8;Q86VB7-3;Q86VB7	.;.;C163A_HUMAN	I	659;647;692;659	ENSP00000352071:M659I;ENSP00000444071:M647I;ENSP00000379863:M692I;ENSP00000403885:M659I	ENSP00000352071:M659I	M	-	3	0	CD163	7531295	0.000000	0.05858	0.063000	0.19743	0.798000	0.45092	-1.761000	0.01805	-0.714000	0.04975	-0.899000	0.02877	ATG	CD163	-	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR	ENSG00000177575		0.507	CD163-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD163	HGNC	protein_coding	OTTHUMT00000399396.2		0.00	18	0	C	NM_004244, NM_203416		7640028	-1			no_errors	ENST00000359156	ensembl	human	known	74_37	missense	13.33	13	2	SNP	0.165	T
CDC37L1	55664	genome.wustl.edu	37	9	4701964	4701964	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr9:4701964C>T	ENST00000381854.3	+	6	1050	c.848C>T	c.(847-849)aCa>aTa	p.T283I	CDC37L1_ENST00000381858.1_Missense_Mutation_p.T283I	NM_017913.2	NP_060383.2	Q7L3B6	CD37L_HUMAN	cell division cycle 37-like 1	283	Interaction with Hsp70.|Required for interaction with STIP1.					cytoplasm (GO:0005737)				breast(1)|kidney(1)|lung(2)	4	all_hematologic(13;0.137)	Breast(48;0.238)		GBM - Glioblastoma multiforme(50;0.0318)		CAACCTATGACAGTTCAGAAT	0.338																																																	0													96.0	88.0	91.0					9																	4701964		2203	4298	6501	SO:0001583	missense	0			AK000497	CCDS6454.1	9p24.1	2013-01-17	2013-01-17		ENSG00000106993	ENSG00000106993			17179	protein-coding gene	gene with protein product		610346	"""CDC37 cell division cycle 37 homolog (S. cerevisiae)-like 1"", ""cell division cycle 37 homolog (S. cerevisiae)-like 1"""				Standard	NM_017913		Approved	HARC, FLJ20639, CDC37B	uc003zio.3	Q7L3B6	OTTHUMG00000019465	ENST00000381854.3:c.848C>T	9.37:g.4701964C>T	ENSP00000371278:p.Thr283Ile		B1AL70|Q9NWS3|Q9NX16	Missense_Mutation	SNP	pfam_Cdc37_Hsp90-bd	p.T283I	ENST00000381854.3	37	c.848	CCDS6454.1	9	.	.	.	.	.	.	.	.	.	.	C	9.096	1.002895	0.19121	.	.	ENSG00000106993	ENST00000381858;ENST00000381854	T;T	0.44881	0.91;0.91	5.82	3.99	0.46301	.	0.698156	0.14455	N	0.318535	T	0.18800	0.0451	N	0.02011	-0.69	0.09310	N	1	B	0.11235	0.004	B	0.19666	0.026	T	0.18398	-1.0338	10	0.44086	T	0.13	-24.3257	8.3889	0.32516	0.0:0.6883:0.0:0.3117	.	283	Q7L3B6	CD37L_HUMAN	I	283	ENSP00000371282:T283I;ENSP00000371278:T283I	ENSP00000371278:T283I	T	+	2	0	CDC37L1	4691964	0.053000	0.20554	0.995000	0.50966	0.950000	0.60333	0.791000	0.26915	0.802000	0.34089	0.655000	0.94253	ACA	CDC37L1	-	NULL	ENSG00000106993		0.338	CDC37L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC37L1	HGNC	protein_coding	OTTHUMT00000051564.1	-	0.00	81	0	C	NM_017913		4701964	+1	tier1	-	no_errors	ENST00000381854	ensembl	human	known	74_37	missense	7.41	50	4	SNP	0.037	T
CDIPT	10423	genome.wustl.edu	37	16	29875648	29875648	+	5'Flank	SNP	G	G	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr16:29875648G>T	ENST00000219789.6	-	0	0				CDIPT_ENST00000569956.1_5'Flank|CDIPT_ENST00000570016.1_5'Flank|CDIPT_ENST00000566113.1_5'Flank|CDIPT-AS1_ENST00000565014.1_RNA|CDIPT-AS1_ENST00000398859.3_RNA|CDIPT_ENST00000561555.1_5'Flank|CDIPT_ENST00000563415.1_5'Flank	NM_006319.3	NP_006310.1	O14735	CDIPT_HUMAN	CDP-diacylglycerol--inositol 3-phosphatidyltransferase						CDP-diacylglycerol metabolic process (GO:0046341)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alcohol binding (GO:0043178)|carbohydrate binding (GO:0030246)|CDP-diacylglycerol-inositol 3-phosphatidyltransferase activity (GO:0003881)|diacylglycerol binding (GO:0019992)|manganese ion binding (GO:0030145)			endometrium(1)|lung(3)	4						ACTCCGATGGGGAATGAGGGG	0.602																																																	0																																										SO:0001631	upstream_gene_variant	0			AF014807	CCDS10657.1, CCDS67002.1	16p11.2	2012-11-19	2010-04-29		ENSG00000103502	ENSG00000103502	2.7.8.11		1769	protein-coding gene	gene with protein product	"""phosphatidylinositol synthase"""	605893	"""CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase)"""			9407135	Standard	NM_006319		Approved	PIS1, PIS	uc002dum.3	O14735	OTTHUMG00000177144		16.37:g.29875648G>T	Exception_encountered		B4DUV0|H3BTV1|Q6FGU1|Q6ZN70	RNA	SNP	-	NULL	ENST00000219789.6	37	NULL	CCDS10657.1	16	.	.	.	.	.	.	.	.	.	.	G	7.325	0.617705	0.14129	.	.	ENSG00000214725	ENST00000398859	.	.	.	4.48	-1.35	0.09114	.	.	.	.	.	T	0.39306	0.1073	.	.	.	.	.	.	.	.	.	.	.	.	T	0.48246	-0.9052	4	0.31617	T	0.26	.	7.7309	0.28786	0.5535:0.0:0.4465:0.0	.	.	.	.	V	7	.	ENSP00000381835:G7V	G	+	2	0	AC120114.1	29783149	0.035000	0.19736	0.071000	0.20095	0.050000	0.14768	0.102000	0.15272	-0.274000	0.09232	0.555000	0.69702	GGG	CDIPT-AS1	-	-	ENSG00000214725		0.602	CDIPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDIPT-AS1	HGNC	protein_coding	OTTHUMT00000255147.3	-	0.00	72	0	G	NM_006319		29875648	+1	tier1	-	no_errors	ENST00000398859	ensembl	human	known	74_37	rna	8.51	43	4	SNP	0.013	T
CDK5RAP1	51654	genome.wustl.edu	37	20	31984822	31984822	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr20:31984822C>T	ENST00000357886.4	-	2	202	c.49G>A	c.(49-51)Gga>Aga	p.G17R	CDK5RAP1_ENST00000477105.1_Intron|CDK5RAP1_ENST00000339269.5_Missense_Mutation_p.G17R|CDK5RAP1_ENST00000346416.2_Missense_Mutation_p.G17R|CDK5RAP1_ENST00000544843.1_Missense_Mutation_p.G17R|CDK5RAP1_ENST00000473997.1_Intron			Q96SZ6	CK5P1_HUMAN	CDK5 regulatory subunit associated protein 1	17					brain development (GO:0007420)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|regulation of neuron differentiation (GO:0045664)|tRNA modification (GO:0006400)	cytoplasm (GO:0005737)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|transferase activity (GO:0016740)			endometrium(2)|kidney(2)|large_intestine(3)|lung(12)|ovary(3)|skin(3)|urinary_tract(1)	26						GCCAATGGTCCCCACCCCAGA	0.547																																																	0													90.0	82.0	84.0					20																	31984822		2203	4300	6503	SO:0001583	missense	0			AF152097	CCDS13219.1, CCDS63255.1	20q11.21	2012-09-20	2002-07-22	2002-07-26	ENSG00000101391	ENSG00000101391			15880	protein-coding gene	gene with protein product		608200	"""chromosome 20 open reading frame 34"""	C20orf34		10721722, 11882646, 15329498	Standard	NM_016408		Approved	CGI-05, HSPC167, C42	uc002wyy.4	Q96SZ6	OTTHUMG00000032256	ENST00000357886.4:c.49G>A	20.37:g.31984822C>T	ENSP00000350558:p.Gly17Arg		A8K7R0|Q5QP46|Q5QP47|Q5QP48|Q675N4|Q675N5|Q9BVG6|Q9BWZ5|Q9H859|Q9NZZ9|Q9Y3F0	Missense_Mutation	SNP	pfam_rSAM,pfam_Methylthiotransferase_N,pfam_TRAM_dom,smart_Elp3/MiaB/NifB,pfscan_TRAM_dom,tigrfam_MiaB_methiolase,tigrfam_Methylthiotransferase	p.G17R	ENST00000357886.4	37	c.49		20	.	.	.	.	.	.	.	.	.	.	C	5.099	0.203835	0.09704	.	.	ENSG00000101391	ENST00000346416;ENST00000357886;ENST00000339269;ENST00000544843	.	.	.	5.05	0.537	0.17144	.	1.004790	0.08004	N	0.989205	T	0.20536	0.0494	N	0.22421	0.69	0.09310	N	1	B;B;B;B;B;B	0.06786	0.001;0.0;0.001;0.001;0.001;0.001	B;B;B;B;B;B	0.08055	0.001;0.002;0.001;0.001;0.001;0.003	T	0.28004	-1.0057	9	0.42905	T	0.14	-0.8964	1.0968	0.01675	0.1844:0.4311:0.1792:0.2052	.	17;17;17;17;17;17	Q675N4;Q96SZ6-4;Q96SZ6;Q675N5;Q53H36;Q96SZ6-3	.;.;CK5P1_HUMAN;.;.;.	R	17	.	ENSP00000341840:G17R	G	-	1	0	CDK5RAP1	31448483	0.000000	0.05858	0.000000	0.03702	0.059000	0.15707	-0.211000	0.09332	0.277000	0.22141	0.491000	0.48974	GGA	CDK5RAP1	-	NULL	ENSG00000101391		0.547	CDK5RAP1-011	KNOWN	basic	protein_coding	CDK5RAP1	HGNC	protein_coding	OTTHUMT00000078697.1	-	0.00	33	0	C	NM_016408		31984822	-1	tier1	-	no_errors	ENST00000357886	ensembl	human	known	74_37	missense	48.89	23	22	SNP	0.000	T
CELF2	10659	genome.wustl.edu	37	10	11356187	11356187	+	Silent	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr10:11356187C>T	ENST00000379261.4	+	10	1133	c.1041C>T	c.(1039-1041)gcC>gcT	p.A347A	CELF2_ENST00000417956.2_Silent_p.A323A|CELF2_ENST00000354897.3_Silent_p.A323A|CELF2_ENST00000537122.1_Silent_p.A236A|CELF2_ENST00000542579.1_Silent_p.A354A|CELF2_ENST00000608830.1_Silent_p.A323A|CELF2_ENST00000399850.3_Silent_p.A323A|CELF2-AS1_ENST00000379256.3_RNA|CELF2_ENST00000427450.1_Silent_p.A323A|CELF2_ENST00000354440.2_Silent_p.A323A|CELF2_ENST00000450189.1_Silent_p.A354A|CELF2_ENST00000416382.2_Silent_p.A347A|CELF2_ENST00000609692.1_Silent_p.A323A|CELF2_ENST00000315874.4_Silent_p.A323A	NM_001025077.2	NP_001020248.1	O95319	CELF2_HUMAN	CUGBP, Elav-like family member 2	347	Ala-rich.				mRNA processing (GO:0006397)|regulation of heart contraction (GO:0008016)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	16						TGGCTGGAGCCACTGTTGGAC	0.498																																																	0													84.0	83.0	83.0					10																	11356187		1936	4139	6075	SO:0001819	synonymous_variant	0			U69546	CCDS41488.1, CCDS44354.1, CCDS44355.1, CCDS44356.1	10p13	2013-02-12	2010-02-19	2010-02-19	ENSG00000048740	ENSG00000048740		"""RNA binding motif (RRM) containing"""	2550	protein-coding gene	gene with protein product		602538	"""CUG triplet repeat, RNA-binding protein 2"", ""CUG triplet repeat, RNA binding protein 2"""	CUGBP2		7869393, 9887331	Standard	NM_006561		Approved	Etr-3, NAPOR-2, BRUNOL3	uc001ikl.4	O95319	OTTHUMG00000017668	ENST00000379261.4:c.1041C>T	10.37:g.11356187C>T			B7ZAN9|Q7KYU4|Q8N499|Q92950|Q96NW9|Q96RQ5|Q96RQ6|Q9UL67	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,prints_Hud_Sxl_RNA	p.A354	ENST00000379261.4	37	c.1062	CCDS44354.1	10																																																																																			CELF2	-	NULL	ENSG00000048740		0.498	CELF2-201	KNOWN	basic|CCDS	protein_coding	CELF2	HGNC	protein_coding		-	0.00	48	0	C			11356187	+1	tier1	-	no_errors	ENST00000450189	ensembl	human	known	74_37	silent	31.71	28	13	SNP	1.000	T
CELSR1	9620	genome.wustl.edu	37	22	46780441	46780441	+	Splice_Site	DEL	T	T	-			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr22:46780441delT	ENST00000262738.3	-	20	6881	c.6882delA	c.(6880-6882)aaa>aa	p.K2294fs		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	2294					anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		CGGTTTTACCTTTTTCTTCAG	0.612																																																	0													36.0	38.0	37.0					22																	46780441		2203	4300	6503	SO:0001630	splice_region_variant	0			AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.6883+1A>-	22.37:g.46780441delT			O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Frame_Shift_Del	DEL	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EG-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.E2295fs	ENST00000262738.3	37	c.6882	CCDS14076.1	22																																																																																			CELSR1	-	pfam_DUF3497	ENSG00000075275		0.612	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR1	HGNC	protein_coding	OTTHUMT00000318037.1		0.00	45	0	T	NM_014246	Frame_Shift_Del	46780441	-1	tier1		no_errors	ENST00000262738	ensembl	human	known	74_37	frame_shift_del	9.52	19	2	DEL	0.959	-
CGN	57530	genome.wustl.edu	37	1	151491490	151491490	+	Silent	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr1:151491490C>T	ENST00000271636.7	+	2	628	c.495C>T	c.(493-495)tcC>tcT	p.S165S		NM_020770.2	NP_065821.1	Q9P2M7	CING_HUMAN	cingulin	159	Head.|Interacts with ZO-2.				transforming growth factor beta receptor signaling pathway (GO:0007179)	cell junction (GO:0030054)|myosin complex (GO:0016459)|tight junction (GO:0005923)	actin binding (GO:0003779)|motor activity (GO:0003774)			NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			AAGTGGCTTCCCCAGGTAGCA	0.592																																																	0													73.0	75.0	74.0					1																	151491490		2203	4300	6503	SO:0001819	synonymous_variant	0			AB037740	CCDS999.1	1q21	2008-02-05			ENSG00000143375	ENSG00000143375			17429	protein-coding gene	gene with protein product		609473				11042084, 12529927	Standard	NM_020770		Approved	KIAA1319	uc009wmw.3	Q9P2M7	OTTHUMG00000012497	ENST00000271636.7:c.495C>T	1.37:g.151491490C>T			A6H8L3|A7MD22|Q5T386|Q9NR25	Silent	SNP	pfam_Myosin_tail	p.S165	ENST00000271636.7	37	c.495	CCDS999.1	1																																																																																			CGN	-	NULL	ENSG00000143375		0.592	CGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CGN	HGNC	protein_coding	OTTHUMT00000034900.3	-	0.00	35	0	C	NM_020770		151491490	+1	tier1	-	no_errors	ENST00000271636	ensembl	human	known	74_37	silent	44.83	16	13	SNP	0.259	T
CLN3	1201	genome.wustl.edu	37	16	28503113	28503113	+	5'UTR	SNP	G	G	A	rs368494637		TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr16:28503113G>A	ENST00000569430.1	-	0	787				CLN3_ENST00000357857.9_5'UTR|CLN3_ENST00000395653.4_5'UTR|CLN3_ENST00000333496.9_5'UTR|CLN3_ENST00000357806.7_5'UTR|CLN3_ENST00000360019.2_5'UTR|CLN3_ENST00000354630.5_5'UTR|CLN3_ENST00000567160.1_5'Flank|CLN3_ENST00000355477.5_5'UTR|CLN3_ENST00000357076.5_5'UTR|APOBR_ENST00000431282.1_5'Flank|CLN3_ENST00000535392.1_5'UTR|APOBR_ENST00000564831.1_5'Flank|APOBR_ENST00000328423.5_5'Flank|CLN3_ENST00000567963.1_5'UTR|CLN3_ENST00000568224.1_5'UTR|CLN3_ENST00000565316.1_5'Flank|CLN3_ENST00000359984.7_5'UTR			Q13286	CLN3_HUMAN	ceroid-lipofuscinosis, neuronal 3						action potential (GO:0001508)|amyloid precursor protein catabolic process (GO:0042987)|arginine transport (GO:0015809)|associative learning (GO:0008306)|autophagic vacuole fusion (GO:0000046)|cell death (GO:0008219)|cellular amino acid metabolic process (GO:0006520)|ceramide metabolic process (GO:0006672)|cytosolic calcium ion homeostasis (GO:0051480)|galactosylceramide metabolic process (GO:0006681)|globoside metabolic process (GO:0001575)|glucosylceramide metabolic process (GO:0006678)|ionotropic glutamate receptor signaling pathway (GO:0035235)|lysosomal lumen acidification (GO:0007042)|lysosomal lumen pH elevation (GO:0035752)|lysosome organization (GO:0007040)|macroautophagy (GO:0016236)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of macroautophagy (GO:0016242)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of proteolysis (GO:0045861)|neuromuscular process controlling balance (GO:0050885)|neurotransmitter metabolic process (GO:0042133)|protein catabolic process (GO:0030163)|protein processing (GO:0016485)|receptor-mediated endocytosis (GO:0006898)|sphingomyelin metabolic process (GO:0006684)|vacuolar transport (GO:0007034)|vesicle transport along microtubule (GO:0047496)	autophagic vacuole (GO:0005776)|caveola (GO:0005901)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|trans-Golgi network (GO:0005802)	unfolded protein binding (GO:0051082)			breast(1)|large_intestine(2)|lung(11)|upper_aerodigestive_tract(1)	15						AGGGTCCAGGGTCATAGAGTG	0.637											OREG0023706	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													34.0	36.0	35.0					16																	28503113		2197	4300	6497	SO:0001623	5_prime_UTR_variant	0			U32680	CCDS10632.1, CCDS73852.1, CCDS73853.1, CCDS73854.1, CCDS73855.1	16p12	2014-09-17	2008-07-29		ENSG00000188603	ENSG00000188603			2074	protein-coding gene	gene with protein product	"""juvenile neuronal ceroid lipofuscinosis"""	607042	"""Batten, Spielmeyer-Vogt disease"""	BTS		18317235	Standard	NM_001042432		Approved	JNCL	uc002dpp.3	Q13286	OTTHUMG00000097024	ENST00000569430.1:c.-33C>T	16.37:g.28503113G>A		802	B2R7J1|O00668|O95089|Q549S9|Q9UP09|Q9UP11|Q9UP12|Q9UP13|Q9UP14	RNA	SNP	-	NULL	ENST00000569430.1	37	NULL	CCDS10632.1	16																																																																																			CLN3	-	-	ENSG00000188603		0.637	CLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLN3	HGNC	protein_coding	OTTHUMT00000214115.2	-	0.00	44	0	G			28503113	-1	tier1	-	no_errors	ENST00000565047	ensembl	human	known	74_37	rna	42.31	15	11	SNP	0.081	A
CNTNAP5	129684	genome.wustl.edu	37	2	125204490	125204490	+	Silent	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr2:125204490G>A	ENST00000431078.1	+	6	1258	c.894G>A	c.(892-894)acG>acA	p.T298T		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	298	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		AGGGCGAGACGGATGCCTTAG	0.557																																																	0													106.0	111.0	109.0					2																	125204490		2170	4274	6444	SO:0001819	synonymous_variant	0			AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.894G>A	2.37:g.125204490G>A			Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Silent	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.T298	ENST00000431078.1	37	c.894	CCDS46401.1	2																																																																																			CNTNAP5	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	ENSG00000155052		0.557	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP5	HGNC	protein_coding	OTTHUMT00000330864.3	-	0.00	22	0	G			125204490	+1	tier1	-	no_errors	ENST00000431078	ensembl	human	known	74_37	silent	31.82	15	7	SNP	0.003	A
COL18A1	80781	genome.wustl.edu	37	21	46895411	46895411	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr21:46895411G>A	ENST00000359759.4	+	4	2026	c.2005G>A	c.(2005-2007)Ggg>Agg	p.G669R	COL18A1_ENST00000355480.5_Missense_Mutation_p.G434R|COL18A1_ENST00000400337.2_Missense_Mutation_p.G254R			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	669	Nonhelical region 1 (NC1).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		CTCTGGCAGCGGGCTCGGGGA	0.692																																																	0													16.0	18.0	17.0					21																	46895411		1866	4083	5949	SO:0001583	missense	0				CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.2005G>A	21.37:g.46895411G>A	ENSP00000352798:p.Gly669Arg		A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Missense_Mutation	SNP	pfam_Collagenase_NC10/endostatin,pfam_DUF959_COL18_N,pfam_Collagen,pfam_Frizzled_dom,superfamily_C-type_lectin_fold,superfamily_ConA-like_lec_gl_sf,superfamily_Frizzled_dom,smart_Frizzled_dom,smart_Laminin_G,pfscan_Frizzled_dom	p.G669R	ENST00000359759.4	37	c.2005		21	.	.	.	.	.	.	.	.	.	.	G	13.76	2.333790	0.41297	.	.	ENSG00000182871	ENST00000400337;ENST00000400347;ENST00000355480;ENST00000359759;ENST00000539645	T;T;T	0.50548	0.74;0.74;0.74	2.98	2.98	0.34508	.	0.259771	0.36409	N	0.002604	T	0.58409	0.2120	L	0.49778	1.585	0.42832	D	0.994027	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	T	0.60110	-0.7327	10	0.56958	D	0.05	.	9.7232	0.40315	0.0:0.0:1.0:0.0	.	669;434;254	P39060;P39060-1;P39060-2	COIA1_HUMAN;.;.	R	254;254;434;669;669	ENSP00000383191:G254R;ENSP00000347665:G434R;ENSP00000352798:G669R	ENSP00000347665:G434R	G	+	1	0	COL18A1	45719839	0.997000	0.39634	0.746000	0.31095	0.019000	0.09904	4.422000	0.59854	1.983000	0.57843	0.196000	0.17591	GGG	COL18A1	-	NULL	ENSG00000182871		0.692	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	COL18A1	HGNC	protein_coding	OTTHUMT00000206827.1	-	0.00	73	0	G			46895411	+1	tier1	-	no_errors	ENST00000359759	ensembl	human	known	74_37	missense	18.97	47	11	SNP	0.786	A
COL5A1	1289	genome.wustl.edu	37	9	137600549	137600549	+	Intron	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr9:137600549G>A	ENST00000371817.3	+	4	1068				COL5A1_ENST00000464187.1_3'UTR	NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1						axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		TCTTGCCCCTGGAAGGGACAA	0.587																																																	0													21.0	20.0	20.0					9																	137600549		873	1986	2859	SO:0001627	intron_variant	0			D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.654+7370G>A	9.37:g.137600549G>A			Q15094|Q5SUX4	RNA	SNP	-	NULL	ENST00000371817.3	37	NULL	CCDS6982.1	9																																																																																			COL5A1	-	-	ENSG00000130635		0.587	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A1	HGNC	protein_coding	OTTHUMT00000054954.2	-	0.00	30	0	G	NM_000093		137600549	+1	tier1	-	no_errors	ENST00000464187	ensembl	human	known	74_37	rna	76.92	3	10	SNP	0.064	A
CSNK1A1	1452	genome.wustl.edu	37	5	148899876	148899876	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr5:148899876C>T	ENST00000377843.2	-	4	912	c.433G>A	c.(433-435)Ggt>Agt	p.G145S	CSNK1A1_ENST00000515768.1_Missense_Mutation_p.G145S|CSNK1A1_ENST00000504676.1_Missense_Mutation_p.G56S|CSNK1A1_ENST00000261798.5_Missense_Mutation_p.G145S|CSNK1A1_ENST00000515435.1_Missense_Mutation_p.G56S	NM_001025105.1|NM_001892.4	NP_001020276.1|NP_001883.4	P48729	KC1A_HUMAN	casein kinase 1, alpha 1	145	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell surface receptor signaling pathway (GO:0007166)|mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear speck (GO:0016607)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(4)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.0407)		CGCCCAATACCCATTAGGAAG	0.333																																					Colon(5;64 69 1309 10383)												0													96.0	98.0	97.0					5																	148899876		2174	4289	6463	SO:0001583	missense	0			AF119911	CCDS47303.1, CCDS47304.1, CCDS64291.1	5q32	2013-01-17			ENSG00000113712	ENSG00000113712			2451	protein-coding gene	gene with protein product	"""clock regulator kinase"""	600505				8050587	Standard	NM_001025105		Approved	CK1, CK1a, CK1alpha, CKIa, CKIalpha	uc003lqw.2	P48729	OTTHUMG00000163463	ENST00000377843.2:c.433G>A	5.37:g.148899876C>T	ENSP00000367074:p.Gly145Ser		D3DQG0|D3DQG1|Q4JJA0|Q5U046|Q5U047|Q6FGA2|Q71TU5|Q96HD2|Q9UDK3	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	p.G145S	ENST00000377843.2	37	c.433	CCDS47303.1	5	.	.	.	.	.	.	.	.	.	.	C	33	5.265572	0.95399	.	.	ENSG00000113712	ENST00000261798;ENST00000377843;ENST00000504676;ENST00000515435;ENST00000322237;ENST00000515768	T;T;T;T;T	0.63417	-0.04;-0.04;-0.04;-0.04;-0.04	5.75	5.75	0.90469	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	U	0.000000	D	0.85039	0.5606	M	0.92317	3.295	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.87902	0.2691	10	0.87932	D	0	.	19.933	0.97127	0.0:1.0:0.0:0.0	.	56;56;145;145;145;56	B4DER9;E7ETM0;Q71TU5;P48729;P48729-2;D6REM4	.;.;.;KC1A_HUMAN;.;.	S	145;145;56;56;145;145	ENSP00000261798:G145S;ENSP00000367074:G145S;ENSP00000426747:G56S;ENSP00000427031:G56S;ENSP00000421689:G145S	ENSP00000261798:G145S	G	-	1	0	CSNK1A1	148880069	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.711000	0.92665	0.655000	0.94253	GGT	CSNK1A1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	ENSG00000113712		0.333	CSNK1A1-201	KNOWN	basic|CCDS	protein_coding	CSNK1A1	HGNC	protein_coding		-	0.00	94	0	C	NM_001892		148899876	-1	tier1	-	no_errors	ENST00000515768	ensembl	human	known	74_37	missense	75.86	14	44	SNP	1.000	T
DIDO1	11083	genome.wustl.edu	37	20	61511340	61511340	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr20:61511340C>A	ENST00000266070.4	-	16	6293	c.5968G>T	c.(5968-5970)Ggt>Tgt	p.G1990C	DIDO1_ENST00000395343.1_Missense_Mutation_p.G1990C	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	1990	Pro-rich.				apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					CGTAGTCCACCAAACTGCAGG	0.597																																					Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)												0													106.0	126.0	119.0					20																	61511340		2202	4299	6501	SO:0001583	missense	0			AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.5968G>T	20.37:g.61511340C>A	ENSP00000266070:p.Gly1990Cys		A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	pfam_TFIIS_cen_dom,pfam_SPOC_C,pfam_Znf_PHD-finger,superfamily_TFIIS_cen_dom,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_TFS2M,pfscan_Znf_PHD-finger	p.G1990C	ENST00000266070.4	37	c.5968	CCDS33506.1	20	.	.	.	.	.	.	.	.	.	.	C	12.90	2.076542	0.36662	.	.	ENSG00000101191	ENST00000266070;ENST00000395343	T;T	0.10382	2.88;2.88	4.91	1.87	0.25490	.	0.378437	0.18629	N	0.135625	T	0.19685	0.0473	L	0.55481	1.735	0.80722	D	1	D	0.71674	0.998	P	0.58013	0.831	T	0.00724	-1.1593	10	0.59425	D	0.04	-7.3074	8.675	0.34174	0.0:0.7473:0.1255:0.1272	.	1990	Q9BTC0	DIDO1_HUMAN	C	1990	ENSP00000266070:G1990C;ENSP00000378752:G1990C	ENSP00000266070:G1990C	G	-	1	0	DIDO1	60981785	0.998000	0.40836	0.001000	0.08648	0.036000	0.12997	2.479000	0.45197	0.203000	0.20529	0.561000	0.74099	GGT	DIDO1	-	NULL	ENSG00000101191		0.597	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIDO1	HGNC	protein_coding	OTTHUMT00000080091.2	-	0.00	73	0	C	NM_080796		61511340	-1	tier1	-	no_errors	ENST00000266070	ensembl	human	known	74_37	missense	32.28	86	41	SNP	0.923	A
DNAJC13	23317	genome.wustl.edu	37	3	132169579	132169579	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr3:132169579C>T	ENST00000260818.6	+	6	673	c.425C>T	c.(424-426)cCt>cTt	p.P142L	DNAJC13_ENST00000486798.1_3'UTR	NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	142					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						CAAATTAATCCTGCAACCAAC	0.368																																																	0													60.0	63.0	62.0					3																	132169579		2203	4298	6501	SO:0001583	missense	0			AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.425C>T	3.37:g.132169579C>T	ENSP00000260818:p.Pro142Leu		Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Missense_Mutation	SNP	pfam_DnaJ_domain,superfamily_ARM-type_fold,superfamily_GYF,smart_DnaJ_domain,pfscan_DnaJ_domain	p.P142L	ENST00000260818.6	37	c.425	CCDS33857.1	3	.	.	.	.	.	.	.	.	.	.	C	22.1	4.242634	0.79912	.	.	ENSG00000138246	ENST00000260818	T	0.17691	2.26	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.24314	0.0589	M	0.72118	2.19	0.80722	D	1	B;B	0.30870	0.298;0.005	B;B	0.25291	0.059;0.004	T	0.01863	-1.1258	10	0.40728	T	0.16	.	20.0371	0.97565	0.0:1.0:0.0:0.0	.	142;142	A7E2Y5;O75165	.;DJC13_HUMAN	L	142	ENSP00000260818:P142L	ENSP00000260818:P142L	P	+	2	0	DNAJC13	133652269	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	5.884000	0.69729	2.734000	0.93682	0.655000	0.94253	CCT	DNAJC13	-	NULL	ENSG00000138246		0.368	DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC13	HGNC	protein_coding	OTTHUMT00000356807.2	-	0.00	192	0	C	NM_015268		132169579	+1	tier1	-	no_errors	ENST00000260818	ensembl	human	known	74_37	missense	34.11	85	44	SNP	1.000	T
DOCK11	139818	genome.wustl.edu	37	X	117773511	117773511	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chrX:117773511G>A	ENST00000276202.7	+	38	4178	c.4115G>A	c.(4114-4116)aGc>aAc	p.S1372N	DOCK11_ENST00000276204.6_Missense_Mutation_p.S1372N	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	1372					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.S1372I(1)		breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						CATCTTAGTAGCCTAGAAAGT	0.408																																																	1	Substitution - Missense(1)	lung(1)											77.0	66.0	70.0					X																	117773511		2203	4300	6503	SO:0001583	missense	0			AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.4115G>A	X.37:g.117773511G>A	ENSP00000276202:p.Ser1372Asn		A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Missense_Mutation	SNP	pfam_DOCK_C,pfam_DOCK_C/D_N,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.S1372N	ENST00000276202.7	37	c.4115	CCDS35373.1	X	.	.	.	.	.	.	.	.	.	.	G	17.29	3.352478	0.61293	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	T;T	0.02085	4.46;4.46	5.12	5.12	0.69794	.	0.145260	0.64402	D	0.000012	T	0.09379	0.0231	M	0.71581	2.175	0.40204	D	0.977559	P;P	0.51791	0.948;0.948	P;P	0.54965	0.765;0.765	T	0.06373	-1.0830	10	0.42905	T	0.14	-17.9158	18.0422	0.89322	0.0:0.0:1.0:0.0	.	1372;1372	A6NIW2;Q5JSL3	.;DOC11_HUMAN	N	1372	ENSP00000276204:S1372N;ENSP00000276202:S1372N	ENSP00000276202:S1372N	S	+	2	0	DOCK11	117657539	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.560000	0.60802	2.284000	0.76573	0.468000	0.43344	AGC	DOCK11	-	NULL	ENSG00000147251		0.408	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	DOCK11	HGNC	protein_coding	OTTHUMT00000356002.1	-	0.00	60	0	G	NM_144658		117773511	+1	tier1	-	no_errors	ENST00000276202	ensembl	human	known	74_37	missense	37.97	49	30	SNP	1.000	A
DTL	51514	genome.wustl.edu	37	1	212241589	212241589	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr1:212241589G>A	ENST00000366991.4	+	9	1051	c.737G>A	c.(736-738)cGt>cAt	p.R246H	DTL_ENST00000475419.1_Intron|DTL_ENST00000542077.1_Missense_Mutation_p.R204H	NM_016448.2	NP_057532.2	Q9NZJ0	DTL_HUMAN	denticleless E3 ubiquitin protein ligase homolog (Drosophila)	246					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|G2 DNA damage checkpoint (GO:0031572)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|regulation of cell cycle (GO:0051726)|response to UV (GO:0009411)|translesion synthesis (GO:0019985)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|chromosome (GO:0005694)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(81;0.00796)|all cancers(67;0.0385)|Epithelial(68;0.102)		TGGGATTTACGTAAGAATTAT	0.368																																																	0													88.0	85.0	86.0					1																	212241589		2203	4300	6503	SO:0001583	missense	0			AF195765	CCDS1502.1, CCDS65778.1	1q32	2013-01-10	2012-02-23		ENSG00000143476	ENSG00000143476		"""DDB1 and CUL4 associated factors"", ""WD repeat domain containing"""	30288	protein-coding gene	gene with protein product	"""RA regulated nuclear matrix associated protein"", ""DDB1 and CUL4 associated factor 2"""	610617	"""denticleless homolog (Drosophila)"""			11278750	Standard	NM_001286229		Approved	RAMP, L2DTL, DCAF2	uc009xdc.3	Q9NZJ0	OTTHUMG00000037133	ENST00000366991.4:c.737G>A	1.37:g.212241589G>A	ENSP00000355958:p.Arg246His		A8K8H8|D3DT98|Q5VT77|Q96SN0|Q9NW03|Q9NW34|Q9NWM5	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R246H	ENST00000366991.4	37	c.737	CCDS1502.1	1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.664937	0.88251	.	.	ENSG00000143476	ENST00000366991;ENST00000542077	T;T	0.23147	1.92;1.92	5.58	4.64	0.57946	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.58090	0.2098	M	0.91196	3.185	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.67146	-0.5744	10	0.59425	D	0.04	-12.4337	12.8929	0.58082	0.0831:0.0:0.9169:0.0	.	204;246	F5GZ90;Q9NZJ0	.;DTL_HUMAN	H	246;204	ENSP00000355958:R246H;ENSP00000443870:R204H	ENSP00000355958:R246H	R	+	2	0	DTL	210308212	1.000000	0.71417	0.949000	0.38748	0.985000	0.73830	8.201000	0.89735	1.423000	0.47198	0.637000	0.83480	CGT	DTL	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000143476		0.368	DTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTL	HGNC	protein_coding	OTTHUMT00000090182.1	-	0.00	102	0	G	NM_016448		212241589	+1	tier1	-	no_errors	ENST00000366991	ensembl	human	known	74_37	missense	5.50	103	6	SNP	1.000	A
UPK3B	80761	genome.wustl.edu	37	7	76633620	76633620	+	Intron	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr7:76633620G>A	ENST00000419923.2	+	6	1408				UPK3B_ENST00000443097.2_Intron|DTX2P1-UPK3BP1-PMS2P11_ENST00000584900.1_RNA			Q9BT76	UPK3B_HUMAN	uroplakin 3B						negative regulation of gene expression (GO:0010629)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(1)|lung(1)|skin(2)	8		Myeloproliferative disorder(862;0.204)				GCCCAGGGCCGCAAGGTGAGT	0.682																																																	0																																										SO:0001627	intron_variant	0			BC004304	CCDS5588.1, CCDS5589.1, CCDS64693.1	7q11.2	2003-07-29			ENSG00000243566	ENSG00000243566			21444	protein-coding gene	gene with protein product	"""uroplakin IIIb"""	611887				12446744	Standard	XM_005250612		Approved	MGC10902, p35, UPIIIb, FLJ32198	uc003ufq.3	Q9BT76	OTTHUMG00000149929	ENST00000419923.2:c.961-14521G>A	7.37:g.76633620G>A			A6NHH5|A8K231|A8MZA8|B3KPU5|Q75MM5|Q86W06	RNA	SNP	-	NULL	ENST00000419923.2	37	NULL	CCDS5588.1	7																																																																																			DTX2P1-UPK3BP1-PMS2P11	-	-	ENSG00000265479		0.682	UPK3B-201	KNOWN	basic|CCDS	protein_coding	DTX2P1-UPK3BP1-PMS2P11	HGNC	protein_coding		-	0.00	214	0	G	NM_030570		76633620	+1	tier1	-	no_errors	ENST00000579700	ensembl	human	known	74_37	rna	8.49	248	23	SNP	0.998	A
EDN3	1908	genome.wustl.edu	37	20	57899499	57899499	+	Silent	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr20:57899499G>A	ENST00000337938.2	+	5	1088	c.702G>A	c.(700-702)caG>caA	p.Q234Q	EDN3_ENST00000311585.7_3'UTR|EDN3_ENST00000371025.3_3'UTR|EDN3_ENST00000395654.3_Silent_p.Q220Q|EDN3_ENST00000371028.2_Silent_p.Q234Q	NM_207034.1	NP_996917.1	P14138	EDN3_HUMAN	endothelin 3	234					blood circulation (GO:0008015)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|inositol phosphate-mediated signaling (GO:0048016)|melanocyte differentiation (GO:0030318)|multicellular organismal development (GO:0007275)|neural crest cell migration (GO:0001755)|neuron differentiation (GO:0030182)|neutrophil chemotaxis (GO:0030593)|peptide hormone secretion (GO:0030072)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart rate (GO:0010460)|positive regulation of hormone secretion (GO:0046887)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|regulation of developmental pigmentation (GO:0048070)|regulation of systemic arterial blood pressure by endothelin (GO:0003100)|regulation of vasoconstriction (GO:0019229)|signal transduction (GO:0007165)|vasoconstriction (GO:0042310)|vein smooth muscle contraction (GO:0014826)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)|receptor binding (GO:0005102)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	19	all_lung(29;0.0115)					GCCTCTTTCAGGAAGGAGCCC	0.562																																																	0													75.0	77.0	77.0					20																	57899499		2203	4300	6503	SO:0001819	synonymous_variant	0			X52001	CCDS13477.1, CCDS13478.1, CCDS13479.1	20q13.2-q13.3	2013-02-26			ENSG00000124205	ENSG00000124205		"""Endogenous ligands"""	3178	protein-coding gene	gene with protein product		131242					Standard	NM_000114		Approved	ET3	uc002yaq.3	P14138	OTTHUMG00000032867	ENST00000337938.2:c.702G>A	20.37:g.57899499G>A			E1P5I5|Q03229|Q7Z6D2|Q9UGT7	Silent	SNP	pfam_Endothln-like_toxin,smart_Endothln-like_toxin,prints_Bibrotoxin/Sarafotoxin-D	p.Q234	ENST00000337938.2	37	c.702	CCDS13477.1	20																																																																																			EDN3	-	NULL	ENSG00000124205		0.562	EDN3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EDN3	HGNC	protein_coding	OTTHUMT00000079919.2	-	0.00	17	0	G	NM_000114		57899499	+1	tier1	-	no_errors	ENST00000337938	ensembl	human	known	74_37	silent	45.00	11	9	SNP	0.001	A
EGFL7	51162	genome.wustl.edu	37	9	139562807	139562807	+	Missense_Mutation	SNP	C	C	T	rs372445708		TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr9:139562807C>T	ENST00000371699.1	+	3	984	c.73C>T	c.(73-75)Cgg>Tgg	p.R25W	EGFL7_ENST00000308874.7_Missense_Mutation_p.R25W|EGFL7_ENST00000371698.3_Missense_Mutation_p.R25W|EGFL7_ENST00000406555.3_Missense_Mutation_p.R25W|MIR126_ENST00000362291.1_RNA|EGFL7_ENST00000492002.1_Intron			Q9UHF1	EGFL7_HUMAN	EGF-like-domain, multiple 7	25					angiogenesis (GO:0001525)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|negative regulation of cell migration (GO:0030336)|negative regulation of Notch signaling pathway (GO:0045746)|positive regulation of endothelial cell proliferation (GO:0001938)|vasculogenesis (GO:0001570)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)			kidney(2)|ovary(1)|prostate(2)|urinary_tract(1)	6	all_cancers(76;0.109)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.87e-06)|Epithelial(140;0.000123)		GCACGCCTACCGGCCCGGGTG	0.697																																																	0								C	TRP/ARG,TRP/ARG	1,4363		0,1,2181	26.0	26.0	26.0		73,73	-0.3	0.7	9		26	0,8584		0,0,4292	no	missense,missense	EGFL7	NM_016215.4,NM_201446.2	101,101	0,1,6473	TT,TC,CC		0.0,0.0229,0.0077	probably-damaging,probably-damaging	25/274,25/274	139562807	1,12947	2182	4292	6474	SO:0001583	missense	0			AF186111	CCDS7002.1	9q34.3	2008-02-05			ENSG00000172889	ENSG00000172889			20594	protein-coding gene	gene with protein product		608582					Standard	NM_016215		Approved	ZNEU1	uc004cih.3	Q9UHF1	OTTHUMG00000020938	ENST00000371699.1:c.73C>T	9.37:g.139562807C>T	ENSP00000360764:p.Arg25Trp		B3KRP0|M9VTX9|Q5M7Y5|Q5VUD5|Q96EG0	Missense_Mutation	SNP	pfam_EMI_domain,pfam_EGF-like_Ca-bd_dom,pfam_EGF_extracell,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_EMI_domain	p.R25W	ENST00000371699.1	37	c.73	CCDS7002.1	9	.	.	.	.	.	.	.	.	.	.	C	11.34	1.609904	0.28712	2.29E-4	0.0	ENSG00000172889	ENST00000371699;ENST00000308874;ENST00000406555;ENST00000371698	D;D;D;D	0.84944	-1.92;-1.92;-1.92;-1.92	4.29	-0.266	0.12942	.	0.404744	0.26605	N	0.023443	D	0.83778	0.5328	M	0.65498	2.005	0.32912	D	0.514594	D	0.71674	0.998	P	0.49387	0.609	D	0.84005	0.0345	10	0.87932	D	0	-21.8943	7.7344	0.28806	0.4712:0.3842:0.1446:0.0	.	25	Q9UHF1	EGFL7_HUMAN	W	25	ENSP00000360764:R25W;ENSP00000307843:R25W;ENSP00000385639:R25W;ENSP00000360763:R25W	ENSP00000307843:R25W	R	+	1	2	EGFL7	138682628	0.000000	0.05858	0.703000	0.30354	0.025000	0.11179	-0.886000	0.04157	-0.253000	0.09514	0.448000	0.29417	CGG	EGFL7	-	NULL	ENSG00000172889		0.697	EGFL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EGFL7	HGNC	protein_coding	OTTHUMT00000055094.1	-	0.00	86	0	C	NM_016215		139562807	+1	tier1	-	no_errors	ENST00000308874	ensembl	human	known	74_37	missense	12.50	70	10	SNP	0.466	T
EGFL7	51162	genome.wustl.edu	37	9	139564780	139564780	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr9:139564780C>T	ENST00000371699.1	+	7	1480	c.569C>T	c.(568-570)aCa>aTa	p.T190I	EGFL7_ENST00000308874.7_Missense_Mutation_p.T190I|EGFL7_ENST00000371698.3_Missense_Mutation_p.T190I|EGFL7_ENST00000406555.3_Missense_Mutation_p.T190I|MIR126_ENST00000362291.1_RNA|EGFL7_ENST00000492002.1_3'UTR			Q9UHF1	EGFL7_HUMAN	EGF-like-domain, multiple 7	190					angiogenesis (GO:0001525)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|negative regulation of cell migration (GO:0030336)|negative regulation of Notch signaling pathway (GO:0045746)|positive regulation of endothelial cell proliferation (GO:0001938)|vasculogenesis (GO:0001570)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)			kidney(2)|ovary(1)|prostate(2)|urinary_tract(1)	6	all_cancers(76;0.109)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.87e-06)|Epithelial(140;0.000123)		CCCAACCCGACAGGTAAACAG	0.667																																																	0													8.0	10.0	9.0					9																	139564780		2135	4227	6362	SO:0001583	missense	0			AF186111	CCDS7002.1	9q34.3	2008-02-05			ENSG00000172889	ENSG00000172889			20594	protein-coding gene	gene with protein product		608582					Standard	NM_016215		Approved	ZNEU1	uc004cih.3	Q9UHF1	OTTHUMG00000020938	ENST00000371699.1:c.569C>T	9.37:g.139564780C>T	ENSP00000360764:p.Thr190Ile		B3KRP0|M9VTX9|Q5M7Y5|Q5VUD5|Q96EG0	Missense_Mutation	SNP	pfam_EMI_domain,pfam_EGF-like_Ca-bd_dom,pfam_EGF_extracell,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_EMI_domain	p.T190I	ENST00000371699.1	37	c.569	CCDS7002.1	9	.	.	.	.	.	.	.	.	.	.	C	3.859	-0.030339	0.07543	.	.	ENSG00000172889	ENST00000371699;ENST00000308874;ENST00000406555;ENST00000371698	D;D;D;D	0.84442	-1.85;-1.85;-1.85;-1.85	3.84	1.92	0.25849	.	2.407100	0.01314	N	0.010701	T	0.81574	0.4851	L	0.51422	1.61	0.26136	N	0.980345	B	0.26318	0.146	B	0.18871	0.023	T	0.62086	-0.6928	10	0.31617	T	0.26	0.0425	8.0612	0.30633	0.3206:0.5237:0.1556:0.0	.	190	Q9UHF1	EGFL7_HUMAN	I	190	ENSP00000360764:T190I;ENSP00000307843:T190I;ENSP00000385639:T190I;ENSP00000360763:T190I	ENSP00000307843:T190I	T	+	2	0	EGFL7	138684601	0.985000	0.35326	0.534000	0.28014	0.055000	0.15305	1.688000	0.37690	0.546000	0.28920	0.561000	0.74099	ACA	EGFL7	-	NULL	ENSG00000172889		0.667	EGFL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EGFL7	HGNC	protein_coding	OTTHUMT00000055094.1	-	0.00	36	0	C	NM_016215		139564780	+1	tier1	-	no_errors	ENST00000308874	ensembl	human	known	74_37	missense	56.41	17	22	SNP	0.445	T
EIF3J	8669	genome.wustl.edu	37	15	44828585	44828585	+	5'Flank	SNP	G	G	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr15:44828585G>T	ENST00000535391.1	+	0	0				EIF3J_ENST00000261868.5_5'Flank|EIF3J_ENST00000424492.3_5'Flank|EIF3J-AS1_ENST00000313807.4_lincRNA					eukaryotic translation initiation factor 3, subunit J											endometrium(1)|large_intestine(5)|liver(2)|skin(1)	9		all_cancers(109;2.81e-14)|all_epithelial(112;2.8e-12)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.0122)		all cancers(107;3.13e-20)|GBM - Glioblastoma multiforme(94;9.81e-07)|COAD - Colon adenocarcinoma(120;0.0754)|Colorectal(105;0.0758)		TCAATGTGCTGGCCTCAAAGG	0.488																																																	0																																										SO:0001631	upstream_gene_variant	0			U97670	CCDS10111.1, CCDS61612.1, CCDS61613.1	15q21.1	2014-05-13	2007-07-27	2007-07-27	ENSG00000104131	ENSG00000104131			3270	protein-coding gene	gene with protein product		603910	"""eukaryotic translation initiation factor 3, subunit 1 alpha, 35kDa"""	EIF3S1		9822659	Standard	NM_001284335		Approved	eIF3-p35, eIF3-alpha, eIF3j	uc001ztv.3	O75822	OTTHUMG00000131158		15.37:g.44828585G>T	Exception_encountered			RNA	SNP	-	NULL	ENST00000535391.1	37	NULL		15																																																																																			EIF3J-AS1	-	-	ENSG00000179523		0.488	EIF3J-002	NOVEL	basic|exp_conf	protein_coding	EIF3J-AS1	HGNC	protein_coding	OTTHUMT00000396804.1		0.00	29	0	G	NM_003758		44828585	-1			no_errors	ENST00000313807	ensembl	human	known	74_37	rna	8.82	31	3	SNP	0.062	T
AC024132.1	0	genome.wustl.edu	37	4	27209597	27209597	+	lincRNA	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr4:27209597G>A	ENST00000382007.1	-	0	2038																											CCTGGAACTCGCCCTCATCAA	0.483																																																	0													93.0	81.0	84.0					4																	27209597		692	1591	2283			0																															4.37:g.27209597G>A				RNA	SNP	-	NULL	ENST00000382007.1	37	NULL		4																																																																																			AC024132.1	-	-	ENSG00000205830		0.483	AC024132.1-001	KNOWN	basic	lincRNA	ENSG00000205830	Clone_based_vega_gene	lincRNA	OTTHUMT00000319578.1	-	0.00	42	0	G			27209597	-1	tier1	-	no_errors	ENST00000382007	ensembl	human	known	74_37	rna	30.00	14	6	SNP	0.000	A
RP11-782C8.2	0	genome.wustl.edu	37	1	143209786	143209787	+	lincRNA	INS	-	-	T	rs531878861	byFrequency	TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr1:143209786_143209787insT	ENST00000412204.2	-	0	1283_1284				RP11-782C8.1_ENST00000438000.1_lincRNA																							AAGCCAATGACTTTTTTCTGAG	0.327																																																	0																																												0																															1.37:g.143209792_143209792dupT				RNA	INS	-	NULL	ENST00000412204.2	37	NULL		1																																																																																			RP11-782C8.2	-	-	ENSG00000232274		0.327	RP11-782C8.2-004	KNOWN	basic	lincRNA	ENSG00000232274	Clone_based_vega_gene	lincRNA	OTTHUMT00000037567.2		0.00	122	0	-			143209787	-1	tier1		no_errors	ENST00000412204	ensembl	human	known	74_37	rna	35.11	61	33	INS	0.592:0.771	T
TMOD3	29766	genome.wustl.edu	37	15	52201248	52201248	+	3'UTR	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr15:52201248G>A	ENST00000308580.7	+	0	1581				RP11-56B16.4_ENST00000559302.1_RNA|U6_ENST00000606352.1_RNA|TMOD3_ENST00000544199.1_3'UTR	NM_014547.4	NP_055362.1	Q9NYL9	TMOD3_HUMAN	tropomodulin 3 (ubiquitous)							striated muscle thin filament (GO:0005865)	tropomyosin binding (GO:0005523)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|stomach(1)	14				all cancers(107;0.00194)		GATTTATGATGAATCTTGGGC	0.244																																					Colon(122;1837 2251 18387 22826)												0																																										SO:0001624	3_prime_UTR_variant	0			AF177171	CCDS10145.1	15q21.1-q21.2	2008-05-14			ENSG00000138594	ENSG00000138594			11873	protein-coding gene	gene with protein product		605112				10662549	Standard	NM_014547		Approved	UTMOD	uc002abn.3	Q9NYL9	OTTHUMG00000131803	ENST00000308580.7:c.*241G>A	15.37:g.52201248G>A			B2R6G7|Q9NT43|Q9NZR0	RNA	SNP	-	NULL	ENST00000308580.7	37	NULL	CCDS10145.1	15																																																																																			RP11-56B16.4	-	-	ENSG00000259185		0.244	TMOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000259185	Clone_based_vega_gene	protein_coding	OTTHUMT00000254740.3	-	0.00	40	0	G			52201248	-1	tier1	-	no_errors	ENST00000559302	ensembl	human	known	74_37	rna	33.33	20	10	SNP	0.000	A
AC104637.1	0	genome.wustl.edu	37	3	163234210	163234210	+	RNA	SNP	A	A	G			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr3:163234210A>G	ENST00000584623.1	-	0	65																											tggtgcaaacattattgaggt	0.294																																																	0																																												0																															3.37:g.163234210A>G				RNA	SNP	-	NULL	ENST00000584623.1	37	NULL		3																																																																																			AC104637.1	-	-	ENSG00000265090		0.294	AC104637.1-201	NOVEL	basic	miRNA	ENSG00000265090	Clone_based_ensembl_gene	miRNA		-	0.00	103	0	A			163234210	-1	tier1	-	no_errors	ENST00000584623	ensembl	human	novel	74_37	rna	14.95	91	16	SNP	0.493	G
NLRP9	338321	genome.wustl.edu	37	19	56220431	56220431	+	Intron	DEL	T	T	-			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr19:56220431delT	ENST00000332836.2	-	9	2871				CTD-2611O12.6_ENST00000600582.1_RNA|CTD-2611O12.7_ENST00000597680.1_RNA|CTD-2611O12.8_ENST00000596293.1_RNA	NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9							cytoplasm (GO:0005737)	ATP binding (GO:0005524)			NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		AGAAATAAAGTTTTTTTTTTT	0.363																																																	0													40.0	41.0	41.0					19																	56220431		2203	4298	6501	SO:0001627	intron_variant	0			AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.2844-21A>-	19.37:g.56220431delT			B2RN12|Q86W27	RNA	DEL	-	NULL	ENST00000332836.2	37	NULL	CCDS12934.1	19																																																																																			CTD-2611O12.8	-	-	ENSG00000267865		0.363	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000267865	Clone_based_vega_gene	protein_coding	OTTHUMT00000453653.1		0.00	25	0	T	NM_176820		56220431	+1	tier1		no_errors	ENST00000596293	ensembl	human	known	74_37	rna	15.00	17	3	DEL	0.000	-
TP53TG3HP	100130700	genome.wustl.edu	37	16	34741207	34741207	+	lincRNA	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr16:34741207C>T	ENST00000562591.1	-	0	0				RP11-80F22.2_ENST00000569755.2_RNA	NR_034019.1																						GGAGCGGAACCGTCTTCAGGA	0.617																																																	0																																												0																															16.37:g.34741207C>T				RNA	SNP	-	NULL	ENST00000562591.1	37	NULL		16																																																																																			RP11-80F22.2	-	-	ENSG00000269622		0.617	RP11-80F22.15-001	KNOWN	basic	lincRNA	ENSG00000269622	Clone_based_vega_gene	lincRNA	OTTHUMT00000465648.1	-	0.00	41	0	C			34741207	-1	tier1	-	no_errors	ENST00000569755	ensembl	human	known	74_37	rna	35.00	26	14	SNP	0.000	T
EP400	57634	genome.wustl.edu	37	12	132561952	132561952	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr12:132561952C>T	ENST00000333577.4	+	54	9323	c.9214C>T	c.(9214-9216)Cca>Tca	p.P3072S	EP400_ENST00000330386.6_Missense_Mutation_p.P2955S|EP400_ENST00000332482.4_Missense_Mutation_p.P2999S|EP400_ENST00000389561.2_Missense_Mutation_p.P3036S|EP400_ENST00000389562.2_Missense_Mutation_p.P3035S|RP13-820C6.2_ENST00000542422.1_RNA			Q96L91	EP400_HUMAN	E1A binding protein p400	3072					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		TCAGGCTTCTCCACAGACTGT	0.587																																																	0													39.0	44.0	42.0					12																	132561952		2183	4273	6456	SO:0001583	missense	0			U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.9214C>T	12.37:g.132561952C>T	ENSP00000333602:p.Pro3072Ser		O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase/SANT-assoc_DNA-bd,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Homeodomain-like,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Myb-like_dom,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.P3072S	ENST00000333577.4	37	c.9214		12	.	.	.	.	.	.	.	.	.	.	C	20.4	3.977273	0.74360	.	.	ENSG00000183495	ENST00000333577;ENST00000389561;ENST00000389562;ENST00000332482;ENST00000330386;ENST00000541296	D;D;D;D;D	0.92299	-2.97;-2.98;-2.93;-2.99;-3.01	5.62	5.62	0.85841	.	0.125530	0.53938	D	0.000048	D	0.93844	0.8031	L	0.29908	0.895	0.48395	D	0.999643	D;D;D;D	0.89917	0.997;1.0;1.0;1.0	D;D;D;D	0.87578	0.986;0.998;0.998;0.998	D	0.94184	0.7434	10	0.56958	D	0.05	.	19.6689	0.95903	0.0:1.0:0.0:0.0	.	3072;3036;2955;3035	Q96L91;Q96L91-2;Q96L91-4;Q96L91-5	EP400_HUMAN;.;.;.	S	3072;3036;3035;2999;2955;3036	ENSP00000333602:P3072S;ENSP00000374212:P3036S;ENSP00000374213:P3035S;ENSP00000331737:P2999S;ENSP00000330620:P2955S	ENSP00000330620:P2955S	P	+	1	0	EP400	131127905	0.998000	0.40836	0.955000	0.39395	0.980000	0.70556	5.667000	0.68067	2.642000	0.89623	0.655000	0.94253	CCA	EP400	-	NULL	ENSG00000183495		0.587	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	EP400	HGNC	protein_coding		-	0.00	37	0	C	NM_015409		132561952	+1	tier1	-	no_errors	ENST00000333577	ensembl	human	known	74_37	missense	25.93	40	14	SNP	1.000	T
EPC1	80314	genome.wustl.edu	37	10	32560606	32560606	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr10:32560606T>C	ENST00000263062.8	-	14	2583	c.2314A>G	c.(2314-2316)Ata>Gta	p.I772V	RP11-166N17.1_ENST00000415731.2_RNA|EPC1_ENST00000375110.2_Missense_Mutation_p.I699V|EPC1_ENST00000319778.6_Missense_Mutation_p.I749V	NM_025209.2	NP_079485.1	Q9H2F5	EPC1_HUMAN	enhancer of polycomb homolog 1 (Drosophila)	772					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(5)|urinary_tract(1)	24		Prostate(175;0.0199)				CGTGCATTTATTGGGGCAATA	0.443																																																	0													220.0	202.0	208.0					10																	32560606		2203	4300	6503	SO:0001583	missense	0			AF277374	CCDS7172.1, CCDS60511.1, CCDS73083.1	10p11	2005-12-12			ENSG00000120616	ENSG00000120616			19876	protein-coding gene	gene with protein product		610999				10976108	Standard	NM_025209		Approved	Epl1	uc001iwg.2	Q9H2F5	OTTHUMG00000017925	ENST00000263062.8:c.2314A>G	10.37:g.32560606T>C	ENSP00000263062:p.Ile772Val		B4DSC3|D3DRX7|Q5VW54|Q5VW56|Q5VW58|Q8NAQ4|Q8NE21|Q96LF4|Q96RR6|Q9H7T7	Missense_Mutation	SNP	pfam_Enhancer_polycomb_C,pfam_Enhancer_polycomb-like_N	p.I772V	ENST00000263062.8	37	c.2314	CCDS7172.1	10	.	.	.	.	.	.	.	.	.	.	T	9.894	1.205011	0.22205	.	.	ENSG00000120616	ENST00000375110;ENST00000319778;ENST00000263062	.	.	.	5.24	1.35	0.21983	.	0.342180	0.29040	N	0.013334	T	0.14141	0.0342	N	0.11427	0.14	0.22562	N	0.998986	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.09377	0.004;0.001;0.001	T	0.21280	-1.0250	9	0.12766	T	0.61	-4.3379	4.2956	0.10899	0.1091:0.0944:0.5553:0.2412	.	699;749;772	Q9H2F5-3;Q9H2F5-2;Q9H2F5	.;.;EPC1_HUMAN	V	699;749;772	.	ENSP00000263062:I772V	I	-	1	0	EPC1	32600612	0.998000	0.40836	0.982000	0.44146	0.946000	0.59487	2.626000	0.46460	0.378000	0.24764	0.254000	0.18369	ATA	EPC1	-	pfam_Enhancer_polycomb_C	ENSG00000120616		0.443	EPC1-004	KNOWN	basic|CCDS	protein_coding	EPC1	HGNC	protein_coding	OTTHUMT00000047484.1	-	0.00	64	0	T			32560606	-1	tier1	-	no_errors	ENST00000263062	ensembl	human	known	74_37	missense	31.75	86	40	SNP	0.983	C
EPS8L1	54869	genome.wustl.edu	37	19	55592816	55592816	+	Frame_Shift_Del	DEL	C	C	-			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr19:55592816delC	ENST00000201647.6	+	8	786	c.730delC	c.(730-732)cccfs	p.P244fs	EPS8L1_ENST00000540810.1_Frame_Shift_Del_p.P180fs|EPS8L1_ENST00000588359.1_Intron|EPS8L1_ENST00000592824.1_3'UTR|EPS8L1_ENST00000586329.1_Frame_Shift_Del_p.P226fs|EPS8L1_ENST00000245618.5_Frame_Shift_Del_p.P117fs	NM_133180.2	NP_573441.2	Q8TE68	ES8L1_HUMAN	EPS8-like 1	244					positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ruffle assembly (GO:1900029)|regulation of Rho protein signal transduction (GO:0035023)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|T cell receptor binding (GO:0042608)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|prostate(1)	12			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		GGACCTGGGTCCCCGGGGTCC	0.716																																					Ovarian(149;255 1863 3636 27051 29647)												0													11.0	12.0	11.0					19																	55592816		2193	4285	6478	SO:0001589	frameshift_variant	0			AK057052	CCDS12914.1, CCDS12915.1	19q13.42	2008-02-05				ENSG00000131037			21295	protein-coding gene	gene with protein product		614987				12620401	Standard	NM_133180		Approved	FLJ20258, DRC3, MGC23164, MGC4642	uc002qis.4	Q8TE68		ENST00000201647.6:c.730delC	19.37:g.55592816delC	ENSP00000201647:p.Pro244fs		Q71RE2|Q8NC10|Q96BB7|Q9BSQ2|Q9GZQ2|Q9NXH0	Frame_Shift_Del	DEL	pfam_PTB,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_SAM/pointed,smart_PTB/PI_dom,smart_SH3_domain,pfscan_SH3_domain	p.R245fs	ENST00000201647.6	37	c.730	CCDS12914.1	19																																																																																			EPS8L1	-	NULL	ENSG00000131037		0.716	EPS8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPS8L1	HGNC	protein_coding	OTTHUMT00000451713.1		0.00	21	0	C	NM_017729		55592816	+1	tier1		no_errors	ENST00000201647	ensembl	human	known	74_37	frame_shift_del	9.09	20	2	DEL	0.910	-
ESR1	2099	genome.wustl.edu	37	6	152332850	152332850	+	Missense_Mutation	SNP	A	A	G			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr6:152332850A>G	ENST00000206249.3	+	5	1518	c.1156A>G	c.(1156-1158)Atc>Gtc	p.I386V	ESR1_ENST00000406599.1_Intron|ESR1_ENST00000440973.1_Missense_Mutation_p.I386V|ESR1_ENST00000338799.5_Missense_Mutation_p.I386V|ESR1_ENST00000427531.2_Missense_Mutation_p.I213V|ESR1_ENST00000456483.2_Missense_Mutation_p.I274V|ESR1_ENST00000443427.1_Missense_Mutation_p.I386V	NM_000125.3	NP_000116.2	P03372	ESR1_HUMAN	estrogen receptor 1	386	Interaction with AKAP13.|Self-association.|Steroid-binding.|Transactivation AF-2.				androgen metabolic process (GO:0008209)|antral ovarian follicle growth (GO:0001547)|cellular response to estradiol stimulus (GO:0071392)|chromatin remodeling (GO:0006338)|epithelial cell development (GO:0002064)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|gene expression (GO:0010467)|intracellular estrogen receptor signaling pathway (GO:0030520)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|male gonad development (GO:0008584)|mammary gland alveolus development (GO:0060749)|mammary gland branching involved in pregnancy (GO:0060745)|negative regulation of gene expression (GO:0010629)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|regulation of apoptotic process (GO:0042981)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|uterus development (GO:0060065)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|transcriptionally active chromatin (GO:0035327)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|enzyme binding (GO:0019899)|estrogen receptor activity (GO:0030284)|estrogen response element binding (GO:0034056)|estrogen-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0038052)|identical protein binding (GO:0042802)|nitric-oxide synthase regulator activity (GO:0030235)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(19)|ovary(1)|prostate(2)|skin(1)	49		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Allylestrenol(DB01431)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Estropipate(DB04574)|Ethinyl Estradiol(DB00977)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Ospemifene(DB04938)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)|Trilostane(DB01108)	CTGGCTAGAGATCCTGATGAT	0.493																																																	0													148.0	132.0	137.0					6																	152332850		2203	4300	6503	SO:0001583	missense	0			X03635	CCDS5234.1	6q24-q27	2013-01-16			ENSG00000091831	ENSG00000091831		"""Nuclear hormone receptors"""	3467	protein-coding gene	gene with protein product		133430		ESR		3754034	Standard	NM_000125		Approved	NR3A1, Era	uc003qon.4	P03372	OTTHUMG00000016103	ENST00000206249.3:c.1156A>G	6.37:g.152332850A>G	ENSP00000206249:p.Ile386Val		Q13511|Q14276|Q5T5H7|Q6MZQ9|Q9NU51|Q9UDZ7|Q9UIS7	Missense_Mutation	SNP	pfam_Oestr_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Oestr_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.I386V	ENST00000206249.3	37	c.1156	CCDS5234.1	6	.	.	.	.	.	.	.	.	.	.	A	5.484	0.274361	0.10403	.	.	ENSG00000091831	ENST00000440973;ENST00000338799;ENST00000456483;ENST00000431219;ENST00000443427;ENST00000206249;ENST00000431590;ENST00000544394;ENST00000415488	D;D;D;D;D;T;D	0.96041	-3.89;-3.89;-3.89;-3.89;-3.89;1.27;-3.89	5.42	5.42	0.78866	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.058010	0.64402	D	0.000002	T	0.81418	0.4818	N	0.04768	-0.165	0.58432	D	0.999998	B;B;B;B;B;B	0.34103	0.01;0.437;0.001;0.05;0.019;0.024	B;B;B;B;B;B	0.37304	0.026;0.246;0.004;0.094;0.022;0.038	D	0.83736	0.0201	10	0.02654	T	1	.	15.4537	0.75297	1.0:0.0:0.0:0.0	.	290;167;81;385;386;386	B0QYW6;E7EVR3;C8CJL6;A8KAF4;G4XH65;P03372	.;.;.;.;.;ESR1_HUMAN	V	386;386;274;167;386;386;314;213;59	ENSP00000405330:I386V;ENSP00000342630:I386V;ENSP00000415934:I274V;ENSP00000387500:I386V;ENSP00000206249:I386V;ENSP00000445454:I213V;ENSP00000401995:I59V	ENSP00000206249:I386V	I	+	1	0	ESR1	152374543	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.973000	0.70456	2.055000	0.61198	0.482000	0.46254	ATC	ESR1	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Str_hrmn_rcpt	ENSG00000091831		0.493	ESR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESR1	HGNC	protein_coding	OTTHUMT00000043308.1	-	0.00	47	0	A			152332850	+1	tier1	-	no_errors	ENST00000206249	ensembl	human	known	74_37	missense	24.39	31	10	SNP	1.000	G
ESRRG	2104	genome.wustl.edu	37	1	216850796	216850796	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr1:216850796C>T	ENST00000408911.3	-	2	247	c.94G>A	c.(94-96)Gat>Aat	p.D32N	ESRRG_ENST00000487276.1_Missense_Mutation_p.D9N|ESRRG_ENST00000366938.2_Missense_Mutation_p.D9N|ESRRG_ENST00000361395.2_Missense_Mutation_p.D9N|ESRRG_ENST00000493748.1_Missense_Mutation_p.D9N|ESRRG_ENST00000360012.3_Missense_Mutation_p.D9N|ESRRG_ENST00000361525.3_Missense_Mutation_p.D9N|ESRRG_ENST00000366937.1_Missense_Mutation_p.D37N|ESRRG_ENST00000391890.3_Missense_Mutation_p.D9N|ESRRG_ENST00000463665.1_Missense_Mutation_p.D9N|ESRRG_ENST00000359162.2_Missense_Mutation_p.D9N|ESRRG_ENST00000366940.2_Missense_Mutation_p.D9N|ESRRG_ENST00000493603.1_Missense_Mutation_p.D9N	NM_001438.3	NP_001429.2	P62508	ERR3_HUMAN	estrogen-related receptor gamma	32					gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	AF-2 domain binding (GO:0050682)|retinoic acid receptor activity (GO:0003708)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(1)|large_intestine(8)|liver(1)|lung(29)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	CAGCTGGAATCAATGTGTCGA	0.517																																																	0													85.0	75.0	79.0					1																	216850796		2203	4300	6503	SO:0001583	missense	0			AF058291	CCDS1517.1, CCDS41468.1, CCDS58060.1, CCDS58061.1	1q41	2014-02-18			ENSG00000196482	ENSG00000196482		"""Nuclear hormone receptors"""	3474	protein-coding gene	gene with protein product		602969				9676434, 10072763	Standard	NM_001243505		Approved	NR3B3	uc001hkw.2	P62508	OTTHUMG00000037025	ENST00000408911.3:c.94G>A	1.37:g.216850796C>T	ENSP00000386171:p.Asp32Asn		A8K4I0|A8K6I2|B3KY84|E9PGB7|F8W8J3|O75454|O96021|Q68DA0|Q6P274|Q6PK28|Q6TS38|Q9R1F3|Q9UNJ4	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Retinoic_acid_rcpt	p.D32N	ENST00000408911.3	37	c.94	CCDS41468.1	1	.	.	.	.	.	.	.	.	.	.	C	17.27	3.347972	0.61183	.	.	ENSG00000196482	ENST00000361525;ENST00000366940;ENST00000366937;ENST00000408911;ENST00000359162;ENST00000361395;ENST00000366938;ENST00000360012;ENST00000493603;ENST00000391890;ENST00000463665;ENST00000487276;ENST00000354407;ENST00000493748;ENST00000475275;ENST00000469486;ENST00000459955;ENST00000481543	D;D;D;D;D;D;D;D;D;D;D;D;D;D;T;T;T	0.94931	-3.25;-3.25;-3.25;-3.32;-3.25;-3.25;-3.25;-3.25;-3.25;-3.28;-3.56;-3.25;-3.25;-3.07;0.92;0.9;0.9	6.16	6.16	0.99307	.	0.043249	0.85682	D	0.000000	D	0.90714	0.7086	N	0.24115	0.695	0.80722	D	1	B;P;B	0.37330	0.078;0.59;0.247	B;B;B	0.37304	0.046;0.246;0.053	D	0.87972	0.2737	10	0.21014	T	0.42	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	9;37;32	E9PGB7;F8W8J3;P62508	.;.;ERR3_HUMAN	N	9;9;37;32;9;9;9;9;9;9;9;9;9;9;9;9;9;9	ENSP00000355225:D9N;ENSP00000355907:D9N;ENSP00000355904:D37N;ENSP00000386171:D32N;ENSP00000352077:D9N;ENSP00000354584:D9N;ENSP00000355905:D9N;ENSP00000353108:D9N;ENSP00000419594:D9N;ENSP00000375761:D9N;ENSP00000418629:D9N;ENSP00000419155:D9N;ENSP00000417374:D9N;ENSP00000419514:D9N;ENSP00000417900:D9N;ENSP00000420370:D9N;ENSP00000418895:D9N	ENSP00000346386:D9N	D	-	1	0	ESRRG	214917419	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.992000	0.56980	2.937000	0.99478	0.650000	0.86243	GAT	ESRRG	-	NULL	ENSG00000196482		0.517	ESRRG-001	KNOWN	basic|CCDS	protein_coding	ESRRG	HGNC	protein_coding	OTTHUMT00000089882.2	-	0.00	46	0	C	NM_206595		216850796	-1	tier1	-	no_errors	ENST00000408911	ensembl	human	known	74_37	missense	60.87	18	28	SNP	1.000	T
ETV1	2115	genome.wustl.edu	37	7	13935516	13935516	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr7:13935516G>A	ENST00000430479.1	-	14	2076	c.1409C>T	c.(1408-1410)cCc>cTc	p.P470L	ETV1_ENST00000405358.4_Missense_Mutation_p.P484L|ETV1_ENST00000405218.2_Missense_Mutation_p.P470L|ETV1_ENST00000403685.1_Missense_Mutation_p.P452L|ETV1_ENST00000405192.2_Missense_Mutation_p.P447L|ETV1_ENST00000242066.5_Missense_Mutation_p.P452L|ETV1_ENST00000343495.5_Missense_Mutation_p.P452L|ETV1_ENST00000420159.2_Missense_Mutation_p.P412L|ETV1_ENST00000399357.3_Missense_Mutation_p.P367L|ETV1_ENST00000403527.1_Missense_Mutation_p.P430L	NM_004956.4	NP_004947.2	P50549	ETV1_HUMAN	ets variant 1	470					axon guidance (GO:0007411)|cell differentiation (GO:0030154)|mechanosensory behavior (GO:0007638)|muscle organ development (GO:0007517)|peripheral nervous system neuron development (GO:0048935)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		TMPRSS2/ETV1(34)|ACSL3_ENST00000357430/ETV1(2)|EWSR1/ETV1(7)|KLK2/ETV1(3)|SLC45A3/ETV1(3)|HNRNPA2B1/ETV1(8)	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31						TTCGTTGTAGGGGTGGGGGTT	0.493			T	"""EWSR1, TMPRSS2, SLC45A3, C15orf21, HNRNPA2B1. ACSL3"""	"""Ewing sarcoma, prostate"""																																			Dom	yes		7	7p22	2115	ets variant gene 1		"""M, E"""	0													54.0	52.0	53.0					7																	13935516		1970	4151	6121	SO:0001583	missense	0				CCDS55083.1, CCDS55084.1, CCDS55085.1, CCDS55086.1, CCDS55087.1, CCDS55088.1	7p22	2008-09-12	2008-09-12		ENSG00000006468	ENSG00000006468			3490	protein-coding gene	gene with protein product		600541	"""ets variant gene 1"""			1340465	Standard	NM_004956		Approved	ER81	uc003ssw.4	P50549	OTTHUMG00000152403	ENST00000430479.1:c.1409C>T	7.37:g.13935516G>A	ENSP00000405327:p.Pro470Leu		A4D118|B2R768|B7Z2I4|B7Z618|B7Z9P2|C9JT37|E9PHB1|F5GXR2|O75849|Q4KMQ6|Q59GA7|Q6AI30|Q9UQ71|Q9Y636	Missense_Mutation	SNP	pfam_ETS_PEA3_N,pfam_Ets_dom,smart_Ets_dom,pfscan_Ets_dom,prints_Ets_dom	p.P470L	ENST00000430479.1	37	c.1409	CCDS55088.1	7	.	.	.	.	.	.	.	.	.	.	G	17.18	3.324343	0.60634	.	.	ENSG00000006468	ENST00000430479;ENST00000242066;ENST00000343495;ENST00000420159;ENST00000399357;ENST00000405192;ENST00000405358;ENST00000403527;ENST00000405218;ENST00000403685	T;T;T;T;T;T;T;T;T;T	0.11277	2.84;2.82;2.82;2.79;2.84;2.87;2.83;2.8;2.84;2.82	4.94	4.94	0.65067	.	0.109671	0.64402	D	0.000007	T	0.31979	0.0814	M	0.62723	1.935	0.80722	D	1	D;D;D;D;D;D;P	0.89917	0.997;1.0;1.0;1.0;0.999;0.999;0.928	P;D;D;D;D;D;P	0.85130	0.84;0.996;0.997;0.996;0.997;0.991;0.609	T	0.01114	-1.1447	10	0.48119	T	0.1	.	18.3571	0.90361	0.0:0.0:1.0:0.0	.	458;452;484;412;367;430;470	Q59GA7;P50549-2;B5MCT2;F5GXR2;B7Z9P2;E9PHB1;P50549	.;.;.;.;.;.;ETV1_HUMAN	L	470;452;452;412;367;447;484;430;470;452	ENSP00000405327:P470L;ENSP00000242066:P452L;ENSP00000340853:P452L;ENSP00000411626:P412L;ENSP00000382293:P367L;ENSP00000385381:P447L;ENSP00000384085:P484L;ENSP00000384138:P430L;ENSP00000385551:P470L;ENSP00000385686:P452L	ENSP00000242066:P452L	P	-	2	0	ETV1	13902041	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.660000	0.83776	2.569000	0.86673	0.650000	0.86243	CCC	ETV1	-	NULL	ENSG00000006468		0.493	ETV1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	ETV1	HGNC	protein_coding	OTTHUMT00000326111.1	-	0.00	54	0	G	NM_004956		13935516	-1	tier1	-	no_errors	ENST00000405218	ensembl	human	known	74_37	missense	13.24	59	9	SNP	1.000	A
FAM135B	51059	genome.wustl.edu	37	8	139165415	139165415	+	Missense_Mutation	SNP	T	T	G			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr8:139165415T>G	ENST00000395297.1	-	13	1473	c.1303A>C	c.(1303-1305)Agt>Cgt	p.S435R		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	435										NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			ATTGTAGGACTTGTCACTGGA	0.308										HNSCC(54;0.14)																																							0													49.0	47.0	48.0					8																	139165415		1832	4083	5915	SO:0001583	missense	0			AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.1303A>C	8.37:g.139165415T>G	ENSP00000378710:p.Ser435Arg		B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	pfam_DUF676_lipase-like,pfam_DUF3657,pfam_PGAP1-like	p.S435R	ENST00000395297.1	37	c.1303	CCDS6375.2	8	.	.	.	.	.	.	.	.	.	.	T	12.52	1.962457	0.34659	.	.	ENSG00000147724	ENST00000395297	T	0.14766	2.48	5.6	4.44	0.53790	.	1.042420	0.07404	N	0.891200	T	0.13713	0.0332	L	0.51422	1.61	0.22666	N	0.998879	P	0.41041	0.736	B	0.36289	0.221	T	0.23833	-1.0177	10	0.27082	T	0.32	-1.9071	8.0845	0.30765	0.0:0.0909:0.0:0.9091	.	435	Q49AJ0	F135B_HUMAN	R	435	ENSP00000378710:S435R	ENSP00000276737:S435R	S	-	1	0	FAM135B	139234597	0.018000	0.18449	0.859000	0.33776	0.653000	0.38743	1.042000	0.30303	0.971000	0.38288	0.533000	0.62120	AGT	FAM135B	-	NULL	ENSG00000147724		0.308	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM135B	HGNC	protein_coding	OTTHUMT00000313590.3	-	0.00	36	0	T	NM_015912		139165415	-1	tier1	-	no_errors	ENST00000395297	ensembl	human	known	74_37	missense	52.50	19	21	SNP	0.280	G
FAM168A	23201	genome.wustl.edu	37	11	73122547	73122547	+	Silent	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr11:73122547C>T	ENST00000064778.4	-	6	623	c.339G>A	c.(337-339)ccG>ccA	p.P113P	RP11-809N8.4_ENST00000542598.1_RNA|FAM168A_ENST00000450446.2_Intron|RP11-809N8.4_ENST00000536855.1_RNA|FAM168A_ENST00000356467.4_Silent_p.P104P			Q92567	F168A_HUMAN	family with sequence similarity 168, member A	113										endometrium(3)|kidney(1)|lung(1)	5						TACTCTGGGTCGGTGGGACCT	0.532																																																	0													80.0	79.0	79.0					11																	73122547		1921	4109	6030	SO:0001819	synonymous_variant	0			BC014932	CCDS41689.1, CCDS66165.1, CCDS73346.1	11q13.4	2008-06-11	2008-06-11	2008-06-11		ENSG00000054965			28999	protein-coding gene	gene with protein product	"""tongue cancer chemotherapy resistance-associated protein 1"""		"""KIAA0280"""	KIAA0280			Standard	XM_005273852		Approved	TCRP1	uc001oty.1	Q92567		ENST00000064778.4:c.339G>A	11.37:g.73122547C>T			A2ICY2|A2ID81|Q86UG2	Silent	SNP	NULL	p.P113	ENST00000064778.4	37	c.339		11																																																																																			FAM168A	-	NULL	ENSG00000054965		0.532	FAM168A-003	KNOWN	basic	protein_coding	FAM168A	HGNC	protein_coding	OTTHUMT00000397424.1	-	0.00	37	0	C	NM_015159		73122547	-1	tier1	-	no_errors	ENST00000064778	ensembl	human	known	74_37	silent	16.33	41	8	SNP	0.784	T
FAM208A	23272	genome.wustl.edu	37	3	56681036	56681036	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr3:56681036G>A	ENST00000493960.2	-	14	1739	c.1729C>T	c.(1729-1731)Cca>Tca	p.P577S	FAM208A_ENST00000355628.5_Missense_Mutation_p.P577S|FAM208A_ENST00000431842.2_Missense_Mutation_p.P181S	NM_001112736.1	NP_001106207.1	Q9UK61	F208A_HUMAN	family with sequence similarity 208, member A	577							poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(11)|prostate(3)|skin(1)	32						GAATCATATGGAAACATAATA	0.313																																																	0													37.0	40.0	39.0					3																	56681036		2198	4296	6494	SO:0001583	missense	0			AF180425	CCDS2877.1, CCDS46853.1	3p14.3	2011-09-14	2011-09-14	2011-09-14	ENSG00000163946	ENSG00000163946			30314	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 63"""	C3orf63		10470851, 11149944	Standard	NM_015224		Approved	se89-1, RAP140, KIAA1105	uc003die.4	Q9UK61	OTTHUMG00000158827	ENST00000493960.2:c.1729C>T	3.37:g.56681036G>A	ENSP00000417509:p.Pro577Ser		A1L3A4|B5ME28|Q9H2F7|Q9UPP7	Missense_Mutation	SNP	pfam_DUF3715	p.P577S	ENST00000493960.2	37	c.1729	CCDS46853.1	3	.	.	.	.	.	.	.	.	.	.	G	10.39	1.336442	0.24253	.	.	ENSG00000163946	ENST00000431842;ENST00000493960;ENST00000355628	T;T;T	0.11930	2.73;2.93;2.93	5.38	2.44	0.29823	.	0.223531	0.32106	N	0.006577	T	0.08582	0.0213	N	0.22421	0.69	0.28480	N	0.915008	B;B;B	0.15141	0.012;0.001;0.002	B;B;B	0.14023	0.01;0.002;0.002	T	0.20371	-1.0277	10	0.38643	T	0.18	-0.9963	7.8837	0.29637	0.1336:0.3528:0.5136:0.0	.	577;577;181	Q9UK61-3;Q9UK61-4;Q9UK61-2	.;.;.	S	181;577;577	ENSP00000399410:P181S;ENSP00000417509:P577S;ENSP00000347845:P577S	ENSP00000347845:P577S	P	-	1	0	C3orf63	56656076	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	2.203000	0.42752	0.312000	0.23038	0.655000	0.94253	CCA	FAM208A	-	NULL	ENSG00000163946		0.313	FAM208A-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	FAM208A	HGNC	protein_coding	OTTHUMT00000352352.2	-	0.00	141	0	G	NM_015224		56681036	-1	tier1	-	no_errors	ENST00000355628	ensembl	human	known	74_37	missense	25.53	70	24	SNP	0.927	A
FAM78B	149297	genome.wustl.edu	37	1	166039702	166039702	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr1:166039702T>C	ENST00000338353.3	-	3	1151	c.562A>G	c.(562-564)Acc>Gcc	p.T188A	FAM78B_ENST00000354422.3_Missense_Mutation_p.T188A			Q5VT40	FA78B_HUMAN	family with sequence similarity 78, member B	188										central_nervous_system(1)|endometrium(5)|large_intestine(1)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(923;0.0813)|Acute lymphoblastic leukemia(8;0.155)					CACTTGATGGTCTGCAGAATG	0.572																																																	0													203.0	181.0	189.0					1																	166039702		2203	4300	6503	SO:0001583	missense	0			AL626787	CCDS30931.1	1q24.1	2008-02-05			ENSG00000188859	ENSG00000188859			13495	protein-coding gene	gene with protein product							Standard	NM_001017961		Approved		uc021pee.1	Q5VT40	OTTHUMG00000034705	ENST00000338353.3:c.562A>G	1.37:g.166039702T>C	ENSP00000339681:p.Thr188Ala		B7Z693	Missense_Mutation	SNP	NULL	p.T188A	ENST00000338353.3	37	c.562	CCDS30931.1	1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.135365	0.77662	.	.	ENSG00000188859	ENST00000354422;ENST00000338353	.	.	.	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.72827	0.3509	M	0.74881	2.28	0.48511	D	0.999666	D	0.61697	0.99	D	0.70935	0.971	T	0.78191	-0.2300	8	0.72032	D	0.01	-0.8519	14.122	0.65195	0.0:0.0:0.0:1.0	.	188	Q5VT40	FA78B_HUMAN	A	188	.	ENSP00000339681:T188A	T	-	1	0	FAM78B	164306326	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.930000	0.87610	2.217000	0.71921	0.533000	0.62120	ACC	FAM78B	-	NULL	ENSG00000188859		0.572	FAM78B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM78B	HGNC	protein_coding	OTTHUMT00000343108.1	-	0.00	24	0	T	NM_001017961		166039702	-1	tier1	-	no_errors	ENST00000338353	ensembl	human	known	74_37	missense	73.91	6	17	SNP	1.000	C
FAM83C	128876	genome.wustl.edu	37	20	33875493	33875493	+	Silent	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr20:33875493G>A	ENST00000374408.3	-	4	1185	c.1089C>T	c.(1087-1089)ctC>ctT	p.L363L	EIF6_ENST00000374443.3_5'Flank|EIF6_ENST00000462894.1_5'Flank|EIF6_ENST00000374450.3_5'Flank|EIF6_ENST00000374436.3_5'Flank|FAM83C-AS1_ENST00000429167.1_RNA	NM_178468.5	NP_848563.1	Q9BQN1	FA83C_HUMAN	family with sequence similarity 83, member C	363										central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(18;0.00252)			CTGGTAGAGCGAGGTAGGAGG	0.647																																																	0													139.0	110.0	120.0					20																	33875493		2203	4300	6503	SO:0001819	synonymous_variant	0			AL121753	CCDS13251.1	20q11.22	2011-04-01	2006-03-23	2006-03-23	ENSG00000125998	ENSG00000125998			16121	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 128"""	C20orf128			Standard	NM_178468		Approved	dJ614O4.7	uc021wck.1	Q9BQN1	OTTHUMG00000032332	ENST00000374408.3:c.1089C>T	20.37:g.33875493G>A			Q14D67|Q5JWN6|Q8N276	Silent	SNP	pfam_DUF1669	p.L363	ENST00000374408.3	37	c.1089	CCDS13251.1	20																																																																																			FAM83C	-	NULL	ENSG00000125998		0.647	FAM83C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM83C	HGNC	protein_coding	OTTHUMT00000078854.3	-	0.00	23	0	G			33875493	-1	tier1	-	no_errors	ENST00000374408	ensembl	human	known	74_37	silent	16.22	31	6	SNP	0.000	A
FAM90A24P	441332	genome.wustl.edu	37	8	7878293	7878293	+	RNA	SNP	A	A	T	rs61580899	byFrequency	TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr8:7878293A>T	ENST00000521100.1	-	0	498							P0C7X0	F90AO_HUMAN	family with sequence similarity 90, member A24, pseudogene								nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)										CCGCAGCCCCAGTCTGTCTTT	0.642																																																	0																																												0					8p23.1	2011-08-31	2011-04-15	2008-06-19		ENSG00000215354			32272	pseudogene	pseudogene			"""family with sequence similarity 90, member A24"""	FAM90A24			Standard	NG_006004		Approved			P0C7X0	OTTHUMG00000163642		8.37:g.7878293A>T			A8MWA1	RNA	SNP	-	NULL	ENST00000521100.1	37	NULL		8																																																																																			FAM90A24P	-	-	ENSG00000215354		0.642	FAM90A24P-002	KNOWN	mRNA_end_NF|basic	processed_transcript	FAM90A24P	HGNC	pseudogene	OTTHUMT00000374637.1	-	0.00	101	0	A	NG_006004		7878293	-1	tier1	-	no_errors	ENST00000521100	ensembl	human	known	74_37	rna	5.69	116	7	SNP	0.000	T
FBXL20	84961	genome.wustl.edu	37	17	37420506	37420506	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr17:37420506C>G	ENST00000264658.6	-	14	1385	c.1125G>C	c.(1123-1125)ttG>ttC	p.L375F	FBXL20_ENST00000577399.1_Missense_Mutation_p.L377F|FBXL20_ENST00000583610.1_Missense_Mutation_p.L375F|FBXL20_ENST00000394294.3_Missense_Mutation_p.L343F	NM_032875.2	NP_116264.2	Q96IG2	FXL20_HUMAN	F-box and leucine-rich repeat protein 20	375				L -> F (in Ref. 1; BAF84533). {ECO:0000305}.	behavioral fear response (GO:0001662)	cytoplasm (GO:0005737)				breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22			LUAD - Lung adenocarcinoma(14;0.146)			GACAGCTCTTCAAGTGCTCCA	0.517																																																	0													151.0	129.0	137.0					17																	37420506		2203	4300	6503	SO:0001583	missense	0			BC007557	CCDS32640.1, CCDS54116.1	17q21.2	2011-06-09				ENSG00000108306		"""F-boxes / Leucine-rich repeats"""	24679	protein-coding gene	gene with protein product		609086				12477932	Standard	NM_032875		Approved	MGC15482, Fbl2, Fbl20	uc002hrt.3	Q96IG2		ENST00000264658.6:c.1125G>C	17.37:g.37420506C>G	ENSP00000264658:p.Leu375Phe		A8K729|Q38J52	Missense_Mutation	SNP	pfam_F-box_dom,superfamily_F-box_dom,smart_F-box_dom,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_F-box_dom	p.L375F	ENST00000264658.6	37	c.1125	CCDS32640.1	17	.	.	.	.	.	.	.	.	.	.	C	19.87	3.907329	0.72868	.	.	ENSG00000108306	ENST00000264658;ENST00000394294	T;T	0.11277	2.79;2.79	5.9	4.93	0.64822	.	0.000000	0.85682	D	0.000000	T	0.32194	0.0821	M	0.85630	2.765	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	T	0.09100	-1.0690	10	0.66056	D	0.02	.	6.0707	0.19887	0.1386:0.655:0.1341:0.0723	.	343;375	Q96IG2-2;Q96IG2	.;FXL20_HUMAN	F	375;343	ENSP00000264658:L375F;ENSP00000377832:L343F	ENSP00000264658:L375F	L	-	3	2	FBXL20	34674032	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.212000	0.32394	1.503000	0.48686	0.563000	0.77884	TTG	FBXL20	-	smart_Leu-rich_rpt_Cys-con_subtyp	ENSG00000108306		0.517	FBXL20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL20	HGNC	protein_coding	OTTHUMT00000444315.2		0.00	25	0	C	NM_032875		37420506	-1			no_errors	ENST00000264658	ensembl	human	known	74_37	missense	9.84	55	6	SNP	1.000	G
GABARAPL1	23710	genome.wustl.edu	37	12	10370694	10370694	+	Silent	SNP	G	G	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr12:10370694G>T	ENST00000266458.5	+	2	448	c.123G>T	c.(121-123)gtG>gtT	p.V41V	GABARAPL1_ENST00000539289.1_3'UTR|GABARAPL1_ENST00000545047.1_Intron|GABARAPL1_ENST00000539170.1_5'UTR|GABARAPL1_ENST00000421801.2_Silent_p.V41V|GABARAPL1_ENST00000545887.1_Silent_p.V41V|GABARAPL1_ENST00000535576.1_5'UTR|GABARAPL1_ENST00000543602.1_Silent_p.V41V|GABARAPL1_ENST00000546017.1_5'UTR|GABARAPL1_ENST00000544284.1_5'UTR	NM_031412.2	NP_113600.1	Q9H0R8	GBRL1_HUMAN	GABA(A) receptor-associated protein like 1	41	Interaction with GABRG2. {ECO:0000250}.				autophagy (GO:0006914)	autophagic vacuole (GO:0005776)|cell body (GO:0044297)|cytoplasmic vesicle (GO:0031410)|dendrite cytoplasm (GO:0032839)|dendrite membrane (GO:0032590)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|microtubule (GO:0005874)	beta-tubulin binding (GO:0048487)|GABA receptor binding (GO:0050811)			NS(1)|lung(1)	2						AAGCCAGGGTGCCTGATCTGG	0.473																																					Melanoma(3;46 76 4652 22680 42285)												0													183.0	155.0	165.0					12																	10370694		2203	4300	6503	SO:0001819	synonymous_variant	0			AF087847	CCDS8620.1	12p13.31	2014-02-12			ENSG00000139112	ENSG00000139112			4068	protein-coding gene	gene with protein product		607420				11414770, 11374880	Standard	NM_031412		Approved	gec1, APG8L, ATG8L, ATG8B	uc001qxs.3	Q9H0R8	OTTHUMG00000168411	ENST00000266458.5:c.123G>T	12.37:g.10370694G>T			B4E0Y7|Q6FIE6	Silent	SNP	pfam_Atg8_fam,pfam_Atg12	p.V41	ENST00000266458.5	37	c.123	CCDS8620.1	12																																																																																			GABARAPL1	-	pfam_Atg8_fam,pfam_Atg12	ENSG00000139112		0.473	GABARAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABARAPL1	HGNC	protein_coding	OTTHUMT00000399651.1	-	0.00	67	0	G			10370694	+1	tier1	-	no_errors	ENST00000266458	ensembl	human	known	74_37	silent	7.14	52	4	SNP	0.997	T
FZD10	11211	genome.wustl.edu	37	12	130648663	130648663	+	Silent	SNP	C	C	T	rs145130520		TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr12:130648663C>T	ENST00000229030.4	+	1	1660	c.1176C>T	c.(1174-1176)aaC>aaT	p.N392N	FZD10_ENST00000539839.1_Missense_Mutation_p.R360C|FZD10-AS1_ENST00000505807.2_RNA			Q9ULW2	FZD10_HUMAN	frizzled class receptor 10	392					brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|gonad development (GO:0008406)|negative regulation of Rho GTPase activity (GO:0034259)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of actin cytoskeleton organization (GO:0032956)|vasculature development (GO:0001944)	cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.N392K(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|pancreas(1)|prostate(3)|urinary_tract(1)	35	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)		TGGACGTCAACGCGCTCACCG	0.662																																																	1	Substitution - Missense(1)	kidney(1)						C		0,4406		0,0,2203	119.0	107.0	111.0		1176	-0.9	0.0	12	dbSNP_134	111	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	FZD10	NM_007197.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		392/582	130648663	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AB027464	CCDS9267.1	12q24.33	2014-01-29	2014-01-29			ENSG00000111432		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4039	protein-coding gene	gene with protein product		606147	"""frizzled (Drosophila) homolog 10"", ""frizzled homolog 10 (Drosophila)"", ""frizzled 10, seven transmembrane spanning receptor"", ""frizzled family receptor 10"""			10448064	Standard	NM_007197		Approved	CD350	uc001uii.3	Q9ULW2		ENST00000229030.4:c.1176C>T	12.37:g.130648663C>T				Missense_Mutation	SNP	NULL	p.R360C	ENST00000229030.4	37	c.1078	CCDS9267.1	12	.	.	.	.	.	.	.	.	.	.	C	7.619	0.676324	0.14841	0.0	1.16E-4	ENSG00000111432	ENST00000539839	.	.	.	5.21	-0.892	0.10570	.	.	.	.	.	T	0.59824	0.2222	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60188	-0.7312	5	0.87932	D	0	.	6.7516	0.23489	0.0:0.4426:0.2172:0.3402	.	.	.	.	C	360	.	ENSP00000438460:R360C	R	+	1	0	FZD10	129214616	0.045000	0.20229	0.024000	0.17045	0.982000	0.71751	-0.641000	0.05434	-0.065000	0.13021	0.561000	0.74099	CGC	FZD10	-	NULL	ENSG00000111432		0.662	FZD10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD10	HGNC	protein_coding			0.00	10	0	C			130648663	+1			no_errors	ENST00000539839	ensembl	human	known	74_37	missense	42.86	4	3	SNP	0.072	T
GATA2	2624	genome.wustl.edu	37	3	128199937	128199937	+	Silent	SNP	C	C	T	rs569990126		TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr3:128199937C>T	ENST00000341105.2	-	6	1699	c.1368G>A	c.(1366-1368)ccG>ccA	p.P456P	GATA2_ENST00000489987.1_5'UTR|GATA2_ENST00000487848.1_Silent_p.P456P|GATA2_ENST00000430265.2_Silent_p.P442P	NM_032638.4	NP_116027.2	P23769	GATA2_HUMAN	GATA binding protein 2	456					blood coagulation (GO:0007596)|cell differentiation in hindbrain (GO:0021533)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|central nervous system neuron development (GO:0021954)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|definitive hemopoiesis (GO:0060216)|embryonic placenta development (GO:0001892)|eosinophil fate commitment (GO:0035854)|GABAergic neuron differentiation (GO:0097154)|homeostasis of number of cells within a tissue (GO:0048873)|inner ear morphogenesis (GO:0042472)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phagocytosis (GO:0006909)|pituitary gland development (GO:0021983)|positive regulation of angiogenesis (GO:0045766)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of phagocytosis (GO:0050766)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of forebrain neuron differentiation (GO:2000977)|regulation of histone acetylation (GO:0035065)|semicircular canal development (GO:0060872)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)|urogenital system development (GO:0001655)|ventral spinal cord interneuron differentiation (GO:0021514)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	C2H2 zinc finger domain binding (GO:0070742)|chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(58)|kidney(2)|large_intestine(3)|lung(9)|prostate(3)|skin(1)|urinary_tract(1)	79				GBM - Glioblastoma multiforme(114;0.173)		GGATGGGCGTCGGAGTGGGCA	0.667			Mis		AML(CML blast transformation)																																			Dom	yes		3	3q21.3	2624	GATA binding protein 2		L	0													70.0	65.0	67.0					3																	128199937		2203	4299	6502	SO:0001819	synonymous_variant	0			AF169253	CCDS3049.1, CCDS46903.1	3q21	2014-09-17	2001-11-28		ENSG00000179348	ENSG00000179348		"""GATA zinc finger domain containing"""	4171	protein-coding gene	gene with protein product		137295	"""GATA-binding protein 2"""			1714909	Standard	NM_032638		Approved	NFE1B	uc003eko.2	P23769	OTTHUMG00000159689	ENST00000341105.2:c.1368G>A	3.37:g.128199937C>T			D3DNB3|Q53YE0|Q96BH0|Q96BH8|Q9BUJ6	Silent	SNP	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	p.P456	ENST00000341105.2	37	c.1368	CCDS3049.1	3																																																																																			GATA2	-	pirsf_TF_GATA-1/2/3	ENSG00000179348		0.667	GATA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GATA2	HGNC	protein_coding	OTTHUMT00000356925.1	-	0.00	32	0	C	NM_032638		128199937	-1	tier1	-	no_errors	ENST00000341105	ensembl	human	known	74_37	silent	34.62	17	9	SNP	0.173	T
GLB1L3	112937	genome.wustl.edu	37	11	134147678	134147678	+	Silent	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr11:134147678C>T	ENST00000431683.2	+	3	234	c.234C>T	c.(232-234)ccC>ccT	p.P78P	GLB1L3_ENST00000389887.5_Silent_p.P78P	NM_001080407.2	NP_001073876.2	Q8NCI6	GLBL3_HUMAN	galactosidase, beta 1-like 3	78					carbohydrate metabolic process (GO:0005975)		beta-galactosidase activity (GO:0004565)			endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|pancreas(1)	13	all_hematologic(175;0.127)	all_cancers(12;5.52e-23)|all_epithelial(12;2.15e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|all_neural(223;0.0182)|Medulloblastoma(222;0.0208)|Esophageal squamous(93;0.0559)		Epithelial(10;1.3e-11)|all cancers(11;2.07e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000873)|Lung(977;0.222)		GGGGTAAGCCCCACTTCACAC	0.587																																																	0													43.0	48.0	46.0					11																	134147678		2201	4296	6497	SO:0001819	synonymous_variant	0				CCDS44780.1	11q25	2008-11-06	2008-01-29		ENSG00000166105	ENSG00000166105			25147	protein-coding gene	gene with protein product						12477932	Standard	NM_001080407		Approved	FLJ90231	uc009zdf.3	Q8NCI6	OTTHUMG00000133524	ENST00000431683.2:c.234C>T	11.37:g.134147678C>T			A6NEM0|A6NN15|Q6P3S3|Q96FF8	Silent	SNP	pfam_Glycoside_Hdrlase_35,pfam_Glyco_hydro_42_N,superfamily_Glycoside_hydrolase_SF,superfamily_Galactose-bd-like,prints_Glycoside_Hdrlase_35	p.P78	ENST00000431683.2	37	c.234	CCDS44780.1	11																																																																																			GLB1L3	-	superfamily_Glycoside_hydrolase_SF	ENSG00000166105		0.587	GLB1L3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	GLB1L3	HGNC	protein_coding	OTTHUMT00000393625.1	-	0.00	42	0	C	NM_138416		134147678	+1	tier1	-	no_errors	ENST00000431683	ensembl	human	known	74_37	silent	12.00	44	6	SNP	0.001	T
GPR144	347088	genome.wustl.edu	37	9	127220915	127220915	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr9:127220915G>T	ENST00000334810.1	+	10	1706	c.1706G>T	c.(1705-1707)gGg>gTg	p.G569V				Q7Z7M1	GP144_HUMAN	G protein-coupled receptor 144	569					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)	4						ACCCAGGTGGGGTCAGCCATC	0.612																																																	0													90.0	91.0	90.0					9																	127220915		692	1591	2283	SO:0001583	missense	0			AY278562		9q34.11	2014-08-08			ENSG00000180264	ENSG00000180264		"""-"", ""GPCR / Class B : Orphans"""	18651	protein-coding gene	gene with protein product							Standard	XM_006710216		Approved	PGR24	uc010mwn.3	Q7Z7M1	OTTHUMG00000020652	ENST00000334810.1:c.1706G>T	9.37:g.127220915G>T	ENSP00000335156:p.Gly569Val		Q86SL4|Q8NH12	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_Pentaxin,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,superfamily_C-type_lectin_fold,smart_Pentaxin,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_Pentaxin,prints_GPCR_2_secretin-like	p.G569V	ENST00000334810.1	37	c.1706	CCDS48016.1	9	.	.	.	.	.	.	.	.	.	.	G	22.3	4.268326	0.80469	.	.	ENSG00000180264	ENST00000334810;ENST00000439837	T	0.51574	0.7	5.08	5.08	0.68730	.	.	.	.	.	T	0.64046	0.2563	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.60047	-0.7339	9	0.26408	T	0.33	.	15.6221	0.76813	0.0:0.0:1.0:0.0	.	569	Q7Z7M1	GP144_HUMAN	V	569;300	ENSP00000335156:G569V	ENSP00000335156:G569V	G	+	2	0	GPR144	126260736	1.000000	0.71417	0.950000	0.38849	0.940000	0.58332	6.956000	0.76013	2.347000	0.79759	0.655000	0.94253	GGG	GPR144	-	NULL	ENSG00000180264		0.612	GPR144-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR144	HGNC	protein_coding	OTTHUMT00000054026.2	-	0.00	42	0	G	NM_182611		127220915	+1	tier1	-	no_errors	ENST00000334810	ensembl	human	known	74_37	missense	12.12	29	4	SNP	1.000	T
GPR35	2859	genome.wustl.edu	37	2	241569885	241569885	+	Silent	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr2:241569885C>T	ENST00000319838.5	+	6	1458	c.516C>T	c.(514-516)tcC>tcT	p.S172S	GPR35_ENST00000438013.2_Silent_p.S203S|GPR35_ENST00000403859.1_Silent_p.S172S|GPR35_ENST00000407714.1_Silent_p.S172S|GPR35_ENST00000430267.1_Silent_p.S172S	NM_001195381.1	NP_001182310.1	Q9HC97	GPR35_HUMAN	G protein-coupled receptor 35	172					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(1)|cervix(1)|endometrium(1)|lung(7)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	17		all_epithelial(40;7.49e-12)|Breast(86;0.000148)|Renal(207;0.00571)|Ovarian(221;0.104)|all_neural(83;0.107)|all_hematologic(139;0.182)|all_lung(227;0.186)|Melanoma(123;0.238)		Epithelial(32;5.29e-32)|all cancers(36;1.38e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.02e-06)|Lung(119;0.00163)|Colorectal(34;0.00463)|LUSC - Lung squamous cell carcinoma(224;0.008)|COAD - Colon adenocarcinoma(134;0.031)		ATTTCAACTCCATGGCGTTCC	0.652																																																	0													39.0	44.0	42.0					2																	241569885		2181	4270	6451	SO:0001819	synonymous_variant	0				CCDS2541.1, CCDS56174.1	2q37.3	2012-08-21			ENSG00000178623	ENSG00000178623		"""GPCR / Class A : Orphans"""	4492	protein-coding gene	gene with protein product		602646				9479505	Standard	NM_005301		Approved		uc021vze.1	Q9HC97	OTTHUMG00000133356	ENST00000319838.5:c.516C>T	2.37:g.241569885C>T			J3KR30|O43495|Q17R58|Q4VBN5|Q4ZFV2|Q6FHI8|Q86UH4	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.S203	ENST00000319838.5	37	c.609	CCDS2541.1	2																																																																																			GPR35	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000178623		0.652	GPR35-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GPR35	HGNC	protein_coding	OTTHUMT00000325631.1	-	0.00	41	0	C	NM_001195382		241569885	+1	tier1	-	no_errors	ENST00000438013	ensembl	human	known	74_37	silent	20.00	28	7	SNP	0.000	T
GPSM2	29899	genome.wustl.edu	37	1	109428158	109428158	+	Missense_Mutation	SNP	T	T	G			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr1:109428158T>G	ENST00000406462.2	+	3	787	c.14T>G	c.(13-15)tTg>tGg	p.L5W	GPSM2_ENST00000264126.3_Missense_Mutation_p.L5W|AKNAD1_ENST00000357393.4_Intron			P81274	GPSM2_HUMAN	G-protein signaling modulator 2	5					establishment of mitotic spindle orientation (GO:0000132)|G-protein coupled receptor signaling pathway (GO:0007186)|lung epithelial cell differentiation (GO:0060487)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTPase regulator activity (GO:0030695)|identical protein binding (GO:0042802)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)	14		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0353)|Lung(183;0.0984)|COAD - Colon adenocarcinoma(174;0.129)|Epithelial(280;0.175)|all cancers(265;0.209)		GAGGAAAATTTGATAAGCATG	0.289																																																	0													115.0	121.0	119.0					1																	109428158		2203	4296	6499	SO:0001583	missense	0			AY136740	CCDS792.2	1p13.3	2013-10-11	2010-06-24		ENSG00000121957	ENSG00000121957		"""Tetratricopeptide (TTC) repeat domain containing"""	29501	protein-coding gene	gene with protein product		609245	"""G-protein signalling modulator 2 (AGS3-like, C. elegans)"", ""deafness, autosomal recessive 82"""	DFNB82		11832491, 8973305, 19888295, 20602914, 21348867	Standard	NM_013296		Approved	LGN, Pins	uc010ovc.2	P81274	OTTHUMG00000011730	ENST00000406462.2:c.14T>G	1.37:g.109428158T>G	ENSP00000385510:p.Leu5Trp		Q5T1N8|Q6IBL7|Q8N0Z5	Missense_Mutation	SNP	pfam_GoLoco_motif,pfam_TPR_1,pfam_TPR-4,smart_TPR_repeat,smart_GoLoco_motif,pfscan_GoLoco_motif,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.L5W	ENST00000406462.2	37	c.14	CCDS792.2	1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.985819	0.74589	.	.	ENSG00000121957	ENST00000406462;ENST00000435987;ENST00000264126;ENST00000435475;ENST00000446797	D;D;D	0.94576	-3.46;-2.71;-3.46	5.62	5.62	0.85841	.	0.101272	0.42172	D	0.000747	D	0.91855	0.7422	N	0.08118	0	0.35700	D	0.815587	D	0.76494	0.999	D	0.81914	0.995	D	0.94990	0.8133	10	0.87932	D	0	0.4938	14.6851	0.69044	0.0:0.0:0.0:1.0	.	5	P81274	GPSM2_HUMAN	W	5	ENSP00000385510:L5W;ENSP00000408664:L5W;ENSP00000264126:L5W	ENSP00000264126:L5W	L	+	2	0	GPSM2	109229681	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	5.461000	0.66699	2.260000	0.74910	0.528000	0.53228	TTG	GPSM2	-	NULL	ENSG00000121957		0.289	GPSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPSM2	HGNC	protein_coding	OTTHUMT00000032400.3	-	0.00	55	0	T	NM_013296		109428158	+1	tier1	-	no_errors	ENST00000264126	ensembl	human	known	74_37	missense	21.05	45	12	SNP	1.000	G
GPSM2	29899	genome.wustl.edu	37	1	109428170	109428170	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr1:109428170G>A	ENST00000406462.2	+	3	799	c.26G>A	c.(25-27)aGa>aAa	p.R9K	GPSM2_ENST00000264126.3_Missense_Mutation_p.R9K|AKNAD1_ENST00000357393.4_Intron			P81274	GPSM2_HUMAN	G-protein signaling modulator 2	9					establishment of mitotic spindle orientation (GO:0000132)|G-protein coupled receptor signaling pathway (GO:0007186)|lung epithelial cell differentiation (GO:0060487)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTPase regulator activity (GO:0030695)|identical protein binding (GO:0042802)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)	14		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0353)|Lung(183;0.0984)|COAD - Colon adenocarcinoma(174;0.129)|Epithelial(280;0.175)|all cancers(265;0.209)		ATAAGCATGAGAGAAGACCAT	0.303																																																	0													127.0	133.0	131.0					1																	109428170		2203	4296	6499	SO:0001583	missense	0			AY136740	CCDS792.2	1p13.3	2013-10-11	2010-06-24		ENSG00000121957	ENSG00000121957		"""Tetratricopeptide (TTC) repeat domain containing"""	29501	protein-coding gene	gene with protein product		609245	"""G-protein signalling modulator 2 (AGS3-like, C. elegans)"", ""deafness, autosomal recessive 82"""	DFNB82		11832491, 8973305, 19888295, 20602914, 21348867	Standard	NM_013296		Approved	LGN, Pins	uc010ovc.2	P81274	OTTHUMG00000011730	ENST00000406462.2:c.26G>A	1.37:g.109428170G>A	ENSP00000385510:p.Arg9Lys		Q5T1N8|Q6IBL7|Q8N0Z5	Missense_Mutation	SNP	pfam_GoLoco_motif,pfam_TPR_1,pfam_TPR-4,smart_TPR_repeat,smart_GoLoco_motif,pfscan_GoLoco_motif,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R9K	ENST00000406462.2	37	c.26	CCDS792.2	1	.	.	.	.	.	.	.	.	.	.	G	16.71	3.199119	0.58126	.	.	ENSG00000121957	ENST00000406462;ENST00000435987;ENST00000264126;ENST00000435475;ENST00000446797	D;D;D	0.92911	-3.13;-2.35;-3.13	5.62	5.62	0.85841	.	0.138954	0.49305	D	0.000148	T	0.75895	0.3912	N	0.08118	0	0.27814	N	0.942036	B	0.26002	0.139	B	0.24006	0.05	T	0.69312	-0.5178	10	0.46703	T	0.11	0.5901	15.3314	0.74215	0.0:0.1386:0.8614:0.0	.	9	P81274	GPSM2_HUMAN	K	9	ENSP00000385510:R9K;ENSP00000408664:R9K;ENSP00000264126:R9K	ENSP00000264126:R9K	R	+	2	0	GPSM2	109229693	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.989000	0.63870	2.801000	0.96364	0.650000	0.86243	AGA	GPSM2	-	NULL	ENSG00000121957		0.303	GPSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPSM2	HGNC	protein_coding	OTTHUMT00000032400.3	-	0.00	60	0	G	NM_013296		109428170	+1	tier1	-	no_errors	ENST00000264126	ensembl	human	known	74_37	missense	20.34	47	12	SNP	1.000	A
GPSM2	29899	genome.wustl.edu	37	1	109428178	109428178	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr1:109428178C>A	ENST00000406462.2	+	3	807	c.34C>A	c.(34-36)Cat>Aat	p.H12N	GPSM2_ENST00000264126.3_Missense_Mutation_p.H12N|AKNAD1_ENST00000357393.4_Intron			P81274	GPSM2_HUMAN	G-protein signaling modulator 2	12					establishment of mitotic spindle orientation (GO:0000132)|G-protein coupled receptor signaling pathway (GO:0007186)|lung epithelial cell differentiation (GO:0060487)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTPase regulator activity (GO:0030695)|identical protein binding (GO:0042802)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)	14		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0353)|Lung(183;0.0984)|COAD - Colon adenocarcinoma(174;0.129)|Epithelial(280;0.175)|all cancers(265;0.209)		GAGAGAAGACCATTCTTTTCA	0.303																																																	0													128.0	134.0	132.0					1																	109428178		2203	4296	6499	SO:0001583	missense	0			AY136740	CCDS792.2	1p13.3	2013-10-11	2010-06-24		ENSG00000121957	ENSG00000121957		"""Tetratricopeptide (TTC) repeat domain containing"""	29501	protein-coding gene	gene with protein product		609245	"""G-protein signalling modulator 2 (AGS3-like, C. elegans)"", ""deafness, autosomal recessive 82"""	DFNB82		11832491, 8973305, 19888295, 20602914, 21348867	Standard	NM_013296		Approved	LGN, Pins	uc010ovc.2	P81274	OTTHUMG00000011730	ENST00000406462.2:c.34C>A	1.37:g.109428178C>A	ENSP00000385510:p.His12Asn		Q5T1N8|Q6IBL7|Q8N0Z5	Missense_Mutation	SNP	pfam_GoLoco_motif,pfam_TPR_1,pfam_TPR-4,smart_TPR_repeat,smart_GoLoco_motif,pfscan_GoLoco_motif,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.H12N	ENST00000406462.2	37	c.34	CCDS792.2	1	.	.	.	.	.	.	.	.	.	.	C	13.24	2.177624	0.38413	.	.	ENSG00000121957	ENST00000406462;ENST00000435987;ENST00000264126;ENST00000435475;ENST00000446797	D;D;D	0.92595	-3.07;-2.32;-3.07	5.62	5.62	0.85841	.	0.073127	0.56097	D	0.000023	T	0.69052	0.3068	N	0.01168	-0.975	0.28934	N	0.891417	B	0.22276	0.067	B	0.21917	0.037	T	0.58907	-0.7553	10	0.25106	T	0.35	8.9705	18.2007	0.89836	0.0:1.0:0.0:0.0	.	12	P81274	GPSM2_HUMAN	N	12	ENSP00000385510:H12N;ENSP00000408664:H12N;ENSP00000264126:H12N	ENSP00000264126:H12N	H	+	1	0	GPSM2	109229701	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.822000	0.48073	2.801000	0.96364	0.650000	0.86243	CAT	GPSM2	-	NULL	ENSG00000121957		0.303	GPSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPSM2	HGNC	protein_coding	OTTHUMT00000032400.3	-	0.00	63	0	C	NM_013296		109428178	+1	tier1	-	no_errors	ENST00000264126	ensembl	human	known	74_37	missense	22.58	48	14	SNP	1.000	A
GPR52	9293	genome.wustl.edu	37	1	174417291	174417291	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr1:174417291G>T	ENST00000367685.2	+	1	80	c.42G>T	c.(40-42)atG>atT	p.M14I	RABGAP1L_ENST00000357444.6_Intron|RABGAP1L_ENST00000367689.3_Intron|RABGAP1L_ENST00000251507.4_Intron	NM_005684.4	NP_005675.3	Q9Y2T5	GPR52_HUMAN	G protein-coupled receptor 52	14					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(3)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|prostate(1)|skin(2)	20						TCCTGAACATGAGCAGTGGCA	0.507																																					Ovarian(92;924 1390 1930 16467 40583)												0													185.0	152.0	163.0					1																	174417291		2203	4300	6503	SO:0001583	missense	0			AF096784	CCDS30941.1	1q24	2012-08-21			ENSG00000203737	ENSG00000203737		"""GPCR / Class A : Orphans"""	4508	protein-coding gene	gene with protein product		604106				9931487	Standard	NM_005684		Approved		uc001gka.1	Q9Y2T5	OTTHUMG00000034901	ENST00000367685.2:c.42G>T	1.37:g.174417291G>T	ENSP00000356658:p.Met14Ile		O75654|Q4VBL6|Q6ISM0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.M14I	ENST00000367685.2	37	c.42	CCDS30941.1	1	.	.	.	.	.	.	.	.	.	.	G	7.916	0.737502	0.15574	.	.	ENSG00000203737	ENST00000367685	T	0.59502	0.26	6.03	4.09	0.47781	.	0.860593	0.09691	U	0.768391	T	0.41949	0.1181	N	0.19112	0.55	0.22819	N	0.998698	B	0.02656	0.0	B	0.01281	0.0	T	0.26395	-1.0104	10	0.22109	T	0.4	2.0647	10.1601	0.42847	0.0671:0.2607:0.6722:0.0	.	14	Q9Y2T5	GPR52_HUMAN	I	14	ENSP00000356658:M14I	ENSP00000356658:M14I	M	+	3	0	GPR52	172683914	1.000000	0.71417	0.788000	0.31933	0.993000	0.82548	2.884000	0.48562	0.808000	0.34231	0.655000	0.94253	ATG	GPR52	-	NULL	ENSG00000203737		0.507	GPR52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR52	HGNC	protein_coding	OTTHUMT00000084511.1	-	0.00	37	0	G	NM_005684		174417291	+1	tier1	-	no_errors	ENST00000367685	ensembl	human	known	74_37	missense	52.78	17	19	SNP	0.946	T
GRIA4	2893	genome.wustl.edu	37	11	105797547	105797547	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr11:105797547C>T	ENST00000530497.1	+	12	1928	c.1928C>T	c.(1927-1929)gCt>gTt	p.A643V	GRIA4_ENST00000525187.1_Missense_Mutation_p.A643V|GRIA4_ENST00000282499.5_Missense_Mutation_p.A643V|GRIA4_ENST00000393127.2_Missense_Mutation_p.A643V			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	643					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		GCTAACCTCGCTGCTTTCCTG	0.423																																																	0													130.0	127.0	128.0					11																	105797547		2202	4298	6500	SO:0001583	missense	0			U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.1928C>T	11.37:g.105797547C>T	ENSP00000435775:p.Ala643Val		Q86XE8	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.A643V	ENST00000530497.1	37	c.1928	CCDS8333.1	11	.	.	.	.	.	.	.	.	.	.	C	36	5.654494	0.96724	.	.	ENSG00000152578	ENST00000282499;ENST00000393127;ENST00000530497;ENST00000525187	T;T;T;T	0.61980	0.06;0.06;0.06;0.06	5.76	5.76	0.90799	Ionotropic glutamate receptor (2);	0.000000	0.64402	D	0.000001	D	0.87269	0.6135	H	0.96943	3.91	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.998	D	0.90539	0.4501	10	0.87932	D	0	.	20.3242	0.98691	0.0:1.0:0.0:0.0	.	643;643	P48058;G3V164	GRIA4_HUMAN;.	V	643	ENSP00000282499:A643V;ENSP00000376835:A643V;ENSP00000435775:A643V;ENSP00000432180:A643V	ENSP00000282499:A643V	A	+	2	0	GRIA4	105302757	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.776000	0.85560	2.882000	0.98803	0.655000	0.94253	GCT	GRIA4	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,prints_NMDA_rcpt	ENSG00000152578		0.423	GRIA4-005	KNOWN	basic|CCDS	protein_coding	GRIA4	HGNC	protein_coding	OTTHUMT00000388593.1	-	0.00	79	0	C			105797547	+1	tier1	-	no_errors	ENST00000282499	ensembl	human	known	74_37	missense	25.74	75	26	SNP	1.000	T
HCP5	10866	genome.wustl.edu	37	6	31430992	31430992	+	RNA	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr6:31430992C>T	ENST00000414046.2	+	0	155					NR_040662.1		Q6MZN7	HCP5_HUMAN	HLA complex P5 (non-protein coding)						defense response (GO:0006952)					urinary_tract(1)	1						GGTTGCGGGTCATGGAGTCCC	0.637																																																	0													20.0	23.0	22.0					6																	31430992		692	1591	2283			0			D88650		6p21.3	2012-10-16	2011-08-02		ENSG00000206337	ENSG00000206337		"""Long non-coding RNAs"""	21659	non-coding RNA	RNA, long non-coding		604676	"""HLA complex P5"""			8462994, 10199916	Standard	NR_040662		Approved	D6S2650E, P5-1	uc003ntl.3	Q6MZN7	OTTHUMG00000031282		6.37:g.31430992C>T			Q04490	RNA	SNP	-	NULL	ENST00000414046.2	37	NULL		6																																																																																			HCP5	-	-	ENSG00000206337		0.637	HCP5-001	KNOWN	basic	sense_overlapping	HCP5	HGNC	sense_overlapping	OTTHUMT00000076614.4	-	0.00	64	0	C	NR_040662		31430992	+1	tier1	-	no_errors	ENST00000414046	ensembl	human	known	74_37	rna	11.32	47	6	SNP	0.000	T
HDC	3067	genome.wustl.edu	37	15	50549624	50549624	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr15:50549624G>T	ENST00000267845.3	-	4	841	c.439C>A	c.(439-441)Cag>Aag	p.Q147K	HDC_ENST00000543581.1_Missense_Mutation_p.Q147K	NM_002112.3	NP_002103.2	Q9UBI9	HDC_HUMAN	histidine decarboxylase	0					respiratory tube development (GO:0030323)	membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)		GGAGGTACCTGCAGGACGCCT	0.557																																					GBM(95;1627 1936 6910 9570)												0													107.0	94.0	98.0					15																	50549624		2196	4295	6491	SO:0001583	missense	0				CCDS10134.1	15q21.2	2013-09-20			ENSG00000140287	ENSG00000140287	4.1.1.22		4855	protein-coding gene	gene with protein product		142704				1487235	Standard	NM_002112		Approved		uc001zxz.3	P19113	OTTHUMG00000131644	ENST00000267845.3:c.439C>A	15.37:g.50549624G>T	ENSP00000267845:p.Gln147Lys			Missense_Mutation	SNP	pfam_PyrdxlP-dep_de-COase,superfamily_PyrdxlP-dep_Trfase,prints_Aromatic_deC	p.Q147K	ENST00000267845.3	37	c.439	CCDS10134.1	15	.	.	.	.	.	.	.	.	.	.	G	18.31	3.594854	0.66219	.	.	ENSG00000140287	ENST00000267845;ENST00000543581	T;T	0.38401	1.14;1.14	5.13	5.13	0.70059	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	T	0.74981	0.3788	H	0.97365	3.99	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.999;1.0	D	0.84579	0.0660	10	0.87932	D	0	-19.8613	18.7731	0.91900	0.0:0.0:1.0:0.0	.	147;147	B7ZM01;P19113	.;DCHS_HUMAN	K	147	ENSP00000267845:Q147K;ENSP00000440252:Q147K	ENSP00000267845:Q147K	Q	-	1	0	HDC	48336916	1.000000	0.71417	0.967000	0.41034	0.022000	0.10575	9.657000	0.98554	2.675000	0.91044	0.655000	0.94253	CAG	HDC	-	pfam_PyrdxlP-dep_de-COase,superfamily_PyrdxlP-dep_Trfase,prints_Aromatic_deC	ENSG00000140287		0.557	HDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDC	HGNC	protein_coding	OTTHUMT00000254540.1	-	0.00	31	0	G			50549624	-1	tier1	-	no_errors	ENST00000267845	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
HDGF	3068	genome.wustl.edu	37	1	156713965	156713965	+	Missense_Mutation	SNP	T	T	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr1:156713965T>A	ENST00000357325.5	-	4	793	c.479A>T	c.(478-480)gAc>gTc	p.D160V	HDGF_ENST00000416666.2_Missense_Mutation_p.D128V|HDGF_ENST00000537739.1_Missense_Mutation_p.D160V|HDGF_ENST00000465180.1_5'UTR|HDGF_ENST00000368206.5_Missense_Mutation_p.D176V|HDGF_ENST00000368209.5_Missense_Mutation_p.D153V	NM_004494.2	NP_004485.1	P51858	HDGF_HUMAN	hepatoma-derived growth factor	160	Glu-rich.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to nucleus (GO:0034504)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription corepressor binding (GO:0001222)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)	9	all_hematologic(923;0.088)|Hepatocellular(266;0.158)	Breast(1374;0.198)		Colorectal(1306;0.018)		CTCCAGCAAGTCCCCTGCTCT	0.617																																																	0													256.0	215.0	229.0					1																	156713965		2203	4300	6503	SO:0001583	missense	0			D16431	CCDS1156.1, CCDS44247.1, CCDS44248.1	1q23.1	2013-10-14	2010-03-19		ENSG00000143321	ENSG00000143321			4856	protein-coding gene	gene with protein product	"""high-mobility group protein 1-like"""	600339	"""hepatoma-derived growth factor (high-mobility group protein 1-like)"""			8833162	Standard	NM_004494		Approved	HMG1L2	uc001fpy.4	P51858	OTTHUMG00000041295	ENST00000357325.5:c.479A>T	1.37:g.156713965T>A	ENSP00000349878:p.Asp160Val		B3KU21|D3DVC9|Q5SZ07|Q5SZ08|Q5SZ09	Missense_Mutation	SNP	pfam_PWWP_dom	p.D176V	ENST00000357325.5	37	c.527	CCDS1156.1	1	.	.	.	.	.	.	.	.	.	.	T	17.53	3.413598	0.62511	.	.	ENSG00000143321	ENST00000357325;ENST00000368209;ENST00000537739;ENST00000416666;ENST00000368206;ENST00000406805	T;T;T;T;T	0.35048	1.77;1.35;1.77;1.38;1.33	4.6	4.6	0.57074	.	0.134244	0.48767	U	0.000168	T	0.39860	0.1094	L	0.55990	1.75	0.54753	D	0.999989	D;D;D;P;D	0.69078	0.969;0.977;0.997;0.745;0.988	P;P;P;B;P	0.61874	0.704;0.779;0.895;0.425;0.779	T	0.28870	-1.0030	10	0.49607	T	0.09	-12.6919	12.0212	0.53344	0.0:0.0:0.0:1.0	.	135;160;176;153;160	B7Z958;B2RDE8;Q5SZ07;Q5SZ08;P51858	.;.;.;.;HDGF_HUMAN	V	160;153;160;128;176;183	ENSP00000349878:D160V;ENSP00000357192:D153V;ENSP00000443120:D160V;ENSP00000416752:D128V;ENSP00000357189:D176V	ENSP00000349878:D160V	D	-	2	0	HDGF	154980589	1.000000	0.71417	0.996000	0.52242	0.762000	0.43233	4.474000	0.60203	1.936000	0.56123	0.369000	0.22263	GAC	HDGF	-	NULL	ENSG00000143321		0.617	HDGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDGF	HGNC	protein_coding	OTTHUMT00000098946.1	-	0.00	17	0	T	NM_004494		156713965	-1	tier1	-	no_errors	ENST00000368206	ensembl	human	known	74_37	missense	36.36	14	8	SNP	0.997	A
HELZ	9931	genome.wustl.edu	37	17	65186379	65186379	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr17:65186379G>A	ENST00000358691.5	-	10	816	c.650C>T	c.(649-651)tCa>tTa	p.S217L	HELZ_ENST00000580168.1_Missense_Mutation_p.S217L|HELZ_ENST00000580662.1_5'UTR	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	217						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					TATCAGCCGTGAAGCATATCT	0.398																																																	0													152.0	136.0	141.0					17																	65186379		1871	4107	5978	SO:0001583	missense	0			D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.650C>T	17.37:g.65186379G>A	ENSP00000351524:p.Ser217Leu		I6L9H4	Missense_Mutation	SNP	pfam_Znf_CCCH,superfamily_P-loop_NTPase,smart_Znf_CCCH	p.S217L	ENST00000358691.5	37	c.650	CCDS42374.1	17	.	.	.	.	.	.	.	.	.	.	G	13.22	2.170775	0.38315	.	.	ENSG00000198265	ENST00000358691;ENST00000417253	D;T	0.83419	-1.72;1.46	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.81527	0.4841	L	0.44542	1.39	0.80722	D	1	P;B	0.48998	0.918;0.447	P;B	0.46885	0.53;0.165	T	0.77242	-0.2660	10	0.14252	T	0.57	-12.1352	19.5907	0.95509	0.0:0.0:1.0:0.0	.	217;217	B7ZLW2;P42694	.;HELZ_HUMAN	L	217	ENSP00000351524:S217L;ENSP00000411144:S217L	ENSP00000351524:S217L	S	-	2	0	HELZ	62616841	1.000000	0.71417	0.700000	0.30305	0.529000	0.34654	7.608000	0.82898	2.640000	0.89533	0.655000	0.94253	TCA	HELZ	-	NULL	ENSG00000198265		0.398	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HELZ	HGNC	protein_coding	OTTHUMT00000447068.1	-	0.00	80	0	G	NM_014877		65186379	-1	tier1	-	no_errors	ENST00000358691	ensembl	human	known	74_37	missense	11.76	75	10	SNP	1.000	A
HERC1	8925	genome.wustl.edu	37	15	63916468	63916468	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr15:63916468G>A	ENST00000443617.2	-	72	13421	c.13334C>T	c.(13333-13335)cCt>cTt	p.P4445L		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	4445					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						GGCTAACAAAGGCCGAAGTTG	0.453																																																	0													145.0	133.0	137.0					15																	63916468		1897	4127	6024	SO:0001583	missense	0			U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.13334C>T	15.37:g.63916468G>A	ENSP00000390158:p.Pro4445Leu		Q8IW65	Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_WD40_repeat,pfam_SPRY_rcpt,superfamily_RCC1/BLIP-II,superfamily_HECT,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl_sf,superfamily_UBA-like,superfamily_ARM-type_fold,smart_SPla/RYanodine_receptor_subgr,smart_WD40_repeat,smart_HECT,pfscan_B30.2/SPRY,pfscan_HECT,pfscan_Reg_chr_condens,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Reg_chr_condens	p.P4445L	ENST00000443617.2	37	c.13334	CCDS45277.1	15	.	.	.	.	.	.	.	.	.	.	G	28.8	4.952060	0.92660	.	.	ENSG00000103657	ENST00000443617	T	0.24538	1.85	5.3	5.3	0.74995	.	0.073871	0.53938	U	0.000056	T	0.25717	0.0626	L	0.43152	1.355	0.80722	D	1	P	0.41313	0.745	B	0.36418	0.224	T	0.04191	-1.0970	10	0.54805	T	0.06	.	19.3238	0.94253	0.0:0.0:1.0:0.0	.	4445	Q15751	HERC1_HUMAN	L	4445	ENSP00000390158:P4445L	ENSP00000390158:P4445L	P	-	2	0	HERC1	61703521	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.531000	0.67148	2.614000	0.88457	0.655000	0.94253	CCT	HERC1	-	NULL	ENSG00000103657		0.453	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC1	HGNC	protein_coding	OTTHUMT00000418523.1	-	0.00	59	0	G	NM_003922		63916468	-1	tier1	-	no_errors	ENST00000443617	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	A
HLX	3142	genome.wustl.edu	37	1	221057561	221057561	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr1:221057561C>T	ENST00000366903.6	+	4	2483	c.982C>T	c.(982-984)Cgg>Tgg	p.R328W	HLX_ENST00000549319.1_Missense_Mutation_p.R114W	NM_021958.3	NP_068777.1	Q14774	HLX_HUMAN	H2.0-like homeobox	328					cell differentiation (GO:0030154)|embryonic digestive tract morphogenesis (GO:0048557)|enteric nervous system development (GO:0048484)|liver development (GO:0001889)|multicellular organismal development (GO:0007275)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|positive regulation of cell proliferation (GO:0008284)|positive regulation of organ growth (GO:0046622)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(9)|lung(11)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	32				GBM - Glioblastoma multiforme(131;0.00914)		CCAGAACCGGCGGATGAAGTG	0.637																																																	0													37.0	42.0	41.0					1																	221057561		2201	4297	6498	SO:0001583	missense	0			BC033808	CCDS1527.1	1q41	2011-06-20	2007-07-26	2007-07-26	ENSG00000136630	ENSG00000136630		"""Homeoboxes / ANTP class : NKL subclass"""	4978	protein-coding gene	gene with protein product		142995	"""H2.0 (Drosophila)-like homeo box 1"", ""H2.0-like homeobox 1 (Drosophila)"", ""H2.0-like homeobox 1"""	HLX1		1676597, 7806220	Standard	NM_021958		Approved	HB24	uc001hmv.4	Q14774	OTTHUMG00000037352	ENST00000366903.6:c.982C>T	1.37:g.221057561C>T	ENSP00000355870:p.Arg328Trp		B2R8A8|Q15988|Q59HE7|Q9NZ75	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_HTH_motif,prints_Homeobox_metazoa	p.R328W	ENST00000366903.6	37	c.982	CCDS1527.1	1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.191297	0.78902	.	.	ENSG00000136630	ENST00000366903;ENST00000427693;ENST00000549319	D;D;D	0.99311	-5.51;-5.73;-5.51	4.89	-1.45	0.08828	Homeobox, eukaryotic (1);Homeodomain-related (1);Helix-turn-helix motif, lambda-like repressor (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.111005	0.36374	N	0.002634	D	0.99542	0.9836	H	0.97103	3.94	0.48632	D	0.999685	D	0.89917	1.0	D	0.97110	1.0	D	0.99278	1.0895	10	0.87932	D	0	-26.9734	15.1971	0.73100	0.6342:0.3658:0.0:0.0	.	328	Q14774	HLX_HUMAN	W	328;61;114	ENSP00000355870:R328W;ENSP00000408248:R61W;ENSP00000449882:R114W	ENSP00000355870:R328W	R	+	1	2	HLX	219124184	0.241000	0.23857	0.988000	0.46212	0.982000	0.71751	0.635000	0.24629	-0.105000	0.12132	-0.320000	0.08662	CGG	HLX	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_HTH_motif,prints_Homeobox_metazoa	ENSG00000136630		0.637	HLX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLX	HGNC	protein_coding	OTTHUMT00000090902.3	-	0.00	35	0	C	NM_021958		221057561	+1	tier1	-	no_errors	ENST00000366903	ensembl	human	known	74_37	missense	50.00	15	15	SNP	1.000	T
HMG20A	10363	genome.wustl.edu	37	15	77759475	77759475	+	Silent	SNP	G	G	A	rs144562040		TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr15:77759475G>A	ENST00000381714.3	+	5	704	c.276G>A	c.(274-276)aaG>aaA	p.K92K	HMG20A_ENST00000336216.4_Silent_p.K92K	NM_018200.2	NP_060670.1	Q9NP66	HM20A_HUMAN	high mobility group 20A	92					chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18						AAGGAAGAAAGAGGAAGAAAC	0.423																																																	0								G		1,4391	2.1+/-5.4	0,1,2195	81.0	78.0	79.0		276	4.1	1.0	15	dbSNP_134	79	0,8588		0,0,4294	no	coding-synonymous	HMG20A	NM_018200.2		0,1,6489	AA,AG,GG		0.0,0.0228,0.0077		92/348	77759475	1,12979	2196	4294	6490	SO:0001819	synonymous_variant	0			AF146222	CCDS10295.1	15q24	2011-07-01	2011-04-05		ENSG00000140382	ENSG00000140382		"""High mobility group / Non-canonical"""	5001	protein-coding gene	gene with protein product	"""HMG box domain containing 1"""	605534	"""high-mobility group 20A"""			10773667	Standard	NM_018200		Approved	HMGX1, FLJ10739, HMGXB1	uc002bcr.3	Q9NP66	OTTHUMG00000143729	ENST00000381714.3:c.276G>A	15.37:g.77759475G>A			A6NHY3|D3DW78|Q53G31|Q9NSF6	Silent	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.K92	ENST00000381714.3	37	c.276	CCDS10295.1	15																																																																																			HMG20A	-	superfamily_HMG_box_dom	ENSG00000140382		0.423	HMG20A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HMG20A	HGNC	protein_coding	OTTHUMT00000419512.2	-	0.00	62	0	G	NM_018200		77759475	+1	tier1	rs144562040	no_errors	ENST00000336216	ensembl	human	known	74_37	silent	8.00	69	6	SNP	1.000	A
IFI44L	10964	genome.wustl.edu	37	1	79095535	79095535	+	Missense_Mutation	SNP	A	A	G			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr1:79095535A>G	ENST00000370751.5	+	4	837	c.658A>G	c.(658-660)Att>Gtt	p.I220V	IFI44L_ENST00000342282.3_5'UTR|IFI44L_ENST00000476521.1_3'UTR	NM_006820.2	NP_006811.2	Q53G44	IF44L_HUMAN	interferon-induced protein 44-like	220					defense response to virus (GO:0051607)|immune response (GO:0006955)	cytoplasm (GO:0005737)				endometrium(4)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	22						AGTCAAGTCTATTTTTCATGG	0.428																																																	0													103.0	103.0	103.0					1																	79095535		2203	4300	6503	SO:0001583	missense	0			AB000115	CCDS687.2	1p22.3	2008-07-18	2004-11-12	2004-11-12	ENSG00000137959	ENSG00000137959			17817	protein-coding gene	gene with protein product		613975	"""chromosome 1 open reading frame 29"""	C1orf29			Standard	NM_006820		Approved	GS3686	uc010oro.2	Q53G44	OTTHUMG00000009724	ENST00000370751.5:c.658A>G	1.37:g.79095535A>G	ENSP00000359787:p.Ile220Val		Q86TE1|Q96B64|Q99984	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.I220V	ENST00000370751.5	37	c.658	CCDS687.2	1	.	.	.	.	.	.	.	.	.	.	A	0.012	-1.683253	0.00745	.	.	ENSG00000137959	ENST00000370751;ENST00000450498	T;T	0.12879	2.79;2.64	2.95	-3.26	0.05064	.	0.968356	0.08431	N	0.946885	T	0.01061	0.0035	N	0.02334	-0.595	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.49826	-0.8898	10	0.02654	T	1	-4.3711	8.48	0.33036	0.585:0.0:0.415:0.0	.	220	Q53G44	IF44L_HUMAN	V	220;197	ENSP00000359787:I220V;ENSP00000400784:I197V	ENSP00000359787:I220V	I	+	1	0	IFI44L	78868123	0.083000	0.21467	0.262000	0.24481	0.619000	0.37552	-0.010000	0.12743	-0.733000	0.04850	-0.308000	0.09152	ATT	IFI44L	-	superfamily_P-loop_NTPase	ENSG00000137959		0.428	IFI44L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFI44L	HGNC	protein_coding	OTTHUMT00000026834.3	-	0.00	41	0	A	NM_006820		79095535	+1	tier1	-	no_errors	ENST00000370751	ensembl	human	known	74_37	missense	34.88	27	15	SNP	0.863	G
IGSF3	3321	genome.wustl.edu	37	1	117127627	117127627	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr1:117127627C>G	ENST00000369486.3	-	9	3253	c.2488G>C	c.(2488-2490)Gag>Cag	p.E830Q	IGSF3_ENST00000369483.1_Missense_Mutation_p.E850Q|IGSF3_ENST00000318837.6_Missense_Mutation_p.E850Q	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	830	Ig-like C2-type 7.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		TGCCGGGTCTCCAGAACCGAC	0.557																																																	0													35.0	37.0	36.0					1																	117127627		2202	4299	6501	SO:0001583	missense	0			AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.2488G>C	1.37:g.117127627C>G	ENSP00000358498:p.Glu830Gln		A6NJZ6|A6NMC7	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.E850Q	ENST00000369486.3	37	c.2548	CCDS30813.1	1	.	.	.	.	.	.	.	.	.	.	C	19.03	3.748409	0.69533	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.68765	-0.35;-0.35;-0.35	5.08	5.08	0.68730	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.671525	0.13983	N	0.349344	T	0.55081	0.1898	L	0.47716	1.5	0.45962	D	0.998786	P;B;P	0.42827	0.751;0.128;0.791	B;B;B	0.43508	0.297;0.144;0.422	T	0.61118	-0.7127	10	0.62326	D	0.03	-32.4853	13.8519	0.63501	0.0:1.0:0.0:0.0	.	850;830;850	O75054-2;O75054;A6NJZ6	.;IGSF3_HUMAN;.	Q	830;850;850	ENSP00000358498:E830Q;ENSP00000358495:E850Q;ENSP00000321184:E850Q	ENSP00000321184:E850Q	E	-	1	0	IGSF3	116929150	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.124000	0.71620	2.631000	0.89168	0.655000	0.94253	GAG	IGSF3	-	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000143061		0.557	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGSF3	HGNC	protein_coding	OTTHUMT00000059040.1		0.00	25	0	C	NM_001542		117127627	-1			no_errors	ENST00000318837	ensembl	human	known	74_37	missense	7.69	24	2	SNP	1.000	G
HRNR	388697	genome.wustl.edu	37	1	152186614	152186614	+	Silent	SNP	C	C	G			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr1:152186614C>G	ENST00000368801.2	-	3	7566	c.7491G>C	c.(7489-7491)tcG>tcC	p.S2497S	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	2497					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGCCACAGCTCGATGACTGTC	0.557																																																	0													1.0	1.0	1.0					1																	152186614		84	271	355	SO:0001819	synonymous_variant	0			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.7491G>C	1.37:g.152186614C>G			Q5DT20|Q5U1F4	Silent	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.S2497	ENST00000368801.2	37	c.7491	CCDS30859.1	1																																																																																			HRNR	-	NULL	ENSG00000197915		0.557	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	HGNC	protein_coding	OTTHUMT00000034016.1	-	0.00	17	0	C	XM_373868		152186614	-1	tier1	-	no_errors	ENST00000368801	ensembl	human	known	74_37	silent	28.57	14	6	SNP	0.000	G
IL22RA2	116379	genome.wustl.edu	37	6	137476103	137476103	+	Silent	SNP	C	C	T	rs143485398		TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr6:137476103C>T	ENST00000296980.2	-	5	747	c.447G>A	c.(445-447)acG>acA	p.T149T	IL22RA2_ENST00000339602.3_Silent_p.T117T|IL22RA2_ENST00000349184.4_Silent_p.T117T	NM_052962.2	NP_443194.1	Q969J5	I22R2_HUMAN	interleukin 22 receptor, alpha 2	149	Fibronectin type-III 2.				cytokine-mediated signaling pathway (GO:0019221)|negative regulation of inflammatory response (GO:0050728)|regulation of tyrosine phosphorylation of Stat3 protein (GO:0042516)	cytosol (GO:0005829)|extracellular space (GO:0005615)	interleukin-22 binding (GO:0042017)|interleukin-22 receptor activity (GO:0042018)			endometrium(1)|large_intestine(1)|lung(3)	5	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000313)|OV - Ovarian serous cystadenocarcinoma(155;0.00407)		TGAACCGCGGCGTCATGCTCC	0.552													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16274	0.0		0.0	False		,,,				2504	0.0																0								C	,,	0,4406		0,0,2203	121.0	111.0	115.0		447,351,351	-11.5	0.0	6	dbSNP_134	115	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	IL22RA2	NM_052962.2,NM_181309.1,NM_181310.1	,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,	149/264,117/232,117/131	137476103	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AY044429	CCDS5182.1, CCDS5183.1, CCDS5184.1	6q24.1-q24.2	2008-02-05			ENSG00000164485	ENSG00000164485		"""Interleukins and interleukin receptors"""	14901	protein-coding gene	gene with protein product		606648				11481447, 11390454	Standard	NM_181309		Approved	CRF2-S1, IL-22BP	uc003qhl.3	Q969J5	OTTHUMG00000015655	ENST00000296980.2:c.447G>A	6.37:g.137476103C>T			Q08AH7|Q6UWM1|Q96A41|Q96QR0	Silent	SNP	pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3	p.T149	ENST00000296980.2	37	c.447	CCDS5182.1	6																																																																																			IL22RA2	-	superfamily_Fibronectin_type3	ENSG00000164485		0.552	IL22RA2-002	KNOWN	basic|CCDS	protein_coding	IL22RA2	HGNC	protein_coding	OTTHUMT00000042399.1	-	0.00	55	0	C			137476103	-1	tier1	rs143485398	no_errors	ENST00000296980	ensembl	human	known	74_37	silent	68.18	14	30	SNP	0.000	T
IRF2BP2	359948	genome.wustl.edu	37	1	234744343	234744344	+	Frame_Shift_Ins	INS	-	-	GA	rs146468937		TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr1:234744343_234744344insGA	ENST00000366609.3	-	1	927_928	c.897_898insTC	c.(895-900)gtcaacfs	p.N300fs	RP4-781K5.2_ENST00000436039.1_RNA|IRF2BP2_ENST00000491430.1_5'Flank|IRF2BP2_ENST00000366610.3_Frame_Shift_Ins_p.N300fs	NM_182972.2	NP_892017.2	Q7Z5L9	I2BP2_HUMAN	interferon regulatory factor 2 binding protein 2	300					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11	Ovarian(103;0.0303)	all_cancers(173;0.0236)|Prostate(94;0.0115)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)|Epithelial(3;6.2e-05)			TTGGGCCTGTTGACCCAGTCCT	0.718																																																	0																																										SO:0001589	frameshift_variant	0			AY278023	CCDS1602.1, CCDS41475.1	1q42.3	2008-02-05			ENSG00000168264	ENSG00000168264			21729	protein-coding gene	gene with protein product		615332				12799427	Standard	NM_182972		Approved	IRF-2BP2	uc001hwg.3	Q7Z5L9	OTTHUMG00000037981	ENST00000366609.3:c.896_897dupTC	1.37:g.234744344_234744345dupGA	ENSP00000355568:p.Asn300fs		B1AM35|B1AM36|Q6P083|Q7Z5L8|Q8N351|Q8WUH8	Frame_Shift_Ins	INS	pfam_Interferon_reg_fac2-bd1_2_Znf	p.N299fs	ENST00000366609.3	37	c.898_897	CCDS1602.1	1																																																																																			IRF2BP2	-	pfam_Interferon_reg_fac2-bd1_2_Znf	ENSG00000168264		0.718	IRF2BP2-002	NOVEL	basic|CCDS	protein_coding	IRF2BP2	HGNC	protein_coding	OTTHUMT00000092705.1		0.00	20	0	-	NM_182972		234744344	-1	tier1		no_errors	ENST00000366609	ensembl	human	novel	74_37	frame_shift_ins	31.58	13	6	INS	0.944:0.981	GA
ITGAE	3682	genome.wustl.edu	37	17	3654953	3654953	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr17:3654953G>T	ENST00000263087.4	-	15	1982	c.1884C>A	c.(1882-1884)agC>agA	p.S628R		NM_002208.4	NP_002199.3	P38570	ITAE_HUMAN	integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide)	628					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	external side of plasma membrane (GO:0009897)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41				UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)		CCTGCGAGGGGCTGGCGGAGA	0.607																																					NSCLC(182;635 2928 8995 38788)												0													55.0	63.0	61.0					17																	3654953		2203	4300	6503	SO:0001583	missense	0			L25851	CCDS32531.1	17p13	2010-03-23				ENSG00000083457		"""CD molecules"", ""Integrins"""	6147	protein-coding gene	gene with protein product		604682				8119947	Standard	NM_002208		Approved	CD103, HUMINAE	uc002fwo.4	P38570		ENST00000263087.4:c.1884C>A	17.37:g.3654953G>T	ENSP00000263087:p.Ser628Arg		Q17RS6|Q9NZU9	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_Integrin_alpha_C_CS,smart_VWF_A,smart_Int_alpha_beta-p,prints_Integrin_alpha,pfscan_VWF_A	p.S628R	ENST00000263087.4	37	c.1884	CCDS32531.1	17	.	.	.	.	.	.	.	.	.	.	G	13.79	2.343458	0.41498	.	.	ENSG00000083457	ENST00000263087	T	0.81330	-1.48	3.14	-1.91	0.07641	.	.	.	.	.	T	0.67859	0.2938	L	0.45051	1.395	0.58432	D	0.999994	B	0.12630	0.006	B	0.08055	0.003	T	0.52946	-0.8507	9	0.62326	D	0.03	.	4.5517	0.12116	0.3276:0.1638:0.5086:0.0	.	628	P38570	ITAE_HUMAN	R	628	ENSP00000263087:S628R	ENSP00000263087:S628R	S	-	3	2	ITGAE	3601702	0.023000	0.18921	0.012000	0.15200	0.596000	0.36781	0.091000	0.15046	-0.479000	0.06813	0.555000	0.69702	AGC	ITGAE	-	smart_Int_alpha_beta-p	ENSG00000083457		0.607	ITGAE-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	ITGAE	HGNC	protein_coding	OTTHUMT00000438169.1		0.00	57	0	G	NM_002208		3654953	-1			no_errors	ENST00000263087	ensembl	human	known	74_37	missense	5.71	32	2	SNP	0.877	T
ITGAL	3683	genome.wustl.edu	37	16	30531228	30531228	+	Nonsense_Mutation	SNP	C	C	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr16:30531228C>A	ENST00000356798.6	+	30	3459	c.3279C>A	c.(3277-3279)taC>taA	p.Y1093*	ITGAL_ENST00000433423.2_Nonsense_Mutation_p.Y327*|ITGAL_ENST00000358164.5_Nonsense_Mutation_p.Y1009*	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	1093					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	TCTACCTCTACGTGCTGAGCG	0.582																																					NSCLC(110;1462 1641 3311 33990 49495)												0													180.0	160.0	166.0					16																	30531228		2197	4300	6497	SO:0001587	stop_gained	0				CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.3279C>A	16.37:g.30531228C>A	ENSP00000349252:p.Tyr1093*		O43746|Q45H73|Q96HB1|Q9UBC8	Nonsense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,prints_Integrin_alpha,pfscan_VWF_A	p.Y1093*	ENST00000356798.6	37	c.3279	CCDS32433.1	16	.	.	.	.	.	.	.	.	.	.	C	14.13	2.442956	0.43326	.	.	ENSG00000005844	ENST00000356798;ENST00000358164;ENST00000433423	.	.	.	5.35	-2.35	0.06684	.	0.000000	0.49305	D	0.000141	.	.	.	.	.	.	0.18873	N	0.999987	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	.	12.2394	0.54534	0.0:0.4905:0.0:0.5095	.	.	.	.	X	1093;1009;327	.	ENSP00000349252:Y1093X	Y	+	3	2	ITGAL	30438729	0.000000	0.05858	0.182000	0.23118	0.177000	0.22998	-1.953000	0.01526	-0.516000	0.06470	-1.598000	0.00824	TAC	ITGAL	-	NULL	ENSG00000005844		0.582	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGAL	HGNC	protein_coding	OTTHUMT00000434508.2		0.00	19	0	C			30531228	+1			no_errors	ENST00000356798	ensembl	human	known	74_37	nonsense	11.11	16	2	SNP	0.032	A
KCNH1	3756	genome.wustl.edu	37	1	211093036	211093036	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr1:211093036C>T	ENST00000271751.4	-	7	1435	c.1408G>A	c.(1408-1410)Gcc>Acc	p.A470T	KCNH1_ENST00000367007.4_Missense_Mutation_p.A443T			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	470					myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)	p.A470T(1)|p.A470S(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		GTGGATGGGGCGATGTTCCCA	0.507																																																	2	Substitution - Missense(2)	large_intestine(1)|lung(1)											162.0	154.0	157.0					1																	211093036		2203	4300	6503	SO:0001583	missense	0			AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.1408G>A	1.37:g.211093036C>T	ENSP00000271751:p.Ala470Thr		B1AQ26|O76035|Q14CL3	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_2pore_dom_K_chnl_dom,pfam_PAS_fold,superfamily_cNMP-bd-like,superfamily_PAS,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS,pfscan_PAS-assoc_C,tigrfam_PAS	p.A470T	ENST00000271751.4	37	c.1408	CCDS1496.1	1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.041835	0.93685	.	.	ENSG00000143473	ENST00000271751;ENST00000367007	D;D	0.98419	-4.92;-4.92	5.57	5.57	0.84162	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98112	0.9377	L	0.35793	1.09	0.80722	D	1	D;D	0.69078	0.988;0.997	P;D	0.65874	0.901;0.939	D	0.99844	1.1064	10	0.87932	D	0	.	18.5224	0.90958	0.0:1.0:0.0:0.0	.	443;470	Q14CL3;O95259	.;KCNH1_HUMAN	T	470;443	ENSP00000271751:A470T;ENSP00000355974:A443T	ENSP00000271751:A470T	A	-	1	0	KCNH1	209159659	1.000000	0.71417	0.975000	0.42487	0.991000	0.79684	7.538000	0.82048	2.623000	0.88846	0.561000	0.74099	GCC	KCNH1	-	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom	ENSG00000143473		0.507	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH1	HGNC	protein_coding	OTTHUMT00000088332.1	-	0.00	47	0	C	NM_002238		211093036	-1	tier1	-	no_errors	ENST00000271751	ensembl	human	known	74_37	missense	54.29	16	19	SNP	1.000	T
KIAA0100	9703	genome.wustl.edu	37	17	26962375	26962375	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr17:26962375C>T	ENST00000528896.2	-	16	2304	c.2230G>A	c.(2230-2232)Gta>Ata	p.V744I	KIAA0100_ENST00000389003.3_Missense_Mutation_p.V601I|RP11-192H23.7_ENST00000583787.1_RNA|KIAA0100_ENST00000544884.1_Missense_Mutation_p.V601I|RP11-192H23.7_ENST00000577814.1_RNA	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	744						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					TCCTCAGCTACAAAAGCTGTG	0.562																																																	0													103.0	94.0	97.0					17																	26962375		2203	4300	6503	SO:0001583	missense	0			D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.2230G>A	17.37:g.26962375C>T	ENSP00000436773:p.Val744Ile		A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	pfam_FMP27_C,pfam_FMP27_N,pfam_FMP27_GFWDK_dom	p.V744I	ENST00000528896.2	37	c.2230	CCDS32595.1	17	.	.	.	.	.	.	.	.	.	.	C	22.8	4.331797	0.81801	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896;ENST00000544884	T;T	0.24350	1.87;1.86	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.47525	0.1450	M	0.66939	2.045	0.80722	D	1	D	0.58970	0.984	D	0.70016	0.967	T	0.29610	-1.0006	10	0.07644	T	0.81	.	19.8635	0.96793	0.0:1.0:0.0:0.0	.	744	Q14667	K0100_HUMAN	I	744;744;744;601	ENSP00000436773:V744I;ENSP00000446443:V601I	ENSP00000005905:V744I	V	-	1	0	KIAA0100	23986502	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	5.561000	0.67339	2.695000	0.91970	0.563000	0.77884	GTA	KIAA0100	-	NULL	ENSG00000007202		0.562	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0100	HGNC	protein_coding	OTTHUMT00000390571.3	-	0.00	54	0	C	NM_014680		26962375	-1	tier1	-	no_errors	ENST00000528896	ensembl	human	known	74_37	missense	43.33	34	26	SNP	1.000	T
KCNJ2	3759	genome.wustl.edu	37	17	68171795	68171795	+	Silent	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr17:68171795C>T	ENST00000243457.3	+	2	998	c.615C>T	c.(613-615)gaC>gaT	p.D205D	KCNJ2_ENST00000535240.1_Silent_p.D205D	NM_000891.2	NP_000882.1	P63252	KCNJ2_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 2	205					cardiac muscle cell action potential involved in contraction (GO:0086002)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|magnesium ion transport (GO:0015693)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion import (GO:0010107)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of resting membrane potential (GO:0060075)|regulation of skeletal muscle contraction via regulation of action potential (GO:0014861)|relaxation of cardiac muscle (GO:0055119)|relaxation of skeletal muscle (GO:0090076)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of membrane (GO:0031224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|voltage-gated potassium channel activity involved in cardiac muscle cell action potential repolarization (GO:0086008)	p.D205E(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(13)|skin(1)|urinary_tract(1)	25	Breast(10;1.64e-08)					CCATGAGAGACGGCAAGCTGT	0.488																																																	1	Substitution - Missense(1)	lung(1)											128.0	106.0	114.0					17																	68171795		2203	4300	6503	SO:0001819	synonymous_variant	0			AF011904	CCDS11688.1	17q24.3	2014-09-17				ENSG00000123700		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6263	protein-coding gene	gene with protein product		600681				7696590, 11240146, 16382105	Standard	NM_000891		Approved	Kir2.1, IRK1, LQT7	uc002jir.3	P63252		ENST00000243457.3:c.615C>T	17.37:g.68171795C>T			O15110|P48049	Silent	SNP	pfam_K_chnl_inward-rec_Kir,pfam_K_chnl_inward-rec_Kir_N,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir2.1	p.D205	ENST00000243457.3	37	c.615	CCDS11688.1	17																																																																																			KCNJ2	-	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir	ENSG00000123700		0.488	KCNJ2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KCNJ2	HGNC	protein_coding	OTTHUMT00000450889.1	-	0.00	26	0	C	NM_000891		68171795	+1	tier1	-	no_errors	ENST00000243457	ensembl	human	known	74_37	silent	28.57	30	12	SNP	0.902	T
KIAA1462	57608	genome.wustl.edu	37	10	30315895	30315895	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr10:30315895G>T	ENST00000375377.1	-	3	3283	c.3182C>A	c.(3181-3183)gCc>gAc	p.A1061D		NM_020848.2	NP_065899.1	Q9P266	JCAD_HUMAN	KIAA1462	1061					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)				breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(23)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	75						TAGCTCACTGGCACCCTGTTC	0.597																																																	0													150.0	149.0	149.0					10																	30315895		1924	4123	6047	SO:0001583	missense	0			AB040895	CCDS41500.1	10p12.1	2013-04-23			ENSG00000165757	ENSG00000165757			29283	protein-coding gene	gene with protein product	"""junctional protein associated with coronary artery disease"""	614398				10819331, 21884682	Standard	NM_020848		Approved	JCAD	uc001iux.3	Q9P266	OTTHUMG00000017885	ENST00000375377.1:c.3182C>A	10.37:g.30315895G>T	ENSP00000364526:p.Ala1061Asp		Q5HYA7|Q5T992|Q86WZ9|Q9BYJ2	Missense_Mutation	SNP	NULL	p.A1061D	ENST00000375377.1	37	c.3182	CCDS41500.1	10	.	.	.	.	.	.	.	.	.	.	G	16.79	3.219332	0.58560	.	.	ENSG00000165757	ENST00000375377	T	0.18016	2.24	5.09	3.19	0.36642	.	0.765317	0.12548	N	0.459347	T	0.26085	0.0636	M	0.61703	1.905	0.09310	N	1	D	0.58268	0.982	P	0.52481	0.7	T	0.11060	-1.0603	10	0.59425	D	0.04	-1.7321	5.7943	0.18377	0.0742:0.1377:0.6455:0.1426	.	1061	Q9P266	K1462_HUMAN	D	1061	ENSP00000364526:A1061D	ENSP00000364526:A1061D	A	-	2	0	KIAA1462	30355901	0.003000	0.15002	0.001000	0.08648	0.014000	0.08584	1.226000	0.32563	0.625000	0.30304	0.462000	0.41574	GCC	KIAA1462	-	NULL	ENSG00000165757		0.597	KIAA1462-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1462	HGNC	protein_coding	OTTHUMT00000047409.1		0.00	21	0	G	NM_020848		30315895	-1			no_errors	ENST00000375377	ensembl	human	known	74_37	missense	7.41	25	2	SNP	0.002	T
KIAA1715	80856	genome.wustl.edu	37	2	176802211	176802211	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr2:176802211G>T	ENST00000272748.4	-	12	1162	c.915C>A	c.(913-915)aaC>aaA	p.N305K	KIAA1715_ENST00000535310.1_Missense_Mutation_p.N230K|KIAA1715_ENST00000544803.1_Missense_Mutation_p.N336K	NM_030650.1	NP_085153.1	Q9C0E8	LNP_HUMAN	KIAA1715	305					blood coagulation (GO:0007596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|limb development (GO:0060173)|regulation of chondrocyte differentiation (GO:0032330)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			endometrium(1)|large_intestine(4)|lung(12)|ovary(2)|skin(1)	20			OV - Ovarian serous cystadenocarcinoma(117;0.0793)			TTCTTGCAGGGTTCAAGAAAA	0.403																																																	0													53.0	53.0	53.0					2																	176802211		2203	4300	6503	SO:0001583	missense	0			AB051502	CCDS33332.1	2q31	2014-06-27			ENSG00000144320	ENSG00000144320			21610	protein-coding gene	gene with protein product	"""lunapark"", ""limb and neural patterns"""	610236				11214970, 22729086	Standard	NM_030650		Approved	ulnaless, Ul, LNP1, LNP	uc002ukc.1	Q9C0E8	OTTHUMG00000154112	ENST00000272748.4:c.915C>A	2.37:g.176802211G>T	ENSP00000272748:p.Asn305Lys		B7ZLA8|Q2M2V8|Q2YD99|Q658W8|Q8N5V9|Q96MS5	Missense_Mutation	SNP	pfam_DUF2296	p.N336K	ENST00000272748.4	37	c.1008	CCDS33332.1	2	.	.	.	.	.	.	.	.	.	.	G	13.35	2.211941	0.39102	.	.	ENSG00000144320	ENST00000272748;ENST00000536291;ENST00000409660;ENST00000544803;ENST00000535310	.	.	.	5.61	1.84	0.25277	Domain of unknown function DUF2296 (1);	0.000000	0.85682	D	0.000000	T	0.81833	0.4906	H	0.94503	3.545	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.999;1.0	T	0.82615	-0.0370	9	0.87932	D	0	-13.6635	9.4424	0.38677	0.7155:0.0:0.2845:0.0	.	307;336;302;305	F5H2Y7;B7ZLA8;B7ZLA9;Q9C0E8	.;.;.;LNP_HUMAN	K	305;307;182;336;230	.	ENSP00000272748:N305K	N	-	3	2	KIAA1715	176510457	1.000000	0.71417	1.000000	0.80357	0.674000	0.39518	2.385000	0.44371	0.395000	0.25257	-0.469000	0.05056	AAC	KIAA1715	-	pfam_DUF2296	ENSG00000144320		0.403	KIAA1715-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1715	HGNC	protein_coding	OTTHUMT00000333949.3	-	0.00	68	0	G	XM_042834		176802211	-1	tier1	-	no_errors	ENST00000544803	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
KIF20A	10112	genome.wustl.edu	37	5	137519021	137519021	+	Silent	SNP	C	C	T	rs141701454	byFrequency	TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr5:137519021C>T	ENST00000394894.3	+	8	1222	c.996C>T	c.(994-996)tgC>tgT	p.C332C	KIF20A_ENST00000508792.1_Silent_p.C314C	NM_005733.2	NP_005724.1	O95235	KI20A_HUMAN	kinesin family member 20A	332	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cytokinesis (GO:0000910)|metabolic process (GO:0008152)|microtubule bundle formation (GO:0001578)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)|transporter activity (GO:0005215)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|liver(2)|lung(9)|prostate(2)|upper_aerodigestive_tract(1)	27			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TGCGGCTATGCGAGGATCAAA	0.488													C|||	14	0.00279553	0.0098	0.0014	5008	,	,		22410	0.0		0.0	False		,,,				2504	0.0																0								C		17,4389	25.3+/-52.1	1,15,2187	63.0	63.0	63.0		996	0.4	1.0	5	dbSNP_134	63	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	KIF20A	NM_005733.2		1,16,6486	TT,TC,CC		0.0116,0.3858,0.1384		332/891	137519021	18,12988	2203	4300	6503	SO:0001819	synonymous_variant	0			AF070672	CCDS4199.1	5q31	2008-02-05	2003-01-13	2003-01-17	ENSG00000112984	ENSG00000112984		"""Kinesins"""	9787	protein-coding gene	gene with protein product		605664	"""RAB6 interacting, kinesin-like (rabkinesin6)"""	RAB6KIFL		11416179, 10806357	Standard	NM_005733		Approved		uc003lcj.3	O95235	OTTHUMG00000129195	ENST00000394894.3:c.996C>T	5.37:g.137519021C>T			B4DL79|D3DQB6	Silent	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.C332	ENST00000394894.3	37	c.996	CCDS4199.1	5																																																																																			KIF20A	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000112984		0.488	KIF20A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF20A	HGNC	protein_coding	OTTHUMT00000251272.1		0.00	29	0	C	NM_005733		137519021	+1			no_errors	ENST00000394894	ensembl	human	known	74_37	silent	8.33	22	2	SNP	0.996	T
KIF22	3835	genome.wustl.edu	37	16	29808330	29808330	+	Frame_Shift_Del	DEL	C	C	-			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr16:29808330delC	ENST00000160827.4	+	2	227	c.187delC	c.(187-189)cccfs	p.P64fs	KIF22_ENST00000400750.2_5'UTR|KIF22_ENST00000561482.1_5'UTR|KIF22_ENST00000569382.2_5'UTR|KIF22_ENST00000400751.5_5'UTR	NM_001256269.1|NM_007317.2	NP_001243198.1|NP_015556.1	Q14807	KIF22_HUMAN	kinesin family member 22	64	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|DNA repair (GO:0006281)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)			endometrium(1)|large_intestine(1)|lung(11)|skin(1)	14						AGCAAGTGATCCCCCCTGTGT	0.572																																																	0													118.0	110.0	112.0					16																	29808330		2197	4296	6493	SO:0001589	frameshift_variant	0			D38751	CCDS10653.1, CCDS58444.1	16p11.2	2008-03-03	2003-01-09	2003-01-10	ENSG00000079616	ENSG00000079616		"""Kinesins"""	6391	protein-coding gene	gene with protein product		603213	"""kinesin-like 4"""	KNSL4		8599929, 11416179	Standard	NM_007317		Approved	Kid, OBP-1, OBP-2	uc002dts.4	Q14807	OTTHUMG00000097771	ENST00000160827.4:c.187delC	16.37:g.29808330delC	ENSP00000160827:p.Pro64fs		B2R5M0|B7Z265|O60845|O94814|Q53F58|Q9BT46	Frame_Shift_Del	DEL	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,superfamily_RuvA_2-like,smart_Kinesin_motor_dom,smart_Hlx-hairpin-Hlx_DNA-bd_motif,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.C65fs	ENST00000160827.4	37	c.187	CCDS10653.1	16																																																																																			KIF22	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000079616		0.572	KIF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF22	HGNC	protein_coding	OTTHUMT00000215012.2		0.00	22	0	C			29808330	+1	tier1		no_errors	ENST00000160827	ensembl	human	known	74_37	frame_shift_del	8.00	23	2	DEL	0.000	-
KIF25	3834	genome.wustl.edu	37	6	168396391	168396391	+	IGR	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr6:168396391G>A	ENST00000515361.1	+	0	0				KIF25-AS1_ENST00000456585.1_lincRNA			Q9UIL4	KIF25_HUMAN	kinesin family member 25						ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of autophagy (GO:0010507)|organelle organization (GO:0006996)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		ttgctgtgggggacccttccc	0.582																																																	0																																										SO:0001628	intergenic_variant	0			AB012722	CCDS5305.1, CCDS43530.1	6q27	2008-02-05	2003-01-09	2003-01-10	ENSG00000125337	ENSG00000125337		"""Kinesins"""	6390	protein-coding gene	gene with protein product		603815	"""kinesin-like 3"""	KNSL3		9925910	Standard	NM_030615		Approved		uc003qwk.1	Q9UIL4	OTTHUMG00000016035		6.37:g.168396391G>A			O94775|Q5SZU9	RNA	SNP	-	NULL	ENST00000515361.1	37	NULL		6																																																																																			KIF25-AS1	-	-	ENSG00000229921		0.582	KIF25-006	KNOWN	basic	processed_transcript	KIF25-AS1	HGNC	protein_coding	OTTHUMT00000362511.1	-	0.00	9	0	G			168396391	-1	tier1	-	no_errors	ENST00000414364	ensembl	human	known	74_37	rna	83.33	1	5	SNP	0.004	A
KIRREL2	84063	genome.wustl.edu	37	19	36351921	36351921	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr19:36351921C>T	ENST00000360202.5	+	8	1237	c.1039C>T	c.(1039-1041)Cgc>Tgc	p.R347C	NPHS1_ENST00000591817.1_Intron|KIRREL2_ENST00000262625.7_Missense_Mutation_p.R347C|KIRREL2_ENST00000347900.6_Missense_Mutation_p.R297C|KIRREL2_ENST00000592409.1_Missense_Mutation_p.R347C	NM_032123.5|NM_199180.2	NP_115499.4|NP_954649.2	Q6UWL6	KIRR2_HUMAN	kin of IRRE like 2 (Drosophila)	347	Ig-like C2-type 4.				cell adhesion (GO:0007155)|negative regulation of protein phosphorylation (GO:0001933)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)				breast(2)|central_nervous_system(1)|endometrium(6)|large_intestine(6)|liver(2)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	48	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			AACCTGGACCCGCCGCGGTGG	0.672																																																	0													11.0	13.0	12.0					19																	36351921		2182	4250	6432	SO:0001583	missense	0			AL136654	CCDS12479.1, CCDS12480.1, CCDS12481.1	19q13.13	2013-01-29				ENSG00000126259		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18816	protein-coding gene	gene with protein product		607762				12837264, 12504092	Standard	NM_199180		Approved	NLG1, NEPH3, FILTRIN, DKFZp564A1164, MGC15718	uc002ocb.4	Q6UWL6		ENST00000360202.5:c.1039C>T	19.37:g.36351921C>T	ENSP00000353331:p.Arg347Cys		C9JHF1|C9JJ76|F1T0I2|Q6P1R1|Q7Z5P1|Q7Z5P2|Q96IQ8|Q9H0T1	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R347C	ENST00000360202.5	37	c.1039	CCDS12481.1	19	.	.	.	.	.	.	.	.	.	.	c	21.1	4.093931	0.76870	.	.	ENSG00000126259	ENST00000262625;ENST00000347900;ENST00000360202;ENST00000341658	T;T;T	0.13778	2.56;2.56;2.56	4.5	3.41	0.39046	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.44483	D	0.000445	T	0.33933	0.0880	M	0.84948	2.725	0.48135	D	0.99959	D;D;D;D;D	0.76494	0.998;0.998;0.998;0.999;0.999	P;P;P;P;P	0.60886	0.828;0.736;0.88;0.809;0.809	T	0.18147	-1.0346	10	0.87932	D	0	-13.5841	9.8689	0.41162	0.2027:0.7973:0.0:0.0	.	347;327;347;297;347	F1T0I2;Q6UWL6-4;Q6UWL6;Q6UWL6-3;Q6UWL6-2	.;.;KIRR2_HUMAN;.;.	C	347;297;347;327	ENSP00000262625:R347C;ENSP00000345067:R297C;ENSP00000353331:R347C	ENSP00000262625:R347C	R	+	1	0	KIRREL2	41043761	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.936000	0.40183	2.362000	0.80069	0.494000	0.49563	CGC	KIRREL2	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000126259		0.672	KIRREL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIRREL2	HGNC	protein_coding	OTTHUMT00000452561.1	-	0.00	76	0	C	NM_032123		36351921	+1	tier1	-	no_errors	ENST00000360202	ensembl	human	known	74_37	missense	8.05	80	7	SNP	1.000	T
KIR2DL3	3804	genome.wustl.edu	37	19	55258837	55258837	+	Splice_Site	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr19:55258837G>A	ENST00000342376.3	+	5	746	c.715G>A	c.(715-717)Ggt>Agt	p.G239S	KIR2DL3_ENST00000434419.2_Intron|KIR3DL1_ENST00000402254.2_Intron|KIR2DL4_ENST00000396284.2_Intron|KIR3DL1_ENST00000538269.1_Intron|KIR3DL1_ENST00000541392.1_Intron|CTB-61M7.1_ENST00000400864.3_RNA	NM_015868.2	NP_056952.2	P43628	KI2L3_HUMAN	killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 3	239					immune response (GO:0006955)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|cervix(1)|large_intestine(1)|lung(11)|ovary(3)|pancreas(1)|skin(2)|urinary_tract(1)	21				GBM - Glioblastoma multiforme(193;0.0192)		CTCCGAAACCGGTGAGTACAG	0.502																																																	0													96.0	91.0	93.0					19																	55258837		1416	2531	3947	SO:0001630	splice_region_variant	0			L41268	CCDS33107.1	19q13.4	2013-01-29				ENSG00000243772		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6331	protein-coding gene	gene with protein product		604938				7749980, 8662091	Standard	XM_006725426		Approved	cl-6, nkat2, nkat2a, nkat2b, p58, CD158B2		P43628	OTTHUMG00000065887	ENST00000342376.3:c.715+1G>A	19.37:g.55258837G>A			O43472|P78402|Q14944|Q14945|Q9UM51|Q9UQ70	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub	p.G239S	ENST00000342376.3	37	c.715	CCDS33107.1	19	.	.	.	.	.	.	.	.	.	.	G	4.543	0.100735	0.08731	.	.	ENSG00000243772	ENST00000342376	T	0.00497	6.98	0.736	-0.442	0.12253	.	.	.	.	.	T	0.00412	0.0013	M	0.61703	1.905	0.09310	N	1	B;P;D;B;B	0.53745	0.03;0.66;0.962;0.425;0.425	B;B;B;B;B	0.37550	0.013;0.124;0.253;0.078;0.078	T	0.47289	-0.9129	9	0.27785	T	0.31	.	3.2705	0.06880	0.3227:0.0:0.6773:0.0	.	239;239;141;239;239	E3NZD7;P43627;P43628-2;P43628;E3NZD8	.;KI2L2_HUMAN;.;KI2L3_HUMAN;.	S	239	ENSP00000342215:G239S	ENSP00000342215:G239S	G	+	1	0	KIR2DL3	59950649	0.001000	0.12720	0.008000	0.14137	0.002000	0.02628	-0.523000	0.06230	-0.114000	0.11936	-1.207000	0.01640	GGT	KIR2DL3	-	NULL	ENSG00000243772		0.502	KIR2DL3-001	KNOWN	basic|CCDS	protein_coding	KIR2DL3	HGNC	protein_coding	OTTHUMT00000141150.1	-	0.00	86	0	G		Missense_Mutation	55258837	+1	tier1	-	no_errors	ENST00000342376	ensembl	human	known	74_37	missense	5.56	136	8	SNP	0.011	A
KMT2D	8085	genome.wustl.edu	37	12	49446706	49446706	+	Silent	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr12:49446706C>T	ENST00000301067.7	-	8	1103	c.1104G>A	c.(1102-1104)gtG>gtA	p.V368V		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	368					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										ACCTGCTACACACCGGGGTAT	0.542																																																	0													105.0	103.0	103.0					12																	49446706		2098	4222	6320	SO:0001819	synonymous_variant	0			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.1104G>A	12.37:g.49446706C>T			O14687	Silent	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.V368	ENST00000301067.7	37	c.1104	CCDS44873.1	12																																																																																			KMT2D	-	NULL	ENSG00000167548		0.542	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2D	HGNC	protein_coding	OTTHUMT00000390183.2	-	0.00	43	0	C			49446706	-1	tier1	-	no_errors	ENST00000301067	ensembl	human	known	74_37	silent	17.50	33	7	SNP	0.875	T
KMT2E	55904	genome.wustl.edu	37	7	104717849	104717849	+	Nonsense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr7:104717849C>T	ENST00000311117.3	+	11	1644	c.1099C>T	c.(1099-1101)Cag>Tag	p.Q367*	KMT2E_ENST00000334877.4_Nonsense_Mutation_p.Q367*|KMT2E_ENST00000476671.1_Nonsense_Mutation_p.Q367*|KMT2E_ENST00000257745.4_Nonsense_Mutation_p.Q367*|KMT2E_ENST00000334914.7_5'UTR	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	367	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										GCTGAGAGAACAGTTTGAAGC	0.318																																																	0													54.0	57.0	56.0					7																	104717849		2203	4291	6494	SO:0001587	stop_gained	0			AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.1099C>T	7.37:g.104717849C>T	ENSP00000312379:p.Gln367*		B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Nonsense_Mutation	SNP	pfam_SET_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_SET_dom,pfscan_SET_dom,pfscan_Znf_PHD-finger	p.Q367*	ENST00000311117.3	37	c.1099	CCDS34723.1	7	.	.	.	.	.	.	.	.	.	.	C	41	8.791905	0.98956	.	.	ENSG00000005483	ENST00000311117;ENST00000393656;ENST00000334877;ENST00000351043;ENST00000257745;ENST00000478990;ENST00000476671;ENST00000537308	.	.	.	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	20.422	0.99049	0.0:1.0:0.0:0.0	.	.	.	.	X	367;367;367;367;367;225;367;301	.	ENSP00000257745:Q367X	Q	+	1	0	MLL5	104505085	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.487000	0.81328	2.832000	0.97577	0.655000	0.94253	CAG	KMT2E	-	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	ENSG00000005483		0.318	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2E	HGNC	protein_coding	OTTHUMT00000348697.1	-	0.00	65	0	C			104717849	+1	tier1	-	no_errors	ENST00000257745	ensembl	human	known	74_37	nonsense	34.88	56	30	SNP	1.000	T
LAMC3	10319	genome.wustl.edu	37	9	133932371	133932371	+	Silent	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr9:133932371G>A	ENST00000361069.4	+	12	2128	c.1995G>A	c.(1993-1995)ccG>ccA	p.P665P	LAMC3_ENST00000480883.1_Intron	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	665	Laminin IV type A. {ECO:0000255|PROSITE- ProRule:PRU00458}.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		GGCTTTCCCCGCCAGCCTCCT	0.617																																																	0													69.0	76.0	74.0					9																	133932371		2203	4300	6503	SO:0001819	synonymous_variant	0			AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.1995G>A	9.37:g.133932371G>A			B1APX9|B1APY0|Q59H72	Silent	SNP	pfam_EGF_laminin,pfam_Laminin_N,pfam_Laminin_B_type_IV,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.P665	ENST00000361069.4	37	c.1995	CCDS6938.1	9																																																																																			LAMC3	-	pfam_Laminin_B_type_IV,smart_EGF_laminin,pfscan_Laminin_B_type_IV	ENSG00000050555		0.617	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC3	HGNC	protein_coding	OTTHUMT00000054717.3	-	0.00	35	0	G	NM_006059		133932371	+1	tier1	-	no_errors	ENST00000361069	ensembl	human	known	74_37	silent	27.03	27	10	SNP	0.000	A
LARP6	55323	genome.wustl.edu	37	15	71128817	71128817	+	Silent	SNP	G	G	A	rs138869907		TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr15:71128817G>A	ENST00000299213.8	-	2	298	c.228C>T	c.(226-228)aaC>aaT	p.N76N		NM_018357.2	NP_060827.2	Q9BRS8	LARP6_HUMAN	La ribonucleoprotein domain family, member 6	76					regulation of translation (GO:0006417)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	19						CCTCACGCTCGTTCTCACCTC	0.512													G|||	1	0.000199681	0.0	0.0	5008	,	,		18903	0.001		0.0	False		,,,				2504	0.0																0								G		1,4397	2.1+/-5.4	0,1,2198	76.0	78.0	77.0		228	-11.2	0.0	15	dbSNP_134	77	0,8594		0,0,4297	no	coding-synonymous	LARP6	NM_018357.2		0,1,6495	AA,AG,GG		0.0,0.0227,0.0077		76/492	71128817	1,12991	2199	4297	6496	SO:0001819	synonymous_variant	0			BC009446	CCDS10236.1, CCDS32281.1	15q23	2012-11-19			ENSG00000166173	ENSG00000166173		"""La ribonucleoprotein domain containing"""	24012	protein-coding gene	gene with protein product		611300				12477932	Standard	NM_018357		Approved	acheron, FLJ11196	uc002ass.3	Q9BRS8	OTTHUMG00000172179	ENST00000299213.8:c.228C>T	15.37:g.71128817G>A			Q5XKE4|Q8N3N2|Q9NUR0	Silent	SNP	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,pfscan_Lupus_La_RNA-bd,prints_Lupus_La	p.N76	ENST00000299213.8	37	c.228	CCDS32281.1	15																																																																																			LARP6	-	NULL	ENSG00000166173		0.512	LARP6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP6	HGNC	protein_coding	OTTHUMT00000417197.2	-	0.00	32	0	G	NM_018357		71128817	-1	tier1	rs138869907	no_errors	ENST00000299213	ensembl	human	known	74_37	silent	47.83	12	11	SNP	0.004	A
LBH	81606	genome.wustl.edu	37	2	30546383	30546383	+	Splice_Site	SNP	A	A	G			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr2:30546383A>G	ENST00000404397.1	+	3	331		c.e3-1					Q53QV2	LBH_HUMAN	limb bud and heart development						multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(2)|large_intestine(1)|lung(2)	5	Acute lymphoblastic leukemia(172;0.155)					TTACTGTCCCAGGATTGTGAA	0.453																																																	0													92.0	85.0	87.0					2																	30546383		876	1991	2867	SO:0001630	splice_region_variant	0			AF110224	CCDS33173.1	2p23.1	2012-12-07	2012-12-07		ENSG00000213626	ENSG00000213626			29532	protein-coding gene	gene with protein product		611763	"""limb bud and heart development homolog (mouse)"""			11230166, 11336496	Standard	NM_030915		Approved		uc002rne.2	Q53QV2	OTTHUMG00000152051	ENST00000404397.1:c.130-1A>G	2.37:g.30546383A>G			B2RBC2|Q9H0Q1	Splice_Site	SNP	-	e3-2	ENST00000404397.1	37	c.130-2		2	.	.	.	.	.	.	.	.	.	.	A	3.424	-0.117554	0.06838	.	.	ENSG00000213626	ENST00000404397	.	.	.	3.37	-1.87	0.07737	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.2777	0.06904	0.3842:0.0:0.3831:0.2327	.	.	.	.	.	-1	.	.	.	+	.	.	LBH	30399887	0.002000	0.14202	0.000000	0.03702	0.007000	0.05969	0.228000	0.17814	-0.365000	0.08076	-0.353000	0.07706	.	LBH	-	-	ENSG00000213626		0.453	LBH-006	PUTATIVE	basic	protein_coding	LBH	HGNC	protein_coding	OTTHUMT00000325096.1	-	0.00	56	0	A	NM_030915	Intron	30546383	+1	tier1	-	no_errors	ENST00000404397	ensembl	human	putative	74_37	splice_site	5.06	75	4	SNP	0.000	G
LOC100287728	100287728	genome.wustl.edu	37	X	134257604	134257604	+	lincRNA	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chrX:134257604G>A	ENST00000453528.1	+	0	751				RP11-85L21.6_ENST00000416873.1_lincRNA	NR_103770.1																						CTTCTGACCCGTCTCTGTGTT	0.493																																																	0																																												0																															X.37:g.134257604G>A				RNA	SNP	-	NULL	ENST00000453528.1	37	NULL		X																																																																																			RP11-85L21.4	-	-	ENSG00000228372		0.493	RP11-85L21.4-001	KNOWN	basic	lincRNA	LOC101805489	Clone_based_vega_gene	lincRNA	OTTHUMT00000058400.1	-	0.00	14	0	G			134257604	+1	tier1	-	no_errors	ENST00000453528	ensembl	human	known	74_37	rna	83.33	3	15	SNP	0.000	A
LOC441666	441666	genome.wustl.edu	37	10	42831504	42831504	+	RNA	SNP	T	T	C			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr10:42831504T>C	ENST00000609841.1	-	0	2399					NR_024380.1																						AATTCTCTTATGTATAGTAAG	0.363																																																	0																																												0																															10.37:g.42831504T>C				RNA	SNP	-	NULL	ENST00000609841.1	37	NULL		10																																																																																			RP11-313J2.1	-	-	ENSG00000215146		0.363	RP11-313J2.1-002	KNOWN	basic	processed_transcript	LOC441666	Clone_based_vega_gene	pseudogene	OTTHUMT00000472483.1	-	0.00	127	0	T			42831504	-1	tier1	-	no_errors	ENST00000609841	ensembl	human	known	74_37	rna	44.03	89	70	SNP	1.000	C
LRRC7	57554	genome.wustl.edu	37	1	70541880	70541880	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr1:70541880C>T	ENST00000035383.5	+	22	4267	c.4237C>T	c.(4237-4239)Cct>Tct	p.P1413S	LRRC7_ENST00000310961.5_Missense_Mutation_p.P1371S|LRRC7_ENST00000415775.2_Missense_Mutation_p.P697S	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	1413						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						GTCACCATTGCCTATTCAGAT	0.512																																																	0													99.0	93.0	95.0					1																	70541880		2203	4300	6503	SO:0001583	missense	0				CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.4237C>T	1.37:g.70541880C>T	ENSP00000035383:p.Pro1413Ser		Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_PDZ,superfamily_PDZ,smart_Leu-rich_rpt_typical-subtyp,smart_PDZ,pfscan_PDZ	p.P1413S	ENST00000035383.5	37	c.4237	CCDS645.1	1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.802483	0.90538	.	.	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000415775;ENST00000370957	T;T;T	0.36520	1.25;1.31;2.41	6.06	6.06	0.98353	.	0.344302	0.31370	N	0.007776	T	0.31263	0.0791	N	0.08118	0	0.50313	D	0.999869	D;D;D	0.89917	0.986;1.0;1.0	P;D;D	0.87578	0.875;0.998;0.994	T	0.24404	-1.0161	10	0.24483	T	0.36	.	19.6279	0.95687	0.0:1.0:0.0:0.0	.	697;1366;1413	F8WE45;Q96NW7-2;Q96NW7	.;.;LRRC7_HUMAN	S	1371;1413;697;1189	ENSP00000309245:P1371S;ENSP00000035383:P1413S;ENSP00000394867:P697S	ENSP00000035383:P1413S	P	+	1	0	LRRC7	70314468	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.176000	0.71955	2.880000	0.98712	0.650000	0.86243	CCT	LRRC7	-	NULL	ENSG00000033122		0.512	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC7	HGNC	protein_coding	OTTHUMT00000131261.1	-	0.00	35	0	C	NM_020794		70541880	+1	tier1	-	no_errors	ENST00000035383	ensembl	human	known	74_37	missense	40.00	12	8	SNP	1.000	T
MAML2	84441	genome.wustl.edu	37	11	96074681	96074681	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr11:96074681G>A	ENST00000524717.1	-	1	1663	c.379C>T	c.(379-381)Cca>Tca	p.P127S	MIR1260B_ENST00000582890.1_RNA	NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	127					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				tagtctggtgggggcggtggg	0.647			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid						OREG0021305	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																												Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	0													25.0	24.0	24.0					11																	96074681		1551	3251	4802	SO:0001583	missense	0			AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.379C>T	11.37:g.96074681G>A	ENSP00000434552:p.Pro127Ser	1317	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Missense_Mutation	SNP	pfam_Neuroggenic_mastermind-like_N	p.P127S	ENST00000524717.1	37	c.379	CCDS44714.1	11	.	.	.	.	.	.	.	.	.	.	G	13.85	2.359183	0.41801	.	.	ENSG00000184384	ENST00000524717;ENST00000440572	T;T	0.52526	0.66;0.66	4.9	4.9	0.64082	.	.	.	.	.	T	0.35508	0.0934	L	0.29908	0.895	0.28612	N	0.908633	P	0.47762	0.9	B	0.39419	0.299	T	0.23726	-1.0180	9	0.45353	T	0.12	.	11.528	0.50591	0.0:0.1809:0.8191:0.0	.	127	Q8IZL2	MAML2_HUMAN	S	127	ENSP00000434552:P127S;ENSP00000412394:P127S	ENSP00000412394:P127S	P	-	1	0	MAML2	95714329	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.612000	0.36889	2.268000	0.75426	0.561000	0.74099	CCA	MAML2	-	NULL	ENSG00000184384		0.647	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAML2	HGNC	protein_coding	OTTHUMT00000395540.1	-	0.00	21	0	G			96074681	-1	tier1	-	no_errors	ENST00000524717	ensembl	human	known	74_37	missense	28.21	28	11	SNP	1.000	A
MBD3L3	653657	genome.wustl.edu	37	19	7056358	7056358	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr19:7056358T>C	ENST00000333843.4	-	2	636	c.602A>G	c.(601-603)cAg>cGg	p.Q201R		NM_001164425.1	NP_001157897.1	A6NE82	MB3L3_HUMAN	methyl-CpG binding domain protein 3-like 3	201					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					central_nervous_system(1)|lung(5)|stomach(1)	7						CATTTCTGCCTGCCTGGCCAG	0.537																																																	0													1.0	2.0	2.0					19																	7056358		448	1167	1615	SO:0001583	missense	0				CCDS45944.1	19p13.2	2014-04-01			ENSG00000182315	ENSG00000182315			37205	protein-coding gene	gene with protein product							Standard	NM_001164425		Approved		uc021uns.1	A6NE82	OTTHUMG00000181976	ENST00000333843.4:c.602A>G	19.37:g.7056358T>C	ENSP00000333183:p.Gln201Arg			Missense_Mutation	SNP	NULL	p.Q201R	ENST00000333843.4	37	c.602	CCDS45944.1	19	.	.	.	.	.	.	.	.	.	.	.	0.981	-0.697029	0.03279	.	.	ENSG00000182315	ENST00000333843	.	.	.	0.607	0.607	0.17564	.	0.500961	0.14905	N	0.291589	T	0.37210	0.0995	L	0.44542	1.39	0.09310	N	1	.	.	.	.	.	.	T	0.26121	-1.0112	6	0.44086	T	0.13	-22.1657	.	.	.	.	.	.	.	R	201	.	ENSP00000333183:Q201R	Q	-	2	0	MBD3L3	7007358	0.455000	0.25736	0.110000	0.21437	0.279000	0.26890	0.959000	0.29240	0.497000	0.27926	0.147000	0.16070	CAG	MBD3L3	-	NULL	ENSG00000182315		0.537	MBD3L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD3L3	HGNC	protein_coding	OTTHUMT00000458500.1	-	0.00	32	0	T	NM_001164425		7056358	-1	tier1	-	no_errors	ENST00000333843	ensembl	human	known	74_37	missense	26.47	25	9	SNP	0.221	C
MBD5	55777	genome.wustl.edu	37	2	149247654	149247654	+	Silent	SNP	A	A	C			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr2:149247654A>C	ENST00000407073.1	+	12	4751	c.3754A>C	c.(3754-3756)Aga>Cga	p.R1252R	MBD5_ENST00000404807.1_Silent_p.R1485R	NM_018328.4	NP_060798.2	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	1252					glucose homeostasis (GO:0042593)|nervous system development (GO:0007399)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|regulation of multicellular organism growth (GO:0040014)|single-organism behavior (GO:0044708)	chromocenter (GO:0010369)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(16)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	62				BRCA - Breast invasive adenocarcinoma(221;0.0569)		GTTACCACCAAGAAACTGTCC	0.423																																																	0													67.0	68.0	68.0					2																	149247654		2203	4300	6503	SO:0001819	synonymous_variant	0			AB040894	CCDS33302.1	2q23.2	2009-04-17			ENSG00000204406	ENSG00000204406			20444	protein-coding gene	gene with protein product		611472				12529184	Standard	NM_018328		Approved	FLJ11113, KIAA1461	uc002twm.4	Q9P267	OTTHUMG00000150440	ENST00000407073.1:c.3754A>C	2.37:g.149247654A>C			A5HMQ4|A7E2B1|Q53SR1|Q9NUV6	Silent	SNP	superfamily_DNA-bd_dom,smart_Methyl_CpG_DNA-bd,pfscan_Methyl_CpG_DNA-bd,pfscan_PWWP_dom	p.R1252	ENST00000407073.1	37	c.3754	CCDS33302.1	2																																																																																			MBD5	-	NULL	ENSG00000204406		0.423	MBD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD5	HGNC	protein_coding	OTTHUMT00000318111.2	-	0.00	46	0	A			149247654	+1	tier1	-	no_errors	ENST00000407073	ensembl	human	known	74_37	silent	25.86	43	15	SNP	0.999	C
MGAM	8972	genome.wustl.edu	37	7	141781920	141781920	+	Intron	SNP	C	C	G			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr7:141781920C>G	ENST00000549489.2	+	39	4713				MGAM_ENST00000475668.2_Silent_p.L2027L	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)						carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CCAAGTACCTCTATGGCTTTG	0.542																																																	0																																										SO:0001627	intron_variant	0			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.4619-12500C>G	7.37:g.141781920C>G			Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom,smart_P_trefoil	p.L2027	ENST00000549489.2	37	c.6081	CCDS47727.1	7																																																																																			MGAM	-	superfamily_Gal_mutarotase_SF_dom	ENSG00000257335		0.542	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	HGNC	protein_coding	OTTHUMT00000351244.3	-	0.00	51	0	C			141781920	+1	tier1	-	no_errors	ENST00000475668	ensembl	human	putative	74_37	silent	17.65	56	12	SNP	1.000	G
MINK1	50488	genome.wustl.edu	37	17	4796810	4796810	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr17:4796810G>A	ENST00000355280.6	+	21	2678	c.2482G>A	c.(2482-2484)Gag>Aag	p.E828K	MINK1_ENST00000453408.3_Missense_Mutation_p.E808K|MINK1_ENST00000347992.7_Missense_Mutation_p.E799K	NM_001024937.3|NM_015716.4|NM_153827.4	NP_001020108.1|NP_056531.1|NP_722549.2			misshapen-like kinase 1											central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)|stomach(1)	6						GTCGTCCAGCGAGGAGGTGGA	0.647																																																	0													50.0	59.0	56.0					17																	4796810		1970	4129	6099	SO:0001583	missense	0			AY775058	CCDS45588.1, CCDS45589.1, CCDS45590.1	17p13.2	2011-04-14	2010-06-24		ENSG00000141503	ENSG00000141503			17565	protein-coding gene	gene with protein product	"""misshapen/NIK-related kinase"""	609426	"""misshapen-like kinase 1 (zebrafish)"""			10708748, 12087176	Standard	NM_015716		Approved	B55, MINK, ZC3, MAP4K6, YSK2	uc010vsl.2	Q8N4C8		ENST00000355280.6:c.2482G>A	17.37:g.4796810G>A	ENSP00000347427:p.Glu828Lys			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Citron,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_dom	p.E828K	ENST00000355280.6	37	c.2482	CCDS45588.1	17	.	.	.	.	.	.	.	.	.	.	G	23.6	4.432739	0.83776	.	.	ENSG00000141503	ENST00000355280;ENST00000453408;ENST00000347992	T;T;T	0.79033	-1.23;-1.23;-1.23	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.79701	0.4491	M	0.74647	2.275	0.49798	D	0.999829	D;D;D;D	0.60575	0.988;0.972;0.98;0.988	P;P;B;P	0.45037	0.467;0.467;0.277;0.467	D	0.83863	0.0269	10	0.72032	D	0.01	.	15.4054	0.74874	0.0:0.0:1.0:0.0	.	791;808;828;799	Q8N4C8-2;Q8N4C8-4;Q8N4C8;Q8N4C8-3	.;.;MINK1_HUMAN;.	K	828;808;799	ENSP00000347427:E828K;ENSP00000406487:E808K;ENSP00000269296:E799K	ENSP00000269296:E799K	E	+	1	0	MINK1	4737586	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	8.359000	0.90093	2.497000	0.84241	0.561000	0.74099	GAG	MINK1	-	NULL	ENSG00000141503		0.647	MINK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MINK1	HGNC	protein_coding	OTTHUMT00000439801.1	-	0.00	41	0	G	NM_015716		4796810	+1	tier1	-	no_errors	ENST00000355280	ensembl	human	known	74_37	missense	22.86	27	8	SNP	1.000	A
MLLT3	4300	genome.wustl.edu	37	9	20414313	20414313	+	Silent	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr9:20414313G>A	ENST00000380338.4	-	5	817	c.531C>T	c.(529-531)agC>agT	p.S177S	MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000475957.1_5'UTR|MLLT3_ENST00000429426.2_Silent_p.S174S	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	177	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctactgctgctgctgc	0.527			T	MLL	ALL																																			Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	0													22.0	31.0	28.0					9																	20414313		2066	3973	6039	SO:0001819	synonymous_variant	0			L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.531C>T	9.37:g.20414313G>A			B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	pfam_YEATS,pfscan_YEATS	p.S177	ENST00000380338.4	37	c.531	CCDS6494.1	9																																																																																			MLLT3	-	NULL	ENSG00000171843		0.527	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLLT3	HGNC	protein_coding	OTTHUMT00000051872.1		0.00	52	0	G	NM_004529		20414313	-1			no_errors	ENST00000380338	ensembl	human	known	74_37	silent	5.26	54	3	SNP	1.000	A
MRPS24	64951	genome.wustl.edu	37	7	43906348	43906348	+	Nonsense_Mutation	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr7:43906348G>A	ENST00000317534.5	-	4	515	c.454C>T	c.(454-456)Cga>Tga	p.R152*	URGCP-MRPS24_ENST00000603700.1_3'UTR|MRPS24_ENST00000467084.1_5'Flank	NM_032014.2	NP_114403.1	Q96EL2	RT24_HUMAN	mitochondrial ribosomal protein S24	152					translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)|mitochondrial small ribosomal subunit (GO:0005763)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	5						AGGTGGAGTCGCACAGGACAT	0.478																																																	0													84.0	83.0	83.0					7																	43906348		2203	4300	6503	SO:0001587	stop_gained	0			AB061207	CCDS5473.1	7p14	2012-09-13			ENSG00000062582	ENSG00000062582		"""Mitochondrial ribosomal proteins / small subunits"""	14510	protein-coding gene	gene with protein product		611986				8127713, 11279123	Standard	NM_032014		Approved	MRP-S24, HSPC335	uc003tit.1	Q96EL2	OTTHUMG00000023175	ENST00000317534.5:c.454C>T	7.37:g.43906348G>A	ENSP00000318158:p.Arg152*		A4D1U9|P82668|Q96Q23|Q9P047	Nonsense_Mutation	SNP	NULL	p.R152*	ENST00000317534.5	37	c.454	CCDS5473.1	7	.	.	.	.	.	.	.	.	.	.	G	19.76	3.886843	0.72410	.	.	ENSG00000062582	ENST00000317534	.	.	.	5.07	3.27	0.37495	.	0.125811	0.52532	D	0.000062	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	-12.5472	4.926	0.13894	0.1788:0.0:0.6539:0.1673	.	.	.	.	X	152	.	ENSP00000318158:R152X	R	-	1	2	MRPS24	43872873	1.000000	0.71417	0.961000	0.40146	0.906000	0.53458	5.126000	0.64721	0.549000	0.28973	-0.148000	0.13756	CGA	MRPS24	-	NULL	ENSG00000062582		0.478	MRPS24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS24	HGNC	protein_coding	OTTHUMT00000250949.1	-	0.00	63	0	G	NM_032014		43906348	-1	tier1	-	no_errors	ENST00000317534	ensembl	human	known	74_37	nonsense	32.08	36	17	SNP	0.994	A
MT-CO1	4512	genome.wustl.edu	37	M	6007	6007	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chrM:6007T>C	ENST00000361624.2	+	1	104	c.104T>C	c.(103-105)cTc>cCc	p.L35P	MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TA_ENST00000387392.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	35					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						AGCTCTAAGCCTCCTTATTCG	0.483																																																	0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.104T>C	M.37:g.6007T>C	ENSP00000354499:p.Leu35Pro		Q34770	Missense_Mutation	SNP	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1	p.L35P	ENST00000361624.2	37	c.104		MT																																																																																			MT-CO1	-	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom	ENSG00000198804		0.483	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-CO1	HGNC	protein_coding			0.00	86	0	T	YP_003024028		6007	+1			no_errors	ENST00000361624	ensembl	human	known	74_37	missense	5.66	50	3	SNP	NULL	C
MT-ATP6	4508	genome.wustl.edu	37	M	8764	8764	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chrM:8764G>A	ENST00000361899.2	+	1	238	c.238G>A	c.(238-240)Gcc>Acc	p.A80T	MT-TY_ENST00000387409.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank			P00846	ATP6_HUMAN	mitochondrially encoded ATP synthase 6	80			A -> T. {ECO:0000269|PubMed:12022039}.		ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|proton-transporting ATP synthase complex, coupling factor F(o) (GO:0045263)	hydrogen ion transmembrane transporter activity (GO:0015078)|transmembrane transporter activity (GO:0022857)			breast(2)|endometrium(7)|kidney(8)|prostate(1)	18						TCATTTTTATTGCCACAACTA	0.423																																																	0																																										SO:0001583	missense	0					mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198899	ENSG00000198899		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	7414	protein-coding gene	gene with protein product		516060	"""ATP synthase 6"", ""spicular retinitis pigmentosa with dementia, seizures, ataxia, proximal muscle weakness and sensory deficit"""	MTATP6, RP		7219534	Standard			Approved	ATP6, ATPase-6, Su6m		P00846		ENST00000361899.2:c.238G>A	M.37:g.8764G>A	ENSP00000354632:p.Ala80Thr		Q34772|Q5S8W5|Q5S9E7|Q5S9I6|Q5SA31|Q6RPB7|Q6VHC0|Q6VHE0|Q6WQF4|Q7YCC1|Q7YCF8|Q7YCG1|Q85KU8|Q85KX1|Q85L05|Q8HNQ4|Q8HNQ8|Q8WCX6|Q9B2U5|Q9B2Z2	Missense_Mutation	SNP	pfam_ATPase_F0-cplx_asu,superfamily_ATPase_F0-cplx_asu,prints_ATPase_F0-cplx_asu,tigrfam_ATPase_F0-cplx_asu	p.A80T	ENST00000361899.2	37	c.238		MT																																																																																			MT-ATP6	-	pfam_ATPase_F0-cplx_asu,superfamily_ATPase_F0-cplx_asu,prints_ATPase_F0-cplx_asu,tigrfam_ATPase_F0-cplx_asu	ENSG00000198899		0.423	MT-ATP6-201	KNOWN	basic|appris_principal	protein_coding	MT-ATP6	HGNC	protein_coding		-	0.00	19	0	G	YP_003024031		8764	+1	tier1	-	no_errors	ENST00000361899	ensembl	human	known	74_37	missense	100.00	0	6	SNP	NULL	A
MTA2	9219	genome.wustl.edu	37	11	62363243	62363243	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr11:62363243C>T	ENST00000278823.2	-	13	1624	c.1235G>A	c.(1234-1236)gGg>gAg	p.G412E	MTA2_ENST00000524902.1_Missense_Mutation_p.G239E|MTA2_ENST00000527204.1_Missense_Mutation_p.G239E	NM_004739.3	NP_004730.2	O94776	MTA2_HUMAN	metastasis associated 1 family, member 2	412					ATP-dependent chromatin remodeling (GO:0043044)|chromatin assembly or disassembly (GO:0006333)|DNA methylation (GO:0006306)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	histone deacetylase complex (GO:0000118)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|histone deacetylase activity (GO:0004407)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	26						CCGAGTGGCCCCCTCAAGCTG	0.542																																																	0													80.0	83.0	82.0					11																	62363243		2202	4299	6501	SO:0001583	missense	0			AB016591	CCDS8022.1	11q12-q13.1	2013-01-25	2004-12-15	2003-12-17	ENSG00000149480	ENSG00000149480		"""GATA zinc finger domain containing"""	7411	protein-coding gene	gene with protein product		603947	"""metastasis associated gene family, member 2"""	MTA1L1		9929979	Standard	NM_004739		Approved	MTA1-L1	uc001ntq.2	O94776	OTTHUMG00000167684	ENST00000278823.2:c.1235G>A	11.37:g.62363243C>T	ENSP00000278823:p.Gly412Glu		Q68DB1|Q9UQB5	Missense_Mutation	SNP	pfam_BAH_dom,pfam_ELM2_dom,pfam_Znf_GATA,superfamily_Homeodomain-like,smart_BAH_dom,smart_SANT/Myb,smart_Znf_GATA,pfscan_BAH_dom,pfscan_ELM2_dom	p.G412E	ENST00000278823.2	37	c.1235	CCDS8022.1	11	.	.	.	.	.	.	.	.	.	.	C	15.12	2.738619	0.49045	.	.	ENSG00000149480	ENST00000278823;ENST00000524902;ENST00000527204	T;T;T	0.45668	1.5;0.89;0.89	4.9	4.9	0.64082	Zinc finger, GATA-type (1);	0.102199	0.64402	D	0.000003	T	0.49795	0.1578	N	0.26130	0.795	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.36335	-0.9752	10	0.25751	T	0.34	-21.6947	15.6137	0.76748	0.0:1.0:0.0:0.0	.	412	O94776	MTA2_HUMAN	E	412;239;239	ENSP00000278823:G412E;ENSP00000431346:G239E;ENSP00000431797:G239E	ENSP00000278823:G412E	G	-	2	0	MTA2	62119819	1.000000	0.71417	1.000000	0.80357	0.804000	0.45430	5.750000	0.68712	2.549000	0.85964	0.655000	0.94253	GGG	MTA2	-	smart_Znf_GATA	ENSG00000149480		0.542	MTA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTA2	HGNC	protein_coding	OTTHUMT00000395578.1	-	0.00	40	0	C	NM_004739		62363243	-1	tier1	-	no_errors	ENST00000278823	ensembl	human	known	74_37	missense	28.57	35	14	SNP	1.000	T
MTF2	22823	genome.wustl.edu	37	1	93575872	93575872	+	Silent	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr1:93575872C>T	ENST00000370298.4	+	2	380	c.91C>T	c.(91-93)Ctg>Ttg	p.L31L	MTF2_ENST00000471953.1_3'UTR|MTF2_ENST00000545708.1_Intron|MTF2_ENST00000370303.4_Silent_p.L31L|MTF2_ENST00000540243.1_Intron	NM_001164392.1|NM_007358.3	NP_001157864.1|NP_031384	Q9Y483	MTF2_HUMAN	metal response element binding transcription factor 2	31					chromatin modification (GO:0016568)|negative regulation of histone H3-K27 methylation (GO:0061086)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K27 methylation (GO:0061087)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|segment specification (GO:0007379)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_lung(203;0.00196)|Lung NSC(277;0.00902)|Melanoma(281;0.099)|Ovarian(761;0.109)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00076)|GBM - Glioblastoma multiforme(16;0.00157)|Epithelial(280;0.0886)		CTTGACCAAGCTGTCTTTACA	0.448																																																	0													138.0	135.0	136.0					1																	93575872		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ010014	CCDS742.1, CCDS53340.1, CCDS53341.1	1p22.1	2013-01-28			ENSG00000143033	ENSG00000143033		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	29535	protein-coding gene	gene with protein product	"""polycomb-like 2"", ""tudor domain containing 19A"""	609882				15563832	Standard	NM_007358		Approved	M96, PCL2, TDRD19A	uc009wdj.3	Q9Y483	OTTHUMG00000010161	ENST00000370298.4:c.91C>T	1.37:g.93575872C>T			A6NGQ9|A8K2Q3|B1AKT5|B1AKT6|Q9UES9|Q9UP40	Silent	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Tudor,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.L31	ENST00000370298.4	37	c.91	CCDS742.1	1																																																																																			MTF2	-	NULL	ENSG00000143033		0.448	MTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTF2	HGNC	protein_coding	OTTHUMT00000028075.3	-	0.00	64	0	C	NM_007358		93575872	+1	tier1	-	no_errors	ENST00000370298	ensembl	human	known	74_37	silent	43.10	33	25	SNP	1.000	T
MUC19	283463	genome.wustl.edu	37	12	40928552	40928552	+	3'UTR	SNP	T	T	G			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr12:40928552T>G	ENST00000474954.1	+	0	4553				MUC19_ENST00000454784.4_Intron			Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						ACAGGTAAACTTGGGGAAAGC	0.388																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000474954.1:c.*4550T>G	12.37:g.40928552T>G			Q8NA85	RNA	SNP	-	NULL	ENST00000474954.1	37	NULL		12																																																																																			MUC19	-	-	ENSG00000205592		0.388	MUC19-006	KNOWN	basic	processed_transcript	MUC19	HGNC	protein_coding	OTTHUMT00000134360.1	-	0.00	100	0	T	XM_003403524		40928552	+1	tier1	-	no_errors	ENST00000474954	ensembl	human	known	74_37	rna	44.32	49	39	SNP	0.010	G
MUC4	4585	genome.wustl.edu	37	3	195510146	195510146	+	Missense_Mutation	SNP	G	G	C	rs199750921		TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr3:195510146G>C	ENST00000463781.3	-	2	8764	c.8305C>G	c.(8305-8307)Ctt>Gtt	p.L2769V	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.L2769V|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.L2769V(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTGACAGGAAGAGGGGTGGCG	0.577																																																	1	Substitution - Missense(1)	kidney(1)											35.0	21.0	25.0					3																	195510146		686	1538	2224	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8305C>G	3.37:g.195510146G>C	ENSP00000417498:p.Leu2769Val		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.L2769V	ENST00000463781.3	37	c.8305	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	-	2.836	-0.241610	0.05906	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.38722	1.12;1.16	1.02	-1.7	0.08159	.	.	.	.	.	T	0.20007	0.0481	N	0.19112	0.55	0.09310	N	1	B	0.24426	0.103	B	0.20384	0.029	T	0.19160	-1.0314	8	.	.	.	.	1.6641	0.02798	0.4545:0.0:0.2536:0.2919	.	2641	E7ESK3	.	V	2769	ENSP00000417498:L2769V;ENSP00000420243:L2769V	.	L	-	1	0	MUC4	196994925	0.000000	0.05858	0.002000	0.10522	0.103000	0.19146	-1.498000	0.02287	-0.413000	0.07507	0.074000	0.15403	CTT	MUC4	-	NULL	ENSG00000145113		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	-	0.00	49	0	G	NM_018406		195510146	-1	tier1	rs199750921	no_errors	ENST00000463781	ensembl	human	known	74_37	missense	18.60	35	8	SNP	0.006	C
MYBL1	4603	genome.wustl.edu	37	8	67488276	67488276	+	Missense_Mutation	SNP	G	G	A	rs373484712		TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr8:67488276G>A	ENST00000522677.3	-	10	1846	c.1436C>T	c.(1435-1437)aCa>aTa	p.T479I	MYBL1_ENST00000517885.1_Missense_Mutation_p.T137I|MYBL1_ENST00000524176.2_Missense_Mutation_p.T479I	NM_001080416.2|NM_001144755.1	NP_001073885.1|NP_001138227.1	P10243	MYBA_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 1	479	Negative regulatory domain. {ECO:0000250}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|skin(1)	25			Epithelial(68;0.00211)|all cancers(69;0.00726)|OV - Ovarian serous cystadenocarcinoma(28;0.00989)|BRCA - Breast invasive adenocarcinoma(89;0.0938)			TTTCAGTGGTGTATGTTTTAG	0.388																																																	0								G	ILE/THR,ILE/THR	0,3886		0,0,1943	89.0	82.0	84.0		1436,1436	5.5	1.0	8		84	1,8275		0,1,4137	no	missense,missense	MYBL1	NM_001080416.2,NM_001144755.1	89,89	0,1,6080	AA,AG,GG		0.0121,0.0,0.0082	probably-damaging,probably-damaging	479/753,479/693	67488276	1,12161	1943	4138	6081	SO:0001583	missense	0			X13294	CCDS47867.1, CCDS55241.1	8q22	2013-07-09	2013-07-09		ENSG00000185697	ENSG00000185697			7547	protein-coding gene	gene with protein product		159405					Standard	XM_005251251		Approved	AMYB, A-myb	uc003xwj.3	P10243	OTTHUMG00000164559	ENST00000522677.3:c.1436C>T	8.37:g.67488276G>A	ENSP00000429633:p.Thr479Ile		E7EW29|Q495F9	Missense_Mutation	SNP	pfam_C-myb_C,pfam_SANT/Myb,pfam_Tscrpt_reg_Wos2-domain,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.T479I	ENST00000522677.3	37	c.1436	CCDS47867.1	8	.	.	.	.	.	.	.	.	.	.	G	20.2	3.956702	0.73902	0.0	1.21E-4	ENSG00000185697	ENST00000522677;ENST00000517885;ENST00000524176	T;T;T	0.36520	1.71;1.93;1.25	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.53916	0.1826	L	0.42245	1.32	0.80722	D	1	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.91635	0.988;0.986;0.999	T	0.52719	-0.8538	10	0.56958	D	0.05	-13.0842	17.4848	0.87684	0.0:0.0:1.0:0.0	.	479;478;479	Q495F9;Q495G0;P10243	.;.;MYBA_HUMAN	I	479;137;479	ENSP00000429633:T479I;ENSP00000428265:T137I;ENSP00000428011:T479I	ENSP00000428265:T137I	T	-	2	0	MYBL1	67650830	1.000000	0.71417	1.000000	0.80357	0.682000	0.39822	8.381000	0.90152	2.571000	0.86741	0.591000	0.81541	ACA	MYBL1	-	NULL	ENSG00000185697		0.388	MYBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBL1	HGNC	protein_coding	OTTHUMT00000379221.3	-	0.00	44	0	G	XM_034274		67488276	-1	tier1	-	no_errors	ENST00000522677	ensembl	human	known	74_37	missense	12.73	48	7	SNP	1.000	A
MYBPC3	4607	genome.wustl.edu	37	11	47368187	47368187	+	Missense_Mutation	SNP	C	C	T	rs373204728		TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr11:47368187C>T	ENST00000545968.1	-	11	971	c.917G>A	c.(916-918)cGg>cAg	p.R306Q	MYBPC3_ENST00000256993.4_Missense_Mutation_p.R306Q|MYBPC3_ENST00000399249.2_Missense_Mutation_p.R306Q	NM_000256.3	NP_000247.2	Q14896	MYPC3_HUMAN	myosin binding protein C, cardiac	306					cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|heart morphogenesis (GO:0003007)|muscle filament sliding (GO:0030049)|myosin filament assembly (GO:0031034)|positive regulation of ATPase activity (GO:0032781)|regulation of heart rate (GO:0002027)|regulation of muscle filament sliding (GO:0032971)|regulation of striated muscle contraction (GO:0006942)|sarcomere organization (GO:0045214)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	A band (GO:0031672)|C zone (GO:0014705)|cytosol (GO:0005829)|sarcomere (GO:0030017)|striated muscle myosin thick filament (GO:0005863)	ATPase activator activity (GO:0001671)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|myosin binding (GO:0017022)|myosin heavy chain binding (GO:0032036)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(4)|lung(16)|ovary(3)|prostate(3)|urinary_tract(2)	42				Lung(87;0.176)		CCTCGGGGTCCGGAAACTGCT	0.627																																																	0								C	GLN/ARG	1,4035		0,1,2017	44.0	55.0	52.0		917	4.0	1.0	11		52	0,8322		0,0,4161	no	missense	MYBPC3	NM_000256.3	43	0,1,6178	TT,TC,CC		0.0,0.0248,0.0081	possibly-damaging	306/1275	47368187	1,12357	2018	4161	6179	SO:0001583	missense	0			X84075	CCDS53621.1	11p11.2	2014-09-17	2001-11-28			ENSG00000134571		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7551	protein-coding gene	gene with protein product		600958	"""myosin-binding protein C, cardiac"""	CMH4		7744002, 8358441	Standard	NM_000256		Approved	MYBP-C, FHC	uc021qis.1	Q14896		ENST00000545968.1:c.917G>A	11.37:g.47368187C>T	ENSP00000442795:p.Arg306Gln		A5PL00|Q16410|Q6R2F7|Q9UE27|Q9UM53	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.R306Q	ENST00000545968.1	37	c.917	CCDS53621.1	11	.	.	.	.	.	.	.	.	.	.	C	7.976	0.750181	0.15778	2.48E-4	0.0	ENSG00000134571	ENST00000545968;ENST00000399249;ENST00000256993	T;T;T	0.57107	0.44;0.42;0.48	4.04	4.04	0.47022	.	.	.	.	.	T	0.30070	0.0753	N	0.08118	0	0.39628	D	0.970137	B	0.20261	0.043	B	0.09377	0.004	T	0.13442	-1.0509	9	0.12430	T	0.62	.	14.0498	0.64730	0.0:1.0:0.0:0.0	.	306	Q14896	MYPC3_HUMAN	Q	306	ENSP00000442795:R306Q;ENSP00000382193:R306Q;ENSP00000256993:R306Q	ENSP00000256993:R306Q	R	-	2	0	MYBPC3	47324763	0.999000	0.42202	0.980000	0.43619	0.014000	0.08584	3.788000	0.55446	2.229000	0.72834	0.561000	0.74099	CGG	MYBPC3	-	NULL	ENSG00000134571		0.627	MYBPC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYBPC3	HGNC	protein_coding	OTTHUMT00000392271.3	-	0.00	58	0	C			47368187	-1	tier1	-	no_errors	ENST00000399249	ensembl	human	known	74_37	missense	10.91	49	6	SNP	0.999	T
MYH4	4622	genome.wustl.edu	37	17	10348311	10348311	+	Silent	SNP	G	G	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr17:10348311G>T	ENST00000255381.2	-	37	5558	c.5448C>A	c.(5446-5448)atC>atA	p.I1816I	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	1816					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)	p.I1816M(1)		NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						CCAGTTTCTGGATCTGCTTCT	0.537																																																	1	Substitution - Missense(1)	lung(1)											173.0	165.0	168.0					17																	10348311		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.5448C>A	17.37:g.10348311G>T				Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.I1816	ENST00000255381.2	37	c.5448	CCDS11154.1	17																																																																																			MYH4	-	pfam_Myosin_tail	ENSG00000264424		0.537	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	MYH4	HGNC	protein_coding	OTTHUMT00000252731.1		0.00	51	0	G	NM_017533		10348311	-1			no_errors	ENST00000255381	ensembl	human	known	74_37	silent	6.25	30	2	SNP	1.000	T
MYOCD	93649	genome.wustl.edu	37	17	12647692	12647694	+	In_Frame_Del	DEL	CAG	CAG	-	rs536181176	byFrequency	TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	CAG	CAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr17:12647692_12647694delCAG	ENST00000343344.4	+	8	910_912	c.910_912delCAG	c.(910-912)cagdel	p.Q310del	MYOCD_ENST00000425538.1_In_Frame_Del_p.Q310del|MYOCD_ENST00000395988.1_3'UTR|AC005358.1_ENST00000609971.1_In_Frame_Del_p.Q214del			Q8IZQ8	MYCD_HUMAN	myocardin	310	Gln-rich.				cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		AATCCTCAGCcagcagcagcagc	0.596														27	0.00539137	0.0098	0.0029	5008	,	,		19180	0.001		0.001	False		,,,				2504	0.0102																0									,,	189,4075		0,189,1943					,,	3.1	1.0			38	472,7780		2,468,3656	no	coding,coding,coding	MYOCD	NM_153604.2,NM_001146313.1,NM_001146312.1	,,	2,657,5599	A1A1,A1R,RR		5.7198,4.4325,5.2812	,,	,,		661,11855				SO:0001651	inframe_deletion	0			AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.910_912delCAG	17.37:g.12647701_12647703delCAG	ENSP00000341835:p.Gln310del		Q5UBU5|Q8N7Q1	In_Frame_Del	DEL	pfam_RPEL_repeat,pfam_SAP_dom,smart_RPEL_repeat,smart_SAP_dom,pfscan_RPEL_repeat,pfscan_SAP_dom	p.Q307in_frame_del	ENST00000343344.4	37	c.910_912	CCDS11163.1	17																																																																																			MYOCD	-	NULL	ENSG00000141052		0.596	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOCD	HGNC	protein_coding	OTTHUMT00000129950.1		0.00	35	0	CAG	NM_153604		12647694	+1	tier1		no_errors	ENST00000425538	ensembl	human	known	74_37	in_frame_del	11.54	23	3	DEL	1.000:1.000:1.000	-
NCAM1	4684	genome.wustl.edu	37	11	113143813	113143813	+	Intron	SNP	C	C	T	rs377104336	byFrequency	TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr11:113143813C>T	ENST00000397957.4	+	19	2667				NCAM1-AS1_ENST00000526229.1_RNA|NCAM1-AS1_ENST00000533638.1_RNA|NCAM1_ENST00000316851.7_Intron			P13591	NCAM1_HUMAN	neural cell adhesion molecule 1						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		CCGCCGGCCACGGCCACGCCT	0.652													C|||	111	0.0221645	0.0182	0.0231	5008	,	,		12917	0.001		0.004	False		,,,				2504	0.0675																0																																										SO:0001627	intron_variant	0				CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000397957.4:c.2667+1215C>T	11.37:g.113143813C>T			A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	RNA	SNP	-	NULL	ENST00000397957.4	37	NULL		11																																																																																			NCAM1	-	-	ENSG00000149294		0.652	NCAM1-001	KNOWN	basic	processed_transcript	NCAM1	HGNC	protein_coding	OTTHUMT00000393677.2	-	0.00	56	0	C	NM_000615		113143813	+1	tier1	-	no_errors	ENST00000528158	ensembl	human	putative	74_37	rna	7.59	73	6	SNP	0.944	T
NEK11	79858	genome.wustl.edu	37	3	130889732	130889732	+	Splice_Site	SNP	G	G	T	rs148813749		TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr3:130889732G>T	ENST00000510769.1	+	10	1337		c.e10+1		NEK11_ENST00000356918.4_Splice_Site|NEK11_ENST00000429253.2_Splice_Site|NEK11_ENST00000510688.1_Splice_Site|NEK11_ENST00000412440.2_Splice_Site|NEK11_ENST00000383366.4_Splice_Site|NEK11_ENST00000508196.1_Splice_Site|NEK11_ENST00000507910.1_Splice_Site|NEK11_ENST00000511262.1_Splice_Site					NIMA-related kinase 11											breast(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(14)|stomach(1)|urinary_tract(2)	33						GGATACCATGGTATGTGTTTG	0.498																																																	0													167.0	146.0	153.0					3																	130889732		2203	4300	6503	SO:0001630	splice_region_variant	0			AK027148	CCDS3069.1, CCDS46915.1, CCDS54639.1	3q22.1	2012-11-15	2012-11-15		ENSG00000114670	ENSG00000114670			18593	protein-coding gene	gene with protein product		609779	"""NIMA (never in mitosis gene a)- related kinase 11"""				Standard	NM_024800		Approved	FLJ23495	uc003eny.3	Q8NG66	OTTHUMG00000159654	ENST00000510769.1:c.1084+1G>T	3.37:g.130889732G>T				Splice_Site	SNP	-	e12+1	ENST00000510769.1	37	c.1399+1		3	.	.	.	.	.	.	.	.	.	.	G	15.49	2.849522	0.51270	.	.	ENSG00000114670	ENST00000510769;ENST00000429253;ENST00000356918;ENST00000510688;ENST00000511262;ENST00000383366;ENST00000412440;ENST00000507910;ENST00000508196	.	.	.	5.16	5.16	0.70880	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8879	0.70584	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NEK11	132372422	1.000000	0.71417	0.875000	0.34327	0.107000	0.19398	4.919000	0.63383	2.793000	0.96121	0.561000	0.74099	.	NEK11	-	-	ENSG00000114670		0.498	NEK11-005	NOVEL	basic|exp_conf	protein_coding	NEK11	HGNC	protein_coding	OTTHUMT00000356757.1	-	0.00	32	0	G	NM_024800	Intron	130889732	+1	tier1	-	no_errors	ENST00000383366	ensembl	human	known	74_37	splice_site	12.12	29	4	SNP	0.978	T
NKX2-6	137814	genome.wustl.edu	37	8	23563999	23563999	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr8:23563999G>A	ENST00000325017.3	-	1	112	c.113C>T	c.(112-114)cCg>cTg	p.P38L	RP11-175E9.1_ENST00000523874.1_RNA|NKX2-6_ENST00000418222.1_5'Flank	NM_001136271.2	NP_001129743.2	A6NCS4	NKX26_HUMAN	NK2 homeobox 6	38					atrial cardiac muscle cell development (GO:0055014)|cell differentiation (GO:0030154)|digestive tract development (GO:0048565)|embryonic heart tube development (GO:0035050)|hypothalamus development (GO:0021854)|negative regulation of apoptotic process (GO:0043066)|pericardium development (GO:0060039)|pharyngeal system development (GO:0060037)|positive regulation of cell proliferation (GO:0008284)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|ventricular cardiac muscle cell development (GO:0055015)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)										AAAGTTTTCCGGGCTCTTCCG	0.652																																																	0																																										SO:0001583	missense	0			CN272646		8p21.2	2012-03-09	2011-06-01			ENSG00000180053		"""Homeoboxes / ANTP class : NKL subclass"""	32940	protein-coding gene	gene with protein product	"""tinman paralog (Drosophila)"""	611770	"""NK2 transcription factor related, locus 6 (Drosophila)"""			15649947	Standard	NM_001136271		Approved	CSX2, NKX4-2	uc011kzy.3	A6NCS4		ENST00000325017.3:c.113C>T	8.37:g.23563999G>A	ENSP00000320089:p.Pro38Leu			Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.P38L	ENST00000325017.3	37	c.113		8	.	.	.	.	.	.	.	.	.	.	G	10.43	1.347907	0.24426	.	.	ENSG00000180053	ENST00000325017	D	0.87650	-2.28	5.26	0.142	0.14816	.	1.563200	0.04095	N	0.312030	T	0.79287	0.4420	.	.	.	0.09310	N	0.999993	.	.	.	.	.	.	T	0.64512	-0.6390	7	0.28530	T	0.3	.	4.9285	0.13905	0.3182:0.0:0.5454:0.1364	.	.	.	.	L	38	ENSP00000320089:P38L	ENSP00000320089:P38L	P	-	2	0	NKX2-6	23619944	0.004000	0.15560	0.002000	0.10522	0.007000	0.05969	-0.205000	0.09411	-0.005000	0.14395	-0.339000	0.08088	CCG	NKX2-6	-	NULL	ENSG00000180053		0.652	NKX2-6-001	KNOWN	basic|appris_principal	protein_coding	NKX2-6	HGNC	protein_coding	OTTHUMT00000376057.4	-	0.00	59	0	G	NM_001136271		23563999	-1	tier1	-	no_errors	ENST00000325017	ensembl	human	known	74_37	missense	22.64	40	12	SNP	0.039	A
NLRC3	197358	genome.wustl.edu	37	16	3602277	3602277	+	RNA	SNP	C	C	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr16:3602277C>A	ENST00000301749.7	-	0	2676				NLRC3_ENST00000359128.5_RNA|NLRC3_ENST00000603507.1_RNA|NLRC3_ENST00000448023.2_RNA|NLRC3_ENST00000419350.2_RNA	NM_178844.2	NP_849172.2	Q7RTR2	NLRC3_HUMAN	NLR family, CARD domain containing 3						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of protein ubiquitination (GO:0031396)|response to lipopolysaccharide (GO:0032496)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(16)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						TGTTCTTCTGCAGGCTGTGGG	0.552																																																	0													65.0	61.0	62.0					16																	3602277		1915	4145	6060			0			BK001112	CCDS73817.1	16p13.3	2014-03-25			ENSG00000167984	ENSG00000167984		"""Nucleotide-binding domain and leucine rich repeat containing"""	29889	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 3"", ""NOD-like receptor C3"""	615648				15705585, 12766759	Standard	NM_178844		Approved	CLR16.2, FLJ00348, NOD3	uc010btn.3	Q7RTR2	OTTHUMG00000177561		16.37:g.3602277C>A			Q5EY36|Q8NF48|Q8NI01|Q8NI02|Q8TEL3	Silent	SNP	superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase	p.L804	ENST00000301749.7	37	c.2412		16																																																																																			NLRC3	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000167984		0.552	NLRC3-201	KNOWN	basic|appris_principal	protein_coding	NLRC3	HGNC	polymorphic_pseudogene		-	0.00	31	0	C	NM_178844		3602277	-1	tier1	-	no_errors	ENST00000448023	ensembl	human	known	74_37	silent	33.33	16	8	SNP	0.993	A
NPIPB5	100132247	genome.wustl.edu	37	16	22545580	22545585	+	In_Frame_Del	DEL	AATCTC	AATCTC	-			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	AATCTC	AATCTC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr16:22545580_22545585delAATCTC	ENST00000517539.1	+	8	1351_1356	c.1276_1281delAATCTC	c.(1276-1281)aatctcdel	p.NL426del	NPIPB5_ENST00000415654.1_3'UTR|NPIPB5_ENST00000424340.1_In_Frame_Del_p.NL426del			A8MRT5	NPIB5_HUMAN	nuclear pore complex interacting protein family, member B5	426	Pro-rich.					integral component of membrane (GO:0016021)											AGCGGATGATAATCTCAAGACACCTT	0.597																																																	0										2,380		1,0,190							0.0			1	16,654		5,6,324	no	coding	LOC100132247	NM_001135865.1		6,6,514	A1A1,A1R,RR		2.3881,0.5236,1.711				18,1034				SO:0001651	inframe_deletion	0				CCDS45443.1	16p12.2	2013-06-11			ENSG00000243716	ENSG00000243716			37233	protein-coding gene	gene with protein product							Standard	NM_001135865		Approved			A8MRT5	OTTHUMG00000163573	ENST00000517539.1:c.1276_1281delAATCTC	16.37:g.22545580_22545585delAATCTC	ENSP00000430633:p.Asn426_Leu427del		B4DK13	In_Frame_Del	DEL	NULL	p.NL426in_frame_del	ENST00000517539.1	37	c.1276_1281	CCDS45443.1	16																																																																																			NPIPB5	-	NULL	ENSG00000243716		0.597	NPIPB5-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NPIPB5	HGNC	protein_coding	OTTHUMT00000374343.2		0.00	11	0	AATCTC	NM_001135865		22545585	+1			no_errors	ENST00000424340	ensembl	human	known	74_37	in_frame_del	33.33	4	2	DEL	0.851:0.854:0.851:0.851:0.843:0.838	0
NPR3	4883	genome.wustl.edu	37	5	32724886	32724886	+	Silent	SNP	C	C	T	rs374205048		TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr5:32724886C>T	ENST00000265074.8	+	2	1195	c.852C>T	c.(850-852)taC>taT	p.Y284Y	NPR3_ENST00000415167.2_Silent_p.Y284Y|NPR3_ENST00000434067.2_Silent_p.Y68Y|NPR3_ENST00000415685.2_Silent_p.Y68Y	NM_000908.3|NM_001204375.1	NP_000899.1|NP_001191304.1	P17342	ANPRC_HUMAN	natriuretic peptide receptor 3	284					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of smooth muscle cell proliferation (GO:0048662)|osteoclast proliferation (GO:0002158)|pancreatic juice secretion (GO:0030157)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of urine volume (GO:0035810)|regulation of blood pressure (GO:0008217)|regulation of osteoblast proliferation (GO:0033688)|skeletal system development (GO:0001501)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	G-protein coupled peptide receptor activity (GO:0008528)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24					Nesiritide(DB04899)	GTGGAGACTACGCCTTCTTCA	0.532																																																	0								C	,,	0,4394		0,0,2197	210.0	220.0	217.0		852,852,204	3.2	1.0	5		217	1,8573	1.2+/-3.3	0,1,4286	no	coding-synonymous,coding-synonymous,coding-synonymous	NPR3	NM_000908.3,NM_001204375.1,NM_001204376.1	,,	0,1,6483	TT,TC,CC		0.0117,0.0,0.0077	,,	284/541,284/542,68/325	32724886	1,12967	2197	4287	6484	SO:0001819	synonymous_variant	0				CCDS47196.1, CCDS56356.1, CCDS56357.1	5p13.3	2014-03-03	2014-03-03		ENSG00000113389	ENSG00000113389			7945	protein-coding gene	gene with protein product	"""guanylate cyclase C"""	108962	"""chromosome 5 open reading frame 23"", ""atrionatriuretic peptide receptor C"", ""natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)"", ""natriuretic peptide receptor C"""	NPRC, ANPRC, C5orf23		2162522, 1979052	Standard	NM_000908		Approved	GUCY2B, FLJ14054	uc003jhv.3	P17342	OTTHUMG00000150316	ENST00000265074.8:c.852C>T	5.37:g.32724886C>T			A2RRD1|B4DT84|E7EPG9	Silent	SNP	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,prints_Ntpep_rcpt	p.Y284	ENST00000265074.8	37	c.852	CCDS56357.1	5																																																																																			NPR3	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I	ENSG00000113389		0.532	NPR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NPR3	HGNC	protein_coding	OTTHUMT00000317550.3	-	0.00	24	0	C	NM_000908		32724886	+1	tier1	-	no_errors	ENST00000265074	ensembl	human	known	74_37	silent	82.35	3	14	SNP	0.999	T
NR1D2	9975	genome.wustl.edu	37	3	24003473	24003473	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr3:24003473C>T	ENST00000312521.4	+	5	842	c.523C>T	c.(523-525)Cgg>Tgg	p.R175W	NR1D2_ENST00000492552.1_3'UTR	NM_001145425.1|NM_005126.4	NP_001138897.1|NP_005117	Q14995	NR1D2_HUMAN	nuclear receptor subfamily 1, group D, member 2	175	Hinge.				gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|lipid homeostasis (GO:0055088)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of energy homeostasis (GO:2000505)|regulation of inflammatory response (GO:0050727)|regulation of lipid metabolic process (GO:0019216)|regulation of skeletal muscle cell differentiation (GO:2001014)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			NS(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	22						AATAGCTGTTCGGTTTGGTCG	0.353																																																	0													58.0	55.0	56.0					3																	24003473		2203	4300	6503	SO:0001583	missense	0			BC045613	CCDS33718.1	3p24.1	2013-01-16			ENSG00000174738	ENSG00000174738		"""Nuclear hormone receptors"""	7963	protein-coding gene	gene with protein product		602304				7997240, 10198169	Standard	NM_005126		Approved	BD73, RVR, EAR-1r, HZF2, Hs.37288	uc003ccs.2	Q14995	OTTHUMG00000155659	ENST00000312521.4:c.523C>T	3.37:g.24003473C>T	ENSP00000310006:p.Arg175Trp		B2R8Q3|O00402|Q86XD4	Missense_Mutation	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.R175W	ENST00000312521.4	37	c.523	CCDS33718.1	3	.	.	.	.	.	.	.	.	.	.	C	17.82	3.483836	0.63962	.	.	ENSG00000174738	ENST00000312521;ENST00000396676	D	0.96619	-4.07	5.84	3.98	0.46160	Nuclear hormone receptor, ligand-binding (1);Zinc finger, nuclear hormone receptor-type (1);	0.053328	0.64402	D	0.000001	D	0.97561	0.9201	M	0.67397	2.05	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97637	1.0146	10	0.87932	D	0	.	14.8386	0.70206	0.2808:0.7192:0.0:0.0	.	175	Q14995	NR1D2_HUMAN	W	175	ENSP00000310006:R175W	ENSP00000310006:R175W	R	+	1	2	NR1D2	23978477	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	2.859000	0.48364	0.733000	0.32492	-0.181000	0.13052	CGG	NR1D2	-	pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt	ENSG00000174738		0.353	NR1D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR1D2	HGNC	protein_coding	OTTHUMT00000341017.3	-	0.00	68	0	C			24003473	+1	tier1	-	no_errors	ENST00000312521	ensembl	human	known	74_37	missense	38.89	33	21	SNP	1.000	T
NSMCE1	197370	genome.wustl.edu	37	16	27268847	27268847	+	Silent	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr16:27268847G>A	ENST00000361439.4	-	2	144	c.45C>T	c.(43-45)caC>caT	p.H15H		NM_145080.3	NP_659547.2	Q8WV22	NSE1_HUMAN	non-SMC element 1 homolog (S. cerevisiae)	15	Interaction with NDNL2.				DNA recombination (GO:0006310)|DNA repair (GO:0006281)|intracellular signal transduction (GO:0035556)|positive regulation of response to DNA damage stimulus (GO:2001022)|protein ubiquitination (GO:0016567)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|Smc5-Smc6 complex (GO:0030915)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(3)	7						GGAAGCGCCGGTGGACATCAG	0.542																																																	0													89.0	94.0	92.0					16																	27268847		2119	4227	6346	SO:0001819	synonymous_variant	0			AF161451	CCDS10628.2	16p12.1	2010-03-23	2006-07-05		ENSG00000169189	ENSG00000169189			29897	protein-coding gene	gene with protein product						11927594	Standard	XM_005255163		Approved	NSE1	uc002doi.1	Q8WV22	OTTHUMG00000131674	ENST00000361439.4:c.45C>T	16.37:g.27268847G>A			D3DWF6|Q9P045|Q9P049	Silent	SNP	pfam_Nse1,pfam_Znf_RING-like,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Znf_RING	p.H15	ENST00000361439.4	37	c.45	CCDS10628.2	16																																																																																			NSMCE1	-	pfam_Nse1	ENSG00000169189		0.542	NSMCE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSMCE1	HGNC	protein_coding	OTTHUMT00000254577.3		0.00	29	0	G	NM_145080		27268847	-1			no_errors	ENST00000361439	ensembl	human	known	74_37	silent	12.00	22	3	SNP	1.000	A
LINC01378	103689918	genome.wustl.edu	37	4	118496828	118496828	+	lincRNA	SNP	T	T	C			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr4:118496828T>C	ENST00000422145.3	+	0	159				NT5C3AP1_ENST00000441170.1_RNA																							CATATAAGGGTACTTCTCTTC	0.333																																																	0																																												0																															4.37:g.118496828T>C				RNA	SNP	-	NULL	ENST00000422145.3	37	NULL		4																																																																																			NT5C3AP1	-	-	ENSG00000213492		0.333	AC092661.1-002	KNOWN	basic	lincRNA	NT5C3AP1	HGNC	lincRNA	OTTHUMT00000291362.3	-	0.00	36	0	T			118496828	-1	tier1	-	no_errors	ENST00000441170	ensembl	human	known	74_37	rna	60.00	6	9	SNP	1.000	C
NUGGC	389643	genome.wustl.edu	37	8	27888775	27888776	+	Frame_Shift_Ins	INS	-	-	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr8:27888775_27888776insT	ENST00000413272.2	-	15	2034_2035	c.1892_1893insA	c.(1891-1893)aatfs	p.N631fs	NUGGC_ENST00000341513.6_Frame_Shift_Ins_p.N631fs	NM_001010906.1	NP_001010906.1	Q68CJ6	SLIP_HUMAN	nuclear GTPase, germinal center associated	631					cellular response to DNA damage stimulus (GO:0006974)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)										GGATCAGGAAATTTTTTTTGCA	0.455																																																	0																																										SO:0001589	frameshift_variant	0			AB075870	CCDS47833.1	8p21.1	2012-06-07	2012-06-07	2012-06-07	ENSG00000189233	ENSG00000189233			33550	protein-coding gene	gene with protein product	"""speckled-like pattern in the germinal center"""		"""chromosome 8 open reading frame 80"""	C8orf80		19734146	Standard	NM_001010906		Approved	HMFN0672, SLIP-GC	uc003xgm.4	Q68CJ6	OTTHUMG00000155970	ENST00000413272.2:c.1893dupA	8.37:g.27888783_27888783dupT	ENSP00000408697:p.Asn631fs		Q6ZP73	Frame_Shift_Ins	INS	pfam_Dynamin_GTPase,superfamily_P-loop_NTPase	p.N631fs	ENST00000413272.2	37	c.1893_1892	CCDS47833.1	8																																																																																			NUGGC	-	NULL	ENSG00000189233		0.455	NUGGC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NUGGC	HGNC	protein_coding	OTTHUMT00000342494.1		0.00	53	0	-	NM_001010906		27888776	-1	tier1		no_errors	ENST00000341513	ensembl	human	known	74_37	frame_shift_ins	5.41	35	2	INS	0.130:0.005	T
NUP153	9972	genome.wustl.edu	37	6	17629455	17629455	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr6:17629455G>T	ENST00000262077.2	-	18	2974	c.2975C>A	c.(2974-2976)cCa>cAa	p.P992Q	NUP153_ENST00000537253.1_Missense_Mutation_p.P1023Q	NM_005124.2	NP_005115.2	P49790	NU153_HUMAN	nucleoporin 153kDa	992					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of RNA export from nucleus (GO:0046832)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleocytoplasmic transporter activity (GO:0005487)|protein anchor (GO:0043495)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			NS(2)|breast(6)|endometrium(4)|kidney(3)|large_intestine(7)|lung(23)|ovary(3)|skin(3)|urinary_tract(2)	53	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			TAAAGAAACTGGGTTGCTTAA	0.348																																																	0													46.0	50.0	48.0					6																	17629455		2201	4298	6499	SO:0001583	missense	0			Z25535	CCDS4541.1, CCDS64359.1, CCDS75407.1	6p22.3	2008-07-29	2002-08-29		ENSG00000124789	ENSG00000124789			8062	protein-coding gene	gene with protein product		603948	"""nucleoporin 153kD"""			8110839	Standard	NM_001278209		Approved	HNUP153	uc003ncd.2	P49790	OTTHUMG00000014312	ENST00000262077.2:c.2975C>A	6.37:g.17629455G>T	ENSP00000262077:p.Pro992Gln		B4DIK2|E7EPX5|F6QR24|Q4LE47|Q5T9I7|Q7Z743	Missense_Mutation	SNP	pfam_Nucleoporin_Nup153,pfam_Znf_RanBP2,pfam_Retro-transposon_transp_CS,smart_Znf_RanBP2,pfscan_Znf_RanBP2	p.P1023Q	ENST00000262077.2	37	c.3068	CCDS4541.1	6	.	.	.	.	.	.	.	.	.	.	G	10.37	1.332608	0.24167	.	.	ENSG00000124789	ENST00000262077;ENST00000430136;ENST00000537253	T;T	0.06371	3.32;3.31	5.75	5.75	0.90469	.	0.272597	0.26183	N	0.025845	T	0.02970	0.0088	L	0.40543	1.245	0.32652	N	0.519259	B;B;B	0.24963	0.101;0.115;0.051	B;B;B	0.26770	0.073;0.043;0.027	T	0.39187	-0.9626	10	0.30854	T	0.27	-5.4574	13.9759	0.64273	0.0:0.0:0.7332:0.2668	.	1023;972;992	F6QR24;Q4LE47;P49790	.;.;NU153_HUMAN	Q	992;972;1023	ENSP00000262077:P992Q;ENSP00000444029:P1023Q	ENSP00000262077:P992Q	P	-	2	0	NUP153	17737434	0.996000	0.38824	0.905000	0.35620	0.996000	0.88848	2.398000	0.44486	2.719000	0.93026	0.655000	0.94253	CCA	NUP153	-	NULL	ENSG00000124789		0.348	NUP153-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP153	HGNC	protein_coding	OTTHUMT00000039953.1	-	0.00	79	0	G			17629455	-1	tier1	-	no_errors	ENST00000537253	ensembl	human	known	74_37	missense	57.89	40	55	SNP	0.907	T
NXPE3	91775	genome.wustl.edu	37	3	101520401	101520401	+	Missense_Mutation	SNP	A	A	G			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr3:101520401A>G	ENST00000491511.2	+	5	1372	c.416A>G	c.(415-417)tAt>tGt	p.Y139C	NXPE3_ENST00000273347.5_Missense_Mutation_p.Y139C|NXPE3_ENST00000477909.1_Missense_Mutation_p.Y139C|NXPE3_ENST00000422132.1_Missense_Mutation_p.Y139C	NM_001134456.1	NP_001127928.1	Q969Y0	NXPE3_HUMAN	neurexophilin and PC-esterase domain family, member 3	139						extracellular region (GO:0005576)											CCCAAGAAGTATGGTGGAGAC	0.502																																																	0													87.0	89.0	88.0					3																	101520401		2203	4300	6503	SO:0001583	missense	0			AK054664	CCDS2945.1	3q12.3	2012-06-14	2012-06-11	2012-06-11	ENSG00000144815	ENSG00000144815			28238	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member C"""	FAM55C		12975309	Standard	NM_001134456		Approved	MGC15606	uc003dvn.3	Q969Y0	OTTHUMG00000159179	ENST00000491511.2:c.416A>G	3.37:g.101520401A>G	ENSP00000417485:p.Tyr139Cys		A8K0X4|D3DN53|Q7Z2S8	Missense_Mutation	SNP	pfam_NXPH/NXPE,superfamily_Ig_E-set	p.Y139C	ENST00000491511.2	37	c.416	CCDS2945.1	3	.	.	.	.	.	.	.	.	.	.	A	17.14	3.313276	0.60414	.	.	ENSG00000144815	ENST00000273347;ENST00000491511;ENST00000477909;ENST00000422132	T;T;T;T	0.15017	2.46;2.46;2.46;2.46	5.97	4.82	0.62117	Immunoglobulin E-set (1);	0.158965	0.64402	N	0.000017	T	0.33381	0.0861	M	0.88512	2.96	0.52501	D	0.999959	P	0.35745	0.518	B	0.42653	0.394	T	0.10894	-1.0610	10	0.44086	T	0.13	-14.8278	12.2461	0.54571	0.9339:0.0:0.0661:0.0	.	139	Q969Y0	FA55C_HUMAN	C	139	ENSP00000273347:Y139C;ENSP00000417485:Y139C;ENSP00000418369:Y139C;ENSP00000396421:Y139C	ENSP00000273347:Y139C	Y	+	2	0	FAM55C	103003091	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.444000	0.80532	1.084000	0.41184	-0.264000	0.10439	TAT	NXPE3	-	pfam_NXPH/NXPE,superfamily_Ig_E-set	ENSG00000144815		0.502	NXPE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NXPE3	HGNC	protein_coding	OTTHUMT00000353711.2	-	0.00	36	0	A	NM_145037		101520401	+1	tier1	-	no_errors	ENST00000273347	ensembl	human	known	74_37	missense	38.89	11	7	SNP	1.000	G
OBSCN	84033	genome.wustl.edu	37	1	228476026	228476026	+	Splice_Site	SNP	G	G	A	rs111643598		TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr1:228476026G>A	ENST00000422127.1	+	37	10119		c.e37+1		OBSCN_ENST00000366709.4_Splice_Site|OBSCN_ENST00000284548.11_Splice_Site|OBSCN_ENST00000366707.4_Splice_Site|OBSCN_ENST00000359599.6_Splice_Site|OBSCN_ENST00000570156.2_Splice_Site	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF						apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				ACCATCAGGCGTAAGACCGTG	0.567													G|||	1	0.000199681	0.0	0.0	5008	,	,		20802	0.0		0.0	False		,,,				2504	0.001																0													70.0	73.0	72.0					1																	228476026		2141	4248	6389	SO:0001630	splice_region_variant	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.10075+1G>A	1.37:g.228476026G>A			Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Splice_Site	SNP	-	e36+1	ENST00000422127.1	37	c.10075+1	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	G	13.41	2.228341	0.39399	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709;ENST00000359599	.	.	.	4.9	4.9	0.64082	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2697	0.90064	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	OBSCN	226542649	1.000000	0.71417	0.999000	0.59377	0.047000	0.14425	8.914000	0.92735	2.571000	0.86741	0.561000	0.74099	.	OBSCN	-	-	ENSG00000154358		0.567	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		-	0.00	42	0	G	NM_052843	Intron	228476026	+1	tier1	-	no_errors	ENST00000422127	ensembl	human	known	74_37	splice_site	65.71	12	23	SNP	1.000	A
OR10A5	144124	genome.wustl.edu	37	11	6867574	6867574	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr11:6867574C>G	ENST00000299454.4	+	1	692	c.661C>G	c.(661-663)Cgc>Ggc	p.R221G	OR10A5_ENST00000379831.2_Missense_Mutation_p.R225G			Q9H207	O10A5_HUMAN	olfactory receptor, family 10, subfamily A, member 5	221					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(1)|skin(2)|urinary_tract(2)	21		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TTCCTATACTCGCATTGCTGC	0.488																																					Pancreas(44;21 1072 25662 28041 45559)												0													287.0	233.0	251.0					11																	6867574		2201	4296	6497	SO:0001583	missense	0			AF324499	CCDS7773.1	11p15.4	2012-08-09			ENSG00000166363	ENSG00000166363		"""GPCR / Class A : Olfactory receptors"""	15131	protein-coding gene	gene with protein product		608493		OR10A1			Standard	NM_178168		Approved	OR11-403, JCG6	uc001met.1	Q9H207	OTTHUMG00000165738	ENST00000299454.4:c.661C>G	11.37:g.6867574C>G	ENSP00000299454:p.Arg221Gly		O95223|Q52M66|Q96R21|Q96R22	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R225G	ENST00000299454.4	37	c.673	CCDS7773.1	11	.	.	.	.	.	.	.	.	.	.	.	10.71	1.427460	0.25726	.	.	ENSG00000166363	ENST00000299454;ENST00000379831	T;T	0.00123	8.7;8.7	3.59	-0.582	0.11709	GPCR, rhodopsin-like superfamily (1);	0.329401	0.26650	N	0.023209	T	0.00241	0.0007	L	0.55017	1.72	0.09310	N	1	P	0.38992	0.653	P	0.52481	0.7	T	0.34204	-0.9838	10	0.42905	T	0.14	.	8.414	0.32659	0.0:0.6463:0.0:0.3537	.	221	Q9H207	O10A5_HUMAN	G	221;225	ENSP00000299454:R221G;ENSP00000369159:R225G	ENSP00000299454:R221G	R	+	1	0	OR10A5	6824150	0.000000	0.05858	0.002000	0.10522	0.391000	0.30476	-0.136000	0.10405	-0.102000	0.12197	0.591000	0.81541	CGC	OR10A5	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000166363		0.488	OR10A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10A5	HGNC	protein_coding	OTTHUMT00000385983.1	-	0.00	59	0	C	NM_178168		6867574	+1	tier1	-	no_errors	ENST00000379831	ensembl	human	known	74_37	missense	18.18	27	6	SNP	0.001	G
OR10A2	341276	genome.wustl.edu	37	11	6891832	6891832	+	Nonsense_Mutation	SNP	G	G	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr11:6891832G>T	ENST00000307322.4	+	1	909	c.847G>T	c.(847-849)Gag>Tag	p.E283*		NM_001004460.1	NP_001004460.1	Q9H208	O10A2_HUMAN	olfactory receptor, family 10, subfamily A, member 2	283						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E283K(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(12)|urinary_tract(1)	24		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.89e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		GAGAAATAACGAGGTGAAGAA	0.448																																																	1	Substitution - Missense(1)	endometrium(1)											110.0	106.0	107.0					11																	6891832		2201	4296	6497	SO:0001587	stop_gained	0			BK004293	CCDS31415.1	11p15.4	2012-08-09		2004-03-10	ENSG00000170790	ENSG00000170790		"""GPCR / Class A : Olfactory receptors"""	8161	protein-coding gene	gene with protein product				OR10A2P			Standard	NM_001004460		Approved	OST363	uc001meu.1	Q9H208	OTTHUMG00000165739	ENST00000307322.4:c.847G>T	11.37:g.6891832G>T	ENSP00000303862:p.Glu283*		B2RNL9|Q6IFG9	Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.E283*	ENST00000307322.4	37	c.847	CCDS31415.1	11	.	.	.	.	.	.	.	.	.	.	g	13.54	2.267184	0.40095	.	.	ENSG00000170790	ENST00000307322	.	.	.	4.18	4.18	0.49190	.	0.103576	0.42682	D	0.000664	.	.	.	.	.	.	0.58432	D	0.999992	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	10.341	0.43877	0.0:0.2003:0.7997:0.0	.	.	.	.	X	283	.	ENSP00000303862:E283X	E	+	1	0	OR10A2	6848408	1.000000	0.71417	0.991000	0.47740	0.158000	0.22134	5.426000	0.66476	2.356000	0.79943	0.650000	0.86243	GAG	OR10A2	-	prints_GPCR_Rhodpsn	ENSG00000170790		0.448	OR10A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10A2	HGNC	protein_coding	OTTHUMT00000385984.1		0.00	50	0	G	NM_001004460		6891832	+1			no_errors	ENST00000307322	ensembl	human	known	74_37	nonsense	8.70	21	2	SNP	0.999	T
OR10J5	127385	genome.wustl.edu	37	1	159505479	159505479	+	Silent	SNP	A	A	G			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr1:159505479A>G	ENST00000334857.2	-	1	363	c.319T>C	c.(319-321)Ttg>Ctg	p.L107L		NM_001004469.1	NP_001004469.1	Q8NHC4	O10J5_HUMAN	olfactory receptor, family 10, subfamily J, member 5	107						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	22	all_hematologic(112;0.0429)					TTAGTGGCCAAGATAACAAAA	0.458																																																	0													121.0	106.0	112.0					1																	159505479		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS30910.1	1q23.2	2012-08-09			ENSG00000184155	ENSG00000184155		"""GPCR / Class A : Olfactory receptors"""	14993	protein-coding gene	gene with protein product							Standard	NM_001004469		Approved		uc010piw.2	Q8NHC4	OTTHUMG00000022738	ENST00000334857.2:c.319T>C	1.37:g.159505479A>G			B9EH35|Q6IFH2	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L107	ENST00000334857.2	37	c.319	CCDS30910.1	1																																																																																			OR10J5	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000184155		0.458	OR10J5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10J5	HGNC	protein_coding	OTTHUMT00000059021.1	-	0.00	57	0	A	NM_001004469		159505479	-1	tier1	-	no_errors	ENST00000334857	ensembl	human	known	74_37	silent	24.62	49	16	SNP	0.476	G
OR52L1	338751	genome.wustl.edu	37	11	6007249	6007249	+	Silent	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr11:6007249C>T	ENST00000332249.4	-	1	966	c.912G>A	c.(910-912)gcG>gcA	p.A304A		NM_001005173.2	NP_001005173.2	Q8NGH7	O52L1_HUMAN	olfactory receptor, family 52, subfamily L, member 1	304						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A289A(2)|p.A304A(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(11)|pancreas(1)|skin(3)|soft_tissue(1)	30		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.98e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GAGGATTGAGCGCAGGTGGCA	0.473																																					Melanoma(121;653 1666 10547 22796 51255)												3	Substitution - coding silent(3)	endometrium(2)|large_intestine(1)											66.0	67.0	67.0					11																	6007249		2073	4230	6303	SO:0001819	synonymous_variant	0			AB065819	CCDS44529.1	11p15.4	2012-08-09			ENSG00000183313	ENSG00000183313		"""GPCR / Class A : Olfactory receptors"""	14785	protein-coding gene	gene with protein product							Standard	NM_001005173		Approved		uc001mcd.2	Q8NGH7	OTTHUMG00000165374	ENST00000332249.4:c.912G>A	11.37:g.6007249C>T			B2RPA6|Q6IFK9	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A304	ENST00000332249.4	37	c.912	CCDS44529.1	11																																																																																			OR52L1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	ENSG00000183313		0.473	OR52L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52L1	HGNC	protein_coding	OTTHUMT00000383754.1	-	0.00	61	0	C	NM_001005173		6007249	-1	tier1	-	no_errors	ENST00000332249	ensembl	human	known	74_37	silent	21.28	37	10	SNP	0.004	T
OR6C76	390326	genome.wustl.edu	37	12	55820661	55820661	+	Missense_Mutation	SNP	G	G	C			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr12:55820661G>C	ENST00000328314.3	+	1	624	c.624G>C	c.(622-624)ttG>ttC	p.L208F		NM_001005183.1	NP_001005183.1	A6NM76	O6C76_HUMAN	olfactory receptor, family 6, subfamily C, member 76	208						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						TATCCACTTTGATATTAGTAA	0.398																																																	0													94.0	86.0	89.0					12																	55820661		2203	4299	6502	SO:0001583	missense	0				CCDS31823.1	12q13.2	2013-09-23			ENSG00000185821	ENSG00000185821		"""GPCR / Class A : Olfactory receptors"""	31305	protein-coding gene	gene with protein product							Standard	NM_001005183		Approved		uc010spm.2	A6NM76	OTTHUMG00000169956	ENST00000328314.3:c.624G>C	12.37:g.55820661G>C	ENSP00000328402:p.Leu208Phe			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L208F	ENST00000328314.3	37	c.624	CCDS31823.1	12	.	.	.	.	.	.	.	.	.	.	g	6.326	0.428272	0.11987	.	.	ENSG00000185821	ENST00000328314	T	0.40476	1.03	4.02	-1.78	0.07957	GPCR, rhodopsin-like superfamily (1);	0.306260	0.17406	U	0.175375	T	0.30230	0.0758	L	0.27053	0.805	0.09310	N	1	P	0.43909	0.821	P	0.49252	0.604	T	0.17319	-1.0373	10	0.72032	D	0.01	.	2.2476	0.04035	0.1564:0.1118:0.3656:0.3662	.	208	A6NM76	O6C76_HUMAN	F	208	ENSP00000328402:L208F	ENSP00000328402:L208F	L	+	3	2	OR6C76	54106928	0.000000	0.05858	0.001000	0.08648	0.048000	0.14542	-2.286000	0.01152	-0.194000	0.10399	-0.319000	0.08680	TTG	OR6C76	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000185821		0.398	OR6C76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6C76	HGNC	protein_coding	OTTHUMT00000406675.1	-	0.00	39	0	G	NM_001005183		55820661	+1	tier1	-	no_errors	ENST00000328314	ensembl	human	known	74_37	missense	32.26	21	10	SNP	0.000	C
OS9	10956	genome.wustl.edu	37	12	58114597	58114597	+	Missense_Mutation	SNP	C	C	T	rs369079310		TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr12:58114597C>T	ENST00000315970.7	+	15	1950	c.1909C>T	c.(1909-1911)Cgc>Tgc	p.R637C	OS9_ENST00000439210.2_Missense_Mutation_p.R508C|OS9_ENST00000257966.8_Missense_Mutation_p.R583C|RP11-571M6.7_ENST00000549477.1_RNA|OS9_ENST00000552285.1_Missense_Mutation_p.R582C|OS9_ENST00000551035.1_Missense_Mutation_p.R550C|OS9_ENST00000413095.2_Missense_Mutation_p.R376C|RP11-571M6.8_ENST00000548410.2_RNA|OS9_ENST00000389142.5_Missense_Mutation_p.R567C|OS9_ENST00000389146.6_Missense_Mutation_p.R622C|OS9_ENST00000435406.2_Missense_Mutation_p.R530C	NM_001017958.2|NM_006812.3	NP_001017958.1|NP_006803.1	Q13438	OS9_HUMAN	osteosarcoma amplified 9, endoplasmic reticulum lectin	637					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein retention in ER lumen (GO:0006621)|protein targeting (GO:0006605)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum lumen (GO:0005788)|Hrd1p ubiquitin ligase complex (GO:0000836)	carbohydrate binding (GO:0030246)|glycoprotein binding (GO:0001948)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	21	all_neural(12;0.00548)|Glioma(12;0.0126)|Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			CCAGAAGGAACGCCAGCGGCA	0.642																																																	0								C	CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	58.0	58.0	58.0		1744,1699,1864,1909	5.3	1.0	12		58	0,8600		0,0,4300	no	missense,missense,missense,missense	OS9	NM_001017956.2,NM_001017957.2,NM_001017958.2,NM_006812.3	180,180,180,180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging	582/613,567/598,622/653,637/668	58114597	1,13005	2203	4300	6503	SO:0001583	missense	0			AB002806	CCDS31843.1, CCDS31844.1, CCDS31845.1, CCDS31846.1, CCDS58246.1, CCDS58247.1, CCDS58248.1, CCDS58249.1	12q13	2009-08-26	2009-08-26						16994	protein-coding gene	gene with protein product	"""endoplasmic reticulum lectin 2"", ""erlectin 2"""	609677				8634085, 9498564, 19346256, 18264092	Standard	NM_006812		Approved	OS-9, ERLEC2	uc001spj.3	Q13438	OTTHUMG00000170284	ENST00000315970.7:c.1909C>T	12.37:g.58114597C>T	ENSP00000318165:p.Arg637Cys		A6NDD1|A6NFR7|A6NLB2|A8K5Q9|B4DE28|B4DPX1|B4E1I6|E7ENT8|E7EW91|F8VUH2|G3XA88|O00579|Q6IBL2|Q8IZ58|Q9BW99	Missense_Mutation	SNP	pfam_PRKCSH,superfamily_Man6P_isomerase_rcpt-bd_dom	p.R637C	ENST00000315970.7	37	c.1909	CCDS31843.1	12	.	.	.	.	.	.	.	.	.	.	C	23.6	4.438585	0.83885	2.27E-4	0.0	ENSG00000135506	ENST00000552285;ENST00000315970;ENST00000439210;ENST00000389146;ENST00000413095;ENST00000551035;ENST00000257966;ENST00000435406;ENST00000389142	T;T;T;T;T;T;T;T;T	0.35789	1.77;1.78;1.78;1.77;1.29;1.77;1.77;1.77;1.7	5.29	5.29	0.74685	.	0.118611	0.56097	D	0.000023	T	0.47911	0.1471	L	0.27053	0.805	0.58432	D	0.999997	D;D;D;D;D;D;D;D	0.89917	1.0;0.999;0.999;1.0;0.999;1.0;1.0;1.0	P;P;P;D;P;D;D;D	0.77557	0.818;0.83;0.897;0.99;0.68;0.968;0.987;0.976	T	0.48937	-0.8990	10	0.87932	D	0	.	15.9613	0.79933	0.0:1.0:0.0:0.0	.	508;550;376;583;567;582;622;637	E7EW91;F8VUH2;B4E321;G3XA88;E9PEY5;Q9BW99;A6NLB2;Q13438	.;.;.;.;.;.;.;OS9_HUMAN	C	582;637;508;622;376;550;583;530;567	ENSP00000450010:R582C;ENSP00000318165:R637C;ENSP00000407360:R508C;ENSP00000373798:R622C;ENSP00000413112:R376C;ENSP00000447866:R550C;ENSP00000257966:R583C;ENSP00000389632:R530C;ENSP00000373794:R567C	ENSP00000257966:R583C	R	+	1	0	OS9	56400864	0.999000	0.42202	0.997000	0.53966	0.711000	0.40976	4.676000	0.61627	2.744000	0.94065	0.655000	0.94253	CGC	OS9	-	NULL	ENSG00000135506		0.642	OS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OS9	HGNC	protein_coding	OTTHUMT00000408344.1	-	0.00	30	0	C	NM_006812		58114597	+1	tier1	-	no_errors	ENST00000315970	ensembl	human	known	74_37	missense	23.53	26	8	SNP	0.999	T
PARD6A	50855	genome.wustl.edu	37	16	67695843	67695843	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr16:67695843C>T	ENST00000219255.3	+	3	414	c.334C>T	c.(334-336)Cgg>Tgg	p.R112W	ENKD1_ENST00000602409.1_5'Flank|PARD6A_ENST00000602551.1_Missense_Mutation_p.R82W|ACD_ENST00000393919.4_5'Flank|PARD6A_ENST00000458121.2_Missense_Mutation_p.R111W|ACD_ENST00000219251.8_5'Flank			Q9NPB6	PAR6A_HUMAN	par-6 family cell polarity regulator alpha	112	Interaction with PRKCI and PRKCZ.				cell cycle (GO:0007049)|cell division (GO:0051301)|cell junction assembly (GO:0034329)|cell-cell junction maintenance (GO:0045217)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|cell projection (GO:0042995)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)	GTP-dependent protein binding (GO:0030742)|Rho GTPase binding (GO:0017048)|transcription factor binding (GO:0008134)			central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)|urinary_tract(2)	6		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.047)|all cancers(182;0.228)		CTCTCTGCAGCGGCGCAAGAA	0.622																																																	0													53.0	57.0	56.0					16																	67695843		2198	4300	6498	SO:0001583	missense	0				CCDS10843.1, CCDS45514.1	16q22.1-q22.3	2013-08-28	2013-08-28		ENSG00000102981	ENSG00000102981			15943	protein-coding gene	gene with protein product		607484	"""par-6 (partitioning defective 6, C.elegans) homolog alpha"", ""par-6 partitioning defective 6 homolog alpha (C. elegans)"""			9482110, 11260256	Standard	XM_005255977		Approved	PAR-6, PAR-6A, TAX40, PAR6alpha, TIP-40	uc002ett.3	Q9NPB6	OTTHUMG00000137534	ENST00000219255.3:c.334C>T	16.37:g.67695843C>T	ENSP00000219255:p.Arg112Trp		O14911|Q9NPJ7	Missense_Mutation	SNP	pfam_OPR_PB1,pfam_PDZ,superfamily_PDZ,smart_OPR_PB1,smart_PDZ,pfscan_PDZ	p.R112W	ENST00000219255.3	37	c.334	CCDS10843.1	16	.	.	.	.	.	.	.	.	.	.	C	17.86	3.492417	0.64074	.	.	ENSG00000102981	ENST00000458121;ENST00000219255	T;T	0.46063	0.88;0.9	5.42	4.44	0.53790	.	0.000000	0.85682	D	0.000000	T	0.65852	0.2731	M	0.79693	2.465	0.51233	D	0.999913	D;D	0.89917	1.0;1.0	D;D	0.83275	0.973;0.996	T	0.71364	-0.4615	10	0.87932	D	0	-12.9227	13.987	0.64341	0.1579:0.8421:0.0:0.0	.	112;111	Q9NPB6;Q9NPB6-2	PAR6A_HUMAN;.	W	111;112	ENSP00000392388:R111W;ENSP00000219255:R112W	ENSP00000219255:R112W	R	+	1	2	PARD6A	66253344	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	1.794000	0.38774	1.219000	0.43474	0.563000	0.77884	CGG	PARD6A	-	NULL	ENSG00000102981		0.622	PARD6A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PARD6A	HGNC	protein_coding	OTTHUMT00000268863.2		0.00	10	0	C	NM_016948		67695843	+1			no_errors	ENST00000219255	ensembl	human	known	74_37	missense	16.00	21	4	SNP	1.000	T
PCDHB18	54660	genome.wustl.edu	37	5	140614307	140614307	+	RNA	DEL	G	G	-	rs184425682	byFrequency	TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr5:140614307delG	ENST00000526308.1	+	0	370					NR_001281.1		Q96TA0	PCDBI_HUMAN	protocadherin beta 18 pseudogene						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|lung(7)|ovary(1)|urinary_tract(1)	18						CTGGCTGCAAGGGGGGGCCAG	0.517																																																	0																																												0			AF152528		5q31.3	2014-03-20			ENSG00000146001	ENSG00000146001		"""Cadherins / Protocadherins : Clustered"""	14548	pseudogene	pseudogene						10380929	Standard	NR_001281		Approved	PCDH-psi2	uc003ljc.1	Q96TA0	OTTHUMG00000167484		5.37:g.140614307delG			B3KTF8	RNA	DEL	-	NULL	ENST00000526308.1	37	NULL		5																																																																																			PCDHB18	-	-	ENSG00000146001		0.517	PCDHB18-002	KNOWN	basic	processed_transcript	PCDHB18	HGNC	pseudogene	OTTHUMT00000394776.1		0.00	59	0	G			140614307	+1	tier1		no_errors	ENST00000526308	ensembl	human	known	74_37	rna	5.13	37	2	DEL	0.001	-
PDE4DIP	9659	genome.wustl.edu	37	1	145039774	145039774	+	5'UTR	DEL	T	T	-			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr1:145039774delT	ENST00000313382.9	-	0	228				PDE4DIP_ENST00000369348.3_Intron|PDE4DIP_ENST00000493130.2_5'Flank|PDE4DIP_ENST00000530740.1_Intron|PDE4DIP_ENST00000478649.2_5'UTR|PDE4DIP_ENST00000369359.4_Intron	NM_001198832.1	NP_001185761	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein						cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TGCTCCCTGCTTTTTTAGAAA	0.587			T	PDGFRB	MPD																																			Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0																																										SO:0001623	5_prime_UTR_variant	0			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000313382.9:c.-165A>-	1.37:g.145039774delT			A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	RNA	DEL	-	NULL	ENST00000313382.9	37	NULL	CCDS55628.1	1																																																																																			PDE4DIP	-	-	ENSG00000178104		0.587	PDE4DIP-001	KNOWN	basic|CCDS	protein_coding	PDE4DIP	HGNC	protein_coding	OTTHUMT00000038856.2		0.00	34	0	T	NM_022359		145039774	-1	tier1		no_errors	ENST00000485062	ensembl	human	known	74_37	rna	6.25	30	2	DEL	0.055	-
PDGFC	56034	genome.wustl.edu	37	4	157684249	157684249	+	Frame_Shift_Del	DEL	C	C	-			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr4:157684249delC	ENST00000502773.1	-	6	1521	c.1031delG	c.(1030-1032)ggafs	p.G345fs	PDGFC_ENST00000541126.1_Frame_Shift_Del_p.G182fs|PDGFC_ENST00000422544.2_Frame_Shift_Del_p.G282fs|PDGFC_ENST00000504672.1_5'UTR|PDGFC_ENST00000542208.1_Frame_Shift_Del_p.G190fs	NM_016205.2	NP_057289.1	Q9NRA1	PDGFC_HUMAN	platelet derived growth factor C	345					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cellular response to amino acid stimulus (GO:0071230)|central nervous system development (GO:0007417)|organ morphogenesis (GO:0009887)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell division (GO:0051781)|positive regulation of DNA replication (GO:0045740)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.08)|Kidney(143;0.0977)|COAD - Colon adenocarcinoma(41;0.212)		CGGCTATCCTCCTGTGCTCCC	0.537																																																	0													126.0	95.0	105.0					4																	157684249		2203	4300	6503	SO:0001589	frameshift_variant	0			AF091434	CCDS3795.1	4q32	2008-02-05			ENSG00000145431	ENSG00000145431			8801	protein-coding gene	gene with protein product		608452				10858496, 10858548	Standard	NM_016205		Approved	SCDGF, fallotein	uc003iph.2	Q9NRA1	OTTHUMG00000161803	ENST00000502773.1:c.1031delG	4.37:g.157684249delC	ENSP00000422464:p.Gly345fs		B4DU34|B9EGR8|Q4W5M9|Q9UL22	Frame_Shift_Del	DEL	pfam_CUB_dom,pfam_PDGF/VEGF_dom,superfamily_CUB_dom,smart_CUB_dom,smart_PDGF/VEGF_dom,pfscan_CUB_dom,pfscan_PDGF/VEGF_dom	p.G344fs	ENST00000502773.1	37	c.1031	CCDS3795.1	4																																																																																			PDGFC	-	NULL	ENSG00000145431		0.537	PDGFC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDGFC	HGNC	protein_coding	OTTHUMT00000366123.1		0.00	39	0	C			157684249	-1	tier1		no_errors	ENST00000502773	ensembl	human	known	74_37	frame_shift_del	26.09	17	6	DEL	1.000	-
PDS5A	23244	genome.wustl.edu	37	4	39871028	39871028	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr4:39871028C>T	ENST00000303538.8	-	22	3030	c.2491G>A	c.(2491-2493)Gaa>Aaa	p.E831K		NM_001100399.1	NP_001093869.1			PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae)											breast(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(9)|lung(14)|prostate(3)|skin(1)|urinary_tract(1)	39						GCTAGTACTTCAGGGGAAACC	0.303																																																	0													169.0	162.0	164.0					4																	39871028		1822	4082	5904	SO:0001583	missense	0			AF294791	CCDS47045.1, CCDS54759.1	4p14	2007-06-20			ENSG00000121892	ENSG00000121892			29088	protein-coding gene	gene with protein product		613200				11076961, 15855230	Standard	NM_001100399		Approved	KIAA0648, PIG54, SCC-112	uc003guv.4	Q29RF7	OTTHUMG00000160582	ENST00000303538.8:c.2491G>A	4.37:g.39871028C>T	ENSP00000303427:p.Glu831Lys			Missense_Mutation	SNP	superfamily_ARM-type_fold	p.E831K	ENST00000303538.8	37	c.2491	CCDS47045.1	4	.	.	.	.	.	.	.	.	.	.	C	35	5.453741	0.96223	.	.	ENSG00000121892	ENST00000303538	.	.	.	5.5	5.5	0.81552	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.76471	0.3992	M	0.72894	2.215	0.80722	D	1	D	0.54772	0.968	P	0.59221	0.854	T	0.75886	-0.3159	8	.	.	.	-20.9183	19.3844	0.94551	0.0:1.0:0.0:0.0	.	831	Q29RF7	PDS5A_HUMAN	K	831	.	.	E	-	1	0	PDS5A	39547423	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.693000	0.84214	2.579000	0.87056	0.655000	0.94253	GAA	PDS5A	-	superfamily_ARM-type_fold	ENSG00000121892		0.303	PDS5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDS5A	HGNC	protein_coding	OTTHUMT00000361287.1	-	0.00	133	0	C	NM_015200		39871028	-1	tier1	-	no_errors	ENST00000303538	ensembl	human	known	74_37	missense	6.17	76	5	SNP	1.000	T
PDZRN4	29951	genome.wustl.edu	37	12	41871704	41871704	+	Intron	SNP	G	G	C			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr12:41871704G>C	ENST00000402685.2	+	4	851				PDZRN4_ENST00000298919.7_Missense_Mutation_p.L15F|PDZRN4_ENST00000539469.2_Intron	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4								ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				TGGCATTGTTGACATGTTGGC	0.308																																																	0													12.0	12.0	12.0					12																	41871704		876	1987	2863	SO:0001627	intron_variant	0			AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.844-28554G>C	12.37:g.41871704G>C			Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.L15F	ENST00000402685.2	37	c.45	CCDS53777.1	12	.	.	.	.	.	.	.	.	.	.	G	9.707	1.156113	0.21454	.	.	ENSG00000165966	ENST00000298919	T	0.04317	3.65	4.37	3.48	0.39840	.	.	.	.	.	T	0.05547	0.0146	.	.	.	0.18873	N	0.999988	B	0.34264	0.446	B	0.34452	0.183	T	0.32214	-0.9915	8	0.56958	D	0.05	.	10.7404	0.46149	0.0927:0.0:0.9073:0.0	.	15	Q6ZMN7-4	.	F	15	ENSP00000298919:L15F	ENSP00000298919:L15F	L	+	3	2	PDZRN4	40157971	0.996000	0.38824	0.386000	0.26170	0.125000	0.20455	1.771000	0.38542	1.141000	0.42275	0.650000	0.86243	TTG	PDZRN4	-	NULL	ENSG00000165966		0.308	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZRN4	HGNC	protein_coding	OTTHUMT00000403701.1	-	0.00	57	0	G	NM_013377		41871704	+1	tier1	-	no_errors	ENST00000298919	ensembl	human	known	74_37	missense	17.05	73	15	SNP	0.667	C
PHKA1	5255	genome.wustl.edu	37	X	71855004	71855004	+	Splice_Site	SNP	C	C	G			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chrX:71855004C>G	ENST00000373542.4	-	16	1874		c.e16+1		PHKA1_ENST00000541944.1_Splice_Site|PHKA1_ENST00000373539.3_Splice_Site|PHKA1_ENST00000373545.3_Splice_Site|PHKA1_ENST00000339490.3_Splice_Site	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)						carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					GCAGCCCTTACCAAGCATGCT	0.458																																																	0													122.0	98.0	106.0					X																	71855004		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.1714+1G>C	X.37:g.71855004C>G			B7ZL05|B7ZL07|Q2M3D7	Splice_Site	SNP	-	e16+1	ENST00000373542.4	37	c.1714+1	CCDS14421.1	X	.	.	.	.	.	.	.	.	.	.	C	15.28	2.785436	0.49997	.	.	ENSG00000067177	ENST00000373545;ENST00000373542;ENST00000541944;ENST00000339490;ENST00000373539	.	.	.	4.47	4.47	0.54385	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.9669	0.64213	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PHKA1	71771729	1.000000	0.71417	1.000000	0.80357	0.417000	0.31264	7.692000	0.84203	1.956000	0.56807	0.415000	0.27848	.	PHKA1	-	-	ENSG00000067177		0.458	PHKA1-001	KNOWN	basic|CCDS	protein_coding	PHKA1	HGNC	protein_coding	OTTHUMT00000058896.1	-	0.00	40	0	C		Intron	71855004	-1	tier1	-	no_errors	ENST00000373539	ensembl	human	known	74_37	splice_site	26.83	30	11	SNP	1.000	G
PKLR	5313	genome.wustl.edu	37	1	155265486	155265486	+	Silent	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr1:155265486C>T	ENST00000342741.4	-	3	383	c.345G>A	c.(343-345)gcG>gcA	p.A115A	PKLR_ENST00000392414.3_Silent_p.A84A	NM_000298.5	NP_000289.1	P30613	KPYR_HUMAN	pyruvate kinase, liver and RBC	115			A -> P (in PKRD; Val de Marne).		ATP biosynthetic process (GO:0006754)|carbohydrate metabolic process (GO:0005975)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|positive regulation of cellular metabolic process (GO:0031325)|pyruvate biosynthetic process (GO:0042866)|response to ATP (GO:0033198)|response to cAMP (GO:0051591)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to nutrient (GO:0007584)|response to other organism (GO:0051707)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|potassium ion binding (GO:0030955)|pyruvate kinase activity (GO:0004743)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_lung(78;6.99e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;3.18e-10)|all cancers(21;7.9e-10)|BRCA - Breast invasive adenocarcinoma(34;0.00116)|LUSC - Lung squamous cell carcinoma(543;0.127)		Pyruvic acid(DB00119)	AGTTGAGTCGCGCAATGTTCA	0.642																																																	0													115.0	92.0	100.0					1																	155265486		2203	4300	6503	SO:0001819	synonymous_variant	0			BC025737, M15465	CCDS1109.1, CCDS44240.1	1q22	2012-10-02			ENSG00000143627	ENSG00000143627	2.7.1.40		9020	protein-coding gene	gene with protein product		609712				3566732	Standard	NM_000298		Approved		uc001fkb.4	P30613	OTTHUMG00000035875	ENST00000342741.4:c.345G>A	1.37:g.155265486C>T			O75758|P11973	Silent	SNP	pfam_Pyrv_Knase_brl,pfam_Pyrv_Knase_C,superfamily_Pyrv/PenolPyrv_Kinase-like_dom,superfamily_Pyrv_Knase_C,superfamily_Pyrv_Knase-like_insert_dom,prints_Pyr_Knase,tigrfam_Pyr_Knase	p.A115	ENST00000342741.4	37	c.345	CCDS1109.1	1																																																																																			PKLR	-	pfam_Pyrv_Knase_brl,superfamily_Pyrv/PenolPyrv_Kinase-like_dom,tigrfam_Pyr_Knase	ENSG00000143627		0.642	PKLR-001	KNOWN	basic|CCDS	protein_coding	PKLR	HGNC	protein_coding	OTTHUMT00000087407.2	-	0.00	33	0	C	NM_000298		155265486	-1	tier1	-	no_errors	ENST00000342741	ensembl	human	known	74_37	silent	20.00	20	5	SNP	0.915	T
PLCL1	5334	genome.wustl.edu	37	2	198950849	198950849	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr2:198950849C>T	ENST00000428675.1	+	2	3006	c.2608C>T	c.(2608-2610)Cgg>Tgg	p.R870W	PLCL1_ENST00000437704.2_Missense_Mutation_p.R772W	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	870					gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|inositol 1,4,5 trisphosphate binding (GO:0070679)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					Quinacrine(DB01103)	GAAGAAAGTTCGGGAATATAC	0.418																																																	0													94.0	80.0	85.0					2																	198950849		2203	4300	6503	SO:0001583	missense	0			D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896			9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE		7633416	Standard	NM_006226		Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.2608C>T	2.37:g.198950849C>T	ENSP00000402861:p.Arg870Trp		Q3MJ90|Q53SD3|Q7Z3S3	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.R870W	ENST00000428675.1	37	c.2608	CCDS2326.2	2	.	.	.	.	.	.	.	.	.	.	C	14.59	2.580704	0.46006	.	.	ENSG00000115896	ENST00000428675;ENST00000437704	T;T	0.20598	2.06;2.09	5.41	4.47	0.54385	.	0.000000	0.56097	D	0.000023	T	0.44891	0.1315	M	0.83953	2.67	0.58432	D	0.999995	D;D	0.76494	0.999;0.999	D;D	0.65140	0.932;0.932	T	0.39251	-0.9623	9	.	.	.	.	11.384	0.49773	0.3442:0.6558:0.0:0.0	.	870;796	Q15111;B4DYZ4	PLCL1_HUMAN;.	W	870;772	ENSP00000402861:R870W;ENSP00000414138:R772W	.	R	+	1	2	PLCL1	198659094	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.613000	0.46351	2.814000	0.96858	0.591000	0.81541	CGG	PLCL1	-	NULL	ENSG00000115896		0.418	PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCL1	HGNC	protein_coding	OTTHUMT00000340210.1		0.00	29	0	C	NM_006226		198950849	+1			no_errors	ENST00000428675	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	T
PLP1	5354	genome.wustl.edu	37	X	103031855	103031855	+	5'UTR	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chrX:103031855C>T	ENST00000303958.2	+	0	78				PLP1_ENST00000361621.2_5'UTR|PLP1_ENST00000418604.1_5'UTR	NM_000533.3	NP_000524.3	P60201	MYPR_HUMAN	proteolipid protein 1						astrocyte development (GO:0014002)|axon development (GO:0061564)|axon ensheathment (GO:0008366)|cell death (GO:0008219)|cell maturation (GO:0048469)|central nervous system myelination (GO:0022010)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|long-chain fatty acid biosynthetic process (GO:0042759)|positive regulation of gene expression (GO:0010628)|substantia nigra development (GO:0021762)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|plasma membrane (GO:0005886)	structural constituent of myelin sheath (GO:0019911)|structural molecule activity (GO:0005198)			breast(1)|endometrium(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)	17						AGGATCCTTCCAGCTGAACAA	0.453																																																	0													53.0	49.0	50.0					X																	103031855		692	1591	2283	SO:0001623	5_prime_UTR_variant	0			M27110	CCDS14513.1, CCDS14514.1	Xq22	2013-05-14	2008-07-28		ENSG00000123560	ENSG00000123560			9086	protein-coding gene	gene with protein product	"""Pelizaeus-Merzbacher disease"""	300401	"""spastic paraplegia 2, uncomplicated"""	SPG2, PLP			Standard	NM_001128834		Approved	GPM6C	uc004elk.3	P60201	OTTHUMG00000022111	ENST00000303958.2:c.-69C>T	X.37:g.103031855C>T			P04400|P06905|Q502Y1|Q6FHZ6	RNA	SNP	-	NULL	ENST00000303958.2	37	NULL	CCDS14513.1	X																																																																																			PLP1	-	-	ENSG00000123560		0.453	PLP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLP1	HGNC	protein_coding	OTTHUMT00000057743.2	-	0.00	48	0	C			103031855	+1	tier1	-	no_errors	ENST00000464776	ensembl	human	known	74_37	rna	31.82	60	28	SNP	0.994	T
PLRG1	5356	genome.wustl.edu	37	4	155458497	155458497	+	Silent	SNP	G	G	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr4:155458497G>T	ENST00000499023.2	-	14	1552	c.1426C>A	c.(1426-1428)Cga>Aga	p.R476R	PLRG1_ENST00000302078.5_Silent_p.R467R|PLRG1_ENST00000393905.2_Silent_p.R476R	NM_001201564.1|NM_002669.3	NP_001188493.1|NP_002660.1	O43660	PLRG1_HUMAN	pleiotropic regulator 1	476					mRNA splicing, via spliceosome (GO:0000398)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|protein localization to nucleus (GO:0034504)|regulation of RNA biosynthetic process (GO:2001141)|signal transduction (GO:0007165)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)|transcription corepressor activity (GO:0003714)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|skin(1)|urinary_tract(1)	22	all_hematologic(180;0.215)	Renal(120;0.0854)				GTTAGTAATCGACTTTCAGAC	0.398																																																	0													116.0	112.0	114.0					4																	155458497		2203	4300	6503	SO:0001819	synonymous_variant	0			AF044333	CCDS34083.1, CCDS56341.1	4q31.2-q32.1	2013-01-10	2011-05-19		ENSG00000171566	ENSG00000171566		"""WD repeat domain containing"""	9089	protein-coding gene	gene with protein product	"""transport and golgi organization 4 homolog (Drosophila)"""	605961	"""pleiotropic regulator 1 (PRL1, Arabidopsis homolog)"", ""pleiotropic regulator 1 (PRL1 homolog, Arabidopsis)"""				Standard	NM_002669		Approved	PRL1, Prp46, PRPF46, Cwc1, TANGO4	uc003iny.3	O43660	OTTHUMG00000161411	ENST00000499023.2:c.1426C>A	4.37:g.155458497G>T			B3KMK4|Q3KQY5|Q8WUD8	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R476	ENST00000499023.2	37	c.1426	CCDS34083.1	4																																																																																			PLRG1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000171566		0.398	PLRG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLRG1	HGNC	protein_coding	OTTHUMT00000364824.1		0.00	39	0	G	NM_002669		155458497	-1			no_errors	ENST00000393905	ensembl	human	known	74_37	silent	6.67	28	2	SNP	1.000	T
POLR2H	5437	genome.wustl.edu	37	3	184081316	184081316	+	Silent	SNP	G	G	C			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr3:184081316G>C	ENST00000456318.1	+	2	1085	c.36G>C	c.(34-36)gtG>gtC	p.V12V	POLR2H_ENST00000443489.1_5'UTR|EIF2B5_ENST00000444495.1_Intron|POLR2H_ENST00000429568.1_Silent_p.V12V|POLR2H_ENST00000452961.1_5'UTR|POLR2H_ENST00000296223.3_Silent_p.V12V|CLCN2_ENST00000434054.2_5'Flank|CLCN2_ENST00000423355.2_5'Flank|POLR2H_ENST00000430783.1_Silent_p.V12V|CLCN2_ENST00000265593.4_5'Flank|CLCN2_ENST00000344937.7_5'Flank|POLR2H_ENST00000438240.1_Intron|CLCN2_ENST00000457512.1_5'Flank	NM_001278699.1	NP_001265628.1	P52434	RPAB3_HUMAN	polymerase (RNA) II (DNA directed) polypeptide H	12					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of type I interferon production (GO:0032481)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|termination of RNA polymerase I transcription (GO:0006363)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cytosol (GO:0005829)|DNA-directed RNA polymerase I complex (GO:0005736)|DNA-directed RNA polymerase II, core complex (GO:0005665)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TTTTCGATGTGAAGGATATTG	0.582											OREG0015950	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													97.0	88.0	91.0					3																	184081316		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS3264.1, CCDS63861.1, CCDS63862.1, CCDS63859.1, CCDS63860.1	3q28	2013-01-21			ENSG00000163882	ENSG00000163882		"""RNA polymerase subunits"""	9195	protein-coding gene	gene with protein product		606023					Standard	NM_001278698		Approved	RPB8	uc003fok.2	P52434	OTTHUMG00000156746	ENST00000456318.1:c.36G>C	3.37:g.184081316G>C		1989	C9J413|C9JBJ6|C9JCU7|C9JUA8|P53802|Q969R0	Silent	SNP	pfam_RNA_pol_Rpb8,superfamily_NA-bd_OB-fold,smart_RNA_pol_Rpb8,pirsf_RNA_pol_Rpb8	p.V12	ENST00000456318.1	37	c.36	CCDS3264.1	3																																																																																			POLR2H	-	pfam_RNA_pol_Rpb8,superfamily_NA-bd_OB-fold,smart_RNA_pol_Rpb8,pirsf_RNA_pol_Rpb8	ENSG00000163882		0.582	POLR2H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR2H	HGNC	protein_coding	OTTHUMT00000345558.1	-	0.00	53	0	G	NM_006232		184081316	+1	tier1	-	no_errors	ENST00000296223	ensembl	human	known	74_37	silent	25.74	75	26	SNP	0.996	C
POLR2H	5437	genome.wustl.edu	37	3	184081340	184081340	+	Silent	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr3:184081340G>A	ENST00000456318.1	+	2	1109	c.60G>A	c.(58-60)aaG>aaA	p.K20K	POLR2H_ENST00000443489.1_5'UTR|EIF2B5_ENST00000444495.1_Intron|POLR2H_ENST00000429568.1_Silent_p.K20K|POLR2H_ENST00000452961.1_5'UTR|POLR2H_ENST00000296223.3_Silent_p.K20K|CLCN2_ENST00000434054.2_5'Flank|CLCN2_ENST00000423355.2_5'Flank|POLR2H_ENST00000430783.1_Silent_p.K20K|CLCN2_ENST00000265593.4_5'Flank|CLCN2_ENST00000344937.7_5'Flank|POLR2H_ENST00000438240.1_Intron|CLCN2_ENST00000457512.1_5'Flank	NM_001278699.1	NP_001265628.1	P52434	RPAB3_HUMAN	polymerase (RNA) II (DNA directed) polypeptide H	20	Non-specific ssDNA binding.				7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of type I interferon production (GO:0032481)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|termination of RNA polymerase I transcription (GO:0006363)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cytosol (GO:0005829)|DNA-directed RNA polymerase I complex (GO:0005736)|DNA-directed RNA polymerase II, core complex (GO:0005665)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CGGAGGGCAAGAAGTTTGACC	0.592											OREG0015950	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													90.0	83.0	85.0					3																	184081340		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS3264.1, CCDS63861.1, CCDS63862.1, CCDS63859.1, CCDS63860.1	3q28	2013-01-21			ENSG00000163882	ENSG00000163882		"""RNA polymerase subunits"""	9195	protein-coding gene	gene with protein product		606023					Standard	NM_001278698		Approved	RPB8	uc003fok.2	P52434	OTTHUMG00000156746	ENST00000456318.1:c.60G>A	3.37:g.184081340G>A		1989	C9J413|C9JBJ6|C9JCU7|C9JUA8|P53802|Q969R0	Silent	SNP	pfam_RNA_pol_Rpb8,superfamily_NA-bd_OB-fold,smart_RNA_pol_Rpb8,pirsf_RNA_pol_Rpb8	p.K20	ENST00000456318.1	37	c.60	CCDS3264.1	3																																																																																			POLR2H	-	pfam_RNA_pol_Rpb8,superfamily_NA-bd_OB-fold,smart_RNA_pol_Rpb8,pirsf_RNA_pol_Rpb8	ENSG00000163882		0.592	POLR2H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR2H	HGNC	protein_coding	OTTHUMT00000345558.1	-	0.00	63	0	G	NM_006232		184081340	+1	tier1	-	no_errors	ENST00000296223	ensembl	human	known	74_37	silent	29.20	80	33	SNP	1.000	A
POLR2H	5437	genome.wustl.edu	37	3	184081347	184081347	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr3:184081347G>A	ENST00000456318.1	+	2	1116	c.67G>A	c.(67-69)Gac>Aac	p.D23N	POLR2H_ENST00000443489.1_5'UTR|EIF2B5_ENST00000444495.1_Intron|POLR2H_ENST00000429568.1_Missense_Mutation_p.D23N|POLR2H_ENST00000452961.1_5'UTR|POLR2H_ENST00000296223.3_Missense_Mutation_p.D23N|CLCN2_ENST00000434054.2_5'Flank|CLCN2_ENST00000423355.2_5'Flank|POLR2H_ENST00000430783.1_Missense_Mutation_p.D23N|CLCN2_ENST00000265593.4_5'Flank|CLCN2_ENST00000344937.7_5'Flank|POLR2H_ENST00000438240.1_Intron|CLCN2_ENST00000457512.1_5'Flank	NM_001278699.1	NP_001265628.1	P52434	RPAB3_HUMAN	polymerase (RNA) II (DNA directed) polypeptide H	23	Non-specific ssDNA binding.				7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of type I interferon production (GO:0032481)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|termination of RNA polymerase I transcription (GO:0006363)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cytosol (GO:0005829)|DNA-directed RNA polymerase I complex (GO:0005736)|DNA-directed RNA polymerase II, core complex (GO:0005665)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CAAGAAGTTTGACCGAGGTAA	0.592											OREG0015950	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													89.0	83.0	85.0					3																	184081347		2203	4300	6503	SO:0001583	missense	0				CCDS3264.1, CCDS63861.1, CCDS63862.1, CCDS63859.1, CCDS63860.1	3q28	2013-01-21			ENSG00000163882	ENSG00000163882		"""RNA polymerase subunits"""	9195	protein-coding gene	gene with protein product		606023					Standard	NM_001278698		Approved	RPB8	uc003fok.2	P52434	OTTHUMG00000156746	ENST00000456318.1:c.67G>A	3.37:g.184081347G>A	ENSP00000392913:p.Asp23Asn	1989	C9J413|C9JBJ6|C9JCU7|C9JUA8|P53802|Q969R0	Missense_Mutation	SNP	pfam_RNA_pol_Rpb8,superfamily_NA-bd_OB-fold,smart_RNA_pol_Rpb8,pirsf_RNA_pol_Rpb8	p.D23N	ENST00000456318.1	37	c.67	CCDS3264.1	3	.	.	.	.	.	.	.	.	.	.	g	36	5.830422	0.96996	.	.	ENSG00000163882	ENST00000456318;ENST00000455712;ENST00000430783;ENST00000296223;ENST00000429568	.	.	.	6.04	5.16	0.70880	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	0.000000	0.85682	D	0.000000	T	0.73713	0.3622	M	0.73430	2.235	0.80722	D	1	P	0.49862	0.929	P	0.56278	0.795	T	0.74438	-0.3665	9	0.51188	T	0.08	-23.6255	13.6081	0.62058	0.0765:0.0:0.9235:0.0	.	23	P52434	RPAB3_HUMAN	N	23	.	ENSP00000296223:D23N	D	+	1	0	POLR2H	185564041	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.221000	0.78016	2.873000	0.98535	0.563000	0.77884	GAC	POLR2H	-	pfam_RNA_pol_Rpb8,superfamily_NA-bd_OB-fold,smart_RNA_pol_Rpb8,pirsf_RNA_pol_Rpb8	ENSG00000163882		0.592	POLR2H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR2H	HGNC	protein_coding	OTTHUMT00000345558.1	-	0.00	67	0	G	NM_006232		184081347	+1	tier1	-	no_errors	ENST00000296223	ensembl	human	known	74_37	missense	26.02	90	32	SNP	1.000	A
POMK	84197	genome.wustl.edu	37	8	42958883	42958883	+	Silent	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr8:42958883G>A	ENST00000331373.5	+	4	447	c.192G>A	c.(190-192)caG>caA	p.Q64Q		NM_001277971.1|NM_032237.3	NP_001264900.1|NP_115613.1	Q9H5K3	SG196_HUMAN	protein-O-mannose kinase	64					brain development (GO:0007420)|carbohydrate phosphorylation (GO:0046835)|learning or memory (GO:0007611)|neuromuscular process (GO:0050905)|neuron migration (GO:0001764)|protein O-linked glycosylation (GO:0006493)|sensory perception of pain (GO:0019233)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|carbohydrate kinase activity (GO:0019200)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)|protein kinase activity (GO:0004672)										GGATAGGACAGATGAAAAACT	0.532																																																	0													138.0	114.0	122.0					8																	42958883		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS6141.1	8p11.21	2013-08-22			ENSG00000185900	ENSG00000185900			26267	protein-coding gene	gene with protein product		615247				16879967, 23519211	Standard	NM_001277971		Approved	FLJ23356, SgK196		Q9H5K3	OTTHUMG00000164100	ENST00000331373.5:c.192G>A	8.37:g.42958883G>A				Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,pfscan_Prot_kinase_dom	p.Q64	ENST00000331373.5	37	c.192	CCDS6141.1	8																																																																																			POMK	-	NULL	ENSG00000185900		0.532	POMK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POMK	HGNC	protein_coding	OTTHUMT00000377291.2	-	0.00	20	0	G	NM_032237		42958883	+1	tier1	-	no_errors	ENST00000331373	ensembl	human	known	74_37	silent	53.85	6	7	SNP	0.991	A
PRB3	5544	genome.wustl.edu	37	12	11420501	11420501	+	Missense_Mutation	SNP	G	G	A	rs12811811		TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr12:11420501G>A	ENST00000279573.7	-	3	817	c.682C>T	c.(682-684)Cca>Tca	p.P228S	PRB3_ENST00000538488.1_Intron|PRB3_ENST00000381842.3_Intron|PRB3_ENST00000440870.3_Intron			Q04118	PRB3_HUMAN	proline-rich protein BstNI subfamily 3	228	10 X 21 AA tandem repeats of [RH]-P-G-K- P-[EQ]-G-[PQS]-P-[PS]-Q-[GE]-G-N-[QK]- [SP]-[QR]-[GR]-P-P-P.|Pro-rich.				defense response to Gram-negative bacterium (GO:0050829)	extracellular region (GO:0005576)				breast(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(5)	25			OV - Ovarian serous cystadenocarcinoma(49;0.201)			TGTGGGGGTGGTCCTTCTGGC	0.632																																																	0													77.0	14.0	37.0					12																	11420501		1586	2681	4267	SO:0001583	missense	0					12p13.2	2012-10-02				ENSG00000197870			9339	protein-coding gene	gene with protein product		168840				1894623	Standard	NM_006249		Approved	PRG	uc001qzs.3	Q04118		ENST00000279573.7:c.682C>T	12.37:g.11420501G>A	ENSP00000279573:p.Pro228Ser		Q15188|Q4VAY3|Q4VAY4|Q7M4M9|Q9UCT9	Missense_Mutation	SNP	NULL	p.P228S	ENST00000279573.7	37	c.682		12																																																																																			PRB3	-	NULL	ENSG00000197870		0.632	PRB3-001	KNOWN	basic|appris_candidate	protein_coding	PRB3	HGNC	protein_coding	OTTHUMT00000402119.5		0.00	16	0	G	NM_006249		11420501	-1			no_errors	ENST00000279573	ensembl	human	known	74_37	missense	17.24	23	5	SNP	0.065	A
PRR23C	389152	genome.wustl.edu	37	3	138763216	138763216	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr3:138763216C>T	ENST00000413199.1	-	1	518	c.247G>A	c.(247-249)Gcg>Acg	p.A83T	PRR23C_ENST00000502927.2_Missense_Mutation_p.A83T|MRPS22_ENST00000495075.1_Intron	NM_001134657.1	NP_001128129.1	Q6ZRP0	PR23C_HUMAN	proline rich 23C	83										breast(2)|lung(7)|skin(2)	11						GACATTGGCGCGAGCTCCAGC	0.682																																																	0													18.0	23.0	22.0					3																	138763216		692	1591	2283	SO:0001583	missense	0				CCDS46924.1	3q22.3	2014-06-03				ENSG00000233701			37173	protein-coding gene	gene with protein product							Standard	NM_001134657		Approved	FLJ46210	uc011bmt.1	Q6ZRP0		ENST00000413199.1:c.247G>A	3.37:g.138763216C>T	ENSP00000396648:p.Ala83Thr			Missense_Mutation	SNP	pfam_UPF0572	p.A83T	ENST00000413199.1	37	c.247	CCDS46924.1	3	.	.	.	.	.	.	.	.	.	.	C	15.13	2.740625	0.49045	.	.	ENSG00000233701	ENST00000413199;ENST00000502927	.	.	.	3.26	-2.85	0.05734	.	1.580240	0.03848	N	0.271746	T	0.28896	0.0717	L	0.47716	1.5	0.09310	N	1	P	0.45126	0.851	B	0.40256	0.324	T	0.29366	-1.0014	9	0.56958	D	0.05	.	3.5745	0.07929	0.1604:0.2563:0.4745:0.1088	.	83	Q6ZRP0	PR23C_HUMAN	T	83	.	ENSP00000396648:A83T	A	-	1	0	PRR23C	140245906	0.201000	0.23410	0.002000	0.10522	0.013000	0.08279	-0.079000	0.11357	-0.636000	0.05524	0.305000	0.20034	GCG	PRR23C	-	pfam_UPF0572	ENSG00000233701		0.682	PRR23C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRR23C	HGNC	protein_coding	OTTHUMT00000361502.1	-	0.00	22	0	C	NM_001134657		138763216	-1	tier1	-	no_errors	ENST00000413199	ensembl	human	known	74_37	missense	32.35	23	11	SNP	0.002	T
PRRX2	51450	genome.wustl.edu	37	9	132481697	132481697	+	Splice_Site	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr9:132481697G>A	ENST00000372469.4	+	2	674	c.447G>A	c.(445-447)caG>caA	p.Q149Q	RP11-483H20.6_ENST00000440413.1_RNA	NM_016307.3	NP_057391.1	Q99811	PRRX2_HUMAN	paired related homeobox 2	149					artery morphogenesis (GO:0048844)|cartilage development (GO:0051216)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic limb morphogenesis (GO:0030326)|inner ear morphogenesis (GO:0042472)|middle ear morphogenesis (GO:0042474)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smoothened signaling pathway (GO:0045880)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(2)|pancreas(1)	3		Ovarian(14;0.00556)				CGCGCGTTCAGGTGAGCGCTC	0.687																																																	0													9.0	9.0	9.0					9																	132481697		2062	4018	6080	SO:0001630	splice_region_variant	0			AF061970	CCDS6926.1	9q34.11	2011-06-20			ENSG00000167157	ENSG00000167157		"""Homeoboxes / PRD class"""	21338	protein-coding gene	gene with protein product		604675				11063257	Standard	NM_016307		Approved	PRX2, PMX2	uc004byh.3	Q99811	OTTHUMG00000020790	ENST00000372469.4:c.447+1G>A	9.37:g.132481697G>A			Q5SZB5|Q9UIB3	Silent	SNP	pfam_Homeobox_dom,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_OAR_dom,pfscan_Homeobox_dom	p.Q149	ENST00000372469.4	37	c.447	CCDS6926.1	9	.	.	.	.	.	.	.	.	.	.	G	13.57	2.277187	0.40294	.	.	ENSG00000167157	ENST00000557730	.	.	.	4.01	3.09	0.35607	.	.	.	.	.	T	0.59838	0.2223	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56420	-0.7982	4	.	.	.	.	10.2559	0.43397	0.1003:0.0:0.8997:0.0	.	.	.	.	K	64	.	.	R	+	2	0	PRRX2	131521518	1.000000	0.71417	1.000000	0.80357	0.704000	0.40688	7.528000	0.81941	1.013000	0.39391	0.561000	0.74099	AGG	PRRX2	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	ENSG00000167157		0.687	PRRX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRX2	HGNC	protein_coding	OTTHUMT00000054598.2	-	0.00	20	0	G	NM_016307	Silent	132481697	+1	tier1	-	no_errors	ENST00000372469	ensembl	human	known	74_37	silent	33.33	18	9	SNP	1.000	A
PRSS12	8492	genome.wustl.edu	37	4	119203107	119203108	+	Frame_Shift_Ins	INS	-	-	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr4:119203107_119203108insT	ENST00000296498.3	-	13	2893_2894	c.2611_2612insA	c.(2611-2613)agtfs	p.S871fs	SNHG8_ENST00000384096.1_lincRNA|PRSS12_ENST00000510903.1_5'Flank	NM_003619.3	NP_003610.2	P56730	NETR_HUMAN	protease, serine, 12 (neurotrypsin, motopsin)	871	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				exocytosis (GO:0006887)|zymogen activation (GO:0031638)	axon (GO:0030424)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)|terminal bouton (GO:0043195)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(3)|kidney(1)|large_intestine(9)|lung(11)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	29						TTTGGTGACACTTTTTATCCAA	0.441																																																	0																																										SO:0001589	frameshift_variant	0			AJ001531	CCDS3709.1	4q25-q26	2010-05-07			ENSG00000164099	ENSG00000164099		"""Serine peptidases / Serine peptidases"""	9477	protein-coding gene	gene with protein product		606709				9540828, 9245503	Standard	NM_003619		Approved	BSSP-3, MRT1	uc003ica.2	P56730	OTTHUMG00000161166	ENST00000296498.3:c.2612dupA	4.37:g.119203112_119203112dupT	ENSP00000296498:p.Ser871fs		Q9UP16	Frame_Shift_Ins	INS	pfam_SRCR,pfam_Peptidase_S1,pfam_Kringle,superfamily_Trypsin-like_Pept_dom,superfamily_Srcr_rcpt-rel,superfamily_Kringle-like,smart_Kringle,smart_Srcr_rcpt-rel,smart_Peptidase_S1,pfscan_Kringle,pfscan_SRCR,pfscan_Peptidase_S1,prints_SRCR,prints_Peptidase_S1A	p.S871fs	ENST00000296498.3	37	c.2612_2611	CCDS3709.1	4																																																																																			PRSS12	-	superfamily_Trypsin-like_Pept_dom,pfscan_Peptidase_S1	ENSG00000164099		0.441	PRSS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS12	HGNC	protein_coding	OTTHUMT00000256516.2		0.00	40	0	-			119203108	-1	tier1		no_errors	ENST00000296498	ensembl	human	known	74_37	frame_shift_ins	30.00	42	18	INS	0.991:1.000	T
PTBP3	9991	genome.wustl.edu	37	9	114989735	114989735	+	Silent	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr9:114989735C>T	ENST00000374255.2	-	13	1551	c.1404G>A	c.(1402-1404)caG>caA	p.Q468Q	PTBP3_ENST00000374257.1_Silent_p.Q440Q|PTBP3_ENST00000343327.2_Silent_p.Q373Q|PTBP3_ENST00000458258.1_Silent_p.Q474Q|PTBP3_ENST00000334318.6_Silent_p.Q471Q			O95758	PTBP3_HUMAN	polypyrimidine tract binding protein 3	468					anatomical structure morphogenesis (GO:0009653)|erythrocyte maturation (GO:0043249)|mRNA processing (GO:0006397)|negative regulation of RNA splicing (GO:0033119)|regulation of cell differentiation (GO:0045595)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)										GAAAGATATTCTGGAAGTTTT	0.393																																																	0													131.0	137.0	135.0					9																	114989735		2203	4300	6503	SO:0001819	synonymous_variant	0			AB023967	CCDS6784.1, CCDS55332.1, CCDS55333.1, CCDS59140.1, CCDS59141.1	9q32	2013-07-16	2011-11-16	2011-11-16	ENSG00000119314	ENSG00000119314		"""RNA binding motif (RRM) containing"""	10253	protein-coding gene	gene with protein product		607527	"""regulator of differentiation (in S. pombe) 1"", ""ROD1 regulator of differentiation 1 (S. pombe)"""	ROD1		10207106	Standard	NM_005156		Approved	DKFZp781I1117	uc004bfx.3	O95758	OTTHUMG00000020503	ENST00000374255.2:c.1404G>A	9.37:g.114989735C>T			B1ALY2|B1ALY3|B1ALY5|B1ALY6|B3KME7|Q68DB9|Q86YB3|Q86YH9	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP-L_PTB	p.Q474	ENST00000374255.2	37	c.1422	CCDS6784.1	9																																																																																			PTBP3	-	tigrfam_HnRNP-L_PTB	ENSG00000119314		0.393	PTBP3-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTBP3	HGNC	protein_coding	OTTHUMT00000053679.1	-	0.00	85	0	C			114989735	-1	tier1	-	no_errors	ENST00000458258	ensembl	human	known	74_37	silent	28.37	101	40	SNP	0.992	T
PTBP3	9991	genome.wustl.edu	37	9	114989791	114989791	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr9:114989791C>T	ENST00000374255.2	-	13	1495	c.1348G>A	c.(1348-1350)Gat>Aat	p.D450N	PTBP3_ENST00000374257.1_Missense_Mutation_p.D422N|PTBP3_ENST00000343327.2_Missense_Mutation_p.D355N|PTBP3_ENST00000458258.1_Missense_Mutation_p.D456N|PTBP3_ENST00000334318.6_Missense_Mutation_p.D453N			O95758	PTBP3_HUMAN	polypyrimidine tract binding protein 3	450					anatomical structure morphogenesis (GO:0009653)|erythrocyte maturation (GO:0043249)|mRNA processing (GO:0006397)|negative regulation of RNA splicing (GO:0033119)|regulation of cell differentiation (GO:0045595)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)										TTGCTGAAATCCTTAGTCAGA	0.453																																																	0													139.0	134.0	136.0					9																	114989791		2203	4300	6503	SO:0001583	missense	0			AB023967	CCDS6784.1, CCDS55332.1, CCDS55333.1, CCDS59140.1, CCDS59141.1	9q32	2013-07-16	2011-11-16	2011-11-16	ENSG00000119314	ENSG00000119314		"""RNA binding motif (RRM) containing"""	10253	protein-coding gene	gene with protein product		607527	"""regulator of differentiation (in S. pombe) 1"", ""ROD1 regulator of differentiation 1 (S. pombe)"""	ROD1		10207106	Standard	NM_005156		Approved	DKFZp781I1117	uc004bfx.3	O95758	OTTHUMG00000020503	ENST00000374255.2:c.1348G>A	9.37:g.114989791C>T	ENSP00000363373:p.Asp450Asn		B1ALY2|B1ALY3|B1ALY5|B1ALY6|B3KME7|Q68DB9|Q86YB3|Q86YH9	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP-L_PTB	p.D456N	ENST00000374255.2	37	c.1366	CCDS6784.1	9	.	.	.	.	.	.	.	.	.	.	C	36	5.733181	0.96856	.	.	ENSG00000119314	ENST00000374257;ENST00000334318;ENST00000458258;ENST00000374255;ENST00000343327	T;T;T;T;T	0.61392	0.15;0.13;0.11;0.11;1.15	5.65	5.65	0.86999	Nucleotide-binding, alpha-beta plait (1);	0.000000	0.85682	D	0.000000	T	0.81128	0.4758	M	0.89095	3.005	0.80722	D	1	D;D;D;D;D;D	0.89917	0.997;0.974;0.997;0.998;0.978;1.0	D;D;D;D;P;D	0.81914	0.993;0.951;0.993;0.995;0.894;0.995	D	0.83792	0.0231	10	0.66056	D	0.02	-9.473	19.7278	0.96172	0.0:1.0:0.0:0.0	.	422;422;355;453;450;456	B1ALY5;O95758-2;B1ALY6;O95758-5;O95758;O95758-4	.;.;.;.;ROD1_HUMAN;.	N	422;453;456;450;355	ENSP00000363375:D422N;ENSP00000334499:D453N;ENSP00000414921:D456N;ENSP00000363373:D450N;ENSP00000340705:D355N	ENSP00000334499:D453N	D	-	1	0	ROD1	114029612	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.776000	0.85560	2.656000	0.90262	0.591000	0.81541	GAT	PTBP3	-	tigrfam_HnRNP-L_PTB	ENSG00000119314		0.453	PTBP3-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTBP3	HGNC	protein_coding	OTTHUMT00000053679.1	-	0.00	64	0	C			114989791	-1	tier1	-	no_errors	ENST00000458258	ensembl	human	known	74_37	missense	31.11	62	28	SNP	1.000	T
PTBP3	9991	genome.wustl.edu	37	9	114989803	114989803	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr9:114989803C>T	ENST00000374255.2	-	13	1483	c.1336G>A	c.(1336-1338)Ggt>Agt	p.G446S	PTBP3_ENST00000374257.1_Missense_Mutation_p.G418S|PTBP3_ENST00000343327.2_Missense_Mutation_p.G351S|PTBP3_ENST00000458258.1_Missense_Mutation_p.G452S|PTBP3_ENST00000334318.6_Missense_Mutation_p.G449S			O95758	PTBP3_HUMAN	polypyrimidine tract binding protein 3	446					anatomical structure morphogenesis (GO:0009653)|erythrocyte maturation (GO:0043249)|mRNA processing (GO:0006397)|negative regulation of RNA splicing (GO:0033119)|regulation of cell differentiation (GO:0045595)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)										TTAGTCAGACCTTGGTCTTCT	0.453																																																	0													137.0	132.0	134.0					9																	114989803		2203	4300	6503	SO:0001583	missense	0			AB023967	CCDS6784.1, CCDS55332.1, CCDS55333.1, CCDS59140.1, CCDS59141.1	9q32	2013-07-16	2011-11-16	2011-11-16	ENSG00000119314	ENSG00000119314		"""RNA binding motif (RRM) containing"""	10253	protein-coding gene	gene with protein product		607527	"""regulator of differentiation (in S. pombe) 1"", ""ROD1 regulator of differentiation 1 (S. pombe)"""	ROD1		10207106	Standard	NM_005156		Approved	DKFZp781I1117	uc004bfx.3	O95758	OTTHUMG00000020503	ENST00000374255.2:c.1336G>A	9.37:g.114989803C>T	ENSP00000363373:p.Gly446Ser		B1ALY2|B1ALY3|B1ALY5|B1ALY6|B3KME7|Q68DB9|Q86YB3|Q86YH9	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP-L_PTB	p.G452S	ENST00000374255.2	37	c.1354	CCDS6784.1	9	.	.	.	.	.	.	.	.	.	.	C	36	5.799138	0.96960	.	.	ENSG00000119314	ENST00000374257;ENST00000334318;ENST00000458258;ENST00000374255;ENST00000343327	T;T;T;T;T	0.57595	0.41;0.4;0.39;0.4;1.42	5.65	5.65	0.86999	Nucleotide-binding, alpha-beta plait (1);	0.174982	0.48286	D	0.000200	T	0.69771	0.3148	M	0.66439	2.03	0.80722	D	1	P;B;P;P;B;B	0.47484	0.896;0.447;0.828;0.547;0.195;0.295	P;P;P;P;B;B	0.60949	0.881;0.483;0.738;0.539;0.25;0.428	T	0.64210	-0.6461	10	0.30854	T	0.27	-4.8714	19.7278	0.96172	0.0:1.0:0.0:0.0	.	418;418;351;449;446;452	B1ALY5;O95758-2;B1ALY6;O95758-5;O95758;O95758-4	.;.;.;.;ROD1_HUMAN;.	S	418;449;452;446;351	ENSP00000363375:G418S;ENSP00000334499:G449S;ENSP00000414921:G452S;ENSP00000363373:G446S;ENSP00000340705:G351S	ENSP00000334499:G449S	G	-	1	0	ROD1	114029624	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.445000	0.80570	2.656000	0.90262	0.591000	0.81541	GGT	PTBP3	-	tigrfam_HnRNP-L_PTB	ENSG00000119314		0.453	PTBP3-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTBP3	HGNC	protein_coding	OTTHUMT00000053679.1	-	0.00	56	0	C			114989803	-1	tier1	-	no_errors	ENST00000458258	ensembl	human	known	74_37	missense	28.57	60	24	SNP	1.000	T
PTBP3	9991	genome.wustl.edu	37	9	114989809	114989809	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr9:114989809C>T	ENST00000374255.2	-	13	1477	c.1330G>A	c.(1330-1332)Gac>Aac	p.D444N	PTBP3_ENST00000374257.1_Missense_Mutation_p.D416N|PTBP3_ENST00000343327.2_Missense_Mutation_p.D349N|PTBP3_ENST00000458258.1_Missense_Mutation_p.D450N|PTBP3_ENST00000334318.6_Missense_Mutation_p.D447N			O95758	PTBP3_HUMAN	polypyrimidine tract binding protein 3	444					anatomical structure morphogenesis (GO:0009653)|erythrocyte maturation (GO:0043249)|mRNA processing (GO:0006397)|negative regulation of RNA splicing (GO:0033119)|regulation of cell differentiation (GO:0045595)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)										AGACCTTGGTCTTCTTGTCCC	0.448																																																	0													137.0	131.0	133.0					9																	114989809		2203	4300	6503	SO:0001583	missense	0			AB023967	CCDS6784.1, CCDS55332.1, CCDS55333.1, CCDS59140.1, CCDS59141.1	9q32	2013-07-16	2011-11-16	2011-11-16	ENSG00000119314	ENSG00000119314		"""RNA binding motif (RRM) containing"""	10253	protein-coding gene	gene with protein product		607527	"""regulator of differentiation (in S. pombe) 1"", ""ROD1 regulator of differentiation 1 (S. pombe)"""	ROD1		10207106	Standard	NM_005156		Approved	DKFZp781I1117	uc004bfx.3	O95758	OTTHUMG00000020503	ENST00000374255.2:c.1330G>A	9.37:g.114989809C>T	ENSP00000363373:p.Asp444Asn		B1ALY2|B1ALY3|B1ALY5|B1ALY6|B3KME7|Q68DB9|Q86YB3|Q86YH9	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP-L_PTB	p.D450N	ENST00000374255.2	37	c.1348	CCDS6784.1	9	.	.	.	.	.	.	.	.	.	.	C	20.2	3.944285	0.73672	.	.	ENSG00000119314	ENST00000374257;ENST00000334318;ENST00000458258;ENST00000374255;ENST00000343327	T;T;T;T;T	0.59224	0.29;0.28;0.28;0.28;1.31	5.65	4.76	0.60689	Nucleotide-binding, alpha-beta plait (1);	0.051453	0.85682	D	0.000000	T	0.65059	0.2655	L	0.58354	1.805	0.58432	D	0.999992	B;B;B;P;P;B	0.47677	0.181;0.169;0.181;0.656;0.899;0.017	B;P;B;P;P;B	0.52189	0.383;0.505;0.261;0.582;0.692;0.055	T	0.66300	-0.5958	10	0.46703	T	0.11	-5.6095	14.6514	0.68800	0.0:0.9301:0.0:0.0699	.	416;416;349;447;444;450	B1ALY5;O95758-2;B1ALY6;O95758-5;O95758;O95758-4	.;.;.;.;ROD1_HUMAN;.	N	416;447;450;444;349	ENSP00000363375:D416N;ENSP00000334499:D447N;ENSP00000414921:D450N;ENSP00000363373:D444N;ENSP00000340705:D349N	ENSP00000334499:D447N	D	-	1	0	ROD1	114029630	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.784000	0.62411	1.392000	0.46585	0.591000	0.81541	GAC	PTBP3	-	tigrfam_HnRNP-L_PTB	ENSG00000119314		0.448	PTBP3-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTBP3	HGNC	protein_coding	OTTHUMT00000053679.1	-	0.00	56	0	C			114989809	-1	tier1	-	no_errors	ENST00000458258	ensembl	human	known	74_37	missense	29.76	58	25	SNP	1.000	T
PTBP3	9991	genome.wustl.edu	37	9	114989821	114989821	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr9:114989821C>T	ENST00000374255.2	-	13	1465	c.1318G>A	c.(1318-1320)Gag>Aag	p.E440K	PTBP3_ENST00000374257.1_Missense_Mutation_p.E412K|PTBP3_ENST00000343327.2_Missense_Mutation_p.E345K|PTBP3_ENST00000458258.1_Missense_Mutation_p.E446K|PTBP3_ENST00000334318.6_Missense_Mutation_p.E443K			O95758	PTBP3_HUMAN	polypyrimidine tract binding protein 3	440					anatomical structure morphogenesis (GO:0009653)|erythrocyte maturation (GO:0043249)|mRNA processing (GO:0006397)|negative regulation of RNA splicing (GO:0033119)|regulation of cell differentiation (GO:0045595)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)										TCTTGTCCCTCTCGAGGAAGC	0.448																																																	0													133.0	126.0	129.0					9																	114989821		2203	4300	6503	SO:0001583	missense	0			AB023967	CCDS6784.1, CCDS55332.1, CCDS55333.1, CCDS59140.1, CCDS59141.1	9q32	2013-07-16	2011-11-16	2011-11-16	ENSG00000119314	ENSG00000119314		"""RNA binding motif (RRM) containing"""	10253	protein-coding gene	gene with protein product		607527	"""regulator of differentiation (in S. pombe) 1"", ""ROD1 regulator of differentiation 1 (S. pombe)"""	ROD1		10207106	Standard	NM_005156		Approved	DKFZp781I1117	uc004bfx.3	O95758	OTTHUMG00000020503	ENST00000374255.2:c.1318G>A	9.37:g.114989821C>T	ENSP00000363373:p.Glu440Lys		B1ALY2|B1ALY3|B1ALY5|B1ALY6|B3KME7|Q68DB9|Q86YB3|Q86YH9	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP-L_PTB	p.E446K	ENST00000374255.2	37	c.1336	CCDS6784.1	9	.	.	.	.	.	.	.	.	.	.	C	37	5.987807	0.97179	.	.	ENSG00000119314	ENST00000374257;ENST00000334318;ENST00000458258;ENST00000374255;ENST00000343327	T;T;T;T;T	0.58652	3.4;3.4;0.32;3.4;1.34	5.65	5.65	0.86999	Nucleotide-binding, alpha-beta plait (1);	0.056406	0.64402	D	0.000002	T	0.78735	0.4330	M	0.83223	2.63	0.80722	D	1	P;D;D;P;D;P	0.59357	0.919;0.978;0.969;0.739;0.985;0.753	P;D;P;P;P;P	0.67103	0.867;0.949;0.857;0.606;0.867;0.696	T	0.80261	-0.1456	10	0.59425	D	0.04	-6.0022	19.7278	0.96172	0.0:1.0:0.0:0.0	.	412;412;345;443;440;446	B1ALY5;O95758-2;B1ALY6;O95758-5;O95758;O95758-4	.;.;.;.;ROD1_HUMAN;.	K	412;443;446;440;345	ENSP00000363375:E412K;ENSP00000334499:E443K;ENSP00000414921:E446K;ENSP00000363373:E440K;ENSP00000340705:E345K	ENSP00000334499:E443K	E	-	1	0	ROD1	114029642	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.052000	0.71080	2.656000	0.90262	0.591000	0.81541	GAG	PTBP3	-	tigrfam_HnRNP-L_PTB	ENSG00000119314		0.448	PTBP3-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTBP3	HGNC	protein_coding	OTTHUMT00000053679.1	-	0.00	52	0	C			114989821	-1	tier1	-	no_errors	ENST00000458258	ensembl	human	known	74_37	missense	30.49	57	25	SNP	1.000	T
PTBP3	9991	genome.wustl.edu	37	9	114989874	114989874	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr9:114989874C>A	ENST00000374255.2	-	13	1412	c.1265G>T	c.(1264-1266)gGg>gTg	p.G422V	PTBP3_ENST00000374257.1_Missense_Mutation_p.G394V|PTBP3_ENST00000343327.2_Missense_Mutation_p.G327V|PTBP3_ENST00000458258.1_Missense_Mutation_p.G428V|PTBP3_ENST00000334318.6_Missense_Mutation_p.G425V			O95758	PTBP3_HUMAN	polypyrimidine tract binding protein 3	422	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				anatomical structure morphogenesis (GO:0009653)|erythrocyte maturation (GO:0043249)|mRNA processing (GO:0006397)|negative regulation of RNA splicing (GO:0033119)|regulation of cell differentiation (GO:0045595)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)										AAGCACTTTCCCATAAAGTCT	0.413																																																	0													107.0	102.0	104.0					9																	114989874		2203	4300	6503	SO:0001583	missense	0			AB023967	CCDS6784.1, CCDS55332.1, CCDS55333.1, CCDS59140.1, CCDS59141.1	9q32	2013-07-16	2011-11-16	2011-11-16	ENSG00000119314	ENSG00000119314		"""RNA binding motif (RRM) containing"""	10253	protein-coding gene	gene with protein product		607527	"""regulator of differentiation (in S. pombe) 1"", ""ROD1 regulator of differentiation 1 (S. pombe)"""	ROD1		10207106	Standard	NM_005156		Approved	DKFZp781I1117	uc004bfx.3	O95758	OTTHUMG00000020503	ENST00000374255.2:c.1265G>T	9.37:g.114989874C>A	ENSP00000363373:p.Gly422Val		B1ALY2|B1ALY3|B1ALY5|B1ALY6|B3KME7|Q68DB9|Q86YB3|Q86YH9	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP-L_PTB	p.G428V	ENST00000374255.2	37	c.1283	CCDS6784.1	9	.	.	.	.	.	.	.	.	.	.	C	32	5.127086	0.94429	.	.	ENSG00000119314	ENST00000374257;ENST00000334318;ENST00000458258;ENST00000374255;ENST00000343327	T;T;T;T;T	0.68624	2.57;2.57;-0.34;2.57;0.69	5.65	5.65	0.86999	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	D	0.89787	0.6816	H	0.98407	4.225	0.80722	D	1	D;P;D;D;D;P	0.89917	0.999;0.925;0.964;1.0;0.994;0.901	D;P;D;D;D;P	0.97110	0.99;0.908;0.944;1.0;0.941;0.85	D	0.93367	0.6732	10	0.87932	D	0	-3.4656	19.7278	0.96172	0.0:1.0:0.0:0.0	.	394;394;327;425;422;428	B1ALY5;O95758-2;B1ALY6;O95758-5;O95758;O95758-4	.;.;.;.;ROD1_HUMAN;.	V	394;425;428;422;327	ENSP00000363375:G394V;ENSP00000334499:G425V;ENSP00000414921:G428V;ENSP00000363373:G422V;ENSP00000340705:G327V	ENSP00000334499:G425V	G	-	2	0	ROD1	114029695	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.776000	0.85560	2.656000	0.90262	0.591000	0.81541	GGG	PTBP3	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP-L_PTB	ENSG00000119314		0.413	PTBP3-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTBP3	HGNC	protein_coding	OTTHUMT00000053679.1	-	0.00	46	0	C			114989874	-1	tier1	-	no_errors	ENST00000458258	ensembl	human	known	74_37	missense	24.24	50	16	SNP	1.000	A
PTBP3	9991	genome.wustl.edu	37	9	114989883	114989883	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr9:114989883C>T	ENST00000374255.2	-	13	1403	c.1256G>A	c.(1255-1257)aGa>aAa	p.R419K	PTBP3_ENST00000374257.1_Missense_Mutation_p.R391K|PTBP3_ENST00000343327.2_Missense_Mutation_p.R324K|PTBP3_ENST00000458258.1_Missense_Mutation_p.R425K|PTBP3_ENST00000334318.6_Missense_Mutation_p.R422K			O95758	PTBP3_HUMAN	polypyrimidine tract binding protein 3	419	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				anatomical structure morphogenesis (GO:0009653)|erythrocyte maturation (GO:0043249)|mRNA processing (GO:0006397)|negative regulation of RNA splicing (GO:0033119)|regulation of cell differentiation (GO:0045595)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)										CCCATAAAGTCTCTGACCACT	0.408																																																	0													97.0	93.0	95.0					9																	114989883		2203	4300	6503	SO:0001583	missense	0			AB023967	CCDS6784.1, CCDS55332.1, CCDS55333.1, CCDS59140.1, CCDS59141.1	9q32	2013-07-16	2011-11-16	2011-11-16	ENSG00000119314	ENSG00000119314		"""RNA binding motif (RRM) containing"""	10253	protein-coding gene	gene with protein product		607527	"""regulator of differentiation (in S. pombe) 1"", ""ROD1 regulator of differentiation 1 (S. pombe)"""	ROD1		10207106	Standard	NM_005156		Approved	DKFZp781I1117	uc004bfx.3	O95758	OTTHUMG00000020503	ENST00000374255.2:c.1256G>A	9.37:g.114989883C>T	ENSP00000363373:p.Arg419Lys		B1ALY2|B1ALY3|B1ALY5|B1ALY6|B3KME7|Q68DB9|Q86YB3|Q86YH9	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP-L_PTB	p.R425K	ENST00000374255.2	37	c.1274	CCDS6784.1	9	.	.	.	.	.	.	.	.	.	.	C	7.992	0.753499	0.15778	.	.	ENSG00000119314	ENST00000374257;ENST00000334318;ENST00000458258;ENST00000374255;ENST00000343327	T;T;T;T;T	0.52754	3.47;3.47;0.65;3.47;1.66	5.65	4.76	0.60689	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.24044	0.0582	N	0.10972	0.075	0.46586	D	0.999116	B;B;B;B;B;B	0.06786	0.0;0.0;0.0;0.001;0.0;0.0	B;B;B;B;B;B	0.10450	0.004;0.003;0.004;0.005;0.004;0.001	T	0.11372	-1.0590	10	0.02654	T	1	-6.64	10.8669	0.46860	0.0:0.8029:0.0:0.1971	.	391;391;324;422;419;425	B1ALY5;O95758-2;B1ALY6;O95758-5;O95758;O95758-4	.;.;.;.;ROD1_HUMAN;.	K	391;422;425;419;324	ENSP00000363375:R391K;ENSP00000334499:R422K;ENSP00000414921:R425K;ENSP00000363373:R419K;ENSP00000340705:R324K	ENSP00000334499:R422K	R	-	2	0	ROD1	114029704	0.992000	0.36948	1.000000	0.80357	0.998000	0.95712	1.723000	0.38053	1.386000	0.46466	0.591000	0.81541	AGA	PTBP3	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP-L_PTB	ENSG00000119314		0.408	PTBP3-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTBP3	HGNC	protein_coding	OTTHUMT00000053679.1	-	0.00	48	0	C			114989883	-1	tier1	-	no_errors	ENST00000458258	ensembl	human	known	74_37	missense	23.08	50	15	SNP	0.999	T
PXMP4	11264	genome.wustl.edu	37	20	32295572	32295572	+	Silent	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr20:32295572G>A	ENST00000409299.3	-	4	671	c.579C>T	c.(577-579)agC>agT	p.S193S	PXMP4_ENST00000344022.3_3'UTR|PXMP4_ENST00000217398.3_3'UTR	NM_007238.4	NP_009169.3	Q9Y6I8	PXMP4_HUMAN	peroxisomal membrane protein 4, 24kDa	193						integral component of membrane (GO:0016021)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)				NS(1)|endometrium(2)|large_intestine(2)|lung(8)	13						GCCATACATTGCTGTCCTCAT	0.562																																																	0													157.0	141.0	146.0					20																	32295572		2203	4300	6503	SO:0001819	synonymous_variant	0			AF072864	CCDS13225.1, CCDS13226.1	20q11.22	2008-07-02	2002-08-29		ENSG00000101417	ENSG00000101417			15920	protein-coding gene	gene with protein product	"""24 kDa peroxisomal intrinsic membrane protein"""		"""peroxisomal membrane protein 4 (24kD)"""			10366717	Standard	NM_183397		Approved	PMP24	uc002wzv.3	Q9Y6I8	OTTHUMG00000032273	ENST00000409299.3:c.579C>T	20.37:g.32295572G>A			A2A2I7|Q9H0T4	Silent	SNP	pirsf_Pmp4	p.S193	ENST00000409299.3	37	c.579	CCDS13225.1	20																																																																																			PXMP4	-	pirsf_Pmp4	ENSG00000101417		0.562	PXMP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PXMP4	HGNC	protein_coding	OTTHUMT00000078739.2	-	0.00	32	0	G	NM_007238		32295572	-1	tier1	-	no_errors	ENST00000409299	ensembl	human	known	74_37	silent	33.33	21	11	SNP	1.000	A
R3HCC1L	27291	genome.wustl.edu	37	10	99968341	99968341	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr10:99968341G>A	ENST00000298999.3	+	5	773	c.470G>A	c.(469-471)gGa>gAa	p.G157E	R3HCC1L_ENST00000370586.2_Intron|R3HCC1L_ENST00000370584.3_Missense_Mutation_p.G157E|R3HCC1L_ENST00000314594.5_5'UTR	NM_014472.4	NP_055287	Q7Z5L2	R3HCL_HUMAN	R3H domain and coiled-coil containing 1-like	157							nucleotide binding (GO:0000166)										GATGTGACAGGACATGAGAGG	0.438																																																	0													88.0	91.0	90.0					10																	99968341		2203	4300	6503	SO:0001583	missense	0			AF525304	CCDS31267.1, CCDS58093.1, CCDS73178.1	10q24.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000166024	ENSG00000166024			23512	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 28"""	C10orf28			Standard	NM_014472		Approved	GIDRP86, PSORT	uc001kox.4	Q7Z5L2	OTTHUMG00000018873	ENST00000298999.3:c.470G>A	10.37:g.99968341G>A	ENSP00000298999:p.Gly157Glu		O60598|Q5W0B4|Q5W0B5|Q86VT9|Q8N9H0	Missense_Mutation	SNP	NULL	p.G157E	ENST00000298999.3	37	c.470	CCDS31267.1	10	.	.	.	.	.	.	.	.	.	.	G	3.092	-0.186692	0.06340	.	.	ENSG00000166024	ENST00000370584;ENST00000538495;ENST00000298999	T;T	0.09723	2.95;2.95	5.61	-1.06	0.10002	.	0.835654	0.10646	N	0.650438	T	0.12178	0.0296	M	0.71581	2.175	0.09310	N	0.999993	B;B	0.32203	0.36;0.36	B;B	0.34385	0.181;0.139	T	0.27673	-1.0067	9	.	.	.	-3.9194	5.298	0.15762	0.3918:0.0:0.4783:0.1299	.	157;157	Q7Z5L2;Q7Z5L2-2	GIDRP_HUMAN;.	E	157	ENSP00000359616:G157E;ENSP00000298999:G157E	.	G	+	2	0	C10orf28	99958331	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.411000	0.02478	-0.073000	0.12842	-0.136000	0.14681	GGA	R3HCC1L	-	NULL	ENSG00000166024		0.438	R3HCC1L-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	R3HCC1L	HGNC	protein_coding	OTTHUMT00000049764.1	-	0.00	32	0	G	NM_014472		99968341	+1	tier1	-	no_errors	ENST00000370584	ensembl	human	known	74_37	missense	37.14	22	13	SNP	0.001	A
RAC2	5880	genome.wustl.edu	37	22	37637065	37637065	+	Intron	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr22:37637065G>A	ENST00000249071.6	-	2	229				RAC2_ENST00000405484.1_Intron|RAC2_ENST00000406508.1_Intron|RAC2_ENST00000401529.3_Silent_p.P83P	NM_002872.3	NP_002863.1	P15153	RAC2_HUMAN	ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)						actin filament organization (GO:0007015)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|bone resorption (GO:0045453)|cell projection assembly (GO:0030031)|G-protein coupled receptor signaling pathway (GO:0007186)|lymphocyte aggregation (GO:0071593)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of neutrophil chemotaxis (GO:0090023)|regulation of cell-substrate adhesion (GO:0010810)|regulation of hydrogen peroxide metabolic process (GO:0010310)|regulation of neutrophil migration (GO:1902622)|regulation of respiratory burst (GO:0060263)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(2)|upper_aerodigestive_tract(1)	12					Dextromethorphan(DB00514)	aggagtgatggggacccctga	0.602																																																	0													4.0	3.0	4.0					22																	37637065		813	1864	2677	SO:0001627	intron_variant	0			M64595	CCDS13945.1	22q13.1	2014-09-17			ENSG00000128340	ENSG00000128340		"""Endogenous ligands"""	9802	protein-coding gene	gene with protein product		602049				2674130	Standard	NM_002872		Approved	EN-7	uc003arc.3	P15153	OTTHUMG00000150540	ENST00000249071.6:c.107+561C>T	22.37:g.37637065G>A			Q9UDJ4	Silent	SNP	pfam_Small_GTPase,superfamily_P-loop_NTPase,smart_Small_GTPase_Rho	p.P83	ENST00000249071.6	37	c.249	CCDS13945.1	22																																																																																			RAC2	-	NULL	ENSG00000128340		0.602	RAC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAC2	HGNC	protein_coding	OTTHUMT00000318812.1	-	0.00	16	0	G			37637065	-1	tier1	-	no_errors	ENST00000401529	ensembl	human	putative	74_37	silent	41.18	10	7	SNP	0.000	A
RASA2	5922	genome.wustl.edu	37	3	141259435	141259435	+	Nonsense_Mutation	SNP	C	C	T	rs371048945		TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr3:141259435C>T	ENST00000452898.1	+	5	546	c.511C>T	c.(511-513)Cag>Tag	p.Q171*	RASA2_ENST00000286364.3_Nonsense_Mutation_p.Q171*	NM_006506.2	NP_006497.2	Q15283	RASA2_HUMAN	RAS p21 protein activator 2	171	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	34						AACTGTATGCCAGCAGCTTGT	0.308																																																	0								C	stop/GLN	0,4406		0,0,2203	96.0	98.0	97.0		511	5.9	1.0	3		97	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained	RASA2	NM_006506.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		171/850	141259435	1,13005	2203	4300	6503	SO:0001587	stop_gained	0			AF115573	CCDS3117.1	3q22-q23	2013-01-10			ENSG00000155903	ENSG00000155903		"""Pleckstrin homology (PH) domain containing"""	9872	protein-coding gene	gene with protein product		601589				8699317	Standard	NM_006506		Approved	GAP1M	uc003etz.1	Q15283	OTTHUMG00000160221	ENST00000452898.1:c.511C>T	3.37:g.141259435C>T	ENSP00000391677:p.Gln171*		A8K7K1|G3V0F9|O00695|Q15284|Q92594|Q99577|Q9UEQ2	Nonsense_Mutation	SNP	pfam_RasGAP,pfam_C2_dom,pfam_Pleckstrin_homology,pfam_Znf_Btk_motif,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,smart_C2_dom,smart_RasGAP,smart_Pleckstrin_homology,smart_Znf_Btk_motif,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_Znf_Btk_motif,pfscan_RasGAP,prints_Znf_Btk_motif	p.Q171*	ENST00000452898.1	37	c.511		3	.	.	.	.	.	.	.	.	.	.	C	19.69	3.875008	0.72180	0.0	1.16E-4	ENSG00000155903	ENST00000286364;ENST00000452898	.	.	.	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.1314	0.86727	0.0:1.0:0.0:0.0	.	.	.	.	X	171	.	.	Q	+	1	0	RASA2	142742125	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.775000	0.62346	2.785000	0.95823	0.591000	0.81541	CAG	RASA2	-	superfamily_C2_dom,pfscan_C2_dom	ENSG00000155903		0.308	RASA2-201	KNOWN	basic	protein_coding	RASA2	HGNC	protein_coding		-	0.00	104	0	C	NM_006506		141259435	+1	tier1	-	no_errors	ENST00000452898	ensembl	human	known	74_37	nonsense	5.56	68	4	SNP	1.000	T
RASGRP4	115727	genome.wustl.edu	37	19	38909030	38909030	+	Splice_Site	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr19:38909030C>T	ENST00000587738.1	-	7	908		c.e7+1		RASGRP4_ENST00000426920.2_Intron|RASGRP4_ENST00000293062.9_Intron|RASGRP4_ENST00000433821.2_Splice_Site|RASGRP4_ENST00000586305.1_Splice_Site|RASGRP4_ENST00000587753.1_Splice_Site|RASGRP4_ENST00000454404.2_Splice_Site			Q8TDF6	GRP4_HUMAN	RAS guanyl releasing protein 4						activation of phospholipase C activity (GO:0007202)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|myeloid cell differentiation (GO:0030099)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|response to extracellular stimulus (GO:0009991)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|GTP-dependent protein binding (GO:0030742)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			cervix(1)|kidney(1)|large_intestine(4)|lung(12)|pancreas(1)|prostate(3)|skin(1)	23	all_cancers(60;4.21e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GCGGGCCTCACCTGTGCCACG	0.667																																																	0													23.0	29.0	27.0					19																	38909030		2089	4206	6295	SO:0001630	splice_region_variant	0			AY048119	CCDS46068.1, CCDS54262.1, CCDS54263.1, CCDS54264.1	19q13.1	2013-01-10						"""EF-hand domain containing"""	18958	protein-coding gene	gene with protein product		607320				11956218	Standard	NM_170604		Approved		uc021uub.1	Q8TDF6		ENST00000587738.1:c.837+1G>A	19.37:g.38909030C>T			A6H8M4|C0LTP2|C0LTP3|C0LTP4|C0LTP5|C0LTP7|C9J416|C9JHZ1|Q8N858|Q96QN5|Q96QN6|Q96QN7	Splice_Site	SNP	-	e7+1	ENST00000587738.1	37	c.837+1	CCDS46068.1	19	.	.	.	.	.	.	.	.	.	.	C	13.64	2.298370	0.40694	.	.	ENSG00000171777	ENST00000433821;ENST00000405332;ENST00000454404	.	.	.	4.72	4.72	0.59763	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2156	0.73264	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RASGRP4	43600870	1.000000	0.71417	1.000000	0.80357	0.062000	0.15995	7.268000	0.78473	2.429000	0.82318	0.561000	0.74099	.	RASGRP4	-	-	ENSG00000171777		0.667	RASGRP4-013	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	RASGRP4	HGNC	protein_coding	OTTHUMT00000460540.1	-	0.00	37	0	C	NM_170604	Intron	38909030	-1	tier1	-	no_errors	ENST00000587738	ensembl	human	known	74_37	splice_site	15.79	32	6	SNP	1.000	T
RASSF7	8045	genome.wustl.edu	37	11	562466	562466	+	Missense_Mutation	SNP	A	A	G			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr11:562466A>G	ENST00000397583.3	+	3	945	c.512A>G	c.(511-513)cAt>cGt	p.H171R	RASSF7_ENST00000454668.2_Missense_Mutation_p.H171R|RP11-496I9.1_ENST00000527113.1_RNA|RASSF7_ENST00000431809.1_Missense_Mutation_p.H171R|RP11-496I9.1_ENST00000527620.1_RNA|RASSF7_ENST00000397582.3_Missense_Mutation_p.H171R|RASSF7_ENST00000344375.4_Missense_Mutation_p.H171R|C11orf35_ENST00000329451.3_5'Flank	NM_003475.3	NP_003466.1	Q02833	RASF7_HUMAN	Ras association (RalGDS/AF-6) domain family (N-terminal) member 7	171					apoptotic process (GO:0006915)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|skin(3)	8		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.18e-28)|Epithelial(43;6.93e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.97e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GAGCTGGGCCATGAGGCCTTC	0.697																																					Pancreas(184;1170 3913 7268)												0													16.0	15.0	16.0					11																	562466		2017	3967	5984	SO:0001583	missense	0			M91083	CCDS7702.1, CCDS44505.1, CCDS44506.1	11p15.5	2008-02-22	2008-02-22	2005-09-14	ENSG00000099849	ENSG00000099849			1166	protein-coding gene	gene with protein product		143023	"""chromosome 11 open reading frame 13"""	C11orf13		1339391	Standard	NM_001143993		Approved	HRC1, HRAS1	uc001lqc.3	Q02833	OTTHUMG00000132004	ENST00000397583.3:c.512A>G	11.37:g.562466A>G	ENSP00000380713:p.His171Arg		G5E9N9|Q3KP41|Q3KP42	Missense_Mutation	SNP	pfam_Ras-assoc,smart_Ras-assoc,pfscan_Ras-assoc	p.H171R	ENST00000397583.3	37	c.512	CCDS7702.1	11	.	.	.	.	.	.	.	.	.	.	A	10.92	1.486332	0.26686	.	.	ENSG00000099849	ENST00000431809;ENST00000397582;ENST00000344375;ENST00000397583;ENST00000454668	D;D;D;D;D	0.92699	-3.09;-3.09;-3.09;-3.09;-3.09	3.52	3.52	0.40303	.	0.380196	0.26757	N	0.022646	D	0.85995	0.5827	L	0.34521	1.04	0.34173	D	0.670057	B;B;B	0.09022	0.001;0.001;0.002	B;B;B	0.06405	0.002;0.002;0.002	D	0.84392	0.0555	10	0.24483	T	0.36	.	12.2365	0.54518	1.0:0.0:0.0:0.0	.	171;171;171	G5E9N9;Q02833;Q02833-2	.;RASF7_HUMAN;.	R	171	ENSP00000403068:H171R;ENSP00000380712:H171R;ENSP00000344226:H171R;ENSP00000380713:H171R;ENSP00000405606:H171R	ENSP00000344226:H171R	H	+	2	0	RASSF7	552466	0.977000	0.34250	0.997000	0.53966	0.848000	0.48234	3.503000	0.53340	1.489000	0.48450	0.379000	0.24179	CAT	RASSF7	-	NULL	ENSG00000099849		0.697	RASSF7-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RASSF7	HGNC	protein_coding	OTTHUMT00000254972.2	-	0.00	49	0	A	NM_003475		562466	+1	tier1	-	no_errors	ENST00000344375	ensembl	human	known	74_37	missense	33.33	22	11	SNP	0.989	G
RBAK	57786	genome.wustl.edu	37	7	5103989	5103989	+	Missense_Mutation	SNP	A	A	C			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr7:5103989A>C	ENST00000353796.3	+	6	1226	c.902A>C	c.(901-903)aAg>aCg	p.K301T	RBAK-RBAKDN_ENST00000396904.2_Intron|RBAK_ENST00000396912.1_Missense_Mutation_p.K301T|RBAK-RBAKDN_ENST00000407184.1_Intron	NM_001204456.1	NP_001191385.1	Q9NYW8	RBAK_HUMAN	RB-associated KRAB zinc finger	301					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(2)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	10		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)		TTCAGCCAAAAGGGAACCCTC	0.408																																																	0													70.0	73.0	72.0					7																	5103989		2203	4300	6503	SO:0001583	missense	0			AF226869	CCDS5337.1	7p22.1	2013-01-08			ENSG00000146587	ENSG00000146587		"""Zinc fingers, C2H2-type"", ""-"""	17680	protein-coding gene	gene with protein product		608191					Standard	NM_021163		Approved	ZNF769	uc003sns.1	Q9NYW8	OTTHUMG00000121155	ENST00000353796.3:c.902A>C	7.37:g.5103989A>C	ENSP00000275423:p.Lys301Thr		A6NDF2|A8KAK4|B2RN44|B9EGS1|F8W6M7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K301T	ENST00000353796.3	37	c.902	CCDS5337.1	7	.	.	.	.	.	.	.	.	.	.	A	13.35	2.211623	0.39102	.	.	ENSG00000146587	ENST00000353796;ENST00000396912	T;T	0.16457	2.34;2.34	3.76	3.76	0.43208	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.53938	D	0.000044	T	0.29061	0.0722	L	0.41906	1.305	0.34527	D	0.708762	D	0.76494	0.999	D	0.79784	0.993	T	0.29088	-1.0023	8	.	.	.	.	11.0559	0.47918	1.0:0.0:0.0:0.0	.	301	Q9NYW8	RBAK_HUMAN	T	301	ENSP00000275423:K301T;ENSP00000380120:K301T	.	K	+	2	0	RBAK	5070515	0.000000	0.05858	1.000000	0.80357	0.997000	0.91878	0.165000	0.16564	1.931000	0.55961	0.454000	0.30748	AAG	RBAK	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000146587		0.408	RBAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBAK	HGNC	protein_coding	OTTHUMT00000241640.2		0.00	31	0	A	NM_021163		5103989	+1			no_errors	ENST00000353796	ensembl	human	known	74_37	missense	5.26	54	3	SNP	0.002	C
RBM12	10137	genome.wustl.edu	37	20	34242782	34242782	+	Missense_Mutation	SNP	C	C	T	rs146169701		TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr20:34242782C>T	ENST00000374114.3	-	3	726	c.463G>A	c.(463-465)Gta>Ata	p.V155I	CPNE1_ENST00000397445.1_Intron|RBM12_ENST00000374104.3_Missense_Mutation_p.V155I|CPNE1_ENST00000397442.1_Intron|CPNE1_ENST00000317677.5_5'Flank|RP1-309K20.6_ENST00000541176.2_Intron|CPNE1_ENST00000352393.4_Intron|CPNE1_ENST00000317619.3_Intron|RBM12_ENST00000359646.1_Missense_Mutation_p.V155I|CPNE1_ENST00000397446.1_Intron|CPNE1_ENST00000397443.1_Intron	NM_001198838.1|NM_001198840.1|NM_006047.5	NP_001185767.1|NP_001185769.1|NP_006038.2	Q9NTZ6	RBM12_HUMAN	RNA binding motif protein 12	155						nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(7)|kidney(1)|large_intestine(3)|lung(14)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			GCTGTTCCTACGCTGGCTGTG	0.478																																																	0								C	,,,,,ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	147.0	145.0	145.0		,,,,,463,463,463,463	-0.8	1.0	20	dbSNP_134	145	0,8600		0,0,4300	yes	intron,intron,intron,intron,intron,missense,missense,missense,missense	CPNE1,RBM12	NM_001198863.1,NM_152925.2,NM_152926.2,NM_152927.2,NM_152928.2,NM_152838.3,NM_006047.5,NM_001198840.1,NM_001198838.1	,,,,,29,29,29,29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,,,,benign,benign,benign,benign	,,,,,155/933,155/933,155/933,155/933	34242782	1,13005	2203	4300	6503	SO:0001583	missense	0			AJ289772	CCDS13261.1	20q11.21	2013-02-12			ENSG00000244462	ENSG00000244462		"""RNA binding motif (RRM) containing"""	9898	protein-coding gene	gene with protein product		607179				11435693	Standard	NM_006047		Approved	HRIHFB2091, KIAA0765, SWAN	uc021wcq.1	Q9NTZ6	OTTHUMG00000032350	ENST00000374114.3:c.463G>A	20.37:g.34242782C>T	ENSP00000363228:p.Val155Ile		B3KRU2|E1P5R6|O94865|Q8N3B1|Q9H196	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.V155I	ENST00000374114.3	37	c.463	CCDS13261.1	20	.	.	.	.	.	.	.	.	.	.	C	1.660	-0.511738	0.04200	2.27E-4	0.0	ENSG00000244462	ENST00000374114;ENST00000359646;ENST00000374104;ENST00000424458	T;T;T;T	0.26067	2.4;2.4;2.4;1.76	5.39	-0.764	0.11027	.	0.509122	0.19976	N	0.101862	T	0.11537	0.0281	N	0.14661	0.345	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.27739	-1.0065	10	0.09084	T	0.74	-1.0017	10.805	0.46512	0.0:0.5071:0.0:0.4929	.	155	Q9NTZ6	RBM12_HUMAN	I	155	ENSP00000363228:V155I;ENSP00000352668:V155I;ENSP00000363217:V155I;ENSP00000411036:V155I	ENSP00000352668:V155I	V	-	1	0	RBM12	33706196	0.988000	0.35896	0.997000	0.53966	0.943000	0.58893	0.075000	0.14686	-0.020000	0.14032	-1.192000	0.01694	GTA	RBM12	-	NULL	ENSG00000244462		0.478	RBM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM12	HGNC	protein_coding	OTTHUMT00000078894.1	-	0.00	38	0	C	NM_006047		34242782	-1	tier1	rs146169701	no_errors	ENST00000359646	ensembl	human	known	74_37	missense	5.80	65	4	SNP	0.996	T
RCAN1	1827	genome.wustl.edu	37	21	35893939	35893939	+	Silent	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr21:35893939G>A	ENST00000313806.4	-	3	574	c.444C>T	c.(442-444)agC>agT	p.S148S	RCAN1_ENST00000381132.2_Silent_p.S93S|RCAN1_ENST00000489903.1_5'UTR|RCAN1_ENST00000399272.1_Silent_p.S67S|RCAN1_ENST00000482533.1_Silent_p.S13S|RCAN1_ENST00000487990.1_Silent_p.S13S|RCAN1_ENST00000443408.2_Silent_p.S13S|RCAN1_ENST00000381135.3_Silent_p.S138S|RCAN1_ENST00000492600.1_Silent_p.S93S|RCAN1_ENST00000481448.1_Silent_p.S138S	NM_004414.5	NP_004405.3	P53805	RCAN1_HUMAN	regulator of calcineurin 1	148					blood circulation (GO:0008015)|calcineurin-NFAT signaling cascade (GO:0033173)|central nervous system development (GO:0007417)|locomotion involved in locomotory behavior (GO:0031987)|negative regulation of smooth muscle cell differentiation (GO:0051151)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|response to ischemia (GO:0002931)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|short-term memory (GO:0007614)|signal transduction (GO:0007165)|skeletal muscle fiber development (GO:0048741)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(1)|large_intestine(1)|lung(2)	5						CCAGGTGTGAGCTTCCTATGT	0.547																																																	0													82.0	84.0	83.0					21																	35893939		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS13637.1, CCDS33551.1, CCDS42921.1, CCDS74788.1, CCDS74790.1	21q22.1-q22.2	2010-08-11	2007-06-26	2007-06-26	ENSG00000159200	ENSG00000159200			3040	protein-coding gene	gene with protein product		602917	"""Down syndrome critical region gene 1"""	DSCR1		8595418	Standard	XM_005260929		Approved		uc002yue.3	P53805	OTTHUMG00000086235	ENST00000313806.4:c.444C>T	21.37:g.35893939G>A			D3DSF9|O00582|O00583|Q53XT0|Q6IBC6|Q7Z555|Q96R03|Q9BU69|Q9UF15|Q9UME4	Silent	SNP	pfam_Calcipressin	p.S148	ENST00000313806.4	37	c.444	CCDS13637.1	21																																																																																			RCAN1	-	pfam_Calcipressin	ENSG00000159200		0.547	RCAN1-001	KNOWN	basic|CCDS	protein_coding	RCAN1	HGNC	protein_coding	OTTHUMT00000194142.1	-	0.00	27	0	G			35893939	-1	tier1	-	no_errors	ENST00000313806	ensembl	human	known	74_37	silent	25.64	29	10	SNP	0.834	A
RCAN3	11123	genome.wustl.edu	37	1	24861731	24861731	+	Silent	SNP	G	G	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr1:24861731G>T	ENST00000374395.4	+	5	1003	c.690G>T	c.(688-690)gcG>gcT	p.A230A	RCAN3_ENST00000436717.2_Silent_p.A220A|RCAN3_ENST00000412742.2_Missense_Mutation_p.R173L|RCAN3_ENST00000538532.1_Silent_p.A172A|RCAN3_ENST00000374393.2_Missense_Mutation_p.R115L	NM_001251978.1|NM_001251979.1|NM_001251984.1	NP_001238907.1|NP_001238908.1|NP_001238913.1	Q9UKA8	RCAN3_HUMAN	RCAN family member 3	230					anatomical structure morphogenesis (GO:0009653)|calcium-mediated signaling (GO:0019722)		RNA binding (GO:0003723)|troponin I binding (GO:0031013)	p.A230A(1)		central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)	7		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00473)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0427)|OV - Ovarian serous cystadenocarcinoma(117;1.13e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;0.000923)|BRCA - Breast invasive adenocarcinoma(304;0.0018)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.00493)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.14)		CGACCGCAGCGTTGAATGAGC	0.587																																																	1	Substitution - coding silent(1)	large_intestine(1)											52.0	51.0	51.0					1																	24861731		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS254.1, CCDS57980.1, CCDS57981.1, CCDS57982.1, CCDS72730.1	1p35.3-p33	2008-02-05	2007-06-26	2007-06-26	ENSG00000117602	ENSG00000117602			3042	protein-coding gene	gene with protein product		605860	"""Down syndrome critical region gene 1-like 2"""	DSCR1L2		10756093	Standard	NM_001251984		Approved		uc001bjj.3	Q9UKA8	OTTHUMG00000003298	ENST00000374395.4:c.690G>T	1.37:g.24861731G>T			A4GU14|A4LA69|E3VWE2|E5L4P0|E5L4P7|E7ENV1|E7EWD8|G1FI66|G1FLF0|Q5ECL3|Q5TGC6|Q9NUC8|Q9UKA7	Missense_Mutation	SNP	pfam_Calcipressin	p.R173L	ENST00000374395.4	37	c.518	CCDS254.1	1	.	.	.	.	.	.	.	.	.	.	G	15.91	2.972910	0.53614	.	.	ENSG00000117602	ENST00000412742;ENST00000374393	.	.	.	5.6	-11.2	0.00127	.	.	.	.	.	T	0.23886	0.0578	.	.	.	0.09310	N	1	B;B	0.21381	0.055;0.013	B;B	0.19666	0.026;0.011	T	0.33240	-0.9876	7	0.62326	D	0.03	-18.5656	6.189	0.20513	0.2229:0.2639:0.4316:0.0816	.	115;173	E7EWD8;E7ENV1	.;.	L	173;115	.	ENSP00000363514:R115L	R	+	2	0	RCAN3	24734318	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-2.833000	0.00742	-2.922000	0.00304	-1.326000	0.01283	CGT	RCAN3	-	NULL	ENSG00000117602		0.587	RCAN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RCAN3	HGNC	protein_coding	OTTHUMT00000009176.2		0.00	43	0	G			24861731	+1			no_errors	ENST00000412742	ensembl	human	known	74_37	missense	6.25	30	2	SNP	0.000	T
RIMKLB	57494	genome.wustl.edu	37	12	8926142	8926142	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr12:8926142C>T	ENST00000538135.1	+	6	1748	c.923C>T	c.(922-924)cCc>cTc	p.P308L	RIMKLB_ENST00000535829.1_Missense_Mutation_p.P308L|RIMKLB_ENST00000357529.3_Missense_Mutation_p.P308L|A2ML1-AS1_ENST00000537288.1_RNA|RIMKLB_ENST00000299673.5_Intron			Q9ULI2	RIMKB_HUMAN	ribosomal modification protein rimK-like family member B	308					cellular protein modification process (GO:0006464)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|citrate-L-glutamate ligase activity (GO:0072591)|metal ion binding (GO:0046872)|N-acetyl-L-aspartate-L-glutamate ligase activity (GO:0072590)			central_nervous_system(2)|kidney(3)|large_intestine(5)|lung(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						TCCCTTCTACCCTCTGGCCGG	0.562																																																	0													75.0	77.0	77.0					12																	8926142		1949	4146	6095	SO:0001583	missense	0			AB033064	CCDS41748.1	12p13.31	2011-09-21	2008-10-13	2008-10-13	ENSG00000166532	ENSG00000166532	6.3.2.N6		29228	protein-coding gene	gene with protein product	"""N-acetylaspartyl-glutamate synthetase"""	614054	"""family with sequence similarity 80, member B"""	FAM80B		10574462, 20643647	Standard	XM_006719116		Approved	KIAA1238, NAAGS, NAAGS-I	uc001qux.2	Q9ULI2		ENST00000538135.1:c.923C>T	12.37:g.8926142C>T	ENSP00000440943:p.Pro308Leu		B7Z834|D3DUV2|Q8N4P4|Q8WTW6	Missense_Mutation	SNP	pfam_ATP-grasp_RimK-type,pfam_GSHS_ATP-bd,pfam_ATP-grasp_DUF201-type,pfscan_ATP-grasp,tigrfam_RpS6_RimK/Lys_biosynth_LsyX	p.P308L	ENST00000538135.1	37	c.923	CCDS41748.1	12	.	.	.	.	.	.	.	.	.	.	C	18.47	3.630392	0.67015	.	.	ENSG00000166532	ENST00000535829;ENST00000357529;ENST00000538135	.	.	.	5.72	5.72	0.89469	.	0.064424	0.64402	U	0.000006	T	0.62024	0.2394	L	0.34521	1.04	0.80722	D	1	D	0.69078	0.997	D	0.63793	0.918	T	0.58912	-0.7552	8	.	.	.	.	11.8477	0.52393	0.0:0.9199:0.0:0.0801	.	308	Q9ULI2	RIMKB_HUMAN	L	308	.	.	P	+	2	0	RIMKLB	8817409	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.764000	0.55264	2.689000	0.91719	0.591000	0.81541	CCC	RIMKLB	-	NULL	ENSG00000166532		0.562	RIMKLB-004	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMKLB	HGNC	protein_coding	OTTHUMT00000398874.1	-	0.00	20	0	C	NM_020734		8926142	+1	tier1	-	no_errors	ENST00000357529	ensembl	human	known	74_37	missense	26.09	17	6	SNP	1.000	T
RMDN2	151393	genome.wustl.edu	37	2	38201273	38201273	+	Silent	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr2:38201273C>T	ENST00000406384.1	+	3	737	c.543C>T	c.(541-543)gtC>gtT	p.V181V	RMDN2_ENST00000417700.2_Silent_p.V36V|RMDN2_ENST00000354545.2_Silent_p.V181V|RMDN2_ENST00000234195.3_Silent_p.V359V|RMDN2_ENST00000407257.1_Silent_p.V359V|RMDN2-AS1_ENST00000414365.2_RNA	NM_001170792.1	NP_001164263.1	Q96LZ7	RMD2_HUMAN	regulator of microtubule dynamics 2	181						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)											ATTTAGATGTCCTTCTTCAGA	0.383																																																	0													139.0	137.0	137.0					2																	38201273		2203	4300	6503	SO:0001819	synonymous_variant	0			AK057516	CCDS1792.1, CCDS54351.1, CCDS54352.1	2p22.2	2013-01-11	2013-01-11	2013-01-11	ENSG00000115841	ENSG00000115841			26567	protein-coding gene	gene with protein product		611872	"""family with sequence similarity 82, member A1"""	FAM82A, FAM82A1		12477932	Standard	XM_005264161		Approved	FLJ32954, RMD2	uc002rqn.2	Q96LZ7	OTTHUMG00000128487	ENST00000406384.1:c.543C>T	2.37:g.38201273C>T			A9UMZ7|A9UN00|Q4ZG33|Q6UXN4|Q8N657|Q8N9A2|Q8NCV6|Q8NHM0	Silent	SNP	NULL	p.V359	ENST00000406384.1	37	c.1077	CCDS54351.1	2																																																																																			RMDN2	-	NULL	ENSG00000115841		0.383	RMDN2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RMDN2	HGNC	protein_coding	OTTHUMT00000325577.1	-	0.00	55	0	C	NM_144713		38201273	+1	tier1	-	no_errors	ENST00000234195	ensembl	human	known	74_37	silent	12.20	72	10	SNP	0.093	T
RNF150	57484	genome.wustl.edu	37	4	142053712	142053712	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr4:142053712T>C	ENST00000515673.2	-	1	284	c.251A>G	c.(250-252)cAg>cGg	p.Q84R	RNF150_ENST00000306799.3_Missense_Mutation_p.Q84R|RNF150_ENST00000420921.2_Intron|RNF150_ENST00000507500.1_Missense_Mutation_p.Q84R			Q9ULK6	RN150_HUMAN	ring finger protein 150	84	PA.					integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)|large_intestine(10)|lung(7)|ovary(1)	19	all_hematologic(180;0.162)					GCGGGCGTCCTGCTTGGGCGA	0.771																																																	0													11.0	14.0	13.0					4																	142053712		2191	4277	6468	SO:0001583	missense	0			AB033040	CCDS34065.1	4q31.1	2013-01-09			ENSG00000170153	ENSG00000170153		"""RING-type (C3HC4) zinc fingers"""	23138	protein-coding gene	gene with protein product						10574462	Standard	XM_005263150		Approved	KIAA1214	uc003iio.1	Q9ULK6	OTTHUMG00000161380	ENST00000515673.2:c.251A>G	4.37:g.142053712T>C	ENSP00000425840:p.Gln84Arg		Q3T1D0|Q6ZNW6	Missense_Mutation	SNP	pfam_Protease-assoc_domain,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.Q84R	ENST00000515673.2	37	c.251	CCDS34065.1	4	.	.	.	.	.	.	.	.	.	.	T	10.91	1.484552	0.26598	.	.	ENSG00000170153	ENST00000306799;ENST00000515673;ENST00000507500	T;T;T	0.07444	3.19;3.19;3.19	4.06	-0.224	0.13115	Protease-associated domain, PA (1);	0.452343	0.19653	N	0.109177	T	0.03011	0.0089	N	0.04355	-0.22	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.09377	0.002;0.002;0.004	T	0.46816	-0.9164	10	0.27082	T	0.32	.	5.3329	0.15942	0.2692:0.0791:0.0:0.6517	.	84;84;84	Q9ULK6-2;Q9ULK6-3;Q9ULK6	.;.;RN150_HUMAN	R	84	ENSP00000304321:Q84R;ENSP00000425840:Q84R;ENSP00000425568:Q84R	ENSP00000304321:Q84R	Q	-	2	0	RNF150	142273162	1.000000	0.71417	0.999000	0.59377	0.907000	0.53573	1.566000	0.36396	0.127000	0.18452	-0.547000	0.04224	CAG	RNF150	-	NULL	ENSG00000170153		0.771	RNF150-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF150	HGNC	protein_coding	OTTHUMT00000364739.2	-	0.00	36	0	T	XM_291090		142053712	-1	tier1	-	no_errors	ENST00000515673	ensembl	human	known	74_37	missense	34.29	23	12	SNP	0.998	C
RNF169	254225	genome.wustl.edu	37	11	74547657	74547657	+	Missense_Mutation	SNP	G	G	T	rs192609539	byFrequency	TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr11:74547657G>T	ENST00000299563.4	+	6	2022	c.2009G>T	c.(2008-2010)cGa>cTa	p.R670L		NM_001098638.1	NP_001092108.1	Q8NCN4	RN169_HUMAN	ring finger protein 169	670					cellular response to DNA damage stimulus (GO:0006974)|negative regulation of double-strand break repair (GO:2000780)|protein ubiquitination (GO:0016567)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|site of double-strand break (GO:0035861)	K63-linked polyubiquitin binding (GO:0070530)|ligase activity (GO:0016874)|nucleosome binding (GO:0031491)|zinc ion binding (GO:0008270)	p.R670Q(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|urinary_tract(1)	15						GAAGAAGACCGACAGTTGGCT	0.552																																																	1	Substitution - Missense(1)	urinary_tract(1)											78.0	81.0	80.0					11																	74547657		1962	4137	6099	SO:0001583	missense	0			AB082522	CCDS41691.1	11q13.4	2008-02-05			ENSG00000166439	ENSG00000166439		"""RING-type (C3HC4) zinc fingers"""	26961	protein-coding gene	gene with protein product						12056414	Standard	NM_001098638		Approved	KIAA1991	uc001ovl.4	Q8NCN4	OTTHUMG00000165516	ENST00000299563.4:c.2009G>T	11.37:g.74547657G>T	ENSP00000299563:p.Arg670Leu		Q6N015	Missense_Mutation	SNP	smart_Znf_RING,pfscan_Znf_RING	p.R670L	ENST00000299563.4	37	c.2009	CCDS41691.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.85|14.85	2.658746|2.658746	0.47467|0.47467	.|.	.|.	ENSG00000166439|ENSG00000166439	ENST00000527301|ENST00000299563	.|T	.|0.55760	.|0.5	5.53|5.53	3.64|3.64	0.41730|0.41730	.|.	.|0.211078	.|0.36338	.|N	.|0.002657	T|T	0.48677|0.48677	0.1513|0.1513	M|M	0.70595|0.70595	2.14|2.14	0.80722|0.80722	D|D	1|1	.|P	.|0.48407	.|0.91	.|B	.|0.40677	.|0.337	T|T	0.51896|0.51896	-0.8647|-0.8647	5|10	.|0.87932	.|D	.|0	-6.4608|-6.4608	7.2913|7.2913	0.26368|0.26368	0.2739:0.0:0.7261:0.0|0.2739:0.0:0.7261:0.0	.|.	.|670	.|Q8NCN4	.|RN169_HUMAN	Y|L	41|670	.|ENSP00000299563:R670L	.|ENSP00000299563:R670L	D|R	+|+	1|2	0|0	RNF169|RNF169	74225305|74225305	1.000000|1.000000	0.71417|0.71417	0.807000|0.807000	0.32361|0.32361	0.990000|0.990000	0.78478|0.78478	4.206000|4.206000	0.58473|0.58473	0.797000|0.797000	0.33971|0.33971	0.655000|0.655000	0.94253|0.94253	GAC|CGA	RNF169	-	NULL	ENSG00000166439		0.552	RNF169-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF169	HGNC	protein_coding	OTTHUMT00000384741.1		0.00	17	0	G	XM_495886		74547657	+1			no_errors	ENST00000299563	ensembl	human	known	74_37	missense	5.56	34	2	SNP	0.924	T
RP1	6101	genome.wustl.edu	37	8	55538983	55538983	+	Silent	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr8:55538983G>A	ENST00000220676.1	+	4	2689	c.2541G>A	c.(2539-2541)ttG>ttA	p.L847L		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	847					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)	p.L847F(1)		NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			CTGGGTATTTGAGAGGAATGG	0.343																																					Colon(91;1014 1389 7634 14542 40420)												1	Substitution - Missense(1)	cervix(1)											43.0	46.0	45.0					8																	55538983		2203	4298	6501	SO:0001819	synonymous_variant	0			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.2541G>A	8.37:g.55538983G>A				Silent	SNP	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.L847	ENST00000220676.1	37	c.2541	CCDS6160.1	8																																																																																			RP1	-	NULL	ENSG00000104237		0.343	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1	HGNC	protein_coding	OTTHUMT00000378532.2	-	0.00	92	0	G	NM_006269		55538983	+1	tier1	-	no_errors	ENST00000220676	ensembl	human	known	74_37	silent	70.51	23	55	SNP	0.895	A
RPF1	80135	genome.wustl.edu	37	1	84961948	84961948	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr1:84961948G>T	ENST00000370654.5	+	8	918	c.903G>T	c.(901-903)aaG>aaT	p.K301N	GNG5_ENST00000487806.1_5'Flank	NM_025065.6	NP_079341.2	Q9H9Y2	RPF1_HUMAN	ribosome production factor 1 homolog (S. cerevisiae)	301	Brix. {ECO:0000255|PROSITE- ProRule:PRU00034}.				rRNA processing (GO:0006364)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)			breast(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(2)|prostate(1)	14						GGAGTGAAAAGAAAGTGGGAA	0.333																																																	0													75.0	78.0	77.0					1																	84961948		2203	4300	6503	SO:0001583	missense	0			AF322053	CCDS695.1	1p22.3	2009-09-25	2009-09-25	2009-09-25	ENSG00000117133	ENSG00000117133			30350	protein-coding gene	gene with protein product	"""RNA processing factor 1"", ""ribosome production factor 1"""		"""brix domain containing 5"""	BXDC5		11864606	Standard	NM_025065		Approved		uc001djv.4	Q9H9Y2	OTTHUMG00000009857	ENST00000370654.5:c.903G>T	1.37:g.84961948G>T	ENSP00000359688:p.Lys301Asn		Q5VSK7|Q6AHX1|Q8WXZ8	Missense_Mutation	SNP	pfam_Brix,superfamily_Anticodon-bd,smart_Brix,pfscan_Brix	p.K301N	ENST00000370654.5	37	c.903	CCDS695.1	1	.	.	.	.	.	.	.	.	.	.	G	14.75	2.628407	0.46944	.	.	ENSG00000117133	ENST00000370654	T	0.23552	1.9	6.07	3.23	0.37069	Brix domain (3);Anticodon-binding (1);	0.000000	0.85682	D	0.000000	T	0.15782	0.0380	M	0.63843	1.955	0.53688	D	0.999972	B	0.29212	0.237	B	0.35114	0.196	T	0.02893	-1.1097	10	0.66056	D	0.02	-16.4377	10.0752	0.42355	0.2648:0.0:0.7352:0.0	.	301	Q9H9Y2	RPF1_HUMAN	N	301	ENSP00000359688:K301N	ENSP00000359688:K301N	K	+	3	2	RPF1	84734536	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.688000	0.46984	0.460000	0.27045	-0.150000	0.13652	AAG	RPF1	-	pfam_Brix,superfamily_Anticodon-bd,smart_Brix,pfscan_Brix	ENSG00000117133		0.333	RPF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPF1	HGNC	protein_coding	OTTHUMT00000027238.1		0.00	55	0	G	NM_025065		84961948	+1			no_errors	ENST00000370654	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	T
RPGRIP1L	23322	genome.wustl.edu	37	16	53682892	53682892	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr16:53682892G>T	ENST00000379925.3	-	16	2338	c.2288C>A	c.(2287-2289)cCa>cAa	p.P763Q	RPGRIP1L_ENST00000564374.1_Missense_Mutation_p.P763Q|RPGRIP1L_ENST00000563746.1_Missense_Mutation_p.P763Q|RPGRIP1L_ENST00000262135.4_Missense_Mutation_p.P763Q	NM_015272.2	NP_056087.2	Q68CZ1	FTM_HUMAN	RPGRIP1-like	763					camera-type eye development (GO:0043010)|cerebellum development (GO:0021549)|cilium assembly (GO:0042384)|corpus callosum development (GO:0022038)|determination of left/right symmetry (GO:0007368)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment or maintenance of cell polarity (GO:0007163)|head development (GO:0060322)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lateral ventricle development (GO:0021670)|liver development (GO:0001889)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|neural tube patterning (GO:0021532)|nose development (GO:0043584)|olfactory bulb development (GO:0021772)|pericardium development (GO:0060039)|regulation of smoothened signaling pathway (GO:0008589)	axoneme (GO:0005930)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	thromboxane A2 receptor binding (GO:0031870)			endometrium(6)|kidney(3)|large_intestine(9)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(2)	46		all_cancers(37;0.0973)				CATATGCTCTGGCCCCTTAAA	0.358																																																	0													105.0	97.0	99.0					16																	53682892		2198	4300	6498	SO:0001583	missense	0				CCDS32447.1, CCDS45486.1	16q12.2	2014-09-17				ENSG00000103494			29168	protein-coding gene	gene with protein product	"""fantom homolog"", ""Meckel syndrome, type 5"", ""protein phosphatase 1, regulatory subunit 134"""	610937				10231032	Standard	NM_015272		Approved	KIAA1005, CORS3, JBTS7, MKS5, NPHP8, FTM, PPP1R134	uc002ehp.3	Q68CZ1		ENST00000379925.3:c.2288C>A	16.37:g.53682892G>T	ENSP00000369257:p.Pro763Gln		A0PJ88|Q9Y2K8	Missense_Mutation	SNP	pfam_DUF3250,pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.P763Q	ENST00000379925.3	37	c.2288	CCDS32447.1	16	.	.	.	.	.	.	.	.	.	.	G	5.940	0.357488	0.11239	.	.	ENSG00000103494	ENST00000379925;ENST00000262135	T;T	0.75938	-0.78;-0.98	6.08	4.1	0.47936	.	0.417989	0.26069	N	0.026534	T	0.56171	0.1967	N	0.24115	0.695	0.49213	D	0.999769	B;B;B;B	0.33883	0.103;0.103;0.43;0.132	B;B;B;B	0.26416	0.035;0.035;0.052;0.069	T	0.53989	-0.8360	10	0.42905	T	0.14	-1.2134	9.3742	0.38272	0.0684:0.0:0.6295:0.3021	.	763;763;763;763	B4E3M8;B7ZKJ9;Q68CZ1;Q68CZ1-2	.;.;FTM_HUMAN;.	Q	763	ENSP00000369257:P763Q;ENSP00000262135:P763Q	ENSP00000262135:P763Q	P	-	2	0	RPGRIP1L	52240393	1.000000	0.71417	0.246000	0.24233	0.017000	0.09413	1.315000	0.33608	0.873000	0.35799	0.591000	0.81541	CCA	RPGRIP1L	-	NULL	ENSG00000103494		0.358	RPGRIP1L-009	KNOWN	basic|CCDS	protein_coding	RPGRIP1L	HGNC	protein_coding	OTTHUMT00000422187.1		0.00	118	0	G	NM_015272		53682892	-1			no_errors	ENST00000379925	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.673	T
SAMSN1	64092	genome.wustl.edu	37	21	15882676	15882676	+	Silent	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr21:15882676C>T	ENST00000400566.1	-	5	597	c.516G>A	c.(514-516)acG>acA	p.T172T	SAMSN1_ENST00000400564.1_Intron|SAMSN1_ENST00000285670.2_Silent_p.T240T	NM_022136.4	NP_071419.3	Q9NSI8	SAMN1_HUMAN	SAM domain, SH3 domain and nuclear localization signals 1	172	SH3.				negative regulation of adaptive immune response (GO:0002820)|negative regulation of B cell activation (GO:0050869)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)	cell projection (GO:0042995)|cytosol (GO:0005829)|nucleus (GO:0005634)	phosphotyrosine binding (GO:0001784)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	24				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.00118)|Colorectal(24;0.00961)|Lung(58;0.164)		GCGTGAAATCCGTATGCACTC	0.483																																																	0													146.0	146.0	146.0					21																	15882676		2181	4282	6463	SO:0001819	synonymous_variant	0			AF222927	CCDS42906.1, CCDS58786.1, CCDS74774.1	21q11	2013-01-10	2006-12-13		ENSG00000155307	ENSG00000155307		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	10528	protein-coding gene	gene with protein product	"""nuclear localization signals, SAM and SH3 domain containing 1"", ""SAM and SH3 domain containing 2"", ""hematopoietic adapter-containing SH3 and sterile &#945;-motif (SAM) domains 1"", ""Src homology domain 3 (SH3)-containing adapter protein SH3 lymphocyte protein 2"""	607978				11536050, 11594764	Standard	NM_022136		Approved	NASH1, SASH2, SH3D6B, HACS1, SLy2	uc002yjv.1	Q9NSI8	OTTHUMG00000074317	ENST00000400566.1:c.516G>A	21.37:g.15882676C>T			B3KWJ3|F8WAA1|Q8NFF7|Q9C041	Silent	SNP	pfam_rSAM/SH3_domain-containing,pfam_SAM_2,pfam_SAM_type1,pfam_SH3_2,superfamily_SAM/pointed,superfamily_SH3_domain,smart_SH3_domain,smart_SAM,pfscan_SAM	p.T172	ENST00000400566.1	37	c.516	CCDS42906.1	21																																																																																			SAMSN1	-	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain	ENSG00000155307		0.483	SAMSN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMSN1	HGNC	protein_coding	OTTHUMT00000157914.1	-	0.00	27	0	C			15882676	-1	tier1	-	no_errors	ENST00000400566	ensembl	human	known	74_37	silent	53.57	13	15	SNP	0.132	T
SEC16A	9919	genome.wustl.edu	37	9	139338310	139338310	+	Frame_Shift_Del	DEL	C	C	-			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr9:139338310delC	ENST00000371706.3	-	27	6334	c.6301delG	c.(6301-6303)gccfs	p.A2101fs	SEC16A_ENST00000431893.2_Frame_Shift_Del_p.A2121fs|SEC16A_ENST00000290037.6_Frame_Shift_Del_p.A2126fs|SEC16A_ENST00000313084.5_Frame_Shift_Del_p.A352fs|SEC16A_ENST00000467838.1_5'UTR|SEC16A_ENST00000313050.7_Frame_Shift_Del_p.A2324fs			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	2146	Pro-rich.|Required for interaction with SEC23A.			S -> P (in Ref. 6; AAH28183). {ECO:0000305}.	COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		AAGGGCATGGCCCCGCTGGGA	0.632																																																	0													56.0	66.0	63.0					9																	139338310		2092	4222	6314	SO:0001589	frameshift_variant	0			AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.6301delG	9.37:g.139338310delC	ENSP00000360771:p.Ala2101fs		A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Frame_Shift_Del	DEL	NULL	p.A2324fs	ENST00000371706.3	37	c.6970		9																																																																																			SEC16A	-	NULL	ENSG00000148396		0.632	SEC16A-001	KNOWN	basic	protein_coding	SEC16A	HGNC	protein_coding	OTTHUMT00000055077.1		0.00	18	0	C	XM_088459		139338310	-1	tier1		no_errors	ENST00000313050	ensembl	human	known	74_37	frame_shift_del	10.53	17	2	DEL	0.003	-
SEC16A	9919	genome.wustl.edu	37	9	139370297	139370297	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr9:139370297G>A	ENST00000371706.3	-	1	1270	c.1237C>T	c.(1237-1239)Ccc>Tcc	p.P413S	SEC16A_ENST00000431893.2_Missense_Mutation_p.P413S|SEC16A_ENST00000290037.6_Missense_Mutation_p.P413S|SEC16A_ENST00000313050.7_Missense_Mutation_p.P591S			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	413					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		GGGGTTGAGGGCTGGGACACG	0.473																																																	0													27.0	31.0	29.0					9																	139370297		2105	4238	6343	SO:0001583	missense	0			AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.1237C>T	9.37:g.139370297G>A	ENSP00000360771:p.Pro413Ser		A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Missense_Mutation	SNP	NULL	p.P591S	ENST00000371706.3	37	c.1771		9	.	.	.	.	.	.	.	.	.	.	G	20.5	3.997184	0.74818	.	.	ENSG00000148396	ENST00000313050;ENST00000371706;ENST00000290037;ENST00000431893;ENST00000404925	T;T;T;T	0.43294	0.98;0.97;0.95;0.96	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.65004	0.2650	M	0.68952	2.095	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.81914	0.989;0.995;0.995;0.984	T	0.65747	-0.6093	10	0.72032	D	0.01	-24.1639	18.9654	0.92694	0.0:0.0:1.0:0.0	.	591;413;413;218	F1T0I1;O15027-5;O15027-4;A4QN19	.;.;.;.	S	591;413;413;413;218	ENSP00000325827:P591S;ENSP00000360771:P413S;ENSP00000290037:P413S;ENSP00000387583:P413S	ENSP00000290037:P413S	P	-	1	0	SEC16A	138490118	1.000000	0.71417	0.998000	0.56505	0.863000	0.49368	5.124000	0.64709	2.800000	0.96347	0.655000	0.94253	CCC	SEC16A	-	NULL	ENSG00000148396		0.473	SEC16A-001	KNOWN	basic	protein_coding	SEC16A	HGNC	protein_coding	OTTHUMT00000055077.1	-	0.00	56	0	G	XM_088459		139370297	-1	tier1	-	no_errors	ENST00000313050	ensembl	human	known	74_37	missense	9.09	40	4	SNP	1.000	A
SEC24C	9632	genome.wustl.edu	37	10	75526866	75526866	+	Nonsense_Mutation	SNP	G	G	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr10:75526866G>T	ENST00000339365.2	+	15	2110	c.1948G>T	c.(1948-1950)Gag>Tag	p.E650*	SEC24C_ENST00000535742.1_Intron|SEC24C_ENST00000411652.2_Nonsense_Mutation_p.E531*|SEC24C_ENST00000345254.4_Nonsense_Mutation_p.E650*|SEC24C_ENST00000540668.1_Intron	NM_004922.3	NP_004913.2	P53992	SC24C_HUMAN	SEC24 family member C	650					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(12)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	Prostate(51;0.0112)					GCCCATTGCAGAGGCCCCAGG	0.468																																																	0													90.0	88.0	88.0					10																	75526866		2203	4300	6503	SO:0001587	stop_gained	0			D38555	CCDS7332.1	10q22	2013-10-21	2013-10-21		ENSG00000176986	ENSG00000176986			10705	protein-coding gene	gene with protein product		607185	"""SEC24 (S. cerevisiae) related gene family, member C"", ""SEC24 family, member C (S. cerevisiae)"""			10214955, 7584044	Standard	NM_004922		Approved	KIAA0079	uc001jux.3	P53992	OTTHUMG00000018476	ENST00000339365.2:c.1948G>T	10.37:g.75526866G>T	ENSP00000343405:p.Glu650*		B4DZT4|Q8WV25	Nonsense_Mutation	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom,superfamily_Znf_Sec23_Sec24	p.E650*	ENST00000339365.2	37	c.1948	CCDS7332.1	10	.	.	.	.	.	.	.	.	.	.	G	38	6.773123	0.97829	.	.	ENSG00000176986	ENST00000345254;ENST00000339365;ENST00000411652	.	.	.	5.57	5.57	0.84162	.	0.043342	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	-12.8558	19.6032	0.95572	0.0:0.0:1.0:0.0	.	.	.	.	X	650;650;531	.	ENSP00000343405:E650X	E	+	1	0	SEC24C	75196872	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.643000	0.89663	0.555000	0.69702	GAG	SEC24C	-	pfam_Sec23/24_trunk_dom	ENSG00000176986		0.468	SEC24C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC24C	HGNC	protein_coding	OTTHUMT00000048679.1	-	0.00	25	0	G			75526866	+1	tier1	-	no_errors	ENST00000339365	ensembl	human	known	74_37	nonsense	14.29	18	3	SNP	1.000	T
SHC3	53358	genome.wustl.edu	37	9	91653172	91653172	+	Silent	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr9:91653172G>A	ENST00000375835.4	-	11	1698	c.1392C>T	c.(1390-1392)ccC>ccT	p.P464P	SHC3_ENST00000375830.1_Silent_p.P12P|SHC3_ENST00000375831.1_Silent_p.P12P	NM_016848.5	NP_058544.3	Q92529	SHC3_HUMAN	SHC (Src homology 2 domain containing) transforming protein 3	464	CH1.				central nervous system development (GO:0007417)|epidermal growth factor receptor signaling pathway (GO:0007173)|insulin receptor signaling pathway (GO:0008286)|learning or memory (GO:0007611)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Ras protein signal transduction (GO:0007265)|synaptic transmission, glutamatergic (GO:0035249)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)	signal transducer activity (GO:0004871)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|skin(3)	28						CGGGCCCCAAGGGCTGGTTCT	0.478																																																	0													69.0	73.0	71.0					9																	91653172		2203	4300	6503	SO:0001819	synonymous_variant	0			D84361	CCDS6681.1	9q22.1	2013-02-14	2005-05-24		ENSG00000148082	ENSG00000148082		"""SH2 domain containing"""	18181	protein-coding gene	gene with protein product		605263	"""src homology 2 domain containing transforming protein C3"""			8808684	Standard	NM_016848		Approved	N-Shc, NSHC, SHCC	uc004aqf.2	Q92529	OTTHUMG00000020179	ENST00000375835.4:c.1392C>T	9.37:g.91653172G>A			Q5T7I7|Q8TAP2|Q9UCX5	Silent	SNP	pfam_PTB/PI_dom,pfam_SH2,smart_PTB/PI_dom,smart_SH2,pfscan_PTB/PI_dom,pfscan_SH2,prints_PID_Shc-like,prints_SH2	p.P464	ENST00000375835.4	37	c.1392	CCDS6681.1	9																																																																																			SHC3	-	NULL	ENSG00000148082		0.478	SHC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHC3	HGNC	protein_coding	OTTHUMT00000052986.1	-	0.00	57	0	G	NM_016848		91653172	-1	tier1	-	no_errors	ENST00000375835	ensembl	human	known	74_37	silent	22.95	47	14	SNP	0.000	A
SHOC2	8036	genome.wustl.edu	37	10	112769572	112769572	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr10:112769572C>A	ENST00000369452.4	+	8	1869	c.1524C>A	c.(1522-1524)caC>caA	p.H508Q	SHOC2_ENST00000265277.5_Missense_Mutation_p.H462Q|SHOC2_ENST00000489390.1_3'UTR	NM_007373.3	NP_031399.2	Q9UQ13	SHOC2_HUMAN	soc-2 suppressor of clear homolog (C. elegans)	508					fibroblast growth factor receptor signaling pathway (GO:0008543)|positive regulation of Ras protein signal transduction (GO:0046579)|Ras protein signal transduction (GO:0007265)|regulation of catalytic activity (GO:0050790)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein phosphatase type 1 complex (GO:0000164)	protein phosphatase binding (GO:0019903)|protein phosphatase regulator activity (GO:0019888)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|skin(2)	17				Epithelial(162;0.000796)|all cancers(201;0.011)|BRCA - Breast invasive adenocarcinoma(275;0.126)		TACTTACTCACCTTCCTGAAG	0.398																																																	0													102.0	90.0	94.0					10																	112769572		2203	4300	6503	SO:0001583	missense	0			AB020669	CCDS7568.1, CCDS58095.1	10q25	2014-09-17	2001-11-28		ENSG00000108061	ENSG00000108061			15454	protein-coding gene	gene with protein product		602775	"""soc-2 (suppressor of clear, C.elegans) homolog"""			9618511, 9674433, 10783161	Standard	NM_007373		Approved	KIAA0862, SOC2, SUR-8, SOC-2, SUR8	uc001kzl.4	Q9UQ13	OTTHUMG00000019047	ENST00000369452.4:c.1524C>A	10.37:g.112769572C>A	ENSP00000358464:p.His508Gln		A8K9W8|B3KR23|O76063|Q5VZS8|Q5VZS9	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.H508Q	ENST00000369452.4	37	c.1524	CCDS7568.1	10	.	.	.	.	.	.	.	.	.	.	C	9.522	1.108523	0.20714	.	.	ENSG00000108061	ENST00000265277;ENST00000369452;ENST00000451838	T;T;T	0.57907	0.37;0.37;0.37	5.75	3.45	0.39498	.	0.087086	0.85682	N	0.000000	T	0.28599	0.0708	N	0.12471	0.22	0.51012	D	0.999906	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.003	T	0.04579	-1.0941	10	0.25751	T	0.34	.	5.1977	0.15246	0.0:0.2452:0.1436:0.6112	.	462;508	Q9UQ13-2;Q9UQ13	.;SHOC2_HUMAN	Q	462;508;298	ENSP00000265277:H462Q;ENSP00000358464:H508Q;ENSP00000408275:H298Q	ENSP00000265277:H462Q	H	+	3	2	SHOC2	112759562	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	1.016000	0.29976	0.460000	0.27045	-0.482000	0.04802	CAC	SHOC2	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000108061		0.398	SHOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHOC2	HGNC	protein_coding	OTTHUMT00000050355.1	-	0.00	57	0	C	NM_007373		112769572	+1	tier1	-	no_errors	ENST00000369452	ensembl	human	known	74_37	missense	58.49	22	31	SNP	1.000	A
SIAE	54414	genome.wustl.edu	37	11	124508462	124508462	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr11:124508462C>G	ENST00000263593.3	-	9	1468	c.1296G>C	c.(1294-1296)caG>caC	p.Q432H	SIAE_ENST00000545756.1_Missense_Mutation_p.Q397H|RNA5SP352_ENST00000363408.1_RNA			Q9HAT2	SIAE_HUMAN	sialic acid acetylesterase	432					carbohydrate metabolic process (GO:0005975)|regulation of immune system process (GO:0002682)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	sialate O-acetylesterase activity (GO:0001681)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(2)	15	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.63e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0243)		TGTCCTTTTTCTGCACCTGGA	0.448																																																	0													170.0	135.0	147.0					11																	124508462		2201	4299	6500	SO:0001583	missense	0			AF300796	CCDS8449.1, CCDS55795.1	11q24	2005-12-15	2005-12-15	2005-12-15		ENSG00000110013			18187	protein-coding gene	gene with protein product	"""sialic acid-specific acetylesterase II"""	610079	"""Ysg2 homolog (mouse)"""	YSG2		10464298	Standard	NM_001199922		Approved	CSE-C, MGC87009, LSE	uc001qan.3	Q9HAT2		ENST00000263593.3:c.1296G>C	11.37:g.124508462C>G	ENSP00000263593:p.Gln432His		B3KPB0|Q8IUT9|Q9HAU7|Q9NT71	Missense_Mutation	SNP	pfam_DUF303_acetylest	p.Q432H	ENST00000263593.3	37	c.1296	CCDS8449.1	11	.	.	.	.	.	.	.	.	.	.	C	9.341	1.063003	0.19987	.	.	ENSG00000110013	ENST00000263593;ENST00000545756	D;D	0.83914	-1.78;-1.77	5.44	3.49	0.39957	.	1.045090	0.07483	N	0.904162	T	0.80742	0.4681	M	0.72479	2.2	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.64947	-0.6287	10	0.39692	T	0.17	-14.383	5.4859	0.16749	0.1449:0.6373:0.1403:0.0775	.	432	Q9HAT2	SIAE_HUMAN	H	432;397	ENSP00000263593:Q432H;ENSP00000437877:Q397H	ENSP00000263593:Q432H	Q	-	3	2	SIAE	124013672	0.000000	0.05858	0.329000	0.25429	0.680000	0.39746	-0.039000	0.12124	0.611000	0.30052	0.655000	0.94253	CAG	SIAE	-	NULL	ENSG00000110013		0.448	SIAE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIAE	HGNC	protein_coding	OTTHUMT00000387070.1	-	0.00	103	0	C	NM_170601		124508462	-1	tier1	-	no_errors	ENST00000263593	ensembl	human	known	74_37	missense	7.43	137	11	SNP	0.009	G
SIGLEC1	6614	genome.wustl.edu	37	20	3678715	3678715	+	Missense_Mutation	SNP	G	G	A	rs558364870		TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr20:3678715G>A	ENST00000344754.4	-	8	1851	c.1852C>T	c.(1852-1854)Cgg>Tgg	p.R618W	SIGLEC1_ENST00000202578.4_Missense_Mutation_p.R618W	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	618	Ig-like C2-type 6.				cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						AGGCCTCGCCGTCCAGCCCCG	0.662													G|||	1	0.000199681	0.0	0.0	5008	,	,		17787	0.001		0.0	False		,,,				2504	0.0																0													12.0	13.0	13.0					20																	3678715		2190	4282	6472	SO:0001583	missense	0			AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.1852C>T	20.37:g.3678715G>A	ENSP00000341141:p.Arg618Trp		Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R618W	ENST00000344754.4	37	c.1852	CCDS13060.1	20	.	.	.	.	.	.	.	.	.	.	G	23.3	4.404835	0.83230	.	.	ENSG00000088827	ENST00000344754;ENST00000202578	T;T	0.23950	1.91;1.88	5.19	3.17	0.36434	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.721938	0.11432	N	0.564665	T	0.46600	0.1401	M	0.77103	2.36	0.09310	N	1	D;D	0.89917	1.0;1.0	D;P	0.65987	0.94;0.899	T	0.23048	-1.0199	10	0.66056	D	0.02	.	7.5572	0.27831	0.0:0.1544:0.5526:0.2931	.	618;618	Q9BZZ2;Q9BZZ2-3	SN_HUMAN;.	W	618	ENSP00000341141:R618W;ENSP00000202578:R618W	ENSP00000202578:R618W	R	-	1	2	SIGLEC1	3626715	0.000000	0.05858	0.008000	0.14137	0.692000	0.40212	0.669000	0.25142	2.710000	0.92621	0.655000	0.94253	CGG	SIGLEC1	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000088827		0.662	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIGLEC1	HGNC	protein_coding	OTTHUMT00000077761.2	-	0.00	63	0	G	NM_023068		3678715	-1	tier1	-	no_errors	ENST00000344754	ensembl	human	known	74_37	missense	38.37	53	33	SNP	0.001	A
SIGLEC11	114132	genome.wustl.edu	37	19	50455220	50455220	+	Missense_Mutation	SNP	G	G	C			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr19:50455220G>C	ENST00000447370.2	-	10	1848	c.1758C>G	c.(1756-1758)atC>atG	p.I586M	CTC-326K19.6_ENST00000451973.1_3'UTR|SIGLEC11_ENST00000426971.2_Missense_Mutation_p.I490M|U3_ENST00000408198.1_RNA	NM_052884.2	NP_443116.2	Q96RL6	SIG11_HUMAN	sialic acid binding Ig-like lectin 11	586					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(6)|pancreas(1)|prostate(1)|skin(1)	32		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)		CCTTCCTGCAGATCTTCACCC	0.637																																																	0													52.0	38.0	43.0					19																	50455220		2203	4300	6503	SO:0001583	missense	0			AF337818	CCDS12790.2, CCDS46150.1	19q13.3	2013-01-29			ENSG00000161640	ENSG00000161640		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15622	protein-coding gene	gene with protein product		607157				11986327	Standard	NM_052884		Approved		uc010ybi.2	Q96RL6	OTTHUMG00000157077	ENST00000447370.2:c.1758C>G	19.37:g.50455220G>C	ENSP00000412361:p.Ile586Met			Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.I586M	ENST00000447370.2	37	c.1758	CCDS12790.2	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	12.28|12.28	1.892081|1.892081	0.33442|0.33442	.|.	.|.	ENSG00000161640|ENSG00000161640	ENST00000447370;ENST00000458019|ENST00000426971	T|.	0.53423|.	0.62|.	2.86|2.86	-2.29|-2.29	0.06805|0.06805	.|.	2.353440|.	0.01541|.	N|.	0.019228|.	T|T	0.17109|0.17109	0.0411|0.0411	N|N	0.17082|0.17082	0.46|0.46	0.09310|0.09310	N|N	1|1	B;P|.	0.34997|.	0.001;0.479|.	B;B|.	0.29353|.	0.001;0.101|.	T|T	0.25502|0.25502	-1.0130|-1.0130	10|5	0.40728|.	T|.	0.16|.	.|.	2.4794|2.4794	0.04583|0.04583	0.2616:0.0:0.3322:0.4062|0.2616:0.0:0.3322:0.4062	.|.	490;586|.	Q96RL6-2;Q96RL6|.	.;SIG11_HUMAN|.	M|C	586;490|480	ENSP00000412361:I586M|.	ENSP00000412361:I586M|.	I|S	-|-	3|2	3|0	SIGLEC11|SIGLEC11	55147032|55147032	0.001000|0.001000	0.12720|0.12720	0.202000|0.202000	0.23494|0.23494	0.903000|0.903000	0.53119|0.53119	-0.149000|-0.149000	0.10204|0.10204	-0.368000|-0.368000	0.08040|0.08040	0.561000|0.561000	0.74099|0.74099	ATC|TCT	SIGLEC11	-	NULL	ENSG00000161640		0.637	SIGLEC11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIGLEC11	HGNC	protein_coding	OTTHUMT00000347382.1	-	0.00	30	0	G	NM_052884		50455220	-1	tier1	-	no_errors	ENST00000447370	ensembl	human	known	74_37	missense	23.53	26	8	SNP	0.292	C
SIPA1L1	26037	genome.wustl.edu	37	14	72205004	72205004	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr14:72205004G>A	ENST00000555818.1	+	21	5581	c.5233G>A	c.(5233-5235)Gaa>Aaa	p.E1745K	SIPA1L1_ENST00000358550.2_Missense_Mutation_p.E1723K|SIPA1L1_ENST00000381232.3_Missense_Mutation_p.E1724K|SIPA1L1_ENST00000554874.1_3'UTR|SIPA1L1_ENST00000537413.1_Missense_Mutation_p.E1198K	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	1745					actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		GGACCAGCTGGAAGGTATGCT	0.468																																																	0													113.0	97.0	103.0					14																	72205004		2203	4300	6503	SO:0001583	missense	0			AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.5233G>A	14.37:g.72205004G>A	ENSP00000450832:p.Glu1745Lys		J3KP19|O95321|Q9UDU4|Q9UNU4	Missense_Mutation	SNP	pfam_DUF3401,pfam_Rap_GAP_dom,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP_dom	p.E1745K	ENST00000555818.1	37	c.5233	CCDS9807.1	14	.	.	.	.	.	.	.	.	.	.	G	36	5.747794	0.96882	.	.	ENSG00000197555	ENST00000381232;ENST00000555818;ENST00000358550;ENST00000537413	T;T;T;T	0.41065	1.01;1.01;1.01;1.01	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.64516	0.2605	L	0.60455	1.87	0.80722	D	1	D;D;D;D;P	0.89917	1.0;0.997;0.989;1.0;0.915	D;D;D;D;P	0.85130	0.997;0.992;0.954;0.997;0.831	T	0.64058	-0.6496	10	0.87932	D	0	-25.4975	20.3206	0.98668	0.0:0.0:1.0:0.0	.	1198;1744;1198;1724;1745	F5GYF8;A6H8W6;B4DYX7;O43166-2;O43166	.;.;.;.;SI1L1_HUMAN	K	1724;1745;1723;1198	ENSP00000370630:E1724K;ENSP00000450832:E1745K;ENSP00000351352:E1723K;ENSP00000440682:E1198K	ENSP00000351352:E1745K	E	+	1	0	SIPA1L1	71274757	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.624000	0.98398	2.813000	0.96785	0.561000	0.74099	GAA	SIPA1L1	-	pfam_DUF3401	ENSG00000197555		0.468	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIPA1L1	HGNC	protein_coding	OTTHUMT00000412806.1	-	0.00	88	0	G	NM_015556		72205004	+1	tier1	-	no_errors	ENST00000555818	ensembl	human	known	74_37	missense	10.00	72	8	SNP	1.000	A
SLC12A9	56996	genome.wustl.edu	37	7	100460405	100460405	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr7:100460405C>T	ENST00000354161.3	+	13	1939	c.1814C>T	c.(1813-1815)tCc>tTc	p.S605F	SLC12A9_ENST00000540482.1_Missense_Mutation_p.S605F|SLC12A9_ENST00000428758.1_Missense_Mutation_p.S605F|SLC12A9_ENST00000415287.1_Missense_Mutation_p.S516F|SLC12A9_ENST00000275729.3_Missense_Mutation_p.S516F	NM_020246.3	NP_064631.2	Q9BXP2	S12A9_HUMAN	solute carrier family 12, member 9	605					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation:chloride symporter activity (GO:0015377)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(20)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	41	Lung NSC(181;0.041)|all_lung(186;0.0581)					CTCTCACCCTCCGTGCGCCAG	0.632																																																	0													133.0	109.0	117.0					7																	100460405		2203	4300	6503	SO:0001583	missense	0			AF284422	CCDS5707.1, CCDS59068.1, CCDS59069.1	7q22	2013-07-18	2013-07-18		ENSG00000146828	ENSG00000146828		"""Solute carriers"""	17435	protein-coding gene	gene with protein product	"""cation-chloride cotransporter-interacting protein"""					10871601, 11239002	Standard	NM_020246		Approved	CIP1	uc003uwp.4	Q9BXP2	OTTHUMG00000156045	ENST00000354161.3:c.1814C>T	7.37:g.100460405C>T	ENSP00000275730:p.Ser605Phe		B7Z740|D6W5X0|D6W5X2|F5H8C2|Q9BWL2|Q9BXP1|Q9BYI0|Q9NQR5	Missense_Mutation	SNP	pfam_AA-permease/SLC12A_dom	p.S605F	ENST00000354161.3	37	c.1814	CCDS5707.1	7	.	.	.	.	.	.	.	.	.	.	C	17.02	3.283087	0.59867	.	.	ENSG00000146828	ENST00000540482;ENST00000428758;ENST00000275729;ENST00000415287;ENST00000354161;ENST00000539308	D;D;D;D;D	0.93953	-2.72;-2.72;-2.36;-2.36;-3.32	5.16	4.21	0.49690	.	0.241779	0.43260	D	0.000588	D	0.96219	0.8767	M	0.85197	2.74	0.58432	D	0.999998	D;B	0.60575	0.988;0.371	D;B	0.64321	0.924;0.2	D	0.96473	0.9350	10	0.87932	D	0	.	12.8135	0.57652	0.0:0.834:0.166:0.0	.	516;605	Q9BXP2-2;Q9BXP2	.;S12A9_HUMAN	F	605;605;516;516;605;231	ENSP00000443702:S605F;ENSP00000408301:S605F;ENSP00000275729:S516F;ENSP00000413796:S516F;ENSP00000275730:S605F	ENSP00000275729:S516F	S	+	2	0	SLC12A9	100298341	0.995000	0.38212	0.289000	0.24876	0.862000	0.49288	5.709000	0.68384	2.404000	0.81709	0.491000	0.48974	TCC	SLC12A9	-	NULL	ENSG00000146828		0.632	SLC12A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC12A9	HGNC	protein_coding	OTTHUMT00000342837.1		0.00	32	0	C	NM_020246		100460405	+1			no_errors	ENST00000354161	ensembl	human	known	74_37	missense	7.32	38	3	SNP	0.876	T
SLC14A1	6563	genome.wustl.edu	37	18	43314239	43314239	+	Splice_Site	SNP	G	G	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr18:43314239G>T	ENST00000321925.4	+	5	574	c.342G>T	c.(340-342)agG>agT	p.R114S	SLC14A1_ENST00000591943.1_3'UTR|SLC14A1_ENST00000436407.3_Splice_Site_p.R170S|SLC14A1_ENST00000502059.2_Splice_Site_p.R6S|SLC14A1_ENST00000535474.1_5'UTR|SLC14A1_ENST00000589700.1_Splice_Site_p.R114S|SLC14A1_ENST00000402943.2_Splice_Site_p.R9S|RP11-116O18.3_ENST00000586213.1_RNA|RP11-116O18.3_ENST00000589510.1_RNA|SLC14A1_ENST00000415427.3_Splice_Site_p.R170S|SLC14A1_ENST00000586142.1_Splice_Site_p.R114S	NM_001128588.3|NM_001146036.2|NM_015865.6	NP_001122060.3|NP_001139508.2|NP_056949.4	Q13336	UT1_HUMAN	solute carrier family 14 (urea transporter), member 1 (Kidd blood group)	114					transmembrane transport (GO:0055085)|urea transmembrane transport (GO:0071918)|urea transport (GO:0015840)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	urea channel activity (GO:0015265)|urea transmembrane transporter activity (GO:0015204)|water transmembrane transporter activity (GO:0005372)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(11)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	21						TGCCCCACAGGTCATTAATAG	0.458																																																	0													177.0	158.0	165.0					18																	43314239		2203	4300	6503	SO:0001630	splice_region_variant	0			BC040128	CCDS11925.1, CCDS45860.1	18q11-q12	2014-07-19	2014-01-02		ENSG00000141469	ENSG00000141469		"""Blood group antigens"", ""Solute carriers"""	10918	protein-coding gene	gene with protein product		613868	"""Kidd blood group"", ""solute carrier family 14 (urea transporter), member 1"""	JK		7797558	Standard	NM_001146037		Approved	HsT1341, RACH1, RACH2	uc010dnk.3	Q13336	OTTHUMG00000132617	ENST00000321925.4:c.342-1G>T	18.37:g.43314239G>T			A8K0P3|B3KR62|B3KVX3|C9EHF2|Q86VM5	Missense_Mutation	SNP	pfam_Urea_transporter	p.R170S	ENST00000321925.4	37	c.510	CCDS11925.1	18	.	.	.	.	.	.	.	.	.	.	G	13.77	2.337699	0.41398	.	.	ENSG00000141469	ENST00000321925;ENST00000415427;ENST00000502059;ENST00000402943;ENST00000436407	T;T;T;T;T	0.51071	0.72;0.72;0.72;0.72;0.72	5.46	4.58	0.56647	.	0.000000	0.85682	D	0.000000	T	0.64438	0.2598	M	0.76328	2.33	0.80722	D	1	D;P;D	0.89917	1.0;0.863;0.996	D;P;D	0.85130	0.997;0.644;0.938	T	0.65166	-0.6234	9	.	.	.	.	8.0794	0.30735	0.2614:0.0:0.7386:0.0	.	170;6;114	Q13336-2;B3KXJ3;Q13336	.;.;UT1_HUMAN	S	114;170;6;9;170	ENSP00000318546:R114S;ENSP00000412309:R170S;ENSP00000442180:R6S;ENSP00000385320:R9S;ENSP00000390637:R170S	.	R	+	3	2	SLC14A1	41568237	1.000000	0.71417	1.000000	0.80357	0.159000	0.22180	2.988000	0.49386	1.283000	0.44513	0.591000	0.81541	AGG	SLC14A1	-	pfam_Urea_transporter	ENSG00000141469		0.458	SLC14A1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	SLC14A1	HGNC	protein_coding	OTTHUMT00000255860.2	-	0.00	78	0	G	NM_015865	Missense_Mutation	43314239	+1	tier1	-	no_errors	ENST00000415427	ensembl	human	known	74_37	missense	8.89	41	4	SNP	1.000	T
SLC2A1	6513	genome.wustl.edu	37	1	43396408	43396408	+	Silent	SNP	C	C	G			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr1:43396408C>G	ENST00000426263.3	-	4	583	c.405G>C	c.(403-405)ctG>ctC	p.L135L	SLC2A1_ENST00000475162.1_5'UTR|SLC2A1_ENST00000372500.3_Silent_p.L135L|SLC2A1_ENST00000415851.2_Intron	NM_006516.2	NP_006507.2	P11166	GTR1_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 1	135					carbohydrate metabolic process (GO:0005975)|cellular response to glucose starvation (GO:0042149)|energy reserve metabolic process (GO:0006112)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|L-ascorbic acid metabolic process (GO:0019852)|protein complex assembly (GO:0006461)|regulation of insulin secretion (GO:0050796)|response to osmotic stress (GO:0006970)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|caveola (GO:0005901)|cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|female pronucleus (GO:0001939)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|midbody (GO:0030496)|plasma membrane (GO:0005886)	D-glucose transmembrane transporter activity (GO:0055056)|dehydroascorbic acid transporter activity (GO:0033300)|glucose transmembrane transporter activity (GO:0005355)|identical protein binding (GO:0042802)|protein self-association (GO:0043621)|xenobiotic transporter activity (GO:0042910)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|pancreas(2)	13	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0122)			Etomidate(DB00292)	AGCCTGTGGTCAGGCCGCAGT	0.622																																																	0													63.0	56.0	59.0					1																	43396408		2203	4300	6503	SO:0001819	synonymous_variant	0			K03195	CCDS477.1	1p34.2	2013-05-22			ENSG00000117394	ENSG00000117394		"""Solute carriers"""	11005	protein-coding gene	gene with protein product		138140	"""human T-cell leukemia virus (I and II) receptor"""	GLUT1, GLUT, HTLVR		8839927, 14622599, 18451999	Standard	NM_006516		Approved	DYT18	uc001cik.2	P11166	OTTHUMG00000007657	ENST00000426263.3:c.405G>C	1.37:g.43396408C>G			A8K9S6|B2R620|D3DPX0|O75535|Q147X2	Silent	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,prints_Sugar/inositol_transpt,prints_Glu_transpt_1,tigrfam_Sugar/inositol_transpt	p.L135	ENST00000426263.3	37	c.405	CCDS477.1	1																																																																																			SLC2A1	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,prints_Sugar/inositol_transpt,tigrfam_Sugar/inositol_transpt	ENSG00000117394		0.622	SLC2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A1	HGNC	protein_coding	OTTHUMT00000020358.2	-	0.00	22	0	C	NM_006516		43396408	-1	tier1	-	no_errors	ENST00000426263	ensembl	human	known	74_37	silent	50.00	8	8	SNP	1.000	G
SMC1B	27127	genome.wustl.edu	37	22	45745630	45745630	+	Silent	SNP	T	T	C			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr22:45745630T>C	ENST00000357450.4	-	23	3473	c.3474A>G	c.(3472-3474)ctA>ctG	p.L1158L	SMC1B_ENST00000404354.3_Intron	NM_148674.3	NP_683515.3	Q8NDV3	SMC1B_HUMAN	structural maintenance of chromosomes 1B	1158	Ala/Asp-rich (DA-box).				meiotic nuclear division (GO:0007126)|sister chromatid cohesion (GO:0007062)	chromosome, centromeric region (GO:0000775)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		TAGTATTGTCTAGGGCTGCAT	0.333																																																	0													94.0	90.0	91.0					22																	45745630		1866	4107	5973	SO:0001819	synonymous_variant	0			AJ504806	CCDS43027.1, CCDS74876.1	22q13	2006-07-06	2006-07-06	2006-07-06	ENSG00000077935	ENSG00000077935		"""Structural maintenance of chromosomes proteins"""	11112	protein-coding gene	gene with protein product		608685	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 2 (yeast)"""	SMC1L2		10591208, 11564881	Standard	XM_005261566		Approved	bK268H5	uc003bgc.3	Q8NDV3	OTTHUMG00000151334	ENST00000357450.4:c.3474A>G	22.37:g.45745630T>C			A0AV46|B0QY23|B0QY24|Q5TIC3|Q6ZUF9|Q9Y3G5	Silent	SNP	pfam_RecF/RecN/SMC_N,pfam_SMC_hinge,superfamily_P-loop_NTPase,superfamily_SMC_hinge,superfamily_t-SNARE,smart_SMC_hinge	p.L1158	ENST00000357450.4	37	c.3474	CCDS43027.1	22																																																																																			SMC1B	-	pfam_RecF/RecN/SMC_N,superfamily_P-loop_NTPase	ENSG00000077935		0.333	SMC1B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC1B	HGNC	protein_coding	OTTHUMT00000322256.2	-	0.00	127	0	T	NM_148674		45745630	-1	tier1	-	no_errors	ENST00000357450	ensembl	human	known	74_37	silent	29.89	61	26	SNP	1.000	C
SMG1	23049	genome.wustl.edu	37	16	18937310	18937312	+	In_Frame_Del	DEL	GCC	GCC	-			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	GCC	GCC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr16:18937310_18937312delGCC	ENST00000446231.2	-	1	464_466	c.52_54delGGC	c.(52-54)ggcdel	p.G18del	CTD-2288F12.1_ENST00000565782.1_RNA|SMG1_ENST00000389467.3_In_Frame_Del_p.G18del|SMG1_ENST00000567737.1_5'UTR			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	18	Interaction with SMG8 and SMG9.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						GATACTTGGTgccgccgccgccg	0.749																																																	0										68,1646		5,58,794						4.3	1.0			5	233,4695		15,203,2246	no	coding	SMG1	NM_015092.4		20,261,3040	A1A1,A1R,RR		4.7281,3.9673,4.5318				301,6341				SO:0001651	inframe_deletion	0			AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.52_54delGGC	16.37:g.18937319_18937321delGCC	ENSP00000402515:p.Gly18del		O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	In_Frame_Del	DEL	pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.G18in_frame_del	ENST00000446231.2	37	c.54_52	CCDS45430.1	16																																																																																			SMG1	-	NULL	ENSG00000157106		0.749	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMG1	HGNC	protein_coding	OTTHUMT00000391817.1		0.00	35	0	GCC	NM_015092		18937312	-1	tier1		no_errors	ENST00000389467	ensembl	human	known	74_37	in_frame_del	12.50	21	3	DEL	1.000:1.000:1.000	-
SNX10	29887	genome.wustl.edu	37	7	26411551	26411551	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr7:26411551C>G	ENST00000338523.4	+	6	609	c.422C>G	c.(421-423)tCt>tGt	p.S141C	SNX10_ENST00000446848.2_Missense_Mutation_p.S167C|SNX10_ENST00000409367.1_Missense_Mutation_p.S101C|SNX10_ENST00000462993.1_3'UTR|SNX10_ENST00000396376.1_Missense_Mutation_p.S141C|SNX10_ENST00000409838.1_Missense_Mutation_p.S57C|AC004540.4_ENST00000451264.1_RNA|AC004540.4_ENST00000451368.1_RNA	NM_001199835.1|NM_013322.2	NP_001186764.1|NP_037454.2	Q9Y5X0	SNX10_HUMAN	sorting nexin 10	141					cilium assembly (GO:0042384)|endosome organization (GO:0007032)|intracellular protein transport (GO:0006886)|osteoclast differentiation (GO:0030316)|protein localization to centrosome (GO:0071539)|protein localization to cilium (GO:0061512)	cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extrinsic component of endosome membrane (GO:0031313)|nucleus (GO:0005634)	1-phosphatidylinositol binding (GO:0005545)|ATPase binding (GO:0051117)			endometrium(1)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	6						ACTAAGTACTCTGTGGAAGAA	0.383																																																	0													127.0	121.0	123.0					7																	26411551		2203	4300	6503	SO:0001583	missense	0			AF121860	CCDS5399.1, CCDS56470.1	7p15.2	2008-05-22			ENSG00000086300	ENSG00000086300		"""Sorting nexins"""	14974	protein-coding gene	gene with protein product		614780				17012226	Standard	NM_013322		Approved		uc010kuu.3	Q9Y5X0	OTTHUMG00000023650	ENST00000338523.4:c.422C>G	7.37:g.26411551C>G	ENSP00000343709:p.Ser141Cys		E9PFH5|Q8IYT5	Missense_Mutation	SNP	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.S167C	ENST00000338523.4	37	c.500	CCDS5399.1	7	.	.	.	.	.	.	.	.	.	.	C	19.45	3.829731	0.71258	.	.	ENSG00000086300	ENST00000416246;ENST00000338523;ENST00000446848;ENST00000396376;ENST00000409367;ENST00000409838	T;T;T;T;T;T	0.66995	-0.24;0.34;0.31;0.34;-0.23;0.71	5.83	5.83	0.93111	.	0.049618	0.85682	D	0.000000	T	0.79621	0.4477	M	0.62723	1.935	0.54753	D	0.999986	D;D	0.76494	0.999;0.997	P;P	0.61328	0.887;0.737	T	0.80160	-0.1498	10	0.72032	D	0.01	.	20.1356	0.98028	0.0:1.0:0.0:0.0	.	167;141	B4DJM0;Q9Y5X0	.;SNX10_HUMAN	C	167;141;167;141;101;57	ENSP00000408164:S167C;ENSP00000343709:S141C;ENSP00000395474:S167C;ENSP00000379661:S141C;ENSP00000387274:S101C;ENSP00000386540:S57C	ENSP00000343709:S141C	S	+	2	0	SNX10	26378076	1.000000	0.71417	0.970000	0.41538	0.965000	0.64279	6.885000	0.75606	2.755000	0.94549	0.650000	0.86243	TCT	SNX10	-	NULL	ENSG00000086300		0.383	SNX10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX10	HGNC	protein_coding	OTTHUMT00000214120.1	-	0.00	45	0	C			26411551	+1	tier1	-	no_errors	ENST00000446848	ensembl	human	known	74_37	missense	8.70	63	6	SNP	0.999	G
SPATA31D1	389763	genome.wustl.edu	37	9	84609178	84609178	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr9:84609178C>T	ENST00000344803.2	+	4	3840	c.3793C>T	c.(3793-3795)Cgt>Tgt	p.R1265C		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	1265					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.R1265S(4)									CAGCGGAATCCGTGTGGCACA	0.532																																																	4	Substitution - Missense(4)	lung(4)											111.0	109.0	110.0					9																	84609178		2012	4180	6192	SO:0001583	missense	0				CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.3793C>T	9.37:g.84609178C>T	ENSP00000341988:p.Arg1265Cys			Missense_Mutation	SNP	NULL	p.R1265C	ENST00000344803.2	37	c.3793	CCDS47986.1	9	.	.	.	.	.	.	.	.	.	.	C	7.678	0.688393	0.14973	.	.	ENSG00000214929	ENST00000344803	T	0.06849	3.25	3.26	2.12	0.27331	.	.	.	.	.	T	0.05914	0.0154	N	0.14661	0.345	0.09310	N	1	D	0.62365	0.991	P	0.45881	0.496	T	0.36383	-0.9750	9	0.38643	T	0.18	0.0316	6.5373	0.22361	0.7291:0.2709:0.0:0.0	.	1265	Q6ZQQ2	F75D1_HUMAN	C	1265	ENSP00000341988:R1265C	ENSP00000341988:R1265C	R	+	1	0	FAM75D1	83798998	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	-0.273000	0.08548	0.642000	0.30620	-0.262000	0.10625	CGT	SPATA31D1	-	NULL	ENSG00000214929		0.532	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31D1	HGNC	protein_coding	OTTHUMT00000402325.1	-	0.00	71	0	C	NM_001001670		84609178	+1	tier1	-	no_errors	ENST00000344803	ensembl	human	known	74_37	missense	80.43	9	37	SNP	0.001	T
SPG20	23111	genome.wustl.edu	37	13	36900491	36900491	+	Intron	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr13:36900491C>T	ENST00000451493.1	-	5	1506				SPG20_ENST00000494062.2_Intron|SPG20_ENST00000495510.1_5'UTR|SPG20_ENST00000438666.2_Intron|SPG20_ENST00000355182.4_Intron	NM_001142295.1	NP_001135767.1	Q8N0X7	SPG20_HUMAN	spastic paraplegia 20 (Troyer syndrome)						abscission (GO:0009838)|adipose tissue development (GO:0060612)|cell death (GO:0008219)|cell division (GO:0051301)|lipid particle organization (GO:0034389)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of collateral sprouting in absence of injury (GO:0048698)|neuromuscular process (GO:0050905)|regulation of mitochondrial membrane potential (GO:0051881)	cytoplasm (GO:0005737)|lipid particle (GO:0005811)|midbody (GO:0030496)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	27		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;2.42e-08)|Epithelial(112;1.58e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00128)|BRCA - Breast invasive adenocarcinoma(63;0.0125)|GBM - Glioblastoma multiforme(144;0.026)		ATCCATTTTCCCAATAGTAGA	0.313																																																	0																																										SO:0001627	intron_variant	0			AB011182	CCDS9356.1	13q13.1	2008-07-04	2007-04-23		ENSG00000133104	ENSG00000133104			18514	protein-coding gene	gene with protein product	"""spartin"""	607111				6022528, 12134148	Standard	NM_001142294		Approved	KIAA0610, TAHCCP1	uc001uvm.3	Q8N0X7	OTTHUMG00000016730	ENST00000451493.1:c.1288+220G>A	13.37:g.36900491C>T			O60349|Q86Y67|Q9H1T2|Q9H1T3	RNA	SNP	-	NULL	ENST00000451493.1	37	NULL	CCDS9356.1	13																																																																																			SPG20	-	-	ENSG00000133104		0.313	SPG20-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SPG20	HGNC	protein_coding	OTTHUMT00000044494.2	-	0.00	11	0	C			36900491	-1	tier1	-	no_errors	ENST00000495510	ensembl	human	known	74_37	rna	55.56	4	5	SNP	0.008	T
SPHKAP	80309	genome.wustl.edu	37	2	228883332	228883332	+	Silent	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr2:228883332C>T	ENST00000392056.3	-	7	2284	c.2238G>A	c.(2236-2238)gaG>gaA	p.E746E	SPHKAP_ENST00000344657.5_Silent_p.E746E	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	746						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TTGGTTCTGTCTCCCTCCTTC	0.473																																																	0													145.0	139.0	141.0					2																	228883332		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.2238G>A	2.37:g.228883332C>T			Q68DA3|Q68DR8|Q9C0I5	Silent	SNP	pfam_AKAP_110_C	p.E746	ENST00000392056.3	37	c.2238	CCDS46537.1	2																																																																																			SPHKAP	-	NULL	ENSG00000153820		0.473	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHKAP	HGNC	protein_coding	OTTHUMT00000331750.1	-	0.00	22	0	C	NM_030623		228883332	-1	tier1	-	no_errors	ENST00000392056	ensembl	human	known	74_37	silent	32.00	17	8	SNP	0.000	T
SPTBN5	51332	genome.wustl.edu	37	15	42169051	42169051	+	Silent	SNP	T	T	C			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr15:42169051T>C	ENST00000320955.6	-	19	4034	c.3807A>G	c.(3805-3807)gcA>gcG	p.A1269A		NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	1269					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		TCTCGCCGTGTGCCCGCAGAG	0.672																																																	0													29.0	37.0	34.0					15																	42169051		2088	4208	6296	SO:0001819	synonymous_variant	0			AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.3807A>G	15.37:g.42169051T>C				Silent	SNP	pfam_Spectrin_repeat,pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.A1269	ENST00000320955.6	37	c.3807		15																																																																																			SPTBN5	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000137877		0.672	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	SPTBN5	HGNC	protein_coding	OTTHUMT00000420237.1	-	0.00	35	0	T	NM_016642		42169051	-1	tier1	-	no_errors	ENST00000320955	ensembl	human	known	74_37	silent	15.38	32	6	SNP	0.006	C
ST14	6768	genome.wustl.edu	37	11	130079337	130079337	+	Splice_Site	SNP	G	G	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr11:130079337G>T	ENST00000278742.5	+	18	2688	c.2270G>T	c.(2269-2271)gGc>gTc	p.G757V		NM_021978.3	NP_068813.1	Q9Y5Y6	ST14_HUMAN	suppression of tumorigenicity 14 (colon carcinoma)	757	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				keratinocyte differentiation (GO:0030216)|proteolysis (GO:0006508)	basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|ovary(3)|pancreas(2)|prostate(1)|skin(3)	32	all_hematologic(175;0.0429)	Lung NSC(97;0.000602)|Breast(109;0.000962)|all_lung(97;0.00126)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0183)|Lung(977;0.228)	Urokinase(DB00013)	CTCTCCCCAGGCACTGGCGCG	0.627																																																	0													19.0	16.0	17.0					11																	130079337		2194	4286	6480	SO:0001630	splice_region_variant	0			AF118224	CCDS8487.1	11q24-q25	2011-08-31	2005-11-19		ENSG00000149418	ENSG00000149418		"""Serine peptidases / Transmembrane"""	11344	protein-coding gene	gene with protein product	"""epithin"", ""matriptase"""	606797		PRSS14		9925927, 10373424	Standard	NM_021978		Approved	SNC19, HAI, MT-SP1, TMPRSS14	uc001qfw.3	Q9Y5Y6	OTTHUMG00000165768	ENST00000278742.5:c.2270-1G>T	11.37:g.130079337G>T			Q9BS01|Q9H3S0|Q9HB36|Q9HCA3	Missense_Mutation	SNP	pirsf_Peptidase_S1A_matripase,pfam_Peptidase_S1,pfam_LDrepeatLR_classA_rpt,pfam_CUB_dom,pfam_SEA_dom,superfamily_Trypsin-like_Pept_dom,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_LDrepeatLR_classA_rpt,smart_Peptidase_S1,prints_LDrepeatLR_classA_rpt,prints_Peptidase_S1A,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_Peptidase_S1	p.G757V	ENST00000278742.5	37	c.2270	CCDS8487.1	11	.	.	.	.	.	.	.	.	.	.	G	27.1	4.799494	0.90538	.	.	ENSG00000149418	ENST00000278742;ENST00000525779	D	0.90732	-2.72	4.93	4.93	0.64822	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.37136	N	0.002224	D	0.91771	0.7397	N	0.26130	0.795	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.91051	0.4878	9	.	.	.	.	17.7275	0.88369	0.0:0.0:1.0:0.0	.	757	Q9Y5Y6	ST14_HUMAN	V	757;659	ENSP00000278742:G757V	.	G	+	2	0	ST14	129584547	1.000000	0.71417	0.872000	0.34217	0.487000	0.33371	5.995000	0.70631	2.292000	0.77174	0.313000	0.20887	GGC	ST14	-	pirsf_Peptidase_S1A_matripase,pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000149418		0.627	ST14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST14	HGNC	protein_coding	OTTHUMT00000386119.1	-	0.00	52	0	G		Missense_Mutation	130079337	+1	tier1	-	no_errors	ENST00000278742	ensembl	human	known	74_37	missense	5.88	64	4	SNP	0.996	T
STAB2	55576	genome.wustl.edu	37	12	104131412	104131412	+	Splice_Site	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr12:104131412G>A	ENST00000388887.2	+	53	5755	c.5551G>A	c.(5551-5553)Ggt>Agt	p.G1851S		NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						TCTTTCTTAGGGTGACCTCTT	0.443																																																	0													47.0	49.0	48.0					12																	104131412		2203	4300	6503	SO:0001630	splice_region_variant	0			AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.5551-1G>A	12.37:g.104131412G>A				Missense_Mutation	SNP	pfam_FAS1_domain,pfam_Link,superfamily_C-type_lectin_fold,superfamily_FAS1_domain,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF_laminin,smart_EGF-like_Ca-bd_dom,smart_FAS1_domain,smart_Link,pfscan_EG-like_dom,pfscan_FAS1_domain,pfscan_Link	p.G1851S	ENST00000388887.2	37	c.5551	CCDS31888.1	12	.	.	.	.	.	.	.	.	.	.	G	15.05	2.717207	0.48622	.	.	ENSG00000136011	ENST00000388887;ENST00000258495	D	0.92805	-3.11	5.44	4.55	0.56014	FAS1 domain (5);	0.058841	0.64402	N	0.000002	D	0.92851	0.7726	M	0.84433	2.695	0.50813	D	0.999896	P	0.47034	0.889	B	0.43889	0.435	D	0.92473	0.5987	9	.	.	.	.	13.7046	0.62631	0.0752:0.0:0.9248:0.0	.	1851	Q8WWQ8	STAB2_HUMAN	S	1851;538	ENSP00000373539:G1851S	.	G	+	1	0	STAB2	102655542	1.000000	0.71417	0.728000	0.30774	0.018000	0.09664	6.150000	0.71801	1.283000	0.44513	0.462000	0.41574	GGT	STAB2	-	pfam_FAS1_domain,superfamily_FAS1_domain,smart_FAS1_domain,pfscan_FAS1_domain	ENSG00000136011		0.443	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAB2	HGNC	protein_coding	OTTHUMT00000407089.1	-	0.00	48	0	G		Missense_Mutation	104131412	+1	tier1	-	no_errors	ENST00000388887	ensembl	human	known	74_37	missense	19.57	37	9	SNP	1.000	A
SYNE1	23345	genome.wustl.edu	37	6	152697593	152697593	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr6:152697593C>T	ENST00000367255.5	-	58	9848	c.9247G>A	c.(9247-9249)Gca>Aca	p.A3083T	SYNE1_ENST00000341594.5_Missense_Mutation_p.A3122T|SYNE1_ENST00000265368.4_Missense_Mutation_p.A3083T|SYNE1_ENST00000423061.1_Missense_Mutation_p.A3090T|SYNE1_ENST00000448038.1_Missense_Mutation_p.A3090T	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3083					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GTGATTTTTGCATTAACCAAC	0.373										HNSCC(10;0.0054)																																							0													101.0	106.0	104.0					6																	152697593		2203	4300	6503	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.9247G>A	6.37:g.152697593C>T	ENSP00000356224:p.Ala3083Thr		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.A3083T	ENST00000367255.5	37	c.9247	CCDS5236.2	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.4|28.4	4.919389|4.919389	0.92249|0.92249	.|.	.|.	ENSG00000131018|ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594|ENST00000454018	T;T;T;T;T|.	0.58060|.	1.28;0.37;1.28;0.36;1.28|.	5.71|5.71	5.71|5.71	0.89125|0.89125	.|.	0.000000|.	0.64402|.	D|.	0.000010|.	T|T	0.67581|0.67581	0.2908|0.2908	M|M	0.69823|0.69823	2.125|2.125	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.76494|.	0.996;0.973;0.996;0.999|.	P;P;P;D|.	0.65874|.	0.871;0.731;0.871;0.939|.	T|T	0.66590|0.66590	-0.5885|-0.5885	10|5	0.27082|.	T|.	0.32|.	.|.	15.4596|15.4596	0.75342|0.75342	0.1393:0.8607:0.0:0.0|0.1393:0.8607:0.0:0.0	.|.	3083;200;3083;3090|.	Q8NF91;B7ZBC4;E7EQI5;Q8NF91-4|.	SYNE1_HUMAN;.;.;.|.	T|I	3083;3090;3083;3090;3122|199	ENSP00000356224:A3083T;ENSP00000396024:A3090T;ENSP00000265368:A3083T;ENSP00000390975:A3090T;ENSP00000341887:A3122T|.	ENSP00000265368:A3083T|.	A|M	-|-	1|3	0|0	SYNE1|SYNE1	152739286|152739286	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	3.637000|3.637000	0.54324|0.54324	2.707000|2.707000	0.92482|0.92482	0.655000|0.655000	0.94253|0.94253	GCA|ATG	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin	ENSG00000131018		0.373	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	-	0.00	115	0	C	NM_182961		152697593	-1	tier1	-	no_errors	ENST00000265368	ensembl	human	known	74_37	missense	33.73	55	28	SNP	1.000	T
SYNE1	23345	genome.wustl.edu	37	6	152751290	152751290	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr6:152751290C>T	ENST00000367255.5	-	36	5346	c.4745G>A	c.(4744-4746)tGt>tAt	p.C1582Y	SYNE1_ENST00000341594.5_Missense_Mutation_p.C1652Y|SYNE1_ENST00000367253.4_Missense_Mutation_p.C1582Y|SYNE1_ENST00000265368.4_Missense_Mutation_p.C1582Y|SYNE1_ENST00000423061.1_Missense_Mutation_p.C1589Y|SYNE1_ENST00000448038.1_Missense_Mutation_p.C1589Y	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1582					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AGCTGAAGAACATATTTTAAT	0.303										HNSCC(10;0.0054)																																							0													53.0	50.0	51.0					6																	152751290		2200	4290	6490	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.4745G>A	6.37:g.152751290C>T	ENSP00000356224:p.Cys1582Tyr		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.C1582Y	ENST00000367255.5	37	c.4745	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	C	17.71	3.456959	0.63401	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253	T;T;T;T;T;T	0.50277	0.75;0.75;0.75;0.75;0.75;0.75	5.97	5.97	0.96955	.	0.000000	0.64402	D	0.000002	T	0.56702	0.2003	M	0.65498	2.005	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0	D;D;D;D;D	0.85130	0.997;0.982;0.98;0.982;0.992	T	0.49934	-0.8886	10	0.07644	T	0.81	.	20.4238	0.99064	0.0:1.0:0.0:0.0	.	1565;1582;1582;1582;1589	B3W695;Q8NF91;Q8NF91-6;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.	Y	1582;1589;1582;1589;1652;1582	ENSP00000356224:C1582Y;ENSP00000396024:C1589Y;ENSP00000265368:C1582Y;ENSP00000390975:C1589Y;ENSP00000341887:C1652Y;ENSP00000356222:C1582Y	ENSP00000265368:C1582Y	C	-	2	0	SYNE1	152792983	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.291000	0.72719	2.834000	0.97654	0.650000	0.86243	TGT	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin	ENSG00000131018		0.303	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	-	0.00	80	0	C	NM_182961		152751290	-1	tier1	-	no_errors	ENST00000265368	ensembl	human	known	74_37	missense	72.86	19	51	SNP	1.000	T
TBC1D4	9882	genome.wustl.edu	37	13	75923344	75923344	+	Missense_Mutation	SNP	G	G	C	rs375499221	byFrequency	TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr13:75923344G>C	ENST00000377636.3	-	5	1716	c.1370C>G	c.(1369-1371)cCg>cGg	p.P457R	TBC1D4_ENST00000425511.1_5'UTR|TBC1D4_ENST00000431480.2_Missense_Mutation_p.P457R|TBC1D4_ENST00000377625.2_Missense_Mutation_p.P457R	NM_014832.2	NP_055647.2	O60343	TBCD4_HUMAN	TBC1 domain family, member 4	457	PID 2. {ECO:0000255|PROSITE- ProRule:PRU00148}.				cellular response to insulin stimulus (GO:0032869)|membrane organization (GO:0061024)|negative regulation of vesicle fusion (GO:0031339)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)	Rab GTPase activator activity (GO:0005097)	p.P457R(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(12)|lung(18)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)		AGAGTGCATCGGGCAGGCCTC	0.478																																																	1	Substitution - Missense(1)	breast(1)											69.0	69.0	69.0					13																	75923344		1931	4129	6060	SO:0001583	missense	0			AB011175	CCDS41901.1, CCDS66563.1, CCDS66564.1	13q22.2	2013-07-09			ENSG00000136111	ENSG00000136111			19165	protein-coding gene	gene with protein product	"""Akt substrate of 160 kDa"""	612465				11829485, 11994271, 15304337	Standard	XM_005266603		Approved	KIAA0603, AS160, DKFZp779C0666	uc001vjl.1	O60343	OTTHUMG00000017088	ENST00000377636.3:c.1370C>G	13.37:g.75923344G>C	ENSP00000366863:p.Pro457Arg		A7E2X8|B4DU25|B4E235|B6ETN8|B6ETN9|Q5W0B9|Q68D14	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_DUF3350,pfam_PTB/PI_dom,superfamily_Rab-GTPase-TBC_dom,smart_PTB/PI_dom,smart_Rab-GTPase-TBC_dom,pfscan_PTB/PI_dom,pfscan_Rab-GTPase-TBC_dom	p.P457R	ENST00000377636.3	37	c.1370	CCDS41901.1	13	.	.	.	.	.	.	.	.	.	.	G	29.7	5.025993	0.93518	.	.	ENSG00000136111	ENST00000377636;ENST00000431480;ENST00000377625	T;T;T	0.19669	2.2;2.13;2.26	6.04	6.04	0.98038	.	0.000000	0.64402	D	0.000001	T	0.52125	0.1715	M	0.77486	2.375	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.50750	-0.8791	10	0.87932	D	0	-22.5512	20.5875	0.99426	0.0:0.0:1.0:0.0	.	457;457;457	O60343-2;O60343-3;O60343	.;.;TBCD4_HUMAN	R	457	ENSP00000366863:P457R;ENSP00000395986:P457R;ENSP00000366852:P457R	ENSP00000366852:P457R	P	-	2	0	TBC1D4	74821345	1.000000	0.71417	0.979000	0.43373	0.955000	0.61496	9.326000	0.96389	2.861000	0.98227	0.643000	0.83706	CCG	TBC1D4	-	NULL	ENSG00000136111		0.478	TBC1D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D4	HGNC	protein_coding	OTTHUMT00000045283.1	-	0.00	37	0	G	NM_014832		75923344	-1	tier1	-	no_errors	ENST00000377636	ensembl	human	known	74_37	missense	32.61	31	15	SNP	1.000	C
TCF12	6938	genome.wustl.edu	37	15	57526275	57526276	+	Frame_Shift_Ins	INS	-	-	CT			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr15:57526275_57526276insCT	ENST00000267811.5	+	12	1309_1310	c.1005_1006insCT	c.(1006-1008)ggtfs	p.G336fs	TCF12_ENST00000452095.2_Frame_Shift_Ins_p.G332fs|TCF12_ENST00000560764.1_3'UTR|TCF12_ENST00000557843.1_Frame_Shift_Ins_p.G336fs|TCF12_ENST00000343827.3_Frame_Shift_Ins_p.G166fs|TCF12_ENST00000333725.5_Frame_Shift_Ins_p.G336fs|TCF12_ENST00000543579.1_Frame_Shift_Ins_p.G166fs|TCF12_ENST00000438423.2_Frame_Shift_Ins_p.G336fs|TCF12_ENST00000537840.1_Frame_Shift_Ins_p.G100fs	NM_003205.3|NM_207038.1	NP_003196.1|NP_996921.1	Q99081	HTF4_HUMAN	transcription factor 12	336					immune response (GO:0006955)|muscle organ development (GO:0007517)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)		TCF12/NR4A3(2)	breast(2)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	36		Colorectal(260;0.0907)		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)		GCTCACAGACAGGTGATGCACT	0.366			T	TEC	extraskeletal myxoid chondrosarcoma																																			Dom	yes		15	15q21	6938	"""transcription factor 12 (HTF4, helix-loop-helix transcription factors 4)"""		M	0																																										SO:0001589	frameshift_variant	0			BC050556	CCDS10159.1, CCDS10160.1, CCDS42042.1	15q21	2013-05-21	2008-07-31		ENSG00000140262	ENSG00000140262		"""Basic helix-loop-helix proteins"""	11623	protein-coding gene	gene with protein product	"""helix-loop-helix transcription factor 4"""	600480				1886779	Standard	NM_003205		Approved	HEB, HTF4, HsT17266, bHLHb20	uc002aeb.3	Q99081	OTTHUMG00000132047	Exception_encountered	15.37:g.57526275_57526276insCT	ENSP00000267811:p.Gly336fs		Q7Z3D9|Q86TC1|Q86VM2	Frame_Shift_Ins	INS	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.G335fs	ENST00000267811.5	37	c.1005_1006	CCDS10159.1	15																																																																																			TCF12	-	NULL	ENSG00000140262		0.366	TCF12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TCF12	HGNC	protein_coding	OTTHUMT00000255069.3		0.00	55	0	-	NM_003205		57526276	+1	tier1		no_errors	ENST00000438423	ensembl	human	known	74_37	frame_shift_ins	43.14	29	22	INS	0.959:1.000	CT
TENM1	10178	genome.wustl.edu	37	X	124029838	124029838	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chrX:124029838C>T	ENST00000371130.3	-	2	533	c.470G>A	c.(469-471)gGg>gAg	p.G157E	TENM1_ENST00000422452.2_Missense_Mutation_p.G157E	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	157	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										ACCATTTTCCCCATCAGACTT	0.408																																																	0													157.0	140.0	146.0					X																	124029838		2203	4300	6503	SO:0001583	missense	0			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.470G>A	X.37:g.124029838C>T	ENSP00000360171:p.Gly157Glu		B2RTR5|Q5JZ17	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD	p.G157E	ENST00000371130.3	37	c.470	CCDS14609.1	X	.	.	.	.	.	.	.	.	.	.	C	18.09	3.545265	0.65198	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	T;T	0.26957	1.7;1.7	5.56	5.56	0.83823	Teneurin intracellular, N-terminal (2);	0.168747	0.40908	D	0.000985	T	0.23886	0.0578	N	0.11427	0.14	0.45490	D	0.998451	P;P;P	0.48089	0.905;0.905;0.905	P;P;P	0.50490	0.642;0.642;0.642	T	0.06588	-1.0818	10	0.25106	T	0.35	.	18.7885	0.91964	0.0:1.0:0.0:0.0	.	157;157;157	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	E	157	ENSP00000360171:G157E;ENSP00000403954:G157E	ENSP00000360171:G157E	G	-	2	0	ODZ1	123857519	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.389000	0.59639	2.469000	0.83416	0.600000	0.82982	GGG	TENM1	-	pfam_Ten_N	ENSG00000009694		0.408	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM1	HGNC	protein_coding	OTTHUMT00000058985.1	-	0.00	50	0	C	NM_014253		124029838	-1	tier1	-	no_errors	ENST00000422452	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
THAP4	51078	genome.wustl.edu	37	2	242573179	242573179	+	Silent	SNP	C	C	G	rs191058185		TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr2:242573179C>G	ENST00000407315.1	-	2	824	c.393G>C	c.(391-393)tcG>tcC	p.S131S		NM_015963.5	NP_057047.4	Q8WY91	THAP4_HUMAN	THAP domain containing 4	131							DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	9		all_cancers(19;2.09e-34)|all_epithelial(40;2.09e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Ovarian(221;0.069)|Lung NSC(271;0.0886)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.2)		Epithelial(32;2.3e-33)|all cancers(36;8.99e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.68e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.65e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0844)		GGTTTCCACTCGAGGACGGTG	0.662																																																	0													59.0	59.0	59.0					2																	242573179		2203	4296	6499	SO:0001819	synonymous_variant	0			AF258556	CCDS2551.1, CCDS54440.1	2q37.3	2013-01-25			ENSG00000176946	ENSG00000176946		"""THAP (C2CH-type zinc finger) domain containing"""	23187	protein-coding gene	gene with protein product		612533				12575992, 10810093	Standard	NM_015963		Approved	CGI-36	uc002wbt.3	Q8WY91	OTTHUMG00000133410	ENST00000407315.1:c.393G>C	2.37:g.242573179C>G			Q53NU7|Q6GRN0|Q6IPJ3|Q9NW26|Q9Y325	Silent	SNP	pfam_DUF1794,pfam_Znf_C2CH,superfamily_Calycin-like,smart_Znf_C2CH,pfscan_Znf_C2CH	p.S131	ENST00000407315.1	37	c.393	CCDS2551.1	2																																																																																			THAP4	-	NULL	ENSG00000176946		0.662	THAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THAP4	HGNC	protein_coding	OTTHUMT00000257267.3	-	0.00	34	0	C	NM_015963		242573179	-1	tier1	-	no_errors	ENST00000407315	ensembl	human	known	74_37	silent	16.28	36	7	SNP	0.000	G
TMC5	79838	genome.wustl.edu	37	16	19509283	19509283	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr16:19509283G>T	ENST00000396229.2	+	22	3765	c.3016G>T	c.(3016-3018)Gcc>Tcc	p.A1006S	TMC5_ENST00000561503.1_Missense_Mutation_p.A647S|TMC5_ENST00000381414.4_Missense_Mutation_p.A948S|TMC5_ENST00000541464.1_Missense_Mutation_p.A954S|TMC5_ENST00000542583.2_Missense_Mutation_p.A1006S|TMC5_ENST00000219821.5_Missense_Mutation_p.A760S|TMC5_ENST00000564959.1_Missense_Mutation_p.A689S|RNU4-46P_ENST00000410818.1_RNA	NM_001105248.1	NP_001098718.1	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5	1006					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						TAATCCAAGGGCCTGATGACT	0.463																																																	0													220.0	198.0	206.0					16																	19509283		2197	4300	6497	SO:0001583	missense	0			AY263164	CCDS10577.1, CCDS42126.1, CCDS45431.1	16p13.11	2008-02-05			ENSG00000103534	ENSG00000103534			22999	protein-coding gene	gene with protein product						12812529, 12906855	Standard	NM_024780		Approved	FLJ13593	uc010var.2	Q6UXY8	OTTHUMG00000131458	ENST00000396229.2:c.3016G>T	16.37:g.19509283G>T	ENSP00000379531:p.Ala1006Ser		Q68DK8|Q8IY20|Q8NHV6|Q9H8I7	Missense_Mutation	SNP	pfam_TMC	p.A1006S	ENST00000396229.2	37	c.3016	CCDS45431.1	16	.	.	.	.	.	.	.	.	.	.	G	10.67	1.415538	0.25552	.	.	ENSG00000103534	ENST00000541464;ENST00000381414;ENST00000396229;ENST00000542583;ENST00000219821	T;T;T;T;T	0.70164	-0.23;-0.16;-0.32;-0.32;-0.46	4.44	0.108	0.14548	.	48.651600	0.00166	N	0.000000	T	0.53786	0.1818	L	0.36672	1.1	0.09310	N	1	B;B;B;B	0.25441	0.126;0.015;0.045;0.126	B;B;B;B	0.21546	0.035;0.013;0.013;0.035	T	0.33523	-0.9865	10	0.46703	T	0.11	1.5638	1.5077	0.02489	0.1896:0.1668:0.4717:0.1719	.	954;760;1006;948	F5GYU8;Q6UXY8-3;Q6UXY8;Q6UXY8-2	.;.;TMC5_HUMAN;.	S	954;948;1006;1006;760	ENSP00000441227:A954S;ENSP00000370822:A948S;ENSP00000379531:A1006S;ENSP00000446274:A1006S;ENSP00000219821:A760S	ENSP00000219821:A760S	A	+	1	0	TMC5	19416784	0.001000	0.12720	0.000000	0.03702	0.063000	0.16089	0.305000	0.19254	0.071000	0.16664	-0.140000	0.14226	GCC	TMC5	-	NULL	ENSG00000103534		0.463	TMC5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC5	HGNC	protein_coding	OTTHUMT00000435888.1		0.00	74	0	G	NM_024780		19509283	+1			no_errors	ENST00000396229	ensembl	human	known	74_37	missense	6.12	46	3	SNP	0.000	T
TMEM63C	57156	genome.wustl.edu	37	14	77703030	77703030	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr14:77703030C>A	ENST00000298351.4	+	9	750	c.606C>A	c.(604-606)ttC>ttA	p.F202L		NM_020431.2	NP_065164.2	Q9P1W3	CSC1_HUMAN	transmembrane protein 63C	202					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)	integral component of membrane (GO:0016021)	calcium activated cation channel activity (GO:0005227)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(1)	23			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0342)		ACTTCATGTTCATGGCTCATC	0.562																																																	0													133.0	139.0	137.0					14																	77703030		2128	4238	6366	SO:0001583	missense	0				CCDS45141.1	14q24.3	2014-05-30	2005-07-25	2005-07-25	ENSG00000165548	ENSG00000165548			23787	protein-coding gene	gene with protein product	"""calcium permeable stress-gated cation channel 1 homolog (Arabidopsis)"""		"""chromosome 14 open reading frame 171"""	C14orf171		24503647	Standard	NM_020431		Approved	DKFZp434P0111, CSC1, hsCSC1	uc001xtf.2	Q9P1W3	OTTHUMG00000171557	ENST00000298351.4:c.606C>A	14.37:g.77703030C>A	ENSP00000298351:p.Phe202Leu		B2RN22|B3KWJ5|Q86TS3|Q86TS4|Q9NSQ4|Q9P1W1	Missense_Mutation	SNP	pfam_DUF221	p.F202L	ENST00000298351.4	37	c.606	CCDS45141.1	14	.	.	.	.	.	.	.	.	.	.	c	3.665	-0.068756	0.07228	.	.	ENSG00000165548	ENST00000298351	T	0.37411	1.2	4.63	4.63	0.57726	.	0.046793	0.85682	D	0.000000	T	0.26593	0.0650	L	0.45285	1.41	0.30755	N	0.744729	B	0.02656	0.0	B	0.09377	0.004	T	0.22208	-1.0223	10	0.02654	T	1	-16.1655	13.3372	0.60524	0.0:0.9202:0.0:0.0798	.	202	Q9P1W3	TM63C_HUMAN	L	202	ENSP00000298351:F202L	ENSP00000298351:F202L	F	+	3	2	TMEM63C	76772783	1.000000	0.71417	0.980000	0.43619	0.038000	0.13279	1.656000	0.37355	2.281000	0.76405	0.550000	0.68814	TTC	TMEM63C	-	NULL	ENSG00000165548		0.562	TMEM63C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM63C	HGNC	protein_coding	OTTHUMT00000414193.1		0.00	13	0	C			77703030	+1			no_errors	ENST00000298351	ensembl	human	known	74_37	missense	7.41	25	2	SNP	1.000	A
TNIK	23043	genome.wustl.edu	37	3	170781598	170781598	+	3'UTR	SNP	A	A	G			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr3:170781598A>G	ENST00000436636.2	-	0	4499				TNIK_ENST00000538048.1_3'UTR|TNIK_ENST00000341852.6_3'UTR|TNIK_ENST00000369326.5_3'UTR|TNIK_ENST00000464785.1_5'UTR	NM_015028.2	NP_055843.1	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase						actin cytoskeleton reorganization (GO:0031532)|activation of JNKK activity (GO:0007256)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite morphogenesis (GO:0048814)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(22)|ovary(5)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)	62	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			CTAGACTGGCATAAGTCCACA	0.428																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF172264	CCDS46956.1, CCDS54673.1, CCDS54674.1, CCDS54675.1, CCDS54676.1, CCDS54677.1, CCDS54678.1, CCDS54679.1	3q26.31	2008-01-23			ENSG00000154310	ENSG00000154310			30765	protein-coding gene	gene with protein product		610005				9628581, 10521462	Standard	NR_027767		Approved	KIAA0551	uc003fhh.2	Q9UKE5	OTTHUMG00000159036	ENST00000436636.2:c.*72T>C	3.37:g.170781598A>G			A7E2A3|A8K4U1|D3DNQ6|O60298|Q8WUY7|Q9UKD8|Q9UKD9|Q9UKE0|Q9UKE1|Q9UKE2|Q9UKE3|Q9UKE4	RNA	SNP	-	NULL	ENST00000436636.2	37	NULL	CCDS46956.1	3																																																																																			TNIK	-	-	ENSG00000154310		0.428	TNIK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNIK	HGNC	protein_coding	OTTHUMT00000352973.2	-	0.00	42	0	A	XM_039796		170781598	-1	tier1	-	no_errors	ENST00000464785	ensembl	human	putative	74_37	rna	16.67	60	12	SNP	0.402	G
TNFSF10	8743	genome.wustl.edu	37	3	172224587	172224587	+	Missense_Mutation	SNP	A	A	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr3:172224587A>T	ENST00000241261.2	-	5	663	c.541T>A	c.(541-543)Ttt>Att	p.F181I	TNFSF10_ENST00000420541.2_3'UTR	NM_003810.3	NP_003801.1	P50591	TNF10_HUMAN	tumor necrosis factor (ligand) superfamily, member 10	181					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell-cell signaling (GO:0007267)|immune response (GO:0006955)|male gonad development (GO:0008584)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to insulin (GO:0032868)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|receptor binding (GO:0005102)			breast(2)|cervix(1)|large_intestine(1)|lung(6)|ovary(1)|skin(4)	15	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.67e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			ATGTAGTAAAACCCTTTTTCA	0.388																																																	0													156.0	154.0	155.0					3																	172224587		2203	4300	6503	SO:0001583	missense	0			U37518	CCDS3219.1, CCDS54680.1	3q26	2006-09-20			ENSG00000121858	ENSG00000121858		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11925	protein-coding gene	gene with protein product		603598				8777713, 8663110	Standard	NM_003810		Approved	TRAIL, Apo-2L, TL2, CD253	uc003fid.3	P50591	OTTHUMG00000156917	ENST00000241261.2:c.541T>A	3.37:g.172224587A>T	ENSP00000241261:p.Phe181Ile		A1Y9B3	Missense_Mutation	SNP	pfam_TNF_dom,superfamily_Tumour_necrosis_fac-like_dom,smart_TNF_dom,pirsf_TNF_ligand_10/11,pfscan_TNF_dom	p.F181I	ENST00000241261.2	37	c.541	CCDS3219.1	3	.	.	.	.	.	.	.	.	.	.	A	9.762	1.170299	0.21621	.	.	ENSG00000121858	ENST00000241261	D	0.94138	-3.36	5.52	0.216	0.15258	Tumour necrosis factor (3);Tumour necrosis factor-like (2);Tumour necrosis factor, conserved site (1);	0.295064	0.39909	N	0.001237	D	0.87908	0.6296	L	0.52126	1.63	0.58432	D	0.999996	B	0.26902	0.163	B	0.22601	0.04	T	0.78127	-0.2325	10	0.51188	T	0.08	-5.6893	5.9986	0.19507	0.5275:0.1308:0.3417:0.0	.	181	P50591	TNF10_HUMAN	I	181	ENSP00000241261:F181I	ENSP00000241261:F181I	F	-	1	0	TNFSF10	173707281	0.028000	0.19301	0.240000	0.24138	0.136000	0.21042	0.286000	0.18902	-0.138000	0.11434	-0.274000	0.10170	TTT	TNFSF10	-	pfam_TNF_dom,superfamily_Tumour_necrosis_fac-like_dom,smart_TNF_dom,pirsf_TNF_ligand_10/11,pfscan_TNF_dom	ENSG00000121858		0.388	TNFSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFSF10	HGNC	protein_coding	OTTHUMT00000346601.1	-	0.00	35	0	A			172224587	-1	tier1	-	no_errors	ENST00000241261	ensembl	human	known	74_37	missense	10.94	57	7	SNP	0.697	T
TNPO1	3842	genome.wustl.edu	37	5	72178965	72178965	+	Silent	SNP	G	G	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr5:72178965G>T	ENST00000337273.5	+	11	1482	c.1056G>T	c.(1054-1056)acG>acT	p.T352T	TNPO1_ENST00000523768.1_Silent_p.T302T|TNPO1_ENST00000454282.1_Silent_p.T302T|TNPO1_ENST00000506351.2_Silent_p.T344T	NM_002270.3	NP_002261.3	Q92973	TNPO1_HUMAN	transportin 1	352					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|protein import into nucleus, translocation (GO:0000060)|RNA metabolic process (GO:0016070)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(6)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	36		Lung NSC(167;0.0053)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;6.14e-54)		GATCGAGGACGGTGGCTCAGC	0.388																																																	0													95.0	90.0	92.0					5																	72178965		2203	4300	6503	SO:0001819	synonymous_variant	0			U70322	CCDS4016.1, CCDS43329.1	5q13.1	2009-01-12	2004-01-29	2004-01-30	ENSG00000083312	ENSG00000083312		"""Importins"""	6401	protein-coding gene	gene with protein product	"""importin 2"""	602901	"""karyopherin (importin) beta 2"""	KPNB2		8808633, 9144189	Standard	NM_153188		Approved	MIP, TRN, IPO2, MIP1	uc003kci.4	Q92973	OTTHUMG00000100967	ENST00000337273.5:c.1056G>T	5.37:g.72178965G>T			B4DVC6|Q92957|Q92975	Silent	SNP	pfam_HEAT,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.T352	ENST00000337273.5	37	c.1056	CCDS43329.1	5																																																																																			TNPO1	-	superfamily_ARM-type_fold	ENSG00000083312		0.388	TNPO1-001	KNOWN	basic|CCDS	protein_coding	TNPO1	HGNC	protein_coding	OTTHUMT00000218577.3	-	0.00	46	0	G	NM_002270		72178965	+1	tier1	-	no_errors	ENST00000337273	ensembl	human	known	74_37	silent	13.33	26	4	SNP	0.125	T
TNXB	7148	genome.wustl.edu	37	6	32030171	32030171	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr6:32030171C>T	ENST00000375244.3	-	20	7132	c.6931G>A	c.(6931-6933)Gtg>Atg	p.V2311M	TNXB_ENST00000375247.2_Missense_Mutation_p.V2311M			P22105	TENX_HUMAN	tenascin XB	2373	Fibronectin type-III 15. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						GCATCTGTCACGGTCAGCTCC	0.607																																																	0													49.0	55.0	53.0					6																	32030171		1363	2588	3951	SO:0001583	missense	0			X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.6931G>A	6.37:g.32030171C>T	ENSP00000364393:p.Val2311Met		P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.V2311M	ENST00000375244.3	37	c.6931		6	.	.	.	.	.	.	.	.	.	.	C	3.896	-0.022989	0.07634	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.61158	0.13;0.13	4.48	2.65	0.31530	.	0.122603	0.36665	N	0.002477	T	0.64136	0.2571	M	0.93594	3.435	0.09310	N	0.999996	D	0.67145	0.996	P	0.58620	0.842	T	0.62492	-0.6843	10	0.66056	D	0.02	.	7.1538	0.25626	0.0:0.6788:0.1442:0.177	.	2311	P22105-3	.	M	2311	ENSP00000364393:V2311M;ENSP00000364396:V2311M	ENSP00000364393:V2311M	V	-	1	0	TNXB	32138149	0.255000	0.24002	0.376000	0.26042	0.006000	0.05464	0.913000	0.28611	0.022000	0.15160	-2.589000	0.00165	GTG	TNXB	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000168477		0.607	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	TNXB	HGNC	protein_coding	OTTHUMT00000268927.2		0.00	46	0	C	NM_019105		32030171	-1			no_errors	ENST00000375247	ensembl	human	known	74_37	missense	15.00	17	3	SNP	0.174	T
TOR1AIP2	163590	genome.wustl.edu	37	1	179820407	179820407	+	Silent	SNP	G	G	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr1:179820407G>T	ENST00000367612.3	-	4	513	c.126C>A	c.(124-126)atC>atA	p.I42I	TOR1AIP2_ENST00000609928.1_Silent_p.I42I	NM_145034.4	NP_659471.1	Q9H496	IFG15_HUMAN	torsin A interacting protein 2	0										cervix(1)|endometrium(3)|large_intestine(1)|lung(10)|ovary(1)|skin(2)	18						CAGAGTGTAGGATCTCAGCTT	0.433																																																	0													136.0	135.0	136.0					1																	179820407		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS1334.1	1q25.2	2012-02-09			ENSG00000169905	ENSG00000169905			24055	protein-coding gene	gene with protein product		614513				15767459	Standard	NM_145034		Approved	LULL1, NET9, IFRG15	uc001gnk.3	Q8NFQ8	OTTHUMG00000035265	ENST00000367612.3:c.126C>A	1.37:g.179820407G>T			Q05BU2	Silent	SNP	pfam_Lamina-ass_polypeptide_CLAP1C	p.I42	ENST00000367612.3	37	c.126	CCDS1334.1	1																																																																																			TOR1AIP2	-	pfam_Lamina-ass_polypeptide_CLAP1C	ENSG00000169905		0.433	TOR1AIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOR1AIP2	HGNC	protein_coding	OTTHUMT00000085304.1	-	0.00	39	0	G	NM_145034		179820407	-1	tier1	-	no_errors	ENST00000367612	ensembl	human	known	74_37	silent	9.52	38	4	SNP	0.003	T
TP53	7157	genome.wustl.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	C	T	rs28934578		TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr17:7578406C>T	ENST00000269305.4	-	5	713	c.524G>A	c.(523-525)cGc>cAc	p.R175H	TP53_ENST00000359597.4_Missense_Mutation_p.R175H|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000413465.2_Missense_Mutation_p.R175H|TP53_ENST00000445888.2_Missense_Mutation_p.R175H|TP53_ENST00000420246.2_Missense_Mutation_p.R175H|TP53_ENST00000455263.2_Missense_Mutation_p.R175H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGGGGCAGCGCCTCACAAC	0.652	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	980	Substitution - Missense(944)|Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(8)|Complex - deletion inframe(3)	large_intestine(350)|breast(103)|upper_aerodigestive_tract(74)|stomach(70)|central_nervous_system(69)|oesophagus(67)|ovary(58)|lung(40)|haematopoietic_and_lymphoid_tissue(39)|urinary_tract(22)|prostate(17)|liver(14)|pancreas(11)|endometrium(10)|biliary_tract(10)|bone(9)|kidney(4)|cervix(4)|skin(3)|vulva(2)|soft_tissue(2)|penis(1)|adrenal_gland(1)	GRCh37	CM062017|CM951224	TP53	M	rs28934578						50.0	50.0	50.0					17																	7578406		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.524G>A	17.37:g.7578406C>T	ENSP00000269305:p.Arg175His		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R175H	ENST00000269305.4	37	c.524	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	31	5.079737	0.94050	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99908	0.9956	M	0.92784	3.345	0.80722	A	1	D;P;D;D;P;B;D	0.89917	0.999;0.578;1.0;0.998;0.632;0.213;0.999	D;B;D;D;B;B;D	0.91635	0.985;0.26;0.999;0.921;0.378;0.144;0.939	D	0.96278	0.9204	9	0.87932	D	0	-11.8679	17.0767	0.86588	0.0:1.0:0.0:0.0	rs28934578	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175H;ENSP00000352610:R175H;ENSP00000269305:R175H;ENSP00000398846:R175H;ENSP00000391127:R175H;ENSP00000391478:R175H;ENSP00000425104:R43H;ENSP00000423862:R82H	ENSP00000269305:R175H	R	-	2	0	TP53	7519131	1.000000	0.71417	0.989000	0.46669	0.795000	0.44927	6.042000	0.70996	2.702000	0.92279	0.655000	0.94253	CGC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	24	0	C	NM_000546		7578406	-1	tier1	rs28934578	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	75.00	6	18	SNP	1.000	T
TPST2	8459	genome.wustl.edu	37	22	26932333	26932333	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr22:26932333G>A	ENST00000338754.4	-	4	1232	c.962C>T	c.(961-963)gCt>gTt	p.A321V	TPST2_ENST00000398110.2_Missense_Mutation_p.A321V|TPST2_ENST00000403880.1_Missense_Mutation_p.A321V	NM_003595.3	NP_003586.3	O60704	TPST2_HUMAN	tyrosylprotein sulfotransferase 2	321					fusion of sperm to egg plasma membrane (GO:0007342)|peptidyl-tyrosine sulfation (GO:0006478)|prevention of polyspermy (GO:0060468)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein-tyrosine sulfotransferase activity (GO:0008476)			central_nervous_system(1)|large_intestine(1)|lung(5)	7						GCCGAGCTGAGCCAGCATGGG	0.587																																																	0													71.0	61.0	64.0					22																	26932333		2203	4300	6503	SO:0001583	missense	0			AF049891	CCDS13839.1	22q12.1	2012-12-13			ENSG00000128294	ENSG00000128294	2.8.2.20	"""Sulfotransferases, membrane-bound"""	12021	protein-coding gene	gene with protein product	"""transport and golgi organization 13 homolog B (Drosophila)"""	603126				9736702, 9733778	Standard	NM_003595		Approved	TANGO13B	uc003acx.3	O60704	OTTHUMG00000150987	ENST00000338754.4:c.962C>T	22.37:g.26932333G>A	ENSP00000339813:p.Ala321Val		B3KQA7|Q6FI98|Q9H0V4	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.A321V	ENST00000338754.4	37	c.962	CCDS13839.1	22	.	.	.	.	.	.	.	.	.	.	G	15.40	2.823646	0.50739	.	.	ENSG00000128294	ENST00000338754;ENST00000398110;ENST00000403880;ENST00000528868;ENST00000445720	T;T;T;T	0.44881	0.91;0.91;0.91;0.91	4.88	4.88	0.63580	.	0.173560	0.39544	N	0.001321	T	0.45736	0.1357	M	0.78049	2.395	0.54753	D	0.999984	B	0.32302	0.363	B	0.27076	0.076	T	0.49072	-0.8977	10	0.39692	T	0.17	-6.7478	17.2272	0.86973	0.0:0.0:1.0:0.0	.	321	O60704	TPST2_HUMAN	V	321;321;321;254;68	ENSP00000339813:A321V;ENSP00000381180:A321V;ENSP00000385192:A321V;ENSP00000403758:A68V	ENSP00000339813:A321V	A	-	2	0	TPST2	25262333	1.000000	0.71417	0.997000	0.53966	0.698000	0.40448	5.752000	0.68728	2.535000	0.85469	0.655000	0.94253	GCT	TPST2	-	superfamily_P-loop_NTPase	ENSG00000128294		0.587	TPST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPST2	HGNC	protein_coding	OTTHUMT00000320820.3	-	0.00	47	0	G	NM_003595		26932333	-1	tier1	-	no_errors	ENST00000338754	ensembl	human	known	74_37	missense	44.44	20	16	SNP	1.000	A
TRIM49	57093	genome.wustl.edu	37	11	89531678	89531678	+	Missense_Mutation	SNP	T	T	C			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr11:89531678T>C	ENST00000329758.1	-	8	1307	c.979A>G	c.(979-981)Agt>Ggt	p.S327G	TRIM49_ENST00000532501.2_Missense_Mutation_p.S250G	NM_020358.2	NP_065091.1	P0CI25	TRI49_HUMAN	tripartite motif containing 49	327	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(14)|prostate(1)|skin(2)|stomach(1)	27		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				GCAAGAAAACTTCTAGGTGTT	0.418																																																	0													13.0	16.0	15.0					11																	89531678		2019	4186	6205	SO:0001583	missense	0			AB037682	CCDS8287.1	11p11.12-q12	2012-05-21	2011-01-25	2004-11-17	ENSG00000168930	ENSG00000168930		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	13431	protein-coding gene	gene with protein product		606124	"""ring finger protein 18"", ""tripartite motif-containing 49"""	RNF18		11018261	Standard	NM_020358		Approved	TRIM49A	uc001pdb.3	P0CI25		ENST00000329758.1:c.979A>G	11.37:g.89531678T>C	ENSP00000327604:p.Ser327Gly		A0AVR7|A0AVR9|Q6DJV1|Q9NS80	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,superfamily_Lambda_DNA-bd_dom,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING	p.S327G	ENST00000329758.1	37	c.979	CCDS8287.1	11	.	.	.	.	.	.	.	.	.	.	T	0.016	-1.527908	0.00959	.	.	ENSG00000168930	ENST00000329758;ENST00000532501	T	0.08458	3.09	0.539	-1.08	0.09936	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	.	.	.	.	T	0.06462	0.0166	L	0.41573	1.285	0.09310	N	1	B	0.29378	0.243	B	0.30716	0.119	T	0.41106	-0.9527	7	.	.	.	.	.	.	.	.	327	P0CI25	TRI49_HUMAN	G	327;250	ENSP00000327604:S327G	.	S	-	1	0	TRIM49	89171326	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.057000	0.11768	-0.399000	0.07668	-1.394000	0.01149	AGT	TRIM49	-	superfamily_ConA-like_lec_gl_sf,prints_Butyrophylin,pfscan_B30.2/SPRY	ENSG00000168930		0.418	TRIM49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM49	HGNC	protein_coding	OTTHUMT00000395435.1		0.00	69	0	T	NM_020358		89531678	-1			no_errors	ENST00000329758	ensembl	human	known	74_37	missense	12.68	62	9	SNP	0.000	C
TRIM49C	642612	genome.wustl.edu	37	11	89774338	89774338	+	Missense_Mutation	SNP	A	A	G			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr11:89774338A>G	ENST00000448984.1	+	8	1308	c.979A>G	c.(979-981)Agt>Ggt	p.S327G	TRIM49C_ENST00000432771.1_Intron	NM_001195234.1	NP_001182163.1	P0CI26	TR49C_HUMAN	tripartite motif containing 49C	327	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|lung(4)	8						AACACCTAGAAGTTTTCTTGC	0.423																																																	0																																										SO:0001583	missense	0			BC126470	CCDS53694.1	11q14.3	2014-02-17	2012-05-18	2012-05-18	ENSG00000204449	ENSG00000204449		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	38877	protein-coding gene	gene with protein product			"""tripartite motif containing 49-like 2"""	TRIM49L2			Standard	NM_001195234		Approved		uc010rua.2	P0CI26		ENST00000448984.1:c.979A>G	11.37:g.89774338A>G	ENSP00000388299:p.Ser327Gly		A0AVR7|A0AVR9|Q6DJV1|Q9NS80	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,superfamily_Lambda_DNA-bd_dom,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING	p.S327G	ENST00000448984.1	37	c.979	CCDS53694.1	11	.	.	.	.	.	.	.	.	.	.	A	3.900	-0.022230	0.07634	.	.	ENSG00000204449	ENST00000448984	T	0.08458	3.09	0.823	-0.7	0.11273	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	.	.	.	.	T	0.05868	0.0153	L	0.38649	1.16	0.09310	N	1	B	0.29378	0.243	B	0.30716	0.119	T	0.41858	-0.9485	8	.	.	.	.	2.82	0.05468	0.4537:0.0:0.0:0.5463	.	327	P0CI26	T49L2_HUMAN	G	327	ENSP00000388299:S327G	.	S	+	1	0	TRIM49L2	89413986	0.000000	0.05858	0.000000	0.03702	0.046000	0.14306	0.039000	0.13884	-0.248000	0.09583	0.254000	0.18369	AGT	TRIM49C	-	superfamily_ConA-like_lec_gl_sf,prints_Butyrophylin,pfscan_B30.2/SPRY	ENSG00000204449		0.423	TRIM49C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIM49C	HGNC	protein_coding	OTTHUMT00000395455.1	-	0.00	127	0	A	NM_001195234		89774338	+1	tier1	-	no_errors	ENST00000448984	ensembl	human	known	74_37	missense	22.22	112	32	SNP	0.001	G
TRPM3	80036	genome.wustl.edu	37	9	73151067	73151067	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr9:73151067C>A	ENST00000377110.3	-	25	5169	c.4926G>T	c.(4924-4926)gaG>gaT	p.E1642D	TRPM3_ENST00000377111.2_Intron|TRPM3_ENST00000358082.3_Missense_Mutation_p.E1504D|TRPM3_ENST00000423814.3_Missense_Mutation_p.E1669D|TRPM3_ENST00000360823.2_Missense_Mutation_p.E1504D|TRPM3_ENST00000396280.5_Missense_Mutation_p.E1491D|TRPM3_ENST00000408909.2_Missense_Mutation_p.E1501D|TRPM3_ENST00000377106.1_Missense_Mutation_p.E1514D|TRPM3_ENST00000396292.4_Missense_Mutation_p.E1514D|TRPM3_ENST00000377105.1_Missense_Mutation_p.E1501D|TRPM3_ENST00000396285.1_Missense_Mutation_p.E1501D|TRPM3_ENST00000357533.2_Missense_Mutation_p.E1646D			Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	1667					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						GCGCACTTGGCTCCTCTGCCG	0.532																																																	0													382.0	361.0	368.0					9																	73151067		2203	4300	6503	SO:0001583	missense	0			AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377110.3:c.4926G>T	9.37:g.73151067C>A	ENSP00000366314:p.Glu1642Asp		A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.E1669D	ENST00000377110.3	37	c.5007	CCDS43835.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.10|10.10	1.256650|1.256650	0.22965|0.22965	.|.	.|.	ENSG00000083067|ENSG00000083067	ENST00000396280|ENST00000377110;ENST00000377106;ENST00000360823;ENST00000377105;ENST00000357533;ENST00000408909;ENST00000396285;ENST00000396292;ENST00000358082;ENST00000423814	.|T;T;T;T;T;T;T;T;T;T	.|0.55234	.|0.58;0.56;0.56;0.53;0.59;0.53;0.56;0.56;0.56;0.58	5.77|5.77	3.9|3.9	0.45041|0.45041	.|.	.|0.241491	.|0.41938	.|N	.|0.000781	T|T	0.33089|0.33089	0.0851|0.0851	L|L	0.27053|0.27053	0.805|0.805	0.37565|0.37565	D|D	0.919229|0.919229	.|B;B;B;B;B;B;B	.|0.02656	.|0.0;0.0;0.0;0.0;0.0;0.0;0.0	.|B;B;B;B;B;B;B	.|0.06405	.|0.002;0.001;0.0;0.0;0.001;0.001;0.0	T|T	0.16867|0.16867	-1.0388|-1.0388	5|10	.|0.30854	.|T	.|0.27	-15.7542|-15.7542	3.771|3.771	0.08642|0.08642	0.1372:0.5906:0.1324:0.1398|0.1372:0.5906:0.1324:0.1398	.|.	.|1642;1632;1646;1504;1501;1614;1501	.|Q9HCF6-2;Q9HCF6-4;A2A3F7;A2A3F4;G5E9G1;Q9HCF6-8;A2A3F3	.|.;.;.;.;.;.;.	S|D	1491|1642;1514;1504;1501;1646;1501;1501;1514;1504;1669	.|ENSP00000366314:E1642D;ENSP00000366310:E1514D;ENSP00000354066:E1504D;ENSP00000366309:E1501D;ENSP00000350140:E1646D;ENSP00000386127:E1501D;ENSP00000379581:E1501D;ENSP00000379587:E1514D;ENSP00000350791:E1504D;ENSP00000389542:E1669D	.|ENSP00000350140:E1646D	A|E	-|-	1|3	0|2	TRPM3|TRPM3	72340887|72340887	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.929000|0.929000	0.56500|0.56500	1.457000|1.457000	0.35212|0.35212	0.758000|0.758000	0.33059|0.33059	0.655000|0.655000	0.94253|0.94253	GCC|GAG	TRPM3	-	NULL	ENSG00000083067		0.532	TRPM3-008	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPM3	HGNC	protein_coding	OTTHUMT00000214158.3	-	0.00	48	0	C	NM_206945		73151067	-1	tier1	-	no_errors	ENST00000423814	ensembl	human	known	74_37	missense	10.00	63	7	SNP	1.000	A
TTC28	23331	genome.wustl.edu	37	22	28379472	28379472	+	Silent	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr22:28379472G>A	ENST00000397906.2	-	23	6324	c.6183C>T	c.(6181-6183)atC>atT	p.I2061I	TTC28-AS1_ENST00000454741.1_RNA|TTC28-AS1_ENST00000453632.1_RNA|TTC28-AS1_ENST00000452612.1_RNA|TTC28-AS1_ENST00000454996.1_RNA|TTC28-AS1_ENST00000435348.1_RNA|TTC28-AS1_ENST00000424161.1_RNA|TTC28-AS1_ENST00000430525.1_RNA|TTC28-AS1_ENST00000425112.1_RNA|TTC28-AS1_ENST00000419253.1_RNA|TTC28-AS1_ENST00000434221.1_RNA|TTC28-AS1_ENST00000430853.1_RNA|TTC28-AS1_ENST00000417497.1_RNA	NM_001145418.1	NP_001138890.1	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28	2061					mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)				endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)	12						CGTTACTGATGATAGAAAACC	0.542																																																	0													89.0	76.0	80.0					22																	28379472		692	1591	2283	SO:0001819	synonymous_variant	0			AB028966	CCDS46678.1	22q12.1	2013-01-10			ENSG00000100154	ENSG00000100154		"""Tetratricopeptide (TTC) repeat domain containing"""	29179	protein-coding gene	gene with protein product		615098				10470851	Standard	NM_001145418		Approved	KIAA1043	uc003adp.4	Q96AY4	OTTHUMG00000151006	ENST00000397906.2:c.6183C>T	22.37:g.28379472G>A			K7ZRV2|O95928|O95929|Q5W189|Q9NTE4|Q9UG31|Q9UGG5|Q9UPV8|Q9Y3S5	Silent	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.I2061	ENST00000397906.2	37	c.6183	CCDS46678.1	22																																																																																			TTC28	-	NULL	ENSG00000100154		0.542	TTC28-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	TTC28	HGNC	protein_coding	OTTHUMT00000320930.2	-	0.00	29	0	G	XM_929318		28379472	-1	tier1	-	no_errors	ENST00000397906	ensembl	human	novel	74_37	silent	41.67	14	10	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179658218	179658218	+	Silent	SNP	G	G	A	rs141617218		TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr2:179658218G>A	ENST00000591111.1	-	9	1673	c.1449C>T	c.(1447-1449)gcC>gcT	p.A483A	TTN_ENST00000342175.6_Silent_p.A483A|TTN_ENST00000359218.5_Silent_p.A483A|TTN_ENST00000589042.1_Silent_p.A483A|TTN_ENST00000342992.6_Silent_p.A483A|TTN_ENST00000460472.2_Silent_p.A483A|TTN_ENST00000360870.5_Silent_p.A483A			Q8WZ42	TITIN_HUMAN	titin	0					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGCTTTATCGGCGGCCACTA	0.398																																																	0								G	,,,,	0,4406		0,0,2203	268.0	265.0	266.0		1449,1449,1449,1449,1449	0.1	1.0	2	dbSNP_134	266	4,8596	3.7+/-12.6	0,4,4296	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	TTN	NM_003319.4,NM_133378.4,NM_133379.3,NM_133432.3,NM_133437.3	,,,,	0,4,6499	AA,AG,GG		0.0465,0.0,0.0308	,,,,	483/26927,483/33424,483/5605,483/27052,483/27119	179658218	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.1449C>T	2.37:g.179658218G>A			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.A483	ENST00000591111.1	37	c.1449		2																																																																																			TTN	-	pfam_Titin_Z,superfamily_RNaseH-like_dom	ENSG00000155657		0.398	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	32	0	G	NM_133378		179658218	-1	tier1	rs141617218	no_errors	ENST00000342992	ensembl	human	known	74_37	silent	59.62	21	31	SNP	0.997	A
UBR1	197131	genome.wustl.edu	37	15	43348619	43348619	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr15:43348619C>T	ENST00000290650.4	-	11	1282	c.1204G>A	c.(1204-1206)Gaa>Aaa	p.E402K	UBR1_ENST00000382177.2_Missense_Mutation_p.E402K	NM_174916.2	NP_777576.1	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin 1	402					cellular response to leucine (GO:0071233)|negative regulation of TOR signaling (GO:0032007)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|proteasome complex (GO:0000502)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(7)|large_intestine(12)|lung(25)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	58		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		CTGATATATTCTTTCTGCAGT	0.294																																																	0													89.0	94.0	92.0					15																	43348619		2203	4297	6500	SO:0001583	missense	0				CCDS10091.1	15q13	2008-06-23			ENSG00000159459	ENSG00000159459		"""Ubiquitin protein ligase E3 component n-recognins"""	16808	protein-coding gene	gene with protein product		605981				9653112	Standard	NM_174916		Approved		uc001zqq.3	Q8IWV7	OTTHUMG00000130702	ENST00000290650.4:c.1204G>A	15.37:g.43348619C>T	ENSP00000290650:p.Glu402Lys		O60708|O75492|Q14D45|Q68DN9|Q8IWY6|Q96JY4	Missense_Mutation	SNP	pfam_ClpS_core,pfam_Znf_N-recognin,superfamily_Ribosomal_L7/12_C/ClpS-like,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.E402K	ENST00000290650.4	37	c.1204	CCDS10091.1	15	.	.	.	.	.	.	.	.	.	.	C	25.5	4.643435	0.87859	.	.	ENSG00000159459	ENST00000290650;ENST00000382177;ENST00000546274	T;T	0.70749	0.33;-0.51	5.14	5.14	0.70334	.	0.214084	0.48286	D	0.000188	T	0.58836	0.2150	L	0.43152	1.355	0.80722	D	1	B;P	0.39665	0.032;0.682	B;B	0.32980	0.016;0.156	T	0.60606	-0.7230	10	0.06236	T	0.91	-0.0573	18.7978	0.92003	0.0:1.0:0.0:0.0	.	402;402	B4DYL2;Q8IWV7	.;UBR1_HUMAN	K	402	ENSP00000290650:E402K;ENSP00000371612:E402K	ENSP00000290650:E402K	E	-	1	0	UBR1	41135911	1.000000	0.71417	0.994000	0.49952	0.942000	0.58702	5.441000	0.66569	2.675000	0.91044	0.650000	0.86243	GAA	UBR1	-	NULL	ENSG00000159459		0.294	UBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR1	HGNC	protein_coding	OTTHUMT00000253202.1	-	0.00	61	0	C	NM_174916		43348619	-1	tier1	-	no_errors	ENST00000290650	ensembl	human	known	74_37	missense	18.31	58	13	SNP	1.000	T
UCA1	652995	genome.wustl.edu	37	19	15939884	15939884	+	RNA	SNP	G	G	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr19:15939884G>T	ENST00000397381.4	+	0	114				AC004510.3_ENST00000589310.1_lincRNA	NR_015379.3				urothelial cancer associated 1 (non-protein coding)																		ctataaagctgcccctctcct	0.498																																																	0																																												0			BC005351		19p13.12	2013-07-02			ENSG00000214049	ENSG00000214049		"""Long non-coding RNAs"", ""-"""	37126	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 178"", ""cancer up-regulated drug resistant"""					18501714, 17416635, 23801869	Standard	NR_015379		Approved	LINC00178, CUDR, UCAT1	uc002nbr.4		OTTHUMG00000182287		19.37:g.15939884G>T				RNA	SNP	-	NULL	ENST00000397381.4	37	NULL		19																																																																																			UCA1	-	-	ENSG00000214049		0.498	UCA1-001	KNOWN	basic	lincRNA	UCA1	HGNC	processed_transcript	OTTHUMT00000362098.19	-	0.00	10	0	G	NR_015379		15939884	+1	tier1	-	no_errors	ENST00000397381	ensembl	human	known	74_37	rna	40.00	6	4	SNP	0.010	T
UMODL1	89766	genome.wustl.edu	37	21	43504206	43504206	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr21:43504206C>T	ENST00000408910.2	+	3	332	c.332C>T	c.(331-333)tCc>tTc	p.S111F	UMODL1_ENST00000400424.2_Missense_Mutation_p.S39F|UMODL1_ENST00000400427.1_Missense_Mutation_p.S39F|UMODL1_ENST00000408989.2_Missense_Mutation_p.S111F	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1	111					adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						CTGAATCAGTCCGGGCAGTTC	0.557																																					Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)												0													148.0	161.0	157.0					21																	43504206		1939	4127	6066	SO:0001583	missense	0				CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.332C>T	21.37:g.43504206C>T	ENSP00000386147:p.Ser111Phe		C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Missense_Mutation	SNP	pfam_ZP_dom,pfam_SEA_dom,pfam_EGF-like_Ca-bd_dom,pfam_EMI_domain,pfam_WAP-type_4-diS_core,superfamily_Fibronectin_type3,superfamily_WAP-type_4-diS_core,smart_WAP-type_4-diS_core,smart_EGF-like_Ca-bd_dom,smart_Fibronectin_type3,smart_ZP_dom,pfscan_EG-like_dom,pfscan_EMI_domain,pfscan_Fibronectin_type3,pfscan_ZP_dom,prints_ZP_dom	p.S111F	ENST00000408910.2	37	c.332	CCDS42936.1	21	.	.	.	.	.	.	.	.	.	.	C	11.86	1.763231	0.31228	.	.	ENSG00000177398	ENST00000400427;ENST00000400424;ENST00000408989;ENST00000408910	T;T;T;T	0.79653	-1.27;-1.25;-1.29;-1.27	3.86	3.86	0.44501	Whey acidic protein, 4-disulphide core (1);	0.000000	0.47093	D	0.000253	D	0.87513	0.6196	M	0.67953	2.075	0.35912	D	0.831209	D;D	0.89917	0.999;1.0	D;D	0.80764	0.994;0.981	D	0.91088	0.4904	10	0.87932	D	0	-31.1465	13.7599	0.62959	0.0:1.0:0.0:0.0	.	111;111	Q5DID0-2;Q5DID0	.;UROL1_HUMAN	F	39;39;111;111	ENSP00000383279:S39F;ENSP00000383276:S39F;ENSP00000386126:S111F;ENSP00000386147:S111F	ENSP00000383276:S39F	S	+	2	0	UMODL1	42377275	0.590000	0.26815	0.808000	0.32385	0.026000	0.11368	2.861000	0.48380	2.449000	0.82847	0.563000	0.77884	TCC	UMODL1	-	superfamily_WAP-type_4-diS_core	ENSG00000177398		0.557	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UMODL1	HGNC	protein_coding	OTTHUMT00000195292.2		0.00	37	0	C			43504206	+1			no_errors	ENST00000408989	ensembl	human	known	74_37	missense	8.82	31	3	SNP	0.749	T
UNC13C	440279	genome.wustl.edu	37	15	54306750	54306751	+	Missense_Mutation	DNP	AT	AT	TA			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	A|T	A|T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr15:54306750_54306751AT>TA	ENST00000260323.11	+	1	1650_1651	c.1650_1651AT>TA	c.(1648-1653)gaATca>gaTAca	p.550_551ES>DT	UNC13C_ENST00000545554.1_Missense_Mutation_p.550_551ES>DT|UNC13C_ENST00000537900.1_Missense_Mutation_p.550_551ES>DT	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	550					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		GTCGTTCTGAATCAGATTTTTC	0.396																																																	0																																										SO:0001583	missense	0			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	Exception_encountered	15.37:g.54306750_54306751delinsTA	ENSP00000260323:p.E550_S551delinsDT		Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_dom,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.E550D|p.S551T	ENST00000260323.11	37	c.1650|c.1651	CCDS45264.1	15																																																																																			UNC13C	-	NULL	ENSG00000137766		0.396	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	HGNC	protein_coding	OTTHUMT00000419028.3	-	0.00	22	0	A|T	NM_173166		54306750|54306751	+1	tier1	-	no_errors	ENST00000260323	ensembl	human	known	74_37	missense	42.42|44.12	19	14|15	SNP	0.989|1.000	T|A
UPF1	5976	genome.wustl.edu	37	19	18971220	18971220	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr19:18971220C>T	ENST00000599848.1	+	16	2515	c.2306C>T	c.(2305-2307)gCc>gTc	p.A769V	UPF1_ENST00000262803.5_Missense_Mutation_p.A758V			Q92900	RENT1_HUMAN	UPF1 regulator of nonsense transcripts homolog (yeast)	769					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|dosage compensation by inactivation of X chromosome (GO:0009048)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40						GAGGAGATTGCCAGCTCGGGC	0.577																																																	0													128.0	120.0	123.0					19																	18971220		2203	4300	6503	SO:0001583	missense	0			AF074016	CCDS12386.1, CCDS74315.1	19p13.2-p13.11	2012-02-29	2006-02-07	2006-02-07	ENSG00000005007	ENSG00000005007			9962	protein-coding gene	gene with protein product	"""UP Frameshift 1"", ""smg-2 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	601430	"""regulator of nonsense transcripts 1"""	RENT1		8855285, 9064659	Standard	XM_005260015		Approved	HUPF1, KIAA0221, NORF1, pNORF1, smg-2	uc002nkf.3	Q92900		ENST00000599848.1:c.2306C>T	19.37:g.18971220C>T	ENSP00000470142:p.Ala769Val		O00239|O43343|Q86Z25|Q92842	Missense_Mutation	SNP	pfam_RNA-helicase_UPF1_UPF2-interct,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase	p.A769V	ENST00000599848.1	37	c.2306		19	.	.	.	.	.	.	.	.	.	.	C	32	5.133190	0.94517	.	.	ENSG00000005007	ENST00000262803	D	0.92595	-3.07	4.62	4.62	0.57501	.	0.000000	0.85682	D	0.000000	D	0.86924	0.6050	N	0.11870	0.19	0.80722	D	1	P;P	0.49961	0.93;0.915	P;B	0.45428	0.48;0.248	D	0.89944	0.4075	10	0.87932	D	0	-35.4882	16.4462	0.83935	0.0:1.0:0.0:0.0	.	769;758	Q92900;Q92900-2	RENT1_HUMAN;.	V	758	ENSP00000262803:A758V	ENSP00000262803:A758V	A	+	2	0	UPF1	18832220	1.000000	0.71417	0.994000	0.49952	0.963000	0.63663	7.430000	0.80321	2.108000	0.64289	0.478000	0.44815	GCC	UPF1	-	superfamily_P-loop_NTPase	ENSG00000005007		0.577	UPF1-002	KNOWN	basic	protein_coding	UPF1	HGNC	protein_coding	OTTHUMT00000464684.1	-	0.00	35	0	C	NM_002911		18971220	+1	tier1	-	no_errors	ENST00000599848	ensembl	human	known	74_37	missense	12.50	28	4	SNP	1.000	T
UXS1	80146	genome.wustl.edu	37	2	106710608	106710608	+	Silent	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr2:106710608C>T	ENST00000409501.3	-	15	1194	c.1137G>A	c.(1135-1137)ccG>ccA	p.P379P	UXS1_ENST00000540130.1_Silent_p.P322P|UXS1_ENST00000409032.1_Silent_p.P211P|UXS1_ENST00000283148.7_Silent_p.P384P			Q8NBZ7	UXS1_HUMAN	UDP-glucuronate decarboxylase 1	379					protein tetramerization (GO:0051262)|UDP-D-xylose biosynthetic process (GO:0033320)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	NAD+ binding (GO:0070403)|protein homodimerization activity (GO:0042803)|UDP-glucuronate decarboxylase activity (GO:0048040)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)	17						CTTCCTCCAGCGGGACCTGTT	0.478																																																	0													146.0	140.0	142.0					2																	106710608		1951	4137	6088	SO:0001819	synonymous_variant	0			AK027244	CCDS46378.1, CCDS58720.1, CCDS58721.1	2q12.2	2012-02-22			ENSG00000115652	ENSG00000115652	4.1.1.35	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	17729	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 6E, member 12"""	609749				19027726	Standard	NM_001253875		Approved	FLJ23591, UGD, SDR6E1	uc002tdn.3	Q8NBZ7	OTTHUMG00000153150	ENST00000409501.3:c.1137G>A	2.37:g.106710608C>T			Q8NBX3|Q9H5C2	Silent	SNP	pfam_Epimerase_deHydtase,pfam_UXS1_N,pfam_dTDP_dehydrorham_reduct,pfam_Male_sterile_NAD-bd,pfam_3Beta_OHSteriod_DH/Estase	p.P384	ENST00000409501.3	37	c.1152	CCDS46378.1	2																																																																																			UXS1	-	NULL	ENSG00000115652		0.478	UXS1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	UXS1	HGNC	protein_coding	OTTHUMT00000329778.1	-	0.00	23	0	C	NM_025076.3		106710608	-1	tier1	-	no_errors	ENST00000283148	ensembl	human	known	74_37	silent	19.05	17	4	SNP	0.001	T
VWA8	23078	genome.wustl.edu	37	13	42149965	42149965	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr13:42149965C>T	ENST00000379310.3	-	43	5349	c.5281G>A	c.(5281-5283)Gtt>Att	p.V1761I		NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8	1761	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.					extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)										GAGTGTCCAACGATGTCATAC	0.358																																																	0													120.0	111.0	114.0					13																	42149965		1843	4101	5944	SO:0001583	missense	0			AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.5281G>A	13.37:g.42149965C>T	ENSP00000368612:p.Val1761Ile		O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	Missense_Mutation	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_VWF_A,superfamily_P-loop_NTPase,smart_AAA+_ATPase,smart_VWF_A,pfscan_VWF_A	p.V1761I	ENST00000379310.3	37	c.5281	CCDS41881.1	13	.	.	.	.	.	.	.	.	.	.	C	9.974	1.226341	0.22542	.	.	ENSG00000102763	ENST00000251030;ENST00000379310	T	0.13657	2.57	5.86	1.61	0.23674	von Willebrand factor, type A (3);	0.664446	0.15164	N	0.277010	T	0.07279	0.0184	N	0.25332	0.735	0.53688	D	0.999978	B	0.28026	0.198	B	0.28784	0.094	T	0.29792	-1.0000	10	0.11794	T	0.64	.	3.7737	0.08652	0.254:0.4211:0.0:0.3249	.	1761	A3KMH1	K0564_HUMAN	I	1665;1761	ENSP00000368612:V1761I	ENSP00000251030:V1665I	V	-	1	0	KIAA0564	41047965	0.983000	0.35010	0.964000	0.40570	0.556000	0.35491	0.586000	0.23894	0.260000	0.21731	-0.150000	0.13652	GTT	VWA8	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000102763		0.358	VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA8	HGNC	protein_coding	OTTHUMT00000354828.2	-	0.00	33	0	C	NM_015058		42149965	-1	tier1	-	no_errors	ENST00000379310	ensembl	human	known	74_37	missense	21.43	33	9	SNP	0.843	T
WDR36	134430	genome.wustl.edu	37	5	110427994	110427994	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr5:110427994G>A	ENST00000513710.2	+	1	12	c.8G>A	c.(7-9)tGc>tAc	p.C3Y	WDR36_ENST00000505303.1_5'Flank|CTC-551A13.2_ENST00000507269.3_RNA|WDR36_ENST00000506538.2_Missense_Mutation_p.C3Y			Q8NI36	WDR36_HUMAN	WD repeat domain 36	3					regulation of axon extension (GO:0030516)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|rRNA processing (GO:0006364)|visual perception (GO:0007601)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(9)|kidney(4)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)		TTTATGTGTTGCACTGAGGGC	0.587																																																	0													76.0	81.0	79.0					5																	110427994		2202	4300	6502	SO:0001583	missense	0			AF385437	CCDS4102.1	5q22.2	2013-01-09			ENSG00000134987	ENSG00000134987		"""WD repeat domain containing"""	30696	protein-coding gene	gene with protein product		609669	"""glaucoma 1, open angle, G"""	GLC1G		15590835, 15677485	Standard	NM_139281		Approved	TA-WDRP, UTP21	uc003kpd.3	Q8NI36	OTTHUMG00000128790	ENST00000513710.2:c.8G>A	5.37:g.110427994G>A	ENSP00000424628:p.Cys3Tyr		A2RUS4|Q68E02|Q8N1Q2	Missense_Mutation	SNP	pfam_SSU_processome_Utp21,pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.C3Y	ENST00000513710.2	37	c.8	CCDS4102.1	5	.	.	.	.	.	.	.	.	.	.	G	17.12	3.306937	0.60305	.	.	ENSG00000134987	ENST00000506538;ENST00000513710	T;T	0.66638	-0.22;-0.22	5.42	2.45	0.29901	.	0.145674	0.32518	N	0.006000	T	0.42517	0.1206	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32079	-0.9920	10	0.87932	D	0	-1.7813	7.4705	0.27347	0.1595:0.1371:0.7033:0.0	.	3	Q8NI36	WDR36_HUMAN	Y	3	ENSP00000423067:C3Y;ENSP00000424628:C3Y	ENSP00000423067:C3Y	C	+	2	0	WDR36	110455893	0.979000	0.34478	0.575000	0.28536	0.105000	0.19272	2.160000	0.42348	0.744000	0.32741	0.655000	0.94253	TGC	WDR36	-	NULL	ENSG00000134987		0.587	WDR36-008	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	WDR36	HGNC	protein_coding	OTTHUMT00000373504.3	-	0.00	42	0	G	NM_139281		110427994	+1	tier1	-	no_errors	ENST00000506538	ensembl	human	known	74_37	missense	10.81	33	4	SNP	0.750	A
WNK2	65268	genome.wustl.edu	37	9	96080256	96080256	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr9:96080256C>T	ENST00000297954.4	+	30	6841	c.6841C>T	c.(6841-6843)Cgg>Tgg	p.R2281W	WNK2_ENST00000395477.2_Intron|WNK2_ENST00000349097.3_Intron|WNK2_ENST00000427277.2_Intron|WNK2_ENST00000356055.3_Intron|WNK2_ENST00000471076.1_Intron|WNK2_ENST00000395475.2_Intron	NM_001282394.1	NP_001269323.1	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	2281					intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(11)|kidney(4)|large_intestine(5)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)	54						AGGGGGACAGCGGGTGGGCAG	0.652																																																	0													53.0	51.0	52.0					9																	96080256		876	1991	2867	SO:0001583	missense	0			AJ242724	CCDS75858.1	9q22.3	2008-02-05	2003-06-23	2005-01-22	ENSG00000165238	ENSG00000165238			14542	protein-coding gene	gene with protein product		606249	"""serologically defined colon cancer antigen 43"""	SDCCAG43, PRKWNK2		9610721, 11571656	Standard	NM_006648		Approved	NY-CO-43, KIAA1760	uc004atj.3	Q9Y3S1	OTTHUMG00000020247	ENST00000297954.4:c.6841C>T	9.37:g.96080256C>T	ENSP00000297954:p.Arg2281Trp		Q5VWF1|Q5VWF2|Q8IY36|Q9C0A3|Q9H3P4	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R2281W	ENST00000297954.4	37	c.6841		9	.	.	.	.	.	.	.	.	.	.	C	14.44	2.537192	0.45176	.	.	ENSG00000165238	ENST00000297954	T	0.70749	-0.51	3.6	-3.29	0.05017	.	5.104090	0.00957	N	0.003051	T	0.50616	0.1626	.	.	.	0.09310	N	1	P	0.41159	0.74	B	0.26969	0.075	T	0.51911	-0.8645	9	0.62326	D	0.03	.	5.2619	0.15578	0.0:0.3803:0.1468:0.4729	.	2281	Q9Y3S1	WNK2_HUMAN	W	2281	ENSP00000297954:R2281W	ENSP00000297954:R2281W	R	+	1	2	WNK2	95120077	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.728000	0.04925	-0.661000	0.05345	-0.136000	0.14681	CGG	WNK2	-	NULL	ENSG00000165238		0.652	WNK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	WNK2	HGNC	protein_coding	OTTHUMT00000317359.1	-	0.00	37	0	C	NM_006648		96080256	+1	tier1	-	no_errors	ENST00000297954	ensembl	human	known	74_37	missense	11.11	40	5	SNP	0.000	T
ZBTB7B	51043	genome.wustl.edu	37	1	154987921	154987921	+	Missense_Mutation	SNP	C	C	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr1:154987921C>T	ENST00000368426.3	+	3	922	c.785C>T	c.(784-786)tCc>tTc	p.S262F	ZBTB7B_ENST00000535420.1_Missense_Mutation_p.S262F|ZBTB7B_ENST00000292176.2_Missense_Mutation_p.S262F|ZBTB7B_ENST00000417934.2_Missense_Mutation_p.S296F	NM_001256455.1	NP_001243384.1	O15156	ZBT7B_HUMAN	zinc finger and BTB domain containing 7B	262					cell differentiation (GO:0030154)|ectoderm development (GO:0007398)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)	29	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GGAACTGCCTCCCCTCCTGAG	0.652																																																	0													27.0	28.0	28.0					1																	154987921		2202	4300	6502	SO:0001583	missense	0			AF007833	CCDS1081.1, CCDS58030.1	1q21.2	2013-01-08		2005-04-07	ENSG00000160685	ENSG00000160685		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	18668	protein-coding gene	gene with protein product	"""zinc finger and BTB domain containing 15"""	607646	"""zinc finger protein 67 homolog (mouse)"""	ZFP67		9370309, 7937772	Standard	NR_045515		Approved	ZBTB15, c-Krox, hcKrox, ZNF857B	uc010peq.3	O15156	OTTHUMG00000037414	ENST00000368426.3:c.785C>T	1.37:g.154987921C>T	ENSP00000357411:p.Ser262Phe		B4E3K5|D3DV83|J3KQQ3|Q68DR2|Q96EP2	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.S296F	ENST00000368426.3	37	c.887	CCDS1081.1	1	.	.	.	.	.	.	.	.	.	.	C	16.72	3.201643	0.58234	.	.	ENSG00000160685	ENST00000535420;ENST00000368426;ENST00000417934;ENST00000292176	T;T;T;T	0.09911	2.95;2.95;2.93;2.95	4.3	4.3	0.51218	.	0.442996	0.18095	N	0.151872	T	0.11367	0.0277	L	0.27053	0.805	0.43896	D	0.996523	D;D;D	0.65815	0.995;0.995;0.995	P;P;P	0.61328	0.887;0.839;0.887	T	0.06826	-1.0805	10	0.59425	D	0.04	.	14.2965	0.66316	0.0:1.0:0.0:0.0	.	262;262;296	A8K6F4;O15156;B4E3K5	.;ZBT7B_HUMAN;.	F	262;262;296;262	ENSP00000438647:S262F;ENSP00000357411:S262F;ENSP00000406286:S296F;ENSP00000292176:S262F	ENSP00000292176:S262F	S	+	2	0	ZBTB7B	153254545	0.981000	0.34729	0.745000	0.31077	0.513000	0.34164	3.051000	0.49885	2.229000	0.72834	0.462000	0.41574	TCC	ZBTB7B	-	NULL	ENSG00000160685		0.652	ZBTB7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB7B	HGNC	protein_coding	OTTHUMT00000091083.1	-	0.00	23	0	C	NM_015872		154987921	+1	tier1	-	no_errors	ENST00000417934	ensembl	human	known	74_37	missense	44.83	16	13	SNP	0.963	T
ZC3H12C	85463	genome.wustl.edu	37	11	110035943	110035943	+	Silent	SNP	G	G	T	rs368064377		TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr11:110035943G>T	ENST00000278590.3	+	6	2184	c.2133G>T	c.(2131-2133)ccG>ccT	p.P711P	ZC3H12C_ENST00000453089.2_Silent_p.P680P|ZC3H12C_ENST00000528673.1_Silent_p.P712P	NM_033390.1	NP_203748.1	Q9C0D7	ZC12C_HUMAN	zinc finger CCCH-type containing 12C	711							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.72e-06)|BRCA - Breast invasive adenocarcinoma(274;1.17e-05)|all cancers(92;9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0279)		TGCACCTGCCGCACTCCGCTG	0.587																																																	0													135.0	157.0	150.0					11																	110035943		2121	4231	6352	SO:0001819	synonymous_variant	0				CCDS44727.1	11q22.3	2012-07-05			ENSG00000149289	ENSG00000149289		"""Zinc fingers, CCCH-type domain containing"""	29362	protein-coding gene	gene with protein product	"""MCP induced protein 3"""	615001				11214970, 18178554	Standard	NM_033390		Approved	KIAA1726, MCPIP3	uc009yxw.3	Q9C0D7	OTTHUMG00000166572	ENST00000278590.3:c.2133G>T	11.37:g.110035943G>T			B4DI65|B4DR47	Silent	SNP	pfam_RNase_Zc3h12	p.P711	ENST00000278590.3	37	c.2133	CCDS44727.1	11																																																																																			ZC3H12C	-	NULL	ENSG00000149289		0.587	ZC3H12C-001	KNOWN	basic|CCDS	protein_coding	ZC3H12C	HGNC	protein_coding	OTTHUMT00000390491.1	-	0.00	25	0	G	NM_033390		110035943	+1	tier1	-	no_errors	ENST00000278590	ensembl	human	known	74_37	silent	52.17	11	12	SNP	1.000	T
ZC3H13	23091	genome.wustl.edu	37	13	46559795	46559795	+	Nonsense_Mutation	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr13:46559795G>A	ENST00000242848.4	-	10	1705	c.1357C>T	c.(1357-1359)Cga>Tga	p.R453*	ZC3H13_ENST00000282007.3_Nonsense_Mutation_p.R453*			Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	453	Arg/Ser-rich.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|lung(25)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	79		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		CGACCATCTCGAGGTTCTCTG	0.488																																					Esophageal Squamous(187;747 2077 11056 31291 44172)												0													205.0	189.0	194.0					13																	46559795		2203	4300	6503	SO:0001587	stop_gained	0			AB020660	CCDS9400.1	13q14.11	2012-07-05	2006-05-15	2006-05-15	ENSG00000123200	ENSG00000123200		"""Zinc fingers, CCCH-type domain containing"""	20368	protein-coding gene	gene with protein product			"""KIAA0853"""	KIAA0853		10048485	Standard	XM_005266301		Approved	DKFZp434D1812	uc001vas.1	Q5T200	OTTHUMG00000016863	ENST00000242848.4:c.1357C>T	13.37:g.46559795G>A	ENSP00000242848:p.Arg453*		A2A323|O94936|Q5T1Z9|Q7Z7J3|Q8NDT6|Q9H0L6	Nonsense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.R453*	ENST00000242848.4	37	c.1357		13	.	.	.	.	.	.	.	.	.	.	G	41	9.135254	0.99077	.	.	ENSG00000123200	ENST00000242848;ENST00000282007;ENST00000431251	.	.	.	5.72	4.87	0.63330	.	0.000000	0.49305	D	0.000142	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.1598	0.81693	0.0:0.0:0.8655:0.1345	.	.	.	.	X	453;453;269	.	ENSP00000242848:R453X	R	-	1	2	ZC3H13	45457796	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.897000	0.69831	1.399000	0.46721	0.591000	0.81541	CGA	ZC3H13	-	NULL	ENSG00000123200		0.488	ZC3H13-001	KNOWN	basic|appris_candidate_longest	protein_coding	ZC3H13	HGNC	protein_coding	OTTHUMT00000044789.1		0.00	11	0	G	NM_015070		46559795	-1			no_errors	ENST00000242848	ensembl	human	known	74_37	nonsense	21.43	11	3	SNP	1.000	A
ZMYND12	84217	genome.wustl.edu	37	1	42914292	42914292	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr1:42914292G>T	ENST00000372565.3	-	3	539	c.270C>A	c.(268-270)ttC>ttA	p.F90L	ZMYND12_ENST00000433602.2_Intron	NM_032257.4	NP_115633.3	Q9H0C1	ZMY12_HUMAN	zinc finger, MYND-type containing 12	90						intracellular (GO:0005622)	metal ion binding (GO:0046872)			NS(1)|endometrium(2)|large_intestine(3)|lung(5)|ovary(2)|prostate(2)|skin(2)	17	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TGGTGTAGCAGAATTCAATCA	0.468																																																	0													98.0	88.0	91.0					1																	42914292		2203	4300	6503	SO:0001583	missense	0			AK057384	CCDS467.1	1p34.1	2008-02-05			ENSG00000066185	ENSG00000066185		"""Zinc fingers, MYND-type"""	21192	protein-coding gene	gene with protein product						11230166	Standard	NM_032257		Approved	DKFZp434N2435	uc001chj.3	Q9H0C1	OTTHUMG00000007333	ENST00000372565.3:c.270C>A	1.37:g.42914292G>T	ENSP00000361646:p.Phe90Leu		Q5VUS6|Q8TC87|Q96M51	Missense_Mutation	SNP	pfam_Znf_MYND,pfscan_Znf_MYND	p.F90L	ENST00000372565.3	37	c.270	CCDS467.1	1	.	.	.	.	.	.	.	.	.	.	G	3.477	-0.106644	0.06924	.	.	ENSG00000066185	ENST00000372565	T	0.61158	0.13	5.44	2.33	0.28932	Tetratricopeptide-like helical (1);	0.362006	0.31531	N	0.007485	T	0.11067	0.0270	N	0.00088	-2.19	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.36237	-0.9756	10	0.02654	T	1	-8.4715	1.6322	0.02734	0.1857:0.1506:0.4884:0.1753	.	90	Q9H0C1	ZMY12_HUMAN	L	90	ENSP00000361646:F90L	ENSP00000361646:F90L	F	-	3	2	ZMYND12	42686879	0.998000	0.40836	1.000000	0.80357	0.984000	0.73092	0.281000	0.18810	1.289000	0.44618	0.561000	0.74099	TTC	ZMYND12	-	NULL	ENSG00000066185		0.468	ZMYND12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYND12	HGNC	protein_coding	OTTHUMT00000019170.1		0.00	37	0	G	NM_032257		42914292	-1			no_errors	ENST00000372565	ensembl	human	known	74_37	missense	5.71	33	2	SNP	0.998	T
ZNF285	26974	genome.wustl.edu	37	19	44892206	44892206	+	Silent	SNP	C	C	A	rs73557001		TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr19:44892206C>A	ENST00000330997.4	-	4	265	c.201G>T	c.(199-201)tcG>tcT	p.S67S	ZNF285_ENST00000591679.1_Silent_p.S74S|ZNF285_ENST00000544719.2_Silent_p.S67S|CTC-512J12.6_ENST00000588212.1_Intron	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	67	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						GCACTTCTTGCGAAAGGTAAC	0.413																																																	0													87.0	91.0	89.0					19																	44892206		2203	4300	6503	SO:0001819	synonymous_variant	0			AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.201G>T	19.37:g.44892206C>A			Q17RJ3|Q6B0A8|Q6ISR5	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S67	ENST00000330997.4	37	c.201	CCDS12638.1	19																																																																																			ZNF285	-	pfscan_Krueppel-associated_box	ENSG00000267508		0.413	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF285	HGNC	protein_coding	OTTHUMT00000443600.1	-	0.00	32	0	C	NM_152354		44892206	-1	tier1	rs73557001	no_errors	ENST00000330997	ensembl	human	known	74_37	silent	18.18	45	10	SNP	0.000	A
ZNF285	26974	genome.wustl.edu	37	19	44892225	44892225	+	Missense_Mutation	SNP	T	T	G	rs114985922	byFrequency	TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr19:44892225T>G	ENST00000330997.4	-	4	246	c.182A>C	c.(181-183)aAg>aCg	p.K61T	ZNF285_ENST00000591679.1_Missense_Mutation_p.K68T|ZNF285_ENST00000544719.2_Missense_Mutation_p.K61T|CTC-512J12.6_ENST00000588212.1_Intron	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	61	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K61T(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						ACTTAACCCCTTTGCCTGAAG	0.403																																																	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)											82.0	86.0	84.0					19																	44892225		2202	4299	6501	SO:0001583	missense	0			AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.182A>C	19.37:g.44892225T>G	ENSP00000333595:p.Lys61Thr		Q17RJ3|Q6B0A8|Q6ISR5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K61T	ENST00000330997.4	37	c.182	CCDS12638.1	19	.	.	.	.	.	.	.	.	.	.	T	6.972	0.549372	0.13374	.	.	ENSG00000062370	ENST00000544719;ENST00000330997	T	0.06449	3.3	3.86	-2.02	0.07388	Krueppel-associated box (2);	.	.	.	.	T	0.03477	0.0100	N	0.22421	0.69	0.09310	N	1	B;B	0.26363	0.147;0.147	B;B	0.17433	0.018;0.018	T	0.47262	-0.9131	9	0.17832	T	0.49	.	6.3993	0.21630	0.0:0.1093:0.5041:0.3865	.	85;61	B7ZLR9;Q96NJ3	.;ZN285_HUMAN	T	84;61	ENSP00000333595:K61T	ENSP00000333595:K61T	K	-	2	0	ZNF285	49584065	0.000000	0.05858	0.000000	0.03702	0.243000	0.25628	-2.025000	0.01435	-0.256000	0.09473	0.373000	0.22412	AAG	ZNF285	-	smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000267508		0.403	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF285	HGNC	protein_coding	OTTHUMT00000443600.1	-	0.00	32	0	T	NM_152354		44892225	-1	tier1	rs114985922	no_errors	ENST00000330997	ensembl	human	known	74_37	missense	20.83	38	10	SNP	0.000	G
ZNF285	26974	genome.wustl.edu	37	19	44892228	44892228	+	Missense_Mutation	SNP	G	G	C	rs117953191	byFrequency	TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr19:44892228G>C	ENST00000330997.4	-	4	243	c.179C>G	c.(178-180)gCa>gGa	p.A60G	ZNF285_ENST00000591679.1_Missense_Mutation_p.A67G|ZNF285_ENST00000544719.2_Missense_Mutation_p.A60G|CTC-512J12.6_ENST00000588212.1_Intron	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	60	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						TAACCCCTTTGCCTGAAGATT	0.403																																																	0													79.0	83.0	82.0					19																	44892228		2201	4299	6500	SO:0001583	missense	0			AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.179C>G	19.37:g.44892228G>C	ENSP00000333595:p.Ala60Gly		Q17RJ3|Q6B0A8|Q6ISR5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A60G	ENST00000330997.4	37	c.179	CCDS12638.1	19	.	.	.	.	.	.	.	.	.	.	G	6.897	0.535060	0.13188	.	.	ENSG00000062370	ENST00000544719;ENST00000330997	T	0.06294	3.32	1.78	-2.09	0.07232	Krueppel-associated box (2);	.	.	.	.	T	0.02455	0.0075	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.42582	-0.9443	9	0.45353	T	0.12	.	3.686	0.08328	0.0:0.1882:0.4872:0.3246	.	84;60	B7ZLR9;Q96NJ3	.;ZN285_HUMAN	G	83;60	ENSP00000333595:A60G	ENSP00000333595:A60G	A	-	2	0	ZNF285	49584068	0.000000	0.05858	0.010000	0.14722	0.284000	0.27059	0.028000	0.13644	-0.674000	0.05253	-0.563000	0.04171	GCA	ZNF285	-	smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000267508		0.403	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF285	HGNC	protein_coding	OTTHUMT00000443600.1	-	0.00	31	0	G	NM_152354		44892228	-1	tier1	rs117953191	no_errors	ENST00000330997	ensembl	human	known	74_37	missense	22.22	35	10	SNP	0.010	C
ZNF285	26974	genome.wustl.edu	37	19	44892266	44892266	+	Splice_Site	SNP	T	T	C	rs200167944		TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr19:44892266T>C	ENST00000330997.4	-	4	207		c.e4-2		ZNF285_ENST00000591679.1_Splice_Site|ZNF285_ENST00000544719.2_Splice_Site|CTC-512J12.6_ENST00000588212.1_Intron	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						TCCCGTCTCCTAGGAGAAGAA	0.413																																																	0													50.0	54.0	53.0					19																	44892266		2173	4283	6456	SO:0001630	splice_region_variant	0			AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.143-2A>G	19.37:g.44892266T>C			Q17RJ3|Q6B0A8|Q6ISR5	Splice_Site	SNP	-	e3-2	ENST00000330997.4	37	c.143-2	CCDS12638.1	19	.	.	.	.	.	.	.	.	.	.	T	9.943	1.218077	0.22373	.	.	ENSG00000062370	ENST00000544719;ENST00000330997	.	.	.	3.86	3.86	0.44501	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.3975	0.38412	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ZNF285	49584106	0.507000	0.26146	0.215000	0.23724	0.122000	0.20287	3.134000	0.50538	1.528000	0.49103	0.373000	0.22412	.	ZNF285	-	-	ENSG00000267508		0.413	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF285	HGNC	protein_coding	OTTHUMT00000443600.1		0.00	22	0	T	NM_152354	Intron	44892266	-1			no_errors	ENST00000330997	ensembl	human	known	74_37	splice_site	14.29	18	3	SNP	0.017	C
ZNF365	22891	genome.wustl.edu	37	10	64429984	64429984	+	Missense_Mutation	SNP	G	G	A	rs371278525		TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr10:64429984G>A	ENST00000395251.1	+	7	908	c.574G>A	c.(574-576)Gat>Aat	p.D192N	ZNF365_ENST00000395249.1_Missense_Mutation_p.D44N|ZNF365_ENST00000410046.3_Missense_Mutation_p.D438N	NM_199452.3	NP_955524	Q70YC4	TALAN_HUMAN	zinc finger protein 365	192										breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27	Prostate(12;0.0297)|all_hematologic(501;0.228)					GACAATCATCGATTTGTTGAC	0.438																																																	0													266.0	263.0	264.0					10																	64429984		2203	4300	6503	SO:0001583	missense	0			AB020651	CCDS7264.1, CCDS7265.1, CCDS31209.1, CCDS41531.1	10q21.2	2008-10-28			ENSG00000138311	ENSG00000138311		"""Zinc fingers, C2H2-type"""	18194	protein-coding gene	gene with protein product	"""Talanin"""	607818				10048485, 12740763	Standard	NM_199450		Approved	KIAA0844, UAN	uc001jmc.2	Q70YC4	OTTHUMG00000018302	ENST00000395251.1:c.574G>A	10.37:g.64429984G>A	ENSP00000378672:p.Asp192Asn			Missense_Mutation	SNP	NULL	p.D438N	ENST00000395251.1	37	c.1312	CCDS7265.1	10	.	.	.	.	.	.	.	.	.	.	G	7.641	0.680823	0.14907	.	.	ENSG00000138311	ENST00000410046;ENST00000395251;ENST00000395249	T	0.56103	0.48	2.97	-5.94	0.02247	.	.	.	.	.	T	0.18676	0.0448	N	0.08118	0	0.09310	N	1	P;P	0.45474	0.574;0.859	B;B	0.26202	0.063;0.067	T	0.29181	-1.0020	9	0.87932	D	0	.	3.9872	0.09521	0.2296:0.0948:0.5184:0.1572	.	192;438	Q70YC4;Q70YC5-3	TALAN_HUMAN;.	N	438;192;44	ENSP00000378672:D192N	ENSP00000378670:D44N	D	+	1	0	ZNF365	64099990	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.481000	0.02323	-2.211000	0.00737	-2.814000	0.00110	GAT	ZNF365	-	NULL	ENSG00000138311		0.438	ZNF365-006	KNOWN	basic|CCDS	protein_coding	ZNF365	HGNC	protein_coding	OTTHUMT00000277036.1	-	0.00	39	0	G	NM_014951		64429984	+1	tier1	-	no_errors	ENST00000410046	ensembl	human	known	74_37	missense	36.67	19	11	SNP	0.000	A
ZNF492	57615	genome.wustl.edu	37	19	22848051	22848051	+	Missense_Mutation	SNP	G	G	C			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr19:22848051G>C	ENST00000456783.2	+	4	1824	c.1580G>C	c.(1579-1581)tGt>tCt	p.C527S	CTC-457E21.9_ENST00000601860.1_RNA	NM_020855.2	NP_065906.1	Q9P255	ZN492_HUMAN	zinc finger protein 492	527					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		all_cancers(12;0.0266)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00203)|Hepatocellular(1079;0.244)				AAAAGAAATTGTGCTGGTGAG	0.328																																																	0													23.0	21.0	22.0					19																	22848051		1781	4012	5793	SO:0001583	missense	0			AB040906	CCDS46032.1	19p13.11	2013-01-08				ENSG00000229676		"""Zinc fingers, C2H2-type"""	23707	protein-coding gene	gene with protein product			"""zinc finger protein 115 (Y20)"""	ZNF115		10819331	Standard	NM_020855		Approved	KIAA1473	uc002nqw.3	Q9P255		ENST00000456783.2:c.1580G>C	19.37:g.22848051G>C	ENSP00000413660:p.Cys527Ser		Q08EI7|Q08EI8	Missense_Mutation	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C527S	ENST00000456783.2	37	c.1580	CCDS46032.1	19	.	.	.	.	.	.	.	.	.	.	.	4.043	0.005664	0.07866	.	.	ENSG00000229676	ENST00000456783	T	0.06371	3.31	1.03	-0.311	0.12761	.	.	.	.	.	T	0.04137	0.0115	N	0.20986	0.625	0.20196	N	0.99993	B	0.16166	0.016	B	0.13407	0.009	T	0.41305	-0.9516	9	0.87932	D	0	.	3.4142	0.07369	0.5593:0.0:0.4407:0.0	.	527	Q9P255	ZN492_HUMAN	S	527	ENSP00000413660:C527S	ENSP00000413660:C527S	C	+	2	0	ZNF492	22639891	0.030000	0.19436	0.009000	0.14445	0.051000	0.14879	1.672000	0.37523	0.516000	0.28340	0.152000	0.16155	TGT	ZNF492	-	NULL	ENSG00000229676		0.328	ZNF492-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF492	HGNC	protein_coding	OTTHUMT00000464581.1	-	0.00	69	0	G	NM_020855		22848051	+1	tier1	-	no_errors	ENST00000456783	ensembl	human	known	74_37	missense	65.96	16	31	SNP	0.428	C
ZNF576	79177	genome.wustl.edu	37	19	44103247	44103247	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr19:44103247G>T	ENST00000336564.4	+	3	504	c.350G>T	c.(349-351)tGt>tTt	p.C117F	ZNF576_ENST00000525771.1_Missense_Mutation_p.C117F|ZNF576_ENST00000529930.1_Missense_Mutation_p.C117F|SRRM5_ENST00000607544.1_Intron|ZNF576_ENST00000391965.2_Missense_Mutation_p.C117F|ZNF576_ENST00000528387.1_Missense_Mutation_p.C117F|IRGQ_ENST00000422989.1_5'Flank|ZNF576_ENST00000533118.1_Missense_Mutation_p.C117F|SRRM5_ENST00000526798.1_Intron	NM_001145347.1	NP_001138819.1	Q9H609	ZN576_HUMAN	zinc finger protein 576	117					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			endometrium(1)|prostate(1)	2		Prostate(69;0.0199)				TGTCCTGACTGTGGCAAGACC	0.642																																																	0													109.0	86.0	94.0					19																	44103247		2203	4300	6503	SO:0001583	missense	0			AK026353	CCDS12625.1	19q13.31	2013-09-20			ENSG00000124444	ENSG00000124444		"""Zinc fingers, C2H2-type"""	28357	protein-coding gene	gene with protein product						12477932	Standard	NM_024327		Approved	MGC2508	uc002owz.2	Q9H609	OTTHUMG00000165479	ENST00000336564.4:c.350G>T	19.37:g.44103247G>T	ENSP00000337852:p.Cys117Phe		Q9BU03	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.C117F	ENST00000336564.4	37	c.350	CCDS12625.1	19	.	.	.	.	.	.	.	.	.	.	G	18.77	3.694660	0.68386	.	.	ENSG00000124444	ENST00000391965;ENST00000525771;ENST00000533118;ENST00000528387;ENST00000529930;ENST00000336564	D;D;D;D;D;D	0.99974	-10.2;-10.2;-10.2;-10.2;-10.2;-10.2	3.49	3.49	0.39957	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.067365	0.64402	D	0.000018	D	0.99981	0.9994	H	0.99800	4.79	0.80722	D	1	D	0.59767	0.986	P	0.61477	0.889	D	0.97554	1.0094	10	0.87932	D	0	-6.4267	10.7988	0.46476	0.0:0.0:1.0:0.0	.	117	Q9H609	ZN576_HUMAN	F	117	ENSP00000375827:C117F;ENSP00000436182:C117F;ENSP00000435899:C117F;ENSP00000435934:C117F;ENSP00000435463:C117F;ENSP00000337852:C117F	ENSP00000337852:C117F	C	+	2	0	ZNF576	48795087	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.142000	0.64820	2.271000	0.75665	0.655000	0.94253	TGT	ZNF576	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000124444		0.642	ZNF576-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF576	HGNC	protein_coding	OTTHUMT00000384397.1	-	0.00	36	0	G	NM_024327		44103247	+1	tier1	-	no_errors	ENST00000336564	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	T
ZNF679	168417	genome.wustl.edu	37	7	63709499	63709499	+	Missense_Mutation	SNP	G	G	T			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr7:63709499G>T	ENST00000421025.1	+	2	273	c.4G>T	c.(4-6)Gct>Tct	p.A2S	ZNF679_ENST00000255746.4_Missense_Mutation_p.A2S	NM_001159524.1|NM_153363.2	NP_001152996.1|NP_699194.2	Q8IYX0	ZN679_HUMAN	zinc finger protein 679	2					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|lung(11)|skin(1)|stomach(1)	18						CAGATTTATGGCTAAAAGACC	0.567																																																	0													71.0	60.0	63.0					7																	63709499		692	1591	2283	SO:0001583	missense	0			BC033523	CCDS47592.1	7q11.21	2013-01-08			ENSG00000197123	ENSG00000197123		"""Zinc fingers, C2H2-type"", ""-"""	28650	protein-coding gene	gene with protein product	"""hypothetical protein MGC42415"""					12477932	Standard	NM_153363		Approved	MGC42415	uc003tsx.3	Q8IYX0	OTTHUMG00000156486	ENST00000421025.1:c.4G>T	7.37:g.63709499G>T	ENSP00000416809:p.Ala2Ser			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A2S	ENST00000421025.1	37	c.4	CCDS47592.1	7	.	.	.	.	.	.	.	.	.	.	g	9.411	1.080578	0.20309	.	.	ENSG00000197123	ENST00000421025;ENST00000255746	T;T	0.06449	3.3;3.3	0.421	-0.841	0.10752	.	.	.	.	.	T	0.07548	0.0190	N	0.08118	0	0.09310	N	1	D	0.63880	0.993	D	0.70227	0.968	T	0.32903	-0.9889	8	0.72032	D	0.01	.	.	.	.	.	2	Q8IYX0	ZN679_HUMAN	S	2	ENSP00000416809:A2S;ENSP00000255746:A2S	ENSP00000255746:A2S	A	+	1	0	ZNF679	63346934	0.003000	0.15002	0.000000	0.03702	0.000000	0.00434	0.503000	0.22610	-0.677000	0.05231	-0.693000	0.03709	GCT	ZNF679	-	NULL	ENSG00000197123		0.567	ZNF679-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF679	HGNC	protein_coding	OTTHUMT00000344317.2	-	0.00	95	0	G	NM_153363		63709499	+1	tier1	-	no_errors	ENST00000255746	ensembl	human	known	74_37	missense	38.37	53	33	SNP	0.000	T
ZNF729	100287226	genome.wustl.edu	37	19	22497511	22497511	+	Missense_Mutation	SNP	C	C	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr19:22497511C>A	ENST00000601693.1	+	4	1410	c.1292C>A	c.(1291-1293)cCc>cAc	p.P431H	ZNF729_ENST00000357491.6_Missense_Mutation_p.P431H			A6NN14	ZN729_HUMAN	zinc finger protein 729	431					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|lung(32)|ovary(3)	41						GGAAAGAAACCCTACAAATGT	0.358																																																	0																																										SO:0001583	missense	0				CCDS59368.1	19p12	2014-02-14			ENSG00000196350	ENSG00000196350		"""Zinc fingers, C2H2-type"", ""-"""	32464	protein-coding gene	gene with protein product							Standard	NM_001242680		Approved		uc021urs.1	A6NN14	OTTHUMG00000182938	ENST00000601693.1:c.1292C>A	19.37:g.22497511C>A	ENSP00000469582:p.Pro431His		M0QY45	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P431H	ENST00000601693.1	37	c.1292	CCDS59368.1	19	.	.	.	.	.	.	.	.	.	.	.	10.67	1.414329	0.25465	.	.	ENSG00000196350	ENST00000357491	T	0.56941	0.43	0.689	-0.492	0.12041	.	.	.	.	.	T	0.66177	0.2763	M	0.90483	3.12	.	.	.	.	.	.	.	.	.	T	0.69997	-0.4993	6	0.87932	D	0	.	6.2733	0.20966	0.0:0.8001:0.0:0.1999	.	.	.	.	H	431	ENSP00000350085:P431H	ENSP00000350085:P431H	P	+	2	0	ZNF729	22289351	0.027000	0.19231	0.001000	0.08648	0.022000	0.10575	0.640000	0.24705	-0.142000	0.11354	-0.347000	0.07816	CCC	ZNF729	-	pfscan_Znf_C2H2	ENSG00000196350		0.358	ZNF729-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF729	HGNC	protein_coding	OTTHUMT00000464396.1	-	0.00	78	0	C	XM_496301		22497511	+1	tier1	-	no_errors	ENST00000601693	ensembl	human	novel	74_37	missense	70.18	17	40	SNP	0.914	A
ZNF837	116412	genome.wustl.edu	37	19	58880231	58880231	+	Missense_Mutation	SNP	G	G	A			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr19:58880231G>A	ENST00000427624.2	-	3	791	c.469C>T	c.(469-471)Cgg>Tgg	p.R157W	CTD-2619J13.3_ENST00000599889.1_RNA|ZNF837_ENST00000597582.1_Missense_Mutation_p.R157W			Q96EG3	ZN837_HUMAN	zinc finger protein 837	157					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|skin(1)	2						AGTTGAGTCCGGGGGTGGTTC	0.701																																																	0													15.0	20.0	19.0					19																	58880231		692	1591	2283	SO:0001583	missense	0			BC012365	CCDS46216.1	19q13.43	2013-01-08			ENSG00000152475	ENSG00000152475		"""Zinc fingers, C2H2-type"""	25164	protein-coding gene	gene with protein product						12477932	Standard	NM_138466		Approved		uc002qsl.4	Q96EG3		ENST00000427624.2:c.469C>T	19.37:g.58880231G>A	ENSP00000405699:p.Arg157Trp			Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R157W	ENST00000427624.2	37	c.469	CCDS46216.1	19	.	.	.	.	.	.	.	.	.	.	G	13.58	2.280227	0.40294	.	.	ENSG00000152475	ENST00000427624	T	0.07216	3.21	1.61	-1.18	0.09617	.	.	.	.	.	T	0.07052	0.0179	L	0.29908	0.895	0.09310	N	1	D	0.76494	0.999	P	0.47941	0.562	T	0.23976	-1.0173	9	0.72032	D	0.01	.	2.2888	0.04133	0.2004:0.0:0.5059:0.2937	.	157	Q96EG3	ZN837_HUMAN	W	157	ENSP00000405699:R157W	ENSP00000405699:R157W	R	-	1	2	ZNF837	63572043	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.424000	0.00475	-0.445000	0.07159	-0.384000	0.06662	CGG	ZNF837	-	NULL	ENSG00000152475		0.701	ZNF837-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF837	HGNC	protein_coding	OTTHUMT00000466962.1	-	0.00	14	0	G	NM_138466		58880231	-1	tier1	-	no_errors	ENST00000427624	ensembl	human	known	74_37	missense	56.25	7	9	SNP	0.000	A
ZYX	7791	genome.wustl.edu	37	7	143080174	143080174	+	Missense_Mutation	SNP	C	C	G			TCGA-V5-AASW-01A-11D-A403-09	TCGA-V5-AASW-10A-01D-A403-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8546b3e1-e5d7-4020-bb50-f0459a2d32a8	2c1d5ac0-914f-4a71-b628-e03a40648085	g.chr7:143080174C>G	ENST00000322764.5	+	5	1127	c.782C>G	c.(781-783)gCt>gGt	p.A261G	ZYX_ENST00000449423.2_Missense_Mutation_p.A174G|AC093673.5_ENST00000429630.1_RNA|ZYX_ENST00000392910.2_Missense_Mutation_p.A104G|ZYX_ENST00000477373.1_3'UTR	NM_001010972.1|NM_003461.4	NP_001010972.1|NP_003452.1	Q15942	ZYX_HUMAN	zyxin	261					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|integrin-mediated signaling pathway (GO:0007229)|regulation of inflammatory response (GO:0050727)|signal transduction (GO:0007165)|stress fiber assembly (GO:0043149)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)	17	Melanoma(164;0.205)					TCATCTCCGGCTCCAGCCCCT	0.587																																																	0													114.0	143.0	133.0					7																	143080174		2203	4300	6503	SO:0001583	missense	0			X95735	CCDS5883.1	7q32	2010-02-26			ENSG00000159840	ENSG00000159840			13200	protein-coding gene	gene with protein product		602002				8917469, 8940160	Standard	XM_005250052		Approved		uc003wcx.3	Q15942	OTTHUMG00000023822	ENST00000322764.5:c.782C>G	7.37:g.143080174C>G	ENSP00000324422:p.Ala261Gly		A4D2G6|Q6I9S4	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.A261G	ENST00000322764.5	37	c.782	CCDS5883.1	7	.	.	.	.	.	.	.	.	.	.	C	7.552	0.662874	0.14710	.	.	ENSG00000159840	ENST00000322764;ENST00000354434;ENST00000449423;ENST00000392910	T;T;T;T	0.55052	0.63;0.55;0.54;0.55	3.18	3.18	0.36537	.	1.864190	0.03206	U	0.175436	T	0.39600	0.1084	N	0.22421	0.69	0.09310	N	1	B;P	0.34662	0.243;0.462	B;B	0.24541	0.054;0.045	T	0.32428	-0.9907	10	0.27785	T	0.31	.	12.0942	0.53744	0.0:1.0:0.0:0.0	.	174;261	B4DQR8;Q15942	.;ZYX_HUMAN	G	261;229;174;104	ENSP00000324422:A261G;ENSP00000346417:A229G;ENSP00000394158:A174G;ENSP00000376642:A104G	ENSP00000324422:A261G	A	+	2	0	ZYX	142790296	0.035000	0.19736	0.490000	0.27465	0.421000	0.31385	2.188000	0.42612	1.294000	0.44707	0.655000	0.94253	GCT	ZYX	-	NULL	ENSG00000159840		0.587	ZYX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZYX	HGNC	protein_coding	OTTHUMT00000156296.2	-	0.00	57	0	C	NM_003461		143080174	+1	tier1	-	no_errors	ENST00000322764	ensembl	human	known	74_37	missense	37.33	47	28	SNP	0.023	G
